Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
fig1 is a front sectional view illustrating the overall configuration of a motor retractor 10 according to a first embodiment of the present invention . as shown in fig1 , the motor retractor 10 comprises a frame 12 . the frame 12 comprises a substantially plate - like back plate 14 , and by fixing this back plate 14 to a vehicle body by means of a connecting part ( not shown ), such as a bolt , or the like , the present motor retractor 10 is mounted to the vehicle body . from both ends of the back plate 14 in a width direction , a pair of foot plates 16 , 18 are extended in parallel with each other , and between these foot plates 16 , 18 , a spool 20 , serving as a winding shaft and manufactured by die casting or the like , is rotatably disposed . the spool 20 is made up of a substantially cylindrical spool main body 22 , and a pair of flange portions 24 , 26 formed substantially in the shape of a disk at both ends of this spool main body 22 , and as a whole , has the shape of a drum . to the spool main body 22 , the base end portion of a webbing 28 formed in the shape of a long strip is connected and fixed , and when the spool 20 is rotated in one direction around the axis thereof ( hereinafter , this direction is called the “ winding - up direction ”), the webbing 28 is wound up from the base end side thereof around the circumference of the spool main body 22 in layers . on the other hand , when the webbing 28 is taken out from the tip end thereof , the spool 20 is rotated while the webbing 28 is taken out ( hereinafter , the direction of rotation of the spool 20 when the webbing 28 is taken out is called the “ taking - out direction ”). on the side of the flange part 24 that is opposite to the flange part 26 , one end side of the spool 20 penetrates substantially coaxially into a round hole 30 formed in the foot plate 16 to protrude to the outside of the frame 12 . on the outside of the frame 12 at the foot plate 16 side , a casing 32 is disposed . the casing 32 is disposed along the axial direction of the spool 20 , facing the foot plate 16 , and fixed to the foot plate 16 . in addition , the casing 32 is opened as a whole toward the foot plate 16 side , and the one end side of the spool 20 penetrating into the round hole 30 enters into the casing 32 , and is rotatably pivotally - supported by the casing 32 . further , inside of the casing 32 , a spiral spring 34 is disposed . the outside end in the spiral direction of the spiral spring 34 is engaged at the casing 32 , while the inside end in the spiral direction of the spiral spring 34 is engaged at the spool 20 . this spiral spring 34 biases the spool 20 in the winding - up direction . the biasing force of this spiral spring 34 ( the winding - up force of the webbing 28 based on that biasing force ) is set relatively weakly , and to such a degree that looseness of the webbing 28 worn by a passenger is eliminated . in other words , the biasing force of the spiral spring 34 is set at a strength that will not give an oppressive feeling to a passenger when the webbing 28 is worn , not being required to be of a strength that causes the webbing 28 taken out from the spool 20 to be wound up to the last against the friction force or the like . further , the spool 20 comprises a pivot portion ( not shown ) protruding coaxially from the end portion on the flange part 26 side . this pivot portion substantially coaxially penetrates into an internally toothed ratchet hole 36 formed in the foot plate 18 to protrude to the outside of the frame 12 , and is rotatably pivotally - supported by a substantially cup - like casing 40 that is fixed with the opening end being butted against the outside surface of the foot plate 18 and constitutes a lock mechanism 38 . the lock mechanism 38 normally tolerates free rotation of the spool 20 in both of the winding - up direction and the taking - out direction , and , and prevents the rotation of the spool 20 in the taking - out direction at the time of vehicle rapid deceleration . in the present first embodiment , when an acceleration sensor 41 prevents a ratchet gear 42 from rotating in the taking - out direction , the relative rotation between the ratchet gear 42 and the spool 20 causes a lock plate 46 to protrude from a lock base 44 and engage with the internal teeth of the ratchet hole 36 in the foot plate 18 , resulting in the rotation of the spool 20 in the taking - out direction being prevented . between the lock base 44 and the spool 20 , a torsion bar may be connected to provide a configuration in which , after the above - mentioned locking , the torsion bar is twisted while the rotation of the spool 20 in the taking - out direction is allowed to achieve energy absorption ( achieve a force limiter function ). further , a motor 60 is disposed between the foot plate 16 and the foot plate 18 under the spool 20 . the motor 60 has an output shaft 62 , on which a gear 64 is coaxially and integrally provided . above the gear 64 in the radial direction , a gear 66 having a diameter larger than that of the gear 64 is disposed . the gear 66 is engaged with the gear 64 , in a state in which the gear 66 is rotatably pivotally - supported by a support plate 68 provided between the foot plates 16 , 18 and the foot plate 16 around an axis parallel with the axis of the spool 20 . in addition , at a lateral side of the gear 66 in the axial direction , a gear 70 having a diameter smaller than that of the gear 66 is coaxially and integrally provided with respect to the gear 66 . further , above the gear 70 in the radial direction , a clutch 72 is provided . the clutch 72 comprises an externally toothed gear 74 formed in the shape of a ring . the gear 74 is provided coaxially and relatively rotatably with respect to the spool 20 in a state in which it is engaged with the gear 70 , and both ends thereof in the axial direction are blocked with disk - like members ( not shown ). in addition , inside of the gear 74 , an adapter 76 in the shape of a cylinder is provided coaxially with respect to the spool 20 . the adapter 76 is connected integrally with the spool 20 , penetrating into the disk - like members that block both ends of the gear 74 , to rotatably pivotally - support the disk - like members , and thus the gear 74 , around the spool 20 . inside of the gear 74 , a connecting member ( not shown ), such as a pawl which is rocked by the centrifugal force , or the like , is accommodated . this connecting member is supported , for example , by the above - mentioned disk - like members , and rotates integrally with the gear 74 . herein , with the clutch 72 , the rotating force of the output shaft 62 of the motor 60 is transmitted to the gear 74 via the gear 64 , the gear 66 , and the gear 70 ( the output shaft 62 and the gear 74 always rotate in synchronism with each other ), and when the output shaft 62 of the motor 60 rotates in the forward direction , the gear 74 rotates in the winding - up direction . when the gear 74 rotates in the winding - up direction , the connecting member is mechanically connected to the circumferential surface of the adapter 76 , resulting in the gear 74 and the adapter 76 being integrally connected to each other . thereby , the rotation of the gear 74 in the winding - up direction ( the forward running of the motor 60 ) is transmitted to the spool 20 via the adapter 76 . on the other hand , when the output shaft 62 of the motor 60 rotates in the reverse direction , the gear 74 rotates in the taking - out direction . in this case , when the gear 74 relatively rotates in the taking - out direction by a predetermined amount with respect to the adapter 76 ( when the reverse running of the motor 60 causes the output shaft 62 to relatively rotate with respect to the spool 20 by a predetermined amount ), the mechanical connection of the connecting member to the adapter 76 is released , and the clutch 72 is brought into a disengaged state . in addition , on the other hand , the present motor retractor 10 comprises a driver 82 and an ecu 86 constituting a control portion . a driving control program according to the first embodiment of the present invention is stored in the ecu 86 . in addition , the motor 60 is electrically connected to a battery 84 loaded on a vehicle via the driver 82 , and with the current from the battery 84 flowing to the motor 60 via the driver 82 , the motor 60 exerts a driving force to rotate the output shaft 62 in the forward or reverse direction . the driver 82 is connected to the ecu 86 , and whether power is to be fed to the motor 60 via the driver 82 , and the direction and magnitude of the supply current are controlled by the ecu 86 . further , a buckle switch 92 serving as the control portion for detecting whether or not a tongue plate provided at the webbing 28 is connected to the buckling apparatus ( both not shown ) is connected to the ecu 86 . when the tongue plate is connected to the buckling apparatus , the buckle switch 92 outputs , to the ecu 86 , a signal at an h level indicating that the switch is in the on state , and , when the tongue plate is disconnected from the buckling apparatus , the buckle switch 92 outputs , to the ecu 86 , a signal at an l level indicating that the switch is in the off state . when the signal outputted from the buckle switch 92 is a signal at an l level , the ecu 86 determines that the webbing 28 is stored in the retractor . in addition , a lock current detection circuit 98 that is a component of the control portion is connected to the ecu 86 . this lock current detection circuit 98 is connected to the motor 60 via the driver 82 , and when an external force resisting the rotation of the output shaft 62 acts , resulting in the motor 60 being overloaded , and the magnitude of the current flowing to the motor 60 ( the driver 82 ) is increased beyond a previously set threshold value il ( when a so - called lock current flows to the motor 60 ), the lock current detection circuit 98 outputs a predetermined electric signal ( hereinafter , this signal is referred to as the “ lock detection signal ”) to the ecu 86 . fig2 a to fig2 d are timing charts illustrating the relationship between the current to be supplied to the motor 60 by the ecu 86 and the driver 82 when the motor retractor 10 is to store the webbing 28 , and time . in the motor retractor 10 , the ecu 86 and driver 82 start to supply a current having a predetermined current value i 0 to the motor 60 for rotating the motor 60 in the forward direction at the time point ( a time point of t 0 in fig2 a ) when it is detected that the tongue plate provided at the webbing 28 has been disconnected from the buckling apparatus ( the passenger having released the wearing state of the webbing 28 ). in this case , on the basis of the adequate storing speed ( the adequate winding - up speed ) for the webbing 28 , the magnitude of the current value i 0 is set such that the magnitude of the current value i 0 is smaller than the threshold value il of the lock current set for the lock current detection circuit 98 ( such that i 0 & lt ; il ). further , at the time point when the time previously set for the ecu 86 has elapsed ( a time point of t 1 in fig2 a ), the ecu 86 determines that the amount of winding - up of the webbing 28 on to the spool 20 has reached the previously set amount ( for example , about half ), and as shown in fig2 a , outputs , to the driver 82 , a signal for lowering the magnitude of the supply current to the motor 60 from the current value i 0 to a current value i 1 . further , at the time point when a predetermined time has elapsed from this lowering of the current value ( a time point of t 2 in fig2 a ), the ecu 86 determines that the webbing 28 has been fully stored on the present motor retractor 10 and outputs , to the driver 82 , a signal for interrupting the power feeding to the motor 60 . in addition , in the motor retractor 10 , when a predetermined time has elapsed after the power feeding to the motor 60 has been interrupted at the time point of t 2 , the ecu 86 and the driver 82 perform the power feeding control as shown in fig2 a ( hereinafter , to be called the “ full operation control ”) several times before terminating the control of power feeding to the motor 60 . on the other hand , when an overload on the motor 60 is detected during the winding - up of the webbing 28 , that is , when a lock detection signal is outputted from the lock current detection circuit 98 to the ecu 86 , the ecu 86 outputs , to the driver 82 , a signal for interrupting the power feeding to the motor 60 , and further , after a predetermined time has elapsed , outputs , to the driver 82 , a signal for redriving the motor 60 . furthermore , at the time of the redriving , the ecu 86 and the driver 82 detect the amount of winding - up of the webbing 28 onto the spool 20 at the time of the above - mentioned overload detection on the basis of the time for driving the motor 60 that has elapsed before the lock detection signal is inputted , that is , the time tl from the time point when the driving of the motor 60 has been started ( the time point of t 0 ) to the time point when the lock detection signal is inputted ( hereinafter , referred to as the “ lock detection time tl ”), and adjust the driving state of the motor 60 according to the length of this lock detection time tl . that is , when a lock current detection signal is inputted to the ecu 86 at a certain time point in an early stage of winding - up of the webbing 28 ( at a time point of t 3 in fig2 b , for example , in a case where the lock detection time tl is short ), the ecu 86 outputs , to the driver 82 , a signal for interrupting the power feeding to the motor 60 , and thereby the power feeding to the motor 60 is interrupted at a time point of t 4 in fig2 b . in this case , the ecu 86 determines that the amount of winding - up of the webbing 28 onto the spool 20 is small , that is , the webbing 28 has hardly been stored on the retractor , and after a predetermined time has elapsed ( at a time point of t 5 in fig2 b ), starts the above - mentioned “ full operation control ”. that is , the ecu 86 and the driver 82 start to supply the current having a current value of i 0 to the motor 60 at the time point of t 5 in fig2 b ; lower the magnitude of the supply current to the motor 60 from the current value i 0 to the current value i 1 at a time point of t 6 in fig2 b ; and interrupt the power feeding to the motor 60 at a time point of t 7 in fig2 b . on the other hand , when a lock current detection signal is inputted to the ecu 86 at a certain time point in a later stage of winding - up of the webbing 28 ( at a time point of t 8 in fig2 c , for example , in a case where the lock detection time tl is long ), the ecu 86 outputs , to the driver 82 , a signal for interrupting the power feeding to the motor 60 , and thereby the power feeding to the motor 60 is interrupted at a time point of t 9 in fig2 b . in this case , the ecu 86 determines that the amount of winding - up of the webbing 28 on the spool 20 is large , that is , that most of the webbing 28 has been stored in the retractor , and after a predetermined time has elapsed ( at a time point of t 10 in fig2 c ), outputs , to the driver 82 , a signal for supplying a current having a current value of i 2 to the motor 60 , thereby driving the motor 60 at a low output . in the present first embodiment , the magnitude of the current value i 2 is set smaller than the current value i 0 ( i 2 & lt ; i 0 ), and the motor 60 is driven in a mode which is the weakest next to the stopped state . furthermore , at a time point of t 11 in fig2 c , the ecu 86 outputs , to the driver 82 , a signal for interrupting the power feeding to the motor 60 , and thereby the motor 60 is stopped . the time for power feeding to the motor 60 ( from t 10 to t 11 ) at this time is shorter than the time for power feeding to the motor 60 in the “ full operation control ” ( from t 0 to t 2 or from t 5 to t 7 ), and the motor 60 is driven for a shorter time . in addition , when a lock current detection signal is inputted to the ecu 86 at a certain time point in a middle stage of winding - up of the webbing 28 ( at a time point of t 12 in fig2 d , for example , in a case where the lock detection time tl is of a medium length ), the ecu 86 outputs , to the driver 82 , a signal for interrupting the power feeding to the motor 60 , and thereby the power feeding to the motor 60 is interrupted at a time point of t 13 in fig2 d . in this case , the ecu 86 determines that the amount of winding - up of the webbing 28 onto the spool 20 is approx . half of that to be obtained at the time of full storage on the retractor , and after a predetermined time has elapsed ( at a time point of t 14 in fig2 d ), outputs , to the driver 82 , a signal for supplying a current having a current value of i 3 to the motor 60 , and thereby driving the motor 60 being driven at a low output . in the present first embodiment , the magnitude of the current value i 3 is set at a value equal to or greater than the current value i 2 and smaller than the current value i 0 ( i 2 & lt ; i 3 & lt ; i 0 ). further , at a time point of t 15 in fig2 d , the ecu 86 outputs , to the driver 82 , a signal for interrupting the power feeding to the motor 60 , thereby stopping the motor 60 . in this case , the time for power feeding to the motor 60 ( from t 14 to t 15 ) is shorter than the time for power feeding to the motor 60 in the “ full operation control ” ( from t 0 to t 2 or from t 5 to t 7 ), and longer than the time for power feeding to the motor 60 when the motor has been overloaded in a later stage of winding - up of the webbing 28 ( from t 10 to t 11 ). therefore , the motor 60 is driven for a time shorter than that in the “ full operation control ” and longer than that in a case where the motor 60 has been overloaded in a later stage of winding - up of the webbing 28 . with the motor retractor 10 as configured above , when the passenger takes out the webbing 28 stored in the present motor retractor 10 to connect the tongue plate ( not shown ) provided at the webbing 28 to the buckling apparatus , a state in which the passenger wears the webbing 28 is achieved . in this wearing state , the webbing 28 restrains the passenger relatively weakly by the biasing force of the spiral spring 34 . on the other hand , when the passenger releases the connection state between the tongue plate and the buckling apparatus to release the wearing state of the webbing 28 , the motor 60 is driven , and the winding - up of the webbing 28 is started . then , when the webbing 28 is wound up to approx . half of the amount of winding - up at the time of full storage on the retractor , the driving force and the rotation speed of the motor 60 are lowered . thereby , the webbing 28 is slowly wound up with a small force . then , when a predetermined time ( the time necessary for fully storing the webbing 28 on the retractor with the “ full operation control ”) has elapsed from the start of winding - up of the webbing 28 , the motor 60 is stopped . on the other hand , when , in the early stage of winding - up the webbing 28 , the passenger &# 39 ; s arm , or the like , gets caught by the webbing 28 , resulting in the motor 60 being overloaded , the motor 60 is stopped , and the winding - up of the webbing 28 is interrupted . then , when a predetermined time ( the time necessary for the passenger to release their arm , or the like , from the webbing 28 ) has elapsed , the motor 60 is redriven . in this case , because the webbing 28 has hardly been stored on the retractor 10 , the motor 60 is driven with the “ full operation control ”; however , even in a case where the passenger has not released their arm , or the like , from the webbing 28 within the above - mentioned predetermined time , the sense of discomfort given to the passenger is minimal , because the amount of taking - out of the webbing 28 is large . in addition , even after the motor 60 has been redriven , the passenger will have enough time for releasing their arm , or the like . in addition , when , in the later stage of winding - up of the webbing 28 , the passenger &# 39 ; s arm , or the like , gets caught by the webbing 28 , resulting in the motor 60 being overloaded , the motor 60 is stopped , and the winding - up of the webbing 28 is interrupted . then , when a predetermined time ( the time necessary for the passenger to release their arm , or the like , from the webbing 28 ) has elapsed , the motor 60 is redriven . in this case , because most of the webbing 28 has been stored on the retractor , the motor 60 is driven at a low output for a short time . therefore , even in case where the passenger has not released their arm , or the like , from the webbing 28 , within the above - mentioned predetermined time , the sense of discomfort given to the passenger by the motor 60 being redriven can be reduced . in addition , because the time for driving the motor 60 is short , unnecessary driving of the motor 60 after completion of the winding - up of the webbing 28 can be prevented , and thus the occurrence of noise due to the unnecessary driving of the motor 60 can be suppressed . in addition , when , in the middle stage of winding - up of the webbing 28 , the passenger arm , or the like , gets caught by the webbing 28 , resulting in the motor 60 being overloaded , the motor 60 is stopped , and the winding - up of the webbing 28 is interrupted . then , when a predetermined time ( the time necessary for the passenger to release their arm , or the like , from the webbing 28 ) has elapsed , the motor 60 is redriven . in this case , because approx . half of the webbing 28 has been stored on the retractor , the motor 60 is driven at a low output for a predetermined time , that is , for a time shorter than that in the “ full operation control ”, and longer than that in a case where the motor 60 has been overloaded in the later stage of winding - up of the webbing 28 . therefore , the sense of discomfort given to the passenger at the time of the motor 60 being redriven can be reduced , and the occurrence of noise after the completion of the winding - up of the webbing 28 can be suppressed . as described above , with the motor retractor 10 according to the first embodiment of the present invention , even when the winding - up of the webbing 28 is resumed in a state in which the catching thereof by an arm , or the like , has not been released , the sense of discomfort given to a passenger can be reduced . furthermore , in the motor retractor 10 according to the first embodiment of the present invention , the ecu 86 detects whether the amount of winding - up of the webbing 28 onto the spool 20 has reached a previously set amount , on the basis of the lock detection time tl ( the time from the start of winding - up of the webbing 28 to the detection of the locking of the motor 60 ), and thus the configuration of the motor retractor 10 is simple . means for detecting the amount of winding - up the webbing 28 ( such as a sensor for detecting the amount of rotation of the spool 20 , or the like ) may be separately provided . in addition , the above - mentioned first embodiment has been provided with a configuration in which , by changing the magnitude of the supply current to the motor 60 , the driving state of the motor 60 is adjusted ; however , besides this configuration , the first embodiment may be adapted to have a configuration in which , by changing the magnitude of the voltage to be applied to the motor 60 , the driving state of the motor 60 is adjusted . in a case where a configuration in which the motor 60 is controlled with the voltage is provided , even when , for example , the motor 60 is driven in a state in which the engine of the vehicle is stopped , resulting in the power supply voltage becoming unstable , the rotation speed of the motor 60 , that is , the speed of winding - up the webbing 28 can be kept constant without being influenced by fluctuations in the power supply voltage . next , a second embodiment of the present invention will be described . for configurations and functions that are essentially the same as those of the first embodiment , the same reference numerals as those in the first embodiment are provided , and description thereof is omitted . fig1 is a front sectional view illustrating the overall configuration of a motor retractor 100 according to a second embodiment of the present invention . this motor retractor 100 is provided with basically the same configuration as that of the motor retractor 10 according to the first embodiment ; however , a driving control program which is different from the driving control program according to the first embodiment is stored in the ecu 86 . fig3 is a timing chart illustrating the relationship between the current to be supplied to the motor 60 by the ecu 86 and the driver 82 when the motor retractor 100 according to the second embodiment of the present invention stores the webbing 28 , and the time . in the motor retractor 100 , the ecu 86 and the driver 82 start to supply a current having a predetermined current value of i 0 to the motor 60 to drive the motor 60 at the time point ( a time point of t 0 in fig3 ) when it is detected that the tongue plate provided at the webbing 28 has been disconnected from the buckling apparatus ( the passenger having released the wearing state of the webbing 28 ). thereby , the winding - up of the webbing 28 is started . at the time of driving the motor 60 , a rush current is flows to the motor 60 as shown in fig3 , and the motor 60 is rapidly driven , however , at this time point , the passenger &# 39 ; s arm , or the like , will not get caught by the webbing 28 , and thus no sense of discomfort will be given to the passenger . then , when , at a time point of t 1 in fig3 , for example , the passenger &# 39 ; s arm , or the like , gets caught by the webbing 28 , resulting in the motor 60 being overloaded , the lock current detection circuit 98 outputs a lock detection signal to the ecu 86 , and the ecu 86 outputs , to the driver 82 , a signal for interrupting the power feeding to the motor 60 . thereby , the motor 60 is stopped at a time point of t 2 in fig3 . further , when , from the time point of t 2 in fig3 , a predetermined time ( the time necessary for the passenger to release their arm , or the like , from the webbing 28 ) has elapsed and a time point of t 3 in fig3 is reached , the ecu 86 and the driver 82 resume the power feeding to the motor 60 , while gradually increasing the magnitude of the current . thereby , the motor 60 starts the driving , while gradually increasing the driving force and the rotation speed , with the webbing 28 starting to be gradually wound up with a small force . therefore , even in a case where , within the above - mentioned predetermined time , the passenger has not released their arm , or the like , from the webbing 28 , the sense of discomfort given to the passenger can be reduced . then , when , at a time point of t 4 in fig3 , the current value of the supply current to the motor 60 has reached i 4 , the ecu 86 and the driver 82 terminate the increase in current , supplying a fixed current ( a stationary current ) with a current value of i 4 to the motor 60 . in this case , the rush current flowing to the motor 60 at the time point of t 4 in fig3 can be reduced , and thus the rush current can be prevented from causing the motor 60 to be rapidly driven , and thus the sense of discomfort given to the passenger can be suppressed . furthermore , because the magnitude i 4 of the stationary current for the motor 60 after the resumption of the power feeding is set such that it is smaller than the magnitude i 0 of the stationary current for the motor 60 before the overload detection , the driving force and the rotation speed of the motor 60 , that is , the winding - up force and the winding - up speed for the webbing 28 , are also decreased . therefore , the sense of discomfort given to the passenger can be further reduced .	1
referring now to the figures in which like numerals indicate like parts , and particularly to fig1 the sock donning assist . device of the present invention is shown generally at 10 donning a sock 11 , with a sock lower portion 12 and a sock upper portion 13 , onto a user foot 14 , with a user foot toe portion 15 , of a user leg 16 of a user 18 by a pair of caretaker hands 20 of a caretaker 24 each of which having a caretaker hand forefinger 22 and a caretaker hand remaining fingers . the configuration of the sock donning assist device 10 can best be seen in fig2 through 5 , and as such , will be discussed with reference thereto . the sock donning assist device 10 includes a hollow rigid substantially l - shaped frame 26 that can be made from metal or plastic , but is not limited to that , and consists of a plurality elongated and slender cylindrical members of specific lengths and shapes that form a frame horizontally - oriented caretaker gripping portion 27 and a frame vertically - oriented sock holding portion 29 . the hollow rigid substantially l - shaped frame 26 includes a pair of frame lower side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 28 . each of the pair of frame lower side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 28 of the hollow rigid substantially l - shaped frame 26 has a frame lower side member front end 30 and a frame lower side member back end 32 . the hollow rigid substantially l - shaped frame 26 further includes a pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 . each of the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 functions as a handle and has a frame lower front member lower end 36 , a frame lower front member upper end 38 , and a frame lower front member intermediate point 39 . the frame lower front member intermediate point 39 of each of the pair of frame lower front , substantially parallel - disposed , straight , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 is positioned below the frame lower front member upper end 38 of each of the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 a distance equal to approximately one third the length of each of the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 . the positioning of the frame lower front member intermediate point 39 of each of the pair of frame lower front , substantially parallel - disposed , straight , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 is strategic and forms a caretaker forefinger gripping space 35 and a caretaker remaining fingers gripping space 37 . each of the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 , at the frame lower front member lower end 36 of each of the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 , extends smoothly upwardly at an obtuse angle , and slightly forwardly at an obtuse angle , from the frame lower side member front end 30 of each of the pair of frame lower side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 28 of the hollow rigid substantially l - shaped frame 26 and together therewith forms a frame lower front smooth convex - shaped bend 40 . the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 are spaced - apart a distance substantially equal to the distance between the pair of frame lower side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 28 of the hollow rigid substantially l - shaped frame 26 . each of the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 has a length sufficient so as to be readily received by each of the pair of caretaker hands 20 of the pair of caretaker arms 22 of the caretaker 24 ( see fig1 ). the hollow rigid substantially l - shaped frame 26 further includes a pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 . each of the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 has a frame upper intermediate side member front end 42 and a frame upper intermediate side member back end 44 . each of the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 , at the frame upper intermediate side member front end 42 of each of the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 , extends smoothly rearwardly at an acute angle , from the frame lower front member upper end 38 of each of the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 and together therewith forms a frame upper intermediate side smooth convex - shaped bend 46 . the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 are spaced - apart a distance substantially equal to the distance between the pair of frame lower side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 28 of the hollow rigid substantially l - shaped frame 26 . the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 are substantially parallel to , and displaced a distance above , the pair of frame lower side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 28 of the hollow rigid substantially l - shaped frame 26 . each of the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 has a length less than the length of each of the pair of frame lower side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 28 of the hollow rigid substantially l - shaped frame 26 . the hollow rigid substantially l - shaped frame 26 further includes a pair of frame lower back , straight , slightly inwardly tapering , substantially vertically - oriented , elongated , and slender cylindrical members 48 . each of the pair of frame lower back , straight , slightly inwardly tapering , substantially vertically - oriented , elongated , and slender cylindrical members 48 of the hollow rigid substantially l - shaped frame 26 has a frame lower back member lower end 50 and a frame lower back member upper end 52 . each of the pair of frame lower back , straight , slightly inwardly tapering , substantially vertically - oriented , elongated , and slender cylindrical members 48 of the hollow rigid substantially l - shaped frame 26 , at the frame lower back member lower end 50 of each of the pair of frame lower back , straight , slightly inwardly tapering , substantially vertically - oriented , elongated , and slender cylindrical members 48 of the hollow rigid substantially l - shaped frame 26 , extends smoothly upwardly at an obtuse angle , and slightly rearwardly at an obtuse angle , from the frame lower side member back end 32 of each of the pair of frame lower side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 28 of the hollow rigid substantially l - shaped frame 26 and together therewith forms a frame lower back smooth convex - shaped bend 54 . the pair of frame lower back , straight , slightly inwardly tapering , substantially vertically - oriented , elongated , and slender cylindrical members 48 of the hollow rigid substantially l - shaped frame 26 are displaced a distance behind the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 and are displaced a distance behind the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 . each of the pair of frame lower back , straight , slightly inwardly tapering , substantially vertically - oriented , elongated , and slender cylindrical members 48 of the hollow rigid substantially l - shaped frame 26 has a length greater than the length of each of the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 . the hollow rigid substantially l - shaped frame 26 further includes a pair of frame intermediate back , straight , substantially parallel - disposed , spaced - apart , vertically - oriented , short , and slender cylindrical members 56 . each of the pair of frame intermediate back , straight , substantially parallel - disposed , spaced - apart , vertically - oriented , short , and slender cylindrical members 56 of the hollow rigid substantially l - shaped frame 26 has a frame intermediate back member lower end 58 and a frame intermediate back member upper end 60 . each of the pair of frame intermediate back , straight , substantially parallel - disposed , spaced - apart , vertically - oriented , short , and slender cylindrical members 56 of the hollow rigid substantially l - shaped frame 26 , at the frame intermediate back member lower end 58 of each of the pair of frame intermediate back , straight , substantially parallel - disposed , spaced - apart , vertically - oriented , short , and slender cylindrical members 56 of the hollow rigid substantially l - shaped frame 26 , extends smoothly upwardly at an obtuse angle , from the frame lower back member upper end 52 of each of the pair of frame lower back , straight , slightly inwardly tapering , substantially vertically - oriented , elongated , and slender cylindrical members 48 of the hollow rigid substantially l - shaped frame 26 and together therewith forms a frame intermediate back smooth convex - shaped bend 61 . the pair of frame intermediate back , straight , substantially parallel - disposed , spaced - apart , vertically - oriented , short , and slender cylindrical members 56 of the hollow rigid substantially l - shaped frame 26 are displaced a distance behind the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 and are displaced a distance behind the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 . the hollow rigid substantially l - shaped frame 26 further includes a frame upper back , semi - circular , vertically oriented , elongated , and slender connecting member 62 . the frame upper back , semi - circular , vertically oriented , elongated , and slender connecting member 62 of the hollow rigid substantially l - shaped frame 26 has a pair of frame upper back member ends 64 and a frame upper back member midway point 65 . the frame upper back , semi - circular , vertically oriented , elongated , and slender connecting member 62 of the hollow rigid substantially l - shaped frame 26 , at each of the pair of frame upper back member ends 64 of the frame upper back , semi - circular , vertically oriented , elongated and slender member 62 of the hollow rigid substantially l - shaped frame 26 , extends smoothly upwardly from each frame intermediate back member upper end 60 of each of the pair of frame intermediate back , straight , substantially parallel - disposed , spaced - apart , vertically - oriented , short , and slender cylindrical members 56 of the hollow rigid substantially l - shaped frame 26 . the frame upper back , semi - circular , vertically oriented , elongated , and slender connecting member 62 of the hollow rigid substantially l - shaped frame 26 is displaced a distance behind the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 and is displaced a distance behind the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 . the hollow rigid substantially l - shaped frame 26 further includes a pair of frame lower intermediate side , straight , substantially parallel - disposed , skew - oriented , elongated , and slender cylindrical members 66 . each of the pair of frame lower intermediate side , straight , substantially parallel - disposed , skew - oriented , elongated , and slender cylindrical members 66 has a frame lower intermediate side member front end 68 and a frame lower intermediate side member back end 70 . each of the pair of frame lower intermediate side , straight , substantially parallel - disposed , skew - oriented , elongated , and slender cylindrical members 66 of the hollow rigid substantially l - shaped frame 26 , at the frame lower intermediate side member front end of each of the pair of frame lower intermediate side , straight , substantially parallel - disposed , skew - oriented , elongated , and slender cylindrical members 66 of the hollow rigid substantially l - shaped frame 26 , extend abruptly rearwardly and slightly upwardly at an obtuse angle , from the frame lower front member intermediate point 39 of each of the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 and are affixed thereto by suitable fastening means 45 that is compatible with the material of the sock donning assist device 10 , such as , but not limited to , solder , epoxy or the like . each of the pair of frame lower intermediate side , straight , substantially parallel - disposed , skew - oriented , elongated , and slender cylindrical members 66 of the hollow rigid substantially l - shaped frame 26 are displaced a distance above , and in the same vertical plane as , each of the pair of frame lower side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 28 of the hollow rigid substantially l - shaped frame 26 and are displaced a distance below , and in the same vertical plane as , each of the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 . each of the pair of frame lower intermediate side , straight , substantially parallel - disposed , skew - oriented , elongated and slender cylindrical members 66 of the hollow rigid substantially l - shaped frame 26 has a length less than the length of each of the pair of frame lower side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 28 of the hollow rigid substantially l - shaped frame 26 and has a length greater than the length of the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 . the hollow rigid substantially l - shaped frame 26 further includes a pair of frame upper front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 72 . each of the pair of frame upper front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , slender cylindrical members 72 has a frame upper front member lower end 74 and a frame upper front member upper end 76 . each of the pair of frame upper front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 72 of the hollow rigid substantially l - shaped frame 26 , at the frame upper front member lower end 74 of each of the pair of frame upper front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 72 of the hollow rigid substantially l - shaped frame 26 , extend smoothly upwardly and slightly rearwardly at an obtuse angle , from the frame lower intermediate side member back end 70 of the pair of frame lower intermediate side , straight , substantially parallel - disposed , skew - oriented , elongated , and slender cylindrical members 66 of the hollow rigid substantially l - shaped frame 26 and together therewith forms a frame lower intermediate side smooth concave - shaped bend 78 . the pair of frame upper front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 72 of the hollow rigid substantially l - shaped frame 26 are substantially parallel to , and displaced a distance forward of , the pair of frame lower back , straight , slightly inwardly tapering , substantially vertically - oriented , elongated , and slender cylindrical members 48 of the hollow rigid substantially l - shaped frame 26 and are displaced a distance rearward of the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 . each of the pair of frame upper front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 72 of the hollow rigid substantially l - shaped frame 26 has a length less than the length of each of the pair of frame lower back , straight , slightly inwardly tapering , substantially vertically - oriented , elongated , and slender cylindrical members 48 of the hollow rigid substantially l - shaped frame 26 . the frame upper intermediate side member back end 44 of each of the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 abruptly meets at an obtuse angle , the frame upper front member lower end 74 of each of the pair of frame upper front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 72 of the hollow rigid substantially l - shaped frame 26 and are affixed thereto by the suitable fastening means 45 . the hollow rigid substantially l - shaped frame 26 further includes a frame u - shaped top , horizontally oriented , forwardly opening , elongated , and slender member 80 . the frame u - shaped top , horizontally oriented , forwardly opening , elongated , and slender member 80 of the hollow rigid substantially l - shaped frame 26 has a pair of frame top member ends 82 and a frame top member midway point 83 . the frame u - shaped top , horizontally oriented , forwardly opening , elongated , and slender member 80 of the hollow rigid substantially l - shaped frame 26 , at the pair of frame top member ends 82 of the frame u - shaped top , horizontally oriented , forwardly opening , elongated , and slender member 80 of the hollow rigid substantially l - shaped frame 26 , extends smoothly rearwardly at an obtuse angle , from each frame upper front member upper end 76 of each of the pair of frame upper front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 72 of the hollow rigid substantially l - shaped frame 26 and together therewith forms a frame upper front smooth convex - shaped bend 84 . the frame u - shaped top , horizontally oriented , forwardly opening , elongated , and slender member 80 of the hollow rigid substantially l - shaped frame 26 is substantially parallel to , and displaced a distance above both , the pair of frame lower side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 28 of the hollow rigid substantially l - shaped frame 26 and is displaced a distance above the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 . the frame u - shaped top , horizontally oriented , elongated , and slender member 80 of the hollow rigid substantially l - shaped frame 26 has a span less than the length of the pair of frame lower side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 28 of the hollow rigid substantially l - shaped frame 26 . the frame top member midway point 83 of the frame u - shaped top , horizontally oriented , elongated , and slender member 80 of the hollow rigid substantially l - shaped frame 26 is affixed to the frame upper back member midway point 65 of the frame upper back semi - circular , vertically oriented , elongated , and slender member 62 of the hollow rigid substantially l - shaped frame 26 , by the suitable fastening means 45 . the hollow rigid substantially l - shaped frame 26 further includes a frame lower back , straight , horizontally - oriented , elongated , and slender cylindrical connecting member 86 . the frame lower back , straight , horizontally - oriented , elongated , and slender cylindrical connecting member 86 of the hollow rigid substantially l - shaped frame 26 has a pair of frame lower back connecting member ends 88 . the frame lower back , straight , horizontally - oriented , elongated , and slender cylindrical connecting member 86 of the hollow rigid substantially l - shaped frame 26 , at the pair of frame lower back connecting member ends 88 of the frame lower back , straight , horizontally - oriented , elongated and slender member 86 of the hollow rigid substantially l - shaped frame 26 , extends smoothly at a right angle , from the area in proximity to each of the frame lower back member lower end 50 of each of the pair of frame lower back , straight , slightly inwardly tapering , substantially vertically - oriented , elongated , and slender cylindrical members 48 of the hollow rigid substantially l - shaped frame 26 . the frame lower back , straight , horizontally - oriented , elongated , and slender cylindrical connecting member 86 of the hollow rigid substantially l - shaped frame 26 is displaced a distance behind the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 and is displaced a distance behind the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 . the operation of the sock donning assist device 10 can best be seen in fig1 and 2 , and as such , will be discussed with reference thereto . as shown in fig2 the sock lower portion 12 of the sock 11 is placed through the frame u - shaped top , horizontally oriented , forwardly opening , elongated , and slender member 80 of the frame vertically - oriented sock holding portion 29 of the hollow rigid substantially l - shaped frame 26 with the sock lower portion 12 of the sock 11 positioned in the interior space of the frame vertically - oriented sock holding portion 29 of the hollow rigid substantially l - shaped frame 26 . the sock upper portion 13 of the sock 11 is stretched over the frame u - shaped top , horizontally oriented , forwardly opening , elongated , and slender member 80 of the frame vertically - oriented sock holding portion 29 of the hollow rigid substantially l - shaped frame 26 . the sock upper portion 13 of the sock 11 is then pulled down over the exterior of the frame vertically - oriented sock holding portion 29 of the hollow rigid substantially l - shaped frame 26 and released so as to be compressingly secured thereto and ready for the caretaker 24 to apply . as shown in fig1 the caretaker hand forefinger 22 of each of the pair of caretaker hands 20 of the caretaker 24 enters each caretaker forefinger gripping space 35 and is bent around each of the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 in a securely gripping fashion . the caretaker hand remaining fingers 23 of each of the pair of caretaker hands 20 of the caretaker 24 enters each caretaker remaining finger gripping space 37 and are bent around each of the pair of frame lower front , straight , substantially parallel - disposed , spaced - apart , substantially vertically - oriented , elongated , and slender cylindrical members 34 of the hollow rigid substantially l - shaped frame 26 in a securely gripping fashion . the presence of each of the pair of frame upper intermediate side , straight , substantially parallel - disposed , spaced - apart , horizontally - oriented , elongated , and slender cylindrical members 41 of the hollow rigid substantially l - shaped frame 26 being positioned in between the caretaker hand forefinger 22 of each of the pair of caretaker hands 20 of the caretaker 24 and the caretaker hand remaining forefingers 23 of each of the pair of caretaker hands 20 of the caretaker 24 increases gripping ability and reduces unwanted rotation of the sock donning assist device 10 during use . the user foot toe portion 15 of the user foot 14 of the user leg 16 of the user 18 is inserted into the sock lower portion 12 of the sock 11 . the combination sock donning assist device 10 and the sock 11 is gently pushed upwards on the user leg 16 of the user 18 . the sock upper portion 13 of the sock 11 pulls up and off the exterior of the frame vertically - oriented sock holding portion 29 of the hollow rigid substantially l - shaped frame 26 and becomes compressingly secured to the user foot 24 of the user leg 16 of the user 18 . the sock donning assist device 10 is then removed with the user foot 14 of the user leg 16 of the user 19 , or in cases of high socks the user leg 16 of the user 19 , leaving the frame u - shaped top , horizontally oriented , forwardly opening , elongated , and slender member 80 of the frame vertically - oriented sock holding portion 29 of the hollow rigid substantially l - shaped frame 26 . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of constructions differing from the types described above . while the invention has been illustrated and described as embodied in a sock donning assist device , it is not limited to the details shown , since it will be understood that various omissions , modifications , substitutions and changes in the forms and details of the device illustrated and its operation can be made by those skilled in the art without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute characteristics of the generic or specific aspects of this invention .	0
turning now to fig1 of the drawings , the hardware system 10 to be employed comprises a computer - controlled receiver 12 that is connected to a conventional personal computer 14 through an interface cable 16 . computer 14 has a conventional video monitor 18 and a conventional keyboard 20 . this receiver utilizes a conventional antenna designated by the reference numeral 22 which for best results , should be located away from the computer to minimize noise - pickup . in the example of fig1 computer 12 is an “ external ” unit that sits apart from the computer 14 . it is connected to the computer using an external communications interface such as rs - 232 , usb , ethernet , etc . alternatively , the receiver 12 may comprise an “ internal ” card - based radio that is simply plugged into the computer bus ( such as isa or pci , etc ), and housed permanently within the computer cabinet . the software which controls the receiver runs on the pc under a standard gui operating system such us windows 95 / 98 , windows nt 4 . 0 , windows 2000 , or a variety of unix “ flavors ” including the increasingly popular “ linux ” variation . in any event , the chosen receiver accepts preestablished tuning and control instructions from the computer via the interface line 16 . different manufacturers use different control sequences and codes to control their radios . for example , with the winradio wr - 1500i internal radio , the following api ( application programming interface ) command is sent to establish a desired tuning and display frequency of 453 . 567 mhz : set frequency ( 453567000 ). the pc 14 runs the application software for tuning the receiver . this software has a graphical control panel , which , in our practical implementation , is illustrated in fig2 . the white rectangular area marked “ g ” represents a two - dimensional tuning field . when the mouse cursor “ e ” is placed in the field and the left mouse button is held down , the intersecting horizontal cursor “ d ” and vertical cursor “ f ” will follow the mouse movement . the horizontal cursor “ d ” represents the tuning resolution . this will vary from the coarsest when the cursor is placed at the top of the field , to the finest when it is at the bottom . the legend “ c ” on the right - hand side of the tuning field represents the current frequency span of the tuning field . if the tuning resolution is coarsest , it is preferable that the frequency span should equal to the entire frequency range of the receiver . alternatively , the legend “ c ” might show the frequency resolution rather than frequency span . the frequency resolution would be equal to the frequency span ( in frequency units ) divided by the width of the tuning window ( in pixels ). in example of fig2 the current selected frequency span is 10 mhz ., which is also reflected on the legend “ b ” which shows the current frequency limits . this legend is dynamically changed according to the vertical position of cursor “ d ”. in other words , if the cursor is moved horizontally across the field while vertically positioned in a constant location , the radio &# 39 ; s frequency will be tuned plus or minus five mhz . from the initial center frequency of 455 . 0 mhz . thus moving of the cursor “ f ” from left to right results in the actual tuning of the receiver , with the tuning resolution depending on the position of cursor “ d ”. if cursor “ d ” is at the top of the tuning window , then moving of cursor “ f ” from the leftmost to the rightmost point of the tuning field will result in the coarsest tuning of the receiver , spanning its entire frequency range in one movement . if cursor “ d ” is at the bottom of the tuning window , then moving of cursor “ f ” will result in the finest tuning of the receiver . while the mouse button is held down , the frequency display “ a ” will keep changing following the hand movements , and show the frequency to which the receiver is currently tuned . turning to fig3 it is also possible to combine the two - dimensional tuning field of fig2 with a spectrum analyzer . the two - dimensional tuning area “ g ” shows spectral lines with increasing resolution from top to bottom . the bottom window “ h ” shows magnified spectrum at the lowest resolution . this is achieved by using the software algorithm of fig4 to be described , with the spectrum lines superimposed on the image , using the function fr ( to be described ) to calculate the variations of the spectrum at various vertical positions . in fig3 by way of example only , the user has selected a frequency of 455 . 678 mhz . the cursor is vertically positioned to enable a possible 10 mhz . tuning swing as the cursor is moved across the field horizontally . the spectral display of field h is also drawn in bold colors beneath the spectrum lines g . [ 0039 ] fig5 shows a display similar to fig3 but additionally using a mouse - operated slide bar 30 for “ old fashioned ” computer frequency selection . moreover the graphical field 33 shows the display resulting when the user has moved to the maximum frequency the radio allows ( i . e ., 50 mhz in this example ). the right side of field 33 is thus blank . the left side 35 shows he panoramic display . beneath it is a miniature power spectral display 34 , that is a miniature version of the power spectrum display in box 37 . fig6 illustrates what happens when the minimum frequency is chosen , which in this case is 50 khz . spectral lines and the display now appear only on the right side ( fig6 ). the preferred algorithm 40 executed by the software is seen in fig4 . in step 42 the initial frequency is determined . the initial cursor position is determined in step 44 , and , in step 46 , the receiver is tuned to the frequency selected in step 42 . that frequency is maintained until step 48 detects mouse movement . in step 50 a new operating frequency is calculated . the function fr is a “ frequency resolution function ”, either calculated in real time , or table - defined , which determines the relationship between the vertical cursor position , and the tuning step ( tuning increment per one pixel ). this function can be linear , logarithmic or other , and determines the progression from the coarse tuning ( when the cursor is at the top of the tuning field ), and the fine tuning ( when at the bottom of the field ). in step 52 the new frequency and mouse cursor positions are remembered , and return occurs on line 54 to tune the receiver to the new frequency , and repeat the process . in box 50 ( fig4 ) the relationship is best described by the following generalized equation : where f1 is the old frequency , and f2 is the new frequency , where x1 , y1 are the new co - ordinates of the mouse , x2 , y2 are the old co - ordinates of the mouse , and f is a function describing a relationship between the position of the mouse and the frequency resolution . this may be a simple linear function , for example : fr ( y )= fr max +( fr min − fr max ) * ( y − y min )/( y max − y min ), where y min is the minimum vertical co - ordinate (“ top ” in our example ), y max is the maximum vertical co - ordinate (“ bottom ” in our example ), fr max is the coarsest frequency resolution ( corresponding to y min ), and fr min is the finest resolution ( corresponding to y max ). this simple linear function makes sure that , at the minimum vertical co - ordinate (“ the highest ” in our example on fig2 and 3 ), the resolution is the coarsest ( fr max ), to make it possible to span the entire frequency range of the receiver . fr max can be calculated as : fr max =( f max − f min )/( x max − x min + 1 ), where f max and f min are the maximum and the minimum frequencies the receiver can be tuned to , respectively ; and x max and x min are maximum and minimum horizontal co - ordinates of the tuning window . fr min is equal to the tuning resolution of the receiver . for example , the winradio receivers have a tuning resolution of 1 hz . in another implementation , it may be preferable for the fr function to be a logarithmic or other function rather than the simple linear function shown in our example above . this means that , for example , with a vertical hand movement from top to bottom , the frequency resolution change would decelerate the lower the cursor moves towards the finer resolution ( this is in fact the situation with our examples shown on fig2 and 3 ). different “ tuning characteristics ” of a receiver could be employed by allowing the user to select from a palette of several “ fr ” functions ( linear , logarithmic , step , etc .). if a step - function is employed , the fr function could be such that the finest resolution would correspond to a typical channel separation in a particular frequency band . for example , in some vhf point - to - point communications , the step size is 25 khz ., which would then correspond to the maximum vertical co - ordinate ( y max ) as described earlier . in another interesting ramification , the fr function can be also made dependent on the actual frequency tuned to , thus making it possible to define different tuning characteristic for different frequency bands . for example , a linear or logarithmic fr function ( with the finest resolution say 1 hz .) could apply to short - wave ( 3 - 30 mhz ) bands , while a step - function with the finest resolution of , say , 10 khz ., could apply to a fm radio band ( 88 - 108 mhz ), where such coarse tuning resolution is preferable . ultimately , the user should be able to assign the most suitable fr function to any specific frequency band within the frequency range of the receiver . in one practical implementation of such concept , the user could be presented with an edit box allowing him to specify a default fr function ( for example , a choice between linear and logarithmic ), and an edit grid . to define “ exception ” bands ( starting and ending frequencies ), where the fr could be defined as a step function to offer a convenience of tuning within those frequency bands where radio channels are separated by equal frequency steps . such a step function might , for example , divide the vertical range ( y - co - ordinate ) to several segments , with the frequency resolution in these segments being an integral multiple of the channel spacing . if , say , the channel spacing in a particular frequency band is 25 khz , then the frequency steps ( from coarsest to finest , or from top to bottom ) could be , for example , 10 mhz , 5 mhz , 1 mhz ., 500 khz , 100 khz , 50 khz and 25 khz , dividing the vertical range to 7 segments , and providing a convenient method of fast navigation in this particular band . the superimposition of a spectrum display onto the tuning field g in fig2 producing results such as can be seen of fig3 and 6 , can be for example done in such a way that the brightness of any x , y point in field g depends on the signal level on the corresponding frequency , so that frequencies with a greater signal level generate points with higher brightness . the color of any point can be made to depend on the signal level gradient on the corresponding frequency . for example , frequencies where the signal level has a higher dependence on the frequency ( i . e . a signal “ peak ”) would generate points with a higher red color content , frequencies where the signal level has a lower dependence on the frequency ( a “ plateau ”) would generate points with a higher blue color content . the spectrum graph is generated by obtaining signal strength values for frequencies within a suitable number of ranges ( coarsest to finest , with increasing resolution ) given by the function fr , around the frequency the receiver is tuned to . the resulting curves are then superimposed on the tuning field , their number depending on how many such ranges have been thus measured . alternatively , a single finest resolution scan can be taken , and the individual curves ( of progressively coarser resolution ) can be calculated from this single one . this concept can be used with any digitally tunable radio and any personal computer . all that is required by the software is to send a command to the receiver “ set frequency to xxx . xxx mhz ”. all remotely controllable receivers accept such command in one form or another . all digitally tuned receivers have a facility to accept such a “ tune to ” command . the relevant command in winradio receivers is setfrequency ( x ), where x is in hz . the low - level software then uses a matrix algorithm to find optimum dividers for the pll . from the foregoing , it will be seen that this invention is one well adapted to obtain all the ends and objects herein set forth , together with other advantages which are inherent to the structure . it will be understood that certain features and subcombinations are of utility and may be employed without reference to other features and subcombinations . this is contemplated by and is within the scope of the claims . as many possible embodiments may be made of the invention without departing from the scope thereof , it is to be understood that all matter herein set forth or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense .	7
the desgly 9 compounds of the invention are illustrated by the following structural formula : ## str1 ## in which : p is phe or phe ( 4 &# 39 ;- alk ); x is d - phe , d - val , d - nva , d - leu , d - ile , d - aile , d - pba , d - nle , d - cha , d - abu , d - met d - chg , d or l - tyr or d or l - tyr ( alk ); a is val , ile , abu , ala , gly , lys , cha , nle , phe , leu , chg or nva ; n is 0 , 1 or 2 , or a pharmaceutically acceptable salt , ester prodrug or complex thereof . a subgeneric group of compounds of this invention comprises compounds of formula i in which x is d - tyr , d - cha , d - phe , d - ile , d - leu , d - val or d - tyr ( et ); p is phe or phe ( 4 &# 39 ;- et ), a is as defined above , y is nh 2 ; w is pro , z is arg and n is 1 . the compounds of formula i in which x is d - tyr ( et ) are particularly active adh antagonists as are the amide 8 congeners . individual compounds of interest are [ 1 -( β - mercapto - β , β - cyclopentamethylenepropionic acid )- 2 - d - tyrosine - 4 - valine - 8 - arginine - 9 - desglycine ] vasopressin , [ 1 -( β - mercapto - β , β - cyclopentamethylenepropionic acid )- 2 - d - tyrosine - 4 - valine - 8 - arginine - 9 - desglycinamide ] vasopressin and , especially , [ 1 -( β - mercapto - β , β - cyclopentamethylenepropionic acid )- 2 -( o - ethyl - d - tyrosine )- 4 - valine - 8 - arginine - 9 - desglycine ] vasopressin . also included in this invention are various derivatives of the compounds of formula i such as addition salts , prodrugs in ester or amide form and complexes . the addition salts may be either salts with pharmaceutically acceptable cations such as nh 4 . sup .⊕, ca . sup .⊕⊕, k . sup .⊕ or na . sup .⊕ at the terminal acid group ( y = oh ) or with a pharmaceutically acceptable salt at a basic center of the peptide ( as in the arg units ). the acetate salt forms are especially useful although hydrochloride , hydrobromide and salts with other strong acids are useful . the compounds , also , form inner salts or zwitter ions as when y is oh . the ester prodrug forms are , for example , lower alkyl esters of the acids of formula i which have from 1 - 8 carbons in the alkyl radical or aralkyl esters such as various benzyl esters . other latentiated derivatives of the compounds of formula i will be obvious to those skilled in the art &# 34 ; complexes &# 34 ; include various solvates such as hydrates or alcoholates or those with supporting resins , such as a merrifield resin . the compounds of formula i are prepared by cyclizing a linear octapeptide by means of the two mercapto groups , at the cysteine unit ( cys ) at position 6 and at the β - mercapto - β , β - cycloalkylenepropionic acid unit ( cap ) at position 1 . the cyclization reaction occurs readily in the presence of a mild oxidizing agent capable of oxidizing a mercaptan to a disulfide . the reaction is represented as follows : ## str2 ## in which : x , p , a and y are as defined for formula i , above ; z is as defined for formula i above or also may be a single bond whenever y is oh ; w is as defined for formula i above or also may be oh whenever z and y are absent ; and q 1 and q 2 are , each , hydrogen or a displaceable group . the intermediates of formula ii are new compounds and are a part of this invention . the compounds of formula iii in which either or both w and z are absent are also new compounds useful as intermediates as described below . the latter have vsp antagonist activity at a lower level than that of the octapeptides . the cyclization reaction of this reaction sequence is most usefully carried out by oxidation . any oxidizing agent known to the art to be capable of converting a dimercaptan to a disulfide may be used . exemplary of such agents are an alkali metal ferricyanide , especially potassium or sodium ferricyanide , oxygen , gas , diiodomethane or iodine . as an example , potassium ferricyanide is added to the dimercaptan of formula ii dissolved in a suitable inert solvent , for example , water or aqueous methanol at temperatures of from 0 °- 40 °. often , oxidation is at a ph of 7 - 7 . 5 at ambient temperature in dilute solution gives good yields , 40 - 50 %, of the cyclic compound . the compounds of formula iii which are the cys ( oh ) 6 or pro ( oh ) 7 compounds are reacted with a dipeptide , a protected ( nh 2 )- wzy , or an amino acid , ( nh 2 )- z - y , respectively , as described hereafter . the linear mercaptan starting material may or may not have displaceable or protective groups common to the art ( q 1 and q 2 ) present at the various amino acid units . such protective groups include benzyl , p - methoxybenzyl , 1 - adamantyl , t - butyl , p - nitrobenzyl , trityl , benzylthiomethyl , ethylcarbamoyl or acetamidomethyl . benzyl , adamantyl or t - butyl are removed by mercuric ( halo ) acetate salts in aqueous methanol at 0 °- 80 °. the protective group is usually removed before cyclization such as during the hydrogen fluoride splitting of the peptide from the supporting resin . it may , however , be removed either during the cyclization or , in situ , before cyclization . the s - acetamidomethyl groups are especially useful . for example , s - acm - pmp - d - tyr ( et )- phe - val - asn - s - acm - cys - pro - obzl was treated with potassium carbonate in aqueous methanol to give the pro acid linear peptide in 78 - 84 % yield . this was , then , oxidatively cyclized using iodine in aqueous methanol to give the desired pro ( oh ) 7 product in 65 - 70 % yield . alternatively , the protected product was cyclized under the same conditions with initial iodine treatment followed by potassium carbonate removal of the protective ester radical . the pro 7 acid was , then , condensed with arg ( nh 2 ), using dcc and dmap in dmf at 0 °- 20 ° to give the ## str3 ## in 45 % yield . iodine , therefore , removes the s - protective group , especially the acm group , and cyclizes the intermediate . mercuric acetate or lead acetate also remove the acm group to yield a metal mercaptide . this is converted to the thiol in situ by treatment with hydrogen sulfide and , then , oxidized in a separate step . the desired cyclic octapeptide of formula i can be conveniently isolated by acidifying the aqueous oxidation mixture , such as using glacial acetic acid , and passing the reaction mixture over an ion - exchange chromatographic column , for example , over a weakly acid , acrylic resin column with acid elution , or by gel filtration over a bead - formed gel prepared by cross - linking dextran with epichlorohydrin . as an alternative to the cyclization of the linear intermediates of formula ii suggested above , the cyclized 6 - cys acids or 7 - pro acids ( those of formula i in which either both tail units , w and z , or only one tail unit , z , are absent ) are condensed with a protected dipeptide , w - z - y , or with an amino acid , z - y , respectively . the reaction of the cys acid or the pro acid with a suitably protected dipeptide or amino acid is carried out using any amide forming reaction common to the peptide art . usually , substantially equimolar quantities of the starting materials are reacted in the presence of a carbodiimide , such as dicyclohexylcarbodiimide , plus 1 - hydroxybenzotriazole or dimethylaminopyridine in an organic solvent at from 0 °- 35 °, preferably , from ice to room temperature . the protective groups are removed by a reaction which will not split the disulfide bond of the hexapeptide ring , for example , mild alkali . the important intermediates of formula ii are conveniently prepared using solid - phase methods of peptide synthesis as discussed in m . manning et al ., j . med . chem . 25 46 ( 1982 ). a commercial benzhydrylamine support resin ( bhr ) is used to prepare the end products of formula i in which y is nh 2 ( the des - glycines ) and a chloromethyl support resin ( cmr ) is used to prepare the compounds of formula i in which y is oh ( the des - glycinamides ). the peptide chain of the linear peptides of formula ii is built up , stepwise , proceeding from unit 8 working toward unit 1 . each unit is properly protected as known in the peptide art and as described below . alternatively , various oligopeptides may be built up using liquid or support reactions , then condensed as a last step in the reaction sequence for preparing the dimercapto intermediates . the preferred sequence of resin supported step reactions is conveniently carried out in a beckman 990b peptide synthesizer without isolation of each intermediate peptide . the details of the procedure are in the working examples presented hereinafter . solution or enzyme reaction conditions are applicable here as known to the art . the various amino acids , which are consecutively added to the resin supported chain are protected as known to the art . for example , the boc protecting group is used for an amino group especially at the α - position ; an optionally substituted benzyl , for the mercapto groups at the pmp and cys units ; tosyl , for the arg unit ; and an optionally substituted carbobenzoxy ( z ) for the tyr or lys units . the protective groups should , most conveniently , be those which are easily removed , that is , using acid treatment for the tert .- butyloxycarbonyl group , sodium - liquid ammonia or catalytic hydrogenation for the benzyl or carbobenzoxy groups where the removal reaction conditions are not conducive to reaction at other portions of the peptide such as the disulfide bond . as other examples of protecting groups , the amino group of an amino acid or oligopeptide is protected conventionally by an acyl group such as formyl , trifluoroacetyl , phthaloyl , p - toluenesulfonyl or o - nitrophenylsulfonyl group ; a benzyloxycarbonyl group such as benzyloxycarbonyl , o - bromobenzyloxycarbonyl , p - bromobenzyloxycarbonyl , o - or p - chlorobenzyloxycarbonyl , p - nitrobenzyloxycarbonyl or p - methoxybenzyloxycarbonyl , an aliphatic oxycarbonyl group such as trichloroethyloxycarbonyl , t - amyloxycarbonyl , t - butoxycarbonyl or diisopropylmethoxycarbonyl , or an aralkyloxycarbonyl group such as 2 - phenylisopropoxycarbonyl , 2 - tolylisopropoxycarbonyl or 2 - p - diphenylisopropoxycarbonyl . amino groups are also protected by forming enamines by reaction with a 1 , 3 - diketone such as benzoylacetone or acetylacetone . the carboxyl groups can be protected by amide formation , hydrazide formation or esterification . the amide group is substituted , if necessary , with a 3 , 4 - dimethoxybenzyl or bis -( p - methoxyphenyl )- methyl group . the hydrazide group is substituted with a benzyloxycarbonyl , trichloroethyloxycarbonyl , trifluoroacetyl , t - butoxycarbonyl , trityl or 2 - p - diphenyl - isopropoxycarbonyl group . the ester group is substituted with an alkanol such as methanol , ethanol , t - butanol or cyanomethylalcohol ; an aralkanol such as benzylalcohol , p - bromobenzylalcohol , p - chlorobenzylalcohol , p - methoxybenzylalcohol , p - nitrobenzylalcohol , 2 , 6 - dichlorobenzylalcohol , benzhydrylalcohol , benzoylmethylalcohol , p - bromobenzoylmethylalcohol or p - chlorobenzoylmethylalcohol ; a phenol such a 2 , 4 , 6 - trichlorophenol , 2 , 4 , 5 - trichlorophenol , pentachlorophenol , p - nitrophenol or 2 , 4 - dinitrophenol ; or a thiophenol such as thiophenol or p - nitrothiophenol . the hydroxy group in tyrosine is optionally protected by esterification or etherification . a group protected by esterification is , for example an o - acetyl group ; a o - benzoyl group , o - benzyloxycarbonyl or o - ethyloxycarbonyl . a group protected by etherification is , for example , an o - benzyl , o - tetrahydropyranyl or o - t - butyl group . the amino group in the guanidino group in arginine can be protected by a salt forming , nitro , tosyl , benzyloxycarbonyl or mesitylene - 2 - sulfonyl group . however , it is not always necessary to protect the guanidino group . the protected linear peptide intermediate is split from the carrying resin matrix , for example , by using ammonia in an alcoholic solvent , and , then , is treated to remove the protective groups , such as by using sodium - liquid ammonia . this procedure gives the amide derivative of the linear octapeptide . more conveniently , the two steps are combined by treating the resin supported peptide with anhydrous hydrogen fluoride in the presence of a suitable cation scavenger as known to the art , such as anisole , to give the octapeptide intermediate of formula ii , in dimercaptan form , and in good yield . the compounds of this invention have potent vasopressin antagonist activity . vasopressin is known to contribute to the anti - diuretic mechanism of action within the kidney . when the action of these compounds antagonizes that of the natural anti - diuretic hormone ( adh ), the body excretes water due to an increased permeability of the terminal portions of the renal tubule . we believe the mechanism of action is at the vasopressin receptors ( v 2 - receptors ) located on the plasma membrane of certain renal epithelial cells . the most notable pharmocodynamic effect of the adh antagonists of the invention is that of a water diuretic rather than of a natriuretic such as a thiazide . any patient suffering from the syndrome of inappropriate antidiuretic hormone secretion ( siadh ) or from an undesirable edematous condition is a target for the claimed compounds . examples of clinical conditions indicated for the compounds of this invention include hypertension , hepatic cirrhosis , congestive heart failure or a component of any traumatic condition resulting from serious injury or disease in which the agonism of naturally occurring vasopressin at the vsp - mediated receptor sites is a contributing factor . the second group of vasopressin receptor sites are the vascular pressor sites ( v 1 - receptors ) located within the cardiovascular system itself . for example , compound 5 of table i below was tested in the dyckes protocol ( u . s . pat . no . 4 , 367 , 255 ) for inhibition of vasopressin - induced vasoconstriction in the rat ; in vitro ( pa 2 8 . 40 ) and in vivo ( pa 2 7 . 71 ). antagonism at the v 2 receptor sites results in vasodilation with an end result of anti - hypertensive activity . treatment of dysmenorrhea is another utility for the compounds of this invention when administered intravenously or intranasally . the compounds of this invention , therefore , are used to treat edema or to expell water in patients in need of such treatment by administering parenterally or by insufflation a nontoxic but effective quantity of the chosen compound , preferably combined with a pharmaceutical carrier . dosage units of the active ingredient are selected from the range 0 . 01 to 10 mg / kg , preferably 0 . 01 to 5 mg / kg , based on a 70 kg patient . the dosage units are applied from 1 to 5 times daily . the pharmaceutical composition for inducing vasopressin antagonism contains an active ingredient of formula i in the form of a dosage unit as described above dissolved or suspended in a standard liquid carrier . a standard carrier is isotonic saline , contained in an ampoule or a multiple dose vial which is suitable for parenteral injection such as for intravenous , subcutaneous or intramuscular administration . a composition for insufflation is similar but is usually administered in a metered dose applicator or inhaler . pulverized powder compositions may , also , be used , along with oily preparations , gels , buffers for isotonic preparations , emulsions or aerosols , as standard composition forms . the compounds of this invention have been demonstrated to have unique antagonistic activity toward the natural antidiuretic hormone ( anti - adh activity ), in vitro , in the medullary tissue of hog or human kidney and , in vivo , in the hydropenic rat or the hydropenic monkey . details of the in vitro protocols are in f . l . stassen et al ., j . of pharm . exp . ther . 233 , 50 - 54 ( 1982 ) but the calculations of cyclase activity and binding potential at the receptor site are as follows : in each experiment the amount of 32 p / camp formed in the absence of medullary membrane is determined ( blank ). the blank value is subtracted from all experimental data . the compound is tested for its effect on basal adenylate cyclase activity and / or on vasopressin stimulated activity . each determination is carried out in triplicate . the ka value is derived from a lineweaver - burke plot . rel . v max =( v max drug / v max vasopressin )× 100 . k i = i /[( ka &# 39 ;/ ka )- 1 ] where i is the concentration of the antagonist , and ka &# 39 ; and ka are the concentrations of vasopressin required to give half - maximal activity of adenylate cyclase in the presence and absence of antagonist , respectively . test procedure for binding assay : in each experiment , the amount of 3 h - vasopressin bound in the absence and in the presence of an excess of vasopressin ( 7 . 5 × 10 - 6 m ) is measured in triplicate . these values represent total and non - specific binding , respectively . the k b of a compound is derived from the equation for competitive inhibition : k b = ic 50 /( 1 + l / k d ), where ic 50 is the concentration required for 50 % inhibition of specific 3 h - vasopressin binding , l is the concentration of the ligand , and k d is the dissociation constant of 3 h - vasopressin ( k d = 3 . 6 × 10 - 9 m ; 1sd = 0 . 4 × 10 - 9 m ). this is the average k d value determined on 3 preparations of hog kidney membranes . food and water are removed from male rats approximately 18 hours prior to testing . animals are housed 4 per metabolism cage . at 0 hour , the test compound is administered intraperitoneally to the test group and an equivalent volume of vehicle is administered to both control groups ( fasted and non - fasted ). urine volume and osmolality are measured every hour for 4 hours . test values are recorded as ml of urine excreted ( cumulative ), meq / rat electrolyte excreted , mg / rat urea excreted , and osmolality in milli - osmoles / kg h 2 o . a tolerance test is used to determine significance . ed 300 is defined as the dose of compound ( μg / kg ) required to lower urine osmolality to 300 m - osmoles / kg . ed 500 is defined as the dose of compound ( μg / kg ) required to lower urine osmolality to 500 m - osmoles / kg . the hydropenic monkey protocol is similar . table i______________________________________ ## str4 ## anti - adh activity in vivo ( rat ) in vitro ( pig ) ed . sub . 300 ki k . sub . bx y a ( μg / kg )* ( nm ) ( μm ) ______________________________________1 . -- d - tyr glynh . sub . 2 val 32 30 0 . 0822 . -- d - tyr nh . sub . 2 val 63 27 0 . 0653 . -- d - tyr oh val 156 160 0 . 354 . -- d - tyr ( et ) glynh . sub . 2 val 9 . 9 5 . 9 0 . 0115 . -- d - tyr ( et ) nh . sub . 2 val 5 . 8 3 . 0 0 . 00786 . -- d - tyr ( et ) nh . sub . 2 abu 13 7 . 6 0 . 018______________________________________ * estimated dose of peptide delivered ip stat ( μg / kg ) which results in reduction of u . sub . osm from hydropenic levels to 300 mosmoles / kg h . sub . 2 o . table i demonstrates , in the described protocols , the anti - vasopressin activity of selected representative compounds whose octapeptide structures have the desgly dipeptide tail which is characteristic of the compounds of this invention . presence of substantial antagonistic activity is unexpected because , in the agonist series , the des - gly - oxytocin has an opposite effect on blood pressure compared with oxytocin itself ( see b . berde at al ., loc . cit .) and shortening the linear tail of oxytocin and vasopressin result is known in the art to cause &# 34 ; a striking decrease of the typical biological activities of the substances &# 34 ; ( see t . barth et al ., loc . cit .). compound 5 of table i , furthermore , has proven to be a compound of exceptional antagonist activity across the various testing protocols in hog or human tissue in vitro tests as well as in hydropenic rat and monkey tests . its anti - adh activity , manifested as the dose required to decrease urine osmolality to 300m osm / kg water in the conscious hydropenic squirrel monkey test , is ed 300 = 8 . 6 nmoles / kg ( i . p .). that of compound 4 of table i is 33 . 1 nmoles / kg . the 2 - d - phe analog of the latter compound is 319 . 0 nmoles / kg . the following examples are intended solely to teach the preparation of the compounds of this invention . all temperatures are in degrees centigrade . for the solid - phase synthesis of the titled resin supported peptide , boc - arg ( tos ) resin ( 3 mmol / 5 . 4 grams of resin ) was used as starting material . the appropriately protected amino acids were coupled sequentially onto the boc - arg ( tos ) resin , prepared by reacting boc - arg ( tos ) as the cesium salt with commercial merrifield resin ( cl - ch 2 resin ) as known to the art , by using a manual program as described in the following steps : 2 . prewashed with 33 % trifluoroacetic acid in methylene chloride with 1 % indole ( 1 time , 1 minute ). 3 . deprotection with 33 % trifluoroacetic acid in methylene chloride with 1 % indole ( 20 minutes ). 5 . prewashed with 10 % triethylamine in methylene chloride ( 1 time , 1 minute ). 8 . protected amino acid ( 10 mmol ) in triethylamine in methylene chloride and 0 . 5m n , n &# 39 ;- dicyclohexylcarbodiimide in methylene chloride ( 20 ml ) were added . in the case of the coupling of the asn moiety , 1 - hydroxybenzotriazole ( hbt , 10 mmol ) was added with boc - asn in dry dimethylformamide . dry dimethylformamide ( dmf ) was also used as solvent when pmp ( bzl ) was coupled onto the peptide resin , using 4 - dimethylaminopyridine ( 10 mm ). completion of each coupling reaction was monitored by the ninhydrin test . the 4 - methoxybenzyl group was used to protect the thiol group of cys and the 2 - bromo - carbobenzoxy group was employed to block the phenolic hydroxyl of d - tyr . the resulting protected pmp ( bzl )- d - tyr ( br - z )- phe - val - asn - cys ( ome - bzl )- pro - arg ( tos )- resin was washed well with methylene chloride and methanol , respectively . after drying in vacuo overnight , 8 . 4 grams of the titled protected resin intermediate was collected . pmp ( bzl )- d - tyr -( p - bromocarbobenzoxy )- phe - val - asn - cys ( ome - bzl )- pro - arg ( tos ) resin ( 4 g , ca . 1 . 5 mmol ) was subjected to ammonolysis using saturated ammonia / methanol solution ( 200 ml ) in dry dimethylformamide ( 50 ml ) at room temperature for 48 hours . after evaporation to dryness , the residue was precipitated by ethyl acetate / n - hexane and filtered to give the protected octapeptide amide ( 1 . 54 g ). this crude peptide was dissolved in liquid ammonia ( 250 ml ) and treated with sodium / liquid ammonia solution to give pmp - d - tyr - phe - val - asn - cys - pro - arg - nh 2 which was , then , oxidized using 0 . 01m potassium ferricyanide solution in 4 l . of aqueous solution at ph 7 - 7 . 5 . after the completion of oxidation reaction , the ph of aqueous solution was adjusted to ph 4 . 5 by adding glacial acetic acid . this solution was passed through a weakly acid acrylic resin ( bio - rex 70 ) column ( 11 × 2 . 5 cm , h + form ) slowly . the column was eluted with 5 % and 50 % acetic acid solution , respectively . crude cyclized ## str6 ## was collected from 50 % acetic acid solution fractions ( 860 mg ). ______________________________________purification of ## str7 ## ______________________________________1 . counter - current distribution : sample : 860 mg crude , n - buoh / hoac / h . sub . 2 o ( 4 : 1 : 5 ) 250 transfers ( a ) fr . 186 - 204 , 436 mg ( b ) fr . 182 - 185 & amp ; 205 - 218 , 219 mg2 . partition chromatography : sample : 250 mg ( from 1 - a ), g - 25 fine ( 2 . 5 × 55 cm ), n - buoh / hoac / h . sub . 2 o ( 4 : 1 : 5 )( a ) fr . 32 - 46 222 mg3 . preparative hplc : sample : 40 mg ( from 2 - a ); alltech c18 , 3000 psig . flow rate : 3 . 0 ml / min . buffer a : 0 . 1 % tfa buffer b : 0 . 25 % tfa / ch . sub . 3 cn ( 4 : 6 ) 60 % b ; isocratic ; 235 nm ( 2 . 0 aufs ) injection : 10 mg / 0 . 5 ml . buffer a 17 mg of pure titled compound . 4 . ion - exchange chromatography : sample : 365 mg ( from 1 - a & amp ; 2 - a ); cmc ; 0 . 01m nh . sub . 4 oac to 0 . 1m nh . sub . 4 oac linear gradient ( a ) fr . 51 - 70 93 . 3 mg ( b ) fr . 71 - 89 86 . 5 mg ( c ) fr . 91 - 110 65 mg ( d ) fr . 111 - 121 24 . 5 mg______________________________________ pmp ( bzl )- d - tyr ( br - z )- phe - val - asn - cys ( ome - bzl )- pro - arg ( tos )- resin ( 4 . 2 g , 1 . 5 mmol ) from example 1 , in 4 . 5 ml distilled anisole , was reacted with anhydrous hydrogen fluoride ( 40 ml ) at 0 ° for one hour . after treatment as described above and evaporation in vacuo to dryness , the residue was treated with anhydrous ether and filtered off to give 1 . 33 g crude peptide . the completion of removal of the bzl group from the pmp moiety was carried out using the sodium in liquid ammonia reaction as described in example 1 . the resulting unprotected octapeptide was cyclized using 0 . 01m potassium ferricyanide solution at ph 7 - 7 . 5 until color persisted for 30 minutes again as described above in the preparation of the amide . desglycinamide octapeptide ( 600 mg ) was collected after acidifying the oxidation solution with acetic acid to ph 4 . 5 and passing the reaction mixture over a bio - rex - 70 column with 1 l . of 5 % acetic acid as eluent . ______________________________________purification of ## str9 ## ______________________________________1 . counter - current distribution : sample : 600 mg from bio - rex 70 . n - buoh / hoac / h . sub . 2 o ( 4 : 1 : 5 ); 200 transfers ( a ) fr . 150 - 161 169 mg ( b ) fr . 133 - 149 & amp ; 162 - 1632 . preparative hplc : sample : 52 mg ( from 1 - a ); alltech c18 ( 25 cms 10 mm , 10 micron ); buffer a : 0 . 1 % tfa buffer b : 0 . 25 % tfa / ch . sub . 3 cn ( 4 : 6 ) 60 % b , isocratic ; 3000 psig ; 3 . 0 ml / min . injection : 10 mg / 0 . 6 ml in buffer a 235 nm ( 2 . 0 aufs ). ( a ) 24 mg ( b ) 7 . 3 mgcombine 2 - a and 2 - b , repurified on hplc to give 15 mgpure peptide . 3 . partition chromatography : sample : 117 mg ( from 1 - a ), g - 25 fine ( 2 . 5 × 55 cm ) n - buoh / hoac / h . sub . 2 o 4 : 1 : 5 ( a ) fr . 32 - 36 83 mg of pure product______________________________________ the titled compound was prepared by the solid phase method on benzhydrylamine resin ( bha ). thus , 1 . 0 g bha resin ( 1 . 13 mmol nh 2 / g resin ) was reacted with 1 . 5 equivalents of boc - arg ( tos ), 1 . 5 equivalents of dcc and 3 . 0 equivalents of hbt which were made up in dimethylformamide to be 0 . 1m in boc - arg ( tos ). deblocking was performed with 50 % tfa / methylene chloride and neutralization with 5 % diea / methylene chloride . the peptide was elongated , stepwise , by coupling , using preformed boc aminoacyl symmetrical anhydrides in dmf ( 0 . 1m ). boc - asn , boc - d - tyr ( et ) and pmp ( mbz ) were successively coupled using dcc and hbt in dmf . completeness of coupling was monitored by the qualitative ninhydrin test and recoupling was performed as necessary . the completed pmp ( mbz )- d - tyr -( et )- phe - val - asn - cys ( mbz )- pro - arg ( tos )- bha resin was washed with methylene chloride and dried to constant weight , 2 . 34 g . the peptide was deblocked and cleaved from the resin by treatment with anhydrous liquid hydrogen fluoride ( 30 ml ) in the presence of anisole ( 4 ml ) at 0 ° for one hour . after evaporation to dryness under vacuum , the resin was washed with ethyl ether , air dried and , then , extracted with degassed dimethylformamide ( 3 × 20 ml ) and 20 % acetic acid ( 4 × 20 ml ). the dmf and acid extracts were added to 4 l of water ( ph 4 . 5 with acetic acid ). the ph was adjusted to 7 . 2 with ammonium hydroxide and the solution was titrated with 0 . 01m potassium ferricyanide under argon with stirring until a yellow color persisted ( 85 ml ). the ph was brought to 4 . 8 with glacial acetic acid . the mixture was filtered and the filtrate passed over a bio - rex 70 column ( h . sup .⊕). after washing the column with water ( 200 ml ) the crude peptide was eluted with 300 ml of pyridine / acetic acid / water ( 30 : 4 : 66 v / v ). the eluant was evaporated under vacuum at 30 °. the residue was dissolved in 100 ml of 0 . 2n acetic acid , then , lyophilized , yielding 507 mg of the crude titled octapeptide . ______________________________________purification of ## str11 ## ______________________________________1 . counter - current distribution : sample : 607 mg crude , n - buoh : hoac : h . sub . 2 o , 4 : 1 : 5 , 240 transfers ( a ) fr . 154 - 170 & amp ; 190 - 192 71 mg ( b ) fr . 171 - 189 230 mg2 . gel filtration sample : 123 mg of sample ( b ), g - 15 ( 2 . 5 × 55 cm ) using 0 . 2 n hoac , 25 ml / hr ( a ) fr . 46 - 50 ˜ 20 mg ( b ) fr . 51 - 77 60 mg pure peptide______________________________________ a mixture of 0 . 1 mmole of ( pmp 1 - d - leu 2 - val 4 - desglynh 2 ) avp , prepared as described above but using boc - d - leu at position 2 , and 0 . 1 mmole of n - propylamine in 20 ml of dmf was reacted with 23 mg ( 0 . 11 mmol ) of dcc and 14 mg ( 0 . 11 mmol ) of hbt at room temperature for 2 hours . the volatiles were evaporated to give an oily product residue . the product was purified as described above using : ( 1 ) gel filtration over g - 10 - sephadex eluted with 0 . 2n acetic acid ; ( 2 ) high pressure liquid chromatography using 0 . 05 % tfa in 39 % acetonitrile in water ; and , again , ( 3 ) gel filtration to give 20 mg of the pure octapeptide of the title . amino acid analysis : asp 0 . 88 , pro 0 . 93 , val 1 . 00 , leu 1 . 09 , phe 0 . 88 , arg 1 . 07 . hplc = 95 % major peak at 11 . 33 with 40 % aqueous acetonitrile with 0 . 05m kh 2 po 4 as buffer . k bind = 12 . 1 % inhibition at 10 - 5 m . using ( pmp 1 - d - tyr ( et ) 2 - val 4 - desglynh 2 )- avp prepared as in example 2 above and benzylamine gives ## str13 ## other n - alkylated derivatives are prepared similarly . for the solid phase synthesis of the title resin - supported peptide , boc - arg ( tos ) bha resin ( 1 . 19 mmol / g of resin ) was used as a starting material . it was prepared by reaching boc - arg ( tos ), 3 mmol , with the benzhydrylamine resin , 1 . 0 mmol , in dimethylformamide for two hours . the benzhydrylamine resin as the hydrochloride salt was covered with methylene chloride overnight . it was , then , washed with methylene chloride ( 4 × 1 min ), neutralized with 7 % diisopropylethylamine in methylene chloride ( 2 × 2 min ), then , 6 × 1 min with methylene chloride alone and , finally , 2 × 1 min with predried dimethylformamide . the loading of boc - arg ( tos ) on the resin was carried out twice on the shaker using 1 - hydroxybenzotriazole ( hbt , 6 mmol ) and dicyclohexylcarbodiimide ( dcc , 3 mmol ). a quantitative ninhydrin test and amino acid analysis were performed routinely after loading to determine the percentage loading on the resin . loading in this particular run was 62 . 66 %, i . e . 0 . 74 mmol / g of resin was available . the subsequent amino acid , boc - pro , was coupled on the shaker using the following protocol . ( 2 ) prewashed with 50 % tfa in methylene chloride ( 1 time , 1 min ). ( 5 ) prewashed with 7 % diea in methylene chloride ( 1 time , 1 min ). ( 9 ) added protected amino acid ( 3 mmol ) and hbt , 6 mmol , in dmf , followed by the addition of dcc in methylene chloride , 3 mmol , and coupling for 2 hours . the subsequent amino acids were coupled sequentially using beckman peptide synthesizer 990 - b . the program used for each coupling except bocasn and pmp ( 4 - mebzl ) was as follows . ( 2 ) prewashed with 50 % tfa in methylene chloride ( 1 time , 1 min ). ( 5 ) prewashed with 7 % diea in methylene chloride ( 1 time , 1 min ). ( 6 ) neutralized with 7 % diea in methylene chloride ( 1 time , 10 min ). ( 8 ) protected amino acids ( 3 mmol ) in methylene chloride , followed by addition of dcc , 3 mmol , 10 ml of 0 . 3m in methylene chloride , and coupling for two hours . in case of coupling of asn moiety , 1 - hydroxybenzotriazole ( hbt , 6 mmol ) was used , 10 ml of 0 . 6m dimethylformamide . dry dimethylformamide was also used as solvent when pmp ( 4 - mebzl ) was coupled onto the peptide resin , using 4 - dimethylaminopyridine ( 3 mmol ). completion of each coupling reaction was monitored by the ninhydrin test . the 4 - methylbenzyl ( 4 - mebzl ) group was used to protect the thiol groups of the cys and pentamethylene mercaptopropionic acid ( pmp ) moieties . pmp ( 4 - mebzl )- d - tyr ( et )- phe - abu - asn - cys -( 4 - mebzl )- pro - arg ( tos ) bha - resin , 1 . 25 g , ( 0 . 37 mmol ) in 2 ml of anisole , was reacted with anhydrous hydrogen fluoride ( 20 ml at 0 ° for 50 min ). after evaporation of hf in vacuo , the residue was washed with anhydrous ether , 4 × 20 ml , and the crude peptide was extracted with dimethylformamide ( 50 ml ) and 33 % acetic acid ( 50 ml ) into 2 liter of degassed water previously adjusted to ph 4 . 5 . the aqueous diluted disulfhydryl octapeptide was cyclized using 0 . 01m potassium ferricyanide solution at ph 7 . 2 until the yellow color persisted for 30 minutes ( 50 ml ). the ph was adjusted to 4 . 5 using glacial acetic acid and the solution was passed through a weakly acid acrylic resin ( bio - rex - 70 ) column ( 2 . 5 × 12 , r . sup .⊕ form ), slowly . the column was eluted with pyridine - acetate buffer ( 30 : 4 : 66 ; pyridine / glacial acetic acid / water ). the pyridine acetate solution was removed by distillation in vacuo . the residue was lyophilized from 10 % acetic acid to give 300 mg ( 76 %) of crude titled peptide . ______________________________________purification of ## str14 ## ______________________________________1 . counter - current distribution : sample : 300 mg , n - buoh / hoac / h . sub . 2 o , 4 : 1 : 5 , 240 transfers . ( a ) fr . 176 - 186 , 99 . 6 mg of pure peptide ( b ) fr . 170 - 175 and 187 - 210 , 117 . 24 mgyield of purified material , 216 . 84 mg ( 55 %) 2 . molecular formula : c . sub . 50 h . sub . 72 n . sub . 12 o . sub . 10 s . sub . 2 molecular weight : 1064 . 53 amino acid analysis : asp ( 1 . 00 ), abu + cys ( 1 . 70 ), tyr ( 0 . 64 ), phe ( 0 . 98 ), arg ( 0 . 91 ) peptide content : 68 . 06 - 91 . 52 % from amino acid analysis 87 . 33 % from nitrogen analysis3 . chromatography data : solvent r . sub . ftlc n - buoh / hoac / h . sub . 2 o / etoac 0 . 56 ( 1 : 1 : 1 : 1 ) n - buoh / hoac / h . sub . 2 o / 0 . 42 ( 4 : 1 : 5 ) upperhplc c . sub . 18 - column k &# 39 ; isocratic h . sub . 2 o / ch . sub . 3 cn / tfa , 3 ( 60 : 40 : 0 . 25 ) 0 . 05 mkh . sub . 2 po . sub . 4 : 7 . 33 acetonitrile ( 60 : 40 ) gradient h . sub . 2 o / ch . sub . 3 cn / tfa , 8 . 82 80 : 20 : 0 . 25 to 50 : 50 : 0 . 25fast atom bombardment ( fab ): m / z 1065 ( m + h ). sup .+ ; 1063 ( m - h ). sup .- ______________________________________ the tetrapeptide supported resin , boc - asn - cys ( 4 - mebzl )- pro - arg ( tos )- bha , 0 . 72 g ( 0 . 36 mmol ), was synthesized on beckman 990 - b peptide synthesizer , starting from the boc - arg ( tos ) benzhydrylamine resin ( 0 . 72 mmol / g ) using a protocol like that of example 5 . the subsequent amino acids were coupled sequentially on the shaker using hbt and dcc for 2 hours in a similar fashion . after coupling of the last residue , i . e , pmp ( 4 - mebzl ), the resin containing peptide was washed as usual , dried to give 0 . 88 g of the titled intermediate . pmp ( 4 - mebzl )- d - tyr ( et )- phe - ala - asn - cys ( 4 - mebzl )- pro - arg ( tos )- bha - resin , in 2 ml of anisole , was reacted with anhydrous hf , 20 ml , at 0 ° for 50 minutes . the work up was done as usual and the uptake of k 3 fe ( cn ) 6 was 45 ml to give 230 mg ( 60 . 8 %) of crude titled peptide . ______________________________________purification of ## str16 ## ______________________________________1 . counter - current distribution : sample : 230 mg , n - buoh / hoac / h . sub . 2 o , 4 : 1 : 5 , 240 transfers ( a ) fr . 160 - 178 , 105 . 2 mg pure product ( b ) fr . 179 - 190 and 150 - 159 , 49 . 5 mgyield of purified material , 154 . 7 mg ( 41 %). 2 . molecular formula : c . sub . 49 h . sub . 70 n . sub . 70 o . sub . 10 s . sub . 2 molecular weight : 1050 . 449 amino acid analysis : asp ( 1 . 00 ), pro ( 1 . 03 ), ala ( 0 . 94 ), cys ( 0 . 46 ), tyr ( 0 . 65 ), phe ( 0 . 91 ), arg ( 0 . 92 ). peptide content : 59 . 18 - 81 . 77 % from two analyses . 3 . chromatography data : solvent r . sub . ftlc mbuoh / hoac / h . sub . 2 o / etoac 0 . 64 ( 1 : 1 : 1 : 1 ) hplc c . sub . 18 - column k &# 39 ; isocratic h . sub . 2 o / ch . sub . 3 cn / tfa , 2 . 18 60 : 40 : 0 . 1gradient h . sub . 2 o / ch . sub . 3 cn / tfa , 6 . 47 60 : 40 : 0 . 1 to 50 : 50 : 0 . 1fast atom bombardment ( fab ): m / z 1051 ( m + h ). sup .+ ; 1049 ( m - h ). sup .- ______________________________________ the titled resin - supported peptide was prepared from boc - arg ( tos ) bha resin ( 0 . 4 mmol / g ) on a shaker using a protocol used before i . e . deprotection - coupling using hbt and dcc for 2 hours , up to boc - val - asn - cys -( 4 - mebzl )- pro - arg ( tos )- bha resin . the next two amino acid residues were coupled using the beckman peptide synthesizer 990 - b . the pmp ( 4 - mebzl ) was coupled manually using dmap - dcc overnight . the resin - containing peptide was washed and dried as usual to give 2 . 00 g of the titled intermediate . pmp -( 4 - mebzl )- d - tyr ( et )- phe ( 4 - et )- val - asn - cys - 4 - mebzl )- pro - arg ( tos )- bha resin , in 3 ml of anisole was reacted with 30 ml of anhydrous hydrogen fluoride at 0 ° for an hour . the work up was done as described above , with 38 ml of k 3 fe ( cn ) 6 taken up . about 50 mg of crude peptide was obtained from the bio - rex column and 139 mg was precipitated out of solution , total yield 189 mg ( 42 . 7 %) of titled peptide . ______________________________________purification : ______________________________________1 . partition column chromatography , sephadex , g - 25 : sample : 50 mg , n - buoh / hoac / h . sub . 2 o , 4 : 1 : 5 ,( a ) fr . a , 23 . 86 mg ( b ) fr . b , 18 . 5 mgpreparative hplc sample : 43 mg ( from 1 , fr . a + fr . b ), altex ods , 10 mm × 25 cm , 5μ , flow rate 4 ml / min ., water / acetonitrile / tfa ( 50 : 50 : 0 . 25 ), isocratic , 229 nm ( 2 . 0 aufs ), injection 2 . 0 mg / 300 μl and 4 . 0 mg / 420 ml to give 30 . 0 mg of pure peptide . 2 . physical data : molecular formula : c . sub . 53 h . sub . 78 n . sub . 12 o . sub . 10 s . sub . 2 molecular weight : 1106 . 47 amino acid analysis : asp ( 1 . 00 ), pro ( 0 . 78 - 0 . 84 ), cys ( 0 . 45 ), val ( 1 . 02 ), tyr ( 0 . 63 ), phe ( p - et ) ( 1 . 50 ), arg ( 1 . 00 - 0 . 96 ) peptide content : 73 . 3 - 89 . 6 % 3 . chromatography data : solvent r . sub . ftlc nbuoh / hoac / h . sub . 2 o / etoac , 0 . 70 1 : 1 : 1 : 1 nbuoh / hoac / h . sub . 2 o , 0 . 299 4 : 1 : 5 upperhplc c . sub . 18 column k &# 39 ; isocratic h . sub . 2 o / ch . sub . 3 ch / tfa , 4 . 43 55 : 45 : 0 . 1gradient h . sub . 2 o / ch . sub . 3 cn / tfa , 8 . 7 60 : 40 : 0 . 1 to 50 : 50 : 0 . 1fab m / z 1107 ( m + h ). sup .+ ; 1105 ( m - h ). sup .- ______________________________________ one millimole of boc - asn - cys ( 4 - mebzl )- pro - arg -( tos )- bha resin was prepared using 1 mmole of boc - arg ( tos )- 4 - methylbenzhydrylamine ( mbha ) resin as starting material by coupling sequentially with the appropriate t - boc - protected amino acids in a beckman 990 - b peptide synthesizer , 990 - b . 1 . 83 grams of the protected peptide resin was obtained and was divided into two equal parts of 0 . 915 g each . one part of the protected peptide resin from above was further sequentially coupled with 1 . 5 mmoles of the appropriate boc amino acids and β -( s - mebzl )- pmp - oh to give 1 . 16 g of the final protected peptide resin . pmp ( s - mebzl )- d - tyr ( et )- phe - gly - asn - cys ( 4mebzl )- pro - arg -( tos ) mbha resin was obtained and dried in vacuo . this protected resin was treated with 1 . 5 ml of anisole and 25 ml of anhydrous hydrogen fluoride at 0 ° for 1 hour . the deprotected peptide was treated with 0 . 01 mole of potassium ferricyanide solution at ph 7 . 2 in 2 liters of water . 53 ml of the oxidizing agent was used . the resulting solution was passed through a c 18 flash column . the column was eluted with 50 % of acetonitrile with 0 . 25 % trifluoroacetic acid in 20 ml per fraction . 325 mg crude product was isolated from the fractions . further purification of the product by ccd ( b / a / w , 4 : 1 : 5 ) to obtain 188 mg of 99 % pure titled product . ______________________________________amino acid analysis : ______________________________________peptide content 82 % asp 1 . 04 tyr 0 . 92pro 1 . 15 phe 1 . 01gly 1 . 00 arg 0 . 91cys 0 . 54fab / ms = m / z ( m + h ). sup .+ 1037______________________________________ one part of the protected peptide resin from example 8 was further sequentially coupled with 1 . 5 mmoles of the appropriate boc amino acids and β -( s - 4 - mebzl )- pmp - oh to give 1 . 06 g of the final protected peptide resin , pmp ( s - 4 - mebzl )- d - tyr ( et )- phe - chg - asn - cys ( s - 4 - mebzl )- pro - arg -( tos ) mbha resin , obtained after drying in vacuo . this protected peptide resin was treated with 1 . 5 ml of anisole and 25 ml of anhydrous hydrogen fluoride . following the usual oxidation by potassium ferricyanide and isolation over a c 18 column , 165 mg crude titled product was obtained . further purification by ccd g - 15 and p - 2 gel filtration as described above gave 55 mg hplc pure titled product . preparation of ## str20 ## and its use for preparing the compound of example 3 4 . 87 g ( 15 mmol ) of the boccys ( 4mebzl ) was dissolved in 30 ml of ethanol and 10 ml of water added . the ph was then adjusted to 7 . 1 with an aqueous solution of cesium bicarbonate . the mixture was concentrated and the residue evaporated three times from 50 ml of toluene . this residue was , then , placed under high vacuum at ambient temperature overnight . the salt was dissolved in 35 ml of dimethylformamide and 5 g of commercial chloromethylphenyl resin added . the mixture was stirred at 53 ° under argon overnight . the mixture was filtered and the resin washed with dimethylformamide ( 5 × 60 ml ), dmf / water , 9 : 1 , ( 5 × 60 ml ), dmf ( 5 × 60 ml ) and ethanol ( 6 × 60 ml ). it was , then , dried under high vacuum at ambient temperature over the weekend . the peptide chain was built up in a beckman synthesizer as described above using the boc derivatives of asn , val , phe , d - tyr ( et ) and the s -( 4 - mebzl ) pmp derivative . the resin was removed and placed in a manual shaker . 0 . 86 g of the peptide resin was treated with 1 . 5 ml of anisole and stirred for 60 min at 0 ° in 15 ml of hydrogen fluoride . the hydrogen fluoride was , then , removed under aspirator pressure at 0 °. the residue was then washed with 3 × 25 ml of ether ( discarded ) and the peptide eluted with dimethylformamide and 30 % acetic acid ( 4 × 10 ml ). this solution was added to 21 of degassed water and the ph adjusted to 7 . 0 with ammonium hydroxide . a 0 . 01m potassium ferricyanide solution was added slowly ( 35 ml ). the ph was then adjusted to 4 . 5 with acetic acid and the mixture stirred for 30 minutes with 25 g ( wet ) of a weakly basic ion exchange resin ( ag - 3 × 4 1r - 4s ). the suspension was filtered and the resin washed with 2 × 400 ml of 30 % acetic acid . the filtrate was , then , passed thru a c 18 flash column ( 7 × 16 mm ). the column was then washed with water ( 3 × 400 ml ) and the peptide eluted with acetonitrile / water / tfa , 50 : 50 : 0 . 25 ). fractions 30 → 36 were combined , concentrated and lyophillized to yield 25 mg of the titled free cys ( oh ) cyclic intermediate . fab mass spectrum in glycerol : 827 ( m + h ) + , 825 ( m - h ) - . the cys acid ( 20 mg ) is reacted with one equivalent of pro - arg ( nh 2 ) hcl ( prepared from the commercial dihydrochloride by treatment with 1 equivalent of triethylamine ) in the presence of dcc and hbt in dimethylformamide to produce the compound of example 3 . similarly , pro ( ome ) is attached to the cys acid , hydrolyzed with mild sodium hydroxide to give the pro acid which is , then , reacted with arg ( hcl )( ome ) to give the acid parent of the compound of example 3 after mild hydrolysis of the ester . this compound is isolated as the potassium salt if desired . see example 12 below . alternatively , the pro - arg ( nh 2 ) is used in the condensation directly . a mixture of 4 . 5 mg of pmp - d - tyr ( et )- phe - val - asn - cys - oh prepared as above and 1 ml of methanol was treated with ethereal diazomethane and purified by preparing hplc ( 50 % ch 3 cn / 50 % h 2 o / 0 . 1 % tfa ) to yield 4 . 3 mg of the methyl ester ( 94 %), fabms m / z 841 ( m + h ) + , homogeneous by hplc and tlc . bocpro - merrifield resin was made by coupling bocpro to merrifield resin using the cesium salt method to give boc - pro - och 2 - c 6 h 4 - resin which was used as the starting material for the synthesis . the synthesis was carried out on the beckman 990 - b peptide synthesizer using the following protocol . three equivalents of the amino acids were dissolved in their appropriate solvents [ the boc derivatives of 4mebzl - cys , val , phe in methylene chloride , asn in dimethylformamide , x such as d - tyr ( et ) or brbz - d - tyr in 1 : 1 methylene chloride / dimethylformamide and 4mebzl - pmp in methylene chloride ] and were coupled using an equimolar amount of dicyclohexylcarbodiimide ( dcc ) and 1 - hydroxybenzotriazole ( hobt ) except for the coupling of 4mebzl pmp where 1 . 0 equivalent of dimethylaminopyridine was used as catalyst . the extent of coupling was determined by qualitative ninhydrin analyses and couplings were repeated when necessary . the boc groups were removed using 1 : 1 trifluoroacetic acid / methylene chloride and after washing the free amine was generated using 5 % diisopropylethylamine / methylene chloride . the sequence of the peptide was checked using solid phase sequencing before the coupling of the 4mebzl - pmp and its homogeneity confirmed . after the final coupling , the resin was dried to give 2 . 24 g of peptide resin in the case of the d - tyr ( et ) 2 - pro 7 compound . 1 . 1 g ( 0 . 5 mmole ) of the d - tyr ( et ) 2 peptide resin with 3 ml of anisole was stirred 60 min . at 0 ° ( ice bath ) in 25 ml of hydrogen fluoride ( hf ). the hf was , then , removed under reduced pressure at 0 °. the residue was washed with ethyl ether ( 4 × 20 ml , discarded ) and the peptide eluted with dimethylformamide 3 × 10 ml , 20 % acetic acid 3 × 10 ml and 0 . 3n ammonium hydroxide 3 × 10 ml . the filtrate was added to 2 l of degassed water and the ph adjusted to 7 . 1 with conc . ammonium hydroxide . a 0 . 01m solution of potassium ferricyanide was then added dropwise with stirring until a faint yellow color persisted ( 41 ml ). this solution was adjusted to ph = 4 . 7 with acetic acid and stored in the cold overnight . the solution was adjusted to ph = 7 with ammonia and stirred for 15 min with 30 g of ag - 3 × 4 bio - rad ion exchange resin ( wet , cl form ). this solution was then filtered slowly through an additional 30 g of resin . the resin was then washed with 4 × 200 ml of 20 % acetic acid and the filtrate stored in the cold overnight . the filtrate was then passed through a flash column ( 5 cm × 10 cm ) of a packing of silica gel coated with a c - 18 silane . the column was then , washed with 350 ml of water and the peptide eluted with 500 ml of 1 : 1 acetonitrile / water ( 0 . 25 % trifluoroacetic acid ) in 20 ml fractions . fractions 11 - 17 were combined and concentrated . the residue was dissolved in conc . acetic acid , diluted with water and lyophillized to yield 189 mg of the d - tyr ( et ) 2 , proline peptide , which was used without further purification for the synthesis of the tail modified peptides . ______________________________________identification of : ______________________________________ ## str22 ## amino acid analysis : peptide content 55 % asp , 1 . 00 ; pro , 1 . 23 ; cys , 0 . 35 ; val ; 1 . 04 , tyr ( et ), 1 . 43 ; phe , 1 . 51 . hplc : satisfactory . ## str23 ## amino acid analysis : peptide content 82 % asp , 0 . 97 ; pro , 1 . 10 ; cys , 0 . 39 ; val , 1 . 05 ; tyr , 0 . 99 ; phe , 0 . 99hplc : satisfactory , 30 % ch . sub . 3 cn / 70 % 0 . 05 m kh . sub . 2 po . sub . 4 , 2 ml / min , 5 uc - 18 , k &# 39 ; = 6 . 14 . ______________________________________ a mixture of 10 mg of the d - tyr ( et )- pro ( oh ) 7 prepared as above , and 1 ml of methanol was treated with ethereal diazomethane and , then , purified by preparing hplc ( 50 % ch 3 cn / 50 % h 2 o / 0 . 1 % tfa ) to yield 7 . 5 mg of the methyl ester ( 74 %), fabms m / z 938 ( m + h + ), homogeneous by hplc and tlc . to a solution of the d - tyr ( et ) 2 - proline heptapeptide , prepared as described above , ( 29 . 7 mg , 0 . 0331 mmol ), and arg ( nh 2 ) ( 0 . 0996 mmol ) in dimethylformamide ( 400 μl ), dicyclohexylcarbodiimide ( 10 . 3 mg , 0 . 05 mmol ) and dimethylaminopyridine ( 0 . 05 mmol ) were added and the reaction mixture was stirred at 0 °- 20 ° for 4 hours . the dimethylformamide was , then , removed under vacuum . the residue was treated as above in example 3 in 45 % yield to give the desired d - tyr ( et ) 2 - val 4 amide . the linear peptidyl resin , pmp ( s - mebzl )- d - tyr ( et )- phe - val - asn - cys ( s - mebzl )- pro - d - arg ( tos )- bha resin , was prepared by the solid phase method using the standard protocol described above . thus , 1 . 5 g benzhydrylamine resin corresponding to 1 . 0 mmol amine was coupled successively with the boc amino acid derivatives in threefold excess using dcc / hobt in methylene chloride / dmf , 1 : 1 . pmp ( s - mebzl ) was coupled with dcc / dmap . completeness of coupling was checked with the kaiser test or a quantitative ninhydrin test . recoupling was performed until the test was negative . the protected peptidyl resin was washed with successive portions of methylene chloride , methanol , ethyl acetate and methylene chloride , and , then , air dried . the peptide was cleaved from the resin with 15 ml of liquid hydrogen fluoride in the presence of 1 . 0 ml of anisole at 0 ° for one hour . after evaporation of the hydrogen fluoride and drying under high vacuum , the resin was washed with 3 × 20 ml of ether and , then , extracted with 2 × 50 ml of 50 % acetic acid , 50 ml of 10 % acetic acid , and 50 ml of water . the combined extracts were diluted to 4 l with water and the ph adjusted to 7 . 2 with 50 % sodium hydroxide solution . the solution was titrated with 0 . 01m k 3 fe ( cn ) 6 solution until a yellow color persisted ( 30 ml ). the ph was adjusted to 4 . 5 with glacial acetic acid and filtered . the filtrate was applied to a cation exchange ( biorex - 70 ) column ( h + form ), washed with water and then eluted with 100 ml of pyridine acetate buffer ( 30 ml of pyridine , 4 ml of acetic acid , 66 ml of water ). the eluant was evaporated to dryness . the residue was dissolved in a small amount of 10 % acetic acid and diluted with water to 1 % acetic acid , then lyophilized , yielding 650 mg of the crude titled peptide . the crude peptide was purified by counter current distribution in n - butanol / acetic acid / water ( b / a / w ) ( 4 : 1 : 5 ) yielding 33 mg partially purified peptide . this was further purified by gel filtration on a sephadex g - 15 column in 1 % acetic acid , yielding 24 . 5 mg pure peptide . amino acid analysis ( hydrolysis in hcl / tfa 2 : 1 , 0 . 005 % phenol for 1 hr .) asp 1 . 00 , pro 0 . 72 , cys 0 . 62 , val 0 . 99 , tyr 1 . 04 , phe 1 . 04 , arg 0 . 95 , 71 % peptide . hplc : ( 40 % acetonitrile / 60 % water / 0 . 01 % tfa ), one peak , k &# 39 ;= 5 . 2 ; ( 45 % acetonitrile / 55 % water / 0 . 1 % tfa ) k &# 39 ;= 3 . 6 ; ( gradient 20 % acetonitrile , 5 &# 39 ;; 20 - 50 % acetonitrile , 20 &# 39 ;; 50 % acetonitrile , 5 &# 39 ;) k &# 39 ;= 8 . 7 , 97 % pure . tlc : rf 0 . 32 ( b / a / w 1 : 1 : 1 ); 0 . 12 ( b / a / w 4 : 1 : 1 ); 0 . 50 ( n - butanol / pyridine / acetic acid / water ), 15 : 10 : 3 : 12 ). the extracted peptidyl resin still contained peptide by amino acid analysis , so it was extracted with 3 × 50 ml of dmf . the dmf was evaporated to dryness and the residue dissolved in 10 % hoac , diluted to 1 % acetic acid and lyophilized , yielding an additional 260 mg of peptide . fab mass spectrometry of this material gave a m / z 1079 which corresponds to m + h for the desired cyclic peptide . substituting a stoichiometric quantity of boc - d - phe for boc - d - try ( br - z ) at the 2 unit of the peptide synthesis of example 1 gives ## str25 ## substituting boc - d - val at the same position using the splitting - oxidation reactions of example 2 gives ## str26 ## substituting β - mercapto - β , β - cyclotetramethylenepropionic acid ( tmp ) for pmp in example 5 gives ## str28 ## β - mercapto - β , β - cyclohexamethylenepropionic acid gives the hmp 1 derivative . substituting in example 1 boc - d - nle at the 2 unit and d - arg ( tos ) at the 8 unit gives ## str29 ## substituting in example 1 boc - α - aminophenylbutyric acid ( pba ) at the 2 unit gives ## str31 ## substituting boc - lys ( clz ) in example 3 for the protected arg gives ## str32 ## other representative compounds which are prepared in like manner are : ## str33 ## a preparation which contains 0 . 5 mg of the cyclic octapeptide of examples 1 or 3 as a sterile dry powder for parenteral injection is prepared as follows : 0 . 5 mg of peptide amide is dissolved in 1 ml of an aqueous solution of 20 mg of mannitol . the solution is filtered under sterile conditions into a 2 ml ampoule and lyophylized . the powder is reconstituted before either intramuscular or intravenous injection to a subject suffering from edema susceptible to anti - adh mechanism of action . the injection is repeated as necessary , from 1 - 5 times daily or in continuous i . v . drug injection . other octapeptides of this invention are made up and used in like manner . 30 mg of finely ground octapeptide of this invention such as the product of example 2 is suspended in a mixture of 75 mg of benzyl alcohol and 1 . 395 g of a suspending agent such as a commercial mixture of semisynthetic glycerides of higher fatty acids . the suspension is placed in an aerosol 10 ml container which is closed with a metering valve and charged with aerosol propellants . the contents comprise 100 unit doses which are administered intranasally to an edematous subject from 1 - 6 times a day .	8
the invention will be described , with the accompanying drawings , in the structural configuration for containment of two large drums . it is to be understood that the invention also encompasses structural configurations sized for containment of any number of drums , including the circumstance of a single drum . such configurations will differ only in overall dimensions , the elements and components of the invention remaining the same . with reference to fig1 and 2 , the overall configuration of the invention is shown . the apparatus comprises a base member 10 and two lid members 20 . the general shape of the apparatus is a rectangular container . base member 10 comprises a bottom 11 , two side walls 12 and two end walls 13 . bottom 11 is substantially rectangular with side walls 12 and end walls 13 substantially upright . bottom 11 is relatively planar to support the drums , but may be constructed with ridges or other raised areas . furthermore , a drain may be incorporated in bottom 11 , which can also be sloped , to facilitate drainage . it is preferable that side walls 12 and end walls 13 angle slightly outward , such that the open top of base member 10 is larger than bottom 11 . this allows plural base members 10 to be nested one inside the next for purposes of storage and transportation . extending below bottom 11 are a number of legs 14 to support the base member 10 above the floor surface . legs 14 are of sufficient height and separation to allow room for insertion of the arms of a forklift or pallet jack for transport of the unit . preferably , legs 14 are circular to deflect the forklift arms without damage should the operator strike one of the legs 14 by mistake . for mobility on level surfaces , casters or wheels may be attached beneath base member 10 . around the upper perimeter of the base member 10 , preferably on both side walls 12 and end walls 13 , but at least on the two side walls 12 , rail member 15 extends outward for engagement of the lid members 20 , as shown in fig3 . rail member 15 is a generally c - shaped guide providing the means for retaining the lid members 20 on the unit and at the sam time allowing the lid members 20 to be separated from each other by sliding each lid member 20 along the trough 16 formed on the upper surface of rail member 15 . the configuration of trough 16 is concave or bevelled such that its interior portion is lower than its exterior to form an inward slant . thus , trough 16 keeps the lid members 20 securely sealed and in place on base member 10 , even under large load forces , since the downward pressure will force the runner members 27 of the lid engagement members 26 firmly into trough 16 rather than outward . additionally , the upper edge of side walls 12 and end walls 13 may have a deflector rim 17 , which is a small flange angled downward toward the interior of the base member 10 . this deflector rim 17 acts to direct any liquid striking its surface into the interior of the unit rather than out into the environment . each lid member 20 comprises a top 21 , side walls 22 and an end wall 23 . as with the base member 10 , the end wall 23 and side walls 22 are preferably angled outward so that the open bottom is larger than the top 21 . this allows nesting of a number of the lid members 20 within themselves or within the base members 10 for transport and storage . for additional structural strength , ribs 28 or other formations may be incorporated in the lid members 20 or in the base member 10 . for connecting the lid members 20 to the base member 10 , engagement means are comprising engagement member 26 are provided . lid engagement member 26 is positioned around the bottoms of side walls 22 , and preferably end wall 23 , of both lid members 20 . lid engagement member 26 is substantially c - shaped to correspond to and enclose rail member 15 of the base member 10 . the joint of the engagement member 26 to the side walls 22 and end wall 23 is configured to correspond to the trough 16 of the base member 10 , so that a runner member 27 is formed . runner member 27 will be convex or angled to seat within trough 16 . any downward pressure will force runner member 27 into trough 16 , maintaining the lid members 20 on base member 10 . runner member 27 will slide laterally within trough 16 , so that the lid members 20 can be moved transversely along rail member 15 to expose a drum 100 , as shown in fig5 . thus the lid member 20 does not need to be completely removed to allow access to the drum 100 , such as when it is needed to pour liquid into said drum 100 . the c - shape of engagement members 26 acts to clamp the lid members 20 onto rail member 15 , such that the lid members cannot be removed from the base member 10 in the vertical direction . furthermore , in the preferred embodiment where the rail member 15 and engagement members 16 extend around the end walls 13 and 23 , respectively , the curvature of engagement members 26 will lock the lid members 20 in place on base member 10 when the lid members 20 are fully closed , by snapping around rail member 15 on the end walls 13 . it is necessary that the two lid members 20 form a secure seal with each other when in the fully closed position to preclude rain , snow , etc . from entering the unit . this is accomplished by providing interlocking means , such as by configuring the open ends of the top 21 and side walls 23 to form an overlapping or mating joint . as shown in fig4 one lid member 20 is formed with an external lip 24 and the other lid member is formed with an internal lip 25 , such that the internal lip 25 will interlock with the external lip 24 to form a secure seal to retain the two lid members 20 in a closed position . the shape of the internal lip 25 an the external lip 24 allow the lid members 20 to be easily opened and closed . in the preferred embodiment , exterior lip 24 is comprised of a full ridge 31 , an open ridge 32 and a mid - plateau 33 . internal lip 25 is comprised of a full ridge 35 , a latching ridge 34 and a mid - plateau 36 . open ridge 32 of the external lip 24 preferably has a small snap flange 37 . to perform the closure operation , the lid members 20 are pushed together such that the internal lip 25 slides inside external lip 24 . latching ridge 34 flexes below mid - plateau 33 and abuts internally within full ridge 31 . full ridge 35 seats within open ridge 32 , with snap flange 37 abutting the down side of full ridge 35 . in this manner the two lid members 20 are securely held together by the interlocking means , yet are easily separable by sufficient pulling force . the snap flange 37 and mid - plateau 36 prevent any liquids or debris from entering the unit when the lid members 20 are closed . the end portions of engagement member 26 on the lid member 20 having external lip 24 are enlarged to form sleeves 29 . this allows the engagement member 26 of the lid member 20 having the internal lip 25 to fit within sleeve 29 when the two lid members 20 are fully closed . apertures to receive locks may be aligned in the sleeve 29 , engagement member 26 and rail member 15 for security purposes . it is also seen that the design of the lid members 20 allows them to be completely removed from the base member 10 by fully sliding them laterally off of rail member 15 if required . it is preferable that the invention be constructed of a plastic material such as polyethylene , due to its superior structural and chemical resistance properties , but the apparatus may be constructed of any suitable material having the necessary properties of liquid impermeability . construction with a plastic material allows the unit to be formed having a translucent base member 10 . this allows easy visual determination of any fluid accumulation inside the unit . while the unit as shown is substantially rectangular , a relatively square configuration is possible for use with one or four drums . the overall minimum size of the apparatus is a function of the number of drums to be contained within . regulations usually require that the volume of the base member 10 be either at least 10 percent of the total capacity of all the drums contained within the unit or 10 percent greater than the largest single drum in the group , whichever amount is greater . for example , if a 55 gallon drum is the largest container size in the unit , then the base member 10 must have a volume greater than 60 . 5 gallons ( 55 + 5 . 5 gallons ). the above examples were given for purposes of illustration , and it will be apparent to those skilled in the art that obvious substitutions and equivalents may be possible . the full scope and definition of the invention therefor is to be as set forth in the following claims .	1
fig2 illustrates an example pump and electrical connector system according to the invention wherein the pump system is retrievable without having to pull the wellbore tubing ( 2 in fig1 ) from out of the wellbore . the present example includes such capability by introducing a “ wet ” matable electrical coupler ( 9 ) ( meaning that electrical connection may be made while submerged in wellbore fluid ) disposed in the lower end of the pump system . the electrical coupler ( 9 ) is landed into an electrical coupler receptacle ( 8 ) mounted onto the production tubing ( 2 ). electrical cables from the electrical coupler ( 9 ) to an electric motor ( 6 ) may be incorporated in a bypass conduit ( 12 ) coupled between the electrical coupler ( 9 ) and the electric motor ( 6 ). the foregoing components allow the pump system to be installed within the production tubing ( 2 ) as well as retrieved from the production tubing ( 9 ) in a cost efficient way by using winch supported well intervention methods such as coiled tubing , wireline , spoolable fiber rod or similar method . as a result , it is not necessary to remove the production tubing ( 2 ) in order to remove the pump system for service or replacement . with certain exceptions , such as the bypass conduit ( 12 ) noted above , and a seal system explained below , the pump system may be a conventional electrical submersible pump ( esp ) known in the art , having external diameter thereof selected to enable passage through the interior of the production tubing ( 2 ) as shown in fig2 . a pack - off or similar annular sealing system ( 13 ) may be disposed in the annular space between the pump system and the production tubing ( 2 ). the pack - off system ( 13 ) can be mounted longitudinally anywhere along the pump system above the pump intake ( 4 ). the pack - off system ( 13 ) ensures that all discharge from the pump is forced to travel upward in the production tubing ( 2 ) and thereby prevents wellbore fluids from being circulated locally downhole from discharge to intake ( 4 in fig1 ) of the pump system . fig2 also shows a seal system ( 11 ) that can be mounted below the lower section of the electrical coupler ( 9 ), where this seal system ( 11 ) provides a fluid barrier with respect to a seal receptacle ( 10 ). wellbore fluids will thus be caused move through the center of the seal system ( 11 ), through the center of the electrical coupler ( 9 ) whereupon the fluid exits the top of the electrical coupler ( 9 ). thereafter , the wellbore fluids are transported in the annular space outside the motor system ( 6 ). the fluid enters the pump intake ( 4 ). then the fluids are transported through the pump ( 3 ) whereafter the fluid exits via the pump discharge ( 4 a ) ( disposed on top of the pump system in the present example ), followed by transport to the surface within the production tubing ( 2 ). the electrical coupler system ( receptacle 8 and coupler 9 ) can be a conductive contact ring coupler wherein corresponding rings in the receptacle 8 and coupler 9 make galvanic contact , or the system can be a wireless or inductive type electrical connector . the wireless electrical connector can for example be of the type that is offered by the company wireless power & amp ; communication as in horten , norway ( www . wpc . no ) and described in norwegian patent no . 320439 “ anordning og fremgangsmate for kontaktlos energioverforing ” (“ a device and method of non - contact energy transmission ”), issued to geir olav gyland . electrical power may be provided from the surface by a cable ( 7 a ) extending to the receptacle ( 8 ) outside the production tubing ( 1 ). fig3 illustrates the system as shown in fig2 , with the difference that the annular sealing packer system ( 13 in fig2 ) between the pump system and the wellbore tubing ( 2 ) may be substituted by an elastomeric swab cup system ( 14 ) made from nitrile rubber or similar suitable elastomeric sealing material . fig4 illustrates another example where the pump system is configured to have the motor ( 6 ) and the protector and seal assembly ( 5 ) disposed above the pump ( 3 ). in the example of fig4 no packer or other annular sealing element is required above the electrical coupler ( 9 ), because the pump intake ( 4 ) is disposed in the bottom of the system , e . g ., sealed inside seal ( 11 ) and the pump discharge ( 4 a ) is disposed above the seal ( 11 ) in the production tubing ( 2 ). to centralize and stabilize the pump system within the production tubing ( 2 ), one or several centralizers ( 15 ) can be disposed between the pump system and the interior of the tubing ( 1 ). fig5 illustrates the electrical coupler receptacle ( 8 ) in more detail , wherein the electrical cable ( 7 ) is coupled to the coupler receptacle ( 8 ) and is sealed against wellbore fluids by an industry standard seal system ( 16 ). thereafter the electrical conductors in the cable ( 7 ) are connected to corresponding electrical contact rings ( 17 ). in some instances electronic controls ( 19 ) may be required to operate the pump system . depending on the selected electrical power transmission device used , the coupler system may require a non - metallic isolation ( 18 ) between the electrical contact rings ( 17 ). in the lower section of the coupler receptacle ( 8 ), one or several recesses ( 20 ) can be machined , where the function of the recesses ( 20 ) is to enable anti rotation devices to be included in the electrical coupler to be landed into the receptacle assembly ( 8 ). the foregoing will be explained below with reference to fig6 . fig6 shows the wet matable electrical coupler ( 9 ) disposed in the lower end of the pump system , where it can be observed that the coupler ( 9 ) has internal fluid flow through capabilities by internal ports ( 9 a ). electrical contact rings ( 21 ) may be incorporated on the exterior of the coupler ( 9 ), and when the coupler ( 9 ) is fully landed in the receptacle ( 8 ) are in electrical contact with the corresponding contact rings ( 17 in fig4 ) in the receptacle ( 8 ), thus transferring electrical power ( and in some examples signals ) to from cable ( 7 in fig4 ) to the pump motor ( 6 in fig2 and fig4 ). dependent on power transmission method , the coupler system may require an electrical insulation ( 22 ) externally on the electrical contact rings ( 21 ). an anti rotation lock pin system ( 23 ) may be landed into the recesses ( 20 in fig5 ) machined into the electrical coupler receptacle ( 8 in fig5 ). the lock pin system ( 23 ) will prevent the pump system from rotating when operated . the seal stack ( 11 ) can be mounted to the lower section of the coupler system , where the seal stack ( 11 ) will seal against external wellbore fluid passage . fig7 illustrates the wet matable electrical coupler ( 9 in fig6 ) fully landed into the electrical coupler receptacle ( 8 in fig5 ). a system ( fig1 a through c explained below ) for flushing the electrical contacts with , for example , dielectric fluids prior to and when mating the coupler ( 9 ) to the receptacle ( 8 ) can be incorporated into the wet mateable coupler system . such flushing can be executed by units connecting , or by a control line from surface either coupled to the wet mateable electrical coupler ( 9 in fig6 ) or the electrical coupler receptacle ( 8 in fig5 ). alternatively , the coupler system can include cup type wipers ( not shown ) internally to the coupler ( 9 ) to remove fluid from the contact rings ( 21 in fig5 and 20 in fig4 ) when the coupler ( 9 ) is inserted into the receptacle ( 8 ). fig8 a and 8b illustrate a variation of the coupler system illustrated in fig6 , and with particular reference to fig8 b wherein in seals ( 24 ) are introduced between , above and below the electrical contact rings ( 21 ) on the coupler ( 9 ). such seals ( 24 ) will enable effective placement of dielectric fluids as well as securing isolation of fluids between the contact rings ( 21 ) when the coupler 9 is engaged to the receptacle ( fig8 a ). hydraulic feedthrough ports ( not illustrated ) can also be introduced where the seals ( 24 ) will ensure pressure tight isolation between such ports . the ports can also be used for flushing the electrical coupler system with dielectric fluids prior to and when mating , and for operation of hydraulically operated tools coupled to the insert system and more . fig9 illustrates the anti rotation lock pin ( 23 , also in fig6 ) landed into the lock pin recess ( 20 , also in fig5 ), where for example a motor housing coupled to the upper side of the pump system ( see fig4 ) is prevented from rotating during start - up and operation of the electric motor ( 6 in fig2 ). fig1 a , 10 b and 10 c illustrate how dielectric fluid can be used to flush the electrical coupler system , and how the seal system isolates the coupler system from wellbore fluids . the foregoing is performed by engaging the lower seal ( 11 ), releasing dielectric fluid ( 26 ) via one or more exit ports ( 25 ). when all flushing fluid has been unloaded , the electrical contacts ( 21 ) are engaged followed by engaging of the remaining seals ( 24 ). this traps the dielectric fluid within the coupler contact area as well as preventing wellbore fluids from entering the coupler system during use . also , engaging the electrical contacts ( 21 ) after sealing off the dielectric fluid around the coupler ( 9 ) will result in a increased pressure between the seals compared to the pressure of the wellbore fluids outside the coupler . this also reduces the chance of wellbore fluids entering the contact areas . an example of a deployment mechanism for dielectric fluid may be better understood with reference to fig1 . a chamber 30 may be filled with dielectric fluid such as oil or non - conductive silicone grease . when the coupler 9 is inserted into the receptacle , the lower part of the coupler ( including seal assembly 11 and port 10 ) may compress the chamber 30 and cause flow of the dielectric fluid through an internal line 31 . the internal line 31 may have discharge ports 31 a , 31 b , 31 c between the contacts 21 , causing the fluid to displace any conductive wellbore fluid between the contacts 21 . an alternative dielectric fluid deployment mechanism is shown in fig1 . a fluid line 7 b may extend from the surface and be used to pump the dielectric fluid through an internal port 31 d in the coupler 9 . the internal port 31 d may extend to discharge ports 31 a , 31 b , 31 c similarly placed to those shown in fig1 . fig1 shows a reservoir of dielectric fluid with an electronic control 33 that may be automatically operated or controlled from the surface . the electronic control may include a pump ( not shown separately ) to discharge dielectric fluid through an internal port 31 with discharge ports 31 a , 31 b , 31 c similar to those shown in fig1 . fig1 shows an example similar to the one shown in fig1 , but including one or more electronic systems 33 , and a second set of discharge ports 31 e , 31 f , 31 g . the system in fig1 may enable circulation of fluid through the coupler contact area . fig1 shows a coupler 9 with a control line 7 b to the surface through which fluid may be pumped through an internal port 31 b in the coupler 9 to energize the seals 24 . the system in fig1 may also include an electronic system 33 for discharge of dielectric fluid through ports 31 e , 31 f , 31 g as in fig1 . fig1 shows use of the coupler where it is used for , e . g ., so called “ two - stage ” well completions , where a lower tubular string 110 ( e . g ., casing ) is placed in the well first with sensors etc . along the casing . the lower tubular string 110 includes a receptacle 108 which may be made according to the various examples explained above . a control line 110 may extend to sensors and other electrically and / or hydraulically operated devices lower in the well . thereafter , an upper completion string 101 ( e . g ., tubing ) is landed into this lower string 110 using the coupler 109 having cable ( s ) 107 and possibly control line ( s ) to the wellhead . the coupler 109 may be made according to the various examples explained above . fig1 shows the receptacle 108 of fig1 in more detail . the receptacle 108 includes an internal shoulder 120 , with or without anti - rotation elements for receiving a corresponding shoulder ( 123 in fig1 ). electrical and / or hydraulic contacts 21 a may be provided to make corresponding connection with electrical and / or hydraulic contacts in the coupler ( fig1 ). the contacts 21 a may be connected to a control line 111 or cable that extends to devices lower in the well , e . g ., sensors and / or valves . fig1 shows the coupler 109 of fig1 in more detail . the coupler includes the above described components and electrical and / or hydraulic contacts 21 . the contacts 21 may be isolated by seals 24 . a seal extension 11 may sealingly engage the interior of the lower part of the receptacle ( 108 in fig1 ) so that when the tubing is mated to the casing , a fluid tight seal is provided . an electrical coupler system and / or esp combination according to the foregoing examples may enable insertion and retrieval of an esp system or other electrically operated device supported on a wellbore tubing to be installed and removed from the wellbore without the need to remove the tubing from the wellbore . while the invention has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments can be devised which do not depart from the scope of the invention as disclosed herein . accordingly , the scope of the invention should be limited only by the attached claims .	4
as an overview , the present invention uses a computer network such as the internet and the resources of the network including emails and webpages to set up initial survey questions , send out emails to references identified by job candidates , collect confidential competency - based survey information via webpages from the identified references , analyze the collected information and generate candidate reports for use by a hiring manager . the system has integrated the screening and selection process with a competency based survey database that allows the comparative review of reference information against one or more candidates , the company &# 39 ; s own employees , the industry or other normalized database by job type , organization or company competency . referring now to fig1 , a job candidate evaluation system 1 of the present invention involves a number of computers 10 , 15 that are connected to each other through a computer network such as the internet . the computers 10 , 15 of the system 1 cooperate with each other to provide comprehensive collection and analysis of reference information that are made through the network 2 . computers 15 are similar to the computer 10 , with the exception of some of the databases and software modules . as illustrated in fig1 , the computer 10 is connected to the internet 2 through , for example , an 110 interface 12 , such as for a lan , wan , or fiber optic , wireless or cable link , which receives information from and sends information to other computers 15 . the computer 10 is also connected to a keyboard 14 for controlling the computer . the computer 10 includes , for example , memory storage 16 , processor ( cpu ) 18 , program storage 20 , and data storage 22 , all commonly connected to each other through a bus 24 . the program storage 20 stores , among others , software programs such as set - up module 26 , collection module 28 , and analysis module 30 as will be explained in detail later herein . the data storage 22 stores , among others , candidate database 34 , benchmark database 36 and survey database 318 , all preferably stored in a relational database that relates all of the databases stored in the data storage . any of the software program modules in the program storage 20 and data from the data storage 22 are transferred to the memory 32 as needed and is executed by the processor 18 . the computer 10 can be any computer such as a windows - based or unix - based personal computer , server , workstation or a mainframe , or a combination thereof . while the computer 10 is illustrated as a single computer unit for purposes of clarity , persons of ordinary skill in the art will appreciate that the system may comprise a group of computers which can be scaled depending on the processing load and database size and which can be remotely located to provide localized non - stop service . fig2 illustrates a high level process flow of the evaluation process according to the present invention . in step 42 , a client company sets up an order for a job candidate or multiple candidates , and prepares one or more surveys for use in the hiring process as will be explained in detail with reference to fig3 . this step is executed by the set - up module 26 . in the same step , the order for the job candidates is done by purchasing a certain number of candidate reports and specifying the purchase information . purchase of one report provides unlimited generation of reports for each job candidate until the time of hire or rejection . in step 44 , the hiring manager identifies a job candidate and receives information about the references or reference providers that are identified by the job candidate , which include an email address for each reference as will be explained in more detail with reference to fig4 . a reference provider should be someone who has worked extensively with the job candidate in the past which include customers , supervisors , and peers . step 44 is executed by the collection module 28 . in step 46 , which is also executed by the collection module 28 , the system 1 sends emails to all of the references that were identified by the job candidate . the email requests each reference to fill out the survey prepared by the hiring manager . the survey information is then collected from the identified references through web pages and stored in the survey database 38 . step 46 is more fully explained with reference to fig5 . in step 48 , executed by the analysis module 30 , the system 1 analyzes the collected information and generates a report that includes the overall assessment of the candidate &# 39 ; s competency in each of the several competency areas and includes any comments supplied by the references . competency is a well known concept that represents a particular characteristic of an individual or organization performing a task , function or project at a particular point in time that leads to successful performance . the report can be a final report with all surveys completed by the references , or it can be a real time interim report with analysis of partially completed survey information which can be requested by the hiring manager at any time . based on the analysis , the system 1 also generates “ interview probes ” for those areas where the candidate did not score as highly as others , a sample of which is shown in fig1 a - 12b . the probes guide an interviewer to obtain more information about the candidate &# 39 ; s level of accomplishments or experience with regard to specific lower scoring competencies . the report may also include coaching tactics to manage and develop the candidate assuming the candidate is hired , a sample of which is shown in fig1 a - 13c . like the interview probes , the coaching tactics are also based on analysis of those areas where the candidate did not score as highly as others . the coaching tactics are suggested “ micro - behaviors ” that the hiring manager can use to help the candidate to develop his strengths in lower - scoring competencies . step 48 is more fully explained with reference to fig6 . in step 50 , the system 1 continuously monitors the job candidates after the hiring process . the system tracks the progress of the hired candidates and collects additional data such as performance levels of the hired candidates . the additional data for all the candidates are then analyzed to generate additional reports containing the correlation between various competencies and high retention / performance . the reports are preferably graphical in nature and graphically illustrate the competencies that are most closely correlated with the high retention / performance of the candidates . the reports can also be customized by a user to specify whether the correlation is based on position - specific , company - wide or industry - wide benchmarks as will be explained in detail with reference to fig7 . fig3 illustrates a detailed process flow of the purchase and set - up step 42 of fig2 . in step 52 , a client company uses an internet enabled computer 15 to access web pages of the system 1 through the internet 2 . the web pages are generated by a conventional database web page generating engine such as php ( hypertext preprocessor ) in conjunction with a relational database program stored in the program storage 20 and the web engine is executed by the processor 18 . the internet enabled computer 15 is equipped with a web browser capable of handling forms . in step 54 , order information such as the client company &# 39 ; s address and contact information of various hiring managers working for the client company are filled out in the web page form that was generated by the computer 10 . in step 56 , purchase information such as the number of reports purchased and credit card data are also entered through the web page . the data entered by the client company are stored in the data storage 22 . in step 58 , the credit card information provided by the client company is verified and in step 60 a client record is created in a client database in the storage 22 with the contact and purchase information . the client record includes an allocation of reports to specific hiring managers and the user id and password for each hiring manager . in step 62 , the computer 10 generates a confirmation message confirming the number of reports purchased and the set - up of the client company in the system 1 . as can be appreciated by persons of ordinary skill in the art , the above steps 52 - 62 are optional and can be omitted by using a billing arrangement where the client company is billed on a periodic basis for the candidate evaluation services that have been rendered . fig4 illustrates a detailed process flow of the candidate and reference identification step 44 of fig2 . when a hiring manager needs to fill a particular position , the manager accesses the computer 10 through a web browser . in step 66 , the hiring manager designates a survey that is to be used for that position . the manager can choose from a set of pre - designed or pre - selected surveys stored in the data storage 22 , design his own by selecting survey questions from an existing set of questions stored in the data storage , create his own set of questions , or modify an existing survey . the questions are stored in a master table in data storage 22 . each survey also has a corresponding record in the database , which points to the questions in the master table that are included for that survey . each survey question relates to a specific job - related and validated competency , selected from a bank of competencies that have been derived , tested and validated from experience and research . fig8 a - 8b illustrate a sample survey that is used for a management position . the survey of fig8 a contains 16 questions that relate to various competencies that are known to be important for a management position . for example , the first three questions relate to a competency known as “ managing the business ”. each of the 16 questions requires the reference to select a value of “ 1 ” through “ 7 ” by clicking on an appropriate radio button . the survey also contains two comment boxes as shown in fig8 b . it includes one for describing the candidate &# 39 ; s strengths and one for describing the candidate &# 39 ; s weaknesses . once a particular survey is selected or created , the hiring manager enters the job candidates &# 39 ; information in step 68 through the computer 15 and sets the required minimum number of references that must be provided by each job candidate . the entered information is stored by the computer 10 in the candidate database 34 of the data storage 22 . in step 68 , the computer 10 also generates a unique 16 character alphanumeric identifier for that job candidate which is also stored in the candidate database 34 . the alphanumeric identifiers are used for security purposes since they ensure that only known and authorized job candidates can enter or access the information in the system 1 . in step 70 , the computer dynamically generates a web page asking whether the reference information will be provided by the job candidate . if the hiring manager answers yes , the computer 10 in step 72 generates and send an email message to the job candidate with a url link to a dynamically generated web page and requesting the job candidate to click on the link to provide information on the references he chooses . a sample email to a job candidate is shown in fig9 . in step 74 , the job candidate receives the email and accesses the web page generated by the computer 10 by clicking on the link provided in the email . in response , the computer transmits through the internet 2 a sample of the survey questions for display on the candidate &# 39 ; s computer 15 along with a dynamically generated web page form to provide information on the references . the sample survey questions assist the candidate in determining which individuals would be appropriate references . in step 76 , the job candidate enters via the web page form the names , email addresses and relationship of the references . the relationship field only allows “ business ” or “ professional ” as “ personal ” references tend to give scores that are severely skewed towards the positive , and may not have specific knowledge about the job - related competencies of the candidate . the candidate also indicates the dates and location of the relevant employment . the candidate then submits the form to the computer 10 . the collection module 28 of the system 10 then verifies that each email address is in a valid format and that there are no duplications . as part of the validity check , the collection module 28 checks the domain portion of each email address against the registered location using industry standard databases ( whois ) to provide the hiring manager additional information if needed . once the candidate is determined to have submitted a valid list , the computer 10 stores the data on references in the candidate database 34 . if the answer to step 70 is no , however , then the hiring manager already has the information of references . that information is entered by the hiring manager in step 78 . the same type of data checking that are performed in step 76 is also performed in step 78 to ensure that no errors are made . fig5 illustrates a detailed process flow of the collection step of fig2 . in step 80 , the computer 10 generates a unique identifier for each reference and send an email message to each reference explaining the purpose of the email and directing the reference to click on a url link to a dynamically generated web page . the unique identifier is generally used internally to uniquely identify the reference within the system 1 . a sample email to each reference is shown in fig1 . the sample email contains a statement that the operator of the system 1 will maintain strict confidentiality of responses provided by the references and that their responses will be aggregated and analyzed so that all of the information generated in a report for the hiring manager will be confidential . this statement is important because it encourages the references to provide more honest responses . in step 82 , the email is received by the computer 15 of the reference . in step 84 , the reference accesses the web page generated by the computer 10 by clicking on the link provided in the email . in response , the computer transmits through the internet 2 a dynamically generated web page form for display on the reference &# 39 ; s computer 15 along with instructions on how to properly complete the form , a sample of which is shown in fig8 a - 8b . in step 86 , the reference enters via the web page form answers to the questions in the survey . for each question , the reference indicates the level of competency possessed by the job candidate using a seven - point scale . the reference is also shown the employment information submitted by the job candidate and is asked to confirm whether the information is accurate . the reference then submits the completed form to the computer 10 in step 88 . in step 90 , the collection module 28 of the system 10 stores the survey data in the survey database 38 . in step 92 , the collection module 28 determines whether there is a sufficient number of completed surveys to provide a meaningful report to the hiring manager . for example , in one case that requires seven references , four references might be considered to provide a meaningful report . if no , then the collection module 28 waits for additional surveys to be completed . if yes , however , step 94 is executed . alternatively , the hiring manager has three additional options at this stage . the first option is to override the minimum number of completed surveys and to request an interim candidate report reports regardless . a second option is to set a predetermined time period from the job candidate identifies the references and checking to see whether the predetermined time period has passed . if it has , then step 94 is executed . the third option is to simply allow the hiring manger to close the job candidate &# 39 ; s record . that option may be convenient in situations such as the job candidate voluntarily withdrawing from the job opening . in step 94 , an email to the hiring manager is generated to let him know that at least an interim report is available , which email is received by him in step 98 . in step 96 , reminder emails are sent to those references that have not provided the survey data within a predetermined time period . fig6 illustrates a detailed process flow of the analysis step of fig2 . in step 100 , the hiring manager accesses the web page generated by the computer 10 by either clicking on the link provided in the email or logging on to the website of the computer 10 independent of the email . at this stage , the analysis module 30 displays a “ dashboard ” for the current status of the job opening . the status includes the state of each candidate &# 39 ; s progress for the completion of the reference information . in step 102 , a request for report on a particular candidate is made . in response , the analysis module 30 in step 104 analyzes the received survey data stored in the survey database 38 and generates a candidate report . a sample report is shown in fig1 a - 11d . as can be seen in fig1 a , the report includes a list of references , email addresses , identification of company and relation to the job candidate , dates worked by the candidate and whether the survey was completed . the report also notes any changes or discrepancies between the information provided by the candidate and the reference . for example , reference named “ roger brown ” reported that the dates worked by the candidate of “ 02 / 00 to 02 / 03 ” is different from “ 01 / 00 to 02 / 03 ”. fig1 b explains the score for each competency in fig1 c which is based on benchmark scores that are stored in the benchmark database 36 . the benchmark scores represent competencies that are stored on an industry - wide basis , company - wide basis or company - specific job position type basis . as seen in fig1 c , scores for each question are averaged and converted to “ very low ” to a “ very high ” score . the scores to questions that are related to the same competency are averaged into the same “ very low ” to a “ very high ” score . for example , the average scores for questions 1 - 3 have been converted to a “ medium ”, “ high ” and “ medium ”, respectively . also , the three questions are grouped into the competency of “ managing the business ” and the average scores for each of questions 1 - 3 are averages and converted to the score of “ medium ”. one third of the questions where the candidate has received the lowest raw numerical averages are weak areas the analysis module has identified and are indicated using asterisks which are used as the basis for generating interview probe questions and coaching tactics as discussed below in step 106 . alternatively , the weak areas are identified by comparing an averaged score for each question against a benchmark score from the benchmark database 36 and those scores that fall below the benchmark score by a predetermined amount are identified as the weak areas and are indicated as such using asterisks . to further make the report useful , it may contain three additional columns : company comparison , industry comparison and overall rating . the company comparison and industry comparison correspond to the benchmark scores on company - wide job type basis , and industry - wide job type basis . the overall rating is derived from taking the average of the raw scores from each normalized database for that job type for the company , industry or other organization and the average of responses from the candidate &# 39 ; s reference providers . this score is converted to a verbal descriptor from very - low to very - high based on lookup table for that value . for example a 4 . 2 - 5 . 9 inclusive , could return a “ high ”, each descriptor range can be set based on selection standards . as shown in fig1 c , questions 3 , 8 , 11 and 16 are highlighted using a rectangular box . the highlighted questions mean that those questions are most closely associated with high performance and retention of job candidates that have been hired which are based on a statistical analysis of performance data of the hired candidates as will be explained in detail with reference to fig7 . the report also contains an overall average score (“ high ” in fig1 c ) which is an average of scores from all the references for all of the questions . alternatively , the analysis module 30 can use the correlation data from the continuous update step 50 of fig2 and generate an overall score on a weighted scale in which the weight used for each question or competency is based on the correlation to the performance data with higher weight being used for higher correlation . fig1 d contains the “ strengths ” and “ could improve ” comments provided by the references . it is important to note that the candidate report maintains strict confidentiality of responses provided by the references . in other words , the candidate report decouples the reference individuals from the responses the reference individuals provide so as to provide anonymity of the reference individuals from the hiring company / hiring manager . this is important as it encourages the references to provide more candid responses . fig1 illustrates a group report which ranks multiple candidates . for each candidate , the group report includes averaged scores for each question , averaged score for each competency , and an overall summary score . the group report also includes questions 3 , 8 and 16 which are highlighted using a rectangular box . the highlighted questions mean that those questions are most closely associated with high performance and retention of job candidates that have been hired which are based on a statistical analysis of performance data of the hired candidates . in step 106 , the hiring manager , after reviewing the report , determines whether to continue with the hiring process for the candidate . if the answer is no , then the analysis step 48 ends at step 111 . if the answer is yes , the analysis step 48 continues with step 108 . in step 108 , the analysis module generates interview questions ( see fig1 a - 12b ) based on the identified weak areas in the report . specifically , the interview questions are associated with the questions in the survey and are stored in the data storage 22 . for each weak area , the analysis module retrieves those interview questions that are associated with the questions that correspond to the weak areas . for example , the report in fig1 c has identified questions 1 , 2 , 7 , 9 , 12 and 13 as the weak areas . for those questions , the analysis module 30 retrieves associated interview questions from the data storage 22 as shown in fig1 a - 12b . in step 110 , the hiring manager , after having interviewed the candidate , determines whether to hire the candidate . if the decision is no , then the analysis step 48 ends . if the decision is a yes , then the analysis module in step 112 generates coaching suggestions that allow the employer to improve the identified weak areas after the candidate is hired . like the interview questions , the coaching suggestions are associated with the questions in the survey and are stored in the data storage 22 . for each weak area , the analysis module 30 retrieves those coaching suggestions that are associated with the questions that correspond to the weak areas as shown in fig1 a - 13c . it is important to note that the steps of survey collection 46 and analysis 48 can be used in an iterative process to screen out job candidates . for example , a hiring manager might use a simple survey containing 4 questions against 100 job candidates to narrow the list down to 10 candidates , then design a new survey containing 16 questions to narrow the 10 candidates down to 3 candidates , and then design another survey containing 20 questions to select one candidate for hire . accordingly , the present invention can be used to both as a screening tool and a selection tool . fig7 illustrates a detailed process flow of the continuous update step of fig2 which is also part of the analysis module 30 . in step 120 , the computer 10 waits for a predetermined time period after the final candidate report was generated . in the embodiment shown , the predetermined time period is one month . in step 122 , the computer 10 prepares and sends an email to the hiring manager with a url link to a dynamically generated web page . the web page asks whether a particular job candidate is hired . alternatively , the email may include two links asking the hiring manager to click on one link if the candidate was hired and to click on the other link is the candidate was not hired . in step 124 , the computer 10 receives the response of the hiring manager and determines whether the job candidate was hired . if no , then that fact is noted and stored in the candidate database 34 in step 126 for later analysis and reporting . if the candidate was hired , then control passes to step 128 . at step 128 , the computer 10 waits for a predetermined time period after the final candidate report was generated . in the embodiment shown , the predetermined time period is one year from the final report . in step 130 , the computer 10 prepares and sends an email to the hiring manager with a url link to a dynamically generated survey web page . the survey web page asks retention and performance information . in the embodiment shown , the survey web page asks two questions : ( 1 ) is the candidate still employed ; and ( 2 ) how well the candidate has performed based on a survey containing multiple questions or based on a single question on a predefined scale , e . g ., scale of 1 - 10 . in step 126 , the response to the two questions from the hiring manager are stored in the candidate database 34 for later analysis and reporting . in step 132 , the analysis module 30 analyzes the hiring data stored in the candidate database 34 . specifically , the retention and performance data are statistically correlated with the various scores received by that candidate in the surveys to identify the questions where high ratings are most closely associated with high performance and retention . the correlation can be calculated on an industry - wide position type basis , on a company - wide basis without regard to the position type or on a company - wide position type basis . thus , when the candidate reports such as shown in fig1 c are generated , the questions where high ratings are most closely associated with high performance and retention are graphically indicated based on the latest data accumulated up to that point . fig1 illustrates a sample report that shows the correlation between survey questions / competencies and performance of hired candidates . as shown , the report includes raw correlation scores and corresponding ratings . for example , question 3 has a raw score of 4 . 7 and a “ very high ” rating . these reports can be used by the hiring manager to continuously improve the survey . for example , the hiring manager can choose to delete the two questions that have the lowest correlation to the performance data and add two new questions from the competency area that has the highest correlation to the performance data . in the example shown , the two lowest scoring questions are questions 1 and 2 , and the competency area having the highest score of 4 . 66 is “ teamwork ”. once step 132 is executed , control passes to step 128 where the computer waits a programmable amount of time usually 6 to 15 months to repeat the steps 130 to 132 to continuously monitor the performance of the job candidates that have been hired in order to continuously improve the survey questions and competency categories . application of the principles of the present invention are many . for example , principles of the survey selection , collection of responses and analysis of the responses can be used to evaluate a large number of vendors who supply products and services to a company through a group of buyers working for the company . the buyers for the company are acting as “ reference providers ”. a sample vendor report as shown in fig1 a - 15b can be used to better manage the large number of vendors . the foregoing specific embodiments represent just some of the ways of practicing the present invention . many other embodiments are possible within the spirit of the invention . accordingly , the scope of the invention is not limited to the foregoing specification , but instead is given by the appended claims along with their full range of equivalents .	6
the first preferred embodiment of a clutchless variable displacement type compressor according to the present invention will now be described with reference to fig1 through 3 . the compressor is generally designated by numeral 10 . the left side and the right side of the compressor 10 as viewed in fig1 correspond to the front side and the rear side thereof . as shown in fig1 , the compressor 10 includes a cylinder block 11 and a front housing 12 connected to the front end of the cylinder block 11 . a rear housing 13 is connected to the rear end of the cylinder block 11 through a valve plate 14 , valve forming plates 15 , 16 and a retainer forming plate 17 . the cylinder block 11 , the front housing 12 and the rear housing 13 cooperate to form the entire housing of the variable displacement type compressor 10 . the front housing 12 and the cylinder block 11 define therebetween a pressure control chamber 121 . a rotary shaft 18 is rotatably supported by the front housing 12 and the cylinder block 11 through radial bearings 19 , 20 . part of the rotary shaft 18 extending out of the pressure control chamber 121 is connected to an external drive source e ( not shown ), e . g . a vehicle engine , and receives a rotational drive force therefrom . a lug plate 21 is secured to the rotary shaft 18 . a swash plate 22 is supported by the rotary shaft 18 in facing relation to the lug plate 21 so as to be slidable in and inclinable relative to the axial direction of the rotary shaft 18 . the lug plate 21 has formed therethrough a pair of guide holes 211 . a pair of guide pins 23 are provided on the swash plate 22 and slidably fitted in the paired guide holes 211 , respectively . the guide holes 211 and the guide pins 23 cooperate to allow the swash plate 22 to incline relative to the axis of the rotary shaft 18 and rotate with the rotary shaft 18 . the inclination of the swash plate 22 is guided by the guide pins 23 slidably fitted in the guide holes 211 and the rotary shaft 18 slidably supporting the swash plate 23 . as the center of the swash plate 22 moves toward the lug plate 21 , the inclination angle of the swash plate 22 increases . the maximum inclination angle of the swash plate 22 is restricted by the contact between the swash plate 22 and the lug plate 21 . the swash plate 22 shown by solid line in fig1 is positioned at the minimum inclination angle . the swash plate 22 shown by chain double - dashed line in fig1 is positioned at the maximum inclination angle . the minimum inclination angle of the swash plate 22 is set slightly larger than 0 °. the cylinder block 11 has formed therethrough a plurality of cylinder bores 111 and a piston 24 is slidably received in each cylinder bore 111 . rotation of the swash plate 22 is converted to reciprocation of each piston 24 in its cylinder bore 111 through a pair of shoes 25 . the rear housing 13 has formed therein a suction chamber 131 as a suction - pressure region and a discharge chamber 132 as a discharge - pressure region . the valve plate 14 , the valve forming plate 16 and the retainer forming plate 17 have formed therethrough a suction port 26 . similarly , the valve plate 14 and the valve forming plate 15 have formed therethrough a discharge port 27 . the valve forming plate 15 has formed therein a suction valve 151 and the valve forming plate 16 has formed therein a discharge valve 161 , respectively . the cylinder bore 111 , the valve forming plate 15 and the piston 24 cooperate to define a compression chamber 112 in the cylinder block 11 . refrigerant gas in the suction chamber 131 is drawn into the compression chamber 112 through the suction port 26 while pushing open the suction valve 151 as the piston 24 moves toward the bottom dead center or leftward in fig1 . the refrigerant gas flowed into the compression chamber 112 is compressed and then discharged into the discharge chamber 132 through the discharge port 27 while pushing open the discharge valve 161 as the piston 24 moves toward the top dead center or rightward in fig1 . the discharge valve 161 is brought into contact with a retainer 171 of the retainer forming plate 17 , thus the opening degree of the discharge valve 161 being restricted . when the pressure in the pressure control chamber 121 is decreased , the inclination angle of the swash plate 22 is increased and the displacement of the variable displacement type compressor is increased , accordingly . on the other hand , the inclination angle of the swash plate 22 is decreased with an increase of the pressure in the pressure control chamber 121 and the displacement of the variable displacement type compressor is decreased , accordingly . the suction chamber 131 is connected with the discharge chamber 132 through an external refrigerant circuit 28 . the external refrigerant circuit 28 includes a condenser 29 for removing heat from the compressed refrigerant gas , an expansion valve 30 and an evaporator 31 for transferring ambient heat to the refrigerant . the expansion valve 30 is a temperature - sensitive valve operable to control the flow rate of refrigerant in accordance with the temperature of the refrigerant at the outlet of the evaporator 31 . a stop device is provided between the discharge chamber 132 and the external refrigerant circuit 28 . when the stop device is opened , the refrigerant gas in the discharge chamber 132 flows out to the external refrigerant circuit 28 and returns to the suction chamber 131 . as shown in fig2 , an electromagnetic first control valve 33 , a second control valve 34 and a check valve 35 are disposed in the rear housing 13 . the first control valve 33 has a solenoid 39 having a fixed core 40 which is energized by an electric current supplied to a coil 41 of the solenoid 39 thereby to attract a movable core 42 toward the fixed core 40 . the electromagnetic force of the solenoid 39 urges a valve body 37 in the direction to close a valve hole 38 against the spring force of a spring 43 . supply of electric current to the solenoid 39 is controlled by a controller c ( duty - ratio controlling being performed in this preferred embodiment ). the first control valve 33 includes a pressure sensing device 36 having therein a bellows 361 , a pressure sensing chamber 362 and a spring 363 . the pressure in the suction chamber 131 ( or suction pressure ) is applied to the bellows 361 through a suction pressure passage 44 and the pressure sensing chamber 362 . the valve body 37 is connected to the bellows 361 . the pressure in the bellows 361 and the spring force of the spring 363 urge the valve body 37 in the direction which causes the valve hole 38 to be opened a valve chamber 50 is formed in the first control valve 33 in communication with the valve hole 38 and also with the discharge chamber 132 through a first supply passage 51 . the second control valve 34 includes a valve housing 45 having therein a valve body 46 and a valve spring 47 urging the valve body 46 . the valve housing 45 includes a disc - shaped end wall 48 and a peripheral wall 49 integrally formed with the end wall 48 . the end of the peripheral wall 49 located remote from the end wall 48 is connected to the retainer forming plate 17 . the valve body 46 includes a disc - shaped base portion 461 , a cylindrical sliding portion 462 integrally formed with the base portion 461 at the peripheral portion thereof and a pillar - shaped contact portion 463 integrally formed with the base portion 461 and extending from the center of the base portion 461 towards the retainer forming plate 17 . the valve body 46 is fitted in the valve housing 45 so that the sliding portion 462 is in sliding contact with the inner peripheral wall 49 of the valve housing 45 . the interior of the valve housing 45 is divided by the valve body 46 into a back pressure chamber 451 and a second control valve chamber 452 . the contact portion 463 of the valve body 46 is contactable at the distal end surface thereof with the retainer forming plate 17 . the end surface of the sliding portion 462 adjacent to the base portion 461 thereof is contactable with the end wall 48 of the valve housing 45 . the valve spring 47 is interposed between the retainer forming plate 17 and the base portion 461 . the valve spring urges the valve body 46 towards the back pressure chamber 451 . the back pressure chamber 451 communicates with the valve hole 38 of the first control valve 33 through a second supply passage 52 . the peripheral wall 49 of the valve housing 45 has formed therethrough a communication hole 492 which is opened and closed by the sliding portion 462 of the valve body 46 . the second control valve chamber 452 communicates with the pressure control chamber 121 through a second throttle passage 53 formed through the retainer forming plate 17 , the valve plate 14 and the valve forming plate 15 , 16 and through a second bleed passage 54 formed through the cylinder block 11 . the second control valve chamber 452 communicates also with the suction chamber 131 through a bleed hole 491 formed through the peripheral wall 49 of the valve housing 45 . when the contact portion 463 of the valve body 46 is in contact with the retainer forming plate 17 as a valve seat defining the second control valve chamber 452 , the second throttle passage 53 is closed thereby to block the fluid communication between the pressure control chamber 121 and the second control valve chamber 452 . the second bleed passage 54 , the second throttle passage 53 , the second control valve chamber 452 and the bleed hole 491 cooperate to form a second release passage 55 between the pressure control chamber 121 and the suction chamber 131 . as shown in fig1 , the pressure control chamber 121 communicates with the suction chamber 131 through a first bleed passage 56 formed through the cylinder block 11 and a first throttle passage 57 formed through the retainer forming plate 17 , the valve plate 14 and valve forming plates 15 , 16 . the first bleed passage 56 and the first throttle passage 57 serve as the first release passage 58 providing constant refrigerant gas communication between the pressure control chamber 121 and the suction chamber 131 . the second release passage 55 and the first release passage 58 are arranged in parallel relation to each other . as shown in fig2 , the check valve 35 includes a check valve housing 59 having therein a check valve body 60 and a check valve spring 61 urging the check valve body 60 in the direction to close a check valve hole 591 formed in the housing 59 . the check valve hole 591 communicates with the communication hole 492 of the second control valve 34 through a third supply passage 62 . when the second throttle passage 53 is closed by the valve body 46 of the second control valve 34 , the communication hole 492 is opened by the sliding portion 462 of the valve body 46 , thus allowing the communication between the back pressure chamber 451 and the check valve hole 591 . a check valve chamber 592 is formed in the check valve 35 which communicates with the pressure control chamber 121 through a fourth supply passage 63 formed through the retainer forming plate 17 , the valve plate 14 , valve forming plates 15 , 16 and the cylinder block 11 . the first supply passage 51 , the second supply passage 52 and the fourth supply passage 63 form a part of a supply passage 64 for supplying refrigerant gas from the discharge chamber 132 to the pressure control chamber 121 . the controller c operable to control the operation of the solenoid 39 of the first control valve 33 ( by duty ratio ) supplies electric current to the solenoid 39 when the air conditioning switch 65 is turned on and stops supplying the electric current when the air conditioning switch 65 is turned off . the controller c is electrically connected to a room temperature setting device 66 and a room temperature detector 67 . with the air conditioning switch 65 turned on the controller c controls the electric current supplied to the solenoid 39 based on the temperature difference between a target temperature set by the room temperature setting device 66 and the actual temperature detected by the room temperature detector 67 . the opening and closing of the valve hole 38 of the first control valve 33 , i . e . the degree of valve opening in the first control valve 33 , depends on the balance among various forces such as the electromagnetic force generated by the solenoid 39 , the spring force of the spring 43 and the urging force of the pressure sensing device 36 . the degree of valve opening in the first control valve 33 can be continuously adjusted by changing the electromagnetic force . specifically , as the electromagnetic force increases , the degree of valve opening in the first control valve 33 decreases . furthermore , as the suction pressure in the suction chamber 131 increases , the degree of valve opening in the first control valve 33 decreases . thus the first control valve 33 is operable to adjust the cross - sectional area of the supply passage from the discharge - pressure region to the pressure control chamber 121 . on the other hand , as the suction pressure in the suction chamber 131 decreases , the degree of valve opening in the first control valve 33 increases . the first control valve 33 controls suction pressure to a set pressure in accordance with the electromagnetic force . fig2 shows the state of the compressor in which with the air conditioning switch 65 turned off , supplying of electric current to the solenoid 39 is stopped ( duty ratio = 0 ), so that the degree of valve opening in the first control chamber 33 is the maximum . in this state , the inclination angle of the swash plate 22 is the minimum that is slightly larger than 0 ° and , therefore , refrigerant gas is being discharged from the cylinder bore 111 to the discharge chamber 132 . it is so arranged that the stop device 32 is closed thereby to stop the circulation of refrigerant in the external refrigerant circuit 28 when the swash plate 22 is at the minimum inclination angle . part of the refrigerant gas discharged from the cylinder bore 111 to the discharge chamber 132 flows into the back pressure chamber 451 in the second control valve 34 through the valve hole 38 in the first control valve 33 . the valve body 46 of the second control valve 34 is moved by the pressure in the back pressure chamber 451 so as to close the second throttle passage 53 . refrigerant gas in the back pressure chamber 451 flows into the check valve chamber 592 through the communication hole 492 , the third supply passage 62 and the check valve hole 591 of the check valve 35 while pushing open the check valve body 60 . thus the refrigerant gas flows into the pressure control chamber 121 through the fourth supply passage 63 . in other words , part of the refrigerant gas in the discharge chamber 132 flows into the pressure control chamber 121 through the supply passage 64 . refrigerant gas in the pressure control chamber 121 flows out thereof through the first release passage 58 and is drawn into the suction chamber 131 and then into the cylinder bore 111 to be compressed . refrigerant gas compressed is discharged into the discharge chamber 132 . the inclination angle of the swash plate 22 is minimum in the state of fig2 and the variable displacement type compressor 10 operates under the minimum displacement . in this state , since the stop device 32 is closed , no circulation of refrigerant gas occurs in the external refrigerant circuit 28 . fig3 shows the state in which with the air conditioning switch 65 turned on , supplying of electric current to the solenoid 39 is maximum ( duty ratio = 1 ) thereby to close the valve opening in the first control valve 33 . unless the variable displacement type compressor 10 operates under the minimum displacement ( unless the inclination angle of the swash plate 22 is minimum ), the stop device 32 is opened and the refrigerant circulates in the external refrigerant circuit 28 . when the valve opening of the first control valve 33 is zero ( when the valve hole 38 is closed ), no refrigerant gas in the discharge chamber 132 flows into the back pressure chamber 451 of the second control valve 34 through the supply passage 64 . accordingly , the valve body 46 of the second control valve 34 is positioned so as to open the second throttle passage 53 and also to close the communication hole 492 by the resultant force of the pressure ( or suction pressure ) in the second control valve chamber 452 in communication with the suction chamber 131 and the spring force of the valve spring 47 . the check valve body 60 is positioned so as to close the check valve hole 591 by the spring force of the check valve spring 61 . in the state of fig3 , the supply passage 64 is closed and no refrigerant gas in the discharge chamber 132 flows into the pressure control chamber 121 through the supply passage 64 . also , since the second release passage 55 is opened , the refrigerant gas in the pressure control chamber 121 flows out to the suction chamber 131 through both the first release passage 58 and the second release passage 55 . in this state , the inclination angle of the swash plate 22 is maximum and , therefore , the variable displacement type compressor 10 is operated under the maximum displacement . when the air conditioning switch is turned on and the electric current supplied to the solenoid 39 of the first control valve 33 is neither 0 nor maximum ( duty ratio being more than 0 but less than 1 ), refrigerant gas flows from the discharge chamber 132 to the back pressure chamber 451 of the second control valve 34 . accordingly , the valve body 46 of the second control valve 34 is positioned so as to close the second throttle passage 53 thereby to close the second release passage 55 . namely , refrigerant gas in the pressure control chamber 121 flows to the suction chamber 131 through the first release passage 58 , and the refrigerant gas flowed from the discharge chamber 132 to the back pressure chamber 451 flows into the pressure control chamber 121 through the check valve 35 . in this state , the inclination angle of the swash plate 22 becomes more than the minimum so that the suction pressure becomes the pressure set in accordance with the duty ratio , so that the variable displacement type compressor 10 is operated under the intermediate displacement . when the first control valve 33 changes from the closed state shown in fig3 to the opened state , the pressure in the discharge chamber 132 propagates to the back pressure chamber 451 thereby to change the valve body 46 of the second control valve 34 from the opened state shown in fig3 to the closed state shown in fig2 . in this case , after the valve body 46 closes the second throttle passage 53 , the check valve 35 opens . thus , the relation between the timing of closing the second control valve 34 and the timing of opening the check valve 35 is set so that the check valve 35 is opened after the valve body 46 of the second control valve 34 is closed in response to the pressure change taking place in the back pressure chamber 451 when the first control valve 33 changes from the closed state to the opened state . when the first control valve 33 changes from the opened state to the closed state shown in fig3 , the pressure in the back pressure chamber 451 decreases and the valve body 46 of the second control valve 34 is moved from the closed position shown in fig2 to the opened position accordingly . ( 1 ) when the valve body 46 of the second control valve 34 is in the closed position thereby to close the second release passage 55 , the valve body 46 is urged by the resultant force of the pressure in the second control valve chamber 46 and the spring force of the valve spring 47 toward the position where the second release passage 55 is opened by the valve body 46 . on the other hand , the valve body 46 is urged by the pressure in the back pressure chamber 451 ( part of the supply passage 64 ) located downstream of the first control valve 33 toward the opposite position where the second release passage 55 is closed by the valve body 46 . when the valve body 46 closes the second release passage 55 , the pressure in the back pressure chamber 451 is substantially the same as the pressure in the pressure control chamber 121 because the pressure in the pressure control chamber 121 propagates through the fourth supply passage 63 into the back pressure chamber 451 located downstream of the first control valve 33 with a throttle function . on the other hand , since the second control valve chamber 452 communicates with the suction chamber 131 through the bleed hole 491 , the pressure in the second control valve chamber 452 is substantially the same as the suction pressure . that is , in the compressor operation under an intermediate displacement , the differential pressure between the second control valve chamber 452 and the back pressure chamber 451 across the valve body 46 is substantially the same as the differential pressure between the suction pressure and the pressure in the pressure control chamber 121 . as compared with the case of the japanese patent application publication no . 2002 - 21721 , the differential pressure between the second control valve chamber 452 ( suction pressure ) and the back pressure chamber 451 ( control pressure ) is higher than that in the case of the above prior art [ the differential pressure between the pressure in the back pressure chamber ( corresponding to the control pressure ) and the pressure in the cylindrical space ( control pressure )]. the structure according to which the differential pressure between the second control valve chamber 452 and the back pressure chamber 451 can be increased over the prior art enables the spring force of the valve spring 47 to increase . such increased spring force of the valve spring 47 permits the valve body 46 to move from the closed position to the opened position more reliably even if any foreign matters enter into a clearance between the peripheral wall 49 of the valve housing 45 and the sliding portion 462 . this contributes to rapid release of refrigerant gas in the pressure control chamber 121 into the suction chamber 131 at a start - up of the compressor . ( 2 ) since the second release passage 55 is closed during the compressor operation under an intermediate displacement , the cross - sectional area of the second throttle passage 53 forming a part of the second release passage 55 can be made relatively larger in light of the operating efficiency . this also contributes to rapid release of refrigerant gas from the pressure control chamber 121 into the suction chamber 131 at a start - up of the compressor . since the first release passage 58 is always opened ( is kept opened ), refrigerant gas in the pressure control chamber 121 flows out to the suction chamber 131 through the first release passage 58 during the operation under an intermediate displacement . the cross - sectional area of the first throttle passage 57 forming a part of the first release passage 58 can be made as small as possible thereby to decrease the amount of refrigerant gas flowing from the pressure control chamber 121 to the suction chamber 131 within the range where smooth compressor operation under an intermediate displacement is achievable without affecting its operation efficiency . in other words , the amount of the refrigerant gas compressed in the discharge chamber 132 and returning to the suction chamber 131 through the pressure control chamber 121 can be reduced for improvement of the operating efficiency . ( 3 ) when the first control valve 33 changes from the opened state to the closed state during the intermediate displacement operation under a high discharge pressure , the pressure in the pressure control chamber 121 may not decrease as desired due to the leakage of refrigerant gas from the cylinder bore 111 to the pressure control chamber 121 . if the pressure which fails to decrease in the pressure control chamber 121 is propagated into the back pressure chamber 451 through the supply passage 64 , the resultant force of the suction pressure in the second control valve chamber 452 and the spring force of the valve spring 47 may not exceed the pressure in the back pressure chamber 451 with the result that the valve body 46 of the second control valve 34 may fail to move from the closed position to the opened position . the check valve 35 is provided to prevent the pressure failing to be decreased in the pressure control chamber 121 from being propagated into the back pressure chamber 451 . therefore , when the first control valve 33 changes from the opened state to the closed state , the valve body 46 of the second control chamber 34 moves from the closed position to the opened position more reliably . ( 4 ) if the check valve 35 opens before the valve body 46 closes the second throttle passage 53 , the pressure in the pressure control chamber 121 is propagated into the back pressure chamber 451 before the valve body 46 closes the second throttle passage 53 , so that the pressure in the back pressure chamber 451 becomes substantially the same as the pressure in the pressure control chamber 121 . as a result , the valve body 46 may be stopped on its way between the opened position and the closed position before reaching the closed position . the check valve 35 is opened after the valve body 46 of the second control valve 34 has been moved to the closed position . therefore , the pressure in the pressure control chamber 121 will not propagate into the back pressure chamber 451 and the pressure in back pressure chamber 451 remains the pressure of the discharge - pressure region of the compressor before the valve body 46 closes the second throttle passage 53 . thus , the valve body 46 is moved by the pressure of the discharge - pressure region in the back pressure chamber 451 to the position to close the second throttle passage 53 . the present invention may be embodied in various ways as exemplified below . as shown in fig4 , the third supply passage 62 of the check valve 35 may be connected to the second supply passage 52 between the first control valve 33 and the second control valve 34 . according to this embodiment , the same advantageous effects as those in the first preferred embodiment are obtained . the check valve 35 in the first preferred embodiment may be dispensed with . in this case , the same advantageous effects as ( 1 ) and ( 2 ) in the first preferred embodiment ( the advantageous effects ( 1 ) and ( 2 ) of the first preferred embodiment ) are obtained . a control valve having a pressure sensing device and operable to adjust the opening degree of its valve body in accordance with the differential pressure between two different points in the discharge - pressure region of the compressor may be used as the first control valve 33 . in other words , any control valve that is operable to increase the opening degree of its valve body with an increase of the refrigerant flow rate in the discharge - pressure region and to decrease the opening degree with a decrease of the refrigerant flow rate in the discharge - pressure region may be used as the first control valve 33 . the first control valve 33 , the second control valve 34 and the check valve 35 may be arranged outside the housing of the variable displacement type compressor and these three valves may be arranged in communication with the suction chamber and the discharge chamber in the variable displacement type compressor through any suitable conduits . the present invention may be applied to a variable displacement type compressor receiving power from an external drive source through a clutch . with the clutch engaged in such variable displacement type compressor , the refrigerant circulates in the external refrigerant circuit even during operation under the minimum displacement . with the clutch disengaged , the circulation of refrigerant in the external refrigerant circuit is stopped .	5
the foregoing effects were substantiated by the following examples of the invention wherein ball bearings were used . ( 1 ) high elastic limit since the ring is subjected locally to a high contact stress . ( 2 ) great rolling fatigue strength since a high contact load is repeatedly applied to the ring . ( 3 ) high hardness . ( 4 ) high abrasion resistance . ( 5 ) least susceptibility to secular changes . ( 6 ) amenability to heat treatment with high stability . accordingly , generally used are high - carbon chromium bearing steels such as jis suj1 , suj2 ( equivalent to sae52100 ), suj3 , suj4 and suj5 , and carburized bearing steels such as jis scr415 , scr420 , scm420 , sncm220 , sncm420 and sncm815 , sae5120 , sae8620 , sae4320 and sae9310 , among which suj2 is most widely used . five kinds of specimens were prepared in comparative example 1 and examples 1 to 4 as listed in table 1 to substantiate the effects . the residual austenite content was determined by x - ray diffractiometry at a position 0 . 1 mm radially outward from the outer ring raceway . as a reference for comparing the effects , an existing bearing was used . the outer ring was made of suj2 and heated at a temperature of 845 ° c . for hardening . after hardening in oil , the ring was tempered at 180 ° c . the outer ring was made of suj2 as in comparative example 1 . the ring was heated at 845 ° c . for hardening , quenched in oil and tempered at 350 ° c . the outer ring was prepared from suj2 as in comparative example 1 . the ring was heated at 845 ° c . for hardening , quenched in oil , then subjected to a sub - zero treatment at − 70 ° c . and thereafter tempered at 200 ° c . the outer ring was prepared from sae5120 , subjected to carburization hardening , then immersed in liquid nitrogen (− 196 ° c .) and thereafter tempered at 210 ° c . the outer ring was prepared from sae5120 , subjected to carburization hardening and then to a subzero treatment at − 60 ° c . and thereafter tempered at 200 ° c . the sub - zero treatment affords higher hardness and lower toughness , so that the ring was subsequently tempered at a higher temperature than in the usual tempering process to give the ring the same hardness as when no sub - zero treatment was conducted . fig2 shows the relationship between the tempering temperature of the sub - zero treated product and the surface hardness thereof . a tester having the specimen installed therein was placed on a vibrating table , and the specimen was subjected to a vibration test by applying a load and vibration thereto at the same time with the inner ring held in rotation . the testing conditions were as follows . each specimen was checked for the degree of fatigue in terms of the time taken for flaking . table 2 shows the result . since the specimens exhibited no abnormalities except for the outer ring , the result is given only for the outer ring . in comparative example 1 , many cracks and structural changes were observed immediately under the raceway of the outer ring after testing , whereas neither cracking nor structural change was found in examples 1 and 3 . only a slight structural change was observed in examples 2 and 4 . during the testing , the bearing before flaking was removed from the tester and was singly subjected to an axial load of 2 . 5 kgf with the inner ring rotated at 1800 r . p . m . to measure variations with time in the vibration acceleration of the outer side of the bearing . table 3 shows the result . the result reveals that the vibration increased markedly in comparative example 1 within a short period of time before flaking , indicating a marked deformation of the raceway . in examples 1 to 4 , unlike comparative example 1 , there was little or no increase in vibration even after a prolonged period of rotation test , this indicating that the raceway remained unchanged despite the testing . tables 2 and 3 show that the bearings of examples 1 to 4 of the invention are greatly improved in life over the existing bearing of comparative example 1 . incidentally , the existing bearing of comparative example 1 was installed in the tester in the same manner as above and tested for rotation under a static load without giving any vibration using the same conditions as above in respect of the bearing load and the speed of inner ring . even after rotation for 1500 hours , the bearing was free of flaking with no cracking or structural change observed immediately under the raceway . this indicates that the bearing is operable without any trouble under the usual conditions . next , the result achieved by an alternator will be described to substantiate the effects of the invention . fig3 shows the construction of the alternator . a pair of frames 10 and 11 forming the shell of the alternator are each in the form of a bowl and are fastened to each other with bolts and nuts . a stator 12 is fixedly fitted to the inner peripheries of these frames 10 and 11 by a suitable method , as by a press fit . the stator 12 is a known one comprising a stator core 12 a and a stator coil 12 b wound around the core . the frames 10 , 11 are centrally formed with hollow cylindrical bearing boxes 10 a , 11 a , respectively , projecting inward . radial ball bearings 13 , 14 are mounted in the boxes 10 a , 11 a , respectively , and rotatably support a rotary shaft 15 thereon . a pair of pawl - shaped pole cores 16 a , 16 b are mechanically fixed to the shaft 15 so as to be positioned inside the stator 12 . a rotor coil 17 is clamped between these cores . the shaft 15 , pole cores 16 a , 16 b and rotor coil 17 provide a known rotor 18 . between the first bearing 13 and the pole core 16 a of the rotor 18 , a collar 19 is fitted around the shaft 15 . a pulley 20 positioned outside the frames 10 , 11 is fastened with a nut 21 to the end of the shaft 15 projecting through the first bearing 13 out of the frame 10 . the shaft 15 is rotatable by an engine ( not shown ) through the pulley 20 . of the inner rings and the outer rings of the pair of bearings 13 , 14 , at least the outer ring of the bearing 13 adjacent to the pulley 20 is made of a steel which is up to 10 % in the amount of residual austenite . the residual austenite content is reduced to not higher than 10 % by the method already stated . fig5 shows the relationship between the amount of residual austenite and the force of rolling friction . the ratio of rolling frictional force plotted in fig5 is 1 when the amount of residual austenite is 10 % in the case where the contact surface pressure is 250 kgf / mm 2 . fig4 shows the relationship between the amount of residual austenite and the proof stress . the proof stress plotted in fig4 is at the strain of 5 × 10 − 6 . austenite is a structure of lower proof stress than martensite , so that the raceway subjected to a load when the balls roll along , if having a high austenite content , deforms to cause the balls to roll along a recess to produce an increased frictional force . conversely , a reduction in the austenite content inhibits heat generation within the bearing due to the high - speed operation of the alterator under high tension , assuring improved endurance against seizure . further in the presence of a large amount of residual austenite , an increased load due to high tension renders the raceway liable to plastic deformation , with the result that vibration occurs every time the balls roll along an unevenly recessed portion during rotation . when the alternator is driven at a high speed , the vibration becomes more pronounced , possibly causing the rotor to interfere with the stator to result in locking . it is effective to reduce the residual austenite content to preclude such plastic deformation . to substantiate the above effect achieved by reducing the residual austenite content , examples are given below wherein radial ball bearings were used . first , four kinds of specimens were prepared in comparative example 2 and examples 5 to 7 as bearings toward the pulley of the alternator , using the material given in table 4 for the inner and outer rings . specimens were also prepared as the bearings on the other side ( rear side ) using the same material as in comparative example 2 for the inner and outer rings . as a reference for the comparison of the effect , an existing bearing was used which was prepared from suj2 generally in use as a bearing material . the hardening heating temperature was 845 ° c . oil hardening was followed by tempering at 180 ° c . the material used was suj2 as in comparative example 2 . heating at 845 ° c . for hardening was followed by oil quenching and then by tempering at 350 ° c . the material used was suj2 as in comparative example 2 . heating at 845 ° c . for hardening was followed by oil quenching , then by a sub - zero treatment at − 60 ° c . and thereafter by tempering at 200 ° c . the material used was suj2 as in comparative example 2 . heating at 845 ° c . for hardening was followed by oil quenching , then by a sub - zero treatment at − 196 ° c . and thereafter by tempering at 200 ° c . the residual austenite content was determined by x - ray diffractiometry over the depth of 0 . 2 mm from the bearing raceway radially outward thereof . the bearing on the pulley side was of the size being no . 6302 ( 42 mm in outside diameter ), and the bearing on the rear side was of the size bearing no . 6002 ( 32 mm in outside diameter ). each pair of specimens was incorporated into an alternator and subjected to a high - speed high - tension test under the following conditions . a failure occurred only in comparative example 2 . more specifically , the failure was seizure involving carbonization of the grease and marked discoloration of the inner and outer rings and the balls , and the retainer was broken to lock the rotatable ring . the bearing on the pulley side only failed because this bearing , which is close to the pulley , is subjected to a greater momental load and therefore heated to a higher temperature than the other bearing on the rear side . although no failure occurred in examples 5 to 7 , the grease was checked for oxidation deterioration by infra - red spectroscopic analysis , which revealed almost no deterioration in examples 5 and 7 but deterioration proceeding in example 6 only . in comparative example 2 , the temperature of the inner and outer rings was measured under the testing conditions to find that the outer ring was 8 to 12 ° c . higher than the inner ring in temperature . this indicates the following . the inner ring is connected to the rotor , which is driven at a higher speed then conventionally and is therefore fully self - cooled by a fan effect to lower the temperature of the inner ring to a level lower than in the prior art , whereas the outer ring is mounted on the frames having attached thereto the stator which evolves a larger amount of heat due to a higher output , with the result that a larger amount of heat is transferred from the stator to the outer ring to result in a higher temperature than conventionally . for illustrative purposes , fig6 shows the result obtained by measuring variations in the vibration level with the lapse of testing time by a vibration acceleration sensor attached to the frame . although the specimens tested were found free of the failure that the rotor interferes with the stator to lock the rotatable ring . comparative example 2 exhibited a higher vibration level . presumably , this indicates that the higher residual austenite content leads to greater plastic deformation . thus , when incorporating the bearings of examples 5 to 7 containing a reduced amount of residual austenite , the alternator can be adapted for a high - speed operation under increased tension . incidentally , the conventional bearings for use in precision machines or devices or the like include those subjected to the sub - zero treatment in order to inhibit the dimensional variations due to the decomposition of austenite . according to the present invention , on the other band , attention is directed not to such dimensional stability but to the characteristics of residual austenite per se to provide the combination of an alternator and a bearing which contains a reduced amount of residual austenite so as to exhibit outstanding performance in an environment involving vibration or impact . consequently , the invention achieves the entirely novel effect of making the alternator smaller in size , lower in weight and higher in output . carburized materials such as sae5120 are usable for the present bearing to conduct the sub - zero treatment after carburization hardening . in this case , unlike the use of suj2 , additional compressive residual stress is available which is advantageous to fatigue life . accordingly , such materials are useful for assuring higher tension for rotation at a further increased speed as will be apparent from the result of examples 3 and 4 listed in table 2 and achieved with the ball bearings .	7
the process according to the invention is shown in fig1 and designated generally by the reference numeral 10 . the process includes the steps of mixing a mixture 14 in step 12 which comprises any one of the mixtures shown generally by the designations &# 34 ; mixture # 1 ,&# 34 ; &# 34 ; mixture # 2 ,&# 34 ; or &# 34 ; mixture # 3 &# 34 ; in blocks 14 , 16 , and 18 . preferred and representative mixtures for practicing the invention will be discussed later in this specification . the mixture 14 or 16 is applied to a vehicle 20 in an applying step 22 . the mixture 14 so applied to the vehicle 20 is partially removed and the alcohol partly evaporated in step 24 of removing by a suitable removal device , a representative removal device being designated generally by the block 28 . following the step 24 of removing the applied mixture 14 or 16 from the surface of the vehicle 20 , the surface is polished in a polishing step 26 . the selection of solutions 14 and 16 are choices where the mixture 16 is used during very cold weather and the mixture 14 is during warmer periods . solution 16 can be used effectively as a general cleaner and polisher in the household but also can substitute for use on vehicles during colder weather . in the step of removing the applied liquid , it is wiped over the area in quick succession to take advantage of the alcohol and ammonia present and in the state of evaporating . this wiping or buffing action smooths the &# 34 ; hills &# 34 ; in the wax formation because the alcohol has softened and partially liquified the wax on the surface . in the final action of polishing the wax haze with a dry paper towel pad , the action is completed . wax on the surface even if liquified by the alcohol remains on the surface because the towel is wet with water , the two no longer being saponified in the solution . a suitable mixture having the essential components for performing the process as representatively shown as mixture # 1 in block 14 is a mixture of 11 / 2 ounces of ammonia and 10 ounces of water and 4 ounces of isopropyl alcohol ( 70 % by volume ) to which may be optionally added a suitable quantity of a surface wax to the vehicle , such as commercial wax , the solution being an excellent dispersant . this proposed mixture varies from a typical mixture of ammonia and water for general cleaning purposes such as called for in the commercial grade parsons ammonia of 4 ounces of ammonia per gallon of water . thus , the ammonia content of the applicant &# 39 ; s solution is substantially increased over a typical commercial recommendation . such an increased concentration of ammonia , in combination with alcohol , has proved suitable for removal of a major contaminant of deposits on automotive body surfaces caused by petroleum - based products such as oils , asphalts , rubber , and vehicle emission products . as is known , rotating wheels of vehicles , for example , throw these products into the turbulent stream of air surrounding the vehicle on a roadway and dirt products containing such quantities of ground petroleum products are themselves deposited in a film which accumulates on the surface of a vehicle . the presence of alcohol not only serves to assist in dissolving the accumulated and deposited petroleum products , it also inhibits freezing if the mixture , for example , in kit form , is stored in a below - freezing atmosphere . the alcohol , it has been observed , serves mainly to soften or liquify the wax present on the surface thus releasing any contaminants from the wax for removal , and also allows levelling of the wax to improve its glossy appearance . mixture 18 (# 3 ) is a highly volatile solution that is particularly succesful in cleaning and polishing brass , chrome , glass , and mirrors and all dense , hard surfaces . too volatile for vehicles , it is an instant polisher of all waxed surfaces and quickly disperses soap curd . its increased volatility does not allow the cleaning capabilities as good as mixture 16 (# 2 ). the application of a mixture without added wax has proved suitable for application to a waxed surface , wherein the wax already present on the surface is smoothed and evened by the process . this application can be repeated many times with successive improvements in the luster until a highest degree of luster is attained . the mixture which contains a wax is suited for both waxed and unwaxed surfaces to achieve a maximum luster . the mixture described above is applied to the surface of the vehicle or other waxable surfaces in the step designated by the reference numeral 22 . preferably , the mixture is sprayed onto a limited area of the entire surface of the vehicle or other waxable surface in a fine mist such as by a commercially - available spray pump and the surface is thereafter wiped dry in the removing step 24 by using a trifold of three highly absorbent paper towels , forming a pad . by these steps 22 and 24 , dirt and particles and wetted dissolved oily products are readily released and captured by the toweling and do not mar the surface , contrary to expectations . visual observation of the products accumulated by a general application of a mixture to a vehicle surface over a period of fifteen months has shown no observable abrasion occurring in the practice of the process . the application of the solution so described , without added wax visually appears to rejuvenate the existing wax surface on a vehicle while at the same time cleaning the surface . visual observation of the paper towel pad used to remove the solution from the vehicle surface indicate blackened deposit areas on the towel , thus evidencing petroleum - based deposits . the step of removing is preferably followed by the step of polishing and levelling of the wax . preferably , polishing consists of using a clean , dry , paper towel pad with a wiping action promptly after the liquid has evaporated and the surface wax appears hazy . this is the final buffing to the finish and results in an improved luster because of the levelling action . successive applications will improve the luster on each step to a point of perfection as allowed by the surface imperfections beneath the wax . it should be considered that &# 34 ; scratching &# 34 ; of the waxed surface caused by grit being drawn across the surface by handpower is actually in the form of abrasive marks induced on the waxed surface . the momentary liquification of that wax by the mixture according to the invention and excited by the wiping motion deters the incidence of abrasion of the wax surface because of the lubricity and the reposturing of the wax filling new voids instantly . the application of the process shown in fig1 for a compact car with an otherwise well - maintained finish requires about five minutes to completely dry clean and polish using the process with about 1 / 3 of an ounce or less of solution and the use of about two highly absorbent 2 - ply paper towels pads . thus , significant cost savings occur , while proving convenient in practicing the procedure . the application also improves the surface of the vehicle to a point where one finds that the usual dirt , grime and dust are greatly diminished therefore speeding up the process of cleaning . in one test , it only required less than four minutes to complete with a total expenditure of 1 / 4 ounce of liquid . another aspect of the invention relates to a provision of a mixture produced in accordance with the mixing step 12 shown in fig1 in a kit designated generally by the reference numeral 40 . the kit 40 includes the solution 14 or 16 , and a supply of paper towel pads 28 and 42 , in a convenient carrying case . the kit 40 , within the confines of a small space , provides all of the ingredients necessary for a vehicle owner or user to dry clean and polish a vehicle at a site convenient to him . for example , the vehicle could be cleaned and polished in a matter of minutes while waiting at a parking lot for a spouse , while pinned in traffic , or attended to commercially as an adjunct to commercial parking lots for a nominal fee . the cost of the ingredients is nominal , while the procedure is ecologically sound in that the residue of paper towels is easily incinerated . as representative examples of the mixtures produced according to the invention , the following are provided : 11 / 2 ounces of commercially available ammonia , available under the parsons brand name , were mixed with 4 ounces of isopropyl alcohol ( 70 % by volume ) and 10 ounces of water . such a solution contained twice the recommended content of the ammonia mixture commercially available as a starting solution , which the manufacturer recommended as 1 ounce per quart of water . such a solution was applied by spraying in accordance with the teachings of this invention and by a highly absorbent paper towel pad , commercially available under the brand name bounty , a highly absorbent pad of three 2 - ply , 11 &# 34 ;× 11 &# 34 ; paper towels . the mixture was applied by a commercially available spray mist bottle , such as that utilized for the application of windex brand cleaner in controlled amounts , wherein the application varied in accordance with the quantity of residue to be removed . for example , heavier deposits of petroleum - based grime near the base of the vehicle and near the wheel wells required the application of greater quantities or repeated applications . such a solution was applied to a honda brand compact automobile by applying about 1 / 3 ounce of the solution so mixed spread over the entire surface of the vehicle . the mixture was removed by evaporation and highly absorbent paper towels , such as bounty 11 &# 34 ;× 11 &# 34 ; 2 - ply towels . visual examination of the towels which were used by applying a clean area often during the absorbing process revealed blackened dissolved deposits while the surface so cleaned revealed an absence of petroleum - based grime , even under microscopic visual examination . thus , it is believed that the petroleum - based grime released and absorbed by the mixture , made possible by the alcohol and ammonia to form a solution which is readily picked up by the towel pads . the mixture was applied without the addition of wax to the mixture in accordance with mixture # 1 described above since the compact automobile had been waxed regularly for the prior 9 months . the mixture was applied not only to the painted surface but also to mirrors , wheels , bumpers , and glass surfaces in a period of about 10 minutes . visual examination of the surface revealed an extraordinarily good luster and preservation of the surface , an apparent smoothing of the waxed surface , and an attractive shine . 11 / 2 ounces of commercially available ammonia , available under the parsons brand name , were added to 4 ounces of alcohol ( 70 % by volume ) and 10 ounces of water . the alcohol was isopropyl alcohol , normally used as rubbing alcohol . this alcohol provided an improved product for exposure and evaporation rate , while satisfactorily achieving a high gloss to the surface . this ratio naturally shortened the time required to polish the wax because the alcohol evaporated faster while the water dried more quickly . the following discussion is helpful in understanding a possible explanation for the unexpected results of the invention . theoretical aspects of gloss and polishing involve the reflection of light . with a mirror having a ratio of reflection of unity , it is known that in actual practice even with the most perfect optical mirror , the reflectance will be a fraction smaller than one . optimum reflections ca only be achieved if the surface is smooth , even and free from scratches , otherwise the incident light will be reflected at irregular angles . polishing then is employed to provide s reflecting , glossy surface . polishes are designed to yield a smooth surface by forming a film upon the surface . a shoe , for example , is covered with a film based on the wax which the shoe polish contains . the wax film fills the scratches and equalizes the unevenness , thereby providing a reflecting surface . with auto polishes , a combined cleaning and polishing effect is obtained : first , the dirt and grime are removed by the cleaning action of the polish ( enhanced in most cases by the presence of soaps and other detergents , mild abrasives and by solvents ); second , after the film is intensified by &# 34 ; buffing &# 34 ; with a soft brush and cloth . by mechanical buffing , a different effect is obtained . here the polishing effect is obtained chiefly by the action of abrasives contained in the wax compound . it is not only the cleaning effect of the abrasives which gives a glossy surface to metal or plastics , but also the heat of friction on the surface of the material being polished . this friction melts a thin microlayer to provide a plastic flow of wax on the surface . this molten material closes and fills all scratches and pores and materially levels the wax surface and on cooling gives the high gloss surface film of &# 34 ; buffed &# 34 ; or polishes metals and plastics . the classic work of polishing by sir george beilby shows that the top layer of the polished solid is different in structure from that of underlying layers . the upper layer has lost its obvious crystalline properties and has apparently flowed over the surface bridging the chasms and filling the irregularities in it . the mechanism of the process has been the subject of discussion by the experts for many years . newton , herschel and others considered that polishing was essentially due to abrasion , that is , to gradual wearing away of the surface irregularities ; in beilby &# 39 ; s view , it was due to some surface tension effect . however , the frictional heat generated at the rubbing surfaces may easily raise the temperature to a high level , and this suggests that the local heat - softening or actual melting may play an important part in the polishing process . the surface film formed by plastic flow during polishing is generally of a very thin micro - structure . to summarize the effect of polishing , the smooth surface is obtained either by material from the polishes , e . g ., the wax film formed by the material contained in the polishing compound , as in the case of shoe polish , or by a layer of the polished material itself which is formed by the frictional heat generated during polishing . sometimes combined effects are obtained , e . g ., film formation of the polished material and film formation by the wax base of the polishing material . this is sometimes the case with metal polishes containing abrasives and &# 34 ; high gloss &# 34 ; waxes . carnauba wax contributes greater hardness and solidity to wax compositions to which it has been added . in this way , beeswax , for example , loses its characteristic stickiness when a little carnauba wax is added to it , and the new mixture offers greater resistance to kneading in the warm hand . on milling the carnauba wax with paraffin wax , the later loses its crystalline structure in the same way that beeswax and japan wax lose their conchoidal fracture . the hardness and gloss of carnauba wax render it particularly suitable for application in wax foundations in polishing preparations . carnauba wax can also be worked up with water free creams as well as with water - containing emulsified products . alone , or preferably in mixtures with easily saponifiable waxes and fats , it can fairly well be saponified , as it contains about 45 % of saponifiable matter . by treatment with alkalis , emulsions of varying density result according to the quality of water added . useful emulsions can be achieved simply by boiling the carnauba wax with soap solutions . a typical formula recommended in a carbide & amp ; carbon chemicals co . publication are typical of automobile polishes : ______________________________________ liquid semi - solid______________________________________carnauba wax 10 12beeswax 6 4paraffin wax 2 6stearic acid 7 7triethanolamine -- 2 . 7morphalene 1 . 7 -- water 75 50white spirit 75 50______________________________________ the formula can be adjusted by less water / solvent for a more paste - like consistency . since most polishes contain abrasives such as bentonite , tripoli , kieslguhr , diatomite , fullers earth , china clay , talc , and so forth , these abrasives provide the means to abrade the surface to remove dirt and grime , such as that appears on the cloth used for this task . the action &# 34 ; cleans &# 34 ; the surface leaving some of the grime in the residue on the surface which is picked up by the cloth . this action also levels the wax surface forcibly while the solvents may aid in the placement of new wax on the surface . it is apparent that the wax / water / soap / solvent emulsion ( with other constituents ) is a self - serving composition designed to work in the application scenario and specifically performs in this limited area . some of these above observations are those expressed in &# 34 ; polishes ,&# 34 ; available from crc press . the author of this book failed to point out also that carnauba wax also raises the melting point of other waxes by seeding this capability wherein these mixtures multiply the melting point not commensurate with the addition of carnauba . dura commodities corporation , a leading importer of carnauba wax , publishes a technical data sheet that states that carnauba wax is soluble in boiling alcohol but is sparingly soluble in alcohol at ambient temperatures . the authors of &# 34 ; polishes &# 34 ; point out that &# 34 ; pure carnauba is soluble in alcohol ( boiling ).&# 34 ; on cooling , white crystalline precipitate separates out . carnauba wax is easily soluble in all solvents generally used in polishing waxes . with this information , the following test was also conducted . a sample packet of carnauba wax was obtained in natural form from dura for testing purposes . since it appeared apparent that the plain 3 : 8 : 20 mixture described above does not deplete the wax deposited on a surface ( even when the wax free solution was used fifty times on a refrigerator door without any noticeable depletion of the wax with a great , successive improvement in the gloss attained ), a test procedure was performed to reproduce a cleaning and polishing action on a flake of pure carnauba ( severest test of all waxes ) for 52 successive applications in order to simulate conditions had one applied this treatment for a period of one year at a rate of once a week . before application , the flake was weighed and on completion , weighed again to determine if losses occurred . this does not , however , take into consideration any oxidation losses . this test also was conducted to prove that the alcohol in the solution at ambient temperature fluidizes the microlayer , thus permitting levelling of the wax and thereby improving gloss and simultaneously allowing &# 34 ; dry cleaning &# 34 ; of the existing wax deposits on this micro - layer . the sample flake of carnauba wax was weighed at an apothecary by a pharmacist and found to weigh 454 milligrams . the sample was then subjected to cleaning and polishing operations 52 times in succession . the flake when weighed at first had a dull yellow appearance with no signs of gloss at all . a flake when wetted with the 3 : 8 : 20 solution and allowed to evaporate from the surface of the flake revealed a change in the surface that had signs of gloss . rubbing this surface with a clean , dry paper towel immediately produced a high gloss . however , on rubbing the surface of the flake that was not treated with a towel , an immediate gloss also appeared . these two tests indicate that carnauba is readily susceptible to rubbing and polishing actions . repeated applications of the above solution to the test sample improved the gloss until it was very slippery and difficult to properly rub . this indicated that the solution ( alcohol ) was fluidizing the microlayer and it appeared that this fluidized layer remained to be polished with a dry towel . during the test run , six pieces of wax from the flake fractured away from the flake . all of the pieces were gathered upon completion of the test and weighed on the same scale and by the same pharmacist . the result was a residue of 430 milligrams , a difference of 24 milligrams from the starting amount . this indicated an approximate 10 milligram loss per each flat face taking into account the 1 / 8 &# 34 ; thickness . it was noted that the paper towel contained many minute particles of wax that had separated from the larger piece . thus , the test is not completely valid but graphically indicated that there is no appreciable loss of wax . the flake had an area of 1 / 2 &# 34 ; square . another test performed some time ago using full strength alcohol on a waxed surface revealed that the wax would be depleted on rubbing with a paper towel to the extent that 12 applications of wax were promptly removed . therefore , there is a delicate balance that was achieved in this solution . the combination , then , of rubbing and polishing a wetted waxed surface which this specific solution produces on the vehicle fluidizes the thin microlayer of the existing wax , i . e ., that already on the surface and that being applied with the solution if so formulated , thus performing a chemically assisted buffing operation to achieve high gloss . the &# 34 ; buffing &# 34 ; herein is hand rubbing with moderate pressure on highly absorbent paper toweling . performed quickly using the 3 : 8 : 20 solution , it smooths out the microlayer by means of fluidizing it ( rather than melting or abrading it ) making for an exemplary means to achieve a high gloss state with very little effort and with a drastic reduction in time . the utter slipperiness of the sample on being wetted and its resistance on drying further indicate the fluidizing action . it is also evident from testing using one &# 39 ; s finger to apply the solution . upon evaporating , the surface suddenly loses its slipperiness . upon wiping with a dry towel , the slipperiness is restored to the dry surface , but not to the great degree of the wetted surface . it is more than evident from the action witnessed and as described in the work &# 34 ; polishes &# 34 ; that the emulsion serves to clean the fluidized wax by means of the ammonia / water phase incorporated in the solution , the grime then being absorbed by the paper towel . this is confirmed since an &# 39 ; 84 honda after repeated uses of the solution became cleaner , taking on a bright ( like new ) appearance . fluidizing of the microlayer also promotes a great reduction in effort and the fast evaporation of the alcohol reduces reaction time to such a short duration that one can dry clean and high polish a compact car in less than four minutes . here one has also to take into consideration that the microlayer is a very fine hardly discernable layer , thus the reduction in mass to be polished of major importance in the time and effort saving step . the solution acts as a excellent dispersing vehicle for waxes . misted on the surface and wax rubbed into the solution produces an excellent way to apply wax in an ultra - thin layer , saving labor and material while maintaining a low profile on an already improved surface . the polish just described would be used for a period of time on a new surface to build an effective wax coating and chemically buffing it to a fine gloss . later application of the unwaxed solution ( 3 : 8 : 20 ) would serve to maintain a clean waxed surface and to improve the gloss on subsequent applications . this is opposed to the accepted and commercially available waxes that cannot hope to remove all the grime and dirt not to mention the almost useless washing with soap and water . in fact , the car surface has very fine accumulations of grime that become imbedded in the wax surface and characteristically dull the surface . the fact that the test car when new was subjected to one year of washing with soap and water had a noticeable brightening effect after numerous applications of the 3 : 8 : 20 solution is further evidence of the removal of color bodies that became encapsulated in the wax on the surface . thus , this solution is seen as an excellent means of maintaining and improving waxed surfaces and imparting bright colors lost to improper care . thus , it has been demonstrated that in order to clean and fine polish a waxed surface that a simple cleaning compound ( household ammonia ) in water in the presence of alcohol can and does promote the release of dirt , grime , and other contaminants by actively fluidizing the microlayer . these contaminants then freed in the liquid phase are readily captured in the high absorbing paper toweling . the resistance to wax absorption by the paper towel is evidently due to the water / ammonia phase that has been absorbed in the fibers of towel . the alcohol in the fluidized zone evaporated leaving a cleaned waxed surface that is finish polished with several passes of a dry towel during the tail end of the evaporation process . the effective amounts of alcohol , water , and ammonia can also be adjusted within the teachings of this invention to accommodate the ambient temperature where the solution of the invention is used . when prepared for a floor or other interior surface , the amount of water was reduced to produce a more volatile solution . thus , for interior surfaces at lower ambients , the ratio was 11 / 2 ounces of ammonia to 4 ounces of alcohol to 8 ounces of water . the results were satisfactory . it is also noted that the 3 : 8 : 12 mixture ( no . 3 ) is a very volatile solution that expressly works well on dense surfaces as shown in step 18 in fig1 and specifically polished metals , sinks , chrome , glass and mirrors while being an excellent soap curd disperser . in this case , the adjustment of the constituents are within the teachings of this invention to accomodate special surface conditions . since the aforementioned procedures succeed in restoring the wax finish on old cars and will maintain a new car with no build - up of haze coupled to the gradual improvement in glass with its attendant improvement in the wax profile to a dense , flat and smooth surface , it is probable that this continued process will ultimately delay or postpone the oxidation process respecting the underlying paint . it is not known how many years or decades are involved at this time . if the painted surface cannot &# 34 ; see &# 34 ; oxygen , then the process could be totally prevented by the continued upgrading of the wax overlay . the invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the claims rather than by the foregoing description , and all changes which come within the meaning and range of the equivalents of the claims are therefore intended to be embraced therein .	1
the compounds of the invention having the structural formula i may be readily prepared by treating a corresponding compound having the structural formula ii with the desired cyclic amine iii or iiia . for purposes of this reaction , the alkylamine substituent of compound iii or iiia may , if desired , be protected by a group which renders it substantially inert to the reaction conditions . thus , for example , protecting groups such as the following may be utilized : silyl groups such trimethylsilyl ; and groups such as trityl , tetrahydropyranyl , vinyloxycarbonyl , o - nitrophenylsulfenyl , diphenylphosphinyl , p - toluenesulfonyl , and benzyl , may all be utilized . the protecting group may be removed , after the reaction between compound iv and compound va or vb if desired , by procedures known to those skilled in the art . for example , the ethoxycarbonyl group may be removed by acid or base hydrolysis and the trityl group may be removed by hydrogenolysis . the reaction between the compound of structural formula ii and a suitably protected compound of formula iii or iiia may be performed with or without a solvent , preferably at elevated temperature for a sufficient time so that the reaction is substantially complete . the reaction is preferably carried out in the presence of an acid acceptor such as an alkali metal or alkaline earth metal carbonate or bicarbonate , a tertiary amine such as triethylamine , pyridine , or picoline . alternatively an excess of the compound of formula iii or iiia may be utilized as the acid acceptor . convenient solvents for this reaction are nonreactive solvents such as acetonitrile , tetrahydrofuran , ethanol , chloroform , dimethylsulfoxide , dimethylformamide , pyridine , picoline , water , and the like . solvent mixtures may also be utilized . convenient reaction temperatures are in the range of from about 20 ° to about 150 ° c . ; higher temperatures usually require shorter reaction times . the removal of the protecting group r 4 may be accomplished either before or after isolating the product , i . alternatively , the protecting group r4 need not be removed . the starting compounds having structural formulae ii are known in the art or , if new , may be prepared from known starting materials by standard procedures or by variations thereof . thus the following compound is disclosed in the noted reference : ## str13 ## the 6 , 7 , 8 - trifluoro - 1 , 4 - dihydro - 1 - methylamino - 4 - oxo - 3 - quinolinecarboxylic acid may also be prepared by a method described in european patent publication no . 90 424a . this compound may be converted to the corresponding 5 - amino - 6 , 7 , 8 - trifluoro - 1 , 4 - dihydro - 1 - methylamino - 4 - oxo - 3 - quinolinecarboxylic acid by first nitrating the above compound with potassium nitrate and sulfuric acid then hydrogenating the nitro group catalytically with palladium on carbon according to known methods . an alternate method for preparing the above starting material is described in the examples . the compounds of the invention having structural formula iii or iiia are either known compounds or they may be prepared from known starting materials by standard procedures or by variations thereof . for example , 3 - pyrrolidinemethanamines having the structural formula d ## str14 ## may be readily prepared from the known starting material methyl 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrolidinecarboxylate , a , [ j . org . chem ., 26 , 1519 ( 1961 )] by the following reaction sequence . ## str15 ## the compound wherein r 3 is hydrogen , namely 3 - pyrrolidinemethanamine , has been reported in j . org . chem ., 26 , 4955 ( 1961 ). thus compound a may be converted to the corresponding amide b by treatment with r 3 nh 2 ; for example , a saturated solution of ethylamine in an alkanol such as methyl alcohol may be utilized . the diamide b may next be reduced to produce the corresponding diamine c . this reduction may be carried out using lithium aluminum hydride , for example , in a convenient solvent such as tetrahydrofuran . compound c may next be debenzylated , for example using hydrogen and 20 % palladium on carbon catalyst to produce the diamine d . alternatively , when r 3 = h in c , the primary amine function may be protected with a group r 4 as defined , hereinabove . for example , the primary amine function may be acylated with an acyl halide such as acetyl chloride by well known procedures . the primary amine function of c may also be converted to a carbamate ester such as the ethyl ester by treatment with ethyl chloroformate in the presence of a strong base such as 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene in a convenient solvent such as methylene chloride . the benzyl group may next be removed , for example as described above for compound c , thereby producing compound d where r is -- co 2 et , which after conversion to a compound of the type va or vb may be reacted with a compound having the structural formula iv to thereby produce a corresponding compound having the structural formulae i . the -- co 2 et group may be removed by standard procedures . likewise spiroamino compounds represented by structural formula vb may be readily prepared from the known starting material 3 - ethoxycarbonyl - 5 - oxo - 3 - pyrrolidineacetic acid ethyl ester [ j . org . chem ., 46 , 2757 ( 1981 )] by the following reaction sequence . ## str16 ## the compound 2 , 7 - diazaspiro [ 4 . 4 ] nonane where r 3 is h is described in the above reference . thus compound e may be converted to the corresponding amide f by treatment with r 3 nh 2 , for example , methyl amine in water followed by benzylation which may be carried out with sodium hydride and benzyl chloride to give g . reduction to the diamine h may be accomplished with lithium aluminum hydride . subsequent debenzylation , for example , with hydrogen and 20 % palladium on carbon catalyst produces the diamine j . the compounds of the invention display antibacterial activity when tested by the microtitration dilution method as described in heifetz , et al , antimicr . agents & amp ; chemoth ., 6 , 124 ( 1974 ), which is incorporated herein by reference . by use of the above referenced method , the followed minimum inhibitory concentration values ( mics in μg / ml ) were obtained for representative compounds of the invention . ______________________________________in vitro antibacterial activityminimal inhibitory concentrationmic ( μg / ml ) com - com - com - com - pound pound pound poundorganisms ex . 1 ex . 2 ex . 3 ex . 4______________________________________enterobacter cloacae ma 2646 6 . 3 0 . 8 0 . 2 1 . 6escherichia coli vogel 12 . 5 0 . 2 0 . 2 1 . 6klebsiella pneumoniae mgh - 2 6 . 3 0 . 2 0 . 2 1 . 6proteus rettgeri m 1771 25 0 . 4 1 . 6 1 . 6pseudomonas aeruginosa ui - 18 25 0 . 2 0 . 8 1 . 6staphylococcus aureus h 228 12 . 5 3 . 1 0 . 4 1 . 6staphylococcus aureus uc - 76 0 . 2 0 . 4 0 . 2 0 . 2streptococcus faecalis mgh - 2 6 . 3 12 . 5 0 . 4 0 . 8streptococcus pneumoniae sv - 1 3 . 1 6 . 3 0 . 1 0 . 8streptococcus pyogenes c - 203 0 . 4 0 . 8 0 . 2 0 . 2______________________________________ the compounds of the invention are capable of forming both pharmaceutically acceptable acid addition and / or base salts . base salts are formed with metals or amines , such as alkali and alkaline earth metals or organic amines . examples of metals used as cations are sodium , potassium , magnesium , calcium , and the like . examples of suitable amines are n , n &# 39 ;- dibenzylethylenediamine , chloroprocaine , choline , diethanolamine , ethylenediamine , n - methylglucamine , and procaine . pharmaceutically acceptable acid addition salts are formed with organic and inorganic acids . examples of suitable acids for salt formation are hydrochloric , sulfuric , phosphoric , acetic , citric , oxalic , malonic , salicylic , malic , gluconic , fumaric , succinic , ascorbic , maleic , methanesulfonic , and the like . the salts are prepared by contacting the free base form with a sufficient amount of the desired acid to produce either a mono or di , etc salt in the conventional manner . the free base forms may be regenerated by treating the salt form with a base . for example , dilute solutions of aqueous base may be utilized . dilute aqueous sodium hydroxide , potassium carbonate , ammonia , and sodium bicarbonate solutions are suitable for this purpose . the free base forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents , but the salts are otherwise equivalent to their respective free base forms for purposes of the invention . use of excess base where r &# 39 ; is hydrogen gives the corresponding basic salt . the compounds of the invention can exist in unsolvated as well as solvated forms , including hydrated forms . in general , the solvated forms , including hydrated forms and the like are equivalent to the unsolvated forms for purposes of the invention . dbt - 1 - 17 the alkyl groups contemplated by the invention comprise both straight and branched carbon chains of from one to about three carbon atoms except when specifically stated to be greater than three carbon atoms . representative of such groups are methyl , ethyl , propyl , isopropyl , and the like . the cycloalkyl groups contemplated by the invention comprise those having three to six carbon atoms such as cyclopropyl , cyclobutyl , cyclopentyl , and cyclohexyl . certain compounds of the invention may exist in optically active forms . the pure d isomer , pure l isomer as well as mixtures thereof ; including the racemic mixtures , are contemplated by the invention . additional assymmetric carbon atoms may be present in a substituent such as an alkyl group . all such isomers as well as mixtures thereof are intended to be included in the invention . the compounds of the invention can be prepared and administered in a wide variety of oral and parenteral dosage forms . it will be obvious to those skilled in the art that the following dosage forms may comprise as the active component , either a compound of formula i or a corresponding pharmaceutically acceptable salt of a compound of formula i . for preparing pharmaceutical compositions from the compounds described by this invention , inert , pharmaceutically acceptable carriers can be either solid or liquid . solid form preparations include powders , tablets , dispersable granules , capsules , cachets , and suppositories . a solid carrier can be one or more substances which may also act as diluents , flavoring agents , solubilizers , lubricants , suspending agents , binders , or tablets disintegrating agents ; it can also be an encapsulating material . in powders , the carrier is a finely divided solid which is in admixture with the finely divided active compound . the tablet the active compound is mixed with carrier having the necessary binding properties in suitable proportions and compacted in the shape and size desired . the powders and tablets preferably contain from 5 or 10 to about 70 percent of the active ingredient . suitable solid carriers are magnesium carbonate , magnesium sterate , talc , sugar , lactose , pectin , dextrin , starch , gelatin , tragacanth , methyl cellulose , sodium carboxymethyl cellulose , a low melting wax , cocoa butter , and the like . the term &# 34 ; preparation &# 34 ; is intended to include the formulation of the active compound with encapsulating material as carrier providing a capsule in which the active component ( with or without other carriers ) is surrounded by carrier , which is thus in association with it . similarly , cachets are included . tablets , powders , cachets , and capsules can be used as solid dosage forms suitable for oral administration . liquid form preparations include solutions suspensions and emulsions . as an example may be mentioned water or water - propylene glycol solutions for parenteral injection . such solutions are prepared so as to be acceptable to biological systems ( isotonicity , ph , etc ). liquid preparations can also be formulated in solution in aqueous polyethylene glycol solution . aqueous solutions suitable for oral use can be prepared by dissolving the active component in water and adding suitable colorants , flavors , stabilizing , and thickening agents as desired . aqueous suspension suitable for oral use can be made by dispersing the finely divided active component in water with viscous material , i . e ., natural or synthetic gums , resins , methyl cellulose , sodium carboxymethyl cellulose , and other well - known suspending agents . preferably , the pharmaceutical preparation is in unit dosage form . in such form , the preparation is subdivided into unit doses containing appropriate quantites of the active component . the unit dosage form can be a packaged preparation , the package containing discrete quantities of preparation , for example , packeted tablets , capsules , and powders in vials or ampoules . the unit dosage form can also be a capsule , cachet , or tablet itself or it can be the appropriate number of any of these packaged forms . the quantity of active compound in a unit dose of preparation may be varied or adjusted from 1 mg to 100 mg according to the particular application and the potency of the active ingredient . in therapeutic use as agents for treating bacterial infections the compounds utilized in the pharmaceutical method of this invention are administered at the initial dosage of about 3 mg to about 40 mg per kilogram daily . a daily dose range of about 6 mg to about 14 mg per kilogram is preferred . the dosages , however , may be varied depending upon the requirements of the patient , the severity of the condition being treated , and the compound being employed . determination of the proper dosage for a particular situation is within the skill of the att . generally , treatment is initiated with smaller dosages which are less than the optimum dose of the compound . thereafter , the dosage is increased by small increments until the optimum effect under the circumstances is reached . for convenience , the total daily dosage may be divided and administered in portions during the day if desired . the following nonlimiting examples illustrate the inventors &# 39 ; preferred methods for preparing the compounds of the invention . a mixture of 100 g ( 0 . 43 mole ) of methyl 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrolidinecarboxylate [ j . org . chem ., 26 , 1519 ( 1961 )], 500 ml methanol and 100 g ( 3 . 2 mole ) of methylamine was heated at 100 ° c . in a pressure reactor for 16 hours . the reaction mixture was cooled and the ammonia and methanol were removed under reduced pressure . the residue was taken up in dichloromethane and washed with 3 × 100 ml 1n sodium hydroxide . the organic layer was dried over magnesium sulfate and the solvent removed at reduced pressure to give 88 . 3 g of n - methyl - 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrolidinecarboxamide as a white solid , mp 82 . 5 °- 83 . 0 ° c . to a suspension of 37 . 40 g ( 1 . 00 mole ) lithium aluminum hydride in 1000 ml tetrahydrofuran , was added a solution of 88 . 3 g ( 0 . 380 mole ) of n - methyl - 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrolidinecarboxamide in tetrafuran dropwise under nitrogen . the reaction was then refluxed overnight . the reaction flask was cooled in an ice bath and 37 . 4 ml of water , 37 . 4 ml of 15 % sodium hydroxide and 112 . 2 ml of water were added . the precipitated solids were filtered and washed with hot ethanol . the combined filtrates were concentrated , then dissolved in dichloromethane , filtered , dried over magnesium sulfate , and the solvent evaporated under reduced pressure to give 68 . 68 g of n - methyl - 1 -( phenylmethyl )- 3 - pyrrolidinemethanamine as an oil . this material was used without further purification in the next step . a mixture of 67 . 28 g ( 0 . 32 mole ) of n - methyl - 1 -( phenylmethyl )- 3 - pyrrolidinemethanamine , 3 g of 20 % palladium on carbon , and 600 ml of methanol was shaken in an atmosphere of hydrogen at about 50 psi and at room temperature for 18 hours . another 3 g of 20 % palladium on carbon was added and the hydrogenation continued for 6 . 5 hours . another 3 . 0 g of 20 % palladium on charcoal was added and the hydrogenation continued for another 4 . 5 hours . the catalyst was filtered and the filtrate evaporated under reduced pressure . the residue was distilled under vacuum ( 72 °- 76 ° c ., 10 . 5 mm hg ) to give 8 . 32 g n - methyl - 3 - pyrrolidinemethanamine . a mixture of 200 g ( 0 . 86 mole ) of methyl 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrolidinecarboxylate [ j . org . chem ., 26 , 1519 ( 1961 )], 1000 ml methanol and 200 g ( 4 . 4 mole ) of ethylamine was heated at 100 ° c . in a pressure reactor for 17 . 2 hours . the reaction mixture was cooled and the excess ethylamine and methanol were removed under reduced pressure . the residue was taken up in dichloromethane and washed with 3 × 150 ml 1n sodium hydroxide . the organic layer was dried over magnesium sulfate and the solvent removed at reduced pressure to give 104 . 6 g of n - ethyl - 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrolidinecarboxamide as a white solid , mp 97 °- 99 ° c . to a suspension of 108 . 68 g ( 2 . 860 mole ) lithium aluminum hydride in 800 ml tetrahydrofuran , was added a solution of 194 . 5 g ( 0 . 790 mole ) of n - ethyl - 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrolidinecarboxamide in 600 ml tetrahydrofuran dropwise under nitrogen . the reaction was then refluxed four hours . the reaction flask was cooled in an ice bath and 108 ml of water , 108 ml of 15 % sodium hydroxide , and 324 ml of water were added . the precipitated solids were filtered and washed with hot ethanol . the combined filtrates were concentrated , then dissolved in dichloromethane , filtered , dried over magnesium sulfate , and the solvent evaporated under reduced pressure to give 151 . 9 g of n - ethyl - 1 -( phenylmethyl )- 3 - pyrrolidinemethanamine as an oil . this material was used without further purification in the next step . a mixture of 151 . 65 g ( 0 . 695 mole ) of n - ethyl - 1 -( phenylmethyl )- 3 - pyrrolidinemethanamine , 5 g of 20 % palladium on carbon , and 1100 ml of ethanol was shaken in an atmosphere of hydrogen at about 50 psi and at room temperature for 21 . 6 hours . another 5 g of 20 % palladium on carbon was added and the hydrogenation continued for 24 hours . the catalyst was filtered and the filtrate evaporated under reduced pressure . the residue was distilled under vacuum ( 88 °- 91 ° c ., 11 . 5 mm hg ) to give 66 . 0 g n - ethyl - 3 - pyrrolidinemethanamine . a mixture of 21 . 9 g ( 0 . 100 mole ) 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrodlidinecarboxylic acid in 150 ml tetrahydrofuran , was cooled to 0 ° c . in an ice bath under nitrogen and 24 . 32 g ( 0 . 150 mole ) carbonyl diimidazole was added . the reaction was stirred at 0 ° c . for 30 minutes , then at room temperature for 30 minutes . a solution of 13 . 55 g ( 0 . 100 mole ) of 2 , 2 , 2 - triflouroethylamine hydrochloride , 15 . 22 g ( 0 . 100 mole ) 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene and 100 ml tetrahydrofuran was added . the reaction was stirred at room temperature overnight . the solvent was removed at reduced pressure . the residue was taken up in dichloromethane and washed 3 × 150 ml saturated sodium bicarbonate . the organic layer was dried over magnesium sulfate and the solvent removed under reduced pressure . the product was purified by column chromatography on silica with ethyl acetate to give 8 . 50 g of 5 - oxo - 1 -( phenylmethyl )- n -( 2 , 2 , 2 - trifluoroethyl )- 3 - pyrrolidinecarboxamide , mp 110 °- 112 ° c . a mixture of 8 . 50 g ( 28 . 3 mole ) of 5 - oxo - 1 -( phenylmethyl )- n -( 2 , 2 , 2 - trifluoroethyl )- 3pyrrolidinecarboxamide in 100 ml tetrahydrofuran was added dropwise to 3 . 22 g ( 84 . 9 mmole ) of lithium aluminum hydride in 50 ml tetrahydrofuran . the reaction was refluxed two hours , then stirred at room temperature overnight . the reaction was cooled in an ice bath and 3 . 2 ml of water , 3 . 2 ml of 15 % sodium hydroxide , and 9 . 6 ml of water were added . the precipitated salts were filtered and washed with hot ethanol . the combined filtrates were concentrated under reduced pressure . the residue was taken up in dichloromethane , filtered , and dried over magnesium sulfate . the solvent was removed at reduced pressure to give 7 . 15 g of 1 -( phenylmethyl )- n -( 2 , 2 , 2 - trifluoroethyl )- 3 - pyrrolidinemethanamine . this material was used without further purification in the next step . a mixture of 7 . 15 g ( 26 . 3 mmole ) 1 -( phenylmethyl )- n -( 2 , 2 , 2 - trifluoroethyl )- 3 - pyrrolidinemethanamine 100 ml of methanol and 0 . 7 g of 20 % palladium on carbon was shaken in an atmosphere of hydrogen at about 50 psi and at room temperature for 24 hours . the catalyst was filtered and the filtrate evaporated under reduced pressure . the residue was distilled under vacuum ( 63 °- 65 ° c ., 2 . 8 mm hg ) to give 2 . 55 g of n -( 2 , 2 , 2 - trifluoroethyl )- 3 - pyrrolidinemethanamine . to a solution of 10 . 96 g ( 50 mmole ) of 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrolidinecarboxylic acid in 150 ml of acetonitrile was added 9 . 73 g ( 60 mmole ) of carbonyldiimidazole . the reaction was heated to 60 ° c . for one hour , cooled to room temperature and treated with 4 . 13 g ( 70 mmole ) of n - propylamine . after stirring for two hours , the solvent was removed in vacuo and the residue partitioned between ether and water . the organic layer was washed with water , 1n hydrochloric acid , dried over magnesium sulfate , filtered , and evaporated invacuo to give 12 . 0 g of 5 - oxo - 1 -( phenylmethyl )- n - propyl - 3 - pyrrolidinecarboxamide , mp 86 °- 87 ° c . to a suspension of 8 . 2 g ( 0 . 2 mole ) of lithium aluminum hydride in 150 ml of dry tetrahydrofuran was added portionwise , 12 . 0 g ( 45 . 6 mmole ) of solid 5 - oxo - 1 -( phenylmethyl )- n - propyl - 3 - pyrrolidinecarboxamide . when the addition was complete , the reaction mixture was stirred at room temperature for 18 hours and then at reflux for two hours . after cooling to room temperature , the mixture was treated dropwise , successively , with 8 ml of water , 8 ml of 15 % aqueous sodium hydroxide and 24 ml of water , titrating the final addition to produce a granular precipitate . the solid was removed by filtration , washed with tetrahydrofuran and the filtrate evaporated in vacuo to give 9 . 6 g of 1 -( phenylmethyl )- n - propyl - 3 - pyrrolidine methanamine , as a heavy syrup . this material was used for the next step without further purification . a mixture of 14 . 0 g ( 60 . 0 mmole ) of 1 -( phenylmethyl )- n - propyl - 3 - pyrrolidinemethanamine , 1 . 0 g of 20 % palladium on carbon and 140 ml of methanol was shaken in an atmosphere of hydrogen at about 50 psi and room temperature for 24 hours . the catalyst was removed by filtering through celite , the filtrate concentrated and distilled in vacuo to give 7 . 1 g of n - propyl - 3 - pyrrolidinemethanamine , bp 49 °- 50 ° c ./ 0 . 25 mm . to a solution of 16 . 4 g ( 75 mmole ) of 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrolidinecarboxylic acid in 150 ml of acetonitrile was added 13 . 8 g ( 85 mmole ) of carbonyldiimidazole . the reaction was heated to 60 ° c . for one hour , cooled to room temperature and treated with 4 . 85 g ( 85 mmole ) of cyclopropylamine . the reaction was stirred at room temperature for 18 hours , the solvent removed in vacuo and the residue partitioned between chloroform and water . the organic layer was washed with water , 1n hydrochloric acid , dried over magnesium sulfate , filtered , and evaporated in vacuo to give 18 . 3 g of 5 - oxo - 1 -( phenylmethyl )- n - cyclopropyl - 3 - pyrrolidinecarboxamide , mp 94 °- 96 ° c . 1 -( phenylmethyl )- n - cyclopropyl - 3 - pyrrolidine - methanamine to a suspension of 8 . 2 g ( 0 . 20 mole ) of lithium aluminum hydride in 150 ml of dry tetrahydrofuran was added portionwise 18 . 0 g ( 70 . 0 mmole ) of solid 5 - oxo - 1 -( phenylmethyl )- n - cyclopropyl - 3 - pyrrolidinecarboxamide . when the addition was complete , the reaction mixture was stirred at room temperature for 18 hours and then at reflux for two hours . after cooling to room temperature , the mixture was treated dropwise , successively , with 8 ml of water , 8 ml of 15 % aqueous sodium hydroxide and 24 ml of water , titrating the final addition to produce a granular precipitate . the solid was removed by filtration , washed with tetrahydrofuran and the filtrate evaporated in vacuo to give 16 . 0 g of 1 -( phenylmethyl )- n - cyclopropyl - 3 - pyrrolidinemethanamine as a heavy oil . this was used for the next step without further purification . a mixture of 13 . 6 g ( 59 . 0 mmol ) of 1 -( phenylmethyl )- n - cyclopropyl - 3 - pyrrolidinemethanamine , 0 . 5 g of 20 % palladium on carbon and 140 ml of methanol was shaken in an atmosphere of hydrogen at about 50 psi and room temperature for 24 hours . the catalyst was removed by filtering through celite , the filtrate concentrated and distilled in vacuo to give 6 . 3 g of n - cyclopropyl - 3 - pyrrolidinemethanamine , bp 88 °- 90 ° / 13 mm . to a solution of 16 . 4 g ( 75 . 0 mmole ) of 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrolidinecarboxylic acid in 150 ml of acetonitrile was added 13 . 8 g ( 85 . 0 mmole ) of 1 , 1 &# 39 ;- carbonyldiimidazole . the reaction was heated to 60 ° c . for one hour , cooled to room temperature and treated with 5 . 0 g ( 85 mmole ) of isopropylamine . the reaction was stirred at room temperature for 18 hours , the solvent removed in vacuo and the residue partitioned between chloroform and water . the organic layer was washed with water , 1n hydrochloric acid , dried over magnesium sulfate and evaporated in vacuo to give 18 . 6 g of 5 - oxo - 1 -( phenylmethyl )- n -( 2 - propyl ) 3 - pyrrolidinecarboxamide , mp 122 °- 124 ° c . to a suspension of 8 . 2 g ( 0 . 2 mole ) of lithium aluminum hydride in 150 ml of dry tetrahydrofuran was added portionwise , 18 . 3 g ( 70 . 0 mmole ) of solid 5 - oxo - 1 -( phenylmethyl )- n -( 2 - propyl )- 3 - pyrrolidinecarboxamide . when the addition was complete , the reaction mixture was stirred at room temperature for 18 hours and then refluxed for two hours . after cooling to room temperature , the mixture was treated dropwise , successively , with 8 ml of water , 8 ml of 15 % aqueous sodium hydroxide and 24 ml of water , titrating the final addition to produce a granular precipitate . the solid was removed by filtration , washed with tetrahydrofuran and the filtrate evaporated in vacuo to give 15 . 6 g of 1 -( phenyl - methyl )- n -( 2 - propyl )- 3 - pyrrolidinemethanamine as a heavy syrup . this material was used for the next step without further purification . a mixture of 13 . 4 g ( 58 . 0 mmol ) of 1 - phenylmethyl - n -( 2 - propyl )- 3 - pyrrolidinemethanamine , 1 . 0 g of 20 % palladium on carbon and 130 ml of methanol was shaken in an atmosphere of hydrogen at about 50 psi and room temperature for 24 hours . the catalyst was removed by filtration through celite ; the filtrate concentrated and distilled in vacuo to give 6 . 3 g of n -( 2 - propyl )- 3 - pyrrolidinemethanamine , bp 58 °- 60 ° c ./ 3 . 5 mm . a mixture of 46 . 7 g ( 1200 mole ) of methyl 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrolidinecarboxylate ( j . org . chem ., 26 , 1519 ( 1961 )], 36 . 7 g ( 1600 mole ) 2 - aminoethanol and 500 ml methanol were refluxed overnight . the reaction was cooled to room temperature and the solvent removed at reduced pressure . the residue was taken up in dichloromethane and extracted 3 × 100 1n sodium hydroxide . the aqueous layer was taken to ph 5 , extracted with 3 × 150 ml dichloromethane , then taken to ph 8 and again extracted with 3 × 150 ml dichloromethane . the aqueous layer was concentrated at reduced pressure and the resulting slurry stirred in dichloromethane . the salts were filtered off . the combined organic layers were dried over magnesium sulfate , the solvent removed at reduced pressure to yield 47 . 9 g of n -( 2 - hydroxyethyl )- 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrolidinecarboxamide as an oil . this was used in the next step without further purification . a mixture of 46 . 66 g ( 0 . 178 mole ) of n -( 2 - hydroxyethyl )- 5 - oxo - 1 -( phenylmethyl )- 3 - pyrrolidinecarboxamide in 200 ml of tetrahydrofuran was added dropwise to a slurry of 20 . 25 g ( 0 . 534 mole ) of lithium aluminum hydride in 150 ml tetrahydrofuran . the reaction was refluxed three hours , then cooled in an ice bath . the work up consisted of sequential addition of 20 ml water , 20 ml 15 % sodium hydroxide then 60 ml water . the reaction was filtered and the precipitate washed with ethanol . the filtrate was concentrated at reduced pressure , the residue taken up in dichloromethane , dried over magnesium sulfate , and the solvent removed at reduced pressure to give 32 . 31 g of 2 -[[[ 1 -( phenylmethyl )- 3 - pyrrolidinyl ] methyl ] amino ] ethanol as an oil . this material was used in the next step without further purification . a mixture of 32 . 32 g of 2 -[[[ 1 -( phenylmethyl ) 3 - pyrrolidinyl ] methyl ] amino ] ethanol , 330 ml of methanol and 3 g of 20 % palladium on charcoal was shaken in an atmosphere of hydrogen at about 50 psi and at room temperature for 18 hours . the solvents were then removed at reduced pressure . the residue was distilled under vacuum ( bp 129 °- 131 ° c . 1 . 5 mm hg ) to give 11 . 43 g of 2 -[( 3 - pyrrolidinyl methyl ) amino ] ethanol . a solution of 20 . 3 g ( 0 . 084 mole ) 3 - ethoxycarbonyl - 5 - oxo - 3 - pyrrolidineacetic acid , ethyl ester [ j . org . chem . 46 , 2757 ( 1981 )] in 40 ml of 40 % aqueous methylamine was stirred at room temperature overnight , then placed in an oil bath and gradually heated to 220 ° c . over 30 minutes allowing volatiles to distill from the open flask . the crude product was crystallized from ethanol to afford 12 . 56 g of 2 - methyl - 2 , 7 - diazaspiro [ 4 . 4 ] nonane - 1 , 3 , 8 - trione , mp 201 °- 204 ° c . a solution of 1 . 82 g ( 10 mmol ) 2 - methyl - 2 , 7diazaspiro [ 4 . 4 ] nonane - 1 , 3 , 8 - trione in 20 ml n , n - dimethylformamide was added gradually under a nitrogen atmosphere to 0 . 050 g ( 10 . 4 mmol ) of 50 % oil suspension of sodium hydride which had been previously washed twice with toluene and covered with 10 ml n , n - dimethylformamide . after stirring one hour there was added 1 . 40 g ( 11 mmol ) of benzyl chloride and stirring was continued overnight at room temperature . after concentrating to a small volume in vacuo , the residue was diluted with 40 ml water and extracted twice with dichloromethane . the combined organic phase was washed with water , dried over magnesium sulfate , and evaporated to give a solid . crystallization from toluene - hexane afforded 1 . 74 g of 2 - methyl - 7 -( phenylmethyl )- 2 , 7 - diazaspiro [ 4 . 4 ] nonane - 1 , 3 , 8 - trione , mp 157 °- 158 ° c . 2 - methyl - 7 -( phenylmethyl )- 2 , 7 - diazaspiro [ 4 . 4 ] nonane dihydrochloride a solution of 1 . 36 g ( 5 . 0 mmol ) 2 - methyl - 7 -( phenylmethy )- 2 , 7 - diazaspiro [ 4 . 4 ] nonane - 1 , 3 , 8 - trione in 50 ml tetrahydrofuran was added dropwise to a suspension of 0 . 95 g ( 25 mmol ) lithium aluminum hydride in 30 ml tetrahydrofuran . ihe mixture was stirred overnight at room temperature , refluxed one hour , cooled , and treated dropwise with 0 . 95 ml water , 0 . 95 ml 15 % sodium hydroxide solution and 2 . 8 ml water . after removal of the inorganic solids by filtration , the filtrate was concentrated in vacuo to give a syrup which was dissolved in isopropanol and treated with excess 6n hydrogen chloride in isopropanol . crystallization afforded 0 . 97 g of 2 - methyl - 7 -( phenylmethyl )- 2 , 7 - diazaspiro [ 4 . 4 ] nonane dihydrochloride , mp 233 - 234 ° c . a solution of 2 - methyl - 7 -( phenylmethyl )- 2 , 7 - diazaspiro -[ 4 . 4 ] nonane dihydrochloride in 150 ml of methanol with 1 . 0 g 20 % palladium on carbon catalyst was hydrogenated at 50 psi for two days . after filtration , the filtrate was concentrated to a thick syrup which crystallized on addition of acetonitrile to give 11 . 50 g of 2 - methyl - 2 , 7diazaspiro [ 4 . 4 ] nonane dihydrochloride , softened at 164 ° c . and melted at 168 °- 170 ° c . example i a suspension of 24 . 33 g ( 0 . 100 mmole ) 3 - ethoxycarbonyl - 5 - oxo - 3 - pyrrolidineacetic acid , ethyl ester in an excess of 2n sodium hydroxide , was stirred three hours at room temperature , acidified with dilute hydrochloric acid , and evaporated to dryness in vacuo . the product , 3 - carboxy - 5 - oxo - 3 - pyrrolidineacetic acid , was taken up in isopropyl alcohol , separated from insoluble sodium chloride by filtration , concentrated to a syrup and dissolved in 100 ml 70 % ethylamine . the solution was gradually heated in an oil bath up to 230 ° c . allowing volates to distill and then maintained at 230 °- 240 ° c . for ten minutes . after cooling , the product was crystallized from isopropyl alcohol to afford 10 . 12 g of 2 - ethyl2 , 7 - diazaspiro [ 4 . 4 ] nonane - 1 , 3 , 8 - trione , mp 168 °- 169 ° c . a suspension of sodium hydride ( 2 . 20 g of 60 % oil suspension ( 0 . 055 mole ) washed with toluene ) in 50 ml n , n - dimethylformamide was treated gradually with a solution of 10 . 0 g ( 0 . 051 mole ) 2 - ethyl - 2 , 7diazaspiro [ 4 . 4 ] nonane - 1 , 3 , 8 - trione in 100 ml n , n - dimethylformamide . after stirring 15 minutes , there was added dropwise 6 . 4 ml ( 0 . 055 mole ) benzyl chloride and the mixture was stirred overnight , concentrated in vacuo and shaken with water - methylene chloride . the organic layer was dried , evaporated , and the product crystallized from toluene - hexane to afford 11 . 11 g of 2 - ethyl - 7 -( phenylmethyl )- 2 - 7 - diazaspiro [ 4 . 4 ] nonane - 1 , 3 , 8 - trione , mp 125 °- 126 . 5 ° c . a solution of 11 . 00 g ( 0 . 0385 mole ) 2 - ethyl - 7 -( phenylmethyl )- 2 , 7 - diazaspiro [ 4 . 4 ] nonane - 1 , 3 , 8 - trione in 100 ml tetrahydrofuran was added dropwise to a suspension of 6 . 00 g ( 0 . 158 mole ) lithium aluminium hydride in 250 ml tetrahydrofuran . after stirring overnight , the mixture was refluxed one hour , cooled , and treated dropwise with 6 ml water , 6 ml 15 % sodium hydroxide , and 18 ml water . inorganic solids were separated by filtration and the filtrate was concentrated , taken up in ether , dried with magnesium sulfate , and reevaporated . the resulting syrup was dissolved in isopropyl alcohol and treated with excess hydrogen chloride in isopropyl alcohol to afford 9 . 63 g of 2 - ethyl - 7 -( phenylmethyl )- 2 , 7 - diazaspiro [ 4 . 4 ] nonane dihydrochloride , mp 196 °- 198 ° c . ( dec ). 2 - ethyl - 2 , 7 - diazaspiro [ 4 . 4 ] nonane dihydrochloride a solution of 9 . 50 g ( 0 . 030 mole ) 2 - ethyl - 7 -( phenylmethyl )- 2 , 7 - diazaspiro [ 4 . 4 ] nonane dihydrochloride in 100 ml methanol was hydrogenated with 1 . 0 g 20 % palladium on carbon catalyst at 50 psi for 22 hours . after filtration , the solution was concentrated to a syrup and crystallized from acetonitrile to afford 6 . 66 g of 2 - ethyl - 2 , 7 - diazaspiro [ 4 . 4 ] nonane dihydrochloride , mp 168 °- 172 ° c . a solution of 77 . 0 g ( 0 . 44 mole ) of 3 - amino - 1 -( phenylmethyl ) pyrrolidine [ j . med . chem ., 24 , 1229 ( 1981 )], 440 ml ( 0 . 44 mole ) 1 . 0n sodium hydroxide and 600 ml of tertiary butyl alcohol was treated dropwise with 98 . 2 g ( 0 . 45 mole ) of di - tertiarybutyl dicarbomate . the reaction was stirred at room temperature for 18 hours and the solvent removed in vacuo . the residue was partitioned between ether and water . the aqueous layer was reextracted with ether , the combined ether layers were washed with water , dried ( mgso 4 ), filtered and evaporated on a steam bath replacing the ether with petroleum ether . the crystals which formed were removed by filtration , washed with ether / petroleum ether ( 1 : 1 ), and dried in vacuo to give 84 . 8 g of 1 , 1 - dimethylethyl [ 1 -( phenylmethyl )- 3 - pyrrolidinyl ] carbamate , mp 114 °- 115 °. a second crop ( 16 . 7 g ) was obtained by concentrating the filtrate . a mixture of 101 . 5 g ( 0 . 37 mole ) of 1 , 1 - dimethylethyl [ 1 -( phenylmethyl )- 3 - pyrrolidinyl ] carbamate , 5 . 0 g of 20 % palladium on carbon and 1 liter of tetrahydrofuran was shaken in an atmosphere of hydrogen at about 50 psi and room temperature for 24 hours . the catalyst was removed by filtering through celite , and the filtrate was concentrated in vacuo to give 6 . 8 g of 1 , 1 - dimethylethyl ( 3 - pyrrolidinyl ) carbamate which solidified upon standing and was of sufficient purity to be used as is for the ensuing steps . to 25 . 2 g ( 0 . 117 mol ) of sodium 2 , 3 , 4 , 5 - tetrafluorobenzoate , prepared as a dry powder from 2 , 3 , 4 , 5tetrafluorobenzoic acid [ j . org . chem . 29 , 2381 ( 1961 )] and aqueous sodium hydroxide with concentration to dryness , was added 400 ml of dry ether and the suspension was cooled to 0 ° c . slowly 25 ml (˜ 2 . 5 equivalents ) of oxalyl chloride in 50 ml of ether was added and the mixture brought to room temperature where it was maintained for 2 . 0 hours . it was filtered and concentrated to remove low boiling impurities . the residue was dissolved in 100 ml of ether and placed in an addition funnel . meanwhile , 2 . 9 g ( 0 . 119 mol ) of magnesium turnings were treated with 100 ml of absolute ethanol and 0 . 3 ml of carbon tetrachloride . to this mixture was added 18 . 6 ml ( 0 . 12 mol ) of diethyl malonate in 75 ml of ether at a rate to keep the temperature just below reflux . when addition was complete , the reaction was refluxed for two hours . at - 20 ° c ., the etheral acid chloride was slowly added . when addition was complete , the reaction was brought to 0 ° c . over 18 hours . the mixture was poured into dilute hydrochloric acid and was extracted into dichloromethane which was dried over magnesium sulfate and concentrated . the residue was then treated with 340 mg of p - toluenesulfonic acid in 600 ml of water at 100 ° c . for two hours with rapid stirring . the oil was extracted into dichloromethane , dried over magnesium sulfate and concentrated . the residue was purified by column chromatography ( silica gel , using toluene : hexane : ether , 4 : 5 : 1 ), to give 18 . 5 g of a reddish oil . this material was triturated with pentane to give 10 . 2 g of 2 , 3 , 4 , 5 - tetrafluorobenzoylacetic acid , ethyl ester , mp 49 °- 51 ° c . to 3 . 0 g ( 11 . 33 mmol ) of 2 , 3 , 4 , 5 - tetrafluorobenzoylacetic acid , ethyl ester was added 2 . 49 g of triethylorthoformate and 2 . 76 g of acetic anhydride . the mixture was heated to 150 ° c . for 2 . 5 hours and was then cooled to 80 ° c . the volitile materials were removed at 0 . 4 mm hg for one hour . the residue was then cooled to 45 ° c . and diluted with 25 ml of isopropyl alcohol . to this solution was added 1 . 65 g of 1 - methylhydrazinecarboxylate , 1 , 1 - dimethylethyl ester ( acta chemica scandinavica 22 , 1 , 1968 ) in 25 ml of isopropyl alcohol . the mixture was stirred overnight , diluted with 30 ml of pentane and filtered to give 3 . 09 g of 2 -[ 2 -( ethoxycarbonyl )- 3 - oxo - 3 -( 1 , 2 , 3 , 4 - tetrafluorophenyl )- 1 - propenyl ]- 1 - methylhydrazinecarboxylate , 1 , 1 - dimethylethyl ester as a white solid , mp 130 °- 131 ° c . to 3 . 09 g ( 7 . 35 mmol ) of 2 -[ 2 -( ethoxycarbonyl )- 3 - oxo - 3 -( 1 , 2 , 3 , 4 - tetrafluorophenyl )- 1 - propenyl - 1 - methylhydrazinecarboxylate , 1 , 1 - dimethyethyl ester in 100 ml of dry dioxane was added 0 . 36 g ( 1 . 02 equivalent ) of sodium hydride ( 50 % dispersion ) which was pentane washed prior to addition . the mixture was then refluxed overnight and was left standing at room temperature for 24 hours . the mixture was concentrated to a thick oil , taken up in dichloromethane , filtered and extracted with water twice . the dichloromethane was dried ( mgso 4 ) and concentrated to a viscous oil which crystallized upon addition of pentane to give 2 . 39 g of 1 -[[( 1 , 1 - dimethylethoxy )- carbonyl ] methylamino ]- 6 , 7 , 8 - trifluoro - 1 , 4 - dihydro - 4 - oxo - 3 - quinolinecarboxylic acid , ethyl ester , mp 99 . 5 °- 102 ° c . to 2 . 00 g ( 5 . 0 mmol ) of 1 -[[( 1 , 1 - dimethylethoxy ) carbonyl ] methylamino ]- 6 , 7 , 8 - trifluoro - 1 , 4 - dihydro - 4 - oxo - 3 - quinolinecarboxylic acid , ethyl ester was added 35 ml of acetic acid and 15 ml of 2n hydrochloric acid . the mixture was placed on a steam bath for 2 . 5 hours , was diluted with 15 ml of water , and was cooled . the solids were filtered to give 1 . 09 g of 6 , 7 , 8 - trifluoro - 1 , 4 - dihydro - 1 - methylamino - 4 - oxo - 3quinolinecarboxylic acid , mp 237 °- 238 ° c . a mixture of 0 . 81 g ( 3 mmol ) 7 - chloro - 6 - fluoro - 1 - methylamino - 1 , 4 - dihydro - 4 - oxo - 3 - quinolinecarboxylic acid ( european patent no . 0 , 090 , 424 ) and 1 . 54 g ( 12 mmol ) -[( ethylamino ) methyl ]- pyrrolidine in 5 ml pyridine was refluxed 19 hours , concentrated to a syrup in vacuo , and diluted with ether to afford a yellow solid . the crude product was dissolved in water , titrated to ph 1 . 5 with dilute hydrochloric acid , and crystallized from methanol to afford 0 . 64 g 7 -[ 3 -[( ethylamino ) methyl ] pyrrolidine ]- 6 - fluoro - 1 - methylamino - 1 , 4 - dihydro - 4 - oxo - 3 - quinolinecarboxylic acid , mp 280 ° c . with decomposition . to 1 . 00 g ( 3 . 68 mmol ) of 6 , 7 , 8 - trifluoro - 1 , 4 - dihydro - 1 - methylamino - 4 - oxo - 3 - quinolinecarboxylic acid in 10 ml of acetonitrile was added 0 . 56 g ( 1 . 0 equivalent ) of 1 , 8 - diazobicyclo -[ 5 , 4 , 0 ] undec - 7 - ene and 0 . 68 g of 1 , 1 - dimethylethyl 3 - pyrrolidinylcarbamate . the mixture was refluxed for one hour and stirred at room temperature overnight . the solids were filtered and washed with ether to give 0 . 92 g of 7 -[ 3 -[[( 1 , 1dimethylethoxy ) carbonyl ] amino ]- 1 - pyrro - lidinyl ]- 6 , 8 - difluoro - 1 , 4 - dihydro - 1 -( methylamino )- 4 - oxo - 3quinolinecarboxylic acid . a portion of this material ( 0 . 38 g ) was treated with 10 ml of trifluoroacetic acid for 2 hours and was concentrated . the residue was taken up in aqueous sodium hydroxide to ph 12 . 5 and then treated with hydrochloric acid to ph 7 . 0 . the solids were filtered to give 0 . 24 g of 7 -( 3 - amino - 1 - pyrrolidinyl )- 6 , 8 - difluoro - 1 , 4 - dihydro - 1 - methylamino - 4 - oxo - 3 - quinolinecarboxylic acid , mp 210 °- 211 ° c . to 0 . 75 g ( 2 . 75 mmol ) of the 6 , 7 , 8 - trifluoro - 1 , 4 - dihydro - 1 - methylamino - 4 - oxo - 3 - quinolinecarboxylic acid in 15 ml of acetonitrile was added 0 . 44 g ( 1 . 05 equivalent ) of 1 , 8 - diazobicyclo [ 5 . 4 . 0 ] undec - 7 - ene , and 0 . 352 g ( 1 . 0 equivalent ) of n - ethyl - 3 - pyrrolidinemethanamine . the mixture was refluxed for one hour and then stirred at room temperature overnight . the solids were filtered to give 0 . 68 g of 7 -[ 3 -[( ethylamino ) methyl ]- 1 - pyrrolidinyl ]- 6 , 8 - difluoro - 1 , 4 - dihydro - 1 - methylamino - 4 - oxo - 3 - quinolinecarboxylic acid , mp 222 °- 224 ° c . to 0 . 75 g ( 2 . 75 mmol ) of the 6 , 7 , 8 - trifluoro - 1 , 4 - dihydro - 1 - methylamino - 4 - oxo - 3 - quinolinecarboxylic acid in 15 ml of acetonitrile was added 0 . 44 g ( 1 . 05 equivalents ) of 1 , 8 - diazobicyclo [ 5 . 4 . 0 ] undec - 7 - ene and 0 . 275 g ( 1 . 0 equivalents ) of 3 - pyrrolidinemethanamine [ j . org . chem ., 26 , 4955 ( 1961 )]. the mixture was refluxed for one hour and stirred at room temperature overnight . the solids were filtered to give 0 . 72 g of 7 -[ 3 -( aminomethyl )- 1 - pyrrolidinyl [- 6 , 8 - difluoro - 1 , 4 - dihydro - 1 - methylamino - 4 - oxo - 3 - quinolinecarboxylic acid , mp 150 °- 180 ° c . slow dec . 1 , 4 - dihydro - 6 - fluoro - 1 - methylamino - 7 -( 7 - ethyl - 2 , 7 - diazaspiro [ 4 . 4 ] nonan - 2 - yl )- 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 1 by using 2 - ethyl - 2 , 7 - diazaspiro [ 4 . 4 ] nonane as the reacting amine . 6 , 8 - difluoro - 1 , 4 - dihydro - 1 - methylamino - 7 -( 7 - ethyl - 2 , 7 - diazasprio [ 4 . 4 ] nonan - 2 - yl )- 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 3 by using 2 - ethyl - 2 , 7 - diazaspiro [ 4 . 4 ] nonane as the reacting amine . 1 , 4 - dihydro - 6 - fluoro - 1 - methylamino - 7 -( 7 - methyl - 2 , 7diazaspiro [ 4 . 4 ] nonan - 2 - yl )- 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 1 by using 2 - methyl - 2 , 7 - diazaspiro [ 4 . 4 ] nonane as the reacting amine . 6 , 8 - difluoro - 1 , 4 - dihydro - 1 - methylamino - 7 -( 7 ethyl - 2 , 7 - diazaspiro [ 4 . 4 ] nonan - 2 - yl )- 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 3 by using 2 - ethyl - 2 , 7 - diazaspiro [ 4 . 4 ] nonane as the reacting amine . 1 , 4 - dihydro - 6 - fluoro - 1 - methylamino - 7 -( 2 , 7 - diazaspiro [ 4 . 4 ] nonan - 2 - yl )- 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 1 by using 2 , 7 diazaspiro [ 4 . 4 ] nonane [ j . org . chem . 46 , 2757 ( 1981 )] as the reacting amine . 1 , 4 - dihydro - 6 , 8 - difluoro - 1 - methylamino - 7 -( 2 , 7 - diazaspiro [ 4 . 4 ] nonan - 2 - yl )- 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 3 by using 2 , 7 - diazaspiro [ 4 . 4 ] nonan [ j . org . chem . 46 , 2757 ( 1981 )] as the reacting amine . 7 -( 3 - amino - 1 - pyrrolidinyl )- 1 , 4 - dihydro - 6 - fluoro - 1 - methylamino - 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 2 by using 1 , 1 - dimethylethyl 3 - pyrrolidinylcarbamate as the reacting amine . 1 , 4 - diydro - 6 - fluoro - 1 - methylamino - 7 -[ 3 -[( methylamino ) methyl ]- 1 - pyrrolidinyl ]- 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 3 by using n - methyl - 3 - pyrrolidinemethanamine as the reacting amine . 1 , 4 - dihydro - 6 , 8 - difluoro - 1 - methylamino - 7 -[ 3 -[( methylamino ) methyl ]- 1 - pyrrolidinyl ]- 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 3 by using n - methyl - 3 - pyrrolidinemethanamine as the reacting amine . 1 , 4 - dihydro - 6 - fluoro - 1 - methylamino - 7 -[ 3 -[( propylamino ) methyl ]- 1 - pyrrolidinyl ]- 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 1 by using n - propyl - 3 - pyrrolidinemethanamine as the reacting amine . 1 , 4 - dihydro - 6 , 8 - difluoro - 1 - methylamino - 7 -[ 3 -[( propylamino ) methyl ]- 1 - pyrrolidinyl ]- 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 3 by using n - propyl - 3 - pyrrolidinemethanamine as the reacting amine . 1 , 4 - dihydro - 6 - fluoro - 1 - methylamino - 7 -[ 3 -[( 2 - propylamino ) methyl ]- 1 - pyrrolidinyl ]- 4 - oxo - 3quinolinecarboxylic acid may be prepared by the method in example 1 by using n -( 2 - propyl )- 3pyrrolidinemethanamine as the reacting amine . 1 , 4 - dihydro - 6 , 8 - difluoro - 1 - methylamino - 7 -[ 3 -[( 2propylamino ) methyl ]- 1 - pyrrolidinyl ]- 4 - oxo - 3quinolinecarboxylic acid may be prepared by the method in example 3 by using n -( 2 - propyl )- 3 - pyrrolidinemethanamine as the reacting amine . 7 -[ 3 -[( cyclopropylamino ) methyl ]- 1 - pyrrolidinyl ]- 1 , 4 - dihydro - 6 - fluoro - 1 - methylamino - 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 1 by using n - cyclopropyl - 3pyrrolidinemethanamine as the reacting amine . 7 -[ 3 -[( cyclopropylamino ) methyl ]- 1 - pyrrolidinyl ]- 1 , 4 - dihydro - 6 , 8 - difluoro - 1 - methylamino - 4 - oxo - 3quinolinecarboxylic acid may be prepared by the method in example 3 by using n - cyclopropyl - 3pyrrolidinemethanamine as the reacting amine . 1 , 4 - dihydro - 6 - fluoro - 1 - methylamino - 4 - oxo - 7 -[ 3 -[[( 2 , 2 , 2 - trifluoroethyl ) amino ] methyl ]- 1 - pyrrolidinyl ]- 3 - quinolinecarboxylic acid may be prepared by the method in example 1 by using n -( 2 , 2 , 2 - trifluoroethyl )- 3 - pyrrolidinemethanamine as the reacting amine . 1 , 4 - dihydro - 6 , 8 - difluoro - 1 - methylamino - 4 - oxo - 7 -[ 3 -[[( 2 , 2 , 2 - trifluoroethyl ) amino ] methyl ]- 1pyrrolidinyl ]- 3 - quinolinecarboxylic acid may be prepared by the method in example 3 by using n -( 2 , 2 , 2 - trifluoroethyl )- 3 - pyrrolidinemethanamine as the reacting amine . 1 , 4 - dihydro - 6 - fluoro - 7 -[ 3 -[[( 2 - hydroxyethyl ) amino ] methyl ]- 1 - pyrrolidinyl ]- 1 - methylamino - 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 1 by using 2 -[( 3 - pyrrolidinylmethyl ) amino ] ethanol as the reacting amine . 1 , 4 - dihydro - 6 , 8 - difluoro - 7 -[ 3 -[[( 2 - hydroxyethyl ) amino ] methyl ]- 1 - pyrrolidinyl ]- 1 - methylamino - 4 - oxo - 3 - quinolinecarboxylic acid can by prepared by the method in example 3 by using 2 -[( 3 - pyrrolidinylmethyl ) amino ] ethanol as the reacting amine . 7 -[ 3 -( aminomethyl )- 1 - pyrrolidinyl ]- 1 , 4 - dihydro - 6 - fluoro - 1 - methylamino - 4 - oxo - 3 - quinolinecarboxylic acid may be prepared by the method in example 1 by using 3 - pyrrolidinemethanamine as the reacting amine .	2
fig1 shows a front perspective view of two flooring slats employing two edge attachment members 77 , 78 according to one embodiment of the present invention . as shown in fig1 , flooring panels 11 having side walls 16 and connector members 20 are sleeved by edge attachment members 77 , 78 , fig2 shows a front elevational view of a single panel with top 12 , bottom 14 and c - shaped connector members 20 , 22 on the sides . the individual connector members 20 , 22 can be provided in various shapes , forms and sizes , and function to secure the panel members in a side wall - to - side wall fashion , two at a time . in one embodiment , the connector members bring adjacent panels into a tight adjacent fit to give the semblance of a permanent seam , which thereby prevents “ punch through ” of loads which may be borne directly on a given seam . the edge attachment members of the present invention do not cover these connector members 20 , 22 , but rather attach over the sides of the panels where there is no connector member . in one embodiment of the present invention , the panels are approximately ½ to two inches in height and five to seven feet in length , but other sizes can be produced depending upon the particular implementation involved . the invention is not dimensionally constrained . further , while fig1 and 2 show flooring panels with a substantially rectangular shape , it will be appreciated that the present invention can be adapted to suit other shapes as desired , including without limitation , circular , polygonal or other shapes . as shown in fig1 and 2 , for example , the panel members 11 have edges 24 which can be joined with other edges to expand the flooring as necessary for a particular application . as shown in fig3 and 4 , for example , panel members 7 and 8 can be secured at respective edges 24 using interlocking edge attachment members 35 and 36 . each edge attachment member 35 , 36 is a single piece and can be characterized as a plurality of segments . the interlocking edge attachment members can be welded onto the respective edges 24 , such that a first sleeve segment 44 of the edge attachment 36 runs parallel to and is flush with the top surface 46 of the floor panel member 8 and a second sleeve segment 43 of the edge attachment 36 runs parallel to and is flush with the bottom surface 45 of the floor panel member 8 . in one embodiment of the present invention , as shown in fig6 and 7 , at least one prong 42 extends perpendicularly from sleeve segments 43 and 44 . these prongs 42 are energy concentrators for the embodiment of the present invention where the edge attachment members are welded to the slats . as shown in fig3 - 4 and 6 , for example , the first sleeve segment 44 and the second sleeve segment 43 are connected by a connector segment 47 . the connector segment 47 comprises a first connector segment endpoint 55 , a second connector segment endpoint 56 and a clip support member 41 . the clip support member 41 extends substantially perpendicularly from the middle of the connector segment 47 that connects the two substantially parallel sleeve segments 43 and 44 . in one embodiment , as shown in fig6 , the clip support member 41 comprises a first clip support member endpoint 58 , a second support member endpoint 59 and a mid - segment 60 that is substantially u - shaped , wherein the two clip support member endpoints 58 and 59 are positioned at the top of the u , and wherein the u - shaped mid - segment extends from the connector segment 47 into the area between the first sleeve segment 44 and the second sleeve segment 43 , and in substantially parallel relation therewith . in one embodiment , as shown in fig4 , each edge attachment member is inserted onto the floor panel member 8 such that the bottom surface 61 of the u - shaped mid - segment 60 of the clip support member 41 is flush with the edge 24 of the floor panel member 8 . in one embodiment of the present invention , a bottom portion 52 of the connector segment 47 is angled towards the panel member edge 24 that the edge attachment member 36 is installed on , as shown in fig4 . the bottom portion 52 is the segment between the second clip support member endpoint 59 and the second connector segment endpoint 56 . in the embodiment of the present invention where the connector segment 47 includes an angled or curved bottom portion 52 , the first sleeve segment 44 of the edge attachment is slightly longer in length than the second sleeve segment 43 . it will be appreciated that the lower half of the connector segment in the embodiment of the present invention shown in fig3 and 4 is not a mirror image of the top half of the connector segment 47 . in one embodiment , as shown in fig3 - 4 and 6 , each edge attachment member further includes a substantially l - shaped extension arm 48 extending substantially horizontally from first sleeve segment 44 at or near the first connector segment endpoint 55 . extension arm 48 has a substantially 90 - degree curve formed at edge 40 that results in a downward extending portion 57 , with a curved clip pinching element 51 at the base of the downward extending portion 57 . the mid - portion 80 of the clip pinching element 51 indents inwardly of the downward extending portion 57 towards the connector segment 47 . as shown in fig3 , edge attachment member 35 can be installed onto the edge 24 of the floor panel member 7 in a similar manner ; however , the edge attachment member is arranged in reverse orientation to that of member 36 in order to interlock therewith . in this way , the rows of panel members can be tightly secured edge - to - edge . as shown in fig5 , the clip support member 71 and clip pinching element 72 can take a different form to that shown in fig3 and 4 . for example , the clip support member 71 can extend substantially perpendicularly from the connector segment 47 into the area between the first sleeve segment 44 and the second sleeve segment 43 . in this embodiment , the edge attachment member 77 is inserted onto the floor panel member 85 such that the tip 75 of the clip support member 71 is flush with the edge 81 of the floor panel member 85 . further , as shown in fig5 , the mid - portion 76 of the clip pinching element 72 extends further inward toward the connector segment 47 to provide greater surface area contact with the opposing clip pinching element when installed . fig1 also shows this alternative embodiment of the present invention . it will be appreciated that the shapes and spatial relationships of the sleeve segments , clip support , connector segment and clip pinching element are substantially as shown in the drawings in order to meet the requirements for a tight fitting engagement with the ability to flex and give so that the edge attachments can be joined and separated at will . representative dimensions in fig6 and 7 can be as follows in accordance with one embodiment of the present invention : distance b can be approximately between 1 . 4 and 1 . 5 inches inclusive ; distance c can be approximately between 1 . 4 and 1 . 5 inches inclusive ; distance b can be approximately between 1 . 4 and 1 . 5 inches inclusive ; distance c can be approximately 0 . 1 inches ; distance d can be approximately between 0 . 6 and 0 . 8 inches inclusive ; distance e can be approximately between 0 . 95 and 1 . 05 inches inclusive ; distance f can be approximately between 0 . 50 and 0 . 55 inches inclusive ; distance g can be approximately between 0 . 020 and 0 . 030 inches inclusive ; and distance h can be approximately between 0 . 20 and 0 . 30 inches inclusive . further , as shown in fig6 , the prong 42 can extend from the surface of the sleeve members at an angle of 45 degrees on both sides , thereby comprising a substantially 90 degree angle . the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the present embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the claims of the application rather than by the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein .	4
fig1 shows an exemplary embodiment of a diagram of a client - server database system 100 with which arrangements described below using fig2 to 5 can be implemented . the client - server database system 100 has a database 102 , a server 101 and computer modules 103 . clients 230 are housed in the computer modules 103 which can access the server 101 over a network 104 . the server 101 manages and handles processing of the content ( hereinafter also referred to as data and / or information records ) stored in the database 102 . a database 102 is an organized collection of information records stored in a storage device in a systematic manner , and can be accessed by the clients 230 by means of queries , where the server 101 is configured to execute the queries on the database 102 and return a response containing the desired results to the clients . the clients 230 are also in communication with applications 231 such as software programs run by computer modules 103 to output queries . in one embodiment , the server 101 and the database 102 may be housed in the same computer module . in an alternate embodiment , the server 101 and the database 102 may be housed in separate computer modules which may be coupled to each other . similarly , in one embodiment , the clients 230 and the applications 231 which request the server 101 for specific content in the form of queries can be housed within the same computer module or alternatively in separate computer modules . a client typically includes an interface module between an application residing on the client side and the server 101 , for example . open database connectivity ( odbc ), oledb ( object linking and embedding database ), . net , or esql / c ( embedded sql c ( c language )). the following embodiment will be described using odbc as an example . it should be apparent to a person skilled in the art that the use of other interfaces modules replacing the odbc fall within the scope of this invention . odbc is an interface standard that makes it possible to access data from a variety of database management systems ( dbms ), or servers 101 . the dbms vendors provide data access functionality for their respective dbmss through the odbc programming interface , which in turn makes it possible for an application on a client to access multiple dbmss through this interface . in the classic concept of client - server architecture , odbc will be part of the client while the dbms is a part of the functionality of the server 101 that is relevant to the present invention . dbms of the server 101 controls the organization , storage and retrieval of data in the database 102 . fig2 shows an exemplary embodiment of a block diagram of a general purpose computer module 103 housing the client with which arrangements described below using fig3 to 5 can be implemented . the processes and code modules shown in fig3 to 5 may be implemented as software , such as one or more application programs executable within the client - server database system 100 . the instructions may be formed as one or more code modules , each code module for performing one or more particular tasks . the computer modules 103 including a client has at least a first part of software and a corresponding code module for processing queries received from an application to be executed by the server . the computer module 103 may also have a second part of software and a corresponding code module for executing the application which outputs queries . the computer module 103 may also have a third part of software and a corresponding code modules for managing a user interface or the inter - device interface used for such tasks as receiving user commands , displaying processing outcome or communicating with the server 101 via a network 104 . the software may be stored in a computer readable medium , including the storage devices described below , for example . the software is loaded onto the server 101 and the computer modules 103 - 1 to 3 from the computer readable medium , and then executed by a respective apparatus . a computer readable medium having such software or computer program recorded on it is a computer program product . the server 101 accessible by the computer module 103 has similar configuration of software and a corresponding code module to realize functions for executing queries . as illustrated in fig2 , the computer module 103 has input devices such as a keyboard 202 and a mouse pointer device 203 , and output device may be a display device 214 . an external modulator - demodulator ( modem ) transceiver device 216 may be used by the computer module 103 for communicating to and from a communications network 104 via a connection 221 . the network 104 may be a wide - area network ( wan ), such as the internet or a private wan . the network 104 couples the computer module 103 to the server 101 and the database 102 . the computer module 103 typically includes at least one processor unit 205 , and a memory unit 206 for example formed from semiconductor random access memory ( ram ) and read only memory ( rom ). the computer module 103 also includes a number of input / output ( i / o ) interfaces including a video interface 207 that couples to the video display 214 , an i / o interface 213 for such devices like the keyboard 202 and mouse 203 , and an interface 208 for the external modem 216 . in some implementations , the modem 216 may be incorporated within the computer module 103 , for example within the interface 208 . the computer module 103 may also have a local network interface 211 which , via a connection 223 , permits coupling of the computer module 103 to a local computer network , known as a local area network ( lan ), for the network 104 connecting the computer module 103 to the server 101 and the database 102 . the interface 211 may be formed by an ethernet ™ circuit card , a wireless bluetooth ™ or an ieee 802 . 11 wireless arrangement . in one embodiment , storage devices 209 are provided and typically include a hard disk drive ( hdd ). it should be apparent to a person skilled in the art that other storage devices such as a floppy disk drive , an optical disk drive and a magnetic tape drive etc , ( not illustrated ) may also be used and fall within the scope of this invention . the components 205 to 213 of the computer module 103 typically communicate via an interconnected bus 204 and in a manner which results in a conventional mode of operation of the computer module 103 known to those in the relevant art . typically , the application programs discussed above ark resident on the storage device 209 and read and controlled in execution by the processor 205 . storage of intermediate product from the execution of such programs may be accomplished using the semiconductor memory 206 , possibly in concert with the hard disk drive 210 . in some instances , the application programs may be supplied to the user encoded on one or more cd - rom or other forms of computer readable media and read via a respective drive , or alternatively may be read by the user from the network 104 . the third part of the application programs and the corresponding code modules mentioned above may be executed to implement one or more graphical user interfaces ( guis ) to be rendered or otherwise represented upon the display 214 or to implement other modes of input / output or storage control . through manipulation of the keyboard 202 and the mouse 203 , a user of the computer module 103 and the application may manipulate the interface to provide controlling commands and / or input to the applications associated with the gui ( s ). fig3 illustrates an exemplary embodiment for processing of queries . when an application 231 outputs an enquiry in the form of a query , in step 301 , the client 230 intercepts the query before passing if onto the server 101 of the client - server database system 100 . in step 302 , the client 230 determines whether of not parsing of the intercepted query can be skipped at the client . whether or not the parsing the intercepted query is to be skipped is specified by the application ( e . g . application 231 ) that outputs the query . the application may specify skipping ( or non - skipping ) of parsing each of the intercepted queries at the client - end , or may switch between specifying skipping and non - skipping with arbitrary timing . if the parsing of the intercepted query is to be skipped , then the client transmits / sends the intercepted query to the server without performing any conventional parsing on the query ( step 303 ). if the parsing of the intercepted query is not to be skipped , the client performs query parsing and then transmits / sends the query to the server ( step 304 ). when the server receives the enquiry ( i . e . input query ) from the client 230 , the server 101 parses and executes the query by manipulating data in the database 102 and returns the response / result to the application 231 via the client 230 . by performing step 303 instead of performing conventional query parsing , the same process of performing query parsing which would be repeated at the server 101 is avoided at the client . an advantage is that the performance of the client - server database system can be improved with shorter response time , reduced overhead for code execution and runtime memory requirements , especially at the client - end , for query processing . when query parsing is skipped , the client 230 may still perform minimal processing on the query , such as determining the query type or the number of parameters of the query . such information can be used for further execution of the appropriate portion of the client ( odbc ) code based on type of sql queries ( i . e . data definition language , data manipulation language etc ) and also used to send the number of parameters ( if any ) to server ( database ). an advantage of performing minimal processing on the query is that a large part of the query parsing can be avoided at the client - end without forfeiting the function for the client to obtain essential information from the query . in an alternative embodiment , steps 302 and 304 may be excluded from the processing at the client , so that all queries from the application through the client 230 are passed onto the server 101 without being parsed . this configuration can be employed to simplify the structure of the client and the application . for example , it would be advantageous not to implement steps 302 and 304 if it is known at the time of building the client - application system that the application will only output queries that do not need parsing . an implementation of processes shown in fig3 will be described in more detail . software ( hereinafter also referred to as program and / or code ) written using open database connectivity ( odbc ) programming language interface for the client 230 , and odbc application program interface ( api ) calls for the application is used as an example . to introduce the option of skipping the process of query parsing , an element called “ skipparsing ” is added to the structure “ tagstmt_opt ” in the odbc driver as shown in fig4 ( a ). “ tagstmt_opt ” is a structure that is used to define various options / attributes , to be used across various stages in the client ( odbc ) code . by default , the value of element “ skipparsing ” is set as false ( i . e . the parser code is not to be skipped ), and to enable skipping the parser , the parser code is set as true . in the code for the client 230 , odbc sqlsetstmtattr , the logic shown in fig4 ( b ) is applied to allow the client 230 to detect a control code for skipping the query parsing specified by the application 231 . in a further part of odbc source code for the client 230 for controlling parser routines , the following logic may be added . if query parsing is to be skipped , ( if ( stmtp → option . skipparsing == true )), minimal processing such as determination of the number of parameters in the query and the determination of query type can be performed . to determine the number of parameters in the query , a code to look for parameter symbol “?” and to store the count of this symbol occurring in a given sql query can be used . to determine the query type , the element “ stmtp → stmttype ” which is known in the existing odbc source code can be used . for faster matching of sql query , a hash table for array of keywords listing query types can be used . the query inputted from the application 231 is scanned , and matched keywords are stored in the local variable . once the identifying and storing of the keyword is completed , the stored keyword value is checked against the array of queries and the query type is set accordingly . fig4 ( c ) show an example of code to implement this function . by skipping the parser code , which may be large , and having relatively small sections of code , the overhead for obtaining necessary information from the query is reduced , thereby achieving significantly better performance . especially , a large amount of buffer space taken up to store tokens of the query and the processing load for syntax check in query parsing is avoided by employing this minimal processing approach . query parsing processes such as syntax check can be skipped at the client 230 as an equivalent process is performed later at the server - end before the execution of the queries . if the application specifies that query parsing by the client 230 is not to be skipped ( if ( stmtp → option . skipparsing == false ), then the client 230 performs query parsing in accordance with the conventional approach . the decision to skip or not skip query parsing at the client - end can be made in accordance with the needs of the database system or the client / application configurations . implementation of this decision in the application source code will be described later . an example of a case where the client - end query parsing cannot be skipped is when the query contains odbc escape sequence which handles values such as date and timestamp in a manner specific to the client . if the odbc escape sequence is part of the query , then parsing to convert the escape sequence to native format which can be understood by the server 101 becomes essential . the following is an example of an odbc escape sequence which necessitates the client - end query parsing : alternatively , the same query can be written without odbc escape sequences , that enable skipping of client - end query parsing : to switch on / off skipping of the client - end query parsing , a control command for switching the attribute sql_ifmx_odbc_skip_parsing can be used in the source code of the application . the following control command used in the application source code enables the skipping of the client - end query parsing for queries that follow . the step 303 is then performed . the following control command used in the application source code disables the skipping of the client - end query parsing for queries that follow . the step 304 is then performed . in the example of the application source code shown in the appendix , the client - end query parsing is enabled by the command of line 0030 indicated in the appendix , and is later disabled by the command of line 0136 indicated in the appendix . as a result , client - end parsing is skipped for queries that are output between line 0031 and line 0135 indicated in the appendix , and queries output after line 0137 indicated in the appendix is parsed by the client 230 . the calls of the function sqlexecdirect ( ) executes the sql queries and a respective result ( success / failure ) will be returned in a variable identified as rc . it is noted that , although specific embodiments have been illustrated and described herein , it will be appreciated by those of ordinary skill in the art that any arrangement calculated to achieve the same purpose my be substituted for the specific embodiments shown . this application is thus intended to cover any adaptations or variations of embodiments of the present invention . therefore , it is manifestly intended that this invention be limited only by the claims and equivalents thereof . /* enable ( by setting to sql_true ) the skip parser attribute / / disable ( by setting to sql_false ) the skip parser attribute . here we will see after disabling we are running the same set of queries which we have run after enabling the skip parser attribute above . this shows how within the same application skip parser attribute can be set	6
referring to fig1 an external electronic device 1 is coupled to an inductive coil 9 upon which the patient is sitting . a first implanted electronic device 10 and a second implanted electronic device 20 are placed in the walls of the rectum or on the serosal surface of the rectum . these first and second implanted electronic devices perform both detection and triggering functions . the inductive coil 9 may be removably coupled to a toilet . it may also be removably coupled to a seat cushion or a mattress . the first and second implanted electronic devices 10 and 20 each comprise a hermetically sealed capsule 12 and 22 in which electronic circuitry is located . attached to the hermetically sealed capsules 12 and 22 are two electrodes 14 and 24 . the electronic circuitry may include an inductive coil , power storage capacitor , and integrated circuit for performing various functions as detailed below and illustrated schematically in fig2 . the external electronic device 1 transmits power and command signals to implanted electronic devices 10 and 20 by creating a modulated radio frequency ( rf ) field on the inductive coil 9 . the modulated radio frequency field may be created using a variant of a class e power oscillator 7 called “ suspended carrier transmission ”. in this scheme , a very high q resonant circuit ( q & gt ; 100 ) consisting of inductive coil 9 and a tuning capacitor can be energized to a high level of inductive field strength while drawing only a small current from a power supply . when the peak sustained oscillations have been achieved in inductive coil 9 , the carrier may be 100 % modulated in fewer than four carrier cycles by opening a switch in the circuit between the tuning capacitor and the coil at precisely the instant when the current through the coil is zero and the voltage on the capacitor is maximal . the carrier can be reinstated rapidly and with minimal energy loss by closing the switch . the number of cycles in which the carrier is on or off can be used to encode digital data for the purpose of controlling the implanted electronic devices 10 and 20 . when the switch is open and the carrier is off , inductive coil 9 can be used as a high impedance antenna to detect outgoing emissions that encode information from implanted electronic devices 10 and 20 . the implanted electronic devices 10 and 20 may be used as a pair to perform different types of measurements . in one embodiment , the implanted electronic devices measure physical distension of the rectum . the implanted electronic device 10 emits a short burst of rf energy upon command from external electronic means 1 , at a time at which the suspended carrier is in the off state . the implanted electronic device 20 detects the strength of the short burst of rf energy emitted by the implanted electronic device 10 , which depends on the physical orientation and distance between the two implanted electronic devices . by locating the implanted electronic devices on opposite sides of the rectum , the strength of the rf coupling between the two devices will reflect distension of the rectum . in another embodiment , the implanted electronic devices measure the electrical resistance of the material in the rectum . the implanted electronic device 10 emits a brief electrical current from its two electrodes 14 . the implanted electronic device 20 detects the strength of the electrical field created in the adjacent tissues via its two electrodes 24 which are connected to an amplifier and a digitizer . the field strength depends on the dimensions and electrical conductivity of the material separating the two implanted electronic devices . solid fecal material has an electrical conductivity that is midway between liquids ( high electrical conductivity ) and gases ( low electrical conductivity ). the results of the two measurements described in the embodiments above are transmitted to the external electronic controller 1 which uses the information about distance and electrical coupling to infer both the amount and the nature of the rectal distension . this information can be presented to the patient through an interface 5 , whereupon the patient decides if and when it is necessary to empty the rectum . in the event that the patient decides to empty the bowels , this is conveyed through interface 5 to a controller 3 which transmits commands to one or both of the implanted electronic devices that cause them to emit electrical current pulses sufficiently strong to trigger peristaltic contractions of the rectum . the implanted electrical devices 10 and 20 may also include an electrical stimulator implanted into the tissues of rectoanal region to facilitate the emptying of the rectum . the implanted electrical devices 10 and 20 may also include an electrical stimulator that activates a plurality of preganglionic parasymapathetic neurons to trigger defecation . the implanted electrical devices 10 and 20 may also include an electrical stimulator that activates a plurality of perianal cutaneous afferents that activate spinal reflexes to trigger defecation . [ 0020 ] fig2 provides a more complete block diagram of the electronic functions performed by circuitry within the external and implanted components in order to support the operations described above . in particular , it depicts an embodiment in which a single type of implant can perform a multitude of functions upon command from the external components . it will be obvious to one skilled in the art that these electronic functions may be divided into two or more types of more specialized implants . referring to fig2 the external components 1 may be subdivided into functional blocks as follows . the user interface 5 provides a display whereby the user can see the results of the measurements in a simplified form upon which he / she can base decisions about self care and control . the user can instruct the system to begin or terminate self - care functions such as stimulating the evacuation of the rectum . the controller 3 includes all digital circuitry required to operate the remainder of the system , including storage devices that are loaded with and retain information specific to the patient and the implanted components , such as calibrations for the sensors and stimulus parameters required to perform self - care functions . power can be provided by ac / dc converter , batteries , or any other suitable device . communication with the implanted electronic devices is achieved by inductive coupling between the external inductive coil 9 and inductive coils contained within each implant . a driver 7 uses class e circuitry to create a sufficiently high field strength of the rf carrier signal produced in external inductive coil 9 so that the voltage generated in each implant &# 39 ; s inductive coil is sufficient to power the electronic circuitry in that implant . a tuning capacitor plus the external inductive coil 9 form a resonantly tuned tank circuit with a high q . an encoder formats the digital command information from the controller 3 to each implant so that it can be applied to the driver 7 in order to modulate the rf carrier signal so as to convey that command information to the implants . after commanding an implant to transmit out sensor data , the controller 3 must stop the transmission of rf power from the external inductive coil 9 by opening an electronic switch in the tank circuit at approximately the phase in the rf oscillation when the field strength in inductive coil 9 passes through zero . this causes inductive coil 9 to act like a high impedance antenna for the much weaker rf oscillations produced by the implant that is transmitting said sensor data by amplitude modulation of this outgoing rf signal . a detector circuit amplifies and conditions the outgoing rf signal as picked up by the inductive coil 9 acting as an antenna . a decoder circuit converts the amplitude fluctuations in the outgoing rf signal into digital data representing the sensor data , which is then processed by the controller 3 . referring to fig2 the implanted electronic devices 10 and 20 may each be subdivided in functional blocks as follows . the implant electronic circuitry 10 and 20 is contained within the hermetically sealed capsule 12 and 22 that protects it from moisture . it is connected to a pair of electrodes 14 and 24 affixed outside the package so as to make electrical contact with the body tissues . an inductive coil and capacitance produces a resonant circuit tuned to the rf carrier frequency , wherein said capacitance includes self - capacitance of the coil windings plus any additional capacitance required for tuning . in its idling state , the resonant circuit is connected to the receiver circuitry , which extracts electrical power from the received rf carrier signal and directs it to a power circuit and to a data circuit . the power circuit converts the rf power to a filtered and regulated dc voltage that powers the other circuitry . the data circuit detects modulation of the rf carrier signal and converts these modulations to digital data that controls the operation of the remainder of the implant circuitry ( not all data effects are shown schematically ). one primary role for the received digital data is to specify the strength and timing of electrical pulses emitted through electrodes 14 and 24 , as controlled by the stimulator function . when stimulation pulses are not being emitted but an rf carrier signal is being received , power extracted from the carrier is stored by on the electrodes themselves by the charger . the ta electrode is pre - anodized to approximately four times the maximal dc voltage produced by the power and charger circuitry so that it acts as an electrolytic storage capacitor with respect to the electrically conductive bodily fluids surrounding the electrode . this permits relatively large amounts of power to be stored and released in the form of intense , brief , intermittent stimulation pulses . the electrodes 14 and 24 can also be disconnected from both the charger and stimulator circuitry and connected to an amplifier circuit that amplifies and conditions potentials present on the electrodes . thus , when one implant is generating a stimulus pulse , another implant can measure the strength of the potential field created in its vicinity by the stimulus pulse , the field strength of which will depend on the nature and thickness of the tissue intervening between the two implants . the amplified signal from the electrodes or a signal from another sensor that may be included is switched to the digitizer which produces digital data corresponding to the amplitude of the sensor signal . the digitized sensor data is used to modulate a transmitter which causes the resonant circuit to emit an outgoing rf telemetry signal that is received by the external inductive coil and its related detector and decoder circuitry . during this transmission , the external circuitry stops transmitting its rf carrier signal . when one implant is generating an outgoing rf telemetry signal , one or more other implants in its vicinity can be commanded to act as sensors of the strength of the rf signal in their vicinity . the rf signal picked up by an implant that is functioning as an rf field sensor is amplified and conditioned by the detector circuit and conveyed to the digitizer for later transmission outward . it is to be understood that other embodiments may be utilized and structural and functional changes may be made without departing from the respective scope of the present invention . the attached description of exemplary and anticipated embodiments of the invention have been presented for the purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed . many modifications and variations are possible in light of the teachings herein .	0
referring again to the drawings , there is shown in fig1 - 4 an anemometer , generally designated as 10 , mounted on hollow support tubes 12 and 14 . the support tubes at their inner ends 16 and 18 are in supportive engagement with outer cylindrical ends 20 and 22 of hub end caps 24 and 26 , respectively . the inner portions of the end caps have cylindrical surfaces 28 and 30 , which are in cylindrical alignment with outer cylindrical surface 36 of the anemometer hub , generally designated as 38 . the hub , fig3 is mounted on bearings 44 for rotation on a cylindrical axle 42 fixed in the end caps 24 and 26 . the outer cylindrical end 22 is threaded externally and the inner axle at end 20 is threaded internally to receive a holding screw 43 so that the hub can be mounted on a shaft instead of the tubes 12 and 14 . this modification permits mounting the hub on a shaft in a hang - glider , for example . the hub has an internal generally annular space 46 containing the rotation sensing system to be described . the inner faces of the end caps 24 and 26 have annular flanges 50 and 52 extending inwardly into complementary annular grooves 54 and 56 , respectively , in the outer faces of the hub . the anemometer has eight identical multi - faced , helicoidal airfoils , generally designated as 60 , each airfoil having a multiple of helicoidal edges . this structure provides effective airfoils because their twist causes a partial vacuum to develop on one side during rotation . at the lower or inner ends of the airfoils , fig2 and 5 , there are lateral posts 62 spaced apart in the axial direction , and secured in complementary , evenly spaced openings 64 in the cylindrical hub surface 36 . extending between the posts are beveled inner ends 66 on the airfoils which terminate in transverse inner airfoil edges 68 spaced radially outwardly from the hub surface . between the edges 68 , the hub surface and the inner edges of the laterally spaced posts are formed generally rectangular slots 72 . these transversely extending spaces need not be of symmetrical configuration but the airfoil edges 68 must be thin to produce a strong vortex . the spaces extending across the airfoils , as 72 , need not be of slot form and can be open at the ends , formed by a central support , for example , connecting the airfoils to the hub . the space or slot distance between the hub and airfoils is relatively narrow as 1 / 16 &# 34 ; or 1 / 8 &# 34 ;. all that is required is to provide space to separate the airfoils and hub . extending outwardly from the posts and the edge 68 , as may be best seen in fig2 illustrating an airfoil 76 , the airfoil is twisted spirally . as shown in fig1 and 5 - 11 , each airfoil has plane surfaces 80 , 82 and 84 on one side , and respective equivalent surfaces 86 , 88 and 90 on the other side , fig2 . the surfaces 80 and 82 intersect in a generally radially extending helicoidal line edge 96 . the surfaces 80 and 82 also intersect with the triangular surface 84 to form helicoidal line edges 98 and 100 , respectively . the surfaces 84 and 90 intersect with outer tip or end surfaces 102 of respective airfoils . surfaces 82 and 88 intersect with helicoidal edge 104 which as it extends downwardly on the airfoil becomes a line edge 106 , fig1 , and as it further extends downwardly on the posts becomes a flat edge 108 . identical edge surfaces are formed on respective other parts of the airfoils . all of the intersecting surfaces of the airfoils form sharp edges . the facing surfaces of adjacent airfoils , such as surfaces 80 , 82 and 84 and 86 , 88 and 90 , are at angles with each adjacent surface of from 166 ° to 173 ° to insure that the air flow on the surfaces does not separate therefrom , and so as to produce the couanda effect . in the embodiment shown , the airfoils are 1 . 125 &# 34 ; wide and 2 . 250 &# 34 ; long externally of the hub . the diameter of the hub is 1 . 2 &# 34 ;, making the total diameter of the anemometer 5 . 700 &# 34 ;. the slot 72 is 0 . 15 &# 34 ; in the radial direction and 0 . 75 &# 34 ; in the axial direction . the post depth into the hub is 0 . 1875 &# 34 ;, and diagonals in the parallelogram , as shown in fig9 are 1 . 125 &# 34 ; × 0 . 125 &# 34 ;. the slot 72 can be changed in shape to accommodate varying airfoil shapes for distributing the vorticity flow to the tips of the blades in such a manner so as to counter the vorticity in the tip effects on the airfoils . the airfoils have been made from plastic , such as polycarbonate , polyvinyl chloride and glass - filled nylon . the rotation sensing system is shown in fig3 and 12 , and is adapted to sense the time for one - half of a revolution of the anemometer rather than count the number of revolutions for a specific period of time . the system is comprised of a metal oxide semiconductor ( mos ) clock 120 , driving an amplifier 122 of sufficient power to supply a light emitting diode ( led ) 124 , the latter being positioned , fig3 on the non - rotating axle 42 in the space 46 within the hub . two element - shaped shutters 126 and 128 are integral with the hub so as to rotate therewith and are positioned adjacent the led and two closely spaced photo - sensing transistors 130 and 132 so as to rotate therebetween and shut off the light from the led to the transistors , the light signal being received by the transistors when the shutters are rotated out of alignment from the led and the transistors . the photo - sensing transistors are connected to a discriminator detector 134 to indicate the direction of rotation and its output to a counter sample - hold amplifier 136 . the output therefrom is directed to a 1 / x ( reciprocal ) read only memory ( rom ) 138 in which a comparative scan determines the wind speed . this system produces a high frequency ( approximately at a rate of 1 megahertz ) series of narrow light pulses in square wave form 140 , fig1 , interrupted by the rotation of the instrument shutters 126 and 128 . the two photo - sensing transistors detect the rotation of the anemometer according to which is turned off first . this detection is determined in the discrimination detector . the shutting off of the light by the shutters changes the wave form to a chopped wave form 142 in a series of pulses which are counted and held in the sample - hold register 136 whose output is directed to the reciprocal 1 / x rom , where the slower the speed of rotation of the instrument provides the greater number of counts per sample . because the instrument is linear in wind speed , the reciprocal of the count per sample is directly proportional to the wind speed . the output of the rom can be recorded on magnetic tape , displayed on liquid crystal or led displays , or on a meter . this system provides the advantages of significantly reducing the power consumption of the led light signal generation , typically by a factor of 10 , increases the accuracy and resolution of the measurement of the anemometer rotation rate , and consequently the speed , because it measures portions of angles of rotation rather than multiples of rotations , produces a linear output , and updates the measurement every one - half rotation . in fig1 the anemometer according to the prior art is shown . here the anemometer has a hub 150 and light blades 152 extending therefrom are equally spaced . the blades are flat but twisted , the twist not being shown . further , there is no space between the inner ends of the blades and the hub . direction of rotation is shown by the arrow 154 . between each pair of blades a vortex 156 is developed and on the left side the vortex 156 produces a resultant force 158 and on the right side the vortex produces a resultant force 160 , in the opposite direction as indicated by the arrow . the result of this is development of forces which tend to rotate the hub in the direction of the forces 162 . these forces 162 , acting in the direction opposite to rotation , cause considerable inaccuracy in measuring the component of the wind on the anemometer . in fig1 an anemometer according to the invention having a hub 38 and airfoils 60 is shown schematically to be rotating in the direction of the arrow 166 . here the airfoils are shown without illustrating the twist . a vortex 168 is formed at the outer end of the airfoils , and the slots 72 extending transversely across the airfoils produce a vortex 170 at the inner ends of the airfoils . in fig1 the vortices 156 and the forces 162 are rotating generally in the same direction whereas in fig1 the vortices 168 and 170 are rotating in opposite directions . the result is that the forces 171 and 173 between neighboring airfoils are reduced because of the strengthened vortices through the slots and the alteration of the flow pattern over the hub . that is , the opposing forces as 162 in fig1 are not developed to any extent . this provides for greater efficiency and accuracy . in fig1 another embodiment of the invention is shown schematically . here a rotor 38 &# 39 ; has eight airfoils 60 &# 39 ; with cut - out spaces or slots 72 &# 39 ; shown extending across the airfoils and between them and the hub . in addition the airfoils have cut - out areas 176 which are intermediate the two ends of the airfoils . again , these cut - out areas may be of substantially any shape , such as slots across the airfoils in the manner of the spaces 72 , but can extend along edges of the airfoils , the airfoils being connected inwardly of the spaces in the latter arrangement . the radial edges of the cut - outs should be sharp so as to produce strong vortices . the direction of rotation is indicated by the arrow 178 . here between neighboring blades four vortices 180 , 182 , 184 and 186 are formed . vortices 180 and 182 rotate in opposite directions and similarly the vortices 184 and 186 rotate in opposite directions . the additional cut - outs further reduce the interaction as indicated by the resultant forces 181 , 183 and 185 , 187 between the neighboring or adjacent airfoils to increase the efficiency and accuracy of the anemometer . one of the important features of the invention is the large cylindrical hub which with the slots and cut - out portions generate vortices indicated in fig1 and 15 . vorticity from these vortices is proportional to the component of the wind along the axis which impacts on the instrument and causes the rotation . the anemometer is free running , retarded only by the drag of the bearings and thus there is little drag or lift on the airfoils when the wind is along the axis of the instrument . as the angle of incidence of the wind increases , the drag and lift in the flow over the airfoils increases , as does the strength of the airfoil tip vortices 168 in fig1 and 180 in fig1 . these are facts which can cause large errors in the prior art designs . here , the vorticity generated by the flow through the slots between the hub and the chamfered airfoils is oppositely directed to that generated by the aerodynamically generated tip vortices . the surprising result is that the tip vortices are neutralized and deflected so as to permit the anemometer to respond to the air flow defined by the helicoidal airfoil edges . the relative strength of the vortices around the edges of the airfoils are of the same strength no matter how strong the wind and no matter how fast the anemometer is rotated at any given angle of attack . therefore , the aerodynamic corrections caused by the vortices 170 in fig1 and 182 , 184 and 186 in fig1 , are effective at all speeds because they are always of the same proportional strength . the shape of the slot 72 can be changed to accommodate varying airfoil shapes to generate vorticity containing flow so as to counter the vorticity induced in the blade tips . the concept of the large cylindrical hub and the airfoils in contrast to the elliptical or spheroidal hubs and flat blades in the prior art provides a substantial improvement in accuracy over the whole range of reynolds numbers from 0 to 10 12 . the airfoil and generally parallelogram shape in the cross - section also improves the accuracy of the instrument in response to changes in wind , particularly to wind direction reversals and complete cessation . the invention and its attendant advantages will be understood from the foregoing description and it will be apparent that various changes may be made in the form , construction and arrangements of the parts of the invention without departing from the spirit and scope thereof or sacrificing its material advantages , the arrangements hereinbefore described being merely by way of example . i do not wish to be restricted to the specific forms shown or uses mentioned except as defined in the accompanying claims , wherein various portions have been separated for clarity of reading and not for emphasis .	6
referring now to the drawings , a housing 10 with side walls 13 is provided comprising a suitable material resistant to caustic solutions at temperatures up to 95 ° c ., such as polypropylene or 316 stainless steel , and serving as an electrolyte reservoir . extending across an upper region of the interior of housing 10 is a support panel or platform 11 . at one side of the housing , there are gaps 36 in the support panel , providing air openings into the electrolyte reservoir . extending upwardly from and supported by the support panel 11 are a plurality of metal - air cells 12 with air gaps therebetween . these cells 12 have a long , flat rectangular shape with side walls 21 having window openings retaining air cathodes 22 . the air cathodes 22 are generally rectangular sheet members fabricated of activated carbon and incorporating an electrically conductive material such a wire mesh . each cathode 22 extends entirely over an opening in wall 21 with its edges sealingly adhered to the interior surface of the wall around the periphery of the opening . the cathodes in the two side walls are preferably electrically connected such that they effectively form a single cathode surrounding the anode spaced between them . the cathodes are susceptible to hydrostatic deformation which affects the gap between the anode and cathode . to avoid this problem , a supporting grid 71 is provided across the opening in wall 21 and small projections 72 are provided on the outer edges of the grid 71 . these projections 72 are arranged so that the projections of adjacent pairs of cells engage each other , thereby providing a rigid structure while permitting free flow of air between the cells . the side walls 21 are joined by a removable top lid 23 , a pair of end walls 24 and a bottom wall 25 , the lid 23 tightly sealing within walls 21 and 24 . the anode 26 has a vertically extending tab 75 projecting upwardly through a slot in lid 23 , and similarly the cathode has a connector lead 76 extending from the side of the cell where the two cathodes are joined . the tab 75 and lead 76 are connected to suitable circuit means ( not shown ) for connecting the cells in series to each other and to an external load . a divider wall 30 is formed between side walls 21 near one end wall 24 to form a narrow discharge conduit 32 adjacent the side edge . this divider wall 30 terminates at an upper edge 31 a short distance below the cell top edge 23 , the edge 31 forming an overflow weir . vertical slots are provided in divider wall 30 and side wall 24 to retain an aluminum anode 26 . this anode terminates slightly below the top edge 31 of divider wall 30 . an inlet tube 27 connects to bottom edge 25 beneath the anode 26 and an outlet tube 33 connects to bottom edge 25 directly below the discharge conduit 32 . these pass through holes 29 and 29a respectively in support panel 11 . preferably the tube 27 is provided with annular grooves containing o - rings which snugly seal the tube 27 within hole 29 . the discharge tube 33 is formed slightly smaller than hole 29a to facilitate inserting and withdrawing the metal - air cell 12 . to prevent leakage of air through holes 29a , a thin foam or rubber pad with small holes may be placed on the panel 11 over the holes 29a . the discharge tubes pass through the small holes in the pad and then through the larger holes 29a . immediately below the inlet tubes 27 is mounted a manifold or manifolds 15 extending across beneath support panel 11 . preferably there is a divider wall 50 providing two manifolds , one for each aligned row of metal - air cells . as shown in fig4 four inlet tubes 16 feed into the manifold 15 , two of these tubes feeding into one half of the manifold and two into the other half . the inlet end of the four tubes 16 connect to a second manifold 17 which in turn connects to three submersible centrifugal pumps 19 by way of outlet lines 18 . two of the three outlet lines 18 are provided with reverse flow check valves 49 . the pumps 19 have inlets 20 which are preferably positioned well above the bottom of the electrolyte reservoir . all tubing , connectors and manifold are preferably made of a non - conducting material in order to reduce possible shunt currents . the electrolyte reservoir preferably has a divider wall 14 with an upper edge 14a forming an overflow weir . as can be seen from fig1 the electrolyte will , after some discharge time has elapsed , have a higher level to the right of the weir and a lower level to the left of the weir . partially clarified electrolyte overflows from the right side to the left side of the weir . inlets 20 for pumps 19 are positioned in the downstream side of the reservoir for pumping partially clarified electrolyte up through manifolds 17 and 15 and through the metal - air cells 12 . the electrolyte travels from the manifold 15 in an upward direction through the gaps between the anode and cathodes simultaneously flushing any reaction product formed in the gaps . the electrolyte with reaction product is carried over the weir 31 and down discharge conduit 32 and outlet 33 back into the upstream side of the electrolyte reservoir . the reaction product s settles to the bottom of the upstream side with the partially clarified electrolyte flowing over the weir for recycle through the metal - air cells . an air distributor wall 35 is provided adjacent the metal - air cells 12 with openings 66 opposite the gaps between the cells for discharge of air through the gaps . a blower 34 feeds air to the distributor wall 35 , this blower being powered by electricity generated by the battery . in operation , the compartment containing the metal - air cells is sealed within a cover 55 as shown in fig2 except for the air inlets 66 and the gaps 36 in the support panel 11 . this compartment cover includes the air distributor wall 35 , a pair of side walls 56 , an end wall 57 opposite wall 35 and a removable lid 58 . the walls 35 , 56 and 57 are tightly sealed together and the bottom edges of the four walls are tightly sealed to the top of the housing 10 , while the lid 58 is tightly connected to the top edges of the four walls . alternatively , the lid 58 may be sealed to the walls and the entire compartment cover may be removable . thus , when the blower 34 is in operation , air is blown across through the gaps between the metal - air cells 12 and down through the support panel openings 36 into the reservoir . the air then travels in the reverse direction across the surface of the electrolyte in the reservoir , picking up hydrogen , then through demister curtain 70 and fiber demisting pads 40 and is discharged to the atmosphere upwardly through a plurality of metal tubes 38 of condenser 37 . heat exchange in the condenser is enhanced by means of a plurality of mechanically bonded metal fins 39 through which air is blown from fans 41 . alternatively , the condenser may be water cooled . the electrolyte may be cooled by means of a heat exchanger 42 , the heat exchange taking place between metal tubes 43 and metal fins 44 by way of air fans 48 . the electrolyte is pumped by way of pump 45 upwardly through tube 46 , through the heat exchanger and is discharged back into the reservoir via discharge line 47 . the operation of the heat exchanger fans is controlled by a thermal switch set to a predetermined temperature . the condenser and heat exchanger may be protected by a cover 60 as shown in fig3 and consisting of two sides 61 , one end wall 63 and a top wall 64 . side walls 61 contain openings 62 to permit free flow of air around the condenser , heat exchanger and circulating air blower . the top wall 64 has an outlet 65 serving as an exhaust from condenser tubes 38 . this outlet 65 may be connected to an exhaust vent . a small auxilliary battery is used to start the battery of the invention , this auxilliary battery being connected to the pumps 19 . thus , when the pumps 19 are activated , they commence pumping electrolyte upwardly through manifolds 17 and 15 . since gas may accumulate in the manifolds , it is desirable to provide a means for venting gas before it passes upwardly through the metal - air cells by providing small holes in the upper regions of the side walls of manifold 15 . after the gas is fully eliminated from the manifold , there continues to be a slight flow of electrolyte through the holes . as soon as the electrolyte makes contact between the anode and cathode , electricity generation commences and the auxilliary battery is no longer required . the pumps 19 and 45 , the blower 34 and the fans 41 and 48 are all driven by excess power from the battery of the invention . it is also possible to provide a manual pumping device to start the battery , thereby avoiding the need for the auxilliary battery . the three pumps 19 provide a sufficiently excess flow capacity that two of the three pumps can fail and sufficient electrolyte will still be pumped to fill the metal - air cells with electrolyte and keep the battery operational . in order to prevent a flow short circuit through a failed pump , reverse flow check valves 49 are provided on all except one pump . when it is desired to stop the battery for any reason , such as replacing the metal - air cells , it is simply a matter of stopping the pumps whereby the electrolyte drains out of the metal - air cells and the cells can be replaced . thus , the battery can be placed back into immediate operation and individual cells can be opened and the anodes replaced at a convenient time . in order to flush the system , a one - way discharge valve outlet may be provided in a side wall 13 of housing 10 at a level above the highest permissible accumulation of reaction product solids 5 and below the level of weir 14a . thus , with the one - way valve in the open position , water can be fed into the pump side of the electrolyte reservoir and then circulated through the pumps and cells into the upstream side of the electrolyte reservoir . simultaneously , liquid flows from the reservoir out through the one - way valve . in this manner , all caustic except for that held within the solids deposit s may be flushed out of the battery . a battery of the design shown in fig1 - 6 was produced with 20 aluminum - air cells . each aluminum anode had a thickness of 13 mm , a height of 18 . 2 cm and a width of 11 . 1 cm . the cathodes used were type ae - 20 gas - diffusion cathodes made by electromedia inc . the cells each had a thickness of 1 . 7 cm , a height of 23 . 0 cm and a width of 13 . 0 cm . the electrolyte was 5m koh with 0 . 005m sodium stannate and it was pumped through the aluminum - air cells at a flow rate of 15 l / min . air was circulated between the cells and through the reservoir at a rate of about 28 l / min . this battery provided over 500 watts continuously for more than 60 hours with an output current of approximately 19 amps . the battery also had a net energy output of over 300 watt - hours per kg of battery weight . in order to determine how the al / koh ratio behaves as a function of discharge time , a computer simulation was carried out based on the equation shown on page 4 at 72 . 5 watts per cell and seed additions of 3 . 30 and 60 grams . the results are shown in fig7 and it can be seen that the higher the seed charge and the earlier it is added , the lower the maximum al / koh ratio attained . because the electrical conductivity of the solution diminishes as the al / koh ratio increases , the effect of the seed additions is reflected in the cell voltage as represented by the family of full line curves in fig7 . it has been determined that if sufficient seed is added to keep the al / xoh ratio below 0 . 60 , current densities as high as 180 ma / cm 2 are possible without anode passivation and that to maintain a current density of 60 ma / cm 2 , sufficient seed to maintain the ratio below 0 . 70 is all that is required . also , with sufficient seed present to avoid an excessively high supersaturation level , crystal growth and secondary nucleation are the precipitation mechanisms , solution viscosity is kept low and the solid material can settle out in the sedimentation zone off the battery , thereby avoiding cell clogging and resultant battery failure . as can be seen from the dashed lines in fig7 once the peak value of the al / xoh ratio has been passed , the ratio becomes constant , striking a balance between the rate of aluminum dissolution and precipitation and seed sedimentation rate . in this way no further passivation is threatened and the lifetime or discharge time of the battery is extended by a factor of 4 to 5 times that which can be obtained in the absence of added seed . certain preferred embodiments of the invention are shown in the following non - limiting examples . the properties and specification of the various baikalox aluminas produced by a deagglomeration process are given in the following table : ______________________________________ baikalox baikalox baikalox baikaloxpowder name cr30 cr15 cr10 cr1______________________________________purity , % al . sub . 2 o . sub . 3 99 . 99 99 . 99 99 . 99 99 . 99major phase alpha alpha alpha alpha % major phase 65 % 85 % 90 % 97 % crystal density , 3 . 98 3 . 98 3 . 98 3 . 98gm / cm . sup . 3bulk density , 0 . 32 0 . 46 0 . 51 0 . 70gm / cm . sup . 3pressed density , 1 . 04 1 . 32 1 . 45 1 . 622000 psi gm / ccultimate particle 0 . 05 0 . 1 0 . 15 & lt ; 1 . 5size , micronsmean agglomerate & lt ; 0 . 5 & lt ; 0 . 5 & lt ; 0 . 6 & lt ; 1 . 5size , micronsspecific surface area , 30 ± 1 15 ± 1 10 ± 1 1b . e . t ., m . sup . 2 / gmloss of ignition , % 1 . 0 . 65 . 25 -- agglomerate size cumulative weight percentdistribution by sedigraph & lt ; 0 . 3 μm 34 31 13 -- & lt ; 0 . 4 μm 44 45 24 -- & lt ; 0 . 5 μm 53 56 38 -- & lt ; 0 . 6 μm 59 68 52 9 & lt ; 1 . 0 μm 78 88 82 45 & lt ; 2 . 0 μm 93 99 95 88 & lt ; 5 . 0 μm 97 100 98 97 & lt ; 10 . 0 μm 100 -- 100 100______________________________________ a supersaturated solution of caustic potassium aluminate was prepared using 4 . 1m koh and 3 . 0m al . three separate containers holding this solution were placed in a constant temperature bath at 50 ° c . to one solution was added 20 g / l of regular hydrargillite seed , to a second solution was added 20 g / l of baikalox cr - 15 and no seed was added to the third solution . the solution conductivities were monitored with in - situ sensors , with an increase in electrical conductivity being symptomatic of hydragillite precipitation according to the reaction : the results in fig8 show that baikalox cr - 15 is an effective seed . the procedure of example 1 was repeated using a solution prepared from 4 . 5m koh and 3 . 3m al . four different α - alumina seeds were tested , including 40 g / l of baikalox cr - 15 , 40 g / l of laboratory - calcined alumina , 80 g / l of alcoa a - 16 and baco ra - 107ls . the results in fig9 show the ineffectiveness of the α - alumina other than baikalcx cr - 15 . the procedure of example 1 was again followed using a solution prepared from 4 . 5m koh and 3 . 27m al . three different baikalox alumina seeds were tested , including 20 g / l baikalox cr - 15 , 20 g / l baikalox cr - 30 and 40 g / l baikalox cr - 1 . the results in fig1 show the superiority of baikalox cr - 15 . the procedure of example 1 was following using a solution prepared from 5 . 0m koh and 3 . 6m al . tests were conducted using 40 g / l baikalox cr - 15 and 40 g / l baikalox cr - 10 . the results in fig1 show these to be equally effective . the procedure of example 1 was followed using a solution prepared from 4 . 5m koh and 3 . 3m al . the tests were conducted using 10 g / l hydrargillite seed and different concentrations of baikalox cr - 15 . the results in fig1 show the relative effectiveness of different dosages of baikalox cr - 15 compared with the hydrargillite .	7
the present invention is best understood by reference to the detailed figures and description set forth herein . embodiments of the invention are discussed below with reference to the figures . however , those skilled in the art will readily appreciate that the detailed description given herein with respect to these figures is for explanatory purposes as the invention extends beyond these limited embodiments . for example , it should be appreciated that those skilled in the art will , in light of the teachings of the present invention , recognize a multiplicity of alternate and suitable approaches , depending upon the needs of the particular application , to implement the functionality of any given detail described herein , beyond the particular implementation choices in the following embodiments described and shown . that is , there are numerous modifications and variations of the invention that are too numerous to be listed but that all fit within the scope of the invention . also , singular words should be read as plural and vice versa and masculine as feminine and vice versa , where appropriate , and alternative embodiments do not necessarily imply that the two are mutually exclusive . the present invention will now be described in detail with reference to embodiments thereof as illustrated in the accompanying drawings . detailed descriptions of the preferred embodiments are provided herein . it is to be understood , however , that the present invention may be embodied in various forms . therefore , specific details disclosed herein are not to be interpreted as limiting , but rather as a basis for the claims and as a representative basis for teaching one skilled in the art to employ the present invention in virtually any appropriately detailed system , structure or manner . it is to be understood that any exact measurements / dimensions or particular construction materials indicated herein are solely provided as examples of suitable configurations and are not intended to be limiting in any way . depending on the needs of the particular application , those skilled in the art will readily recognize , in light of the following teachings , a multiplicity of suitable alternative implementation details . at least some preferred embodiments of the present invention provide an electronically controlled antiskid system for wheeled vehicles with manual brakes to increase safety by improving directional control and shortening the stopping distance by reducing tire skids while braking when compared to conventional manual brake systems . at least some preferred embodiments are used with manual brake systems where the vehicle &# 39 ; s operator uses their hands and / or feet to actuate and power the mechanical or hydraulic brakes . at least some preferred embodiments do not use any hydraulic or pneumatic power to apply the brakes . instead , at least some preferred embodiments use an electronic controller and a wheel speed sensor to detect a tire skidding event on a wheeled vehicle and command an actuator to move the brake linkage to reduce the brake force that the operator is applying to the brake pads of the skidding wheel and thus reduce the tire skids . in at least some preferred embodiments , electrical power from the vehicles &# 39 ; electrical system is used to power the antiskid system , including the actuators . at least some preferred embodiments can operate on either dc or ac power . in addition , some embodiments can operate on portable battery power , which is ideal for bicycle applications that have no on - board electrical systems . as illustrated by way of example in fig1 , today &# 39 ; s electronically controlled antiskid systems are not well suited for vehicles with manual brakes because a power source for the brake system must be added to the vehicle . this is not practical due to the added weight , cost and the difficulty of mounting the many needed components . at least some preferred embodiments of the present invention provide the same safety benefits for vehicles with manual brake systems without the need for all of the additional components required for a vehicle with powered brakes . antiskid systems according to at least some preferred embodiments weigh and cost less and are more compact than antiskid systems for powered brakes since there is no need for a hydraulic or pneumatic pump , a drive motor , control valves , relief valves and piping . in at least some preferred embodiments , the actuator that moves the brake linkage can be located anywhere in the brake linkage system . this can reduce the cost of retrofitting the antiskid system into vehicles already in use . at least some preferred embodiments may also reduce maintenance costs by extending tire life by reducing tire skids and tire blowouts and may reduce the cost of vehicle insurance by reducing the number of accidents caused by loss of directional control when braking in typical use of at least some preferred embodiments , the manual brake system already in place and certified on a vehicle is not impacted by the addition of the antiskid system . all elements of a manual brake system , shown by way of example in fig2 a and 2b , remain operational on the vehicle when the electronically controlled antiskid system is not operating . this is important for aircraft where re - certifying the entire brake system is impractical due to the added cost and the need to comply with the most current certification requirements . at least some preferred embodiments can be retrofit on vehicles already in operation or may be installed in new production vehicles as they are being manufactured . in some cases , a retrofit can be performed by replacing the current master cylinder with a plug and play replacement called an electric master cylinder . in at least some preferred embodiments , the electronic controller of the antiskid system for manual brakes can be adapted from electronic controllers for antiskid systems for powered brakes . this includes both analog and digital controller designs that are available today . in addition , antiskid software algorithms for powered brake systems can also be adapted to be used in at least some preferred embodiments . adapting current antiskid electronics and software for the electronic controller in at least some preferred embodiments is attractive to perspective manufacturers in the antiskid brake business as it can reduce both the development time and cost to manufacture . most currently known antiskid controllers compare the wheel speeds of all of the wheels on the vehicle to determine if a skidding event is occurring or about to occur with one or more of the wheels . some electronic controllers use software algorithms to estimate the vehicle &# 39 ; s “ reference ” or ground speed . other antiskid controllers use inputs from other systems on board the vehicle to determine the estimated ground or reference speed . a function that can be added to some embodiments of the present invention is a global positioning system ( gps ) capability that calculates the ground speed of the vehicle using gps satellite data . at least some preferred embodiments of the present invention may be implemented with an advanced controller for aircraft and motorcycles applications or a basic controller sufficient for bicycle applications . for example , without limitation , a simple version of the electronic controller may be used on off road bicycles when a cyclist needs to maintain maximum braking and directional control when riding down a step dirt hill . in this non - limiting example , the electronic controller is an on / off switch that the cyclist holds “ on ” to engage the antiskid actuator in a “ pulse the brakes mode ” when the antiskid function is needed . at least some preferred embodiments of the present invention may utilize either type of automotive wheel speed sensors : the variable - reluctance or the magneto - resistive type of sensor . these sensors are environmentally rugged , lightweight , compact and low cost , and magneto - resistive wheel speed sensors can operate down to zero wheel speeds . furthermore , wheel speed sensors in at least some preferred embodiments are not mounted inside the axle of the wheel . wheel speed sensors typically use a gear shaped device called a tone ring to disrupt the magnetic field around the wheel speed sensor . aircraft wheel speed sensors integrate the tone rings with the senor into a single unit that is mounted inside the aircraft &# 39 ; s axle . this is not practical on general aviation aircraft due to the small axle diameters . the wheel speed sensor used in at least some preferred embodiments is located outside the axle . in addition in at least some preferred embodiments , the tone ring can be integrated into the brake disc for vehicles that utilize a disc brake . this is done by forming a gear shape in the outside or inside diameter of the brake disc . this can be done on aircraft , motorcycles or bicycles and can reduce weight and system complexity . there are several groups of people that could benefit from an electronically controlled antiskid system for vehicles with manual brakes in accordance with at least some preferred embodiments of the present invention . pilots of general aviation ( ga ) aircraft can utilize at least some preferred embodiments to increase safety and reduce operating costs . the landing phase of flight has the highest accident rate and loss of direction control is the biggest accident factor in this category . having an antiskid system available for ga aircraft pilots could improve aircraft safety and increase pilots &# 39 ; peace of mind . flight schools may also be interested in having the antiskid function according to at least some preferred embodiments on their ga aircraft since they typically experience two blown tires a year per aircraft from excessive braking by students . manufacturers of ga aircraft with manual brake systems may also be interested in at least some preferred embodiments , as they could create more sales . with at least some preferred embodiments , manufacturers of aircraft brakes and antiskid systems would be able to enter the untapped retrofit market with over 200 , 000 ga airplanes flying today with manual brakes and no antiskid system available for these aircraft . motorcycle manufactures may be interested in at least some preferred embodiments for motorcycles with manual brakes as many motorcycle manufacturers continue to provide more safety features on their vehicles , similar to cars to promote safety and increase sales . at least some preferred embodiments would be particularly beneficial for motorcycles that are operated in wet or icy conditions . with at least some preferred embodiments manufacturers of motorcycle brakes would also be able to enter the untapped retrofit market with millions of motorcycles in use today with manual brakes and no antiskid system available for these vehicles . bicycle manufactures may be interested in at least some preferred embodiments for bicycles operated in wet and icy conditions and for bicycles operated by off - road cyclists that need enhanced skid and directional control when riding their bicycles in the dirt or mud . with at least some preferred embodiments manufacturers of bicycle brakes would be able to enter the untapped retrofit market with millions of bicycles in use today with manual brakes and no antiskid system available for these vehicles . in a basic embodiment of the present invention , an antiskid system uses an actuator assembly to move a brake linkage to reduce the force that an operator is applying to a brake pad . the actuator assembly that moves the brake linkage utilizes a pulsing motion to reduce the average force that is being applied to the brake pad to reduce or eliminate tire skid . in this basic embodiment , the antiskid system also uses an electronic controller that is an on / off switch that is actuated by the vehicle &# 39 ; s operator to turn on the actuator assembly that pulses the manual brake linkage to reduce or eliminate tire skid . a typical application this embodiment is on a bicycle . in an advanced embodiment of the present invention , an antiskid system uses an actuator assembly that can set and hold a position of a manual brake linkage to modulate the force on a brake pad . wheel speed sensors and optional gps data are used by an electronic controller to detect a skidding event . when a skidding event is detected , the electronic controller automatically commands the actuator to modulate the brake force to reduce tire skid . this advanced embodiment provides more efficient antiskid protection than a basic embodiment . a typical application for the present embodiment is on ga aircraft and motorcycles . fig3 a , 3 b and 3 c are schematic diagrams showing an exemplary manual brake system for one wheel on a vehicle , in accordance with an embodiment of the present invention . fig3 a is an overall view of a simple hydraulic system with three alternate locations for a lock and release assembly and an actuator assembly , and fig3 b is a close - up view of a fourth alternate location for the lock and release assembly and the actuator assembly in the simple hydraulic system . fig3 c is an overall view of a more complex mechanical system with six alternate locations for the lock and release assembly and the actuator assembly . the present embodiment may be used on vehicles with two main wheels each with a separate brake and an independent hand or foot brake lever that is used by an operator to actuate and power the brakes . the wheels may be located in the front and rear of these vehicles such as in motorcycles and bicycles , or they may be located on the left and right side of these vehicles such as in ga aircraft . referring to fig3 a , the brake system uses the force applied to a brake lever 200 by the operator &# 39 ; s hand or foot to create the hydraulic brake pressure . hydraulic pressure is created by transferring the force from the operator &# 39 ; s hand or foot to brake lever 200 to an input shaft 201 that is connected to a piston 203 in a hydraulic master cylinder 202 . hydraulic piston 203 is contained in a cavity within master cylinder 202 in such a manner that hydraulic pressure is created in proportion to the force applied to brake lever 200 by the operator &# 39 ; s hand or foot . a hydraulic pipe 204 connects master cylinder 202 to a hydraulic brake cylinder 111 . hydraulic brake cylinder 111 comprises a brake piston 112 that is connected to a brake pad 113 , which is pushed against a brake disc / drum 114 creating the friction to slow the turning disc / drum 114 that is connected to a wheel 115 . this action slows and stops the vehicle . in the present embodiment , the antiskid system comprises a lock and release assembly , an actuator assembly and an electronic controller . the actuator assembly may comprise a gearmotor and pulses the brake linkage to reduce the average force on the brake pads . the lock and release assembly connects the actuator assembly to the brake linkage when the antiskid function is needed and disconnects the actuator assembly from the brake linkage when the antiskid function is not needed or if there is a loss of electrical power . there is a lock and release assembly for each actuator assembly . the actuator assembly and the lock and release assembly can be powered by the vehicle &# 39 ; s electrical system or by a portable battery . the lock and release assembly and the actuator assembly can be located in several positions through out the manual hydraulic brake linkage system . for example without limitation , a lock and release assembly 301 a and an actuator assembly 302 a are shown mounted at brake lever 200 , a lock and release assembly 301 b and an actuator assembly 302 b are shown mounted near input shaft 201 , and a lock and release assembly 301 c and an actuator assembly 302 c are shown mounted near brake pad 113 . referring to fig3 b , a fourth exemplary location of a lock and release assembly 301 d and an actuator assembly 302 d is shown mounted in hydraulic piping 204 using a hydraulic cylinder 304 . lock and release assembly 301 d may be located anywhere along hydraulic piping 204 . in some hydraulic brake system there is limited access to the mechanical linkage . when this is the case , a hydraulic cylinder 304 can be placed any convenient location in the brake line 204 as shown in fig3 b . the shaft on the hydraulic cylinder 304 provides a mechanical linkage for connecting actuator assembly 302 d and lock and release assembly 301 d . in the present embodiment , the electronic controller used on the manual hydraulic and mechanical brake system is an on / off switch that is actuated by the vehicle &# 39 ; s operator to turn on actuator assembly 302 a , 302 b , 302 c , or 302 d that pulses the manual brake linkage to reduce or eliminate tire skids . the switch also turns on lock and release assembly 301 a , 301 b , 301 c , or 301 d to connect actuator assembly 302 a , 302 b , 302 c , or 302 d to the brake linkage . a typical application for an electronic controlled antiskid system utilizing an on / off switch is on a bicycle . in an alternate embodiment , the system comprises an actuator assembly with a gearmotor that pulses the brake linkage to reduce the average force on the brake pads without a lock and release assembly . there may be an actuator assembly for one or both wheels . the actuator assembly may be powered by the vehicle &# 39 ; s electrical system or by a portable battery . the lock and release assembly may be eliminated when the configuration of the brake linkage enables the actuator assembly to engage and disengage the brake linkage without the need for a connection device . this is the case on some bicycle brake systems where the actuator assembly moves the scissor type brake linkages at the brake pads or when the actuator assembly moves the brake handle . when there is no lock and release assembly , a position switch is required to turn off the actuator assembly at its most refracted position . referring to fig3 c , the manual mechanical brake system for a motorcycle or bicycle is shown . these vehicles have two main wheels each with a separate brake and an independent hand or foot brake levers that are used by the operator to actuate and power the brakes . only the brake system for the rear wheel is shown ; although , there may also be a manual mechanical brake system for the front wheel on motorcycles and bicycles . in the present embodiment , the vehicle operator provides the power for the actuation of the brakes by pushing or pulling on brake lever 200 with his hand or foot . brake lever 200 is coupled to a mechanical lever 206 with a rod or cable 205 . when the operator pushes or pulls on brake lever 200 , mechanical lever 206 pulls or pushes rod or cable 207 that is connected to a mechanical lever 208 that is connected to brake pad 113 by a rod or cable 207 . brake pad 113 is pushed against brake disc / drum 114 creating the friction to slow the turning brake disc / drum 114 that is connected to wheel 115 . this action slows or stops the vehicle . in alternate embodiments the number and arrangement of rods , cables and levers may vary depending on the particular geometry of the vehicle . in the present embodiment , a lock and release assembly , an actuator assembly and an electronic controller is added to the manual mechanical brake system . as in the simple system , the lock and release assembly and the actuator assembly can be located in several positions through out the manual mechanical brake linkage system . for example , without limitation , a lock and release assembly 301 e and an actuator assembly 302 e are shown mounted near brake lever 200 , a lock and release assembly 301 f and an actuator assembly 302 f are shown mounted along rod or cable 205 , a lock and release assembly 301 g and an actuator assembly 302 g are shown mounted on mechanical lever 206 , a lock and release assembly 301 h and an actuator assembly 302 h are shown mounted along rod or cable 207 , a lock and release assembly 301 i and an actuator assembly 3021 are shown mounted on mechanical lever 208 , and a lock and release assembly 301 j and an actuator assembly 302 j are shown mounted near brake pad 113 . hybrid manual brake systems exist that combine hydraulic and mechanical linkages to couple the operator &# 39 ; s hand and / or foot movements to operate and power the brake mechanism . the brake pads in these hybrid manual brake systems can be mechanically or hydraulically actuated . in alternate embodiments the features and functions described above for the manual hydraulic and manual mechanical brake systems can be used in their respective locations in these hybrid systems . fig4 a and 4b are schematic diagrams illustrating an exemplary electronic controller for an antiskid system for manual brakes , in accordance with an embodiment of the present invention . fig4 a shows the electronic control as an on / off switch 400 , and fig4 b shows the electronic control with the addition of a rheostat 407 . referring to fig4 a , an electricity source 401 is connected to on / off switch 400 by an electrical cable 402 . electricity source 401 may be various different types of electricity sources such as , but not limited to , a vehicle power source , batteries , etc . on / off switch 400 supplies a lock and release assembly 301 and an actuator assembly 302 with electrical power through an electrical cable 403 . when an operator closes on / off switch 400 , lock and release assembly 301 connects to the brake linkage and actuator assembly 302 pulses the brakes . when the operator opens on / off switch 400 , actuator assembly 302 stops pulsing the brakes and lock and release assembly 301 disconnects from the brake linkage . in alternate embodiments the functionality of the electronic controller may be increased by replacing on / off switch 400 with other types of switches . one alternate embodiment comprises a force switch that is mounted in the brake linkage and closes when a specific brake force is reached . this turns on the actuator assembly and the lock and release assembly connecting the actuator assembly to the brake linkage . when the brake force drops below a specific level , the force switch opens and the actuator assembly stops pulsing the brakes and the lock and release assembly disconnects from the brake linkage . in this embodiment , a separate force switch is required for each actuator assembly . in another alternate embodiment , a pressure switch is mounted in the hydraulic circuit and closes when a specific brake pressure is reached . this turns on the actuator assembly and the lock and release assembly connecting the actuator assembly to the brake linkage . when the brake pressure drops below a specific level , the pressure switch opens and the actuator assembly stops pulsing the brakes and the lock and release assembly disconnects from the brake linkage . the pressure switch only works with manual hydraulic brake systems . in this embodiment , a separate pressure switch is needed for each actuator assembly . in another alternate embodiment , an inertia switch is mounted to the vehicle and closes when a specific deceleration level is reached . this switch turns on the actuator assembly and the lock and release assembly connecting the actuator assembly to the brake linkage . when the vehicle &# 39 ; s deceleration drops below a specific level , the inertia switch opens and the actuator assembly stops pulsing the brakes and the lock and release assembly disconnects from the brake linkage . only one inertia switch is needed for all of the actuator assemblies in this embodiment . in yet another alternate embodiment , on / off switch 400 is replaced with a rheostat that is actuated by the vehicle &# 39 ; s operator in order to turn on the actuator assembly that pulses the manual brake linkage to reduce or eliminate tire skids . the rheostat enables the operator to vary the voltage , which in turn varies the frequency of the pulses from the actuator assembly . the rheostat also activates and disengages the lock and release assembly . in the present embodiment , a rheostat is need for each actuator assembly . referring to fig4 b , rheostat 407 is used in the present embodiment in combination with a switch 404 . in order to function properly with rheostat 407 , switch 404 is preferably a force switch , a pressure switch , or an inertia switch . the vehicle &# 39 ; s operator manually controls the speed of the actuator assembly that varies the frequency of the pulses to the brake linkage using rheostat 407 . rheostat 407 is used after switch 404 automatically turns on the actuator assembly . in the present embodiment , a rheostat is needed for each actuator assembly . in the present embodiment , the electronic controller uses on / off switch 400 actuated by the vehicle &# 39 ; s operator or automatic switch 404 to turn on actuator assembly 302 that pulses the manual brake linkage to reduce or eliminate tire skids . once actuator assembly is turned on , rheostat 407 may be actuated by the operator to control the pulsing of actuator assembly 302 . switch 400 or 404 also turns on lock and release assembly 301 to connect actuator assembly 301 to the brake linkage . a typical application for an electronic controlled antiskid system in accordance with the present embodiment is in a bicycle . alternate embodiments of the present invention may incorporate an electronic controller that increases its functionality by incorporating a wheel speed sensor and a tone ring for each wheel that is coupled to a computing device such as , but not limited to , a smart phone by a wire or wireless connection . the tone ring and brake disc can be integrated into one assembly by making a gear shape on the inside or outside diameter of the brake disc . the wheel speed sensor and tone ring are preferably mounted outside the axle rather than inside the axle . the computing device may also comprise a gps capability like those found on smart phones . with the use of application software , the computing device may interpret the wheel speed and compare it to the gps ground speed calculated by the computing device . the electronic controller includes brake release switches for each wheel that enable the operator to manually turn the gearmotors in the actuator assemblies on or off to pulse the brake linkages or to stop the pulsing . earphones located on the operator &# 39 ; s left and right ears are connected to the computing device by wire or wireless connection . when the computing device determines that a wheel is skidding or about to skid , the computing device sends a tone to the left or right ear corresponding to the brake release switch that needs to be turned on to pulse the appropriate brake . the tone continues until the skidding stops to alert the operator to turn off the pulsing . in alternate embodiments a visual signal may be sent to the operator to warn the operator of wheel skidding , for example , without limitation , a flashing light on a control panel . in the present embodiment , the electronic controller can be powered by the vehicle &# 39 ; s electrical system or by a portable battery . in some embodiments rheostats can be used instead of on / off switches to vary the frequency of the pulses to the brake linkage . the embodiments described in the foregoing are directed to relatively basic implementations of an electronically controlled antiskid system for manual hydraulic and mechanical brake systems . however , the embodiments illustrated by way of example in fig3 a , 3 b and 3 c may also be implemented as a more advanced system by incorporating an electronic controller with advanced functions . fig5 is a schematic diagram of an exemplary electronic controller 500 in an electronically controlled antiskid system installed on two wheels 115 of a vehicle , in accordance with an embodiment of the present invention . in the present embodiment , the system comprises an actuator assembly 302 to set and hold a position of the brake linkage . this enables advanced electronic controller 500 to modulate the force from the brake pads on brake discs / drums 114 . modulating the force from the brake pads is more effective at preventing tire skids than pulsing the brake pads , which is done in the foregoing embodiments . in the present embodiment , a switch is not required to actuate the antiskid system . instead , advanced electronic controller 500 monitors the speed of wheels 115 as detected by wheel speed sensors 116 to determine if one wheel is rotating at a slower speed than the other wheel . advanced electronic controller has electronic circuitry that can provide the electrical power for wheel speed sensors 116 and receive the wheel speed data for each wheel 115 through electric cables 118 . in alternate embodiments the advanced electronic controller may be connected to the wheel speed sensors through a wireless connection . in the present embodiment , a tone ring 117 turns with wheel 115 and creates a magnetic field disruption that can be detected by wheel speed sensors 116 to enable wheel speed sensor 116 to determine the wheel speed . in alternate embodiments , the tone ring and the brake disc / drum can be integrated into one assembly by making a gear shape on the inside or outside diameter of the brake disc / drum . in the present embodiment , wheel speed sensor 116 and tone ring 117 are mounted outside the axle . based on the difference in wheels speeds and the rate of change of the wheel speeds , advanced electronic controller 500 determines if a skid event is occurring or about to occur . advanced electronic controller 500 also may use an optional global positioning signal ( gps ) to calculate the vehicle &# 39 ; s ground or reference speed . this feature enhances the ability of advanced electronic controller 500 to detect and control skidding events . when advanced electronic controller 500 detects a skidding event , it automatically commands a lock and release assembly 301 to connect actuator assembly 302 to the brake linkage system . advanced electronic controller 500 then commands actuator assembly 302 to move the brake linkage a specific distance . when the brake linkage is moved , the force on the brake pads is reduced . no matter how hard the vehicle &# 39 ; s operator pushes or pulls on the brake lever , it cannot be converted into a force on the brake pads because the brake linkage is generally prevented from moving . once the skid is prevented , reduced or eliminated , advanced electronic controller 500 de - energizes lock and release assembly 301 , which disconnects actuator assembly 302 from the brake linkage system , and actuator assembly 302 is commanded by advanced electronic controller 500 to return to its home position . with the antiskid system in its standby mode , the manual hydraulic or mechanical brake system remains fully functional until a new skid event is detected and the antiskid process is repeated again . the antiskid system remains in standby mode as long as the antiskid function is not needed or if there is a loss of electrical power . in an alternate embodiment , an advanced electronic controller may be used to pulse the actuator assembly rather than modulating the force on the brake pads . an advantage of the advanced form of electronic controller 500 for an antiskid system for manual brakes is that electronic controller 500 can be adapted from the electronic controllers for antiskid systems for powered brakes . this includes both analog and digital controller designs that are available today . in addition , antiskid software algorithms for powered brake systems can also be adapted to be used with electronic controller 500 . adapting current antiskid electronics and software for electronic controller 500 makes it attractive to perspective manufacturers in the antiskid business as it will reduce both the development time and cost if they are licensed to produce an antiskid system according to the present embodiment . advanced electronic controller 500 also has the computing power to capture and annunciate faults with the antiskid system . advanced electronic controller 500 also provides an interface connection with the antiskid control panel located at the operator &# 39 ; s station . advanced electronic controller 500 may be powered by the vehicle &# 39 ; s electrical system or by a portable battery . in the present embodiment , actuator assembly 302 moves the brake linkage to reduce the force that is being applied to the brake pads and thus reduce or eliminate the tire skid . actuator assembly 302 must have enough power to overcome the input force being applied by the operator &# 39 ; s hand or foot . as shown by way of example in fig3 a , 3 b and 3 c , actuator assembly 302 can be located in several locations throughout the hydraulic or mechanical brake linkage system . the power needed to overcome the mechanical leverage depends on where actuator assembly 302 is located in the brake linkage system . actuator assembly 302 only needs to move the brake pad a small distance to reduce the force on brake disc / drum 114 . for example , without limitation , testing has shown that when actuator assembly 302 is connected to the input shaft of the master cylinder , the input shaft must only move 0 . 07 inches to reduce the pressure from 400 psi to 50 psi . electricity is the primary source of power for actuator assembly 302 . power may be provided from the vehicle &# 39 ; s electrical system , the vehicle &# 39 ; s battery , or a portable battery through advanced electronic controller 500 . advanced electronic controller 500 is connected to lock and release assembly 301 and actuator assembly 302 through an electric cable 501 . vehicles with manual brake systems that have an electrical system usually have a direct current ( dc ) system . consequently , actuator assembly 302 typically uses dc electricity . however , alternating current ( ac ) electricity can also be used with actuator assembly 302 by converting the vehicle &# 39 ; s dc electrical power to ac electrical power for the antiskid system . actuator assembly 302 is typically driven by an electric motor ; however , a hydraulic or pneumatic motor can also drive actuator assembly 302 . when a hydraulic or pneumatic motor is used , an electric motor drives a hydraulic or pneumatic pump that in turn drives the hydraulic or pneumatic motor that drives actuator assembly 302 . power can also be provided from an accumulator or tank that contains compressed gas that can drive a hydraulic or pneumatic motor . the accumulator can directly power a hydraulic or pneumatic cylinder . the motors that drive actuator assembly 302 in most implementations use a gearbox to reduce the speed and increase the torque of the output shaft of the motor . the gearbox can be integral with the motor or can be independent from the motor . the function of actuator assembly 302 is to move the brake linkage a small distance to reduce the force on the brake pad . therefore , the electric , hydraulic or pneumatic motors , with and without gearboxes , in some cases must convert their rotary output motion into a linear motion . fig6 a through 6k illustrate eleven different exemplary methods to drive an actuator assembly , in accordance with embodiments of the present invention . fig6 a shows a piston . fig6 b shows a bellows actuator 602 . fig6 c shows an inflatable accumulator 603 . fig6 d shows a motor 604 with a screw 606 . fig6 e shows motor 604 with helical gears 608 . fig6 f shows motor 604 with a worm gear 609 . fig6 g shows motor 604 with a gear 612 and a gear rack 613 . fig6 h shows motor 604 with scissor arms 616 . fig6 i shows motor 604 with a cam 617 . fig6 j shows motor 604 with a lever arm 619 . fig6 k shows an electric solenoid 621 . any of these methods can be used with an electronically controlled antiskid brake system for manual brakes to drive the actuator assembly . fig6 a through 6c show three methods for converting hydraulic or pneumatic power into a linear motion . referring to fig6 a , a cylinder 600 comprises a piston inside to drive an output shaft 601 in a linear motion . referring to fig6 b , bellows actuator 602 expands or contracts with the hydraulic or pneumatic power exerted onto it to convert this power into a linear motion . referring to fig6 c , inflatable accumulator 603 converts hydraulic or pneumatic power into a linear motion in the same manner as bellows actuator 602 . fig6 d through 6j use motor 604 to drive the actuator assembly . motor 604 can be electric , hydraulic or pneumatically powered . motor 604 uses a gearbox 605 to reduce the speed of the output shaft and increase the torque ; however , all of these methods may be implemented without a gearbox . motor 604 turns continuously and has the ability to reverse its rotation . motor 604 and gearbox 605 convert the rotary motion of the output shaft of motor 604 into a linear motion to move the brake linkage . referring to fig6 d , a nut 607 moves along screw 606 to convert the rotary motion of screw 606 into linear motion . referring to fig6 e , two helical gears 608 interconnect so that the rotation of one helical gear 608 translates into the linear motion of the other helical gear 608 . referring to fig6 f , worm gear 609 interconnects with a worm wheel 610 to drive a connecting rod 611 in a linear motion . referring to fig6 g , gear 612 and gear rack 613 interconnect so that the rotation of gear 612 moves gear rack 613 in a linear motion . referring to fig6 h , scissor arms 616 are connected to motor 604 with a screw 615 and a nut 614 . as screw 615 rotates , nut 614 moves along screw 615 and scissor arms 616 move up and down . referring to fig6 i , cam 617 rotates , moving a cam follower 618 in a linear motion . referring to fig6 j , lever arm 619 drives a connecting rod 620 in a linear motion . referring to fig6 k , electric solenoid 621 pulls or pushes an armature 622 with a magnetic field . armature 622 moves the brake linkage . those skilled in the art , in light of the present teachings , will readily recognize that a multiplicity of other suitable means may be used to drive the actuator assembly in alternate embodiments . for example , without limitation , an electric servomotor may be used to drive the actuator assembly . the servomotor utilizes an electric motor coupled to a gearbox that has an electronic sensor that monitors the rotation and position of the output shaft of the gearbox . with the use of an electronic servo controller , the output shaft of the servomotor can be commanded to rotate a specific distance and hold that position . in other non - limiting examples , the actuator assembly may utilize the independent elements described above and couple them together in various configurations . these elements can include , without limitation , combinations of electric motors , hydraulic or pneumatic pumps and motors , many different devices to convert rotary to linear motion , solenoids , hydraulic or pneumatic actuators and servomotors . these elements may also be integrated into sub - assemblies or complete assemblies to form the actuator assembly . at least some preferred embodiments of the present invention may utilize one of two types of actuator assemblies . for example , without limitation , in a basic implementation , the actuator assembly 302 pulses the brakes by moving the brake linkage back and forth a short distance at a rate of several times a second . the linear actuators described above by way of example with respect to fig6 d through 6h can pulse the brake linkages by reversing motor 604 several times a second . if a hydraulic or pneumatic cylinder is used to pulse the brake linkage as shown by way of example in fig6 a through 6c , a control valve is needed to change the linear direction of cylinder 600 . when a cam is used to convert the rotary motion of the output shaft of motor 304 into a linear motion as shown by way of example in fig6 i , motor 304 does not need to be reversed to pulse the brake linkage . electric solenoid 621 can be used to pulse the brake linkage by turning solenoid 621 on and off . in more advanced implementations , the actuator assembly utilizes a servomotor that the electronic controller can command to move the brake linkage a specific distance and hold a position . when the brake system linkage is moved , the force on the brake pads is reduced . no matter how hard the vehicle &# 39 ; s operator pushes or pulls on the brake lever , the force cannot be converted into a force on the brake pads because the brake system linkage is generally prevented from moving . in at least some preferred embodiments the lock and release assembly connects the actuator assembly to the brake linkage . this connection is made when the antiskid function is needed to reduce the force on the brake pads to reduce or eliminate tire skids . the lock and release assembly must have enough power to connect it to the brake linkage and support the force applied by the actuator assembly . as shown by way of example in fig3 a , 3 b and 3 c , the lock and release assembly can be located in several locations throughout the hydraulic or mechanical brake linkage . the power required to overcome the mechanical leverage depends on where the lock and release assembly is located in the brake linkage . testing has shown that when the actuator assembly is connected to the input shaft of the master cylinder , the lock and release assembly must support a maximum force of approximately 225 pounds , which equates to 600 psi . this is roughly 50 % more pressure than the maximum operating pressure of the manual hydraulic brake system . when the antiskid function is no longer needed , the lock and release assembly disconnects the actuator assembly from the brake linkage . this enables the normal manual brake operation to resume . on some vehicles , the release function must occur even when there is a power failure . in these cases a spring release is used that operates under the maximum load conditions . this is referred to as a fail - safe mode . fig7 a through 7j illustrate ten different exemplary methods of connecting a lock and release assembly to a brake linkage shaft 201 , in accordance with embodiments of the present invention . fig7 a shows a locking tab method . fig7 b shows a locking clamp method . fig7 c shows a wire lock method . fig7 d shows a tapered wedge method . fig7 e shows a dual cam lock method . fig7 f shows a strap clamp method . fig7 g shows a locking collar method . fig7 h shows an external fork method . fig7 i shows an iron particle method , and fig7 j shows a hydraulic piston method . referring to fig7 a , a hole in a locking tab 700 connects locking tab 700 to brake linkage shaft 201 when one end of locking tab 700 is moved in a parallel direction to brake linkage shaft 201 . the diameter of the hole is slightly larger than brake linkage shaft 201 . the thickness of locking tab 700 is preferably sized to create enough locking force while providing enough material not to deform under load . a pivot edge 701 partially establishes the force that is required to release locking tab 700 . varying the distance from brake linkage shaft 201 to pivot edge 701 changes the force required to release locking tab 700 . referring to fig7 b , two jaws made of metal or other high strength material connect to brake linkage shaft 201 when the jaws are moved towards each other to create a locking clamp 702 . a pivot point 703 located close to brake linkage shaft 201 creates additional leverage when the other end of the jaws of locking clamp 702 are brought together . referring to fig7 c , a wire lock 704 is created by wrapping a coil of wire around brake linkage shaft 201 and pulling tightly on both ends of the wire . referring to fig7 d , a tapered wedge 705 is inserted into a tapered groove 706 to make a firm connection with brake linkage shaft 201 . referring to fig7 e , a dual cam lock 707 firmly connects to brake linkage shaft 201 when the cams are rotated . referring to fig7 f , the ends of a strap 708 are pulled tight in relation to a support collar 709 to connect to brake linkage shaft 201 . referring to fig7 g , a locking collar 711 is connected to brake linkage shaft 201 by inflating a ring 710 with air or fluid . referring to fig7 h , a tapered fork 712 is placed over the outside diameter of brake linkage shaft 201 . the outside diameter of brake linkage shaft 210 and the inside surface of tapered fork 712 may have matching grooves 713 to increase the integrity of the connection . referring to fig7 i , brake linkage shaft 201 comprises a piston 715 attached to brake linkage shaft 201 inside a cylinder 719 . also inside cylinder 719 are iron particles 714 that become rigid when electrified . when iron particles 714 are electrified , cylinder 719 locks to piston 715 and brake linkage shaft 201 . referring to fig7 j , a hydraulic piston 716 connects to brake linkage shaft 201 . this is done by preventing hydraulic fluid 720 from flowing freely in interconnected pipes 717 when a valve 718 is closed . piston 716 connected to brake linkage shaft 210 is unable to move when fluid 720 is locked in place . those skilled in the art , in light of the present teachings , will readily recognize that a multiplicity of different suitable means may be used to connect the lock and release assembly the brake linkage , which enables the actuator assembly to move the brake linkage and reduce the force on the brake pads . the lock and release assembly in at least some preferred embodiments requires an actuator to connect and disconnect it from the brake linkage . electricity is the primary source of power for the lock and release assembly . power may be provided from the vehicle &# 39 ; s electrical system , the vehicle &# 39 ; s battery , or a portable battery . vehicles with manual brake systems that have an electrical system typically have a direct current ( dc ) system . therefore , the lock and release assembly normally uses dc electricity . however , alternating current ( ac ) electricity can also be utilized to power the lock and release assembly . the lock and release assembly can be driven by an electric motor . a hydraulic or pneumatic motor can also drive the lock and release assembly . when a hydraulic or pneumatic motor is used , an electric motor drives a hydraulic or pneumatic pump that in turn drives the hydraulic or pneumatic motor that drives the lock and release assembly . power can also be provided from an accumulator or tank that contains compressed gas that can drive a hydraulic or pneumatic motor . the accumulator can also directly power a hydraulic or pneumatic cylinder to operate the lock and release assembly . when motors are used to drive the lock and release assembly , the motors in most cases use a gearbox to reduce the speed and increase the torque of the output shaft of the motor . the gearbox can be integral with the motor or it can be independent from the motor . the lock and release assembly may use an electric , hydraulic or pneumatic motor , with or without a gearbox , and in some cases the rotary output motion of the motor must be converted into a linear motion . fig6 d through 6j illustrate seven exemplary methods for converting the rotary motion of the output shaft of a motor or gearbox to a linear motion . any of these methods or other methods may be used with the lock and release assembly to convert the rotary motion of a motor or gearbox to a linear motion to move the brake linkage . for example , without limitation , when a hydraulic or pneumatic source of power is available , a hydraulic or pneumatic cylinder can be used to operate the lock and release assembly . these cylinders can utilize a piston , bellows or inflatable bag to convert the hydraulic or pneumatic energy into a linear motion , as shown by way of example in fig6 a through 6c . an electric solenoid can also be used to operate the lock and release assembly by applying electrical power to a coil , which moves an armature with its magnetic field to move the lock and release assembly , as illustrated by way of example in fig6 k . the lock and release assembly can utilize the independent elements described above and couple them together in various different combinations . these elements may include , without limitation , combinations of electric motors , hydraulic or pneumatic pumps and motors , many different devices to convert rotary to linear motion , solenoids , hydraulic or pneumatic actuators and servomotors . these elements can also be integrated into sub - assemblies or complete assemblies to form the lock and release assembly . as described in foregoing , there are many methods for incorporating the lock and release assembly and the actuator assembly for an electronically controlled antiskid system for vehicles with manual brakes in accordance with at least some preferred embodiments of the present invention . the following description outlines a preferred method of incorporating the lock and release assembly and the actuator assembly in a manual hydraulic brake system . on manual hydraulic brake systems , the master cylinder , the lock and release assembly and the actuator assembly can be combined into an integrated package that is referred to herein as an electric master cylinder ( emc ). the master cylinder in the integrated package maintains the same geometry and retains the same functions as the manual master cylinder that has been certified for the vehicle . this enables the original manual brake system to remain certified and fully functional when the electronic controlled antiskid system is not operating . fig8 is a side view of an exemplary electric master cylinder ( emc ) with an integrated actuator assembly 302 , in accordance with an embodiment of the present invention . in the present embodiment , the emc comprises a motor 800 to control the movements of an input shaft 201 . motor 800 in the emc may one of two different types of electrical motors . the first type is a servomotor that supports an advanced implementation because the servomotor can rotate an output shaft 802 to a specific position as directed by an electronic controller . this controls the distance that input shaft 201 moves , giving the system the ability to modulate the hydraulic brake pressure . this pressure modulation feature increases the efficiency of the antiskid system . the second type of motor that can be used on the emc is a gearmotor . when energized , the gearmotor rotates continuously . this in turn rotates a cam 803 continuously raising and lowering input shaft 201 a set distance . the gearmotor “ pulses ” the brakes to reduce tire skidding . because the hydraulic brake pressure cannot be modulated , the gearmotor configuration is a less efficient antiskid system compared to the servomotor configuration . a position switch is required to stop the gearmotor when the cam is in its lowest position . in the present embodiment , electric motor 800 is attached to a master cylinder 202 . attached to output shaft 802 of motor 800 is a drive train 804 . drive train 804 couples output shaft 802 of motor 800 to cam 803 . several different types of drive trains can be used such as , but not limited to , gears ( as shown ), sprockets and chain , belts and pulleys , etc . any of these drive trains may be used with either a servomotor or a gearmotor . in addition , the servomotor can use a push / pull rod to connect output shaft 802 to cam 803 because the output shaft of a servomotor only rotates approximately 90 degrees . one end of drive train 804 is centrally located about output shaft 802 of motor 800 and the other end is centrally located about input shaft 201 of master cylinder 202 . mounted under cam 803 is a thrust bearing 805 . thrust bearing 805 reduces the friction and torque in drive train 804 from the force applied to input shaft 201 from a brake lever by an operator &# 39 ; s hand or foot . attached to drive train 804 and located at input shaft 201 is cam 803 . cam 803 uses ramps to raise and lower cam followers 806 when drive train 804 is rotated by motor 800 . cam 803 has one ramp for each cam follower 806 . the slope of the ramps determines the rate and amount of modulation or pulsing on the brake system &# 39 ; s hydraulic pressure . in the present embodiment , actuator assembly 302 comprises motor 800 , output shaft 802 , cam 803 , drive train 804 , and thrust bearing 805 , and these items can be located radially in any position about input shaft 201 to create a compact design to facilitate the retrofit replacement of the manual master cylinder 202 with the integrated emc in the vehicle . in the present embodiment , a lock and release assembly 301 is also integrated into the emc . lock and release assembly 301 comprises cam followers 806 an electric lock solenoid 807 , a mounting block 808 , axles 809 , a pivot edge 810 , a lock tab 811 , a lock solenoid armature 812 , a nut 813 , a washer 814 a release spring 815 , a fastener 816 , and anti - rotation ears 817 . lock and release assembly 301 can be located radially in any position about input shaft 201 to create a compact design to facilitate the retrofit replacement of the manual master cylinder 202 with the emc . lock and release assembly 301 connects actuator assembly 302 to input shaft 201 when there is a skidding situation . electric lock solenoid 807 is energized by the electronic controller when lock and release assembly 301 needs to connect to input shaft 201 when the brake pressure must be lowered to generally prevent , reduce or eliminate a tire skid . the electrically actuated lock solenoid 807 is used in the present embodiment so that , if there is a loss of electrical power , the antiskid system automatically disconnects from input shaft 201 and the manual brake system remains fully operational . however , in alternate embodiments the lock and release assembly may use other connection means such as , but not limited to , those shown by way of example in fig6 a through 6j . in the present embodiment , lock and release assembly 301 is integrated with manual master cylinder 202 and is centrally located about input shaft 201 of master cylinder 202 . lock and release assembly 301 comprises at least two cam followers 806 equally spaced around input shaft 201 . multiple cam followers 806 are needed to generally prevent side loading of input shaft 201 when cam 803 is rotated and input shaft 201 is raised and lowered . cam followers 806 ride on the ramps of cam 803 . when cam 803 is rotated by motor drive assembly 804 , cam followers 806 are raised and lowered by rolling up and down the ramps of cam 803 . a mounting block 808 is required to secure cam followers 806 and lock solenoid 807 together as a single unit . mounting block 808 has a vertical hole through it that centrally locates it about input shaft 201 . rocking of mounting block 808 about input shaft 201 is preferably minimized by having a close tolerance hole for input shaft 201 with a sufficient length to diameter ratio . protruding from mounting block 808 are axles 809 , which are used to attach cam followers 806 to mounting block 808 . mounting block 808 comprises pivot edge 810 located a short distance from input shaft 201 . this distance partially determines the lock and release loads for lock tab 811 . also attached to mounting block 808 is lock solenoid 807 . lock tab 811 comprises a hole that centrally locates lock tab 811 about input shaft 201 . the diameter and thickness of the hole are sized to create the necessary lock and release loads of lock tab 811 . lock tab 811 comprises a feature at one end to facilitate the attachment of lock solenoid armature 812 . in the present embodiment , lock solenoid 807 is attached to mounting block 808 in such a way that lock solenoid 807 can be adjusted vertically to create the desired pull force with lock solenoid armature 812 , which is attached to lock tab 811 . when electrical power is applied to lock solenoid 807 , a magnetic force is created that pulls lock solenoid armature 812 into lock solenoid 807 . this pulls lock tab 811 towards lock solenoid 807 , which secures lock tab 811 to input shaft 201 . a hold down spring 819 is centrally located about input shaft 201 . hold down spring 819 is retained on input shaft 201 with nut 813 and washer 814 . hold down spring 819 generally ensures that lock tab 811 remains seated against pivot edge 810 in both the locked and released modes of operation . hold down spring 819 also generally ensures that lock and release assembly 301 returns to its lowest position when lock solenoid 807 is de - energized . release spring 815 located between solenoid mounting block 808 and lock tab 811 generally ensures that lock tab 811 releases from input shaft 201 when lock solenoid 807 is de - energized . release spring 815 is retained in the proper position by placing it over lock solenoid armature 812 . release spring 815 provides a fail - safe mode when used in conjunction with electric solenoid 807 . the movement of lock tab 811 is restricted by fastener 816 . anti - rotation ears 817 are part of master cylinder 202 and generally prevent lock and release assembly 301 from rotating about input shaft 201 when the actuator assembly 302 is operating . in some embodiments the hydraulic cylinder , shown by way of example in fig3 b , may use the same elements of the emc to create an integrated package combining the hydraulic cylinder 304 , the lock and release assembly 301 and the actuator assembly 302 . testing of a prototype emc has shown that 38 watts of electrical power is used to operate both lock and release assembly 301 and actuator assembly 302 . this level of power consumption is achieved at a proof pressure of 600 psi , which is 50 % higher than the maximum operating pressure of master cylinder 202 . actuator assembly 302 and lock and release assembly 301 work against a force on input shaft 201 of 225 pounds to attain the 600 psi of brake pressure . testing of the prototype emc has also revealed that hydraulic brake pressure may be modulated at a rate of 1000 psi per second and the pressure may be set within 10 psi using a servomotor . the total weight for lock and release assembly 301 and actuator assembly 302 in the present embodiment is less than one pound . in at least some preferred embodiments , the function of a wheel speed sensor is to provide a signal to an electronic controller that can be used to determine the speed that the wheel is turning . there are two types of wheel speed sensors that can be used in an electronically controlled antiskid system for vehicles with manual brakes . the first type is a variable - reluctance sensor . the disadvantage of the variable - reluctance sensor is the decreasing signal strength as the wheel rotation slows . this means that the antiskid function cannot operate below a vehicle speed of approximately 10 miles per hour due to an insufficient signal from the wheel speed sensor . the second type of wheel speed sensor is an active or magneto - resistive sensor . this type of sensor cannot generate a signal on its own and needs input power from the electronic controller to operate . however , an advantage of the magneto - resistive type of wheel speed sensor is that it can operate down to zero wheel speed . this means the antiskid function can work down to zero vehicle speed making the antiskid function available during both high and low speeds . fig9 is a side view of an exemplary wheel speed sensor 116 attached to a brake caliper 900 located on a main wheel 115 , in accordance with an embodiment of the present invention . in the present embodiment , wheel speed sensor 116 is connected to brake caliper 900 using a bracket 901 . bracket 901 can be an integral part of brake caliper 900 or it can be a separate item that is attached to brake caliper 900 . an electrical cable 118 with suitable conductors and shielding transmits electrical power from an electronic controller to wheel speed sensor 116 . the same electrical cable 118 transmits the wheel speed signal from sensor 116 to the electronic controller . the variable - reluctance and magneto - resistive types of wheel speed sensors both require a gear - shaped tone ring to operate . when the tone ring rotates near a wheel speed sensor of either type , a magnetic field fluctuates around the sensor . the electronic controller interprets the voltage and frequency variation sent from sensor 116 and converts this information into a speed of rotation of wheel 115 . in the present embodiment , the tone ring is incorporated into a brake disc 902 by cutting a gear shape into the outside circumference of brake disc 902 . this enables brake disc 902 to perform the function of a tone ring . in alternate embodiments the gear shape may be cut into the inside diameter of the brake disc . in the present embodiment , wheel speed sensor 116 , attached to brake caliper 900 , and brake disc 902 , which functions as a tone ring , are externally mounted to the axle of wheel 115 . having fully described at least one embodiment of the present invention , other equivalent or alternative methods of providing an electronically controlled antiskid braking system for vehicles with manual brakes according to the present invention will be apparent to those skilled in the art . the invention has been described above by way of illustration , and the specific embodiments disclosed are not intended to limit the invention to the particular forms disclosed . for example , the particular implementation of the antiskid system may vary depending upon the particular type of vehicle used . the vehicles described in the foregoing were directed to two wheeled implementations ; however , similar techniques are to provide antiskid systems for vehicles with manual brakes that have fewer or more wheels such as , but not limited to , unicycles , tricycles , three wheeled motorcycles , all terrain vehicles ( atvs ), etc . non - two wheeled implementations of the present invention are contemplated as within the scope of the present invention . the invention is thus to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the following claims . claim elements and steps herein have been numbered and / or lettered solely as an aid in readability and understanding . as such , the numbering and lettering in itself is not intended to and should not be taken to indicate the ordering of elements and / or steps in the claims .	1
the term “ alkyl ” by itself or as part of another substituent means , unless otherwise stated , a straight or branched chain hydrocarbon radical , including di - and multi - radicals , having the number of carbon atoms designated ( i . e . c1 - c10 means one to ten carbons ) and includes straight or branched chain groups such as methyl , ethyl , n - propyl , isopropyl , n - butyl , t - butyl , isobutyl , sec - butyl , homologs and isomers of n - pentyl , n - hexyl , 2 - methylpentyl , 1 , 5 - dimethylhexyl , 1 - methyl - 4 - isopropylhexyl and the like . the term “ alkylene ” by itself or a part of another substituent means a divalent radical derived from an alkane , as exemplified by — ch 2 ch 2 ch 2 ch 2 —. a “ lower alkyl ” is a shorter chain alkyl , generally having six or fewer carbon atoms . the term “ heteroalkyl ” by itself or in combination with another term means , unless otherwise stated , a stable straight or branched chain radical consisting of the stated number of carbon atoms and one or two heteroatoms selected from the group consisting of o , n , and s , a wherein the nitrogen and sulfiur atoms may optionally be oxidized and the nitrogen heteroatom may optionally be quaternized . the heteroatom ( s ) may be placed at any position of the heteroalkyl group , including between the rest of the heteroalkyl group and the fragment to which it is attached , as well as attached to the most distal carbon atom in the heteroalkyl group . examples include — o — ch 2 — ch 2 — ch 3 , — ch 2 — ch 2 — o — ch 3 , — ch 2 — ch 2 — ch 2 — oh , — ch 2 — ch 2 — nh — ch 3 , — ch 2 — ch 2 — n ( ch 3 )— ch 3 , — ch 2 — s — ch 2 — ch 3 , — ch 2 — ch 2 — s ( o )— ch 3 , — o — ch 2 — ch 2 — ch 2 — nh — ch 3 , and — ch 2 — ch 2 — s ( o ) 2 — ch 3 . up to two heteroatoms may be consecutive , such as , for example , — ch 2 — nh — och 3 . the term “ heteroalkylene ” by itself or as part of another substituent means a divalent radical derived from heteroalkyl , as exemplified by — ch 2 — ch 2 — s — ch 2 — ch 2 — and — ch 2 — s — ch 2 — ch 2 — nh —. the terms “ cycloalkyl ” and “ heterocycloalkyl ”, by themselves or in combination with other terms , represent , unless otherwise stated , cyclic versions of “ alkyl ” and “ heteroalkyl ”, respectively . examples of cycloalkyl include cyclopentyl , cyclohexyl , cycloiieptyl , and the like . examples of heterocycloalkyl include 1 - piperidinyl , 2 - piperidinyl , 3 - piperidinyl , 4 - morpholinyl , 3 - morpholinyl , tetmahydrofiran - 2 - yl , tetrahydrofliran - 3 - yl , tetrahydrothien - 2 - yl , tetrahydrothien - 3 - yl , 1 - piperazinyl , 2 - piperazinyl , and the like . the term “ alkenyl ” employed alone or in combination with other terms , means , unless otherwise stated , a stable straight chain or branched monounsaturated or diunsaturated hydrocarbon group having the stated number of carbon atoms . examples include vinyl , propenyl ( allyl ), crotyl , isopentenyl , butadienyl , 1 , 3 - pentadienyl , 1 , 4 - pentadienyl , and the higher homologs and isomers . a divalent radical derived from an alkene is exemplified by — ch ═ ch — ch 2 —. the term “ heteroalkenyl ” by itself or in combination with another term means , unless otherwise stated , a stable straight or branched chain monounsaturated or diunsaturated hydrocarbon radical consisting of the stated number of carbon atoms and one or two heteroatoms selected from the group consisting of o , n , and s , and wherein the nitrogen and sulfur atoms may optionally be oxidized and the nitrogen heteroatom may optionally be quarternized . up to two heteroatoms may be placed consecutively . examples include — ch ═ ch — o — ch 3 , — ch ═ ch — ch 2 — oh , — ch 2 — ch ═ n — och 3 , — ch ═ ch — n ( ch 3 )— ch 3 , and — ch 2 — ch ═ ch — ch 2 — sh . the term “ alkynyl ” employed alone or in combination with other terms , means , unless otherwise stated , a stable straight chain or branched hydrocarbon group having the stated number of carbon atoms , and containing one or two carbon - carbon triple bonds , such as ethynyl , 1 - and 3 - propynyl , 4 - but - 1 - ynyl , and the higher homologs and isomers . the term “ alkoxy ” employed alone or in combination with other terms , means , unless otherwise stated , an alkyl group , as defined above , connected to the rest of the molecule via an oxygen atom , such as , for example , methoxy , ethoxy , 1 - propoxy , 2 - propoxy and the higher 30 homologs and isomers . the terms “ halo ” or “ halogen ” by themselves or as part of another substituent mean , unless otherwise stated , a fluorine , chlorine , bromine , or iodine atom . the term “ aryl ” employed alone or in combination with other terms , means , unless otherwise stated , a phenyl , 1 - naphthyl , or 2 - naphthyl group . the maximal number of substituents allowed on each one of these ring systems is five , seven , and seven , respectively . substituents are selected from the group of acceptable substituents listed above . the term “ heteroaryl ” by itself or as part of another substituent means , unless otherwise stated , an unsubstituted or substituted , stable , mono - or bicyclic heterocyclic aromatic ring system which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of n , o , and s , and wherein the nitrogen and sulfir heteroatoms may optionally be oxidized , and the nitrogen atom may optionally be quaternized . the heterocyclic system may be attached , unless otherwise stated at any heteroatom or carbon atom which affords a stable structure . the heterocyclic system may be substituted or unsubstituted with one to four substituents independently selected from the list of acceptable aromatic substituents listed above . examples of such heterocycles include 2 - pyrrolyl , 3 - pyrrolyl , 3 - pyrazolyl , 2 - imidazolyl , 4 - imidazolyl , pyrazinyl , 2 - oxazolyl , 4 - oxazolyl , 5 - oxazolyl , 3 - isoxazolyl , 4 - isoxazolyl , 5 - isoxazolyl , 2 - thiazolyl , 4 - thiazolyl , 5 - thiazolyl , 2 - furyl , 3 - furyl , 2 - thienyl , 3 - thienyl , 2 - pyridyl , 3 - pyridyl , 4 - pyridyl , 2 - pyrimidyl , 4 - pyrinidyl , 5 - benzothiazolyl , purinyl , 2 - benzimidazolyl , 5 - indolyl , 1 - isoquinolyl , 5 - isoquinolyl , 2quinoxalinyl , 5 - quinoxalinyl , 3 - quinolyl , and 6 - quinolyl . pharmaceutically acceptable salts of the compounds of formula i include salts of these compounds with relatively nontoxic acids or bases , depending on the particular substituents found on specific compounds of formula i . when compounds of formula i contain relatively acidic functionalities , base addition salts can be obtained by contacting the neutral form of compound i with a sufficient amount of the desired base , either neat or in a suitable inert solve examples of pharmaceutically acceptable base addition salts include sodium , potassium , calcium , ammonium , organic amino , or magnesium salt , or a similar salt . when compounds of formula i contain relatively basic functionalities , acid addition salts can be obtained by contacting the neutral form of compound i with a sufficient amount of the desired acid , either neat or in a suitable inert solvent . examples of pharmaceutically acceptable acid addition salts include those 30 derived from inorganic acids like hydrochloric , hydrobromic , nitric , carbonic , monohydrogencarbonic , phosphoric , monohydrogenphosphoric , dihydrogenphosphoric , sulfuric , monohydrogensulfuric , hydriodic , or phosphorous acids and the like , as well as the salts derived from relatively nontoxic organic acids like acetic , propionic , isobutyric , oxalic , maleic , malonic , benzoic , succinic , suberic , fumaric , mandelic , phthalic , benzenesulfonic , p - tolylsulfonic , citric , tartaric , methanesulfonic , and the like . also included are salts of amino acids such as arginate and the like , and salts of organic acids like gluconic or galactunoric acids and the like ( see , for example , berge , s . m ., et al , “ pharmaceutical salts ”, journal of pharmnaceutical science , vol . 66 , pages 1 - 19 ( 1977 )). certain specific compounds of formula i contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts . the free base form may be regenerated by contacting the salt with a base or acid and isolating the parent compound in the conventional manner . the parent form of the compound differs from the various salt forms in certain physical properties , such as solubility in polar solvents , but otherwise the salts are equivalent to the parent form of the compound for the purposes of the present invention . certain compounds of the present invention can exist in unsolvated forms as well as solvated forms , including hydrated forms . in general , the solvated forms are equivalent to unsolvated forms and are intended to be encompassed within the scope of the present invention . certain compounds of the present invention possess asymmetric carbon atoms ( optical centers ); the racemates , diastereomers , and individual isomers are all intended to be encompassed within the scope of the present invention . the compounds of the present invention may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds . for example , the compounds may be radiolabeled with radioactive isotopes , such as for example tritium ( 3 h ) or carbon - 14 ( 14 c ). all isotopic variations of the compounds of the present invention , whether radioactive or not , are intended to be encompassed within the scope of the present invention . in various preferred embodiments of the pharmaceutical compositions of compounds of formula i , y is s ( o 2 ) and z is nr 1 r 2 , wherein r 1 is hydrogen or methyl , and r 2 is a substituted phenyl , preferably mono -, di -, or trisubstituted as follows . in one group of preferred compounds , y is s ( o 2 ) and z is nr 1 r 2 , wherein r 1 is hydrogen or methyl , and r 2 is a phenyl group , preferably substituted in the para position by one of the following groups : hydroxy , amino , ( c1 - c10 ) alkoxy . ( c1 - c10 ) alkyl , ( c1 - c10 ) alkylamino , and [ di ( c1 - c10 ) alkyl ] amino , with up to four additional substituents independently chosen from hydrogen , halogen , ( c1 - c10 ) alkoxy , ( c1 - c10 ) alkyl , and [ di ( c1 - c10 ) alkyl ] amino . also preferred are compounds of formula i where there is no linking group e between r 1 and r 2 . illustative examples of pharmaceutical compositions and compounds of the subject pharmaceutical methods include : examples of the most preferred pharmaceutical compositions and compounds of the subject pharmaceutical methods include : the invention provides for certain novel compounds of general formula i that possess one or more valuable biological activities such as a pharmacologic , toxicologic , metabolic , etc . exemplary compounds of this embodiment of the invention include : preferred compounds of this embodiment of the invention have specific pharmacological properties . examples of the most preferred compounds of this embodiment of the invention include : the invention provides methods of making the subject compounds and compositions . in one general embodiment , the methods involve combining pentafluorophenylsulfonyl chloride with an amine having the general formula r 1 r 2 nh under conditions whereby the pentafluorophenylsulfonyl chloride and amine react to form the desired compound , and isolating the compound . compounds with the generic structure 1 or 3 ( scheme i ) may be prepared by reacting the appropriate staring amine in a solvent such as tetaahydrofiuran ( tbe ), dimethylformamide ( dmf ), ether , toluene or benzene in the presence of a base such as pyridine , pdimethylaminopyridine , triethylamine , sodium carbonate or potassium carbonate and pentafluorophenylsulfonyl chloride or pentafluorophenylsulfinyl chloride , respectively . pyridine itself may also be used as the solvent . preferred solvents are pyridine and dmf and preferred bases are pyridine , triethylamine , and potassium carbonate . this reaction can be carried out at a temperature range of 0 ° c . to 100 ° c ., conveniently at ambient temperature . compounds of the generic structure i can also be obtained by treating the starting sulfonamide ( scheme ii ) with a base such as lda , nah , dimsyl salt , alkyl lithium , potassium carbonate , under an inert atmosphere such as argon or nitrogen , in a solvent such as benzene , toluene , dmf or thf with an allglating group containing a leaving group such a cl , br , i , mso —, tso —, tfao —, represented by e in scheme ii . a preferred solvent for this . reaction is thf and the preferred base is lithium bis ( trimethylsilyl ) amide . this reaction can be carried out at a temperature range of 0 ° c . to 100 ° c ., conveniently at ambient temperature . sulfonic esters ( 2 ) and sulfinic esters ( 4 ) may be prepared by reacting the appropriate starting phenol in a solvent such as thf , dmf , toluene or benzene in the presence of a base such as pyridine , triethylamine , sodium carbonate , potassium carbonate or 4 - dimethylaminopyridine with pentafluorophenylsulfonyl chloride or pentafluorophenylsulfmyl chloride , respectively . pyridine itself may also be used as the solvent . preferred solvents are pyridine and dmf and preferred bases are sodium carbonate and potassium carbonate . this reaction can be carried out at a temperature range of 0 ° c . to 100 ° c ., conveniently at ambient temperature . compounds of the general structure 5 , in which ar is an aromatic group and x is from one to three , can be obtained from the corresponding methyl ethers ( scheme iii ) by reaction with boron tribromide in a solvent of low polarity such as hexanes or ch 2 cl 2 under an inert atmosphere at a temperature ranging from − 45 ° to 30 ° c . in a preferred embodiment , the reaction is carried out in ch 2 cl 2 at about 30 ° c . occasionally , the substrates for the transformations shown in schemes i - iii may contain functional groups ( for example , amino , hydroxy or carboxy ) which are not immediately compatible with the conditions of the given reaction . in such eases , these groups may be protected with a suitable protective group , and this protective group removed subsequent to the transformation to give the original functionality using well know procedures such as those illustrated in t . w . greene and p . g . m . wuts , protective groups in organic synthesis , second edition , john wiley & amp ; sons , inc ., 1991 . the compounds used as initial starting materials in this invention may be purchased from commercial sources or alternatively are readily synthesized by standard procedures which are well know to those of ordinary skill in the art . some of the compounds of formula i may exist as stereoisomers , and the invention includes all active stereoisomeric forms of these compounds . in the case of optically active isomers , such compounds may be obtained from corresponding optically active precursors using the procedures described above or by resolving racemic mixtures . the resolution may be carried out using various techniques such as chromatography , repeated recrystallization of derived asymmetric salts , or derivatization , which techniques are well known to those of ordinary skill in the art . the compounds of formula i which are acidic or basic in nature can form a wide variety of salts with various inorganic and organic bases or acids , respectively . these salts must be pharmacologically acceptable for administration to mammals . salts of the acidic compounds of this invention are readily prepared by treating the acid compound with an appropriate molar quantity of the chosen inorganic or organic base in an aqueous or suitable organic solvent and then evaporating the solvent to obtain the salt . acid addition salts of the basic compounds of this invention can be obtained similarly by treatment with the desired inorganic or organic acid and subsequent solvent evaporation and isolation . the compounds of the invention may be labeled in a variety of ways . for example , the compounds may be provided as radioactive isotopes ; for example , tritium and the 14 c - isotopes . similarly , the compounds may be advantageously joined , covalently or noncovalently , to a wide variety of joined compounds which may provide pro drugs or function as carriers , labels , adjuvents , coactivators , stabilizers , etc . hence , compounds having the requisite structural limitations encompass such compounds joined directly or indirectly ( e . g . through a linker molecule ), to such joined compounds . the subject compositions were demonstrated to have pharmacological activity in in vitro and in vivo assays , e . g . are capable of specifically modulating a cellular physiology to reduce an associated pathology or provide or enhance a prophylaxis . preferred compounds are capable of specifically regulating ldl receptor gene expression . compounds may be evaluated in vitro for their ability to increase ldl receptor expression using western - blot analysis , for example , as described in tam et al . ( 1991 ) j . biol . chem . 266 , 16764 . established animal models to evaluate hypocholesterolemic effects of compounds are known in the art . for example , compounds disclosed herein are shown to lower cholesterol levels in hamsters fed a high - cholesterol diet , using a protocol similar to that described in spady et al . ( 1988 ) j . clin . invest . 81 , 300 ; evans et al . ( 1994 ) j . lipid res . 35 , 1634 ; lin et al ( 1995 ) j . med . chem . 38 , 277 . the invention provides methods of using the subject compounds and compositions to treat disease or provide medicinal prophylaxis , to upregulate ldl receptor gene expression in a cell , to reduce blood cholesterol concentration in a host , etc . these methods generally involve contacting the cell with or administering to the host an effective amount of the subject compounds or pharmaceutically acceptable compositions . the compositions and compounds of the invention and the pharmaceutically acceptable salts thereof can be administered in any effective way such as via oral , parenteral or topical routes . generally , the compounds are administered in dosages ranging from about 2 mg up to about 2 , 000 mg per day , although variations will necessarily occur depending on the disease target , the patient , and the route of administration . preferred dosages are administered orally in the range of about 0 . 05 mg / kg to about 20 mg / kg , more preferably in the range of about 0 . 05 mg / kg to about 2 mg / kg , most preferably in the range of about 0 . 05 mg / kg to about 0 . 2 mg per kg of body weight per day . in one embodiment , the invention provides the subject compounds combined with a pharmaceutically acceptable excipient such as sterile saline or other medium , water , gelatin , an oil , etc . to form pharmaceutically acceptable compositions . the compositions and / or compounds may be administered alone or in combination with any convenient carrier , diluent , etc . and such administration may be provided in single or multiple dosages . useful carriers include solid . semi - solid or liquid media including water and non - toxic organic solvents . in another embodiment , the invention provides the subject compounds in the form of a pro - drug , which can be metabolically converted to the subject compound by the recipient host . a wide variety of produg formulations are known in the art . the compositions may be provided in any convenient form including tablets , capsules , lozenges , troches , hard candies , powders , sprays , creams , suppositories , etc . as such the compositions , in pharmaceutically acceptable dosage units or in bulk , may be incorporated into a wide variety of containers , for example , dosage units may be included in a variety of containers including capsules , pills , etc . the compositions may be advantageously combined and / or used in combination with other hypocholesterolemic and / or hypolipemic therapeutic or prophylactic agents , different from the subject compounds . in many instances , administration in conjunction with the subject compositions enhances the efficacy of such agents . exemplary hypocholesterolemic and / or hypolipemic agents include : bile acid sequestrants such as quaternary amines ( e . g . cholestyramine and colestipol ); nicotinic acid and its derivatives ; hmg - coa reductase inhibitors such as mevastatin , pravastatin , and simvastatin ; gemfibrozil and other fibric acids , such as gemfibrozil , clofibrate , fenofibrate , benzafibrate and cipofibrate ; probucol ; raloxifene and its derivatives ; and mixtures thereof . the compounds and compositions also find use in a variety of in vitro and in vivo assays , including diagnostic assays . for example , various allotypic ldl receptor gene expression processes may be distinguished in sensitivity assays with the subject compounds and compositions , or panels thereof . in certain assays and in in vivo distribution studies , it is desirable to used labeled versions of the subject compounds and compositions , e . g . radioligan displacement assays . accordingly , the invention provides the subject compounds and compositions comprising a detectable label , which may be spectroscopic ( e . g . fluorescent ), radioactive , etc . the following examples are offered by way of illustration and not by way of limitation . 1 h nmr spectra were recorded on a varian gemini 400 mhz nmr spectrometer . significant peaks are tabulated in the order . multiplicity ( s , singlet ; d , doublet ; t , triplet ; q , quartet ; m , multiplet ), coupling constant ( s ) in hertz , number of protons . electron ionization ( ei ) mass spectra were recorded on a hewlett packard 5989a mass spectrometer . fast atom bombardment ( fab ) mass spectroscopy was carried out in a vg analytical zab 2 - se high field mass spectrometer . mass spectroscopy results are reported as the ratio of mass over charge , and the relative abundance of the ion is reported in parentheses . 4 -( n , n - dimethylamino )- 1 - pentafluorophenylsulfonamidobenzene . to n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride ( 3 g , 14 . 6 mmol ) suspended in pyridine ( 50 ml ) at 0 ° c . under argon was added dropwise pentafluorophenylsulfonyl chloride ( 2 . 38 ml , 16 mmol ). the reaction mixture was stirred for 30 min at 0 ° c . and allowed to warm to ambient temperature . the reaction mixwre was stired at room temperature for 3 h . the volume of the mixture was then reduced to 10 ml under reduced pressure . the mixure was diluted with ethyl acetate and the reaction quenched with water . the layers were separated and the aqueous layer extracted twice with ethyl acetate . the organic layers were combined and washed with brine and dried with mgso 4 . the solvent was evaporated and the residue purified by chromatography on silica , eluting with ch 2 cl 2 . the title product was obtained as a white solid in 63 % yield ( 3 . 4 g ). 1 h nmr ( cdcl 3 ): 7 . 01 ( d , j = 8 . 9 hz , 2h ), 6 . 77 ( s , 1h ), 6 . 59 ( d , j = 8 . 3 hz , 2h ), 2 . 92 ppm ( s , 6h ). fab m / z ( relative abundance ): 367 ( 100 %, m + h + ), 135 ( 30 %), 121 ( 25 %). anal . calcd . for c 14 h 11 f 5 n 2 o 2 s : c , 45 . 95 , h , 3 . 03 , n , 7 . 65 . found c , 45 . 83 , h , 2 . 99 , n , 7 . 62 3 -( n , n - dimethylamino )- 1 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ): 7 . 12 ( t , j = 8 hz , 1h ), 7 . 05 ( s , 1h ), 6 . 57 ( s , 1h ) 6 . 53 ( d , j = 8 hz , 1h ), 6 . 40 ( d , j = 8 hz , 1h ), 2 . 94 ppm ( s , 6h ). fab m / z : 366 ( 100 %, m + ). the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 3 -( n , n - dimethylamino ) aniline . 1 , 2 - ethylenedioxy - 4 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ): 6 . 97 ( s , 1h ) 6 . 76 ( d , j = 8 . 6 hz , 1h ), 6 . 72 ( d , j = 2 . 6 hz , 1h ), 6 . 62 ( dd , j = 8 . 6 , 2 . 6 hz , 1h ), 4 . 21 ppm ( s , 4h ). fab m / z : 381 ( 100 %, m + h + ). anal calcd . for c 14 h 8 f 5 no 4 s : c , 44 . 09 , h , 2 . 12 , n , 3 . 68 , s , 8 . 39 . found : c , 43 . 83 , h , 2 . 19 , n , 3 . 62 , s , 8 . 20 . the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 3 , 4 - ethylenedioxyaniline . 1 , 2 - methylenedioxy - 4 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ): 6 . 85 ( s , 1h ), 6 . 78 ( s , 1h ), 6 . 70 ( d , j = 8 hz , 1h ), 6 . 57 ( d , j = 8 hz , 1h ), 5 . 97 ppm ( s , 2h ). the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 3 , 4 - methylenedioxyaniline . 1 , 2 - dimethoxy - 4 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ): 6 . 98 ( s , 1h ), 6 . 85 ( d , 1h ), 6 . 74 ( d , 1h ), 6 . 60 ( dd , 1h ), 3 . 85 ( s , 3h ), 3 . 83 ppm ( s , 3h ). ei , m / z : 383 ( 50 , m + ), 152 ( 100 ). the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 3 , 4 - dimethoxyaniline . 2 - hydroxy - 1 - methoxy - 4 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ): 6 . 93 ( s , 1h ), 6 . 7 - 6 . 8 ( m , 3h ), 5 . 68 ( bs , 1h ), 3 . 85 ppm ( s , 3h ). ei , m / z : 333 ( 20 , m + ), 138 ( 100 ). mp 118 - 120 ° c . the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 3 - hydroxy - 4 - methoxyaniline . 2 - fluoro - 1 - methoxy 4 - pentafluorosulfonamidobenzene . 1 h nmr ( dmso ) 11 . 15 ( broad s , 1h ), 7 . 13 ( t , j = 9 hz , 1h ), 7 . 02 ( dd , j = 9 . 5 2 . 5 hz , 1h ), 6 . 94 ppm ( dd , j = 8 . 8 1 . 5 hz , 1h ), 3 . 79 ppm ( s , 3h ). ei , m / z : 371 ( 20 , m + ), 140 ( 100 ). anal . calcd . for c 13 h 7 hf 6 n 1 o 3 s 1 : c , 42 . 06 , h , 1 . 90 , n , 3 . 77 , s , 8 . 64 . found : c , 42 . 19 , h , 1 . 83 , n , 3 . 70 , s , 8 . 60 . mp 118 - 119 ° c . the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 3 - fluoro - p - anisidine . 4 - methoxy - 1 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ): 6 . 99 ( s , 1h ), 6 . 96 ( d , j = 4 hz , 2h ), 6 . 88 ( d , j = 4 hz , 2h ), 3 . 83 ppm ( s , 3h ). ei , m / z : 353 ( 60 , m + ), 122 ( 100 ). m . p . 102 - 103 ° c . the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 4 - methoxyaniline . 3 - hydroxy - 1 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cd 3 od ): 7 . 15 ( t , j = 8 . 1 hz , 1h ), 6 . 67 ( t , j = 2 . 2 hz , 1h ) 6 . 60 ( dd , j = 1 . 3 hz , 7 . 8 hz , 1h ), 6 . 52 ppm ( dd , j = 2 . 4 hz 8 . 3 hz , 1h ). ei , m / z : 339 ( 80 , m + ), 256 ( 50 ), 81 ( 100 ). the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 3 - hydroxyaniline . 4 - hydroxy - 1 - pentafluorosulfonamidobenzene . 1 h nmr ( cd 3 od ): 6 . 95 ( d , j = 8 . 9 hz , 2h ), 6 . 65 ppm ( d , j = 8 . 9 hz , 2h ). ei , m / z : 339 ( 30 , m + ). the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 4 - hydroxyaniline . 1 , 2 - dimethyl - 4 - pentafluorophenylsulfonamidobenene . 1 h nmr ( cdcl 3 ): 7 . 03 ( d , j = 7 . 9 hz , 1h ), 6 . 92 ( s , 1h ), 6 . 85 - 6 . 82 ( m , 2h ), 2 . 18 ( s , 3h ), 2 . 16 ppm ( s , 3h ). the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 3 , 4 - dimethylaniline . 4 ( n , n - diethylamino )- 1 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ): 6 . 93 ( d , j = 8 . 8 hz , 2h ), 6 . 78 ( s , 1 ), 6 . 45 ( d , j = 8 . 7 hz , 2h ), 3 . 25 ( dd , j = 7 . 0 hz , 7 . 3 hz , 4h ), 1 . 10 ppm ( t , j = 7 . 2 hz , 6h ). the compound was prepared by a protocol similar to that of example 1 by replacing n , n - diethyl - 1 , 4 - phenyldiamine dihydrochloride with 4 -( n , n - diethylamino ) aniline . 4amino - 1 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ): 6 . 82 ( d , j = 8 . 7 hz , 2h ), 6 . 49 ppm ( d , j = 8 . 7 hz , 2h ). ei , m / z : 338 ( 7 , m + ), 107 ( 100 ), 80 ( 40 ). the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 1 , 4 - diaminobenzene . pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ): 7 . 30 ( d , j = 8 hz , 2h ), 7 . 13 - 7 . 2 ( m , 3h ), 7 . 0 ppm ( s , 1h ). ei , m / z : 323 ( 90 , m + ), 92 ( 100 ). the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with aniline . 5 - pentafluorophenylsulfonamidoindazole . 1 h nmr ( cd 3 od ): 7 . 98 ( s , 1h ), 7 . 69 ( s , 1h ), 7 . 47 ( d , j = 8 . 3 hz , 1h ), 7 . 23 ppm ( d , j = 8 . 3 hz , 1h ). ei m / z : 364 ( 50 , m + h + ), 133 ( 100 ). the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 5 - aminoindazole . 5 - pentafluorophenylsulfonamidoindole . 1 h nmr ( cdcl 3 ): 8 . 2 ( s , 1h ), 7 . 43 ( s , 1h ), 7 . 3 ( d , j = 8 hz , 1h ), 7 . 22 ( s , 1h )), 6 . 98 ( d , j = 8 hz , 1h ), 6 . 92 ppm ( s , 1h ), 6 . 50 ppm ( s , 1h ). ei m / z : 362 ( m + ), 131 ( 100 ). the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyt - 1 , 4 - phenyldiamine dihydrochloride with 5 - aminoindole . 4 -( n , n - dimethylamino )- 1 -( pentafluorophenylsulfonamido ) benzene ( 100 mg , 0 . 273 mmol ) was dissolved in dry thf ( 2 . 5 ml ) and to the system was added under n 2 at room temperature a 1m solution of lithium bis ( trimethylsilyl ) amide ( 0 . 274 ml ). the reaction mixture was stirred for 10 min followed by addition of mei ( 65 mg , 0 . 028 ml ). the reaction mixture was stirred overnight , the solvent was evaporated under reduced pressure and the crude product purified by hplc using silica as the stationary phase and eluting with 20 % etoac / hex ( v / v ) to afford the product as a white solid in 60 % yield ( 62 mg ). ei m / z : 380 ( 35 , m + ), 149 ( 100 ). 1 h nmr ( cd 3 od ) 7 . 05 ( d , j = 8 hz , 2h ), 6 . 68 ( d , j = 8 hz , 2h ), 3 . 33 ( s , 3h ) 2 . 93 ( s , 6h ). anal . calcd . for c 15 h 13 f 5 so 2 n 2 : c , 47 . 37 , h , 3 . 45 , n , 7 . 37 . found : c , 47 . 37 , h , 3 . 49 , n , 7 . 32 . 1 , 2 - dihydroxy - 4 - pentafluorophenylsulfonamidobenzene . 1 - hydroxy - 2 - methoxy - 4 - pentafluorophenylsulfonamidobenzene ( 250 mg , 0 . 678 mmol ) was suspended in dry ch 2 cl 2 ( 5 ml ) at 0 ° c . under nitrogen . to the mixture was added bbr 3 as a 1m solution in ch 2 cl 2 ( 0 . 746 mmol , 1 . 1 eq .). the mixture was warmed to ambient temperature and stirred overnight . the reaction mixture was poured over ice ( 75 ml ) and extracted 3 times with 30 ml portions of ch 2 cl 2 . the organic layer was dried with mgso 4 and the solvent was evaporated . the crude product was purified by chromatography over silica eluting with 30 % ( v / v ) etoac / hex to afford the product as a white solid in 41 % yield ( 98 mg ). 1 h nmr ( dmso ): 10 . 63 ( s , 1h ), 9 . 15 ( s , 1h ), 8 . 91 ( s , 1h ), 6 . 61 ( d , j = 9 hz , 1h ), 6 . 58 ( d , j = 3 hz , 1h ), 6 . 39 ppm ( dd , j = 9 hz 3 hz , 1h ). 4 - ethoxy - 1 - pentafluorophenylsulfonamidobenzne . to a strred solution of p - phenetidine ( 0 . 100 g , 0 . 729 mmol ) in dimnethylformamide ( 3 . 65 ml ) at 25 ° c . was added pentafluorophenyl sulfonyl chloride ( 0 . 135 ml , 0 . 911 mmol ), followed by sodium carbonate ( 0 . 116 g , 1 . 09 mmol ), and the reaction mixture was stirred for 18 hours . ihe reaction mixture was diluted with ethyl acetate ( 50 ml ) and washed with 20 % ammonium chloride ( 2 × 20 ml ) and saturated sodium chloride ( 2 × 20 ml ). the organic layer was dried ( sodium sulfite ), and the ethyl acetate was removed under reduced pressure to yield a reddish - brown oil . column chromatography ( 3 : 1 ethyl acetate / hexane ) yielded the title compound ( 0 . 222 g , 83 %). 1 h nmr ( cdcl 3 ) 7 . 08 ( d , j = 9 hz , 2h , 7 . 04 ( s , 1h ), 6 . 80 ( d , j = 9 hz , 2h ), 3 . 96 ( q , j = 7 hz , 2h ), 1 . 37 ppm ( t , j = 7 hz , 2h ). ir ( neat ) 3000 - 3600 , 1750 cm − 1 . ei m / z : 367 ( m + ), 154 , 136 . the compounds of examples 20 through 26 were prepared by a protocol similar to that of example 19 by replacing p - phenetidine with the appropriate amine . 3 , 5 - dimethoxy - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared by to a protocol similar to that of example 19 by replacing p - phenetidine with 3 , 5 - dimethoxyanine . 1 h nmr ( cdcl 3 ) 6 . 91 ( s , 1h ), 6 . 32 ( s , 2h ), 6 . 25 ( s , 1h ), 3 . 72 ppm ( s , 6h ). 3 - ethoxy - 1 - pentafluorophenylsulfonamidobenzene the compound was prepared by a protocol slimilar to that of example 19 by replacing p - phenetidine with 3 - ethoxyaniline . 1 h nmr ( cdcl 3 ) 7 . 35 ( t , j = 8 hz , 1h ), 7 . 21 ( s , 1h ), 6 . 92 ( s , 1h ), 6 . 86 ( d , j = 8 hz , 1h ), 6 . 83 ( d , j = 8 hz , 1h ), 4 . 15 ( q , j = 6 hz , 2h , 1 . 56 ppm ( t , j = 6 hz , 3h ). 7 - hydroxy - 2 - pentafluorophenylsulfonamidonaphthalene . the compound was prepared by a protocol similar to that of example 19 by replacing p - phenetidine with 2 - amino - 7 - hydroxynaphthalene . 1 h nmr ( cdcl 3 ) 8 . 15 ( t , j = 8 hz , 1h ), 7 . 55 ( d , j = 8 hz , 1h ), 7 . 44 ( s , 1h ), 7 . 42 ( d , j = 8 hz , 1h ), 7 . 40 ( s , 1h ), 6 . 88 ppm ( q , j = 8 hz , 1h ). 3 - phenoxy - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared by a protocol similar to that of example 19 by replacing p - phenetidine with 3 - phenoxyaniline . 1 h nmr ( cdcl 3 ) 7 . 34 ( t , j = 8 hz , 2h ), 7 . 26 ( t , j = 8 hz , 1h ), 7 . 16 ( t , j8 hz , 1h ), 6 . 94 ( d , j = 8 hz , 2h ), 6 . 86 ( d , j = 8 hz , 1h ), 6 . 82 ( d , j = 8 hz , 1h ), 6 . 74 ( s , 1h ). 3 - methoxy - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared by a protocol similar to that of example 19 by replacing p - phenetidine with 3 - methoxyaniline . 1 h nmr ( cdcl 3 ) 7 . 20 ( d , j = 8 hz 1h , ), 6 . 95 ( s , 1h ), 6 . 78 ( d , j = 8 hz 1h ,), 6 . 70 ( t , j = 8 hz , 1h ), 3 . 79 ppm ( s , 1h ). 4 -( 1 - morpholino )- 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared by a protocol similar to that of example 19 by replacing p - phenetidine with 4 ( 1 - morpholino ) aniline . 1 h nmr ( cdcl 3 ) 7 . 09 ( d , j = 8 hz , 2h ), 6 . 85 ( d , j = 8 hz , 2h ), 3 . 85 ( t , j = 8 hz , 4h ), 3 . 15 ppm ( t , j = 8 hz , 4h ). 5 - pentafluorophenylsulfonamido - 1 , 2 , 3 - trimethoxybenzene . the compound was prepared by a protocol similar to that of example 19 by replacing p - phenetidine with 3 , 4 , 5 - trimethoxyaniline . 1 h mnr ( cdcl 3 ) 8 . 14 ( s , 1h ), 6 . 46 ( s , 2h ), 3 . 69 ( s , 6h ), 3 . 59 ( s , 3h ). 1 , 3 - dimethoxy - 2 - hydroxy - 5 - pentafluorophenylsulfonamidobenzene . 1 , 2 - dihydroxy - 3 - methoxy - 5 - pentafluorophenylsulfonamidobenzene . 5 - pentafluorophenylsulfonamido - 1 , 2 , 3 - trihydroxybenzene . 1 , 2 , 3 - methoxy - 5 - pentafluorophenylsulfonamidobenzene ( 269 mg , 0 . 6 mmol ) was suspended in dry ch 2 cl 2 ( 5 ml ) at 0 ° c . under nitrogen . to the mixture was added bbr 3 as a 1m solution in ch 2 cl 2 ( 3 . 26 mmol , 5 eq .). the mixture was warmed to ambient temperature and stirred overnight the reaction mixture was poured over ice ( 75 ml ) and extted 3 times with 30 ml portions of ch 2 cl 2 . the organic layer was dried with mgso 4 , evaporated , and the residue was subjected to chromatography over silica eluting with 30 % ( v / v ) etoac / hex to afford the three products . the compounds of examples 28 and 29 were prepared in a manner similar to that described above beginning with the product of example 20 and treating it with bbr 3 . 1 , 3 - dimethoxy - 2 - hydroxy - 5 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ) 10 . 85 ( s , 1h ), 8 . 31 ( s , 1h ), 6 . 41 ( s , 2h ), 3 . 66 ppm ( s , 6h ). 1 , 2 - dihydroxy - 3 - methoxy - 5 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ) 10 . 73 ( s , 1h ), 8 . 31 ( s , 1h ), 6 . 27 ( s , 1h ), 6 . 26 ( s , 1h ), 3 . 66 ppm ( s , 3h ). 5 - pentafluorophenylsulfonamido - 1 , 2 , 3 - trihydroxybenzene . 1 h nmr ( cdcl 3 ) 11 . 0 ( s , 1 h ), 9 . 03 ( s , 2h ), 8 . 06 ( s , 1h ), 6 . 13 ppm ( s , 2h ). 3 - hydroxy - 5 - methoxy - 1 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ) 11 . 2 ( s , 1h ), 9 . 63 ( s , 1h ), 6 . 23 ( s , 1h ), 6 . 21 ( s , 1h , 6 . 08 ( s , 1h ), 3 . 63 ( s , 3h ). 3 , 5 - dihydroxy - 1 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ) 7 . 15 ( s . 1h ), 6 . 25 ( s , 2h ), 6 . 15 ( s , 1h ), 5 . 31 ( s , 2h ). 2 - fluoro - 1 - methoxy - 4 -( n - methylpentafluorophenylsulfonamido ) benzene . prepared using a procedure similar to that of example 18 replacing 4 -( n , n - dimethylamino )- 1 - pentafluorophenylsulfonamidobenzene with the appropriate non - substituted sulfonamide ( product of example 7 ). 1 h nmr ( cdcl 3 ): 6 . 97 - 6 . 94 ( m , 2h ), 6 . 89 ( t , j = 9 hz , 1h ), 3 . 87 ( s , 3h ), 3 . 35 ppm ( t , j = 1 hz ). ei m / z : 385 ( 20 , m + ), 154 ( 100 ). anal . calcd . for c 14 h 9 f 6 no 3 : c , 43 . 64 , h , 2 . 35 , n , 3 . 64 . found c , 43 . 55 , h , 2 . 38 , n , 3 . 65 . 2 - bromo - 1 - methoxy - 4 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ): 7 . 3 5 ( d , j = 3 hz , 1h ), 7 . 15 ( dd , j = 9 hz , 3 hz , 1h ), 6 . 97 ( s , 1h ), 6 . 81 ( d , j = 9 hz , 1h ), 3 , 88 ppm ( s , 3h ). ei m / z : 433 ( 35 , m + ), 202 ( 100 ). the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 3 - bromo - 4 - methoxyaniline . 2 - chloro - 1 - methoxy - 4 - pentafluorophenylsulfonamidobenzene . 1 h nmr ( cdcl 3 ): 7 . 19 ( d , j = 3 hz , 1h ), 7 . 08 ( dd , j = 9 hz , 3 hz , 1h ), 7 . 01 ( s , 1h ), 6 . 84 ( d , j = 9 hz , 3 . 85 ( s , 3h ). ei m / z ( rel . abundance ): 387 ( 10 , m + ), 156 ( 100 ). the compound was prepared by a protocol similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 3 - chloro - 4 - methoxyaniline . 4n , n - dimethylamino )- 1 - pentafluorophenylsulfonamidobenzene hydrochloride . 4 -( n , n - dimethylamino )- 1 - pentafluorophenylsulfonamidobenzene ( 2 g , 5 . 5 mmol ) was dissolved in 15 ml of diethyl ether at ambient temperure under nitrogen . gaseous hcl wa bubbled into the reaction mixture for 5 min the mixture was filtered and the resulting solid washed twice with 15 ml portions of ice cold diethyl ether to afford the product as a white solid ( 1 . 89 g , 86 % yield ). 1 h nmr ( cd 3 od ): 7 . 62 ( dd , j = 9 . 0 hz , 1 . 6 hz , 2h ), 7 . 44 ( dd , j = 9 . 0 hz , 1 . 6 hz , 2h ), 3 . 28 ppm ( s , 6h ). fab m / z : 367 ( 100 %, m + h + ), 135 ( 90 %), 121 ( 45 %). anal . calcd . for c 14 h 13 clf 5 n 2 o 2 s : c , 41 . 79 , h , 3 . 01 , n , 6 . 97 , s , 7 . 95 . found c , 41 . 71 , h , 3 . 05 , n , 7 . 01 , s , 7 . 96 . 3 , 4 - difluoro - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared in a manner similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 3 , 4 - difluoroaniline . 1 h nmr ( cdcl 3 ) 7 . 13 ( m , 3h ), 6 . 91 ppm ( m , 1h ). ei , m / z ( relative abundance ): 359 ( 20 ), 128 ( 100 ). anal . calcd . for c13h4f7n1o2s1 : c , 40 . 12 , h , 1 . 12 , n , 3 . 90 . found : c , 40 . 23 , h , 1 . 17 , n , 3 . 89 . 4 - trifluoromethoxy - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepare in a manner similar to that of example 1 by replacing n , n - dimethy - 1 , 4 - phenyidiamine dihydrochloride with 4 -( trifluoromethoxy ) aniline . 1 h nmr ( cdcl 3 ) 7 . 18 ppm ( m , 4h ). ei , m / z ( relative abundance ): 407 ( 20 ), 176 ( 100 ). anal . calcd . for c13h5f8n1o3s1 : c , 38 . 34 , h , 1 . 24 , n , 3 . 44 . found : c , 38 . 33 , h , 1 . 30 , n , 3 . 43 . 2 - chloro - 5 - pentafluorophenylsulfonamdopyridine . the compound was prepared in a manner similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with 5 - amino - 2 - chloropyridine . h nmr ( dmso - d 6 ): 8 . 18 ( d , j = 2 . 68 hz , 1h ), 7 . 64 ( dd , j = 8 . 75 , 2 . 89 hz , 1h ), 7 . 50 ppm ( d , j = 8 . 75 hz , 1h ). ei m / z 358 ( 20 , m + ), 127 ( 100 ). anal . calcd . for c 11 h 4 clf 5 n 2 o 2 s : c , 36 . 83 , h , 1 . 12 , n , 7 . 81 , s , 8 . 94 , cl 9 . 90 . found : c , 37 . 00 , h , 1 . 16 , n , 7 . 78 , s , 8 . 98 , cl 10 . 01 . white crystals with m . p .= 144 - 145 ° c . 2 - hydroxy - 1 - methoxy - 4 -( n -( 5 - hydroxypentyl )- pentafluorophenylsulfonamido ) benzene . n -( 5 - hydroxypentyl )- 2 - hydroxy - 1 - methoxy - 4 - aminobenzene was prepared by reductive amination of 5 - amino - 2 - methoxy phenol with glutaric dialdehyde with nabh 4 in meoh . 2 - hydroxy - 1 - methoxy - 4 -( n -( 5 - hydroxypentyl )- pentafluorophenylsulfonamido ) benzene was prepared in a manner similar to that of example 1 by replacing n , n - dimethyl - 1 , 4 - phenyldiamine dihydrochloride with n -( 5 - hydroxypentyl )- 2 - hydroxy - 1 - methoxy - 4 - aminobenzene . 1 h nmr ( cdcl 3 ): 6 . 78 ( d , j = 8 . 6 hz , 1h ), 6 . 71 ( dd , j = 8 . 59 , 2 . 48 hz , 1h ), 6 . 63 ( d , j = 2 . 48 hz , 1h ), 3 . 88 ( s , 3h ), 3 . 7 ( t , j = 6 . 8 hz , 2h ), 3 . 6 ( t , j = 6 . 39 hz , 2h ), 1 . 5 ppm ( m , 6h ). anal . calcd . for c 18 h 18 f 5 no 5 s : c , 47 . 47 , h , 3 . 98 , n , 3 . 08 , s , 7 . 04 . found : c , 47 . 47 , h , 4 . 04 , n , 3 . 11 , s , 6 . 97 . white crystals with m . p .= 118 °. 4 -( 1 , 1 - dimethyl ) ethoxy - 1 - pentafluorophenylsulfonamidobenzene . the compouid was prepared in a manmer similar to example 46 by replacing 3 - chloroaniline with 4 - t - butoxyanilime . 4 - t - butoxyaniline was prepared by thie method of day ( j . med . chem . 1975 , 18 , 1065 ). 1 h nmr ( cdcl 3 ): d 7 . 07 ( m , 2 ), 6 . 92 ( m , 2 ), 6 . 88 ( m , 1 ), 1 . 31 ( s , 9 ). ms ( ei ): m / z 395 ( 1 , m + ), 339 ( 28 ), 108 ( 100 ). anal . calcd . for c 16 h 14 f 5 no 3 s : c , 48 . 61 ; h , 3 . 57 ; n , 3 . 54 ; s , 8 . 11 . found : c , 48 . 53 ; h , 3 . 60 ; n , 3 . 50 ; s , 8 . 02 . 1 - bromo - 3 - hydroxy - 4 - methoxy - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared by bromination of the compound of example 6 with n - bromosuccmimide in dichloromedtane . 1 h nmr ( cdcl 3 ) 7 . 28 ( br s , 1h ), 7 . 21 ( d , j = 9 hz , 1h ), 6 . 80 ( d , j = 9 hz , 1h ), 6 . 05 ( s , 1h ), 3 . 89 ppm ( s , 3h ). ei , m / z ( relative abundance ): 449 ( 25 ), 447 ( 25 ), 218 ( 100 ), 216 ( 100 ). anal . calcd . for c13h8br1f5n1o4s1 : c , 34 . 84 , h , 1 . 57 , n , 3 . 13 , s , 7 . 15 . found : c , 34 . 75 , h , 1 . 60 , n , 3 . 07 , s , 7 . 08 . 2 - bromo - 4 - methoxy - 5 - hydroxy - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared by bromination of the compound of example 6 with n - bromosuccinimide in dichloromethane . 1 h nmr ( cdcl 3 ) 7 . 28 ( s , 1h ), 7 . 16 ( br s , 1h ), 6 . 91 ( s , 1h ), 5 . 63 ( s , 1h ), 3 . 85 ppm ( s , 3h ). ei , m / z ( relative abundance ): 449 ( 25 ), 447 ( 25 ), 218 ( 100 ), 216 ( 100 ). anal . calcd . for c13h8br1f5n1o4s1 : c , 34 . 84 , h , 1 . 57 , n , 3 . 13 , s , 7 . 15 . found : c , 34 . 84 , h , 1 . 57 , n , 3 . 05 , s , 7 . 06 . 1 - bromo - 4 - fluoro - 5 - methoxy - 2 - pentafluorophenylsulfonamidobenzene . the compound was prepared by bromination of the compound of example 7 with bromine water . 1 h nmr ( cdcl 3 ): 7 . 49 ( d , j = 11 . 72 hz , 1h ), 7 . 21 ( s , 1h ), 7 . 04 ( d , j = 8 . 2 hz , 1h ), 3 . 84 ppm ( s , 3h ). ei m / z : 449 ( 20 , m + ), 451 ( 20 ), 228 ( 100 ), 230 ( 100 ). anal . calcd . for c 13 h 6 brf 6 no 3 s : c , 34 . 69 , h , 1 . 34 , n , 3 . 11 , s , 7 . 12 , br , 17 . 75 . found : c , 34 . 76 , h , 1 . 29 , n , 3 . 05 , s , 7 . 12 , br , 17 . 68 . white crystals with m . p .= 109 ° c . 2 - hydroxy - 1 - methoxyapentafluormphenylslfonamidobenzene sodium salt . the compound was prepared by treating the compound of exmple 6 with an equimolar amount of 1n naoh ( aq ) . the mixture was then lyophilized and the residue recrystallyzed from ethyl acetate / ether . 1 h nmr ( dmso ) 8 . 40 ( s , 1h ), 6 . 57 ( d , j = 9 hz , 1h ), 6 . 39 ( d , j = 2 hz , 1h ), 6 . 24 ( dd , j = 9 , 2 hz , 1h ), 3 . 62 ppm ( s , 3h ). anal . calcd . for c13h7f5n1na1o4s1 : c , 39 . 91 , h , 1 . 80 , n , 3 . 58 , na 5 . 88 , s , 8 . 19 . found : c , 39 . 79 , h , 1 . 86 , n , 3 . 50 , na 5 . 78 , s , 8 . 07 . 2 - hydroxy - 1 - methoxy - 4 - pentafluorophenylsulfonamnidobenzene potassium salt . the compound was prepared in a manner similar to that of example 42 by replacing 1n naoh with 1n koh . 1 h nmr ( dmso ) 8 . 30 ( br s , 1h ), 6 . 55 ( d , j = 9 hz , 1h ), 6 . 36 ( d , j = 2 hz , 1h ), 6 . 25 ( dd , j = 9 , 2 hz , 1h ), 3 . 61 ppm ( s , 3h ). anal . calcd . for c13h7f5k1n1o4s1 : c , 38 . 33 , h , 1 . 73 , n , 3 . 44 , s , 7 . 87 . found : c , 38 . 09 , h , 1 . 79 , n , 3 . 39 , s , 7 . 97 . 2 - fluoro - 1 - methoxy - 4 - pentafluorophenylsulfonamidobenzene potassium salt the compound was prepared in a manner similar to that of example 43 by replacing the compound from example 6 with example 7 . 1 h nmr ( dmso ) 6 . 80 ( t , j = 10 hz , 1h ), 6 . 72 ( dd , j = 9 , 2 hz , 1h ), 6 . 54 ( dd , j = 9 , 2 hz , 1h ), 3 . 68 ppm ( s , 3h ). anal . calcd . for c13h6f6k1n1o3s1 : c , 38 . 15 , h , 1 . 48 , n , 3 . 42 , s , 7 . 83 . found : c , 38 . 09 , h , 1 . 51 , n , 3 . 35 , s , 7 . 73 . m . p .= 202 - 205 ° c . 2 - fluoro - 1 - methoxy - 4 - pentafluorophenylsulfonamidobenzene sodium salt . the compound was prepared in a manner similar to that of example 44 by replacing 1n koh with 1n naoh . 1 h nmr ( dmso ) 6 . 80 ( t , j = 10 hz , 1h ), 6 . 71 ( dd , j = 9 , 2 hz , 1h ), 6 . 53 ( dd , j = 9 , 2 hz , 1h ), 3 . 69 ppm ( s , 3h ). anal . calcd . for c13h6f6n1na1o3s1 : c , 39 . 71 , h , 1 . 54 , n , 3 . 56 , na 5 . 85 , s , 8 . 15 . found : c , 39 . 56 , h , 1 . 62 , n , 3 . 49 , na 5 . 88 , s , 8 . 08 . m . p . & gt ; 250 ° c . 3 - chloro - 1 - pentafluorophenylsulfonamidobenzene . to a solution of pentafluorophenylsulfonyl chloride ( 0 . 15 ml , 1 . 00 mmol ) in meoh ( 4 ml ) was added 3 - chloroaniline ( 260 mg , 2 . 04 mmol ). after stirring at rt for 1 h , the reaction mixture was concentrated under reduced pressure and the residue was taken up in etoac and then filtered through a plug of silica gel . the filtrate was concentrated to give a yellow oil that upon chromatography provided 265 mg ( 74 %) of product . 1 h nmr ( cdcl 3 ): d 7 . 28 - 7 . 24 ( m , 1h ), 7 . 21 - 7 . 17 ( m , 2h ), 7 . 10 - 7 . 08 ( m , 1h ), 7 . 07 ( s , 1h ). ms ( ei ): m / z 357 ( 42 , m + ), 258 ( 76 ), 126 ( 87 ), 99 ( 100 ). anal . calcd . for c 12 h clf 5 no 2 s : c , 40 . 30 ; h , 1 . 41 ; n , 3 . 92 ; s , 8 . 96 . found : c , 40 . 18 ; h , 1 . 35 ; n , 3 . 84 ; s , 8 . 90 . 4 - chloro - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared in a manner similar to that described in example 46 by replacing 3 - chloraniline with 4 - chloroaniline . 1 h nmr ( cdcl 3 ): d 7 . 30 ( m , 2h ), 7 . 20 ( m , 1h ), 7 . 14 ( m , 2h ). ms ( ei ): m / z 357 ( 27 , m + ), 258 ( 38 ), 126 ( 100 ), 99 ( 85 ). anal . calcd . for c 12 h 5 clf 5 no 2 s : c , 40 . 30 ; h , 1 . 41 ; n , 3 . 92 ; s , 8 . 96 . found : c , 40 . 19 ; h , 1 . 37 ; n , 3 . 87 ; s , 8 . 88 . 3 - nitro - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared in a manner similar to that described in example 46 by replacing 3 - chloroanile with 3 - nitroaniline . 1 h nmr ( cdcl 3 ): d 8 . 14 ( s , 1h ), 8 . 06 - 8 . 03 ( m , 2h ), 7 . 66 - 7 . 63 ( m , 1h ), 7 . 55 ( m , 1h ). ms ( ei ): m / z 368 ( 54 , m + ), 137 ( 70 ), 91 ( 100 ). anal . calcd . for c 12 h 5 f 5 n 2 o 4 s : c , 39 . 14 ; h , 1 . 37 ; n , 7 . 61 ; s , 8 . 71 . found : c , 39 . 39 ; h , 1 . 45 ; n , 7 . 46 ; s , 8 . 58 . 4 - methoxy - 1 - pentafluorophenylsulfonamido - 3 - trifluoromethylbenzene . the compound was prepared in a manner similar to that descnbed in example 46 by replacing 3 - chloroaniline with 4 - methoxy - 3 - ifluoromethylaniline which was obtained by the hydrogenation of the corresponding nitro compound . white solid , mp 121 - 123 ° c . 1 h nmr ( cdcl 3 ): d 7 . 43 - 7 . 37 ( m , 2h ), 6 . 96 ( d , j = 8 . 8 , 1h ), 3 . 88 ( s , 3h ). ms ( ei ): m / z 421 ( 16 , m + ), 190 ( 100 ). anal . calcd . for c 14 h 7 f 8 no 3 s : c , 39 . 92 ; h , 1 . 67 ; n , 3 . 32 ; s , 7 . 61 . found : c , 40 . 17 ; h , 1 . 68 ; n , 3 . 28 ; s , 7 . 67 . 4 - methoxy - 1 -( n -( 2 - propenyl ) pentafluorophenylsulfonamido ) benzene . to a solution of 4 - methoxy - 1 - pentafluorophenylsulfonamidobenzene ( 448 mg , 1 . 27 mmol ) in thf ( 3 ml ) was added triphenylphosphine ( 333 mg , 1 . 27 mmol ) a , d alkyl alcohol ( 0 . 09 ml , 1 . 27 mmol ). diethylazodicarboxylate ( 0 . 20 ml , 1 . 27 mmol ) was added and the mixture was stirred at rt after 1 h , the reaction mixture was poured onto saturated nacl ( 10 ml ) and extracted with ch2cl 2 ( 3 × 10 ml ). the combined organic extracts were washed with saturated nahco 3 ( 10 ml ) and dried ( mgso 4 ). concentration followed by flash chromatography ( 25 : 25 : 1 / hexanes : ch 2 cl 2 : etoac ) provided 451 mg ( 90 %) of product as a white solid , mp 59 - 60 ° c . 1 h nmr ( cdcl 3 ): d 7 . 06 ( m , 2h ), 6 . 85 ( m , 2h ), 5 . 79 ( m , 1h ), 5 . 15 ( s , 1h ), 5 . 11 ( m , 1h ), 4 . 37 ( d , j = 6 . 3 , 2h ), 3 . 80 ( s , 3h ). ms ( ei ): m / z 393 ( 33 , m + ), 162 ( 100 ), 134 ( 66 ). anal . calcd . for c 16 h 11 f 5 no 3 s : c , 48 . 98 ; h , 2 . 83 ; n , 3 . 57 ; s , 8 . 17 . found : c , 49 . 13 ; h , 3 . 15 ; n , 3 . 63 ; s , 8 . 15 . 1 -( n -( 3 - butenyl ) pentafluorophenylsulfonamido )- 4 - methoxybenzene . the compound was prepared in a manner similar to that described in example 50 by replacing alkyl alcohol with 3 - buten - 1 - ol . white solid , mp 64 - 66 ° c . 1 h nmr ( cdcl3 ): d 7 . 08 ( m , 2h ), 6 . 86 ( m , 2h ), 5 . 74 ( m , 1h ), 5 . 10 - 5 . 04 ( m , 2h ), 3 . 83 ( m , 2h ), 3 . 81 ( s , 3h ), 2 . 25 ( q , j = 6 . 9 , 2h ). ms ( ei ): m / z 407 ( 13 , m + ), 366 ( 24 ), 135 ( 100 ). anal . calcd . for c 17 h 14 f 5 no 3 s : c , 50 . 13 ; h , 3 . 46 ; n , 3 . 44 ; s , 7 . 87 . found : c , 50 . 25 ; h , 3 . 51 ; n , 3 . 43 ; s , 7 . 81 . 4 - methoxy - 1 -( n -( 4 - pentenyl ) pentafluorophenylsulfonamido ) benzene . the compound was prepared in a manner similar to that described in example 50 by replacing alkyl alcohol will 4 - pentent - 1 - ol . low melting semi - solid . 1 h nmr ( cdcl 3 ): d 7 . 08 ( m , 2h ), 6 . 87 ( m , 2h ), 5 . 74 ( m , 1h ), 5 . 02 - 4 . 96 ( m , 2h ), 3 . 81 ( s , 3h ), 3 . 76 ( t , j = 7 . 04 , 2h ), 2 . 11 ( q , j = 6 . 9 , 2h ), 1 . 60 ( pentet , j = 7 . 3 , 2h ). ms ( ei ): m / z 421 ( 30 , m + ), 190 ( 100 ). anal . calcd . for c 18 h 16 f 5 no 3 s : c , 51 . 31 ; h , 3 . 83 ; n , 3 . 32 ; s , 7 . 61 . found : c , 51 . 44 ; h , 3 . 89 ; n , 3 . 38 ; s , 7 . 54 . 1 -( n - 2 , 3 - dihydroxypropyl ) pentafluorophenylsulfonamido )- 4 - methoxybenzene . to a solution of 4 - methoxy - 1 -( n -( 2 - propenyl ) pentafluorophenyksulfonamido ) benzene ( 101 mg , 0 . 26 mmol ) in acetone : water ( 8 : 1 , 1 ml ) at rt was added n - methylmorpholine n - oxide ( 34 . 0 mg , 0 . 29 mmol ) and oso 4 ( 0 . 10 ml of 0 . 16 m solution in h 2 o , 1 . 60 × 10 − 2 mmol ). after stirring at rt for 18 h , the reaction mixture was treated with saturated nahso 3 ( 5 ml ) and allowed to stir at rt . after 1 h , the reaction mixture was poured onto saturated nahso 3 ( 5 ml ) and extacted with ch 2 cl 2 ( 3 × 10 ml ). the combined organic extracts were dried ( mgso 4 ) and concentrated . flash chromatography ( 1 : 1 , 1 : 2 / hexanes : etoac ) afforded 90 mg ( 83 %) of product as a white solid , mp 130 - 131 ° c . 1 h nmr ( cdcl 3 ): d 7 . 11 ( m , 2h ), 6 . 85 ( m , 2h ), 3 . 78 ( s , 3h ), 3 . 90 - 3 . 65 ( m , 5h ). anal . calcd . for c 6 h 13 f 5 no 5 s : c , 45 . 08 ; h , 3 . 07 ; n , 3 . 29 ; s , 7 . 52 . found : c , 45 . 09 ; h , 3 . 33 ; n , 3 . 27 ; s , 7 . 46 . 1 -( n -( 3 , 4 - dihydroxybutyl ) pentafluorophenylsulfonamido )- 4 - methoxybenzene . the compound was prepared in a marner similr to that described in example 53 by replacing 4 - methoxy - 1 -( n -( 2 - propenyl ) pentafluorophenylsulfonaido ) benzene with 1 -( n - 3 - butenyl ) pentafluorophenylsulfonamido )- 4 - methoxybenzene . white solid , mp 126 - 128 ° c . 1 h nmr ( cdcl 3 ): d 7 . 10 ( m , 2h ), 6 . 88 ( m , 2m , 4 . 13 ( m , 1h ), 3 . 96 ( m , 1h ), 3 . 81 ( s , 3h ), 3 . 78 - 3 . 73 ( m , 1h ), 3 . 64 ( dd , 1 , j = 2 . 9 , 10 . 7 , 1h ), 3 . 47 ( dd , j = 7 . 3 , 11 . 2 ; 1h ), 2 . 67 ( bs , 1h ), 1 . 92 ( bs , 1h ), 1 . 62 ( m , 2h ). 1 -( n -( 4 , 5 - dihydroxypentyl ) pentafluorophenylsulfonamido )- 4 - methoxybenzene . the compound was prepared in a manner similar to that described in example 53 by replacing 4 - methoxy - 1 -( n -( 2 - propenyl ) pentafluorophenylsulfonamido ) benzene with 4 - methoxy - 1 -( n -( 4 - pentenyl ) pentafluorophenylsulfonamido ) benzene . white solid , mp 116 - 118 ° c . 1 h nmr ( cdcl 3 ): d 7 . 07 ( m , 2h ), 6 . 86 ( m , 2h ), 3 . 80 ( s , 3h ), 3 . 78 ( m , 2h ), 3 . 71 - 3 . 62 ( m , 2h ), 3 . 43 ( dd , j = 7 . 5 , 10 . 8 ; 1h ), 1 . 90 ( bs , 2h , 1 . 66 - 1 . 49 ( m , 4h ). anal . calcd . for c 18 h 18 f 5 no 5 s : c , 47 . 48 ; h , 3 . 98 ; n , 3 . 08 ; s , 7 . 04 . found : c , 47 . 58 ; h , 3 . 95 ; n , 3 . 06 ; s , 6 . 95 . 1 -( n -( 4 - hydroxybutyl ) pentafluorophenylsulfonamido )- 4 - methoxybenzene . to a solution of 1 -( n -( 3 - butenyl ) pentafluorophenylsulfonamido )- 4 - methoxybenzene ( 410 mg , 1 . 01 mmol ) in thf ( 6 . 5 ml ) at − 78 ° c . was added bh 3 . thf ( 1 . 00 ml of a 1 m solution in thf , 1 . 00 mmol ). after stirring at − 78 ° c . for 1 h and at 0 ° c . for 1 h , the reaction mixture was treated with h 2 o ( 20 ml ) and sodium perborate ( 513 mg , 5 . 14 mmol ). after stirring at rt for 2 h , the mixture was poured onto h 2 o ( 20 ml ) and extracted with ch 2 cl 2 ( 3 × 15 ml ). the combined organic extracts were washed with sat . nacl ( 20 ml ) and dried ( mgso 4 ). concentration followed by chromatography ( 2 : 1 / hexanes : etoac ) afforded 270 mg ( 64 %) of product as a white solid , mp 88 - 90 ° c . 1 h nmr ( cdcl 3 ): d 7 . 08 ( m , 2h ), 6 . 85 ( m , 2h ), 3 . 80 ( s , 3h ), 3 . 77 ( m , 2h ), 3 . 64 ( t , j = 6 . 0 ; 2h ), 1 . 63 - 1 . 55 ( m , 5h ), 1 . 50 ( bs , 1h ). anal . calcd . for c 17 h 16 f 5 no 4 s : c , 48 . 00 ; h , 3 . 79 ; n , 3 . 29 ; s , 7 . 54 . found : c , 48 . 08 ; h , 3 . 76 ; n , 3 . 34 ; s , 7 . 46 . 4 - methoxy - 1 -( n -( 5 - hydroxypentyl ) pentafluorophenylsulfonamido ) benzene . the compound was prepared in a manner similar to that described in example 56 by replacing 1 -( n -( 3 - butenyl ) pentafluorophenylsulfonamido )- 4 - methoxybenzene with 4 - methoxy - 1 -( n ( 4 - pentenyl ) pentafluorophenylsulfonamido ) benzene . white solid , mp 96 - 97 ° c . 1 h nmr ( cdcl 3 ): d 7 . 08 ( m , 2h ), 6 . 86 ( m , 2h ), 3 . 81 ( s , 3h ), 3 . 76 ( t , j = 6 . 8 , 2h ), 3 . 62 ( t , j = 6 . 4 ; 2h ), 1 . 58 - 1 . 43 ( m , 6h ). anal . calcd . for c 18 h 18 f 5 no 4 s : c , 49 . 20 ; h , 4 . 13 ; n , 3 . 19 ; s , 7 . 30 . found : c , 49 . 11 ; h , 4 . 09 ; n , 3 . 14 ; s , 7 . 19 . 4 - methoxy - 3 - nitro - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared in a manner similar to example 46 by replacing 3 - chloroaniline with 4 - methoxy - 3 - nitroaniline which was prepared by the method of norris ( aust . j . chem . 1971 , 24 , 1449 ). orange - yellow solid , mp 95 - 97 ° c . 1 h nmr ( cdcl 3 ): d 7 . 64 ( d , j = 2 . 7 ; 1h ), 7 . 51 ( dd , j = 2 . 7 , 9 . 0 ; 1h ), 7 . 09 ( s , 1h ), 7 . 09 ( d , j = 9 . 0 ; 1h ), 3 . 95 ( s , 3h ). anal . calcd . for c 13 h 7 f 5 n 2 o 5 s : c , 39 . 21 ; h , 1 . 77 ; n , 7 . 03 ; s , 8 . 05 . found : c , 39 . 19 ; h , 1 . 73 ; n , 6 . 97 ; s , 7 . 95 . 3 - amino - 4 - methoxy - 1 - pentafluorophenylsulfonamidobenzene . to a solution of 4 - methoxy - 3 - nitro - 1 - pentafluorophenylsulfonamidobenzene ( 627 mg , 1 . 58 mmol ) in ethanol ( 10 ml ) was added 10 % pd / c ( 51 mg ). the resulting mixture was stirred under an atmosphere of hydrogen gas at 1 atm pressure . after 14 h , the mixture was passed through a pad of celite and the filtte was concentrated to give a solid residue . silica gel chromatography ( 2 : 1 , 1 : 1 / hexanes : etoac ) yielded 542 mg ( 93 %) of product as a white solid , mp 142 - 143 ° c . 1 h nmr ( dmso - d 6 ): 10 . 64 ( s , 1 ), 6 . 68 ( d , j = 8 . 4 ; 1h ), 6 . 44 ( d , j = 2 . 1 ; 1h ), 6 . 30 ( d , j = 2 . 1 , 8 . 4 ; 1h ), 4 . 88 ( bs , 2h ), 3 . 69 ( s , 3h ). anal . calcd . for c 13 h 9 f 5 n 2 o 3 s : c , 42 . 40 ; h , 2 . 46 ; n , 7 . 61 ; s , 8 . 71 . found : c , 42 . 29 ; h , 2 . 36 ; n , 7 . 52 ; s , 8 . 60 . 4 - butoxy - 1 - pentafluorophenylsuifonamidobenzene . to a solution of pentafluorophenylsulfonyl chloride ( 203 mg , 0 . 763 mmol ) in meoh ( 4 ml ) was added 4 - butoxyaniline ( 0 . 26 ml , 1 . 53 mmol ). after stirring at rt for 1 h , the reaction mixture was poured onto 1 m hcl ( 15 ml ) and extacted with ch 2 cl 2 ( 3 × 10 ml ). the combined organic extracts were washed with saturated nacl ( 10 ml ) and dried ( mgso 4 ). concentration followed by flash chromatography ( 25 : 25 : 1 / hexanes : ch 2 cl 2 : etoac ) provided 189 mg ( 63 %) of product 1 h nmr ( cdcl 3 ): d 7 . 07 ( m , 2h ), 6 . 86 ( s , 1h ), 6 . 80 ( m , 2h ), 3 . 89 ( t , j = 6 . 5 ; 2h ), 1 . 73 ( m , 2h ), 1 . 46 ( m , 21 , 0 . 95 ( t , j = 7 . 5 ; 2h ). ms ( ei ): m / z 395 ( 30 , m + ), 164 ( 35 ), 108 ( 100 ). anal . calcd . for c 16 h 14 f 5 no 3 s : c , 48 . 61 ; h , 3 . 57 ; n , 3 . 54 ; s , 8 . 11 . found : c , 48 . 54 ; h , 3 . 53 ; n , 3 . 50 ; s , 8 . 02 . 1 - pentafluorophenysulfonamido - 4 - phenoxybenzene . the compound was prepared in a manner similar to that described in example 60 by replacing 4 - butoxyaniline with 4 - phenoxyaniline . 1 h nmr ( cdcl 3 ): 7 . 36 - 7 . 30 ( m , 2h ), 7 . 15 - 7 . 10 ( m , 3h ), 6 . 99 ( s , 1h ), 6 . 98 - 6 . 90 ( m , 4h ). ms ( ei ): m / z 415 ( 32 , m + ), 184 ( 100 ), 77 ( 66 ). anal . calcd . for c 18 h 10 f 5 no 3 s : c , 52 . 05 ; h , 2 . 43 ; n , 3 . 27 ; s , 7 . 72 . found : c , 51 . 78 ; h , 2 . 45 ; n , 3 . 25 ; s , 7 . 53 . 4 - benzyloxy - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared in a manner sirila to that described in example 60 by replacing 4 - butoxyanilne with 4 - benzyloxyauiline . 4 - benzyloxyailine was obtained from the commercially available hydrochloride salt by treatment with aqueous naoh . 1 h nmr ( cdcl 3 ): 7 . 38 - 7 . 37 ( m , 4h ), 7 . 36 - 7 . 32 ( m , 1h ), 7 . 10 - 7 . 08 ( m , 2h ), 7 . 91 - 7 . 88 ( m , 2h ), 6 . 78 ( s , 1h ), 5 . 01 ( s , 1h ). ms ( ei ) m / z 429 ( 19 , m + ), 91 ( 100 ). anal . calcd . for c 19 h 12 f 5 no 3 s : c , 53 . 14 ; h , 2 . 82 ; n , 3 . 26 ; s , 7 . 45 . found : c , 53 . 07 ; h , 2 . 78 ; n , 3 . 21 ; s , 7 . 35 . 4 - methylmercapto - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared in a manner similar to that described in example 60 by replacing 4 - butoxyailine with 4 -( methylmercapto ) ailine . 1 h nmr ( cdcl 3 ): 7 . 17 ( m , 2h ), 7 . 09 ( m , 2h ), 6 . 89 ( m , 1h ), 2 . 44 ( s , 3h ). ms ( ei ): m / z 369 ( 24 , m + ), 138 ( 100 ), 77 ( 66 ). anal . calcd . for c 13 h 8 f 5 no 2 s 2 : c , 42 . 28 ; h , 2 . 18 ; n , 3 . 79 ; s , 17 . 36 . found : c , 42 . 20 ; h , 2 . 21 ; n , 3 . 72 ; s , 17 . 28 . 2 - methoxy - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared in a manner similar to that described in example 60 by replacing 4 - butoxyaniline with o - anisidine 1 h nmr ( cdcl 3 ): d 7 . 54 ( dd , j = 1 . 5 , 8 . 0 ; 1h ), 7 . 13 ( dt , j = 1 . 5 , 8 . 0 ; 1h ), 6 . 94 ( dt , j = 1 . 2 , 8 . 0 ; 1h ), 6 . 84 ( dd , j = 1 . 2 , 8 . 0 ; 1h ), 3 . 79 ( s , 3h ). ms ( ei ): m / z 353 ( 82 , m + ), 122 ( 100 ), 94 ( 95 ). anal . calcd . for c 13 h 8 f 5 no 3 s : c , 44 . 19 ; h , 2 . 28 ; n , 3 . 97 ; s , 9 . 06 . found : c , 44 . 10 ; h , 2 . 26 ; n , 3 . 92 ; s , 9 . 03 . 4 - allyloxy - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared in a anner similar to that described in example 60 by replacing 4 - butoxyaniline with 4 - alkyloxyanilie . 4 - allyloxyaniline was prepared by the method of butera ( j . med . chem . 1991 , 34 , 3212 ). 1 h nmr ( cdcl 3 ): 7 . 08 ( m , 2h ), 6 . 87 ( m , 1h ), 6 . 82 ( m , 2h ), 6 . 04 - 5 . 94 ( m , 1h ), 5 . 39 - 5 . 34 ( m , 1h ), 5 . 29 - 5 . 25 ( m , 1h ), 4 . 484 . 46 ( m , 2h ). ms ( ei ): m / z 379 ( 11 , m + ), 148 ( 32 ), 41 ( 100 ). anal . calcd . for c 15 h 10 f 5 no 3 s : c , 47 . 50 ; h , 2 . 66 ; n , 3 . 96 ; s , 8 . 45 . found : c , 47 . 53 ; h , 2 . 68 ; n , 3 . 62 ; s , 8 . 37 . 1 - penuruorophenylsulfonamido - 4 - propoxybenzene . the compound was prepared in a manner similar to that described in example 60 by replacing 4 - butoxyaniline with 4 - propoxyaniline . 4 - propoxyaniline was obtained by catalytic hydrogenation of 4 - alkyloxynitrobenzene . 4 - allyloxynitrobenzene was prepared by the method of butera ( j . med . chem . 1991 , 34 , 3212 ). 1 h nmr ( cdcl 3 ): 7 . 09 ( m , 2h ), 6 . 82 ( m , 2h ), 6 . 78 ( m , 1h ), 3 . 87 ( t , j = 6 . 5 ; 2h ), 1 . 78 ( m , 2h ), 1 . 02 ( t , j = 7 . 4 ; 3h ). ms ( el ): m / z 381 ( 20 , m + ), 150 ( 40 ), 108 ( 100 ). anal . calcd . for c 15 h 12 f 5 no 3 s : c , 47 . 25 ; h , 3 . 17 ; n , 3 . 67 ; s , 8 . 41 . found : c , 47 . 01 ; h , 3 . 20 ; n , 3 . 61 ; s , 8 . 31 . 4 - methyl ) ethoxy - 1 - pentafluorophenylsulfonamidobenzene . the compound was prepared in a manner similar to that described in example 60 by replacing 4 - butoxyaniline with 4 - isopropoxyaniline . 4 - isopropoxyaniline was prepared from 4 - fluoronitrobenzene in analogy to the method of day ( j . med . chem . 1975 , 18 , 1065 ). 1 h nmr ( cdcl 3 ): 7 . 08 ( m , 2h ), 7 . 00 ( s , 1h ), 6 . 81 ( m , 2h ), 4 . 48 ( heptet , j = 6 . 1 ; 1h ), 1 . 30 ( d , j = 6 . 04 ; 6h ). ms ( ei ): m / z 381 ( 7 , m + ), 339 ( 8 ), 108 ( 100 ). anal . calcd . for c 15 h 12 f 5 no 3 s : c , 47 . 25 ; h , 3 . 17 ; n , 3 . 67 ; s , 8 . 41 . found : c , 47 . 08 ; h , 3 . 18 ; n , 3 . 60 ; s , 8 . 34 . 1 - pentafluorophenylsulfonyloxybenzene . to a stirred solution of phenol ( 0 . 068 g , 0 . 729 mmol ) in dimethylfonnamide ( 3 . 65 ml ) at 25 ° c . is added pentafluorophenyl sulfonyl chloride ( 0 . 135 ml , 0 . 911 mmol ), followed by sodium carbonate ( 0 . 116 g , 1 . 09 mmol ), and the reaction mixture is stirred for 18 hours . the reaction mixture is diluted with ethyl acetate ( 50 ml ), washed with 20 % ammonium chloride ( 2 × 20 ml ), and saturated sodium chloride ( 2 × 20 ml ). the organic layer is dried ( sodium sulfite ), and the ethyl acetate removed under vacuum . column chromatography ( 3 / 1 ethyl acetatelhexane ) yields the title compound . 1 - pentafluorophenylsulfonylindole . to a stirred solution of indole . ( 0 . 085 g , 0 . 729 mmol ) in dimethylformamide ( 3 . 65 ml ) at 25 ° c . is added pentafluorophenyl sulfonyl chloride ( 0 . 135 ml , 0 . 911 mmol ), followed by sodium carbonate ( 0 . 116 g , 1 . 09 mmol ), and the reaction mixture is stirred for 18 hours . the reaction mixture is diluted with ethyl acetate ( 50 ml ), washed with 20 % ammonium chloride ( 2 × 20 ml ), and saturated sodium chloride ( 2 × 20 ml ). the organic layer is dried ( sodium sulfite ), and the ethyl acetate removed under vacuum . column chromatography ( 3 / 1 ethyl acetate / hexane ) yields the title compound . 2 - fluoro - 1 - methoxy - 4 - pentafluorophenylsulfonamidobenzene . to 3 - fluoro - p - anisidine ( 3 g 21 . 2 mmol ) suspended in thf ( 50 ml ) with pyridine ( 1 . 84 g , 23 . 3 mmol ) at 0 ° c . under argon is added dropwise pentafluorophenylsulfinyl chloride ( 5 . 3 g , 21 . 2 mmol ). the reaction mixture is stirred for 30 min . at 0 ° c . and allowed to warm to ambient temperature . the reaction mixture is strirred at room temperature and followed by tlc . after the reaction is completed the mixture is diluted with ethyl acetate and the reaction quenched with water . the layers are separated and the aqueous layer extracted twice with ethyl acetate . the organic layers are combined and dried with brine and with na 2 so 4 . the solvent is evaporated and the residue purified by chromatography on silica to give the title compound . 2 - anilino - 3 - pentafluorophenylsulfonamidopyridine . to a solution of pentafluorophenyisulfony chloride ( 863 mg , 3 . 24 mmol ) in pyridine ( 9 ml ) at rt was added 3 - amino - 2 - analinopyridine ( 600 mg , 3 . 24 mmol ). after stirring at rt overnight the reaction mixture was concented at reduced pressure and the residue partitioned between 1 m hcl ( 50 ml ) and ch2cl2 ( 50 ml ). the organic extract was dried and concentrated to give an oil which was purified by mplc to give 377 mg ( 28 %) of product as an orange solid . h 1 nmr ( cdcl 3 ): 8 . 50 ( bs , 1h ), 7 . 80 ( d , j = 5 . 1 , 1h ), 7 . 61 ( d , j = 8 . 0 , 1h ), 7 . 32 ( t , j = 8 . 0 , 2h ), 7 . 25 ( d , j = 8 . 0 , 2h ), 7 . 11 ( t , j = 7 . 3 , 1h ), 6 . 80 ( dd , j = 5 . 6 , 7 . 7 , 1h ), 4 . 20 ( bs , 1h ). ms ( fab ): m / z 438 ( m + na ), 416 ( m + h ). compounds were evaluated for their ability to increase ldl receptor expression in hep g2 cells using western - blot analysis as described in tam et al ., j . biol . chem ., 266 , 16764 ( 1991 ) the data presented ( ec max ) reflect the minimum concentration at which a maximal induction of ldl receptor was observed for each compound . in all cases , the level of induction was greater than that observed under lipid - free conditions ( activated system ). all publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference . although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding , it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims .	0
referring to fig1 , an embodiment of a manual fork truck 100 comprises a truck body 10 , and a tightening device 30 mounted on the truck body 10 . the tightening device 30 tightly holds and secures goods on the truck body 10 . the truck body 10 comprises a base bracket 11 , two pallet forks 13 , two load wheels 15 , a guide wheel 17 , and an operating pusher 19 . the base bracket 11 is a substantially trapezoidal shaped base , and comprises a first end 111 which is substantially trapezoidal shaped , a second end 113 opposite and parallel to the first end 111 , and a top surface 115 interconnecting the first end 111 and the second end 113 . the two pallet forks 13 are substantially rectangular board shaped . the tow pallet forks 13 are separately mounted to the first end 111 of the base bracket 11 , and positioned adjacent to a bottom portion of the base bracket 11 . the two pallet forks 13 cooperatively form a carrying space ( not labeled ) together with the base bracket 11 , for loading goods ( not shown ). each of the two pallet forks 13 defines a mounting hole 133 adjacent to a distal end of each of the two pallet forks 13 , away from the base bracket 11 . the mounting hole is substantially rectangular shaped . in an alternative embodiment , the mounting hole 133 may be a mounting slot recessed from a bottom surface of the pallet fork 13 , away from the base bracket 11 . the mounting slot partially receives each of the two load wheels 15 . each of the two load wheels 15 is oppositely mounted to a bottom portion of each of the two pallet forks 13 , and partially received within the mounting hole 133 . the guide wheel 17 is rotatably and adjustably mounted to the second end 113 of the base bracket 11 , adjacent to a substantially middle portion of the bottom portion of the base bracket 11 . a direction of the guide wheel 17 can be adjusted for guiding and adjusting directions of the truck body 10 . the operating pusher 19 is adjustably hinged to the second end 113 of the base bracket 11 , adjacent to and above the guide wheel 17 , for being handled by an operator during use . the tightening device 30 is mounted on the top surface 115 of the base bracket 11 . the tightening device 30 tightly holds and secures goods on the pallet forks 13 of the truck body 10 . the tightening device 30 comprises a tightening rod 31 , a fixing portion 33 on one end of the tightening rod 31 , and a plurality of tightening assemblies 35 separately and axially assembled to the tightening rod 31 . in the illustrated embodiment , the tightening rod 31 is a hollow cylindrical post made of metallic material . the fixing portion 33 comprises a plurality of strengthening rib sheets projecting radially from an outer periphery of the distal end of the tightening rod 31 . the plurality of strengthening rib sheets are substantially triangular shaped , and configured to facilitate fastening the tightening rod 31 with the top surface 115 of the base bracket 11 . the fixing portion 33 is fixedly welded to the top surface 115 of the base bracket 11 in one embodiment . each of the plurality of tightening assemblies 35 comprises at least one tightening arm 351 , and a tightening belt 353 . in the illustrated embodiment , each of the plurality of tightening assemblies 35 comprises two tightening arms 351 symmetrically projecting from the outer periphery of the tightening rod 31 , and a tightening belt 353 . each of the two tightening arms 351 is substantially u - shapes . the tightening belt 353 has one end connected to one of the two tightening arms 351 , and one free end . as in use , the goods are put on the two pallet forks 13 and received within the carrying space of the manual fork truck 100 , the free end of the tightening belt 353 tightly surrounds the goods and is finally detachably connected to another one of the two tightening arms 351 . thus , the goods is securely held to the truck body 10 . also referring to fig2 , wherein an isometric view of a second embodiment of a tightening device 40 is shown . the tightening device 40 has a structure similar to that of the tightening device 30 of the first embodiment . the tightening device 40 comprises a tightening rod 41 , a fixing portion 43 on one end of the tightening rod 41 , and a plurality of tightening assemblies 45 separately and axially assembled to the tightening rod 41 . each of the plurality of tightening assemblies 45 comprises two tightening arms 451 , and a tightening belt 453 . each of the two tightening arms 451 is substantially u - shapes . the difference between the first and the second embodiments is that the tightening rod 41 has a hollow telescopic structure . the tightening rod 41 comprises a plurality of hollow tubes 411 telescopically connected together one by one . in the illustrated embodiment , the tightening rod 41 is substantially stepped shaft shaped and comprises four hollow telescopic tubes 411 of different diameters . referring to fig3 , wherein an isometric view of another embodiment of a tightening assembly 90 is shown . the tightening assembly 90 comprises a rope barrel 91 which is a hollow cylinder , a tightening rope 93 with one end rotatably coiled around the rope barrel 91 and one free end , and two rolling wheels 95 oppositely and rotatably mounted to two ends of the rope barrel 91 . the free end of the tightening rope 93 is exposed to the outside . in use , one of the two rolling wheels 95 of the tightening assembly 90 is fixed to the tightening rod 31 or the tightening rod 41 . the free end of the tightening rope 93 may be pulled out to tightly surround the goods and connected to one of the two tightening arms 351 or the two tightening arms 451 , thereby by holding and securing the goods to the truck body 10 . when in an unused state , the tightening rope 93 is coiled around the rope barrel 91 . the tightening device 30 or the tightening device 40 has a simple structure with small volume , and is easy to operate with excellent tightening capabilities , thereby providing great convenience to the operator . the tightening device 30 or the tightening device 40 may not take up carrying spaces of the truck body 10 since it is mounted on the top surface 115 of the base bracket 11 . it is to be understood , however , that even through numerous characteristics and advantages of the disclosure have been set forth in the foregoing description , together with details of the structure and function of the invention , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .	1
in accordance with one embodiment of this invention , an object transport apparatus for conveying at least one object from a first reference surface position to a second reference surface position is disclosed , comprising pickup means having an upper and a lower vertical travel limit for releasably engaging the object ; and transport means cooperatively connected to the pickup means for selecting any desired path of travel from the first reference position through an arcuate motion having an independently variable range of elevations equal to the vertical travel limits of the pickup means to the second reference position . in accordance with another embodiment of this invention , a method for transporting an object is disclosed , comprising the step of swinging the object from a first reference surface position to a second reference surface position . the foregoing and other objects , features , and advantages will be apparent from the following , more particular , description of the preferred embodiments of the invention , as illustrated in the accompanying drawings . referring to fig1 an object transport apparatus for conveying an object from a first reference surface position to a second reference surface position is shown generally at reference number 10 . the transport apparatus 10 is shown provided with a pickup means , shown generally by reference number 20 , for releasably engaging the object . referring additionally to fig2 a sectional view taken along line 2 -- 2 of fig1 and to fig3 a sectional view taken along line 3 -- 3 of fig1 it will be seen that the pickup means 20 are provided with an elongated arm member 22 having opposed first and second ends , a pickup surface 25 located near the first end of the arm 22 , which pickup surface 25 is provided with at least a vacuum orifice 24 defined by the pickup surface 25 . to provide optimal dynamic response , the arm 22 is preferably fabricated from high strength low mass material , such as aluminum or magnesium . the vacuum orifice 24 is coupled to a selectively operable vacuum source by an arm vacuum passage 28 open to the vacuum orifice 24 , a flexible vacuum hose 30 open to the arm vacuum passage 28 and also open to a shaft vacuum passage 48 which terminates in a vacuum inlet 50 . the vacuum inlet 50 is , in turn , connected to an external vacuum source . referring also to fig4 it can be seen that the arm 22 is supported at a central portion between the ends by pivot means for engaging the arm 22 , as for example , a pair of pivots 42 . the pickup means 20 are further provided with a cam follower 32 having a cam follower surface , preferably threadedly mounted in a dielectric cam follower bushing 33 coupled to the arm body 22 . the pickup means 20 are preferably provided with a plurality of grip fingers 26 which are in communication with , and define the periphery of , the pickup surface 25 so that an object adhered to the pickup surface 25 is restrained from lateral movement , as for example , during the scrubbing of a semiconductor chip onto a lead frame to form a eutectic bond . it can be seen that the pickup surface 25 , pivotally mounted about the pivots 42 , has a finite range of elevations having an upper limit and a lower limit . alternatively , the arm 22 can be provided with a socket ( not shown ) adapted to receive the shank of a conventional die collet ( not shown ), thereby allowing various die collet configurations to be used in lieu of the combination of the pickup surface 25 and the grip fingers 26 . it is apparent that the pickup surface 25 can be indexed to a position parallel , in a first plane perpendicular to the axis formed by the pivots 42 , to a reference surface by traversing the cam follower 32 threadedly mounted in the dielectric cam follower bushing 33 . the arm 22 can be fabricated in two parts , as indicated by the break shown in fig1 and 3 . it is also apparent that the pickup surface 25 can be indexed to a position parallel , in a second plane parallel to the axis formed by the pivots 42 and perpendicular to the longitudinal axis of the arm 22 , to a reference surface by fabricating the arm 22 in two pieces and releasably mechanically coupling the two pieces so that the plane of the pickup surface 25 can be rotated about the longitudinal axis of the arm 22 . the transport apparatus 10 is further comprised of transport means cooperatively connected to the pickup means 20 for selecting any desired path of travel from the first reference surface position , through an arcuate motion having an independently variable range of elevations equal to the vertical limits of the pickup means 20 , to the second reference surface position . the transport means is provided with a frame shown generally by reference number 70 , having a frame body 72 for supporting the other operative elements of the transport apparatus , and rotation means , shown generally by reference number 40 , for rotating the pivot means , coupled to the rotation means 40 and the arm 22 , in a reversible angular motion over an arcuate range . the rotation means 40 are comprised of , as for example , a shaft 52 having an axis rotatably mounted to the frame 70 ; a shaft yoke 44 engaging the pivots 42 on a pivotal axis orthogonally disposed to the shaft axis in a plane parallel to the shaft axis ; a driven sprocket 54 coupled to the shaft 52 ; a cogged belt 56 engaging the driven sprocket 54 ; a driver sprocket 58 engaging the cogged belt 56 at a point remote from the driven sprocket 54 ; and a rotation motor 62 supported by the frame 70 and having a rotation motor shaft 60 coupled to the driver sprocket 58 . the rotation motor 62 is preferably an electrical stepping - type motor which , being provided with a defined reference position , can be rotated in incremental steps by application of timed current pulses , thereby providing an index of motion from the reference position . the shaft yoke 44 is coupled to the flexible vacuum hose 30 , and partially defines the shaft vacuum passage 48 which is further defined by the shaft 52 . the vacuum inlet 50 is preferably integral with the shaft 52 and aligned on the shaft axis . referring additionally to fig4 a sectional view taken along line 4 -- 4 of fig2 and to fig5 a sectional view taken along line 5 -- 5 of fig2 it will be seen that the transport means are further comprised of a cam means , shown generally by reference number 80 , for pivoting the arm 22 in a reversible pivotal motion about the pivot means over a pivotal motion range . the cam means 80 are supported by the frame 70 and comprised of a cam motor 82 mounted to the frame body 72 , having a cam motor shaft 86 having a cam motor shaft axis ; a cam mandrel 88 coupled to the cam motor shaft 86 ; a cam roller 90 having an axis of rotation and a cam surface for contacting the cam follower surface coupled to the cam mandrel 88 so that the axis of rotation is parallel to but not coincidental with the cam motor shaft axis . the cam motor 82 is preferably an electrical stepping - type motor which , being provided with a defined reference position , can be rotated in incremental steps by application of timed current pulses , thereby providing an index of motion from the reference position . the cam follower surface is preferably positioned in a symmetric manner about the shaft axis , so that , at any point within the rotation means 40 produced range of arcuate motion , the cam motor 82 may be driven to revolve the eccentrically mounted cam roller 90 about the cam motor shaft 86 , contacting the cam follower surface with the cam surface and thereby pivoting the arm body 22 and the pickup surface 25 about the pivots 42 . the pickup means 20 are also preferably provided with a spring 34 coupled , as for example , to the arm body 22 at an arm spring anchor 36 and coupled to the yoke 44 at a yoke spring anchor 46 , for loading the cam follower surface of the cam follower 32 toward the cam surface of the cam roller 90 . the transport means are further comprised of : control means having an input receiving means for receiving at least one input and output sending means for sending at least one output for controllably operating the transport apparatus 10 ; rotation data means for defining a position of the arm 22 within the arcuate motion range as a first of the inputs ; cam position data means for defining a position of the arm 22 within the pivotal motion range as a second of the inputs ; contact indicator means for defining a contact of any of the grip fingers 26 with one of the reference surface positions as a third of the inputs ; and reference surface position data input means for defining the first reference surface position as a fourth of said inputs and the second reference surface postion as a fifth of the inputs . the control means are preferably comprised of a microprocessor 110 electrically coupled to the transport apparatus 10 , capable of receiving and storing a plurality of instructions , receiving the plurality of data inputs , processing the data inputs according to the programmed instructions , and sending at least one control signal based on the conclusion of that processing operation . referring to fig1 the rotation data means are shown comprised of a rotation index plate 64 concentrically mounted about the rotation motor shaft 60 , a rotation index plate slot 65 in the rotation index plate 64 , and a rotation index sensor means 66 for detecting the presence of the rotation index plate slot 65 at a given reference position . the rotation index sensor means 66 are comprised , as for example , of an electric optical sensor so arranged as to send a signal to the control means when the rotation index plate slot 65 is engaged by the electric optical sensor . referring to fig1 and 4 , the cam position data means are shown comprised of a cam index plate 94 concentrically mounted about the cam motor shaft 86 , a cam index plate slot 96 in the cam index plate 94 , and cam index sensor means 98 for detecting the presence of the cam index plate slot 96 at a given reference position . the cam index sensor means 98 are comprised , as for example , of an electric optical sensor so arranged as to send an electrical signal to the control means when the cam index plate slot 96 is engaged by the electric optical sensor . with the cam index sensor means 98 providing an initial index position for the cam mandrel 88 , and necessarily also for the cam roller 90 , the cam motor 82 being an electrical stepping - type motor , and control being provided by a programmable electronic computer , it can be seen that the degree of rotation of the cam roller 90 can be independently and precisely controlled , thereby operating in conjunction with the spring 34 to move the cam follower surface and provide the pickup surface 25 with a pivotal motion about the pivots 42 in the finite range of elevations having the upper limit and the lower limit . the contact indicator means are comprised of , as for example , the cam roller 90 having an electrically conductive cam surface electrically connected to the control means and the cam follower 32 provided with an electrically conductive cam follower surface electrically connected to the control means . referring to fig2 it can be seen that the pickup surface 25 and the surrounding grip fingers 26 are lowered by driving the cam motor 82 in a direction tending to move the cam roller 90 away from the cam follower 32 . contact is normally maintained between the cam follower 32 and the cam roller 90 by the spring 34 . when the grip fingers 26 make contact with a surface , as for example , one of the reference surfaces , and the cam motor 82 is further driven in a direction tending to move the cam roller 90 away from the cam follower 32 , the arm body 22 is restrained from further motion by the contact of the grip fingers 26 with the surface resulting in a break in the physical and the electrical contact between the cam follower surface of cam follower 32 and the cam surface of the cam roller 90 . this break in electrical conductivity can be defined by the control means with reference to the exact position of the cam motor 82 , thereby providing an exact definition of the elevation of the grip fingers 26 when contact is made with the surface . furthermore , the control means can be programmed to stop rotation of the cam motor 82 prior to the grip fingers 26 contacting the surface so that the pickup surface 25 may be positioned immediately above the pickup surface while avoiding contact of the grip fingers 26 with the pickup surface . the control means could be further programmed to independently define the elevation of the two respective reference surfaces , and further programmed to control the exact elevation of the grip fingers 26 above the reference surface at the time of pickup with respect to the thickness of the object being transported . the reference surface position data input means for defining the first reference surface position and the second reference surface position as control means inputs are preferably comprised of at least one electro - optical sensor capable of scanning a surface and providing an electronic output defining an image of that surface and constituting a control means input . the control means then compares that input image with a programmed virtual image and processes differences in the images to direct the actual reference surface position as defined with respect to the corresponding virtual reference surface position . in operation , the transport apparatus 10 is advantageously used in a semiconductor production process , for example , when separating individual semiconductor chips from a semiconductor wafer and attaching those individual semiconductor chips to individual lead frames . preferably , the lead frames are sequentially mounted in a position shifting apparatus such that only one second reference surface position need be defined . the individual semiconductor chips lie in a matrix pattern forming the wafer , thus requiring that either each of the semiconductor chips be sequentially shifted to the first reference surface position or that the transport apparatus be shifted to allow the first reference surface position to sequentially coincide with the position of each of the individual semiconductor chips in the wafer matrix . in practice , it has been found preferable to mount the transport apparatus on a first x - y transport mechanism controlled by the control means to provide any lateral motion necessary to allow the pickup surface 25 to swing to its travel limits and still meet the first and second reference surface positions , and to also mount the wafer supporting first reference surface on a second control means controlled x - y transport mechanism which can shift the individual semiconductor chips in the wafer matrix to a single first reference surface position . the transport apparatus 10 , starting from an initial index position , starts operation by swinging the pickup surface 25 of the arm 22 about the axis of the shaft 52 by driving the rotation motor 62 , the driver sprocket 58 , the cogged belt 56 , and the driven sprocket 54 coupled to the shaft 52 . although the rotation means 40 are provided with a pair of yoke stops 45 mounted on the yoke 44 and the frame 70 is provided with a pair of frame stops 76 mounted to the frame body in alignment with the yoke stops 45 so that the limits of the arcuate range of motion are defined , the angular motion can be stopped at any selected point within the arcuate range . simultaneously , with the step of rotating the arm 22 , the cam motor 82 may be driven to pivot the arm 22 and the pickup surface 25 about the pivots 22 so that the pickup surface 25 is immediately above the object to be picked at such time that the pickup surface 25 reaches the first reference surface position . the external vacuum source then applies vacuum , at the command of the control means , to the vacuum inlet 50 , the shaft vacuum passage 48 , the flexible vacuum tube 30 , the arm vacuum passage 28 , and to the vacuum orifice 24 , thereby adhering the object to the pickup surface 25 . the cam motor 82 is then driven in an opposite direction thereby pivoting the pickup surface 25 in an upward direction about the pivots 42 a distance adequate to avoid interference with any adjacent object or obstruction , whereupon the rotation motor 62 is also driven in an opposite direction thereby rotating the arm 22 and pickup surface 25 about the shaft axis in an arcuate motion toward the second reference surface position . while the acceleration of the pickup surface 25 about the pivots 42 could be controlled by a contoured surface on the cam roller 90 , in the preferred embodiment the angular acceleration rates of the pickup surface 25 about the pivots 42 and about the axis of the shaft 52 are both determined by the timed electrical pulses respectively applied to the cam motor 82 and the rotation motor 62 by the microprocessor 110 . the control means continues to drive the cam motor 82 until every portion of the pickup means 20 can clear any intervening obstruction , whereupon the rotation of the cam motor is reversed thereby pivoting the pickup surface 25 downward so that it is immediately above the second reference surface position when the rotation motor 62 completes the step of rotating the pickup surface to the second reference surface position . the external vacuum source then releases the vacuum at the command of the control means thereby releasing the object at the second reference surface position . alternately , prior to releasing the object , the cam motor 82 may be driven an additional incremental amount to allow the object to come into physical contact with the second reference surface position and the x - y transport mechanism may then be reciprocated to &# 34 ; scrub &# 34 ; the object into the second reference surface position , as for example , to form a eutectic bond between a semiconductor chip and a lead frame . subsequent to the release of the object , the cam motor 82 and the rotation motor 62 may be simultaneously driven to either return the transport apparatus to the index position or to continue the transport process as a cylical operation . the above description of preferred embodiments is given by way of example only . changes in form and details may be made by one skilled in the art without departing from the scope of the invention as defined by the appended claims .	1
in this example the biotank 10 of the invented technique is equiped with two rotating cell segments contact aerators 30 which are rotantingly arranged around a central shaft in the biotank . for the rotation around the central shaft a contact aerator is using a motor drive system 40 which is not shown in detail in this figure . a oxygen sensor 50 is installed in the liquid of the biotank to measure the actual oxygen value . dependent of the measured actual value the sensor regulates the motor drive system to control the number of revolutions of the contact aerators , which are in this example the cell segment contact aerators 30 . the wastewater flows into the biotank through the influent 60 . in the biotank an aerea 70 nearby the water surface is established which is called aerobic environmental zone . in this zone the concentration of dissolved oxygen is usually greater than 1 . 0 mg / l . nearby the bottom of the biotank another environmental zone 80 is established . this is the anoxic environmental zone in which the concentration of dissolved oxygen is usually less than 0 . 5 mg / l . in the shown example a transition zone 90 between the aerobic zone 70 and the anoxic zone 80 is existent , in which the concentration of dissolved oxygen is in the range from 0 . 5 to 1 . 0 mg / l . the extension of this transition zone is for instance represented with the two light lines . the treated water flows out of the biotank 10 through the effluent 100 to the final clarifier 20 . return sludge is recycled through the outlet 120 from the final clarifier 20 to the inlet 140 into the biotank 10 . excess sludge is taken from the return sludge flow between final clarifier and biotank through the outlet 130 . through the effluent 110 purified water can leave the final clarifier . in the invented technique preference is given to the mentioned cell segment contact aerators which are known and can be used in variations too , e . g . by use of a so - called pipe segments contact aerator . together both contact aerators work as a true hybrid system , a combination of the activated sludge and the fixed film process . as mentioned above the contact aerators consists of several fixed film surfaces which are installed in a stationary position in the biotank under the water level and which may be submerged all the time or which can emerge periodically with the total fixed film surface area or with parts of them . the purification of the wastewater is effected on the one side by suspended activated sludge in the mixed liquor of the biotank 10 and on the other side by fixed film microorganisms in a biofilm on the roating surface areas of the contactors ( so - called sessil biomass ). the advantages of the activated sludge process are combined with those of the fixed film processes in only one technique . specially the oxygen supply for the microorganisms is ensured by rotating the contact aerator slowly effected by an infinitely variable gear motor ( frequency controlled gear motor ) above water - level . as soon as a segment emerges with its chambers above water level during this rotation , the activated sludge of the mixed liquor inside the chambers runs out . the segment will then be filled with atmospheric air . the necessary oxygen for the biological wastewater treatment dissolves on the wet surfaces of the fixed biofilm . because this very large surface area is directly disposed to the partial pressure of the air , an immediate saturation of the oxygen concentration is achieved . by diffusion oxygen penetrates into the deeper layers of the biofilm due to the concentration gradient . while the segments are submerging again into the mixed liquor the air cannot escape any more and is trapped in the segments . the air is forced conducted to the bottom of the biotank and on this way the air is compressed more and more . during the downward rotation parts of the air can escape and are channeled in the form of middle fine and fine bubbles to the center of the aerator caused by the shape of the segments . finally the bubbles reach the water surface trough the opposite segments and effect in combination with the rotation of the contact aerator a homogeneous mixing of the biotank and the sufficient supply of the mixed liquor with oxygen . during the upward rotation of the contact aerator the partially airfilled segments provide buoyancy and reduce tremendously the propulsive power for rotation . only a few moments before emerging again the rest of the air is being released into the water . the fixed film on the surface areas within the segments are supplied with oxygen up to saturation while passing the atmosphere . the forced conducted air is contacting again all inner surface areas of the plates or discs in the segments during rotation . by this all microorganisms of the fixed film are sufficiently supplied with oxygen during rotation in the mixed liquor too . the forced conducted air contacts the specially profiled surfaces of the plates and discs . due to these profiles consistently new , innumerable transition zones are formed for the oxygen transfer under compresssed conditions of the trapped air . this results in the typical coincident oxygen supply for both components , fixed biofilm and suspended activated sludge . to illustrate the efficiency of the invented technique the results of measurement from a model purification plant are explained which was specially dimensioned for an advanced nitrification . the total biomass as sum of the activated sludge and the fixed film biomass ranges from 5 to 10 kg dry solids per m 3 . the average power consumption of the biostage was 5 . 6 kw . the total tank volume was 240 m 3 . the volume load reach a value of 0 . 7 kg bod 5 /( m 3 - d ). the water depth in the biotank was nearly 4 m . the diameter of the installed cell segments contact aerator was 4 . 25 m whereby the distance between the bottom of the tank and the lowest point on the circuit of the contact aerator was 0 , 25 m . the contact aerator towers up nearly 0 . 5 m with its highest point on the circuit beyond the water surface of the biotank . the concentration of dissolved oxygen was measured in the liquid of the biotank at 5 observation points nearby the cell segments contact aerator using commercial oxygen sensors . observation point 1 was installed in a water depth of 0 . 5 m or 3 . 5 m beyond the bottom . observation point 2 was installed in a water depth of 1 . 5 m or 2 . 5 m beyond the bottom . observation point 3 was installed in a water depth of 2 . 5 m or 1 . 5 m beyond the bottom . observation point 4 was installed in a water depth of 3 . 45 m or 0 . 55 m beyond the bottom . observation point 5 was installed in a water depth of 3 . 95 m or 0 . 05 m beyond the bottom . dependent on the measured actual values of the concentration of dissolved oxygen the numbers of revolutions of the contact aerator was regulated in a range from 0 . 3 to 1 . 0 revolutions per minute in such a way that the measured actual values shown in table 1 were constantly measured at the observation points 1 - 5 . average values of each month of a test period of one year are listed . the efficiency of the purification plant results from the figures listed in table 2 . the following parameters in the influent and the effluent of the plant were measured : biological oxygen demand ( bod 5 ), chemical oxygen demand ( cod ), phosphats - phosphorus ( po 4 -- p ), ammonium nitrogen ( nh 4 -- n ), nitrite nitrogen ( no 2 -- n ) and nitrate nitrogen ( no 3 -- n ). in table 2 the average values of each month of a test period of one year are listed . by the shown results in table 2 it appears , that working with the invented technique an advanced nitrification and denitrification in combination with an advanced biological p - uptake is possible in only one biotank with one technique table 1______________________________________observation point dry1 2 3 4 5 solidsmonth concentration of dissolved oxygen ( mg / l ) ( kg / m . sup . 3 ) ______________________________________january 1 . 27 1 . 11 0 . 88 0 . 25 0 . 01 6 . 12february 1 . 35 1 . 15 0 . 80 0 . 20 0 . 01 7 . 32march 1 . 20 1 . 24 0 . 84 0 . 22 0 . 00 6 . 02april 1 . 29 1 . 18 0 . 80 0 . 27 0 . 01 7 . 72may 1 . 32 1 . 14 0 . 90 0 . 32 0 . 01 7 . 02june 1 . 36 1 . 16 0 . 90 0 . 30 0 . 01 6 . 92july 1 . 34 1 . 19 0 . 88 0 . 27 0 . 00 7 . 62august 1 . 38 1 . 20 0 . 90 0 . 40 0 . 01 6 . 52september 1 . 38 1 . 19 0 . 88 0 . 40 0 . 01 7 . 01october 1 . 31 1 . 15 0 . 89 0 . 34 0 . 00 7 . 02november 1 . 29 1 . 14 0 . 90 0 . 48 0 . 01 6 . 42december 1 . 40 1 . 20 0 . 90 0 . 47 0 . 01 6 . 32______________________________________ table 2__________________________________________________________________________rate of flow influent effluent influent effluent influent effluent influent effluent influent effluent influent effluent ( m . sup . 3 / d ) bod . sub . 5 bod . sub . 5 cod cod po . sub . 4 -- p po . sub . 4 -- p nh . sub . 4 -- n nh . sub . 4 -- n no . sub . 2 -- n no . sub . 2 -- n no . su no . sub . 3 -- n4 - 500 ( mg / l ) ( mg / l ) ( mg / l ) ( mg / l ) ( mg / l ) ( mg / l ) ( mg / l ) ( mg / l ) ( mg / l ) ( mg / l ) ( mg / l ) ( mg / l ) __________________________________________________________________________january 215 3 572 31 16 . 5 1 . 1 33 . 4 5 . 3 0 . 02 0 . 017 1 . 5 4 . 3febuary & lt ; 390 432 32 12 . 1 1 . 0 28 . 4 3 . 6 0 . 02 0 . 01 0 . 9 4 . 0march & lt ; 3 200 476 34 15 . 4 0 . 9 41 . 3 3 . 8 0 . 017 0 . 02 1 . 1 4 . 3april 350 510 37 18 . 9 1 . 2 27 . 4 5 . 8 0 . 18 0 . 017 1 . 6 3 . 0may 3 190 490 32 16 . 8 0 . 9 31 . 4 4 . 0 0 . 17 0 . 04 4 . 0 2 . 4june & lt ; 3 220 343 34 12 . 4 0 . 9 43 . 4 2 . 4 0 . 21 0 . 17 3 . 3 2 . 5july 3230 422 35 11 . 8 0 . 7 41 . 3 3 . 2 0 . 17 0 . 16 3 . 2 1 . 8august 38 364 31 14 . 3 1 . 0 36 . 4 3 . 0 0 . 46 0 . 21 4 . 1 1 . 4september 190 3 491 36 11 . 8 1 . 2 38 . 0 4 . 3 0 . 34 0 . 28 2 . 2 1 . 4october 3 460 34 13 . 4 0 . 9 38 . 4 3 . 1 0 . 23 0 . 17 2 . 8 2 . 3november 190 3 417 36 13 . 4 1 . 0 39 . 4 4 . 0 0 . 43 0 . 23 3 . 4 4 . 5december 180 3 410 32 11 . 9 0 . 9 34 . 3 4 . 5 0 . 43 0 . 36 3 . 4__________________________________________________________________________ 4 . 4	8
the following will provide a detailed description of forming a novel source / drain contact structure with low contact resistance . the description includes exemplary embodiments , not excluding other embodiments , and changes may be made to the embodiments described without departing from the spirit and scope of the invention . the following detailed description does not limit the invention . instead , the scope of the invention is defined by the appended claims . fig1 is a cross - sectional view 100 of a conventional transistor source / drain contact structure . modern transistors are formed in a substrate 105 and isolated from each other by shallow trench isolation ( sti ). the substrate 105 is preferably made of bulk silicon , but other commonly used materials and structures such as sige , silicon on insulator ( soi ), sige on insulator , and strained silicon on insulator can also be used . a gate stack including a gate dielectric 110 and a gate electrode 120 is formed in one of the transistors . lightly doped drain / source ( ldd ) regions 130 are then formed by implanting impurities such as boron or phosphor into the substrate 105 . then spacers 140 are formed on the sidewalls of gate electrode 120 . as is known in the art , the formation of spacers 140 preferably includes forming one or more dielectric layer ( s ) and etching the dielectric layer ( s ). the remaining portion of the dielectric layer ( s ) becomes the spacers 140 . the formation of the dielectric layer ( s ) includes commonly used techniques , such as plasma enhanced chemical vapor deposition ( pecvd ), low - pressure chemical vapor deposition ( lpcvd ), sub - atmospheric chemical vapor deposition ( sacvd ), and the like . the spacers 140 may comprise a single layer ( silicon nitride or sion layer ) or more than one layer , such as a silicon nitride or sion layer on a silicon oxide layer . after the spacer formation , implanting impurities into semiconductor substrate forms a source / drain region 150 . then the source / drain region is silicided by annealing a deposited metal . source / drain electrode are subsequently formed on the source / drain region 150 by making a contact thereon . referring again to fig1 , the conventional source / drain contact is formed by etching a contact hole in a inter - metal - dielectric 160 , depositing a barrier layer 175 on the sidewalls and bottom 172 of the contact hole , and filling the contact hole with a metal 180 . the convention source / drain contact has a barrier - layer - to - silicide area just the size of the bottom 172 of the contact hole . a total contact resistance rc may be expressed by the following equation : where r 1 represents a filling metal resistance , r 2 represents a resistance of the barrier layer on the sidewalls of the contact hole , and r 3 represents a resistance of the barrier layer on the bottom of the contact hole . since the barrier layer typically has high resistance , even though conventional contact structure employs various methods to reduce r 1 , the total contact resistance rc is still high due to the high r 3 . the present invention discloses a novel source / drain contact structure and methods for making the same . the novel source / drain contact structure can reduce r 3 in eq . 1 . fig2 a and 2b are flowcharts 200 and 250 illustrating beginning process steps for forming the novel source / drain contact structure according to embodiments of the present invention . referring to flowchart 200 of fig2 a , after forming the source / drain region 150 in the substrate 105 as shown in fig1 , the contact forming process begins with a siliciding source / drain step 205 . first , a metal layer is blanket is deposited . the metal layer preferably includes metals that will have a low or middle barrier height with the underlying semiconductor material , such as cobalt , nickel , tantalum , tungsten , and combinations thereof . the device is then annealed to form a silicide between the deposited metal layer and the underlying source / drain region 150 . un - reacted metal is then removed . it is to be realized that if germanium is present in the source / drain region 150 , germano - silicide will be formed . throughout the description , the term “ silicide ” also includes germano - silicide , as well as other materials known to people having skills in the art . after the source / drain silicidation step 205 , a first barrier layer deposition step 210 is performed . according to a first embodiment of the present invention , the first barrier layer is deposited by selective electroless plating of a metal , such as cowp , cowb , ta / tan , ru or fe , on the source / drain silicided area . according to a second embodiment of the present invention , the first barrier layer is made of a selective epitaxy growth barrier layer ( co , cosi ). according to a third embodiment of the present invention , the first barrier layer is formed by atomic layer deposition of materials , such as ru . referring to flowchart 250 of fig2 b , according to a fourth embodiment of the present invention , the contact formation process may begin with a metal 1 deposition step 255 . typically , metal 1 is used for first metal connection layer . here the metal 1 is selectively deposited on the source / drain region 150 . the metal 1 preferably includes metals that will have a low or middle barrier height with the underlying semiconductor material , such as cobalt , nickel , tantalum , tungsten , and combinations thereof . a first barrier layer ( tin ) is selectively deposited on the metal 1 in step 260 . the device is then annealed in step 265 to form a silicide between the metal 1 layer and the underlying source / drain region 150 . fig3 is a flowchart 300 illustrating process steps subsequent to either flowchart 200 or 250 for forming the source / drain contact according to the embodiments of the present invention . after the silicide and barrier layers are formed on the source / drain region , a conductive layer may be deposited on the barrier layer in step 310 . according to both the first and second embodiments of the present invention , where the barrier layer is made of either electroless plated cowp , cowb or ta / tan , or epitaxy grown co or cosi , the conductive layer may be formed by selective electroless plating of cu on the barrier layer . according to the third embodiment of the present invention , where the barrier layer is formed by atomic layer deposition of a material such as ru , the conductive layer may be formed by either electroless plating or atomic layer deposition of cu . according to the fourth embodiment of the present invention shown in fig2 b , the conductive layer may be formed by electroless plating , atomic layer deposition or epitaxy growth of a metal , such as cu . but according to the first embodiment of the present invention , where the barrier layer is formed by electroless plating of cowp , cowb , ag , ru or fe , the conductive layer deposition step 215 may be skipped altogether . referring again to fig3 , a dielectric layer serving as inter - metal - dielectric is deposited on the conductive layer or the barrier layer directly in step 320 . afterwards , a contact hole is etched in the dielectric layer in step 330 . with continuous reference to fig3 , a second barrier layer is deposited on the side walls and bottom of the contact hole in step 340 . the second barrier layer is often made of ta / tan . then a sputtering step 350 punches through or exposes the bottom area of the contact hole . after step 350 , a cu seed layer is deposited in step 360 . on top of the cu seed layer , more cu is deposited to fill up the contact hole in step 370 . then a contact to the source / drain region is formed . fig4 a and 4b are cross - sectional views of contact structures 400 and 450 formed by the process steps described by the flowchart 200 of fig2 a or flowchart 250 of fig2 b and the flowchart 300 of fig3 . referring to fig4 a , a first barrier layer 410 is deposited on the source / drain region 150 by step 210 of fig2 a or steps 260 and 265 of fig2 b . a conductive layer 415 is deposited on the barrier layer 410 by step 310 of fig3 . an inter - metal - dielectric layer 420 is deposited thereafter by step 320 of fig3 . a contact hole is then etched through the inter - metal - dielectric layer 420 by step 330 of fig3 . then a second barrier layer 425 is deposited on the sidewalls and bottom of the contact hole by step 340 of fig3 . before filling up the contact hole with a metal 430 by step 370 of fig3 , the second barrier layer 425 on the bottom of the contact hole is removed by the sputtering step 350 of fig3 , to allow the filling metal 430 to directly contact the conductive layer 415 . for reducing contact resistance , cu is typically chosen as the filling metal 430 . referring to fig4 b , the only difference between fig4 b and fig4 a is that the conductive layer 415 of fig4 a is eliminated in fig4 b , and the filling metal 430 contacts the first barrier layer 410 directly . referring again to both fig4 a and 4b , even though the first barrier layer 410 , which typically has higher resistance , is still present , it has a large contact area with the underlying source / drain region . in a typical process , the first barrier layer 410 covers the entire source / drain region 150 . as a result of the large contact area , the r 3 of eq . 1 may be greatly reduced , and so are the overall contact resistance rc of the contact structure 400 or 450 . although specific materials , such as cu for filling metal , etc ., are used to describe the embodiments of the present invention , one having skill in the art would realize that the inventive essence of the present invention lies in the process sequence of forming the first barrier layer 410 , which results in the increased contact area between the first barrier layer 410 and the source / drain region 150 , which in turn causes the total contact resistance rc to decrease . therefore , other metals , such as aluminum may also be used in various steps of the embodiments of the present invention . the above illustration provides many different embodiments or embodiments for implementing different features of the invention . specific embodiments of components and processes are described to help clarify the invention . these are , of course , merely embodiments and are not intended to limit the invention from that described in the claims . although the invention is illustrated and described herein as embodied in one or more specific examples , it is nevertheless not intended to be limited to the details shown , since various modifications and structural changes may be made therein without departing from the spirit of the invention and within the scope and range of equivalents of the claims . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention , as set forth in the following claims .	7
an object of the present invention is to completely eliminate any folds in lost foam castings . in the testing of the present invention , a box pattern is molded from eps ( expandable polystyrene ) prepuff , conditioned , and coated with a ceramic finish . the coated eps patterns are glued in clusters to a sprue which is then placed in a flask , and sand is compacted around it . the box pattern is gated to allow the converging metal , aluminum 319 alloy at 1350 ° f ., to fill the patterns . the placement of the gating in the box pattern is done to maximize fold defects from converging metal fronts in the casting . the eps bead , created in a two - step process , has a molecular weight of approximately 240 , 000 , a bead size distribution ranging from 250 to 500 microns , and a pentane blowing agent . the first step in a two - step process is the polymerization of styrene using benzoyl peroxide as an initiator . the suspension process is carried out in water in a stirred reactor using tricalcium phosphate ( tcp ) as a suspending agent and sodium dodecyl benzenesulfonate as an anionic surfactant to keep the styrene droplets from coalescing when they form discrete particles of polystyrene beads . a secondary initiator such as t - butyl perbenzoate is used to reduce the unreacted styrene to less than 1000 ppm in a secondary cure cycle . the second step of the two - step process is to suspend the polystyrene beads in water while carrying out an impregnation using pentane as the blowing agent near or above the softening point of the polystyrene . the impregnated beads are commonly known as eps . t24 polystyrene beads , the feedstock used to make t170b , a commercially available expandable polystyrene bead which is used for lost foam production , were impregnated with pentane containing various brominated organic additives , discussed below . the eps manufactured in this way has the same molecular weight and bead size distribution as the starting material . five commonly used flame retardants in the modified grade of eps are shown in table 1 , below . the flame retardants are incorporated usually in levels less than 1 . 0 wt %. in some cases , a relatively high temperature peroxide , such as dicumyl peroxide , is added during the impregnation cycle along with the flame retardant . dicumyl peroxide acts as a synergist and allows the use of less flame retardant while giving the same level of protection during a fire . other organic peroxides can be used if the decomposition half - life is greater than 2 hours at 100 ° c ., for instance , vulcup r [∝, ∝′- bis ( t - butylperoxy ) dilsopropylbenzene ]. while one of the purposes of the flame retardant in eps is to generate hbr while being heated at elevated temperatures , a more important function is to generate free radicals which reduce the polystyrene molecular weight so that the material quickly can liquefy . this can be verified by running melt index experiments using astm d - 1238 , run under condition g using a weight of 4900 g at 200 ° c . with and without flame retardants . in the presence of active flame retardants or peroxides , the melt flow of the extrudate will come out like water , while the control will flow like molasses . the general procedure for making a control was as follows : 235 pounds of water and 235 pounds of t24 polystyrene beads were added to a 50 gallon reactor being stirred at 250 rpm ; 474 g of tcp , 29 g of sodium dodecyl benzenesulfonate , and 160 g of triton ® x - 102 ( alkylaryl polyether alcohol ), a nonionic surfactant having an hlb value of 15 , were then added . suitable nonionic surfactants have an hlb value ranging from 12 to 18 . the reactor was heated from room temperature to 225 ° f . at a rate of 8 ° f . every 5 minutes . the reactor was purged three times with nitrogen and the pentane was added starting at 125 ° f . at a rate of 1 . 5 lb every five minutes . a total of 20 pounds was used . when the temperature reached 225 ° f ., it was kept at this temperature for three hours . the reactor was then cooled to 110 ° f . and the contents were emptied into a batch out tank containing water and hydrochloric acid ( hcl ). the contents were acidified to a ph of around 2 . 0 to remove tcp . the beads were dried by passing them through a dryer and screened to remove any agglomerated beads . each hundred pounds of dry beads were then treated with 10 grams of silicone oil . the same procedure was followed when adding brominated organic additives during the impregnation of the polystyrene beads . thus , for run 3 , 320 g of dicumyl peroxide was added . for run 4 , 725 g of hbcd was added . eps box patterns were prepared from the eps beads made in runs 1 to 9 . the eps parts were conditioned and then dipped into a ceramic coating . after drying , the parts were glued in clusters to a sprue and then placed in a flask . sand was compacted around them . aluminum 319 alloy was poured into the patterns at 1350 ° f ., and afterward the parts were examined for folds . control runs 1 and 2 were poured at different times and resulted in average fold defect values of 26 and 34 mm 2 . twenty castings were poured for control run 1 , while ten castings were poured for control run 2 , each casting containing two box patterns . eps does not depolymerize cleanly back to 100 % monomeric styrene , as does methyl methacrylate from polymethyl methacrylate . the amount varies from 70 to 75 % depending on the actual conditions used during the depolymerization ( around 400 ° c .). thus , each time decomposition of the polystyrene occurs , the results will be different in terms of the amount of gases , styrene , and other liquid and solid residues being generated . at higher temperatures used for pouring aluminum , the amount of styrene decreases and the formation of carbon , methane , and hydrogen are prevalent . run 3 , using 0 . 30 wt . % dicumyl peroxide as the additive , resulted in a high concentration of folds , 52 mm 2 , nearly twice as many per area as the control . to retard fold formation , the ceramic coating must provide a physical barrier between the metal front and the sand . the coating allows for the removal of gas decomposition products at a controlled rate to escape into the sand . in addition , the coating assists in the removal of styrene and other liquid decomposition products by wicking the liquids into the sand . if there is solid residue from the decomposition of polystyrene , it will be trapped as the metal flows and displaces the polystyrene . if the additive is ineffective , as it is for this run , the additive helps to form “ globs ” of polystyrene residue which accumulate and lead to folds as the metal front converges . runs 4 and 5 used 0 . 68 wt . % hbcd from two different manufacturers . although hbcd exists in three isomeric forms , the isomer content is not important in reducing fold defects , as the fold areas were identical ( 4 mm 2 ). the above additive ( hbcd ) allows for a complete breakdown of the polystyrene into liquid and gaseous products faster and more consistently than some other additives . run 6 shows that using 0 . 30 wt . % dicumyl peroxide with 0 . 68 wt . % hbcd resulted in nearly as many folds per area as the control . run 7 using 0 . 10 wt . % dicumyl peroxide with 0 . 68 wt . % hbcd resulted in the disappearance of nearly all folds . run 8 , which had a reduced hbcd level from 0 . 68 to 0 . 40 wt . %, showed an increase in the fold area from 4 to 9 mm 2 , but was still much less than the control . run 9 showed that adding product d to hbcd increased the fold area . thus in this application , product d is not beneficial . [ 0036 ] table 3 aluminum casting results - runs 10 to 13 ( eps flame retardants ) flame retardant average % flame retardant run % ( 0 . 68 wt . %) fold area mm 2 incorp . 10 product d 11 95 . 3 11 product a 0 76 . 9 12 product b 6 55 . 0 13 product e 7 81 . 3 runs 10 to 13 were better than the control in reducing the fold area . run 11 had no folds in any of the 10 castings , and gave the best results of any of the flame retardants tested . tetrabromocyclooctane is very effective in quickly reducing the molecular weight of polystyrene at elevated temperatures in a consistent manner . the by - products , liquids and gases , pass through the coating efficiently during the metal pour resulting in converging metal fronts having no carbon defects . in order to further demonstrate the effectiveness of the present invention , the seven flame retardants shown in the table below were subjected to tga ( thermal gravimetric analysis ) under n2 at 10 ° c . per minute . the shape of the curve was instructive ; products a , b , c and e , all decompose sharply by 305 ° c . products f and g decompose above 390 ° c . product d decomposes incompletely from 200 to 500 ° with 80 % loss at 264 ° c . eps beads containing products a , b , c and e produced casting with the smallest areas of fold defects . product d gave the least effective results , but was still more effective than the control . tga decomposition is a good indicator of whether the flame retardant will decrease fold defects . this could be due to the fact that product d does not decompose quickly over a short temperature range . by not decomposing , it added to the residue being generated during the process and increases the fold area . globs of material which do not decompose cleanly would be expected to accumulate as the metal front rises to the surface , and remain there after a pour as a carbon defect . products f and g , which decompose above 390 ° c ., gave more folds than the other flame retardants . while product g is similar to the control in fold area , use of product f resulted in nearly twice as many folds as the controls . the above results indicate that these flame retardants are too stable , i . e ., by not decomposing at a much lower temperature , they add to the residue being generated during the process . note that these two flame retardants are not used as flame retardants for eps , but are used successfully in high impact polystyrene to reduce flammability . it is apparent that only those flame retardants which are commonly used as flame retardants for eps , other than product d , will significantly reduce fold formation in patterns used in the lost foam process . while this invention has been described with respect to particular embodiments thereof , it is apparent that numerous other forms and modifications of this invention will be obvious to those skilled in the art . the appended claims in this invention generally should be construed to cover all such obvious forms and modifications which are within the true spirit and scope of the present invention .	8
the schematic representation according to fig1 shows the top view of a partial area 10 of a wafer 11 , on which are arranged a plurality of similar chips containing electronic components or electronic circuits . four such chips 12 - 15 are depicted in cutaway portions in fig1 . these chips are applied to the wafer 11 using known methods from semiconductor technology , for example , using the bipolar planar process . the chips are arranged symmetrically in rows and columns , whereby chip 12 is supposed to be arranged in row 6 , column 10 ; chip 13 in row 6 , column 11 ; chip 14 in row 7 , column 10 ; and chip 15 in row 7 , column 11 . for the sake of clarity , the inner structure of the chips is not depicted . edge areas 16 of the width d , representing the socalled slicing troughs , are situated between the individual chips 12 - 15 . these edge areas 16 cannot be used , up to a certain width , for layout components of the chips , because when the wafer 11 is sawn apart , slicing cuts of the width c are made through the edge areas 16 to dissociate the chips . as a result , edge - area strips of the width c fall off . the remainder of the width must be kept free , as the position of the slicing trace within the edge areas 16 cannot be exactly predicted because of the adjusting tolerance . therefore , the slicing cut can be situated all the way to the left on chip 12 , or all the way to the right on chip 13 . instead of dissociating the chips by sawing the wafer 11 apart , the edge areas 16 can also be scribed and , after that , broken off . in any case , however , a strip of material falls off from the edge area 16 . existing identifying markings consisting of binary - coded line elements are provided in the vertical edge area 16 between chips 12 and 13 , or rather chips 14 and 15 . these line elements run thereby perpendicularly to the edge of the semiconductor structures ( layouts ) of the chips , thus right across the edge areas 16 . the two upper regions 17 , 18 of identifying markings , which are offset to the left , are allocated to chip 12 , while the two lower regions 19 , 20 of identifying markings , which are offset to the right , are allocated to chip 13 . the regions 17 , 18 thereby form a safety clearance s with the chip 12 , as do the regions 19 , 20 with chip 13 . this safety clearance s serves to rule out with certainty any affects of the identifying markings on the semiconductor structures of the chips . as a result of these safety clearances s , the usable width of the edge areas is reduced to the value b . to clarify the functions and the configuration of the identifying markings , the representation according to fig1 is not shown true - to - scale . in actuality , the edge areas and identifying markings are substantially smaller in comparison to the size of the chips . fig2 and 3 give a rough idea of the actual size ratios . the following values serve as numerical examples : d = 80 μm , s = 10 μm , c = 30 μm . thus , given a symmetrical cut , one strip remains in each case for the identifying markings of the width 15 μm . the areas 17 and 19 each convey the row number for chips 12 and 13 ; in the present case , the column numbers for row 6 and areas 18 , 20 , and , in the present case , for rows 10 or 11 . the line elements in areas 17 through 20 consist of oxide , for example of structured emitter oxide . the line elements thereby represent 0 - bits , while the free locations embody 1 - bits . between two free locations , thus between two 1 - bits , a narrow oxide strip is arranged for the sake of clarification . the digital coding through the line elements is clarified in fig1 with appropriate numerical specifications . from a pure technological standpoint , the identifying markings are able to be applied to the wafer 11 in almost every process step during chip production . the identifying markings can be shown quite simply and robustly in one lithographic step , in which oxide windows are opened for the last time . during the bipolar planar process , this would be the contact - window plane . to this end , when production takes place in the pattern generator and in the repeater , exclusively the contact - window mask must be provided with the identifying marking structures next to each chip . all other masks or planes remain unchanged . in the region of the bits , the oxide in the slicing trough is not cauterized , rather it is only removed where one bit is supposed to be set in the binary representation of the column or row numbers . the width of the oxide window to be opened and the clearance between two adjacent windows must be selected on the basis of the occurring etching tolerances . as a variation of the depicted and clarified arrangement of the identifying markings , one can , of course , also select an inverse arrangement , in which the oxide elements represent the 1 - bits . in principle , one can also eliminate the narrow clearance strips between two locations that have been etched free , since their sole purpose is to improve readability . furthermore , it is possible to group several arrangements of column or row areas on one side of the chip , or to distribute them over several sides . in the depicted embodiment , the identifying markings are arranged in each case on the right lateral edge , above , and on the left lateral edge , below . the upper and lower edges can also be provided with identifying markings . in the most favorable case , the slicing cut is made symmetrically , so that a middle strip of the width c is not needed . in this case , all that is retained on the remaining lateral edge areas of the dissociated chips are the respective , allocated identifying markings . in principle , this represents the most favorable solution . however , if the slicing cut runs asymmetrically , which can hardly be prevented in practice , then in the most unfavorable case , the identifying markings on the narrower strip can be completely dropped ( when this strip is smaller than or equal to the safety clearance s ). in addition , the wider strip of the adjacent chip still contains identifying markings , which are not allocated to this chip . one is , nevertheless , still able to differentiate , since the allocated identifying markings exhibit substantially larger dimensions due to the staggered arrangement . the omission of the identifying markings on the adjacent chip likewise has no adverse effect , since a wider edge area is retained , in turn , for this chip on the diametrically opposing side . in fig2 the right upper area of chip 12 , and in fig3 the left lower area of this chip are shown true - to - scale . while to simplify the representation in fig1 only a 4 - bit marking was provided for the column or row numbers , a 5 - bit marking is realized in fig2 and 3 . the regions 17 and 18 of the identifying markings are identical on the upper right and on the lower left lateral edges . contrary to fig1 they are portrayed here as area elements , which no longer actually exhibit a line form . the subsequent chip 21 is arranged in column 9 on the left lateral edge area of chip 12 . in each case , the uppermost identifying element 22 of the regions 18 indicating the column is conceived as a type of arrowhead and points away from the allocated chip 12 and toward the edge area of the unsliced wafer . it is thus guaranteed that , on the one hand , one can differentiate with certainty between row and column numbers and , moreover , that the earlier rotational position on the wafer can be determined for the dissociated chip . over and above that , the edge areas 16 can contain still further chip - specific data , such as the identification of different variants of one chip type , the process modification , manufacturing date , production location , and the like . the identifications for these data can be distributed over the four edge areas .	7
as shown in fig1 , the electromagnetic actuator of the invention comprises an electromagnet 1 with a core 2 and a coil 3 . the electromagnet 1 exerts an electromagnetic force in a controlled manner on an armature 4 integral with a pushrod 5 that can move along the x axis . such an actuator is , for example , used to actuate an internal combustion engine valve , the actuator being placed in such a way that the pushrod 5 extends along the sliding axis of the valve . as is known , the actuator includes another electromagnet ( not shown ) that extends opposite the electromagnet 1 so as to selectively attract the armature 4 in the opposite direction . the end of the pushrod 5 and the end of the valve are returned to each other by opposing springs ( not shown ) that define an equilibrium position of the pushrod / valve assembly in which the armature extends substantially at mid - path between the two electromagnets . the core 2 of the electromagnet 1 has a base 10 from which two lateral branches 11 and a central branch extend , the coil 3 extending around said central branch . the central branch comprises two portions 12 with facing inclined faces integral with the base 10 . the portions 12 form a support part , for supporting the core 2 , said part being designed to accommodate permanent magnets 13 so that the latter extend obliquely to the x axis and form a v , the point of which here is turned toward the base 10 . a wedge 14 forming an end part of the central branch is thus formed in the v . the path of the flux lines generated by the permanent magnets 13 , which pass through the core 2 so as to form a return path in the armature 4 , is depicted as the bold dashed lines in fig1 . the wedge 14 has an end face 15 in which a groove 17 lies parallel to the permanent magnets 13 . the groove 17 ensures that there is a sharp separation between the respective flux lines of the two permanent magnets 13 that pass on either side of the groove 17 . as may be seen in fig2 ( in which the core is illustrated upside - down with respect to fig1 ), the actuator is mounted as follows . after having formed the core 2 by assembling the laminations that form the base 10 , the lateral branches 11 and the support portions 12 , the permanent magnets 13 are put into position on the support portions 12 . in this regard , the support portions 12 include steps 50 making it easier to position the magnets 13 . after having formed the wedge 14 , by assembling the corresponding laminations , the wedge 14 is then attached to the permanent magnets 13 as indicated by the arrow . the wedge 14 then lies above the permanent magnets 13 and is self - centered by the v formed by the permanent magnets 13 . to keep the whole assembly in place , nonmagnetic clamps 18 are used , each of these having , on the one hand , an elongate part ( visible in cross section in fig1 ) that is housed in the groove 17 of the active face 15 of the wedge 14 , and on the other hand , braces that extend into holes passing through the wedge 14 , then between the permanent magnets 13 and finally in holes in the core 2 ( these not being visible ) so as to be fastened to the latter , for example by screwing or by riveting ( as a variant , the braces could pass through the core 2 so as to be fixed directly to the body 100 ). the clamps make it possible to exert a compressive force so as to take up , or even eliminate , the residual gap that may remain owing to the manufacturing tolerances between , on the one hand , the support portions 12 and the permanent magnets 13 and on the other hand , the permanent magnets 13 and the wedge 14 . this gap take - up allows the magnetic efficiency of the actuator to increase . as may be seen in fig3 , the geometry of the core 2 imposes on the central branch of the latter critical passage sections for the flux lines of the permanent magnets 13 . first critical sections s 1 extend in the wedge 14 between one of the ends of the permanent magnets 13 and the central axis x . second critical sections s 2 each extend in one of the bearing portions between one of the ends of the corresponding permanent magnets 13 and the angle formed by the base 10 and the bearing portion 12 . finally , third critical sections s 3 extend in the wedge 14 between an external face and the groove 17 . each of these critical sections s 1 , s 2 , s 3 has a minimum area through which the entire flux of one of the permanent magnets 13 passes . moreover , the armature 4 also has fourth critical sections s 4 through which the entire flux of one or other of the permanent magnets 13 passes . it is known that the constituent ferromagnetic material of the core 2 and of the armature 4 has a saturation threshold above which it becomes increasingly difficult to make additional flux pass through a given passage section . it is important , when in only the flux generated by the permanent magnets 13 , for the constituent material of the core 2 and of the armature to work , in the critical sections s 1 , s 2 , s 3 , s 4 , below the saturation threshold so as to retain the possibility of the flux generated by the coil passing through them and thus providing said coil with an acceptable efficiency . to do this , the critical sections s 1 , s 2 , s 3 , s 4 should have sufficiently large areas . the width of the core 2 in the sections s 1 , s 2 , s 3 , is called d 1 , d 2 , d 3 respectively . if l is the length of the core ( measured along a direction perpendicular to the plane of the figure ), the critical sections s 1 , s 2 , s 3 have respective areas : likewise if d 4 is the width of the armature in the section s 4 and if the length of the armature is taken to be approximately l , the area of the section s 4 is a 4 = l × d 4 . as regards the flux of the permanent magnets 13 this is approximately proportional to the area of the surface of the permanent magnets in contact with the core . if h is the height of the permanent magnets , this area is to avoid the critical sections being saturated , it is necessary to given an upper limit to the ratio of the flux to the area of the critical section in question , and therefore to limit the ratios : r 1 = a / a 1 ; r 2 = a / a 2 ; r 3 = a / a 3 ; and r 4 = a / a 4 . the upper limit of these ratios depends on the nature of the constituent material of the core 2 and of the armature 4 . the upper limit of the ratios r 1 , r 2 , r 3 , r 4 is preferably equal to : 3 . 2 for a core or armature made of silicon - iron ; 3 . 75 for a core or armature made of 17 / 18 % cobalt - iron ; and 4 . 15 for a core or armature made of 48 / 50 % cobalt - iron . since the length l comes into the expressions for the areas a , a 1 , a 2 , a 3 and a 4 it should be noted that these ratios may also be expressed as r 1 = h / d 1 , r 2 = h / d 2 , r 3 = h / d 3 and r 4 = h / d 4 so that the ratios represent length ratios . as may be seen in fig3 , the core 2 illustrated here is such that the wedge 14 terminates in a point approximately at those ends of the permanent magnets 13 which are opposite the ends where the sections s 1 are taken in the wedge 14 . likewise , the bearing portions 12 terminate in a point at those ends of the permanent magnets 13 which are opposite the ends where the sections s 2 are taken in the bearing portions 12 . in this configuration , the tangent of the half - angle φ of the v formed by the permanent magnets 13 is approximately equal to d 2 / h or d 1 / h , i . e . the inverse of the ratios r 1 and r 2 . this therefore amounts to giving the ratios r 1 and r 2 an upper limit or to giving the half - angle φ at the apex of the v a lower limit . the lower limit of the half - angle φ of the apex of the v is preferably equal to : 17 ° for a core made of silicon - iron ; 13 . 5 ° for a core made of 17 / 18 % cobalt - iron ; and 12 ° for a core made of 48 / 50 % cobalt - iron . these values make it possible to prevent saturation in the critical sections under just the flux of the permanent magnets 13 . in any event , the half - angle φ at the apex of the v will be chosen to be equal to or greater than 10 °. however , the ratios r 1 , r 2 , r 3 , r 4 should not be too small as otherwise this would lead to excessively large passage sections limiting the efficiency of the permanent magnets 13 . in practice , the ratios r 1 , r 2 , r 3 , r 4 are preferably chosen to be equal to or greater than 2 . in terms of angle , this condition amounts to limiting the half - angle φ of the v to a value equal to or less than 25 °. the invention is not limited to what has just been described , rather quite to the contrary it encompasses any variant falling within the scope defined by the claims . in particular , although actuators have been illustrated here in which the permanent magnets form a v , the tip of which is turned toward the base of the core , it will also be possible to place the magnets in such a way that they form a v with the tip directed toward the armature . the magnet support part of the base will have inclined faces no longer facing each other but being turned toward the lateral branches , whereas the end part of the central branch will no longer have a wedge shape but a hat shape . although critical sections have been considered here in the central branch , it is obvious that the limits that apply to the ratios r 1 , r 2 , r 3 , r 4 also apply to any similar ratio associated with any section taken in the rest of the core or of the armature , said ratio then being equal to the area of the surface of the permanent magnet to the area of the relevant section .	7
state of the art for downstream tdd transmission is quite similar to that described for upstream : the headend transmits a preamble to facilitate the cpe receiver , followed by a payload whose modulation profile is chosen to adapt to the particular channel conditions for the particular intended cpe receiver . in the downstream case , the direction of the traffic is reversed , and the channel properties may in general be different from the upstream case , such as the pathloss ( which may be characterized as distance ), snr , channel capacity , and receptivity , and these properties may vary per cpe . a preamble is broadly defined as to other well know methods having substantially the same purpose , such as : header , phy header , start marker , phy start marker , pilot tones , pilot carriers or the like . also , the preamble may carry some information about how the subsequent payload is to be decoded ( e . g ., some indication of the modulation profile ). when the headend needs to send a different payload to a different cpe , it transmits another preamble first , followed by the payload adapted to the channel conditions for that particular cpe . the second preamble is needed to facilitate the second cpe receiver , because , although the second receiver would be able to detect and acquire the phy layer parameters from the first preamble , the second cpe receiver is in general unable to receive and decode the first payload because it uses some other modulation profile , so the second receiver loses track of the headend &# 39 ; s transmission . thus , the second preamble is needed for the second cpe receiver to re - detect and re - acquire the signal from the headend before the second payload arrives . as shown in fig3 , the presently claimed invention teaches headend 30 to concatenate two or more of the downstream payloads , where each may have different modulation profiles , without requiring intervening preambles to be transmitted . headend 30 transmits a single preamble 38 at the start of downstream phase 46 , followed by the concatenated payloads 32 , 34 , 36 . although this disclosure in the examples described , only three payloads are described , this disclosure is intended to include any number of payloads . if two such payloads are concatenated by headend 30 , then the presently claimed invention eliminates the need for the headend to transmit a second intervening preamble between them . if three such payloads are concatenated by the headend , then the presently claimed invention eliminates the need for the headend to transmit a second and third intervening preamble . a similar result is obtained for 4 or more such payloads that are concatenated by the headend . headend 30 may concatenate in this fashion for as long as it has downstream data available for transmission to cpes , or until reaching the end of downstream phase 46 of the current tdd cycle 48 . the headend would restart the process for each downstream phase of subsequent tdd cycles . an example of the claimed invention advances the state of the art because the amount of overhead consumed by downstream preambles is reduced , thereby making more channel - time available per downstream phase 46 for headend 30 to schedule information - carrying payloads . furthermore , the overhead associated with employing a high order modulation profile for nearby cpes is reduced , enabling the headend to more readily achieve the higher information - rates for those cpes . this reduction in preamble overhead can be quite significant if many preambles are eliminated , such as the case when the headend is actively servicing a large number of cpes and / or when there are many relatively short payloads to be transmitted downstream that are latency - sensitive . making the downstream transmissions more efficient , the claimed invention enables the headend to sustain a higher downstream throughput capacity . alternatively , the headend can schedule less time for downstream phases 46 , thereby allowing for a greater volume of upstream traffic in upstream phases 50 to be transmitted , or allowing for shortened tdd cycles 48 to reduce latency . an example of the claimed invention , as shown in fig3 , teaches headend 30 to concatenate payloads in rank order of progressively increasing modulation profile . that is , a first payload 32 of a concatenated set of payloads has the lowest modulation profile of the set , and a last payload 36 of a concatenated set has the highest modulation profile in the set , and payloads in the middle 34 of a concatenated set have intermediate modulation profiles . as a very simplistic example , the payloads intended for the most distant cpes 40 are transmitted by headend 30 shortly after preamble 38 , followed by payloads intended for mid - range cpes 42 , then finally ending with payloads intended for the most nearby cpes 44 . this rank ordering by progressive modulation profile is important , since it enables all of the intended cpes to not only detect and acquire the phy layer parameters from single leading preamble 38 , but also to keep track of the headend &# 39 ; s transmissions up to and including the particular payloads intended for those cpes . each cpe is typically informed by headend 30 beforehand which payloads within downstream phase 46 are intended for it ( e . g ., headend 30 can inform this via a scheduling message ( s ) sent to cpes beforehand , such as a well - known media access plan ( map ) message ). for example , consider the headend &# 39 ; s downstream transmission from the perspective of the most distant cpe 40 : most distant cpe 40 receives single leading preamble 38 , from which it detects and acquires the phy layer parameters required to properly decode the subsequent payload , such as gain , frequency - offset and timing information . very first payload 32 arriving after single leading preamble 38 is the payload with the lowest modulation profile ( e . g ., intended for the most distant cpe 40 , for example 256 - qam ). consequently , this most distant cpe 40 is able to accurately track the headend &# 39 ; s transmission for the duration of first payload 32 , and accurately receive and decode the payload information bits intended for this most distant cpe 40 . next to arrive at most distant cpe 40 is second payload 34 in the concatenated set of payloads . second payload 34 might possibly have the same modulation profile as first payload 32 , but in general would have a higher modulation profile than first payload 32 ( e . g ., being intended for the next most distant cpe 42 to receive downstream traffic in the concatenated set , for example 512 - qam ). this rank order by progressive modulation profile is imposed by headend 30 according to the claimed invention . second payload 34 , having higher modulation profile , is more difficult for the most distant cpe 40 to track and decode accurately , and , in general , may not be accurately decoded . however , most distant cpe 40 has already received and decoded first payload 32 to which it was intended , and there is no longer any need for most distant cpe 40 to track or decode any more payloads in downstream phase 46 of current tdd cycle 48 . now consider the same example , but from the perspective of most nearby cpe 44 : most nearby cpe 44 receives single leading preamble 38 , from which it detects and acquires the phy layer parameters required to properly decode subsequent payloads , such as gain , frequency - offset and timing information . first payload 32 arriving after single leading preamble 38 is the payload with the lowest modulation profile ( e . g ., intended for most distant cpe 40 ). consequently , most nearby cpe 44 is easily able to accurately track the headend &# 39 ; s transmission for the duration of first payload 32 . next to arrive at most nearby cpe 44 is second payload 34 in the concatenated set of payloads . second payload 34 might possibly have the same modulation profile as first payload 32 , but in general would have a higher modulation profile than the first payload . nevertheless , most nearby cpe 44 is able to continue accurately tracking the headend &# 39 ; s transmission for the duration of second payload 34 . similarly , most nearby cpe 44 is able to continue accurately tracking all the subsequent payloads in downstream phase 46 , even as their modulation profiles increase progressively . finally , last payload 36 in the concatenated set , having the highest modulation profile of all ( e . g ., 1024 - qam ), arrives at most nearby cpe 44 . last payload 36 is specifically intended for most nearby cpe 44 , so it can be accurately tracked and decoded . while various embodiments of the disclosed method and apparatus have been described above , it should be understood that they have been presented by way of example only , and should not limit the claimed invention . likewise , the various diagrams may depict an example architectural or other configuration for the disclosed method and apparatus . this is done to aid in understanding the features and functionality that can be included in the disclosed method and apparatus . the claimed invention is not restricted to the illustrated example architectures or configurations , rather the desired features can be implemented using a variety of alternative architectures and configurations . indeed , it will be apparent to one of skill in the art how alternative functional , logical or physical partitioning and configurations can be implemented to implement the desired features of the disclosed method and apparatus . also , a multitude of different constituent module names other than those depicted herein can be applied to the various partitions . additionally , with regard to flow diagrams , operational descriptions and method claims , the order in which the steps are presented herein shall not mandate that various embodiments be implemented to perform the recited functionality in the same order unless the context dictates otherwise . although the disclosed method and apparatus is described above in terms of various exemplary embodiments and implementations , it should be understood that the various features , aspects and functionality described in one or more of the individual embodiments are not limited in their applicability to the particular embodiment with which they are described . thus , the breadth and scope of the claimed invention should not be limited by any of the above - described exemplary embodiments . terms and phrases used in this document , and variations thereof , unless otherwise expressly stated , should be construed as open ended as opposed to limiting . as examples of the foregoing : the term “ including ” should be read as meaning “ including , without limitation ” or the like ; the term “ example ” is used to provide exemplary instances of the item in discussion , not an exhaustive or limiting list thereof ; the terms “ a ” or “ an ” should be read as meaning “ at least one ,” “ one or more ” or the like ; and adjectives such as “ conventional ,” “ traditional ,” “ normal ,” “ standard ,” “ known ” and terms of similar meaning should not be construed as limiting the item described to a given time period or to an item available as of a given time , but instead should be read to encompass conventional , traditional , normal , or standard technologies that may be available or known now or at any time in the future . likewise , where this document refers to technologies that would be apparent or known to one of ordinary skill in the art , such technologies encompass those apparent or known to the skilled artisan now or at any time in the future . a group of items linked with the conjunction “ and ” should not be read as requiring that each and every one of those items be present in the grouping , but rather should be read as “ and / or ” unless expressly stated otherwise . similarly , a group of items linked with the conjunction “ or ” should not be read as requiring mutual exclusivity among that group , but rather should also be read as “ and / or ” unless expressly stated otherwise . furthermore , although items , elements or components of the disclosed method and apparatus may be described or claimed in the singular , the plural is contemplated to be within the scope thereof unless limitation to the singular is explicitly stated . the presence of broadening words and phrases such as “ one or more ,” “ at least ,” “ but not limited to ” or other like phrases in some instances shall not be read to mean that the narrower case is intended or required in instances where such broadening phrases may be absent . the use of the term “ module ” does not imply that the components or functionality described or claimed as part of the module are all configured in a common package . indeed , any or all of the various components of a module , whether control logic or other components , can be combined in a single package or separately maintained and can further be distributed in multiple groupings or packages or across multiple locations . additionally , the various embodiments set forth herein are described in terms of exemplary block diagrams , flow charts and other illustrations . as will become apparent to one of ordinary skill in the art after reading this document , the illustrated embodiments and their various alternatives can be implemented without confinement to the illustrated examples . for example , block diagrams and their accompanying description should not be construed as mandating a particular architecture or configuration .	7
fig1 shows a first communication network k 1 which comprises a first mobile radio network mfn 1 , a first packet - switched domain ps 1 , an internet protocol - based multimedia subsystem ims , a server s 1 in the form of a push - to - talk server , a second packet - switched domain ps 2 and a second mobile radio network mfn 2 . in the first mobile radio network mfn 1 , a first base station bs 1 and a second base station bs 2 are arranged which is connected to a first switching center sgsn 1 ( serving gprs support node ) of the first packet - switched domain ps 1 . the first switching center sgsn 1 is connected via a first gateway ggsn 1 ( gateway gprs support node ) to a control unit cscf ( call state control function ) of the internet protocol - based multimedia subsystem . in the multimedia subsystem ims , a home subscriber server hss is also located . the control unit cscf is connected to the server s 1 . the server s 1 contains a computer program a ( application ) for controlling the method steps of the method described . the server also has a database xdm ( data memory ) which can be accessed via a user interface ( administration interface ) s . the control unit cscf is also connected via a second gateway ggsn 2 to a second switching center sgsn 2 of the second packet - switched domain ps 2 . the second switching center sgsn 2 , in turn , is connected to a third base station bs 3 and a fourth base station bs 4 of the second mobile radio network mfn 2 . five communication terminals keg 1 , keg 2 , keg 3 , keg 4 and keg 5 can be connected to the communication network k 1 via the base stations bs 1 to bs 4 . the communication terminals keg 1 to keg 5 are gprs - enabled ( general packet radio service ) mobile telephones in the exemplary embodiment . in other exemplary embodiments , however , communication terminals in the form of , for example , a portable computer with mobile radio interface , a palmtop , a landline telephone or a personal computer can also be used . the five communication terminals keg 1 to keg 5 belong to a preselected group g of communication terminals . this group membership is symbolized by a dashed border . fig2 shows a second communication network k 2 which differs from the first communication network k 1 , described in conjunction with fig1 , essentially only in that the control unit cscf is connected not only to the push - to - talk server s 1 but additionally to a second server s 2 in the form of a session initiation protocol application server s 2 ( sip application server ). in the second communication network k 2 , the program a is not arranged in the push - to - talk server s 1 but in the sip application server s 2 . in the second communication network k 2 shown in fig2 , the method steps are controlled by the program a running in the sip application server s 2 . this program a can access the database xdm arranged in the push - to - talk server s 1 and controls the ( elementary ) communication functions of the server s 1 ( e . g . the push - to - talk functions via sip ), especially in order to initiate the invite link message and establish the communication link of all communication terminals ready for communication which belong to the same preselected communication group . as an alternative , the database xdm can also be arranged in the server s 2 . fig3 shows a message sequence of the method according to the invention . in the text which follows , an exemplary sequence of the method according to the invention and the operation of the server according to the invention are explained by means of fig3 and 1 . this is based on the assumption of the following initial situation : a communication link has already been established between the communication terminals keg 1 and keg 2 ; via this communication link , a push - to - talk service is implemented in which communication terminals keg 1 and keg 2 participate . the communication terminals keg 1 and keg 2 participate in a push - to - talk session of the group g . the push - to - talk service is also called “ group talk ”. the push - to - talk ( ptt ) service is implemented here via the packet - switched internet protocol - based multimedia subsystem ; in this connection , this service is also called “ push - to - talk - over - cellular ” ( poc ). a session of a group communication service is generally also called “ session ”. a user of the communication terminal keg 3 would also like to participate in the push - to - talk service and therefore switches on his communication terminal keg 3 . immediately following the switching - on of the communication terminal keg 3 , the communication terminal keg 3 sends a first start message 1 in the form of an sip message “ register ” to the first communication network k 1 ( arrow 1 : register ). this first start message 1 passes via the second base station bs 2 , the first switching center sgsn 1 , the first gateway ggsn 1 to the control unit cscf of the multimedia subsystem ims . by means of this start message “ register ”, the third communication terminal keg 3 is logged in in familiar manner at the multimedia subsystem ims ; it is registered in the internet multimedia subsystem that the communication terminal keg 3 is ready for communication (“ online ”). by means of this start message 1 , the communication terminal keg 3 thus registers itself for utilization of internet protocol - based services offered by the communication network k 1 . following this , the start message 1 is forwarded to the push - to - talk server s 1 and reaches the program a running in it . ( in the exemplary embodiment described further below by means of fig2 , the start message 1 is forwarded to the server s 2 and reaches the program a running in it .) in another method sequence , the start message can also be sent by the communication terminal keg 3 only after a communication function has been activated on the communication terminal keg 3 ( for example by its user ); this activation could take place , for example , by the user operating a particular key on the communication terminal keg 3 . after the reception of the start message 1 at the server end , the server ( more precisely the program a running in the server ) reads out an information item contained in the start message and transmitted with the start message about the communication terminal keg 3 . this information item about the communication terminal can be present , for example , as a telephone number ( msisdn — mobile station isdn number ) or as a session initiation protocol address ( e . g . user @ domain . com ). in precise terms , this information about the communication terminal describes the user of the communication terminal keg 3 . however , since the user of the communication terminal keg 3 remains unchanged during the entire method sequence and has “ personalized ” the communication terminal keg 3 as it were ( for example by plugging a personal sim card into the terminal ( subscriber identity module )), this telephone number or this sip address represents information about the terminal keg 3 during the method sequence . the term “ information about the communication terminal ” is used in this sense in this description . using this information about the communication terminal , the server s 1 determines the preselected group to which the communication terminal belongs . information about the group membership of the individual communication terminals is stored in the database xdm in the server s 1 ( or in a database provided especially for this purpose ). in the exemplary embodiment , the server s 1 contains stored such group information that the communication terminal keg 3 belongs to the group g and that communication terminals keg 1 , keg 2 , keg 4 and keg 5 also belong to group g . ( in the exemplary embodiment described further below by means of fig2 , the information about the group membership of the individual communication terminals can be stored in the server s 1 or also in the server s 2 in the database xdm or in a database provided especially for this purpose .) after evaluation of the group information , the server s 1 thus has the information that the communication terminal keg 3 belongs to group g . the server s 1 thereupon sends a link message 2 in the form of the session initiation protocol message “ invite ”, known as such , to the communication terminal keg 3 . this link message 2 is transmitted from the server s 1 via the control unit cscf , the first gateway ggsn 1 , the first switching center sgsn 1 and the base station bs 2 to the communication terminal keg 3 . the communication terminal keg 3 thereupon sends a link confirmation message 3 in the form of a session initiation protocol message “ ok ” to the server s 1 . this link confirmation message 3 is conveyed from the communication terminal keg 3 via the second base station bs 2 , the first switching center sgsn 1 , the first gateway ggsn 1 and the control unit cscf to the first server s 1 . the server s 1 receives this link confirmation message 3 . with the reception of the link confirmation message 3 , the communication link between the communication terminal keg 3 and the communication terminals keg 1 and keg 2 already participating in the push - to - talk service in group g is established by the push - to - talk server s 1 . by means of an information item about the session , contained in the link message 2 and the link confirmation message 3 , e . g . by means of a name contained in the form of an sip address , the server s 1 allocates the communication terminal keg 3 to this session and then also transmits the voice messages from and to the communication terminal keg 3 . a communication link thus now exists between the communication terminals keg 1 , keg 2 and keg 3 ; these three communication terminals can now communicate with one another as part of the push - to - talk service , this communication being handled via the push - to - talk server s 1 . in this method , the server s 1 , in the establishment of the communication link ( during the link set - up ), simulates an additional communication terminal of group g , a virtual sixth communication terminal , as it were . this is because the server s 1 acts like a communication terminal , like a so - called “ sip user agent ” of an sip - enabled mobile telephone in the exemplary embodiment . this is because , from the point of view of the communication terminal keg 3 , the link message 2 appears to originate from an additional communication terminal , where this additional communication terminal handles the function of an originator . the communication terminal keg 3 can thus not see that it is not communicating with a communication terminal but with the server s 1 . this is particularly advantageous because , as a result , the method described does not contravene the “ oma poc control plane , candidate version 1 . 0 - 4 nov 2005 , open mobile alliance , oma - ts - poc - controlplane - v1 — 0 - 20051104 - c ” standard : the communication terminal keg 3 and furthermore also the communication terminals keg 4 and keg 5 do not recognize that they are communicating with a server ( and not with a communication terminal ) during the establishment of the communication link . thus , the communication terminals keg 3 , keg 4 and keg 5 do not need to be modified or adapted for use in the method according to the invention . he method described can also be used for implementing another group communication service , for example a chat service . instead of the push - to - talk server s 1 , a chat server would then be equipped with the program a , this chat server implementing the chat service . the sequences for establishing the communication link between the communication terminals of the group , described above , would proceed in the same manner in this arrangement . the chat service is occasionally also called “ chat group talk ”. next , a user of the communication terminal keg 4 , by operating a corresponding key , activates the push - to - talk communication function of his communication terminal keg 4 . the communication terminal keg 4 thereupon sends a second start message 4 ( arrow 4 : register ) to the server s 1 . the server s 1 receives this second start message 4 , determines , by means of an information item about the terminal keg 4 transmitted in the start message ( for example by means of the sip address meier @ yxz . com ), by utilizing the database xdm , that the communication terminal keg 4 belongs to group g . the server s 1 thereupon sends a second link message 5 ( arrow 5 : invite ) to the communication terminal keg 4 . the communication terminal keg 4 answers with a second link confirmation message 6 ( arrow 6 : ok ) which is received by the server s 1 . the server s 1 thereupon establishes the communication link between the communication terminal keg 4 and the communication terminals keg 1 , keg 2 and keg 3 , already using the push - to - talk service , in the manner described above . the push - to - talk service can now proceed between the four communication terminals keg 1 to keg 4 ; each of these communication terminals can send voice messages to the other three communication terminals via the communication link and receive voice messages from these . during the sequence of the method steps for establishing the communication link between the communication terminal keg 4 and the communication terminals keg 1 , keg 2 and keg 3 , a user of communication terminal keg 5 has already switched on his communication terminal and activated the communication function . the communication terminal keg 5 thereupon sends a third start message 7 ( arrow 7 : register ) to the server s 1 . the server s 1 receives this third start message 7 , reads the transmitted information about the terminal out of the third start message and , by means of this transmitted information ( e . g . an sip address ), determines that the communication terminal keg 5 also belongs to group g . the server s 1 thereupon sends a third link message 8 ( arrow 8 : invite ) to the communication terminal keg 5 . the communication terminal keg 5 answers with a third link confirmation message 9 ( arrow 9 : ok ). the communication link between the communication terminal keg 5 and the communication terminals keg 1 to keg 4 of group g is thereupon established . the push - to - talk server s 1 implements the push - to - talk service , i . e . the push - to - talk server transmits , e . g . voice message packets between the communication terminals of the group . the group membership of the communication terminals can be altered via the user interface s of server s 1 ( i . e . group g can be administered or configured , respectively ). it is possible to access the database xdm of the push - to - talk server s 1 directly via this user interface ( administration interface ) s ; such a database is also called “ push - to - talk - over - cellular xml ( extended markup language ) document management ( poc xdm ). this user interface can be accessed in various ways . an access can be made , for example , by a communication terminal ( for example communication terminal keg 3 ) by using the xcap ( xml configuration access protocol ) protocol . however , the user interface s can also be accessed by a network operator of the communication network k 1 or from a call center , where a user can use a so - called customer care portal for changing the group membership of his communication terminal . finally , it is also possible that a user of the communication terminals ( for example a user of communication terminal keg 3 ) accesses the database xdm of the push - to - talk - over - cellular service via a computer connected to the internet , using an internet page / a web interface via the user interface s of the server s 1 . the last - mentioned possibility of changing / administering the group membership of the communication terminal advantageously enables the group membership to be administered and to change in a particularly comfortable manner via an internet page . the method described above can also be performed in the same manner with the communication network k 2 of fig2 , with the difference that the program a runs in the server s 2 and the server s 2 works in conjunction with the database arranged in the server s 1 . server s 1 then also receives or sends the start messages , link messages and link confirmation messages and communicates with the server s 2 . as an alternative , the start messages , the link messages and the link confirmation messages can be transmitted from the control unit cscf via the server s 1 to the server s 2 , and conversely , or the start messages can be transmitted directly from the control unit cscf to the server s 2 . the method described for establishing a communication link between communication terminals of a group is essentially controlled by the server . this method has a number of advantages : the preselected or preconfigured group ( priority group ) is persistent ( permanent , non - volatile ), i . e . if one of the mobile communication terminals of the group is replaced by another device ( for example in the case of a defect or loss of a communication terminal ), the preselected group does not need to be newly administered because the group database ( poc xdm ) in the server is not changed by exchanging a mobile communication terminal . this is of advantage , especially if communication terminals are handed on by a user to another user and are newly personalized , for example by inserting a new sim card . in this case , too , no change of the database arranged in the server is necessary . the method can proceed with any communication terminals as long as they are suitable for the group communication service ( that is to say , for example , the push - to - talk service or the chat service ). in the communication terminals , no special functions relating to the method are needed ; these special functions are implemented in the server , instead . this is a considerable advantage both for the vendors of communication terminals , for network operators of communication networks and for service providers . this advantage becomes particularly clear if one recalls that it is often very difficult to produce suitable terminals in sufficient number , and to make them available to the service user , for newly developed innovative communication technologies or services . the server behaves like a communication terminal so that the method can be implemented without infringing on standards ; the method can also be implemented easily in communication networks already in existence . the sip message “ register ” is advantageously used not only for registering the communication terminal in the communication network but is used at the same time also as start message . this message is received by the server and starts the method sequence , for example , the start message activates the program a contained in the server s 1 which controls the further method sequence ( the start message triggers the program ). the program a can be stored advantageously either in the push - to - talk server s 1 and run there or the program a can be stored in a server connected to the push - to - talk server ( e . g . an sip application server ), and run there . this results in a method which can be variably adapted to the situations present in each case in the communication networks .	7
the present invention is an improved seed metering disc for a seed planter which provides for universal seed use . referring to fig1 and fig2 an exemplary improved universal seed metering disc 10 comprises a seed disc 20 and a seed retention plate 30 . seed disc 20 has a front side 41 and a backside 42 , wherein the front side has a plurality of grooved seed pockets 50 and seed cells 55 . the seed pockets 50 are generally radially situated around the front side 42 of the seed disc 20 . each of the seed pockets 50 comprise a channel which leads directly into a seed cell 55 . each channel may be round and smooth to facilitate seed movement within the seed pockets 50 . each seed cell 55 has a recess 66 , a seed delivery opening 67 and seed cell retention walls 68 . each seed cell 55 is further defined by seed retention plate 30 affixed to the seed disc 20 such as to form a backside of each seed cell 55 where the recess 66 ends at break 69 . seed retention plate 30 is substantially similar in shape and diameter as the seed disc 20 and is made from any suitable material , including a weather - safe durable material , such as a coated aluminum . the seed retention plate 30 can be affixed to the seed disc 20 by any appropriate fastening means , including a set of one or more fastening bolts 70 that pass through the front side 41 of the seed disc 20 and through the seed retention plate 30 where the bolts can be secured by one or more locking nuts . the locking nuts should be fastened tightly such as to provide contact or near contact between the seed disc 20 and the seed retention plate 30 , wherein the distance between seed disc 20 and seed retention plate 30 is small enough to prohibit seeds from sliding between the seed disc 20 and the seed retention plate 30 . in one embodiment , as shown in fig2 a gasket 80 , comprised of either sponge , foam , or other suitable material , is placed between the seed disc 20 and the seed retention plate 30 . the gasket assists in holding the seeds in the seed cells 55 by increasing the friction force which the seed must overcome in order to slide from the seed cell 55 . the gasket 80 further provides a means for ensuring contact or near contact between the seed disc 20 and the seed retention plate 30 , and fills any space therebetween . seeds stored in a seed reservoir of a planter are dropped onto the seed disc 20 which is at rotating in a vertical plane along a shaft which contacts and retains the seed metering disc 10 through the shaft hole 85 . in an embodiment , more than one seed metering discs 10 are used by dividing the planter into a set number of row units , connecting one seed metering disc 10 per row unit , and evenly delivering seeds from the seed reservoir to each of the row units . the seed disc 20 rotates at a set speed creating a centrifugal force which , along with a brush system as described in u . s . pat . no . 5 , 058 , 766 , forces the seeds into the seed pockets 50 . the rotational force pushes the seeds along the channel of the seed pockets 50 until the seeds reach the seed cells 55 . the seeds then fall individually , or in small seed packets , into the recess 66 of seed cells 55 and are retained within the seed cells 55 by the seed retention walls 68 and the seed retention plate 30 . smaller seeds that would otherwise slide out break 69 and out the backside 42 in the recess 66 of the seed cell 55 are held in place by the seed retention plate 30 . when the seed metering disc 10 reaches a fixed point in its rotation , the seeds are thrust from the seed cells 55 out the seed delivery opening 67 and into the corresponding crop row . while the present invention has been illustrated by the description of embodiments thereof , and while the embodiments have been described in detail , it is not the intention of the applicant to restrict or in any way limit the scope of the appended claims to such detail . additional advantages and modifications will readily appear to those skilled in the art . therefore , the invention , in its broader aspects , is not limited to the specific details and illustrative examples shown and described . accordingly , departures may be made from such details without departing from the spirit or scope of the applicant &# 39 ; s general inventive concept .	0
fig1 shows a watermark embedding process for encoding content dependent metrics into a watermark for use in detecting and characterizing content alteration . to illustrate the process , consider an example application for detecting alteration of image content . in this example , a watermark embedder divides an input media signal ( 100 ) ( e . g ., a host image ) into blocks ( 102 ). it then calculates signal metrics for each block ( 104 ). the metrics for each block form a signature ( 106 ). the embedder quantizes the metrics in the signature and encodes the resulting signature as part of a watermark message in the block using a watermark embedding process ( 108 ), such as the methods described in u . s . pat . no . 5 , 862 , 260 , and in co - pending applications ser . no . 09 / 503 , 881 . an additional enhancement of the method is to encrypt each quantized signature with an encryption key . in one implementation , the embedder calculates the signature from a combination of signal metrics in different blocks , and then embeds the signature in one or more blocks using a spread spectrum embedding function . to illustrate the process , consider an example of three 8 bit quantized metrics per block . the metrics are concatenated to form a 24 bit number and then error correction encoding to create a binary message string . the embedder spread spectrum modulates the message string and maps elements of the resulting signal to locations within an image block ( e . g ., a block of luminance values ). the embedder perceptually adapts the signal to the image block and adds elements in the adapted watermark signal to corresponding luminance values in the block . to increase the robustness of the watermark , the embedder can be designed to repeat the embedding process to redundantly encode the same signature into several blocks . other watermark embedding functions may be used as well , such as statistical feature modulation techniques where statistical features of samples in the block are adjusted to correspond to a value associated with a desired message symbol . the statistical features used for watermark embedding may be selected so as not to interfere with statistical features of the signal metrics . the signal metrics within the signature are quantized such that the metrics are sensitive to certain types of signal alterations , but are relatively insensitive to the changes in the pixel values resulting from embedding the watermark . preferably , the quantized metrics are the same before and after image watermark embedding . to ensure this is the case , the watermark embedder selects metrics that change less than an acceptable threshold before and after the watermark process . one way to guarantee that the metric is the same before and after encoding is to pick a signal metric that the watermark embedding function does not alter or alters only slightly . for example , the signal metric may be derived from frequency components or regions of the host signal and then embedded into other frequency components or regions of that host signal . as another example , the metric may measure a statistical feature that remains unchanged by the watermark embedding process . the watermark embedder may also make two or more iterative embedding passes through the image on watermarked blocks in which the quantized signal metrics differ before and after the embedding process . with each pass on a particular image block , the embedder updates the metric , the image block , or both , embeds the metric and stops when the quantized metric is within an acceptable tolerance threshold before and after it is embedded into the image block . one approach is to use the quantized metric of the watermarked block as the updated metric that is embedded in the original image block . in this approach , the metric computed from the watermarked block at each pass is embedded back in the original image block until the signal metric is within an acceptable tolerance before and after embedding . another approach is to change the pixel values of the image block slightly on each pass so that the metric is more likely to be the same before and after watermark embedding . one example of this approach is to use the watermarked block in one pass as the input to the next pass . here , the embedder may re - calculate the metric from the updated image and embed it into the updated image block . alternatively , it may select a metric computed from a previous pass and embed it into the updated image block . after watermark embedding is complete , the watermarked image may be printed , distributed electronically , or both . if the image is printed , then it is later scanned with a image scanning device to convert back to a digital form for analysis . fig2 shows a watermark decoding process for detecting and characterizing alterations to a watermarked image based on a comparison of signal metrics computed of the watermarked image and extracted from the watermark message . the decoder reads the watermarked image ( 120 ), divides it into blocks of the same size used in the embedder ( 122 ), and calculates metrics that form the signature of each block ( 124 . in some applications , a watermark decoder such as the one described in u . s . pat . no . 5 , 862 , 260 , and in co - pending application ser . no . 09 / 503 , 881 may first re - align the watermarked image ( 126 ) to approximate its orientation state at the time of computing the signal metric and embedding the watermark . to determine the orientation state , the decoder detects and determines the orientation of a calibration signal forming part of the watermark . the orientation state is defined by orientation parameters ( e . g ., rotation , scale , differential scale , shear , and shift or translation ) calculated by correlating the calibration signal with the watermarked image . by compensating for geometric distortion before the signal metrics are computed , the decoder approximately aligns the image blocks to their original orientation state before calculating the signal metrics and watermark payload . the watermark decoder extracts the watermark message payload from each block ( 128 ), potentially after re - aligning the image data using the calibration signal embedded in the watermark . next , the decoder compares the computed signatures with the signatures extracted from the watermark ( 130 ). the decoder then provides an indication of the alterations detected and type of alterations based on the differences between the computed and extracted signatures ( 132 ). in particular , the signal metrics are known through empirical analysis to degrade in predictable ways in response to certain types of image manipulation , such as compression , scanning , printing , cropping , photocopying , selective swapping of image content , etc . based on characterizations of these degradations , the decoder translates the degradation of the signal metrics into corresponding signal degradations . it may then display the watermarked signal along with graphic indicators highlighting altered blocks and their corresponding types of alteration . some of these metrics are computed for each block and some are based on the difference of information between two consecutive blocks . the size of the block depends on particular application and on the image size . if locating the area of tampering is of more importance , a smaller size is preferable with the constraint that a small sized block metric may not be statistically representative . the size of the image block used for calculating signal metrics may be the same or different from the size of the block used to embed the watermark message . for example , in cases where the signal metric block size is larger than the watermark block size , the embedder may divide each signal metric block into sub - blocks corresponding to watermark blocks and encode the signal metrics in each of the sub - blocks . 1 . histogram features of image blocks : histogram difference and histogram variance . the histogram difference metric is calculated as the sum of differences between the histograms of two consecutive blocks , whereas the histogram variance characterizes the brightness contrast of an individual block . one implementation , for example , used a histogram with 64 bins for an image size of 240 by 320 pixels sub - divided into blocks of 40 by 40 pixels each . 2 . motion vectors among spatially or temporally adjacent image blocks . the brightness difference between two consecutive blocks , and the rate of change of this difference are indicators of localized tampering of the signal . for example , a temporal metric is calculated as the standard deviation of the block intensity differences . a spatial metric is calculated as the variance of edge information of a block . one implementation , for instance , computes horizontal and vertical edge information by separately convolving the image block with a high pass filter ( e . g ., such as a sobel filter ) in the horizontal and vertical directions . it then computes the sum of squares of each value in the respective high pass filter outputs . finally , it computes the spatial signal metric as the standard deviation of the sum of squares . a velocital metric is computed as a statistical measure of the ratio of the temporal over the spatial metrics . 3 . pixel intensity based metrics : average and variance of intensity across the block ; 4 . frequency content metrics : ratio of low frequency content to total energy in a block . in one implementation , the watermark embedder inserts signature comprised of three quantized metrics : a measure of edges in the block ( the spatial metric ); a motion vector metric calculated as a function of the difference between the block and an adjacent block ( the temporal metric ), and a ratio of the first and second metrics ( the velocital metric ). fig3 is a matrix of characterizations showing how these signal metrics have been found to correspond to types of degradations . the matrix entries indicate the extent to which the metric specified at the head of the column changes after processing specified in the corresponding row . this or a similar matrix may be used to construct a parametric model that characterize a type of alteration based on the extent of changes to each of the signal metrics embedded in the watermark . to characterize a type of alteration to the watermarked signal , the decoder applies the changes measured in the signal metrics to the model , which maps the changes to one or more alteration types . the decoder may then provide visual feedback , displaying the watermarked signal , graphically highlighting the blocks detected as being altered and displaying the type or types of alteration . the last row of the matrix shows the effect of a form of spatial spread spectrum watermarking , where a spatial , pseudo random watermark image is added to the image . to generate the watermark image , a watermark message is spread over a pseudorandom number and the resulting values mapped to locations in an image block . the watermark image values are perceptual adapted so as to be substantially imperceptible in the watermarked image . as evidenced in the last row , certain metrics are highly sensitive to this type of watermarking process . thus , if this type of watermark is used to embed signal metrics , it should be used in conjunction with signal metrics that are less sensitive to it , or it should be embedded in parts of the image ( e . g ., spatial areas or frequencies ) that are independent of those from which the signal metric is calculated . for many applications , signal metrics are typically tuned to detect specific types of alteration , like compression , photocopying , printing , scanning , etc . knowing that degradation due to photocopying an image is different in the direction the paper is moving compared to its orthogonal direction , one is prompted to choose a pair of metrics that enables a comparison of horizontal and vertical characteristics of an image block . photocopying of watermarked images can be detected , for example , by encoding horizontal edge information in one metric and vertical edge information in another metric . the extent of the differences in the horizontal and vertical edge information may be used to detect photocopying . in particular , if the watermark decoder measures horizontal or vertical edge information changes that exceed an acceptable tolerance , it deems the image to have been altered . this application of signal metrics is useful in determining whether a printed article is genuine . frequency domain analysis and frequency domain watermarks may be used to characterize certain types of signal alteration . in one implementation , a watermark encoder performs a wavelet packet decomposition of an image to calculate a energy distribution signature and embeds this signature into a watermark . the energy distribution signature shows the actual bands ( in a complete wavelet packet decomposition ) of the embedding of the localization signature which is obtained from the metrics described above . a wavelet packet decomposition of an image decomposes the image into a tree structure where each child node represents a wavelet decomposition of the original image , or a block of the image . child nodes are selected for further decomposition if the entropy of the image band at the node is greater than a predetermined entropy threshold . a compatible watermark decoder analyzes features calculated from a wavelet packet decomposition of a watermarked image to detect alteration . in particular , the watermark decoder analyzes the entropy of selected nodes of the decomposition and detects and characterizes alteration by applying detected changes in entropy at the nodes to a parametric model . this model characterizes certain types of alterations based on how they alter entropy at nodes of the wavelet packet decomposition . having described and illustrated the principles of the technology with reference to specific implementations , it will be recognized that the technology can be implemented in many other , different , forms . to provide a comprehensive disclosure without unduly lengthening the specification , applicants incorporate by reference the patents and patent applications referenced above . while the invention is illustrated with reference to images , it also applies to other media types including audio . in the case of audio , the signal metrics may be computed from and embedded into temporal blocks of an audio signal . the watermark embedding may modulate features in the time , frequency , or some other transform domain of the host audio signal block . the signal metrics may be based on statistical features of the time domain audio data or frequency domain audio data . preferably , the signal metrics are embedded into features of the audio signal block from which they are derived in a manner that does not interfere with the value of the signal metric . in other words , the signal metrics for a block are within an acceptable tolerance before and after watermark embedding of the signal metric . the tolerance level is set so that alterations being detected are distinguishable from slight changes in the signal metrics due to the watermark embedding process . the signal metrics may be computed from data in one set of frequencies and then embedded into another set for each block of audio in an audio signal file . additionally , the signal metrics may be computed from one set of samples in a block and embedded into another set of samples in the block . in addition to signal metrics , the watermark may be used to convey other information , such as an identifier of the content , an index to related metadata , rendering control instructions , etc . for example , the watermark can carry a network address or index to a network address to link the watermarked signal to a network resource such as a related web site . some blocks may be used to carry signal metrics , while others may be used to carry other payload information , such as metadata , or a pointer to metadata stored in an external database . the methods , processes , and systems described above may be implemented in hardware , software or a combination of hardware and software . for example , the auxiliary data encoding processes may be implemented in a programmable computer or a special purpose digital circuit . similarly , auxiliary data decoding may be implemented in software , firmware , hardware , or combinations of software , firmware and hardware . the methods and processes described above may be implemented in programs executed from a system &# 39 ; s memory ( a computer readable medium , such as an electronic , optical or magnetic storage device ). the particular combinations of elements and features in the above - detailed embodiments are exemplary only ; the interchanging and substitution of these teachings with other teachings in this and the incorporated - by - reference patents / applications are also contemplated .	7
the embodiments of the invention provide a structure for a packet structure in a wireless communications network designed according to an emerging ieee 802 . 15 . 4a standard as described in ieee draft p802 . 15 . 4a / d2 , april , 2006 ; as shown in fig4 , a packet 400 includes a synchronization header ( shr ) 410 , a physical layer header ( phr ) 420 , and a payload 430 of data . the shr 420 includes a preamble 440 and start of frame delimiter ( sfd ) 450 . the preamble 440 includes repetitions of a selected pbts 110 as shown in fig1 . the sfd structure according to an embodiment of the invention differs from that specified in ieee draft p802 . 15 . 4a / d2 standard . the sfd 450 includes n repeated pairs of constant cores and varying suffixes , 460 and 465 , 470 and 475 , 480 and 485 , . . . , 490 and 495 . the suffix can also be called a counter . if there are n repetitions of the constant core , then there are n different suffixes or counters . one structure for the core includes ternary symbols {− si , 0 , 0 , 0 , si , − si }. if n is 4 , then four different suffixes can be specified . as shown in fig5 , the first suffix can be c 1 ={ 0 , 0 } 465 , the second suffix c 2 ={ 0 ,− si } 475 , the third suffix c 3 ={ 0 − si } 485 , and the fourth suffix c 4 ={ si ,− si } 495 . if each suffix has a different pattern of ternary symbols as described above , then the receiver can determine the number of repetitions received at a given time . this makes it possible to synchronize a clock of the receiver relatively within the sfd 450 without any ambiguity . furthermore , the receiver can still obtain statistical multiplexing gain from the repetitions of the constant cores of the sfd 450 . the problem with the counter approach as described above is that the sfd as a whole does not have a good autocorrelation function . the autocorrelation function contains high side lobes . therefore , it improves the detection performance compared to that in ieee draft p802 . 15 . 4a / d2 , april , 2006 . however , the improvement is marginal . this embodiment of the invention specifies a packet structure as an improvement to the packet structure described in the ieee draft p802 . 15 . 4a / d2 , april , 2006 and also in the parent application . according to this embodiment , a packet 600 includes a synchronization header ( shr ) 610 , a physical layer header ( phr ) 620 and payload 630 . the shr 610 includes a preamble 640 and a start of frame delimiter ( sfd ) 650 . the preamble 640 contains repetitions of a selected one of the perfectly balanced ternary sequences ( pbts ) 110 as described above . that is , the multiple pbts 110 in the preamble are all identical . the structure of the sfd 650 differs from that in the ieee draft p802 . 15 . 4a / d2 , april , 2006 . the sfd according to this embodiment includes an arbitrary sequence of codes 660 , e . g ., 64 codes . each code may represent a fixed length 2 n − 1 ternary sequence , e . g ., length of 31 , 63 , or 127 . if the code is 0 , then the fixed length sequence 661 is all zeros . if the code is + 1 , then the sequence 110 is s i as in the preamble , and if the code is − 1 , then the sequence 110 is − s i , a negation of the pbts 110 in the preamble . the construction of the sfd 650 can be described as the kronecker product of two codes as in fig7 . specifically in this embodiment , the sfd 650 is the kronecker product of an arbitrary sequence of ternary code su 700 , e . g ., 64 codes , and a selected fixed length ternary code 701 , e . g ., si , − si . if the ternary code in su is 0 , then the kronecker product results in a sequence of all zeros . after the kronecker operation , we have the following equation for the entire sfd sequence where the symbol { circle around (×)} represent the kronecker product and the overall length of the sfd 650 is in one embodiment , an order and arrangement of the first 8 codes 660 are identical to the second 8 codes , e . g ., { 0 , 0 , + 1 , + 1 , − 1 , 0 , − 1 , 0 , 0 , 0 , + 1 , + 1 , − 1 , 0 , − 1 , 0 }, and the order and arrangement of the remaining codes are arbitrary . the advantage of having an sfd 650 with the arbitrary structure as defined above is that the sequence 650 has a high peak to side - lobe ratio , which leads to improved detection performance . in one embodiment , optimal ternary codes that maximize detection performance can be any of the following arbitrary sequences : the embodiment of the invention improves synchronization of a receiver to a received packet and improves the detection of the start of frame delimiter ( sfd ). although the invention has been described by way of examples of preferred embodiments , it is to be understood that various other adaptations and modifications may be made within the spirit and scope of the invention . therefore , it is the object of the appended claims to cover all such variations and modifications as come within the true spirit and scope of the invention .	7
the preferred embodiments of the invention now will be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . the invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . furthermore , all “ examples ” given herein are intended to be non - limiting . the present invention is directed towards the enablement of reducing hdd activity , thereby improving the reliability and increasing the lifetime of the hdd . in a dhct , an hdd may be used to store programs for viewing later . disadvantageously , in the event of an hdd failure , the stored programs are typically lost and unrecoverable . therefore , the reliability and lifetime of the hdd in a dhct , which may also be known as a digital video recorder ( dvr ) dhct , is important to a consumer who has selected to record and save certain programs . fig1 illustrates a block diagram of a typical dhct 110 that receives forward signals and transmits reverse signals from a communications network . the communications network ( cn ) 105 provides programs and other data to a plurality of dhcts , where only one dhct is shown for illustration purposes , over coaxial cable , optical fiber , wireless , or any other means of transmitting signals . the dhct 110 includes a tuner system 115 that receives the programs and filters one or more selected programs based on commands from a processor and interfaces 120 . the programs streaming on tuned channels may then be provided to a coupled analog backend ( abe ) 130 for immediate display , and / or the programs may be stored in an hdd 125 for viewing in the future . video images of the streaming programs are staged in video memory 135 just prior to being sent to the abe 130 for display and are typically provided at a rate of 20 to 30 frames per second . the abe 130 then handles other internal processes , such as receiving video data from the processor 120 and then assembles and sends the data to an appropriate output interface 140 . a dhct 110 typically includes a plurality of different interfaces 140 for outputting the channel to different viewing devices depending upon its format . some examples of a video interface include a coaxial radio frequency ( rf ) output that connects to nearly any television and outputs standard definition ( sd ) video . the television usually tunes the outputted program on channel 3 or 4 . rca phono connectors with composite ntsc or pal video and audio outputs are also compatible with most of today &# 39 ; s televisions . rca connectors can carry sd or high definition ( hd ) analog video in rgb ( red , green , blue ) format or ypbpr format , which is a variation on rgb . a digitized version of ypbpr could also be carried on the three rca connectors in a format referred to as ycbcr . the rca interface is of better quality than the coaxial interface . an s - video interface is a small round mini - din connector with a slightly better quality than the rca interface . high speed interfaces are available in dvi ( digital video interface ) and hdmi ( high definition multimedia interface ). fig2 illustrates an example of the hdd 125 that is suitable for use in the dhct 110 of fig1 . the hdd 125 is used primarily to store programs for playback at a later time . the hdd 125 also comprises a time shift buffer ( tsb ) 205 for temporarily storing a copy of the program stream on the currently tuned channel regardless of whether or not the hdd 125 is storing the program for later viewing . the tsb 205 may store approximately one hour of programming , thereby allowing a user to use trick play functions , such as pause , rewind , fast forward , stop , etc , while viewing a live program that is being tuned , or streamed . at the end of the tsb buffering limit , the oldest packets of the buffered program are continuously dropped to allow for further buffering of the program streaming on the tuned channel . if it is desired that the program also be saved , the program will be stored on the hdd 125 along with a copy being stored in the tsb 205 for the trick play functions . when the tuned channel is changed to another channel , the packets stored in the tsb 205 are subsequently cleared or overwritten to allow for buffering of the new program streaming on the changed channel . if the previous program is being stored on the hdd 125 , a first tuner continues to store the program while a second tuner filters the new program streaming on the changed channel to the tsb 205 . conventionally , the program is buffered in the tsb 205 as received from the tuner system 115 ; for example , an hd quality program is buffered to the tsb 205 in its original hd format or in a compressed format from which the original hd can be reproduced . accordingly , an hd format program is typically buffered at a higher rate ( i . e ., more bytes per second are written to the hdd 125 ) and with more data than would be buffered using sd quality . additionally , the program is always buffered in the tsb 205 even when a user is quickly changing channels . furthermore , the tsb 205 continues buffering the program streaming on the tuned channel when the dhct 110 remains on even while the television is turned off . since the tsb 205 is included in the hdd 125 and is always buffering the program on a tuned channel , the hdd 125 is continuously active . therefore , the higher the operating temperature of the hdd 125 along with the continuous activity , the more likely the hdd 125 will degrade and may prematurely fail . accordingly , it is an object of the present invention to minimize the hdd activity . in accordance with the present invention , the hdd activity can be minimized by sharing the buffering load of the tuned channel reducing the activity of the internal tsb 205 and thereby reducing the hdd activity . in a preferred embodiment of the present invention , the tuned , or streaming , channel is buffered in a provisional buffer that is not located within the hdd 125 . more specifically , instead of buffering the streaming program in the tsb 205 at all times , a provisional buffer is used to share the load with the tsb 205 . advantageously , when the provisional buffer is buffering the streaming program , the hdd 125 may at that time be inactive . a provisional buffer may be a separate buffer ; however , a preferred embodiment utilizes available video memory 135 , system memory 138 , or hdd cache memory either alone or in combination . fig3 illustrates a block diagram of a dhct 300 that is suitable for use in implementing the present invention . a provisional load sharing buffer ( plsb ) 305 is coupled to the processor 120 for receiving the streaming program for a limited duration . in the preferred embodiment , the plsb 305 is a smaller buffer than the tsb 205 and , as mentioned , may be a combination of the video memory 135 , system memory 138 , hdd cache memory , or a separate device , such as nand flash . the size of the plsb 305 along with the rate at which data is being buffered to it can be determined by the system operator or the manufacturer . by way of example , an operator or user can determine whether the plsb 305 buffers the rate of the streaming program or a reduced rate of the program ( e . g ., an hd quality compared to an sd quality ). advantageously , the plsb 305 sharing the load with the tsb 205 allows the hdd 125 , which can be either an internal or an external hdd , to deactivate for a period of time that is proportional to the size of the plsb 305 . the present invention allows the plsb 305 to buffer the streaming , or currently tuned , program for a shorter duration to accommodate for channel changes without burdening the tsb 205 and hence the hdd 125 . once the plsb 305 is full , depending upon its size and the buffering rate , and there has not been a channel change , the processor 120 then transfers the buffered program to the tsb 205 . a first method is to continue buffering the streaming program in the empty plsb 305 at a determined rate until its contents are full again , at which point , the buffered program is again transferred to the tsb 305 . in this manner , the hdd 125 is inactive for the short duration depending on whether or not the hdd 125 is recording another program on a channel that is not currently being viewed . for example , the plsb 305 may buffer approximately 5 minutes of a streaming program at a reduced rate before the stored program is either overwritten with a new streaming program on a different channel or is transferred to the tsb 205 . advantageously , by using the plsb 305 , the user can still rewind or pause the 5 minutes of programming that is either buffered in the plsb 305 or that was transferred to the tsb 205 along with decreasing the activity of the hdd 125 . another method is to buffer the streaming program in the plsb 305 at a reduced rate until such time as its contents are full . once the plsb 305 is full and the channel has not changed , the buffering responsibility may be transferred to the tsb 305 to continue buffering the program . at this point , the tsb 305 may begin buffering the program with the streaming quality ( e . g ., an hd quality of an hd program ) or continue buffering at the reduced rate . more specifically , an sd quality of the program may be buffered at all times in the plsb 305 and also in the tsb 205 when it is appropriate . in this manner , the buffered program does not contain as much data as a buffered hd program , and therefore the hdd 125 does not work as much to store the data . in one embodiment , a reduced video quality is achieved by just buffering the mpeg i - frames and discarding p and b - frames . another embodiment , may be to re - encode a decimated version of the video sequence ( e . g ., every other pixel is discarded or adjacent pixels are averaged together ) before routing the program to the plsb 305 , the tsb 205 , or the hdd 125 . it will be appreciated that the viewer of an sd television will not notice the difference during playback of a buffered sd program . additionally , another option may be to stop buffering the program in the tsb 205 , if necessary , to minimize the hdd 125 activity . if the tuned program ( s ) was selected for recording onto the hdd 125 , the processor 120 continues to route the program ( s ) to the hdd 125 for storage . fig4 illustrates a block diagram of a dhct 400 that is suitable for use in implementing the present invention . buffering an sd quality of the program , buffering the streaming program in the plsb 305 , or stop buffering the program altogether can be decided based on several factors . in accordance with the present invention , a first factor may be to monitor the temperature of the hdd 125 with an external or internal temperature device 405 . when the temperature rises to a predetermined threshold , a processor 410 may then instruct the tsb 205 to buffer a reduced quality of the program ( s ) as opposed to an hd quality . alternatively , the processor 410 may instruct the plsb 305 to buffer the streaming program until such time as the hdd reduces its internal temperature to an acceptable range . another factor may be to monitor the health of the hdd 125 . the processor 410 may run periodic tests on the hdd 125 to analyze and report hdd performance . if it reports that the hdd 125 is beginning to show signs of malfunction , the tsb 205 can be instructed to begin buffering a reduced quality of the program or completely stop buffering the program and allow the plsb 305 to buffer the streaming program until further notice . accordingly , systems and methods have been described that increase the lifetime of a hdd 125 by sharing the buffering of a streaming program between the plsb 305 and the tsb 205 . it should be emphasized that the above - described embodiments of the present invention , particularly , any “ preferred ” embodiments , are merely possible examples of implementations , merely set forth for a clear understanding of the principles of the invention . many variations and modifications may be made to the above - described embodiment ( s ) of the invention without departing substantially from the spirit and principles of the invention . all such modifications and variations are intended to be included herein within the scope of this disclosure and protected by the following claims .	7
the device , according to the present invention , comprises a position sensor with a high resolution and high electromagnetic interference immunity hall effect sensor to be used for controlling electric motors and mechanical shafts . generally , said device comprises : mapping means of magnetic fields related to operational variables of an electric motor ; detection means of said magnetic field ; acquisition and processing means of the signals produced by said magnetic field detection means . with reference to fig1 , we can see a possible embodiment of the device according to the present invention . said embodiment includes the following parts : a device for mapping magnetic fields related to operational variables of an electric motor , realised , for example , by a disk made of non - ferromagnetic material , for example aluminium 10 , provided with a certain number of circular sockets 11 on the outer boundary , related to the number of poles of the motor 13 , the shaft angular position of which is to be measured . said number can be chosen , for example , equal to the number of the poles of the motor 13 or equal to a multiple or a sub - multiple of said number . in a preferred embodiment of the device according to the present invention , the said non - ferromagnetic disk shall have a diameter between 200 mm and 500 mm , in particular , a preferred embodiment of the present invention will be described in which said diameter is equal to 220 mm a set of magnets 12 , for example circular - shaped , which fit into said sockets . in a preferred embodiment of the present invention , sixteen nd — fe — b circular - shaped magnets , type sc35ma80 ° c ., having a diameter of 30 mm , a thickness of 2 mm will be used and will be placed with their geometric centers located around a circumference of 183 mm in diameter . two linear hall effect sensors 20 , 21 , for example of the differential type , placed in mutual electrical quadrature and facing said aluminium disk on which the magnets 12 are placed . an interface and acquisition card 14 which comprises means for extracting information regarding the absolute electrical angular position from the output signals of the hall effect sensors . according to a preferred embodiment of the present invention , said means for extracting information regarding the absolute electrical angular position from the output signals of the hall effect sensors are shown in the block diagram in fig2 , which include the following : hall effect sensors 20 , 21 ; an analog signals processing card 22 used for : reconstructing the magnetic field value from the differential output signals of sensors 20 and 21 , making sure that any electrical offsets are totally removed and ensuring an appropriate amplification of the detected signal ; two analog multipliers 23 , 24 , if required ; two signal amplifiers 25 , 26 ; a programmable oscillator 28 ; an rtdc ( resolver to digital converter ) module 27 , if required , namely a functional unit which is normally made with commercial components according to the methods described in the prior art and able to achieve angular information when connected to a conventional “ resolver ” device ; a microprocessor acquisition card 29 , if required . the device may be completed with a self - calibration circuitry , if required , which is able , for instance , to allow proper operation even in case of parameter variations of the electronic and magnetic components caused by the ageing or altered environmental conditions in which the device operates . the non - ferromagnetic disk 10 is solidly connected with the electric motor shaft , the motion of which is to be analyzed in addition to the determination of the exact angular position of the rotor . depending on the type of motor being tested , it is possible to choose an appropriate setup of the device according to the present invention in order to allow the specific arrangement of the magnets 12 in the recesses 11 to exactly reproduce the magnetic field spectrum in order to measure the operational variables of the motor involved . as a result of such configuration , it is possible to read , at the terminals of the hall effect sensors , for example two pairs of analog differential signals which , when appropriately processed , will result in pseudo - sinusoidal signals in quadrature between each other with the same frequency of the values of the supply current of the motor under test and from which it will be possible to extract , for example , the instantaneous electrical angular position of the rotor with a process based on the properties of elementary trigonometric functions . the above - mentioned magnetic field mapping and detection means can be implemented within the same electric motor of which the operation parameters are being measured , without showing the problems mentioned above , and associated with the presence of a high level of electromagnetic noise generated inside the electric motor during its normal operation . specifically , the method for the determination of the angular position of the motor , according to the present invention , is carried out according to the following steps : a ) the hall effect sensors 20 , 21 detect the magnetic field of the magnets 12 placed on the outer boundary of the aluminium disk 10 , thereby generating two differential electrical signals ; b ) the signals obtained at step a ) are processed by the processing card 22 in order to shape them into sinusoidal signals in quadrature between each other c ) the signals obtained at step b ) will eventually be modulated in amplitude via a sinusoidal signal generated from the programmable oscillator 28 with a suitable frequency ( for example , twenty times higher , although it is also possible to employ a “ zero frequency ” modulating signal : in this case the output signal from the multiplier will have the same shape of the original input signal and an amplitude scaled up or down by a multiplicative constant ) relative to the maximum electric frequency of the motor supply current , said maximum frequency being equal to the frequency of rotation multiplied by the number of poles of the electric machine . d ) the signals obtained at step c ) are processed by a “ resolver to digital converter ” ( rtdc ) circuitry 27 in order to extract the data related to the angular position of the motor , thereby making it available for subsequent processings , if any . the following specifies more in detail the processings carried out by the method previously described . assuming θ is the instantaneous electrical angular position of the rotor to be determined ; and assuming a is the amplitude and ω the angular frequency of the sinusoidal carrier used in step c ). the modulated signals generated at step c ) and sent to the “ resolver to digital converter ” ( rtdc ) will be as follows : the rtdc board , already known in the prior art , is generally designed as to transform this information directly into the value of θ which represents the measurement of the required angle , output through a negative feedback system . let &# 39 ; s assume that the rtdc system starts from any arbitrary angle θ value , assuming it is φ , generically represented in digital form by a digital counter within the rtdc board ; in step d ), within the rtdc board , the two signals mentioned above are respectively multiplied by the cosine and by the sine of the angle φ , thereby obtaining the following signals : x 2 = a · sin ω t · cos θ · sin φ at the output of the multiplier of the rtdc board , an error amplifier subtracts signal x 2 from signal x 1 , thus obtaining : ε = x 1 − x 2 = a · sin ω t ·( sin θ · cos φ − cos θ − sin φ ) lastly , a negative feedback system inside the rtdc board , based on a phase locked loop ( pll ), quickly adjusts the value φ of the counter so as to eliminate the angular error ( θ − φ ). therefore , the signal obtained in step d ) of the method according to the present invention contains the information related to the absolute electrical angular position which is stored into the n bit counter of the rtdc board and can be output using several communication protocols , such as , for example , serial , parallel , incremental encoder emulation protocols etc .	6
a preferred embodiment of the present invention will be described below in detail with reference to the accompanying drawings . in the following description , identical reference numerals are used to denote members substantially identical or corresponding to those used in the previously described related art ( refer to fig1 and 2 and the like ). first of all , an example of the entire construction of a vcr which is one example of the recording and / or reproducing apparatus according to the present invention will be described below . referring to fig6 a recorder 100 includes a rotary cylinder 101 which effects recording or reproduction of information on and from magnetic tape 201 . this rotary cylinder 101 is disposed at a predetermined position of a main chassis 102 . tape reels and the like are disposed on the main chassis 102 , and a tape cassette 200 in which the magnetic tape 201 is accommodated is mounted at a position opposing the rotary cylinder 101 . the recorder 100 also includes a capstan 106 , a capstan motor 105 , a tape guide member ( slider ) 4 &# 39 ; for drawing the magnetic tape 201 from the tape cassette 200 on the tape entrance side of the rotary cylinder 101 , a tape guide member ( slider ) 4 for drawing the magnetic tape 201 from the tape cassette 200 on the tape exit side of the rotary cylinder 101 , and the like . guide members 3 are secured to the main chassis 102 , and slots 8 for determining the directions of travel of the respective sliders 4 and 4 &# 39 ; are formed in the corresponding guide members 3 . positioning members 2 are also secured to the main chassis 102 , and the slots 8 are formed in the respective positioning members 2 in the vicinity of the rotary cylinder 101 . the tape loading operation of the recorder 100 will be described below . after the tape cassette 200 has been mounted on the main chassis 102 , the sliders 4 and 4 &# 39 ; travel along the respective slots 8 to draw the magnetic tape 201 from an opening portion 200a of the tape cassette 200 . the respective sliders 4 and 4 &# 39 ; further proceed from the guide members 3 to the positioning members 2 along the slots 8 , and are determined in position by coming into abutment with abutment faces 2a of the positioning members 2 . when the sliders 4 and 4 &# 39 ; reach their abutment positions , the magnetic tape 201 is wrapped around the rotary cylinder 101 by the tape drawing posts 5 and 6 disposed on each of the sliders 4 and 4 &# 39 ;. thus , in the recorder 100 , the magnetic tape 201 is made to run along a predetermined tape path , whereby recording or reproduction can be effected ( refer to fig1 and 2 ). the structure of the portion of engagement between the slider 4 and the slot 8 will be described below . fig7 is a diagrammatic side elevational view partly in cross section showing the state of engagement between the slider 4 and the guide member 3 which are located on the tape exit side . as described above , the tape drawing posts 5 and 6 are disposed on the top of the slider 4 , and projections 4a are formed on the bottom of the slider 4 . while the slider 4 is traveling , the projections 4a serve as sliding portions which slide in contact with the guide member 3 or the positioning member 2 . an engagement pin 10 which engages with the guide member 3 is secured to the bottom of the slider 4 . the engagement pin 10 is fitted in the slot 8 for sliding motion with respect to guide member portions 3a and 3b located on the opposite sides of the slot 8 . accordingly , the slider 4 can travel along the slot 8 . it is to be noted that since the slot 8 is formed over the guide member 3 and the positioning member 2 , the engagement pin 10 is fitted in the slot 8 for sliding motion with respect to positioning member portions 2b and 2c in the vicinity of the rotary cylinder 101 . a flange portion 9 is formed at the bottom end of the engagement pin 10 , and a top end face 9a and a top end face 9b which are separated from each other by a step are formed on the side of the flange portion 9 which opposes the guide member portions 3a and 3b . the distance ( clearance ) between the flange portion 9 and the guide member portion 3a on one side of the slot 8 differs from the distance ( clearance ) between the flange portion 9 and the guide member portion 3b on the other side of the slot 8 . specifically , as shown in fig7 a clearance c between the flange portion 9 and the guide member portion 3a on the right side of the slot 8 is selected to be smaller than a clearance c &# 39 ; between the flange portion 9 and the guide member portion 3b on the left side of the slot 8 . owing to this arrangement , the vertical motion of the slider 4 with respect to the guide member 3 is restricted by three points , i . e ., the two projections 4a and the top end face 9a . accordingly , the vertical clearance between the slider 4 and the guide member 3 is substantially equal to the clearance c , and even if the slider 4 travels upwardly within such clearance , the top end face 9b does not come into abutment with the guide member portion 3b . therefore , the area of abutment between the flange portion 9 and the guide member 3 during the sliding of the slider 4 can be reduced to half . since the area of abutment is reduced , the sliding resistance between the slider 4 and the guide member 3 can be reduced . as shown in fig7 it is desirable that the top end face 9b which is spaced more apart from the guide member 3 be formed on a side closer to the rotary cylinder 101 with respect to the slot 8 , while the top end face 9a which serves as a substantial abutment face be formed on the opposite side to the rotary cylinder 101 with respect to the slot 8 owing to this arrangement , the slider 4 may incline in the direction of an arrow b as viewed in fig7 but does not at all incline in the direction of an arrow c as viewed in fig7 whereby the tape drawing posts 5 and 6 can be prevented from contacting the rotary cylinder 101 . since the flange portion 9 is formed in the above - described manner , it is possible to minimize the sliding resistance even in an arrangement in which the guide member 3 is formed to bend in the vertical direction . fig8 ( a ) and 8 ( b ) show the slider 4 which is located in a bent portion 11 of the guide member 3 which is bent downwardly toward the clearances c and c &# 39 ;. fig8 ( a ) is a partly cross - sectional , side elevational view as viewed in a direction perpendicular to the slot 8 , while fig8 ( b ) is a partly cross - sectional , side elevational view as viewed obliquely from behind with respect to the direction ( indicated by an arrow a ) of travel of the slider 4 . although the bent portion 11 is formed in an intermediate portion of the guide member 3 , the guide member 3 and the flange portion 9 can be prevented from interfering with each other , because the clearance between the flange portion 9 and the guide member 3 is enlarged on one side of the slot 8 . accordingly , the slider 4 can be made to travel smoothly even in the bent portion 11 . in addition , even if the guide member 3 is formed to be twisted and bent in the vertical direction , it is possible to achieve effects similar to the above - described ones . as described above , when the tape loading operation comes to an end , the slider 4 is determined in horizontal position by coming into abutment with the abutment face 2a of the positioning member 2 . fig9 is a diagrammatic cross - sectional view taken in a direction perpendicular to the slot 8 , showing the state of engagement between the positioning member 2 and the slider 4 which is in abutment with the abutment face 2a . a projection 2 &# 39 ; for reducing the clearance c &# 39 ; between the top end face 9b and the positioning member 2 to make the clearance c &# 39 ; equal to the clearance c is formed on the bottom of the positioning member 2 . accordingly , when the tape loading operation is completed , a predetermined clearance is held on the opposite sides of the slot 8 by the projection 2 &# 39 ;, whereby it is possible to reliably position the slider 4 in either of the horizontal and vertical directions . in the present embodiment , a mechanism constituted by the positioning members 2 , the guide members 3 and the sliders 4 and 4 &# 39 ; is referred to as the positioning mechanism . fig1 ( a ) and 10 ( b ) are respectively a diagrammatic plan view and a diagrammatic cross - sectional side view which show the positioning member 2 and the vicinity thereof on an enlarged scale , and fig1 ( c ) is a diagrammatic cross - sectional side view showing the abutment portion 2a of the positioning member 2 on an enlarged scale . the positioning member 2 is formed integrally with the base of the rotary cylinder ( rotary drum ) 101 , and as shown in fig1 ( a ), the abutment portion 2a is formed by an approximately v - shaped notch . in the abutment portion 2a , as shown in fig1 ( b ), part of a notch face s1 which is located relatively above a notch face s2 owing to the inclination of the positioning member 2 with respect to the surface of the main chassis 102 is chamfered off with respect to a plane approximately perpendicular to the surface of the main chassis 102 . accordingly , the notch face s1 is composed of a face s11 approximately perpendicular to the surface of the main chassis 102 and a face s12 which is formed by chamfering . the notch face s1 is chamfered off by not less than half the thickness t of the positioning member 2 so that the angle between the face s12 and the plane approximately perpendicular to the surface of the main chassis 102 is made larger than the angle of inclination of the surface of the positioning member 2 with respect to the surface of the main chassis 102 . the notch face s2 is made approximately parallel to the face s11 . the tape loading operation of the recorder 100 will be described below with reference to fig1 and 12 . first of all , as shown in fig1 , after the tape cassette 200 has been mounted on the main chassis 102 , the sliders 4 and 4 &# 39 ; travel along the respective slots 8 to draw the magnetic tape 201 from the opening portion 200a of the tape cassette 200 . the respective sliders 4 and 4 &# 39 ; further proceed from the guide members 3 to the positioning members 2 along the slots 8 , and are determined in position by positioning pins 21 coming into abutment with the corresponding abutment faces 2a of the positioning members 2 . the state of the slider 4 which is one of the sliders 4 and 4 &# 39 ; positioned in this manner is shown in fig1 ( a ) in diagrammatic plan view and in fig1 ( b ) and 13 ( c ) in diagrammatic cross - sectional side view . in the present embodiment , when the positioning pin 21 comes into abutment with the abutment portion 2a , the positioning pin 21 is supported by the abutment portion 2a at two points p1 and p2 . a distance h between the point of force p1 and the point of force p2 is reduced to an extremely small value by the face s11 formed by chamfering the notch face s1 , so that the magnitude of the resultant moment decreases to a negligibly small value . accordingly , the sliders 4 and 4 &# 39 ; can be stably held on the respective positioning members 2 . then , as shown in fig1 , when the sliders 4 and 4 &# 39 ; reach their abutment positions , the magnetic tape 201 is wrapped around the rotary cylinder 101 by the tape drawing posts 5 and 6 disposed on each of the sliders 4 and 4 &# 39 ;. thus , in the recorder 100 , the magnetic tape 201 is made to run along a predetermined tape path , whereby recording or reproduction can be effected by the writing or reading of a magnetic recording through magnetic heads of the rotary cylinder 101 . as described above , in the positioning mechanism of the recorder 100 according to the present embodiment , during the loading of the magnetic tape 201 , when the sliders 4 and 4 &# 39 ; travel to the positioning member 2 , the positioning pins 21 are brought into abutment with the corresponding abutment portions 2a of the positioning member 2 , with the vertical distance h between the points of force p1 and p2 on the respective notch face s1 and s2 with which each of the positioning pins 21 comes into direct abutment being shortened by the amount of chamfering of the notch face s1 of the abutment portion 2a , so that the absolute values of moment due to couples acting on the respective points of force p1 and p2 are reduced . accordingly , by adjusting the amount of the chamfering , it is possible to reduce the absolute values to a negligible extent , whereby it is possible to stably hold the positioning pins 21 on the abutment portions 2a and reliably position the sliders 4 and 4 &# 39 ;. in other words , the recorder 100 according to the present embodiment can position the sliders 4 and 4 &# 39 ; stably and accurately , and can also be made inexpensive because of its simple construction which makes it unnecessary to provide a mold with a slide mechanism during the manufacture of the positioning mechanism . in addition , as described previously , in the present embodiment , if the flange portion 9 is formed at the bottom end of the engagement pin 10 of each of the sliders 4 and 4 &# 39 ; so that the clearance between the flange portion 9 and the guide member 3 differs between the opposite sides of the slot 8 , the area of abutment between the guide member 3 and the flange portion 9 can be reduced to decrease the sliding resistance . accordingly , even if the bent portion 11 which is bent in the vertical direction is formed in an intermediate portion of the guide member 3 , the guide member 3 and the flange portion 9 can be prevented from interfering with each other , and the slider 4 ( 4 &# 39 ;) can be made to travel smoothly . in addition , at the time of completion of the tape loading operation , the clearance between the flange portion 9 and the positioning member 2 can be made approximately the same on the opposite sides of each of the slots 8 by the projection 2 &# 39 ; of the positioning member 2 . thus , the slider 4 ( 4 &# 39 ;) which is reliably positioned can form a predetermined tape path . in the present embodiment , the top end faces 9a and 9b are formed on the flange portion 9 with a step interposed therebetween so that the clearance between the flange portion 9 and the guide member portion 3a differs from the clearance between the flange portion 9 and the guide member portion 3b . however , the top end face of the flange portion 9 may be formed in the same plane on the opposite sides of the slot 8 , and the thickness of the guide member portion 3a on one side of the slot 8 may be made different from the thickness of the guide member portion 3b on the other side of the slot 8 . in this case , if the positioning member 2 is formed in the same plane on the opposite sides of the slot 8 , the clearance between the positioning member 2 and the flange portion 9 can be made equal on the opposite sides of the slot 8 at the time of completion of the tape loading operation . by setting this clearance to a predetermined amount , it is possible to reliably determine the vertical position of the slider 4 ( 4 &# 39 ;). although the above description of the embodiment does not refer to the fact that the tape cassette 200 travels over the main chassis 102 , the tape cassette 200 is mounted on a slidable chassis , as will be described later , and is capable of traveling toward and away from the rotary cylinder 101 . it is also to be noted that the above - described positioning mechanism can , of course , be applied to an arrangement in which a tape cassette is mounted on a fixed chassis . although the above description has referred to a tape guide mechanism and a positioning mechanism which constitute part of the tape loading mechanism in the present embodiment , a more specific description will be given in connection with a tape drawing mechanism . first of all , to clarify the feature of the tape drawing mechanism in the present embodiment , one example of a conventional tape drawing mechanism will be described below . fig1 shows a conventional magnetic - tape loading device for drawing magnetic tape from a tape cassette and wrapping the magnetic tape around a rotary cylinder in a magnetic recording and / or reproducing apparatus whose entire size is reduced in such a way that the rotary cylinder is accommodated into a cassette mouth . in the following description , &# 34 ; m &# 34 ; denotes &# 34 ; main &# 34 ;, &# 34 ; sr &# 34 ; denotes &# 34 ; supply - reel side &# 34 ;, and &# 34 ; tr &# 34 ; denotes &# 34 ; take - up - reel side &# 34 ;. the conventional magnetic - tape loading device shown in fig1 includes an m chassis 111 ( denoted by 102 in fig1 ), a rotary cylinder 112 ( denoted by 101 in fig1 ) which is provided on the m chassis 111 , a slidable chassis 113 which is provided for movement back and forth above the m chassis 111 in opposite directions indicated by a double - headed arrow f , and a loading lever 120 which is turnably supported on the m chassis 111 via a shaft 120b and which has a gear portion 120c and a pin 120a with which a slot 113a provided in the slidable chassis 113 is slidably engaged . a cassette 121 is mounted on the slidable chassis 113 in a positionally restricted state . the arrangement shown in fig1 also includes an sr gear 119 which meshes with the gear portion 120c and is supported for rotation about a shaft 119a provided on the m chassis 111 , an sr arm 118 which rotates integrally with the sr gear 119 , an sr link 123 which is pivotally supported by the sr arm 118 , an sr skate 114 which is rotatably supported on the sr link 123 via a shaft 114a and is provided with a guide post 114b for drawing the tape , and an sr rail 125 which is provided on the m chassis 111 and with which the shaft 114a is slidably engaged . the arrangement shown in fig1 also includes a tr gear 117 which meshes with the sr gear 119 and which is rotatably supported by a shaft 117a . a tr arm 116 , a tr link 122 , a sr skate 115 , a shaft 115a , a guide post 115b and a tr rail 124 correspond to the sr arm 118 , the sr link 123 , the sr skate 114 , the shaft 114a , the guide post 114b and the sr rail 125 , respectively . incidentally , fig1 shows the state in which a tape loading operation is completed . if a cam gear ( not shown ) is rotated by a motor ( not shown ), the loading lever 120 which is slidably engaged with the cam gear is rotated , whereby the sr gear 119 which meshes with the gear portion 120c of the loading lever 120 and the tr gear 117 which meshes with the sr gear 119 are rotated . the sr arm 118 rotates together with the sr gear 119 , and the rotation of the sr arm 118 is transmitted to the sr skate 114 via the sr link 123 so that the sr skate 114 travels along the sr rail 125 via the shaft 114a , thereby effecting a tape loading operation . in the meantime , since the tr gear 117 to the tr skate 115 are identical in arrangement to the sr gear 119 to the sr skate 114 , the tr gear 117 which meshes with the sr gear 119 rotates in the opposite direction to the direction of rotation of the sr gear 119 , thereby effecting a tape loading operation . in addition , since the loading lever 120 has the loading - lever pin 120a which is slidably engaged with the slot 113a of the slidable chassis 113 on which to mount the tape cassette 121 , the slidable chassis 113 also travels upwardly as viewed in fig1 with the rotation of the loading lever 120 in interlocking relation to the tape loading operations of both the sr skate 114 and the tr skate 115 . in the above - described operation , the tape ( not show ) is drawn from the tape cassette 121 and wrapped around the periphery of the rotary cylinder 112 by the two guide posts 114b and 115b . however , if , in order to reduce the depth of an recording and / or reproducing apparatus , the above - described conventional example is used to arrange a tape drawing mechanism so that a rotary cylinder can be accommodated into a small cassette mouth of a tape cassette to be used in , for example , a digital vcr , there is the problem that as the tape cassette travels toward the rotary cylinder from a position away from the same , passage spaces for guide posts for drawing magnetic tape between the side walls of the cassette mouth and the rotary cylinder become smaller , and such spaces are finally lost while the tape cassette is traveling . as a result , there is the problem that it is necessary to incorporate members for separately driving skates on which the guide rollers are respectively provided and a slidable chassis on which the tape cassette is mounted and which travels with respect to the rotary cylinder , so that a complicated mechanism is needed and the number of component parts is difficult to reduce . to solve the above problems , the tape drawing mechanism according to the present embodiment includes first guide means and second guide means for performing a tape loading operation in which the first and second guide means travel while drawing tape from a tape cassette and wrap the tape around a rotary cylinder at a predetermined position , first moving means for moving the first guide means at a predetermined speed , and second moving means for moving the second guide means while varying a moving speed thereof . the following is a detailed description of the tape drawing mechanism . fig1 to 22 are diagrammatic views of the construction of a tape loading device according to the embodiment of the present invention . fig1 shows an unloading state , fig1 shows a loading - complete state , fig1 and 18 are fragmentary side views , and fig1 to 22 show different operational states from the unloading state to the loading - complete state . referring to fig1 to 22 , the rotary cylinder 101 is disposed on the m chassis 102 via a mounting member ( drum base ) which is not shown . the tape cassette 200 having the cassette mouth ( opening portion ) 200a is mounted on a slidable chassis 503 by a cassette holder and positioning members ( none of which is shown ). the slidable chassis 503 is disposed for movement back and forth with respect to the m chassis 102 in opposite directions indicated by the double - headed arrow f , by means of slide slots 503a to 503d which are respectively slidably engaged with slide guide shafts 102a to 102d which are erected on the m chassis 102 . a slide lever 505 is disposed for rotation about the slide guide shaft 102c of the slidable chassis 503 , and has a slide pin 505a , a slide driving shaft 505b and a gear portion 505c which is formed over its peripheral portion . the slide pin 505a is slidably engaged with the slot 503e of the slidable chassis 503 . a cam gear 506 is disposed for rotation about a slide guide shaft 102e which is erected on the m chassis 102 , and has cam slots 506a and 506b , and the slide driving shaft 505b is slidably engaged with the cam slot 506a . a loading gear 507 has a gear portion formed around its periphery , and is disposed for rotation about a loading shaft 102f which is erected on the m chassis 102 . a tr arm 508 has three kinds of gear portions 508a , 508b and 508c which differ from one another in pitch and diameter . the tr arm 508 is rotatably engaged with a tr shaft 102g which is erected on the m chassis 102 , and meshes with the gear portion of the loading gear 507 at the gear portion 508a . a tr link 510 is disposed for rotation about a tr link pin 508d of the tr arm 508 . an sr arm 509 has a gear portion 509a to mesh with the gear portion 508a of the tr arm 508 , a gear portion 509b to mesh with the gear portion 508b of the tr arm 508 , and a gear portion 509c to mesh with the gear portion 508c of the tr arm 508 . during the rotation of the sr arm 509 , the gear portions 509a , 509b and 509c mesh with the respective gear portions 508a , 508b and 508c of the tr arm 508 in a sequentially switched manner which will be described later . the sr arm 509 is disposed for rotation about the sr shaft 102b which is erected on the m chassis 102 . an sr link 512 is disposed for rotation about an sr link pin 509d of the sr arm 509 . a tr skate 511 has guide posts 511c and 511d , and is disposed for rotation about the axis of a hole portion 510b ( refer to fig1 ) of the tr link 510 and has a skate guide 511b which is slidably engaged with a guide rail 514 together with a skate guide 511a . an sr skate 513 has guide posts 513c and 513d ( refer to fig1 ), and is disposed for rotation about the axis of a hole portion 512b ( refer to fig1 ) of the sr link 512 and has a skate guide 513b which is slidably engaged with a guide rail 515 together with a skate guide 513a . the operation of the above - described arrangement will be described below . first , the cam gear 506 is rotated from the state shown in each of fig1 and 19 in a direction a as viewed in each of fig1 and 19 , by a motor ( not shown ). the cam portion 506a is rotated by the rotation of the cam gear 506 , and when the portion of the cam portion 506a which is engaged with the slide driving shaft 505b moves from a concentric portion 506a3 to a portion 506a2 of the cam portion 506a , the slide lever 505 starts to rotate in a direction b . with the rotation of the slide lever 505 , the slide pin 505a presses the slot 503e of the slidable chassis 503 so that the slidable chassis 503 starts to travel toward the rotary cylinder 101 and , at the same time , the loading gear 507 which meshes with the gear portion 505c of the slide lever 505 starts to rotate in a direction c , the tr arm 508 starts to rotate in a direction d , and the sr arm 509 starts to rotate in a direction e . since the tr arm 508 is slidably engaged with the tr skate 511 via the tr link 510 , the tr skate 511 starts to travel along the guide rail 514 . similarly , since the sr arm 509 is slidably engaged with the sr skate 513 via the sr link 512 , the sr skate 513 starts to travel along the guide rail 515 . since power is transmitted from the slide lever 505 to the sr arm 509 through the meshed gears during this time , letting zs be the number of teeth of the slide lever 505 , letting zt1 be the number of teeth of the gear portion 508a of the tr arm 508 and letting zs1 be the number of teeth of the gear portion 509a of the sr arm 509 , the angle of rotation of the sr arm 509 and the angle of rotation of the tr arm 508 with respect to a variation θs in the angle of rotation of the slide lever 505 are expressed as follows : since the sr arm 509 rotates faster than the tr arm 508 , the sr skate 513 performs a tape loading operation while traveling faster than the tr skate 511 . when the tape loading operation proceeds to the state shown in fig2 after it has been started , the mesh between the tr arm 508 and the sr arm 509 transfers from the mesh between the gear portion 508a of the tr arm 508 and the gear portion 509a of the sr arm 509 to the mesh between the gear portion 508b and the gear portion 509b . at this time , the relation between the number of teeth zt2 of the gear portion 508b and the number of teeth zs2 of the gear portion 509b becomes : therefore , the angle of rotation of the sr arm 509 and the angle of rotation of the tr arm 508 with respect to the variation θs in the angle of rotation of the slide lever 505 become : angle of rotation of sr arm θs2 = θt thus , the rotation of the sr arm 509 whose angle of rotation varies faster than the angle of rotation of the tr arm 508 is reduced in speed so that the variation in the angle of rotation of the sr arm 509 and the variation in the angle of rotation of the tr arm 508 become equal to each other and the traveling speeds of the sr skate 513 and the tr skate 511 become equal to each other . then , when the tape loading operation proceeds from the state shown in fig2 to the state shown in fig2 , the mesh between the tr arm 508 and the sr arm 509 transfers from the mesh between the gear portion 508b and the gear portion 509b to the mesh between the gear portion 508c and the gear portion 509c . at this time , the relation between the number of teeth zt3 of the gear portion 508c and the number of teeth zs3 of the gear portion 509c becomes : therefore , the angle of rotation of the sr arm 509 and the angle of rotation of the tr arm 508 with respect to the variation θs in the angle of rotation of the slide lever 505 become : thus , the relation in angle of rotation between the sr arm 509 and the tr arm 508 becomes : so that the speed of rotation is reduced between the tr arm 508 and the sr arm 509 and the traveling speed of the sr skate 513 becomes smaller . the tr arm 508 and the sr arm 509 travel while holding this variation in the angle of rotation , and the cam portion 506a of the cam gear 506 which is in sliding contact with the slide driving shaft 505b of the slide lever 505 travels from the portion 506a2 to the concentric portion 506a3 . accordingly , since the rotation of the slide lever 505 is stopped , the travel of the slidable chassis 503 and the rotations of the sr arm 509 and the tr arm 508 are stopped so that the tape loading operation is completed in the state shown in each of fig1 and 22 . in the above - described manner , during the tape loading operation , the mesh between the three kinds of gear portions of the sr arm 509 and the three kinds of gear portions of the tr arm 508 is sequentially switched over . accordingly , as shown in fig2 and 24 , during the travel of the slidable chassis 503 , the tr arm 508 makes a rotation in proportion to the travel of the slidable chassis 503 , whereas the sr arm 509 rotates at a higher speed while the slidable chassis 503 is traveling from its unloading position to its middle position , and can be slowed down in the area from the middle position to its catching position . in addition , during the tape loading operation shown in fig2 , 26 and 27 , the sr arm 509 travels as follows in accordance with the timing of operation of the sr arm 509 and the tape cassette 200 . first , the sr arm 509 passes through its faster - rotation area ( refer to fig2 ) while passing through the space between the rotary cylinder 101 and the tape cassette 200 which becomes smaller with the travel of the slidable chassis 503 toward the rotary cylinder 101 . then , after the sr arm 509 has moved out of the cassette mouth 200a , the sr arm 509 passes through its slower - rotation area ( refer to fig2 ) while the variation in the angle of rotation of the sr arm 509 is approaching the variation in the angle of rotation of the tr arm 508 , so that the sr arm 509 and the tr arm 508 can complete catching finally at the same time . in the present embodiment , in the tape loading and unloading operation , magnetic tape ( not shown ) is drawn from the supply reel of the tape cassette 200 by the guide posts 511c and 511d ; 513c and 513d , and is then taken up . accordingly , during the tape loading operation , as the sr skate 513 approaches its loading completion position toward which the load on the magnetic tape increases , the traveling speed of the sr skate 513 is made slower on a supply - reel side which is distant from a take - up reel , whereby the amount of variation in the load on the magnetic tape can be reduced and damage to the magnetic tape during loading can also be effectively reduced . incidentally , the unloading operation is performed in a sequence opposite to the above - described one . as is apparent from the foregoing description , in accordance with the present embodiment , during loading , by varying the traveling speed of either one of guide means , it is possible to pass guide posts through a passage space when the passage space is as large as possible , the passage space becoming smaller as a tape cassette approaches a rotary cylinder from a position distant therefrom . accordingly , all the guide posts can be driven by a single driving means without the need to incorporate a plurality of members for separately driving a plurality of driving means , whereby it is possible to realize simplification of the entire mechanism and a reduction in the total number of components parts used . in particular , the present embodiment can be effectively used in digital vcrs or the like which use tape cassettes having small cassette mouths .	6
in the following description , reference is made to the accompanying drawings that form a part hereof , and in which is shown by way of illustration specific embodiments in which the invention may be practiced . it is to be understood that other embodiments may be utilized and structural changes may be made without departing from the scope of the present invention . referring now to the drawings , in which like numerals represent the same or similar elements , and , initially , to fig1 , in which an exemplary embodiment of the international mobile subscriber identity ( imsi ) mail system is illustrated . specifically , the imsi mail system 10 , in its preferred embodiment , includes a sender system 12 , an imsi mail server system 14 and a recipient system 16 . as shown in fig2 , user can send email to any imsi or email address through email client 1 supporting multiple platforms using imsi mail server 2 . the imsi mail server 2 preferably includes a recording medium ( not shown ) for storing mail boxes , emails and other related information therein . additionally , as shown in fig1 as conventional e - mail server 3 can be provided within the imsi mail server system 14 . as shown in fig1 and 3 , email client 1 can be an imsi mail client application 1 . 1 installed on a user device and specifically operable on different device operating systems , e , g ., ios , android , windows phone , windows and mac : an imsi mail web client 1 . 2 . i . e ., a client application accessible via the internet ; or any conventional email client 1 . 3 , e . g ., outlook , etc . the process performed by imsi mail server 2 is further illustrated in fig4 . in accordance with the preferred embodiment , server 2 receives an email sending request ( step 2 . a . 1 ) to a recipient &# 39 ; s imsi or imsi @ imsimail . com address from email client 1 , or a mail box creation request ( step 2 . b . 1 ) from imsi mail client application 1 . 1 . alternatively , server 2 can also receive a mail box verification request ( step 2 . c . 1 ) discussed further below . on receiving the email sending request ( step 2 . a . 1 ), server 2 will check if a recipient mail box exists ( step 2 . a . 2 ). if the recipient mail box exists server 2 will place mail into the existing mail box ( step 2 . a . 5 ). otherwise , server 2 will create a new recipient mail box ( step 2 . a . 3 ), a welcome email to the recipient ( step 2 . a . 4 ) and will place both the sender &# 39 ; s email and the welcome e - mail into the newly created mail box ( step 2 . a . 5 ), further , to alert the recipient , server 2 will send a communication ( e . g ., sms ) to the recipient &# 39 ; s imsi address ( step 2 . a . 6 ) to provide the email access details . on receiving the mail box creation request ( step 2 . b . 1 ) from the imsi mail client application 1 . 1 , server 2 will verify if a mail box exists ( step 2 . a . 2 ) for the requestor &# 39 ; s imsi . if mail box does not exist , server 2 will then create a mail box ( step 2 . a . 3 ) and will send a “ successfully created ” message as a response to the email client 1 ( steps 2 . a . 8 ; 2 . d ). similarly to the steps discussed above server 2 will also create a welcome email ( 2 . a . 4 ) and will place the welcome email into the newly created mail box ( step 2 . a . 5 ). on receiving the mail box verification request ( step 2 . c . 1 ) from the email client 1 , server 2 will verify existence of the mail box ( step 2 . c . 2 ) using the requestor &# 39 ; s imsi and password . if the mail box exists , server 2 will send a response “ exists ” to the requestor ( steps 2 . c . 3 ; 2 . d ). otherwise , it will send a response “ does not exist ” ( steps 2 . c . 4 ; 2 . d ). it should be noted that , in the preferred embodiment , the step 2 . c . 2 ( mail box verification ) may be performed at the conventional email server 3 . processes performed at the imsi mail client application 1 . 1 are illustrated in fig5 . client application 1 . 1 can be conventionally installed , e . g ., from an application store , or from imsimail . com ( step 1 . 1 . 1 ). on running the client application 1 . 1 for the first time , the process of configuration is performed ( step 1 . 1 . 2 ), as described below with respect to fig6 . further , during each run of the client application 1 . 1 , the process of verification is performed ( step 1 . 1 . 3 ). after running the client application successfully , a user can send an email to any imsi or email address ( step 1 . 1 . 5 ), can view the inbox ( step 1 . 1 . 6 ), can configure email forwarding to traditional entails ( step 1 . 1 . 7 ), can change password ( step 1 . 1 . 8 ), and / or can attach other multiple imsis to the same mail box ( step 1 . 1 . 9 ). client application 1 . 1 is also configured to perform mail box auto synchronization ( step 1 . 1 . 10 ) periodically . as shown in fig6 , in the preferred embodiment of the invention , upon running the imsi mail client application 1 . 1 for the first time ( step 1 . 1 . 2 . 1 ), the client application checks the user device to determine whether it is a mobile phone or any other device ( step 1 . 1 . 2 . 2 ). if the user device is a mobile phone , then the application obtains the imsi ( step 1 . 1 . 2 . 3 ) and sends a verification request to imsi mail server ( step 1 . 1 . 2 . 4 ) by providing imsi . application then checks the server response ( step 1 . 1 . 2 . 5 ). if the response is “ does not exist ,” then application 1 . 1 sends a mail box creation request to the imsi mail server ( step 1 . 1 . 2 . 13 ). next , application again checks the server response ( step 1 . 1 . 2 . 14 ). if the response is “ successfully created ,” the local configuration is set ( step 1 . 1 . 2 . 15 ), application home is displayed to the user ( step 1 . 1 . 2 . 16 ), and mail box synchronization is performed ( step 1 . 1 . 2 . 17 ). otherwise , an error message is prompted to the user ( step 1 . 1 . 2 . 18 ). if the client application determines that the user &# 39 ; s device is not a mobile phone , it prompts a sign - in or sign - up option ( step 1 . 1 . 2 . 7 ) and checks the option selected by the user ( step 1 . 1 . 2 . 8 ). if the user selects the “ sign - in ” option , the application allows the user to sign - in using his / her imsi and password ( step 1 . 1 . 2 . 9 ). otherwise , the application displays the sign - up screen . at the sign - up screen , the user is prompted to enter the imsi ( step 1 . 1 . 2 . 10 ). thereafter , a random security code is sent to the provided imsi , preferably , using sms or any other similar channel , ( step 1 . 12 . 11 ) and code input is prompted . user then enters the provided security code ( step 1 . 1 . 2 . 12 ), and the application sends the mail box creation request to the imsi mail server 2 ( step 1 . 1 . 2 . 13 ) providing the requestor &# 39 ; s imsi and the code . application then checks the server response ( step 1 . 1 . 2 . 14 ), and , if the response is “ successfully created ,” the local configuration is set ( step 1 . 1 . 2 . 15 ). application home is then displayed to the user ( step 1 . 1 . 2 . 16 ) and mail box synchronization step ( step 1 . 1 . 2 . 17 ) is performed . otherwise , the error message is displayed to the user ( step 1 . 1 . 2 . 18 ). the process of sending email using the imsi mail client application is illustrated in more detail in fig7 . to send an email to any imsi or email address , a user first selects a “ compose ” option ( step 1 . 1 . 5 . 1 ), and an email form is then shown to the user . user can then select a device contact or type in any imsi or email address ( step 1 . 1 . 5 . 2 ), and press send ( step 1 . 1 . 5 . 3 ). multiple recipients can be selected and / or entered into the “ to ”, “ cc ” and “ bcc ” fields . application 1 . 1 then verifies the recipients : if any of the recipients only has the imsi listed , the application appends “@ imsimail . com ” to the imsi of the recipient to create a complete imsi mail address ( step 1 . 1 . 5 . 4 ). this artifically constructed address indicates to the server that the mail is intended for the mail box of a recipient having the corresponding imsi . application then sends the email through the imsi mail server smtp ( step 1 . 1 . 5 . 5 ), and the user is notified that the mail is successfully sent to the recipient ( 1 . 1 . 5 . 6 ). instead of using a mobile device , a user may send email messages using the presently disclosed system by utilizing a imsi mail web client 1 . 2 , as shown in fig8 . user can access web client 1 . 2 in any browser , and sign in using the imsi and password ( step 1 . 2 . 1 ). after successfully signing in , the user can send email to any imsi or email address ( step 1 . 2 . 2 ), can view the inbox ( step 1 . 2 . 3 ), can configure email forwarding to traditional emails ( step 1 . 2 . 4 ), can change the password ( step 1 . 2 . 5 ), and / or can attach other multiple imsis to the mail box ( step 1 . 2 . 6 ). finally , the present system can be utilized using conventional email clients , e . g ., outlook . using any conventional email client 1 . 3 , a user can configure imsi mail by appending “@ imsimail . com ” to the recipient &# 39 ; s imsi . pop3 / imap and smtp settings will be provided for the user at the imsimail . com website . thus , an email can be sent to any imsi by appending the extension “@ imsimail . com ” to the recipient &# 39 ; s imsi . the figures in this disclosure are conceptual illustrations allowing for an explanation of the present invention . notably , the figures and examples above are not meant to limit the scope of the present invention to a single embodiment , as other embodiments are possible by way of interchange of some or all of the described or illustrated elements . moreover , where certain elements of the present invention can be partially or fully implemented using known components , only those portions of such known components that are necessary for an understanding of the present invention are described , and detailed descriptions of other portions of such known components are omitted so as not to obscure the invention . in the present specification , an embodiment showing a singular component should not necessarily be limited to other embodiments including a plurality of the same component , and vice - versa , unless explicitly stated otherwise herein . moreover , applicants do not intend for any term in the specification or claims to be ascribed an uncommon or special meaning unless explicitly set forth as such . further the present invention encompasses present and future known equivalents to the known components referred to herein by way of illustration . the foregoing description of the specific embodiments so fully reveals the general nature of the invention that others can , by applying knowledge within the skill of the relevant art ( s ) ( including the contents of the documents cited and incorporated by reference herein ), readily modify and / or adapt for various applications such specific embodiment , without undue experimentation , without departing from the general concept of the present invention . such adaptations and modifications are therefore intended to be within the meaning and range of equivalents of the disclosed embodiments , based on the teaching and guidance presented herein . while various embodiments of the present invention have been described above , it should be understood that they have beer presented by way of example , and not limitation . it would he apparent to one skilled in the relevant art ( s ) that various changes in form and detail could be made therein without departing from the spirit and scope of the invention . thus , the present inventions should not be limited by any of the above described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents .	7
referring now to fig1 of the drawing , a display apparatus 1 is shown comprised of a plurality , such as 3 , of concentric cylindrical sections 10 , 3 and 4 . section 10 is the largest diameter outer section and may be comprised of a wire framework formed by circular wire elements 11 interconnected by spaced vertical wire elements 12 . the lowermost circular wire element 11 is connected , in any suitable manner , such as connectors 13 , to a generally flat planar circular base 2 . as seen in fig3 , the underside 14 of base 2 is coupled to a rotary device , such as a rotatable turntable 5 or glides or the like . referring again to fig1 , second cylindrical section 3 , of lesser diameter than section 10 , is spaced from section 10 and may be of opaque material of like and also secured to base 2 in any suitable manner . a third cylindrical section 4 , of lesser diameter than section 3 , is spaced from section 3 and may also be of opaque material . it is also secured to base 2 in any suitable manner . as seen in fig2 , a plurality of circular concentric areas 15 to 17 are thus provided about apparatus 10 . as seen in fig3 , the sections 10 , 3 and 4 are preferably of the same overall height so as to present a visually appealing appearance . however , the sections 10 , 3 and 4 may be of differing heights if desired . as seen in fig4 , a modification of the outer wall or section 10 of fig1 is shown . thus , outer section 1 a may be of a transparent plastic instead of being formed by a plurality of interconnected wire elements as in the embodiment of fig1 . if desired , a display card or the like may be provided on the apparatus of fig1 and 4 . this can be seen in fig5 wherein like numerals refer to like parts of fig1 in this embodiment , a socket 6 is secured at generally the midpoint of base 2 and a pole 7 extends upwardly therefrom . a display card 8 may be secured to the top of pole 7 to provide indicia associated with the apparatus ( or may be provided with hooks or holes to insert fasteners to display cards , packages , etc .). any suitable means may be used to rotate the apparatuses of fig1 to 4 . rotatable turntable 5 is shown in detail in fig6 . thus , turntable 5 may include a circular ball bearing plate 18 mounted to the underside 14 of base 2 and secured to a base support 19 . plate 18 is well known in the art and allows base 2 to rotate with respect to base support 19 . the apparatus 1 of fig1 is shown in fig7 having a plurality of magazines and periodicals displayed therein . it is of course understood that the apparatus of fig4 and 5 are used in like manner . in any event , it can be seen in fig7 that a plurality of magazines 20 are displayed in a circular array within area 15 ( fig2 ) and a plurality of other magazines which may be taller , or newspapers 21 ( fig7 ), are displayed in center area 17 ( fig2 ). other magazines 20 ( fig7 ) are displayed in a circular array within area 16 ( fig2 ). it can be seen that there are disclosed multiple storage areas in a single apparatus for regularly sized magazines , taller magazines or newspapers , or other publications . the newspapers , magazines and other periodicals are organized neatly without sacrificing valuable space . the apparatuses of the invention can be used in a child &# 39 ; s room , a living room , beauty parlors , barbershops , a doctor &# 39 ; s office , etc . the titles and articles in magazines 20 are prominently displayed in a circular array . colorful comic books and coloring books can be displayed in a like manner in a child &# 39 ; s room , nursery , pediatric office , etc . although three areas 15 to 17 are disclosed , obviously two may be provided ( area 16 may be eliminated ). the wall 3 supports the backs of the magazines so they stand up . although a wire framework is disclosed in fig1 , and a transparent outer wall in fig4 , obviously any suitable see - through means may be used , such as a perforated screen , wire mesh , etc . the middle cylinder 4 may be eliminated and if used , can hold other materials . a plurality of devices , such as apparatus 1 in fig1 , may be stacked and vertically interconnected in any suitable manner . any suitable materials may be used , such as plastic , metal , etc . the apparatuses of the invention may be of any suitable dimensions , such as 15½ ″ in overall diameter and 8½ ″ in overall height . although a particular embodiment of the invention has been disclosed , variations thereof may occur to an artisan and the scope of the invention is only intended to be limited by the scope of the appended claims .	0
a detailed description of one preferred embodiment of an apparatus for presenting a test chart embodying the present invention will now be given referring to the accompanying drawings . fig1 shows an overview of an apparatus 1 for presenting a test chart which is used for a test of near vision . reference numeral 2 is a case in the shape of a plate , which holds a test chart plate 3 in the shape of a disk , which is provided with a plurality of test charts ( a detail of test charts is mentioned below ), numeral 4 is a test chart window , having an opening , which is used for presenting a test chart provided for the test chart plate 3 to an eye to be examined . the test chart plate 3 is held by the case 2 so as to rotate with the center at a pin 5 , therefore if the operator operates and rotates below portion of the test chart plate 3 which is sticking out from the case 2 , then it is changed - over to the desired test chart to be positioned at the test chart window 4 . in addition , the test chart window 4 is also provided for just a back side of the case 2 so that test charts provided for the back side of the test chart plate 3 can be presented . the apparatus 1 for presenting a test chart , as shown in fig2 can be mounted to the subjective refractive power measuring unit 50 which changes - over various optical elements to be positioned at a test window 51 , through the near - point rod 52 . the case 2 of the apparatus 1 is provided with a suspending part 6 through which the near - point rod 52 mounted to the subjective refractive power measuring unit 50 is made to pass . the suspending part 6 is movable along the near - point rod 52 . the near - point rod 52 has a scale which denotes a test distance . if the suspending part 6 is made to be positioned in accordance with the scale , then a test distance of the apparatus 1 can be set so as to be a desired distance . the case 2 is held by the suspending part 6 so as to rotate , therefore , a test chart provided for the back side thereof can be presented by reversing the case 2 with being suspended . in fig2 reference numeral 60 is an operating unit provided with various switches used for driving the subjective refractive power measuring unit 50 . next , the test chart plate 3 will be described hereinafter . in fig3 a dotted line 10 denotes a field corresponding to the test chart window 4 of the case 2 , a plurality of test charts in the dotted line 10 is presented to the eye . in the preferred embodiment , five test - charts groups 11a - 11e are provided for one side . the test - charts group 11a includes test charts for visual acuity values 0 . 1 - 0 . 5 in a test distance 40 cm , and in the same manner , the test - charts group 11b includes test charts for visual acuity values 0 . 6 - 1 . 0 in a test distance 40 cm . by the side of respective horizontal lines of test charts , there is shown each visual acuity value of respective horizontal lines of test charts in a test distance 40 cm and each distance in which respective horizontal lines of test charts correspond to a visual acuity value 1 . 0 ( see fig4 ). the test - charts groups 11c and 11d include test charts lined transversely which is utilized for a phoria test , the test - charts group 11c is drawn to be a size corresponding to a visual acuity value 1 . 0 in a test distance 40 cm , and the test - charts group 11d is drawn to be a size corresponding to a visual acuity value 0 . 6 in a test distance 40 cm , respectively . the test - charts group 11e is a radial test chart in which numerals around radial lines are drawn to be a size corresponding to a visual acuity value 0 . 2 in a test distance 40 cm . in fig3 fields 20a - 20e denoted by oblique lines between respective dotted lines 10s are covered by the case 2 during the test so as not to be seen through the test chart window 4 . these fields 20a - 20e are provided with information - display parts 21a and 21c - 21e , in which a test distance , the method of use or the like for respective test - charts groups 11a - 11e are drawn . for example , in the information - display part 21a , as shown in fig4 information concerning the test - charts groups 11a and 11b are drawn , namely , such description &# 34 ; both test - charts groups are for a test distance 40 cm &# 34 ; is drawn . further , below column of the display 12a where is at the side of respective horizontal lines of test charts , there is shown a description denoting a distance making the test chart be for a visual acuity value 1 . 0 . in addition , an arrow 22a shows that contents of the information - display part 21a means the test - charts groups 11a and 11b next to there . the information - display part 21c shows a test distance of the test - charts group 11c and the matter that the test - charts group 11c is for a visual acuityvalue 1 . 0 in the test distance , and the information - display part 21d shows a test distance of the test - charts group 11d and a visual acuity value in the test distance . the information - display part 21e shows a test distance of the test - charts group 11e and the matter that the numeral is for a visual acuity value 0 . 2 in the test distance . the information - display parts 21c - 21e are also turned out by arrows , respectively . in addition , the back side of the test chart plate 3 is also provided with five test - charts groups different from the ones shown in fig3 and the information - display parts concerning each test - charts group in the field where do not appear on the test chart window 4 during test . fig5 shows an example thereof , and inside of the dotted line 10 corresponding to the test chart window 4 is provided with a cross grid test chart 24a which is utilized for testing a presbyopia adding power ( diopter ). and , for the field 25a which exists between the cross grid test chart 24a and the next test chart on the right side , an information - display part 26a for the cross grid test chart 24a is provided , and is denoted by an arrow 27a . the information is , for example , related to the method of use of the cross grid test chart 24a such as &# 34 ; set a cross cylinder lens then add a plus power ( diopter ) until an examinee can see both vertical lines and horizontal lines equally .&# 34 ;. next , a test of the preferred embodiment will be described hereinafter by utilizing such apparatus 1 for presenting a test chart having such composition . firstly , a test for detecting a presbyopia adding power ( diopter ) will be described . after a test for far vision is performed by using the subjective refractive power measuring unit 50 , as shown in fig2 the apparatus 1 for presenting a test chart , mounted to the near - point rod 52 , is set ahead of the test window 51 , then above - mentioned cross grid test chart 24a is made to be positioned at the test chart window 4 . besides , a test distance for cross grid test is not defined , however , the test distance may be preferably set so as to be 40 cm considering the visual acuity test to be performed thereafter . in the case that the operator want to know a test distance for a visual acuity test , the operator can confirm it by rotating and operating the test chart plate 3 to be appeared on the information - display part 21a . in addition , in the case that the operator want to know the method of use of the cross grid test chart 24a , the operator can confirm it by making the information - display part 26a appear on the test chart window 4 in the same manner . the operator sets the optical system corresponding to the perfect correcting power values for both eyes , obtained by the far vision test , to the test window 51 of the subjective refractive power measuring unit 50 by operating the operating part 60 , then sets a cross cylinder lens . and , the operator adds a plus spherical power ( diopter ) until the examinee can see both vertical and horizontal lines of the cross grid test chart 24a equally , obtaining a desired adding power ( diopter ). next , a visual acuity test of near vision will be described . the apparatus 1 for presenting a test chart is mounted to the subjective refractive power measuring unit 50 through the near - point rod 52 , and either test - charts group 11a or 11b is positioned at the test chart window 4 so as to be presented to the eye . in the case that the operator want to know a test distance in order to set this test chart , the operator can confirm it by seeing the information - display part 21a . in addition , in the case of performing a test with different test distance , the operator can understand details of distance display drawn on the side of respective horizontal lines of test - charts groups 11a and 11b , accordingly , the operator can perform the test in order to examine whether a visual acuityvalue 1 . 0 is obtained or not by making the apparatus 1 for presenting a test chart be positioned at its distance . as described above , for the test chart plate 3 , since the information necessary for test concerning each test - charts group is provided , therefore the operator can confirm the information easily prior to the presentation of the test - charts group to the examinee without preparing a manual , a guide book or the like . in addition , during a test , since the information does not appear on the test chart window 4 , therefore , the unnecessary characters are made not to presented to the eye , accordingly the accurate test can be performed without the eye being unfixed . besides , if a method of use of respective test charts and a simplified summary are provided for the information - display parts 21c , 21d and 21e , then it becomes more convenient . for example , if the method of use such as &# 34 ; add the plus spherical power ( diopter ) to make the numeral readable . multiply the numeral of darker lines by 30 to obtain the astigmatism axial angle &# 34 ; is drawn on the information - display part 21e for radial test charts , thereby the operator is to be assisted . the foregoing description of the preferred embodiments of the invention has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed , and modifications and variations are possible in the light of the above teachings or may be acquired from practice of the invention . the embodiments chosen and described in order to explain the principles of the invention and its practical application to enable one skilled in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto , and their equivalents .	0
the rig mat of the present invention is substantially planar device for supporting a mass and distributing its weight over the surface on which it is lain . the present rig mat modules , singly or combined in an assembly , are useful for constructing temporary roadways , crane and equipment pads and foundations for other temporary structures ( e . g ., scaffolding and platforms ). referring now to the drawings , the details of preferred embodiments of the present invention are graphically and schematically illustrated . like elements in the drawings are represented by like numbers , and any similar elements are represented by like numbers with a different lower case letter suffix . as shown in fig1 the rig mat 10 of the present invention comprises a top plate 50 and a bottom plate 52 , each plate having an exposed surface 54 , an interior surface 56 and a perimeter edge 60 . the plates 50 , 52 are disposed in parallel alignment with their interior surfaces 56 juxtaposed to define a grating space 14 between them . the spacer grate assembly 16 is disposed within the grating space 14 . the spacer grate 16 is in contact with and is fixed to the interior surfaces 56 of the top and bottom plates 50 & amp ; 52 at the upper and lower bearing surfaces 34 , 36 of the spacer grate assembly 16 grating bars 22 . in the preferred embodiment , the interior surfaces 56 of the top and bottom plates 50 & amp ; 52 are fixed to the upper and lower bearing surfaces 34 , 36 of the grating bars 22 using an adhesive 68 ( see fig3 a to 3 c ). the spacer grate 16 comprises a plurality of grating bars 22 disposed in a parallel spaced relationship to each other , and a plurality of cross - rod assemblies 26 disposed in a parallel spaced relationship to each other and in perpendicular relationship to the grating bars 22 . the cross - rod assemblies 26 pass through and are attached to the grating bars 22 to fix the spaced relationship of the grating bars 22 relative to each other . as shown in fig2 each grating bar 22 has a length l , a width w and a height h . the width and the height h define the cross - section of the grating bar 22 . preferably , the grating bars 22 have a cross - section that is substantially oblong . the length l of the grating bars 22 range from at least about 2 feet and longer . the length l of the grating bars 22 defines the dimension of the grating bars 22 that are in parallel with each other . the spaced relationship d of the grating bars 22 is about 2 - times to 20 - times the width w of the grating bars 22 . the width w of the grating bars 22 is about 0 . 5 to about 1 . 0 inches . for large mass loads , in a preferred embodiment spaced relationship d was 2 - times the width w with the width w of the grating bar 22 being about 0 . 6 inches . the height h of the grating bars can be about 1 . 0 to about 2 . 0 inches , and in the preferred embodiment was about 1 . 5 inches . the grating bars 22 further comprise a plurality of rod apertures 24 passing through a height surface 23 of the grating bar 22 , which is perpendicular to the width w of the grating bar 22 . the rod apertures 24 are disposed in alignment for closely passing therethrough the cross - rods assemblies 26 . the distance s between adjacent rod apertures 24 in a preferred embodiment was about 18 inches . however , the spacing s between rod apertures is selectable by the ordinary skilled artisan in view of the expected mass and dynamics ( movement ) of the load on the top plate 50 of the rig mat 10 . a cross - rod assembly 26 comprises two spacer - rods 28 separated by a wedge - rod 30 . see fig2 . each spacer - rod 28 has an outer engagement surface 31 and an inner flat surface 34 . the spacer - rods 28 are shaped with a curvilinear outer engagement surface 31 to facilitate passing a relatively larger cross - section of spacer rod 28 through the cross - rod apertures 24 than without the curvilinear engagement surface 31 . the outer engagement surface 31 has a plurality of spaced engaging means 32 for engaging the grating bar 22 where the cross - rod 26 passes through the rod - aperture 24 . the inner flat surface 34 serves as a mating surface that slideably interfaces with the wedge - rod 30 . in a preferred embodiment , the outer engagement surface 31 of the spacer rod 28 includes a plurality of engagement means 32 . in the embodiment shown , the engagement means 32 were notches for closely engaging the thickness of the rod - apertures 24 as the cross - rod assemblies 26 passed through the grating bars 22 . the notches 32 were spaced apart and fixed the spaced relationship d of the grating bars 22 . the wedge - rod 30 has two similar and opposite interface surfaces 46 for slidably contacting the mating surface 34 of each of the two spacer - rods 28 , and for separating the spacer - rods 28 apart . additionally , off - set 90 degrees from the interface surfaces 46 , the wedge - rod 30 has two other similar and opposite curvilinear surfaces 48 , the curvilinear surfaces 48 disposed to closely pass through the rod - apertures 24 . the cross bar wedge - rods 30 are preferably i - shaped , with their interface surfaces 46 indented or recessed to facilitate slidably receiving the spacer - rods 28 . as shown in fig3 a to 3 c , an edge binder 66 is disposed around the perimeter of the assembled plates 50 & amp ; 52 and spacer grate 16 to engage the perimeter edges 60 of the plates 50 & amp ; 52 . the binder 66 encloses the grating space 14 ( see fig1 ) and provides additional structural integrity to the perimeter of the assembled rig mat module 10 . the binder 66 may have a cross section configured in a “ t ”- shape as shown in fig3 a to 3 c , or may be flush with the perimeter edge ( not shown ), or some other configuration ( e . g ., see fig4 a and 4b ). the edge binder 66 can be fixed in place or can be removable by a choice of means known to one of ordinary skill in the art , such as a fastener 64 like a rivet or bolt and nut , a screw 67 or an adhesive 68 . to form a rig mat assembly , a plurality of rig mat modules are lain on a ground surface adjacent each other in a desired pattern and anchored to the ground surface using stakes . alternatively , to facilitate anchoring the mat modules 10 relative to each other on a groung surface , as shown in fig4 a and 4b , the rig mat module 10 of the present invention optionally comprises a coupling means for holding the perimeter edge of the rig mat module adjacent to the perimeter edge of an other rig mat module 10 . an example of a coupling means is a simple stake 70 passing through an anchor bore 72 in the plates 50 & amp ; 52 and edge binder 66 of the rig mat module 10 proximate its perimeter edge 60 in a number of location to fix adjacent rig mat modules 10 to an underlying surface . the edge binder 60 used in the coupling means can take a variety of cross sectional configurations as shown in the figures . it can be a “+”- shaped binder 66 a or a plane block binder 66 b . in a preferred embodiment , when the binder edge 66 a & amp ; 66 b is utilized as a part of a coupling means , it is removable from the both of the adjacent mat modules 10 , as shown in fig4 a and 4b . the stake 70 a can have a squared “ u ” configuration and be disposed to pass through two adjacent rig mat 10 at the same time . if heavy anchoring of the mat modules 10 is required , the mat modules 10 may further comprise anchor bores 72 a ( see fig3 .) distributed over the plane of the mat module , through which heavy duty stakes ( not shown ) may be driven to anchor the mat module 10 in place on the ground surface . as shown in fig5 a , the thickness of the plates 50 & amp ; 52 can be different depending on the anticipated loading of the top plate 50 and / or the condition of the surface contacting the bottom plate 52 . the plates 50 & amp ; 52 themselves can be a single thickness or comprised of a laminate . additionally , as shown in fig5 b , either exterior surface 54 of a plate 50 & amp ; 52 can be layered with a cover plate 78 which is removable . the cover plate 78 can be utilized to provide protection to the plate 50 & amp ; 52 under it or to increase its loading capacity . a cover plate 78 can be replaced when worn or not needed , or can be switched out to provide an exposed surface 54 a on the rig mat module 10 suitable for a specific purpose ( e . g ., a high friction or gripping surface for a slippery environment ). the cover plate can be removably attached to the exposed or exterior surface of a top or bottom plate 50 & amp ; 52 by any of a variety of means known to the ordinary skilled artisan , such as the use of screw fasteners 64 as shown in fig5 b . assembly of the present rig mat 10 from its component parts is readily accomplishable by one of ordinary skill in the art in view of the teachings and figures herein . although alternative methods are known to the ordinary skilled artisan , one method of assembling the present rig mat 10 is to first assemble the spacer grating 16 . a technique useful for assembling the spacer grating 16 of the rig mat module 10 is known in the art ( see u . s . pat . no . 4 , 522 , 009 ). generally , the grating bars 22 are set out in the desired parallel and spaced relationship with their rod - apertures 24 in alignment . a pair of spacer rods 28 of an appropriate length , oriented with their engagement surfaces 31 in opposition , are inserted through the aligned rod - apertures 24 . a wedge - rod 30 is slid between the two spacer - rods to separate them and cause the notches 32 to engage the thickness ( or width w ) of the rating bars 22 . in a preferred embodiment , all of the points of contact between the various structural components and features of the rig mat module 10 are bonded together , except for the cover plate 78 , if one is utilized . in particular , this is practiced to bond the wedge - rod 30 to the two spacer - rods 28 at the two interface surfaces 46 of the wedge - rod 30 . this may be accomplished using an adhesive , epoxy resin or like bonding agent that is appropriate for the constriction materials of the surfaces to be bound . such bonding agents are known to and selectable by the ordinary skilled artisan for practice in the present invention . of course , attachment means other than bonding agents , such as bolt , nail or screw type fasteners 64 , may be utilized where appropriate , e . g ., for attaching the binder edge 66 ( see fig3 a to 4 b ) or a cover plate 78 ( see fig5 b ). preferably , component parts of the present invention 10 are fiber reinforced plastic ( frp ) shapes constructed using a pultrusion process as is known in fire art . also , the present components preferably utilize an isophtalic polyester or a vinyl ester resin with flame retardant and ultra - violet ( uv ) inhibitor additives . after fabrication , all cut ends , holes and abrasions of the rig mat module preferably are sealed with a compatible resin to prevent fraying and intrusion of moisture . should additional ultraviolet protection be required , a uv coating can be applied . to demonstrate the utility of the present invention , a rig mat module 10 useful in a travel way or work apron assembly was produced and fabricated into an assembled surface . this embodiment of a rig mat module 10 was approximately 8 feet across and 30 feet long . fig6 is a top view , partial schematic layout of the primary components of the rig mat module , without the top and bottom plates being shown . the cross - rods 26 were spaced at about 18 inches from the adjacent cross - rod 26 . twenty cross - rods were used . in this embodiment , the wedge - rod 30 of each cross rod 26 was a single piece . however , each of the two spacer - rods 28 comprised a two - piece length ( section a , fig6 ) which is further illustrated in fig7 . fig7 illustrates how the two separate pieces of each spacer - rod 28 were butted together and used in combination with the wedge - rod 30 to provide the wedge - rod 26 of this embodiment . the grating bars 22 ( only 2 of a plurality shown ) each had a length l of about 30 feet . because grating bars of that length were not readily available , each grating bar 22 was comprised of two sub - lengths and butted together ( section b , fig6 ) to form an overall gating bar 22 of de desired length , which is further illustrated in fig8 . the top and bottom plates 50 & amp ; 52 were constructed of 0 . 5 inch thick fiberglass plating . the height h of the grating bars 22 , and hence the spacer grate 16 , was 1 . 5 inches , which made the overall thickness of the rig mat module 10 about 2 . 5 inches . the prototype rig mat module was 8 ft .× 30 ft .× 2 . 5 in . the first successful testing of the prototype rig mat module 10 was at − 34 ° f . and with weight in excess of 185 psi . additional testing of the prototype rig mat module 10 to 485 psi was without failure . while the above description contains many , specifics , these should not be constructed as limitations on the scope of the invention , but rather as exemplifications of one or another preferred embodiment thereof . many other variations are possible , which would be obvious to one skilled in the art . accordingly , the scope of the invention should be determined by the scope of the appended claims and their equivalents , and not just by the embodiments .	4
referring to fig1 reference 1 generally designates a wall which , in practice , is of a cylindrical form and which outlines a containment zone for a typical nuclear reactor ( not shown ) included in a nuclear power plant . the wall may be composed of a very thick , reinforced concrete wall , as well as a leakproof lining of stainless steel which is applied to the inside of the wall . the bottom part of the containment zone forms an area for a pool or basin of water -- the surface of which is indicated by reference 2 . at a level below the water surface , a plurality of strainer devices are mounted , one such device being indicated by reference 3 . a main component of such a device is the housing or tube 4 which is provided with a perforated mantle wall , the perforations or apertures being indicated by reference number 11 . the wall 4 is provided on its exterior a plurality of radially projecting wings or flanges 5 mounted thereon . in the embodiment shown in fig1 each individual strainer housing or tube 4 is connected to a lower suction conduit 6 . the latter may be connected in common to a plurality of such housings . housing 4 is mounted by suitable means ( not shown ) relatively closely to the inside of the containment wall 1 . water from the lower level of the containment pool can be drawn or taken into the interior cavity or chamber of the housing and thereafter can be transported through a suction conduit to an emergency cooling system , the latter typically involving nozzles , sprinklers or the like mounted near or at the upper portion of the containment zone . thus , when required , the reactor core can be provided with sprinkled water via such a system . the above - described structure and its outlined features , to this point , represents a conventional system . according to the present invention , however , the strainer housing or tube 4 is connected to an accumulator tank or container 7 , for holding and storing water . the tank 7 is connected , as schematically shown via line 8 , to a source of pressurized gas ( not shown ), with the line 8 including a valve 9 . in this manner , a pressurized gaseous fluid can be fed into the tank 7 in order to momentarily release or eject water into the cavity of the strainer housing 4 . typically , conduit 8 may be a relatively thin pipeline mounting the on / off valve 9 . as shown in fig1 pipe or conduit 8 passes through the concrete wall 1 forming the containment area , while the source of pressurized gas is located outside of the containment wall . the pressurized gas source may be any suitable conventional type ; for example , a simple gas bottle or a compressor with a suitable gas storage zone may be employed for this purpose . a typical gaseous fluid which may be used includes e . g . nitrogen , although other gases such atmospheric air can also be used . reference number 10 designates an aperture in the wall of the container 7 , the latter of which may be typically made from e . g . metal plate . preferably , the aperture 10 is provided in the upper area or top 7 &# 39 ; of the tank . in order to prevent large volumes of gas from escaping in a relatively short period of time , aperture 10 will have a relatively small diameter such as 1 to 5 mm ( suitably 2 to 3 mm ). thus , with such measurements , it will only be possible to slowly release gas from the tank over longer periods of time for a given volume of gas . it will be understood that although one aperture 10 has been illustrated for the sake of simplicity , it will be understood that two or more apertures may be used in practice . the operation of the strainer device in fig1 can be described as follows : under normal conditions , the tank 7 is filled with water from the surrounding pool of water in the containment zone . water to the emergency cooling system can be sucked into the interior of the strainer housing and can be transmitted or forwarded to the nozzles or sprinklers of the emergency system through the suction conduit 6 . under such conditions , the valve 9 in the gas conduit line 8 would be in a closed condition . after a period of time where water passes through the apertures or holes 11 of the housing 4 , there is a risk that the apertures may be clogged or plugged due to the fact that fibres or other foreign material may accumulate on the exterior of the housing wall and form a mat of such material or fibres . when that occurs , backflushing of the unit is required and typically this is performed by opening the valve 9 so that the pressurized gas can flow into the tank 7 and release or expel water from the tank into the interior of the cavity or chamber of the strainer housing 4 . in the above manner , water inside the strainer housing 4 will flow outwardly through the perforations 11 of the mantle wall thus removing the covering fiber mat . this fiber mat removal is highly facilitated by the presence of the radially projecting wings 5 , which divide the mat into sections , each of which can thus be easily released from the wall exterior . this backflushing operation , can in its entirety , be carried out in the space of a few seconds , since the pressurized gas rapidly empties from the tank 7 and forces the water into housing 4 and out through the apertures of the strainer wall . for this reason , it will be seen that it is not necessary to interrupt the regular operation of the pump , which normally draws water into the conduit 6 . once the backflushing operation has been completed , the cut - off valve 9 is closed so that the tank 7 is refilled with water from the pool . this automatic refilling is carried out through the aperture ( s ) 10 in the top of the tank , which allows the evacuation of remaining gas from the tank . in other words , water from the strainer housing may flow slowly upwardly into the tank at the same time as the gas is successively evacuated through apertures 10 . in a preferred embodiment illustrated in fig2 through 4 , a rotation - generating means 12 is provided in the area between tank 7 and strainer housing or tube 4 . the rotation - generating means 12 may include a conical - shaped body 13 , which is arranged centrally in tube 4 , and a plurality of curved blades 14 affixed on the outside of body 13 . as indicated in fig4 the top portion 14 &# 39 ; of each blade 14 is planar and extends in parallel to the axial water flow from tank 7 to housing 4 , while the remaining main portion 14 &# 34 ; below portion 14 &# 39 ; is curved and extends at an angle relative to portion 14 &# 39 ;. it should also be noted that the embodiment of fig2 is modified in comparison with the embodiment of fig1 insofar as a tube portion 15 connecting housing tube 4 with the conical bottom portion 7 &# 34 ; of accumulator tank 7 has a reduced diameter as compared with tube 4 . this reduced portion 15 passes into another conical portion 4 &# 39 ; surrounding body 13 at the top of tube 4 . water passing through the annular space between the outside of conical body 13 and the inside of tube portion 4 &# 39 ; will be set into a rotary and axial motion . the result is that the water , when entering tube 4 , has a tendency to be dispersed evenly on the inside of the tube . it will be noted that there is a certain distance between the bottom part of body 13 and the upper holes in the set of holes 11 in the tube wall . accordingly , the rotating water will be evenly distributed when reaching the holes so as to secure a strong even outflow of water through the holes . from the above description , the advantages of the invention will be obvious . due to the fact that the backflushing can be carried out during an extremely short period of time , the regular suction of water into the conduit 6 does not have to be interrupted . furthermore , the necessary piping in the form of the gas pipeline 8 can be made with very thin dimensions ( compared with the heavy water conduit 6 ). this facilitates the drawing of pipeline 8 through the containment wall 7 . within the scope of the invention it is also conceivable to place the accumulator or storage tank 7 outside the reactor containment zone and connect the same with the strainer housing via suitable conduits .	1
fig1 shows a hydraulic ram 1 and a drive unit 19 that actuates ram 1 according to the invention . ram 1 is of a type widely used as a jack and suitable for use in practice of the present invention . ram 1 has a cylinder and piston ( not shown ) in a casing 2 and a telescoping piston rod 3 secured to the piston , and which can raise a load as oil is pumped into the cylinder below the piston . casing 2 is secured to a base plate 4 . a reciprocating piston - type pump 5 is mounted to casing 2 and can pump oil into the cylinder from an oil chamber ( not shown ) within the casing 2 . pump 5 is operable by a pump lever 6 that is pivotally secured to a plunger 7 of pump 5 and to a link 8 . link 8 in turn is pivotally mounted to the base plate 4 . a valve 9 is provided for bleeding oil from the cylinder back into the oil chamber so as to allow retraction of the jack . valve 9 is operable by rotation of a control rod 10 . some jack - type rams provide , instead of or additionally to such a valve , means whereby oil can optionally be pumped into a space ( not shown ) above the piston so that retraction can be achieved by this means instead of or in addition to applying a force to the piston rod . still other rams provide multiple concentric pistons that telescope within one another to achieve a greater ratio of lift stroke to cylinder length than is possible with a single piston . these rams too are usable with the invention . jacks that combine a cylinder and telescoping piston with an oil ( or other working fluid ) reservoir , a lever - actuated pump and suitable control valve ( s ) are especially convenient for practice of the present invention . however , it is not intended to imply that such jacks are the only form of rams that may be used in practice of the invention . an advantage of rams such as ram 1 is that they require no connection to an external hydraulic oil supply . this can greatly simplify the provision of lifting device that is compact and powered by means other than manual means . drive unit 19 comprises an electric motor 11 coupled to a speed reducer 12 . speed reducer 12 is preferably a gear type speed reducer , whose output shaft rotates a crank arm 13 . crank arm 13 is pivotally connected to one end 14 of a link rod 94 whose other end 15 is pivotally connected to pump lever 6 . the result is that when motor 11 is driven from a suitable electric power supply ( not shown ), point 14 describes a circular path 16 and lever 6 is pumped up and down as shown by arrow 17 , thus actuating ram 1 to lift a load applied downwardly to the piston rod 3 . fig2 and 3 show the application of the invention to a vehicle - towable road trailer 20 provided with a load tray 21 that can tilt to dump its load . referring to fig2 , from which unnecessary mechanical detail has been omitted , there is shown a trailer 20 , suitable for towing by an automobile or the like with a hitch connection 121 . trailer 20 includes a frame 22 mounted on wheels 23 . tip tray 21 is hingedly connected to the frame 22 by a 10 pair of hinges 24 at the rear of the frame 22 . a ram 25 is provided for raising and lowering tray 21 and is shown in two positions in fig2 , position “ a ” corresponding to the raised position of tray 21 and position “ b ” corresponding to the lowered position of tray 21 . piston rod 32 of ram 25 is connected to tray 21 at pivot 41 . referring now to fig3 , ram 25 is mounted to a bar 26 that extends between a pair of spaced generally upright members 27 . members 27 are hingedly mounted to side girders 28 of frame 22 at hinged connections 29 so that the bar 26 is free to pivot about an axis 30 through hinged connections 29 . thus , ram 25 can pivot about axis 30 . this arrangement allows ram 25 to change its angle relative to frame 22 and tray 21 as tray 21 is raised and lowered . the arrangement further allows suitable positioning of axis 30 along the length of ram 25 so as to provide advantageous geometry throughout the stroke of ram 25 and to avoid possible buckling of ram 25 at full extension of its piston rod 32 . also mounted to the pivot bar 26 , is a drive unit 33 comprising an electric motor 34 and geared speed reducer 35 . drive unit 33 is mounted to the pivot bar 26 by a main bracket 135 and a stabilizing cross strut 36 in combination adapted to fix the drive unit relative to the pivot bar 26 and therefore to ram 25 . the combination of drive unit 33 and ram 25 is similar to the arrangement shown in fig1 , and operates in the same way . by securing drive unit 33 and ram 25 to bar 26 , the relative positions of drive unit 33 and ram 25 are preserved at all operating positions of ram 25 . pump lever 37 of ram 25 is shown as curved and this assists in provision of a compact arrangement for driving ram 25 with drive unit 33 . however a straight pump lever could be used instead . the motor 34 is powered , via an electrical cable 38 , from the electrical system of the towing vehicle ( not shown ) or any other suitable electrical supply . a suitable electrical switch ( not shown ) is provided , preferably on trailer 20 itself , to switch motor 34 on and off . to raise tray 21 , the motor 34 is switched on and rotates the crank 39 whereby a link 40 reciprocatingly actuates the pump lever 37 and in turn operates the pump 139 of ram 25 to extend piston rod 32 . the pivot 41 may be located towards the front of the underside of the tip tray 21 to lessen the load on the ram 25 or may be placed at a position intermediate the length of the tip tray 21 to allow use of a shorter ram 25 . to lower tray 21 , a user operates a release valve 42 that is connected by an extension 43 to a knob 44 which is mounted to the bar 26 and below frame 22 out of the way of the descending tip tray 21 . the user may control the descent of the tip tray 21 whereby to permit it to gently return to its lowermost position where it can be secured to the frame 22 optionally by a latch or clamp device ( not shown ). other positions of controls for release valve 42 may be chosen , but may require an articulated extension ( unlike rigid extension 43 ) to accommodate the changing orientation of the ram 25 relative to the frame 22 . a flexible cable may also be provided as an alternative to operate release valve 42 , for example a so - called “ bowden ” cable having a flexible cable in a flexible supporting sheath . the drive unit 33 may be enclosed in a cover ( not shown ) both for aesthetic and practical purposes , that is to keep the mechanism free of dust , mud and grime to which the trailer 20 may be exposed in use . another way to provide a tilting tray facility for a trailer or vehicle using the invention will now be described . fig4 is a schematic side view ( i . e . with unimportant mechanical detail omitted ) of a tray 50 that is pivotally mounted by hinges 49 to a fixed frame ( represented by a symbol 51 in fig4 ) that may be a trailer frame ( like frame 22 ) or a chassis of a road vehicle ( not shown ) such as a small utility vehicle . tray 50 is shown in raised and lowered positions in fig4 . also hingedly connected to the frame at a pivot 53 is a beam 54 . beam 54 is pivotally connected to one end 55 of a link 56 and the other end 57 of link 56 is connected pivotally to tray 50 . pivotally connected to beam 54 is upper end 58 of a piston rod 59 of a ram 60 . ram 60 is itself connected to the frame at a pivot 61 in a way described below . position “ a ” of ram 60 in fig4 corresponds to the raised position of tray 50 and position “ b ” corresponds to the lowered position of tray 50 . beam 54 is shown in fig4 as having a bend 62 , but persons skilled in the art will recognize that this is not essential . beam 54 happens to provide a compact arrangement , which is important in tray raising applications . comparison of fig2 and 4 shows that a shorter ram can be used in the arrangement of fig4 . the arrangement shown in fig4 can also be proportioned to provide a better match between the available thrust on piston rod 59 and the effort required to raise the tray 50 from its lowered position to its raised position . fig5 shows the mechanical arrangement for mounting and actuation of ram 60 . only a part of the frame is shown , namely transverse beams 64 and 65 . ram 60 is mounted on a platform 63 that is in turn pivotable about pivot 61 , so that the combination of ram 60 and platform 63 pivots together about pivot 61 . a drive unit 66 , comprising an electric motor 67 and gear - type speed reducer 68 is secured by brackets 69 and 70 so as be in a fixed position relative to ram 60 irrespective of the position of ram 60 . brackets 69 and 70 are secured to the ram 60 and the platform 63 respectively . drive unit 66 when operated from a suitable electric supply rotates a crank arm 71 that is pivotally connected to one end 72 of a link 73 . the other end 74 of link 73 is pivotally connected to pump lever 75 of ram . 60 . lever 75 actuates a plunger - type pump 76 that is integral with ram 60 . drive unit 66 is mounted substantially beside ram 60 ( i . e . so that lever 75 extends approximately transversely to the direction of travel 77 of the vehicle ) for compactness and approximately constant ground clearance . ( in contrast , in the arrangement in fig2 and 3 , drive unit 33 will have a ground clearance that varies as bar 26 swings during raising and lowering of tray 21 .) although not shown in fig5 , a suitable protective cover can be mounted ( for example from brackets 69 and / or 70 ) in a position fixed relative 5 to drive unit 66 to protect drive unit 66 from mud , dust and the like . a release valve ( comparable to valves 9 and 42 above ) is not shown in fig5 , but a suitable arrangement for operating such a valve may be provided in ways similar to those described above . it will be apparent to persons skilled in the mechanical art that the 10 drive - unit - and - ram arrangements described above may be readily adapted to applications other than the raising and lowering of load trays of trailers and utility and other vehicles . for example , they could be applied to the raising of booms in cranes and the like and generally to applications where a load has to be raised and lowered . the use of hydraulic or pneumatic rams having integral or permanently associated pumps operated by levers , for example those sold as jacks , allows effective load lifting devices to be made in comparatively small sizes , for example where the ram is required to develop a force of in the 500 kg , or 1 tonne or 1 . 5 tonne ranges , without the expense and complexity of providing , and later maintaining , external hydraulic power supplies . it is not essential that a rotary motor be used in the drive units as described above . referring now to fig6 a and 6 b , the linkages involved in a lifting mechanism using a motor 80 having a linearly reciprocating plunger 81 is shown . the plunger 81 is connected to one end 82 of a link 83 whose other end 84 is pivotally connected to a pump lever 85 of a ram 86 . it can be seen that by the reciprocation of the plunger 81 up and down that the pump lever 85 is also pivoted up and down whereby to operate a pump associated with ram 86 . fig7 and 8 show a further lifting apparatus 100 of the invention that has been found useful . apparatus 100 is a particular embodiment of apparatus shown in fig4 and 5 , and has a ram 101 foot - mounted on a platform 102 similar to platform 63 ( fig5 ) that is able to pivot about a pivot 103 , and piston rod 104 of ram 101 is pivotally connected to a boom 105 at pivot 106 , boom 105 being pivotally connected by a pivot 111 to a base 112 . links 107 are pivotally connected to boom 105 and to load supports 108 as shown in the figures . apparatus 100 is suitable for mounting to a supporting structure such as a vehicle chassis or frame 109 and load supports 108 are secured to a load 110 . ( load 110 is here assumed to be secured movably or guided by additional means not shown , for example pivotally secured to structure 109 , and in particular could be a tilting tray as in the earlier - described embodiments . a drive unit 118 is provided that is similar to drive unit 66 of fig5 and actuates pump lever 119 . ( drive unit 118 is shown in fig8 , but for clarity not in fig7 .) boom 105 is curved , with its concave side downwards . it has been found that the use of such a curved boom can allow for achieving a compact arrangement with comparatively high load capacity and a short stroke ram . in particular , where limited vertical clearance is available between a vehicle chassis frame and the base of a tilt tray , the arrangement shown in fig7 and 8 can be advantageous . fig9 shows a cross sectional view of boom 105 , which can conveniently be made using channel - section structural section ( s ). the curved shape of boom 105 can be achieved in manufacture by bending in suitable cases , or by the use of short straight sections welded to produce a similar geometry . fig1 and 11 show an arrangement similar to that shown in fig7 to 9 , whereby the boom 122 is shaped in an arc through welding of a plurality of short straight sections . in the embodiment as shown , the arrangement is in the form of a tilting / tipping unit 120 for incorporation into a vehicle , such as a trailer , utility vehicle or the like . such vehicles typically comprise a tray ( not shown ) for receiving a load , which can be tipped / tilted to assist in depositing the load from the tray , and / or positioning the load on the tray . the tipping / tilting unit 120 can be readily installed in the vehicle and has a base 121 which is secured against a chassis or frame of a vehicle , and one or more connector members 123 which are pivotally secured to the tray of the vehicle . in this arrangement , the tipping / tilting unit 120 is secured between the chassis of the vehicle and the tray of the vehicle . the boom 122 is pivotally mounted at one end to the base 121 , and is able to pivot about this point through action of the ram 124 . as described above with regard to the alternative embodiments of the present invention , the ram 124 linearly drives a piston rod 127 , which is pivotally connected to the boom 122 at a pivot point 128 . extension of the piston rod 127 from the ram 124 causes the boom 122 to extend as shown in fig1 . as the boom 122 extends , the ram 124 also pivots to ensure that the piston rod moves in a freely moves in a linear manner . to facilitate this pivot action of the ram 124 , the ram 124 is mounted on a platform 125 that is able to pivot about a pivot point 126 . the other end of the boom 122 is attached to the connector members 123 by way of a link 129 . the links 129 are pivotally connected to the end of the boom 122 and the connector members 123 to enable the tray to pivot between a tilted position as depicted in fig1 , and a flat or level position , as depicted in fig1 . in the position as shown in fig1 , the tipping / tilting unit 120 is compactly arranged such that it fits between the chassis of the vehicle and the tray . as shown , the piston rod 127 is retracted into the ram 124 and as such that ram 124 is pivoted into a retracted position as shown . a drive unit 130 is provided to operate the ram 124 such that the piston rod 127 can move between its extended and retracted positions . the drive unit 130 may be in the form of motor as discussed previously , which operates a pump lever 131 of the ram 124 . it will be appreciated that the tipping / tilting unit 120 can be easily supplied for installation in a vehicle . however , in many instances , it may be necessary to provide associated support frames about the tipping / tilting unit 120 such that the arrangement can be easily incorporated into the structure of the vehicle , without requiring onerous installation techniques to ensure that the tipping / tilting unit 120 is orientated correctly to tilt the tray of the vehicle . for this reason , the arrangement 140 of fig1 and 13 has been proposed . as shown , in the arrangement 140 , the tipping / tilting unit 120 is mounted between a base frame 135 and a support frame 138 . the base frame 135 can be constructed such that it can be easily mounted to the chassis of the vehicle through existing mounting means , such as bolts and the like . similarly , the support frame 138 can have appropriate mounting means to receive a tray , upon which a load can be supported . both the base frame 135 and the support frame 138 are pivotally connected at a pivot point 133 such that when the tipping / tilting unit 120 is operated , the support frame 138 is moved with respect to the base frame 135 , which in turn causes the tray to tilt / tip with respect to the chassis of the vehicle . it will be appreciated that such an arrangement 140 enables the present invention to be simply installed in a vehicle between the chassis and the tray of the vehicle , without requiring precision positioning and mounting of the individual components of the tipping / tilting unit 120 . in the arrangements shown in fig2 and 3 , 4 and 5 , 7 and 8 , 10 and 11 , and 12 and 13 , drive units 33 , 66 , 118 , and 130 are supported in fixed positions relative to the rams 25 , 60 and 124 respectively . however , where only limited movement of a ram is required in a mechanism , it may be practical to hold a drive unit in a fixed position while the ram pivots . in this case , simple pivots ( for example at the ends of links 40 or 73 ) may have to be replaced by ball - and - socket pivots . still other variations may be made without exceeding the spirit and scope of the invention . in this specification the terms “ vehicle ” and “ vehicular ” are meant to be interpreted as being applicable both to self - propelled vehicles such as light trucks , utility vehicles and the like , and also to trailers intended for towing by other vehicles . in this specification , the word “ comprise ” and its derivatives when used in relation to a set of integers , elements , items or steps is to be taken to mean that the integers , elements , items or steps are present but not to be taken to preclude the possibility that other integers , elements , items or steps are or may be present also .	1
the present invention now will be described more fully hereinafter in the following detailed description of the invention , in which some , but not all embodiments of the invention are described . indeed , this invention may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will satisfy applicable legal requirements . according to the present invention , a flame retardant thermoplastic resin composition with superior scratch resistance comprises : a base resin comprising ( a ) about 30 to about 90 parts by weight of a polycarbonate resin , ( b ) about 15 to about 50 parts by weight of a polymethylmethacrylate resin , and ( c ) about 5 to about 50 parts by weight of a polyethylene terephthalate - based resin ; and ( d ) about 5 to about 30 parts by weight of a phosphorus - based flame - retarding agent based on 100 parts by weight of the base resin . the polyethylene terephthalate - based resin ( c ) can be an amorphous polyethylene terephthalate resin . the thermoplastic resin composition can optionally further comprise about 1 to about 30 parts by weight of an impact modifier based on 100 parts by weight of the base resin . the thermoplastic resin composition may further comprise at least one additive selected from the group consisting of anti - dripping agents , oxidation inhibitors , plasticizers , heat stabilizers , light stabilizers , compatibilizers , pigments , dyes , inorganic fillers , and the like , and combinations thereof . components of the resin composition will be described in detail hereafter . aromatic polycarbonate resins ( a ) in accordance with the invention can be obtained by reaction of diphenol with phosgene , haloformate or diester carbonate , wherein the diphenol is represented by the following formula 1 . wherein a is a single bond , c 1 - c 5 alkylene , c 1 - c 5 alkylindene , c 5 - c 6 cycloalkylindene , — s —, — so 2 —, or — sio 2 —. examples of diphenols represented by formula 1 can include without limitation hydroquinol , resorcinol , 4 , 4 ′- dihydroxydiphenyl , 2 , 2 - bis -( 4 - hydroxyphenyl )- propane ( commonly called bisphenol - a or bpa ), 2 , 4 - bis -( 4 - hydroxyphenyl )- 2 - methylbutane , 1 , 1 - bis -( 4 - hydroxyphenyl )- cyclohexane , 2 , 2 - bis -( 3 - chloro - 4 - hydroxyphenyl )- propane , 2 , 2 - bis -( 3 , 5 - dichloro - 4 - hydroxyphenyl )- propane , and the like , and combinations thereof . the polycarbonate resin of the invention can have a weight average molecular weight ( m w ) of about 10 , 000 to about 200 , 000 g / mol , for example , about 15 , 000 to about 80 , 000 g / mol . the polycarbonate resin may comprise a branched chain . the polycarbonate resin may be obtained by adding about 0 . 05 to about 2 mol % of a multi - functional compound having a valence of 3 or more , for example , a compound containing a phenol group having a valence of 3 or more , to the rest of diphenol used for polymerization . in accordance with the invention , the amount of polycarbonate resin ( a ) is in the range of about 30 to about 90 parts by weight , for example about 50 to about 70 parts by weight , based on the weight of the base resin which comprises ( a ) the polycarbonate resin , ( b ) the polymethylmethacrylate resin , and ( c ) the polyethylene terephthalate - based resin . because the polycarbonate resin facilitates flame retardancy , an amount of polycarbonate resin less than about 30 parts by weight can reduce flame retardancy and mechanical strength of the resin composition . an amount of polycarbonate resin more than about 90 parts by weight can reduce scratch resistance of the resin composition . polycarbonate resin in an amount of about 50 to about 70 parts by weight can be useful in exemplary embodiments to maintain a balance of physical properties . pmma resins in accordance with the invention comprise a homopolymer containing methylmethacrylate as a main component , a copolymer containing at least one group selected from alkyl acrylate groups and alkyl methacrylate groups , or a mixture thereof . the amount of pmma resin can range from about 15 to about 50 parts by weight , for example about 20 to about 40 parts by weight , based on the weight of the base resin which comprises ( a ) the polycarbonate resin , ( b ) the polymethylmethacrylate resin , and ( c ) the polyethylene terephthalate - based resin . an amount of pmma resin less than about 15 parts by weight can make it difficult to impart scratch resistance and an amount of pmma resin more than about 50 parts by weight can reduce flame retardancy . in particular , the pmma resin can make it difficult to attain flame retardancy with a phosphorus - based flame - retarding agent . pmma resin in an amount of about 20 to about 40 parts by weight can be useful in exemplary embodiments to attain both scratch resistance and flame retardancy at the same time . pet - based resins in accordance with the invention serve not only to improve wear resistance , but also to improve the flame retardancy of the whole resin composition via a correlated reaction with the polycarbonate and polymethylmethacrylate resins upon burning of the composition . the amount of polyethylene terephthalate - based resin can range from about 5 to about 50 parts by weight , for example about 5 to about 25 parts by weight , based on the total weight of the base resin . an amount of polyethylene terephthalate - based resin less than about 5 parts by weight can have an insignificant effect on enhancing wear resistance and flame retardancy , and an amount of polyethylene terephthalate - based resin more than about 50 parts by weight can reduce notched - impact strength . polyethylene terephthalate - based resin in an amount of about 5 to about 25 parts by weight can be useful in exemplary embodiments to maintain the balance of physical properties . examples of polyethylene terephthalate - based resins may include , but are not limited to , conventional polyethylene terephthalate resins ( pet ), polyethylene terephthalate resins obtained by recycling , and the like , as well as combinations thereof . in exemplary embodiments of the invention , the polyethylene terephthalate - based resin may be amorphous polyethylene terephthalate or glycol - modified polyethylene terephthalate , such as poly ( ethylene - 1 , 4 - cyclohexanedimethylene terephthalate ) ( petg ), and the like , and combinations thereof , to improve notched - impact resistance . if necessary , a portion or all of the polyethylene terephthalate resin may be substituted by poly ( butylene terephthalate ) ( pbt ), poly ( cyclohexane terephthalate ) ( pct ), poly ( ethylene naphthalate ) ( pen ), and the like , as well as combinations thereof . in exemplary embodiments , the composition of the invention essentially consists of the pc , pmma , and pet resins as the base resin . for example , if pet is not present in the composition , desired scratch resistance of the composition can be obtained by increasing the content of pmma , but the flame retardancy is reduced due to the decomposition properties of pmma . in accordance with the invention , pet in the composition changes the decomposition path of pmma when the composition is burned to relatively easily obtain flame retardancy and produce a flame retardant resin with a conventional halogen free based flame retarding agent . furthermore , an impact modifier is optionally added to the resin composition so that the resin composition has improved impact strength and can be useful in any of the desired applications . the flame - retarding agent in accordance with the invention is typically a phosphorus - based flame - retarding agent , such as but not limited to an aromatic phosphoric ester - based compound . the aromatic phosphoric ester - based compound has a structure of the following formula 2 , but it should be understood that the scope of the invention is not limited to the aromatic phosphoric ester - based compound of formula 2 . wherein r 1 , r 2 , r 4 , and r 5 are each independently a c 6 - c 20 aryl group or a c 1 - c 20 alkyl - substituted c 6 - c 20 aryl group , r 3 is derived from a dialcohol , such as resorcinol , hydroquinol , bisphenol - a , bisphenol - s , and the like , and the value of n is in the range of 0 to 5 . when n is 0 , the phosphoric ester - based compound may include triphenylphosphate , tricresylphosphate , cresyldiphenylphosphate , trixylenylphosphate , tri ( 2 , 4 , 6 - trimethylphenyl ) phosphate , tri ( 2 , 4 - ditertiarybutylphenyl ) phosphate , tri ( 2 , 6 - ditertiarybutylphenyl ) phosphate , and the like , and combinations thereof . when n is 1 , the phosphoric ester compound may include resorcinol bis ( diphenylphosphate ), hydroquinol bis ( diphenylphosphate ), bisphenol - a - bis ( diphenylphosphate ), resorcinol bis ( 2 , 6 - ditertiarybutylphenylphosphate ), hydroquinol bis ( 2 , 6 - dimethylphenylphosphate ), and the like , and combinations thereof . when n is 2 or more , the phosphoric ester - based compound may exist as a mixture in the form of oligomer . the aforementioned compounds may be added to the base resin as a single or blended compound . the aromatic phosphoric ester - based compound may be partially or entirely substituted by any of other phosphorus containing compounds of different structures , such as red phosphorus , phosphonate , phosphinate , phosphagen , and the like , and combinations thereof . the aromatic phosphoric ester - based compound is added to the produced resin composition in accordance with the invention as a flame - retarding agent , and the amount may be in the range of about 5 to about 30 parts by weight based on 100 parts by weight of the base resin . an amount of the aromatic phosphoric ester - based compound less than about 5 parts by weight can make it difficult to attain the desired flame retardancy , and an amount of the aromatic phosphoric ester - based compound more than about 30 parts by weight can reduce mechanical strength and thermal resistance . an impact modifier in accordance with the invention may be added to the resin composition to enhance impact resistance . the impact modifier can include graft copolymers , olefin - based copolymers , and combinations thereof . the graft copolymers are obtained by polymerizing at least one rubber monomer selected from the group consisting of diene - based rubbers , acrylate - based rubbers , and silicone - based rubbers to form a rubber polymer , followed by grafting at least one monomer selected from the group consisting of graft - copolymerizable styrene , alpha - methyl styrene , alkyl - substituted styrene , acrylonitrile , methacrylonitrile , methylmethacrylate , maleic anhydride , alkyl or phenyl nucleus - substituted maleimide , and the like to the rubber polymer . the impact modifier can include the rubber in an amount of about 20 to about 80 parts by weight . exemplary diene - based rubbers include without limitation butadiene , isoprene , and the like , and combinations thereof . examples of the acrylate - based rubbers may include monomers , such as methylacrylate , ethylacrylate , n - propylacrylate , n - butylacrylate , 2 - ethylhexylacrylate , hexylmethylacrylate , 2 - ethylhexylmethylacrylate , and the like , and combinations thereof . the silicone - based rubbers may be made of cyclosiloxanes , for example , hexamethylcyclotrisiloxane , octamethylcyclotetrasiloxane , decamethylcyclopentasiloxane , dodecamethylcyclohexasiloxane , trimethyltriphenylcyclotrisiloxane , tetramethyltetraphenylcyclotetrasiloxane , octaphenylcyclotetrasiloxane , and the like , and combinations thereof . at least one of these cyclosiloxanes may be selected and used as the silicone - based rubber . additionally , it is possible to use ethylene / propylene rubbers , or polyolefin - based rubbers such as terpolymer of ethylene - propylene - diene ( epdm ), and the like , as well as combinations thereof . in accordance with the invention , although the impact modifier may be optionally added depending on the use of the resin composition , the amount of impact modifier can be present in the range of about 1 to about 30 parts by weight , based on 100 parts by weight of the base resin which comprises the aforementioned ( a ), ( b ) and ( c ) resins . in a method for manufacturing the thermoplastic resin composition of the present invention , at least one additive selected from the group consisting of anti - dripping agents such as polytetrafluoroethylene , oxidation inhibitors , plasticizers , heat stabilizers , light stabilizers , compatibilizers , pigments , dyes , inorganic fillers , and the like , as well as combinations thereof may be added to the resin composition depending on the respective application of the resin composition . examples of the inorganic fillers may include glass fiber , clay , silica , talc , ceramics , and the like , and combinations thereof . such additives can be present in the resin composition in an amount up to about 50 parts by weight , based on 100 parts by weight of the base resin . the resin composition may be produced using any of the known methods that can be used to produce resin compositions . for example , the resin composition may be prepared in the form of pellets by simultaneously blending the components of the composition of the present invention and other additives , followed by melt - extrusion using an extruder . the resin composition of the invention may be used in molding various products and is particularly useful in the production of components for electrical and electronic products , such as housings for tvs and office automation equipment . hereinafter , the present invention will be described in more detail with reference to the following examples . these examples are proposed to illustrate the present invention more specifically , and it will be apparent to those skilled in the art that the scope of the present invention is not limited to these examples . components of a base resin , a flame - retarding agent , and an impact modifier used for inventive examples and comparative examples are as follows . panlite l - 1225 grade available from teijin chemicals ltd . of japan is used as the pc resin . pmma ih 830 grade available from lg chemical ltd . of south korea is used as the pmma resin . sky green k2012 grade , which is a glycol - modified amorphous pet resin available from sk chemical co . of south korea , is used as the petg resin . px - 200 grade , which is resorcinol bis ( di - 2 , 6 - xylenylphosphate ) available from daihachi chemical industry co ., ltd . of japan , is used as the phosphoric ester - based compound in the inventive example and comparative examples . metablen c223 - a grade , which is available from mrc corporation and obtained by graft copolymerization of methylmethacrylate and styrene to a butadiene rubber , is used as the impact modifier . teflon ™ 7aj available from dupont co . of u . s . a . is used as the anti - dripping agent . resin compounds are produced in pellet shapes by blending materials ( a )-( d ) as described above in amounts listed in table 1 , followed by extruding the blended materials at temperatures in the range of 220 - 260 ° c . through a typical twin - screw extruder . pellets of each resin compound are dried at 80 ° c . for 3 hours , followed by injection - molding at a injection temperature of 250 ° c . and a mold temperature of 60 ° c . with 8 oz injection molding machine , thereby providing test specimens used for measuring impact resistance , flame retardancy , and pencil hardness . for the test specimens of the invention and comparative examples prepared as shown in the following table 1 , the flame retardancy is evaluated according to a flame retardancy regulation in ul 94v , and izod impact strength is evaluated according to astm d - 256 . the pencil hardness is evaluated using specimens of 10 cm by 10 cm which are maintained at a temperature of 23 ° c . and a relative humidity of 50 % for 48 hours according to jis k 5401 . scratch resistance is classified as 3b , 2b , b , hb , f , h , 2h , 3h , etc . based on the results of pencil hardness of the specimens . as can be seen from the following table , the higher the value of h , the higher the scratch resistance , whereas the higher the value of b , the lower the scratch resistance . the resin compositions of the inventive examples can maintain superior scratch resistance with a pencil hardness of f or more while exhibiting a flame retardancy of v0 , which is the highest degree of flame retardancy . in addition , by adding the mbs resin as an impact modifier to the resin composition , it is possible to obtain a resin composition having good impact strength . as compared with inventive example 2 , although comparative example 2 has the same amount of polycarbonate as that of inventive example 2 , comparative example 2 has a greater amount of pmma and does not contain pet , which is an essential component of the present invention . as a result , the flame retardancy of comparative example 2 is reduced and fails to pass vertical burning test under ul 94 due to the aforementioned amounts . on the contrary , as can be seen from table 1 , inventive example 2 contains pet and thus can ensure superior pencil hardness and flame retardancy . comparative example 5 does not contain the polycarbonate resin contributing to the improvement of flame retardancy and fails to attain the desired flame retardancy . in addition , as can be seen from table 1 , comparative examples 3 , 4 , 6 and 7 demonstrate poor scratch resistance when pmma is not present . many modifications and other embodiments of the invention will come to mind to one skilled in the art to which this invention pertains having the benefit of the teachings presented in the foregoing descriptions . therefore , it is to be understood that the invention is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims . although specific terms are employed herein , they are used in a generic and descriptive sense only and not for purposes of limitation , the scope of the invention being defined in the claims .	2
referring briefly to fig1 a and 1b , it will there be seen that prior art series x - polled bimorph 10 is excited on only one side of the element . in fig1 a , the reference numeral 10 denotes the bimorph when no voltage is applied thereto . a bimorph is made of two strips of conductors that expand longitudinally at different expansion rates when voltage is applied thereto . accordingly , conductors 12 and 14 share a common length when no voltage is applied thereto as depicted in fig1 a . in fig1 b , 200 volts is applied to prior art bimorph 10 . in this particular example , the expansion rate of conductor 14 exceeds that of conductor 12 so that the length of conductor 14 exceeds that of conductor 12 when voltage is applied to conductor 12 . bimorph 10 therefore becomes curved . the amount of curvature increases in direct relation to an increase in applied voltage . no voltage is applied to the central electrode in a series - polled bimorph . turning now to fig2 a and 2b , there it will be seen that this invention discloses the use of parallel polled bimorphs 20 in braille cell assemblies as distinguished from the prior art series polled bimorphs . the novel parallel polled bimorph design harnesses the power of bimorph technology by driving both sides of the piezo bender with a common voltage of the same polarity , as depicted diagrammatically in fig2 a and 2b , and by grounding the central conductor . novel bimorph 20 includes top plate 22 , bottom plate 24 , and internal or central conductor 26 . any applied voltage in the range from zero ( 0 ) to two hundred fifty ( 250 ) volts is within the scope of this invention . a novel virtual bimorph ground , established by grounding the center conductor , eliminates the prior art need for custom drive electronics to drive both positive and negative high voltage cells . moreover , the novel parallel polled bimorphs enable the provision of common electrical contact between top and bottom plates 22 and 24 , respectively . said top and bottom plates 22 , 24 are electrically isolated from one another as depicted in fig2 a and 2b , the top and bottom elements 22 , 24 of y - polled bimorph 20 are polarized in a common direction . this configuration enables busing the outer conductors and driving internal strip 26 . with this method , both top and bottom piezo elements 22 , 24 are properly biased so that they work together . a novel “ virtual ground ” is created at 100 v to enable the existing drive electronics to operate this superior piezo technology . other voltages for the establishment of the virtual ground are within the scope of the invention . the use of parallel bimorphs enables busing of piezo strips 22 and 24 . a simplified clip providing mechanical stability and electrical contact may therefore be used , without requiring special metallic plating . more particularly , the top and bottom plates are electrically isolated from one another by novel bimorph clip denoted 30 as a whole in fig3 . clip 30 includes top horizontal wall 32 and bottom horizontal wall 34 . top horizontal wall 32 is soldered to pcb 36 and has an arm that extends downwardly to linear contact area 32 a and upwardly therefrom . conversely , bottom horizontal wall 34 is also soldered to pcb 36 and has an arm that extends upwardly to linear contact area 34 a and downwardly therefrom . the space between contact area 32 a and 34 a is slightly less than the thickness of bimorph reed 20 . each arm is formed of an electrically conductive flexible and resilient material and said arms are inherently biased toward one another so that a bimorph reed 20 disposed in sandwiched relation therebetween is firmly engaged thereby . bimorph clip 30 , being integrally formed with pcb 36 , secured bimorph reed 20 to said pcb . the invention is not limited to the depicted design of clip 30 . a wide variety of other bimorph reed clip designs providing mechanical stability and electrical contact is within the scope of the invention . bimorph reed clip 30 is designed for the surface mount technology ( smt ) process to avoid manual placement of the part . the bimorph reed clip also is mechanically ideal for piezo alignment and vibration . the use of parallel polled bimorph reeds in combination with bimorph clip 30 eliminates the prior art need for sixteen ( 16 ) wires and thirty - two ( 32 ) hand - solder joints per braille cell assembly . the parallel polled bimorph reed design also results in an estimated fifty percent ( 50 %) power reduction by reducing the operating voltage and the mechanical resistance presented by the prior art construction . note that each bimorph actuator is mechanically held at its fulcrum by metal contacts on the pcb . these contacts also provide an electrical connection for biasing the bimorph actuator . this novel structure is an improvement over the above - mentioned prior art structures that hold the bimorph in a mechanical frame formed of non - conductive plastic and which require the soldering of sixteen ( 16 ) wires and thirty - two ( 32 ) hand - soldered connections per cell . the new cell eliminates all wires and thus all of the thirty two ( 32 ) hand - soldered connections . only the center conductor is soldered by hand in the novel design . this solder connection is completed in the constraints of alignment fixture to accurately control the position of the work end of the bimorph . bimorph clip 30 may be thought of as a split clip or an isolated clip because the contact on the top of the bimorph is electrically isolated from the contact on the bottom of the bimorph . in another embodiment of clip 30 , known as a common clip , net deemed currently suitable for use in a commercial embodiment of the invention , the top of the bimorph is mechanically and electrically connected to the bottom of the bimorph . although functional , the effects of long - term aging of the ceramic in the bimorph are unacceptable . in this common clip , both halves of the bimorph work in concert with one another but untested piezo material properties , specifically the aging effect of reverse - biasing the ceramic material , require further investigation . half the high voltage , or 100 volts , was applied to the center of the common clip . this center voltage , or bimorph virtual ground , enables the use of standard high voltage drive circuitry and a common clip . the common clip may become viable as advances are made in piezo - ceramic technology . the serviceability of each novel bimorph is maintained and improved over other designs . if an individual braille dot does not meet specification , that braille cell is removed and the bad bimorph removed by reflowing a single solder joint . tie replacement bimorph is then inserted into the braille cell pcb and aligned with the aid of a fixture . this avoids the problem in removing prior art bimorphs where individual bimorph removal is complicated by the attachment of two ( 2 ) wires to each bimorph . fig4 a depicts a braille cell assembly 40 mounted on top wall 44 of a chassis / backplane not depicted in this figure and fig4 b depicts a plurality of said braille cell assemblies mounted on said top wall . braille cell assembly 40 includes pcb 36 to which is soldered a plurality of novel bimorph clips 30 in vertically spaced relation to one another during standard smt processing . a bimorph reed 20 is then inserted between biased arms 32 , 34 of each clip 30 using an alignment jig . each center conductor 26 of each bimorph reed 20 is then soldered to pcb 36 . this process eliminates the need for sixteen ( 16 ) hand - soldered jumper wires . it also eliminates the prior art need for providing plating on bimorph reed 20 to enable said bimorph reed to accept solder . a plurality of pcb - receiving sockets 42 is mounted on top wall 44 in spaced relation to one another as depicted . a large number of braille cell assemblies 40 may therefore be mounted to said top wall as suggested by fig4 b . fig5 discloses the pin connections of braille device interface 50 . interface 50 defines the required connections to drive the display . this embodiment enables left or right side connections and further enables independent scanning of key switches without changing latched display data . fig6 a and 6b are perspective views of opposite sides of braille cell assembly 40 . the disclosure of these fig6 a and 6b is essentially the same as the disclosure of fig4 a and 4b but fig6 a and 6b make it clearer that clips 30 and bimorph reeds 20 are mounted on both sides of pcb 36 . note that there are four ( 4 ) bimorph reeds 20 mounted on each side of pcb 36 so that there are eight ( 8 ) bimorph reeds mounted on each pcb 36 . accordingly , it should be understood that each pcb is dedicated to a braille cell having eight ( 8 ) braille pins and each bimorph reed is dedicated to a braille pin of said braille cell . fig7 a is a top perspective view of chassis / backplane 60 and fig7 b is a bottom perspective view thereof . chassis / backplane 60 includes top wall 44 ( see fig4 a and 4b ) and bottom wall 46 . it also includes an angle wall 62 having a plurality of sets 64 of pinholes or bores 66 formed in a horizontal part 62 a thereof . horizontal part 62 a of angle wall 62 abuts a leading edge of top wall 44 and is coplanar therewith . each pinhole or bore 66 is adapted to slideably receive a pin , not depicted in fig7 a and 7b . note that there are eight ( 8 ) pinholes or bores 66 per set 64 of pinholes or bores . upstanding flat wall 68 abuts a trailing edge of top wall 44 and a trailing edge of bottom wall 46 . a plurality of slots 70 is formed in the lower edge of said flat wall 68 . each slot engages a protuberance 36 a formed in the trailing end of its associated pcb . a corresponding plurality of slots 72 is formed in top wall 44 to accommodate the respective leading ends of the pcbs . each set of slots 70 and 72 cooperate with one another to provide a mount for each pcb 36 . fig8 a depicts chassis / backplane 60 when a pcb 36 is mounted in each slot 70 and 72 . it also depicts a braille pin 80 disposed in each pinhole or bore 66 . one ( 1 ) bimorph reed 20 is associated with each pin 80 , there being one pcb 36 having eight ( 8 ) bimorph reeds mounted thereto associated with each set 64 of eight ( 8 ) pinholes or bores 66 as aforesaid . pins 80 are provided in four differing lengths as indicated in fig8 b . the pins may be manufactured individually , or they may be manufactured in connected - together groups of eight ( 8 ) that are separated from one another after assembly into the braille cell , thereby improving manufacturability . each pin 80 has a solid or hollow construction and includes four ( 4 ) parts that share a common longitudinal axis of symmetry . each of the four ( 4 ) parts may have a transverse cross - section of any predetermined geometrical configuration . a more detailed description of the pins is provided in u . s . patent application ser . no . 10 / 710 , 808 , filed aug . 4 , 2004 by the same inventors . that patent application is hereby incorporated by reference into this disclosure . the novel cell cap of this invention is depicted in fig9 a and 9b and is denoted as a whole by the reference numeral 90 . twenty ( 20 ) sets 92 of pinholes 94 are depicted , each pinhole being adapted to slidingly receive tip 80 d of pin 80 . this configuration is referred to as a “ double decade ” and represents one ( 1 ) module . unlike the aforementioned prior art braille cells that require one individual cap per set of pinholes , cell cap 90 is a monolithic cap for all sets of pinholes , i . e ., cell cap 90 enables one cap to cap a plurality of braille cells . cell cap 90 significantly reduces the tolerance issues associated with individual caps without compromising access to the individual braille cells if repair or replacement is required . cell cap 90 of the braille multi - cell module is smooth , lacking the grooves and unevenness between each cell ( character ) found in all existing braille displays on the market . this advantageous side - effect of a cost - reduction effort is one of the most significant features of the invention . to users , the tactility of the grooves and cell - to - cell unevenness of prior art braille displays is equivalent to the aggravation caused sighted people by the noise and flickering of a computer monitor . the paper - like smoothness of the novel braille display is a first in the electronically refreshable braille display industry . moreover , the monolithic cell cap provides better dimensional control of the braille electromechanical module when it is assembled in the final product . prior art cell caps produce a gap between the braille module and the opening in the braille display case . each gap is a result of the accumulation of dimensional tolerances on a per cell basis as distinguished from the novel single dimensional tolerance for a plurality of cells . the invention of the monolithic cell cap supplants the above - mentioned prior art approach that employs an extra frame to correctly space each cell at a centerline . this prior art approach is unsatisfactory because it further accentuates the unevenness of the display and provides additional area for contaminates . monolithic cell cap 90 can be constructed with anti - bacterial plastics or other suitable materials to inhibit the spread and growth of germs . in all embodiments , the braille pin of the assembly is captive in the mechanical design . it is secured between a top wall of the chassis / backplane 60 and cell providing a negative and a positive stop to the braille pin &# 39 ; s displacement , respectively . there is no dependency on the bimorph actuators hold the braille pins in place . there is no dependency on the bimorph actuators to hold the braille pins in place . this improves manufacturability and serviceability . this low cost part of the design ( frame top wall , cell cap , and pins ) eliminates the requirement to clean bio - contaminates on a regular basis , as it can now be considered a disposable item . the braille cell pcb that contains the expensive high voltage control circuitry , expensive bimorph actuators , and critical alignment is reused in a new , clean mechanical chassis / backplane during cleaning or refurbishment of the display . frame ( chassis / backplane ) bottom wall 46 is more fully depicted in fig1 . six ( 6 ) threaded inserts , collectively denoted 100 , are employed to attach the double decade assembly to the final oem product . frame bottom wall 46 is preferably constructed of a material that does not require additional isolation from the metal chassis to which it is mounted . slots 102 cooperate with slots 72 formed in frame top wall 44 to hold pcbs 36 . fig1 illustrates a set of buttons and a frame 110 for holding the buttons . each button has a head 112 that is enlarged with respect to its stem 114 . frame 110 has a comb - like construction where the contiguous teeth of the comb are spaced apart from one another by a space that slideably receives a stem 114 . the teeth of the comb thus support heads 112 . buttons 110 perform functions relating to cursor location and panning features . fig1 depicts the novel double decade braille cell assembly without the novel cell cap . note that there are two ( 2 ) button and frame assemblies 110 of the type depicted in fig1 and that said assemblies 110 are disposed in confronting relation to one another . fig1 depicts the double decade braille cell assembly with the novel cell cap 92 in its functional position . all pins are in their retracted position in this fig . the modularization provided by the novel design is a key to success in providing a low cost product that is economical to manufacture and easy to service . each of the braille cells can be individually installed or removed from service as a result of the backplane / chassis solution . the backplane / chassis provides the benefits of electrical interconnect , correct mechanical alignment , high voltage isolation , and a stable platform for additional circuitry such as tactile switches commonly used for routing the cursor to a specified cell location . any number of cells may be used in the modularization , and each module is interconnectable to another module . for commercial purposes , the minimum - sized module has been selected at twenty ( 20 ) cells , thereby enabling the selling of products including twenty ( 20 ) cells , forty ( 40 ) cells , sixty ( 60 ) cells , eighty ( 80 ) cells , and so on . other module sizes are within the scope of this invention . for example , production of a four ( 4 ) cell module would enable production of a forty four ( 44 ) cell braille display ( 20 + 20 + 4 ), a seventy - two cell braille display ( 20 + 20 + 20 + 4 + 4 + 4 ), an eighty four ( 84 ) cell braille display ( 20 + 20 + 20 + 20 + 4 ), and so on . the provision of the monolithic cell cap also produces an array of button caps over the tact switches . this array of button caps reduces labor costs . prior art braille dell manufacturers require each switch cap be individually installed . it will be seen that the advantages set forth above , and those made apparent from the foregoing description , are efficiently attained and since certain changes may be made in the above construction without departing from the scope of the invention , it is intended that all matters contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described , and all statements of the scope of the invention that , as a matter of language , might be said to fall therebetween . now that the invention has been described ,	6
there is illustrated in fig1 a first embodiment of a protection / isolation system 2 against infected or disease - bearing persons , according to the present invention . the system 2 is composed of a framework 4 , which advantageously , can be easily assembled and dismantled , e . g ., an assembly of rods 6 and suitable interengaging and interlocking joints 8 . the framework 4 is provided with members 10 for anchoring it to the ground , or floor , when provided . to the inside or outside of the framework 4 there is attached at least one pre - configured enclosure 12 made of flexible thin material , impermeable to bacteria , and / or viruses and / or germs . the enclosure 12 is attached to the framework 4 by any suitable means 14 , for example , simple tie strips , band loops or self - locking bands . care should be taken to keep the floor part flat , even under the influence of under - pressure . this can be achieved by making the floor of a heavier material than that of the walls . in the embodiment shown , there are formed two chambers , an isolation chamber 16 and an airlock chamber 18 , which are in communication via an entrance / exit slot 20 made in the material of the enclosure 12 . the interior of the airlock chamber 18 is accessed via closable slot 22 . the enclosure 12 is also provided with a closable opening 24 for entering bulky equipment into the chamber 16 . the chamber 16 is covered with a ceiling 26 having air inlet holes 28 for obtaining controlled , even distribution of air flowing therethrough . there are also provided above the ceiling 26 , air inlets 30 leading to chamber 16 and an air entry valve 32 leading to the airlock chamber 18 . air leaves the isolation chamber 16 through a sleeve 34 to a blower / filter unit 36 ( fig2 ). two service ports 38 , 40 are located adjacent the sleeve 34 . optionally , the system 2 is furnished with brackets 42 , facilitating connection to other , like systems , or to stationary structures . the system 2 shown in fig2 is similar to the system 2 of fig1 , except for the air flow passageway to airlock chamber 18 , which is different . here , air is sucked in through the air flow distribution ceiling 44 of the airlock chamber 18 , independent from the isolation chamber 16 . air from the airlock chamber 18 exits the airlock through hepa filter 46 and , a blower 48 sucking the air from the ceiling 44 through the airlock chamber 18 via the filter 46 to the outside . referring to fig3 , there is illustrated the system 2 according to the present invention , similar to system 2 of fig2 , however , according to this embodiment , the system does not depict the framework 4 . instead , the thin flexible enclosure 12 forming the chamber 16 and airlock chamber 18 , as well as other structural elements and units , are suspended and affixed via means 14 and brackets 42 to frameworks or stationary structures disposed within the enclosure or located adjacent thereto ( not shown ). turning now to fig4 and 5 , there are depicted details of the blower / filter 36 . seen is a noise and air directing cover 50 , a blower 52 , and a filter housing 54 having a pedestal 58 . inside the housing there is disposed the hepa filtering element 60 and a uv lamp 62 for radiating ultraviolet light . to the housing 54 there is attached a sleeve 64 having a removable cover 66 for storage purposes . a connector 68 facilitates quick connection between the sleeve 64 and housing 54 . further seen in fig4 is an electrical switch 70 and pressure drop gauge 72 , as well as an electrical power cord 74 . the system 2 for protecting and isolating infected or disease - bearing persons operates as follows : air from the outside is sucked into the isolation chamber 16 via air inlets 30 , passes through the chamber &# 39 ; s perforated ceiling 26 and uniformly flows from top to bottom in a laminar flow , without causing any turbulence , and is propelled out of the chamber through the blower / filter 36 which , in the process , destroys the bacteria by means of the uv radiation from the uv lamp 62 ( fig1 and 5 ). outside air can similarly enter airlock chamber 18 ( fig2 and 3 ) through its perforated ceiling 44 resulting from the suction action of blower 48 expelling filtered air after passing the filter 46 . hence , bacteria contaminated air which passes through the blower / filter 36 and a closely disposed ( e . g ., & lt ; 20 cm ) uv lamp , reduces or eliminates the potential risk of infection . instead of , or in addition to the bacteria destroying uv lamp , the surfaces of the filter may be treated with biocides , such as antibacterial chemical substances . preferably , the under - pressure which is formed and maintained in the chambers , should be higher than 10 pa . also satisfactory results are obtained when the airflow created in the airlock chamber is higher than 0 . 3 m / sec . in order to render the system more efficient , there may be provided a sensor , e . g ., a volume of movement sensor , indicating entrance of at least one person to the chambers and activating the system . referring now to fig6 , there is shown a further embodiment of the invention in which the entrance and exit to and from the isolation and airlock chambers are effected through single or double wing doors 76 , 78 , advantageously , swinging doors . also seen is a portable air - filtering unit 80 , which can easily be propelled into position after erection of the chambers 16 and 18 . as described hereinbefore , the isolation and airlock chambers should be kept under the influence of under - pressure . in order to more effectively achieve it , the bottom bars or rods of the framework 4 are structured as illustrated in fig7 a and 7b . seen in these figures are generally u - shaped rails 82 , partly accommodating compressible , elongated elements 84 , advantageously , tubular elements . in order to retain the elements 84 in place , the elements are wrapped around and held in place by a double layer of the flaps of the flexible material 12 from which the enclosure is made , e . g ., by providing at the bottom thereof tubular passages into which preformed elements 84 are inserted , or alternatively , by welding the bottom part around the elements 84 . as can be understood , in addition to the weight of the framework 4 , upon causing an under - pressure in the chambers , the rails 82 and elements 84 will be tightly pressed to the ground or floor to maintain the under - pressure inside the chambers . the compressible elements 84 will compensate for unevenness of the floor under the elements , to better seal the framework thereagainst . the enclosure 12 may be provided with elongated gloves , so as to facilitate treatment of patients from the outside , without having to enter the enclosure . it will be evident to those skilled in the art that the invention is not limited to the details of the foregoing illustrated embodiments and that the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof . the present embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims rather than by the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein .	8
referring now to the drawings , a wireless adapter 100 for a digital camera 10 is shown . the wireless adaptor 100 enables wireless communications between the digital camera 10 and remote devices or services , such as a home computer 30 , web album 32 , web blog 34 , or remote print server 36 over a wireless network . the wireless adapter 100 can be used with both digital still cameras and digital video cameras . the wireless adapter 100 detachably connects to the digital camera 10 and provides remote access capability to the digital camera 10 that otherwise lacks inherent wireless networking capabilities . fig1 shows an exemplary networking environment in which the wireless adapter 100 can be used . as will be described in greater detail below , the wireless adapter 100 can connect to a wireless wide area network ( wwan ) 20 , such as a cellular network or wimax network , or to a wireless local area network ( wlan ) 22 . the wlan 22 may comprise any local area network that can be accessed wirelessly , such as a home network with a wireless router . the wwan 20 and / or wlan 22 may provide connection to the internet 24 . a home computer 30 is connected to the wlan 22 . web album 32 , web blog 34 , and print server 36 are connected to the internet 24 . fig2 shows an exemplary wireless adaptor 100 . wireless adaptor 100 includes camera interface 102 , communication control circuit 104 , wireless interfaces 106 , 108 , and power control circuit 110 . camera interface 102 provides an interface to the digital camera 10 to enable communication between the wireless adapter 100 and digital camera 10 . communication control circuit 104 comprises processing circuits and memory for implementing file transfer agent functions and controlling the overall operation of the wireless adapter as herein after described . wireless interfaces 106 , 108 enable communication over wireless network , such as wwan 20 and wlan 22 . power control circuit 110 manages power to the wireless adapter 100 . power can be supplied by an internal battery ( not shown ) or an external power source via an optional connector 130 . camera interface 102 may comprise a serial or parallel interface , such as a universal serial bus ( usb ) interface , a firewire interface , etc . connector 128 connects the camera interface 102 with the digital camera 10 . in one exemplary embodiment , the camera interface 102 functions as a usb host device and the digital camera functions as a usb client device . power may be supplied by the digital camera 10 through the camera interface 102 . in one exemplary embodiment , wireless interface 106 enables long - range communication over a wwan 20 , while wireless interface 108 enables short - range wireless communication over wlan 22 . the wireless interface 106 may comprises a standard cellular transceiver , such as a gsm or cdma transceiver . alternatively , the wireless interface 106 may comprise a wimax transceiver or ofdm transceiver . wireless interface 108 may comprise , for example , a bluetooth , wifi , rfid , or nfc interface . the communication control circuit 104 includes a file transfer agent ( fta ) 105 to provide remote access capability . the file transfer agent 105 stores information about one or more remote destinations in memory of the wireless adapter 100 . such information may include the destination address for each destination and authentication information , such as the username and password for each destination . the file transfer agent 105 is configured to receive image data from the digital camera 10 and to transfer the image data to the remote destination via one of the wireless interfaces 106 , 108 . an optional configuration connector 132 can be provided for connecting the communication control circuit 104 to an external computer ( not shown ) to configure the wireless adaptor 100 . in one embodiment , the file transfer agent 105 emulates a printer as described in related application ser . no . 60 / 863 , 382 filed concurrently herewith and incorporated herein by reference . in this embodiment , file transfer agent 105 implements pictbridge or other direct printing technology to communicate directly with the digital camera 10 . the file transfer agent can create one or more emulated printers that appear to the digital camera 10 like any other printer . each emulated printer is associated with a particular remote destination . when the user “ prints ” to an emulated printer , the file transfer agent 105 transfers the image data to a corresponding remote destination . by emulating a printer , the file transfer agent 105 provides networking capabilities to any digital camera 10 that implements pictbridge or other direct printing technology . fig3 a and 3b illustrate a first exemplary method for connecting the wireless adapter 100 with the digital camera 10 . both mechanical connections and electrical connections are shown . mechanical connection is made by means of threaded connectors . the camera body 12 for the digital camera 10 includes a conventional tripod connector 14 with internal threads for mounting the digital camera 10 to a tripod ( not shown ). the wireless adapter body 120 includes a mounting screw 124 that threads into the tripod connector 14 on the camera body 12 . the mounting screw 124 on the wireless adapter body includes a finger grip 126 that can be accessed through a window 122 in the wireless adapter body 120 as shown in fig3 a . alternatively , the mounting screw 124 can pass through the wireless adapter body 120 as shown in fig3 b . electrical connection between the camera 10 and wireless adapter 100 is made by means of mating connectors . a female connector 16 is disposed on the camera body 12 and the male connector 128 is disposed on the wireless adapter body 120 . the spacing and relative orientation between the male connector 128 and the mounting screw 124 on the wireless adapter body 120 is the same as the spacing and relative orientation between the female connector 16 and the tripod connector 14 on the camera body 12 . fig4 a and 4b illustrate a second exemplary method of connecting the wireless adapter 100 with the digital camera 10 . the camera body 12 includes a tripod connector 14 as previously described on a bottom surface , and a female connector 16 along one side of the digital camera 10 . the wireless adapter 100 extends along two sides of the digital camera 10 . the wireless adapter 100 includes a mounting screw 124 and male connector 128 for connecting to the digital camera 10 as previously described . fig4 a shows an embodiment in which the mounting screw 124 is accessed through a window 122 in the wireless adapter body 120 . fig4 b shows an embodiment in which the mounting screw 124 passes through the wireless adapter body 120 . fig5 a and 5b illustrate a third method for connecting the wireless adapter 100 to the digital camera 10 . as in the two previous embodiments , the wireless adapter body 120 includes a mounting screw 124 adapted to engage with a tripod connector 14 on the camera body 12 . the mounting screw 124 may be accessed through a window 122 in the adapter body as shown in fig5 a , or may pass through the wireless adapter body 120 as shown in fig5 b . the electrical connection is made by means of a cable connector 136 having a male connector 128 at one end thereof that engages a female connector 16 on the camera body 12 . fig5 a and 5b illustrate a fixed cable . those skilled in the art will appreciate , however , that an additional connector ( not shown ) may be provided for disconnecting the cable connector 136 from the wireless adapter body . fig6 a and 6b illustrate a fourth method of connecting the wireless adapter 100 to the digital camera 10 . the wireless adapter body 120 includes a mounting screw 124 adapted to engage with a tripod connector 14 on the camera body 12 as previously described . the mounting screw 124 may be accessed through a window 122 in the adapter body as shown in fig6 a , or may pass through the wireless adapter body 120 as shown in fig6 b . the electrical connection is made by a short - range wireless interfaces 18 , 134 . short - range wireless interface 18 , 134 may comprise such a near - filed communication ( nfc ) interface , or bluetooth interface . fig7 a - 7c illustrate exemplary antenna arrangements for the wireless adapter 100 . as shown in fig7 a , the circuits in wireless adaptor 100 may be disposed in a bottom and / or side portion of the adaptor 100 . the wireless adapter 100 in the illustrated embodiment extends along two sides of the digital camera 10 . the bottom portion of the wireless adapter body 120 contains the mounting hardware and electrical circuits 102 - 110 for the wireless adapter 100 . the antenna 112 is contained within or mounts to the side portion of the wireless adapter body 120 . the side portion may , if desired , include part of the electrical circuitry 102 - 110 . the antenna 112 may be fixed in place as shown in fig7 a . alternatively , the antenna may slide between retracted and extended positions as shown in fig7 b . in another embodiment , shown in fig7 c , the antenna 112 is pivotally connected to the wireless adapter body 120 and pivots between retracted and extended positions . fig8 a - 8c illustrate an embodiment in which the wireless adapter 100 includes two antennas 112 and 114 . the two antennas 112 , 114 may be used for transmitting in different frequency bands or may be used to provide diversity . in fig8 a , the first antenna 112 is disposed on the side portion of the wireless adapter 100 as previously described , and a second antenna 114 is disposed on the bottom portion of the wireless adapter 100 . the antennas 112 , 114 may be fixed or movable . if movable , the antennas 112 , 114 may slide or pivot between retracted and extended positions . fig8 b illustrates an embodiment of the wireless adaptor having a fixed antenna 112 disposed on the side portion of the wireless adaptor 100 and a second movable antenna disposed on the bottom portion of the wireless adaptor 100 . the movable antenna 114 may slide between retracted and extended positions . fig8 c illustrates an embodiment of the wireless adapter 100 having two antennas 112 , 114 disposed on the side portion of the wireless adapter 100 . the first antenna 112 is a fixed antenna and the second antenna 114 is a movable antenna . the movable antenna 114 pivots between retracted and extended positions . fig9 a - 9d show embodiments of the wireless adapter 100 for a digital video camera 10 . the wireless adapter 100 in these embodiments is adapted to mount to a bottom surface of the digital video camera 10 . the wireless adapter 100 can be connected to the digital video camera 10 using the methods previously described and shown in fig3 - 6 . in fig9 a , the antenna 112 for the wireless adapter 100 is disposed toward a front end of the wireless adapter . fig9 b shows a slidable antenna 112 that slides between extended and retracted positions . fig9 c shows a pivoting antenna 112 that pivots between extended and retracted positions . fig9 d shows an embodiment of the wireless adapter 100 for a digital video camera 10 having two antennas 112 , 114 . a first antenna 112 is fixed at the front end of the wireless adapter 100 . a second antenna 114 is mounted for pivotal movement between extended and retracted positions . it will be appreciated that the second antenna 114 could also slide between extended and retracted positions . the present invention may , of course , be carried out in other ways than those specifically set forth herein without departing from essential characteristics of the invention . the present embodiments are to be considered in all respects as illustrative and not restrictive , and all changes coming within the meaning and equivalency range of the appended claims are intended to be embraced therein .	7
the present invention provides organoboron complexes and derivatives , including neutral tricoordinate boron derivatives , as well as methods of making the same , which act as lewis bases and undergoes one - electron oxidation into corresponding radical cations . the present invention also provides borylene ( h — b :) and borinylium ( h — b + .) complexes stabilized by two cyclic ( alkyl )( amino ) carbenes as well as methods of making the same . the present invention demonstrates that neutral tricoordinate organoboron , featuring boron in the + 1 oxidation state , can be oxidized to afford the corresponding stable radical cation , and also protonated to give the conjugate acid . the abbreviations used herein have their conventional meaning within the chemical and biological arts . where substituent groups are specified by their conventional chemical formulae , written from left to right , they equally encompass the chemically identical substituents that would result from writing the structure from right to left , e . g ., — ch 2 o — is equivalent to — och 2 —. as used herein , the term “ alkyl ” refers to a straight or branched , saturated , aliphatic radical having one to six carbon atoms , unless otherwise indicated ( e . g ., alkyl includes methyl , ethyl , propyl , isopropyl , butyl , sec - butyl , isobutyl , tert - butyl , and the like ). alkyl represented along with another radical ( e . g ., as in arylalkyl ; heteroarylalkyl ; cycloalkylalkyl ; or heterocycloalkylalkyl ) means a straight or branched , saturated aliphatic divalent radical having the number of atoms indicated ( e . g ., aralkyl includes benzyl , phenethyl , 1 - phenylethyl 3 - phenylpropyl , and the like ). it should be understood that any combination term using an “ alk ” or “ alkyl ” prefix refers to analogs according to the above definition of “ alkyl ”. for example , terms such as “ alkoxy ” “ alkylhio ” refer to alkyl groups linked to a second group via an oxygen or sulfur atom . as used herein , the term “ alkylene ” refers to either a straight chain or branched alkylene of 1 to 7 carbon atoms , i . e . a divalent hydrocarbon radical of 1 to 7 carbon atoms ; for instance , straight chain alkylene being the bivalent radical of formula —( ch 2 ) n —, where n is 1 , 2 , 3 , 4 , 5 , 6 or 7 . preferably alkylene represents straight chain alkylene of 1 to 4 carbon atoms , e . g . a methylene , ethylene , propylene or butylene chain , or the methylene , ethylene , propylene or butylene chain mono - substituted by c 1 - c 3 - alkyl ( preferably methyl ) or disubstituted on the same or different carbon atoms by c 1 - c 3 - alkyl ( preferably methyl ), the total number of carbon atoms being up to and including 7 . one of skill in the art will appreciate that a single carbon of the alkylene can be divalent , such as in —( hc ( ch 2 ) n ch 3 )—, wherein n = 0 - 5 . as used herein , the term “ alkoxy ” refers to a radical — or where r is an alkyl group as defined above e . g ., methoxy , ethoxy , and the like . as used herein , the term “ amino ” means the radical — nh 2 . unless indicated otherwise , the compounds of the invention containing amino moieties include protected derivatives thereof . suitable protecting groups for amino moieties include acetyl , tert - butoxycarbonyl , benzyloxycarbonyl , and the like . as used herein , the term “ aryl ” refers to a monocyclic or fused bicyclic , tricyclic or greater , aromatic ring assembly containing 6 to 16 ring carbon atoms . for example , aryl may be phenyl , benzyl or naphthyl , preferably phenyl . “ arylene ” means a divalent radical derived from an aryl group . aryl groups can be mono , di , or tri substituted by one , two or three radicals selected from alkyl , alkoxy , aryl , hydroxy , halogen , cyano , amino , amino alkyl , trifluoromethyl , alkylenedioxy and oxy c 2 - c 3 alkylene , or 1 or 2 naphthyl ; or 1 or 2 phenanthrenyl . as used herein , the term “ aralkyl ” means a radical -( alkylene )- r where r is aryl as defined above e . g ., benzyl , phenethyl , and the like . as used herein , the term “ cycloalkyl ” refers to a saturated or partially unsaturated , monocyclic , fused bicyclic or bridged polycyclic ring assembly containing from 3 to 12 ring atoms , or the number of atoms indicated . for example , c 3 - c 8 cycloalkyl includes cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl , and cyclooctyl . cycloalkyl also includes norbornyl and adamantyl . as used herein , the term “ cycloalkylalkyl ” means a radical -( alkylene )- r where r is cycloalkyl as defined above . as used herein , the term “ cyclic ( alkyl )( amino ) carbene ” refers to a carbene having a cycloalkyl group and an amino group bonded together , e . g ., the cyclic ( alkyl )( amino ) carbene may include the amino group may be in a straight chain or as a cyclic group such as a heterocyclic carbene or an n - heterocyclic carbene . example cyclic ( alkyl )( amino ) carbenes ( caacs ) are set forth in m . melaimi , m . soleilhavoup , g . bertrand , angew . chem . int . ed ., 49 , 8810 . ( 2010 )) as used herein , the terms “ halo ” or “ halogen ,” by themselves or as part of another substituent , mean , unless otherwise stated , a fluorine , chlorine , bromine , or iodine atom . as used herein , the terms “ heterocycloalkyl ” and “ heterocyclic ” refer to a ring system having from 3 ring members to about 20 ring members and from 1 to about 5 heteroatoms such as n , o and s . for example , heterocycle includes , but is not limited to , tetrahydrofuranyl , tetrahydrothiophenyl , morpholino , pyrrolidinyl , pyrrolinyl , imidazolidinyl , imidazolinyl , pyrazolidinyl , pyrazolinyl , piperazinyl , piperidinyl , indolinyl , quinuclidinyl and 1 , 4 - dioxa - 8 - aza - spiro [ 4 . 5 ] dec - 8 - yl . as used herein , the term “ heterocycloalkylalkyl ” means a radical -( alkylene )- r where r is heterocycloalkyl as defined above . as used herein , the term “ heteroaryl ” refers to a monocyclic or fused bicyclic or tricyclic aromatic ring assembly containing 5 to 16 ring atoms , where from 1 to 4 of the ring atoms are a heteroatom each n , o or s . for example , heteroaryl includes pyridyl , indolyl , indazolyl , quinoxalinyl , quinolinyl , isoquinolinyl , benzothienyl , benzofuranyl , furanyl , pyrrolyl , thiazolyl , benzothiazolyl , oxazolyl , isoxazolyl , triazolyl , tetrazolyl , pyrazolyl , imidazolyl , thienyl , or any other radicals substituted , especially mono or di substituted , by e . g . alkyl , nitro or halogen . pyridyl represents 2 , 3 , or 4 pyridyl , advantageously 2 or 3 pyridyl . thienyl represents 2 or 3 thienyl . quinolinyl represents preferably 2 , 3 , or 4 quinolinyl . isoquinolinyl represents preferably 1 , 3 , or 4 isoquinolinyl . benzopyranyl , benzothiopyranyl represents preferably 3 benzopyranyl or 3 benzothiopyranyl , respectively . thiazolyl represents preferably 2 or 4 thiazolyl , and most preferred , 4 thiazolyl . triazolyl is preferably 1 , 2 , or 5 ( 1 , 2 , 4 triazolyl ). tetrazolyl is preferably 5 tetrazolyl . as used herein , the term “ heteroaralkyl ” means a radical -( alkylene )- r where r is heteroaryl as defined above . preferably , heteroaryl is pyridyl , indolyl , quinolinyl , pyrrolyl , thiazolyl , isoxazolyl , triazolyl , tetrazolyl , pyrazolyl , imidazolyl , thienyl , furanyl , benzothiazolyl , benzofuranyl , isoquinolinyl , benzothienyl , oxazolyl , indazolyl , or any of the radicals substituted , especially mono or di substituted . substituents for the aryl and heteroaryl groups are varied and are selected from : halogen , or ′, oc ( o ) r ′, nr ′ r ″, sr ′, r ′, cn , no 2 , co 2 r ′, conr ′ r ″, c ( o ) r ′, oc ( o ) nr ′ r ″, nr ″ c ( o ) r ′, nr ″ c ( o ) 2 r ′, nr ′ c ( o ) nr ″ r ″′, nh c ( nh 2 )═ nh , nr ′ c ( nh 2 )═ nh , nh c ( nh 2 )═ nr ′, s ( o ) r ′, s ( o ) 2 r ′, s ( o ) 2 nr ′ r ″, n 3 , ch ( ph ) 2 , perfluoro ( c 1 - c 4 ) alkoxy , and perfluoro ( c 1 - c 4 ) alkyl , in a number ranging from zero to the total number of open valences on the aromatic ring system ; and where r ′, r ″ and r ′″ are independently selected from hydrogen , c 1 - c 8 alkyl and heteroalkyl , unsubstituted aryl and heteroaryl , ( unsubstituted aryl ) ( c 1 - c 4 ) alkyl , and ( unsubstituted aryl ) oxy ( c 1 - c 4 ) alkyl . as used herein , the term “ hydroxyl ” refers to the radical having the formula oh . each of the above terms ( e . g ., “ alkyl ,” “ heteroalkyl ,” “ aryl ” and “ heteroaryl ”), when indicated as “ substituted ” or “ optionally substituted ,” are meant to include both substituted and unsubstituted forms of the indicated radical . substituents for the alkyl and heteroalkyl radicals ( including those groups often referred to as alkylene , alkenyl , heteroalkylene , heteroalkenyl , alkynyl , cycloalkyl , heterocycloalkyl , cycloalkenyl , and heterocycloalkenyl ) can be one or more of a variety of groups selected from , but not limited to : — or ′, ═ o , ═ nr ′, ═ n — or ′, — nr ′ r ″, — sr ′, - halogen , — sir ′ r ″ r ′″, — oc ( o ) r ′, — c ( o ) r ′, — co 2 r ′, — conr ′ r ″, — oc ( o ) nr ′ r ″, — nr ″ c ( o ) r ′, — nr ′— c ( o ) nr ″ r ′″, — nr ″ c ( o ) 2 r ′, — nr — c ( nr ′ r ″ r ′″)═ nr ″, — nr — c ( nr ′ r ″)═ nr ′″, — s ( o ) r ′, — s ( o ) 2 r ′, — s ( o ) 2 nr ′ r ″, — nr ( so 2 ) r ′, — cn and — no 2 in a number ranging from zero to ( 2m ′+ 1 ), where m ′ is the total number of carbon atoms in such radical . r ′, r ″, r ′″ and r ′″ are each independently selected from hydrogen , c 1 - c 8 alkyl and heteroalkyl , unsubstituted aryl and heteroaryl , ( unsubstituted aryl )-( c 1 - c 4 ) alkyl , and ( unsubstituted aryl ) oxy -( c 1 - c 4 ) alkyl . when a compound of the invention includes more than one r group , for example , each of the r groups is independently selected as are each r ′, r ″, r ′″ and r ″″ groups when more than one of these groups is present . when r ′ and r ″ are attached to the same nitrogen atom , they can be combined with the nitrogen atom to form a 4 -, 5 -, 6 -, or 7 - membered ring . for example , — nr ′ r ″ is meant to include , but not be limited to , 1 - pyrrolidinyl and 4 - morpholinyl . from the above discussion of substituents , one of skill in the art will understand that the term “ substituted alkyl ” is meant to include groups including carbon atoms bound to groups other than hydrogen groups , such as haloalkyl ( e . g ., — cf 3 and — ch 2 cf 3 ) and acyl ( e . g ., — c ( o ) ch 3 , — c ( o ) cf 3 , — c ( o ) ch 2 och 3 , and the like ). as used herein , the term “ kc 8 ” refers to potassium graphite . as used herein , the term “ salt ” refers to acid or base salts of the compounds used in a method of the present invention . illustrative examples of acceptable salts are mineral acid ( hydrochloric acid , hydrobromic acid , phosphoric acid , and the like ) salts , organic acid ( acetic acid , propionic acid , glutamic acid , trifluoroacetic acid , trifluoromethanesulfonic acid , citric acid and the like ) salts , quaternary ammonium ( methyl iodide , ethyl iodide , and the like ) salts . as used herein , the term “ isomers ” refers to compounds having the same number and kind of atoms , and hence the same molecular weight , but differing in respect to the structural arrangement or configuration of the atoms . as used herein , the terms “ a ,” “ an ,” or “ a ( n )”, when used in reference to a group of substituents or “ substituent group ” herein , mean at least one . for example , where a compound is substituted with “ an ” alkyl or aryl , the compound is optionally substituted with at least one alkyl and / or at least one aryl , wherein each alkyl and / or aryl is optionally different . in another example , where a compound is substituted with “ a ” substituent group , the compound is substituted with at least one substituent group , wherein each substituent group is optionally different . description of compounds of the present invention are limited by principles of chemical bonding known to those skilled in the art . accordingly , where a group may be substituted by one or more of a number of substituents , such substitutions are selected so as to comply with principles of chemical bonding and to give compounds which are not inherently unstable and / or would be known to one of ordinary skill in the art as likely to be unstable under ambient conditions , such as aqueous , or neutral conditions . in one embodiment , the present invention provides a tricoordinate borylene complex , having the structure of formula i : in formula i , r 1 and r 2 are independently alkyl , aryl , arylalkyl , cycloalkyl , cycloalkylalkyl , heteroaryl , heteroarylalkyl , heterocycloalkyl , or heterocycloalkylalkyl . r 7 , r 8 , r 9 , and r 10 are independently hydrogen , alkyl , aryl , arylalkyl , cycloalkyl , cycloalkylalkyl , heteroaryl , heteroarylalkyl , heterocycloalkyl , or heterocycloalkylalkyl . at least one of r 7 and r 8 is other than hydrogen . at least one of r 9 and r 10 is other than hydrogen . r 3 , r 4 , r 5 , r 6 , r 11 , r 12 , r 13 , and r 14 are independently hydrogen , acyl , alkyl , alkoxy , amino , aryl , arylalkyl cyano , cycloalkyl , cycloalkylalkyl , halo , heteroaryl , heteroarylalkyl , heterocycloalkyl , heterocycloalkylalkyl , hydroxyl , or nitro . r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , r 7 , r 8 , r 9 , r 10 , r 11 , r 12 , r 13 , and r 14 are independently optionally substituted with 1 - 5 substituents selected from the group consisting of alkyl , alkoxy , amino , aryl , cycloalkyl , halo , heteroaryl , hydroxyl , and nitro . also included are the salts , hydrates , and isomers thereof . y 1 , y 2 , y 3 , and y 4 are independently aryl , arylalkyl , cycloalkyl , or cycloalkylalkyl . y 1 , y 2 , y 3 , and y 4 are independently optionally substituted with from 1 - 5 substituents selected from the group consisting of alkyl , aryl , halo , heteroaryl , and hydroxyl . in some embodiments , y 1 or y 2 is aryl or optionally both y 1 and y 2 are aryl . in some embodiments , y 1 or y 2 is 2 , 6 - diisopropyl - phenyl or optionally both y 1 and y 2 are 2 , 6 - diisopropyl - phenyl . in some other embodiments , y 3 or y 4 is cycloalkyl or optionally both y 3 and y 4 are cycloalkyl . in certain embodiments , y 3 or y 4 is cyclohexyl or optionally both y 3 and y 4 are cyclohexyl . r 15 , r 16 , r 17 , r 18 , r 19 , r 20 , r 21 , r 22 , r 23 , and r 24 are independently hydrogen , acyl , alkyl , alkoxy , amino , cyano , halo , or nitro . in some embodiments , r 15 , r 16 , r 20 , and r 24 are isopropyl . in some of these embodiments , y 3 and y 4 are cyclohexyl . in some other embodiments , the present invention provides a stable borinylium radical having the structure of formula ii : in formula ii , r 21 and r 22 are independently alkyl , aryl , arylalkyl , cycloalkyl , cycloalkylalkyl , heteroaryl , heteroarylalkyl , heterocycloalkyl , or heterocycloalkylalkyl . r 27 , r 28 , r 29 , and r 30 are independently hydrogen , alkyl , aryl , arylalkyl , cycloalkyl , cycloalkylalkyl , heteroaryl , heteroarylalkyl , heterocycloalkyl , or heterocycloalkylalkyl . at least one of r 27 and r 28 is other than hydrogen . at least one of r 29 and r 30 is other than hydrogen . r 23 , r 24 , r 25 , r 26 , r 31 , r 32 , r 33 , and r 34 are independently hydrogen , acyl , alkyl , alkoxy , amino , aryl , arylalkyl , cyano , cycloalkyl , cycloalkylalkyl , halo , heteroaryl , heteroarylalkyl , heterocycloalkyl , r 22 , r 23 , r 24 , r 25 , r 26 , r 27 , r 28 , r 29 , r 30 , r 31 , r 32 , heterocycloalkylalkyl , hydroxyl , or nitro . r 21 , r 33 , and r 34 are independently optionally substituted with 1 - 5 substituents selected from the group consisting of alkyl , alkoxy , amino , aryl , cycloalkyl , halo , heteroaryl , hydroxyl , and nitro . also included are the hydrates or isomers of formula ii . in certain embodiments , the gacl 4 − is substituted for another suitable anion . y 21 , y 22 , y 23 , and y 24 are independently aryl , arylalkyl , cycloalkyl , or cycloalkylalkyl . y 21 , y 22 , y 23 , and y 24 are independently optionally substituted with from 1 - 5 substituents selected from the group consisting of alkyl , aryl , halo , heteroaryl , and hydroxyl . r 45 , r 46 , r 47 , r 48 , r 49 , r 50 , r 51 , r 52 , r 53 , and r 54 are independently hydrogen , halo , acyl , alkyl , alkoxy , amino , cyano , or nitro . in certain embodiments , the present invention provides a boronium salt , having the structure of formula iii : in formula iii , r 61 and r 62 are independently alkyl , aryl , arylalkyl , cycloalkyl , cycloalkylalkyl , heteroaryl , heteroarylalkyl , heterocycloalkyl , or heterocycloalkylalkyl . r 67 , r 68 , r 69 , and r 70 are independently hydrogen , alkyl , aryl , arylalkyl , cycloalkyl , cycloalkylalkyl , heteroaryl , heteroarylalkyl , heterocycloalkyl , or heterocycloalkylalkyl . at least one of r 67 and r 68 is other than hydrogen . at least one of r 69 and r 70 is other than hydrogen . r 63 , r 64 , r 65 , r 66 , r 71 , r 72 , r 73 , and r 74 are independently hydrogen , acyl , alkyl , alkoxy , amino , aryl , arylalkyl , cyano , cycloalkyl , cycloalkylalkyl , halo , heteroaryl , heteroarylalkyl , heterocycloalkyl , heterocycloalkylalkyl , hydroxyl , or nitro . r 61 , r 62 , r 63 , r 64 , r 65 , r 66 , r 67 , r 68 , r 69 , r 70 , r 71 , r 72 , r 73 , and r 74 are independently optionally substituted with 1 - 5 substituents selected from the group consisting of alkyl , alkoxy , amino , aryl , cycloalkyl , halo , heteroaryl , hydroxyl , and nitro . also included are the hydrates and isomers of formula iii . in other embodiments , the cf 3 so 3 − is substituted for another suitable anion . y 31 , y 32 , y 33 , and y 34 are independently aryl , arylalkyl , cycloalkyl , or cycloalkylyl . y 31 , y 32 , y 33 , and y 34 are independently optionally substituted with from 1 - 5 substituents selected from the group consisting of alkyl , aryl , halo , heteroaryl , and hydroxyl . r 85 , r 86 , r 87 , r 88 , r 89 , r 90 , r 91 , r 92 , r 93 , and r 94 are independently selected from the group consisting of hydrogen , halo , acyl , alkyl , alkoxy , amino , cyano , and nitro . in other embodiments , the present invention provides a transition metal complex comprising a transition metal and a compound or complex of formulas i , ii , or iii . in some embodiments , a compound or complex of formulas i , ii , or iii is a tricoordinate boron , as set forth herein , wherein the boron is in the + 1 oxidative state and is isoelectronic with an amine . in other embodiments , the present invention provides a transition metal complex , wherein the tricoordinate boron is in the + 1 oxidative state and is substantially as provided in fig2 . in some embodiments , the present invention provides metal complexes , including at least one ligand selected from formulas i , ii , or iii that are useful as catalysts in a variety of organic reactions . one of skill in the art will appreciate that such complexes can employ a number of metals , including , but not limited to , transition metals , and have a variety of geometries ( e . g ., trigonal , square planar , trigonal bipyramidal and the like ) depending on the nature of the metal and its oxidation state and other factors including , for example , additional ligands . in some other embodiments , the present invention provides a coordination complex including a metal atom and at least one ligand selected from formulas i , ii , or iii . in some embodiments , the present invention provides a coordination complex including a metal atom and at least one ligand selected from formulas i , ii , or iii , wherein the metal atom is selected from li , na , k , rb , cs , be , mg , ca , sr , ba , ra , sc , y , la , ti , zr , hf , v , nb , ta , cr , mo , w , mn , tc , re , fe , ru , os , co , rh , ir , ni , pd , pt , cu , ag , au , zn , cd , hg , al , ga , in , tl , ge , sn , pb , sb , bi , or po . in some embodiments , the metal atom is selected from ir , pd , rh ru , or au . in some other embodiments , the coordination complex further includes at least one ligand selected from halide , pseudohalide , tetraphenylborate , perhalogenated tetraphenylborate , tetrahaloborate , hexahalophosphate , hexahaloantimonate , trihalomethanesulfonate , alkoxide , carboxylate , tetrahaloaluminate , tetracarbonylcobaltate , hexahaloferrate ( iii ), tetrahaloferrate ( iii ), tetrahalopalladate ( ii ), alkylsulfonate , arylsulfonate , perchlorate , cyanide , thiocyanate , cyanate , isocyanate , isothiocyanate , amines , imines , phosphines , phosphites , carbonyl compounds , alkenyl compounds , allyl compounds , carboxyl compounds , nitriles , alcohols , ethers , thiols or thioethers . in some embodiments , the coordination complex includes gold ; a complex having formulas i , ii , or iii ; and optionally a member selected from bent - allenes , phosphines , sulfonated phosphines , phosphites , phosphinites , phosphonites , arsines , stibines , ethers , ammonia , amines , amides , sulfoxides , carbonyls , nitrosyls , pyridines and thioethers . in general , any transition metal ( e . g ., a metal having d electrons ) can be used to form the complexes / catalysts of the present invention . for example , suitable transition metals are those selected from one of groups 3 - 12 of the periodic table or from the lanthanide series . preferably , the metal will be selected from groups 5 - 12 and even more preferably groups 7 - 11 . for example , suitable metals include platinum , palladium , iron , nickel , iridium , ruthenium and rhodium . the particular form of the metal to be used in the reaction is selected to provide , under the reaction conditions , metal centers which are coordinately unsaturated and not in their highest oxidation state . to further illustrate , suitable transition metal complexes and catalysts include soluble or insoluble complexes of platinum , palladium , iridium , iron , rhodium , ruthenium and nickel . palladium , rhodium , iridium , ruthenium and nickel are particularly preferred and palladium is most preferred . the transition metal complexes of the present invention can include additional ligands as required to obtain a stable complex . the additional ligands can be neutral ligands , anionic ligands and / or electron - donating ligands . the ligand can be added to the reaction mixture in the form of a metal complex , or added as a separate reagent relative to the addition of the metal . anionic ligands suitable as additional ligands are preferably halide , pseudohalide , tetraphenylborate , perhalogenated tetraphenylborate , tetrahaloborate , hexahalophosphate , hexahaloantimonate , trihalomethanesulfonate , alkoxide , carboxylate , tetrahaloaluminate , tetracarbonylcobaltate , hexahaloferrate ( iii ), tetrahaloferrate ( iii ) or / and tetrahalopalladate ( ii ). preferably , an anionic ligand is selected from halide , pseudohalide , tetraphenylborate , perfluorinated tetraphenylborate , tetrafluoroborate , hexafluorophosphate , hexafluoroantimonate , trifluoromethanesulfonate , alkoxide , carboxylate , tetrachloroaluminate , tetracarbonylcobaltate , hexafluoroferrate ( iii ), tetrachloroferrate ( iii ) or / and tetrachloropalladate ( ii ). preferred pseudohalides are cyanide , thiocyanate , cyanate , isocyanate and isothiocyanate . neutral or electron - donor ligands suitable as additional ligands can be , for example , amines , imines , phosphines , phosphites , carbonyl compounds , alkenyl compounds ( e . g ., allyl compounds ), carboxyl compounds , nitriles , alcohols , ethers , thiols or thioethers . still other suitable ligands can be carbene ligands such as the diaminocarbene ligands ( e . g ., n - heterocyclic carbenes ). while the present invention describes a variety of transition metal complexes useful in catalyzing organic reactions , one of skill in the art will appreciate that many of the complexes can be formed in situ . accordingly , ligands ( either carbene ligands or additional ligands ) can be added to a reaction solution as a separate compound , or can be complexed to the metal center to form a metal - ligand complex prior to its introduction into the reaction solution . the additional ligands are typically compounds added to the reaction solution which can bind to the catalytic metal center . in some preferred embodiments , the additional ligand is a chelating ligand . while the additional ligands can provide stability to the catalytic transition metal complex , they may also suppress unwanted side reactions as well as enhance the rate and efficiency of the desired processes . still further , in some embodiments , the additional ligands can prevent precipitation of the catalytic transition metal . although the present invention does not require the formation of a metal - additional ligand complex , such complexes have been shown to be consistent with the postulate that they are intermediates in these reactions and it has been observed the selection of the additional ligand has an affect on the course of the reaction . in related embodiments , the present invention provides metal complexes , of the type described above , in which the ligand having formula i , ii , or iii has a pendent functionalized side chain ( e . g ., aminoalkyl , mercaptoalkyl , acyloxyalkyl and the like ) in which the functional group acts as a ligand to provide a bidentate ligand feature . in still other embodiments , the ligand forms a metal complex with bidentate ligands that are not tethered to the cyclic carbene moiety . in some embodiments , the present invention provides a reaction mixture including a coordination complex including a metal atom and at least one ligand selected from a compound or complex having formula i , ii , or iii under conditions sufficient for catalysis to occur , a solvent and an olefin substrate , wherein said olefin substrate is selected to participate in an olefin metathesis reaction . in some other embodiments , the olefin substrate is selected as a substrate for ring closing metathesis . in some embodiments , the olefin substrate is selected as a substrate for ring opening polymerization metathesis . in some other embodiments , the olefin substrate is selected as a substrate for cross metathesis . in some embodiments , the olefin substrate is selected as a substrate for acyclic diene polymerization metathesis . v . catalytic reactions suitable for use with the compounds and complexes of the present invention as noted above , the compounds and complexes of the present invention are useful in catalyzing a variety of organic reactions . the compounds and complexes of the present invention include neutral tricoordinate boron derivatives , which act as a lewis base , and undergoes one - electron oxidation into the corresponding radical cation . accordingly , the compounds and complexes of the present invention are useful for catalyzing lewis base catalyzed reactions . the reactions of the present invention can be performed under a wide range of conditions , and the solvents and temperature ranges recited herein should not be considered limiting . in general , it is desirable for the reactions to be run using mild conditions which will not adversely affect the reactants , the catalyst , or the product . for example , the reaction temperature influences the speed of the reaction , as well as the stability of the reactants and catalyst . the reactions will typically be run at temperatures in the range of 25 ° c . to 300 ° c ., more preferably in the range 25 ° c . to 150 ° c . additionally , the reactions are generally carried out in a liquid reaction medium , but in some instances can be run without addition of solvent . for those reactions conducted in solvent , an inert solvent is preferred , particularly one in which the reaction ingredients , including the catalyst , are substantially soluble . suitable solvents include ethers such as diethyl ether , 1 , 2 - dimethoxyethane , diglyme , t - butyl methyl ether , tetrahydrofuran and the like ; halogenated solvents such as chloroform , dichloromethane , dichloroethane , chlorobenzene , and the like ; aliphatic or aromatic hydrocarbon solvents such as benzene , xylene , toluene , hexane , pentane and the like ; esters and ketones such as ethyl acetate , acetone , and 2 - butanone ; polar aprotic solvents such as acetonitrile , dimethylsulfoxide , dimethylformamide and the like ; or combinations of two or more solvents . in some embodiments , reactions utilizing the catalytic complexes of the present invention can be run in a biphasic mixture of solvents , in an emulsion or suspension , or in a lipid vesicle or bilayer . in certain embodiments , the catalyzed reactions can be run in the solid phase with one of the reactants tethered or anchored to a solid support . in certain embodiments it is preferable to perform the reactions under an inert atmosphere of a gas such as nitrogen or argon . the reaction processes of the present invention can be conducted in continuous , semi - continuous or batch fashion and may involve a liquid recycle operation as desired . the processes of this invention are preferably conducted in batch fashion . likewise , the manner or order of addition of the reaction ingredients , catalyst and solvent are also not generally critical to the success of the reaction , and may be accomplished in any conventional fashion . the reaction can be conducted in a single reaction zone or in a plurality of reaction zones , in series or in parallel or it may be conducted batchwise or continuously in an elongated tubular zone or series of such zones . the materials of construction employed should be inert to the starting materials during the reaction and the fabrication of the equipment should be able to withstand the reaction temperatures and pressures . means to introduce and / or adjust the quantity of starting materials or ingredients introduced batchwise or continuously into the reaction zone during the course of the reaction can be conveniently utilized in the processes especially to maintain the desired molar ratio of the starting materials . the reaction steps may be effected by the incremental addition of one of the starting materials to the other . also , the reaction steps can be combined by the joint addition of the starting materials to the metal catalyst . when complete conversion is not desired or not obtainable , the starting materials can be separated from the product and then recycled back into the reaction zone . the processes may be conducted in either glass lined , stainless steel or similar type reaction equipment . the reaction zone may be fitted with one or more internal and / or external heat exchanger ( s ) in order to control undue temperature fluctuations , or to prevent any possible “ runaway ” reaction temperatures . furthermore , one or more of the reactants can be immobilized or incorporated into a polymer or other insoluble matrix by , for example , derivativation with one or more of substituents of the aryl group . in order to be able to protect the boron center while still having space for coordination of two carbenes , caac 1 ( v . lavallo et al ., angew . chem . int . ed ., 44 , 5705 ( 2005 )), a ligand featuring a bulky 2 , 6 - diisopropylphenyl group at nitrogen and a flexible cyclohexyl moiety as the second carbene substituent was employed ( fig1 ). the first caac was installed classically ( y . wang et al ., j . am . chem . soc ., 129 , 12412 ( 2007 ); y . wang et al ., j . am . chem . soc ., 130 , 3298 ( 2008 ); p . bissinger et al ., angew . chem . int . ed ., 50 , 4704 ( 2011 )) by reaction of 1 with bbr 3 in hexane , which afforded the ( caac ) bbr 3 adduct 2 in 94 %. then , in order to observe the putative ( caac ) bh adduct by a second caac , a five - fold excess of potassium graphite was added to 1 / 1 mixture of boron adduct 2 and caac 1 in dry toluene . the reaction mixture was stirred at room temperature for 14 hours , and from a complex mixture of products , compound 3 was isolated as a red powder in only 8 % yield ( fig2 ). surprisingly , when the same experiment was carried out in the absence of caac 1 , the ( caac ) 2 bh adduct 3 was also formed , and isolated in 33 % yield . the 1 h - decoupled 11 b nmr spectrum of 3 demonstrates a broad signal at 12 . 5 ppm with a half - width of 216 hz . in the proton - coupled 11 b nmr spectrum , no clear splitting but a broadening of the signal with a half - width of 261 hz was observed . the presence of the hydrogen atom at boron was confirmed by an infrared absorption at 2455 cm − 1 ( fig5 ), which can be assigned to the b — h stretching mode . additional experiments demonstrated that the hydrogen atom is abstracted from an aryl group of a carbene . in some embodiments , the present invention provides a method of preparing a stable tricoordinate boron in the + 1 oxidative state by stabilizing a borylene center with a pair of carbene ligands . the method includes contacting a boron trihalide with a pair of carbene ligands in a hexane to form a solution . the method also includes warming the solution to room temperature with stirring for about 14 hours . the method also includes removing the solvent under vacuum to form a product i . further , the method includes contacting the product i with kc 8 in toluene with stirring for about 14 hours to form a product ii . the methods also includes filtering the kc 8 from the remainder of the product ii . the methods includes removing the solvent from the product ii , drying the product ii under vacuum , and washing the product ii with pentane to form a product iii . in other embodiments , the present invention provides a methods as set forth herein further including adding the product iii to toluene . the methods also includes contacting the product iii in toluene with gallium trichloride with stirring for about 14 hours . the methods further includes removing the volatiles under vacuum . the methods also include extracting the solid residue with acetonitrile . the methods includes removing the solvent under vacuum and drying the solid residue under vacuum . in some other embodiments , the present invention provides a methods as set forth herein further including contacting trifluoromethanesulfonic acid at room temperature in toluene with product iii with stirring for about 14 hours . the method also includes removing volatiles under vacuum . in any of the methods set forth herein , the contacting a boron trihalide with a pair of carbene ligands in a hexane may occur at − 78 ° c . in other embodiments , the boron trihalide is bbr 3 or bcl 3 . in still other embodiments , the boron trihalide is bbr 3 . in other embodiments , the pair of carbene ligands are independent of each other a cyclic ( alkyl )( amino ) carbene . in certain embodiments , the cyclic ( alkyl )( amino ) carbene has the following structure : in yet other embodiments , the present invention provides a tricoordinate boron complex prepared in accordance with any of the methods set forth herein . manipulations were performed under an atmosphere of dry argon using standard schlenk techniques . solvents were dried by standard methods and distilled under argon . 11 b , and 13 c nmr spectra were recorded on varian inova 500 and bruker 300 spectrometers at 25 ° c . nmr multiplicities are abbreviated as follows : s = singlet , d = doublet , t = triplet , sept = septet , m = multiplet , br = broad signal . melting points were measured with a buchi melting point apparatus system . epr spectra were recorded on bruker emx at 298 k . single crystals suitable for an x - ray diffraction study were obtained by recrystallization from a dry tetrahydrofuran solution at room temperature . in the solid state ( fig3 , left ), the carbene carbons c1 and c2 , boron , and the hydrogen h1 are in a perfectly planar arrangement ( sum of the bond angles at b : 359 . 94 ). the b1 - c1 [ 1 . 5175 ( 15 ) å ] and b1 - c2 [ 1 . 5165 ( 15 ) å ] bond distances are equal and are halfway between typical b — c single ( 1 . 59 å ) and double ( 1 . 44 å ) bonds ( m . m . olmstead , p . p . power , k . j . weese , j . am . chem . soc ., 109 , 2541 ( 1987 )), suggesting the delocalization of the lone pair of electrons at boron to the empty p - orbitals of the carbene centers . ab initio calculations performed on 3 at the bp86 / def2 - svp level of theory support this bonding analysis . the carbene → bh donation occurs from the a lone pairs of carbene ligands into the empty in - plane molecular orbital at boron , affording two low - lying orbitals . the homo of 3 (− 3 . 34 ev ) is essentially an electron lone pair in the p ( n )- orbital of boron , which mixes in a bonding fashion with the p ( π ) atomic orbital of the two carbene carbons ( fig4 , left ). the charge exchange via a donation and π backdonation leaves the bh moiety in 3 with a partial charge of + 0 . 05 e . for comparison , the bh fragment in ( ch 3 ) 2 bh , which has two b — c electron - sharing bonds , carries a positive charge of + 0 . 61 e . therefore , the zwitterionic form 3b , featuring a dianionic boron center ( j . monot et al ., angew . chem . int . ed ., 49 , 9166 ( 2010 )), is a far weaker resonance contributor than 3a , which shows the parent borylene coordinated by two carbene ligands . a single crystal x - ray diffraction study showed that the boron center of [ 3 + . ] gacl 4 − is in a perfectly planar arrangement , as observed for its precursor 3 ( fig3 , center ). however , the boron - carbon and carbon - nitrogen bond distances are longer and shorter , respectively , than those of 3 , in line with the weaker electron - donation from boron to the carbene ligand . compound [ 3 + . ] gacl 4 − is one of very few crystallographically characterized boron radicals ( m . m . olmstead , p . p . power , j . am . chem . soc ., 108 , 4235 ( 1986 )) and molecules featuring boron in the formal + 2 oxidation state ( r . dinda et al ., angew . chem . int . ed ., 46 , 9110 ( 2007 )). the boron in compound 3 is in the formal oxidation state + 1 and is electron - rich . this was confirmed by the cyclic voltammogram ( fig6 ) of a thf solution of 3 [ 0 . 1 m nbu 4 npf 6 electrolyte ], which shows a reversible one - electron oxidation at e 1 / 2 =− 0 . 940 v versus fc +/ fc [ fc : ferrocene ]. indeed , addition at room temperature of two equivalents of gallium trichloride to a toluene solution of 3 quantitatively afforded the radical cation [ 3 + . ] gacl 4 − . the room temperature electron paramagnetic resonance spectrum in thf solution displays a complex system ( g = 2 . 0026 ) due to the couplings with the boron [ a ( 11 b )= 6 . 432 g ], hydrogen [ a ( 1 h )= 11 . 447 g ], and two nitrogen nuclei [ a ( 14 n )= 4 . 470 g ] ( fig7 ). the values of spin couplings with the 11 b and 1 h nuclei are similar to those observed in the persistent ( nhc ) bh 2 radical , whereas the coupling constant with the 14 n nuclei is greater than those in the nhc adducts ( t . matsumoto , f . p . gabbaï , organometallics , 28 , 4252 ( 2009 ); j . c . walton et al ., j . am . chem . soc ., 132 , 2350 ( 2010 )), in line with the higher electron - acceptor ability of caacs versus nhcs . calculations using the natural bond orbital ( nbo ) method , confirmed that the spin density is mainly located at boron ( 0 . 50 e ) with some contributions of the nitrogen atoms ( 0 . 16 e and 0 . 17 e ). the singly occupied molecular orbital ( somo ) (− 7 . 30 ev ) is essentially the boron p - orbital , weakly mixing with the p ( n ) atomic orbital of the two carbene carbons ( fig4 , right ). because of the presence of a lone pair of electrons at boron , bis ( carbene ) bh adduct 3 can react with electrophiles , which is quite unusual for tricoordinate boron compounds ( y . segawa , m . yamashita , k . nozaki , science , 314 , 113 ( 2006 ); t . b . marder , science , 314 , 69 ( 2006 ); h . braunschweig , angew . chem . int . ed ., 46 , 1946 ( 2007 ); k . nozaki , nature , 464 , 1136 ( 2010 ); m . s . cheung , t . b . marder , z . lin , organometallics , doi : 10 . 1021 / om200115y ; h . braunschweig et al ., angew . chem . int . ed ., 49 , 2041 ( 2010 )). no reactions of 3 were observed with trimethylsilyl - or methyl - trifluoromethanesulfonate even after heating at 80 ° c . for 14 hours , probably due to the presence of the two bulky caac ligands , which shield the boron center . to probe basicity further , an equimolar amount of trifluoromethane sulfonic acid was added to a toluene solution of compound 3 at room temperature , and after work up , the conjugate acid [ 3h + ] cf 3 so 3 − was isolated in 89 % yield . the proton - coupled 11 b nmr spectrum of this salt shows a triplet ( j bh = 83 . 5 hz ) at − 21 . 8 ppm , confirming the presence of two hydrogen atoms directly bonded to boron , and thus the boronium nature ( w . e . piers , s . c . bourke , k . d . conroy , angew . chem . int . ed ., 44 , 5016 ( 2005 )) of [ 3h + ] cf 3 so 3 − . the solid state structure confirmed the tetracoordination of boron . the boron - carbon and carbon - nitrogen bond distances are in the range of single and double bonds , respectively , in line with the absence of back - donation from boron to the carbene ligand . to quantify the basicity of 3 , the gas phase proton affinity was calculated ( bp86 / def2 - svp + zpe ): the 1108 kj / mol value is much higher than that calculated for the free bh ( 856 kj / mol ), and comparable to the unsaturated free n - phenyl substituted nhc ( 1107 kj / mol ) ( r . tonner , g . heydenrych , g . frenking , chem . phys . chem ., 9 , 1474 ( 2008 )). in toluene solution , we found that 3 is readily protonated by brch 2 co 2 h , whereas the reaction with phco 2 h proceeded very slowly , and only trace amounts of [ 3h + ] phco 2 − were detected after 14 hours . boronium [ 3h + ] cf 3 so 3 − is rapidly deprotonated by sodium ethoxide in a thf solution giving back 3 in 68 % yield , though no reaction was observed with strong but bulky bases such as potassium hexamethyldisilazide , lithium diisopropylamide , or t - butyllithium , confirming the steric shielding of the boron center ( unsuccessful attempts to deprotonate bis ( phosphine ) bhx adducts ( x : h , br ) were reported by m . sigl , a . schier , h . schmidbaur , chem . ber ., 130 , 1411 ( 1997 )). although the parent borylene adduct 3 and the radical cation [ 3 + . ] gacl 4 − are sensitive to air , they are stable at room temperature under argon both in solution and in the solid state for two months at least ( m . p . 3 : 328 ° c . ; [ 3 + . ] gacl 4 − : 278 ° c . ), which strikingly demonstrates the stabilizing efficiency of caacs . in marked contrast to the well - known tricoordinate boron (+ 3 ) derivatives , compound 3 , featuring a boron in the + 1 oxidation state , behaves as a lewis base , and can readily be oxidized . its reactivity with electrophiles is hampered by the bulkiness of the caac ligands , but the steric and electronic properties of carbenes can be substantially modulated . compounds of type 3 are isoelectronic with amines and phosphines , and because of the lower electronegativity of boron , compared to those of nitrogen and phosphorus , they are potential strong electron - donor ligands for transition metals . boron tribromide ( 5 . 00 g , 20 . 0 mmol ) was added at − 78 ° c . to a hexane solution ( 200 ml ) of caac 1 ( 6 . 50 g , 20 . 0 mmol ). the reaction mixture was warmed to room temperature and stirred for 14 hours . after the solvent was removed under vacuum , the resulting white solid was washed with pentane , and dried under vacuum to give 2 as a white powder ( 10 . 80 g , 94 % yield ). 1 h nmr ( 300 mhz , cdcl 3 ): δ = 7 . 43 ( t , 3 j = 7 . 8 hz , 1h , p - ch ), 7 . 25 ( d , 3 j = 7 . 0 hz , 4h , m - ch ), 3 . 32 - 3 . 16 ( m , 2h , ch 2 ), 2 . 80 ( sept , 3 j = 6 . 5 hz , 2h , ch ( ch 3 ) 2 ), 2 . 32 ( s , 2h , ch 2 ), 1 . 98 - 1 . 60 ( m , 8h , ch 2 ), 1 . 47 ( s , 6h , ch 3 ), 1 . 41 ( d , 3 j = 6 . 5 hz , 6h , ch ( ch 3 ) 2 ), 1 . 30 ( d , 3 j = 6 . 5 hz , 6h , ch ( ch 3 ) 2 ); 13 c nmr ( 75 mhz , cdcl 3 ): δ = 145 . 8 ( o ), 130 . 4 ( p ), 125 . 6 ( m ), 125 . 2 ( ipso ), 80 . 9 ( c q ), 61 . 3 ( c q ), 45 . 2 ( ch 2 ), 36 . 9 ( ch 2 ), 29 . 7 ( ch 3 ), 29 . 5 ( ch ), 26 . 5 ( ch 3 ), 25 . 2 ( ch 3 ), 24 . 7 ( ch 2 ), 23 . 1 ( ch 2 ); 11 b nmr ( 96 mhz , cdcl 3 ): δ =− 13 . 5 . toluene ( 20 ml ) was added at room temperature to a mixture of 2 ( 1 . 00 g , 1 . 74 mmol ) and potassium graphite ( 1 . 17 g , 8 . 68 mmol ). after stirring for 14 hours , toluene ( 75 ml ) was added to the mixture , and then graphite and kbr were filtered off . after the solvent was removed under vacuum , the solid residue was washed with pentane ( 100 ml ), and dried under vacuum to afford 3 as a red powder ( 185 mg , 33 % yield ). single crystals of 3 were obtained by recrystallization from a thf solution at room temperature . mp : 328 ° c . ( dec . ); ir ( solid , cm − 1 ) v max 2455 ( b — h ), 1 h nmr ( 500 mhz , toluene - d 8 ): δ = 7 . 07 - 6 . 92 ( m , 6h , m - ch and p - ch ), 3 . 34 - 3 . 26 ( m , 2h , ch 2 ), 3 . 09 ( sept , 3 j = 8 . 3 hz , 2h , ch ( ch 3 ) 2 ), 2 . 75 ( sept , 3 j = 8 . 3 hz , 2h , ch ( ch 3 ) 2 ), 2 . 60 - 2 . 53 ( m , 2h , ch 2 ), 2 . 13 ( s , 2h , ch 2 ), 2 . 12 ( s , 2h , ch 2 ), 1 . 87 - 1 . 54 ( m , 16h , ch 2 ), 1 . 30 ( d , 3 j = 8 . 3 hz , 6h , ch ( ch 3 ) 2 ), 1 . 27 ( d , 3 j = 8 . 3 hz , 6h , ch ( ch 3 ) 2 ), 1 . 19 ( d , 3 j = 8 . 3 hz , 6h , ch ( ch 3 ) 2 ), 1 . 01 ( s , 6h , ch 3 ), 0 . 99 ( s , 6h , ch 3 ), 0 . 23 ( d , 3 j = 8 . 3 hz , 6h , ch ( ch 3 ) 2 ); attempts to observe the bh signal by 2d 11 b - 1 h nmr both in solution and in solid state failed , possibly because of the large quadripolar moment of boron ; 13 c nmr ( 125 mhz , thf - d s ): δ = 149 . 3 ( o ), 147 . 9 ( o ), 138 . 3 ( ipso ), 127 . 2 ( p ), 125 . 6 ( m ), 124 . 4 ( m ), 68 . 0 ( c q ), 51 . 8 ( c q ), 43 . 2 ( ch 2 ), 36 . 4 ( ch 2 ), 31 . 7 ( ch 2 ), 30 . 0 ( ch 3 ), 29 . 5 ( ch ), 29 . 0 ( ch 3 ), 28 . 2 ( ch ), 27 . 0 ( ch 3 ), 25 . 4 ( ch 3 ), 24 . 6 ( ch 3 ), 24 . 4 ( ch 3 ), 24 . 2 ( ch 2 × 2 ), 24 . 0 ( ch 2 ); 11 b nmr ( 96 mhz , toluene - d 8 ): δ = 12 . 5 ( h 1 / 2 = 216 hz ). erms ( esi ): 662 . 5708 [( m ) + , 662 . 5713 ( c 46 h 71 bn 2 )]. toluene ( 6 ml ) was added at room temperature to a mixture of 3 ( 150 mg , 0 . 23 mmol ) and gallium trichloride ( 81 mg , 0 . 46 mmol ). after stirring for 14 hours , volatiles were removed under vacuum . the solid residue was extracted with acetonitrile ( 10 ml ), then the solvent was removed under vacuum , and the solid residue dried under vacuum to afford [ 3 + . ] gacl 4 − as a purple powder ( 177 mg , 88 % yield ). single crystals of [ 3 + . ] gacl 4 − were obtained by recrystallization from a mixture of thf and toluene ( 4 : 1 ) solution at room temperature . mp : 278 ° c . ( dec .). hrms ( esi ): 662 . 5734 [( m ) + , 662 . 5713 ( c 46 h 71 bn 2 )] synthesis of boronium [ 3h + ] cf 3 so 3 − . trifluoromethanesulfonic acid ( 45 mg , 0 . 30 mmol ) was added at room temperature to a toluene ( 12 ml ) solution of 3 ( 200 mg , 0 . 30 mmol ). after stirring for 14 hours , volatiles were removed under vacuum to afford [ 3h + ] cf 3 so 3 − as a purple powder ( 217 mg , 89 % yield ). single crystals of [ 3h + ] cf 3 so 3 − were obtained by recrystallization from a thf solution at room temperature . [ 3h + ] cf 3 so 3 − decomposes at 246 ° c . without melting ; 1 h nmr ( 500 mhz , cd 3 cn ): δ = 7 . 07 - 7 . 03 ( m , 4h , m - ch ), 6 . 89 - 6 . 87 ( m , 2h , p - ch ), 2 . 83 - 2 . 77 ( m , 2h , ch 2 ), 2 . 40 ( sept , 3 j = 8 . 3 hz , 2h , ch ( ch 3 ) 2 ), 2 . 36 ( s , 2h , chh ), 1 . 98 - 1 . 91 ( m , 2h , ch 2 ), 2 . 00 ( s , 2h , chh ), 1 . 99 - 1 . 91 ( m , 2h , ch 2 ), 1 . 86 ( sept , 3 j = 8 . 3 hz , 2h , ch ( ch 3 ) 2 ), 1 . 77 - 1 . 41 ( m , 16h , ch 2 ), 1 . 18 ( s , 6h , ch 3 ), 1 . 07 ( d , 3 j = 8 . 3 hz , 6h , ch ( ch 3 ) 2 ), 0 . 91 ( d , 3 j = 8 . 3 hz , 6h , ch ( ch 3 ) 2 ), 0 . 87 ( s , 6h , ch3 ), − 0 . 11 ( d , 3 j = 8 . 3 hz , 6h , ch ( ch 3 ) 2 ), bh was not found ; 13 c nmr ( 125 mhz , cd 3 cn ): δ = 145 . 9 ( o ), 143 . 7 ( o ), 133 . 9 ( ipso ), 130 . 3 ( p ), 126 . 69 ( m ), 126 . 66 ( m ), 79 . 9 ( c q ), 58 . 1 ( c q ), 47 . 3 ( ch 2 ), 36 . 6 ( ch 2 ), 31 . 7 ( ch 2 ), 30 . 4 ( ch 3 ), 30 . 0 ( ch ), 29 . 9 ( ch 3 ), 29 . 5 ( ch ), 27 . 4 ( ch 3 ), 26 . 3 ( ch 3 ), 24 . 6 ( ch 3 ), 24 . 4 ( ch 3 ), 24 . 2 ( ch 2 ), 22 . 4 ( ch 2 ), 22 . 2 ( ch 2 ); 11 b nmr ( 96 mhz , thf - d g ): δ =− 21 . 8 ( t , 1 j bh = 83 . 5 hz , bh 2 ); 19 f nmr ( 282 mhz , cd 3 cn ) δ =− 80 . 9 ; hrms ( esi ): 663 . 5791 [( m + h ) + , 663 . 5791 ( c 46 h 72 bn 2 )]. deprotonation of boronium [ 3h + ] cf 3 so 3 − with naoet . thf ( 8 ml ) was added at room temperature to a mixture of [ 3h + ] cf 3 so 3 − ( 100 mg , 0 . 12 mmol ) and sodium ethoxide ( 10 mg , 0 . 15 mmol ). after stirring for 14 hours , volatiles were removed under vacuum , and then toluene ( 12 ml ) was added to the residue . naotf was filtered off , the solvent was removed under vacuum , and the solid residue dried under vacuum to afford 3 ( 54 mg , 68 % yield ). the bruker x8 - apex x - ray diffreaction instrument with mo - radiation was used for data collection of compounds 3 , [ 3 + . ] gacl 4 − , and [ 3h + ] cf 3 so 3 − . all data frames were collected at low temperatures ( t = 95 and 100 k ) using an ω , φ - scan mode ( 0 . 3 ° ( ω - scan width , hemisphere of reflections ) and integrated using a bruker saintplus software package . the intensity data were corrected for lorentzian polarization . absorption corrections were performed using the sadabs program . the sir97 was used for direct methods of phase determination , and bruker shelxtl software package for structure refinement and difference fourier maps . atomic coordinates , isotropic and anisotropic displacement parameters of all the non - hydrogen atoms of three compounds were refined by means of a full matrix least - squares procedure on f 2 . all h - atoms were included in the refinement in calculated positions riding on the c atoms , with u [ iso ] fixed at 20 % higher than isotropic parameters of carbons atoms which they were attached . drawings of molecules were performed using ortep 3 and povray for windows . metrical data for the solid state structure of 3 , [ 3 + . ] gacl 4 − , and [ 3h + ] cf 3 so 3 − are available free of charge from the cambridge crystallographic data centre under reference numbers ccdc - 822247 , ccdc - 822248 , and ccdc - 822249 , respectively . fig8 below shows schematically the bonding situation in ( bh )( caac ) 2 3 . the carbine → bh donation occurs from the σ lone pair of the carbene ligands into the empty in - plane sp and p molecular orbitals at boron . the totally symmetric (+) combination of the r lone pairs donates charge into the empty sp ( σ ) orbital of bh , while the antisymmetric (+ −) combination donates charge into the vacant in - plane p ( π ) molecular orbital of boron . thus , the electronic reference state of the bh fragment in ( caac ) 2 bh 3 is not the x 1 σ + ground state as in the free borylene bh , which has a doubly occupied sp (∝) orbital , but it is the excited c 1 δ state with a p ( π ) lone - pair ( 39 ). the ( caac )→( bh )←( caac ) σ donation is complemented by π backdonation from the p ( π ) lone - pair orbital of bh , which mixes in a bonding fashion with the p ( π ) atomic orbital of the two carbene carbons , yielding the energetically high - lying homo of 3 (− 3 . 34 ev ). the boron - carbon bonds in 3 are rather strong . the calculations at bp86 / def2 - svp predict a bond dissociation energy ( bde ) for the reaction 3 →( x 1 σ + ) bh + 2 caac a value of d o = 665 kj / mol which gives a mean bde of d o = 332 . 5 kj / mol for each c → b donor - acceptor bond . this may be compared with the calculated bde for the carbon - boron bond in the complex nhc ( bh 3 ) which is only d o = 245 kj / mol . although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding , one of skill in the art will appreciate that certain changes and modifications may be practiced within the scope of the appended claims . in addition , each reference provided herein is incorporated by reference in its entirety to the same extent as if each reference was individually incorporated by reference . where a conflict exists between the instant application and a reference provided herein , the instant application shall dominate .	2
the disclosed embodiments provide a micro - fluidic device capable of fractionating a complex mixture of analytes , such as peptides or proteins , within a separation chamber zone according to their isoelectric points . the fractionated mixture is recovered as discrete fractions uniformly ejected from the separation chamber zone perpendicular to a direction in which the analytes move during fractionation , herein referred to as a “ direction of separation .” this is enabled at least in part by including one or more flow path deflector elements situated proximate an inlet port and further being situated in such a way as to be between the inlet port and a plurality of outlet ports . for instance , the one or more flow path deflector elements can block a shortest path between the inlet port and at least one of the plurality of outlet ports . upon the sample impacting the one or more flow path deflector elements , the sample can be redirected in a particular manner , such as a predetermined manner that enables the sample to flow in such a way that is substantially absent any lateral intermixing ( e . g ., of fractionated analyte groups , once separation has occurred ). in yet further embodiments , the one or more flow path deflector elements can block a shortest path between the inlet port and all of the plurality of outlet ports . the outlet ports can be preceded by ( e . g ., can be downstream of ) a plurality of channels . the channels can be substantially parallel to each other , and each can lead from a different widthwise position in the separation chamber zone to one of the plurality of outlet ports . each channel can be preceded by ( e . g ., downstream of ) a pair of walls that narrows in a direction leading to the channel , e . g ., thereby forming a bottleneck shape . furthermore , the separation chamber zone of the device is preferably less than 1 ml in volume , more preferably less than 500 μl and most preferably less than 250 μl . accordingly , the device provided in embodiments herein can be utilized for small but complex samples requiring low operational voltage . fig1 through 10 , wherein like parts are designated by like reference numerals throughout , illustrate example embodiments of a micro - fluidic device . although certain embodiments will be described with reference to the example embodiments illustrated in the figures , it should be understood that many alternative forms can be embodied . one of skill in the art will appreciate different ways to alter the parameters of the embodiments disclosed , such as the size , shape , or type of elements or materials , in a manner still in keeping with the spirit and scope of the devices provided in the disclosure herein . fig1 and 2 depict one embodiment of the device , comprised of a micro - fluidic chamber 1 and lid 3 that is sealed to the chamber as to create a separation chamber zone 7 , a single inlet port 5 and multiple channels 12 ( e . g ., formed of a piping , tube , housing , sets of opposing walls , etc .) each leading to ( e . g ., terminating at ) an outlet port 2 ( e . g ., an opening , slit , hole , gap , orifice , etc .) forming an exit to one of the channels 12 . the micro - fluidic chamber 1 is less than 50 mm in length , and preferably less than 20 mm in length . the inlet port 5 is provided , e . g ., through the lid . a sample of analytes is introduced and flowed into the device via the inlet port . alternatively , analyte may be aspirated into the device by applying a negative pressure at the inlet port and drawing the sample in through the outlet ports . the micro - fluidic chamber 1 includes a plurality of different and preferably distinct portions , which can be designated as various chamber zones . accordingly , the device contains the separation chamber zone 7 , as well as a fluid distribution chamber zone 15 . the fluid distribution chamber zone 15 can be situated between the separation chamber zone 7 and the inlet port 5 , and the separation chamber zone 7 can be situated between fluid distribution chamber zone 15 and the channels 12 , e . g ., such that the fluid distribution chamber zone 15 , the separation chamber zone 7 , the channels 12 , and the outlet ports 2 are arranged sequentially in a series of portions in fluid communication . accordingly , in illustrative embodiments , the fluid distribution chamber zone 15 precedes ( e . g ., is upstream of ) the separation chamber zone 7 . one or more flow path deflector elements ( such as an initial flow path deflector element 10 and a plurality of additional flow path deflector elements 11 ) can be situated in the fluid distribution chamber zone 15 , and can “ smooth ” the fluid flow as it transitions from the inlet port to the separation chamber zone 7 , e . g ., by causing redirection of impinging analytes in such a way that produces laminar , substantially parallel flow of the analytes within the separation chamber zone 7 . in illustrative embodiments , the plurality of additional flow path deflector elements 11 are included and situated in such a way as to be between the initial flow path deflector element 10 and a plurality of outlet ports 2 ( see fig3 ). for instance , the plurality of additional flow path deflector elements 11 can be aligned in a row , and can be spaced at uniform or non - uniform distances from one another . accordingly , the flow path deflector elements 10 , 11 can assist in discharging the sample from the device in a uniform manner subsequent to fractionation . in other embodiments , only a single flow path deflector element ( e . g ., the initial flow path deflector element 10 ) is included . in still other embodiments , only the plurality of flow path deflector elements 11 is included . one of skill in the art will appreciate a wide variety of ways to arrange the one or more flow path deflector elements ( e . g ., 10 , 11 ) in such a way as to create substantially parallel flow of a sample of analytes through the separation chamber zone 7 . once the sample of analytes has flowed as far as ( e . g ., has flowed into , but not beyond ) the separation chamber zone 7 , flow is preferably stopped . the sample of analytes is then fractionated in the separation chamber zone 7 between two electrode pads ( 8 and 9 ), which are connected to a direct current power supply via contacts 4 , 6 . one of skill in the art will appreciate other ways to create an electric field having a direction extending across a width of the separation chamber zone 7 . accordingly , in the presence of such an electric field generated by the depicted or an alternative electric field generation device , the sample of analytes fractionates into a plurality of fractionated analyte groups . accordingly , it should be appreciated that the separation chamber zone 7 is the particular area in which the sample of analytes is intended to be fractionated . thus , in illustrative embodiments , the separation chamber zone 7 does not include any flow path deflector elements 10 , 11 , but rather is formed of an open area in which analytes of a sample can flow and separate according to isoelectric points under the presence of a generated electric field . thus , in illustrative embodiments provided herein , the separation chamber zone 7 can be defined as the open space situated between the channels 12 and the flow path deflector elements 10 , 11 . in such illustrative embodiments , the flow path deflector elements 10 , 11 are included in a fluid distribution chamber zone 15 contained within the micro - fluidic chamber 1 ( see fig2 , 3 , and 6 ) which precedes ( e . g ., is upstream of ) the separation chamber zone 7 . in further illustrative embodiments , the fluid distribution chamber zone 15 is generally triangular shape . however , other shapes are possible and contemplated by the present disclosure . in general , the flow path deflector elements 10 , 11 can be any structural mechanism for determining or defining the flow path of a sample , as determined by impact of the sample against the flow path deflector elements 10 , 11 . for instance , the flow path deflector elements 10 , 11 can be cylindrical columns , walls forming defined pathways , or any other suitable deflector element . once sufficiently fractionated ( e . g ., in an amount suitable for the intended usages of the sample ), the fractionated analyte groups are pushed out of the device through the plurality of outlet ports 2 by re - initiating flow through the inlet port . in illustrative embodiments , prior to passing through the plurality of outlet ports 2 , the fractionated analyte groups additionally pass through a plurality of channels 12 , each of which leads from a different widthwise position in the separation chamber zone 7 to one of the plurality of outlet ports 2 . in illustrative embodiments , all of the plurality of channels 12 are substantially parallel to one another . however , in alternative embodiments , only some or none of the plurality of channels 12 are parallel to one another . in yet further illustrative embodiments , preceding ( e . g ., upstream of ) at least one of the channels 12 is a pair of substantially opposing walls 13 that narrow in a direction leading to the channel 12 . in this manner , the pair of substantially opposing walls 13 can form a bottleneck shape that compacts ( e . g ., compresses , condenses , intermixes , etc .) flow of one or more fractionated analyte groups flowing into the channel 12 . in illustrative embodiments , such a pair of walls 13 precedes ( e . g ., is upstream of ) each of the plurality of channels 12 , so as to form a plurality of pairs of substantially opposing and narrowing walls 13 . in illustrative embodiments , the analyte sample is mixed with buffer components that allow a ph gradient to form in an electric field to effect the isoelectric separation . the analyte is loaded into the device through the inlet port 5 by any suitable mechanical method , such as a micro - pump , syringe or pipette . once sample has flowed as far as the separation chamber zone 7 ( e . g ., has flowed into but not beyond ), flow of the sample of analytes is preferably stopped . to minimize the amount of sample used , introduction into the separation chamber zone 7 can be accomplished by sandwiching the analyte between a leading , sample - free running buffer , and a trailing sample - free buffer . thus , analyte is substantially only present within the separation chamber zone 7 . a dc electric field is applied across the electrodes 4 , 6 , allowing a ph gradient to form , and for the proteins or peptides analytes to align in the electric field according to their pi . once fractionation is completed , the electric field is optionally turned off , flow is reinitiated through the inlet port 5 , and the fractionated analyte in the separation chamber zone 7 is forced via parallel flow through the multiplicity of outlet ports 2 . the flow path deflector elements 10 , the additional flow path deflector elements 11 , and the cross - sectional areas of the outlet ports 2 can be sized , shaped , and positioned in such a way to assure the substantially uniform and substantially parallel flow from the separation chamber zone 7 into the channels 12 and through the outlet ports 2 , e . g ., thereby preventing substantially lateral intermixing of fractionated analyte groups within the separation chamber zone 7 . fig3 depicts a fluid flow analysis through the device for a newtonian fluid , showing that flow is substantially parallel as the fractionated analyte groups are forced from the separation chamber zone 7 through the channels 12 ( depicted by the parallel nature and relatively uniform length of the flow arrows in the separation chamber ). as described previously herein , the substantially parallel flow through the separation chamber zone 7 and in the channels 12 can prevent lateral intermixing of the fractionated analyte groups . for ease of collection , the outlet ports 2 can be spaced in accordance with common , multiple - sample receiving vessels , such as 96 , 384 or 1536 well plate formats or any of various maldi target plate configurations . alternatively , the fractionated analyte can be blotted directly onto a membrane and probed with antibodies . an advantage of the device &# 39 ; s small size is that it is amenable to valuable samples as well as not introducing a large sample dilution factor that is common with other separation methods . the simple construction of the device makes it suitable for single use applications , such as high throughput analysis . the principles for the charge - based separation are the same as those known for isoelectric focusing . proteins or peptides are typically separated in an electric field in a ph gradient by migrating in the electric field until they reach the ph of their neutral charge , and migration ceases . most commonly , the separation is done in a polyacrylamide gel with the aid of mobile carrier ampholytes , immobilized acrylamido buffers , or both to create the ph gradient . since the device of the current invention is gel - free , the buffer systems used here need to support the formation of a suitable ph gradient in the electric field . this can be done using carrier ampholytes , or mixtures of amphoteric buffers , such as good &# 39 ; s buffers ( see for example u . s . pat . no . 5 , 447 , 612 ). it can be appreciated that the shape of the resultant ph profile is dependent upon the concentrations and number of components in the separation buffer . in peptide separations , for a relatively concentrated analyte , since the peptides themselves are amphoteric , they can behave like carrier ampholytes and support the creation of a ph gradient without the addition of many other buffer compounds . the choice of buffer components is affected by both the ph range required for the separation , and by the compatibility requirements of any downstream sample preparation , such as for mass spectrometry . the endpoints of the ph gradient established in the separation chamber can be affected by using immobilized acrylamido buffer polymers in the gel buffer pads 8 , 9 at the electrodes 4 , 6 , as is known in the art of making ipg strips . another important feature of the invention is that the hydraulic flow through the device is substantially parallel through the separation chamber to the outlet ports so that fractionated proteins or peptides can be recovered with minimal subsequent re - mixing . a flow analysis is shown in fig3 for a newtonian buffer , which represents a worst case for potential re - mixing . in some embodiments , the flow path deflector elements 10 , 11 are designed such that the resulting pressure drop between the inlet distribution zone and the separation chamber promotes parallel flow in the separation chamber zone 7 . additionally , it might also be advantageous to add a polymer , or other component , that mitigates mixing by adding a yield stress to the buffer rheology . a yield stress in the buffer fluid &# 39 ; s rheology would have the effect of further promoting the parallel flow nature within the separation chamber zone 7 . a suitable component for this purpose is linear polyacrylamide , but other uncharged , water soluble polymers are adequate , such as polyethylene glycol and polysaccharides including , but not limited to , hydroxypropyl methylcellulose , methylcellulose , or agarose . further , a mixture of linear acrylamido buffer polymers can serve the dual function of providing modified rheological properties and ability to establish a ph gradient in the electric field . accordingly , this micro - fluidic chamber 1 can be designed such that flow in the separation chamber zone 7 between the inlet port 5 and the multiple outlet ports 2 is substantially parallel . the fluid distribution chamber zone 15 ( e . g ., forming an initial entry zone ) that includes flow path deflector elements 10 , 11 similarly can evenly distribute the buffer flow throughout the separation chamber zone 7 . it can be equally desirable to form the outlet ports 2 and / or channels 12 so as to promote substantially parallel flow pattern in the separation chamber zone 7 . the lengths and widths of the multiple channels 12 can be individually designed so that the flow across the separation zone is uniform , i . e ., the pressure distribution within the separation chamber zone 7 is maintained relatively uniform . for convenience , it is desirable to have the outlet ports 2 in register with some common collection device such as a 96 - well or 384 - well plate . since the micro - fluidic chamber 1 can be small as compared to traditional ief devices , separation times are shorter , and the required voltage to affect fractionation is lower . since the micro - fluidic chamber 1 can be about 20 mm , and typical ipg strips are 70 to 110 mm in length , the applied voltages can be 15 - 30 % the applied voltages of a typical ipg application . this represents a significant reduction in required operating voltage . furthermore , given that the separation zone is gel - free , it is expected that the analyte components have electrophoretic mobilities 100 to 1000 greater than in typical ipg applications . therefore , the device provided herein provides benefits , such as reduced separation times and lower applied voltages . the device provided herein can be fabricated from any suitable material as is known in the art for micro - fluidic devices . a common material is silicon , which additionally can have the properties of electrically insulating and conductive regions that would facilitate the design and introduction of the anode and cathode electrodes . silicon also has good thermal conduction properties , so such a device could easily be cooled during the fractionation process . alternatively , polymeric materials such as polycarbonate or polydimethylsiloxane , or glass are also useful . the device disclosed herein is suitable for charge - based separations sufficient to enhance the performance of downstream analytical techniques , such as immunoassays and mass spectrometry . complex inlet and outlet pumping schemes are not required and thus can be excluded from certain embodiments , since the flow path deflector elements 10 , 11 are positioned in such a way as to cause the flow to be sufficiently uniform in the separation zone to prevent re - mixing of the separated analytes . consequently , the device can be loaded and unloaded using a laboratory pipette or another micro - pumping device , such as a syringe . for instance , fig4 and 5 depict the micro - fluidic device as an attachment to a standard laboratory pipette . the outlet ports are designed to coincide with the spacing of a 384 - well plate for convenient recovery of the separated analytes . unseparated sample can be aspirated into the separation chamber with the pipette , drawing the sample through the multiplicity of outlet ports . once the fractionation is complete , the separated analytes are pushed out again through the outlet ports by the pipette . fig6 depicts a further example embodiment , in which the channels 12 are positioned in such a way that a density of the channels 12 ( e . g ., a “ channel distribution density ”) increases when moving from a widthwise position aligned with an edge of a width 16 of the separation chamber zone 7 to a widthwise position aligned with a center of the width 16 of the separation chamber zone 7 . for instance , the density of the channels 12 at a widthwise position in the micro - fluidic chamber 1 that is proximate a center of the width 16 of the separation chamber zone 7 can be lesser than a density of the channels 12 at a widthwise position in the micro - fluidic chamber 1 that is proximate either edge of the width 16 of the separation chamber zone 7 . furthermore , the density of the channels 12 can be a function of widthwise position that decreases when moving from a widthwise position aligned with either edge of the width 16 of the separation chamber zone 7 to a widthwise position aligned with the center of the width 16 of the separation chamber zone 7 . accordingly , distances ( e . g ., distance 17 a ) between channels 12 situated nearer to the center of the width 16 of the separation chamber zone 7 can be lesser than distances ( e . g ., distances 17 b ) between channels 12 situated nearer to the edges of the width 16 of the separation chamber zone 7 . furthermore , flow path deflector elements ( e . g ., the plurality of flow path deflector elements 11 ) that are included in the device can be arranged with a center - increasing distribution density . for example , a density of the flow path deflector elements 11 ( e . g ., a “ flow path distribution density ”) can increase when moving from a widthwise position aligned with an edge of the width 16 of the separation chamber zone 7 to a widthwise position aligned with the center of the width 16 of the separation chamber zone 7 . for instance , the density of the flow path deflector elements 11 at a widthwise position in the micro - fluidic chamber 1 that is proximate a center of the width 16 of the separation chamber zone 7 can be greater than a density of the flow path deflector elements 11 at a widthwise position in the micro - fluidic chamber 1 that is proximate either edge of the width 16 of the separation chamber zone 7 . furthermore , the density of the flow path deflector elements 11 can be a function of widthwise position that increases ( e . g ., in a quadratic fashion ) when moving from a widthwise position aligned with either edge of the width 16 of the separation chamber zone 7 to a widthwise position aligned with the center of the width 16 of the separation chamber zone 7 . accordingly , distances between flow path deflector elements 11 situated nearer to the center of the width 16 of the separation chamber zone 7 can be greater than distances between flow path deflector elements 11 situated nearer to the edges of the width 16 of the separation chamber zone 7 . utilizing such distribution densities of the flow path deflector elements ( e . g ., 10 , 11 ) and / or the channels 12 can be beneficial in some instances for promoting substantially parallel flow of sample through the separation chamber zone 7 . for instance , by providing narrower gaps between the flow path deflector elements ( e . g ., 10 , 11 ) and / or the channels 12 , flow of sample can be restricted at positions where the pressure of the fluid is highest . this can cause buildup of sample at the high pressure , narrow passages , thereby causing lateral redirection of the sample , thus promoting distribution of the sample throughout the separation chamber zone 7 and further promoting parallel flow through the separation chamber zone 7 . it should be noted that the number of flow path deflector elements 11 can be equal or unequal to the number of channels 12 included in the device . furthermore , the distribution density of the channels 12 can be proportional or un - proportional to the distribution density of the flow path deflector elements 11 . thus , the non - uniform distances between the channels 12 can be proportional or un - proportional to the non - uniform distances between the flow path deflector elements 11 . additionally or alternatively to having ( a ) a non - uniform distribution density of the flow path deflector elements 10 , 11 and / or ( b ) a non - uniform distribution density of the channels 12 , widths of the channels 12 can be non - uniform . for instance , fig7 depicts an example embodiment in which seven channels 12 a - g have widths 22 a - g . in the example embodiment of fig7 , channels 12 a - g leading from a widthwise position in the separation chamber 7 that is relatively nearer to a center of the width 16 thereof are narrower than channels 12 a - g leading from a widthwise position that is relatively farther from the center of the width 16 . accordingly , the widths 22 a , 22 g can be greater than the widths 22 b , 22 f ; the widths 22 b , 22 f can be greater than the widths 22 c , 22 e ; the widths 22 c , 22 e can be greater than the width 22 d . in this manner , widths 22 a - g of the channels 12 a - g can decrease moving from either edge of the width 16 of the separation chamber zone 7 . this can be effective , for instance , in restricting flow of fractionated analyte groups through the middle portion ( i . e ., at the center of the width 16 ) of the separation chamber zone 7 , thereby restricting flow of the fractionated analyte groups at positions where pressure is higher . this , in turn , can promote uniform flow rates through all of the channels 12 a - g , thereby assisting in creating substantially parallel flow of the fractionated analyte groups through the separation chamber zone 7 . in illustrative embodiments , the widths 22 of the plurality of channels 12 increase as a function of widthwise position relative to a center of the width 16 of the separation chamber zone 7 . in further illustrative embodiments , the function by which the widths of the plurality of channels 12 increases is a quadratic function . accordingly , it will be appreciated that the channels can be characterized by significantly less amounts of variation among the widths than is schematically depicted in fig7 . in general , each width 22 a - g can be uniform or non - uniform across a length of the channel 12 a - g . in the example embodiment of fig7 , each individual width 22 a - g is substantially uniform across an entire length 23 of the channel 12 a - g . the outlet ports 5 ( e . g ., at which the channels 12 terminate ) similarly can have widths that vary from one another , as with the widths 22 a - g of the channels 12 a - g . for instance , the widths of the outlet ports 5 can be the same as the widths 22 a - g of the channels 12 a - g , and thus the widths of the outlet ports 5 can increase as a ( e . g ., quadratic ) function of widthwise position relative to the center of the separation chamber zone 7 . alternatively , the widths of the outlet ports 5 can be different from the widths 22 a - g of the channels 12 a - g . in general , the widths of the outlet ports may be proportional or non - proportional to the widths 22 a - g of the channels 12 a - g . in the example embodiment of fig7 , the micro - fluidic chamber 1 of the device includes the initial flow path deflector element 10 as well as the plurality of flow path deflector elements 11 . in this example embodiment , the plurality of flow path deflector elements 11 are spaced apart at non - uniform distances , and the plurality of channels 12 a - g are spaced apart at uniform distances . accordingly , the non - uniform spacing of the plurality of flow path deflector elements 11 and the non - uniform widths 22 a - g of the plurality of channels 12 a - g ( i . e ., non - uniform across the plurality ) can work in combination to maintain flow through the separation chamber 7 in a substantially parallel manner preventing lateral intermixing . in general , the flow path deflector elements that are included in the device ( e . g ., the initial flow path deflector element 10 and / or the plurality of additional flow path deflector elements 11 ) can be any suitable physical structure for being positioned in such a way as to block the flow path of a sample of analytes and to thereby cause redirection of the sample upon impact of the sample against the flow path deflector elements 10 , 11 . for instance , in the example embodiments depicted and described with reference to fig1 through 7 , the flow path deflector elements 10 , 11 are pins ( e . g ., cylindrical columns ), e . g ., constructed of silicone or any other suitable material . however , it should be appreciated that many other shapes and configurations are possible and contemplated within the scope of the present disclosure . for instance , fig8 illustrates several example embodiments of the flow path deflector elements 10 , 11 from a top view . as illustrated , the flow path deflector elements 10 , 11 can include one or more of a cylindrical column 16 , a foil shaped member 17 ( e . g ., a fin , which can have a elliptical cross section when viewed from a front view ), a triangular prism 18 , a v - shaped column 19 , a rectangular prism 20 , a thicket 21 ( e . g ., steel wool or other material forming a tortuous path within the fluid distribution chamber zone 15 ), any other flow path deflector elements , and any suitable combination thereof . in embodiments including a thicket 21 , the thicket 21 can fill at least a portion , only a portion , or substantially all of the fluid distribution chamber zone 15 . although the example embodiments of fig1 through 8 depict one or more flow path deflector elements ( e . g ., 10 , 11 ), it should be appreciated that in some alternative embodiments , flow path deflector elements are not included . for instance , fig9 depicts an example embodiment of a micro - fluidic chamber 1 for inclusion in devices provided herein . the micro - fluidic chamber 1 can include channels 12 having widths that are non - uniform across all of the channels 12 , as depicted . alternatively , the widths can be uniform across all of the channels 12 . in embodiments such as the one depicted in fig9 , sample can be introduced into the separation chamber zone 7 in an evenly distributed fashion by drawing sample in through the outlet ports 2 , e . g ., as an alternative to introducing sample through the inlet port 5 . furthermore , in such embodiments , the lengths of the channels 12 can be significantly reduced , as would be appreciated by one of skill in the art upon reading the present specification . for example , fig1 depicts a flow chart of a method for using the device of fig9 in order to fractionate a sample of analytes . sample is introduced into the separation chamber zone 7 in an evenly distributed fashion through the outlet ports ( step 110 ). more specifically , in illustrative embodiments , sample is drawn through each of the outlet ports 2 , through each of the channels 12 , and into a plurality of different widthwise positions in the separation chamber zone 7 . for instance , sample can be introduced by producing a negative pressure at the inlet port 5 . in some embodiments , the negative pressure at the inlet port 5 is produced by actuating a syringe , pipette , or other micro - pump coupled to the inlet port 5 , which thereby causes the sample to flow into the outlet ports 2 from a fluid reservoir that is coupled to the outlet ports 2 . as an alternative , in some embodiments , sample may be caused to be introduced through the outlet ports 2 by generating a positive pressure at the outlet ports 2 . once sample is situated suitably within the separation chamber zone 7 , flow preferably is stopped ( step 112 ), e . g ., by halting actuating motion of the syringe , pipette , or other micro - pump producing the negative pressure at the inlet port 5 . the evenly distributed sample can be fractionated ( step 114 ), e . g ., by generating an electric field across the width 16 of the separation chamber zone 7 . in this manner , a plurality of fractionated analyte groups can be generated after a sufficient period of time has passed . once fractionated , the fluid distribution chamber zone 15 can be pressurized to force the fractionated analyte groups out through the channels 12 and outlet ports 2 . for example , in illustrative embodiments , additional fluid ( e . g ., one or more gases , one or more liquids , or a combination thereof ) is introduced through the inlet port 5 into the fluid distribution chamber zone 15 , in such a way as to force the fractionated analyte groups back out through the outlet ports 5 . preferably , additional fluid that is introduced into the fluid distribution chamber zone 15 to force fractionated analyte groups out the outlet ports 5 is less viscous than each of the plurality of fractionated analyte groups . when such additional , less viscous fluid is introduced into the fluid distribution chamber zone 15 , it contacts the boundary of the fractionated analyte groups and distributes within the fluid distribution chamber zone 15 . once a sufficient quantity of the additional , less viscous fluid has passed through the inlet port 5 , the additional fluid will compress until it possesses a great enough pressure to push the fractionated analyte groups through the channels 12 and out the outlet ports 5 . given that the additional , less viscous fluid distributes evenly throughout the fluid distribution chamber zone 15 prior to undergoing sufficient compression to build up a motive force , the pressure generated thereby is substantially evenly distributed along the entire width 16 of the separation chamber zone 7 ( e . g ., along the entire rearward boundary of the fractionated analyte groups ). this even distribution of the additional , less viscous fluid causes the fractionated analyte group to flow back through the separation chamber zone 7 in a substantially parallel fashion , thereby preventing substantially lateral intermixing of the fractionated analyte groups . alternatively or additionally to utilizing an additional ( e . g ., less viscous ) fluid , other methods of pressurizing the fluid distribution chamber zone 15 can be used in step 116 . furthermore , in embodiments where additional fluid is introduced in step 116 , it is possible to utilize a more viscous or equally viscous fluid , e . g ., by including the flow path deflector elements 10 , 11 within the fluid distribution chamber zone 15 in a manner sufficient to cause even distribution of the additional fluid therein prior to contacting the fractionated analyte groups . still other alternative embodiments are possible . for example , one of skill in the art will appreciate upon reading the present specification that there are other ways to shape the outlet ports 2 such that outlet ports 2 having widthwise positions aligned nearer to the center of the width 16 of the separation chamber zone 7 are more restrictive to flow than outlet ports 2 having widthwise positions aligned nearer to the edges of the width 16 of the separation chamber zone 7 . for instance , fig1 a and 11b depict one such example of such a micro - fluidic chamber 1 of a micro - fluidic device from a top view and a front view , respectively . in particular , in the example embodiment of fig1 a and 11b , depths ( e . g ., heights , as depicted in the front view of fig1 b ) of the outlet ports 2 can be variable . the variable depths can be provided as an alternative or addition to providing the outlet ports 2 with variables widths , as depicted at least in fig7 and 9 . in the example embodiment of fig1 a and 11b , the widths are constant . all values in fig1 a and 11b ( which are in inches ) are illustrative and in no way limit the embodiments provided herein . one of skill in the art will appreciate that there are many ways to provide the outlet ports 2 with variable areas achieving the effect of greater flow restriction at widthwise positions nearer the center of the width 16 of the separation chamber zone 7 . numerous modifications and alternative embodiments of the embodiments disclosed herein will be apparent to those of skill in the art in view of the foregoing description . accordingly , this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the best mode . details of the structure may vary substantially without departing from the spirit of the embodiments provided here , and exclusive use of all modifications that come within the scope of the appended claims is reserved . it is intended that the present invention be limited only to the extent required by the appended claims and the applicable rules of law . it is also to be understood that the following claims are to cover all generic and specific features of the invention described herein , and all statements of the scope of the invention which , as a matter of language , might be said to fall therebetween . the publications , websites and other reference materials referenced herein to describe the background of the invention and to provide additional detail regarding its practice are hereby incorporated by reference . the devices as depicted in fig1 and 2 were fabricated as follows . the micro - fluidic channels ( 1 ) were cast in silicone ( elastosil ® lr 3003 / 20 , wacker chemical corporation , adrian , mich . ), allowed to set , but were not cured at elevated temperature . the separation zones ( 7 ) of these devices were about 20 mm by 5 mm , with a depth of about 0 . 5 mm . flow distribution elements ( 11 ) were an array of eighteen 0 . 5 mm diameter posts , quadratically spaced over a 12 mm span . the glass lid ( 3 ) was mated to the silicone micro - fluidic channels ( 1 ) assuring proper alignment of the access ports ( 4 , 5 and 6 ). adhesion of the glass to the silicone was accomplished under mild clamping pressure , and curing the assembly at about 190 ° c . for 1 hour . the assembled device was measured to have a separation zone ( 7 ) volume of about 70 μl . about 10 μl was required to fill the device up to the flow distribution chamber ( 15 ), and about 5 μl occupied all of the exit channels ( 12 ). therefore , the total fluid occupied in the device was about 85 μl . the electrode gel pads ( 8 and 9 ) were each measured to have a volume of about 7 . 5 μl . the electrode gels ( 8 and 9 ) were created as 2 % agarose ( agarose low eeo , type i , sigma - aldrich co . llc , st . louis , mo .). a 2 % agarose solution was created by dissolving the appropriate amount of agarose in a 20 mm , ph 7 . 2 phosphate buffer at about 90 ° c . a dry device assembled in accordance with example 1 was heated to 60 ° c . in order to maintain the fluidity of the agarose solution . a 7 . 5 μl volume was pipetted into each electrode port . the device was cooled to room temperature , and the electrode gels were allowed to set . platinum wires were inserted into each electrode gel to facilitate connection to a power supply . a running buffer of 1 mm glutamic acid / 1 mm histidine / 1 mm lysine / 2 mm , ph 7 . 2 phosphate buffer ( all chemicals from sigma - aldrich co . llc , st . louis , mo .) was prepared . 7 . 5 μl of a saturated congo red solution was added to 150 μl of the running buffer . 80 μl of the congo red / running buffer mixture was introduced through the inlet port ( 5 ) into a device made in accordance with example 2 . the device was connected to an electrophoresis power supply ( model ev215 , consort bvba , turnhout , belgium ) and run at 50 vdc for 6 minutes . the initial current drawn by the device was 107 μa . the red color was observed to move from the cathode gel almost immediately , indicating migration of the congo red toward the anode . at the interface between the running buffer and the anode gel , blue material started to form , indicating a drop of the ph at the anode and the alignment of the running buffer components in the electric field . the blue color propagated across the separation chamber , as the clear zone at the cathode end grew . after about 4 minutes of running , the blue region reached about 8 mm across the separation chamber , and there were no traces of red color left . this indicates migration of the congo red toward the anode and a ph of less than about 3 . 0 in the anode region of the device ( congo red has a blue - red transition in a ph range of 3 . 0 - 5 . 2 ). after 6 minutes , the ending current was 172 μa . no disrupting eddy currents due to electroosmotic flow ( eof ) were observed . a device was assembled in accordance with example 2 , except the electrode gels were set at different phs to facilitate the formation of a ph gradient . the anode gel was made as a 1 . 5 % agarose gel in 30 mm glutamic acid . the cathode gel was made as a 1 . 5 % agarose gel in 30 mm lysine . phycocyannin was run in a carrier ampholyte running buffer . native phycocyannin ( sigma - aldrich item p - 2172 ) was dissolved in a 2 % carrier ph 3 - 10 ampholyte solution ( sigma - aldrich item 39878 ). the device was run at 120 vdc for 1 hour . the initial current drawn by the system was about 130 μa ( about 15 mw ). the phycocyannin was observed to form a band within about 5 minutes near the anode end of the separation chamber . the band migrated to about 4 mm from the anode gel within 20 minutes of running , and remained stationary for the remainder of the run . the current drawn by the system was about 550 ( 6 . 6 mw ) from about 4 minutes to the end of the run . a device , as described in example 1 , was filled with water containing a blue food coloring . approximately 40 μl of water containing yellow food coloring was slowly introduced through the inlet port . a substantially straight blue - yellow boundary was observed in the middle of the separation chamber , thereby verifying parallel flow .	1
exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings . fig2 a is a plan view illustrating a transformer according to an exemplary embodiment of the present invention . fig2 b is a cross - sectional view taken along the line a - a ′ of the transformer shown in fig2 a . referring to fig2 a and 2b , the transformer according to the exemplary embodiment of the present invention includes a bobbin unit b , a core unit co that is coupled to the bobbin unit b , coil units c 1 and c 2 that are wound around the bobbin unit b , and terminal units ii and io that are formed on the bobbin unit b . the bobbin unit b has a predetermined length and a through hole bi formed therein . the core unit co includes an inner core coi and an outer core coo . the inner core coi is inserted into the through hole bi of the bobbin unit b . the outer core coo is formed along one surface of the bobbin unit b that is formed in a longitudinal direction of the bobbin unit b . the inner core coi and the outer core coo are electromagnetically coupled to each other to form a magnetic path that is a path of magnetic flux . here , one inner core coi and one outer core coo are electromagnetically coupled to each other to form one magnetic path . the coil units c 1 and c 2 are wound around outer circumferential surfaces of the bobbin unit b . the coil units c 1 and c 2 include a primary coil c 1 and a plurality of secondary coils c 2 . the primary coil c 1 is wound around the center of the outer circumferential surfaces of the bobbin unit b . the plurality of secondary coils c 2 are wound around both sides of the outer circumferential surfaces , respectively , around the primary coil c 1 along the longitudinal direction of the bobbin unit b . the primary coil c 1 corresponds to the secondary coil c 2 to form one electric transformer . when the secondary coils c 2 are wound around both sides of the outer circumferential surfaces of the bobbin unit b , respectively , two transformers may be integrated into one transformer structure . when two of each of the secondary coils c 2 are wound , four electrical transformers may be integrated into one transformer structure . the terminal units ii and io include an input terminal ii and an output terminal io . the terminal units ii and io may further include a fixing or grounding terminal ig . the input terminal ii and the output terminal io are formed at one surface and the other surface of the bobbin unit b , respectively , which are located opposite to each other . the input terminal ii transmits input power to the primary coil c 1 , a first input terminal ii 1 is connected to one end of the primary coil c 1 , and a second input terminal ii 2 is connected to the other end of the primary coil c 1 . the output terminal io transmits to the outside , output power that is set according to a winding ratio between the primary coil c 1 and the secondary coils c 2 . then , a first output terminal io 1 of the output terminal io is connected to one end of the one secondary coil c 2 that is wound around the outer circumferential surfaces of the one side of the bobbin unit b , and a second output terminal io 2 is connected to the other end of the secondary coil c 2 that is wound around the outer circumferential surfaces of the one side of the bobbin unit b . in the same manner , a third output terminal io 3 is connected to one end of the other secondary coil c 2 that is wound around the outer circumferential surfaces of the other side of the bobbin unit b , and a fourth output terminal io 4 is connected to the other end of the secondary coil c 2 that is wound around the outer circumferential surfaces of the other side of the bobbin unit b . preferably , the output terminal io and the outer core coo may be formed on the same outer circumferential surface of the bobbin unit b . as shown below in table 1 , experiments show that an output current deviation can be reduced by an electromagnetic action between the input and output terminals ii and io , the core unit co , and the coil units c 1 and c 2 when the output terminal io and the outer core coo are formed at the same outer circumferential surface . referring to table 1 , when the output terminal io and the outer core coo are formed at the same outer circumferential surface of the same bobbin unit b , a tube current deviation between the lamps is 0 . 3 ma . on the other hand , when the output terminal io and the outer core coo are formed at the different outer circumferential surfaces of the bobbin unit b that are opposite to each other , the tube current deviation between the lamps is 1 . 8 ma . in general , when a rated output current ( lamp tube current ) is 8 ma , an output current deviation that is required by a user is 0 . 5 ma . therefore , preferably , the output terminal io and the outer core coo are formed at the same outer circumferential surface of the bobbin unit b . further , a cross walk cw that equally divides the winding number of the primary coil c 1 may be formed at the center of the outer circumferential surfaces around which the primary coil c 1 of the bobbin unit b is wound . taking into account the fact that the output power is determined according to the winding ratio between the primary coil c 1 and the secondary coils c 2 , the output power of each of the secondary coils c 2 can be equally controlled . fig3 a is an exploded perspective view illustrating a transformer according to one exemplary embodiment of the present invention . referring to fig3 a , the one exemplary embodiment of the transformer according to the present invention relates to an exemplary embodiment of a core unit co that is used in the transformer according to the invention . the core unit co includes two open square - shaped cores that are coupled to form one magnetic path . that is , a first open square - shaped core includes a first support part v 1 , a first inner protrusion part coi 1 , and a first outer protrusion part coo 1 . the first support part v 1 has one side and the other side . the first inner protrusion part coi 1 is formed at the one side of the first support part v 1 and inserted into a through hole bi of a bobbin unit b . the first outer protrusion part coo 1 is formed at the other side of the first support part v 1 along the same direction as a direction of the first inner protrusion part coi 1 , and formed along one surface formed in the longitudinal direction of the bobbin unit b . in the same manner , a second open - square shaped core includes a second support part v 2 , a second inner protrusion part coi 2 , and a second outer protrusion part coo 2 . the second support part v 2 has one side and the other side . the second inner protrusion part coi 2 is formed at the one side of the second support part v 2 and inserted into the through hole bi of the bobbin unit b . the second outer protrusion part coo 2 is formed at the other side of the second support part v 2 along the same direction as a direction of the second inner protrusion part coi 2 , and formed along one surface formed in the longitudinal direction of the bobbin unit b . the first and second open square - shaped cores face each other and are coupled to each other . the first and second inner protrusion parts coi 1 and coi 2 form one inner core coi . the first and second outer protrusion parts coo 1 and coo 2 and the first and second support parts v 1 and v 2 form one outer core coo . since a description of the bobbin unit b , coil units , and terminal units is the same as that with reference to fig2 a and 2b , the description thereof will be omitted . fig3 b is an exploded perspective view illustrating a transformer according to another exemplary embodiment of the present invention . referring to fig3 b , the inner protrusion parts coi 1 and coi 2 of the first and second open square - shaped cores as described above in fig3 a may be thinner than the outer protrusion parts coo 1 and coo 2 . as the thickness of the inner protrusion parts coi 1 and coi 2 increases , the length of the bobbin unit b increases , which results in an increase in volume of the transformer . therefore , when the thickness of the inner protrusion parts coi 1 and coi 2 is reduced within an allowable range in terms of electromagnetism , the volume of the transformer can be further reduced . fig3 c is an exploded perspective view illustrating a transformer according to still another exemplary embodiment of the present invention . the still another exemplary embodiment of a core unit co that is used in the transformer according to the invention will be described in detail . the core unit co includes an inner core coi and an outer core coo . the inner core coi is an i - shaped core that has a predetermined length , and the outer core coo is a c - shaped core that has a plurality of protrusion parts v 1 and v 2 . the inner core coi includes one end and the other end , and is inserted into a through hole bi of a bobbin unit b . the outer core coo is formed along one surface in a longitudinal direction of the bobbin unit b among outer circumferential surfaces of the bobbin unit b . further , the outer core coo includes protrusion parts v 1 and v 2 that are formed at one side and the other side thereof along the same direction . the first protrusion part v 1 of the outer core coo is electrically connected to the one side of the inner core coi , and the second protrusion part v 2 is electrically connected to the other end of the inner core coi , thereby forming one magnetic path . in the above - described core unit according to the still another embodiment of the invention , the inner core coi is shorter than the outer core coo . for this reason , one end surface and the other end surface of the inner core coi are electrically connected to surfaces that face the through hole bi of the bobbin unit b among surfaces of the first and second protrusion parts v 1 and v 2 of the outer core coo . fig3 d is an exploded perspective view illustrating a transformer according to yet another exemplary embodiment of the present invention . fig3 d illustrates the yet another exemplary embodiment of a core unit co that is used in the transformer according to the invention when the inner core coi and the outer core coo of the core unit co shown in fig3 c have the same length . referring to fig3 d , the inner core coi has the same length as the outer core coo . one side and the other side of a surface that faces the outer core coo among surfaces of the inner core coi are electromagnetically coupled to end surfaces of the first and second protrusion parts v 1 and v 2 of the outer core coo , respectively , to thereby form one magnetic path . fig4 a is a circuit diagram illustrating one example of a connection between the transformer according to the present invention and lamps . referring to fig4 a , the transformer according to the exemplary embodiments of the present invention may be connected to a plurality of lamps . first , input power that is transmitted to the primary coil c 1 through the input terminals io 1 and io 2 is converted into output power that is set beforehand according to a winding ratio between the primary coil c 1 and the plurality of secondary coils c 2 . then , the output power is transmitted to the plurality of lamps through the output terminals io 1 , io 2 , io 3 , and io 4 . when each of the plurality of lamps is a long bar - shaped lamp , the four lamps receive the output power through the first to fourth output terminals io 1 , io 2 , io 3 , and io 4 . here , the output terminals io 1 and io 2 are electrically connected to one end and the other end of one secondary coil c 2 , respectively , and the output terminals io 3 and io 4 are electrically connected to one end and the other end of the other secondary coil c 2 , respectively . then , the four lamps emit light . fig4 b is a circuit diagram illustrating another example of a connection between the transformer according to the present invention and lamps . referring to fig4 b , when each of the plurality of lamps is a u - shaped lamp , two lamps receive the output power through the first to fourth output terminals io 1 , io 2 , io 3 , and io 4 . here , the output terminals io 1 and io 2 are electrically connected to one end and the other end of one secondary coil c 2 , respectively , and the output terminals io 3 and io 4 are electrically connected to one end and the other end of the other secondary coil c 2 , respectively . then , the two lamps emit light . at this time , one end and the other end of one u - shaped lamp may be electrically connected to the first and second output terminals io 1 and io 2 , respectively , and one end and the other end of the other u - shaped lamp may be electrically connected to the third and fourth output terminals io 3 and io 4 , respectively . fig5 is a graph illustrating a tube current of lamps when the transformer according to the present invention and the lamps are connected to each other . referring to fig5 , four or eight transformers according to the exemplary embodiments of the present invention are used , and lamps are connected to output terminals of the transformers . the tube current of the sixteen lamps is measured . as shown in graph of fig5 , when taking into account the fact that an output current deviation that is required by a user is 0 . 5 ma when a rated output current ( lamp tube current ) is 8 ma , a deviation of the tube current that flows into the sixteen lamps is within the deviation of 0 . 5 ma . this means that even when the transformer according to the exemplary embodiments of the present invention has a structure in which a plurality of electric transformers are integrated into one transformer structure to form one magnetic path and reduce the volume of the transformer , the transformer accurately performs the proper function . as described above , characteristics of the transformer according to the exemplary embodiments of the present invention are compared with those of the transformer according to the related art shown in fig1 a and 1b . referring to table 2 , the transformer according to the related art forms two magnetic paths and a core section has a width of 43 . 5 mm 2 , while the transformer according to the exemplary embodiments of the present invention forms one magnetic path and a core section has a width of 27 mm 2 . as a result , the volume of the transformer according to the related art is 5873 mm 3 , while the transformer according to the exemplary embodiments of the present invention is 4289 mm 3 . therefore , the transformer according to the exemplary embodiments of the present invention has almost the same electrical characteristic as the transformer according to the related art . however , the volume of the transformer according to the exemplary embodiments of the present invention is reduced by approximately 27 %. as set forth above , according to exemplary embodiments of the invention , a plurality of electrical transformers are integrated into one transformer structure to form one magnetic path , thereby reducing the volume of the transformer . while the present invention has been shown and described in connection with the exemplary embodiments , it will be apparent to those skilled in the art that modifications and variations can be made without departing from the spirit and scope of the invention as defined by the appended claims .	7
referring to fig1 there is seen a minivan 10 having a spare tire 12 mounted under the floor 11 of the rear compartment thereof . in the stowed position tire 12 is firmly secured against the bottom of floor 11 as seen in fig2 and 3 . when the tire 12 is needed it is lowered to the ground as shown by phantom lines in fig3 . tire 12 is supported under the vehicle by means of a cable 14 generally of the commonly used wire rope type . cable 14 is connected to the center of tire rim 15 by means of a clip 16 of conventional design . clip 16 is centrally attached to the end of cable 14 and is preferably of a rectangular upwardly centrally angled configuration as shown . this conventional angled configuration causes clip 16 to be self centering in the center of rim 15 . cable 14 as shown is threaded over a pulley 18 and the opposite end connected to a lever 20 . one end of lever 20 is pivotally connected to the floor of the vehicle by means of a pin or bolt 21 . the end of cable 14 opposite that connected to clip 16 is resiliently connected to lever arm 20 by the arrangement shown in fig4 . a block 22 slidably mounted within arm 20 is accessible through an opening 23 in the upper surface of lever arm 20 . the preferred configuration for lever arm 20 is of a hollow square cross sectioned metal tube . as seen in fig4 an end of block 22 bears against a coil spring 24 or similar resilient member . spring 24 biases the end of cable 14 toward the end of lever 20 . thus when the cable is relaxed or if the load of the lever arm in pulling the cable exerts a moment more or less perpendicular to the longitudinal axis of the lever arm as is the case approximately to the point shown in fig3 by phantom lines , the biasing of spring 24 causes the point of attachment of cable 14 to lever arm 20 to be a distance a away from pivot point 21 . then , when the lever arm is rotated counter - clockwise as seen in fig3 from the position shown by phantom lines , a greater moment is exerted parallel to the axis of lever arm 20 . this moment causes compression of spring 24 so that the effective lever arm is shortened to distance b as seen in fig2 and 3 . this shortening of the lever arm increases the amount of leverage available to the user in raising the tire . this improvement of the leverage lightens the work effort required to lift the tire , thus making it easier for an operator of limited physical strength to raise the tire . the spring also makes it easier for the lever arm to be moved to an overcenter position wherein the cable is pulling linearly parallel to the axis of lever arm 20 as seen in fig3 . finally , the presence of spring 24 in the compressed state when the tire is raised insures that the tire is firmly mounted against the bottom of the motor vehicle floor 11 . a latch member 26 is provided to insure that the arm 20 remains in the position of fig3 wherein it is located in a recess 28 in the floor of the rear of the vehicle 10 . the mechanism thus remains concealed , particularly if covered by carpeting or matting . while latch 26 is indicated to be of a simple pivoting type , it will readily be apparent that other latches of various types such as sliding types or hooks can be substituted by those skilled in the art . preferably the sides of the opening in the motor vehicle floor are reinforced by members such as angle irons 30 in order to provide adequate support for pulley 18 . while preferred embodiments of the invention have been indicated for purposes of illustration , it will be apparent to those skilled in the art that various other modifications can be made without departing from the spirit of the invention or scope of the appended claims .	1
referring now to fig1 - 3 of the drawings there is shown a container 1 , for serving as a pizza box stacker dispenser and carrier , in the general form of a hollow upright rectangular parallelepiped having a front panel 3 , a rear panel 5 , a left side panel 7 and a right side panel 9 . the container 1 has an open top 11 through which a stack of conventional pizza boxes 13 may be inserted . although described for use in storing , carrying , and dispensing pizza boxes , the present invention is applicable generally to storing , carrying , and dispensing other types of boxes or other uniformly sized rectangular objects preferably having a low profile . on the front panel 3 of the container 1 there is a centered vertical slot 15 forming a window in the panel 3 through which a portion of the stack of boxes can be seen . the window 15 provides a view from which it can be determined when it is necessary to refill the container 1 with more pizza boxes after a sufficient number have been withdrawn from the bottom of the container 1 as hereinafter explained . at the bottom of the container 1 there is a rectangular lower opening 17 having a width slightly larger than the width of the pizza boxes intended to be stored within the container 1 and dispensed from it . continuous with the opening 17 at the bottom of the container 1 is an upper opening 19 having a width narrower than the width of the pizza boxes 13 . the opening 19 is wide enough to enable the lowermost pizza box 13 a in the container 1 to be grasped , preferably with the thumb of one hand pressing against the front edge of the box and the fingers of the same hand touching the box from below . the opening 19 preferably has a rounded top to form an arch for structural integrity and an aesthetically pleasing appearance . on each side of the opening 19 there is inserted through a horizontal slot 21 in the front panel 3 of the container 1 , a right angle bracket 25 serving as a support for the bottom of the lowermost pizza box 13 a in an area proximate the front panel 3 of the container 1 . although shown as mounted on the front panel 3 of the container 1 , the supports 25 can be mounted on the inside surfaces of the left side panel 7 and right side panel 9 adjacent the inside surface of the front panel 3 . referring now to fig2 of the drawings there is shown the rear panel 5 of the container 1 . cut into the rear panel 5 of the container 1 is a rectangular opening 23 having a width slightly larger than the width of the largest sized boxes 13 and a height greater than the height of a single box 13 but less than twice the height of a box 13 . hence one box 13 , and only one box 13 , may be received within the rear opening 23 at a time . spanning the opening 23 and preferably disposed in the plane of the rear surface of rear panel 5 is a resilient band 6 as best seen in fig3 . the resilient band 6 is preferably made of an elastic material such as rubber or the like and can be a common rubber band . alternatively , the resilient band can be formed from a strip of spring steel or the like . the resilient band 6 serves as a barrier for normally preventing the lowermost box 13 a from accidentally penetrating the rear opening 23 far enough for the front of the box 13 a to recede from the supports 25 and drop to the floor 33 . when the box 13 a is to be withdrawn from container 1 , it is pushed rearwardly through the rear opening 23 against an opposing force of the resilient band far enough for the front of the box 13 a to clear the supports 25 and be lowered to an elevation whereat it can be withdrawn through the front opening 3 without obstruction . in order to provide ample room for the lowermost box 13 a to be momentarily pushed rearwardly through the opening 23 , the container 1 should be spaced from the wall behind it . this can be ensured by providing one or more spacers between the rear panel 5 of the container 1 and the wall behind it . suitable spacers 24 may be formed at the time the opening 23 is cut into the rear wall 5 of the container 1 as follows . a centered rectangular panel slightly narrower than the width of the container 1 is cut out of the rear wall 5 . the distance between each side edge of the rear opening and its adjacent wall determines the depth of the corresponding spacer to be formed . that is , each of the margins between the rear opening 23 and respective side wall 7 , 9 is cut or scored along parallel horizontal lines which are extensions of the top and bottom edges of the rear opening 23 . the margins may then be folded ninety degrees to project rearwardly from the rear surface 5 of the container 1 . for increased rigidity , the margins may be folded over on themselves and fastened to themselves by glue , tacking or any other appropriate fastening device . in the latter case , the container 1 should be wide enough relative to the widest size of box to be stacked therein to allow a rear opening wider than the width of the widest size box and margins between the opening 23 and side panels 7 , 9 to permit folded spacers of sufficient depth . the ends 8 , 8 of the resilient band 6 penetrate openings in the container 1 at or adjacent the intersection of the spacers 24 with the side walls 7 , 9 . the ends 8 , 8 of the resilient band 6 are adhered to the outer surfaces of the side walls 7 , 9 by a suitable fastener such as glue , adhesive tape , thumb tacks , push pins , or the like . referring to fig4 of the drawings , looking down into the container 1 , there can be seen the horizontal surfaces of front supports 25 formed by brackets which support the bottom of the lowermost pizza box in the stack of boxes 13 housed within the container 1 . the uppermost surfaces of the horizontal portions of the brackets 25 are at an elevation greater than the bottom of the rectangular opening 23 which is in the plane of the floor 33 of the container 1 or , if the container 1 has no floor , the plane of the bottom of the container 1 . referring now to fig5 of the drawings there is shown a stack of pizza boxes 13 within a container 1 from which the lowermost box 13 a is to be removed . as can be seen in fig5 , the lowermost box 13 a has been pushed , by inserting pressure on its front panel , exposed in the upper opening 19 of the container 1 , toward the rear of the container 1 thereby causing the lowermost box 13 a to begin to pass through the rectangular opening 23 toward a position rearward of the supports 25 on which the front lower edge of the lowermost box 13 a is still resting . at this time the area of the top surface of the lowermost box 13 a within the container 1 continues to engage the bottom surface of the box 13 b immediately above it , with the weight of the stack of boxes 13 causing friction between the lowermost box 13 a being dispensed and the box 13 b above it . referring now to fig6 , as the lowermost box 13 a is pushed further rearward through the rectangular opening 23 , the front of the lowermost box 13 a clears the supports 25 . as soon as the lowermost box 13 a clears the supports 25 , it is free to drop or be lowered to a position near the bottom of the container 1 in registration with the front opening 17 . as soon as the lowermost box 13 a is tilted downward , it disengages the box 13 b above it except for a line of engagement along the bottom rear edge of the box 13 b . this greatly reduces the amount of friction between the boxes 13 a and 13 b and the force which must be exerted on the lowermost box 13 a to withdraw it from the container 1 below the force that would have to be exerted if the lowermost box 13 a were withdrawn while its entire surface area within the container 1 was in engagement with the bottom surface of the box 13 b immediately above it . as the lowermost box 13 a is withdrawn a short distance through the opening 23 , the rear end of the box 13 b immediately above drops until its lower rear edge meets the floor 33 as can be seen in fig7 and 8 . at this time the box 13 b is in a stable disposition with its front bottom edge resting on the supports 25 and rear bottom edge resting on the floor 33 . hence the box 13 b can no longer move with and follow the box 13 a beneath it . this desirable result enables withdrawal of the lowermost box 13 a through the opening 17 to be continued free of any friction between boxes 13 a and 13 b . the only possible friction is between the box 13 a and the floor 33 due only to the weight of the box 13 a which is free of the weight of the stack above . even this relatively small amount of friction may be alleviated if the box is lifted off the floor 33 as it is withdrawn through the opening 17 . the floor 33 of the container 1 is optional and not necessary to its dispensing function . however , the floor 33 provides a smooth surface for withdrawing the box to be dispensed with little friction and also enhances the rigidity of the container 1 . another benefit of the floor 33 is that it protects the boxes 13 from the surface of the countertop on which the container 1 is placed including any debris which may be present on the countertop . for portability , the container 1 may be collapsed by inwardly folding adjacent panels along diagonally opposed vertical edges . if present , a floor or ceiling panel can be removed . to facilitate removal and replacement of the floor or ceiling panel , the panel ( s ) may be fastened in place by removable push pins ( not shown ) insertable from outside of the container into adjacent edges of the floor / ceiling panel ( s ). the brackets 25 may be right angle brackets made from any rigid material including metal or plastic . for maximum strength , the brackets 25 can be inserted through horizontal slots 21 scored into the front panel 3 of the container 1 . referring additionally to fig9 , the inside surfaces of the vertical arms of the angle brackets 25 facing the outer surface of the front panel 3 can be coated with a pressure - sensitive adhesive covered by a peel away strip and pressed against , and thereby affixed to , the front panel 3 . the horizontal arm of each angle bracket 25 rests on , and is supported by , the exposed inside edge of its respective slot 21 for stability and strength . alternatively , as shown in fig1 , the vertical arm of the bracket 25 can be apertured for receiving an expandable push pin fastener that can be inserted through the front panel 3 and the vertical arm from either side . other types of conventional fasteners may employed as will be known to those skilled in the art . it is important that the portion of the fastener that extends into the interior of the container 1 not penetrate deeply enough to interfere with the downward movement of the stack of pizza boxes as each lowermost box 13 a is withdrawn . in instances where an adhesive used to affix the brackets forming the supports 25 to the panel on which the brackets are mounted is strong enough to withstand shearing forces on the inside surfaces of the container 1 due to the weight of the stacked boxes 13 , the rear surfaces of the vertical arms of the brackets 25 can be adhered to the inside surface of the front panel 3 of the container 1 without forming , or inserting the brackets through , slots in the front panel 3 of the container 1 . here , too , a peel off strip can be used to expose an adhesive on the rear of the brackets &# 39 ; vertical arms which can then be pressed against the inside facing surface of the front panel 3 . it is to be noted that the front supports 25 can be affixed not only to the front panel of the container 1 but also to the inside surfaces of the side panels 7 , 9 of the container 1 at positions adjacent to the front panel 3 . it is desirable that the inner dimensions of the container 1 , that is the length and width , be only slightly larger than the length and width of the largest size pizza boxes to be stored in and dispensed from the container 1 . in order to prevent jamming of the pizza boxes within the container 1 , it is preferable to have each of the length and width of the inside of the container 1 exceed the outside length and width of the largest sized pizza boxes by ⅛ to one ¼ inch . a single container 1 may accommodate stacks of pizza boxes of smaller than the largest size by employing supports having horizontal members which protrude into the container 1 by an appropriate distance in order to maintain the above stated relationship by which the front supports 25 , on the one hand , and the rear wall 5 , on the other hand , extend toward one another by a distance greater than the distance by which the depth of the inside of the container 1 exceeds the depth d of the pizza boxes 13 . for a container having a width w c and a depth d c housing a stack of boxes having a width w b and a depth d b , the minimum distance s of the rear edge or lip 26 of each front support 25 from the inner surface of the front panel 3 may be computed as follows . referring to fig1 , for a front support having an upper surface at a elevation e above the floor 33 , the d c − s =√{ square root over ( )}( d b 2 − h 2 ) s = d c −√{ square root over ( )}( d b 2 − h 2 ) where the supports 25 are mounted on the side panels 7 , 9 , the edges most distal from the front panel and proximate the rear panel should be a minimum of distance s from the inside surface of front panel 3 . where boxes for large size pizzas are to be stacked , each having a depth d b and width w b of 16 inches , and a height h of two inches , and the container 1 was a depth d c and width w c of 16 . 5 inches the following dimensions for the container 1 have been found to be desirable . elevation of front support 25 above floor 33 = 5 inches for the same container 1 as in example 1 above , where boxes for medium size pizzas are to be stacked , each having a depth d b and width w b of 14 inches , and a depth d of two inches , elevation of front support 25 above floor 33 = 5 inches for the same container 1 as in examples 1 and 2 above , where boxes for small size pizzas are to be stacked , each having a depth d b and width w b of 12 inches , and a depth d of two inches , to allow for slight variances in the dimensions of the container 1 and boxes 13 , it is preferable that the actual distance of the rear lip 26 of each front support 25 from the inner surface of the front panel 3 be ½ to 1½ inches greater than s . in certain environments , it may be desirable to place the container 1 under a counter or elsewhere on the floor of the establishment instead of upon an elevated countertop . in fig1 , there is shown an alternate embodiment of the invention in the form of container 1 ′ which is substantially identical to container 1 with the following differences which allow for its use in an inverted disposition whereby boxes can be dispensed from near the top of the container 1 ′. referring now to fig1 , a fixed panel 4 ′ forms a ceiling of the container 1 ′ and another fixed panel 33 ′ forms a floor of the container 1 ′ when container 1 ′ is inverted with respect to the normal orientation of container 1 . the floor panel 33 ′ is removable or hinged along one edge so that it may be moved out of the way with the container turned over to permit boxes 13 to be inserted into container 1 ′ before turning the container 1 ′ back to the position ready for dispensing the boxes 13 as shown in fig1 . seated atop two coil springs 12 ′, 12 ′ fixed to the upper surface of floor 33 ′ is a pusher in the form of a planar panel 14 ′ which is movable in a vertical direction for urging a stack of pizza boxes 13 upwardly against the force of gravity whereby the front upper surface of the topmost box 13 a ′ engages an undersurface of each support 25 ′ in the container 1 ′ and the rear upper surface of the topmost box 13 a ′ engages the ceiling panel 4 ′. the boxes in the stack 13 ′ are inverted relative to their dispositions when used on a countertop in container 1 so that when withdrawn they are in an upright position for enabling the top of each box 13 a ′ to lifted for opening the box 13 a ′ without first having to turn it to an upright position . the springs 12 ′, 12 ′ shown fully compressed when the container is filled with boxes 13 are long enough to raise the bottommost box 13 c ′ to a position where the front upper surface of the box 13 c ′ engages the undersurface of each support 25 ′ in the container 1 ′ and the rear upper surface of box 13 c ′ engages ceiling panel 4 ′. although two coil springs have been shown in the drawings , it is possible to employ a single spring of large enough diameter , preferable at or near the center of the pusher 14 ′. when the box 13 a ′ is to be withdrawn from container 1 ′, it is pushed rearwardly through the rear opening 23 ′ against the opposing force of the elastic band 6 ′ far enough for the front of the box 13 a ′ to clear the supports 25 ′ and be raised to an elevation whereat it can be withdrawn through the front opening 3 ′ without obstruction . container 1 ′ can be employed atop a counter in a disposition like container 1 shown in fig5 or on a floor in the position shown in fig1 by inverting it . it is to be appreciated that the foregoing is a description of a preferred embodiment of the invention to which alterations and modifications may be made without departing from the spirit and scope of the invention .	1
several embodiments of the principle of the present invention are described in the following detailed description . two embodiments exemplify the hard - wired method described above and two exemplify a software - based approach and a composite approach . the embodiment exemplified in fig2 shows a display module 10 with three leds ( led r , led g and led b ) in a common - anode configuration , supplied with current through resistors r 1 - r 9 and switches sw r , sw g and sw b . in this and later embodiments , the switches could be electronic ( bipolar transistors or mos transistors , for example ) or electromechanical ( reed relays , for example ). closure of any one switch causes currents to flow through all three leds . the resistors r 1 , r 4 , r 7 connected to the “ red ” switch sw r are chosen to set a desired operating current in the red led ( led r ), and to set currents in the green and blue leds ( led g and led b respectively ) to bring the combined light - output to a pre - determined corrected - red colour . when switch sw r is closed , as shown in fig2 a main current set by resistance r 1 passes through led r , which provides most of the light output from the module . simultaneously , correction currents set by r 4 and r 7 pass through led g and led b respectively , whose light output combines with that of led r to produce the corrected red primary colour . the resistors r 2 , r 5 , r 8 and r 3 , r 6 , r 9 connected to the green and blue switches , sw g and sw b respectively , are determined in an analogous way . [ 0039 ] fig3 illustrates an example of how a repetitive cycle may be established to share time among the three switches sw r , sw g and sw b of fig2 . the cycle may be divided into three or more phases , not necessarily of equal duration . each switch may be open or closed during its phase of the cycle , according to the desired output , but is open during phases allocated to other switches . preferably the cycle rate is sufficient to avoid visible flicker . in the example shown , sw r is closed during part or all of the red phase , allowing a main current to flow through the red led r and correction currents to flow through the green led g and blue led b . within the green and blue phases , similarly , main currents and correction currents can flow through switches sw g and sw b during intervals for which they are closed . the intensity of each corrected colour can be controlled by varying the proportion of available time that its corresponding switch is closed . this technique ensures that the proportions of the uncorrected colours in a corrected colour remain constant as the corrected - colour intensity is varied . in fig3 the switch - closures are shown as starting at the beginning of their allotted phases , but this is not a necessary restriction to the circuit &# 39 ; s operation . the current - determining resistors r 1 - r 9 in fig2 may be replaced by current sources ( switched current mirrors , for example ), in order to gain immunity to variation of led characteristics with ambient temperature . an alternative way of using the module in fig2 is to cause more than one switch to be closed simultaneously . the currents contributed to a particular led by different switches may be approximately , but not exactly , additive . if current mirrors were used , as suggested above , the currents could be made truly additive . the advantage of simultaneous closure is an increase in the duty - cycle of each led , and a consequent increase in maximum intensity for a given maximum led current . the above embodiment may be modified in an obvious way to accommodate a common - cathode led pixel module . the embodiment exemplified in fig4 shows a display module with four leds ( r , g 1 , g 2 and b ) arranged in a bridge configuration . for the sake of example , two green leds ( g 1 , g 2 ) and one each of red ( r ) and blue ( b ) are included in the module , but this choice is not essential to the invention or its embodiment . like the embodiment of fig2 the latter embodiment provides a means of setting main and correction currents in each led . the master switches , m1 and m2 , are opened and closed in a cyclic sequence of phases which include the switch - states : both open , m1 closed ( m2 open ) and m2 closed ( m1 open ). the durations of the phases may be fixed , but not necessarily equal . the master switches can be common to an array of led modules . preferably , the repetition rate of the cyclic sequence is sufficient to avoid visible flicker . [ 0044 ] fig5 illustrates a cycle in which there are four phases , the durations of which are determined by opening and closing master switches m1 and m2 of fig4 . one of the colour - selection switches sw r , sw g or sw b may be closed for part or all of each phase - interval , subject to a restriction that only a sub - set of the colour - selection switches is permitted to close within each phase . for example , in the particular circuit of fig4 sw r may close only when m1 and m2 are both open ; sw b may close only when m1 is open and m2 is closed , and sw g can be closed when either m1 or m2 is closed and the other master - switch is open . any corrected colour can be emitted by closing one of the colour switches sw r , sw g , sw b during all or part of the master - switch phase with which it is associated . for example , if m1 and m2 are open and sw r is closed , the current through the red led ( labelled r ) is determined by a combination of r 1 and r 5 ( in series with r 4 , which is small ). correction currents are supplied to the blue ( b ) and green ( g 2 ) leds through resistor r 2 , with r 3 and r 6 determining the proportion that flows through g 2 . similar arguments apply under other conditions : when m1 is closed and the sw g is closed ( with main current through g 1 ), when m2 is closed and sw g is closed ( with main current through g 2 ), and when m2 is closed and sw b is closed ( with main current through b ). the circuit shown in fig4 is merely one example . its details depend on the relative voltage - drops across leds of different nominal colours . an important feature of this circuit is that colour - correction can be associated with an individual led pixel module , using master phase switches common to several modules , and switches for individual modules that activate each colour during part or all of a master - switch phase . a further embodiment may use a digital processor and memory to control the duty - cycle of each led in the display module , or an array of display modules . whereas in the previous embodiments , colour - correction was performed by resistive circuits uniquely associated with each pixel , in this embodiment the circuit may be simplified and the intensity and colour characteristics of each pixel may be stored in memory , as a look - up table for example , and accessed by the processor in order to determine the time - intervals for which each led should be switched on . by way of example of the latter embodiment , fig6 shows an array of common - anode display modules ( dm 1 , 2 , 3 , . . . , n ) and associated switches . the particular embodiment illustrated in fig6 uses one set of switches ( sw 1 , sw 2 , sw 3 , . . . , sw n ) to select which module is being activated , and a second set of switches ( sw r , sw g , and sw b ) to select the nominal led colour of whichever module has been selected . this arrangement is merely one example ; if sufficient outputs can be derived from the computer processor ( not shown ), the leds in an array can all be switched individually . this may provide higher average intensity for given maximum led current than the arrangement illustrated . a key advantage of the latter embodiment is the simplicity of the hardware . in order to set a particular display module to an arbitrarily - specified colour , the processor may access the stored calibration data for the leds , r , g and b , of which the module is composed . it may then calculate the required time - intervals for the red , green and blue switches , sw r , sw g and sw b , and turn the switches on and off in a cyclic manner , at a rate sufficient to avoid flicker . in order to clarify the processor &# 39 ; s task , it may be assumed that the calibration data for a display module is expressed in terms of the proportion of the time for which each led in the circuit of fig6 must conduct to produce each corrected primary colour of specified maximum intensity . such calibration data would be specific to the resistor - values r 1 , r 2 and r 3 and the power - supply voltage , as well as to the characteristics of the leds in an individual display module . for example , colour - corrected red might require the red led r to conduct for 32 % of the time , the green led g to conduct for 5 % of the time , and the blue led b to conduct for 2 % of the time . such calibration data may be expressed as a set of linear equations , or as a matrix equation , such as : [ corrected red corrected green corrected blue ] = [ a 11 a 12 a 13 a 21 a 22 a 23 a 31 a 32 a 33 ]  [ uncorrected red uncorrected green uncorrected blue ] ( 1 ) where a 11 = 0 . 32 , a 12 = 0 . 05 and a 13 = 0 . 02 in the numerical example , and the matrix coefficients are to be interpreted as the proportions of time for which the uncorrected primary colour leds are to be switched on in order to produce the corrected primary colours at full intensity . the operation on the right - hand side of the equation is a conventional matrix multiplication . it may be assumed that the data to be displayed is expressed in terms of the amounts of ( corrected ) primary colours required to produce a particular intensity and hue in each display module . this would be so for the rgb signals supplied to a colour television or video - display monitor , for example . the amounts of corrected red , blue and green can be specified by coefficients b 1 , b 2 and b 3 , as follows , desired   colour = [ b 1 b 2 b 3 ]  [ corrected red corrected green corrected blue ] ( 2 ) the proportions of time , for which the uncorrected primary colour leds need to be switched on , follow directly by substituting equation ( 1 ) into equation ( 2 ) and performing the multiplications and additions implied by their combination . this calculation may be performed by the processor for each pixel module , using its individual calibration data and the primary - colour amounts specified by some external device , such as a video - signal source . the processor is required to turn switches ( sw 1 . . . sw n and sw r , sw g and sw b ) on and off at appropriate times to achieve the calculated time - proportions and to do so at a rate sufficient to avoid flicker . if the output lines that are available from the processor are insufficient for the embodiment illustrated in fig6 addressable latches can be used to drive the switches . the processor may only need to address each latch briefly , compared to the cycle - period , in order to change its state and turn the associated switch on or off . an alternative way of using the circuit in fig6 is to switch on each of the colour - correction leds for part of the conduction interval of the led whose colour is being corrected . using the same numerical example as before , a half - maximum - intensity colour - corrected red would be obtained by switching the red led on for 16 % ( 50 % of 32 %) of the repetitive cycle , and within the same part of the cycle , switching the green and blue leds on for 2 . 5 % and 1 % of the cycle - period . this method may reduce the computational load on the processor . the embodiment shown in fig7 is a composite scheme , illustrating several of the features described earlier . the display modules dm1 - dm8 may be similar to those in fig6 which is what the module representation in fig7 is intended to imply . alternatively , with minor changes to the circuit , the display modules may take the form illustrated in fig2 or fig6 . the detailed form of the display modules is not a central issue in this embodiment . the point is that the concept of fig7 can be applied to various forms of display module , because it allows both the upper and lower switches ( shown as transistors ) to be controlled by the processor . either the upper or lower switches , or some combination of them , can be common to a number of display modules . [ 0058 ] fig7 shows the use of addressable latches al1 to al3 to demultiplex a limited number of output lines from a processor , as described earlier . only eight modules are shown , but the principle can be extended in an obvious way to a larger number of modules , preferably a power of two , eg . 16 , 32 , 64 . . . . with reference to the diagram , a particular module is selected by the address lines ( a2 , a1 , a0 ). a particular led colour , corrected or uncorrected depending on the form of the module , is selected by asserting an enable input ( e r , e g or e b ) of one of the three latches . with appropriate relative timing of the processor outputs , the new state of the selected latch is determined by a high or low logic level on the data output . the processor needs to address a particular latch twice per cycle : once to turn the associated led ( or combination of leds ) on and once to turn it off . the power - on reset may be used to ensure that all latches are in a known state when power is first applied to the circuit . [ 0059 ] fig8 shows a display component including a linear array of display modules 11 , together with electronic driving circuits for the array . the component may be built on a ceramic substrate 12 , with printed thick - film conductive tracks 13 and resistors 14 , or by using conventional printed - circuit construction , and / or other technology . driver transistors 15 , leds 16 and integrated circuits 17 used for controlling led currents may be either surface - mount packaged components soldered to printed pads , or die - form devices with wire - bond connections to the pads . each display module 11 includes a row of three or more leds 16 , nominally red , green and blue primaries , enclosed within one compartment of a reflector 18 and encapsulated in an optically - translucent medium 19 ( refer fig9 ) that scatters and diffuses light output . in fig8 reflector 18 is raised from substrate 12 to reveal leds 16 underneath . in practice it may sit directly on substrate 12 , near its edge . one purpose of optical medium 19 is to mix the three primary colours , so that a display module 11 is not perceived as three separate sources of light . another purpose of optical medium 19 is to spread radiated light over a relatively wide angular range , so that display module 11 approximates a lambertian source , presenting a consistent brightness and colour from different points of view . driver transistors 15 that supply currents to leds 16 are mounted behind reflector 18 , together with resistors 14 . the values of resistors 14 set the main and correction currents for each led 16 . in a preferred embodiment , resistors 14 may be in the base circuits of transistors 15 , which are operated in an unsaturated mode , so that the led currents are relatively independent of led voltage - drop . alternative circuits could use saturated transistors , with series collector resistors to define the led currents , or current - mirror circuits , which would almost eliminate any dependence of led currents on the current gains of the transistors . digital circuits for switching transistors 15 on and off may also be mounted on substrate 12 , as an integral part of the display component . an advantageous feature of the aforementioned embodiment of the invention is that thick - film resistors 14 may be adjusted in value , using laser - trimming equipment for example , to adjust the currents of leds 16 to desired values . in this way , parameter variations of transistors 15 and leds 16 may be compensated during the manufacturing process . the laser - trimming process can be actively controlled by feedback from an instrument that measures the intensity and chromaticity of each led 16 . by this means , led currents can be set to achieve consistent target values of intensity and chromaticity for compensated primary colours . it is evident that trimming resistors 14 during manufacture of the display component obviates the need for further adjustment , calibration or software compensation of the array of display modules when it is incorporated into a larger item of equipment , such as a video display panel . the thick - film technology described above may also facilitate temperature - compensation of the display - array . resistive inks used to print resistors can be chosen to have desired temperature coefficients , appropriate to counteract thermal - dependencies of transistors and leds , which are likely to be significant over the operating temperature range of a typical installation . an alternative , or complementary , method of temperature compensation may be to adjust the supply voltage to the complete circuit in response to operating temperature . the display - array component may typically be used by grouping a number of such components into a rectangular array or tile , constructed as a row of parallel substrates supported by an orthogonal motherboard or back - plane . a number of these tiles would then be assembled to construct a larger display panel , containing many thousands of display modules if television or computer - monitor level of resolution is required . in order to reduce visually - obtrusive borders between linear arrays when they are grouped into tiles , the top edge of reflector 18 and the edges of the divisions between its compartments may be brought forward of substrate 12 , as shown in the cross - sectional view of fig9 . these edges can be made substantially thinner than substrate 12 . the diffusing medium 19 can fill the space enclosed by reflector 18 , including the region immediately in front of substrate 12 . if the lines of demarcation between display modules are regarded as obtrusive , a moderately - diffusing screen 20 could be placed in front of the whole array . the shape of reflector 18 may be chosen to provide a fairly broad angular distribution of light output , which may be further broadened and smoothed by the diffusing medium 19 . to this end , the reflector compartments may be curved in two planes : in one shown by the cross - section of fig9 and in a plane orthogonal to the cross - section . finally , it is to be understood that various alterations , modifications and / or additions may be introduced into the constructions and arrangements of parts previously described without departing from the spirit or ambit of the invention . [ 1 ] y . le grand , light , colour and vision , 2nd ed ., chapman and hall ltd : london , 1968 ; 564 pp . [ 2 ] g . wyszecki and w . s . stiles , color science . concepts and methods , quantitative data and formulas , john wiley and sons , inc : new york , 1967 ; 628 pp . [ 3 ] r . w . g . hunt , measuring colour , ellis horwood limited : chichester , 1987 ; 221 pp . [ 4 ] cie , colorimetry , 2nd ed ., commission internationale de i &# 39 ; eclairage : vienna , 1986 ; publication no 15 . 2 , 77 pp .	6
referring to fig1 , there is shown , as an example , a schematic drawing of a known system 98 for generating high voltages from a battery . the system comprises a battery 100 comprising a plurality of battery cells . the voltage generated by the battery will pass through protection means 101 and be applied to the load 102 across the terminals 104 and 106 . if the load requires a voltage of y volts and each battery cell has a typical voltage of x volts then the total number of cells required in this system can be calculated by x / y . since the cells are series connected , the failure of any one cell will result in failure of the battery . as well , the failure of the protection means will also fail the system . hence , this system is very unreliable . as the battery 100 discharges the output voltage will vary over time and this will be detrimental to the load 102 . reliability of the system can be improved by regularly changing the used battery 100 with a fresh battery . alternatively a second battery can be added to the system to increase redundancy . however , both alternatives are not cost or labor efficient . in another embodiment of this known system 98 , a circuit could be added to each cell of the battery to detect cell failure and subsequently isolate the cell from the battery . however , the addition of circuitry to each cell of a large battery would result in a costly system and high resistance loads on the battery from the circuitry itself . referring to fig2 , there is shown another example of a battery system 198 for generating high voltages having greater reliability than the system of fig1 . in this system there are multiple smaller battery packs 200 to supply the load . this triple redundancy increases the reliability of the voltage source . the each battery circuit comprises a battery pack 200 in series with protection means 201 and voltage blocking element 202 . in the event that a battery pack fails , the blocking element will isolate the failed battery circuit from the other two surviving circuits . the current from each battery circuit is then combined before entering a voltage converter 203 which takes the low voltage of the battery packs and increases it to the required system output voltage 204 required by the load across the terminals 206 and 208 . the advantage of this system is in the redundancy of the battery circuits . any one battery circuit ( or two circuits ) can fail and the system continues to function on the surviving circuit ( s ). a further advantage of this system is the ability to regulate the voltage output 204 regardless of the state of charge of individual batteries . a disadvantage of this system is the requirement for all of the system power to pass through a non - redundant voltage converter 203 . failure of the voltage converter would fail the system . as well , the system will require heavy cable connections between the voltage converter and the batteries to carry the current demanded by the load . another major disadvantage of this system is its inability to select the battery circuits having the greatest state of charge . one battery circuit may end up supplying more of the load than the other two circuits depending on the health of the battery cells , cell voltage , cell impedance and impedance of the series components such as protection means 201 and blocking element 202 . another disadvantage of this system is the threshold of the blocking element 202 which may be only a fraction of a volt . in that case , a battery that has a terminal voltage that fraction of a volt higher than all other batteries in the system will end up providing all of the power . the blocking elements will block current from the two lower voltage circuits . this situation is especially dangerous in systems where a freshly charged battery may be hot - swapped into an active system . referring to fig3 , there is illustrated a schematic of another known method to increase reliability of ups systems . in the system illustrated 302 , each battery 200 in the multiple battery system is serially connected to an independent voltage converter 301 . the advantage of this system is that the failure of any battery or any voltage converter will not render the system inoperable . the disadvantage of this system lies in the tendency for the voltage converters 301 to fail to share the system load . if one voltage converter senses the output 204 as being out of tolerance , it may attempt to supply all the power required to bring the output back into regulation . this problem is exacerbated at high loads as the distance from each battery to the load will result in larger measurement errors and therefore the batteries closest to the load are more likely to supply more of the power to the load . this makes it very difficult to balance power distribution across the batteries 200 . this problem gets progressively more difficult as more batteries are added to the system . the state of charge of the individual batteries is also ignored in this setup . the amount of power delivered by any individual battery is based solely on the accuracy of the control circuitry involved in response to the load . referring now to fig4 there is illustrated a circuit 400 that shows an example of a slightly improved approach to improving reliability of multi - battery systems . in this system there are multiple batteries 200 and multiple voltage converters 401 serially connected to each of the batteries . this circuit includes an analog feedback system 403 that permits each of the voltage converters to sense the overall output voltage 204 . the analogue feedback system ensures that each of the independent voltage converters 401 will sense the identical output voltage 204 . this improves accuracy of voltage regulation but using an analogue signal will have inherent inaccuracies due to how the converters interpret the signal . this may result in a single voltage battery circuit delivering more or less power to the load than the other two battery circuits . this circuit also suffers from inaccuracy because when many batteries are used in a single system the probability of error increases and the distribution of an accurate and noise - free analog signal becomes a challenge . this circuit also ignores the state of charge of the batteries and instead seeks only to balance the amount of power equally among all batteries . referring now to fig5 , there is shown one embodiment of the present invention that overcomes the deficiencies discussed above . the invention comprise a circuit 498 that comprises a plurality of battery circuits each comprising a battery 500 that is connected to and monitored by protection means 501 . generally the circuit will have at least two batteries and each battery will have a battery positive 510 and a battery negative 512 terminal . this combination of batteries will provide the system with the desired level of voltage output and reliability . protection means 501 is connected across the battery positive and negative terminals . the output of the protection means is through protection means positive 514 and negative 516 terminals . the protection means output is feed into energy storage means 502 connected to the positive terminal of protection means . the energy storage means stores energy when it receives a true digital control signal from a logic circuit means 503 . the logic circuit means is a gate that outputs a true digital control signal when the protection signal 505 from protection means 501 and the digital enabling signal 506 from voltage sensing element 504 are both true . the enabling signal is generated by a voltage sensing element 504 connected across the circuit positive and negative terminals . the voltage sensing element outputs a pulse - width modulated or frequency modulated digital enabling signal that varies with the output 204 . if the output is too low , the enabling signal will be true for a larger proportion of time which will cause more energy to be stored in the energy storage means 502 . the energy storage means 502 will discharge its stored energy when the digital input to it is false . the energy storage means will typically be composed of an inductor and at least one transistor . other elements can be added . in another embodiment of the invention the energy can be stored in capacitors . energy storage tends to be proportional with voltage . in the case of an inductor when a battery is connected to an inductor , current will ramp up through the inductor at a rate that is proportional to the inductance and the circuit resistance . the current is therefore essentially independent of voltage . the actual power being stored is therefore proportional to the voltage of the battery since power is equal to voltage multiplied by current . similarly , if the energy storage means is a capacitor , the energy stored is equal to one - half capacitance multiplied by the square of the terminal voltage . therefore , in the case of a capacitor storage element , a battery with a higher voltage will deliver considerably more power to the load due to the squared dependence on voltage . in this way , the battery 500 with the highest potential , which generally relates to state of charge , will also deliver the most energy to the load 204 . this system therefore automatically , and without any specific analog or digital control , has a tendency to cause the battery with the highest capacity to also supply the most power to the load . referring to fig6 , power delivery to the output 204 can achieve lower noise by implementing separate controls to each battery 500 or by grouping the controls such that one energy storage means 502 would be discharging into the load while another energy storage means on another battery is charging . if the operating frequency of the enabling signal from the voltage sensing element 504 is f , then a system with two separate control groups would have an output noise frequency of 2f . higher output frequencies result in lower total noise as filtering elements become more efficient at eliminating noise as frequency increases . it is possible to have as many control signals as there are batteries . the system would time shift each control signal the same amount . for example , if there were two enabling signals 506 from two voltage sensors 504 and the system was operating at an update frequency of 1 khz in a pulse width modulating mode , then the period of the signal is 1 / frequency or about 1 milli - second . the two enabling signals would therefore have similar pulse width and identical frequency , but would be time - shifted by 0 . 5 milli - seconds . if four enabling signals were used , they would ideally be time - shifted by 0 . 25 milli - seconds . in general , where n enabling signals are used and the expected period of anyone signal is t , then each control signal should be time shifted by approximately t / n . protection signals 505 can be generated based on a variety of battery conditions sensed by protection means including , but not limited to , low voltage , high voltage , temperature or high current . the protection signal will allow a given battery to ignore the enable signal 506 that would normally cause power to be taken from the battery . the energy storage means 502 may optionally output a digital disable signal that would cause the charging cycle to terminate prematurely . this signal , which is not shown on fig5 , could be generated in the case of excess heat , current , voltage or magnetic flux . such a signal can also protect the system from a short - circuit on the output 204 . it can also be seen from fig5 and fig6 that any battery or any combination of batteries may be removed from the system at any time . provided the energy storage means 502 is of sufficient size that the remaining energy storage means can power the system , then the system will continue to function normally . although the description above contains much specificity , these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this invention . any digital gates or signals may be easily redefined such that they perform similar functions as inverse logic or using alternate gates or logic topology . logic , analog detection and control means may be implemented using integrated circuitry , microprocessor control , software and wireless control . thus the scope of the invention should be determined by the appended claims and their legal equivalents rather than by the examples given .	7
the present invention includes an apparatus and method to protect the tubesheet of a shell - and - tube heat exchanger , such as a gas heated reformer or enhanced heat transfer reformer ( ehtr ), from metal dusting . this includes partially isolating the tubesheet from the process gas by means of an isolation baffle and sweeping the volume between the tubesheet and the isolation baffle with a gas that will not promote metal dusting , thereby protecting the back of the tubesheet . the present invention provides a means and arrangement to keep the hot process gas on the shell side of the unit from contacting the backside of the tubesheet by providing a zone ( isolated space ) to be swept with a purge gas that inhibits metal dusting , introducing said purge gas into the zone , and allowing that purge gas to mix with the balance of the syngas leaving the unit for further processing . fig1 illustrates a side view of a gas heated reformer such as an ehtr 20 incorporating one embodiment of the present invention . in this embodiment , the purge ports 22 are near the edge of the tubesheet 18 , as shown in fig1 and 2 . some other key features of the invention are discussed below . a gas distribution baffle 38 is provided below the exit nozzle 14 to ensure even flow of gas over all the tubes as the gas travels vertically up the shell side of the ehtr 20 . without this baffle , the gas would tend to short circuit to the exit bypassing those tubes located opposite the shell from the exit nozzle . an isolation baffle 12 is located above the exit nozzle 14 separating the flow path of the combined synthesis gas ( syngas ) from a protected or isolated space 16 between the isolation baffle and the tubesheet 18 . the purge ports 22 in the tubesheet 18 allow a small portion of feed gas to leak through the tubesheet and purge the isolated space 16 between the tubesheet and the isolation baffle 12 . the flow through the purge ports is carefully calibrated to provide a minimum velocity in the annuli ( not shown ) between the tubes 26 and the isolation baffle 12 , and the annulus ( not shown ) between the isolation baffle 12 and the inner wall 28 of the ehtr 20 . the location and spacing of the purge ports is chosen to provide one of several flow patterns in the isolated space between the tubesheet and the isolation baffle . the selection depends on the relative clearances ( the annuli ) between the tubes and the isolation baffle , and between the isolation baffle and the inner wall of the ehtr . in the embodiment shown in fig1 and 2 , the flow is generally across the tube bundle toward the exit nozzle 14 from the inner wall of the ehtr diametrically opposite the exit nozzle . fig2 illustrates the tubesheet 18 with the catalyst containing tubes 26 and the purge ports 22 in the tubesheet . the flow from the purge ports is designed to sweep the entire volume of the isolated space 16 between the isolation baffle 12 and the tubesheet 18 , as shown in fig1 . fig3 and 4 illustrate another embodiment of the invention with the purge ports 22 located more centrally in the tubesheet 18 . in this embodiment , the purge ports are located on a circle with radius r hole circle = r tubesheet *{ square root over ( 2 /)} 2 equation 2 so that there is an equal area inside and outside the “ hole circle .” in this embodiment the flow from the purge ports is from the purge ports outward and inward in the area between the isolation baffle 12 and the tubesheet 18 . in this case , since the purge gas flow does not have as far to travel , there is a greater probability that the flow will be more uniform through the annuli between the tubes 26 and the isolation baffle 12 , and the annulus between the isolation baffle 12 and the inner wall 28 of the ehtr 20 . while the embodiments shown in fig1 - 4 use a portion of the process fluid as the purge gas or sweep gas , there may be situations where that is not desirable . for example , since the purge gas will not be reformed , the concentration of higher hydrocarbons may be unacceptable for downstream processing , or the methane in the feed may increase the overall methane concentration to an unacceptable level . in these cases , a purge gas other than the feed gas may be desired . for example , a stream 32 of steam may be used for purging , as shown in fig5 . steam will adequately purge the isolated space 16 between the isolation baffle 12 and the tubesheet 18 ; and since it introduces no impurities into the process stream , the steam can be added at higher levels than feed gas , if needed . while an internal manifold ( not shown ) could be constructed within the feed enclosure of the ehtr 20 , it is simpler to add the steam through a single external nozzle ( inlet nozzle ) 34 in the sidewall 36 of the ehtr . in this case , since the steam ( purge gas ) will be introduced at a single point rather than in a distributed manner , slightly more steam may be needed to adequately ensure that the steam is properly distributed across all of the annul between the isolation baffle 12 and the tubes 26 , and the annulus between the isolation baffle 12 and the inner wall 28 of the ehtr . other hole patterns through the tubesheet 18 can be used if it is desired to direct the purge gas in a particular manner . for example , the ehtr 20 may have two exit nozzles 14 rather than one . if the exit nozzles are arranged 180 ° apart , the most preferred manner to arrange the purge ports 22 is on the diameter perpendicular to the diameter between the two exit nozzles . other patterns may be preferred for different orientations of the exit nozzles to ensure adequate purging of the isolated space 16 . although illustrated and described herein with reference to certain specific embodiments , the present invention is nevertheless not intended to be limited to the details shown . rather , various modifications may be made in the details within the scope and range of equivalents of the claims and without departing from the spirit of the invention .	5
identical parts are provided with the same reference symbols in all figures . fig1 shows a function plan 2 for planning a control system or an automation system . the function plan 2 is composed , in a modular manner , of individual function modules ( modules 4 for short ) each representing an automation function . each module 4 is - assigned an unambiguous module identifier a , b , . . . , i which can be used to identify it . in the present exemplary embodiment , each module 4 has at least one input and one output , the modules 4 being linked to one another on the signal side by virtue of plan - internal module connections 6 . the inputs are respectively arranged on the left - hand edge of the boxes representing the modules 4 , and the outputs are arranged on the right - hand edge . the connections 6 between the modules 4 are illustrated in fig1 using solid lines . the direction of signal flow - from an output of a module 4 to the input of another module 4 in each case - is illustrated using direction arrows in this case . the module a is distinguished from the other modules b , . . . , i insofar as it has , in addition to a plan - internal input , a cross - plan ( external ) input 8 which receives its input signal from another function plan . inputs which read in process signals and represent an interface to the process to be monitored or controlled by the automation system or to the underlying technical system could generally also be provided . the module f does not have an input connection at all since its input ports which are not identified in any more detail in this case are so - called parameterized input ports in which the respective input signal is predefined independently of the results or output signals from the other modules 4 . the individual steps of the method are explained in detail below using the function plan 2 shown in fig1 : in the first step , all of the modules 4 which do not have any input connections or in which all of the input signals are already present are determined and marked . this generally also concerns those signals which originate from other function plans ( which have already been processed ). in the exemplary embodiment according to fig1 , it can be seen that the module f is the only module which does not have an input connection . therefore , it can be directly allocated the order number 1 . the output signal from the module f is thus also defined , this output signal simultaneously representing the input signal for the module g which is connected downstream of the module f . therefore , the module g can be inserted into the processing order immediately after the module f . it thus receives the order number 2 . the operation is generally continued until no other module can be processed in this manner . for example , that module h which is connected downstream of the module g cannot be directly assigned an order number since it also has , in addition to the ( upper ) input which has already been defined in terms of the signal , a further ( lower ) input whose input signal depends on the signal processing of further modules . the result of the direct determination of the order which has been carried out in advance is illustrated in fig2 . the order numbers which have already been allocated are respectively depicted in this case in the upper left - hand corner of the boxes representing the modules 4 . in the next step , all of the modules 4 are weighted with regard to their subsequent processing . the criteria used for this sorting operation have a decisive influence on the result of the overall process of determining the order . changing the organization and comparison criteria therefore makes it possible to modify the end result in a corresponding manner . an advantageous sorting operation is obtained by using the following comparison criteria , the priority of the conditions mentioned decreasing in the downward direction . that is to say the comparison criterion b ) is used only if two modules 4 to be compared are identical as regards the comparison criterion a ) etc . a ) modules 4 having an order number which has already been allocated b ) modules 4 having a start identifier c ) number of input signals which have been unambiguously determined d ) unambiguous module number or position in the function plan . a start identifier according to criterion b ) is generally allocated to those modules 4 which have an input which reads in process signals . the comparison criteria mentioned in point d ) have a comparatively low priority and are only used to ensure that the method can be reproduced ( determinism ). in the exemplary embodiment , the following sorting results under the prerequisite that the cross - plan input signal at the module a is provided by another function plan , which has already been processed , and has thus been unambiguously determined according to criterion c ): the individual modules 4 are now processed according to the order obtained by means of the pre - sorting operation , in which case a distinction needs to be made between the following cases : the module 4 in question already has an order number . in this case , the operation can be immediately continued with the next module 4 . in the exemplary embodiment , this applies to the modules f and g . otherwise , the module 4 in question is defined as the starting module and the signal path is traced in the forward direction whilst observing the branching rules . beginning with module a and using as a basis the rule that a plurality of output connections of a module are processed in turn from the bottom to the top , the image shown in fig3 results . the operation of tracing the signal path is illustrated in said figure using dashed lines . the module a is followed by c , then d , then e , h and d again . since the module d has already been previously found , forward propagation stops at the module h . the modules found during signal tracing are now assigned the following sequence list . in this case , the modules f and g with a processing number which has already been allocated are placed in front in accordance with convention ( but not necessarily ): the modules organized in this sequence list l 1 can also be assigned a preliminary order number . in this case , it should be borne in mind , on the one hand , that the numbers 1 and 2 have already been allocated in advance to the modules f and g , with the result that the numbering now continues with 3 in the case of the module a . on the other hand , the preliminary numbering may also change once again in the subsequent recursion steps . it is also possible to dispense with allocating preliminary order numbers and instead to operate with the sequence lists only in the manner described below . in the case of this procedure , the order numbers are thus allocated only using the complete sequence list which has been definitively sorted . the signal path traced is now traced back in the reverse direction until a module having a further output connection which has not yet been selected or marked is reached . in the exemplary embodiment , this is the module e having a further output connection to module i . the signal tracing operation thus begins again in the forward direction starting from the module e . the signal path traced is again illustrated in fig4 using a dashed line . since the module a which can be reached from the module i has already been found during the method , forward propagation stops at the module i . the sequence list l 1 obtained in this iteration step thus has only a single list element , namely i . the sequence list obtained in the previous pass is updated by inserting the new sequence list ( only the module i in this case ) into the previous sequence list l 1 immediately after the module e , the positions of the subsequent list elements being shifted backward ( by one in this case ). the updated sequence list therefore looks as follows : the preliminary order of the modules which has been updated in a corresponding manner is again depicted in fig4 . a further propagation phase in the reverse direction follows . this phase finally stops at the module a which also has a second output connection to module b which has hitherto not been traced . the subsequent forward movement ends as early as at module b according to fig5 . the module b is inserted into the sequence list l 2 obtained last immediately after a , the subsequent elements again being shifted backward . the sequence list which has been updated again thus finally has the following form : since all of the modules in the function plan have been processed , the method stops . the image shown in fig5 , in which the definitively allocated order numbers are depicted in all of the modules in the function plan 2 , finally results . on account of the feedback loops , two cycle delays occur , namely during the transition from h to d and from i to a . in the event of a plurality of output connections of a module being processed in the opposite direction from top to bottom , the result shown in fig6 would be produced . the resultant order would be modified somewhat in this case but the quality determined by the number of cycle delays and the incorporation of already existing signals would remain unchanged . if , after all of the outputs of the starting module have been processed in full , further modules which have hitherto not yet been reached were to exist , the recursion procedure according to the original sorting operation ( carried out in step ii . of the method ) would begin from scratch with the next module which has not yet been reached . this would also be the case following premature aborting of the recursion upon reaching a module which has been provided with a start identifier , for example a module which reads in process signals . some special treatments may also be required when determining the order of the modules , in particular in the case of relatively complex function plans . for example , in the case of a function plan which has been segmented into partial plans , it is possible to determine whether a partial plan which contains a module that has been provided with a start identifier likewise inherits this feature for determining the plan order . in particular , modules which read in process signals are granted a higher priority by allocating a start identifier . in addition , there are internal dependences for particular modules , which dependences may likewise have an effect on the processing order . in the case of sequence chains , for example , there is a superordinate top module which is connected , on the output side , to further associated sequence blocks in the same function plan . in this case , it must be ensured that the top module is always executed before the sequence blocks since the sequence blocks which are connected downstream are dependent on the signals generated by the top module . for this reason , such a top module likewise receives a start identifier which is not , however , passed on to the associated plan or partial plan since the dependence is only effective inside the plan . finally , it may also be necessary or expedient to manually influence the processing order for particular plans in order to advantageously modify the sequence of the modules by resorting to empirically obtained know - how , for example .	6
with reference to fig1 there is shown the vehicle &# 39 ; s main engine or prime mover 1 which in many territories for environmental , operational and economic reasons cannot be left running to provide heat , air conditioning , electric , hydraulic or mechanical power to the driver or the vehicle &# 39 ; s ancillary equipment during stops . engine 1 includes a radiator 2 , a thermostat 3 , and a fan 4 in the conventional manner . the fan can be directly , belt or electrically driven with or without a clutch . by driving it electrically or hydraulically , the fan can be used to cool the system &# 39 ; s coolant when the main engine is shut down . an engine - driven coolant circulation pump 5 circulates coolant through the main engine block 1 , and via the coolant lines 6 and 7 and the blower assisted cab heater 8 to an auxiliary power unit 10 when the prime mover is running . the engine block can have an electrically powered block heater 9 . power to this heater can come from shore power or the vehicle &# 39 ; s generator 20 . apu 10 has its own circulation pump 11 which circulates coolant via lines 6 and 7 and the heater 8 to main engine 1 . this way , either or both of the engines can run and circulate coolant for preheating and standby heating of both engines , utilizing waste heat from the combustion process . the apu has a load compensating control of conventional type to compensate for variations to its load . apu 10 powers a hydraulic pump 12 , of such type that it can work with water or a water / antifreeze mixture as the hydraulic fluid . one such commercially available pump is the danfoss nessie . pump 12 can be direct or belt driven and can have a clutch 13 . the pressure line 14 from pump 12 can be connected to a pressure relief valve ( safety valve ) 15 , which opens at overpressure to dump the hydraulic fluid back into the main cooling system . pressure line 14 is shown as being split to direct hydraulic fluid to hydraulic motors 16 and 17 via a valve 18 . valve 18 can be an on / off type for dumping fluid back into the system when in the off position , and / or a constant flow type for maintaining motor 16 at a uniform speed so that connected generator 20 delivers a constant voltage or constant frequency or both . alternatively , motors 16 and 17 can be of a constant rpm type with manual or automatic displacement regulation . motor 17 drives an air conditioning compressor 39 via a belt , fixed coupling or temperature or pressure regulated clutch 19 . motors 16 and 17 are shown connected in series but could alternatively be connected in parallel . a diverter valve 21 allows part of or all of the flow from hydrostatic pump 12 to be directed to a choker valve 23 which can be either manually or electrically controlled or , as shown in fig1 by means of an hydraulic cylinder 24 having an electrically powered valve 25 receiving signals from a temperature sensor 26 placed in the cooling circuit . the purpose of the choker valve is to create resistance , friction and / or turbulence to transform hydrostatic power into heat in the coolant and also to increase the load on apu 10 in order to create more waste heat . the operation of the choker valve is controlled and determined by the temperature in the coolant which is monitored by sensor 26 . with choker valve 23 closed such as by means of an override switch 27 , the hydraulic flow from diverter valve 21 is directed to an hydraulic valve bank 28 which regulates flow to one or more hydraulic cylinders , motors or actuators 29 used , for example , to actuate tailgates , loading ramps , cranes or other power equipment . the return fluid is dumped back into the main cooling system via return line 33 . in the event that single ram or single stroke hydraulic cylinders are connected into the system , a make up tank and breather cap 30 will absorb any surge in the coolant / hydraulic system . environmentally sensitive components of the present system are shown placed within a protective enclosure 31 . as will be appreciated from the foregoing by those skilled in the art , the present system permits the integration of what previously have been two entirely separate systems , namely a hydrodynamic one characterized by high flow rates and low pressures exemplified by cooling systems , and a hydrostatic one characterized by low flow rates and high pressures exemplified by hydraulic equipment . the integration permits the use of a single fluid for both systems advantageously drawn from a single source which further facilitates elimination of redundancies in fluid storage , cooling and plumbing . the above - described embodiments of the present invention are meant to be illustrative of preferred embodiments of the present invention and are not intended to limit the scope of the present invention . various modifications , which would be readily apparent to one skilled in the art , are intended to be within the scope of the present invention . the only limitations to the scope of the present invention are set out in the following appended claims .	5
a preferred embodiment of the present invention will now be described with reference to the attached figures , in which the same reference numerals are used to identify the same elements throughout the several views . referring to fig4 a , 5b , 5c and 5d , a cutting tip 2 is formed by assembling a tip core 10 , a skirt 30 and a mixer 50 . the cutting tip also includes a rubber o - ring 22 which cooperates with the mixer end 14 of the tip core in order to seal a cutting oxygen passage 16 , as will be further described below . the tip core can be formed as a hollow cylinder , and is preferably formed from copper tubing . it has an outlet end 12 , a mixer end 14 and the longitudinal cutting oxygen passage 16 extending between the ends 12 and 14 . the exterior periphery of the tip core has a taper 19 adjacent the outlet end 12 , for example one formed by swaging , and a reduced diameter discharge passage 18 . preferably , an annular , arcuate chamfer is formed around the discharge passage 18 at the outlet end 12 . the skirt 30 , which is also preferably formed from copper tubing , has an outlet end 32 and a mixer end 34 . a portion 36 of the length of the skirt adjacent the outlet end 32 is tapered by swaging . in addition , a plurality of circumferentially spaced swaged grooves 38 , extending substantially in the direction of the length of the skirt , are formed in the internal surface of the skirt at the tapered outlet portion 36 . the outer periphery of the skirt adjacent the mixer end 34 has screw threads 40 . the mixer 50 is preferably formed from machined brass . it forms a cap having a generally stepped conical shape with an axial bore 51 extending from its large diameter end 52 to its small diameter end 54 . the bore is also stepped so as to form a large diameter threaded section 56 , a smaller diameter passage section 58 , a yet smaller diameter core fitting section 60 and a cutting oxygen inlet opening 62 . the sections 56 , 58 and 60 are separated by steps or shoulders . moreover , the passage section 58 is tapered such that its diameter progressively increases toward section 56 . a circumferentially spaced plurality of tangential fuel gas inlet passages 64 extend through the peripheral wall of the mixer so as to reach the passage section 58 of the bore . the fuel gas is preferably acetylene , although other fuel gases may be used . a circumferentially spaced plurality of tangential preheat oxygen inlet passages 66 also extend through the peripheral wall of the mixer to a smaller diameter portion of the passage section 58 of the bore , at a position axially offset from the inlet passages 64 . as best seen in fig5 d , the inlet passages 64 and 66 have mutually opposite orientations , as will be discussed further below . as best seen in fig4 the mixer end 14 of the tip core 10 is fitted into the bore of the mixer 50 until it is snugly fit within the core fitting section 60 of the bore . at this time , the o - ring 22 is also fitted in the core fitting section and is held between the mixer end 14 of the tip core and a shoulder 61 at the bottom of the core fitting section 60 . at the time , the cutting oxygen passage 16 communicates with the cutting oxygen inlet opening 62 , and is sealed from the remainder of the bore 51 by the o - ring 22 . the skirt 30 is then concentrically fitted over the core tip 10 so that its mixer end 34 fits into the large diameter threaded section 56 of the mixer bore , after which the skirt can be threaded onto the mixer 50 by cooperation of the screw threads 40 of the skirt and screw threads 57 in the threaded section 56 of the bore . as the skirt is threaded into the mixer , the tapered inner surface of the tapered outlet portion 36 of the skirt approaches and contacts the tapered outer surface 19 adjacent the outlet end 12 of the tip core . the angle of taper of the tapered surface 19 of the tip core and the angle of taper of the tapered outlet portion 36 of the skirt are matched so that the two have a continuous surface contact , except for the grooves 38 . the grooves 38 and the tapered surface 19 therefore cooperate to form a circumferentially spaced plurality of longitudinal outlet passages 70 which emerge from the tip at the outlet ends 12 and 32 of the tip core and skirt , respectively . once the skirt 30 is threaded tightly on the mixer 50 , the tapered portion 36 of the skirt securely holds the tip core 10 in the position shown in fig4 with an annular passage 72 being located between the tip core and the skirt along the entire length of the skirt , except for the portion having the outlet passages 70 . in addition , the tip core is spaced from the wall of the mixer in the passage section 58 so as to form an annular space 74 which comprises a tapered axial extension of the annular passage 72 . due to the taper of the passage section 58 , the sectional area of the annular space progressively increases toward the annular passage 72 . the assembled cutting tip 2 can then be inserted in a conventional cutting torch head 76 , as shown in fig4 . the cutting torch head has conventional inlets 78 , 80 and 82 for a fuel gas such as acetylene , preheat oxygen and cutting oxygen , respectively . in operation , preheat oxygen is supplied to the preheat oxygen inlet 80 of the cutting torch head , from which it reaches an annular manifold chamber 81 surrounding the mixer in the region of the circumferentially spaced preheat oxygen inlet passages 66 . a flow of preheat oxygen is thus charged into the annular space 74 via the preheat oxygen inlet passage 66 . since the preheat oxygen inlet passages 66 extend tangentially with a counterclockwise orientation ( fig5 d ), the charged preheat oxygen will have a counterclockwise ( first ) circumferential flow velocity component . moreover , the preheat oxygen will form a vortex having an axial component directed toward the outlet of the tip , due to the taper of the passage portion 58 , and so the counterclockwise swirling preheat oxygen will move axially toward the position of the fuel gas inlet passages 64 . fuel gas is supplied to the fuel gas inlet passages 64 via the fuel gas inlet 78 in the cutting torch head and the annular manifold chamber 79 surrounding the mixer in the region of the fuel gas inlet passages 64 . the circumferentially spaced fuel gas inlet passages 64 are also tangential , but with a clockwise orientation . therefore , the fuel gas will enter the annular space 74 with a clockwise ( second ) flow velocity component , i . e ., a circumferential flow velocity component which is opposite to that of the preheat oxygen . the interaction of the circumferentially oppositely directed fuel gas and preheat oxygen flows will cause a very rapid and aggressive mixing of the gases , while canceling the opposed circumferential flow components . as a result , there will rapidly form a substantially homogeneous mixture which is moving substantially axially toward the tip outlet with no circumferential or swirling flow components . a laminar gas flow can therefore rapidly be achieved . according to a further feature of this embodiment of the invention , the sectional area of each of the outlet passages 70 progressively decreases along its length by 30 % of its original value , in the gas flow direction . that is , the sectional areas of each of the grooves 38 progressively decreases in the flow direction from the annular passage 72 toward the outlet end 32 of the skirt . it has been found that this convergence improves the ability of the flowing gas mixture to achieve a laminar flow at the outlet of the cutter tip . fig6 and 7a - 7d illustrate the swaging of the skirt 30 . a skirt precursor 30 &# 39 ; in the form of the length of copper tubing having screw threads 40 at one end is mounted on a swaging mandrel assembly 100 , as shown in fig6 . the swaging mandrel assembly includes a mandrel core 102 which can be formed from a steel rod having a threaded axial extension 104 and an opposite , small diameter axial extension 106 . a mandrel grip 108 is rotatably fitted over the small diameter extension 106 and is held in place by the retaining ring 110 . the mandrel grip has internal screw threads 112 which can mate with the screw threads 40 of the skirt precursor . a mandrel head 114 is threaded onto the threaded extension 104 of the mandrel core . the mandrel head is formed of hardened tool steel , preferably machined out of blanks using wire edm ( electrodischarge machining ), and is then nitrided for further hardening . it has a longitudinally tapered surface with longitudinally extending projections 116 which correspond to the internal grooves 38 to be formed in the skirt . fig7 c is a detail showing one of the projection sections 116 &# 39 ; at position c along the length of the mandrel head , while fig7 d shows the projection section 116 &# 34 ; at position d along the length of the mandrel head . as can be seen from these figures , the projections are progressively narrowed so that the grooves 38 will progressively converge with a smaller sectional area , as described above . for swaging , the skirt precursor , which can be partially threaded onto the mandrel grip , is first swaged in a tapered swaging die 118 to form the tapered portion 36 of the skirt . subsequently , the skirt precursor is fully threaded onto the screw threads 112 , as a result of which the mandrel head 114 advances into the tapered skirt precursor ( to the left in fig6 ). as the mandrel head advances , it swages the grooves 38 into the skirt precursor . since the outlet passages 70 are formed by the cooperation of the grooves 38 and the tip core , there is no need to mill , drill or otherwise machine the passages into a metal part , as was required in conventional cutting tips , thereby reducing the cost and difficulty of tip production . moreover , the circumferentially oppositely directed inlets for the preheat oxygen and fuel gas create a swirling flow which promotes rapid mixing , but without leaving a rotating mixture flow . this , together with the converging sectional areas of the outlet passages , promotes the rapid formation of a laminar mixture flow in a short tip length . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein .	8
the ferroelectric liquid crystal compounds of the present invention are prepared according to the following general reaction scheme : ## str6 ## where x = f , cl or br . in general terms compounds of formula i are prepared by deoxygenation of the enantiospecific intermediate epoxy alcohols of formula vii by a modification of the barton procedure ( robbins et al . ( 1983 ) j . amer . chem . soc . 105 : 4059 ; barton and mccombie ( 1975 ) j . chem . soc . perkins trans . 1 : 1574 ). the epoxy alcohols ( vii ) in turn are prepared via an enantioselective epoxidation ( martin et al . ( 1981 ) 103 : 6237 - 6240 and sharpless , u . s . pat . no . 4 , 471 , 130 ) from the allyl alcohols of formula vi . the allyl alcohols ( vi ) are synthesized by reaction of the benzaldehydes of formula iv with the b - alkenyl - 9 - bbn ( 9 - borabicyclo [ 3 . 3 . 1 ] nonane ) of formula v which add across the carbonyl group of the benzaldehyde ( jacob and brown ( 1977 ) j . org . chem . 42 : 579 - 580 ). the benzaldehydes ( iv ) are prepared by esterification of 4 - formylbenzoylchloride with the substituted phenols of formula iii . the 9 - bbn derivatives ( v ) are prepared by a known method by reaction of the appropriate terminal alkyne with 9 - bbn ( brown et al . ( 1979 ) j . amer . chem . soc . 101 : 96 - 99 ). for example , b -[( e )- 1 - octene - 1 - yl ]- 9 - bbn is prepared by reaction of 1 - octyne with 9 - bbn . substituted phenols ( iii ) are either available from commercial sources or are readily prepared by methods known to the art . for example , the preparation of a number of 4 - alkoxyphenols is described in neubert et al . ( 1978 ) mol . crys . liq . cryst . 44 : 197 - 210 . substituted alkoxy biphenols of formula iii ( where n = 2 ) can be prepared by analogous methods . the 4 - decyloxyphenol used in the present work was prepared by the method of neubert et al ., supra . alkyl phenols and alkyl biphenols of formula iii can also be prepared by methods known to the art . compounds of formula ii , epoxy halides , are also prepared from the intermediate epoxy alcohols ( vii ). the epoxy halides can be prepared as a mixture of the threo and erhthro diastereomers which can be separated , for example , by silica column chromatography . alternatively , in most cases , the individual diastereomers can be prepared directly , in isomerically pure form . by appropriate choice of halogenation reagent any of the compounds of formula iia or iib , where x is f , cl or br can be readily prepared using procedures described herein . compounds of formula i , ii and vii each represent one of a pair of enantiomers . the pair of enantiomers of each compound will function in an equivalent manner . for illustration , the structure of the enantiomer of the fluoroepoxide ( iia , where n = 1 , r &# 39 ;= n - decyloxy and r = n hexyl ) is shown : ## str7 ## compound viii will function equivalently to its enantiomer of formula iia in flc materials , except that the sign of p will be reversed . the enantiomers of compounds of formulas i and ii can be prepared from the epoxy alcohol enantiomer of formula vii by the methods described herein . the enantiomers of the epoxy alcohols of formula vii can be prepared by the method of example 3 replacing the l - tartrate reagent with the analogous d - tartrate reagent . if the starting materials 4 - decyloxyphenol and b -[( e )- 1 - octene - 1 - yl ]- 9 - bbn are employed the intermediate epoxy alcohol ( vii ) and subsequently the epoxide ( i ) or epoxy halides ( ii ), where r &# 39 ; is n - decyloxy and r is n - hexyl , result . the liquid crystal properties of the compounds of formula i are illustrated by those of the epoxide i , where n = 1 , r &# 39 ;= n - decyloxy and r = n - hexyl , which is hereinafter designated w203 , while the properties of the epoxy halides of formulas iia are illustrated by those of fluoro ( designated w200 ) or chloro ( designated w210 ) epoxides of formula iia where n = 1 , r &# 39 ;= n - decyloxy and r = n - hexyl and the properties of the epoxy halides of formula iib are illustrated by those of the fluoro epoxide ( designated w199 ) where n = 1 , r &# 39 ;= n - decyloxy and r = n - hexyl . none of the compounds w199 , w200 , w203 or w210 in pure form possesses an enantiotropic or monotropic ferroelectric ( smectic c ) liquid crystal phase . however , when these compounds are mixed with a known flc host material , such as w82 ( formula ix ), mixtures possessing ferroelectroic smectic c phases are produced . ## str8 ## table 1 summarizes the phase transition temperatures , optical rise times and polarization densities of some exemplary mixtures . in table 1 , the phases are noted as x = crystal , i = isotropic liquid , a = smectic a , c = chiral smectic c , n = chiral nematic and phase transition temperatures are given in ° c . optical rise times are measured in response to a driving voltage of 15 v / μm at the temperature given in the table . polarization densities ( p ) are given in nc / cm 2 and the magnitude of p was measured by integration of the dynamic current response on reversing the applied electric field , as described in martinot - lagargde ( 1976 ) j . phys . 37 , c - 3 , p . 129 and martinot - lagarde ( 1977 ) j . phys . lett . 38 , l - 17 . w82 ( ix ) is known to possess an enantiotropic ferroelectric c * phase with very low polarization density of the order of 1 nc / cm 2 and very low electro - optical switching speed of the order of 3 msec ( 1 μm thick layer , ssflc geometry , 15 v / μm driving voltage ). mixtures of the compounds of the present invention , particularly compounds w200 , w203 and w210 , as shown in table 1 , possess ferroelectric c * phases with higher polarization density and or faster switching speeds than w82 . an important aspect of the present invention is the finding that the 1 - haloepoxides of formula iia have properties as flc dopants significantly different from those of formula iib . compounds of formula iia can impart higher polarization densities in flc mixtures . this property can be qualitatively compared in the different diastereomers by comparing the polarization densities of the pure diastereomers which can be extrapolated from polarization density measurements in mixtures . the extrapolated p of w199 ( formula iib ) is about + 25 nc / cm 2 , while that of w200 ( formula iia ) is about - 170 nc / cm 2 . this difference can be discerned physically , since flc mixtures containing the iia isomer will display higher polarization densities ( p ), and higher switching speeds than flc mixtures containing an equal amount of the corresponding iib isomer . it is believed that the difference in polarization densities of iia and iib isomers is due to the relative alignment of the epoxide and halogen bond dipoles in the preferred configuration of the isomers within the flc phase . with the iia isomers the dipoles are aligned in the same direction with respect to the smectic tilt plane , while in the iib isomers the dipoles are opposed , resulting in the higher polarization density of the iia isomer . the relationship between dipole alignment and ferroelectric polarization density has been discussed for related molecules in walba et al . ( 1986a ), and walba et al . ( 1986b ), supra . the difference in polarization between isomers of formula iia and iib is general and qualitatively independent of x and the structure of the core . variation in the structure of the cores and length and degree of branching in the r and r &# 39 ; groups of compounds encompassed in formulas i and ii can affect the liquid crystal properties of the pure material or mixtures containing them . for example , some of the compounds of the present invention may possess smectic c * phases while others do not and the characteristics of any such smectic c * phases ( i . e . stability , temperature range ) may vary . table 1__________________________________________________________________________properties of flc mixtures τ . sub . r temp . pmixture phase sequence μsec ° c . nc / cm . sup . 2__________________________________________________________________________w203 ( 34 %) + w82 x ← 43 → c * ← 56 → n * ← 60 → 67 43w199 ( 7 . 37 %) + w82 x → 53 → c * ← 66 → a ← 70 → 40 + 2 x ← 40 ← c * w199 ( 31 %) in w82 c * ← 58 ← a ← 59 ← n * ← 65 ← i 90 37w200 ( 7 . 58 %) in w82 x → 25 → c * ← 61 . 3 → a ← 66 → i 76 28 - 13w210 ( 18 %) in w82 x → 40 → c * → 50 → a → 61 - 70 → i 130 25 - 15 ← 46 ← a ← 56 - 58 ← i__________________________________________________________________________ this example illustrates the procedure for synthesizing benzaldehydes of formula iv by condensation of an alkoxyphenol ( iii ) with 4 - formylbenzoylchloride . a 1 l flame dried flask equipped with a magnetic stirring bar and a syringe septum was charged with 14 g of 4 - decyloxyphenol ( 55 . 91 mmole ), 9 . 45 g of 4 - formylbenzoylchloride ( 56 . 06 mmole ) and 0 . 82 g of 4 - pyrrolidinopyridine in 500 ml of dry tetrahydrofuran ( thf ). triethylamine ( 8 . 6 ml , 61 . 70 mmole ) was added while stirring vigorously . the reaction mixture was stirred for 1 . 5 h , after which the amine hydrochloride was filtered off and the filtrate was concentrated . the solid obtained was dissolved in 300 ml of ch 2 cl 2 and the solution was then washed sequentially with 75 ml of saturated aqueous cuso 4 , 75 ml of 15 % ( w / v ) aqueous naoh , 75 ml of 10 % ( v / v ) aqueous hcl and 75 ml of saturated aqueous nahco 3 . the washed organic layer was then dried over na 2 so 4 / k 2 co 3 and the solvent was removed in vacuo to obtain 29 g of crude product . recrystallization from 1000 ml 2 - propanol and 600 ml of 33 % ( v / v ) ethylacetate / hexanes afforded 15 . 18 g ( 71 % yield ) of 4 &# 39 ;-( n - decyloxy ) phenyl 4 -( formyl ) benzoate ( iv , where r &# 39 ;= n - decyloxy ). the following example illustrates the synthesis of allyl alcohols of the formula vi by reaction of benzaldehydes of formula iv with b -[( e )- 1 - alken - 1 - yl ]- 9 - bbn , formula v . a 250 ml flame dried flask equipped with a syringe septum , a condenser and a magnetic stirring bar was charged with 10 . 93 g of 4 &# 39 ;- n - decyloxy ) phenyl 4 -( formyl ) benzoate ( 28 . 57 mmole ) in 110 ml thf . to this solution , 11 . 64 g ( 32 . 86 mmole ) b -[( e )- 1 - octen - 1 - yl ]- 9 - bbn ( v , where r = n - hexyl ) was added dropwise , under argon . the reaction mixture was then stirred at room temperature for 2 h , after which it was brought to reflux and stirred overnight . ethanolamine ( 1 . 98 ml , 32 . 86 mmole ) was then added to the cooled ( ice / water ) reaction mixture . the cooled reaction mixture was then stirred for 15 m before the solvent was removed . ether ( 50 ml ) was then added to the reaction concentrate , the mixture was cooled ( ice / water ) and the resulting solid was filtered through silica gel ( 1 inch , in a 11 / 2 in filter funnel ). the solid was eluted from the silica by washing with 20 % ( v / v ) ethylacetate / hexanes ( 6 × 25 ml ). the combined filtrates were concentrated in vacuo and the resulting crude product purified by flash chromatography on silica gel by eluting with 20 % ( v / v ) ethylacetate / hexane to afford 10 . 31 g ( 73 % yield ) of the allyl alcohol 4 &# 39 ;-( n - decyloxy ) phenyl 4 -[( e )- 2 - noneneol ] benzoate ( vi , where r &# 39 ;= n - decyloxy and r = n - hexyl ). this example illustrates the procedure for synthesizing epoxy alcohols of formula vii from the allyl alcohols of formula vi . a 250 ml flame dried flask equipped with a magnetic stirring bar and a syringe septum was charged with 5 . 49 g of titanium ( iv ) isopropoxide ( 18 . 44 mmole ) in 100 ml of ch 2 cl 2 . the solution was cooled to - 30 ° c . while stirring under argon . (+)- diisopropyl l - tartrate ( 4 . 65 ml , 22 . 11 mmole ) was then added to the flask and the mixture was stirred for 20 m . a cold ( ccl 4 / dry ice ) solution of 4 &# 39 ;-( n - decyloxy ) phenyl 4 -[( e )- 2 - nonene - ol ] benzoate ( 9 . 12 g , 18 . 44 mmole ) in 50 ml ch 2 cl 2 was then added to the reaction flask . an additional 34 ml of ch 2 cl 2 was used to wash in any residual allyl alcohol . the cooled reaction mixture was then stirred for 10 m after which 3 . 32 ml of t - butyl hydroperoxide ( 2 . 5m in toluene , 8 . 3 mmole ) was added . the reaction mixture was then placed in a freezer for 18 h . a solution of ferrous sulfate ( 9 . 22 g ) and tartaric acid ( 3 . 7 g ) in 37 ml of water was prepared and cooled ( ice / water ). the cooled solution was then added to the reaction mixture and the mixture was warmed to room temperature and stirred for 1 h . the aqueous and organic solvent layers were separated and the aqueous layer was washed with ether ( 3 × 50 ml ). the ether washings were combined with the organic layer , which was then dried over naso 4 . solvent was removed in vacuo and the resulting oil was dissolved in a minimum amount of 20 % ( v / v ) ethylacetate / hexanes . this solution was filtered through silica ( 2 inches ) which was washed thoroughly with 20 % ( v / v ) ethylacetate / hexanes . the combined filtrate was concentrated and purified by flash chromatography on silica by eluting with 25 % ( v / v ) ethylacetate / hexanes . recrystallization of the product from hexanes at - 20 ° c . resulted in a gel . the recrystallization solution was then centrifuged (- 20 ° c .) and the solvent was decanted from the 4 &# 39 ;-( n - decyloxy ) phenyl 4 -[( 2s , 3s )- 3 - hexyloxirane - 2 -( s ) methanol ] benzoate gel ( vii , where r &# 39 ;= n - decyloxy and r = n - hexyl ; 3 . 73 g , 88 % yield ). this example illustrates the need for synthesizing expoxides of formula i by reduction of epoxy alcohols of formula vii a flame dried 10 ml flask equipped with a magnetic stirring bar and a syringe septum was charged with 0 . 5 g of 4 &# 39 ;-( n - decyloxy ) phenyl 4 -[( 2s , 3s )- 3 - hexyloxirane - 2 -( s ) methanol ] benzoate ( 0 . 98 mmole ) and 0 . 24 g of dmap , dimethylaminopyridine , ( 1 . 96 mmole ) in 6 ml of ch 2 cl 2 . phenyl chlorothionocarbonate ( 0 . 18 ml , 1 . 3 mmole ) was then added by syringe under argon . the reaction mixture was stirred overnight . the reaction mixture was diluted with an additional 10 ml of ch 2 cl 2 and was then washed sequentially with 10 ml of water , 10 % ( v / v ) hcl ( 3 × 10 ml ) and 10 ml of brine . the organic layer was then dried over na 2 so 4 and the solvent was removed in vacuo . the resulting oil was purified by flash chromatography by eluting with 11 % ( v / v ) ethylacetate / hexanes to yield 0 . 61 g ( 97 % yield ) of the phenyl thionocarbonate 4 -[( 2s , 3s )- 3 - hexyloxirane - 2 -( s )- methyl phenyl thionocarbonate ] benzoate as a clear colorless oil . a flame dried , 10 ml three neck flask equipped with a magnetic stirring bar , a condenser and a syringe septum was charged with 0 . 062 g of 4 -[( 2s , 3s )- 3 - hexyloxirane - 2 -( s )- methyl phenyl thionocarbonate ] benzoate ( 0 . 097 mmole ), 0 . 13 ml of tributyltin hydride ( 0 . 48 mmole ) and 0 . 002 g of aibn , azobis isobutyronitrile , ( 0 . 001 mmole ) in 1 ml of distilled toluene . the reaction mixture was degassed with argon ( 20 m ) prior to heating ( 75 ° c ., 1 . 5 h with stirring ). the volatiles were then removed in vacuo , and the product residue was purified by flash chromatography on silica gel by eluting with 11 . 5 % ( v / v ) ethylacetate / hexanes . an essentially quantitative yield of the epoxide 4 &# 39 ;-( n - decyloxy ) phenyl 4 -[( 2s , 3s )- 3 - hexyloxirane - 2 - methyl ] benzoate ( i , where r &# 39 ;= n - decyloxy and r = n - hexyl ) was obtained . this example illustrates the procedure for synthesizing threo and erythro isomers of epoxy halides of formula ii ( a and b ) from epoxy alcohols of formula vii . 4 &# 39 ;-( n - decyloxy ) phenyl 4 -[( 2s , 3s )- 3 - hexyloxirane - 2 -( s ) methanol ] benzoate ( 0 . 5 g , 0 . 98 mmole ) in 80 ml of ch 2 cl 2 was introduced into a 100 ml flame dried flask equipped with a syringe septum and a stirring bar . the reaction flask was cooled in a dry ice / acetone bath after which 0 . 13 ml of diethylaminosulfur trifluoride , dast , ( 0 . 98 mmole ) was added and the cooled reaction mixture was stirred for 2 h . water ( 7 ml ) was added to the reaction mixture , which was then warmed to room temperature . a brine solution ( 10 ml ) was added to the mixture and the organic layer was separated from the aqueous layer . the organic layer was washed with 10 ml saturated nahco 3 and then dried over k 2 co 3 / na 2 so 4 . the solvent was removed in vacuo and the product residue was purified by flash chromatography on silica gel by eluting with 9 % ( v / v ) ethylacetate / hexanes to afford 0 . 46 g ( 92 % yield ) of the epoxy halide 4 &# 39 ;-( n - decyloxy ) phenyl 4 -[( 2s , 3s )- 3 - hexyloxirane - 2 - fluoromethyl ] benzoate ( ii , where r &# 39 ; 32 n - decyloxy and r = n - hexyl ). the product was a mixture of the threo ( iia ) isomer ( 0 . 11 g ; 24 %) and the erythro ( iib ) isomer ( 0 . 35 g ; 76 %). the amount of erythro isomer produced could be increased to about 50 % by doing the dast reaction at higher temperature ( about 0 ° c .). the epoxy fluoride diasteromers were separated by repeated silica gel chromatography ( about 0 . 5 mg of mixture on a 50 mm × 8 in column ) employing 9 % ( v / v ) ethylacetate / hexanes as the eluting solvent . about 5 - 6 passes through the column were required to obtain satisfactory separation . substitution of thionyl chloride for dast reagent in this procedure afforded the mixture of epoxy chlorides , which were readily separated by silica gel chromatography . this example illustrates a procedure for preparing the threo isomer of the halo epoxides of formula iia . a solution of 4 &# 39 ;-( n - decyloxy ) phenyl 4 -[( 2s , 3s )- 3 - hexyloxirane - 2 -( s ) methanol ] benzoate ( 0 . 5 g , 0 . 98 mmole ), triethylamine ( 0 . 3 ml , 2 . 15 mmole ) and dmap ( 0 . 05 g ) in 2 ml of ch 2 cl 2 was cooled ( ice / water ). to this cooled , stirred solution , 0 . 1 ml of methanesulfonyl chloride ( 1 . 29 mmole ) was added . the mixture was stirred for an additional 20 m after which 20 ml of ether was added to the reaction mixture and the organic layer was washed sequentially with 10 % ( v / v ) hcl ( 3 × 10 ml ) and 10 ml of saturated nahco 3 . the washed organic layer was then dried over na 2 so 4 and the solvent was removed in vacuo to give a quantitative yield of the epoxy mesylate , 4 &# 39 ;-( n - decyloxy ) phenyl 4 -[( 2s , 3s )- 3 - hexyloxirane - 2 -( s )- methanesulfonyl methyl ] benzoate . the epoxy mesylate ( 0 . 32 g , 0 . 54 mmole ), licl ( 0 . 06 g , 1 . 42 mmole ) and 2 drops of 12 - crown - 4 in dimethylfuran ( dmf ) was introduced into a 10 ml flame dried flask equipped with a magnetic stirring bar and a syringe septum . the reaction mixture was then stirred for 4 days , under argon . ether ( 10 ml ) was added to the reaction mixture and the mixture was then poured over 10 ml of ice / water . the solvent layers were separated and the aqueous layer was then washed with ether ( 6 × 10 ml ). the washings were combined with the organic layer and dried over na 2 so 4 / k 2 co 3 and the solvent was removed in vacuo . the resulting solid was purified by flash chromatography on silica gel by eluting with 9 % ( v / v ) ethylacetate / hexanes yielding 0 . 22 g ( 76 %) of epoxy chloride , 4 &# 39 ;-( n - decyloxy ) phenyl 4 -[( 2s , 3s )- 3 - hexyloxirane - 2 -( r )- chloromethyl ] benzoate ( iia , where r &# 39 ;= n - decyloxy and r = n - hexyl ). attempts to prepare the analogous threo epoxy fluoride by this procedure ( lif substituted for licl ) were unsuccessful , resulting in opening of the epoxide ring . the invention has been described and illustrated by reference to several preferred embodiments , but it is not intended to limit the invention by doing so . for example , while as noted above , a single enantiomer of each chirally asymmetric compound has been prepared , it is intended that the invention encompass both enantiomers of each compound . it is also intended that the invention include mixtures of the two enantiomers of the same formula in which there is an excess of one enantiomer . it is further intended that the invention encompasss not only the flc dopant compounds of formulas i and ii , but also compositions or formulations in which these compounds are admixed with each other or with other compounds including lc and flc materials .	2
fig1 to 4 a show the cylinder pressure p entered over the crank angle kw . as is clearly shown in fig1 , a pressure increase occurs only after the ignition point zzp in the case of knocking combustion 2 . this increase in pressure after the ignition point zzp is thus a characteristic feature of knocking combustion . the reference pressure curves with regular combustion are designated with reference numeral 1 . the pressure curve in the case of premature combustion 3 , 4 differs substantially from the same , as is shown in fig2 and 3 . fig2 shows a premature combustion 3 with knocking . the feature of this premature combustion is that the pressure increase occurs before the ignition point zzp . a too strong pressure increase before the ignition point zzp leads to the consequence that a strongly superimposed knocking is initiated when at the time of the exceeding of the knocking threshold there is still unburned mixture in the combustion chamber . fig3 shows a premature combustion 4 without knocking . in this case too , the pressure increase occurs clearly before the ignition point zzp . since in this first phase of the combustion the ignitable mixture has been combusted entirely , there is no superimposed knocking . since a premature combustion , with or without knocking , is linked to a strong pressure increase in the compression phase , a distinct recognition of premature combustion with or without knocking can occur at a very early stage , namely in real time , by monitoring the pressure curve in the compression phase . as an alternative or in addition to the evaluation of the cylinder pressure , the recognition of the premature combustion can also be made on the basis of an ionic current signal i at the spark plug , as is shown in fig4 a and 4 b . the cylinder pressure signals p and the ionic current signals i are shown over the crank angle kw for regular combustion 1 and premature combustion 3 , 4 . it is possible to conclude premature combustion from the curve of the ionic current signal i after the end ez of the spark . in the case of a normal combustion 1 , the ionic current signal i has a characteristic curve , with the ionic current signal i dropping suddenly after the end ez of the spark . the drop of the ionic current signal i is followed by a first maximum value 1 a which can be allocated to chemical ionization . a higher second maximum value 1 b which can be allocated to thermal ionization follows at a distance a to the spark end ez , the occurrence of which coincides with the combustion peak pressure . when a premature combustion 3 , 4 occurs , these two maximum values 1 a , 1 b are not distinct . when premature combustion 3 occurs in combination with knocking , a maximum value 3 a can be noticed in the ionic current signal i as a result of thermal ionization , which occurs however earlier than in the case of normal combustion 1 . the amount of maximum value 3 a is substantially larger than the maximum values 1 a and 1 b during normal combustion . a premature combustion 3 with knocking events can be recognized when a maximum value 3 a of the ionic current signal i which can be allocated to thermal ionization lies over a defined threshold value and / or occurs within a defined period a after the spark end ez . the threshold value can be formed for example by the highest maximum value 1 b of the ionic current signal occurring under regular combustion after the spark end ez . when extremely premature combustion 4 occurs without knocking , the ionic current signal curve i has a substantially continually dropping progress ( without extreme values ) after the spark end ez . a premature combustion without knocking events can thus be recognized in such a way that the ionic current signal i after the spark end ez decreases continually at least within the chosen measuring window a , without maximum values occurring . by recognizing the position of the combustion with ionic current measurement or by recognizing the time difference between the ignition spark and the peak pressure position it is possible to reliably distinguish between normal combustion 1 and premature combustion 3 , 4 .	5
referring now to the drawing , a pillow construction in accordance with my invention may be seen . the pillow , generally designated 10 , includes a main body portion 11 and a neck supporting portion 12 , joined in this embodiment at joint 13 . the main body portion 11 and the neck supporting portion 12 are each made of polyurethane foam only of different degrees of firmness ; the neck supporting portion having the greater firmness . overall the pillow 10 , of fig1 is generally t - shaped with the portion 11 corresponding to the head of the t and the neck supporting portion 12 constituting the body of the t . of course , it is obvious in the drawing that the neck portion 12 is smaller than the head portion 11 , and is shorter in the longitudinal direction , measured in the direction of the users spine . the neck portion 12 has a length in this direction of 3 to 5 inches which is sufficient to provide support for the neck . the head portion 11 is longer than the neck portion 12 measured in the same direction , e . g . 8 inches or longer . excess length of the head supporting portion 11 is optional . it is important to note that the head supporting portion 11 is wider than the neck supporting portion 12 resulting in a major feature of the invention . the head supporting portion 11 is at least 8 inches in width dictated by the possibility that sleepers lie on their sides with the side of their face against the pillow . note that the neck supporting portion 12 is slightly wider than the sleeper &# 39 ; s neck . when the sleeper turns to either side , as illustrated in fig4 his head is supported , but his chin and mouth area are not in contact with the pillow 10 , at all . for those who do not like side at pressure on their jaw or their mouth partially buried in the pillow , this new design of pillow provides comfort not heretofore available . for those who must wear orthodontic headgear , i . e . external bracing , one not only provides superior comfort for the sleeper , but it allows such persons to lie on their side on a pillow while wearing headgear for the first time . they also have the privilege of having greater neck support than head support by reason of the dual density or firmness feature described above . for those who are unaccustomed to greater neck support than head support and want the feature of no jaw and mouth obstruction , the embodiment of fig5 is particularly valuable . the embodiment of fig5 is generally cruciform in shape with a head supporting portion 11 and a neck supporting portion 12 of greater firmness than the head supporting portion 11 and an additional neck supporting portion 14 which is used by reversing the pillow 20 as shown in fig5 . the neck supporting portion 14 is of different firmness from the neck supporting portion 12 . it may be of the same firmness as the head supporting portion 11 or of greater or lesser firmness than the head supporting portion 11 . this is illustrated in fig7 by the dashed lines indicating different degrees of firmness . fig3 illustrates the differential firmness of the pillow of fig1 graphically . firmness is illustrated in the ordinate direction and distance from the front of the pillow is represented in the abscissa direction . the area 12 of the neck supporting portion is shown having a greater firmness and the head supporting portion having lesser firmness . the abrupt change in stiffness appears at joint 13 of fig1 . in fig7 a transition exists at the joint 13 where the greater stiffness neck supporting portion 12 joins the lesser stiffness of the head supporting portion 11 . the firmness of alternate neck supporting portion 14 may be greater , equal to , or less than the firmness of the head supporting portion 11 as may be desired . this is illustrated by dashed lines . a lesser firmness as illustrated by section ( 14 ) is not consistent with my basic desire but conceivably one might want graduated firmness from neck to head . this is possible using the combination of portion 12 , portion 11 and portion 14 . in carrying out the preferred embodiment of this invention shown in fig1 i employed the following material : ______________________________________neck supporting portion 12 polyurethane foam 1 . 45 #/ ft . sup . 3 firmness : soft . e . g . indentation load deflection ( ild rating ) of # 22 - 28 using astm or equivalent test method to provide a 25 % compression on a 4 &# 34 ; thick foam sample with the weight applied as 8 &# 34 ; × 8 &# 34 ; steel plate . head supporting portion 11 polyurethane foam 1 . 45 #/ ft . sup . 3 firmness : supersoft e . g . ( ild rating ) of # 15 - 21 as identified above . joint stabond ms - 230 adhesive of the stabond corp of gardena , ca 90249______________________________________ typical dimensions for a pillow made in accordance with my invention are : ______________________________________dimensions useful range______________________________________width of 11 25 &# 34 ; 12 &# 34 ; or greaterlength of 11 9 &# 34 ; 8 &# 34 ; or greaterheight of pillow 4 &# 34 ; 2 &# 34 ; to 4 &# 34 ; width of 12 and 14 11 &# 34 ; 5 &# 34 ; to 11 &# 34 ; length of 12 and 14 31 / 2 &# 34 ; 3 &# 34 ; to 5 &# 34 ; ______________________________________ i do recognize that it is possible using controlled foaming techniques to vary the density of foam in a single foam plastic body . such a technique could be applied to my invention to provide differential firmness with the neck supporting portion having greater firmness than the head supporting portion . in such case the abrupt firmness noted in fig3 & amp ; 7 will not occur , but more gradual changes will be present . in each of the embodiments , the pillows are shown with right angle corners , for ease of manufacture by cutting of the foam plastic . it must be recognized that the pillow may be shaped at their edges , if desired , without changing their functional relationship of the pillow sections . the above described embodiments of this invention are merely descriptive of its principles and are not to be considered limiting . the scope of this invention instead shall be determined from the scope of the following claims , including their equivalents .	0
the present invention may be understood more readily by reference to the following detailed description of preferred embodiments of the invention and to the figures and their previous and following description . before the present system and method are disclosed and described , it is to be understood that this invention is not limited to specific synthetic methods , specific components , or to particular compositions , as such may , of course , vary . it is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting . as used in the specification and the appended claims , the singular forms “ a ,” “ an ” and “ the ” include plural referents unless the context clearly dictates otherwise . thus , for example , reference to “ a sponsor ” includes mixtures of sponsors , reference to “ a sponsor ” includes mixtures of two or more such sponsors , and the like . ranges may be expressed herein as from “ about ” one particular value , and / or to “ about ” another particular value . when such a range is expressed , another embodiment includes from the one particular value and / or to the other particular value . similarly , when values are expressed as approximations , by use of the antecedent “ about ,” it will be understood that the particular value forms another embodiment . it will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint , and independently of the other endpoint . “ optional ” or “ optionally ” means that the subsequently described event or circumstance may or may not occur , and that the description includes instances where said event or circumstance occurs and instances where it does not . in this specification and in the claims which follow , reference will be made to a number of terms which shall be defined to have the following meanings : “ host ” is defined as the organizational entity through which the transactions of the present system and method take place . the “ host ” can also refer to the internet server responsible for conducting said transactions . “ sports team ” is defined as a group of individuals cooperating to compete in sporting events . examples include , but are not limited to , the atlanta braves ®, the atlanta falcons ®, and the atlanta hawks ®. “ individual athlete ” is defined as a person trained to compete in sports . examples include , but are not limited to , lance armstrong and tiger woods . “ sponsorship transaction ” is defined as a user transferring funds to the host and the user receiving a sponsorship award . “ sponsorship amount ” is defined as a sum of money transferred from a user to the host for the purpose of sponsoring a sports team or individual athlete . examples include , but are not limited to , five dollars , ten dollars , and one - hundred dollars . “ cumulative sponsorship amount ” is defined as an amount determined by the host and sports teams and individual athletes that is a minimum acceptable sponsorship amount . examples include , but are not limited to , five - hundred dollars , one - thousand dollars , ten - thousand dollars . “ primary sponsor ” is defined as the sponsor that is the largest most visible sponsor of a sports team or individual athlete . examples include , but are not limited to , the united states postal service was a primary sponsor of lance armstrong , a successful cyclist , for many years . “ co - sponsor ” is defined as a sponsor that is not the largest most visible sponsor of a sports team or individual athlete . reference will now be made in detail to the present aspects of the invention , example ) of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers are used throughout the drawings to refer to the same or like parts . the system and method disclosed herein can be applied to various sports and sponsor targets . examples of such sports include , but are not limited to , surfing , skate boarding , fishing , soccer , snow boarding , water skiing , boating , slalom down hill skiing , sailing , and all motorized and mechanized sports . in one aspect , illustrated in fig6 , a method for sponsoring is provided that comprises receiving a user selected sponsor target ( step 601 ), receiving a monetary amount from the user wherein a portion of the monetary amount is contributed toward a cumulative sponsorship amount ( step 602 ), sending the user a sponsorship award ( step 603 ), repeating the previous steps until the cumulative sponsorship amount is reached ( step 604 ), and sponsoring the user selected sponsor target ( step 605 ). the user selection can be made over a network . the user selected sponsor target can be , for example , athletes , sports teams , and vehicles . the sponsor target can be , for example , an olympic team , a nascar ® driver , and an x - games athlete . the sponsorship award can indicate that the user sponsored the user selected sponsor target . the value of the sponsorship award is associated with the monetary amount received from the user . in a further aspect , illustrated in fig7 , a method for sponsoring is provided that comprises selecting a sponsor target ( step 701 ) and transferring a monetary amount to a host wherein a portion of the monetary amount is contributed toward a cumulative sponsorship amount ( step 702 ), and receiving a sponsorship award ( step 703 ). the user selection can be made over a network . the user selected sponsor target can be , for example , athletes , sports teams , and vehicles . the sponsor target can be , for example , an olympic team , a nascar ® driver , and an x - games athlete . the sponsorship award can indicate that the user sponsored the user selected sponsor target . the value of the sponsorship award is associated with the monetary amount received from the user . in another aspect , illustrated in fig8 , a method of sponsoring is provided that comprises listing a sponsor target with a host ( step 801 ), determining a cumulative sponsorship amount ( step 802 ), determining a sponsorship award ( step 803 ), receiving the cumulative sponsorship amount from the host ( step 804 ), and recognizing the host ( step 805 ). the listing can be performed over a network . the sponsor target can include , for example , athletes , sports teams , and vehicles . the sponsor target can be , for example , an olympic team , a nascar ® driver , and an x - games athlete . the sponsorship award can indicate that a user sponsored the sponsor target . the value of the sponsorship award can be associated with a monetary amount received from a user . fig1 illustrates generally , the steps involved in the disclosed method for sponsoring sports teams or individuals ( both also referred to as sponsor targets ). the first step 101 of the method comprises a user selecting a sports team 206 a , b or an individual athlete 207 a , b to sponsor . this selection can be through the internet 208 at a host website , at a retail location , at a sporting event , and the like . once the user has selected a sports team 206 a , b or an individual athlete 207 a , b to sponsor , the user transfers the desired sponsorship amount to the host , as indicated in block 102 . the transfer can be through the internet via electronic funds transfer means such as bank accounts , credit cards , paypal ®, or the like . the transfer can also be through a point of sale transaction such as credit cards , checks , or cash . the host sends the user a sponsorship award upon receipt of the sponsorship amount , as indicated in block 103 . the award &# 39 ; s value can be directly related to the amount of the sponsorship amount . the award can be a pen , a t - shirt , a towel , a cup , a hat , a sticker , a poster , or similar . the host will then proceed to deposit the sponsorship amount into a financial account , as indicated in block 104 . the financial account can be an interest bearing account such as , for example , a cash deposit ( cd ), a mutual fund , a checking account , or a savings account . after a sufficient number of users have contributed sponsorship amounts such that a pre - determined cumulative sponsorship amount is reached , the host will distribute the cumulative sponsorship amount to the selected sports team 206 a , b or an individual athlete 207 a , b , as indicated in block 105 . the cumulative amount can be determined by the sports team 206 a , b or an individual athlete 207 a , b . for example , jeff gordon , a top nascar ® driver and team , has a minimum sponsorship amount of approximately $ 80 , 000 . 00 . in exchange for this amount , the sponsor receives a 5 × 12 inch space on both sides of jeff gordon &# 39 ; s race car for the racing season . the selected sports team 206 a , b or an individual athlete 207 a , b will recognize the host as a sponsor , as indicated in block 106 . such recognition can include , but is not limited to , placing a host logo on a sports team 206 a , b or an individual athlete 207 a , b vehicle , uniform , equipment , banner at a sporting venue , and the like . fig2 illustrates generally , an exemplary system implementing the disclosed method . this exemplary system is only an example of a system and is not intended to suggest any limitation as to the scope of use or functionality of system architecture . neither should the system be interpreted as having any dependency or requirement relating to any one or combination of components illustrated in the exemplary system . fig2 illustrates the primary components and relationships of the disclosed system and method . a user 201 interacts with a host server 202 via the internet 208 through an internet - enabled computer connection . the user 201 interacts with the host server 202 via an internet enabled personal computer running a standard web - browser . the user 201 can also interact with the host server 202 via standard point of sale transactions . an example of such point of sale transactions includes conducting a sponsorship transaction at a physical location such as a sporting goods store , a sport specialty store , or a sporting event . the user 201 is also capable of interacting with the host server 202 through a plurality of internet enabled kiosks at various physical locations . the host server 202 is capable of conducting a plurality of sponsorship transactions with a plurality of users 201 . through the host server 202 , the user 201 is able to view a host website and browse and search a plurality of sports teams 206 a , b or individual athletes 207 a , b to sponsor . the host server 202 supports a plurality of user 202 profile databases , sports team 206 a , b and individual athlete 207 a , b databases , primary sponsor and co - sponsor 406 databases , and credit card and other financial transaction processing . it will be readily apparent to those skilled in the art that the databases can be any suitable database management system such as oracle , informix , sybase , sql server , access , mysql , postgresql , or the like . once the user 201 selects a sports teams 206 a , b or individual athlete 207 a , b to sponsor , the user 201 can electronically transfer funds to the host through the host server 202 via a financial transaction system 204 . the financial transaction system 204 can implement electronic funds transfers between a multitude of financial accounts as is known to one skilled in the art . the host server 202 can interact with a user award system 203 to send the user 201 a sponsorship award . the user award system can vary depending upon the sports teams 206 a , b or individual athlete 207 a , b . by way of example , and not limitation , there can be three levels of sponsorship silver , gold , and platinum . the silver level can be reached by contributing $ 200 . 00 . the user 201 can receive a hat and t - shirt with the host logo , access to messages from their team keeping them up to date with team happenings , offers for discount tickets and travel to events , and the right to say they sponsored the sports teams 206 a , b or individual athlete 207 a , b . gold level can be reached by contributing $ 500 . 00 . the user 201 can receive the benefits of the silver level , plus “ behind the scenes ” passes , t - shirt and hats with the name of the sports teams 206 a , b or individual athlete 207 a , b they are sponsoring . the platinum level can be reached by contributing $ 1 , 000 . 00 . the user 201 can receive the benefits of the silver and gold levels , plus a jacket with the sports teams 206 a , b or individual athlete 207 a , b , autographed posters , license plates frames , key chains , and “ vip ” lunches at selected events hosted by the host . these benefits will vary based on the particular sporting events . the host server 202 electronically transfers the sponsorship amount through the financial transaction system 204 into a financial account 205 . once a cumulative sponsorship amount has been reached for a sports team or individual , the cumulative sponsorship amount is transferred from the financial account 205 to the sports team 206 a , b or individual athlete 207 a , b selected by the user 201 . fig3 illustrates a more detailed view of the sponsorship transaction process . the user 201 uses an internet - enabled computer to access the host server 202 via the internet 208 . as indicated in block 301 , user 201 browses and searches through the host website and queries various sports team 206 a , b and individual athlete 207 a , b databases . the user 201 can view the name of the sports team 206 a , b and individual athlete 207 a , b along with the sponsorship award that the user 201 can receive based on a sponsorship amount . the user 201 selects the specific sports team 206 a , b and / or individual athlete 207 a , b to sponsor and , as indicated in block 302 , the user 201 then enters their user 201 profile into a user profile database on the host server 202 . a user 201 profile can contain pertinent information such as , but not limited to , name , address , phone number , email address , and sport preferences . the user 201 will only need to enter this information once , as their information is stored and is accessible by the user 201 via a password . the user 201 profile will be associated with the primary sponsor and co - sponsors 406 associated with the sports team 206 a , b or individual athlete 207 a , b that the user 201 selected to sponsor . as shown in block 310 , the user 201 profile can be transmitted to the primary sponsor and co - sponsors for various marketing uses . such marketing uses can include , but are not limited to , direct product marketing to users 201 , providing discounts to users 201 , and the like . as indicated in block 303 , after the user 201 has entered their profile information , the user 201 enters payment information to transfer the desired sponsorship amount to the host . payment information can include , but is not limited to , credit cards , bank account and routing numbers , paypal ® accounts , and the like . the payment is processed and the sponsorship amount is deposited into a host financial account as indicated in block 304 . the host financial account can be , for example , a checking account , a savings account , a mutual fund , and the like . a sponsorship award is sent to the user 201 , as shown in block 305 . the sponsorship award can include pens , t - shirts , towels , posters , tickets to sporting events , and the like . the host financial account is monitored to determine when a pre - determined cumulative sponsorship amount has been reached for each sports team 206 a , b or individual athlete 207 a , b , as indicated in block 306 . as shown in block 307 , if the cumulative sponsorship amount has not been reached , the process continues with the same or other users 201 until the cumulative sponsorship amount is reached . as shown in block 307 , if the cumulative sponsorship amount has been reached , the cumulative sponsorship amount is transferred to the appropriate sports team 206 a , b or individual athlete 207 a , b , as shown in block 308 . such distributions can be made , for example , by mailing a check to the sports team 206 a , b or individual athlete 207 a , b , automatically electronically depositing funds , and the like . as indicated in block 309 , the sports team 206 a , b or individual athlete 207 a , b will recognize the receipt of the cumulative sponsorship amount by promoting the host . such promotion of the host can be made by , for example , placing a host logo on a team vehicle , uniform , banner , website , and the like , fig4 describes examples of synergies generated by the disclosed system and method . the user 402 benefits through having the ability to sponsor their favorites sports teams and individual athletes . this allows the user 402 to show their support through financial contribution and ensures the success of the sport as a whole . the individual athlete 403 benefits through receiving sponsorship funds that might not have been received otherwise , thus ensuring the individual athlete 403 can continue to participate in the sport . nascar ® 404 benefits through receiving sponsors for the drivers and their teams , thus connecting the fans to the sport more intimately , ensuring fan loyalty . olympic teams 405 benefit through receiving much needed funding to cover training and travel costs , allowing the teams to concentrate on their sport . primary and co - sponsors benefit by receiving invaluable marketing information . this information can allow targeted advertising and product offering . these benefits are conveyed by and through the host 401 , serving as the medium through which all the aforementioned benefits flow . fig5 illustrates an example of a suitable computing system environment in which the system and method may be implemented . the computing system environment is only one example of a suitable computing environment and is not intended to suggest any limitation as to the scope of use or functionality of the invention . neither should the computing environment be interpreted as having any dependency or requirement relating to any one or combination of components illustrated in the exemplary operating environment . in particular , the environment is an example of computerized devices that can implement the system and method as has been described . the system and method are operational with numerous other general purpose or special purpose computing system environments or configurations . examples of well known computing systems , environments , and / or configurations that may be suitable for use with the system and method include , but are not limited to , personal computers , server computers , laptop devices , and multiprocessor systems . additional examples include set top boxes , programmable consumer electronics , network pcs , minicomputers , mainframe computers , distributed computing environments that include any of the above systems or devices , and the like . the system and method may be described in the general context of computer instructions , such as program modules , being executed by a computer . generally , program modules include routines , programs , objects , components , data structures , etc . that perform particular tasks or implement particular abstract data types . the system and method may also be practiced in distributed computing environments where tasks are performed by remote processing devices that are linked through a communications network . in a distributed computing environment , program modules may be located in both local and remote computer storage media including memory storage devices . the systems of fig2 , and 3 , can include a general - purpose computing device in the form of a computer 501 . the components of the computer 501 can include , but are not limited to , one or more processors or processing units 503 , a system memory 512 , and a system bus 513 that couples various system components including the processor 503 to the system memory 512 . the system bus 513 represents one or more of several possible types of bus structures , including a memory bus or memory controller , a peripheral bus , an accelerated graphics port , and a processor or local bus using any of a variety of bus architectures . by way of example , such architectures can include an industry standard architecture ( isa ) bus , a micro channel architecture ( mca ) bus , an enhanced isa ( eisa ) bus , a video electronics standards association ( vesa ) local bus , and a peripheral component interconnects ( pci ) bus also known as a mezzanine bus . this bus , and all buses specified in this description can also be implemented over a wired or wireless network connection . the bus 513 , and all buses specified in this description can also be implemented over a wired or wireless network connection and each of the subsystems , including the processor 503 , a mass storage device 504 , an operating system 505 , application software 506 , data 507 , a network adapter 508 , system memory 512 , an input / output interface 510 , a display adapter 509 , a display device 511 , and a human machine interface 502 , can be contained within one or more remote computing devices 515 a , b , c at physically separate locations , connected through buses of this form , in effect implementing a fully distributed system . the computer 501 typically includes a variety of computer readable media . such media can be any available media that is accessible by the computer 501 and includes both volatile and non - volatile media , removable and non - removable media . the system memory 512 includes computer readable media in the form of volatile memory , such as random access memory ( ram ), and / or non - volatile memory , such as read only memory ( rom ). the system memory 512 typically contains data such as data 507 and and / or program modules such as operating system 505 and application software 506 that are immediately accessible to and / or are presently operated on by the processing unit 503 . the computer 501 may also include other removable / non - removable , volatile / non - volatile computer storage media . by way of example , fig5 illustrates a mass storage device 504 which can provide non - volatile storage of computer code , computer readable instructions , data structures , program modules , and other data for the computer 501 . for example , a mass storage device 504 can be a hard disk , a removable magnetic disk , a removable optical disk , magnetic cassettes or other magnetic storage devices , flash memory cards , cd - rom , digital versatile disks ( dvd ) or other optical storage , random access memories ( ram ), read only memories ( rom ), electrically erasable programmable read - only memory ( eeprom ), and the like . any number of program modules can be stored on the mass storage device 504 , including by way of example , an operating system 505 and application software 506 . each of the operating system 505 and application software 506 ( or some combination thereof ) may include elements of the programming and the application software 506 . data 507 can also be stored on the mass storage device 504 . a user can enter commands and information into the computer 501 via an input device ( not shown ). examples of such input devices include , but are not limited to , a keyboard , pointing device ( e . g ., a “ mouse ”), a microphone , a joystick , a serial port , a scanner , and the like . these and other input devices can be connected to the processing unit 503 via a human machine interface 502 that is coupled to the system bus 513 , but may be connected by other interface and bus structures , such as a parallel port , game port , or a universal serial bus ( usb ). a display device 511 can also be connected to the system bus 513 via an interface , such as a display adapter 509 . for example , a display device can be a monitor or an lcd ( liquid crystal display ). in addition to the display device 511 , other output peripheral devices can include components such as speakers ( not shown ) and a printer ( not shown ) which can be connected to the computer 501 via input / output interface 510 . the computer 501 can operate in a networked environment using logical connections to one or more remote computing devices 515 a , b , c . by way of example , a remote computing device can be a personal computer , portable computer , a server , a router , a network computer , a peer device or other common network node , and so on . logical connections between the computer 501 and a remote computing device 515 a , b , c can be made via a local area network ( lan ) and a general wide area network ( wan ). such network connections can be through a network adapter 508 . a network adapter 508 can be implemented in both wired and wireless environments . such networking environments are commonplace in offices , enterprise - wide computer networks , intranets , and the internet 208 . for purposes of illustration , application programs and other executable program components such as the operating system 505 are illustrated herein as discrete blocks , although it is recognized that such programs and components reside at various times in different storage components of the computing device 501 , and are executed by the data processor ( s ) of the computer . an implementation of application software 506 may be stored on or transmitted across some form of computer readable media . computer readable media can be any available media that can be accessed by a computer . by way of example , and not limitation , computer readable media may comprise “ computer storage media ” and “ communications media .” “ computer storage media ” include volatile and non - volatile , removable and non - removable media implemented in any method or technology for storage of information such as computer readable instructions , data structures , program modules , or other data . computer storage media includes , but is not limited to , ram , rom , eeprom , flash memory or other memory technology , cd - rom , digital versatile disks ( dvd ) or other optical storage , magnetic cassettes , magnetic tape , magnetic disk storage or other magnetic storage devices , or any other medium which can be used to store the desired information and which can be accessed by a computer . it will be apparent to those skilled in the art that various modifications and variations can be made in the present system and method without departing from the scope or spirit of the system and method . other embodiments of the system and method will be apparent to those skilled in the art from consideration of the specification and practice of the system and method disclosed herein . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the system and method being indicated by the following claims .	6
the following description is presented to enable any person skilled in the art to make and use the invention , and is provided in the context of a particular application and its requirements . various modifications to the described embodiments will be readily apparent to those skilled in the art and the generic principles herein may be applied to other embodiments . thus , the present invention is not intended to be limited to the embodiments and examples shown but is to be accorded the widest possible scope in accordance with the features and principles shown and described . the particular features and advantages of the invention will become more apparent with reference to the appended fig2 - 3 , taken in conjunction with the following description . fig2 a is a schematic illustration of a gas chromatograph to mass spectrometer interface in accordance with the present invention . in fig2 a , reference number 10 refers to a gas chromatograph ( only a portion of which is illustrated ) and reference number 20 refers to a mass spectrometer ( only a portion of which is illustrated ). the system 100 shown in fig2 a comprises a conduit 40 which partially encloses an interior volume 41 which is contiguous and conterminous with the heated gc oven interior volume 18 . the conduit 40 is sealed , in an air - tight tight fashion , to the housing 19 of the gc oven and extends outward from the housing 19 and between the gc and the ms such that the conduit interior volume 41 comprises an outward extension of the interior volume 18 of the gc oven . this configuration enables the heated internal air or gas of the oven to flow into or out of the conduit interior volume 41 . the conduit 40 is preferably lined with a low thermal mass rigidized ceramic fiber insulation 52 in order to minimize thermal lag and heat loss to the outer shell of the conduit 40 . the use of rigidized insulation allows operation without heat loss to a metallic liner ( such as is typically used in the lining of a gc oven ) while at the same time prevents erosion of the insulator as would occur for loose glass or ceramic wool type insulation materials . as one example , the insulation 52 may comprise the material htp as is described in nasa tech briefs , winter 1985 , vol . 4 , msc - 20654 . a duct 42 in the system 100 ( fig2 a ) channels higher pressure oven - heated air from periphery of an oven blower or fan into the conduit interior volume 41 such that flowing temperature regulated air or gas 46 flows along and around the entire length of the transfer tube 14 contained within the volume 41 . this free flow of air around and along the transfer tube 14 allows thermal regulation of the section of the gc column contained within the transfer tube within the conduit interior volume . preferably , the end of the duct disposed within the conduit should be placed such that the flowing temperature - regulated air or gas arrives or exits at or close to the end of the conduit 40 furthest from the gc oven . this ensures that no dead volume remains in the conduit which would otherwise result in a temperature gradient along its length . the transfer tube 14 should be sufficiently rigid to support the column but should have sufficiently low thermal mass so as to enable oven temperature changes to be communicated to the section of column within the transfer tube with suitably low time lag . this enables the temperature of the column within volume 41 to track the controlled temperature of the oven interior 18 without resulting in adverse band broadening , peak tailing or sample decomposition . as one example , the inventors have discovered that 1 . 6 millimeter ( mm ) or 1 / 16 inch or smaller outer diameter stainless steel tubing fulfills these requirements . however , the tubing may have a larger diameter ( up to 2 mm ) in order to accommodate the largest available diameter capillary gc column . the transfer tube 14 is preferably terminated in the gc oven proper in order to conveniently access vacuum fitting 13 for column installation and removal . although the vacuum fitting 13 could be positioned closely to ion source 22 in order to further reduce thermal mass , thus tracking overall oven temperature more accurately , it is preferable that some degree of thermal mass near the terminal end of the gc column is present in order to offset potential peak splitting due to the laminar air flow conditions in this area . the effects of peak splitting caused by rapid gc temperature fluctuations are described in f . munari and s . trestianu “ thermal peak splitting in capillary gas chromatography ” journal of chromatography , 279 ( 1983 ) 457 - 472 . the system shown in fig2 a extends accurate heating control of the column to within close proximity to the mass spectrometer 20 . as seen in the example of fig2 a , the end of the conduit 40 may protrude past or beyond the mass spectrometer housing 29 through a gap or aperture 49 in the ms housing 29 . the vacuum within the mass spectrometer may be sealed against ambient air intrusion by means , for instance , of a flange 48 that is sealed , in vacuum - tight fashion by means of a gasket or o - ring 50 , against a wall or other structural feature of the ms housing . air or gas from within the gc oven is prevented from entering the mass spectrometer and the integrity of the ms vacuum may be maintained ( while maintaining proximity of the conduit interior volume 41 to the mass spectrometer 20 ) by means of a membrane 44 through which the column - containing transfer tube passes and which comprises an air - tight and vacuum tight seal over exit port 47 of the conduit 40 . as one example , the membrane may comprise a stainless steel foil of thickness within the range of approximately 0 . 010 to 0 . 020 inches . the diameter and thickness of the membrane 44 can be selected so as to offer minimal heat loss from oven air to the structural enclosure of conduit 40 , while at the same time offering sufficient strength to avoid a vacuum rupture imposed by the high vacuum of the ms interior 28 . additionally , this membrane allows sufficient heating of terminal end of transfer tube 14 by ion source 22 without excessive heat loss from the ion source . the conduit 40 may comprise an integral part of the gc oven housing 19 . alternatively , the conduit 40 may be provided as a modular accessory that attaches to or mates with a pre - existing gap 9 in a wall of the gc oven . for instance , the gap 9 may comprise a pre - existing output port or aperture , such as , for instance , a port or aperture to which various accessory apparatuses ( e . g ., detectors ) may be interchangeably mated or fitted . fig2 b illustrates an embodiment , in accordance with the invention , in which a portion of the duct 42 is located within a portion ( such as a wall portion ) of the gc oven housing 19 . this configuration frees up space within the interior of the gc oven for positioning a portion of the column . further , the configuration shown in fig2 b may cause less interruption of the air or gas flow within the gc oven . fig3 a is a schematic illustration of a gas chromatograph to mass spectrometer interface 155 partially contained within a gc oven 7 and showing one method of fluidic coupling between an inlet of the duct 42 and a fan or blower 43 within the gc oven 7 . as shown in fig3 a , the inlet of the duct 42 may be disposed behind a plenum or partition 51 within the gc oven so as to intercept the radial flow of flowing gas 46 emanating from the blower fan 43 . returning air or gas 45 is drawn in towards fan 43 and is channeled towards the central hub of the fan 43 by one or more gaps 55 of or within the plenum or partition 51 . the gaps 55 may comprise , for instance , perforations or slits within the plenum or partition 51 . in the configuration shown in fig3 a , air or gas set in motion by fan 43 is forced to flow laterally outward in a region between the plenum 51 and the gc oven housing 19 as a result of confinement between these latter two elements . consequently , a pressure differential is established with a relatively higher pressure region existing laterally outward from the fan 43 between the plenum 51 and the gc oven housing 19 . as shown in fig3 a , the inlet of the duct 42 is disposed so as to intercept a portion of the air or gas within this high pressure region and direct it into the relatively lower pressure conduit interior volume 41 . fig3 a illustrates an embodiment in which a portion of the duct 42 is contained within the gc oven housing 19 as shown in fig2 b . however , the configuration illustrated in fig2 a , configuration in which the duct is positioned within the gc oven interior , could also be used . fig3 b is a schematic illustration of another gas chromatograph to mass spectrometer interface 157 partially contained within a gc oven 7 . the system 157 shown in fig3 b is similar to the system 155 shown in fig3 a , except that , in the system 157 , a heater or heating element 53 is positioned between the fan or blower 43 and the inlet of the duct 42 . in this configuration , air or gas 46 is forced to flow adjacent to the heater 53 just prior to entering the duct 42 . this configuration can compensate for any heat losses along the length of the duct . although fig3 b illustrates a configuration in which a portion of the duct 42 is contained within the gc oven housing 19 ( i . e ., as in fig2 b ), the configuration in which the duct is positioned within the gc oven interior ( i . e ., as in fig2 a ) could also be used . fig3 c is a schematic illustration of still another gas chromatograph to mass spectrometer interface 159 partially contained within a gc oven 7 and showing another method of fluidic coupling between an inlet of the duct 42 and the fan or blower 43 . in the configuration shown in fig3 c , the inlet of the duct 42 is positioned within a relatively lower pressure region near the gap ( or gaps ) 55 in the plenum or partition 51 . in this situation , the duct draws returning air or gas 45 out of the conduit interior volume 41 , causing temperature regulated air or gas to flow from the gc oven interior 18 into the conduit interior volume 41 . alternatively , any location within the gc oven confines offering a pressure differential is suitable in order to establish flow within the duct 42 . although fig3 c illustrates a configuration in which a portion of the duct 42 is contained within the gc oven housing 19 ( i . e ., as in fig2 b ), the configuration in which the duct is positioned within the gc oven interior ( i . e ., as in fig2 a ) could also be used . fig3 d illustrates is a schematic illustration of yet another gas chromatograph to mass spectrometer interface 161 partially contained within a gc oven 7 . in the configuration illustrated in fig3 d , a portion of the duct 42 within the conduit 40 encloses a portion of the transfer tube 14 such that the flowing temperature regulated air or gas 46 is confined along the portion of the transfer tube 14 , thereby improving heat transfer from the air or gas 46 to the transfer tube . although fig3 d illustrates a configuration in which a portion of the duct 42 is contained within the gc oven housing 19 ( i . e ., as in fig2 b ), the configuration in which the duct is positioned within the gc oven interior ( i . e ., as in fig2 a ) could also be used . the discussion included in this application is intended to serve as a basic description . although the present invention has been described in accordance with the various embodiments shown and described , one of ordinary skill in the art will readily recognize that there could be variations to the embodiments and those variations would be within the spirit and scope of the present invention . the reader should be aware that the specific discussion may not explicitly describe all embodiments possible ; many alternatives are implicit . accordingly , many modifications may be made by one of ordinary skill in the art without departing from the spirit , scope and essence of the invention . neither the description nor the terminology is intended to limit the scope of the invention . any publications , patents or patent application publications mentioned in this specification are explicitly incorporated by reference in their respective entirety .	6
referring now to the drawings , the quick connection shown in fig1 and 2 comprises an upstream element generally designated by reference 2 , which constitutes the female part of this connection . this upstream element is conventionally connected to an installation ( not shown ), delivering oxygen at high pressure , for example close to 200 bars . this upstream element 2 comprises a tubular body 4 which defines an enclosure 6 intended to be placed in communication with the afore - mentioned oxygen installation . this upstream enclosure 6 receives a separate sheath 8 within which a valve is capable of sliding , as will be described hereinafter in greater detail . this sheath 8 forms a peripheral flange 10 , beyond which a chamber 12 extends . the latter is placed in communication , via a re - entrant shoulder 14 , with a cylindrical housing 16 whose diameter , or transverse dimension , is less than that of the afore - mentioned chamber 12 . grooves are hollowed out in the walls of this housing 16 , which receive two o - rings 18 , disposed one behind the other in the direction of flow of the gas . furthermore , the body 4 is provided , in its downstream part , with a lock 20 mounted to slide against a spring 22 . this lock allows the removable fixation of a downstream element of the connection , as will be described hereinbelow . a valve 24 is slidably mounted in the interior volume of the upstream element 2 . it comprises a cylindrical body 26 extended , at a first end , by a plurality of axial fingers 28 defining passages . a shank 30 , which extends from the body 26 , opposite to the fingers 28 , is free to slide in the interior volume of the sheath 8 . furthermore , this valve 24 is provided with a radial ring 32 having bores 34 made therein . a spring 36 , coming into abutment at one of its ends against the flange 10 , makes it possible to return this ring 32 against the shoulder 14 of the upstream element 2 . the quick connect coupling shown in fig1 and 2 also comprises a downstream element , forming the male part of the coupling . the arrangement of this downstream element 38 , as well as its mode of fixation to the upstream element 2 , via the lock 20 , are of conventional type . the annular free end of this downstream element 38 is given reference 40 . in the position illustrated in fig1 the upstream ( 2 ) and downstream ( 38 ) elements are disconnected . consequently , the valve is pushed by the spring 22 in downstream direction , with respect to the flow of the gas . in this arrangement , the ring 32 abuts against the shoulder 14 . the body 26 of the valve 24 , received in the housing 16 , is placed opposite an intermediate region r , which borders this housing 16 and lies between the upstream o - ring 18 and the shoulder 14 . this intermediate region is made in massive form , in that its transverse dimensions are sufficient for it to guarantee , due to its metallic nature , an efficient dissipation of heat . this region r presents a significant longitudinal dimension , or length l . the transverse sections of the intermediate region r and of the body 26 , which correspond to the respectively inner and outer diameters of these elements , are such that the latter form an annular gap of reduced section , ensuring a primary seal . this gap , designated by reference i , presents a small transverse section , corresponding to the clearance between the body 26 and the region r opposite . this clearance corresponds to conventional machining tolerances and allows the valve to slide easily in its housing . in service , the rise in pressure in the chamber 12 creates a sudden rise in temperature . however , this sudden rise does not exist in the vicinity of the o - rings , thanks to the primary seal ensured by the gap i . in effect , the quantity of gas flowing in this gap i is small and undergoes a rapid cooling , the intermediate region r as well as the body 26 of the valve opposite , constituting massive metal parts which allow an efficient dispersion of heat . consequently , the o - rings 18 are only slightly heated and do not risk igniting . in the position illustrated in fig2 the upstream ( 2 ) and downstream ( 38 ) elements are connected to each other . in this arrangement , the fingers 28 of the valve 24 are in abutment against the frontal wall of the annular end 40 of the downstream element 38 . these fingers 28 are arranged upstream of the shoulder 14 , with the result that the gas is free to flow in the direction of the housing 16 , via the bores 34 and the passages formed between these fingers 28 . in the position of opening of fig2 the intermediate region r is opposite the annular end 40 of the downstream element 38 . their transverse sections , which respectively correspond to the inner diameter of this region r and outer diameter of this end 40 , are such that these latter form an annular gap i ′ for passage of the gas . this gap i ′ presents a transverse dimension similar to that of the gap i described previously , formed by cooperation of the valve 24 and the region r . when the pressure of the gas suddenly rises in the chamber 12 , in this position of opening of the valve , the resulting sudden rise in temperature is non - existent in the vicinity of the o - rings , thanks to the gap i ′ which ensures a primary seal . consequently , similarly to what happens in the position of closure of the valve , the o - rings 18 are substantially not subject to a rise in temperature , with the result that they do not risk igniting . the length l of the intermediate region r is advantageously greater than the length 1 of the fingers 28 . in effect , this makes it possible to maintain , opposite the region r , either a part of the annular end 40 , or a part of the body 26 , whatever the axial positions of the downstream element and of the valve 24 . consequently , during translation of the valve 24 , under the action of the downstream element 38 , a portion of annular gap , of small section , permanently exists , which protects the o - rings 18 from the sudden rise in pressure of the oxygen . the invention has been described with reference to upstream and downstream elements , respectively forming female and male parts of the connection . it is also applicable to a connection whose upstream and downstream elements respectively form male and female parts . the invention enables the objects set forth hereinabove to be attained . in effect , applicants have observed that the phenomena of inflammation , to which the o - rings are subjected , are principally due to sudden rises in the pressure of the oxygen flowing in the vicinity of these o - rings , inducing a considerable temperature rise . the existence of the primary sealing zones i and i ′ makes it possible to dissipate the energy that the gas possesses , once it arrives in contact with the o - rings . the latter are thus subjected only to a slight temperature rise , with the result that their mechanical soundness is not affected .	5
fig1 shows a block diagram of a scene intensity measuring and illumination source detection apparatus 10 in accordance with the present invention . the apparatus 10 provides illumination source determination as well as light metering to determine appropriate exposure settings for an image capture device 11 having a variable aperture ( not shown ) and a shutter ( not shown ) moveable between open and closed positions . in accordance with the present invention , light from a photographic scene is incident on an off - axis segment of a diffractive optical element ( doe ) 12 . the doe 12 disperses the incident light into its spectral components , as well as focuses the incident light onto an array of photodetectors 14 . the doe 12 is formed with focusing power and spectral dispersion by using a decentered , or off - axis , segment of a larger doe . thus , the use of the off - axis doe 12 provides the same function as a multi - element system , such as a combination of a diffraction grating and a focusing lens , or a combination of a prism and a focusing lens . referring now to fig2 a , a top view of the off - axis segment of the doe 12 of fig1 is shown in more detail . the lines as shown in fig2 a represent contours of equal surface heights on the diffractive profile of the doe 12 . fig2 b shows a side view of the surface height profile along the line a -- a through the center of the doe 12 . maximum diffraction efficiency is achieved by using blazed surface relief profiles , as shown in fig2 b . maximum theoretical diffraction efficiency at the center design wavelength is up to 100 percent . a more detailed discussion of doe &# 39 ; s is presented in commonly - assigned u . s . pat . no . 5 , 581 , 405 , issued on dec . 3 , 1996 , entitled &# 34 ; hybrid refractive / diffractive achromatic camera lens and camera using such .&# 34 ; once the light is incident on the doe 12 , the resulting detector plane spectral intensity distribution results is a line of dispersed light with short wavelengths closer to the optical axis and longer wavelengths further away . in a direction perpendicular to the high spatial frequency component of the doe 12 , the light is dispersed with red light deflected by the largest amount and blue light deflected by the least amount . in a direction parallel to the high spatial frequency component of the doe 12 , the light is concentrated into a focused line . by placing the array of photodetectors 14 at the image plane of the doe 12 , the relative spectral intensity of different wavelength regions of the scene illumination source can be determined by converting the incident illumination from each part of the dispersed spectrum into a voltage proportional to its intensity . referring now to fig3 a - 3c , spectral intensity graphs are shown for fluorescent light , tungsten , and daylight , respectively . one of the characteristics of fluorescent illumination is the presence of strong emission lines from the ionized mercury gas discharge line , which is partially absorbed by a phosphor coating on the fluorescent tube and partially transmitted . fig3 a shows a number of spectral intensity profiles for various fluorescent lamps . as shown in the profiles of fig3 a , the presence of the mercury gas discharge emission lines can be detected by looking at a narrow spectrum around 404 . 7 nm , 435 . 8 nm , 546 . 1 nm , or 578 . 0 nm . the relative spectral intensity of the 435 . 8 nm and the 546 . 1 nm spectrums are higher than those of 404 . 7 nm or 578 nm . if the relative spectral intensity of the mercury gas discharge emission lines when compared to the spectral intensities of other regions of the emission spectrum , such as 400 - 430 nm or 500 - 540 nm , is very high ( for example , 3 : 1 or 5 : 1 ), it indicates that the illumination of the photographic scene is from a fluorescent light source . fig3 b shows the output spectral intensity distribution for various tungsten filaments operating at different color temperatures . as the color temperature increases , the peak emission wavelength moves to shorter wavelengths and more blue light is present in the output spectrum . a typical tungsten lamp would operate at a color temperature of approximately 2600 to 3500 degrees kelvin . as shown in fig3 b , if the relative illumination from the red region is much higher than that from the blue region , and the relative spectral intensity of the gas discharge lines when compared to the relative spectral intensities of broad spectral areas are not a large ratio , then it can be concluded that the scene illumination is from a tungsten source . fig3 c shows the transmitted output spectrum from the sun , which corresponds to a color temperature of approximately 5630 degrees kelvin . as shown in fig3 c , if the relative spectral intensities of the red , green , and blue spectral regions are approximately equal , and there are no gaseous discharge lines present , then it indicates that the illumination source is daylight . referring again to fig1 the scene intensity measuring and illumination source detection apparatus 10 in accordance with the present invention will now be described . the incident light from the photographic scene is dispersed and focused by the doe 12 onto the array of photodetectors 14 . in order to determine scene illuminant information ( i . e ., whether the photographic scene is illuminated by fluorescent light , tungsten , or daylight ), the array of photodetectors 14 includes seven photodetectors . three of the photodetectors 14 detect the blue spectral region and are identified as b - 1 , b - 2 , and b - 3 . the b - 2 photodetector is positioned to receive the 435 . 8 nm spectral line of the ionized mercury gas discharge that is present in the fluorescent output spectrum . the b - 1 and b - 3 photodetectors are positioned so that b - 1 receives the 400 - 430 nm spectral component and b - 3 receives the 440 - 500 nm spectral component . similarly , the green spectral region is dispersed onto three photodetectors 14 , which are identified as g - 1 , g - 2 , and g - 3 . the g - 2 photodetector is positioned to receive the 546 . 1 nm mercury discharge line present in the fluorescent output spectrum . the g - 1 and g - 3 photodetectors are positioned so that g - 1 receives the 500 - 540 nm spectral component , and g - 3 receives the 550 - 600 nm spectral component . the remaining photodetector 14 , identified as r - 1 , detects the red spectral region from 600 - 700 nm . each photodetector 14 detects the specific spectral component of the incident light , and produces a photocurrent corresponding to the spectral intensity ( measured in watts / cm 2 * nm ) of the spectral range . for example , photodetector b - 1 produces a photocurrent corresponding to the spectral intensity in the spectral range of 400 - 430 nm . thus , photocurrents are produced in the corresponding spectral ranges of 400 - 430 nm , 435 . 8 nm , 440 - 500 nm , 500 - 540 nm , 546 . 1 nm , 550 - 600 nm , and 600 - 700 nm . the detected photocurrents are input into transimpedance amplifiers 16 , which convert the currents to voltage detection signals which are proportional to the intensity of the incident light &# 39 ; s spectral components . the corresponding detection signals are then digitized by an a to d converter 18 . in operation , when a trigger switch 20 of the image capture device 11 , such as a two - level switch used in a point and shoot camera , is depressed half - way , a digital controller 22 in the image capture device 11 signals the a to d converter 18 to convert the analog voltage detection signals to digital numbers . the digital numbers , which are proportional to the spectral components of the incident light intensity , are read by the digital controller 22 and stored into a controller memory 24 . the digital numbers are then used to evaluate the relative intensity of the spectral components in order to determine the scene illuminant information . to determine whether the scene illumination source is fluorescent light , tungsten , or daylight , the digital controller 22 calculates the ratio of the measured spectral intensities of b - 2 to b - 1 , b - 2 to b - 3 , g - 2 to g - 1 , g - 2 to g - 3 and the sum of b - 1 , b - 2 , b - 3 compared to sum of g - 1 , g - 2 , g - 3 and to r - 1 . it should be noted that the photocurrent from photodetectors b - 1 and b - 3 can be larger than that from photodetector b - 2 due to the fact that the spectral intensity is integrated over a larger wavelength range . when the ratio of the spectral intensities of b - 2 to b - 1 , b - 2 to b - 3 , g - 2 to g - 1 or g - 2 to g - 3 is high , for example , on the order of 3 : 1 or 5 : 1 , the digital controller 22 then determines if there is any 120 hz component from b - 2 at 435 . 8 nm by looking at the output of the transimpedance amplifier 16 utilizing a high pass filter , or a notch filter 26 tuned to 120 hz . it is well known in the art that fluorescent light has a characteristic 120 hz intensity profile . thus , if the 120 hz component is present , the scene illuminant is fluorescent light . if the ratio of the summation of the blue signals ( b - 1 , b - 2 , b - 3 ) to the red signal ( r - 1 ) is over 2 : 1 and there is no ac component in blue or green , then the scene illuminant is tungsten . if the ratio of the summation of the blue signals ( b - 1 , b - 2 , b - 3 ) to the summation of the green signals ( g - 1 , g - 2 , g - 3 ), or the summation of the green signals ( g - 1 , g - 2 , g - 3 ) to the red signal level ( r - 1 ) is within 25 %, then the scene illuminant is daylight . once the scene illuminant is determined to be fluorescent light , tungsten , or daylight , the scene illuminant information is stored in the controller memory 24 in the image capture device 11 . the digital controller 22 then sends a code to a magnetic write head 28 in the image capture device 11 to record the presence of fluorescent light , tungsten , or daylight on photographic film 30 ( or with the digital image data if the image capture device is a digital camera ). if the image capture device 11 is a camera using photographic film 30 , the information can be stored on a magnetic coating on each frame of the photographic film 30 or can be recorded optically outside the image area of the photographic film 30 by a light emitting diode ( led ). likewise , if the image capture device 11 is a digital camera , the information is stored with the digital image data for each picture . a photofinisher can then read the information stored on each photographic film frame or with the digital image data to properly compensate for the presence of fluorescent light , tungsten , or daylight during printing . to determine the scene intensity , and thus , the required exposure time for a given photograph or digital image , the digital controller 22 sums the spectral intensities from all spectral regions ( b - 1 , b - 2 , b - 3 , g - 1 , g - 2 , g - 3 , and r - 1 ). if the intensity is below a predetermined level , a camera flash ( not shown ) will be activated to provide artificial illumination . if the intensity is above the predetermined level , the camera flash is not activated , and the digital controller 22 uses an algorithm to determine the appropriate exposure settings for the image capture device 11 . the algorithms for determining exposure settings are well known in the art , and can be , for example , an algorithm to calculate the exposure time for a given aperture setting based on film speed and total scene intensity . alternatively , a combination of aperture setting and exposure time can be determined by the digital controller 22 . the digital controller 22 then sends the appropriate aperture setting and shutter exposure time information to an aperture drive ( ad ) 32 and shutter drive ( sd ) 34 , respectively , of the image capture device 11 . it will be understood by those skilled in the art that the digital controller 22 can send the information as analog control voltage signals or as digital data signals . the aperture drive 32 and shutter drive 34 control the size of the aperture and the duration of the shutter in its open position , respectively , to adjust the exposure of the photographic film or digital image in a manner well known in the art . it is well known in the art that other types of digital cameras use interline transfer ccd sensors which integrate the incident illumination over an exposure time . these sensors vary the exposure duration electronically , and therefore , do not utilize a shutter exposure time or an aperture setting . for digital cameras using interline transfer ccd sensors , the digital controller 22 can determine an appropriate exposure integration time from the summation of the spectral intensities from all spectral regions . interline transfer ccd sensors are described in more detail in &# 34 ; solid state imaging with charge - coupled devices &# 34 ; by a . theuwissen , on page 117 . the scene intensity measuring and illumination source detection apparatus 10 in accordance with the present invention has been described in conjunction with digital processing . however , it would be understood by persons skilled in the art that the processing could also be accomplished by analog processing , for example , by use of an analog comparator or by taking the difference of two signals produced by a logarithmic amplifier . the invention has been described in detail with particular reference to a preferred embodiment thereof . however , it will be appreciated that variations and modifications can be effected by a person of ordinary skill in the art without departing from the spirit and scope of the invention .	6
referring now to fig1 there is shown a schematic drawing of a logic tree of active and passive cholesteric liquid crystal ( clc ) elements which are so arranged and controlled that a single input to a first stage of the logic tree may be delivered to any one of the outputs of the last stage of the logic tree by appropriately switching electronically controlled half - wave retarders associated with the active clc elements of the logic tree . by programming the switching of the half - wave retarders of each stage of the logic tree , a laser input to the first stage of the logic tree may , for example , provide a scanned version of the input at the outputs of the last stage of the logic tree . the application of the logic tree as a scanner will be described in detail in what follows . it will also become clear that the same embodiment has other applications . considering fig1 in more detail , logic tree 1 is shown consisting of a plurality of stages labeled stage 1 - stage 4 wherein each stage includes one or more branches each of which consists of an active and passive clc element . thus , stage 1 consists of a branch 2 which , in turn , includes active clc element 18 and passive clc element 19 . stage 2 consists of branches 3 , 4 ; the former including active clc element 21 and passive clc element 22 while the latter includes active clc element 23 and passive clc element 24 . stage 3 consists of four branches 5 - 8 each of the branches consisting of active and passive clc elements 31 , 33 , 35 , 37 and 32 , 34 , 36 , 38 , respectively . similarly , stage 4 consists of eight branches 9 - 16 each of these branches including active and passive clc elements 41 , 43 , 45 , 47 , 49 , 51 , 53 , 55 and 42 , 44 , 46 , 48 , 50 , 52 , 54 , and 56 , respectively , just like the previously mentioned branches . at this point , it should be appreciated that many more stages may be added to tree 1 with each succeeding stages having twice as many branches as the preceding stage . using this approach , stage 4 in fig1 has 2 n − 1 branches wherein n is the stage number . thus , stage 4 has 2 4 − 1 or eight branches . since each branch has two clc elements , each stage has 2 n elements and , for stage 4 , sixteen elements . thus , stage 10 , for example , would have 2 10 or 1024 clc elements providing one light output per element or 1024 outputs . since fig1 is representative of the way logic tree 1 operates regardless of the number of stages , only four stages have been incorporated to clearly demonstrate how such a logic tree may be used to provide a scanned light output from a plurality of elements which are activated by an input from a single source of electromagnetic energy . before describing the operation of fig1 it should be understood that the active clc elements of each branch in fig1 do not depart from similar active elements shown in fig1 of u . s . pat . no . 5 , 459 , 591 entitled “ electromagnetic energy beam steering devices ” in the name of s . m . faris , which is hereby incorporated by reference . the passive clc elements of the present invention differ from the active clc elements in that the passive clc elements do not incorporate an electronically controlled , variable half - wave retarder or π - cell . thus , each branch of logic tree 1 as represented by branch 2 of fig1 includes an active clc element 18 and a passive clc element 19 . the former includes a cholesteric liquid crystal member 60 , a transparent electrode 62 , a ground plane ( not shown ), and a controllable half - wave retarder 61 while the latter includes a cholesteric liquid crystal member which is identical to member 60 . since each of the branches 3 , 4 , 5 - 8 and 9 - 16 is identical with branch 2 of fig1 each cholesteric liquid crystal element and each half - wave retarder of each branch is identified with the same reference numbers 60 , 61 respectively . in fig1 active clc element 18 and passive clc element 19 of branch 2 both include cholesteric liquid crystal members 60 which are disposed at an angle , preferably 45 °, within each of the elements 18 , 19 . members 60 are made from a nematic liquid crystal material with chiral additives or polysiloxane side - chain polymers which cause the cigar - shaped molecules to be spontaneously aligned in an optically active structure of either a left - handed or right - handed helix with a helical pitch , p . the twisting direction and the pitch , p , of the helices are determined by the nature and concentration of the additives . a clc member , like member 60 , has all its helices aligned in one direction and is capable of reflecting light , for example , having one circular polarization having a characteristic wavelength or band of wavelengths . cholesteric liquid crystal ( clc ) members 60 which are used in the practice of the present invention and their method of fabrication are shown in u . s . pat . no . 5 , 221 , 982 , filed jul . 5 , 1991 and issued on jun . 22 , 1993 in the name of s . m . faris . this patent is herewith incorporated by reference . while clc members 60 are shown in fig1 as being single elements , it should be understood that a plurality of clc members 60 may be substituted for each of the members 60 to provide for the reflection and transmission of circularly polarized radiation having a plurality of wavelengths or band of wavelengths which are provided by a plurality of sources of electromagnetic radiation . it should be appreciated that , in the practice of the present invention , members 60 may be made of any material which can be switched to reflect and / or transmit electromagnetic energy by the application of electric or magnetic fields to that material . half - wave retarders or π - cells 61 shown schematically in fig1 are of the type shown and described in u . s . pat . no . 4 , 670 , 744 , filed march 14 , 1985 and issued on jun . 2 , 1987 in the name of t . s . buzak and may be utilized in the practice of the present invention . the buzak patent is herewith incorporated by reference . alternatively , instead of clc films , polarizing reflectors , polarizing prisms or mcneill prisms may be utilized in the practice of the present invention and are commercially available . when more than a single wavelength of electromagnetic radiation is used in the arrangement of fig1 a broad band π - cell may be utilized to provide half - wave retardation of each wavelength to maintain the same intensity level for each wavelength . logic tree 1 of fig1 is activated from a source 17 of electromagnetic radiation which may be a laser or any other source of radiation the output of which may be converted from a linearly polarized orientation to a circularly polarized orientation by means of a quarter - wave plate ( not shown ) in a manner well known to those skilled in the optical arts . if the resulting output is not appropriately polarized , a half - wave retarder may be utilized to provide the conversion from one circular polarization to the other polarization . for purposes of the present application , radiation emanating from source 17 is circularly polarized in either a clockwise or counter - clockwise direction . lasers which are commercially available may be utilized to provide outputs which fall within the visible , infrared or ultraviolet spectra . while source 17 is shown as a single source in fig1 it should be appreciated that it also represents a plurality of sources each having a different wavelength . thus , source 17 may include lasers which emit at the red , green and blue wavelengths of the visible spectrum so that the projected beam of radiation is a beam of light having a single color or combinations of these wavelengths . it should also be appreciated that source 17 may comprise lasers or other sources of electromagnetic radiation which are capable of being intensity modulated . in this way , the source output may be varied in intensity from zero to a maximum intensity including all gradations in between . in fig1 source of electromagnetic radiation 17 is shown directly irradiating a member 60 of active element 18 of branch 2 from which it is either transmitted or reflected depending on the polarization of the emitted radiation . the emitted radiation from source 17 may have a single intensity or it may be an intensity modulated signal provided by a television camera 25 or the like . by appropriately programming π - cells or half - wave retarders 61 , an unmodulated or intensity modulated signal is delivered in a scanned manner to the active and passive clc elements 41 - 56 of branches 9 - 16 of stage 4 . in this way , an unmodulated or intensity modulated beam of radiation is scanned across elements 41 - 56 providing an output which is similar in every way to a single scan line of a conventional television set . if an input is provided in digital form , a digital - to - analog converter 26 may be interposed between camera 25 and source 17 in a well - known manner . in fig1 variable half - wave retarders 61 are activated by a programmable pulsed source 27 which gets timing information from camera 25 via interconnection 28 . a plurality of driver interconnections 29 extend from pulsed source 27 and each interconnection 29 is connected to a separate electrode 62 which applies an electric field to an associated half - wave retarder 61 when activated by pulsed source 27 . in fig1 fifteen driver interconnections 29 would be utilized each one of which , when pulsed , activates a separate variable half - wave retarder 61 . in operation , logic tree 1 is activated when source 17 is activated . the object is to provide a scanned output from a single input to a plurality of outputs in stage 4 of logic tree 1 . it is , therefore , required that the outputs of active and passive elements 41 , 43 , 45 , 47 , 49 , 51 , 53 , 55 and 42 , 44 , 46 , 48 , 50 , 52 , 54 and 56 , respectively , be activated so that outputs are obtained from these elements in the order shown in fig1 . since element 41 is to provide the first output , if the input signal is right - hand circularly polarized ( rcp ) radiation and all members 60 are designed to be reflective of left - hand circularly polarized ( lcp ) radiation , the rcp light passes through active elements 18 , 21 , 31 and 41 unhindered since these elements reflect lcp radiation and transmit rcp radiation . an rcp radiation output , therefore , appears at the output port of element 41 . in the next time period , half - wave retarder 61 of element 41 is activated by a pulse from pulsed source 27 via an interconnection 29 to electrode 62 causing retarder 61 to introduce a half - wave delay into the input rcp radiation which has passed through active elements 18 , 21 and 31 causing the rcp radiation to be converted to lcp radiation . the lcp radiation then reflects from member 60 of element 41 which is reflective of lcp radiation toward member 60 of element 42 which is also reflective of lcp radiation . the impinging lcp radiation is then reflected to the output port of element 42 . in the next time period , an output is desired from the output port of active element 43 . to accomplish this , retarders 61 at the inputs of active elements 31 of stage 3 and active elements 43 of stage 4 are activated by applying pulses to their associated transparent electrodes 62 . once this is done , the rcp radiation at the input of active element 31 is converted to lcp radiation and reflects from lcp reflective member 60 over to lcp reflective member 60 of passive element 32 where it is reflected toward active element 43 . the lcp input at active element 43 encounters a half - wave retarder 61 and is converted to rcp radiation . the latter then passes unaffected to the output port of active element 43 because its clc member 60 reflects only lcp radiation . in the next interval , pulsed source 27 deactivates half - wave retarder 61 associated with active element 43 and continues activation of the half - wave retarder 61 associated with active element 31 . in this way , the lcp radiation impinging on element 43 encounters no delay and remains as lcp radiation which is then reflected from lcp reflective member 60 of element 43 toward passive element 44 . the thus reflected lcp radiation is reflected from lcp reflective member 60 of element 44 to its output port . rather than tediously describing every passage through every element , the order of the activation of half - wave retarders 61 will be described since every path from input to output port can be gleaned from the previous description and drawing shown in fig1 . to obtain an output at active element 45 , only the variable half - wave retarders 61 associated with active elements 21 and 33 must be activated . to obtain an output at active element 46 , variable half - wave retarders 61 associated with active elements 21 , 33 and 45 must be activated . to obtain an output at active element 47 , the variable half - wave retarders associated with active elements 21 and 47 must be activated . to obtain an output at passive element 48 , only the variable half - wave retarder associated with active element 21 need be activated . an output at active element 49 may be obtained by activating the half - wave retarders associated with active elements 18 and 23 . an output at passive element 50 may be obtained by activating the half - wave retarders associated with active elements 18 , 23 and 49 . to obtain an output at active element 51 , the half - wave retarders associated with active elements 18 , 35 and 51 must be activated . an output may be obtained from passive element 52 by activating half - wave retarders 61 associated with active elements 18 , 23 and 35 . to obtain an output at active element 53 , half - wave retarders 61 associated with active elements 18 and 37 must be activated . an output at passive element 54 may be obtained by activating half - wave retarders 61 associated with active elements 18 , 37 and 53 . to obtain an output at active element 55 , half - wave retarders 61 associated with active elements 18 and 55 are activated . finally , active element 56 is activated by activating half - wave retarder 61 associated with active element 18 . once half - wave retarders 61 are activated by applying pulses to transparent electrodes 62 from programmable pulsed source 27 as described hereinabove , a scanned output varying in intensity at each of the active and passive elements 41 through 56 is obtained . the outputs do not all have the same polarization and , for the embodiment of fig1 have a polarization pattern of alternating rcp and lcp as the elements are scanned from left to right . recognizing that such variation is present is important where outputs having the same circular polarization are desired or required so that fixed half - wave retarders may be placed to convert all the polarization &# 39 ; s to the same polarization . thus , in fig1 for example , fixed half - wave retarders 63 may be placed at the outputs of active elements 41 , 43 , 45 , 47 , 49 , 51 , 53 and 55 to convert their rcp outputs to lcp . the ability to do this conversion is particularly important in arrangements which provide a 3 - d output because the perception of 3 - d is based on having two spatially displaced images each of which has a different polarization . if the input to active clc element 18 in fig1 is changed to lcp and all the clc members 60 in logic tree 1 are changed to be reflective of rcp , the outputs obtained are exactly the same as those shown in fig1 . an identical output pattern to that shown in fig1 is obtainable where the input is lcp and all the members 60 are reflective of lcp . a pattern opposite to that shown in fig1 is obtainable where the input is rcp and all the members 60 are reflective of rcp . [ 0057 ] fig2 is a schematic diagram of a logic tree 1 similar to that shown in fig1 . it shows only the logic tree without the associated laser and electronics . the purpose is to show that the polarization of members 60 reflective of different polarizations may be varied to produce outputs having different polarizations from those shown in fig1 . each of the boxes representing active and passive elements in fig2 contains either the letter l or r indicating that the clc member 60 therein is reflective of either left - handed or right - handed circular polarization . without going into exhaustive detail , suffice it to say that the outputs shown in fig2 are obtained from an lcp input having the following polarization pattern when retarders 61 are switched in the same order as described in connection with fig1 : a pattern different from that shown above would be obtained if the input polarization were changed to rcp and members 60 of logic tree 1 were reflective of polarization &# 39 ; s opposite to those shown in fig2 . the output pattern is as follows : the foregoing illustrates how the output polarization may be controlled for applications where information is polarization encoded or scrambled ; transmitted and decoded or unscrambled by using a key which controls the variable half - wave retarders 61 . from the point of view of ease of manufacturing , logic trees having the same clc members 60 are the most advantageous as will be seen when the fabrication process is described hereinbelow . the arrangement of fig1 provides an advantage over the scanning arrangement shown in u . s . pat . no . 5 , 459 , 591 in that input light has to traverse , in a 1024 × 1024 array , 1024 clc members 2 ( in the patent ) to provide an output at its furthest imaging cell 1 ( in the patent ). if each clc member has transmissibility ( t ), the final imaging cell will have a transmissibility of ( t ) 1024 . thus , even with a transmissibility approaching 1 , say 0 . 999 , the output at the 1024 th imaging cell would be : ( 0 . 999 ) 1024 which , to all intents and purposes , is zero . opposed to this is the present approach where , to provide the last output in a 1024 × 1024 array , only twenty clc members 60 or two per stage need to be traversed providing a transmissibility of ( t ) 20 . under these conditions the 1024th output , assuming t = 0 . 999 , would be ( 0 . 999 ) 20 which is approximately ninety percent of the input intensity . the minimum transmissibility for a ten stage array would be ( t ) 10 or one transition per stage . from the foregoing , while logic tree 1 of fig1 represents an improvement over the prior art in terms of output light intensity , it should be clear that each logic tree 1 requires its own input laser or source of electromagnetic radiation 17 . thus , to provide an 8 × 8 array , for example , eight logic trees 1 would have to be stacked in the manner shown in fig3 . [ 0066 ] fig3 is an orthographic projection of eight logic trees 1 positioned one atop the other which , in accordance with the teaching of the present application , provide 64 outputs . one source of electromagnetic radiation 17 per logic tree 1 is required . because of space limitations , the showing of fig3 has been limited to the use of only three of the stages of fig1 . also , since each of logic trees 1 in fig3 is identical with the other logic trees 1 , only the topmost logic tree 1 with its clc members 60 and variable half - wave retarders 61 have been shown . also , as will become clear hereinafter , the dimensions shown are not to scale . in fig3 × 8 array 70 is shown which comprises eight logic trees 1 stacked one atop the other . each logic tree 1 is comprised of three stages , stage 1 , stage 2 , and stage 3 . stage 1 comprises branch 2 ; stage 2 comprises branches 3 , 4 and stage 3 comprises branches 5 - 8 as shown in fig1 . each branch includes active and passive clc elements similar to those shown in stages 1 - 3 of fig1 and each of the active and passive elements includes a cholesteric liquid crystal member 60 which is positioned at an angle of 45 ° within each of the active and passive elements of array 70 . also , included are variable half - wave retarders 61 which are arranged in fig3 just like the variable retarders 61 in stages 1 - 3 of fig1 . in fig3 each logic tree 1 is activated by an associated source of electromagnetic radiation 17 , preferably a laser , thus requiring a total of eight sources 17 . as each laser is actuated , variable half - wave retarders 61 are actuated as described in connection with fig1 hereinabove and the output of each laser 17 appears as a scanned modulated signal going from left to right at the outputs of imaging cells 71 of each of logic trees 1 . in the arrangement shown in fig3 sources 17 and retarders 61 may be actuated sequentially or simultaneously . if the outputs of sources 17 are converted to right - hand circular polarization ( rcp ) and all clc members 60 are reflective of left - hand circular polarization ( lcp ), the outputs of each logic tree 1 of fig3 will be the same as those shown in fig1 namely : as suggested in connection with the description of fig1 fixed half - wave retarders may be appropriately positioned to make all the outputs have the same polarization . while the number of lossy transitions per logic tree has been reduced over that shown in the prior art , this has been accomplished by the use of a source 17 for each logic tree 1 incorporated in an array 70 . with arrangements like that shown in fig3 expanded to a 1024 × 1024 array , for example , 1024 sources 17 would be required . this requirement can be eliminated and the number of sources reduced to one by using a logic tree 1 like that shown in fig1 the outputs of which , provided from a single source 17 , act as inputs to an array 70 like that shown in fig3 . this will become clear from a consideration of fig4 which is an orthographic projection similar to fig3 except that , instead of a plurality of sources 17 , only a single source 17 , in combination with a logic tree 1 like that shown in fig1 disposed perpendicularly to the logic trees 1 of fig3 is required . considering fig4 in more detail , array 70 is identical with array 70 shown in fig3 . also , source of electromagnetic radiation 17 in fig4 is similar to sources 17 shown in fib . 3 . in fig4 an input logic tree 72 is shown disposed between array 70 and source 17 such that each imaging cell 71 of logic tree 72 acts as an input to an associated logic tree 1 of array 70 . thus , the uppermost imaging cell 71 of input logic tree 72 provides an input to the leftmost element of the topmost of logic trees 1 of array 70 . this input which may be an intensity modulated signal from source 17 , is scanned across the imaging cells 71 of the topmost logic tree 1 of array 70 in a manner analogous to the scan of a television frame . when the scanned output of the topmost logic tree 1 reaches its last imaging cell 71 , the output of source 17 is switched to the next imaging cell 71 ( immediately beneath the topmost imaging cell 71 ) of logic tree 72 . the output of that next imaging cell then acts as the input to the logic tree 1 immediately beneath the topmost logic tree 1 of array 70 . the inputs to the last mentioned logic tree 1 are then delivered to the imaging cells 71 of that logic tree 1 in sequence from left - to - right providing a scanned , intensity modulated signal similar to that of a television scan line . each of the remaining imaging cells 71 of input logic tree 72 is then actuated by programming electrodes 62 and variable half - wave retarders 61 associated with logic tree 72 in the same manner described hereinabove in connection with fig1 . similarly , each of the logic trees 1 of array 70 is actuated by outputs from an associated imaging cell 71 of input logic tree 72 . then , under control of programmed electrodes 62 and half - wave retarders 61 , these outputs , now inputs , to an associated logic tree 1 , are delivered to the imaging cells 71 of each logic tree 1 as a scanned line having portions which may vary in intensity from imaging cell 71 - to - imaging cell 71 . in this way , by accessing logic trees 1 from top - to - bottom , for example , in fig4 an image is built up which , depending on the imaging cell density , can provide images of extremely high resolution . from the foregoing , it should be clear that the modulated output of a single source 17 , preferably a laser , may be delivered to the imaging cells 71 of a plurality of stacked logic trees 1 like array 70 in fig4 . as shown in fig4 the use of an input logic tree 72 permits the use of a single source 17 as opposed to the multiplicity of sources 17 shown in fig3 . the value of the arrangement shown in fig4 becomes more apparent when it is recalled that for a 1024 × 1024 array embodiment like fig3 lasers would be required . thus , in addition to reducing the number of lossy transitions as provided by the embodiment of fig3 the embodiment shown in fig4 also reduces the number of sources 17 required to the absolute minimum of one . while the electronic equipment required to operate displays like those shown in fig3 , has not been shown , it should be appreciated that the same components as shown in fig1 and which are well - known in the imaging arts may be utilized in the practice of the present invention . thus , timing information obtained from camera 25 , for example , is applied via interconnection 28 to programmable pulsed sources 27 . the latter then applies switching signals to both logic tree 72 and each of logic trees 1 to appropriately control their electrodes 62 and half - wave retarders 60 so that a scanned energy output may be delivered from the imaging cells 71 of each logic tree 1 and input logic tree 72 . referring now to fig5 an orthographic projection of an imaging array is shown which , in combination with viewing glasses and stereo displaced images provides a 3 - d display . in fig5 input logic tree 72 is accessed by a source 17 of electromagnetic radiation which is modulated by outputs of a stereoscopic television camera 73 via interconnection 74 . the two outputs from stereo camera 73 are stereo displaced so that , if they are separated one from the other by some characteristic like polarization , the two resulting images may be delivered one to each eye ( using appropriate glasses ) and combined in the brain to provide a three - dimensional image . one of the images is provided by applying scanned lines from stereo camera 73 via interconnection 74 to laser 17 . the output of the latter is then applied to input logic tree 72 from which scanned line outputs are delivered from the topmost and alternate imaging cells 71 under control of programmable pulsed source 75 which actuates variable half - wave retarders 61 thereof via interconnections 76 . the output from the topmost of imaging cells 71 of input logic tree 72 is applied for a given interval to leftmost member 60 of the uppermost of logic trees 1 . at the same time , variable half - wave retarders 61 under control of programmable pulsed source 27 are appropriately actuated so that a portion of the scanned line from stereo camera 73 is delivered to each of the imaging cells 71 of the uppermost of logic trees 1 of array 70 . in the instance of fig5 each imaging cell 71 of array 70 is illuminated for a time equal to ⅛ the given interval of a scanned line from camera 73 . for a 1024 × 1024 array , the illuminating time would be { fraction ( 1 / 1024 )} th of the scanned line interval . the first image is completed by applying scanned lines from stereo camera 73 via interconnection 74 which modulate laser 17 during each alternate interval after the first to each alternate imaging cell 71 after the first imaging cell 71 of input logic tree 72 . each scanned line is delivered to the imaging cells 71 of each alternate logic tree 1 of array 70 in the same manner described in connection with the delivery of the first scanned line to the uppermost of logic trees 1 of array 70 . the stereo displaced image from stereo camera 73 is delivered as scanned lines via interconnection 74 to laser 17 where they modulate the output of laser 17 . the stereo displaced scanned line outputs are delivered to laser 17 during the second and alternate intervals after the second interval . the first stereo displaced output from laser 17 , under control of programmable pulsed source 75 which appropriately actuates the variable half - wave retarders 61 of input logic tree 72 , is delivered to the second - from - the - top of imaging cells 71 of logic tree 72 as a scanned line . this last mentioned output acting as an input to the leftmost clc member 60 of the second - from - the - top of logic trees 1 of array 70 is delivered to the imaging cells 71 of the second - from - the - top of logic trees 1 of array 70 under control of programmable pulsed source 27 as portions of the scanned line output of laser 17 . as with the first image generation , the imaging cells 71 of the stereo displaced image are illuminated for a time equal to ⅛ the given interval of a scanned line . the stereo displaced image is completed by applying scanned lines from stereo camera 73 via interconnection 74 to laser 17 during each alternate interval after the second interval to each alternate imaging cell 71 after the second imaging cell 71 of input logic tree 72 . each stereo displaced scanned line is delivered to the imaging cells 71 of the second and alternate logic trees 1 of array 70 in the same manner described in connection with the delivery of the first stereo displaced scanned line to the second - from - the - top of logic trees 1 of array 70 . if the polarization applied to logic trees 1 is rcp and the members 60 thereof are designed to reflect lcp , logic trees 1 provide an image at their imaging cells 71 in the same way described in connection with fig1 and the resulting outputs will have polarizations like those shown in fig1 . the polarizations at stage 3 for each of logic trees 1 are : to obtain this result , however , input logic tree 72 must provide rcp at all its imaging cells 71 . this requires an rcp input from laser 71 , a logic tree with elements which reflect lcp and fixed half - wave retarders 63 ( not shown ) disposed after imaging cells 71 which provide lcp outputs . to obtain a single polarization for all of the outputs of first and alternate logic trees 1 of array 70 , for example , rcp , the lcp outputs of these logic trees 1 must be converted to rcp . this is accomplished by interposing fixed half - wave retarders 63 over the imaging cells 71 having lcp outputs . similarly , to obtain a single but opposite polarization for all of the outputs of the second and alternate logic trees 71 , for example , lcp , the rcp outputs of these logic trees 1 must be converted to lcp . this is accomplished by interposing fixed - half wave retarders 63 over the imaging cells 71 having rcp outputs . at this point , two stereo - displaced images appear at the output imaging cells 71 of array 70 . one image has an rcp polarization while the other has an lcp polarization . then , using glasses which have one lens which passes rcp and another lens which passes lcp , a 3 - d image is perceived by a viewer . in connection with the 3 - d embodiment of fig5 it should be appreciated that outputs from stereo camera 73 may be in either digital or analog form . if the former , the digital signals may be converted to analog signals using a digital - to - analog converter in a well - known way . also , to the extent that logic trees 1 are provided with signals representing a scanned line of an image and a stereo displaced image , these signals are arranged to alternately access alternate ones of logic trees 1 in succession until two stereo displaced images are formed at the imaging cells 71 of array 70 . the scanned lines of an image and a stereo displaced image are electronically interlaced so that source 17 is modulated first by signals representing a scanned image and then by signals representing a scanned stereo displaced image and so on in succession until the two images are formed . from fig5 it can be seen that , for a 3 - d array , two 4 × 8 interleaved arrays are required , one for an image and another for a stereo displaced image . extrapolating this information to a practical level , if 1024 imaging cells are wanted for each image , an array of 2048 × 1024 imaging cells would be required . using the same approach as demonstrated by fig5 two 512 × 1024 interleaved arrays may be used with the sacrifice of some resolution . in fig5 logic trees 1 have been interleaved horizontally for ease of fabrication but , they may be interleaved vertically without departing from the spirit of the present application . referring now to fig6 there is shown an orthographic , cut - away projection of a plurality of layers 80 of insulating material , like sio 2 , polycarbonate , acrylic or any other appropriate optically transparent material , and a plurality of layers 81 of cholesteric liquid crystal ( clc ) material interleaved with layers 80 . in fig6 layers 80 , 81 are subjected to a slicing operation which cuts into layers 80 , 81 at an angle , preferably 45 °. layers 80 , 81 may be cut by saws , lasers , jets or other appropriate tool to provide layers 82 which contain clc members 60 disposed at an angle of 45 ° in insulating material as shown in fig7 . [ 0094 ] fig7 is a cross - sectional view of a layer of insulating material in which clc members 60 are disposed at an angle of 45 °. the spacing of clc members 60 is determined by controlling the thicknesses of insulating layers 80 prior to the slicing step of fig6 . since alignment of clc members 60 is important in transmitting electromagnetic energy from stage - to - stage the spacing of members 60 must be carefully controlled . thus , in fig7 the spacing between clc members 60 is t units and could comprise stage 1 , for example , of array 70 of fig4 . [ 0095 ] fig8 is a cross - sectional view of a layer of insulating material in which members 60 are disposed at an angle of 45 ° and is similar to fig7 except that members 60 are spaced apart by t / 2 units . layer 82 and other like layers are fabricated by slicing an arrangement like that shown in fig6 except that the thicknesses of layers 80 of insulating material are reduced to half that shown in fig6 . after slicing a stack like that shown in fig6 the resulting layer 82 with a spacing of t / 2 between members 60 could comprise stage 2 , for example , of array 70 of fig4 . [ 0096 ] fig9 is a cross - sectional view of a layer of insulating material in which members 60 are disposed at an angle of 45 ° and is similar to fig7 except that members 60 are spaced apart by t / 4 units . layer 82 in fig9 is fabricated by slicing an arrangement like that shown in fig6 except that the thicknesses layers 80 would be reduced to one - quarter that shown in fig6 . after slicing a stack like that shown in fig6 the resulting layer 82 with a spacing of t / 4 between members 60 could comprise stage 3 , for example , of array 70 of fig4 . the spacing of members 60 is always reduced by half as additional stages are added so that higher and higher resolutions may be obtained . thus , for an array with ten stages , the spacing between clc members 60 would be t / 512 units . by slicing arrangements like that shown in fig6 and controlling the thicknesses of layers 80 , layers 82 with members 60 spaced apart by different amounts like those shown in fig7 - 9 may be easily obtained . as will be seen below , layers 82 with appropriately spaced members 60 may be stacked to produce an array 70 like that shown in fig4 or an array having as many stages as desired . this can be done on a mass - production basis to produce literally thousands of layers like layers 82 of fig7 - 9 . [ 0099 ] fig1 is a cross - sectional , orthographic projection of a layer 82 which contains clc members 60 disposed at an angle of 45 ° therein . layer 82 in fig1 is similar to layer 82 of fig8 except that in fig1 , a ground plane 83 is deposited or formed on the bottom of layer 82 . layer 83 is transparent and metallic in character and acts as a ground plane for subsequently deposited electrodes which activate variable half - wave retarders 61 . a material like indium - tin oxide ( ito ) may be deposited or formed in a well - known way on the bottom of layer 82 of fig1 . the transparency of ito , of course , permits the transmission of light energy from stage - to - stage with little or no loss in intensity . referring to fig1 , there is shown a cross - sectional , orthographic projection similar to fig1 except that electrodes 84 are shown disposed over every other clc member 60 , like they would be if layer 83 of fig1 were to be utilized as a stage 2 in an array 70 like that shown in fig4 . this pattern of electrode spacing will always be the same regardless of which stage is being considered . a reconsideration of fig1 shows this to be true since each stage always comprises at least one branch consisting of active and passive clc elements . electrode 84 ( 62 in fig1 ) is always associated with and forms a part of variable half - wave retarders 61 which , in turn , is always associated with the active clc element of any branch . like ground plane 83 , electrode 84 is comprised of indium - tin - oxide ( ito ) material which is transparent to the electromagnetic radiation being utilized . to obtain electrodes 84 in the form shown in fig1 , indium - tin oxide is formed atop layer 82 and , using well - known lithographic , masking and etching techniques , electrodes 84 are appropriately positioned over every other clc member 60 . rather than carrying out two separate deposition steps for ground plane 83 and electrodes 84 , the ito material may be formed simultaneously on each side of layer 82 . then , the photolithographic , masking and etching steps are carried out . referring now to fig1 , there is shown a cross - sectional view of a layer 82 similar to that shown in fig1 except that a spacer is added around the periphery of layer 82 and the thus enclosed volume is filled with a phase - shifter material in liquid form . in fig1 , a spacer 85 is formed around the periphery of layer 82 by , for example , gluing a spacer 85 of insulating material around the edge of layer 82 . spacer 85 separates layers 82 from other overlying layers and defines the volume into which phase - shifter material 86 is placed . [ 0103 ] fig1 is a top view of a logic tree 1 made up of layers 82 like those shown in fig7 - 12 . the arrangement of fig1 shows the topmost logic tree 1 of fig4 after it has been fabricated in accordance with the teaching of the present application . fig1 can also be considered a side - view of input logic tree 72 since its structure does not depart in any way from the structure of logic tree 1 . one way of assembling the structure of fig1 , is to stack a finished layer 82 like that shown in fig1 on a finished layer 82 like that shown at the bottom of fig1 . another layer 82 like that shown at the top of fig1 is stacked atop the finished layer 82 of fig1 . the layers are glued together with the topmost layer 82 forming stage 1 as shown in fig4 ; the middle layer 82 forming stage 2 as shown in fig4 and the bottom layer 82 forming stage 3 as shown in fig4 . thus , inputs provided to the leftmost clc member 60 of topmost layer 82 will , under control of inputs to electrodes 84 from pulsed source 27 , appear as outputs emanating , from left - to - right , from clc members 60 of bottommost layer 82 as a scanned line of modulated or unmodulated light . for the array , once stacked , the top and bottom thereof may be covered with insulating layers , one of which contains holes which register with the ends of electrodes 84 and ground planes 83 . thus , even when logic trees 1 are not being utilized , their associated electrodes 61 , 84 which extend from top - to - bottom of array 70 and are electrically connected as shown in fig5 are simultaneously energized . inputs to the stacked logic trees 1 are provided , as shown in fig4 from imaging cells 71 of input logic tree 72 . the orientation of input logic tree 72 with respect to array 70 is best shown in fig4 which does not depart in any way from the arrangement of fig1 . the latter figure merely shows the structural details to better effect . thus , as previously explained in fig4 outputs from imaging cells 71 of input logic tree 72 are scanned from top - to - bottom of tree 72 and each output initially accesses the leftmost member 60 of its associated logic tree 1 such that outputs appear at imaging cells 71 of array 70 as a plurality of left - to - right scans which go from the topmost logic tree 1 to the bottommost logic tree 1 of array 70 . input logic tree 72 may take the form of an array 70 rotated 90 ° so that imaging cells 71 there of register with the leftmost retarder 61 of each of the logic trees 1 like lasers 17 as shown in fig3 . in this instance , only a single logic tree 1 of the rotated array 70 is energized . alternatively , the array shown in fig1 may be fabricated without introducing the phase shifter material 86 . the structure of fig1 is then sliced in a direction parallel to the surface there of resulting in a structure similar to input logic tree 72 as shown in fig4 . the resulting slice is placed on an insulating layer and bonded to it . a cover layer of insulating material having holes therein which register with electrodes 84 and ground planes 83 is fabricated by drilling or etching using well - known photolithographic techniques . the volumes enclosed by the insulation layer are now filled with liquid phase shifter material 86 . the cover layer is affixed to the other side of the logic tree slice . a metallic layer such as aluminum is then deposited on the surface of the cover layer and in the holes previously formed therein . then , using well - known photolithographic masking and etching techniques , conductors to electrodes 84 in a ground planes 83 are formed without going into exhaustive detail , it should be appreciated that the side of input logic tree 72 of fig4 may be butted against the back of array 70 . in this way , the overall thickness of the arrangement of fig4 is substantially reduced . well - known optical techniques using reflectors may be used to apply a 90 ° turn to light emanating from imaging cells 71 of tree 72 when it is butted against the back of array 70 . since electrodes 84 extend from front - to - back on each logic tree 1 as shown , for example , in fig1 , they are best accessed from the front or back of the array with activating metallic lines 29 , as shown in fig4 extending in insulated spaced relationship with a surface of array 70 to a plug which can be connected to pulsed source 27 , for example . this may be accomplished using well - known photolithographic and etching techniques . the arrangements shown in fig6 - 12 may have the following typical dimensions : layers 82 0 . 5 mm thick and up electrodes 84 500 å to 1000 å thick ground planes 83 500 å to 1000 å thick spacer 85 1μ to 10μ thick elements 60 2μ to 30μ thick cells 71 0 . 5 mm wide and up . may exceed 10 cm typical voltages applied to electrodes 84 may range between 5v and 100v . from the foregoing , it should be clear that arrays 70 may range in size from that typical of t . v . sets used in the home to displays similar to those used in stadia . the resulting arrays are flat , light weight , require but a single laser source or multiple laser sources and are inexpensive and easily fabricated .	7
although the present invention may be used with diagrams from any number of graphical environments , simulink / stateflow ( s / s ) diagrams are used as representative examples of such diagrams . simulink / stateflow ( s / s ) [ 2 ] diagrams are graphical representations of dynamical systems , and can capture both time - driven as well as event - driven dynamics of hybrid systems . stateflow diagrams are used for representing and simulating event - driven dynamics . the s / s diagrams can be simulated to generate sample - runs ( runs on sample times ) which provide a means for their validation . other means of validation include testing and verification . in order to be able to test a s / s diagram or verify an implementation of a s / s diagram , a model - based approach is desirable , where a model can be used for automated test generation or as a formal specification . simulink blocks can be time - driven or non time - driven . a time - driven block , such as an integrator block , represents the time - dependent mathematical relationships between its inputs and outputs . on the other hand , non time - driven block , such as a stateflow block or a discrete event subsystem block , may evolve upon the occurrence of events . here , we focus on study the semantic translation of time - driven blocks , and for conciseness , we write “ simulink blocks ” to mean only the “ time - driven simulink blocks ”. we propose an approach for translating the behaviors of a simulink diagram at ( discrete ) sample times to input / output - extended finite automata ( i / o - efa ) [ 9 , 15 ]. note that a simulink diagram can represent a hybrid system that combines event - driven discrete and time - dependent continuous behaviors , whereas i / o - efa is a model of a reactive untimed infinite state system . yet , since we are only interested in capturing the behaviors of a simulink diagram at sample times , an i / o - efa model ( which is untimed ) suffices . simulink provides a library of blocks ( such as transfer functions , discontinuities , math operations , logic and bit operations etc . ), which can be interconnected in a hierarchical fashion to form an overall simulink diagram . we consider the blocks in the simulink library to be “ atomic ”, and formally define an atomic - block . further we formulate two rules , namely connecting - rule and conditioning - rule , used in simulink for building complex blocks by combining the simpler ones , and formally define a class of simulink diagrams formed using these rules . this recursive view of defining the class of all simulink diagrams leads to a recursive translation in form of i / o - efa . in order to obtain an i / o - efa model recursively , we first present an algorithm for translating an atomic - block to an i / o - efa . next for each rule of combining simpler simulink diagrams to construct a complex simulink diagram , we develop a corresponding rule for combining the i / o - efa models of simpler simulink diagrams to build the i / o - efa model of the more complex simulink diagram . we introduce the concept of a step of an i / o - efa to emulate the computation of a simulink diagram at a sample time . a sequence of steps , namely , a step - trajectory , generates outputs over a sequence of sample times . we show that the translation approach is sound and complete : the input - state - output behavior of the i / o - efa , defined in terms of a step - trajectory , preserves the input - state - output behavior of the corresponding simulink diagram at each sample time ( assuming the same integration method for any of the continuous blocks with dynamics ). the translation approach is recursive . formal definitions of an atomic simulink block and a class of simulink diagrams formed using the identified connecting - rule and conditioning - rule are provided . these definitions can be used to create a more complex simulink diagram from the simpler ones . the model of i / o - efa is amenable to automated test generation [ 10 ] or verification [ 14 ]. the model can be directly supplied to a test generation or verification tool that accepts i / o - efa models or programming languages such as c / c ++ or java since an i / o - efa model can be easily translated into these languages . the translation approach has no special restriction on the types of simulink blocks . the approach supports virtually all blocks in simulink library ( in this patent we only consider time - driven blocks ) provided that the block can be mathematically written as input - state - output functions over time . also unlike [ 4 ], it does not require a clear separation between discrete and continuous dynamics for modeling hybrid systems . as an illustration , consider for example the bouncing ball example presented herein . the translation approach is sound and complete : the input - state - output behavior of an i / o - efa model , as defined in terms of a step - trajectory , preserves the input - state - output behavior of the corresponding simulink diagram at each sample time ( assuming the same integration method for any of the continuous blocks with dynamics ). the translation approach can handle the simulink features such as multi - rate diagrams , sample times with initial offsets , variable - step simulation etc . the translation approach is general in that it can be applied to other graphical modeling and simulation tools such as labview . we present the notion of an input - output extended finite automaton ( i / o - efa ) as a formal model of representation for a simulink diagram . i / o - efa is a model of a reactive untimed infinite state system in form of an automaton , extended with discrete variables such as inputs , outputs , and data . using i / o - efa as a model , many value - passing processes can be represented as finite graphs . an i / o - efa consists of locations ( i . e ., symbolic - state ), data ( i . e ., numeric - state ), numeric - inputs , numeric - outputs , symbolic - inputs , symbolic - outputs , transitions , an initial location , initial data values , and a final location . the locations ( symbolic - states ) together with the data ( numeric - states ) form the state - space of a i / o - efa . the locations are finite and form the vertices of the automaton graph . the edges of the graph represent transitions between the locations and are guarded by constraints over the data and the inputs . the occurrence of a transition triggers a data update and an output assignment . definition 1 an input / output extended finite automaton ( i / o - efa ) is a tuple l is the set of locations ( symbolic - states ), d = d 1 × . . . × d n is the set of typed data ( numeric - states ), u = u 1 × . . . × u m is the set of typed numeric - inputs , y = y 1 × . . . × y p is the set of typed numeric - outputs , σ is the set of symbolic - inputs , δ is the set of symbolic - outputs , l 0 εl is the initial location , d 0 ⊂ d is the set of initial - data values , l m εl is the final location , and e is the set of edges , and each eεe is a 7 - tuple , e =( o e , t e , σ e , δ e , g e , f e , h e ), where o e εl is the origin location , t e εl is the terminal location , σ e εσ ∪{ ε } is the symbolic - input , δ e εδ ∪{ ε } is the symbolic - output , g e ⊂ d × u is the enabling guard ( a predicate ), f e : d × u → d is the data - update function , h e : d × u → y is the output - assignment function . initially , p starts from the initial location l 0 and an initial data value d o εd 0 . while at a certain state ( l , d ) εl × d , a transition eεe such that o e = l is enabled if the input σ e arrives , and the data d and input u are such that the guard g e ( d , u ) holds . note when σ e = ε , the transition is enabled when only the guard g e ( d , u ) holds ; on the other hand when g e ( d , u )= true , then the transition is enabled when only σ e arrives . an enabled transition can be executed . the execution of an enabled transition e at the state ( o e , d ) causes p to transit to the location t e , the data value is updated to ƒ e ( d , u ), the output variable is assigned the value h e ( d , u ), and a discrete output δ e is emitted . simulink provides a library of blocks , which can be used as minimal systems , and the corresponding simulink diagrams will then be minimal simulink diagrams . we refer to such blocks as atomic blocks . the atomic - blocks can be composed in a recursive fashion to construct more complex simulink diagrams , and we discuss the rules of composition in the next section . an atomic - block can be stateful or stateless . a stateful block &# 39 ; s output depends on the history of its inputs . an example of a stateful block is the unit delay block . on the other hand , the output of a stateless block depends only on its current inputs . an example of a stateless block is the gain block , which simply outputs its input signal , multiplied with a constant called the gain . an atomic - block can be classified as continuous - time versus discrete - time , and is associated with a sample - period . for a continuous - time block , sample - period is the time between the instants when it is numerically simulated . for a discrete - time block , sample - period is the time between the instants when the corresponding discrete - time system evolves . definition 2 an atomic simulink block ψ can be represented as a tuple ( u ψ , y ψ , d ψ , d 0 ψ ,{( g i ψ , ƒ i ψ , h i ψ )} i = 1 q ψ ,( t ψ , t o ψ )), u ψ = u 1 ψ × . . . × u m ψ ψ is the set of typed inputs , y ψ = y 1 ψ × . . . × y p ψ ψ is the set of typed outputs , d ψ = d 1 ψ × . . . × d n ψ ψ is the set of typed data , d 0 ψ ⊂ d ψ is the set of initial data conditions , {( g i ψ , ƒ i ψ , h i ψ )} i = 1 q ψ is a set of triples , where g i ψ ⊂ d ψ × u ψ is a predicate representing an enabling guard , such that v i = 1 q ψ g i = true , ƒ i ψ : d ψ × u ψ → d ψ is a data - update function , h i ψ : d ψ × u ψ → y ψ is an output - assignment function . t ψ is the sample period and t 0 ψ is an offset ( it is assumed zero by default if unspecified ). remark 1 the kth sampling time occurs at kt ψ + t o ψ . the value of the input signal at the kth sampling time is denoted as u ( k )=( u 1 ( k ), . . . , u m ψ ( k )) εu ψ , and similarly for other signals . at the kth sampling time , if the data d ( k ) and the input u ( k )) are such that g i ψ ( d ( k ), u ( k )) holds , the next data , d ( k + 1 )= ƒ i ψ ( d ( k ), u ( k )), is computed , and the output value is assigned to y ( k )= h i ψ ( d ( k ), u ( k )). note that for continuous - time blocks , the data - update and output - assignment functions correspond to the ones obtained through discretization at sample times using an appropriate integration method . simulink allows different kinds of sample period that include discrete , continuous , inherited (− 1 ), constant ( inf ) and triggered etc . discrete sample periods are the only kind for which the evolution times of the corresponding system are known a priori . for blocks with other kinds of sample period , simulink determines the evolution times of the corresponding system from the block &# 39 ; s type or by its context within the model during the compilation phase of simulation . given a simulink diagram , the sample period of a non continuous - time block can be obtained from the get_param ( object , ‘ compiledsampletime ’) command after compiling the diagram . the sample - period of a continuous - time block , which is used in discretization , can be chosen to be the greatest common divisor of all non continuous - time blocks using the following rule [ 3 ]: for 1 ≦ i , j ≦ n , t ψ = { gcd ⁡ ( { t ψ i } ) if ⁢ ⁢ t o ψ i = t o ψ j gcd ⁡ ( { t ψ i , t o ψ i } ) otherwise , ⁢ and ⁢ ⁢ t o ψ = { t o ψ i if ⁢ ⁢ t o ψ i = t o ψ j 0 otherwise . also note for a stateless atomic - block ψ , the set d ψ is empty ( and accordingly , there are no initial data conditions or data - update functions ). the integrator block provides a continuous - time integration of the input signal . it models the relations , { dot over ( d )}( t )= u ( t ) with d ( 0 )= d 0 , and y ( t )= d ( t ), where u is its input , d is its data , y is its output , t is the continuous - time variable , and d 0 is the initial data condition . using euler &# 39 ; s method the discretization is d ( k + 1 )= d ( k )+ t ψ u ( k ). thus , the integrator block can be represented as : ( u , y , d , d 0 ,{(−, d ( k + 1 )= d ( k )+ t ψ u ( k ), y ( k )= d ( k ))},( t ψ , t 0 ψ )), where t ψ is the sample - period and t 0 ψ is an offset . note that the integrator block can be configured further by setting certain parameters to have a more complex behavior . an example is the integrator block ψ 5 in fig3 . in example 1 we did not include this much detail for the sake of simplicity of illustration . we introduce the following concepts for the computation of an atomic block over sample times . definition 3 given an atomic - block ψ and an input uεu ψ , we call the computation of the corresponding output yεy ψ a step of ψ over u . y is called the output of a step of ψ over u . given an input sequence { u ( k )} k = 0 k , a step - trajectory of ψ over { u ( k )} k = 0 k is a sequence of steps of ψ , where the kth step ( 0 ≦ k ≦ k ) in the sequence is over the input u ( k ). letting y ( k ) ( 0 ≦ k ≦ k ) denote the output of ψ over u ( k ), { y ( k )} k = 0 k is called the output of step - trajectory of ψ over { u k } k = 0 k . a simulink diagram , also called a system - block , can be constructed by recursively composing atomic - blocks and other simpler system - blocks according to certain rules . the following two rules are the among the rules that simulink uses for the construction of complex simulink diagrams from the simpler ones : connecting - rule : a certain input of one system - block can be connected to a certain output of another system - block . the connections over a set of system - blocks ψ can be represented using a relation c ⊂ ( ψ × n ) 2 , where n denotes the set of port numbers . a connection c =(( ψ 1 , i ),( ψ 2 , j )) εc connects the output port i of system - block ψ 1 to an input port j of system - block ψ 2 . the “ c - connected ψ system ” thus formed is denoted ψ / c . note a possible choice for connections is the “ null - connection ”, and { ψ }/∅= ψ . conditioning - rule : a system - block can be made conditionally executable when a certain guard condition over certain variables , called control - inputs , holds . further the data may be reset when the guard condition holds , and the output may be reset when the guard condition is violated . given a system - block ψ , a conditioning over ψ is a 5 - tuple θ :=( u θ , g θ , ƒ θ , h θ ,( t θ , t o θ )), u θ = u 1 θ × . . . × u m θ θ is the set of conditioning - inputs ( also called control - inputs ), g θ ⊂ u θ is a condition ( predicate ) over u θ , ƒ θ : d ψ → d ψ is a data - resetting function , h θ : y ψ → y ψ is an output - resetting function , and t θ is a sample - period , t o θ is an offset . when g θ holds , ψ computes , and otherwise , h θ assigns the output . also , when g ø becomes true , the first computation of ψ is preceded by a data - update by ƒ θ . the “ θ - conditioned ψ ” system thus formed is denoted ψ θ . the conditioning - rule can be implemented by placing a system - block inside a certain subsystem block ( of simulink library ) which can be configured to specify the conditioning parameters . note a possible choice for conditioning is “ null - conditioning ”, denoted ⊥:=(−, true , id , id , ∞), in which case ψ ⊥= ψ . ( here id denotes the identity function .) next we formally define the class of simulink diagrams ( also referred to as system - blocks ) formed using the above rules . definition 4 a certain class of simulink diagrams ( also referred to as system - blocks ) is recursively defined as follows . 2 . ψ is a set of system - blocks , c ⊂ ( ψ × n ) 2 is a set of interconnections , then c - connected ψ , denoted ψ / c , is a system - block . 3 . ψ is a system - block and θ is a conditioning over ψ , then θ - conditioned ψ , denoted ψ θ , is a system - block . sample - period , t ψ and offset t o ψ are obtained using the rule defined in remark 1 over { t ψ , t o ψ \| ψεψ }. note the above definition of t ψ ensures that each computation of each system - block ψεψ coincides with some computation of the connected system - block ψ ( i . e ., no computation of any system - block is missed ). t ψ _ = { t θ if ⁢ ⁢ t θ ⁢ ⁢ specified t ψ otherwise , ⁢ and ⁢ ⁢ offset ⁢ ⁢ t o ψ _ = { t o θ if ⁢ ⁢ t θ ⁢ ⁢ specified t o ψ otherwise . note by the simulink grammar , for a system - block ψ := ψ θ , t θ is either specified and in which case t ψ is inherited to be t θ , or is unspecified and in which case t ψ is inherited to be t ψ . similarly for t o ψ . consider the simulink diagram ψ of a counter shown in fig1 , where the unit delay block ψ 5 is a discrete - time atomic - block and the block ψ 1 is an enabled subsystem block . the output y 5 increases by 1 at each sample - period when the control input u is positive , and y 5 resets to its initial value when the control input u is not positive . the saturation block ψ 2 limits the value of y 5 in the range between − 0 . 5 and 7 . the sample - period of ψ 5 is 0 . 01 seconds and others are either constant ( inf ) or inherited (− 1 ). t o ψ 5 = 0 by default since unspecified . using get_param command after compiling ψ , t ψ = t ψ i = 0 . 01 for i = 1 , 2 , 3 , 4 , 5 . ψ belongs to the class of simulink diagrams defined in definition 4 : ψ 1 =({ ψ 3 , ψ 4 , ψ 5 }/ c 2 ) θ , where c 2 ={(( ψ 3 , •),( ψ 4 , •)), (( ψ 4 , •),( ψ 5 , •)), ( ψ 5 , •),( ψ 4 , •))}, θ =( u θ , u θ ( k )& gt ; 0 , d ( k )= d 0 , ( y 3 ( k ), y 4 ( k ), y 5 ( k ))=(−, −, y 50 ), −) c 1 ={(( ψ 1 , •),( ψ 2 , •))}, and ψ 2 , ψ 3 , ψ 4 , ψ 5 are atomic - blocks . note since we choose the pulse type of the source block pulse generator to be time based , ψ is a single - rate simulink diagram . thus the source block for generating the inputs and the sink block scope for displaying the outputs are not considered as part of the simulink diagram being translated , and hence not included in ψ . if the pulse type of the source block is chosen to be sample based and the sample time is different from 0 . 01 , then ψ becomes a multirate simulink diagram . consider the multirate simulink diagram ψ shown in fig2 , where blocks ψ 3 and ψ 7 are discrete - time blocks with sample - period of 0 . 01 and 0 . 025 seconds , respectively . the zero - order hold block ψ 8 is also a discrete - time block that samples the incoming signal at 0 . 01 . blocks ψ 5 and ψ 6 are continuous - time blocks . the sample - periods of other blocks are either constant ( inf ) or inherited (− 1 ). all offsets are 0 by default since unspecified . thus , t ψ i = 0 . 01 for i = 1 , 2 , 3 , 4 , 8 and t ψ 7 = 0 . 025 . since gcd ( 0 . 01 , 0 . 025 )= 0 . 005 , we opt to discretize ψ 5 and ψ 6 at a sample - period of 0 . 005 . then t ψ 5 = t ψ 6 = 0 . 005 , and also t ψ = 0 . 005 . ψ belongs to the class of simulink diagrams defined in definition 4 : ψ = ψ / c , where ψ ={ ψ 1 , ψ 2 , ψ 3 , ψ 4 , ψ 5 , ψ 6 , ψ 7 , ψ 8 } and c is omitted . u =∅, d = d 3 × d 5 × d 6 × d 7 with d 0 ={( 0 , 0 , 0 , 0 )}. note the sink block scope for displaying the outputs is not considered as part of the simulink diagram being translated , and hence not included in ψ . consider the simulink diagram ψ of a bouncing ball shown in fig3 . ψ models a hybrid - system of a bouncing ball that is thrown up with an initial velocity of 15 m / s from an initial height of 10 m . y 5 ( resp ., y 2 ) is the position ( resp ., velocity ) of the ball . ψ 2 and ψ 5 are continuous - time blocks . we have opted to discretize ψ 2 and ψ 5 at a sample period of 0 . 01 . the sample - periods of other blocks are either constant ( inf ) or inherited (− 1 ). then t ψ = t ψ i = 0 . 01 for 1 , . . . , 7 . ψ belongs to the class of simulink diagrams defined in definition 4 : ψ = ψ / c , where ψ ={ ψ 1 , ψ 2 , ψ 3 , ψ 4 , ψ 5 , ψ 6 , ψ 7 } and c is omitted . u =∅, d = d 1 × d 2 with d 0 ={( 15 , 10 )}. when system - blocks are composed using the connecting - rule to form a more complex system - block , the input of one system - block becomes the output of another system - block . to respect the interdependency of the inputs / outputs , simulink defines and uses the notion of an execution - order ( which it refers as sorted - order ) to determine the order in which the system - blocks included inside a connected system - block are executed . note that the conditioning - rule does not require defining a sorted - order since it is applied to a single system - block . given a system - block ψ / c formed using the connecting - rule , the sorted - order of the system - blocks { ψεψ } is given as an ordering function ord : ψ → n , where n is the set of natural numbers . the sorted - order induces a total - order over ψ , i . e ., for ψ , ψ ′ εψ , ord ( ψ )= ord ( ψ ′) if and only if ψ = ψ ′. accordingly ψεψ is executed before ψ ′ εψ if ord ( ψ )& lt ; ord ( ψ ′). the sorted - order value ord ( ψ ) can be displayed , as part of a label ascribed to a system - block ψεψ , by selecting the option sorted order from simulink block displays menu . assuming , without loss of generality of correctness of translation , that the optimization on conditional execution behaviors is turned off , the label ascribed to ψ has the format : id ( ψ / c ): ord ( ψ ): { id ( ψ )}, where id is a function that associates a certain identifier number to a system - block . the { id ( ψ )} part may be missing if ψ an atomic - block . whenever we need to indicate the label ascribed to ψεψ , we write it in the form : ψ [ id ( ψ / c ): ord ( ψ ){ id ( ψ )}]. the notion of sorted - order is essential in defining the step of a system - block . definition 5 given a system - block ψ and an input uεu ψ , the step of ψ over u is recursively defined as follows : if ψ is an atomic - block , then the step of ψ over u is as defined in definition 3 . if ψ = ψ / c is a connected system - block , then for j min ≦ j ≦ j max , where j min = min { ord ( ψ ): ψεψ } and j max = max { ord ( ψ ): ψεψ }, letting ψ j εψ denote the system - block with ord ( ψ j )= j , a step of ψ over u is a sequence of steps , whose jth element is the step of ψ j εψ over u j , the input of ψ j as determined by the set of connections c . if ψ = ψ θ is a conditioned system - block , then a step of ψ over u is the step of ψ ′ over u if g θ holds , and otherwise it is the execution of the output - resetting function h θ . also when g θ becomes true , the first execution of the step of ψ ′ over u is preceded by the execution of the data - resetting function ƒ θ . given an input sequence { u ( k )} k = 0 k , a step - trajectory of ψ over { u ( k )} k = 0 k is a sequence of steps of ψ , where the kth step ( 0 ≦ k ≦ k ) in the sequence is over the input u ( k ). letting y ( k ) ( 0 ≦ k ≦ k ) denote the output of ψ over u ( k ), { y ( k )} k = 0 k is called the output of step - trajectory of ψ over { u k } k = 0 k . note in the 2 nd item of definition 5 , when kt ψ + t 0 ψ = k ψ j t ψ j + t o ψ j a step of ψ j is computed by h i ψ j if g i ψ j holds , and k ψ j increases when k increases ; otherwise when kt ψ + t o ψ ≠ k ψ j t o ψ + t o ψ j , the output of ψ j remains its previous value , and k ψ j remains unchanged when k increases . consider the simulink diagram of ψ the counter shown in fig1 that was also discussed in example 2 , and its sorted - order displayed in fig1 . we have ψ 1 =( ψ 2 / c 2 ) θ =({ ψ 3 [ 1 : 0 ], ψ 4 [ 1 : 2 ], ψ 5 [ 1 : 1 ]}/ c 2 ) θ . a step of ψ ={ ψ 1 , ψ 2 }/ c 1 is a step of ψ 1 followed by a step of ψ 2 since ord ( ψ 1 )& lt ; ord ( ψ 2 )= 2 . a step of ψ 1 =({ ψ 3 , ψ 4 , ψ 5 }/ c 2 ) θ is obtained as follows : if g θ holds , the sequence of steps of ψ 3 , ψ 5 , ψ 4 is executed since ord ( ψ 3 )= 0 & lt ; ord ( ψ 5 )= 1 & lt ; ord ( ψ 4 )= 2 ; and otherwise , h θ computes . also when g θ becomes true , the first execution of the sequence of steps of ψ 3 , ψ 5 , ψ 4 is preceded by the computation of ƒ θ . consider the multirate simulink diagram ψ of fig2 that was also discussed in example 3 , and its sorted - order displayed in fig2 . it can be seen that ψ ={ ψ 1 [ 0 : 2 ], ψ 2 [ 0 : 6 ], ψ 3 [ 0 : 7 ], ψ 4 [ 0 : 8 ], ψ 5 [ 0 : 3 ], ψ 6 [ 0 : 4 ], ψ 7 [ 0 : 0 ], ψ 8 [ 0 : 5 ]}/ c . it then follows that a step of ψ is the sequence of steps of ψ 7 , ψ 1 , ψ 5 , ψ 6 , ψ 8 , ψ 2 , ψ 3 and ψ 4 . note for j = 1 , . . . , 8 , a step of ψ j is computed whenever kt ψ = k ψ j t ψ j , and otherwise , ψ j retains its previous values of the data and the output . consider the simulink diagram ψ of the bouncing ball of fig3 that was also discussed in example 4 , and its sorted - order displayed in fig3 . it can be seen that ψ ={ ψ 1 [ 0 : 7 ], ψ 2 [ 0 : 3 ], ψ 3 [ 0 : 2 ], ψ 4 [ 0 : 1 ], ψ 5 [ 0 : 5 ], ψ 6 [ 0 : 4 ], ψ 7 [ 0 : 0 ]}/ c . it then follows that a step of ψ is the sequence of steps of ψ 7 , ψ 4 , ψ 3 , ψ 2 , ψ 6 , ψ 5 and ψ 1 . we describe how a simulink diagram can be semantically translated to an i / o - efa . for any system - block ψ , its i / o - efa model is obtained by connecting two i / o - efa models , one for output - assignments and other for state - updates . we use l 0 − ψ , l m − ψ to denote the initial / final location for first i / o - efa , and l 0 + ψ , l m + ψ to denote the initial / final location for second i / o - efa . the two i / o - efa &# 39 ; s are connected using two edges : succession - edge connecting the final location l m − ψ of the first i / o - efa to the initial location l 0 + ψ to of the second i / o - efa , and time - advancement edge connecting the final location l m + ψ of the second i / o - efa to the initial location l 0 − ψ to of the first i / o - efa that increments time : k := k + 1 . translating atomic - blocks . fig4 depicts the two i / o - efa models connected by the succession and time - advancement edges for an atomic - block ψ . a formal description of the translation is provided in the following algorithm . algorithm 1 for an atomic - block ψ =( u ψ . y ψ , d ψ , d o ψ , {( g i ψ , ƒ i ψ , h i ψ )} i = 1 q ψ , ( t ψ , t o ψ )), p − ψ =( l − ψ ,−, u ψ , y ψ ,−,−, l 0 − ψ ,−, l m − ψ , e − ψ ), l − ψ ={ l 0 − ψ , l m − ψ } and e − ψ ={( l 0 − ψ , l m − ψ , −, −, g i ψ , −, h i ψ )\| i ≦ q ψ }. p + ψ =( l + ψ , d p ψ , u ψ , y ψ ,−,−, l 0 + ψ , d 0 p ψ , l m + ψ , e + ψ ), l + ψ ={ l 0 + ψ , l m + ψ }, d p ψ := d ψ × k is the set of data , where k is the set of sampling times , d 0 p ψ := d 0 ψ ×{ 0 } is the set of initial - data conditions , and e + ψ ={( l 0 + ψ , l m + ψ , −, −, g i ψ , ƒ i ψ , −)\| i ≦ q ψ }. p ψ =( l ψ , d p ψ , u ψ , y ψ ,−,−, l 0 ψ , d 0 p ψ , l m ψ , e ψ ), l ψ = l − ψ ∪ l + ψ , l 0 ψ = l 0 − ψ , l m ψ = l m + ψ , and e ψ = e − ψ ∪ e + ψ ∪{( l m − ψ , l 0 + ψ , −, −, −, −, −)}∪{( l m + ψ , l 0 − ψ −, −, −, −, k = k + 1 )}. translating for connecting - rule . in the i / o - efa models of a connected system - block ψ = ψ / c , the initial and final locations of the first ( resp ., second ) i / o - efa are the initial and final locations of the first ( resp ., second ) i / o - efa model of ψεψ that has the smallest and largest ord ( ψ )- value in ψ , respectively . also in order to preserve the sorted - order , there is an edge from the final location of the first ( resp ., second ) i / o - efa of ψεψ to the initial location of the first ( resp ., second ) i / o - efa of ψ ′ εψ if and only if ord ( ψ ′)= ord ( ψ )+ 1 . also in order to allow multirate system - blocks within a connected system - block , certain “ bypass ” edges are introduced within each system - block ψεψ connecting the initial location l 0 − ψ ( resp ., l 0 + ψ ) and final location l m − ψ ( resp ., l m + ψ ) of the first ( resp ., second ) i / o - efa of ψ . these edges are guarded by └ kt ψ + t 0 ψ ≠ k ψ t ψ + t 0 ψ ┘, implying that will be bypassed at those values of k when kt ψ + t 0 ψ is not equal to k ψ t ψ + t 0 ψ . in contrast , the converse guard condition of └ kt ψ + t o ψ = k ψ t ψ + t 0 ψ ┘ is introduced for the original set of edges originating at l 0 − ψ and l 0 + ψ . an illustration of the translating of ψ = ψ / c is depicted in fig5 , whereas a formalization is presented in algorithm 2 . without loss of generality , we assume that if (( ψ , i ),( ψ , j )) εc , then y i ψ = u j ψ , i . e ., the same variable has been used to denote the two signals . p − ψ =( l − ψ , d − p ψ , u ψ , y ψ ,−,−, l 0 − ψ , d 0 − p ψ , l m − ψ , e − ψ ), l − ψ :=∪ ψεψ l − ψ , d − p ψ := k × π ψεψ k ψ × t ψ t 0 ψ × π ψεψ t ψ × π ψεψ t 0 ψ , u ψ and y ψ are as defined in first part of remark 2 , l 0 − ψ = l 0 − ψ such that ord ( ψ )= min { ord ( ψ ): ψεψ }, d 0 − p ψ ={ 0 }× π ψεψ { 0 }× t ψ × t o ψ × π ψεψ t ψ × π ψεψ t o ψ , l m − ψ := l m − ψ such that ord ( ψ )= max { ord ( ψ ): ψεψ }, and e − ψ =∪ ψ {( l 0 − ψ , l m − ψ , −, −, [ kt ψ + t o ψ = k ψ t ψ + t o ψ ]^ g i ψ , −, h i ψ )\| i ≦ q ψ } ∪ {( l 0 − ψ , l m − ψ , −, −, └ kt ψ + t o ψ ≠ k ψ t ψ + t o ψ ┐, −, y ψ ( k )= y ψ ( k − 1 ))} ∪{( l m − ψ , l 0 − ψ ′, −, −, −, −, −)\| ord ( ψ ′)= ord ( ψ )+ 1 ≦\| ψ \|, and ψ , ψ ′ εψ }. p + ψ =( l + ψ , d + p ψ , u ψ , y ψ ,−,−, l 0 + ψ , d 0 + p ψ , l m + ψ , e + ψ ), l + ψ :=∪ ψεψ l + ψ , d p ψ := d ψ × k × π ψεψ k ψ × t ψ × t o ψ × π ψεψ t ψ × π ψεψ t o ψ , where d ψ is as defined in first part of remark 2 , u ψ and y ψ are as defined in first part of remark 2 , l 0 + ψ = l 0 + ψ such that ord ( ψ )= min { ord ( ψ ): ψεψ }, d 0 + p ψ = d 0 ψ ×{ 0 }× π ψεψ { 0 }× t ψ × t o ψ × π ψεψ t ψ × π ψεψ t o ψ , where d 0 ψ is as defined in first part of remark 2 , l m + ψ := l m + ψ such that ord ( ψ )= max { ord ( ψ ): ψεψ }, and e + ψ =∪ ψ {( l 0 + ψ , l m + ψ , −, −, [ kt ψ + t o ψ = k ψ t ψ + t o ψ ]^ g i ψ , ( d ψ ( k + 1 ), k ψ )=( θ i ψ , k ψ + 1 ), −)\| i ≦ q ψ } ∪ ψ {( l 0 + ψ , l m + ψ , −, −, └ kt ψ + t o ψ ≠ k ψ t ψ + t o ψ ┐, d ψ ( k + 1 )= d ψ ( k ), −)} ∪{( l m + ψ , l 0 + ψ ′ , −, −, −, −, −)\| ord ( ψ ′)= ord ( ψ )+ 1 ≦\| ψ \|, and ψ , ψ ′ εψ }. p ψ =( l ψ , d p ψ , u ψ , y ψ ,−,−, l 0 ψ , d 0 p ψ , l m ψ , e ψ ), l ψ := l − ψ ∪ l + ψ , d p ψ = d + p ψ , l 0 ψ = l 0 − ψ , d 0 p ψ = d 0 + p ψ , l m ψ := l m + ψ , and e ψ = e − ψ ∪ e + ψ ∪{( l m − ψ , l 0 + ψ , −, −, −, −, −)}∪{( l m + ψ , l 0 − ψ , −, −, −, −, k = k + 1 )}. remark 3 if ψ is a single - rate system - block , then the i / o - efa model of ψ = ψ / c presented in algorithm 2 can be simplified since in this case t ψ = t ψ and t o ψ = t o ψ for each ψεψ and so kt ψ + t o ψ = k ψ t ψ + t o ψ for each k . e − ψ =∪ ψ e − ψ ∪{( l m − ψ , l 0 − ψ ′ ,−,−,−,−,−)\| ord ( ψ ′)= ord ( ψ )+ 1 ≦\| ψ \|, and ψ , ψ ′ εψ }, and e + ψ =∪ ψ e + ψ ∪{( l m + ψ , l 0 + ψ ′ ,−,−,−,−,−)\| ord ( ψ ′)= ord ( ψ )+ 1 ≦\| ψ \|, and ψ , ψ ′ εψ }. consider ψ 2 / c 2 ={ ψ 3 , ψ 4 , ψ 5 }/ c 2 of example 2 , where ord ( ψ 3 )& lt ; ord ( ψ 5 )& lt ; ord ( ψ 4 ). the i / o - efa model for ψ 2 / c 2 , obtained using algorithm 2 for the connecting - rule and remark 3 , is shown in fig6 . the dotted boxes contain the 1st / 2nd i / o - efas of ψεψ 2 , and also of ψ 2 / c 2 . consider the multirate simulink diagram of fig2 that was discussed in example 3 . the i / o - efa model of ψ , obtained using algorithm 2 for the connecting - rule , is shown in fig7 . translating for conditioning - rule . in the translation of a conditioned system - block ψ = ψ θ , the 1st i / o - efa of ψ is the 1st i / o - efa of ψ together with ( i ) a newly added location l 0 − ψ , that also serves as the initial location of the first i / o - efa model of ψ , ( ii ) two newly added edges for capturing the conditional execution of ψ , and ( iii ) a “ bypass edge ” when the condition g θ doesn &# 39 ; t hold . the 2nd i / o - efa of ψ is the 2nd i / o - efa of ψ together with ( i ) a newly added location l 0 + ψ , that also serves as the initial location of the second i / o - efa model of ψ , ( ii ) a newly added edge for capturing the conditional execution of ψ , and ( iii ) a “ bypass edge ” when the condition g θ doesn &# 39 ; t hold . an extra binary - valued data - variable d θ , with initial value 0 , is introduced to keep track of the period over which g θ holds . an illustration of the translating of ψ = ψ θ is depicted in fig8 , whereas a formalization is presented in algorithm 3 . p − ψ =( l − ψ , d θ , u ψ , y ψ ,−,−, l 0 − ψ , d 0 θ , l m − ψ , e − ψ ), l − ψ = l − ψ ∪{ l 0 − ψ }, d θ ={ 0 , 1 }, u ψ and y ψ are as defined in second part of remark 2 , d 0 θ ={ 0 }, l m − ψ = l m − ψ , and e − ψ = e − ψ ∪{( l 0 − ψ , l 0 − ψ , −, −, g θ ^[ d θ = 0 ],( ƒ θ ; d θ := 1 ), −)}∪ {( l 0 − ψ , l 0 − ψ , −, −, g θ ^[ d θ = 1 ], −, −)}∪{( l 0 − ψ , l m − ψ , −, −, g θ , −, h θ )}. p + ψ =( l + ψ , d p ψ , u ψ , y ψ ,−,−, l 0 + ψ , d 0 p ψ , l m + ψ , e + ψ ), l + ψ = l + ψ ∪{ l 0 + ψ }, d p ψ = d p ψ × d θ , d 0 p ψ = d 0 p ψ × d 0 θ , l m + ψ = l m + ψ , and e + ψ = e + ψ ∪{( l 0 + ψ , l 0 + ψ , −, −, g θ , −, −)}∪ {( l 0 + ψ l m + ψ , −, −, g θ , ( d ψ ( k + 1 ), d θ )=( d ψ ( k ), 0 ), −)}. p ψ =( l ψ , d p ψ , u ψ , y ψ ,−,−, l 0 ψ , d 0 p ψ , l m ψ , e ψ ), l ψ = l − ψ ∪ l + ψ , l 0 ψ = l 0 − ψ , l m ψ = l m + ψ , and e ψ = e − ψ ∪ e + ψ ∪{( l m − ψ , l 0 + ψ , −, −, −, −, −)}∪{( l m + ψ , l 0 − ψ , −, −, −, −, k = k + 1 )}. remark 4 algorithms 1 , 2 and 3 provide translation under the fixed - step simulation semantics of simulink . the algorithms can be modified to follow the variable - step simulation semantics as well . the variable - step solvers in the simulink dynamically increase ( or reduce ) the step size ( i . e ., the value of t ψ ) if the error exceeds ( or falls under ) a specific limit er ceiling ( or er floor ) to see the modification , suppose the error calculation formula is ƒ e ( y ψ ( k ), y ψ ( k − 1 ), . . . , t ψ ). then the time - advancement edge ( l m + ψ , l 0 − ψ , −, −, −, −, k = k + 1 ) will be replaced by the following set of edges : {( l m + ψ , l 0 − ψ ,−,−,[ ƒ e er ceiling ], t ψ = t ψ / 2 , k = k + 1 ),( l m + ψ , l 0 − ψ ,−,−,[ θ e er floor ], t ψ = 2 * t ψ , k = k + 1 ) ( l m + ψ , l 0 − ψ ,−,−,[ er floor ƒ e eƒ ceiling ],−, k = k + 1 )}. consider ψ 1 =( ψ 2 / c 2 ) θ of example 2 . the i / o - efa model of ψ 2 / c 2 was obtained in example 8 , and the i / o - efa model of ψ 1 , obtained using algorithm 3 for the conditioning - rule , is shown in fig9 . the dotted boxes contain the 1st / 2nd i / o - efas of ψ 2 / c 2 , and also of ψ 1 . consider the simulink diagram ψ ={ ψ 1 , ψ 2 }/ c of the counter shown in fig1 that was also discussed in example 2 . the i / o - efa model for ψ 1 was obtained in example 10 , and the i / o - efa model of ψ , obtained using algorithm 2 for the connecting - rule and remark 3 , is shown in fig1 . consider the simulink diagram ψ of the bouncing ball of fig3 , and also discussed in example 4 . the i / o - efa model of ψ , obtained using algorithm 2 for the connecting - rule and remark 3 , is shown in fig1 . in order to show that the translating approach is sound and complete , we introduce the concept of a step and of a step - trajectory of an i / o - efa model of a system - block . in the i / o - efa model p ψ of a system - block ψ , each increment of k corresponds to an execution of a path π =( l 0 ψ , . . . , l m ψ , l 0 ψ ). a computation along the kth execution of such a path gives an output value y ( k ) for an input u ( k ). definition 6 given an i / o - efa model p ψ of a system - block ψ and input uε ∪ ψ , a step of p ψ over u is the computation of a sequence of edges starting from l 0 ψ and ending at l m ψ , followed by the time - advancement edge . given an input sequence { u ( k )} k = 0 k , a step - trajectory of p ψ over { u ( k )} k = 0 k is a sequence of steps , where the kth step ( 0 ≦ k ≦ k ) in the sequence is over the input u ( k ). letting y ( k ) ( 0 ≦ k ≦ k ) denote the output of ψ over u ( k ), { y ( k )} k = 0 k is called the output of step - trajectory of p ψ over { u k } k = 0 k . next we show that the input - output behavior of an i / o - efa model at a sampling time , defined in terms of a step , preserves the input - output behavior of the corresponding simulink diagram at the same sampling time , defined in terms of a step . lemma 1 given a system - block ψ and an input u ( k ) and at the kth sampling time , let y ψ ( k ) and y p ψ ( k ) be the outputs of the steps of ψ and p ψ , respectively , over u ( k ). then y ψ ( k )= y p ψ ( k ), where p ψ is obtained from the algorithms 1 , 2 and 3 . proof : if ψ is an atomic - block , then from algorithm 1 and definitions 5 and 6 , a step of both ψ and p ψ at the kth sampling time k compute : y ψ ( k )= h i ψ ( d ( k ), u ( k )), where d ⁡ ( k ) = { f i ψ ⁡ ( d ⁡ ( k - 1 ) , u ⁡ ( k - 1 ) ) if ⁢ ⁢ k & gt ; 0 d 0 otherwise } , if ψ = ψ / c , then from algorithms 2 and definitions 5 and 6 , a step of both ψ and p ψ over u ( k ) at the kth sampling time compute ( y ψ j min ( k ), . . . , y ψ j ( k ), . . . , y ψ j max ( k )), where ψ j εψ and : ( i ) if kt ψ + t o ψ = k ψ j t ψ j + t o ψ j : y ψ j ( k )=( d ( k ), u ( k )), where d ⁡ ( k ) = { f i ψ j ⁡ ( d ⁡ ( k - 1 ) , u ⁡ ( k - 1 ) ) if ⁢ ⁢ k & gt ; 0 d 0 otherwise } u r ψ j ( k )= y s ψ j ′ ( k ) if (( ψ j , r ),( ψ j ′ , s )) εc ( ii ) if kt ψ + t o ψ ≠ k ψ j + t o ψ j : y ψ j ( k )= y ψ j ( k − 1 ). if ψ = ψ θ , then from algorithms 3 and definitions 5 and 6 , a step of both ψ and p ψ over u ( k ) at the kth sampling time compute : the following proposition shows that the input - output behavior of an i / o - efa model over a sequence of sampling times , defined in terms of a step - trajectory , preserves the input - output behavior of the corresponding simulink diagram over the same sequence of sampling times , defined in terms of a step - trajectory . proposition 1 given a system - block ψ and an input sequence { u ( k )} k = 0 k , let { y ψ ( k )} k = 0 k and { y p ψ ( k )} k = 0 k be the outputs of step - trajectories of ψ and p ψ , respectively , over { u ( k )} k = 0 k . then { y ψ ( k )} k = 0 k ={ y p ψ ( k )} k = 0 k , where p ψ is as obtained from the algorithms 1 , 2 and 3 . proof : the proof follows from lemma 1 and definitions 5 and 6 . to validate our model , a simulation for a certain input sequence ( pulse with period 1 . 2 second and pulse width 25 %) was obtained for the simulink diagram ψ of fig1 ( using fixed - step discrete solver ) and is shown in fig1 . the simulation of the i / o - efa model p ψ was done in stateflow . since a step of p ψ is defined to be the execution of a cycle starting from and ending at the initial location and visiting the final location once , the sample period for the stateflow model of p ψ was scaled down by the length of the cycle ( the number of locations of p ψ ). the simulation result of p ψ ( using fixed - step discrete solver ) is also shown in fig1 . a simulation was obtained for the multirate simulink diagram ψ of fig2 ( using fixed - step continuous solver odel euler ) and is shown in fig1 . the simulation of the i / o - efa model p ψ was done in stateflow ( note the computer cannot check the equality of two floating numbers , one way to handle this is to duplicate the set of t ψ s and t o ψ s , relabel and amplify them to make them integers ). recall t ψ = 0 . 005 . the sample - period for the stateflow model of p ψ was scaled down by the number of locations of p ψ . the simulation result of p ψ ( using fixed - step discrete solver ) is also shown in fig1 . a simulation was obtained for the simulink diagram ψ of fig3 ( using fixed - step continuous solver odel euler ) and is shown in fig1 . the simulation of the i / o - efa model p ψ was done in stateflow . recall the sample - period of ψ is 0 . 01 . the sample - period for the stateflow model of p ψ was scaled down by the number of locations of p ψ . the simulation result of p ψ ( using fixed - step discrete solver ) is also shown in fig1 . we briefly introduce the works related to ours , discussing succinctly their features . [ 4 ] presented a translation algorithm for converting a restricted subclass of s / s diagrams into a semantically equivalent hybrid automaton . for the subclass of s / s diagrams considered there exists a clear separation between the discrete and the continuous dynamics : all mode changes are made through switches , and whose controlling variables are restricted to be the outputs of the stateflow modules . in general , however , the discrete modes do not have to be determined by the output variables of the stateflow modules , and switches do not have to be used to switch continuous dynamics . our approach does not require a clear separation between discrete and continuous dynamics for modeling hybrid systems . also our translation approach has no special restriction on the types of simulink blocks . the approach supports virtually all blocks in simulink library ( in this work we only consider time - driven blocks ) provided that the block can be mathematically written as input - state - output functions over time . [ 5 ] described a translation scheme for deriving hybrid automata models from s / s models . however , no formal algorithms are provided . we presented formal algorithms for the translation . [ 3 , 6 , 13 ] describes a technique for translating discrete - time simulink diagrams into lustre programs . lustre is a synchronous language and the translation is a mapping between elements of simulink diagrams ( for example , signals and atomic blocks ) and lustre programs ( for example , flows and operators / nodes ). the execution sequence of simulink blocks in the lustre programs is determined by lustre compiler . also only the discrete - time blocks are translated . in our approach , the execution sequence of simulink blocks is directly captured in the i / o - efa models . also , our approach supports virtually all time - driven blocks in simulink library . [ 7 ] mentioned a translation of s / s diagrams into the language of “ sal [ 1 ] for the purposes of test generation . however , the details of the translation were not given . [ 8 ] reported translation of simulink diagrams to a model of concurrent processes communicating with fifo queues or registers , called spi model , in contrast to i / o - efa model in our approach . there has also been work on code - generation for simulink diagrams [ 12 , 11 ]. one emphasis is in intellectual property reuse ( i . e ., code reuse for a group of atomic blocks ) and so their approach is modular . in contrast we focus on formal modeling of simulink diagrams with the goal of providing models that are readily amenable for further analysis ( verification , test - generation , etc .). we presented a recursive approach for translating a class of simulink diagrams as input / output - extended finite automata ( i / o - efa ), which is amenable to automated test generation or verification . we treat the blocks in the simulink library to be “ atomic ” and formulate two rules used in simulink for building complex blocks by combining the simpler ones . we provided a recursive and formal definition for the class of simulink diagrams formed using these rules . we presented algorithms for ( i ) translating an atomic - block as an i / o - efa , ( ii ) combining the i / o - efa models of simpler simulink diagrams to build the i / o - efa model of a more complex simulink diagram , constructed using certain rules of composition . we introduced the concept of a step ( resp ., step - trajectory ) of an i / o - efa to emulate the computation of a simulink diagram at a sample time ( resp ., over a sequence of sample times ). we showed that the translating approach is sound and complete : the input - output behavior of an i / o - efa model , as defined in terms of a step - trajectory preserves the input - output behavior of the corresponding simulink diagram at each sample time ( assuming the same integration method for any of the continuous blocks with dynamics ). finally , the translation approach has no specific restriction on the types of simulink blocks or the structure of simulink diagrams supported and can handle multirate simulink diagrams , sample times with initial offsets and variable - step simulation etc . although various embodiments have been shown and described in detail , the present invention is not to be limited to the specific embodiments shown as the present invention contemplates numerous variations , options , and alternatives in its implementation as may be appropriate in various situations . for example , the present invention contemplates that different types of diagrams may be used . the methodology may be implemented in various types of computing devices using any number of types of software to provide instruction sets for performing the logic of the methodologies described herein . p . caspi , a . curic , a . maignan , c . sofronis , and s . tripakis . translating discrete - time simulink to lustre . lecture notes in computer science , 2855 : 84 - 99 , 2003 . a . agrawal , g . simon , and g . karsai . semantic translation of simulink / stateflow models to hybrid automata using graph transformations . electronic notes in theoretical computer science , 109 : 43 - 56 , december 2004 . r . alur , a . kanade , s . ramesh , and k . c . shashidhar . symbolic analysis for improving simulation coverage of simulink / stateflow models . in emsoft &# 39 ; 08 : proceedings of the 7 th acm international conference on embedded software , pages 89 - 98 , new york , n . y ., usa , 2008 . acm . p . caspi , a . curic , a . maignan , c . sofronis , s . tripakis , and p . niebert . from simulink to scade / lustre to tta : a layered approach for distributed embedded applications . sigplan not ., 38 ( 7 ): 153 - 162 , 2003 . a . gadkari , s . mohalik , k . c . shashidhar , j . suresh a yeolekar , and s . ramesh . automatic generation of test cases using model checking for sl / sf models . workshop on model - driven engineering , verification , and validation , 2007 . m . jersak , d . ziegenbein , f . wolf , k . richter , r . ernst , f . cieslog , j . teich , k . strehl , and l . thiele . embedded system design using the spi workbench . in proc . of the 3 rd international forum on design languages , 2000 . r . kumar , c . zhou , and s . basu . finite bisimulation of reactive untimed infinite state systems modeled as automata with variables . in proceedings of the 25 th american control conference , pages 6057 - 6062 , minneapolis , minn ., june 2006 . d . lee and m . yannakakis . principles and methods of testing finite state machines — a survey . proceedings of the ieee , 84 ( 8 ): 1090 - 1123 , 1996 . r . lublinerman , c . szegedy , and s . tripakis . modular code generation from synchronous block diagrams — modularity vs . code size . in popl &# 39 ; 09 , 2009 . r . lublinerman and s . tripakis . modular code generation from triggered and timed block diagrams . in real - time and embedded technology and applications symposium ( rtas &# 39 ; 08 ), 2008 . n . scaife , c . sofronis , p . caspi , s . tripakis , and f . maraninchi . defining and translating a “ safe ” subset of simulink / stateflow into lustre . in proc . emsoft &# 39 ; 04 , 2004 . t . takenaka , k . okano , t . higashino , and k . taniguchi . symbolic model checking of extended finite state machines with linear constraints over integer variables . syst . comput . japan , 37 ( 6 ): 64 - 72 , 2006 . c . zhou and r . kumar . on identification of input / output extended automata with finite bisimilar quotients . in 2009 american control conference , st . louis , mo ., june 2009 .	6
a locking system according to the invention differentiates locks based on a priority hierarchy . some embodiments of the invention may also distinguish locks for two types of operations on a data structure : a write operation and a read operation . a lock for a write operation ( sometimes referred to as a “ write lock ”) by one thread will prevent any other operation by another thread from obtaining a lock on the locked up resources . a lock for a read operation ( sometimes referred to as a “ read lock ”) by one thread will then prevent a write lock from being obtained on the locked up resources by another thread . thus , two concurrent write locks from different threads to the same resources will conflict with each other , as the modification of the resources by the write operation of one thread will affect the results produced by the write operation of the other thread . likewise , a concurrent write lock and a read lock from different threads on the same resources will conflict with each other for the same reason . two concurrent read locks , even to the same resources and from different threads , typically will not conflict . that is , because the execution of one read operation will usually not interfere with the results obtained by another read operation , then a locking system may classify all concurrent read locks , regardless of their source , as non - conflicting in order to optimize access to the data structure . if , however , a thread does employ read operations that may interfere with the read operations of another thread , then two concurrent read locks from different threads to the same resources may also be considered conflicting locks . alternately , a locking system may forego efficiencies obtained by distinguishing read locks from write locks , and simply treat all locks as conflicting . in addition to locking the resources specified in a lock request , a lock may also restrict access in some way to other resources . for example , with a tree data structure , operations on a given node may advantageously be applied to all of that node &# 39 ; s descendants . this frees a thread from having to obtain a separate lock each time that it accessed a different node in a subtree . moreover , this facilitates consistently applying an operation to an entire subtree . similarly , an operation on a node should also be respected on any of the nodes in the chain of parents leading from a locked node to the root of the entire tree . for example , if one thread executes a write operation on a child node while another thread executes a read operation on a parent node , then the results of the read operation may be invalid . thus , with some embodiments of the invention , a lock on a node will also prevent a conflicting lock from being obtained on both ancestors of that node and descendants of that node . more particularly , for some embodiments of the invention , a lock on a specified node will also lock all of its descendants ( that is , the subtree of nodes defined by taking the specified node as the root node ), and prevent conflicting locks from being obtained on the ancestors of the specified node . with other embodiments of the invention , however , a lock on a specified node may simply prevent conflicting locks from being obtained on the ancestors or descendants of the specified node . by differentiating locks according to priority , the locking system of the invention will prevent a request for a lock from waiting for resources that are already locked up by a lock with an equal or higher priority . this allows different threads to concurrently access different portions of a data structure without causing a deadlock , as will be explained in detail below . as will be appreciated by those of ordinary skill in the art , a locking technique according to the invention may be implemented using software . that is , a locking system according to the invention may be described in the general context of computer - executable instructions , such as program modules , executed by one or more computing devices . generally , program modules include routines , programs , objects , components , data structures , etc . that perform particular tasks or implement particular abstract data types . typically the functionality of the program modules may be combined or distributed as desired in various embodiments . because the invention may be implemented using software , it may be helpful for a better understanding of the invention to briefly discuss the components and operation of a typical programmable computer on which various embodiments of the invention may be employed . fig3 illustrates an example of a computing device 301 that provides a suitable operating environment in which various embodiments of the invention may be implemented . this operating environment is only one example of a suitable operating environment , however , and is not intended to suggest any limitation as to the scope of use or functionality of the invention . other well known computing systems , environments , and / or configurations that may be suitable for use with the invention include , but are not limited to , personal computers , server computers , hand - held or laptop devices , multiprocessor systems , microprocessor - based systems , programmable consumer electronics , network pcs , minicomputers , mainframe computers , distributed computing environments that include any of the above systems or devices , and the like . the computing device 301 typically includes at least some form of computer readable media . computer readable media can be any available media that can be accessed by the computing device 301 . by way of example , and not limitation , computer readable media may comprise computer storage media and communication media . computer storage media includes volatile and nonvolatile , removable and non - removable media implemented in any method or technology for storage of information such as computer readable instructions , data structures , program modules or other data . computer storage media includes , but is not limited to , ram , rom , eeprom , flash memory or other memory technology , cd - rom , digital versatile disks ( dvd ) or other optical storage , magnetic cassettes , magnetic tape , magnetic disk storage or other magnetic storage devices , punched media , holographic storage , or any other medium which can be used to store the desired information and which can be accessed by the operating environment 301 . communication media typically embodies computer readable instructions , data structures , program modules or other data in a modulated data signal such as a carrier wave or other transport mechanism , and includes any information delivery media . the term “ modulated data signal ” means a signal that has one or more of its characteristics set or changed in such a manner as to encode information in the signal . by way of example , and not limitation , communication media includes wired media such as a wired network or direct - wired connection , and wireless media such as acoustic , rf , infrared and other wireless media . combinations of any of the above should also be included within the scope of computer readable media . with reference to fig3 , in its most basic configuration the computing device 301 typically includes a processing unit 303 and system memory 305 . depending on the exact configuration and type of computing device 301 , the system memory 305 may include volatile memory 307 ( such as ram ), non - volatile memory 309 ( such as rom , flash memory , etc . ), or some combination of the two memory types . additionally , device 301 may also have mass storage devices , such as a removable storage device 311 , a non - removable storage device 313 , or some combination of two storage device types . the mass storage devices can be any device that can retrieve stored information , such as magnetic or optical disks or tape , punched media , or holographic storage . as will be appreciated by those of ordinary skill in the art , the system memory 305 and mass storage devices 311 and 313 are examples of computer storage media . the device 301 will typically have one or more input devices 315 as well , such as a keyboard , microphone , scanner or pointing device , for receiving input from a user . the device 301 will typically also have one or more output devices 317 for outputting data to a user , such as a display , a speaker , printer or a tactile feedback device . other components of the device 301 may include communication connections 319 to other devices , computers , networks , servers , etc . using either wired or wireless media . as will be appreciated by those of ordinary skill in the art , the communication connections 319 are examples of communication media . all of these devices and connections are well know in the art and thus will not be discussed at length here . fig4 illustrates a data structure system 401 according to one embodiment of the invention . as shown in this figure , the data structure system 401 communicates with one or more threads 403 - 407 . more particularly , the threads 403 - 407 request access to information resources maintained by the data structure system 401 . in the illustrated embodiment , each of the threads 403 - 407 is generated by the same software application , but two or more of the threads 403 - 407 may alternately be generated by different software applications . the data structure module 409 maintains information in the data structure 411 . the data may be any type of information such as , for example , data relating to an electronic ink document . it should be noted that , while fig3 schematically illustrates the data structure 411 as a tree structure , the data structure module 409 may also maintain data in an alternate structure of any desired typed or configuration . the data may physically be stored in the system memory 305 , the removable storage 311 , the non - removable storage 313 or a combination thereof using , for example , any suitable database software application . the data structure system 401 also includes a lock request evaluation module 413 . the lock request evaluation module 413 receives requests to access one or more resources of the data structure 405 from the threads 403 - 407 . typically , a request to access resources will identify the node ( or nodes ) for which access is requested ( sometimes referred to hereafter as the “ requested node ”), and the type of access requested ( that is , whether the thread will access the requested node with a read operation or a write operation ). the access request will also include a request to lock the requested node , along with a priority for the requested lock . in addition , the access request may specify whether the requested lock will be a preemptable lock or a non - preemptable lock . in response to receiving a lock request , the lock request evaluation module 413 determines whether the lock request will succeed or fail . if the lock request evaluation module 413 decides to approve a requested lock , it then passes the lock request to the lock maintenance module 415 . the lock maintenance module 415 tracks existing locks . thus , when the requested node becomes available , the lock maintenance module 415 will initiate the requested lock so that the thread can obtain the specified access to the requested node . the lock maintenance module 415 will then keep track of the new lock as well . the operation of the lock request evaluation module 413 and the lock maintenance module 415 will now be discussed in more detail with reference to the flowchart illustrated in fig5 . in step 501 , a thread 403 , 405 or 407 submits a request to access one or more resources ( for example , to access to a subtree ) in the data structure 409 . the access request identifies the resources for which access is requested , and the type of access requested . that is , the access request will specify whether the access is to execute a read operation or a write operation . it will also request a lock on the root node of the subtree , along with a priority for the lock . upon receiving a lock request , the lock request evaluation module 413 first determines if the requested lock is a write lock . if the requested lock is not a write lock ( that is , if the requested lock is a read lock ), then in step 505 the lock request evaluation module 413 determines if access to the requested node has been restricted by a conflicting lock . that is , the lock request evaluation module 413 determines if there is an existing write lock on the requested node . the lock request evaluation module 413 also determines if there are any conflicting write locks on any of the ancestors or descendants of the requested node that would prevent a write lock from being obtained on the requested node . as previously noted , a write operation on a node by one thread may also affect the results of a read or write operation on an ancestor or descendant of that node by another thread . accordingly , while the ancestors or descendants of the node may not be identified in the read lock request , the lock request evaluation module 413 also determines if a conflicting write lock has already been obtained for these resources . thus , the lock request evaluation module 413 determines if the requested lock will conflict with an existing lock that would restrict access to any of the requested resources . if none of the requested node , its ancestors and its descendants have been locked up by a conflicting lock , then the lock request evaluation module 413 immediately approves the requested lock in step 507 , and passes the approved lock request onto the lock maintenance module 415 . if the requested node , one of its ancestors or one of its descendant has already been locked by a conflicting write lock , however , then the lock request evaluation module 413 determines if the priority of the requested read lock is a high priority in step 509 . with the illustrated embodiment of the invention , the lock request evaluation module 413 recognizes only two priorities of locks , high and low . accordingly , if the priority of the requested read lock is not high , it must be low , and thus equal to or lower than the priority of the conflicting write lock on the requested lock , its ancestor or descendant . as a result , the lock request evaluation module 413 fails the requested lock in step 511 . if , however , the requested read lock has a high priority , then in step 513 the lock request evaluation module 413 checks to confirm that all of the conflicting write locks on the requested node , its ancestors and its descendants are low priority . if one of these conflicting write locks are high priority , then again the requested read lock is equal to this conflicting high priority write lock , and the requested read lock is failed in step 511 . if all of the conflicting write locks on the requested node , its ancestors and its descendants are low priority ( and thus lower in priority than the requested read lock ), then in step 515 the lock request evaluation module 413 will approve the requested read lock . in step 517 , the lock request evaluation module 413 passes the requested read lock onto the lock maintenance module 415 , which notes that the requested read lock is waiting for the existing conflicting write locks to complete and should be implemented when these locks are completed . returning now to step 503 , if the lock request evaluation module 413 determines that a thread has requested a write lock ( that is , that the requested lock will conflict with any existing lock from another thread ), then in step 519 the lock request evaluation module 413 determines if there are any conflicting non - preemptable read locks or write locks that would restrict access to the requested node . that is , the lock request evaluation module 413 determines if there is an existing conflicting lock on the requested node . it also determines if there are any existing , conflicting non - preemptable read locks or write locks on the ancestors or descendants of the requested node . if there are not ( that is , if there are no existing locks or if the only existing locks are preemptable ), then in step 521 the lock request evaluation module 413 voids any existing preemptable read locks on the requested nodes , its ancestors and its descendants . then , in step 507 , it approves the requested write lock and passes the requested write lock onto the lock maintenance module 415 to be implemented . if , however , there is one or more conflicting non - preemptable read locks or write locks on a requested node , one of its ancestors or one of its descendants , then in step 523 the lock request evaluation module 413 determines if any of these conflicting locks has a high priority . again , because the lock request evaluation module 413 in this embodiment only recognizes two priorities , if any of these conflicting locks has a high priority , then the priority of the requested lock must be equal to or lower than the priority of these conflicting locks . thus , in step 511 , the lock request evaluation module 413 fails the requested write lock . on the other hand , if none of the conflicting locks on the requested node , its ancestors or its descendants has a high priority , then in step 525 the lock request evaluation module 413 determines the priority of the requested write lock . if it is low , then again it must be equal to the priority of the conflicting locks , and is failed in step 511 . if , however , the priority of the requested write lock is high , it is greater than the priority of any conflicting lock on the requested node , its ancestors and its descendants , and in step 515 the lock request evaluation module 413 will approve the requested read lock . in step 517 , the lock request evaluation module 413 passes the requested read lock onto the lock maintenance module 415 to be implemented when the existing conflicting write locks are completed . in the illustrated embodiment , the locking system uses only two priorities . it should be noted , however , that other embodiments of the invention may employ a priority hierarchy with any number of desired priorities . as in the embodiment described above , with these alternate embodiments of the invention a requested lock will not wait on a conflicting , non - preemptable lock of equal or higher priority . for example , if the locking system according to the invention employed three priorities , high , medium and low , then a lock request for a medium priority lock would not wait for an existing conflicting lock with a high or medium priority to complete , but would wait for an existing conflicting lock with a low priority to complete . similarly , a lock request for a high priority lock would not wait for an existing conflicting lock with a high priority to complete , but would wait for an existing conflicting lock with a medium or low priority to complete . of course , the implementation of still greater numbers of different priorities will be apparent from the foregoing description . in the foregoing illustrated embodiment , any write lock will preempt a preemptable lock , regardless of the relative priority of the different locks . it should be appreciated , however , that alternate embodiments of the invention may only allow a write lock to preempt a preemptable read lock of lower priority . also , it should be noted that , to facilitate an understanding of the invention , the invention has been explained above with particular emphasis on prioritizing locks between different threads of a single software application . as will be appreciated by those of ordinary skill in the art from the foregoing description , however , the invention may also be employed to prevent lock conflicts between threads of different software applications . still further , while the above discussion of the invention distinguishes locks for read operations from locks for write operations , various embodiments of the invention need not make that distinction . instead , as previously noted , these embodiments of the invention may characterize all locks from different threads as conflicting locks . although the invention has been defined using the appended claims , these claims are exemplary in that the invention may be intended to include the elements and steps described herein in any combination or sub combination . accordingly , there are any number of alternative combinations for defining the invention , which incorporate one or more elements from the specification , including the description , claims , and drawings , in various combinations or sub combinations . it will be apparent to those skilled in the relevant technology , in light of the present specification , that alternate combinations of aspects of the invention , either alone or in combination with one or more elements or steps defined herein , may be utilized as modifications or alterations of the invention or as part of the invention . it may be intended that the written description of the invention contained herein covers all such modifications and alterations . for instance , in various embodiments , a certain order to the data has been shown . however , any reordering of the data is encompassed by the present invention .	8
the present invention provides a height and azimuth adjustable container set , utilized for all the purposes embedded containers are utilized , i . e ., to serve as bases for lighting fixtures , as transformer housings , and as junction boxes , but with a major difference from conventional embedded containers . the adjustable container sets of the present invention also are utilized for the precise and simplified , economic mounting and adjusting of the height of the lighting fixture to be mounted upon it . also , the adjustable containers of the present invention provide for precise and simplified , economic aligning of the azimuth of the lighting fixtures and aligning the lights with respect to each other , by virtue of the azimuth alignment . the adjustable container set of the present invention is used to improve existing containers , while being efficiently and economically adjustable . these containers are installed in airport runways , taxiways , and other aircraft ground traffic areas to serve as bases for lighting fixtures , transformer housings , and junction boxes . the adjustments take place when the containers and their lighting fixtures are installed initially , e . g ., when new runway , taxiway , and other aircraft ground traffic areas are first built and every time they are repaved . the present invention provides a height and azimuth alignments adjustments assembly utilized for the more economic , precise , and simplified adjusting of the heights of concrete embedded containers and the azimuth alignment of airport inset lighting fixtures mounted thereon . these containers of the present invention are installed and reused in airport runways and taxiways and other aircraft ground traffic areas to serve as bases for lighting fixtures , transformer housings , and as junction boxes . in the actual testings and installations of the alignments adjustments assembly disclosed and described in u . s . patent application ser . no . 08 / 002 , 014 filed jan . 8 , 1993 and entitled “ alignments adjustments assembly apparatus and method ,” now u . s . pat . no . 5 , 541 , 362 , i have discovered certain aspects which could be modified . one drawback is that airport runway light bolts used to install the airport runway light on or in the airport runway light support can be part of a corrosion problem . corrosive materials such as deicing chemicals used on the aircraft can accelerate corrosive problems between the light bolts and the light support . the airport runway light stainless steel bolts can accelerate corrosive attack by a galvanic action between dissimilar metals . the present invention provides an alignment adjustments assembly which corrects the problem of corrosion . one drawback is that a great number of the existing conventional , fixed - length extensions installed as stacked - on embedded containers have tilted from their vertical axis . this tilting , which at the place of tilting is relatively small , nevertheless increases the angle at which the light beam from an inset lighting fixture is projected , thereby diverting the light beam away from incoming airplanes . at one - half mile ( 1 kilometer ) away from the approach area , it is difficult for the pilot of a landing airplane to see the light because of the very large divergence at that point from the point at which it should otherwise be , when properly height - adjusted . the present invention provides an alignment adjustments assembly which corrects the problem of tilting . another drawback encountered is that the new larger and heavier airplanes , now becoming more common , exert a larger torsional force upon the inset lighting fixtures . tests made to simulate those larger torsional forces on the alignment adjustment assembly disclosed and described in u . s . patent application ser . no . filed jan . 8 , 1993 and entitled “ alignments adjustments assembly apparatus and method ,” now u . s . pat . no . 5 , 541 , 362 , proved that a very slight rotational movement occurs , even though considered relatively insignificant today . nevertheless , even heavier airplanes could provide a more significant rotational movement that would alter the azimuth alignment of the lighting fixture , which in turn would impede the pilot of an incoming airplane from seeing the light . the present invention provides an alignments adjustments assembly which corrects the problem of the rotation of the assembly . yet another drawback encountered is the need to install a separate component called the mud dam , consisting of a flat , three - quarters inch ( 19 mm ) thick spacer ring with a flat , thin steel band welded all around the periphery of the flat spacer ring . this band is about one and a quarter inches ( 3 . 3 cm ) wide . the present invention provides an alignment adjustments assembly that does not require the installation of a separate mud dam . a further drawback encountered is that there are two types of inset light construction with respect to its bottom side . the bottom on one type is short and flat . the bottom on the other is longer and at an angle with respect to the light base vertical axis . the longer , angled bottom does not allow the light to fit properly on the top flange of the apparatus as disclosed and described in u . s . patent application ser . no . 08 / 002 , 014 filed jan . 8 , 1993 and entitled “ alignments adjustments assembly apparatus and method ,” now u . s . pat . no . 5 , 541 , 362 . the present invention provides an alignments adjustments assembly which will allow the longer , angled bottom type inset lights to be installed upon it . yet a further drawback encountered is that , in a great many occasions , an “ o ” ring seal is specified . in such cases , a separate flat , three - quarters inch ( 19 mm ) thick spacer ring , with a groove on its top flat side , is installed between the fixed - length extension and the lighting fixture . the present invention provides an alignment adjustments assembly which does not require installing a separate flat spacer ring with a groove on its top flat side . the invention includes an existing embedded container with an inverted flange on one end onto which an adapter flange bolts . the adapter flange has acme threads in its center aperture . the apparatus and method of the present invention also include an outside acme threaded adjustable extension , which threads down into the adapter flange , to provide the precise height required and the precise alignment of its lighting fixture . the adjustable height extension has a top flange to provide a base upon which the specified lighting fixture can be bolted . the present invention provides height and azimuth light support sets utilized for the more efficient and economic , precise , and simplified adjusting of the heights of exiting art embedded containers and the alignment of their light fixtures . these containers are installed in airport runways and taxiways to serve as bases for lighting fixtures , as transformer housings , and as junction boxes . referring now to fig1 and 2 , a container 1 is represented schematically with three fixed - length extensions 2 , 7 , and 11 bolted together . container 1 is embedded in concrete 25 at the time an airport runway , taxiway , and other aircraft ground traffic areas ( hereinafter aircraft ground traffic areas ) are first built . these ground traffic areas generally are built upon a compacted granular sub - base 26 . steel containers 1 , in addition to serving as bases for mounting airport inset lighting fixtures 95 also serve as transformer housings and junction boxes to bring electrical power to lighting fixture 95 , as shown in fig1 , and 7 . fixed - length extension 2 is bolted to top flange 30 on container 1 , which has 12 threaded bolt holes 136 , as shown in fig1 , by means of its bottom flange 4 and bolts 3 . fixed - length extension 2 is bolted to bottom flange 6 of fixed - length extension 7 by means of its top flange 5 and bolts 8 . fixed - length extension 7 is bolted on top of fixed - length extension 2 . fixed - length extensions have twelve bolt holes in both of their flanges , i . e ., top flange 5 and bottom flange 4 of extension 2 , as shown in fig1 . the bolt holes , not shown , on the top flanges of the extensions are threaded , while the bolt holes , not shown , on the bottom flange are not threaded . nevertheless , the bolt holes in both flanges of the fixed - length extensions are on a bolt hole circle diameter identical to bolt circle diameter 137 , as shown in fig1 , of container 1 . fixed - length extension 7 is bolted to bottom flange 10 of fixed - length extension 11 by means of its top flange 9 and bolts 12 . fixed - length extension 11 is bolted on top of fixed - length extension 7 . fixed - length extensions provide only a gross height adjustment . one or a plurality of flat spacer rings 15 are required for providing the more precise final height adjustment . flat spacer rings 15 are installed on top flange 13 of fixed - length extension 11 , as shown in fig1 , i . e ., the top fixed - length extension , to provide the final height adjustment 17 for inset lighting fixture 95 . flat spacer rings 15 can be one or more . they are fabricated as thin as 1 / 16 inch ( 1 . 6 mm ) and as thick as three - quarters inch ( 19 mm ) or thicker . mud dam 36 , as shown in fig1 and 10 , comes next on top of spacer rings 15 . the inset lighting fixture 95 is bolted together with flat spacer rings 15 and mud dam 36 onto the top flange 13 of the top fixed - length extension 11 by means of bolts 14 . continuing to refer to fig1 and 2 , several layers of pavement 19 , 20 , 21 are shown , to exemplify the fact that fixed - length extensions 2 , 7 , and 11 are utilized for height adjustments every time an aircraft ground traffic area is first built or upgraded by the installation of new pavement , i . e ., each new layer of pavement 19 , 20 , and 21 . the new layers create new surfaces 22 , 23 , and 24 and therefore new heights . these airport aircraft ground traffic area upgrades create the need for heights adjusting devices , with flanges identical to those of the embedded container 1 , in order to adapt the container 1 to the new surface , i . e ., the new height and further in order for the lighting fixture 95 to be installed slightly above the new pavement surface , i . e ., surface 22 , 23 , or 24 , at a close tolerance 17 above new pavement surface 24 , for example . in order to seal pavement layers 19 , 20 , 21 around container 1 , grout 18 is utilized . pavement rings 36 , commonly known in the industry as mud dam 36 , as shown in fig1 and 10 , are installed on top of spacer rings 15 to protect lighting fixture 95 from being splashed by the grout 18 at the time of its application . inset lighting fixture 95 is set inside mud dam protection ring 36 , as shown in fig1 . mud dam 36 consists of a flat ring 38 , as shown in fig1 , generally of ¾ inch ( 19 mm ) in thickness , with a 1 to 1¼ inch ( 2 . 54 to 3 . 27 cm ) wide , flat , thin steel band welded around the periphery of flat ring 38 . flat ring 38 has bolt holes 39 which match bolt holes , not shown , on flat spacer rings 15 , on fixed - length extension 11 as well as on lighting fixture 95 . bolt holes on fixed - length extension 11 are threaded . lighting fixture 95 is bolted onto fixed - length extension 11 , together with mud dam 36 and flat spacer rings 15 by means of bolts 14 . mud dams 36 are generally provided with grooves 43 in order to accept “ o ”- ring gasket 44 . when any one layer of pavement is first placed , it is done by placing it over the entire surface , i . e ., surface 31 . then the pavement 19 is core - drilled at the location of each container 1 to remove the pavement at that location to install fixed - length extension 2 , any flat spacer ring 15 , mud dam 36 , and finally lighting fixture 95 at the new height created by pavement 19 and surface 22 , by way of example . this process is repeated every time a new layer of pavement is added , i . e ., for further layers 20 and 21 . the core drilled hole is larger in diameter than the diameter of container 1 , hence the requirement to utilize grout 18 to fill in the void and therefore the need to install a mud dam 36 , as shown in fig1 , to protect lighting fixture 95 , as shown in fig1 when grout 18 is poured . a new method has been used for a few years already , whenever an aircraft ground traffic area reconstruction takes place , i . e ., resurfacing or repaving . instead of adding a new layer of pavement on top of the last one installed , the last one layer , i . e ., pavement layer 21 , is milled down by large roto - milling machines . this method is extensively explained in my u . s . pat . no . 5 , 431 , 510 entitled “ overlay protection plate apparatus and method .” prior to roto - milling the pavement top layer , i . e ., layer 21 , the lighting fixtures , any spacer rings , the mud ring , and the top , existing fixed - length extensions have to be removed . an overlay protection plate , not shown , is bolted to top flange 30 , on container 1 , to prevent debris from falling into container 1 . after roto - milling , a new layer of pavement is installed , and the new pavement is core - drilled at the location of each container 1 to replace the items removed back to their original position . core drilling at each embedded container location is done to provide access for reinstalling the items previously removed . nevertheless , in a great percentage of the cases , i . e ., at each of the individual container locations , differences of height occur , creating the need for the installation of additional flat spacer rings 15 on top of the ones removed and being reinstalled . referring to fig1 and 2 , lighting fixture 95 is installed at a close tolerance 17 slightly above pavement surface 24 . the optical system , not shown , inside the lighting fixture , projects its light beam 32 through lens 107 in window 108 of lighting fixture 95 at a precise angle 34 from surface 24 to allow a pilot landing aircraft 51 , as shown in fig3 , see light beam 32 , from a distance of about one - half mile ( 1 kilometer ), when landing at night or under other low visibility conditions . lighting fixtures 95 are also known as centerline lights because they are installed on the embedded containers in the center of the aircraft ground traffic areas , i . e ., runways , taxiways , and others . the continuous landing of aircraft , day and night , year after year , on top of these lighting fixtures can provide a slight tilting 41 , as shown in fig2 , of the lighting fixture and fixed - length extension 11 , as represented by 41 ( not to scale ), as shown in fig2 , for the purpose of making this explanation more clearly understood . this tilting 41 will alter the installed height tolerance 17 , as shown in fig1 , which now would be larger as represented by 42 in fig2 . the maximum installed height tolerance 17 is 1 / 16 inch ( 1 . 6 mm ), per f . a . a . ( u . s . federal aviation administration ) specifications . tilting 41 is shown as a separation of flange 10 of fixed - length extension 11 from flange 9 of fixed - length extension 7 . even the slightest tilting of lighting fixture 95 and the associated extension produces an angular deviation , angle 35 , as shown in fig2 and 3 , which is larger than the precise angle 34 obtained by a combination of the precise height adjustment of lighting fixture 95 and the angle at which light beam 32 is emitted from lighting fixture 95 , through its lenses 107 , in windows 108 , as shown in fig1 and 2 . this lighting fixture emitted light beam angle is set at the factory and is precisely established by f . a . a . regulations . an increased angle 35 would project emitted light beam 33 away from a line of sight from the pilot when landing aircraft 51 , as shown in fig3 , as it descends for landing . as a result , the pilot of aircraft 51 would not be able to see light beam 33 when landing at night or during poor visibility conditions . an increase in the height adjustment 17 of lighting fixture 95 would have the same effect , i . e ., the light beam would not be visible to the pilot at landing . in addition , an increased installed height creates the danger of the lighting fixture being plowed - off , during winter time , when snow is regularly plowed off airport ground traffic areas . this creates the danger of lighting fixtures , bolts , rings , and other components , being thrown onto these traffic areas , with the resulting danger to landing aircraft . conventionally , tilting is field - corrected by installing a thick tapered spacer ring , not shown . these tapered rings are custom made , per field measurement , and they are installed after first removing some of the existing flat spacer rings 15 , to correct angular deviation 35 of light beam 33 to the correct angular adjustment 34 of the light beam . tilting of the fixed - length extension is corrected , when the apparatus and methods of the present invention are utilized , because fixed - length extensions , bolted one on top of the other are no longer required . referring to fig7 , and 9 , lighting fixtures today are manufactured with two different types of bottom portions . fig7 shows lighting fixture 95 with six non - threaded , counter sunk bolt holes 109 drilled through mounting flange 106 . bolt holes 109 are set apart at an angle 115 of 60 degrees one from another , in bolt circle 114 . lighting fixture 95 is provided with optical lenses 107 in countersunk windows 108 and with a flat , short , straight down bottom portion 100 . electrical wires 111 and connector 112 are provided for bringing electrical power to lighting fixture 95 from an isolation transformer , not shown , in conventional container 1 , as shown in fig1 and 2 . lighting fixture 105 of fig8 has six non - threaded , countersunk bolt holes 109 drilled through mounting flange 106 . bolt holes 109 are set apart at an angle 115 of 60 degrees one from another , in bolt circle 114 . lighting fixture 105 is provided with optical lenses 107 in countersunk windows 108 and with a long , angled bottom 110 , hence the novel angled 66 opening 67 of adjustable extension 55 , as shown in fig4 . angled 66 opening 67 allows lighting fixture 105 to be installed on flange 62 of the extension , in addition to allowing also the installation of lighting fixture 95 , as shown in fig7 . continuing to refer to fig8 , lighting fixture 105 is also provided with wires 111 and connector 112 for bringing electrical power to lighting fixture 105 from conventional embedded container 1 , as shown in fig1 and 2 . azimuth orientation arrows 113 are engraved on mounting flange 106 in the countersunk windows 108 area . arrows 113 are also engraved in countersunk windows 108 of lighting fixture 95 . the difference between lighting fixture 95 and lighting fixture 105 is in the short , flat bottom portion 100 of fixture 95 versus the longer , angled bottom portion of fixture 105 . engraved azimuth arrows 113 are required for aiding a lighting fixture installer in orienting lenses 107 , on windows 108 , directly to the exact azimuth alignment , to correctly align , in azimuth , the light beam projected through lenses 107 with the aircraft landing direction . the azimuth alignments are required when the lighting fixture is first installed and on every occasion maintenance is performed on the fixture , i . e ., removal for bulb change and others . fig9 is a top view , i . e ., a plan view , of the lighting fixtures of fig7 and 8 . the lighting fixtures 95 , 105 have six countersunk bolt holes 109 each on bolt circle 114 , with a bolt circle diameter identical to the diameter of the bolt circle , not shown , of bolt holes 64 , on top flange 62 , as shown in fig4 . the bolt circle diameter , the number and size of bolts and bolt holes in the lighting fixtures , as well as in the flange where the lighting fixtures are to be installed , i . e ., top flange 62 , as shown in fig4 , or in conventional top flange 13 , as shown in fig1 , are specified by specifications known as circulars , issued by the f . a . a . referring now to fig4 , and 6 , adjustable extension 55 and adapter flange 85 represent the preferred embodiment of the alignments adjustments assembly of the present invention . adjustable extension 55 consists of a tubular , cylindrical section , defined by a non - threaded top portion 58 which has its bottom portion 57 threaded with acme threads 56 , e . g ., by way of example at four threads per inch ( 2 . 54 cm ). top portion 58 and bottom threaded portion 57 are the wall of the cylindrical portion , i . e ., the wall of a tubular cylinder , shown in elevation , partially in section , in fig4 . acme threaded portion 57 is threaded for approximately six inches ( 15 cm ) from bottom end 61 . threaded portion 57 has a minimum of six vertical rows of threaded holes 59 , 60 , i . e ., parallel to its vertical axis 68 , as opposed to three vertical rows of holes at 120 degrees apart , disclosed in u . s . patent application ser . no . 08 / 002 , 014 filed jan . 8 , 1993 entitled “ alignments adjustments assembly apparatus and method ,” now u . s . pat . no . 5 , 541 , 362 . holes 59 are on a horizontal plane different from holes 60 , i . e ., intercalated , i . e ., staggered as shown in fig4 , so that at all times there will be a minimum of four and a maximum of six holes 59 , 60 for threading allen set - screws 81 , as shown in fig5 , through them and for tightening against inside threaded surface 87 of adapter flange 85 , as shown in fig6 . by the method of the present invention , at least one allen set - screw 81 , as shown in fig5 , protruding through holes 59 or 60 , penetrates at least one eighth inch ( 3 . 2 mm ) into a drilled aperture 86 , as shown in fig6 , on inside threaded surface 87 of adapter flange 85 . allen set - screws are threaded through both holes 59 and 60 , shown threaded through hole 59 on fig5 for simplification purposes . allen set - screws are of a minimum ½ inch ( 1 . 3 cm ) nominal diameter . top flange 62 is welded at top portion 71 of the tubular , cylindrical portion of the extension 55 . top flange 62 has 12 threaded bolt holes 64 through it , when seeing it in plan , but shown only in section in fig4 . these threaded bolt holes 64 have a bolt circle diameter , not shown , that coincides with bolt circle diameter 114 , as shown in fig9 , of lighting fixture 95 and 105 , as shown in fig7 and 9 , respectively . the bolt circle and bolt size are mandated by the f . a . a . specifications , i . e ., u . s . federal aviation administration specifications . all features shown on fig9 , a plan view , coincide with a plan view , not shown , of fig7 in all respects , i . e ., they are substantially identical . therefore , either lighting fixtures of fig7 or fig8 can be bolted onto top flange 62 . top flange 62 has opening 67 at an angle 66 of approximately 45 degrees . in addition to accepting lighting fixture 95 , as shown in fig7 , it also accepts lighting fixture 105 , as shown in fig9 . preferably top flange 62 and tubular cylindrical portion 57 are made of stainless steel . the stainless steel assembly 55 of the present invention provides an alignment adjustments assembly which corrects the problem of corrosion from materials such as corrosive deicing chemicals or by a galvanic action between dissimilar metals between the light bolts and the light support . novel mud dam protecting ring 69 , consisting of a 1 to 1¼ inches wide ( 2 . 54 to 3 . 27 cm ), thin , stainless steel band , is built in one piece with top flange 62 , if adjustable extension 55 is built in one piece , which is the preferred method . mud dam protecting ring 69 can also be welded all around the outer periphery of top flange 62 if adjustable extension 55 is built of individual components . mud dam 69 is positioned to protect the lighting fixture and its lenses 107 , as shown in fig7 , and 9 from grout 122 , as shown in fig1 , when grout 122 is poured . groove 65 is provided on surface 63 of top flange 62 in order to accept “ o ”- ring 70 , shown lifted from groove 65 , on fig4 . the adjustable extension of the present invention can be cast , in one piece , e . g ., from stainless steel , comprising the tubular , cylindrical portion as well as the top flange 62 and mud dam protection ring 69 . it can then be machine - finished including groove 65 and mud dam protection ring 69 . acme - threads 56 are cut for a minimum of up to 6 inches ( 15 cm ) or more from bottom end 61 . all holes 59 , 60 , and 64 are then drilled and tapped . preferably , each individual component is made of stainless steel . the adjustable extension can also be made of individual components , i . e ., a tubular piece , to obtain the cylindrical portion and a standard steel plate , machine - finished to obtain the top flange 62 , to which a thin , steel band is welded to make the protection ring 69 . then the flange 62 is welded at 71 , top end of non - threaded portion 58 of the tubular piece , i . e ., the cylindrical portion . any additional machine - finishing then is done , including groove 65 . acme threads 56 are cut for a minimum of 6 inches ( 15 cm ) or more from bottom end 61 . all holes 59 , 60 , and 64 are then drilled and tapped . optionally , acme threads 56 could be cut , and holes 59 and 60 drilled and tapped in the field at the point of use . the order in which the fabrication steps are herein described , i . e ., for casting in one piece or for individual components , is not intended to limit the many variations of manufacturing sequencing , as those skilled in the art would recognize . therefore , all sequencing steps , whether listed or not , are part of the apparatus and method of the present invention . as it can be readily understood by those skilled in the art , the adjustable extension can be made in any overall length , including any length of its threaded portion 57 . this feature provides the design engineers a great advantage in planning for future aircraft ground traffic changes , i . e ., additional layers of pavement or the replacement of existing layers of pavement with new , thicker layers , to upgrade these aircraft traffic areas to new generations of larger , heavier aircraft . fig5 represents the allen set - screw 81 component of the present invention shown threaded - in and protruding through threaded portion 57 of the adjustable extension . fig6 represents the circular adapter flange 85 component part of the present invention shown in elevation . non - threaded aperture 86 is at least ⅛ inch ( 3 . 2 mm ) deep , drilled into acme threaded surface 87 in opening 88 . inside opening 88 is threaded with 4 acme threads per inch ( 2 . 54 cm ) in order to thread extension 55 into it . non - threaded holes 89 are 12 in number ( only two shown ) and are drilled through surface 90 . bolt holes 89 are drilled on a bolt circle , not shown , identical to the bolt circle 137 , as shown in fig1 , on top flange 30 of conventional embedded container 1 , as shown in fig1 and 2 . adapter flange 85 thereby provides the means for the installation of adjustable extension 55 onto embedded stainless steel container 1 a , as shown in fig1 and 12 . for the installation of the alignments adjustments assembly of the present invention on airport runway embedded stainless steel container 1 a , adapter flange 85 is bolted onto top flange 30 , as shown in fig1 , and 12 of embedded container 1 after removing bolts 3 , as shown in fig1 and 2 and all fixed - length extensions 2 , 7 , and 11 . when adapter flange 85 is bolted onto stainless steel container 1 a , the adjustable extension 55 can be threaded into adapter flange 85 , through acme threaded opening 88 , in order to install an airport inset lighting fixture upon top flange 62 , as shown in fig4 and 11 , of adjustable extension 55 . all allen set screws are threaded through holes 59 , 60 of extension 55 and torqued to a minimum of 60 foot - pounds ( 8 kilogram - meters ) against acme threaded surface 87 of adapter flange 85 , one of them , torqued against the inside of drilled aperture 86 . referring now to fig1 , a completed installation of the apparatus of the present invention is represented . aperture 86 on acme threaded surface 87 is drilled as follows . first , adjustable extension 55 with “ o ” ring 70 , in groove 65 and with lighting fixture 105 bolted onto it , as shown in fig1 , is threaded into adapter flange 85 , which has been bolted already onto stainless steel container 1 a by means of bolts 121 . lighting fixture 105 on adjustable extension 55 then is brought to the exact height and azimuth by threading in adjustable extension 55 until aximuth orientation arrows 113 are aligned to the precise azimuth at the required height . prior to any installation , a surveyor provides the necessary centerline marks 138 , as shown in fig1 , on the pavement , i . e ., of a runway , for aiding the installer in finding the correct azimuth line . at this point , the lighting fixture is removed , and all required allen set - screws are installed through holes 59 , 60 of adjustable extension 55 and fully torqued at 60 foot - pounds ( 8 kilogram - meters ) against acme threaded surface 87 to immobilize adjustable extension 55 in place , keeping it at the desired azimuth alignment and height adjustment . then , aperture 86 is drilled approximately ⅛ inch ( 3 . 2 mm ) into surface 87 of adapter flange 85 , through one of threaded holes 59 or 60 of the adjustable extension 55 . immediately after aperture 86 is drilled - in , the remaining allen set - screw 81 is threaded through the respective hole 59 or 60 and fully torqued at 60 foot - pounds ( 8 kilogram - meters ) against the inside of aperture 86 . by making at least one allen set - screw 81 penetrate at least ⅛ inch ( 3 . 2 mm ) into aperture 86 , on surface 87 of adapter flange 85 , by installing six allen set - screws , and by making the set - screw ½ inch ( 12 . 7 mm ) in diameter , the adjustable extension 55 and the lighting fixture mounted thereupon will not be made to turn by the torque tangentially applied by the force of airplane wheels , including those of the newer , heavier airplanes landing upon the lighting fixtures or by the twisting action created by heavy aircraft locked wheels when turning . all holes 59 , 60 not utilized are plugged - in with threaded , plastic plugs , not shown . when holes 59 , 60 are plugged - in , the lighting fixture is connected to electrical power connector 123 from imbedded container 1 by means of cable 111 and connector 112 . then the lighting fixture is re - bolted onto top flange 62 of adjustable extension 55 with its azimuth orientation arrows 113 aligned in azimuth , by means of bolts 120 . “ o ” ring 70 is compressed by the bolting pressure , thereby providing a tight water seal . angled bottom 110 of lighting fixture 105 fits very well in angled 66 opening 67 , as shown in fig4 , of the 25 adjustable extension . at this point , the installation is completed by pouring - in grout 122 all around the alignments adjustments assembly 55 , 85 , of the present invention . it can be seen that the novel protection ring 69 , as shown in fig4 and 11 , prevents grout 122 from getting on the lighting fixture , especially so on its lens 107 through window 108 . it is also readily understood that groove 65 , as shown in fig4 , provided on surface 63 of top flange 62 of adjustable extension 55 eliminates the requirement for installing a separate spacer ring with a groove on it for the i () installation of “ o ” ring 70 . the alignments adjustments assembly of the present invention is reusable . when the alignments adjustments assembly is installed and the airport aircraft ground traffic area is modified , creating a higher or lower surface , i . e ., if surface 24 were made higher or lower , extension 55 can be threaded in or out , after first removing all allen set - screws 81 , to provide a new height adjustment without affecting the azimuth alignment . azimuth is a straight line , i . e ., toward the horizon , in the direction of aircraft landings , with the centerline 138 , as shown in fig1 , of the aircraft ground traffic area runway , taxiway , defining this straight line . thus the embedded containers with their inset lights mounted thereupon all are installed at a specified distance one from another on this centerline for the length of the aircraft ground traffic area . at the time embedded stainless steel container 1 a is first installed , its top flange 30 , as shown in fig1 , is aligned in azimuth , by aligning centerline 138 of the aircraft ground traffic area to pass exactly aligned with two diametrically opposed threaded bolt holes 136 . prior to its installation , a surveyor provides markings on the pavement for aiding in the azimuth alignment of stainless steel container 1 a . bolt holes 136 are at an angle 135 of 30 degrees apart , and they are set on bolt circle 137 with a diameter identical to bolt circle 114 , as shown in fig9 , on the lighting fixtures 95 , 105 . bolt circle diameter 137 on top flange 30 also is identical to the bolt circle diameter , not shown , on adapter flange 85 , which bolts thereupon , by the method of the present invention . adjusting the height of adjustable extension 55 would not affect the azimuth alignment of a lighting fixture installed upon its flange 62 , as shown in fig1 , because extension 55 acme threaded portion 57 is provided with at least four acme threads 56 per inch ( 2 . 54 cm ). at four acme threads per inch ( 2 . 54 cm ), it would take four full , 360 degree turns of adjustable extension 55 , for it to go up or down one inch ( 2 . 54 cm ). therefore the adjustable extension will move up or down only ¼ inch ( 6 . 3 mm ) when rotated 360 degrees about its axis 68 , i . e ., one single , complete rotation . a 30 degree turn of adjustable extension 55 will produce a height change of only 0 . 0208 inches ( 0 . 05 mm ), up or down , i . e ., one twelfth of ¼ inch ( 6 . 3 mm ). the measure of 0 . 0208 inches ( 0 . 05 mm ) is slightly more than 1 / 64 inch ( 1 . 6 mm ). the overall tolerance 17 , as shown in fig1 is 1 / 16 inch ( 1 . 6 mm ). a 30 degree turn equals one twelfth of one full 360 degree rotation . therefore , adjustable extension 55 can be rotated a few degrees about its axis 68 in any direction to obtain a very precise azimuth alignment without negatively affecting its height adjustment . any azimuth alignment adjustment would always be 15 degrees or less because bolt holes 109 , as shown in fig9 , of the lighting fixtures , by faa mandate , are spaced apart 60 degrees , i . e ., only six holes . bolt holes 64 on top flange 62 , as shown in fig4 , are spaced at 30 degrees , exactly the same as bolt holes 136 , as shown in fig1 , on top flange 30 of the embedded container , i . e ., 12 bolt holes , also by faa specifications the diameter of bolt circles 114 , as shown in fig9 , and 137 , as shown in fig1 , are also identical to that of the top flange 62 . accordingly , a 30 degree azimuth alignment adjustment is obtained by properly positioning the lighting fixture upon top flange 62 of adjustable extension 55 , matching its bolt holes 109 with the two bolt holes 64 on flange 62 , positioning arrows 113 closest to the correct azimuth alignment marked on the pavement by a surveyor . the final , precise adjustment of 15 degrees or less is done by simply turning the adjustable extension . from fig9 , it can be seen that windows 108 are centered between two bolts 109 , and , therefore , orientation arrow 113 is at 30 degrees apart from the two adjacent bolt holes 109 . referring now to fig1 and 14 , a universal top adjustable alignment container 255 is shown in elevation in fig1 and in plan view , i . e . top view , in fig1 . the non - corrosive top adjustable alignment container 255 is another preferred embodiment of the present invention . fig1 shows , for the purpose of illustration , an airport inset light 205 , a new type of airport inset lighting fixture , manufactured by hughes phillips . the novel features of the universal top adjustable alignment container 255 allow the installation of any of the three types of lighting fixtures that exist in the u . s . market today , e . g ., lighting fixture 95 , shown in elevations in fig7 and in plan view in fig9 ; lighting fixture 105 , shown in elevation in fig8 and in plan view in fig9 ; and the newest inset lighting fixture 205 , shown in elevation in fig1 . any of the three lighting fixtures 95 , 105 , and 205 can be installed on the universal top adjustable alignment container 255 without requiring its top flange 262 to have an angled opening 66 ( fig4 ), as it is required for the flange 62 of the adjustable extension 55 of fig4 . continuing to refer to fig1 , the novel top flange 262 of the universal top adjustable alignment container 255 has an opening 267 with a straight inside surface 266 instead of an angled inside surface 66 as shown in fig4 . in addition , the top flange 262 is thicker than the top flange 62 of fig4 . this additional thickness allows a stepped bottom 201 of the lighting fixture 205 to be perfectly fit inside the opening 267 of the top flange 262 , with a flange 206 inside the mud dam 269 . the universal top adjustable alignment container 255 of fig1 is preferably cast in one piece , in stainless steel . the casting can then be machined to form the top flange 262 , a flat surface 263 , with a groove 265 in it , the mud dam 269 , and an opening 267 , with its straight surface 266 . twelve threaded holes 264 ( only two shown ) are drilled and tapped through the surface 263 of the flange 262 . then acme threads 256 are cut , at four threads per inch , on a surface 257 for a minimum of six inches from a bottom a 261 of a tubular section 257 . the tubular section 257 is of a required wall thickness 274 to allow for the required strength of the threads to resist shearing forces created by the axial loading forces applied upon the lighting fixtures by landing aircrafts . at this point , holes 259 and 260 are drilled and tapped through the tubular section 257 , through its wall thickness 274 . holes 259 and 260 are intercalated , i . e ., staggered . these holes 259 and 260 , if required , could be drilled and tapped in the field instead of in the factory . nevertheless , drilling and tapping holes 259 and 260 in the field is not the preferred method because it is not cost effective , and it is inefficient . threaded bolt holes 264 of the top flange 262 are a total of twelve , i . e ., at 30 degrees 235 from each other , as shown on fig1 . these holes 264 are drilled and tapped through a surface 263 of the flange 262 on a bolt circle 214 ( fig1 ), which is similar to the bolt circle 114 of fig9 , on the lighting fixtures 95 and 105 of fig7 and 8 , respectively . bolt holes 209 of lighting fixture 205 are drilled through flange 206 on a bolt circle ( not shown ) similar to bolt circle 214 on top flange 262 . lighting fixture 205 has six bolt holes ( only two shown ) spread at sixty degrees apart , similar to the configuration 235 shown of fig9 for lighting fixtures 95 , 105 . the number of holes , sizes , and degrees apart are all mandated by the faa , i . e ., the federal aviation administration , in specifications known as faa circulars . lighting fixture 205 of fig1 has a stepped bottom comprising a portion 201 and a portion 200 . the portion 200 provides electrical wires 211 that bring electrical power to the lighting fixture 205 . flange 206 is utilized to install the lighting fixture upon surface 263 of top flange 262 of universal top adjustable container 255 , inside its mud dam 269 . lighting fixture 205 , when bolted onto top flange 262 , compresses an “ o ” ring 270 in a groove 265 , providing a water tight seal between the lighting fixture 205 and the inside of the universal top adjustable alignment container 255 of fig1 . lighting fixture 209 has two countersunk windows 208 , similar to the countersunk windows 108 on lighting fixtures 95 , 105 of fig9 . the lighting fixture 205 also has one azimuth orientation arrow ( not shown ) engraved in each of countersunk windows 208 . the countersunk windows 208 , engraved azimuth arrows , lighting system , and their angular positioning for all lighting fixtures manufactured in the u . s . are all very similar and they are all mandated by faa regulations , i . e ., faa circulars . engraved azimuth arrows ( not shown ) on the lighting fixture 205 are utilized to aid the installer in aligning the lighting fixture 205 in azimuth , on the runway centerline and in the direction 32 of landing aircraft 51 ( fig3 ). referring now to fig1 , a plan view , i . e ., a top view , of the universal top adjustable alignment container 255 , of fig1 , is shown . fig1 shows the top flange 262 , with its mud dam 269 and twelve threaded holds 264 drilled and tapped on tile bolt circle 214 , at thirty degrees 235 from each other . fig1 also shows groove 265 in surface 263 of top flange 262 . groove 265 is provide for receiving “ o ” ring 270 . in addition , fig1 shows straight surface 266 of inside opening 267 and inside surface 274 of tubular section 257 . the universal top adjustable alignment container of the present invention can also be fabricated of individual components , which can be welded together . by way of an example , top flange 262 can be welded at 271 to the tubular section 257 , and mud dam 269 can be made of a piece of thin steel welded to the outer periphery of top flange 262 . any machining including the cutting of acme threads 256 and the drilling and tapping of holes 259 , 260 , and 264 can be done at the time each component is fabricated or after all or part of the components have been welded together . whether cast in one piece or fabricated of individual components , the universal top adjustable alignment container 255 preferably is made of stainless steel , to provide for corrosion resistance . the alignments adjustments precision makes the apparatus of tile present invention an efficient and economical apparatus and method for the replacement of conventional , existing fixed - length extensions at the time of renovation , i . e ., resurfacing of aircraft ground traffic areas , as well as for new installations of such traffic areas by eliminating the need for installing fixed - length extensions , by eliminating the need for installing several flat spacer rings of various thicknesses , by eliminating the need for installing and angle - correcting , tapered spacer rings , i . e ., leveling rings , and by eliminating the need for installing a separate mud dam . in addition , the installation of alignments adjustments assembly of the present invention saves labor costs , and the assembly is reusable . thus it can be seen that the invention accomplishes all of its objectives . the apparatus and process of the present invention are not limited to the descriptions of specific embodiments presented hereinabove , but rather the apparatus and process of the present invention should be viewed in terms of the claims that follow and equivalents thereof . further , while the invention has been described in conjunction with several such specific embodiments , it is to be understood that many alternatives , modifications , and variations will be apparent to those skilled in the art in light of the foregoing detailed descriptions . accordingly , this invention is intended to embrace all such alternatives , modifications , and variations which fall within the spirit and scope of the appended claims .	5
embodiments of the present invention will be described below with reference to the accompanying drawings . fig2 is a perspective view showing the outer appearance of an embodiment according to the present invention , fig3 a is a sectional view showing a state in which an insertion portion for a memory cartridge as a solid - state memory apparatus is open , and fig3 b is a sectional view showing a state in which the memory cartridge is inserted in the insertion portion and the insertion portion is closed . in these drawings , a camera main body 20 comprises a cover 22 , a cartridge holder 24 which can pivot about a pivot center 24a , a loading detection switch 26 , electric contacts 28 for communicating with the memory cartridge , a release button 30 , a liquid crystal display ( lcd ) device 32 , a cover member 34 , a cover biasing compression coil 36 , a memory cartridge 38 , memory contacts 38a of the memory cartridge 38 , an eject button 40 for the memory cartridge 38 , and a power switch 42 of the camera main body 20 . the operation of each section will be described below . in order to perform photographing , the eject button 40 is operated to set the open state shown in fig3 a , and the memory cartridge 38 is inserted in the holder 24 in a direction indicated by an arrow shown in fig3 a . if a barrier shutter for protecting a contact is provided for the memory cartridge 38 , the barrier shutter is opened by opening means ( not shown ) during insertion . when the memory cartridge 38 reaches a predetermined position deep in the holder 24 , the cartridge 38 is locked by a locking mechanism ( not shown ). thereafter , by closing the cover 22 , the memory contacts 38a are brought into contact with and are electrically connected to the electric contacts 28 of the camera body 20 , as shown in fig3 b . after insertion is completed , the loading detection switch 26 is operated , and the state shown in fig3 b is held by a cover locking mechanism ( not shown ). fig4 is a block diagram showing an arrangement of electric circuits of this embodiment . in fig4 the same reference numerals as in fig2 a , and 3b denote the same parts . referring to fig4 the camera main body 20 includes a photographic lens 50 , a ccd image pickup device 52 , a signal processor 54 , an a / d converter 56 , an interface circuit 58 with respect to the memory cartridge 38 , a controller 60 constituted by a microcomputer for controlling the overall system , and a switch 62 for inputting various commands . the image pickup device 52 converts an optical image of an object photographed by the photographic lens 50 into an electrical signal , and the signal processor 54 perform predetermined image signal processing . the a / d converter 56 digitizes an output from the signal processor 54 . an output from the a / d converter 56 is supplied to and stored in the memory cartridge 38 via the interface circuit 58 and the contacts 28 and 38a . fig5 shows a control operation flow chart for performing checking in the above solid - state camera . referring to fig5 when a power source is switched on by the power switch 42 ( s1 ), the controller 60 checks an open / close state of the loading detection switch 26 ( s2 ). if unloading is detected , the controller 60 performs a warning operation by means of the display device 32 and / or a sound so as to cause the user to load the memory cartridge 38 ( s4 ). if the memory cartridge 38 is already loaded , the controller 60 reads out various pieces of specification information stored beforehand in the loaded memory cartridge 38 ( s5 and s6 ) and displays the readout information on the display device 32 ( s7 ). fig6 shows the format of communication data from the memory circuit 38 to the camera main body 20 . if no memory capacity remains , the controller 60 displays a warning indicating that photographing cannot be performed on the display device 32 ( s9 ), and prohibits photographing ( s10 ). if the necessary memory capacity remains , the controller 60 reads a remaining backup battery capacity of the memory cartridge 38 ( s11 ). if the battery capacity is below a predetermined value , the controller 60 displays information indicating that photographing cannot be performed on the display device 32 and prohibits photographing ( s9 and s10 ). if the battery capacity is over the predetermined value , the controller 60 displays information indicating that photographing can be performed ( s13 ), waits for release ( s14 ), and performs photographing / recording ( i . e ., writes an output from the image pickup device 52 in the memory cartridge 38 ) ( s15 ). after recording ( s15 ), the controller 60 updates information concerning the number of photographed frames , the memory remaining capacity , and the like ( s16 ). the flow then returns to step s6 , and the controller 60 checks the memory capacity and the backup battery capacity and waits for the next release . the flow may be modified such that communication with the memory cartridge 38 is directly performed without checking the open / close state of the loading detection switch 26 immediately after the power source is switched on , and if the communication cannot be performed , the operator is warned of unloading or defective loading of the memory cartridge to prohibit photographing . in the above embodiment , the switch 26 is separately provided to detect loading completion of the memory cartridge 38 . some of the electric contacts 28 of the camera main body 20 , however , may be used to detect loading . in this case , two contacts 28a of a plurality of electric contacts 28 are used for loading detection , and the remaining contacts 28b are used for communication . one of the contacts 28 for loading detection is to be grounded . when loading of the memory cartridge 38 is completed , the memory contacts 38a are electrically connected to the contacts 28 . in accordance with whether an electrical signal ( voltage value or current value ) from the contact 28a is lower or higher than a predetermined level , the controller 60 of the camera main body 20 checks whether loading is completed . it is a matter of course that all the electric contacts 28 can be used for both loading detection and communication in such a manner that loading detection and data communication are performed at different timings . in this manner , the number of contacts 28 and 38a can be reduced . as is apparent from the above description , according to this embodiment , whether an image to be photographed can be recorded in the memory cartridge is automatically checked . therefore , photographing can be performed more reliably and more rapidly . a solid - state camera according to another embodiment of the present invention will be described below with reference to fig7 to 9 . fig7 is a block diagram showing an arrangement of the embodiment in which the present invention is applied to a solid - state camera using a solid - state memory apparatus similar to the memory cartridge 38 of the above embodiment as a still image recording medium . referring to fig7 a solid - state memory apparatus 65 comprising various ic memory devices and a cpu as a controller for controlling the ic memory devices can be detached from a camera main body 64 . the solid - state memory apparatus 65 exchanges various information with the camera main body 64 via a predetermined bus line . the camera main body 64 comprises a photographic lens 66 , a shutter 67 , a solid - state image pickup device 68 such as a ccd , a signal processor 69 , an a / d converter 70 , a driver 71 for the image pickup device 68 , a cpu 72 for controlling the overall system , a timing controller 73 for defining operation timings of the processor 69 , the converter 70 , and the driver 71 of the image pickup device 68 , and a display / switch unit 74 including various switches and a display device . the operation of fig7 will be described below with reference to a flow chart shown in fig8 . when a power switch of the camera main body 64 is turned on ( s1 ), loading of the solid - state memory apparatus 65 is waited ( s2 ). the cpu 72 communicates with the loaded solid - state memory apparatus 65 and detects specification information ( e . g ., memory device classification , the transfer speed upper limit , and the remaining capacity shown in fig6 ) of the solid - state memory apparatus 65 ( s3 ). on the basis of this information , the cpu 72 determines operation speeds of the device 68 , the processor 69 , the converter 70 , and the driver 71 and controls the timing controller 73 . when a user depresses a shutter switch of the display / switch unit 74 , the shutter 67 is opened , and an output from the image pickup device 68 is transferred to and written in the solid - state memory apparatus 65 at the above timings via the signal processor 69 and the a / d converter 70 . since a maximum continuous photographing speed is determined on the basis of the memory information obtained in step s3 , the cpu 72 displays a possible maximum continuous photographing speed ( s4 ), and monitors unloading of the solid - state memory apparatus 65 ( s5 ). fig9 is a block diagram showing an arrangement of still another embodiment of the present invention . in fig9 the same reference numerals as in fig7 denote the same parts . in this embodiment , image data digitized by an a / d converter 70 is temporarily stored in a frame memory 75 . the image data temporarily stored in the frame memory 75 is read out from the frame memory 75 at a speed corresponding to a transfer speed of a memory device of a solid - state memory 75 and written in the solid - state memory apparatus 65 . the above embodiment employs an arrangement in which when the solid - state memory 65 is loaded , the cpu 72 of the camera main body 64 inquires classification of a memory device used as the solid - state memory apparatus 65 . the arrangement , however , may be made such that the above various types of information are mechanically set in the solid - state memory apparatus 65 and detecting means for detecting the mechanically set information may be provided for the camera main body 64 . with this arrangement , the cpu need not communicate with the memory . in this embodiment , the maximum continuous photographing speed of the solid - state camera is limited to a write enable speed of the solid - state memory apparatus 65 and displayed . therefore , operability of the solid - state camera , especially its continuous photographing operability is improved . in the above description , the solid - state camera has been exemplified . the present invention , however , can be generally applied to an apparatus for recording a certain kind of information in a detachable solid - state memory apparatus . as is apparent from the above description , according to this embodiment , information can be reliably recorded even when solid - state memory apparatuses using various types of memory devices are replaced and used . an embodiment of a solid - state memory apparatus according to the present invention will be described below with reference to fig1 to 12 . note that the solid - state memory apparatus according to this embodiment is obtained by applying the present invention to the memory cartridge and the solid - state memory apparatus of the above embodiments . fig1 is a block diagram showing an arrangement of the embodiment of the present invention . referring to fig1 , a solid - state memory apparatus 65 according to this embodiment includes a status output line 76 , an address / control input line 77 , a clock input line 78 , and a data input / output line 79 . in the case of a serial signal , the data input / output line 79 is constituted by one signal line . in the case of a parallel signal , however , the data input / output line is constituted by signal lines in the number corresponding to the number of parallel signals . the solid - state memory apparatus 65 also includes a memory device 80 , an address counter 81 , an address preset circuit 82 , a controller 83 , a recognition code storing circuit 84 , and a buffer 85 . the input lines 77 and 78 and the input / output line 79 are connected to a solid - state camera via electric contacts as shown in fig3 . when the camera sends a predetermined command to the address / control input line 77 , an operation mode of the solid - state memory apparatus 65 is set . that is , a clock signal is supplied to the clock input line 78 and a binary signal is supplied to the address / control input line 77 at timings shown in fig1 . a relationship between binary values at portions a , b , c , and d in fig1 and the operation modes is shown in table 1 below . note that a maximum of 16 commands can be used by using four bits in this embodiment . table 1______________________________________a b c d operation mode______________________________________0 0 0 0 counter clear0 0 0 1 counter up0 0 1 0 counter down0 0 1 1 counter down / load ( followed by e to j ) 0 1 0 0 memory clear0 1 0 1 memory readout0 1 1 0 memory write0 1 1 1 recognition code readout1 x x x system reservation______________________________________ in synchronism with a clock supplied from the clock input line 78 , the controller 83 decodes a command from the address / control input line 77 and operates the respective sections by the designated operation mode . for example , in this embodiment , by storing memory addresses corresponding to the number of photographs in the address preset circuit 82 , image data can be randomly accessed by designating the number of a photograph . that is , when the number of photographs to be read is designated , the address preset circuit 82 loads its start address in the address counter 81 , and the address counter 81 sequentially counts up . in this manner , writing or reading of a storage area corresponding to the designated number can be performed . similarly , a recognition code can be output from the recognition code storing circuit 84 to the camera main body . more specifically , when &# 34 ; 0111 &# 34 ; is supplied from the camera main body to the address / control input line 77 , the controller 83 sends a command to the recognition code storing circuit 84 to output a stored recognition code . this recognition code is output to the camera main body via the output buffer 85 and the data input / output line 79 . note that the recognition code storing circuit 84 stores various types of specification information as shown in fig6 . fig1 is a timing chart for explaining the above operation . a clock signal is normally supplied from the camera main body to the solid - state memory apparatus 65 , and the internal circuit in the solid - state memory apparatus 65 operates in synchronism with this clock . a readout command &# 34 ; 0111 &# 34 ; of memory recognition code is supplied from the camera main body to the address / control input line 77 at the timing shown in fig1 . the first &# 34 ; 0 &# 34 ; is a start bit . the controller 83 interprets this command and sets a status bit at &# 34 ; h &# 34 ;, thereby informing the camera main body that the data is effective . in synchronism with a clock , the controller 83 causes the recognition code storing circuit 84 to output storage data ( in this embodiment , &# 34 ; 00101100 &# 34 ;) to the data input / output line 79 via the buffer 85 . a read - only memory or a combinational logic circuit , e . g ., is used as the recognition code storing circuit 84 . when this recognition code may be determined to include information such as a memory capacity , a transfer rate , and an image size , its length is not limited to 8 bits . in the above embodiment , the recognition code is read out by a command response scheme . an exclusive readout terminal , however , may be used to read out the code . in addition , in the above embodiment , data exchange is performed by four types of signal lines . data exchange , however , may be performed by using a larger or smaller number of signal lines . as is easily understood from the above description , according to the embodiments of the present invention , regardless of an outer shape or standardization of an interface , a new electronic device can be used to achieve a large capacity and a high speed .	7
the figures described above and the written description of specific structures and functions below are not presented to limit the scope of what i have invented or the scope of the appended claims . rather , the figures and written description are provided to teach any person skilled in the art to make and use the inventions for which patent protection is sought . those skilled in the art will appreciate that not all features of a commercial embodiment of the inventions are described or shown for the sake of clarity and understanding . persons of skill in this art will also appreciate that the development of an actual commercial embodiment incorporating aspects of the present inventions will require numerous implementation - specific decisions to achieve the developer &# 39 ; s ultimate goal for the commercial embodiment . such implementation - specific decisions may include , and likely are not limited to , compliance with system - related , business - related , government - related and other constraints , which may vary by specific implementation , location and from time to time . while a developer &# 39 ; s efforts might be complex and time - consuming in an absolute sense , such efforts would be , nevertheless , a routine undertaking for those of skill in this art having benefit of this disclosure . it must be understood that the inventions disclosed and taught herein are susceptible to numerous and various modifications and alternative forms . particular embodiments of the invention may be described below with reference to block diagrams and / or operational illustrations of methods . it will be understood that each block of the block diagrams and / or operational illustrations , and combinations of blocks in the block diagrams and / or operational illustrations , can be implemented by analog and / or digital hardware , and / or computer program instructions . such computer program instructions may be provided to a processor of a general purpose computer , special purpose computer , asic , and / or other programmable data processing system . the executed instructions may create structures and functions for implementing the actions specified in the block diagrams and / or operational illustrations . in some alternate implementations , the functions / actions / structures noted in the figures may occur out of the order noted in the block diagrams and / or operational illustrations . for example , two operations shown as occurring in succession , in fact , may be executed substantially concurrently or the operations may be executed in the reverse order , depending upon the functionality / acts / structure involved . computer programs for use with or by the embodiments disclosed herein may be written in an object - oriented programming language , conventional procedural programming language , or lower - level code , such as assembly language and / or microcode . the program may be executed entirely on a single processor and / or across multiple processors , as a stand - alone software package or as part of another software package . lastly , the use of a singular term , such as , but not limited to , “ a ,” is not intended as limiting of the number of items . also , the use of relational terms , such as , but not limited to , “ top ,” “ bottom ,” “ left ,” “ right ,” “ upper ,” “ lower ,” “ down ,” “ up ,” “ side ,” and the like are used in the written description for clarity in specific reference to the figures and are not intended to limit the scope of the invention or the appended claims . the inventions disclosed and taught herein comprise systems and methods of controlling one or more upss by providing a system bypass circuit in addition to any internal bypass associated with each ups . closing the system bypass circuit allows the one or more upss to be serviced or otherwise taken off line . the systems and methods may comprise placing each ups into internal bypass prior to placing the ups system into system bypass . further , the systems and methods may comprise automatic bypassing and / or restricted bypassing as desired , such as by forcing one or more of the upss to go into internal bypass when one or more covers are removed . additionally or alternately , engaging the system bypass feature may require that one or more of the individual upss is placed in internal bypass first . while there are an infinite number of embodiments that utilize one ore more of these inventions , a few specific embodiments are discussed below . fig1 illustrates a conventional ups 10 comprising a power module having a rectifier section 20 and an inverter section 30 . it will be understood that a primary power source ( not shown ), such as line utility , may supply the ups at primary input 12 . the primary ac power is rectified to dc power , which is communicated , such as by a dc bus 22 , to the inverter section 30 , where the dc power is inverted to a form of ac power . not shown in fig1 is a back up power source , such as one or more batteries , that can feed the inverter section 30 when the primary power source is offline . also illustrated in fig1 is internal bypass 14 , which , as the name implies , bypasses the power module 20 , 30 of the ups . the internal bypass 14 is structured to communicate ac power , such as from the primary power source ( or a secondary power source ), to power output 16 of the ups . also illustrated in fig1 is switch 40 that allows the power output to source from power module 20 , 30 ( as shown in fig1 ) or from the internal bypass 14 . it will be understood the switch 40 may comprise a mechanical switch , such as a breaker , an electronic switch such as an scr , or any number of other devices adapted to transfer power as described herein . turning now to fig2 , a first embodiment of an uninterruptible power supply system 100 utilizing aspects of the present invention is illustrated . a first ups 10 a is shown and another ups 10 n is shown to represent a plurality of paralleled upss 10 a through 10 n . for purposes of this disclosure , upss 10 a through 10 n are illustrated to be identical , but it will be appreciated that non - identical upss can be paralleled with the present invention as well . this embodiment of the ups system 100 shows power input 12 a through 12 n drawing power from a primary power source 50 and the bypass circuits 14 a through 14 n drawing power from a bypass power source 52 . in certain embodiments and / or applications , the primary power source 50 and bypass power source 52 may comprise the same source , such as a line utility . illustrated in fig2 is system or maintenance bypass 60 that connects a power source , such as primary power 50 or bypass power 52 to the load bus 70 . the system bypass 60 comprises a switch 62 , shown in the opened condition . the ups system 100 also comprises load bus switches 64 a through 64 n , which are shown in the closed condition . although the bypass switch 62 , and the load bus switches 64 a through 64 n are illustrated as separate switches , it will be appreciated that a single multi - pole switch , whether mechanical or electronic or a combination thereof , may be used as well . the system of fig2 is shown in the normal operating mode of the ups system in which power from the primary source 50 is passed through the power modules 20 a - n , 30 a - n through the load bus switches 64 a though 64 n and on to the load bus 70 . bypass switch 62 as well as the internal bypass circuits 14 a through 14 n are in the opened condition . fig3 illustrates the ups system 100 in internal bypass mode . as can be seen , ups switches 40 a through 40 n have been activated such that the power modules of the paralleled ups have been bypassed . power from the bypass power source 52 ( which may be the same as primary power source 50 ) is passed through to the load bus 70 via load bus switches 64 a through 64 n . activation of the ups switches 40 a through 40 n may be accomplished by any known means , including wired or wireless activation or mechanical activation , remotely or directly . fig4 illustrates the ups system 100 in system bypass mode . as can be seen , ups switches 40 a through 40 n have been activated such that the power modules of the paralleled ups have been bypassed . thereafter , system switch 62 and load bus switches 64 a through 64 n are closed and opened , respectively , simultaneously or substantially simultaneously so that power on the load bus 70 is substantially uninterrupted . in this condition , power from the bypass power source 52 ( which may be the same as primary power source 50 ) is passed through to the load bus 70 via bypass switch 62 thereby bypassing all of the paralleled upss , including their power modules 20 a - n , 30 a - n . activation of the system switch 62 and the load bus switches 64 a through 64 n may be accomplished by any known means , including wired or wireless activation or mechanical activation , remotely or directly . it will be appreciated that once the ups system illustrated in fig4 is placed in system bypass mode , one or more bypassed upss may be removed or otherwise serviced . it will also be appreciated that by requiring each targeted ups , such as upss 10 a through 10 n , to be placed into internal bypass prior to engaging the system bypass 12 , potentially damaging or harmful back feed is thereby prevented or minimized . fig5 a and 5 b illustrate aspects of a preferred ups for use with the present inventions . ups 80 comprises a power module 82 ( comprising a rectifier section and an inverter section ), an internal bypass 84 and a ups switch 86 , as discussed previously . in addition , ups 80 comprises one or more contacts or switches 88 , such as mechanical micro - switches , adjacent selected covers or panels 90 . the switch 88 communicates with ups switch 86 so that a change in state of switch 88 causes a change in state of ups switch 86 . for example , a switch 88 may be placed adjacent a primary access panel 92 , such that removal of the panel by , for example , a service technician , causes a change in state of switch 88 , such as from opened to closed or vice versa . this change in state is communicated , preferably electronically , to ups switch 86 , which causes switch 86 to change state correspondingly . in a preferred embodiment of ups 80 , removing the panel 92 causes the ups switch to place the ups 80 into bypass mode , as illustrated in fig5 b . fig6 illustrates a preferred ups system 200 comprising a plurality of paralleled upss 80 ( only one shown for clarity ) such as described above with respect to fig5 . fig6 also illustrates system bypass 100 comprising a switch 102 , such as described previously . the system bypass switch 102 may preferably comprise a mechanical breaker switch having multiple poles corresponding to the number of paralleled upss . in this configuration , the system switch 102 also comprises load bus switches 102 a through 102 n ( not shown ). it will be appreciated that the system switch 102 may be adapted such that when switch 102 is open , the load bus switches 102 a - n are closed , and vice versa . also shown in fig6 is system switch interlock 104 , which may comprise a bar , panel , or other physical structure that impedes or prevents actuation of system switch 102 . the system bypass is also disclosed to comprise an interlock switch 106 , such as mechanical micro - switch . when the interlock 104 is moved or removed , the switch 106 changes state and causes the ups switches 86 a through 86 n ( not shown ) to enter the internal bypass condition . thereafter , actuation of the system bypass switch 102 cause the ups to go into system bypass without producing damaging backfeed on the ups power modules . other and further embodiments utilizing one or more aspects of the inventions described above can be devised without departing from the spirit of my invention . for example , a suitable programmed controller can stage the internal bypass functions followed by the system bypass function . further , the various methods and embodiments of the present invention can be included in combination with each other to produce variations of the disclosed methods and embodiments . discussion of singular elements can include plural elements and vice - versa . the order of steps can occur in a variety of sequences unless otherwise specifically limited . the various steps described herein can be combined with other steps , interlineated with the stated steps , and / or split into multiple steps . similarly , elements have been described functionally and can be embodied as separate components or can be combined into components having multiple functions . the inventions have been described in the context of preferred and other embodiments and not every embodiment of the invention has been described . obvious modifications and alterations to the described embodiments are available to those of ordinary skill in the art . the disclosed and undisclosed embodiments are not intended to limit or restrict the scope or applicability of the invention conceived of by me , but rather , in conformity with the patent laws , i intend to fully protect all such modifications and improvements that come within the scope or range of equivalent of the following claims .	7
as seen in fig1 a and 1b , wire line a is attached to the top of the well sealing device b by being preferably threadedly attached to cable head 100 . cable head 100 is attached to upper housing 200 by means of shear pin 120 . more than one such shear pin 120 can be used , and it will typically be a solid brass pin . cable head 100 extends downwardly into the upper end of pressure cylinder 300 in a relatively close sliding fit with the walls of ignition chamber 320 in pressure cylinder 300 . the lower end of cable head 100 has circumferential sealing grooves 102 in which conventional rubber seals 104 can be used . the upper end 306 of cylinder 300 abuts shoulder 106 on cable head 100 . the lower end of pressure cylinder 300 contains setting pressure chamber 310 which is connected to ignition chamber 320 by means of channel 430 in mandrel 400 . a conventional ignitor 114 can be housed in cable head 100 connected to an electric lead 116 run with wire line a by known means . leading from the ignitor 114 is primary ignition channel 130 which communicates with setting pressure chamber 310 by way of ignition chamber 320 and channel 430 . propellant 362 , preferably gun powder or equivalent gas producing material , fills setting pressure chamber 310 . the outer surface of pressure cylinder 300 has downwardly angled ratchet threads 390 which mesh with upwardly angled ratchet threads 930 in the inner surface of ratchet ring 900 . ratchet threads 390 and 930 are left hand threads in order to insure continued tightening of the plug during drilling if it becomes necessary to drill the plug out . ratchet ring 900 is slotted to allow the passage of shear pin 120 . pressure cylinder 300 is slidably mounted within pressure chamber 210 of upper housing 200 . the upper end of the inner surface of upper housing 200 has downwardly angled threads 290 which mesh with upwardly angled threads 920 on the outer surface of ratchet ring 900 . threads 290 and 920 are also left hand threads . mandrel 400 is threaded into pressure cylinder 300 by means of threads 350 and 450 . mandrel 400 extends downwardly through the lower end of upper housing 200 in a slidable fashion . the lower end of upper housing 200 is sealed against mandrel 400 by internal circumferential grooves 202 which can contain known rubber seals 204 . the lower end of mandrel 400 is fixedly attached to lower housing 500 by means of being threaded directly into lower housing 500 by means of threads 460 and 560 . slidably mounted along mandrel 400 between upper housing 200 and lower housing 500 are slip segments 600 held in place by conventional means , spreader elements 700 and sealing member 800 . the lower end of upper housing 200 has slip drive surface 250 which bears downwardly against the upper end of upper slip segment 600 . on the inner surface of slip segments 600 are frusto - conical surfaces 630 and on the outer surface are slip teeth 610 which face upwardly on upper segments 600 and which face downwardly on lower segments 600 . immediately below upper slip segment 600 and immediately above lower slip segment 600 are spreader elements 700 which have outwardly facing frusto - conical surfaces 710 which mate with inwardly facing frusto - conical surfaces 630 on the slip segments 600 . spreader elements 700 also have flat surfaces 730 which mate with flat surfaces 810 on sealing member 800 . sealing member 800 is a resilient three piece sealing member such as rubber or neoprene which slidably engages mandrel 400 in its inner bore and which is designed to expand until its outer surfaces 830 seal against the well casing c . upper element 802 has inner frusto - conical surface 803 which mates with outer frusto - conical surface 805 on center element 804 , leaving a concealed gap between upper end 807 of center element 804 and inner face 809 of upper element 802 . similarly , lower element 806 and center element 804 have a concealed gap therebetween and similar matching frusto - conical surfaces . the operation of well sealing device b will now be described . well sealing device b is lowered into casing c to the desired point by means of wire line a . an electrical signal from the surface causes the ignitor 114 to ignite propellant 362 which initially drives pressure cylinder 300 upwardly , pushing cable head 100 upwardly , relative to upper housing 200 , shearing shear pin 120 between cable head 100 and ratchet ring 900 . continued expansion sets the slip segments 600 immediately thereafter . propellant 362 burns , generating an expanding gas causing upper housing 200 to be driven downwardly relative to pressure cylinder 300 because of the opposing pressures exerted on pressure cylinder 300 and reaction surface 230 at the lower end of pressure chamber 210 . mandrel 400 is attached in a rigid fashion to lower housing 500 , so as upper housing 200 is driven downwardly , the slip segments 600 and sealing member 800 between upper housing 200 and lower housing 500 are subjected to a vertical compressive force . upper housing 200 presses downwardly on upper slip segments 600 which are driven outwardly by upper spreader element 700 and at the same time lower slip segments 600 are driven outwardly by lower spreader element 700 as upper and lower spreader elements 700 are driven toward each other by the compressive force . as the spreader elements 700 are driven toward each other , they also compress sealing element 800 , causing center element 804 to expand upper and lower elements 802 and 806 outwardly until outer surfaces 830 of upper element 802 and lower element 806 contact well casing c . as upper housing 200 is driven downwardly relative to pressure cylinder 300 , ratchet threads 390 and 930 maintain the final relative axial position of upper housing 200 and pressure cylinder 300 . this prevents any subsequent slackening of the compressive force on slip segments 600 and sealing member 800 . spreader elements 700 are tapered at a shallow angle so as to allow cylinder 300 to move sufficiently to shear the shear pin 120 before slip segments 600 contact securely with well casing c . therefore , wire line a is positively released from the well sealing device b by the early expansion of propellant 362 which causes the upward movement of cable head 100 relative to housing 200 . wire line a can then be removed from the well bore . any subsequent pressure differential across the well sealing device b will result in a pressure being exerted from the high pressure side against sealing member 800 which will in turn press against spreader element 700 on the low pressure side of the seal , which will , in turn , exert further pressure on slip segments 600 on the low pressure side , insuring that slip segment teeth 610 maintain their engagement with well casing c . increased pressure differential will result in increased sealing pressure at sealing member 800 and increased holding pressure at slip segment teeth 610 . the description given here is intended to illustrate the preferred embodiment of this invention . one skilled in the art will be able to devise variations on this invention which will be essentially equivalent to this embodiment . to the extent that any variations are equivalent , it is intended that they be encompassed by the following claims .	4
in the following preferred examples , the molar ratio of the ethylene to propylene group in the backbone structure of the ppt / pet copolyester is preferably in the range of 60 / 40 to 99 / 1 , and more preferably 70 / 30 to 95 / 5 . the ppt / pte copolyester used to prepare the polyester fiber of the present invention preferably has an intrinsic viscosity [ η ] of 0 . 5 - 1 . 5 dl / g determined at 25 ± 0 . 2 ° c . using phenol / tetrachloroethane ( 3 / 2 , w / w ) as the solvent . according to a first preferred embodiment of the present invention , the ppt / pet copolyester can be prepared by the following steps . first , bis ( 3 - hydroxypropyl ) terephthalate ( bhpt ), terephthalic acid , and ethylene glycol are reacted together in an esterification reaction . then , the esterified product is subjected to undergo a polycondensation reaction . in the above process , ethylene glycol and terephthalic acid can be fed in a molar ratio of 1 . 0 to 4 . 0 and preferably 1 . 1 to 1 . 5 . further , terephthalic acid and bhpt can be fed in a molar ratio of from 99 / 1 to 1 / 99 , whereas the molar ratio is preferably of from 60 / 40 to 99 / 1 and more preferably from 70 / 30 to 95 / 5 . the bis ( 3 - hydroxypropyl ) terephthalate suitable for use in the present invention can be either a monomer or an oligomer obtained from reacting terephthalic acid and 1 , 3 - propanediol via an esterification reaction . 1 , 3 - propanediol and terepthalic acid can be fed in a molar ratio of from 1 . 0 to 4 . 0 , and preferably from 1 . 1 to 1 . 5 . alternatively , bis ( 3 - hydroxypropyl ) terephthalate used can be either a monomer or an oligomer obtained from reacting dimethyl terephthalate ( dmt ) and 1 , 3 - propanediol via an ester exchange reaction . according to a second preferred embodiment of the present invention , the ppt / pet copolyester can be prepared via the following steps . first , terephthalic acid , ethylene glycol , and 1 , 3 - propanediol are reacted together in an esterification reaction . then , the esterified product is subjected to undergo a polycondensation reaction . in the above process , ethylene glycol and 1 , 3 - propanediol can be fed in a molar ratio of from 99 / 1 to 1 / 99 , whereas the molar ratio is preferably of from 60 / 40 to 99 / 1 and more preferably from 70 / 30 to 95 / 5 . the esterification reaction in the present invention can be conducted at a room temperature up to a temperature of 280 ° c ., preferably 200 ° c . to 260 ° c ., and the esterification ratio is preferably controlled to 90 % to 99 %. the polycondesation can be conducted at a temperature of 200 ° c . to 280 ° c . according to the present invention , by controlling the corresponding usage amounts of bhpt , terephthalic acid , and ethylene glycol , the ppt / pet copolyester fiber containing a desired ethylene / propylene molar ratio can be obtained . the main difference between ppt and pet resides in their structural units . in ppt , the soft chain is of the more flexible ( ch 2 ) 3 group with an odd carbon number . in pet , the soft chain is of the more rigid ( ch 2 ) 2 group with an even carbon number . with such structural differences , ppt has indeed a superior dyeability than pet . the present invention incorporates an appropriate amount of ( ch 2 ) 3 chain of ppt into the main chain of pet , so the ppt / pet copolyester having both ( ch 2 ) 2 and ( ch 2 ) 3 groups can be formed accordingly . further , the ppt / pet copolyester fiber can also be produced by using the conventional fiber process . the fiber of the ppt / pet copolyester with both ( ch 2 ) 2 and ( ch 2 ) 3 groups has a dyeability superior than that of the pet , and it can even be better than that of the ppt . in addition , the ppt / pet copolyester of the present invention can be prepared by directly adapting conventional polyester apparatuses . the following examples are intended to illustrate the process and the advantages of the present invention more fully without limiting its scope , since numerous modifications and variations will be apparent to those skilled in the art . 50 . 6 kg of terephthalic acid ( tpa ) and 30 . 2 kg of 1 , 3 - propanediol ( pdo ) were charged in an esterification vessel and stirred thoroughly at a stirring rate of 130 rpm in the presence of an esterification catalyst . nitrogen was then introduced at a flow rate of 4 l / min , and the reaction pressure was maintained at 2 kg / cm 2 g . the internal temperature of the esterification vessel was increased to 245 ° c . during the esterification process , the byproducts water and 1 , 3 - pdo were separated by using a separation tower such that 1 , 3 - pdo was introduced to the esterification reaction system and that water was made to flow out from the top of the tower , which is then cooled and recovered . the total esterification reaction time was 3 . 5 hours . the esterified product bhpt was cooled and crushed , by which the saponification value can be determined , and the saponification value was then converted to have a calculated esterification conversion of 98 . 1 %. the reaction conditions are summarized in table 1 . 55 kg of tpa , 27 kg of ethylene glycol ( eg ), and 4 . 5 kg of bhpt ( obtained from example 1 ) were charged in an esterification vessel and stirred thoroughly at a stirring rate of 130 rpm in the presence of the sb 2 o 3 catalyst . the molar ratio of eg and tpa was 1 . 3 , whereas the molar ratio of tpa and bhpt was 95 : 5 . in addition , nitrogen was introduced at a flow rate of 4 l / min , and the reaction pressure was maintained at 2 kg / cm 2 g . the internal temperature of the esterification vessel was increased to 255 ° c . during the esterification process , the byproducts water and 1 , 3 - pdo were separated by using a separation tower such that 1 , 3 - pdo was introduced to the esterification reaction system and that water was made to flow out from the top of the tower , which is then cooled and recovered . the total esterification reaction time was 3 . 3 hours . the esterified product was then moved into a polymerization vessel to proceed the polymerization reaction . the vacuum was equal to or less than 1 torr . furthermore , the polymerization temperature was controlled to 255 ° c .- 270 ° c ., and the stirring rate was first 60 rpm and then decreased to 30 rpm during the reaction . the total polymerization time was 3 . 5 hours . finally , the ppt / pet copolyester product in molten form was extruded into filaments , cooled in a cool water vessel , and then cut into ppt / pet copolyester chips having an intrinsic viscosity ( iv ) of 0 . 62 dl / g . the reaction conditions are summarized in table 1 . the composition , intrinsic viscosity , and thermal properties of the ppt / pet copolyester are shown in table 2 . 50 kg of tpa , 24 . 3 kg of eg , and 19 . 1 kg of bhpt ( obtained from example 1 ) were charged in an esterification vessel and stirred thoroughly at a stirring rate of 130 rpm in the presence of the sb 2 o 3 catalyst . the molar ratio of eg and tpa was 1 . 3 , whereas the molar ratio of tpa and bhpt was 82 : 18 . nitrogen was introduced at a flow rate of 4 l / min , and the reaction pressure was maintained at 2 kg / cm 2 g . the internal temperature of the esterification vessel was increased to 245 ° c . during the esterification process , the byproducts water and 1 , 3 - pdo were separated by using a separation tower such that 1 , 3 - pdo was introduced to the esterification reaction system and that water was made to flow out from the top of the tower , which was then cooled and recovered . the total esterification reaction time was 3 . 5 hours . the esterified product was then moved into a polymerization vessel to proceed the polymerization reaction . the vacuum was equal to or less than 1 torr . furthermore , the polymerization temperature was controlled to 245 ° c .- 255 ° c ., and the stirring rate was first 60 rpm and then decreased to 30 rpm during the reaction . the total polymerization time was 4 hours . finally , the ppt / pet copolyester product in molten form was extruded into filaments , cooled in a cool water vessel , and then cut into ppt / pet copolyester chips having an intrinsic viscosity ( iv ) of 0 . 66 dl / g . the reaction conditions are summarized in table 1 . the composition , intrinsic viscosity , and thermal properties of the ppt / pet copolyester are shown in table 2 . 30 kg of tpa , 7 . 3 kg of eg , and 8 . 9 kg of 1 , 3 - pdo were charged in an esterification vessel and stirred thoroughly at a stirring rate of 130 rpm in the presence of the sb 2 o 3 catalyst . the molar ratio of eg and 1 , 3 - pdo was 50 : 50 . nitrogen was introduced at a flow rate of 4 l / min , and the reaction pressure was maintained at 2 kg / cm 2 g . the internal temperature of the esterification vessel was gradually increased to 240 ° c . during the esterification process , the byproducts water , eg and 1 , 3 - pdo were separated by using a separation tower such that eg and 1 , 3 - pdo were introduced to the esterification reaction system and that water was made to flow out from the top of the tower , which was then cooled and recovered . the total esterification reaction time was 3 hours . the esterified product was then moved into a polymerization vessel to proceed the polymerization reaction . the vacuum was equal to or less than 1 torr , and the polymerization temperature was controlled to 245 ° c .- 255 ° c . the total polymerization time was 2 . 5 hours . finally , the ppt / pet copolyester product in molten form was extruded into filaments , cooled in a cool water vessel , and then cut into ppt / pet copolyester chips having an intrinsic viscosity ( iv ) of 0 . 55 dl / g . the reaction conditions are summarized in table 1 . the composition , intrinsic viscosity , and thermal properties of the ppt / pet copolyester are shown in table 2 . the ppt / pet copolyester was determined for dma and the obtained tg curve has only one peak , indicating that the ppt / pet copolyester is a homogeneous phase , not a mixture of ppt and pet . 50 . 6 kg of tpa and 30 . 2 kg of 1 , 3 - pdo were charged in an esterification vessel and stirred thoroughly at a stirring rate of 130 rpm in the presence of the sb 2 o 3 catalyst . nitrogen was introduced at a flow rate of 4 l / min , and the reaction pressure was maintained at 2 kg / cm 2 g . the internal temperature of the esterification vessel was gradually increased to 245 ° c . during the esterification process , the byproducts water and 1 , 3 - pdo were separated by using a separation tower such that 1 , 3 - pdo were introduced to the esterification reaction system and that water was made to flow out from the top of the tower , which was then cooled and recovered . the total esterification reaction time was 3 . 5 hours . the esterified product was then moved into a polymerization vessel to proceed the polymerization reaction . the vacuum was equal to or less than 1 torr , the polymerization temperature was controlled to about 255 ° c . and the stirring rate was first 60 rpm and then decreased to 30 rpm during the reaction . the total polymerization time was 4 hours . finally , the ppt product in molten form was extruded into filaments , cooled in a cool water vessel , and then cut into ppt chips having an intrinsic viscosity ( iv ) of 0 . 8 dl / g . the reaction conditions are summarized in table 1 . the ppt / pet copolyester chips obtained from example 2 and example 3 , and the ppt chips obtained from example 5 were melt spun in a spinning machine at a spinning temperature of 200 ° c . to 260 ° c . and at a spinning rate of 3000 m / min into partially oriented yarns ( poy ) having a fineness of 1 . 3 dpf ( deniers per filament ), a strength of 2 . 3 g / d , and an elongation of higher than 100 %. the poy of polyester was then spun by a textured machine into draw - textured yarns ( dty ) of 0 . 9 dpf . the strength of the ppt / pet copolyester dty prepared from the chips of example 2 was higher than 2 . 9 g / d , and the strength of the ppt / pet copolyester dty prepared from the chips of example 3 was higher than 3 . 4 g / d . further , the pet fiber from hualon corporation ( tradename : p - dty 75d / 72f ) and the above three kinds of ppt / pet copolyester dty fibers were made into circular knits and then dyed . the dyed samples were measured for color strength ( the total k / s reflectivity ), washing fastness , and light fastness to compare their dyeability . the results are shown in table 3 . the washing fastness and light fastness were expressed by ratings . rating 4 indicates excellent while rating 2 indicates fair . the color strength was expressed by the total k / s reflectivity . larger k / s value indicates that the sample was dyed deeper . it can be seen from table 3 that the pet textile and the ppt / pet copolyester textile have a better dyeability than the pet textile . the ppt / pet copolyester textile with an ethylene to propylene molar ratio of 74 : 26 ( from example 3 ) has a even better dyeability than the ppt textile . the foregoing description of the preferred embodiments of this invention has been presented for purposes of illustration and description . obvious modifications or variations are possible in light of the above teaching . the embodiments were chosen and described to provide the best illustration of the principles of this invention and its practical application to thereby enable those skilled in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . all such modifications and variations are within the scope of the present invention as determined by the appended claims when interpreted in accordance with the breadth to which they are fairly , legally , and equitably entitled .	3
while the present disclosure is described with reference to several illustrative embodiments described herein , it should be clear that the present disclosure should not be limited to such embodiments . therefore , the description of the embodiments provided herein and the references to magnetic resonance imaging ( mri ) systems are examples of the systems utilizing superconducting magnets and are merely illustrative of the present disclosure and should not limit the scope of the disclosure as claimed . it will be appreciated by those skilled in the art that the disclosed methods are applicable to many other systems using superconducting magnets . briefly described , a method and a system are disclosed for saving energy in keeping many superconducting magnets appropriately cold , while a superconducting magnet is not being used , by discharging the magnet and keeping it in temperatures between the critical temperature of the magnet and the ambient temperature . traditionally , even if a superconducting magnet system is not being actively used for a while , whether a weekend or a month , the temperature of the “ cold mass ,” which is defined as the coils and structure components that operate at below critical temperature of the coils , is not allowed to rise above critical temperature of the superconducting coils of the superconducting magnet system . mri scanners are used for biomedical research and diagnosis of human disease and disorder . imaging by an mri scanner requires a very uniform , constant , and stable magnetic field over a specific volume . conventionally , such a magnetic field , often referred to as a b 0 field , is produced by a permanent or superconducting magnet . for human applications , mri devices that use permanent magnets typically generate b 0 magnetic fields of less than 0 . 5 t , and for research on animals they generate less than 1 . 5 t . for higher resolution imaging , superconducting magnets need to produce higher magnetic fields . superconducting b 0 magnets use coils which must be maintained at cryogenic temperatures that are lower than the critical temperature of the superconducting coils . conventionally , to achieve this , the coils of a superconducting mri magnet operate in a pool / bath of boiling liquid helium under close to 1 atmosphere of pressure that keeps the coils at about 4 . 2k . typically , the liquid helium fills parts of the helium vessel and the rest is helium vapor that is allowed to vent to ambient atmosphere . as shown in fig1 , the helium vessel is surrounded by a radiation shield and both , the helium vessel and the surrounding radiation shield , are placed inside an exterior vessel . the exterior vessel includes certain vacuum space . the vessel , the radiation shield , the liquid helium vessel , and certain other parts are called a “ cryostat .” the cryostat reduces and minimizes heat transfer to the helium vessel . but inevitably there is heat transfer to helium vessel and eventually to the liquid helium bath by : 1 ) conduction through structural members of the cryostat , radiation shield , and the helium vessel ; 2 ) radiation ; and 3 ) residual partial pressure in the vacuum space . the heat transferred to the liquid helium bath naturally keeps the liquid helium in boiling condition and , therefore , in continuous generation of helium vapor , which vents to the atmosphere . in certain superconducting magnets , called zero - boil - off systems , the vaporized helium gas is re - condensed to liquid helium by a cryocooler and returned to the liquid helium bath . contrary to its name , zero - boil - off , the re - condensing is not 100 % and some helium vapor vents to the atmosphere . in a superconducting magnet where the coils are placed in a liquid helium bath , whether the magnet is of zero - boil - off type or not , the temperature of the liquid helium is essentially constant because the liquid helium bath is at its boiling point , and the temperature can only change if all or most of the liquid helium vaporizes . for superconducting magnets that use liquid helium , the goal of the cryostat is to maintain the liquid helium in its vessel with the least amount of loss to the atmosphere . there is no incentive to have the coils at any temperature appreciably above that of the boiling liquid helium . because if the temperature increases , no liquid helium will remain in the vessel and superconducting coils will need to be discharged or be allowed to quench . in such a case , to revert back to the operating conditions , one needs to refill the helium vessel with liquid helium , which requires a significant effort . also , since superconducting magnets in conventional mri systems operate in persistent mode and stay charged , there is no benefit in discharging them at any time . the mri superconducting magnets are only discharged to service the magnet . the charge and discharge of these magnets require significant time and effort and are typically avoided for as long as possible . in order to achieve a constant magnetic field , superconducting magnets of mri systems operate in the so called persistent mode , where the current circulates through a set of superconducting coils that are connected in series by superconducting joints to form a superconducting loop . additionally , to reach persistent mode , the set of coils need to have a persistent switch . principles of persistent mode operation are described , for example , in superconducting magnets , m . n . wilson , oxford university press , new york , n . y . ( 1983 ), chapter 11 . there are many other superconducting magnets that operate in a direct current ( dc ) mode such as those used in nuclear magnetic resonance ( nmr ) spectroscopy or particle accelerators , which preferably operate in persistent mode . in conclusion , the conventional superconducting magnets , such as mri superconducting magnets , stay charged with their coils in a pool of liquid helium . again , there is no incentive to increase the temperature of the coils and discharge these systems because there is a significant penalty for increasing the temperature of these coils and discharging these magnets . even in the zero - boil - off systems there is no incentive to slow down the cryocooler , because doing so will increase the rate of helium vapor venting through the cryostat . and if venting is restricted , the pressure inside the helium vessel will increase and will have serious implications . therefore , customarily , the users of such systems leave their systems on , even when their systems stay idle . an alternative to the class of liquid helium cooled superconducting magnets discussed above is the class of cryogen - free ( cf ) superconducting magnets . cf superconducting magnets are cooled to very low temperatures by one or more two - stage cryocoolers ( also known as cryo - refrigerator ) that make physical contact with selected parts of the magnet system and extract heat by conduction . this method of cooling is commonly referred to as cryogen free or conduction cooling . the amount of cooling ( removal of heat ) that is provided by a two - stage cryocooler can be a few tens of watts for the first stage to reach , for example , a temperature of 30 ° to 60 ° k ., and a few watts for the second stage to reach , for example , 3 ° to 10 ° k . if the desired temperature is to be maintained , the amount of heat transferred ( also known as heat leak ) to the superconducting magnet from the environment should be reduced to or be lower than the cooling capacity of the cryocooler . typically , a cf superconducting magnet includes several parts including a vacuum vessel , radiation shield , mechanical support structure , electrical connection , various sensors , valves , and coils made from superconducting wires . fig2 shows a schematic diagram of a cryogen - free superconducting magnet . for the superconducting magnet to operate properly and produce the required magnetic field , the temperature of the coils made from superconducting wires ( superconducting coils ), the structure , the connections that keep the coils together , need to be kept below the critical temperature of the superconducting coils . similar to the liquid helium cooled superconducting magnet , in a cf superconducting magnets the superconducting coils , the structure , and the connections which keep the coils together may be referred to as “ cold - mass .” the convection heat transfer to the cold - mass is reduced by removing the gases , such as air , which may surround the cold - mass . air may be removed by housing the cold - mass inside a vacuum chamber . radiation heat transfer is reduced by housing the cold - mass inside a radiation shield , which in turn is housed within the vacuum chamber . the radiation shield is cooled by the first stage of the cryocooler to a temperature of , for example , 30 ° to 60 ° k ., and is usually covered on the side facing the vacuum chamber with several layers of reflective insulation , often referred to as “ super - insulation .” a conduction cooled systems is distinguished from a liquid helium cooled system by the fact that the cold - mass of the conduction cooled system and , therefore , its superconducting coils , operate in vacuum and that the temperature of the coils of the conduction cooled system can be allowed to increase without the penalties associated with handling of liquid helium or helium vapor . according to the methods disclosed in this application , cf superconducting magnets , for example those in mri systems , do not need to remain at a given temperature or stay charged even when they are not being used . to reach an “ idle mode ,” these magnets are discharged and the temperature of their cold - masses is permitted to increase by making the cryocooler work at lower cooling capacity or even stop for periods of time , which in turn saves some energy that otherwise will be used by the cryocooler . to prepare for the idling mode according to the present disclosure , the superconducting magnet is discharged by transferring its stored energy to heat exchangers outside of the magnet and by running the cryocooler at a lower cooling capacity . in the disclosed idling mode the temperature of the coils , while higher than the superconducting critical temperature , is not allowed to rise as high as the room temperature . however , during this process the temperatures of the first and the second stage of the magnet system reach higher values . for example , the temperature of the first stage parts , such as the radiation shield , may increase by 10 ° to 30 ° k ., and the temperature of the second stage parts , such as coils , may also increase by 10 ° to 40 ° k . in the disclosed idling mode , the cryocooler power consumption will be significantly lower than it is during the superconducting mode . according to this disclosure , an mri magnet is shifted to idling mode when the magnet is not going to be used for an extended period of time , such as for days or weeks . in anticipation of the magnet reuse , the cooling system is switched from idling mode to full cooling mode , where the magnet cools to a superconducting state and is recharged . recooling the first stage and the second stage by 10 ° to 40 ° k . can be achieved in a few hours rather than a few days that are required to cool a magnet down from room temperature . one of the key advantages of the disclosed idling mode , compared to keeping the magnet in superconducting state , is that a great amount of energy , which actually would have been wasted during an inactive time interval , is saved . as previously mentioned , the disclosed idling method may be applied to persistent mode superconducting magnets used in nuclear magnetic resonance ( nmr ) spectroscopy applications as well . this method may also be applied to the so called driven superconducting magnets where the coils of the superconducting magnet are connected to a current power supply that charges the coils and keeps them charged . those skilled in the art will recognize that many known means and methods may be adopted to control the cold - mass temperature and keep the cold - mass at any desired temperature between the room temperature and cryogenic temperatures , during the idling mode . for example a programmable or a preprogrammed idling switch may be included in the disclosed superconducting magnet system which can be turned on to initiate the lowering of the cooling capacity of the first and the second stages of the cryocooler and maintain the cold - mass at a programmed temperature , and which can be turned off to cool down the cold - mass to a desired cryogenic temperature . a preprogrammed idling switch may have used software or be hardwired . in another example , a user of the system may manually , using a control mechanism , set the first and the second stage temperature increases of the cold - mass based on the planned idling time . in yet another example , a calibrated control component such as a knob , a dial , or a slide switch may be used to set the idling mode temperature based on tabulated energy savings . those skilled in the art will recognize that the cold - mass of a conduction cooled superconducting magnet system may include modules of materials that increase the heat capacity of the cold - mass so that during interruption to the cooling system the temperature of the cold - mass rises slower than otherwise . these modules may include metals , polymers , and ceramics . also these modules may include hermetically sealed containers that contain gases such as neon , nitrogen , or helium . clearly the higher the idling temperature for the first stage and second stage of the cryocooler is the more energy is saved ; however , more time will be needed to re - cool the system back to superconducting and therefore the operating mode ( up - time ). therefore the overall operation of a cf superconducting magnet being able to switch to an idling mode may be such that to optimize the energy savings and the up - time of the magnet system . for example if the system is to be in idling mode just for a weekend , the first stage and the second stage of the magnet system may be set to idle at 20 k , and 50 k respectively , but if the system is to be idling for a week or more , the first stage and the second stage of the magnet system may be set to idle at 40 k , and 60 k . in the former case , re - cooling time or up - time is shorter than in the latter case , but the extra energy savings may justify the extra cooling time of the latter case . in various methods of controlling and or programming the idling temperatures the user of the cf superconducting magnet can decide on what are the optimum parameters for idling mode . changes can be made to the claimed invention in light of the above detailed description . while the above description details certain embodiments of the invention and describes the best mode contemplated , no matter how detailed the above appears in text , the claimed invention can be practiced in many ways . details of the system may vary considerably in its implementation details , while still being encompassed by the claimed invention disclosed herein . particular terminology used when describing certain features or aspects of the invention should not be taken to imply that the terminology is being redefined herein to be restricted to any specific characteristics , features , or aspects of the invention with which that terminology is associated . in general , the terms used in the following claims should not be construed to limit the claimed invention to the specific embodiments disclosed in the specification , unless the above detailed description section explicitly defines such terms . accordingly , the actual scope of the claimed invention encompasses not only the disclosed embodiments , but also all equivalent ways of practicing or implementing the claimed invention . the above specification , examples , and data provide a complete description of the manufacture and use of the composition of the invention . since many embodiments of the invention can be made without departing from the spirit and scope of the invention , the invention resides in the claims hereinafter appended . it is further understood that this disclosure is not limited to the disclosed embodiments , but is intended to cover various arrangements included within the spirit and scope of the broadest interpretation so as to encompass all such modifications and equivalent arrangements . it will also be understood by those skilled in the art that single - stage coolers and / or multiple coolers may be adopted in various embodiments to achieve the same results discussed in this disclosure . it will be understood by those within the art that , in general , terms used herein , and especially in the appended claims ( e . g ., bodies of the appended claims ) are generally intended as “ open ” terms ( e . g ., the term “ including ” should be interpreted as “ including but not limited to ,” the term “ having ” should be interpreted as “ having at least ,” the term “ includes ” should be interpreted as “ includes but is not limited to ,” etc .). it will be further understood by those within the art that if a specific number of an introduced claim recitation is intended , such an intent will be explicitly recited in the claim , and in the absence of such recitation no such intent is present . for example , as an aid to understanding , the following appended claims may contain usage of the introductory phrases “ at least one ” and “ one or more ” to introduce claim recitations . however , the use of such phrases should not be construed to imply that the introduction of a claim recitation by the indefinite articles “ a ” or “ an ” limits any particular claim containing such introduced claim recitation to inventions containing only one such recitation , even when the same claim includes the introductory phrases “ one or more ” or “ at least one ” and indefinite articles such as “ a ” or “ an ” ( e . g ., “ a ” and / or “ an ” should typically be interpreted to mean “ at least one ” or “ one or more ”); the same holds true for the use of definite articles used to introduce claim recitations . in addition , even if a specific number of an introduced claim recitation is explicitly recited , those skilled in the art will recognize that such recitation should typically be interpreted to mean at least the recited number ( e . g ., the bare recitation of “ two recitations ,” without other modifiers , typically means at least two recitations , or two or more recitations ). furthermore , in those instances where a convention analogous to “ at least one of a , b , and c , etc .” is used , in general such a construction is intended in the sense one having skill in the art would understand the convention ( e . g ., “ a system having at least one of a , b , and c ” would include but not be limited to systems that have a alone , b alone , c alone , a and b together , a and c together , b and c together , and / or a , b , and c together , etc .). it will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms , whether in the description , claims , or drawings , should be understood to contemplate the possibilities of including one of the terms , either of the terms , or both terms . for example , the phrase “ a or b ” will be understood to include the possibilities of “ a ” or “ b ” or “ a and b .” while the present disclosure has been described in connection with what is considered the most practical and preferred embodiment , it is understood that this disclosure is not limited to the disclosed embodiments , but is intended to cover various arrangements included within the spirit and scope of the broadest interpretation so as to encompass all such modifications and equivalent arrangements .	7
the surfaces of the two bones at the joint are covered in cartilage . articular cartilage is multi - layered . a thin superficial layer provides a smooth surface for the two bones to slide against each other . cartilage is composed of cells called condrocytes which are dispersed in a firm gel - like ground substance , called the matrix . the main purpose of cartilage is to provide a framework upon which bone deposition could begin . another important purpose of cartilage is to provide smooth surfaces for the movement of articulating bones . in order to illustrate the invention , the following examples are included . however , it is to be understood that these examples do not limit the invention and are only meant to suggest a method of practicing the invention . the following examples used hyaluronan prepared by the methods disclosed in japan patents 1284023 and 1353027 ( publication of examined application number : s60 - 009042 , title : separating method for acidic polysaccharides from connective tissues ; and patent number 1353027 , publication of examined application number : s61 - 021241 , title : separating method for acidic polysaccharides from connective tissues ), which concluding : hyaluronan of 6 , 000 , 000 dalton ( synvisc , biomatrix , usa ), of 600 , 000 - 1 , 200 , 000 dalton ( artzdispo , seikagaku , japan ), of 600 , 000 - 1 , 200 , 000 dalton ( hikamilon dispo , taisho pharmaceutical co ., ltd ., japan ), of 600 , 000 - 1 , 200 , 000 dalton ( lumisteron dispo , nissin , japan ), of 600 , 000 - 1 , 200 , 000 dalton ( unihylon dispo , uji , japan ), of 500 , 000 - 730 , 000 dalton ( hyalgan , fidia , italy ), and of 500 , 000 - 730 , 000 dalton ( suplasyn , bioniche , ireland ) hyaluronan reduced amounts of h 2 o 2 and inflammatory factors for demonstrating the effects of hyaluronan injected into patient &# 39 ; s articulation on the production of h 2 o 2 in synovial , we firstly drew the synovial from hyaluronan - treated patient and analyzed the content of free radical . the method for free radical analysis followed the method described in american journal of transplantation 2005 , 5 : 1194 - 1203 , which is incorporated herein by reference . briefly , the sampled synovial was colded on ice . 200 μl of the cold synovial was placed on iron plate , and then put into the detecting cell of chemiluminescence detector ( cla - fs1 , tohoku electronic ind . co ., sendai , japan ). after turning on the detector and measuring the backgroung for 50 sec , 500 μl of luminol ( from sigma corp ., usa , as 0 . 1 mm solution prepared by disolving the powder in phosphate buffer slution ( pbs ), stored at 4 ° c .) or lucigenin ( from sigma corp ., usa , as 0 . 1 mm solution prepared by disolving the powder in pbs , stored at 4 ° c . was added , and then the content of free radicals was measured in 300 sec , with one respective accumulative value obtained at the interval of 10 sec . the background integration in 300 sec was calculated by : ( average integration of time - count in 50 sec )× 30 . the average free radical count for each sample at the interval of 10 sec was calculated as follow : ( total area integration under time - count curve − background integration in 300 sec )÷ 25 . as showed in fig1 , hyaluronans with molecular weight of 500 , 000 to 8 , 000 , 000 dalton exhibited an effect on reducing the production of h 2 o 2 in synovial fluid . among the hyaluronans tested in this experiment , the effectiveness thereof in reducing the production of h2o 2 is 600 , 000 - 1 , 200 , 000 dalton & gt ; 500 , 000 - 730 , 000 dalton & gt ; 6 , 000 , 000 dalton . we also used the synovial fluid sampled f synovial fluid from untreated patient as a control . by the results showed in fig2 , the content of was significantly reduced in the synovial fluid from the hyaluronan - treated patients as compared to the control synovial fluid , which contained high level of free radicals such as o 2 −. , h 2 o 2 . the production of free radicals and mortality of chondrocytes were deminished by hyaluronan in vitro in order to realize the in vitro effects of hyaluronan on the reactivity of free radicals , such as h 2 o 2 , we took 200 μl of h 2 o 2 at various concentrations ( 0 , 100 , 200 , and 400 μm ) for analysing the presence of free radicals by chemiluminescence detector . additionally , 20 μl of hyaluronan was provided at the presence of 200 μm h 2 o 2 . the content of free radical was measured as described above . results were showed in fig3 a . the level of free radical was increased as the increasing concentrations of h 2 o 2 . however , the production of free radical was inhibited at the presence of hyaluronan ( with 200 μm h 2 o 2 ), which was almost at the same level in the h 2 o 2 - untreated group ( i . e ., the group at the presence of 0 μm h 2 o 2 ). for knowing that the increased contents of free radical will cause cell death , we also investigated effects of hyaluronan on the mortality caused by free radicals . the cartilage tissue was collected from a patient older than 60 years old . the primary chondrocytes were isolated and cultured in appropriate medium and conditions described as follow . the collected cartilage tissue was weighed in a centrifuge tube , and then washed with 10 ml pbs twice . the washed cartilage tissue was transferred onto a 10 cm cell culture dish by a blunt forceps and washed with 10 ml pbs once again . the soft tissue and bone tissue attaching to the cartilage were excised with a scalpel . the separated white cartilage tissue was transferred onto a 10 cm cell culture dish , and then divided into pieces having volume less than 1 mm 3 by using a scalpel . to the cell culture dish containing cartilage pieces 60 μl of typr ii cellulose ( 100mg / ml ) was added , and then shaken on a shaker ( 50 rpm ) at 37 ° c ., 5 % co 2 for 4 hr . the digested cartilage tissue was washed with 5 ml of culture medium . the separated cells were transferred into a sterile 15 ml centrifuge tube , and washed with 10 ml pbs twice . the cells were resuspended in 10 ml of culture medium . 50 μl of the cell culture was sampled for counting viable chondrocytes . 40 μl pbs and 10 μl of 10 × trypan blue were added to the sampled cell culture , mixed thoroughly and 10 μl of the mixture was dropped into hemocytometer . the cell density was calculated as follow : total counted cell no in 9 lattices x 2 × 10 4 / 9 = cell no ./ ml . chondrocytes were inoculated into a flask at the density of 1 × 10 4 / ml , and cultured at 37 ° c ., 5 % co 2 , with changing fresh medium every three days . for the displacement of fresh medium , the culture medium was drawn off by a disposable pipette , and 10 ml pbs was carefully added along the wall of flask . after shaking the culture flask gently , pbs was drawn off and 12 ml of fresh medium was added , and then the culture flask was incubated at 37 ° c ., 5 % co 2 . for the in vivo test , various concentrations ( 0 , 100 , 200 , and 400 μm ) of h 2 o 2 were added to the cell culture respectively , with the two additional groups added 0 and 200 μm h 2 o 2 each plus 20 μl of hyaluronan . the chondrocytes were cultured for one day under the h 2 o 2 treatment , and then collected for detecting their viability . as shown in fig3 b , the viability of chondrocyte was decreased with the increasing concentrations of h 2 o 2 . on the contrary , however , the viability of chondrocyte was increased at the presence of hyaluronan . accordingly , it is suggested that hyaluronan possesses the ability to inhibit the production of free radicals , decrease the mortality of chondrocytes , and further improve the proliferation of chondrocytes . this experiment is provided to evaluate the effects of hyaluronan on the growth of chondrocytes in old patient &# 39 ; s joint . the chondrocytes from old patient were isolated and cultured as described in example 2 . chondrocytes were cultured to 80 % confluence and plated in 60 mm dish ( each contained about 8 × 10 4 cells ), then further cultured over night . the culture medium was replaced with fresh medium containing 1 mg / ml hyaluronan ( ha group ) or fresh medium only ( control group ), and the cultivation was continued till 12 days , with a replacement of culture medium ( with or without hyaluronan ) at day 5 . the initial cell number was counted at day 0 , and taken a count every 2 days . the growth curves of cultured cells were shown in fig4 . in day 2 to day 4 , the cell number of chondrocytes grew at the presence of hyaluronan ( ha group ) was significantly greater than control group of about 1 . 7 - fold . the cell number in ha group was greater than control group of above twofold at day 6 . hyaluronan promoted the growth of chondrocytes by controlling their cell cycle the chondrocytes from old patient were isolated and cultured as described in example 2 . chondrocytes were cultured to 80 % confluence and plated in 100 mm dish ( each contained about 3 × 10 5 cells ). the culture medium was replaced with medium containing 1 mg / ml hyaluronan ( ha group ) or fresh medium ( control group ) on next day , and the cultivation was continued till 8 days . cell sampling was begun at day 0 and kept at intervals of 2 days . the harvested cells were treated as described below for the analysis of cell cycle by a flow cytometery . the cultured chondrocytes were washed with pbs , trypsinized and suspended in 5 ml of culture medium containing 5 % fetal calf serum ( fcs ). the cells were washed with 5 ml cold pbs , and then fixed in 1 ml of 70 % alcohol at − 20 ° c . for more than 1 hr . the fixed cells were washed with 5 ml pbs and spun at low speed ( 1200 rpm / min ), then stained with 1 ml of propidium iodide ( pi )/ triton x - 100 solution ( which containg 0 . 1 % triton x - 100 , 0 . 2 mg / ml rnase a , and 20 μg / ml pi at final concentration , respectively ) at room temperature in the dark for 30 min . the sample was mixed throughly and filtered through 35 - μm nylon membrane before run on the flow cytometery ( fl2 - a ) for detecting the fluorescence expressed on cells . the results were shown in fig5 . referring to the detection of g0 / g1 phase in cell cycle ( fig5 a ), the % of cells in g0 / g1 phase in the control group was higher than those in ha group at day 4 , otherwise , there is no significant difference between those two groups . by the results in s phase detection ( fig5 b ), there is no statistical difference between ha and control groups from day 0 to day 8 . on the other hand , it was found that the % of cells in g2 / m phase in the ha group was much higher than those in control group at day 4 , but showed no difference after day 6 ( see , fig5 c ). hyaluronan promoted the growth of chondrocyte by up - regulating the expression of cyclin b1 ( g2 / m ) for further understanding the mechanism of hyaluronan action in modulating the cell cycle of chondrocyte , we investigated the expression of various cell cycle regulating factors at the prescence of hyaluronan ( 1 mg / ml ). the chondrocytes cultured and treated as described in example 2 were harvested at day 2 , 4 , 6 , and 8 and prepared for western blotting as follow . the harvested cells were washed with 1 × pbs three times , and ripa buffer ( containing 50 mm tris ( ph7 . 5 ), 150 mm nacl , 1 % np40 , 0 . 1 % sds , 0 . 5 % sodium deoxycholic acid , and proteinase inhibitor ) was added to lyse cell and release proteins . the cell lysate was collected in an eppendorf tube and spun at 12 , 000 rpm , at 4 ° c . for 30 min . the quantified supernatant containing 20 μg protein was mixed with sampling buffer ( with glycerin ) at the rate of 1 : 4 , and boiled in 100 ° c . water bath for 5 min . the prepared protein sample was loaded on sds - polyacrylamide gel for electrophoresis , and then transferred onto a nylon paper . the nylon paper was blocked with 5 % skimed milk in tris buffer at room temperature for 1 hr . the nylon paper was washed with tris buffer three times , each for 5 min . the primary antibody was added and the mixture was shaked at room temperature for 1 hr or at 4 ° c . over night . the nylon paper was washed with tris buffer five times , each for 5 min . the secondary antibody was added and the mixture was shaked at room temperature for 40 min . the nylon paper was washed with tris buffer as described above . the chemiluminescence detecting kit ( ecl kit ) was added and reacted at room temperature for 1 min , and then developed in dark room . as shown in fig6 , the expression of g0 / g1 phase regulating proteins , such as cyclin d1 , cdk4 , and cdk6 , exhibited no difference between the control and ha groups . however , the g2 / m phase regulating protein , cyclin b1 , exhibited higher expression level in ha - treated cells than those in control group . furthermore , the expression of cyclin b13 - associated protein cdc2 was unchanged . the present invention has been illustrated by the embodiments and examples described above . the skilled in the art will appreciate that any modification or change can be made as if not depart from the spirit and scope of the invention . the present invention was encompassed in the appended claims .	0
the smpte control time code for a single frame and part of two adjacent frames is shown in fig1 to which reference is now made . for each frame the control time code comprises 80 binary bits . bits 0 to 63 provide the time and frame codes as well as spare bits for use by the user if desired . bits 64 to 79 comprise a sync word . the control time code is conventionally recorded in a linear track as a phase - modulated serial code , usually referred to as a biphase mark . the control time code is selfcontained and self - clocking and is immune to 180 ° phase reversals . since it is a square wave , it can be recorded using a saturated or unsaturated recording method . each sync word is the same as shown at the bottom of fig1 . the 16 - bit pattern of the sync word is unique , in the sense that it cannot occur elsewhere in the control time code , and it provides both an indication of the direction in which the video tape is being transported , that is , in the forward or reverse direction of transport ( marked f and r in fig1 ), and also identifies the beginning and / or ending of the set of 80 bits corresponding to a frame , so that the 64 bits providing the time and frame codes can be extracted for processing . the 64 bits providing the time and frame codes include , as shown from right to left in fig1 bits for tens of hours , 4 bits for units of hours , 4 bits for tens of minutes , 4 bits for units of minutes , 4 bits for tens of seconds , 4 bits for units of seconds , 4 bits for tens of frames and 4 bits for units of frames . each of these groups of 4 bits is preceded by a respective group of 4 bits which the user can use for his own purposes if desired . in the example shown , the binary digits indicated show that the particular frame is identified by a time code of 23 hours , 59 minutes , 59 seconds and is frame number 29 within that second . although there are further refinements to the smpte control time code , since they are not material to the present invention , they are omitted . full details can be found in the journal of the smpte vol . 79 , dec . 1970 , pp . 1086 to 1088 . the ebu control time code is very similar to the smpte control time code , the differences in form and content between them are not significant to the present invention , except as concerns frame frequency . the smpte control time code is normally used for video signals with a frame frequency of 30 frames per second and the ebu control time code is normally used for video signals with a frame frequency of 25 frames per second . when using a vtr , each frame , or alternatively each field of a video signal is recorded in a respective track of a video magnetic tape , the tracks being disposed obliquely relative to the direction of transport of the video tape , and in recording and reproduction a rotary magnetic head arrangement scans the video tape . during reproduction , the scanning is under the control of a control signal which is derived from a control signal track running lengthwise along the edge of the video tape . the video tape also carries at least a number 1 and a number 2 or cue audio tracks , also running lengthwise along the video tape . the control time code may be recorded in the number 2 audio track or in the oblique tracks during the vertical blanking intervals of the video signal . the present invention derives the control time code from the video tape , determines the direction of tape transport from the sync word , and extracts the 64 bits providing the time and frame codes . the embodiments of the invention make use of the fact that the control time code for recorded video signals in which the frame frequency is 30 frames per second contains frame numbers which do not occur with recorded signals in which the frame frequency is 25 frames per second . in the following description it is assumed that , when there are 30 frames per second , the 30 frames in a second are numbered 00 to 29 , and when there are 25 frames per second , the 25 frames are numbered 00 to 24 , as is the usual practice . where the frame frequency is 30 frames per second , therefore , there exist frame numbers 25 , 26 , 27 , 28 and 29 which do not exist when the frame frequency is 25 frames per second . it will be clear to those skilled in the art how the present invention may be modified if the frames are numbered 1 to 30 and 1 to 25 . detection based on the frame numbers can be done independently of the direction of tape transport and of the speed of tape transport , and no modification of the control time code is required to enable the frame frequency to be detected . the first embodiment of the invention is described with reference to fig2 . the control time code derived from a video tape ( not shown ) may be supplied to an input terminal 1 connected to a code reader 2 , or alternatively , code reader 2 may extract the control time code from a reproduced signal derived from the video tape and supplied to input terminal 1 . code reader 2 detects the direction of tape transport from the sync word , and in dependence thereon supplies a signal pd which is high or &# 34 ; 1 &# 34 ; for tape transport in the forward direction and low or &# 34 ; 0 &# 34 ; for tape transport in the reverse direction . signal pd is supplied to one input of each of and gates 10 and 11 , and via respective inverters 24 and 25 to one input of each of and gates 9 and 12 . the signal pd may be used by indicating apparatus ( not shown ) to provide a visual indication of the tape transport direction . code reader 2 also develops a clock pulse signal cp1 synchronized to the frame frequency of the control time code , and supplies clock signal cp1 to a memory 3 , a delay 15 , and one input of an and gate 16 . code reader 2 also extracts the 64 bits providing the time and frame codes and supplies them to memory 3 for storage therein . an output 4 is optionally connected from memory 3 , for supplying the time and frame codes to a display 22 or a television picture monitor 23 . display 22 , or the monitor 23 , if provided , may incorporate decoding means to decode the time and frame codes and to provide a visual display of the time and frame number either alone or in association with a television picture , respectively . memory 3 also derives a frame code signal sf , suitably of 8 bits , comprising 4 bits for the tens of frames and 4 bits for the units of frames , which is supplied to respective frame code detectors 5 , 6 , 7 and 8 . frame code detector 5 supplies an output signal s00 which is &# 34 ; 1 &# 34 ; when the frame code signal sf represents frame 00 , and is &# 34 ; 0 &# 34 ; at all other times . likewise , frame code detectors 6 , 7 and 8 respectively supply output signals s24 , s35 and s29 which are &# 34 ; 1 &# 34 ; when frame code signal sf represents frames 24 , 25 and 29 respectively , and are &# 34 ; 0 &# 34 ; at all other times . the outputs of frame code detectors 5 , 6 , 7 and 8 are supplied to second inputs of and gates 9 , 10 , 11 and 12 , respectively . the outputs of and gates 9 and 10 are connected to two inputs respectively of an or gate 13 . the two outputs of and gates 11 and 12 are connected to two inputs of an or gate 14 . the output of or gate 13 is connected by way of delay 15 to the other input of and gate 16 . the output of and gate 16 supplies a gated clock pulse signal cp2 which is applied to the clock input ck of a jk flip - flop 17 . the output of or gate 14 is connected directly to the j input of flip - flop 17 , and by way of an inverter 26 to the k input flip - flop 17 . an output signal is derived at an output terminal 18 connected to the q output of flip - flop 17 . for reasons which will be explained below this output signal is &# 34 ; 1 &# 34 ; when the input control time code corresponds to a frame frequency of 30 frames per second and is &# 34 ; 0 &# 34 ; when the input control time code corresponds to a frame frequency of 25 frames per second . this output signal can therefore be used to provide an indication and / or effect a control , for example in a dual - standard vtr . in particular , in a dual - standard vtr , the output signal can be used to ensure reproduction of a recorded video signal at the appropriate frame frequency , and on the assumption that a recorded signal with a frame frequency of 30 frames per second is an ntsc system signal , and a recorded signal with a frame frequency of 25 frames per second is a ccir system signal , can condition the vtr to effect appropriate decoding . the way in which the embodiment of fig2 derives the appropriate output signal will now be explained with reference to fig3 a to 3f which show waveforms of signals produced when the control time code supplied to input terminal 1 is an smpte control time code associated with a video signal having a frame frequency of 30 frames per second reproduced from a video tape running in the forward tape transport direction . clock signal cp1 ( fig3 a ), derived by code reader 2 , comprises short pulses with a repetition frequency synchronized with the frame frequency of the control time code . the precise value of this frequency varies depending on the speed at which the video tape is being transported . since the tape transport direction is forward , signal pd enables and gates 10 and 11 , but signal pd , inverted in inverters 24 and 25 inhibits , or makes nonconductive , and gates 9 and 12 . when the frame code for frame 24 is supplied to frame code detector 6 , the output signal s24 thereof changes from &# 34 ; 0 &# 34 ; to &# 34 ; 1 &# 34 ; ( fig3 b ). the resulting pulse passes and gate 10 and , after being delayed by one frame period by delay 15 , is supplied to and gate 16 . this delayed pulse , ( fig3 c ) acts as a gating pulse for clock signal cp1 at and gate 16 , to allow one short pulse from clock signal cp1 to pass in order to form the gated clock pulse signal cp2 ( fig3 d ). when the frame code for frame 25 is supplied to frame code detector 7 , the output signal s25 thereof changes from &# 34 ; 0 &# 34 ; to &# 34 ; 1 &# 34 ; ( fig3 e ), and the resulting pulse passes and gate 11 and or gate 14 , to be applied to the j and k inputs of flip - flop 17 directly and after inversion respectively . in coincidence with this , the short gated clock pulse cp2 is supplied to flip - flop 17 . as is conventional , when a clock signal is applied to the clock input ck of jk flip - flop 17 , its set output q is forced to agree with the signal at its j input . thus , a &# 34 ; 1 &# 34 ; output signal is developed at the q output of flip - flop 17 ( fig3 f ). if the q output of flip - flop 17 was originally &# 34 ; 1 &# 34 ;, it remains &# 34 ; 1 &# 34 ;. this condition indicates 30 frames per second . reference is now made to fig4 a to 4f , which show waveforms developed when the control time code supplied to the input terminal 1 is an ebu control time code associated with a video signal having a frame frequency of 25 frames per second and which are reproduced from a video tape operating in the forward tape transport direction . the signals cp1 , s24 , s24 delayed one frame period and gated clock pulse signal cp2 ( fig4 a , 4b , 4c , and 4d ) are similar to those described above with reference to fig3 a to 3d . it will , however , be noticed that in this case the delayed pulse ( fig4 c ) coincides with the first frame period , that is the frame 00 , in the next second . moreover , since no frame numbered 25 exists in this code , no frame code for a frame 25 is supplied to frame code detector 7 . therefore , the output signal s25 of frame code detector 7 remains &# 34 ; 0 &# 34 ; ( fig4 e ). the short gated clock pulse signal cp2 is therefore supplied to the clock input ck of flip - flop 17 while a &# 34 ; 0 &# 34 ; is supplied to its j input . the output signal at the q output of flip - flop 17 becomes &# 34 ; 0 &# 34 ; ( fig4 f ), or , alternatively , if the q output of flip - flop 17 was already &# 34 ; 0 &# 34 ;, it remains &# 34 ; 0 &# 34 ;. this condition indicates 25 frames per second . although is no reason to believe that the embodiment in fig2 should fail to provide the correct output at output terminal 18 at the first transition from one second to the next , if such a failure should occur ; as the operation described above is repeated every second . thus , any failure to provide the correct output as the first transition is very quickly rectified . it will also be noticed that once flip - flop 17 is in the appropriate condition , no further switching of flip - flop 17 occurs . the output signal an output terminal 18 thus remains steady at &# 34 ; 1 &# 34 ; or &# 34 ; o &# 34 ; as appropriate . the following paragraphs describe the operation when the video tape is transported in the reverse tape transport direction . fig5 a to 5f show waveforms developed when the control time code supplied to the input terminal 1 is an smpte control time code associated with a video signal having a frame frequency at 30 frames per second , derived from a reverse direction of tape transport . since the tape transport direction is reversed signal pd enables and gates 9 and 12 , but not and gates 10 and 11 . when the frame code for frame 00 is supplied to frame code detector 5 , the output signal s00 thereof changes from &# 34 ; 0 &# 34 ; to &# 34 ; 1 &# 34 ; ( fig5 b ). the resulting pulse passes and gate 9 and , after being delayed one frame period by delay 15 , is supplied to and gate 16 . this delayed pulse ( fig5 c ) acts as a gating pulse for clock signal cp1 at and gate 16 to allow one short gated clock pulse cp2 to pass and gate 16 ( fig5 d ). when the frame code for frame 29 is supplied to frame code detector 8 , the output signal s29 thereof changes from &# 34 ; 0 &# 34 ; to &# 34 ; 1 &# 34 ; ( fig5 e ), and the resulting pulse passes and gate 12 and or gate 14 , to be applied to the j and k inputs of flip - flop 18 directly and after inversion respectively . in coincidence with this , the short gated clock pulse cp2 is supplied to flip - flop 17 . the output signal developed at the q output of the flip - flop 17 becomes &# 34 ; 1 &# 34 ; ( fig4 f ), or alternatively , if it is already &# 34 ; 1 &# 34 ;, it remains &# 34 ; 1 &# 34 ;. this signal applied to output terminal 18 indicates 30 frames per second , just as in the case when the tape transport direction was forward . fig6 a to 6g show waveforms developed when the control time code supplied to the input terminal 1 is an ebu control time code associated with a video signal having a frame frequency of 25 frames per second , derived from tape transport in the reverse direction . the signals cp1 , s00 , s00 delayed one frame period and cp2 , the waveforms of which are shown in fig6 a , 6b , 6c and 6d are generally similar to those described above with reference to fig5 a to 5d . it will , however , be noticed that the delayed pulse shown in fig6 c which originated in the first frame period 00 , is applied to and gate 16 during frame 24 of the adjacent second because of the reverse direction of tape transport . moreover , since there is no frame 29 in the ebu time code , no frame code for a frame 29 is supplied to frame code detector 8 , and there is therefore no pulse produced in output signal s29 ( fig6 e ). the short gated clock pulse signal cp2 is therefore supplied to the clock input ck of jk flip - flop 17 while a &# 34 ; 0 &# 34 ; exists at its j input . the output at the q output of flip - flop 17 therefore becomes &# 34 ; 0 &# 34 ; ( fig6 f ), or , alternatively , if already &# 34 ; 0 &# 34 ;, it remains &# 34 ; 0 &# 34 ;. this condition indicates 25 frames per second , just as in the case where the tape transport direction was forward . although the embodiment of fig2 includes memory 3 , this is merely a convenient means of storing the control time code and extracting the required parts from it . such extraction can be carried out without a memory 3 to store the control time code . also , delay 15 may provide a delay of more than one frame period , without departing from the scope of the invention . conforming modifications of a type which would be clear to one skilled in the art must be made to the embodiment to accommodate these differences . a second embodiment of the invention is described with reference to fig7 which illustrates only those parts of the embodiment necessary to describe how it differs from the first embodiment shown in fig2 . the second embodiment omits frame code detectors 7 and 8 of the first embodiment for detecting frames 25 and 29 . and gates 19 and 20 are provided with input signals s00 and s24 from frame code detectors 5 and 6 respectively . signal pd is supplied directly to one input of and gate 19 , and by way of an inverter 26 to one input of and gate 20 . the outputs of and gates 19 and 20 are respectively connected to two inputs of an or gate 21 , the output of which is connected to the j and k inputs of flip - flop 17 directly and by way of inverter 21 , respectively . the operation of the second embodiment is very similar to that of the first embodiment , and will therefore only be described briefly . when the control time code supplied to input terminal 1 is an smpte control time code corresponding to a frame frequency of 30 frames per second , signals are developed as shown in fig3 a to 3d . in particular the short gated clock pulse signal cp2 is supplied to flip - flop 17 . however , following frame 24 there is no &# 34 ; 1 &# 34 ; in signal s24 from frame code detector 6 ( fig3 b ). there is thus no output from or gate 21 . the output signal developed at the q output of flip - flop 17 becomes or remains &# 34 ; 0 &# 34 ; indicating 30 frames per second . when the control time code supplied to input terminal 1 is an ebu control time code corresponding to a frame frequency of 24 frames per second , signals will be developed as shown in fig4 a to 4d . the short gated clock signal cp2 is supplied to flip - flop 17 during frame 24 . signal singal s00 from the frame code detector 5 is &# 34 ; 1 &# 34 ; at this time , a &# 34 ; 1 &# 34 ; is applied from or gate 21 to the j input of flip - flop 17 . the output signal at the q output of flip - flop 17 becomes or remains &# 34 ; 1 &# 34 ; indicating 25 frames per second . generally similar operations occur when the tape transport direction is reversed , waveforms corresponding to fig5 a to 5d and 6a to 6d , respectively , being developed in response to smpte and ebu control time codes . again the output signal developed at the q output of the flip - flop 17 is , in this embodiment , &# 34 ; 0 &# 34 ; indicating 30 frames per second , or &# 34 ; 1 &# 34 ; indicating 25 frames per second . having described specific preferred embodiments of the invention with reference to the accompanying drawings , it is to be understood that the invention is not limited to these precise embodiments , and that various changes and modifications can be effected therein by one skilled in the art without departing from the scope and spirit of the invention as defined by the appended claims .	6
embodiments of the present invention provide for a method and system for automatically rerouting data from an overbalanced logical circuit in a data network . when an overbalanced condition in a logical circuit is detected , the data in the overbalanced circuit may be rerouted to a “ logical failover network ,” thereby minimizing lost data until the overbalanced condition in the logical circuit is cleared . in the following detailed description , references are made to the accompanying drawings that form a part hereof , and in which are shown by way of illustration specific embodiments or examples . referring now to the drawings , in which like numerals represent like elements through the several figures , aspects of the present invention and the exemplary operating environment will be described . embodiments of the present invention may be generally employed in a data network 2 as shown in fig1 . the data network 2 includes local access and transport areas (“ latas ”) 5 and 15 which are connected by an inter - exchange carrier (“ iec ”) 10 . it should be understood that the latas 5 and 15 may be data networks operated by a commonly owned local exchange carrier (“ lec ”). it should be further understood that the iec 10 may include one or more data networks which may be operated by a commonly owned iec . it will be appreciated by those skilled in the art that the data network 2 may be a frame relay network , asynchronous transfer mode (“ atm ”) network , or any other network capable of communicating data conforming to layers 2 - 4 of the open systems interconnection (“ osi ”) model developed by the international standards organization , incorporated herein by reference . it will be appreciated that these networks may include , but are not limited to , communications protocols conforming to the multiprotocol label switching standard (“ mpls ”) networks and the transmission control protocol / internet protocol (“ tcp / ip ”), which are known to those skilled in the art . the data network 2 includes a network circuit which channels data between a host device 112 and a remote device 114 through the lata 5 , the iec 10 , and the lata 15 . it will be appreciated by those skilled in the art that the host and remote devices 112 and 114 may be local area network (“ lan ”) routers , lan bridges , hosts , front end processors , frame relay access devices (“ frads ”), or any other device with a frame relay , atm , or network interface . it will be further appreciated that in the data network 2 , the latas 5 and 15 and the iec 10 may include network elements ( not shown ) which support interworking to enable communications between host and remote devices supporting dissimilar protocols . network elements in a data network supporting interworking may translate frame relay data packets or frames sent from a host frad to atm data packets or cells so that a host device may communicate with a remote device having an atm interface . the latas 5 and 15 and the iec 10 may further include one or more interconnected network elements , such as switches ( not shown ), for transmitting data . an illustrative lec data network will be discussed in greater detail in the description of fig2 below . the network circuit between the host device 112 and the remote device 114 in the data network 2 includes a physical circuit and a logical circuit . as used in the foregoing description and the appended claims , a physical circuit is defined as the physical path that connects the end point of a network circuit to a network device . for example , the physical circuit of the network circuit between the host device 112 and the remote device 114 includes the physical connection 121 between the host device 112 and the lata 5 , the physical connection 106 between the lata 5 and the iec 10 , the physical connection 108 between the iec 10 and the lata 15 , and the physical connection 123 between the lata 15 and the remote device 114 . routers and switches within the latas 5 and 15 and the iec 10 carry the physical signal between the host and remote end devices 112 and 114 through the physical circuit . it should be understood that the host and remote devices may be connected to the physical circuit described above using user - to - network interfaces (“ unis ”). as is known to those skilled in the art , an uni is the physical demarcation point between a user device ( e . g ., a host device ) and a public data network . it will further be understood by those skilled in the art that the physical connections 106 and 108 may include trunk circuits for carrying the data between the latas 5 and 15 and the iec 10 . it will be further understood by those skilled in the art that the connections 121 and 123 may be any of various physical communications media for communicating data such as a 56 kbps line or a t1 line carried over a four - wire shielded cable or over a fiber optic cable . as used in the foregoing description and the appended claims , a logical circuit is defined as a portion of the network circuit wherein data is sent over variable communication data paths or logical connections established between the first and last network devices within a lata or iec network and over fixed communication data paths or logical connections between latas ( or between iecs ). thus , no matter what path the data takes within each lata or iec , the beginning and end of each logical connection between networks will not change . for example , the logical circuit of the network circuit in the data network 2 may include a variable communication path within the lata 5 and a fixed communication path ( i . e ., the logical connection 102 ) between the lata 5 and the iec 10 . it will be understood by those skilled in the art that the logical connections 102 and 104 in the data network 2 may include network - to - network interfaces (“ nnis ”) between the last sending switch in a lata and the first receiving switch in an iec . as is known to those skilled in the art , each logical circuit in a data network may be identified by a unique logical identifier . in frame relay networks , the logical identifier is called a data link connection identifier (“ dlci ”) while in atm networks the logical identifier is called a virtual path identifier / virtual circuit identifier (“ vpi / vci ”). in frame relay networks , the dlci is a 10 - bit address field contained in the header of each data frame and contains identifying information for the logical circuit as well as information relating to the destination of the data in the frame and service parameters for handling network congestion . for example , in the data network 2 implemented as a frame relay network , the designation dlci 100 may be used to identify the logical circuit between the host device 112 and the remote device 114 . it will be appreciated that in data networks in which logical circuit data is communicated through more than one carrier ( e . g ., an lec and an iec ) the dlci designation for the logical circuit may change in a specific carrier &# 39 ; s network . for example , in the data network 2 , the designation dlci 100 may identify the logical circuit in the lata 5 and lata 15 but the designation dlci 800 may identify the logical circuit in the iec 10 . illustrative service parameters which may be included in the dlci include a committed information rate (“ cir ”) parameter and a committed burst size (“ bc ”) parameter . as is known to those skilled in the art , the cir represents the average capacity of the logical circuit and the bc represents the maximum amount of data that may be transmitted . it will be appreciated that the logical circuit may be provisioned such that when the cir or the bc is exceeded , the receiving switch in the data network will discard the frame . it should be understood that the logical circuit parameters are not limited to cir and bc and that other parameters known to those skilled in the art may also be provisioned , including , but not limited to , burst excess size (“ be ”) and committed rate measurement interval (“ tc ”). in atm networks , the vpi / vci is an address field contained in the header of each atm data cell and contains identifying information for the logical circuit as well as information specifying a data cell &# 39 ; s destination and specific bits which may indicate , for example , the existence of congestion in the network and a threshold for discarding cells . it should be understood that the logical circuit in the data network 2 may be a permanent virtual circuit (“ pvc ”) available to the network at all times or a temporary or a switched virtual circuit (“ svc ”) available to the network only as long as data is being transmitted . it should be understood that the data network 2 may further include additional switches or other interconnected network elements ( not shown ) creating multiple paths within each lata and iec for defining each pvc or svc in the data network . it will be appreciated that the data communicated over the logical connections 102 and 104 may be physically carried by the physical connections 106 and 108 . the data network 2 may also include a failover network 17 for rerouting logical circuit data , according to an embodiment of the invention . the failover network 17 may include a network failover circuit including physical connections 134 and 144 and logical connections 122 and 132 for rerouting logical circuit data in the event of a failure in the network circuit between the host device 112 and the remote device 114 . the failover network 17 will be described in greater detail in the description of fig4 below . the data network 2 may also include a network management system 175 in communication with the lata 5 , the lata 15 , and the failover network 17 . the network management system 175 may be utilized to obtain status information for the logical and physical circuit between the host device 112 and the remote device 114 . the network management system 175 may also be utilized for rerouting logical data in the data network 2 between the host device 112 and the remote device 114 . the network management system 175 will be discussed in greater detail in the description of fig3 below . fig2 illustrates the lata 5 in the data network 2 described in fig1 above , according to an embodiment of the present invention . as shown in fig2 , the lata 5 includes interconnected network devices such as switches 186 , 187 , and 188 . it will be appreciated that the data network 2 may also contain other interconnected network devices and elements ( not shown ) such as digital access and cross connect switches (“ dacs ”), channel service units (“ csus ”), and data service units (“ dsus ”). as discussed above in the description of fig1 , the connection data paths of a logical circuit within a data network may vary between the first and last network devices in a data network . for example , as shown in fig2 , the logical circuit in the lata 5 may include the communication path 185 between the switches 186 and 188 or the communication path 184 between the switches 186 , 187 , and 188 . as discussed above , it should be understood that the actual path taken by data through the lata 5 is not fixed and may vary from time to time , such as when automatic rerouting takes place . it will be appreciated that the switches 186 , 187 , and 188 may include a signaling mechanism for monitoring and signaling the status of the logical circuit in the data network 2 . each time a change in the status of the logical circuit is detected ( e . g ., a receiving switch begins dropping frames ), the switch generates an alarm or “ trap ” which may then be communicated to a management station , such as a logical element module ( described in detail in the description of fig3 below ), in the network management system 175 . the trap may include , for example , status information indicating network congestion . the status information may include forward and backward explicit congestion notifications (“ fecns ” and “ becns ”). as is known to those skilled in the art , a fecn is a frame relay message that notifies a receiving switch that there is congestion in the network . a fecn bit is sent in the same direction in which the frame was traveling , toward its destination . a becn is a frame relay message that notifies a sending switch that there is congestion in the network . a becn bit is sent in the opposite direction in which the frame is traveling , toward its transmission source . in one embodiment , the signaling mechanism may be in accord with a local management interface (“ lmi ”) specification , which provides for the sending and receiving of “ status inquiries ” between a data network and a host or remote device . the lmi specification includes obtaining status information through the use of special management frames ( in frame relay networks ) or cells ( in atm networks ). in frame relay networks , for example , the special management frames monitor the status of logical connections and provide information regarding the health of the network . in the data network 2 , the host and remote devices 112 and 114 receive status information from the switches in the individual latas they are connected to in response to a status request sent in a special management frame or cell . the lmi status information may include , for example , whether or not the logical circuit is congested or whether or not the logical circuit has failed . it should be understood that the parameters and the signaling mechanism discussed above are optional and that other parameters and mechanisms may also be utilized to obtain connection status information for a logical circuit . fig3 illustrates the network management system 175 which may be utilized to automatically reroute logical circuit data from a failed logical circuit in the data network of fig1 , according to an embodiment of the invention . the network management system 175 includes a service order system 160 , a network database 170 , a logical element module 153 , a physical element module 155 , a network management module 176 , and a test module 180 . the service order system 160 is utilized in the data network 2 for receiving service orders for provisioning network circuits . the service order includes information defining the transmission characteristics ( i . e ., the logical circuit ) of the network circuit . the service order also contains the access speed , cir , burst rates , and excess burst rates . the service order system 160 communicates the service order information to a network database 170 over management trunk 172 . the network database 170 assigns and stores the parameters for the physical circuit portion of the network circuit such as a port number on the switch 186 for transmitting data over the physical connection 121 to and from the host device 112 . the network database 170 may also be in communication with an operations support system ( not shown ) for assigning physical equipment to the network circuit and for maintaining an inventory of the physical assignments for the network circuit . an illustrative operations support system is “ tirks ”® ( trunks integrated records keeping system ) marketed by telecordia ™ technologies , inc . of morristown , n . j . the network database 170 may also be in communication with a work force administration and control system (“ wfa / c ”) ( not shown ) used to assign resources ( i . e ., technicians ) to work on installing the physical circuit . the network management system 175 also includes the logical element module 153 which is in communication with the switches in the data network 2 through management trunks 183 . the logical element module 153 runs a network management application program to monitor the operation of logical circuits which includes receiving trap data generated by the switches which indicate the status of logical connections . the trap data may be stored in the logical element module 153 for later analysis and review . the logical element module 153 is also in communication with the network database 170 via management trunks 172 for accessing information regarding logical circuits such as the logical identifier data . the logical identifier data may include , for example , the dlci or vpi / vci header information for each data frame or cell in the logical circuit including the circuit &# 39 ; s destination and service parameters . the logical element module 153 may consist of terminals ( not shown ) that display a map - based graphical user interface (“ gui ”) of the logical connections in the data network . an illustrative logical element module is the naviscore ™ system marketed by lucent technologies , inc . of murray hill , n . j . the network management system 175 further includes the physical element module 155 in communication with the physical connections of the network circuit via management trunks ( not shown ). the physical element module 155 runs a network management application program to monitor the operation and retrieve data regarding the operation of the physical circuit . the physical element module 155 is also in communication with the network database 170 via management trunks 172 for accessing information regarding physical circuits , such as line speed . similar to the logical element module 153 , the physical logical element module 155 may also consist of terminals ( not shown ) that display a map - based gui of the physical connections in the lata 5 . an illustrative physical element module is the integrated testing and analysis system (“ intas ”), marketed by telecordia ™ technologies , inc . of morristown , n . j ., which provides flow - through testing and analysis of telephony services . the physical element module 155 troubleshoots the physical connections for a physical circuit by communicating with test module 180 , which interfaces with the physical connections via test access point 156 . the test module 180 obtains the status of the physical circuit by transmitting “ clean ” test signals to test access point 156 ( shown in fig2 ) which “ loops back ” the signals for detection by the test module 180 . it should be understood that there may be multiple test access points on each of the physical connections for the physical circuit . the network management system 175 further includes the network management module 176 which is in communication with the service order system 160 , the network database 170 , the logical element module 153 , and the physical element module 155 through communications channels 172 . it should be understood that in one embodiment , the network management system 175 may also be in communication with the lata 15 , the iec 10 , and the failover network 17 . the communications channels 172 may be on a lan . the network management module 176 may consist of terminals ( not shown ), which may be part of a general - purpose computer system that displays a map - based gui of the logical connections in data networks . the network management module 176 may communicate with the logical element module 153 and the physical element module 155 using a common object request broker architecture (“ corba ”). as is known to those skilled in the art , corba is an open , vendor - independent architecture and infrastructure which allows different computer applications to work together over one or more networks using a basic set of commands and responses . the network management module 176 may also serve as an interface for implementing logical operations to provision and maintain network circuits . the logical operations may be implemented as machine instructions stored locally or as instructions retrieved from the logical and physical element modules 153 and 155 . an illustrative method detailing the provisioning and maintenance of network circuits in a data network is presented in u . s . patent application ser . no . 10 / 348 , 592 , entitled “ method and system for provisioning and maintaining a circuit in a data network ,” filed on jan . 23 , 2003 , and assigned to the same assignee as this application , which is expressly incorporated herein by reference . an illustrative network management module is the broadband network management system ® (“ bbnms ”) marketed by telecordia ™ technologies , inc . of morristown , n . j . fig4 illustrates an illustrative failover data network for rerouting logical circuit data , according to one embodiment of the present invention . as shown in fig4 , the failover network 17 includes an iec 20 , a lata 25 , and an iec 30 . the failover network further includes a network failover circuit which includes a physical failover circuit and a logical fail over circuit . the physical failover circuit includes the physical connection 134 between the lata 5 ( shown in fig1 ) and the iec 20 , the physical connection 136 between the iec 20 and the lata 25 , the physical connection 138 between the lata 25 and the iec 30 , and the physical connection 144 between the iec 30 and the lata 15 ( shown in fig1 ). similarly , the logical failover circuit may include the logical connection 122 between the lata 5 ( shown in fig1 ) and the iec 20 , the logical connection 124 between the iec 20 and the lata 25 , the logical connection 126 between the lata 25 and the iec 30 , and the logical connection 132 between the iec 30 and the lata 15 ( shown in fig1 ). it should be understood that in one embodiment , the network failover circuit illustrated in the failover network 17 may include a dedicated physical circuit and a dedicated logical circuit provisioned by a network service provider serving the latas 5 , 15 , and 25 and the iecs 20 and 30 , for rerouting logical data from a failed logical circuit . fig5 illustrates a flowchart describing logical operations 500 for automatically rerouting data from an overbalanced logical circuit in a data network , according to an embodiment of the invention . it will be appreciated that the logical operations 500 may be initiated when a customer report of a network circuit failure is received in the data network 2 . for example , a customer at the remote device 114 may determine that the remote device 114 is dropping frames or cells sent from the host device 112 ( e . g ., by reviewing lmi status information in the host device ). after receiving the customer report , the network service provider providing the network circuit may open a trouble ticket in the service order system 160 to troubleshoot the logical circuit . the logical operations 500 begin at operation 505 where the network management module 176 receives status information for a logical circuit in the data network 2 . it will be appreciated that in one embodiment , the status information may be received by communicating with the logical element module 153 to request trap data generated by one or more switches in the data network 2 which indicate the status of one or more logical connections making up the logical circuit . it will be appreciated that in one embodiment of the present invention , the communication of the status information for the logical circuit may be manually initiated by a technician from a terminal in the network management module 176 . in another embodiment of the present invention , the network management module 176 may be configured to automatically monitor the logical circuits for trap data to identify logical circuit congestion in the data network 2 . after receiving the status information for the logical circuit at operation 505 , the logical operations 500 continue at operation 510 where the network management module 176 determines whether the logical circuit is overbalanced ( i . e ., congested ) based on the received status information . it should be understood that a logical circuit is overbalanced when one or more logical connections in a logical circuit are overbalanced . as discussed above in the description of fig2 , trap data indicating an overbalanced logical connection may include fecns and becns from a sending switch and a receiving switch indicating dropped frames or cells in the data network 2 . these traps may be generated , for example , when the maximum cir or bc ( as specified in the dlci of a frame in a frame relay network , for example ) is exceeded . for example , in the data network 2 shown in fig1 , the “ x ” marking the logical connections 102 and 104 indicate that both connections are dropping frames or cells for the logical circuit in the lata data networks 5 and 15 . in this example , such a condition may indicate that a receiving switch in the iec 10 is sending a becn to a sending switch in the lata 5 over the logical connection 102 while a sending switch in the iec 10 is sending a fecn to a receiving switch in the lata 15 over the logical connection 104 . it will be appreciated that in this example , the logical circuit congestion lies in the iec data network 10 . if at operation 510 , it is determined that the logical circuit is not overbalanced , the logical operations 500 then return to operation 505 where the network management module 176 again receives status information for the logical circuit . if , however , at operation 510 it is determined that the logical circuit is overbalanced , the logical operations continue to operation 515 . at operation 515 , the network management module 176 identifies a logical failover circuit for rerouting the data from the logical circuit in the data network . for example , if as shown in fig1 , it is determined that the congestion in the overbalanced logical circuit in the data network 2 has been isolated to the iec data network 10 , a logical failover circuit in the failover network 17 may be automatically selected to reroute the logical data such that it bypasses the iec data network 10 . for example , the logical failover circuit may be selected including the logical connections 122 , 124 , 126 , and 132 ( as shown in fig4 ) to reroute the logical data from the host device 112 , through the lata 5 , the iec 20 , the lata 25 , the iec 30 , the lata 15 , and finally to the remote device 114 . it should be understood that the network management module 176 may select the logical failover circuit by identifying a logical connection or nni in the overbalanced logical circuit . information related to each logical connection in a logical circuit may be stored in the database 170 including the first and second ends of the logical circuit to which the logical connection belongs . once the ends of a logical circuit are determined by accessing the database 170 , the network management module 176 may select a logical failover circuit having a communication path including the first and second ends of the overbalanced logical circuit for rerouting data . it will be appreciated that in one embodiment , the logical failover circuit selected may be a dedicated circuit which is only utilized for rerouting logical data from the overbalanced logical circuit ( i . e ., the failover circuit does not normally communicate data traffic ). in another embodiment , the logical failover circuit may be an existing logical circuit which is normally utilized for communicating data traffic in the data network 2 . in this embodiment , the selection of the logical failover circuit may also include determining whether one or more logical connections in the logical circuit are currently communicating data traffic or are currently unused . if currently unused , the logical connections may be selected for rerouting logical data . for example , a technician at the logical element module 153 or the network management module 176 may utilize a map - based gui displaying the logical connections in the lata data networks 5 and 15 and their status . a dedicated logical failover circuit ( or a currently unused logical circuit with available logical connections ) may then be selected as a logical failover circuit for communicating logical data from a failed logical circuit . the logical operations 500 then continue from operation 515 to operation 520 . as discussed above , the logical circuits in a data network are identified by a logical circuit identifier ( id ). at operation 520 , the network management module 176 compares the identifier ( e . g ., the dlci or vpi / vci ) of the logical circuit to the identifier of the selected logical failover circuit . if at operation 520 , it is determined that the identifier &# 39 ; s of the failed logical circuit and the logical failover circuit are the same , the logical operations 500 then continue from operation 520 to operation 530 . if , however , at operation 520 it is determined that logical circuit identifiers of the failed logical circuit and the logical failover circuit are not the same , the logical operations 500 then continue from operation 520 to operation 525 where the network management module 176 renames the logical circuit id of the logical failover circuit to the id of the failed logical circuit . the logical operations 500 then continue from operation 525 to operation 530 . it will be appreciated that in the failover network 17 , a dedicated failover logical circuit may be assigned to an existing logical circuit in a data network and identified with the same id as the existing logical circuit . however , a logical failover circuit which is already an existing logical circuit ( i . e ., normally communicates data traffic in a data network ) is already assigned a unique logical circuit id . thus , in the presently described embodiment of the invention , the logical identifier of a logical failover circuit may be renamed so that it is in accord with a current logical identifier of a logical circuit . for example , in a frame relay data network , a logical circuit may be identified as dlci 100 while a logical failover circuit may be identified as dlci 250 . the logical failover circuit may be renamed from dlci 250 to dlci 100 . it will further be appreciated that the network management module 176 may store the changes to logical circuit identifiers as reroute data in the database 170 . this reroute data may then be accessed to restore the original logical identifiers to the logical failover circuit once the trouble in the failed logical circuit has been repaired . at operation 530 the network management module 176 reroutes the data from the overbalanced logical circuit to the logical failover circuit . it will be appreciated that the reroute of the data may be accomplished from the logical management module 153 or the network management module 176 which , in communication with the switches in the data network 2 ( and the failover network 17 ), sends instructions to reroute the logical data from the nnis or logical connections 102 and 104 to the failover nnis or logical connections 122 , 124 , 126 , and 132 in the logical failover circuit . the logical operations 500 then continue from operation 530 to operation 535 . at operation 535 , the network management module 176 determines the failed logical circuit has been restored . this determination may be made , for example , by receiving a confirmation from the iec data network 10 that the failed logical connections 102 and 104 have been restored or from continuous or periodic logical circuit monitoring performed by the logical element module 153 in communication with the network management module 176 , to establish that the logical connections are successfully communicating data . if at operation 535 it is determined that the overbalanced logical circuit has not been restored , the logical operations 500 return to operation 530 where the rerouting of the data is maintained on the logical failover circuit . if however , at operation 535 , it is determined that the overbalanced logical circuit has been restored , then the logical operations 535 continue to operation 540 where the data on the network failover circuit is rerouted back to the restored logical circuit . similar to the rerouting of the logical data onto the logical failover circuit , the rerouting of the logical data back onto the restored logical circuit may be accomplished from the network management module 176 which , in communication with the switches in the data network 2 ( and the failover network 17 ) sends instructions to reroute the data from the failover nnis or logical connections 122 , 124 , 126 , and 132 to the restored nnis or logical connections 102 and 104 in the restored logical circuit . the logical operations 500 then end . it will be appreciated that in one embodiment , the logical circuit failover procedure may be initiated as a service offering by a local exchange carrier ( lec ) to an inter - exchange carriers ( iec ) for rerouting congested or overbalanced logical circuits . thus , an iec may utilize a lec &# 39 ; s data network for relieving overbalanced logical circuits . in another embodiment , the logical circuit failover procedure may be initiated as part of a customer subscription service offered by the network service provider . the subscription service may include use of the logical failover circuit for a predetermined time period after the customer &# 39 ; s data has been rerouted . for example , a customer subscribing to the failover service would automatically have the logical circuit failover procedure initiated and the customer &# 39 ; s data would be rerouted for up to two hours over the logical failover circuit after a determination that the customer &# 39 ; s network circuit has failed . if a customer is not a subscriber , the failover service may still be initiated and the customer may be billed based on the length of time the failover service was in service . in another embodiment , the customer may be offered the failover service by the service provider in real - time ( i . e ., upon determining a logical circuit 5 failure ). it will be appreciated that the embodiments of the invention described above provide for a method and system for automatically rerouting data from an overbalanced logical circuit in a data network . when an overbalanced condition in a logical circuit is detected , the data in the overbalanced circuit may be rerouted to a “ logical failover network ,” thereby minimizing lost data until the overbalanced condition in the logical circuit is cleared . the various embodiments described above are provided by way of illustration only and should not be construed to limit the invention . those skilled in the art will readily recognize various modifications and changes that may be made to the present invention without following the example embodiments and applications illustrated and described herein , and without departing from the true spirit and scope of the present invention , which is set forth in the following claims . fig6 illustrates a flowchart describing logical operations 600 for prioritized rerouting of logical circuit data in the data network 2 of fig1 , according to an embodiment of the invention . it will be appreciated that the logical operations 600 may be initiated when a customer report of a network circuit failure is received in the data network 2 . for example , a customer at the remote device 114 may determine that the remote device 114 is dropping frames or cells sent from the host device 112 ( e . g ., by reviewing lmi status information in the host device ). after receiving the customer report , the network service provider providing the network circuit may open a trouble ticket in the service order system 160 to troubleshoot the logical circuit . the logical operations 600 begin at operation 605 where the network management module 176 identifies a failed logical circuit in the data network 2 . it will be appreciated that a logical circuit failure may be based on status information received in communications with the logical element module 153 to request trap data generated by one or more switches in the data network 2 . the trap data indicates the status of one or more logical connections making up the logical circuit . for example , in the data network 2 shown in fig1 , the “ x ” marking the logical connections 102 and 104 indicates that both connections are “ down beyond ” the logical connections in the lata data networks 5 and 15 . it will be appreciated that in this example , the logical circuit failure lies in the iec data network 10 . an illustrative method detailing the identification of logical circuit failures in a data network is presented in co - pending u . s . patent application ser . no . 10 / 745 , 170 , entitled “ method and system for automatically identifying a logical circuit failure in a data network ,”, filed on dec . 23 , 2003 , and assigned to the same assignee as this application , which is expressly incorporated herein by reference . after identifying a failed logical circuit at operation 605 , the logical operations 600 continue at operation 610 where the network management module 176 determines the quality of service (“ qos ”) parameter for the communication of data in the failed logical circuit . as discussed above in the description of fig1 , the qos parameters for a logical circuit are contained within the dlci ( for frame relay circuits ) or the vpi / vci ( for atm circuits ). the qos parameters for logical circuits may also be stored in the network database 170 after the circuits are provisioned in the data network . thus , in one embodiment of the present invention , the network management module 176 may determine the logical identifier for the failed logical circuit from the trap data received from the logical element module 153 and then access the database 170 to determine the qos parameter for the circuit . the logical operations then continue from operation 610 to operation 615 . at operation 615 , the network management module 176 identifies a logical failover circuit for communicating failed logical circuit data over an alternate communication in the data network 2 . for example , if as shown in fig1 , it is determined that the failure in the logical circuit in the data network 2 has been isolated to the iec data network 10 , a logical failover circuit in the failover network 17 may be automatically selected to reroute the logical data such that it bypasses the iec data network 10 . for example , the logical failover circuit may be selected including the logical connections 122 , 124 , 126 , and 132 ( as shown in fig4 ) to reroute the logical data from the host device 112 , through the lata 5 , the iec 20 , the lata 25 , the iec 30 , the lata 15 , and finally to the remote device 114 . it should be understood that the network management module 176 may select the logical failover circuit by identifying a logical connection or nni in the overbalanced logical circuit . information related to each logical connection in a logical circuit may be stored in the database 170 including the first and second ends of the logical circuit to which the logical connection belongs . once the ends of a logical circuit are determined by accessing the database 170 , the network management module 176 may select a logical failover circuit having a communication path including the first and second ends of the overbalanced logical circuit for rerouting data . it will be appreciated that in one embodiment , the logical failover circuit selected may be a dedicated circuit which is only utilized for rerouting logical data from the failed logical circuit ( i . e ., the failover circuit does not normally communicate data traffic ). in this embodiment , the logical failover circuit may be provisioned with the same qos parameter as the logical circuit to which it is assigned . in another embodiment , the logical failover circuit may be an existing logical circuit which is normally utilized for communicating data traffic in the data network 2 . in this embodiment , the selection of the logical failover circuit may also include determining whether one or more logical connections in the logical circuit are currently communicating data traffic or are currently unused . if currently unused , the logical connections may be selected for rerouting logical data . for example , a technician at the logical element module 153 or the network management module 176 may utilize a map - based gui displaying the logical connections in the lata data networks 5 and 15 and their status . a dedicated logical failover circuit ( or a currently unused logical circuit with available logical connections ) may then be selected as a logical failover circuit for communicating logical data from a failed logical circuit . the logical operations 600 then continue from operation 615 to operation 620 . at operation 620 , the network management module 176 determines the qos parameter for the previously identified logical failover circuit . it will be appreciated that the identification of the qos parameter for the logical failover circuit may be made by identifying the logical circuit id for the logical failover circuit and then accessing the network database 170 to retrieve the qos parameter for the circuit . the logical operations 600 then continue from operation 620 to operation 625 . at operation 625 , the network management module 176 compares the qos parameters for the failed logical circuit and the logical failover circuit to determine if they are the same . if the qos parameters are the same , the logical operations continue to operation 635 where the failed logical circuit data is rerouted over the logical failover circuit . an illustrative method detailing the rerouting of failed logical circuits in a data network is presented in co - pending u . s . patent application ser . no . 10 / 744 , 921 , entitled “ method and system for automatically rerouting logical circuit data in a data network ,”, filed on dec . 23 , 2003 , and assigned to the same assignee as this application , which is expressly incorporated herein by reference . for example , if the network management module 176 determines that the qos for the failed logical circuit and the logical failover circuit is constant bit rate (“ cbr ”), then the failed logical circuit data is rerouted over the logical failover circuit while maintaining the same quality of service . it will be appreciated that in data networks supporting interworking ( i . e ., both frame relay and atm devices ), the network management module 176 may be configured to reroute logical circuit data based on similar qos parameters from each protocol . for example , if the failed logical circuit has a frame relay qos parameter of variable frame relay (“ vfr ”) real time , the network management module 176 may reroute the data to an atm logical failover circuit having a qos parameter of variable bit rate (“ vbr ”) real time , since these quality of service parameters are defined to tolerate only small variations in transmission rates . similarly , a failed logical circuit having an atm qos parameter of unspecified bit rate (“ ubr ”) may be rerouted over a frame relay logical failover circuit having a qos of vfr non - real time since both of these parameters are tolerant of delay and variable transmission rates . if , however , at operation 625 , the network management module 176 determines that the qos parameters for the failed logical circuit and the logical failover circuit are not the same , then the logical operations continue from operation 625 to operation 630 where the network management module 176 obtains authorization to reroute the logical circuit data . once authorization is received , the logical operations 630 then continue to operation 635 where the failed logical circuit data is rerouted over the logical failover circuit . it will be appreciated that authorization may be obtained if the logical failover circuit is provisioned for a lower quality of service than the failed logical circuit . for example , authorization may be obtained from an atm circuit customer with a qos parameter of cbr to reroute logical circuit data to a failover logical circuit with a qos parameter of vbr real time . it will be appreciated that in some instances , a customer unwilling to accept delay and variable transmission rates for high priority data ( such as voice ) may not wish data to be rerouted over a lower priority circuit . the logical operations 600 then end .	7
some preferred embodiments of the present control method of a power source of a forestry machine are described in the following by referring to the above - mentioned figures . thus , parts used for implementing the method are indicated in the figures with reference numerals that correspond to the reference numerals in this description . fig1 thus shows a diagram in which a power source 1 of a forestry machine 20 utilizes directly or indirectly one or more work and / or handling devices controlled by a control means 2 and denoted with reference numerals 3 and 4 . the control means gives , in a conventional manner , a control command to one or more work devices or handling devices , which control command starts , for instance , the desired operation in the forestry machine . the control command of the control means given to one or more work devices and / or handling devices is , however , transmitted substantially simultaneously to the power source of the forestry machine as well , conventionally to the control unit controlling it , for example to an electronic control unit ( ecu ). thus , there is time to predict the power or torque request presented to the power source by the work device and / or handling device function started by the control command in the required control parameters to be transmitted to the power source . the work device consists of , for example , a boom system 30 , such as a crane or a loader . the control parameters of the power source 1 can also be affected by taking into account the power or torque request presented to the power source by several simultaneous functions of a work and / or handling device . when the requests exceed a preset limit value , the effect on control parameters according to the invention is started . on the other hand , solutions are known where the operation of the power source is actively monitored for this purpose with a means arranged on it . when the means gives information on the load of the power source , a change in the control parameters directed at the power source by the method is arrangeable to be started only when the load level of the power source exceeds a preset limit value . also the duration of a power change to be provided for the power source can be adjusted separately . a control command provides for the power source 1 a momentary change in the productivity of the previous power or , for instance , torque . thus , there is time to raise for example the power production of the power source even before the function of the work and / or handling device 3 and 4 in question begins to require of the power source of the forestry machine power that is greater than the usual power production availability . in practice , this control may manifest itself for instance as an increase in the injection amount of fuel for a short time just before the expected power demand higher than usual occurs . in this way , for example in diesel engines the speeding up and sufficiency of the increase in the boost pressure of a supercharged engine can be ensured , guaranteeing the power or torque level of the power source in each particular case . typically there will be , after the arrival of the control command , some dozens or hundreds of milliseconds for the power source 1 of the forestry machine to prepare for the increasing power demand that the power source is subjected to . this is possible because the delays of an electronically controlled hydraulic system , for example , can be utilized in the control . such delays are generated for instance in hydraulically precontrolled control valves used in forestry machines . fig2 and 3 show such precontrol and control valves 5 and 6 . further , if required , a given delay can be deliberately added to a given activated function to enable better predictability , to the extent to which this can be done without the usability of the forestry machine suffering . preferably , such a delay can be implemented by software in a control means , for instance . the control parameter of the power source to be affected may be , for example , the power source &# 39 ; s rotative speed , injection advance of fuel mentioned above , torque of the power source or any other control parameter controllable with known means . the present method is particularly useful when applying it to be used in connection with the start of the trunk feeding or sawing function , shown schematically in fig2 , to momentarily raise the power level of the power source 1 . in this way , the fuel consumption and exhaust gas emissions of a diesel engine , for example , can be minimized . in particular , the advantages of such a solution become apparent in the case of a hydraulic system utilizing a harvester head 25 of a harvester , whereby the power demands vary a great deal , particularly when the feeding function 7 and the sawing function 8 alternate in trunk handling . the present method for controlling a power source can be used to control power sources other than the primary power source 1 of a forestry machine . fig3 thus shows a solution in which power generated by the primary power source of a forestry machine is stored at least partly in , for instance , a set of accumulators or other energy - storing means 9 . if required , the power can be taken into use from the storing means in the form of electric or other kind of power transmission , whereby the control steps are directed at this power source 10 that thus forms a secondary power source . analogically , pressure accumulators or the like solutions known as such for storing hydraulic energy can be considered instead of storing electric energy . thus , instead of a generator arrangement 11 and a control means 12 controlling it , for example a hydraulic pump should be attached to the primary power source in a manner known as such . in such an embodiment , the pressure accumulator itself could function as a secondary power source , whereby the control of the secondary power source could be considered to encompass the control of the flow and pressure of the pressure medium discharging from the pressure accumulator . the present method can be applied to controlling this secondary power source in also such a case where the energy - storing means essentially belonging to the above arrangement could generate powers greater than those generated by the primary power source of the forestry machine . in the exemplary case presented above , electric energy charged in the set of accumulators 9 , for instance , is used in an electric engine 13 for running a hydraulic pump 14 , for instance , the electric motor constituting in this case the secondary power source 10 . thus , the rotative speed of this electric engine , for example , can be momentarily or for a longer time controlled to be higher to achieve greater power production availability . on the other hand , with an electric system an analogic arrangement can be implemented hydraulically . in such a case , the primary power source 1 of the forestry machine would utilize a large hydraulic pump 14 pressurizing and filling a pressure accumulator , whereby the secondary power source 10 would be a hydraulic engine that would take the pressurized medium into use from this pressure accumulator . a hydraulic engine could also in this case be controlled to predict variations in the power demand . on the other hand , in the case of hydraulic implementation , the pressure accumulator itself could function as said secondary power source , whereby the control of the secondary power source could be considered to encompass the control of the flow and pressure of the pressure medium discharging from the pressure accumulator . it is to be understood that the above description and the associated figures are only intended to illustrate the present solution . the solution is thus not restricted only to the embodiment presented above or defined in the claims , but many different variations and modifications possible within the idea defined in the attached claims will be obvious to those skilled in the art .	5
the present invention will be further described in reference to the following drawing figure diagrams which teach all that is depicted therein and anticipations thereof . although , the diagrams are representative embodiments of the present invention , it will be obvious to those skilled in the art that deviations from the figures are also beneficial , and such deviations are also within the scope and spirit of the present invention . fig1 is a cross - section diagram of a prior art can assembly . can assemblies are generally cylinders closed on one end and open on the other . the can assembly 13 is such a cylinder . inside the can assembly 13 is the superhard materials mixture 14 , comprising a composite of superhard particles for sintering . the can assembly is closed by lid 15 , having a sealant material 16 arranged between the lid 15 and superhard material mixture 14 . openings 17 and 18 are provided between the superhard mixture and the can assembly to promote ventilation of contaminants and capillary flow of the meltable sealant 16 , in this case copper . the hpht assembly is heated in a vacuum furnace that produces an environment which cleanses the components of unwanted contaminants and hermetically seals the container in preparation for further hpht processing . fig2 is a cross - section diagram of a prior art can assembly employing an outer can 20 and an inner can 21 . the double can assembly contains the superhard materials mixture comprising a substrate 22 and a layer of superhard particles 23 . the assembly is closed by a lid 24 having a meltable sealant 25 . once again an opening 26 is provided between the inner and outer can assembly and the superhard materials mixture in order to allow the flow of contaminants from the can assembly and to promote the capillary flow of the sealant , in this case a copper braze , around the mixture 22 and 23 . although the purpose of the inner and outer can assembly is to provide a better seal from contamination , the figure fails to provide a sealant barrier in the opening 26 to prevent the sealant &# 39 ; s access to the mixture . contamination from undesirable impurities is the leading cause of low quality products and low production yields in the art of hpht superhard products such as polycrystalline diamond and cubic boron nitride . fig3 is a perspective diagram of an embodiment of the can assembly of the present invention comprising a cylindrical can 30 and a cap 31 . line aa describes the plane of the cross section in subsequent figures . fig4 is a perspective diagram of an embodiment of the can assembly of the present invention comprising a cylindrical can 40 having a convex , or conical , region 42 and an end cap 41 . those skilled in the art will understand that the conical region produces a superhard element having a similar shape . fig5 is a cross - section diagram of an embodiment of the present invention depicting a can assembly comprising a can 50 having an extended side wall length 51 . the can contains a superhard substrate 53 and a layer 54 comprising superhard particles such as diamond or cubic boron nitride . the extended side wall length 51 of the can 50 is formed over the surface of substrate 51 in aid of assembly and compaction of the superhard mixture and to promote sealing of the mixture . the can assembly is closed by end cap 52 which is fitted onto the can . a meltable sealant material 55 is interposed between the end cap and the can with access to narrow opening 57 . opening 57 is of sufficient width , say between about 0 . 0005 to 0 . 050 inches , to promote the outflow of contamination and yet produce the surface energy necessary to drive the capillary flow of the meltable sealant 55 . a sealant barrier 56 is provided around the circumference of the substrate 53 intermediate the meltable sealant 35 and the superhard mixture comprising 53 and 54 . when the can assembly of fig5 is placed in the vacuum chamber of a high temperature furnace and placed under high vacuum and high temperature sufficient to ventilate contaminates from the assembly , the assembly is cleansed of undesirable contamination . the temperature of the furnace is then increased sufficiently to melt the sealant . by capillary action , the sealant flows into the opening 57 and hermetically seals the can assembly . the flow of the sealant is stopped by the sealant barrier 56 , thereby protecting the cleansed hpht mixture from further contamination from the sealant itself . the can is then retrieved from the furnace in preparation for further hpht processing . the sealant barrier 56 comprises a material that inhibits the surface tension between mating surfaces and interrupts the flow of the sealant melt under the cleansing environment of the vacuum furnace and under the further conditions of hpht processing . such materials are commonly known as : stop - off , stop - off compound , solder / braze stop , solder mask , and sealant flow control . one such material is marketed under the name of “ green stop - off type 1 ” by nicrobraz , wall colmondy corporation , madison hts ., mi . such sealant barriers comprise refractory materials of inert oxides , graphite , silica , magnesia , yttria , boron nitride , or alumina and are applied by coating , etching , brushing , dipping , spraying , silk screen painting , plating , baking , and chemical or physical vapor deposition techniques . in the embodiment of fig5 , the sealant barrier was applied as a paint using a brush . it may be applied to the surface of anyone of the assembly components where it would be desirable to prevent the flow of the liquid sealant . fig6 is a cross - section diagram of an embodiment of the present invention similar to that depicted in fig5 comprising at can 61 containing a substrate 64 and a superhard mixture 67 . the can is closed by end cap 62 . the sealant 65 is depicted as melted filling the opening 66 and stopped by the sealant barrier 63 so that it does not flow into the region of the superhard mixture 64 and 67 . fig7 is a cross - section diagram of an embodiment of the present invention similar to that depicted in fig5 comprising a can 70 and an end cap 71 containing a substrate 72 and superhard particles 73 . the assembly comprises the addition of a lid 75 as a further protection for the superhard mixture comprising a substrate 72 and superhard particles 73 . the sealant 76 and the sealant barrier 77 are contained within the opening 74 so that when the sealant is melted it flows within the opening 74 around the lid 75 and is stopped by the sealant barrier 77 . the can assembly will thereby be hermetically sealed from contamination during further hpht processing . fig8 is a cross - section diagram of a double can assembly embodiment of the present invention . the assembly comprises an inner can 80 and an outer can 81 containing a substrate 82 and a mixture of superhard particles 83 . within the space 84 are positioned the lid 85 , the sealant 86 , and the sealant barrier 87 . the assembly also comprises an additional sealant barrier 88 . the additional sealant barrier 88 serves to prevent the sealant from escaping the assembly during processing . when the sealant is melted , it flows within the opening 84 to surround the open portion of the can and is confined between the two regions of sealant barrier 87 and 88 . fig9 is a cross - section diagram of a sealable assembly comprising a can 90 containing a substrate 91 and superhard particles 92 . the assembly further comprises an opening 95 for positioning a sealant sleeve 94 and a sealant barrier 96 , which may be a sleeve or a coating . the can 90 further comprises a recess 93 for cooperating with the insertion of the sealant sleeve 94 . the assembly may be swaged together so that the components of the assembly are tightly fit together prior to sealing in a vacuum furnace . as noted in the other figures , the sealant barrier is positioned intermediate the sealant and the superhard particles . in this manner , the superhard particles are protected from undesirable contamination during hpht processing . fig1 is a cross - section diagram of a sealed embodiment of the present invention comprising a can 90 and an end cap 93 containing a substrate 91 and superhard particles 92 . within the space 94 are located the lid 95 , the sealant 96 , and the sealant barrier 97 and 100 . in cooperation with the sealant , the assembly comprises a circumferential groove 101 around the substrate 91 and a cooperating indentation 98 in the wall of the can 90 . the end cap 93 also comprises cooperating indentations 99 and 100 that may be used in connection with the sealant barrier . when the can assembly is assembled , it may be swaged together so that the components are in tight fit with each other . the cooperating indentations , when used in association with the sealant barrier , provide a mechanical and a chemical stop for the flow for the sealant . surprisingly , the applicants have found that regardless of the fit between the components , the heat and vacuum of the furnace are sufficient to drive off contaminants within the assembly . it is believed that the during high temperature processing the superhard mixture expands less than the metal can components thereby providing sufficient opening for the escape of contaminants during the vacuum cycle . by maintaining a tight fit between the components , the applicants believe that higher surface tension is achieved to drive the capillary action of the melting sealant . the applicants have found , also , that smooth surface finishes between the can and the superhard components is beneficial for achieving a competent seal .	1
fig1 is a schematic diagram of an embodiment of a scanning photoelectron microscope according to the present invention . in fig1 a beam of light 1a from a light source 1 is caused to pass through an aperture 3 by a condenser lens 2 , is caused to enter a scanningmirror 4 by a drive unit 16 and is introduced into a sample chamber 6 into which gas has been introduced , by the reflection of the scanning mirror 4 through a window 5 . the beam of light introduced into the sample chamber 6is condensed on a sample on a stage 8 by an objective lens 7 . the beam of light is caused to scan the surface of the sample two - dimensionally ( in x - direction and y - direction ) by the scanning mirror 4 , as required . two scanning mirrors 4 for x - direction and y - direction , respectively , for thus scanning the beam of light are usually prepared , but such construction is well known and therefore , in fig1 for the sakeof convenience , only one mirror 4 is shown . for example , of course , x - direction may be scanned by the scanning mirror and in y - direction , the surface of the sample may be moved , or the surface of the sample may be moved two - dimensionally . a photoelectron emitted from the sample by the application of the light thereto ionizes the gas in the sample chamber 6 , whereby the multiplied electron is captured by a detector 9 ( electrode ) of positive potential relative to the sample . that is , the detector 9 is maintained at positive potential by a power source 10 ( the sample is earthed ), and such a distance and voltage that no discharging will take place between the detector and the sample are determined . the sample chamber 6 is kept at predetermined pressure by controlling a gas introduction unit 11 and an evacuation unit 12 by a gas control unit 13 . a photoelectron signal is displayed on a monitor 15 through an amplifier 14in synchronism with the mirror scanning . with such a construction , the sample interchange door , not shown , of the sample chamber 6 is opened , andthen the sample is placed onto the stage 8 and the sample interchange door is closed , whereafter the gas control unit 13 is operated to control the gas introduction unit 11 and the evacuation unit 12 , thereby keeping the interior of the sample chamber 6 at predetermined pressure . thereafter , the light from the light source 1 is emitted ( this is accomplished by the changeover from the turn - off to the turn - on of the light source , or by thechangeover from the closing to the opening of a shutter , not shown ). the beam of light 1a on the sample is caused to scan two - dimensionally by the drive unit 16 , whereby the photoelectron emitted from the sample travels toward the detector 9 , but is captured by the detector 9 with an electron created as a result of the photoelectron colliding with the gas to thereby ionize the gas , and is amplified by the amplifier 14 , whereafter it is inputted to the monitor 15 and becomes the calescence point signal of the monitor 15 , whereby the two - dimensional photoelectron image of the sample is displayed on the monitor 15 . fig2 shows a modification comprising a combination of the scanning photoelectron microscope shown in fig1 and a scanning optical microscope , and in fig2 the same members as those in fig1 are given the same reference numerals and need not be described . the scanning mirror4 in fig1 is constructed as a half - transmitting scanning mirror 4 &# 39 ; using a half mirror , and the reflected light from the sample is passed through an aperture 30 and a condenser lens 17 and is detected by a photodetector 18 . the detection signal is amplified by an amplifier 19 , whereafter it enters the monitor 15 and is displayed as a sample image on the monitor 15in synchronism with the scanning of the half - transmitting scanning mirror 4 &# 39 ;. the outputs of the amplifiers 14 and 19 are superposed one upon the other , whereby an optical image and a photoelectron image are obtained at a time . of course , the output of the amplifier 14 and the output of the amplifier 19 may be selected by a changeover switch , not shown , which is provided in the monitor 15 , and the optical image and the photoelectron image may be alternatively displayed . fig3 shows a second modification in which the beam of light 1a is not scanned , but the stage 8 is driven two - dimensionally by a stage drive unit20 and the sample is scanned relative to the beam of light 1a and the sample is disposed in the atmosphere , the photoelectron signal is capturedby the detector 9 , is amplified by the amplifier 14 and is displayed on themonitor 15 in synchronism with the scanning of the sample . in fig3 the beam of light 1a from the light source is a beam of light difficult to scan by a mirror , for example , x - rays from synchrotron radiation or the like , and the mirror 7 is a toroidal x - ray mirror or a freznel zone plate . a beryllium x - ray window is used as the window 5 . also , in the above - described embodiments , the sample is placed in the sample chamber 6 , but it is known that photoelectrons are also obtained inthe atmosphere , and it is not requisite to confine the sample in the pressure - controlled sample chamber 6 . fig4 is a schematic diagram of a scanning photoelectron microscope according to a second embodiment of the present invention . in fig4 the same members as those in fig1 are given the same referencenumerals and need not be described . in fig4 a synchrotron light source 1 &# 39 ; is a light source capable of emitting lights of wavelengths from the infrared range to the ultraviolet range . a wavelength selection spectroscope 22 selects only the light of necessary wavelength from the beam of light 1a from the synchrotron light source 1 &# 39 ; and causes it to enter the condenser lens 2 . in the second embodiment , the wavelength selection spectroscope 22 causes only x - rays ofwavelength 1 nm to enter the condenser lens 2 . a reflecting mirror 4a reflects the beam of light 1a and causes it to pass through an x - ray transmitting window 5a of thin diamond film , and introduces it into the sample chamber 6 into which gas has been introduced . in the present embodiment , the sample chamber 6 has a volume of 1 m 3 . also , the arrangement of the optical system takes the absorption of x - rays by the gas into consideration . the stage 8 is movable two - dimensionally ( in x - direction and y - direction infig4 ), and in the second embodiment , by the two - dimensional movement of the stage 8 , the beam of light 1a condensed on the sample 21 is caused to scan two - dimensionally on the sample 21 . photoelectrons created from the sample 21 by this scanning enter an electron energy analyzer 23 . the electron energy analyzer 23 passes therethrough only those of photoelectrons created from the sample 21 whichhave necessary energy , and can be adjusted in z - direction in fig4 so thatit can be disposed at a location whereat the energy of the photoelectrons is not lost ( amplified ) by the gas atmosphere in the sample chamber 6 ( thedetails of this will be described later ). also , in the present embodiment , an electron energy analyzer of the retarding field type is used as the electron energy analyzer 23 . fig5 shows the details of the electron energy analyzer 23 of fig4 and the electron energy analyzer 23 is comprised of a grid 23a , a grid 23b anda power source 23c . the power source 23c gives a voltage to the grid 23a . the grid 23b drops photoelectrons not enough to satisfy necessary energy to the earth . turning back to fig4 the photoelectrons passed through the electron energy analyzer 23 collide with gas molecules in the sample chamber 6 , andare detected by a detector 9a which is at positive potential relative to the sample 21 . the detector 9a uses a ring - like metal ( in the present embodiment , copper ) and is disposed so as not to intercept the beam of light 1a , and is given a voltage so that the potential difference thereof from the grid 23a may not exceed 400 v . a cpu 24 effects the adjustment of the electron energy analyzer 23 in z - direction through a motor , not shown , and controls the gas introduction unit 11 , the evacuation unit 12 and a stage controller 25 . the evacuation unit 12 evacuates the sample chamber 6 . the gas introductionunit 11 introduces gas into the sample chamber 6 , and in this second embodiment it introduces helium ( he ). the stage controller 25 moves the stage 8 two - dimensionally through a motor , not shown , as previously described . in the second embodiment , x - rays of wavelength 1 nm is used and therefore , the synchrotron light source 1 &# 39 ; to the reflecting mirror 4a are covered with a cover 26 of lead . the observing operation of the scanning photoelectron microscope constructed as described above will hereinafter be described . fig6 is a flow chart for the observation of the sample 21 , and description will hereinafter be continued with reference to this flow chart . the cpu 24 controls the pressure in the sample chamber 6 to the pressure indicated by the operator ( step 101 ). for example , when the sample chamber 6 is to be set to 500 pa , the cpu 24 evacuates the sample chamber 6 rendered into the atmospheric pressure by the interchange of the sample 21 to the order of 100 pa by the evacuation unit 12 . the cpu 24 introduces helium by the gas introduction unit 11 until the pressure in the sample chamber 6 becomes 500 pa . thereby , the cpu 24 can render the interior of the sample chamber 6 into a helium atmosphere of 500 pa . the cpu 24 calculates the position of the electron energy analyzer 23 on the basis of the set pressure ( step 102 ). the cpu 24 first finds the molecule number density ( number / m 3 ) of the helium ( he ) gas . the state equation of the gas is expressed by the following equation : where p is the pressure ( pa ), v is the volume ( m 3 ) of the sample chamber 6 , n is the molecule number of the gas in the sample chamber 6 , isboltzman &# 39 ; s constant ( jk - 1 ), and t is temperature ( k ). since the molecule number density n ( number / m 3 ) is n / v , the above equation can be modified as follows . ( the molecule number density of the gas does not depend on the kind of the gas .) if the temperature in the sample chamber 6 is 300 k . ( 27 ° c . ), as previously described , the volume of the sample chamber 6 is 1 m 3 and boltzman &# 39 ; s constant is 1 . 380662 × 10 - 23 ( jk - 1 ) and therefore , these numerical values are substituted for the above equation to thereby calculate the cpu 24 then calculates the position of the electron energy analyzer 23 from the equation below . the equation below is for finding the distance bywhich the photoelectron advances its energy without losing ( amplifying ) theenergy . where σ is the ionization and excitation cross section ( m 2 ) of the gas by the electron , and when the gas is helium gas in the required photoelectron energy area , σ is 3 . 6 × 10 - 21 ( m 2 ) at maximum and therefore , the cpu 24 adjusts the position of the electron energy analyzer 23 in the direction of the optical axis ( step 103 ). the cpu 24 adjusts the grid 23a of the electron energy analyzer 23 so as toassume a position spaced apart by 2 . 3 ( mm ) from the sample 21 along the optical axis ( z - direction ). the grid 23b is adjusted so as to not to contact with the sample 21 . the cpu 24 moves the stage 8 two - dimensionally and scans the sample 21 withx - rays ( step 104 ). the wavelength selection spectroscope 22 passes therethough only x - rays of wavelength 1 nm of the beam of light 1a emitted from the synchrotron lightsource 1 &# 39 ; and therefore , the x - rays of wavelength 1 nm are condensed on thesample 21 . when the x - rays are condensed on the sample 21 , the cpu 24 moves the stage 8 two - dimensionally through the stage controller 25 . by the two - dimensional movement of the stage 8 , the sample 21 is scanned with thebeam of light 1a ( step 105 ). a photoelectron corresponding to this scanningposition is created from the sample 21 . the cpu 24 makes the detector 9a detect the photoelectron created from the sample 21 ( step 106 ). the grid 23a of the electron energy analyzer 23 , as previously described , is at a location spaced apart by 2 . 3 ( mm ) from the sample 21 along the optical axis ( z - direction ). therefore , the photoelectrons created from thesample 21 enter the electron energy analyzer 23 without losing ( amplifying ) their energy . the electron energy analyzer 23 selects and passes therethrough only those of the photoelectrons which have necessary energy . in the second embodiment , an electron energy analyzer of the retarding field type is used as the electron energy analyzer 23 and thus , when as described above , the grid 23a is at a location spaced apart by 2 . 3 ( mm ) from the sample 21 , a voltage of the order of - 400 v is applied with a discharge voltage taken into account . the photoelectrons passed through the electron energy analyzer 23 collide with the molecules of helium in the sample chamber 6 and the thereby amplified . these photoelectrons are detected by the detector 9a . the cpu 24 makes the amplifier 14 amplify the photoelectrons detected by the detector 9a as previously described , and causes them to be inputted asan image signal to the monitor 15 . thus , the monitor 15 displays the photoelectron image of the sample 21 . also , when it is desired to change the pressure in the sample chamber 6 andthe kind of the gas , return can be made to the step 101 . in the second embodiment , the photoelectrons are amplified by helium , any gas such as steam or nitrogen can be applied . in the following , the position of the electron energy analyzer 23 when nitrogen ( n 2 ) is used as a modification of the second embodiment is found . in this modification , the pressure in the sample chamber 6 is 100 pa . from the aforementioned state equation of the gas , the molecule density number n when the pressure in the sample chamber 6 is 100 pa is n = 2 . 41 × 10 22 ( number / m 3 ). the maximum value of the ionization and excitation cross section σ of nitrogen ( n 2 ) by photoelectron is from this , the grid 23a can be adjusted to a location distant by 1 . 60 ( mm ) from the sample 21 . in the present embodiment , x - rays of wavelength 1 nm is used as the light source , but x - rays of other wavelength or ultraviolet rays of a wavelengthof the order of 200 nm may also be used . also , in the present embodiment the stage 8 is moved two - dimensionally to thereby scan the beam of light 1a condensed on the sample 21 and the sample 21 , but alternatively , the reflecting mirror 4a may be caused to scan two - dimensionally . that is , as is well known , two mirrors for x - direction and y - direction , respectively , can be used and design can be made such that the respective mirrors are caused to scan . also , where the sample 21 is electrically conductive , photoelectrons not enough to satisfy the necessary energy can be dropped to the earth throughthe sample 21 and therefore , the grid 23b can be eliminated .	7
detailed embodiments of the methods and structures of the present disclosure are described herein ; however , it is to be understood that the disclosed embodiments are merely illustrative of the described methods and structures that can be embodied in various forms . in addition , each of the examples given in connection with the various embodiments of the disclosure is intended to be illustrative , and not restrictive . further , the figures are not necessarily to scale , some features can be exaggerated to show details of particular components . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a representative basis for teaching one skilled in the art to variously employ the methods and structures of the present disclosure . for purposes of the description hereinafter , the terms “ upper ”, “ lower ”, “ top ”, “ bottom ”, and derivatives thereof shall relate to the disclosed structures , as they are oriented in the drawings . referring to fig2 , an illustrative structure and a method for forming semiconductor fet devices on a semiconductor - on - insulator ( soi ) substrate are described . fig2 shows a substrate [ 100 ], presently silicon - on - insulator ( soi ). the soi layer [ 102 ] is located above the buried - oxide layer ( box ) [ 101 ] and the substrate [ 100 ]. the buried oxide ( box ) layer [ 101 ] on the substrate [ 100 ] can be made as a silicon oxide , a nitride , a silicon nitride , and / or an oxynitride , e . g ., silicon oxynitride , having a thickness ranging from 5 nm to 1000 nm , or preferably , from 10 nm to 200 nm , and still more preferably , from 10 nm to 25 nm . the semiconductor - on - insulator ( soi ) substrate can be employed as the semiconductor substrate . when employed , the soi substrate includes a handle substrate superimposed by a buried insulator layer located on an upper surface of the handle substrate , and a semiconductor device layer located on an upper surface of the buried insulator layer . the handle substrate and the semiconductor device layer of the soi substrate can include the same or different semiconductor material . the term “ semiconductor ” as used herein in connection with the semiconductor material of the handle substrate and the semiconductor device layer denotes any semiconducting material including , for example , si , ge , sige , sic , sigec , inas , gaas , inp or other like iii / v compound semiconductors . multilayers of these semiconductor materials can also be used as the semiconductor material of the handle substrate and a semiconductor device layer [ 102 ]. in one embodiment , the handle substrate [ 100 ] and the semiconductor device layer are both made of si . the handle substrate and the semiconductor device layer can have the same or different crystal orientation . for example , the crystal orientation of the handle substrate and / or the semiconductor device layer can be { 100 }, { 110 }, or { 111 }. other crystallographic orientations besides those specifically mentioned can also be used in the present disclosure . the handle substrate of the soi substrate can be a single crystalline semiconductor material , a polycrystalline material , or an amorphous material . the semiconductor device layer of the soi substrate is a single crystalline semiconductor material . a single crystalline semiconductor material ( or monocrystalline semiconductor material ) is a semiconductor material in which the crystal lattice of the entire sample is continuous and unbroken to the edges of the sample , with no grain boundaries . the buried insulator layer of the soi substrate can be a crystalline or non - crystalline oxide or nitride . in one embodiment , the buried insulator layer is made of oxide . the buried insulator layer 101 can be continuous or it can be discontinuous . when a discontinuous buried insulator region is present , the buried insulator region exists as an isolated island that is surrounded by semiconductor material . the soi substrate can be formed utilizing standard processes including for example , simox ( separation by ion implantation of oxygen ) or layer transfer . when a layer transfer process is employed , an optional thinning step can follow the bonding of two semiconductor wafers together . the optional thinning step reduces the thickness of the semiconductor layer to a layer having a thickness that is more desirable . the thickness of the semiconductor device layer of the soi substrate is typically from 100 å to 1000 å , with a thickness from 500 å to 700 å being more typical . in some embodiments , and when an etsoi ( extremely thin semiconductor - on - insulator ) substrate is employed , the semiconductor device layer of the soi has a thickness of less than 100 å . if the thickness of the semiconductor device layer is not within one of the above mentioned ranges , a thinning step such as , for example , planarization or etching can be used to reduce the thickness of the semiconductor device layer to a value within one of the ranges mentioned above . referring to fig3 , a shallow trench isolation ( sti ) [ 103 ] created by a fabrication sequence is shown including trench etching , dielectric deposition such as oxide , followed by planarization such as cmp . the isolation formed by the sti process includes patterning ( e . g ., deposition a sacrificial pad layer ( e . g ., pad oxide and pad nitride ), patterning ( e . g ., by lithography ) and etching sti trenches , preferably by reactive ion etch ( rie ), filling the trenches with one or multiple insulators including but not limited to oxide , nitride , oxynitride , high - k dielectric , or any suitable combination of those materials . the planarization process , such as chemical - mechanical polishing ( cmp ), can be used to provide a planar structure . besides sti [ 103 ] other isolation such as mesa isolation , local oxidation of silicon ( locos ) can also be used . the sacrificial pad oxide and pad nitride can then be stripped . fig4 shows ion implantation into different regions to form n - well [ 104 ] and p - well [ 105 ] regions . the n - well ion implantation can be n - type dopant elements including arsenic or phosphorus . the p - well ion implantation preferably uses a p - type dopant material , including boron or indium . referring to fig5 , forming a gate stack is illustrated including a gate dielectric [ 106 ], a gate electrode [ 107 ], and a hardmask [ 108 ]. the gate dielectric [ 106 ] can be selected from silicon oxide , silicon oxynitride , nitride , high - k materials such as hafnium oxide or stacked combinations thereof . gate electrode [ 107 ] is a conductor or semiconductor , e . g ., polysilicon or metal , e . g ., tin , or stacked combinations thereof . the polysilicon layer can be doped by way of ion implantation or in - situ doped during the deposition . the hardmask [ 108 ] is typically a dielectric , e . g ., silicon oxide , silicon nitride or a stacked combination thereof . referring to fig6 , gate patterning is shown preferably using photoresist , a mask exposure using optical source , and photoresist development leaving the photoresist in desired areas [ 109 ]. fig7 shows the resulting structure after etching the hardmask , preferably using a rie process , and transferring the photoresist pattern into the hardmask . referring to fig8 , the structure is shown following the removal of the photoresist by way of a stripping process , leaving the etched hardmask in the desired pattern . fig9 shows the structure after etching the gate electrode [ 107 ] and gate dielectric [ 106 ], preferably using a directional rie , forming gates in the desired pattern . fig1 shows the structure following the deposition of a conformal spacer layer [ 110 ]. the spacer material is preferably a dielectric such as silicon nitride or silicon oxide that can be deposited by way of chemical vapor deposition ( cvd ), atomic layer deposition ( ald ) or molecular layer deposition ( mld ). fig1 illustrates the resulting structure after etching the spacer material , preferably using a directional reactive ion etch ( rie ) tot remove the spacer material from the horizontal surfaces but keeping it on the vertical sidewalls . fig1 shows a photoresist masking [ 111 ] that opens areas that are to receive n + doping by ion implantation [ 112 ]. n - dopant materials preferably include arsenic or phosphorus . the n + region serves as the source drain region of an nfet or as the n - well contact of the diode . alternatively , the n + region could be formed by etching a trench and filling it with epitaxially deposited semiconductor , such as n - doped sic . fig1 shows a photoresist masking step [ 113 ] that opens areas set to receive p + doping by ion implantation [ 114 ]. p - dopant materials may include boron . the p + region serves as the p + portion of the diode or the source drain region of the pfet ( not shown ). the photoresist is then removed , resulting in the structure shown in fig1 . alternatively , the p + region can be formed by etching a trench and filling it with epitaxially deposited semiconductor , such as p - doped sige . fig1 illustrates the photoresist step which covers and protects the diode , while exposing the fet region to etching that removes the hardmask [ 108 ] over the fet gate . the hardmask etch is preferably performed by rie etching . the rie etching can result in damaging the exposed regions as will be illustrated with reference to fig1 . referring to fig1 , the structure is shown following rie etching , illustrating the resulting damaged regions [ 116 ]. because the photoresist [ 115 ] covers the diode region , it protects the diode from hardmask rie damage , and preserves not only the diode , but it also avoids degradation of the diode ideality . fig1 shows a cross - section view of the structure after silicide [ 117 ] formation . the silicide can be selected from nickel silicide , titanium silicide , cobalt silicide , or any other silicide material . the nickel , titanium , cobalt or other similar metal is deposited on the entire structure . during at heating of the wafer , preferably by rapid thermal annealing ( rta ), the silicide forms as a reaction between the metal and the silicon on the exposed n + or p + regions including gate regions not covered by spacer [ 110 ] or the hardmask [ 108 ]. the fet gate is silicided leaving the diode gate unsilicided as a result of the hardmask still remaining in place . the unreacted metal on the spacer or the hardmask is etched away , preferably by aqueous chemistry . still referring to fig1 , in one embodiment , the gated - diode shown is devoid of any damage resulting from the absence of siliciding the gate , and is further formed alongside the fet having a silicided gate that allows it to achieve a high - performance caused by the reduced gate resistance . fig1 shows an embodiment wherein the gated - diode with its non - silicided gate is formed alongside the nfet and pfet having a silicided gate . it should be noted that while the gated - diode is shown as a p +/ n diode , an embodiment of the inventive structure could be equally applicable to a n +/ p diode . fig2 shows a plan view of the structure illustrated in fig1 depicting additional details of the structure . the non - silicided gate [ 123 ] of the gated - diode is shown in the region on top of the active region of the device , leaving the cap layer in place within the active region , thereby avoiding rie damage to the active region of the diode . the gate [ 121 ] of the gated - diode is silicided outside the active region to the diode , over the sti , by removing the cap layer in the stated region that allows silicide to form . the silicide within the region enables a good contact between the contact [ 120 ] and the gate [ 121 ] of the gated - diode . removing the cap layer in the region outside of the active area of the gated - diode does not create damage near the active region of the diode . shown in fig2 , the gate of the fet is silicided [ 122 ]. fig2 shows a plan view of the structure from fig1 , illustrating an embodiment of the gated - diode with a non - silicided gate [ 124 ] and nfet [ 125 ] and pfet [ 126 ] with a silicided gate . the gate of the gated - diode is not silicided [ 124 ] in the region above the active region of the device , and leaving the cap layer in place within this region , making it possible to avoid rie damage in the active region of the diode . the gate of the gated - diode is silicided outside the diode active region [ 122 ], over the sti , by removing the cap layer in this region , thus enabling silicide to be formed . the silicide in this region provides good contact between the contact [ 120 ] and the gate of the gated - diode . removing the cap layer in the region outside of the active area of the gated - diode does not create damage near the active region of the diode . the gate of the fets [ 125 , 126 ] is silicided . fig2 shows a plan view of an embodiment of an alternate diode structure illustrating other plan - view designs of the gated - diode ( nfet and pfet not shown ). in an embodiment , the diode is formed within the perimeter of the gate . as previously described , the gate of the gated - diode is not silicided [ 128 ] in the region located above the active region of the device by leaving the cap layer in place in this region , to avoid rie damage within the active region of the diode . the gate of the gated - diode is silicided [ 127 ] in an area beyond the diode active region and spanning over the sti , and removing the cap layer from the region , thereby permitting the formation of silicide . while the present disclosure has been particularly shown and described with respect to preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in forms and details can be made without departing from the spirit and scope of the present disclosure . in one therefore intended that the present disclosure not be limited to the exact forms and details described and illustrated , but fall within the scope of the appended claims .	7
the present invention is described below with reference to the embodiments shown in the drawings . fig1 is a block diagram schematically illustrating the general structure of a digital camera to which an embodiment of the present invention is applied . the digital camera 10 , for example , is a digital single - lens reflex camera . light made incident to a lens system 11 forms an image on an imaging surface of an image sensor 14 ( e . g ., a cmos image sensor ) through an aperture 12 and a color filter array 13 . the image sensor 14 may be controlled by drive signals from an image sensor driver 15 . image signals obtained by the image sensor 14 may be fed to an image signal processor 16 to be subjected to various types of image signal processing that are well known in the art , and in turn , the image may be displayed on a monitor 17 . an af controller 19 may control the positions of the lenses in the lens system 11 to carry out the autofocus operation . further , an aperture controller 20 may control the size of the aperture 12 . note that the image sensor driver 15 , the af controller 19 and the aperture controller 20 are controlled by instructions from a controller 21 , and the controller 21 may perform various types of processes , including the autofocus operation ( detailed later ), based on the manipulation of switches in a switch group 22 . the switch group 22 may include a release switch , af button , dial switches , a touch panel , etc . with references to fig2 a , 2 b and 3 , an outline of a focusing - image display verification method for the present embodiment will be explained . note that in the present embodiment a contrast - detect autofocus ( caf ) operation is applied . fig2 a and 2b represent captured images of two dissimilar types of objects having different spatial frequencies . in fig2 a and 2b , caf areas a 2 and a 3 are indicated within an actual pixel area ( or an effective pixel area ) a 1 , and are used in a caf operation to compare the contrast between them . in fig2 a , a person &# 39 ; s face in large scale is positioned at the center of the image . on the other hand , in fig2 b , three people are imaged with distant background view . in general , images of the type in fig2 b have higher spatial frequency compared to images of the type in fig2 a , which makes it relatively difficult to verify the focusing degree of an image having a high spatial frequency like the one in fig2 b . therefore , in the present embodiment a focusing image within the caf area is magnified with the focus point at its center and displayed on the monitor 17 ( see fig1 ) after the caf operation is completed , with the magnification being controlled in accordance to the spatial frequency within the caf area . the relationship between the spatial frequency and the magnitude of the present embodiment is represented in the graph of fig3 . namely , in the present embodiment , a focusing image is enlarged by a greater magnification as the spatial frequency is increased for display on the monitor 17 . note that as in the example indicated in fig3 , in a lower spatial frequency band the magnification linearly increases as the spatial frequency increases until it surpasses a predetermined spatial frequency , at which point the magnification is sustained at a constant ( the maximum magnification ). however , the relationship between the spatial frequency and the magnification is not restricted to the present example . further , the focusing image may be larger than the caf area , such that an area surrounding the caf area may be included . next with reference to the flowchart of fig4 , a focusing - image display operation of the present embodiment will be explained . note that the focusing - image display operation is carried out mainly by the controller 21 ( see fig1 ). the operations indicated in fig4 are carried out when a through - the - lens image ( live preview ) is displayed on the monitor . when an af request is detected in step s 100 , a caf operation is initiated in step s 102 . namely , a caf operation is carried out in cooperation with the af controller 19 by comparing the contrast between images captured successively within the caf area ( see fig1 ). when the caf operation of step s 102 is completed , whether or not a request for a focus - verification assist has been detected is determined in step s 104 . the focus - verification assist request designates whether or not to perform the above - mentioned magnifying control while a focusing image is displayed . for example , whether the request exists is determined by whether or not the focus - verification assist mode has been preset by a user . when it is determined that the focus - verification assist request does not exist , this process is immediately terminated and the normal through - the - lens operation or live preview starts . however when it is determined that the focus - verification assist request exists , the last image within the caf area during the caf operation of step s 102 is stored in memory ( not shown ) at step s 106 . the spatial frequency of the image stored in memory is then calculated and , for example , a magnification to the size of the through - the - lens image is determined with reference to a lookup table that corresponds to the graph in fig3 in step s 108 . in step s 110 the resolution of an image of the caf area , which is stored in the memory , is modified based on the magnification obtained in step s 108 and , in turn , the image is magnified and displayed on the monitor 17 ( see fig1 ). in step s 112 , a determination is made as to whether or not either the display of the focusing image on the monitor 17 has been canceled or a predetermined time has elapsed from the beginning of the display of the focusing image . the representation may be cancelled by the manipulation of a predetermined button ( not shown ) included in the switch group 22 and , for example , the predetermined time may be preset to approximately 2 seconds . the determination of step s 112 is repeated until either the display of the focusing image has been cancelled or the predetermined time has elapsed . when either one of these events occurs the focusing - image display operation is completed and the normal through - the - lens image display or live preview resumes . as described above , according to the present embodiment , a focusing image can be enlarged at an appropriate magnification associated with the spatial frequency of an object image and displayed on a monitor . note that only the pixel signals from the caf area within the effective pixel area may be read out to perform an accelerated caf operation . further , this caf operation and method of displaying the focusing - image in this invention may be combined , such that the size of a focusing - image displayed on the monitor may be determined from the spatial frequency of the caf area . further , although the present embodiment has been described for a single - lens reflex camera , the present invention is not restricted to a digital camera and may also be applied to a device , including a cell phone and the like , which is provided with a digital camera . although the embodiment of the present invention has been described herein with reference to the accompanying drawings , obviously many modifications and changes may be made by those skilled in this art without departing from the scope of the invention . the present disclosure relates to subject matter contained in japanese patent application no . 2010 - 200880 ( filed on sep . 8 , 2010 ), which is expressly incorporated herein , by reference , in its entirety .	6
the aforementioned ingredients of the nonaqueous component of the dental bleaching composition of the present invention is critical to the performance of the present invention . hydrogen peroxide is available to dentists in a thirty to thirty - five percent ( 30 %- 35 %) aqueous solution . the nonaqueous component of the composition of the present invention permits the dentist to prepare an active bleaching composition in a solid form , either as a paste or gel , for direct application to the teeth to be bleached , with the period of treatment initiated photo - optically for activating the composition and terminated by removal of the paste or gel from the treated teeth upon a visual color transformation after a fixed time period . the color transformation will occur only if hydrogen peroxide dissociates to a concentration of nascent oxygen sufficient to cause color transformation of the color indicator in the composition within that time frame the color indicator is , accordingly , for practical purposes , a critical component which must be compatible with the other components and yet provide a distinct , uniform color to the gel or paste composition , which will oxidize and transform to another color or become colorless in response to the level of activity , corresponding to the dissociation of concentrated hydrogen peroxide over a fixed time period . only guinea green and , to a lesser extent , phenolphthalin , has been found to satisfy this requirement of the invention . the concentration of guinea green in the gel or paste has little effect on its color transformation characteristic . it is thus a direct indicator of hydrogen peroxide activity . if the hydrogen peroxide used in forming the gel or paste was of a low concentration due to aging , no significant color change will occur in the time frame set for treating the patient , independent of the concentration of the color indicator in the gel . guinea green is a commercially available dye sold by the aldrich chemical company , having the chemical identity : ethyl [ 4 -( p -[ ethyl ( m - sulfobenzyl ) amino ]- alpha - phenylbenzylidene - 2 , 5 - cyclohexadien - 1 - ylidene ) ( m - sulfobenzyl ) ammonium hydroxide inner salt sodium salt . guinea green colors the composite material green and provides an identity of the activity level of the material by becoming colorless when sufficiently oxidized . if the hydrogen peroxide component has deteriorated due to age , insufficient oxidation will occur to neutralize the green color . it is at present difficult for a practicing dentist to know if the hydrogen peroxide supply in the dental office is active , since its activity is dependent upon storage time and temperature . it is also important to permit the hydrogen peroxide to penetrate the enamel in order to lighten the enamel of he teeth . the guinea green will neutralize to provide the total absence of color over a total treatment time period of from about five ( 5 ) to fifteen ( 15 ) minutes for the composition of the present invention . phenolphthalin is a colorless crystal derived from phenolphthalein which converts to a reddish color when sufficiently oxidized . this is a less preferred redox indicator . the concentration level of the color indicator is not a critical factor and , in fact , only a minor percent , of between 0 . 01 and 0 . 3 percent by volume , is all that is necessary to produce an intense color . the preferred ratio of the aqueous hydrogen peroxide component to the nonaqueous component is 50 to 100 parts by volume , with a more preferred ratio of 50 to 70 parts by volume , with 60 parts being optimum . stated otherwise , the preferred ratio is five parts of the nonaqueous powder to three parts hydrogen peroxide . the inert silica gelling agent in the nonaqueous component is preferably an amorphous fumed silica . fumed silica are silicon dioxide particles of extremely small size , substantially below one ( 1 ) micron . the preferred concentration of the silica gelling agent in the nonaqueous component is between fifty to eighty percent ( 50 %- 80 %) by volume , and is the major ingredient of this component , as well as of the gel or paste . another essential ingredient of the nonaqueous component is the incorporation of an accelerator for controlling the breakdown of hydrogen time period . the preferred accelerator is manganese sulfate monohydrate . &# 34 ; oxone ,&# 34 ; a potassium persulphinate product of the du pont corporation may also be used in combination , in instance the oxone functions as a co - catalyst . the range for use of each component of the accelerator is indicated in the table of examples . the dissociation of hydrogen peroxide is initiated , in accordance with the invention , by the use of a dental curing light . the optical energy accelerates the catalyst for activating and promoting the acceleration of free radical polymerization of hydrogen peroxide , and by use of a redox color indicator , as discussed heretofore , for timing the duration of the bleaching operation after it is initiated . preferably light energy in the visible spectrum of between 400 and 700 nanometers should be used to initiate the breakdown of hydrogen peroxide . the application of light energy may be maintained for the entire treatment period , but preferably at least about three minutes . the color indicator , as explained heretofore serves as a critical component for providing a visual indication of the completion of treatment , and as an indicator that the hydrogen peroxide was , in fact , active during treatment . as an alternative to manganese sulfate , ferrous sulfate may be used as the catalytic activator and at essentially the same concentration level . in fact , using ferrous sulfate , it is possible to activate the composition at room temperature without the application of visible light . however , in such case a quiescent period of at least about five to seven minutes is necessary before catalytic activity begins to become meaningful . thus , the ability to control the initiation of the operation is lost and much more time is necessary to complete treatment . accordingly , it is preferred to operate with the application of light energy which provides a more effective control over catalytic activity . manganese sulfate is preferred when applying light and has been found to be responsive to light energy , thereby accelerating catalytic activity during the application of light energy to provide a complete treatment in under ten to fifteen minutes . the remainder of the nonaqueous formulation is provided by a polymethylvinyl ether maleate potassium salt polymeric compound or cellulosics , preferably selected from the class consisting of carboxymethyl cellulose , hydroxyethyl cellulose and sodium cellulose sulfate . the preferred compound is sold under the trademark name gantrez ( ms - 955 ) by the gaf corporation of new jersey . the polymethylvinyl ether maleate potassium salt or celulosic ether compound is also essential to the nonaqueous formulation , and provides thermoplasticity and thickening properties to the paste or gel composition formed with hydrogen peroxide , so as to permit the paste to be built up upon the teeth to be bleached and remain essentially erect , i . e ., the material does not sag or slump during the treatment period . it also slows drying of the composition to maintain the level of activity on the tooth surface throughout the treatment time period . it is important that the gel or paste remain aqueous for the entire treating period and yet remain physically stationary and in place on the tooth surface to permit maximum surface interaction and prevent gingival damage . it is postulated that the hydrogen peroxide must penetrate the enamel of the tooth while dissociating to maximize bleaching . the combination of the silica gelling agent and the cellulose ether compound represents the major constituents of the nonaqueous formulation , and preferably should equal at least about eighty percent ( 80 %) of such composition . the following table indicates the preferred range for each constituent in the nonaqueous component and illustrates eight ( 8 ) examples of varying concentrations for the constituents , with example number ( 1 ) being the preferred composition . in the other seven examples , one element is eliminated or modified , with the other constituents adjusted relative to example number ( 1 ) functioning as the control for comparison purposes : table______________________________________constituent range ( percent ) ______________________________________ ( a ) silica absorbent gelling agent 50 - 75 ( b ) ( 1 ) manganese sulfate monohydrate 2 - 10 ( 2 ) oxone 0 - 10 ( 3 ) ferrous sulfate 2 - 10 ( c ) gantrez remainder to 25 ( d ) guinea green 0 . 01 - 0 . 3______________________________________ ______________________________________consti - examplestuent ( 1 ) ( 2 ) ( 3 ) ( 4 ) ( 5 ) ( 6 ) ( 7 ) ( 8 ) ( 9 ) ______________________________________ ( a ) 70 70 70 70 30 100 70 70 70 ( b - 1 ) 4 . 8 1 . 8 4 . 8 0 4 . 8 4 . 8 4 . 8 4 . 8 --( b - 2 ) 5 . 75 0 5 . 75 5 . 75 5 . 75 5 . 75 5 . 75 15 . 0 --( b - 3 ) -- -- -- -- -- -- -- -- 4 ( c ) 19 . 24 19 . 24 0 19 . 24 19 . 24 19 . 24 30 19 . 24 19 . 24 ( d ) 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1______________________________________ the formulation of example one ( 1 ) was the easiest to mix and apply . the composition did not dry out during bleaching . the process required three ( 3 ) to five ( 5 ) minutes of light activation and a total of about ten ( 10 ) minutes until the color changed from green to white . the formulation was applied to a stained tooth with the stain appreciably reduced upon completion of the process . examples three ( 3 ), six ( 6 ), and seven ( 7 ) were failures in that the material dried too quickly and did not appear to bleach as well . example five ( 5 ) did not form a satisfactory paste or gel and , accordingly , was too difficult to apply . examples two ( 2 ) and four ( 4 ) provided results similar to example one ( 1 ), but took almost twice the time , indicating insufficient accelerator . example eight ( 8 ) appeared unstable during storage , indicating the presence of an excess of oxone . example nine ( 9 ) used no light and at room temperature ( 23 ° c .) began bubbling in six ( 6 ) minutes and turned light brown ( from green ) after nine minutes .	0
referring now to the figures of the drawing in detail and first , particularly , to fig1 thereof , there is shown schematically a scale 1 that is provided in an instrument cluster of a vehicle which has an internal combustion engine and is equipped with a coasting function , and it serves to indicate a current load condition of the internal combustion engine . the indication range of the scale 1 extends from a left - hand scale edge 2 , which is associated with the “ overrun ” operating condition of the internal combustion engine , and a right - hand scale edge 2 ′, which is associated with the “ full load ” operating condition of the internal combustion engine . a range of the scale 1 which is bounded by a left - hand limiting value gl and a right - hand limiting value gr defines a load condition range of the internal combustion engine which is preferred for entry to the coasting phase . a field 3 in the bar graph is filled in accordance with the current value of a parameter which characterizes the load condition of the internal combustion engine . the limiting values gl , gr are specified or determined in such a way that the adoption of the “ coasting ” driving condition , e . g . for reasons of economy or , for example , for technical reasons , so as to avoid load jumps when entering / emerging from the coasting function and hence to avoid exposing the drive train to excessive loads , is advantageous and / or necessary when the current value of the parameter which characterizes the load condition of the internal combustion engine is within the range between the limiting values gl , gr . an application can be used to provide a freely selectable graduation of the scale 1 . fig2 to 5 show the scale 1 from fig1 in the condition where it is indicating various different load conditions of the internal combustion engine . in all of fig1 to 7 , the operating point is indicated symbolically by a stylized cursor 5 . in particular , fig2 shows the scale 1 in the condition where it is indicating the “ full load in traction ” load condition of the internal combustion engine , fig3 shows the scale 1 in the condition where it is indicating the “ partial load in traction ” load condition of the internal combustion engine , fig4 shows the scale 1 in the condition where it is indicating the “ slight overrun ” load condition of the internal combustion engine , while fig5 shows the scale 1 in the condition where it is indicating the “ maximum overrun ” load condition of the internal combustion engine . to summarize , the driver can thus see at any time how close he is to the operating point or operating range of coasting , and can take this information into account in the deliberate selection of coasting operation . fig6 shows the scale 1 in the condition where it is indicating that the “ coasting ” function can be activated , i . e . the load condition of the internal combustion engine at that moment has a value at which the “ coasting ” function can be activated . a variable bar does not now appear on the scale 1 ; instead , the area of the field 3 between the left - hand scale edge 2 and the left - hand limiting value gl is filled in order in this way to indicate to the driver that the “ coasting ” function can be activated at this time . fig7 shows the scale 1 in the condition where it is indicating that the “ coasting ” function is active . again , a variable bar does not appear on the scale 1 ; instead , the area of the field 3 between the limiting values is now filled in order in this way to indicate to the driver that the “ coasting ” function is active . indication of the load condition can be activated and / or deactivated automatically in response to a user instruction or in a manner dependent on particular preconditions .	8
fig1 provides an overview of the processing completed by the system for the collaborative , on - line development and delivery of customized risk transfer programs . in accordance with the present invention , an automated method of and system ( 100 ) for collaborative , on - line development and delivery of customized risk transfer programs is provided . processing starts in this system ( 100 ) with the specification of system settings and the initialization and activation of software data “ bots ” ( 200 ) that extract , aggregate , manipulate and store the internal data , external data , customer ( 20 ) input and a customer financial model required for completing system processing . the data from external databases is used to analyze generic event risks and prices on investments for the asset classes and contingent liabilities specified by the system operator ( 21 ). in the preferred embodiment , the customer financial model is created using the system described in the cross referenced application ser . no . 10 / 747 , 471 as required to identify the impact of the different elements of value , external factors and risks on customer financial performance and value . however , any other method or system for developing this data could be used to the same effect . all required data is extracted via a network ( 45 ) from a basic financial system database ( 5 ), an external database ( 25 ), an advanced finance system database ( 30 ) and a customer database ( 35 ). these information extractions and aggregations may be influenced by a system operator ( 21 ) through interaction with a user - interface portion of the application software ( 700 ) that mediates the display , transmission and receipt of all information to and from browser software ( 800 ) such as the microsoft internet explorer or netscape navigator in an access device ( 90 ) such as a phone or personal computer that the customer ( 20 ) or system operator interact with . while only one basic financial system database ( 5 ), external database ( 25 ), advanced finance system database ( 30 ) and customer database ( 35 ) is shown in fig1 , it is to be understood that the system ( 100 ) can extract data from an unlimited number of databases and customers via the network ( 45 ). it also to be understood that the customer ( 20 ) and the system operator ( 21 ) can operate separate access devices ( 90 ). it should also be understood that it is possible to complete a bulk extraction of data from each database ( 5 , 25 , 30 and 35 ) via the network ( 45 ) using data extraction applications before initializing the data bots . the data extracted in bulk could be stored in a single datamart or data warehouse where the data bots could operate on the aggregated data . all extracted information is stored in a file or table ( hereinafter , table ) within an application database ( 50 ) as shown in fig2 . the application database ( 50 ) contains tables for storing input , extracted information and system calculations including an xml profile table ( 140 ), a bot date table ( 141 ), a customer table ( 142 ), a risk products table ( 143 ), a swaps table ( 144 ), a customer profile table ( 145 ), an exchange payout history table ( 146 ), an generic risk table ( 147 ), a liability scenario table ( 148 ), an asset position table ( 149 ), an external database table ( 150 ), an asset forecasts table ( 151 ), an asset correlation table ( 152 ), an scenario table ( 153 ), an exchange simulation table ( 154 ), a contingent capital table ( 155 ), an optimal exchange mix table ( 156 ) and an exchange premium history table ( 157 ) a system settings table ( 158 ), a metadata mapping table ( 159 ), a conversion rules table ( 160 ), a basic financial system table ( 161 ) and an advanced finance system table ( 162 ). other combinations of tables and files can be used to the same effect . the application database ( 50 ) can optionally exist on a hard drive , a datamart , data warehouse or departmental warehouse . the system described herein has the ability to accept and store supplemental or primary data directly from user input , a data warehouse or other electronic files in addition to receiving data from the customer databases described previously . as shown in fig3 , the preferred embodiment described herein is a computer system ( 100 ) illustratively comprised of a user - interface personal computer ( 110 ) connected to an application - server personal computer ( 120 ) via a network ( 45 ). the application server personal computer ( 120 ) is in turn connected via the network ( 45 ) to a database - server personal computer ( 130 ). the user interface personal computer ( 110 ) is also connected via the network ( 45 ) to an internet browser appliance ( 90 ) that contains browser software ( 800 ) such as microsoft internet explorer or netscape navigator . the database - server personal computer ( 130 ) has a read / write random access memory ( 131 ), a hard drive ( 132 ) for storage of the application database ( 50 ), a keyboard ( 133 ), a communications bus card containing all required adapters and bridges ( 134 ), a display ( 135 ), a mouse ( 136 ) and a cpu ( 137 ). the application - server personal computer ( 120 ) has a read / write random access memory ( 121 ), a hard drive ( 122 ) for storage of the non - user - interface portion of the enterprise portion of the application software ( 200 and 300 ) described herein , a keyboard ( 123 ), a communications bus containing all required adapters and bridges ( 124 ), a display ( 125 ), a mouse ( 126 ), a cpu ( 127 ) and a printer ( 128 ). while only one client personal computer is shown in fig3 , it is to be understood that the application - server personal computer ( 120 ) can be networked to fifty or more client personal computers ( 110 ) via the network ( 45 ). the application - server personal computer ( 120 ) can also be networked to fifty or more server , personal computers ( 130 ) via the network ( 45 ). it is to be understood that the diagram of fig3 is merely illustrative of one embodiment described herein as the system ( 100 ) and application software ( 200 , 300 and 700 ) could reside on a single computer or any number of computers that are linked together using a network . in a similar manner the system operator ( 21 ) and / or the customer ( 20 ) could interface directly with one or more of the computers in the system ( 100 ) instead of using an access device ( 90 ) with a browser ( 800 ) as described in the preferred embodiment . the user - interface personal computer ( 110 ) has a read / write random access memory ( 111 ), a hard drive ( 112 ) for storage of a client data - base ( 49 ) and the user - interface portion of the application software ( 700 ), a keyboard ( 113 ), a communications bus containing all required adapters and bridges ( 114 ), a display ( 115 ), a mouse ( 116 ), a cpu ( 117 ) and a printer ( 118 ). the application software ( 200 , 300 and 700 ) controls the performance of the central processing unit ( 127 ) as it completes the calculations required to support the collaborative development and implementation of a risk transfer program . in the embodiment illustrated herein , the application software program ( 200 , 300 and 700 ) is written in a combination of c ++ and visual basic ® although other languages can be used to the same effect . the application software ( 200 , 300 and 700 ) can use structured query language ( sql ) for extracting data from the different databases ( 5 , 25 , 30 and 35 ). the customer ( 20 ) and system operator ( 21 ) can optionally interact with the user - interface portion of the application software ( 700 ) using the browser software ( 800 ) in the browser appliance ( 90 ) to provide information to the application software ( 200 , 300 and 700 ) for use in determining which data will be extracted and transferred to the application database ( 50 ) by the data bots . user input is initially saved to the client database ( 49 ) before being transmitted to the communication bus card ( 124 ) and on to the hard drive ( 122 ) of the application - server computer via the network ( 45 ). following the program instructions of the application software , the central processing unit ( 127 ) accesses the extracted data and user input by retrieving it from the hard drive ( 122 ) using the random access memory ( 121 ) as computation workspace in a manner that is well known . the computers ( 110 , 120 and 130 ) shown in fig3 illustratively are ibm pcs or clones or any of the more powerful computers ( such as mainframe computers ) or workstations that are widely available . typical memory configurations for client personal computers ( 110 ) used with the present invention should include at least 512 megabytes of semiconductor random access memory ( 111 ) and at least a 100 gigabyte hard drive ( 112 ). typical memory configurations for the application - server personal computer ( 120 ) used with the present invention should include at least 2056 megabytes of semiconductor random access memory ( 121 ) and at least a 250 gigabyte hard drive ( 122 ). typical memory configurations for the database - server personal computer ( 130 ) used with the present invention should include at least 4112 megabytes of semiconductor random access memory ( 131 ) and at least a 500 gigabyte hard drive ( 132 ). using the system described above , customer financial data is analyzed before a comprehensive risk management program is developed and implemented for each customer . the risk reduction program development is completed in two stages . as shown in fig5 the first stage of processing ( block 200 from fig1 ) programs bots to continually extract , aggregate , manipulate and store the data from user input , external databases ( 25 ) and customer databases ( 30 ) as required . bots are independent components of the application that have specific tasks to perform . as shown in fig6 the second stage of processing ( block 300 from fig1 ) analyzes customer risk profiles , determines the optimal risk transfer program for each customer , sets prices and communicates with each customer as required to complete risk reduction program development and implementation . the processing described in this application for identifying the optimal risk transfer program for each customer can optionally be completed at the enterprise level ( as shown in the cross referenced application ser . no . 09 / 688 , 983 ) before data is transmitted to the system of the present invention . the flow diagrams in fig5 details the processing that is completed by the portion of the application software ( 200 ) that obtains systems settings from the system operator ( 21 ) before extracting , aggregating and storing the information required for system operation from a basic financial system database , an external database ( 25 ), and advanced finance system database ( 30 ) and a customer database ( 35 ). system processing starts in a block 201 , fig5 a , which immediately passes processing to a software block 202 . the software in block 202 prompts the system operator ( 21 ) via the system settings data window ( 701 ) to provide system setting information . the system setting information entered by the system operator ( 21 ) is transmitted via the network ( 45 ) back to the application server ( 120 ) where it is stored in the system settings table ( 158 ) in the application database ( 50 ) in a manner that is well known . the specific inputs the system operator ( 21 ) is asked to provide at this point in processing are shown in table 1 . the software in block 202 uses the current system date to determine the time periods ( months ) that require data to complete the development of risk transfer programs . after the date range is calculated , it is stored in the system settings table ( 158 ). in the preferred embodiment data is obtained for the three year period before and the three year forecast period after the current date . the system operator ( 21 ) also has the option of specifying the data periods that will be used for completing system calculations . after the storage of system setting data is complete , processing advances to a software block 203 . the software in block 203 prompts the system operator ( 21 ) via the metadata and conversion rules window ( 702 ) to map metadata using the standard previously specified by the system operator ( 21 ) ( xml , microsoft open information model or the metadata coalitions specification ) from the basic financial system database ( 5 ), the external database ( 25 ), the advanced financial system database ( 30 ) and the customer database ( 35 ) to the enterprise hierarchy stored in the system settings table ( 158 ) and to the pre - specified fields in the metadata mapping table ( 159 ). pre - specified fields in the metadata mapping table include , the revenue , expense and capital components and sub - components for the exchange and pre - specified fields for expected value drivers . because the bulk of the information being extracted is financial information , the metadata mapping often takes the form of specifying the account number ranges that correspond to the different fields in the metadata mapping table ( 159 ). table 2 shows the base account number structure that the account numbers in the other systems must align with . for example , using the structure shown below , the revenue component for the enterprise could be specified as enterprise 01 , any department number , accounts 400 to 499 ( the revenue account range ) with any sub - account . as part of the metadata mapping process , any database fields that are not mapped to pre - specified fields are defined by the system operator ( 21 ) as component of value , elements of value or non - relevant attributes and “ mapped ” in the metadata mapping table ( 159 ) to the corresponding fields in each database in a manner identical to that described above for the pre - specified fields . after all fields have been mapped to the metadata mapping table ( 159 ), the software in block 203 prompts the system operator ( 21 ) via the metadata and conversion rules window ( 702 ) to provide conversion rules for each metadata field for each data source . conversion rules will include information regarding currency conversions and conversion for units of measure that may be required to accurately and consistently analyze the data . the inputs from the system operator ( 21 ) regarding conversion rules are stored in the conversion rules table ( 160 ) in the application database ( 50 ). when conversion rules have been stored for all fields from every data source , then processing advances to a software block 204 . the software in block 204 checks the bot date table ( 141 ) and deactivates any basic financial system data bots with creation dates before the current system date and retrieves information from the system settings table ( 158 ), metadata mapping table ( 159 ), conversion rules table ( 160 ), the asset position table ( 149 ) and the basic financial system table ( 161 ). the software in block 204 then initializes data bots for each field in the metadata mapping table ( 159 ) that mapped to the basic financial system database ( 5 ) in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). bots are independent components of the application that have specific tasks to perform . in the case of data acquisition bots , their tasks are to extract and convert data from a specified source and then store it in a specified location . each data bot initialized by software block 204 will store its data in the asset position table ( 149 ) or the basic financial system table ( 161 ). every data acquisition bot for every data source contains the information shown in table 3 . after the software in block 204 initializes all the bots for the basic financial system database , the bots extract and convert data in accordance with their preprogrammed instructions in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). as each bot extracts and converts data from the basic financial system database ( 5 ), processing advances to a software block 209 before the bot completes data storage . the software in block 209 checks the basic financial system metadata to see if all data for all fields have been extracted and that there are metadata assignments for all extracted data . if the software in block 209 finds no unmapped data fields , then the extracted , converted data are stored in the asset position table ( 149 ) or the basic financial system table ( 161 ). alternatively , if there are unmapped data fields , then processing advances to a block 211 . the software in block 211 prompts the system operator ( 21 ) via the metadata and conversion rules window ( 702 ) to provide metadata and conversion rules for each new field . the information regarding the new metadata and conversion rules is stored in the metadata mapping table ( 159 ) and conversion rules table ( 160 ) while the extracted , converted data are stored in the asset position table ( 149 ) or the basic financial system table ( 161 ). it is worth noting at this point that the activation and operation of bots where all the fields have been mapped to the application database ( 50 ) continues . only bots with unmapped fields “ wait ” for user input before completing data storage . the new metadata and conversion rule information will be used the next time bots are initialized in accordance with the frequency established by the system operator ( 21 ). in either event , system processing passes on to a software block 221 . the software in block 221 checks the bot date table ( 141 ) and deactivates any external database data bots with creation dates before the current system date and retrieves information from the generic risk table ( 147 ), external database table ( 150 ), system settings table ( 158 ), metadata mapping table ( 159 ) and conversion rules table ( 160 ). the software in block 221 then initializes data bots for each field in the metadata mapping table ( 159 ) that mapped to the external database ( 25 ) in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). bots are independent components of the application that have specific tasks to perform . in the case of data acquisition bots , their tasks are to extract and convert data from a specified source and then store it in a specified location . each data bot initialized by software block 221 will store its data in the generic risk table ( 147 ) or the external database table ( 150 ). after the software in block 221 initializes all the bots for the advanced finance system database , the bots extract and convert data in accordance with their preprogrammed instructions in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). as each bot extracts and converts data from the external database ( 25 ), processing advances to a software block 209 before the bot completes data storage . the software in block 209 checks the advanced finance system metadata to see if all data for all fields have been extracted and that there are metadata assignments for all extracted data . if the software in block 209 finds no unmapped data fields , then the extracted , converted data are stored in the generic risk table ( 147 ) or external database table ( 150 ). alternatively , if there are unmapped data fields , then processing advances to a block 211 . the software in block 211 prompts the system operator ( 21 ) via the metadata and conversion rules window ( 702 ) to provide metadata and conversion rules for each new field . the information regarding the new metadata and conversion rules is stored in the metadata mapping table ( 159 ) and conversion rules table ( 160 ) while the extracted , converted data are stored in the generic risk table ( 147 ) or external database table ( 150 ). it is worth noting at this point that the activation and operation of bots where all the fields have been mapped to the application database ( 50 ) continues . only bots with unmapped fields “ wait ” for user input before completing data storage . the new metadata and conversion rule information will be used the next time bots are initialized in accordance with the frequency established by the system operator ( 21 ). in either event , system processing passes on to a software block 225 . the software in block 225 checks the bot date table ( 141 ) and deactivates any advanced finance system data bots with creation dates before the current system date and retrieves information from the system settings table ( 158 ), metadata mapping table ( 159 ), conversion rules table ( 160 ) and advanced finance system table ( 162 ). the software in block 225 then initializes data bots for each field in the metadata mapping table ( 159 ) that mapped to the advanced finance system database ( 30 ) in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). bots are independent components of the application that have specific tasks to perform . in the case of data acquisition bots , their tasks are to extract and convert data from a specified source and then store it in a specified location . each data bot initialized by software block 225 will store its data in the asset position table ( 149 ) or the advanced finance system table ( 162 ). after the software in block 225 initializes all the bots for the advanced finance system database , the bots extract and convert data in accordance with their preprogrammed instructions in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). as each bot extracts and converts data from the basic financial system database ( 5 ), processing advances to a software block 209 before the bot completes data storage . the software in block 209 checks the advanced finance system metadata to see if all data for all fields have been extracted and that there are metadata assignments for all extracted data . if the software in block 209 finds no unmapped data fields , then the extracted , converted data are stored in the asset position table ( 149 ) or the advanced finance system table ( 162 ). alternatively , if there are unmapped data fields , then processing advances to a block 211 . the software in block 211 prompts the system operator ( 21 ) via the metadata and conversion rules window ( 702 ) to provide metadata and conversion rules for each new field . the information regarding the new metadata and conversion rules is stored in the metadata mapping table ( 159 ) and conversion rules table ( 160 ) while the extracted , converted data are stored in asset position table ( 149 ) or the advanced finance system table ( 162 ). it is worth noting at this point that the activation and operation of bots where all the fields have been mapped to the application database ( 50 ) continues . only bots with unmapped fields “ wait ” for user input before completing data storage . the new metadata and conversion rule information will be used the next time bots are initialized in accordance with the frequency established by the system operator ( 21 ). in either event , system processing passes on to a software block 226 . the software in block 226 checks the bot date table ( 141 ) and deactivates any customer database data bots with creation dates before the current system date and retrieves information from the system settings table ( 158 ), metadata mapping table ( 159 ), conversion rules table ( 160 ) and customer table ( 142 ). the software in block 226 then initializes data bots for each field in the metadata mapping table ( 159 ) that mapped to the customer database ( 35 ) in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). bots are independent components of the application that have specific tasks to perform . in the case of data acquisition bots , their tasks are to extract and convert data from a specified source and then store it in a specified location . each data bot initialized by software block 226 will extract the model of customer financial performance by element of value , factor and risk and the confidence interval for risk reduction programs specified by the customer . the bot will then store this data in the customer profile table ( 145 ). after the software in block 226 initializes all the bots for the advanced finance system database , the bots extract and convert data in accordance with their preprogrammed instructions in accordance with the frequency specified by system operator ( 21 ) in the system settings table ( 158 ). as each bot extracts and converts data from the customer database ( 25 ), processing advances to a software block 209 before the bot completes data storage . the software in block 209 checks the advanced finance system metadata to see if all data for all fields have been extracted and that there are metadata assignments for all extracted data . if the software in block 209 finds no unmapped data fields , then the extracted , converted data are stored in the customer profile table ( 145 ). alternatively , if there are unmapped data fields , then processing advances to a block 211 . the software in block 211 prompts the system operator ( 21 ) via the metadata and conversion rules window ( 702 ) to provide metadata and conversion rules for each new field . the information regarding the new metadata and conversion rules is stored in the metadata mapping table ( 159 ) and conversion rules table ( 160 ) while the extracted , converted data are stored in the customer profile table ( 145 ). it is worth noting at this point that the activation and operation of bots where all the fields have been mapped to the application database ( 50 ) continues . only bots with unmapped fields “ wait ” for user input before completing data storage . the new metadata and conversion rule information will be used the next time bots are initialized in accordance with the frequency established by the system operator ( 21 ). in either event , system processing passes on to software block 301 . the flow diagram in fig6 details the processing that is completed by the portion of the application software ( 300 ) that analyzes information from a number of customers and arranges for risk “ swaps ” and / or the sale of risk transfer products to each customer at a price that meets the profit goals and reserve requirements of the company operating the risk exchange . the description below will follow the processing and activities of the system described herein when one new customer profile is transmitted to the exchange . system processing in this portion of the application software ( 300 ) begins in a block 302 . the software in block 302 checks the bot date table ( 141 ) and deactivates any transfer bots with creation dates before the current system date for the customer transmitting data to the exchange . the software in block 302 then retrieves the information from the xml profile table ( 140 ), the customer table ( 142 ), the risk products table ( 143 ), the swaps table ( 144 ) and the customer profile table ( 145 ) as required to initialize transfer bots for the customer transmitting a summary profile to the exchange . bots are independent components of the application that have specific tasks to perform . in the case of transfer bots , their primary tasks are to identify swaps , existing product and new products that can be used to satisfy the risk transfer needs of the customer transmitting data to the exchange . for example , if one customer has a significant risk from oil prices dropping ( a heating oil company , for example ) and another customer faces a significant risk when oil prices rise ( a trucking company , for example ), then the transfer bot will identify the offsetting risk factors and record a swap . if the risk transfer can be completed by both an existing risk transfer product and a swap , then preference is given to the swap . every transfer bot contains the information shown in table 4 . after the transfer bot identifies the swaps , existing products and new products that will satisfy the needs of the enterprise for risk transfer the results are saved to the application database ( 50 ). information on swaps is saved on the swaps table ( 144 ) and the customer profile table ( 145 ) and information on new products is saved in the risk products table ( 143 ) without a price . the price for new products will be established later in the processing . after data storage is complete , processing advances to a software block 305 . the software in block 305 checks the bot date table ( 141 ) and deactivates any liability scenario bots with creation dates before the current system date . the software in block 305 then retrieves the information from the xml profile table ( 140 ), the customer table ( 142 ), the risk products table ( 143 ), the swaps table ( 144 ), the customer profile table ( 145 ), the exchange payout history table ( 146 ), the generic risk table ( 147 ) and the exchange premium history table ( 156 ) as required to initialize new liability scenario bots . bots are independent components of the application that have specific tasks to perform . in the case of liability scenario bots , their primary tasks are to create a series of scenarios estimating the net payout ( premiums minus payout = net payout ) associated the risks that may be transferred via swaps or insurance from all customers . there are two types of scenarios developed at this stage of processing , normal scenarios and extreme scenarios . the scenarios are developed by combining the information and statistics from summary profiles transmitted by the customers of the exchange with the exchange payout history , the exchange premium history and generic risk information obtained from the external database ( 25 ). every liability scenario bot activated in this block contains the information shown in table 5 . after the liability scenario bots are initialized , they retrieve the required information from the xml profile table ( 140 ), the customer table ( 142 ), the risk products table ( 143 ), the swaps table ( 144 ), the customer profile table ( 145 ), the exchange payout history table ( 146 ), the generic risk table ( 147 ), the external database table ( 150 ), the basic financial system table ( 161 ), the advanced finance system table ( 162 ) and the exchange premium history ( 156 ) before generating a series of net payout scenarios that are appropriate for the type of analysis being completed — extreme or normal . the bot saves the scenarios in the liability scenario table ( 148 ) in the application database ( 50 ) and processing advances to a block 309 . the software in block 309 continually completes analyses similar to those completed by the analysis bots in the enterprise portion of the cross referenced application ser . no . 10 / 747 , 471 . the software in this block uses the publicly available information stored in the external database table ( 150 ) to complete the analyses shown in table 6 for each equity investment listed in the asset position table ( 149 ) and described in data obtained from the external database ( 25 ). the results of the first three forecasts ( items 2 , 3 and 4 from table 6 ) are saved in the asset forecasts table ( 151 ) in the application database ( 50 ) and the market value factors ( item 1 from table 6 ) are saved with the appropriate equity in the asset position table ( 149 ). the software in this block uses the publicly available information stored in the external database table ( 150 ) to complete the analyses shown in table 6 for each income generating investments ( i . e . bonds or real estate ) listed in the asset position table ( 149 ) and described in data obtained from the external database ( 25 ). the software in block 309 then analyzes the covariance between the causal factors for each of the assets to determine the covariance between these assets under both normal and extreme conditions . the results of these analyses are then stored in the asset correlation table ( 152 ) before processing advances to a block 310 . the software in block 310 checks the bot date table ( 141 ) and deactivates any scenario bots with creation dates before the current system date . the software in block 310 then retrieves the information from the asset position table ( 149 ), the external database table ( 150 ) and the asset correlation table ( 152 ) as required to initialize the scenario bots . bots are independent components of the application that have specific tasks to perform . in the case of scenario bots , their primary task is to identify likely scenarios for the evolution of the causal market value factors . the scenario bots use information from the external databases to obtain forecasts for individual causal factors before using the covariance information stored in the asset correlation table ( 152 ) to develop scenarios for the other causal factors under normal and extreme conditions . every scenario bot activated in this block contains the information shown in table 7 . after the scenario bots are initialized , they retrieve the required information and develop a variety of normal and extreme scenarios as described previously . after the scenario bots complete their calculations they save the resulting scenarios in the scenario table ( 153 ) in the application database ( 50 ) and processing advances to a block 311 . the software in block 311 checks the bot date table ( 141 ) and deactivates any net capital scenario bots with creation dates before the current system date . the software in block 311 then retrieves the information from the liability scenario table ( 148 ), and the scenario table ( 153 ) as required to initialize net capital scenarios bots . bots are independent components of the application that have specific tasks to perform . in the case of net capital scenario bots , their primary task is to run four different types of simulations for the exchange . the net capital scenario bots run monte carlo simulations of the exchange financial performance using the two types of scenarios generated by the asset and liability scenario bots — normal and extreme . the net capital scenario bots also run an unconstrained genetic algorithm simulation that evolves to the most negative scenario and simulations specified by regulatory agencies . every net capital scenario bot activated in this block contains the information shown in table 8 . after the net capital scenario bots are initialized , they retrieve the required information and simulate the financial performance of the risk exchange under the different scenarios . after the net capital scenarios complete their calculations , the resulting forecasts are saved in the exchange simulation table ( 154 ) in the application database ( 50 ) and processing advances to a block 312 . the software in block 312 checks the bot date table ( 141 ) and deactivates any asset optimization bots with creation dates before the current system date . the software in block 312 then retrieves the information from the asset position table ( 149 ), the external database table ( 150 ), the asset forecasts table ( 151 ), the asset correlation table ( 152 ), the scenario table ( 153 ), the exchange simulation table ( 154 ) and the advanced finance systems table ( 162 ) as required to initialize asset optimization bots . bots are independent components of the application that have specific tasks to perform . in the case of asset optimization bots , their primary task is to determine the optimal mix of assets and contingent capital purchases ( purchase reinsurance and / or other contingent capital purchases , etc .) for the exchange under each scenario using a linear programming optimization algorithm that is constrained by any limitations imposed by regulatory requirements . a multi - criteria optimization is also run at this stage to determine the best mix for maximizing value under combined normal and extreme scenarios . a penalty function for asset liability mismatch can be added as required to minimize the difference between asset and liability lives . other optimization algorithms can be used at this point to achieve the same result . every asset optimization bot activated in this block contains the information shown in table 9 . after the asset optimization bots complete their analyses , the resulting asset and contingent capital mix for each set of scenarios and the combined analysis is saved in the optimal exchange mix table ( 156 ) in the application database ( 50 ) and the revised simulations are saved in the exchange simulation table ( 154 ) before processing passes to a software block 313 . the software in block 313 prepares and displays the optimal mix of asset purchases , asset sales and contingent capital purchases for the normal , extreme and combined scenario analysis using the optimal mix review window ( 703 ). the optimal mix for the normal and extreme scenarios are determined by calculating the weighted average sum of the different scenarios where the weighting is determined by the relative likelihood of the scenario . the display identifies the optimal mix from the combined analysis as the recommended solution for exchange value maximization . at this point , the system operator ( 21 ) is given the option of : 1 ) editing ( adding or deleting products and activities ) from the recommended solution ; 3 ) selecting and then editing the optimal mix from the normal scenarios ; 5 ) selecting and then editing the optimal mix from the extreme scenarios ; or after the system operator ( 21 ) has finished the review and the optional edit of the selected mix , any changes are saved in the optimal exchange mix table ( 156 ) in the application database ( 50 ) before processing advances to a software block 314 . the software in block 314 compares the new optimal mix to the existing asset position stored in the asset position table ( 149 ) and orders are generated to purchase assets , sell assets and / or purchase contingent capital as required to bring the current asset position in line with the new optimal mix . these orders are then transmitted via a network ( 45 ) to other institutions and exchanges on the internet ( 40 ). when the order confirmations are received , the asset position table ( 149 ) is updated with the new information and processing advances to a block 315 . it is worth noting at this point that the processing described for the previous blocks in this section ( 302 , 305 , 109 , 310 , 311 , 312 , 313 and 314 ) could also be used to manage an investment portfolio on a stand alone basis . the software in block 315 prepares and displays the proposed prices for the risk transfer products and the swaps that are going to be offered to the customer using the price review window ( 704 ). the list prices from the risk products table ( 143 ) are used for the existing risk products . pricing for swaps are calculated by marking up the cost of the swap by a standard percentage . the software in block 315 marks up the calculated breakeven price for any new risk transfer products that were proposed by the bots in block 302 . at this point , the system operator ( 21 ) is given the option of : 1 ) editing the recommended prices for any and all of the risk transfers — swaps , existing products and new products ; 3 ) removing some of swaps and / or risk transfer products from the list . after the system operator ( 21 ) completes the review , all price changes and the prices for any new risk transfer products are saved in the risk products table ( 143 ) before processing advances to a block 316 . the software in block 316 continually runs an analysis to define the optimal risk reduction strategy for the normal and extreme scenarios for each customer . it does this by first retrieving data from the xml profile table ( 140 ), the customer table ( 142 ), the risk products table ( 143 ), the swaps table ( 144 ), the customer profile table ( 145 ), the exchange payout history table ( 146 ), the generic risk table ( 147 ), the external database table ( 150 ) and the scenario table ( 153 )— the information required to initialize the optimization algorithm . the software in the block uses a linear program that uses the financial model for each customer under the range of conditions expected for each scenario to determine the optimal risk transfer program ( swaps , derivative purchases , insurance purchases , etc .) within the specified confidence interval ( the confidence interval specified by the system operator ( 21 ) is used if the customer has not specified a confidence interval ). a multi criteria optimization determines the best mix for reducing the risk under a combined normal and extreme scenario . other optimization algorithms and simulations can be used at this point to the same effect . the optimizations consider the effect of changes in the cost of capital on the optimal risk transfer solution . the resulting mix of product purchases and swaps for each scenario ( normal and extreme ) and the combined analysis is saved in the customer profile table ( 145 ) in the application database ( 50 ) before processing passes to a software block 317 . the shadow prices from these optimizations are also stored in the risk products table ( 143 ) for use in identifying new risk reduction products that the system operator ( 21 ) may choose to offer at a later date . this information can also be used to modify pricing by customer . the software in block 317 uses the customer interface window ( 705 ) to display the information regarding the optimal risk transfer program for the customer and the pricing for the products and swaps that will be used to transfer the risks identified in the optimal risk transfer program . this information could optionally be transmitted to the customer in a summary xml format that is similar to the one initially transmitted to the exchange by the customer . the customer ( 20 ) can reject , edit and / or accept the proposed mix of products and swaps that are displayed . the software in block 317 accepts and confirms orders , updates the information contained in the risk products table ( 143 ), the swaps table ( 144 ), the customer profile table ( 145 ) and the exchange premium history table ( 157 ) to reflect the accepted and confirmed orders . the software in block 317 also accepts input from the customer ( 20 ) regarding any new losses that the customer may have experienced . the software in block 317 verifies the loss is for an insured risk , updates the customer profile table ( 145 ), updates the exchange payout history table ( 146 ) and arranges for payment of the claim in a manner that is well known . this processing is continues until the customer ( 20 ) indicates that the session is complete . system processing advances to a software block 318 . the software in block 318 checks the system settings table ( 158 ) to determine if the system ( 100 ) is operating in continuous mode . if the system is operating in a continuous mode , then processing returns to block 205 and the processing described above is repeated . alternatively , if the system is not operating in continuous mode , then processing advances to a software block 320 and stops . thus , the reader will see that the system and method described above transforms extracted transaction data , corporate information , information from external databases and information from the internet into detailed risk analyses and risk transfer programs specifically tailored to each customer using the system . the level of detail , breadth and speed of the risk analysis allows customers and managers of the system to manage their risks in a fashion that is superior to the method currently available to users of existing risk analysis systems and traditional insurance products . because the profiles used in the system ( 100 ) provide a comprehensive picture of the financial status of the companies transferring risk through the exchange , the system and method described herein can be used with essentially no modifications to provide an on - line transfer system for : the system described herein could be used to manage transfers of ownership rights alone or in combination with foreign exchange , liquidity and risk . while the above description contains many specificity &# 39 ; s , these should not be construed as limitations on the scope of the invention , but rather as an exemplification of one preferred embodiment thereof . accordingly , the scope of the invention should be determined not by the embodiment illustrated , but by the appended claims and their legal equivalents .	6
dipropylene glycol mono ( c 1 - 6 - alkyl ) ethers have a high thermal expansion coefficient , which substantially facilitates the adjustment of the floating bodies . the ethers according to the invention are environmentally compatible , non - toxic or non - skin - irritant ( the structurally very similar free dipropylene glycols are used as components of cosmetic compositions ; the compatibility of the ethers according to the invention is very similar to that of free dipropylene glycol ). due to the mixability of the ether compounds according to the invention with water , the flash point may be decreased or completely eliminated . in their broadest configuration , the solution proposed by the invention is a buoyancy liquid for a galilean thermometer which comprises at least one dipropylene glycol mono ( c 1 - 6 - alkyl ) ether . the present invention also provides a galilean thermometer comprising a buoyancy liquid which comprises at least one dipropylene glycol mono ( c 1 - 6 - alkyl ) ether . likewise , the present invention provides a method of preparing a galilean thermometer , comprising utilizing at least one dipropylene glycol mono ( c 1 - 6 - alkyl ) ether . in one embodiment the buoyancy liquid has the following structure wherein r is a c 1 - 6 - alkyl group : the dipropylene glycol mono ( c 1 - 6 - alkyl ) ether comprised by the present invention may be a single compound or a mixture of a plurality of compounds . the c 1 - 6 - alkyl group comprises the substituents methyl , ethyl , propyl , butyl , pentyl and hexyl , with all constitutional isomer groups being contained , such as e . g . : n - propyl , isopropyl , n - butyl , i - butyl , t - butyl and correspondingly branched embodiments of the c 5 and c 6 alkyl groups . the invention further comprises the possible constitutional isomers of the dipropylene glycol structure . dipropylene glycol is formed by condensation of two molecules of propylene glycol being present in two constitutional isomers , namely 1 , 2 - propylene glycol and 1 , 3 - propylene glycol . according to the invention , the ether may comprise the derivatives of dipropylene glycol of two identical propylene glycol units , as well as also mixture derivatives obtained from , for example , 1 , 2 - propylene glycol and 1 , 3 - propylene glycol . the latter may in turn be divided in two structural subgroups depending on which of the two hydroxyl groups , remaining in the propylene glycol dimmer , is etherified by the c 1 - 6 - alkyl group . preferred , according to the invention , are mono alkyl ethers of di ( 1 , 2 - propylene glycol ). also preferred are compounds in which the c 1 - 6 - alkyl group represents a methyl or a butyl group . especially preferred are the di ( 1 , 2 - propylene glycol ) mono methyl ethers and butyl ethers . these may be used as an individual chemical compound or as an isomer mixture of the above - described kind . an especially preferred example for practical application is di ( 1 , 2 - propylene glycol ) monomethyl ether which is available on the market as a mixture of constitutional isomers , for example under the trade name dowanol dpm ® of dow chemical ( available in germany from the company brenntag gmbh , 34250 lohfelden ). according to a further preferred embodiment of the invention , the ether is used in the form of a mixture with water . the addition of water increases the flash point of the buoyancy liquid , thereby decreasing the hazard of fire when it is handled or when it is unintentionally released from the thermometer . the amount of water is preferably of from about 3 to about 50 parts by weight ( in the following pbw ), relative to 100 pbw of the ether component . within this range , a satisfying increase of the flash temperature is obtained , on the one hand , and the thermal extension coefficient is maintained on a sufficiently high level for a simple adjustment of the floating bodies , on the other hand . the water amount is preferably of from about 5 to about 20 pbw , more preferably of from about 7 to about 15 pbw , relative to 100 pbw of the ether component . the optimum ratio between ether and water , with respect to the increase of the flash temperature , depends in each case on the ether selected . the optimum water amount for dipropylene glycol mono methyl ether is in the range of 9 weight - parts , approximately from 8 to 10 wt .-%. with these and higher amounts of water , the flash point completely disappears , i . e . when the flash point of pure ether at 73 ° c . is reached , as much water vapour appears together with the ether vapour that an ignition of the gaseous mixture in the common test procedure according to pensky - martens is no longer obtained . the test procedure according to pensky - martens is described in detail in the regulation en 22719 , european committee of standardization ( and iso 2719 , which are incorporated by reference herein ). thus , water proportions of approximately from 8 to 10 pbw are especially preferred . the above - defined dipropylene glycol ethers have the tendency to become slowly decomposed by irradiation with light in the visible and / or ultraviolet range . for this reason , the buoyancy liquid of the galilean thermometer according to the invention advantageously comprises a stabilizer . the character of the stabilizer is not specially limited as long as it is dissolvable in the buoyancy liquid and effectively prevents its decomposition . the amount of the stabilizer is not particularly limited either . practically , the stabilizer amount is advantageously from about 30 to about 80 parts per million ( ppm ) ( by weight , relative to the weight of the ether component ), more preferably from about 40 to about 70 ppm , and most preferably from about 50 to about 60 ppm . for example , in one particular example , the buoyancy liquid of the present invention comprises 100 parts by weight of a mixture of at least one isomer of diproplylene glycol monomethyl ether , from about 8 to about 12 parts by weight of water , and bht as a stabilizer . in the following , examples of buoyancy liquids according to the present invention are indicated , which are most preferred : the buoyancy liquid of the galilean thermometer according to the invention may further contain other additives in usual amounts , such as e . g . dyes , wetting agents , or density modifying agents .	6
fig1 shows a double - skin building panel of this invention including facing sheet 11 , a liner sheet 12 and structural thermal insulation 13 which is adhesively secured to the inner surfaces of the facing sheet 11 and liner sheet 12 . each panel 10 has a first edge 14 and a second edge 15 . in general , the liner sheets 12 and facing sheets 11 are fabricated from metals such as painted steel , aluminum , aluminized steel , stainless steel and the like in gauges of 26 gauge to about 14 gauge . most building panels have a metal thickness of 18 to 22 gauge . panels customarily have a width of 60 to 90 cm and are supplied in lengths from about 1 / 2 meter to about 12 meters . the panel thickness ranges from about 35 to 100 mm . customarily the liner sheet 12 has a flat surface as shown in fig1 except for the joint - forming features along each side of the liner sheet 12 . the liner sheet 12 may have small corrugations or other deformations for aesthetic or strengthening purposes . customarily the facing sheet 11 is a flat surface between the joint forming side edges as shown in fig1 . however , the facing sheet 11 may be suitably profiled for aesthetic purposes and to reduce the volume of each panel and thereby to reduce the amount of thermal insulation 13 which is required to complete the panel . a typical profiling pattern 11 &# 39 ; is shown in fig1 . the structural insulating material 13 preferably is foamed - in - place polyurethane foam having a density of 2 to 5 pcf . polyurethane foam provides excellent thermal insulation properties and also provides , when properly applied , excellent adhesion to the liner sheet 12 and the facing sheet 11 . it will be observed that the structural insulation terminates in a gap 16 , 17 at each edge of the panel 10 between the liner sheet 12 and the facing sheet 11 . other foamed substances may be employed to produce the present panel , for example , polyisocyanurate foam , preformed batts of thermal insulation such as polyurethane foam batts , polyisocyanurate batts , phenolic foam batts , expanded polystyrene batts , which are secured to the facing sheet 11 and liner sheet 12 by appropriate adhesive substances . a further type of structural thermal insulation which may be employed is honeycomb filler which is secured between the facing sheet 11 and liner sheet 12 by means of a suitable adhesive and wherein the first edge 14 and second edge 15 of the panel are filled with preformed , shaped insulating spacers or foamed - in - place plastics . the first edge 14 of the facing sheet 11 includes a first lateral corner 18 , a first sloping wall surface 19 , a first gutter 20 and a free edge 21 . the angle of the sloping wall surface 19 with respect to the plane of the facing sheet 11 is between 30 and 60 degrees , and is preferably determined by the geometry of the resulting joint which will permit the second panel to be connected to a first secured panel . the second edge 15 of the liner sheet 11 has a second lateral corner 22 , a second sloping wall surface 23 which is essentially parallel to the first sloping wall surface 19 . the second sloping wall surface 23 connects with a first shoulder 24 having a shoulder surface facing away from the facing sheet 11 . the first shoulder 24 connects with a first groove forming surface 25 which is essentially parallel with the facing sheet 11 and which connects to a first normal wall surface 26 which in turn connects to a first outboard flange 27 having a free edge 28 . the first outboard flange 27 is essentially parallel to the facing sheet 11 . the shoulder 24 , first groove forming surface 25 and a portion of the first normal wall surface 26 define a first groove 29 . it will be observed that the free edge 28 is located outboard from the second lateral corner 22 . the first edge 14 of the liner sheet 12 ends in a third lateral corner 30 from which a third normal surface 31 extends toward a second shoulder 32 having a shoulder surface facing away from the liner sheet 12 . the third shoulder connects to a second groove forming surface 33 which is essentially parallel to the liner sheet 12 . the second groove forming surface 33 connects to a fourth normal surface 34 which connects to a third groove forming surface 35 which is essentially parallel to the liner sheet 12 . the third groove forming surface 35 connects to a fifth normal surface 36 , a third shoulder 37 and a sixth normal surface 38 . the third shoulder faces the liner sheet 12 . the sixth normal surface 38 joins a second outboard flange 39 having a free edge 40 . the second outboard flange 39 is essentially parallel to the liner sheet 12 . it will be observed that the free edge 40 extends outboard beyond the third lateral corner 30 of the liner sheet 12 . a second groove 41 is formed by the second groove forming surface 33 , the fourth normal surface 34 , and the combination of the third groove forming surface 35 , the fifth normal surface 36 , and the third shoulder 37 . a third groove 42 is formed by the fourth normal surface 34 , the third groove forming surface 35 and the fifth normal surface 36 . the second edge 15 of the liner sheet 12 has a fourth lateral corner 43 and a seventh normal wall surface 44 which connects with a third outboard flange 45 terminating with a third sloping wall surface 46 and a hook - shaped cross - section member 47 having a free edge 48 . the first gap 16 and the second gap 17 preferably have a width of 3 to 12 mm to provide a thermal break between the liner sheet 12 and the facing sheet 11 . multiple panels of this invention are secured to a building framework by means of fasteners such as screws and associated bracket members of the type shown in fig3 . as shown in fig2 a first panel 10a is initially secured to a building framework designated generally by the numeral 49 which , in a typical building , would be a horizontal beam , girder or subgirt to which a threaded fastener 50 can be secured . the panels of this invention are particularly adapted to being assembled horizontally in which assembly the building structural element 49 is a column or vertical mullion . the first panel 10a is secured to the building framework 49 at its first edge ( not shown in fig2 ) and its second edge 15a is secured to the building framework 49 by means of the threaded fastener 50 which has an enlarged head portion 51 . the fastener 50 extends through a bracket 52 ( shown in fig3 ), the first groove forming surface 27 , a portion of the structural thermal insulation and thence through the liner sheet 12 into the building structure 49 . the bracket 52 as shown in fig3 is a rectangular plate having plural fastener receiving openings 53 and having at least one bent tab 54 which penetrates the structural thermal insulation through the second gap 17 and engages the inner surface of the liner sheet 12 adjacent to the fourth lateral corner 43 . the flat plate portion of the bracket 52 overlies the first outboard flange 27 and the third outboard flange 45 which are coplanar in the assembled panel . the secured bracket 52 provides a mechanical connection for both the facing sheet 11 and the liner sheet 12 with the building structure 49 . the first panel 10a is thus secured by means of a sufficient number of fasteners 50 and brackets 52 , spaced in accordance with the structural requirements of the building . typically fastening brackets are provided along the length of the panel connecting joint every one - to - five meters . the second panel 10b is next secured by introducing the second panel 10b at an angle to the plane of the building structure 49 whereby the shoulder 32 slides between the third outboard flange 45 and the building structure 49 . the panel 10b is pivoted until its liner sheet 12b engages the building structure 49 . the sloping wall surfaces 19 , 23 are in engagement and the lateral corners 18 , 22 are aligned . the seventh normal wall surface 44 is in confronting relation with the third normal wall surface 31 ; the lateral corners 30 , 43 are aligned . the second shoulder 32 bears against the inboard surface of the third outboard flange 45 ; the hook - shaped cross - section member 47 fits in the third groove 42 . the first end of the second panel 10b is thus secured . the installer proceeds to the second end of the panel 10b ( not shown ) and secures it in a similar fashion . a bead 55 of weather - resistant caulking material is provided in the gutter 20 before the panels are assembled . the bead 55 of weather - resistant caulking material forms a weathertight seal between the facing sheets 11a , 11b . a similar bead 56 of caulking material may be provided in the third groove 42 to provide a weathertight seal with the hook - shaped cross - section member 47 . it will be observed that any stresses which may be applied to the resulting building wall tending to cause disengagement of the joint or to cause opening of the joint will be mechanically resisted . separation of the facing sheets 11a , 11b is opposed by the overlapping connection of the gutter 20 with the first shoulder 24 . separation of the liner sheets 12a , 12b is resisted by the engagement of the hook - shaped surface 47 with the fifth normal surface 36 which defines the third groove 42 . because of the sloping surfaces 19 , 23 , any panel disengagement stresses tend to increase the engagement of the gutter 21 with the shoulder 24 and the engagement of the hook - shaped cross - section member 47 in the third groove 42 . the benefits of this invention may be achieved by eliminating the cross - section hook - shaped member 47 , the third sloping surface 46 and their functions . in this alternative construction , the panel disengaging stresses will be resisted by the engagement of the gutter 20 with the shoulder 24 . any outwardly applied disengaging stresses will be transferred in a direction which increases the engagement between the interlocking gutter 20 and shoulder 24 . the panels of this invention may be assembled horizontally to great advantage . as shown in fig1 the panels are assembled from top - to - bottom with the first edge 14 being the uppermost edge and the second edge 15 being the bottom edge . the sloping wall surfaces 19 , 23 are thereby arranged to minimize water entry into the joint assembly .	4
as previously mentioned , certain characteristic property requirements must be met for permanent soft liners to be successful . these properties include permanent resiliency , high dimensional stability , adequate adhesion to the denture base material , adequate wettability in the oral environment and compatibility with oral tissues . resiliency is the ability of a material to spring back to its original shape after the removal of applied stress . resiliency may be defined as the energy required to deform the material to the elastic limit , and is usually determined by measuring the area under a stress - strain curve up to the elastic limit e in a well - known manner . the elastic limit , of course , is the point beyond which strain is no longer directly proportional to stress , and beyond which strains are not fully recovered . a high performance soft denture liner must have high resiliency to enable it to absorb large amount of energy without being permanently deformed . high resiliency is an important characteristic of the elastomers of the invention . high dimensional stability is also essential to the good fitting of the denture . poor dimensional stability is often associated with significant swelling of the material , or the dissolution of the material , or the leaching of the additives such as plasticizer in the oral environment . in some cases , the degradation reactions such as hydrolysis will also help destroy dimensional stability . adequate adhesion to the denture base is essential . adhesion has been defined as the state in which two surfaces are held together by interfacial forces of attraction , owing to the interactions of atoms and molecules . adhesion may be chemical , or mechanical , or both . chemical adhesion involves bonding at the i0 atomic or molecular level . mechanical adhesion involves the retention by the interlocking or penetration of one phase into the surface of the other . in general , materials which are similar in chemical structures have better adhesion properties than materials which are dissimilar . it is clear that the liners should adhere well to the denture base for long usage . most current denture materials are based on the polymer pmma ; therefore , the soft denture liners of the present invention should adhere well to that base polymer . adequate wettability in the oral environment is also desirable . wetting is the process in which a liquid spontaneously adheres to and spreads on a solid surface . adequate wetting of denture liners by water and saliva is necessary to the retention of the denture . wettability is often characterized by measuring the contact angle , the angle between substrate plane and free surface of a liquid droplet at the line of the contact with the substrate . the greater the tendency for a liquid to wet the surface , the smaller the contact angle . for example , the contact angle of water on the denture base acrylic polymer pmma is 74 , while the contact angle of water on the non - wetting polytetrafluoroethylene is 110 . denture liners are in direct contact with oral tissue and should be compatible with the tissue . they should be non - toxic , non - irritant , and incapable of sustaining bacterial growth . organosilicon polymers have been increasingly used in many areas of applications . polysiloxanes are desirable because of their high degree of chemical inertness , low degree of toxicity , and high degree of thermal and oxidative stability . the chemical and physical properties of polysiloxanes are significantly dependent on the substituents r and r &# 39 ; in the polymers ( i ). polysiloxanes can be either hydrophobic or hydrophilic depending on the nature of the substituents . for example , polydimethylsiloxane ( and polydialkylsiloxanes in general ) is a hydrophobic polymer which can be used as a water repellant . the uniqueness of polysiloxanes is that siloxane bonds si -- o -- si in the main chains , as well as si -- c bonds where side groups are bonded to silicon , are extremely flexible with a great freedom of motion . this is reflected in lower melting points , lower glass transition temperatures , lower viscosity , and lower surface tension , and is responsible for the elastomeric behaviors of many polysiloxanes . in general , crosslinking of polysiloxanes can be achieved by several methods . one such method involves free radical crosslinking of linear polysiloxanes through the use of organic peroxides , e . g ., benzoyl peroxide , at elevated temperature . the method is applicable to both polysiloxanes with unreactive end groups and polysiloxanes with reactive group , e . g ., vinyl groups ( called vinyl - terminated polysiloxanes ). if vinyl groups are present , crosslinking can be achieved at lower temperature or with less active peroxide . a second method involves cross - linking of linear polysiloxane or lightly branched polysiloxanes with reactive end groups such as silanols ( hydroxyl - terminated polysiloxanes ). the crosslinking requires a cross - linking agent , e . g ., tetraethyl silicate , and a catalyst , e . g ., dibutyl tin dilaurate , and is a condensation reaction by nature which may be characterized as follows : ## str7 ## a third method involves cross - linking of polysiloxane by addition reactions . the reactions generally involve the addition of silyl hydride groups (-- sih ) to vinyl groups ( ch 2 ═ ch --) attached to silicon with the aid of a platinum containing catalyst as shown in ( ix ). ## str8 ## the importance of polysiloxane - based permanent soft denture liners of the invention are unique polysiloxane materials which possess more of the desired characteristics than any previous materials . the permanent soft denture liners of the invention , based on polysiloxanes ( iv ) or ( v ), offer many advantages . the polysiloxanes possess dimethacrylate or diacrylate groups which undergo free radical polymerization and crosslinking upon application of heat , light or chemicals . the curing of the polysiloxanes ( iv ) and ( v ) can be accomplished by photo - crosslinking using a visible light photoinitiator , e . g . camphorquinone , and an accelerator , e . g ., dimethylaminophenethanol , or by thermal crosslinking with aid of benzoyl peroxide . photo - crosslinking offers the possibility of chairside replacement of permanent soft liners , not heretofore possible . specifically , the embodiments of the invention are directed to high performance permanent soft denture liners based on crosslinking of the acryloxyalkyl - terminated or methacryloxyalkyl - terminated polydialkylsiloxanes of ( iv ) ( the most preferred of which are ( v )) with the crosslinking agent dimethacrylate siloxane monomer ( vi ), or the crosslinking agent diacrylate siloxane monomer ( vii ). the curing of the liners can be conducted both by photo - crosslinking and thermal - crosslinking . the new liners should exhibit high and permanent resiliency , high dimensional stability , low in water sorption and water solubility , and have good adhesion to denture base polymer pmma , good wettability and are compatible to oral tissues . although the linear polysiloxanes ( iv ) and ( v ) can be crosslinked by a suitable initiator with or without a crosslinking agent , use of a crosslinking agent which itself is siloxane monomer chain , such as 1 , 3 - bis ( 3 - methacryloxypropyl ) tetramethyldisiloxane mptds ( vi ) or 1 , 3 - bis [( p - acryloxymethyl ) phenethyl ] tetramethyldisiloxane ( vii ), would offer more advantage . both polysiloxanes ( iv ) or ( v ) and the crosslinking agents ( vi ) and ( vii ) possess either methacrylate groups or acrylate groups which are chemically similar to that of pmma , the wettability and adhesion of the new liners to denture base polymer pmma would be expected to be excellent . the crosslinked bonds , unlike those produced by the condensation reactions , should be more stable and resistant to degradation reactions such as hydrolysis . in addition , the crosslinking agents ( vi ) and ( vii ) are themselves highly flexible siloxane monomers possessing flexible si - 0 - si bonds which are expected to further improve and modify the elasticity and resilience of the liners . with two phenyl groups in the monomer chain , the siloxane monomer ( vii ) would be expected to be stiffer than the monomer ( vi ). thus , the firmness of the liners can be changed by choosing either monomer ( vi ) or ( vii ), or by varying the monomer concentration . the siloxane polymer methacryloxypropyl - terminated polydimethylsiloxane ( v ) ( viscosity = 1500 - 2000 centistokes ), and the two siloxane monomers , 1 , 3 - bis ( 3 - methacryloxypropyl ) tetramethyldisiloxane ( vi ) and 1 , 3 - bis [( p - acryloxymethyl ) phenethyl ] tetramethyldisiloxane ( vii ), are available from hules america , inc . of bristol , pa . with respect to photo - curing of the permanent soft denture liners , a photoinitiator and an activator should be selected which initiate the crosslinking upon exposure to visible light . the photoinitiator and the activator must be miscible with the monomers . camphorquinone and tertiary amines such as 2 - dimethylamino ethyl methacrylate , 4 - ethyl , n , n - dimethylaminobenzoate and dialkylamino phenethanols are candidates for the photoinitiator / activator systems . crosslinking of the polysiloxane ( iv ) without the presence of the crosslinking agents is also believed to be feasible . a filler , such as fume silica , can be added to the polysiloxane to enhance the mechanical properties and the ease of handling . the filler is preferably radiopaque , e . g ., barium sulfate , or barium alumino borosilicate . the filler can be treated with an organosilane coupling agent to increase the bonding between the polymer and the filler . possible coupling agents include vinyltriethoxysilane , hexamethyldisilazane or r - methacryloxypropyl trimethoxysilane , which are commercially available . the first two are more hydrophobic , while the third one is more polar . coupling agents can be applied in organic solvents . it is contemplated that the composites contain approximately 10 - 30 weight % of the filler . in accordance with the above criteria and in furtherance of demonstrating the soft denture liners of the invention , the following examples are offered . the examples verify the above discussion regarding properties of the liner . 11 . 0561 gm of compound ( v )-- methacryloxypropyl - terminated polydimethylsiloxane ( weight average molecular weight , m w = 22 , 500 ) obtained from huls america of bristol , pennsylvania , was mixed with 11 . 1 mg of benzoyl peroxide , and stirred until benzoyl peroxide was homogeneously dispersed in the polymer . a glass mold having a dimension of 2 mm × 9 mm × 75 mm was filled with the polymer mixture , and the mixture cured at 75 ° c . for 6 hours . the curing transformed the clear , viscous liquid polymer into a clear , soft and resilient elastomer . the percent elongation of the elastomer is more than 150 % when stretched . the methacryloxypropyl - terminated polydimethylsiloxane and benzoyl peroxide mixture was prepared according to example 1 . 10 weight % of fumed silica filler aerosil ox50 ( degussa corp .) was added to the polymer mixture and mixed homogeneously . the viscous polymer composite paste was introduced into the glass mold and cured at 75 ° c . for 6 hours . the cured specimen was a white , soft resilient elastomer having more than 150 % elongation when stretched . the hardness of the cured specimen was higher than that of the cured specimen obtained in example 1 . the methacryloxypropyl - terminated polydimethylsiloxane and benzoyl peroxide mixture was prepared according to example 1 . 20 weight % of fumed silica filler aerosil ox50 ( degussa corp .) was added to the polymer mixture and mixed homogeneously . the viscous polymer composite paste was filled into the glass mold and cured at 75 ° c . for 6 hours . the cured specimen was a white , soft resilient elastomer having more than 150 % elongation when stretched . the hardness of the cured specimen was higher than the cured specimen obtained in example 2 . dumbbell shaped specimens were fabricated 15 and the tensile strength of the specimens was measured using comten tensile tester according to the astm designation : d412 - 87 , standard test method for rubber properties in tension . the dimension of the neck in the specimen was 3 mm ( thick )× 25 mm ( wide ). the tensile strength of the specimen was found to be greater than 174 psi ( 1 . 2 mpa ). 2 . 1411 g of methacryloxypropyl - terminated polydimethylsiloxane was mixed with of 1 , 3 - bis ( 3 - methacryloxypropyl ) tetramethyldisiloxane ( mptds ) ( obtained from huls america of bristol , pa . ), and 2 . 1 mg of benzoyl peroxide , and stirred until a homogeneous mixture was obtained . the glass mold was filled with the mixture , and the mixture cured at 75 ° c . for 6 hours . the thermal cure transformed the clear viscous polymer - monomer liquid into a clear , soft and resilient elastomer having more than 150 % elongation when stretched . the specimen prepared in this example differed from the one prepared in example 1 in that this specimen contained 5 weight % of the monomer mptds which acted as the crosslinking agent . 10 weight % of fumed silica filler aerosil ox50 ( degussa corp .) was added to the polymer - monomer - benzoyl peroxide mixture prepared according to example 4 , and mixed homogeneously to obtain polymer composite paste . the glass mold was filled with the viscous polymer paste and cured at 75 ° c . for 6 hours . the thermal cure transformed the composite paste into a white , soft and resilient elastomer having more than 150 % elongation when stretched . the hardness of the specimen was higher than the elastomer obtained in example 4 . 1 . 2010 g of methacryloxypropyl - terminated polydimethylsiloxane was mixed with 12 . 1 mg of camphorquinone and 5 . 8 mg of 2 - dimethylamino ethyl methacrylate , and stirred until a homogeneous mixture was obtained . 0 . 8925 g of the polymer mixture was then mixed homogeneously with 0 . 1780 g of fumed silica filler aerosil ox50 ( degussa corp .) to obtain a polymer composite paste . the polymer composite paste was used to fill a stainless steel mold with a dimension of 6 mm ( diameter )× 3 mm ( height ) having both sides covered with 1 mm thick glass plates . a visible light cure unit , visilux 2 of 3m co . of st . paul , minnesota , was used to expose the polymer composite specimen through the top glass plate . the exposure time was 3 minutes . the photocuring transformed the yellow polymer composite paste into a white , soft , rubbery and flexible elastomer . this invention has been described in this application in considerable detail in order to comply with the patent statutes and to provide those skilled in the art with the information needed to apply the novel principles and to construct and use such specialized components as are required . however , it is to be further understood that the invention can be carried out by specifically different formulations and that various modifications both as to equipment and procedure details can be accomplished without departing from the scope of the invention itself .	8
it should be understood that the description of the preferred embodiment is illustrative and that it should not be taken in a limiting sense . embodiments of this invention will be explained in conjunction with the drawings . this preferred embodiment according to the present invention will describe an apparatus and method for carrying out a semiconductor baking process . however , other equipment including a susceptor on which a wafer is mounted may be practiced in accordance with the present invention . in this embodiment , “ displacement position ” of guiding blocks means the position of the guiding blocks during a baking process . “ awaiting position ” of the guiding blocks is the position apart from the center of a susceptor , more spaced than the displacement position therefrom , to provide a sufficient margin for loading a wafer on the susceptor . “ normal position ” of a wafer means the predetermined position proper to conduct a process ( e . g ., a baking process ). the guiding blocks at the displacement position and the awaiting position are referred by the solid and broken lines in fig2 and 300 ′, respectively . [ 0031 ] fig1 illustrates a schematic view of an apparatus 10 which can be employed in a semiconductor fabrication process wherein a wafer is subjected to a baking operation . fig2 and 3 show the plane and sectional features in the area where a wafer is positioned . the apparatus 10 includes a susceptor 100 , a lift pin assembly 200 , guiding blocks 300 , a guide block mover 400 , and a tester 500 . the susceptor 100 , which is provided to accommodate a semiconductor substrate , such as a wafer w , comprises a plate 120 and spacers 140 . the plate 120 includes heating elements ( not shown ) such as heating coils to warm up a wafer to a proper temperature for processing . the top of the plate 120 is round and flattened . the spacers 140 are installed at the top edges of the plate 120 to support the wafer w , contacting with the edges of the wafer w . the spacers 140 may be provided at regular intervals and may be from three to six in number . the wafer w is separated from the plate 120 , so that it is not in contact with the plate 120 that is heated up to a high temperature during a process . at the top of the susceptor 100 , a cover 160 is provided to facilitate an airtight condition during processing of the semiconductor substrate . the cover 160 is cylinder - shaped and includes an upper plate 162 , and a sidewall 164 which extends downwardly from the edge of the upper plate 162 . the lift pin assembly 200 ( fig3 ), driven by a robot arm ( not shown ), moves the wafer w above and onto the susceptor 100 . assembly 200 comprises lift pins 220 , a support plate 240 for the pins 220 , and an elevator device 260 . the lift pins 220 , which are joined to the upholding plate 240 in a square arrangement , receiving the wafers w from the robot arm . the support plate 240 is connected to the elevator device 260 , such as a hydraulic / pneumatic cylinder , and is movable to a plurality of positions in an upward and downward direction . the lift pins 220 are inserted into openings 122 in the support plate 120 for vertically movement within the openings 122 . the wafer w is transferred to the lift pins 220 by means of the robot arm when the lift pins 220 ascend to protrude above the top of the plate 120 and then mounted on the susceptor 100 when the lift pins 200 descend under the top of the plate 120 by way of the openings 122 . the guiding blocks 300 lead the wafer w to be positioned on an accurate position within the susceptor 100 . the guiding blocks 300 are disposed on the spacers 140 , each including slopes 320 formed inside from the top surface thereof . the wafer w slips down along the slope 320 to be positioned on the accurate position when it strays from the accurate position to result its edges to be partially laid on the tops of the guiding blocks . the baking apparatus 10 also includes a guiding block transfer unit 400 for moving the guiding blocks 300 in a predetermined distance to the displacement position or the awaiting position . it is desirable to render the guiding blocks 300 to be moved linearly along guiding lanes 142 within the range of the radius of the plate 120 . the guiding lanes 142 are formed in the spacers 140 to facilitate the linear movement of the guiding blocks 300 . the guiding lanes 142 are shaped in the form of apertures ( or openings ) or trenches . the guiding blocks 300 may include underlying projections ( not shown ) which are movably inserted into the guiding lanes 142 . referring to fig4 the guiding block transfer unit 400 is constructed of a driver 420 , a shaft 440 , supporting rods 460 , and transfer rods 480 . the shaft 440 is vertically connected to the driver 420 such as a stepping motor , hydraulic or pneumatic cylinder , or an actuator , and is rotated on its axis by the driver 420 . the topside of the shaft 440 is horizontally combined with the supporting rods 460 at constant intervals , and in the same number as that of the guiding blocks 300 . the other ends of the supporting rods 460 are joined with the transfer rods 480 which are each connected to the guiding blocks 300 . the supporting rods 460 and the transfer rods 480 are pivotally joined one to the other . the transfer rods 480 move in a range of angles when the supporting rods 460 are rotated . this enables the guiding blocks 300 to be linearly movable along the guiding lanes 142 . each of the transfer rods 480 is composed of a horizontal portion 482 , a vertical portion 484 , and a connection portion 486 , respectively . the horizontal portion 462 is linearly connected to the supporting rod 460 by means of a pivotable section on the same plane . the vertical portion 484 perpendicularly extends upwardly from the end of the horizontal portion 482 . the connection portion 486 is disposed parallel to the horizontal portion 482 , and is pivotally attached to the end of the vertical portion 484 . while the horizontal and vertical portions , 482 and 484 , may comprise a single body portion , they may also be combined by attachment devices such as screws . [ 0040 ] fig5 depicts a feature of combining a guiding block and a transfer rod , utilizing , for example , guiding block 300 , spacer 140 , and transfer rod 480 , respectively . referring to fig5 a and 6 b , the connection portions 386 of the transfer rods 480 are inserted into hollows 124 formed in the sidewalls of the plate 120 under the spacers 140 . in each illustrative structure , the guiding block 300 and the transfer rod 480 are combined by means of , for example , a bolt 722 and a nut 724 , through openings 302 and 487 , to penetrate the center of the guiding block 300 and the end of the connection portion 486 . the bolt 722 is coupled to the nut 724 through the opening in the guiding block 300 , the holed guiding lane 142 in the spacer 140 , and the opening in the connection portion 486 of the transfer rod 480 . the wafer w expands with heat during a baking process . this narrows the distance between the wafer w and the guiding blocks 300 at the displacement positions . at high processing temperature , the wafer w abuts against the guiding blocks 300 . such abutting action can be overcome by adjusting the displacement position of the guiding blocks 300 in accordance with the processing temperature in the baking apparatus 10 . in the present baking apparatus 10 , the opening 487 in the connection portion 486 of the transfer rod 480 is elongated along the span of the connection portion 486 , as in the case of the guiding lane 142 . preferably , the length of the elongate opening is larger than the diameter of the bolt 722 . thus , the elongate opening 487 enables a combinable position between the guiding block 300 and the transfer rod 480 to be varied , which adjusts the displacement position of the guiding block 300 . fig6 a and 6b exemplarily show available features of the displacement positions for the guiding block 300 combined with the transfer rod 480 . the location of the guiding block is dependent on whether relatively lower or high processing temperatures is employed . in a lower temperature scenario , as shown in fig6 a , the bolt 722 is fixed by the nut 724 at a position adjacent to one end 487 a of the opening 487 , establishing the displacement position of the guiding block 300 in a location inward on the spacer 140 . in a higher temperature scenario , as shown in fig6 b , the bolt 722 is fixed by the nut 724 at a location adjacent to the other end 487 b of the opening 487 , establishing the displacement position of the guiding block 300 in a location outward on the spacer 140 . for instance , the relative location may set about 0 . 5 mm for a distance between the wafer ( e . g ., in diameter of 300 mm ) and the guiding block 300 at the locating position of them , about 2 . 0 mm for the length of the opening 487 in the transfer rod 480 ( i . e ., a distance between both ends 487 a and 487 b ). as shown in fig7 a resilient element 740 , such as a spring or coil , may be inserted into the hollow 124 formed in the sidewall of the plate 120 , for preventing a heating process from continuing to operate even when the guiding block 300 is positioned at the displacement position in the condition of an abnormal operation of the guiding block transfer unit 400 . the resilient element 740 surrounds the connection portion 486 of the transfer rod 480 , both ends of which attach onto a link 488 embedded at the connection portion 486 and a link 125 embedded in the hollow 124 , respectively . the resilient element 740 maintains its equilibrium , neither compressed nor stretched , when the guiding block 300 is set on the displacement position . the resilient element 740 also has a modulus of elasticity designed to minimize vibration when it is relieved from a compressed state . [ 0045 ] fig8 a and 8b illustrate a procedure of positioning the wafer w in a normal position by means of the guiding blocks 300 . in fig8 a , the solid circle referred to as w denotes a wafer which is out of the normal position . the broken line referred to as w ′ denotes the normal position on which the wafer should be placed for processing . when the wafer is loaded onto the susceptor , the guiding blocks 300 are moved to their aligning positions before the lift pins 220 descend . this pre - alignment operation permits sufficient spacing of the wafers and prevents the wafer edges from being partially laid onto the guiding blocks 300 . thereafter , if the top ends of the lift pins 220 are inserted into the openings 122 , the guiding blocks 300 will move to their displacement positions to correct the positional error of the wafer . as a result , the wafer w will be positioned in their normal position as shown in fig8 b . [ 0046 ] fig9 a , 9b , and 9 c illustrate sequential changes of positioning the guiding blocks 300 to fit the wafer w on the normal position . first , as shown in fig9 a , the lift pins 220 on which the wafer w is mounted go down after the guiding blocks 300 have moved into the displacement positions . when the top ends of the lift pins 220 are inserted into the openings 122 by elevating the lift pins 220 , the guiding blocks 300 move to the awaiting positions , and are then returned to the displacement positions , as shown by the arrows in fig9 a and 9b . even when the edges of the wafer w are initially laid on the guiding blocks 300 , the realignment of the guiding blocks 300 enables the wafer w to be set in the normal position as shown in fig9 c . returning to fig1 the apparatus 10 is associated with a testing unit 500 for monitoring whether or not the wafer w is positioned in the normal position on the susceptor 100 to avoid adversely affecting the baking process due to the misaligned placement of the wafer edges on the guiding blocks 300 which makes the wafer slant . the testing unit 500 is constructed of a vacuum pump 510 , a vacuum line 520 extending from the vacuum pump 510 , a sensor 540 for gauging pressure in the vacuum line 520 , and a display panel 560 showing a value of pressure calibrated by the sensor 540 . the vacuum line 520 extends into the space between the rear of the wafer w and the plate 120 . the pressure in the vacuum line 520 is detected by the sensor 540 when the vacuum pump 510 is started before the baking process begins . the sensor 540 can be a digital vacuum sensor , and the amount of pressure in the vacuum line may be more accurately established without damaging the wafer w . if , however , a pressure value measured by the sensor 540 becomes out of a predetermined range due to the positional error of the wafer w ( i . e ., the wafer w is laid on the guiding blocks 300 ), an alarm can be generated to inform an operator of the misalignment of the wafer w . alternatively , vacuum holes may be provided in the spacer 140 around which the edges of the wafer w can be mounted in the normal position , connected to the vacuum line 520 . [ 0048 ] fig1 summarizes a sequential flow of positioning the wafer w onto the susceptor 100 . first , the displacement positions of the guiding blocks 300 are adjusted wherein the bolt 722 is inserted into the openings 302 and 487 respectively formed at the guiding block 300 and the connection portion 486 of the transfer rod 480 . the transfer rod 480 moves within a predetermined range to set the combining position of the guiding block 300 and the transfer rod 480 . then , the bolt 722 is joined with the nut 724 to fix the guiding block 300 on the transfer rod 480 ( step s 10 ). next , the cover 160 is elevated from the plate 120 so that the lift pins 220 protrude above the top surface of the plate 120 . the wafer w is transferred to the upper work space of the plate 120 by a robot arm to which it is adhered . the wafer w is then laid onto the lift pins 220 by the robot arm ( step s 20 ). the lift pins 220 are lowered , and the cover 160 is closed ( step s 30 ). if the lift pins 220 descend under the upper surface of the plate 120 through the openings 122 , the driver 420 makes the guiding blocks 300 move from the displacement position to the awaiting position and then back to the displacement position ( step s 40 ). the realigning of the guiding blocks 300 causes the wafer w to be positioned on the normal position of the susceptor 100 even when the wafer w is misaligned with respect to the normal position or is mounted on the guiding blocks 300 . thereafter , the testing unit 500 checks whether the wafer w is positioned at the normal position on the susceptor 100 ( step s 50 ). the vacuum pump is actuated and the sensor 540 detects the pressure in the vacuum line 520 . if the measured value of the pressure in the line 520 is under the predetermined range , the baking process is carried out . on the other hand , if the pressure in line 520 is outside of the predetermined range of pressure , an audible signal is generated to inform an operator of misaligned status of the wafer w . in the embodiments described so far , while the guiding blocks 300 are linearly movable by the single driver , it may also be possible for the guiding blocks 300 to be continuously moved in a generally circular path . it is also possible to transfer each guiding block by each driver . according to the baking apparatus and method of the present invention , it is possible to prevent a misaligned placement of a wafer in which the wafer is positioned away from the normal position or the wafer edges are locally mounted on the guiding blocks . moreover , a wafer can be transferred to the normal position anyway even when the guiding block driver operates abnormally , because the guiding blocks can be returned to a predetermined displacement position for carrying out the process using a resilient element . further , there is provided of an inspecting function by the testing unit to check out whether a wafer is safely laid on the upper surface of the susceptor before continuing the baking process . this prevents carrying out the process with misaligned placement of the wafer on the susceptor . although the preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as described in the accompanying claims	7
fig1 shows an applicator top 1 with a neck 3 which connects with a container body 5 . the applicator top has a wall 7 with a thinner section 9 , which allows the user to flex the area inward , pushing a portion of the contents out of the container . the contact surface 11 of a lip applicator may be constructed with a one - piece or two - shot construction so that the actual raised lip - contacting surface 13 may be constructed of a compliant material . fig2 shows the structure of fig1 with a cap 15 formed on a living hinge 17 on an extension 19 from the applicator top 1 . in an alternate form of applicator top 21 shown in fig3 a flow channel 23 is exposed between a base 25 and a sloping wall 27 . at the top of the sloping wall 27 a double hinge spacer 29 with two living hinges 31 and 33 supports a cap 53 , which covers the applicator surface . as shown in fig4 when the head 21 is flexed , the contents of the body 5 are squeezed outward through hollow channel 23 to spread across the applicator . a flexing area 37 allows the downward flexing of the head 21 . as shown in fig5 the base 25 and sloping wall 27 may be enlarged into a wall 7 similar to that shown in fig1 with the flex area 37 sufficient to flex when pressure is placed on the applicator 11 or applicator pad 13 . a central opening 39 allows the contents of the body to spread radially outwardly across the annular applicator . in fig6 the head 41 has a cap 53 mounted on a double hinge 29 . the base 25 has a snap 43 which may either be a recess as shown or a projection which cooperates with a projection or recess on the free end 45 of the cap 53 . a large central valve 47 within the annular applicator surface 13 radially supplies materials from the body 5 to the annular applicator surface 13 . a preferred projecting complementary snap 48 , which cooperates with the recess 43 , is shown in fig7 . the double hinge 29 has two living hinges 31 and 33 . the valve 47 is a compliant valve that dispenses the contents of the container 5 as a ring on the compliant annular applicator surface 13 . fig8 shows a side view of the applicator head 41 , showing how the cap 53 is attached to the wall 7 with the double hinge 29 . windows 49 promote the flexibility of the wall and allow molding of the flexing area 37 . fig9 is an enlarged detail of the dispenser head . fig1 shows the cap 53 folded downward against the head 41 and container 5 as it would be when the applicator surface 13 is in use . the compliant material which is molded on structural material in the applicator 13 also is flowed downward 50 over the top of the container 5 to provide a non - slip surface . as shown in fig1 , the compliant surface on the applicator 13 extends onto the body 5 as a non - slip surface . an applicator head 51 with a modified cap 53 is shown in fig1 . the cap has a base 25 , a wall 7 and a valve 47 which flows the material over the annular compliant applicator surface 13 , the same as the other applicator heads . cap 53 has clasps 55 which are inwardly curved and which grip the wall 7 , holding the cap closed . the double hinge attachment 29 is identical . in the molded position of the cap 53 and applicator head 51 , as shown in fig1 , the double hinge 29 is horizontal , as is the top 57 of the cap . the clasps 55 are molded in a continuation of the cylindrical surface of the cap 53 . as shown in fig1 , the flat top 57 provides an area for lenticular lenses 59 to selectively reveal multiple image graphics below the lenticular lens 59 . as shown in fig1 , the cylindrical clasp wings 55 grip the cylindrical wall 7 , holding the cap 53 closed . as shown in fig1 , the cap 53 is closed on the wall 7 of the applicator head 51 . the lower end 60 of the body 5 is crimped and sealed after the body has been filled with the contents . fig1 shows the cap 53 closed on the cylindrical surface 7 . the applicator head 61 is enlarged to cylindrically align with the cap 53 . as shown in detail of fig1 , the double hinge 29 allows the cap 53 to swing rearward . the lower living hinge 31 allows the center zone 63 of the double hinge 29 to fold within the relieved area 65 so that the center zone lies along the cap neck 61 . as shown in fig1 , a plug post 67 with reinforcement 69 is formed on the inside of top 57 of the cap 53 to plug the exit hole 39 in the center of the annular applicator surface 11 . fig1 and 19 show the cap 53 and the post 67 in the molded position . the front view shown in fig2 shows the alignment of the plug post 67 with the product release opening 39 . fig2 shows an applicator head 21 with a modified cap 35 , which has a flat top 70 on which lenticular lenses may be mounted parallel to the applicator surface . the wall 7 has base 25 and upper wall 27 portion . the end 71 of the cap is shortened to provide easy lifting of the cap . fig2 - 43 show caps with connector blades 73 . the cap necks 7 are provided with receivers 75 which receive the blades in snap - in condition . the connector blades 73 are connected to the living hinges 31 , which are part of the double hinge 29 fig2 shows a cap 53 mounted with a connector blade 73 . fig2 shows a cap 35 molded with a connector blade 73 for fitting within a recess 75 on a rearward extension at the rear of dispenser head 81 , which is similar to the dispenser head 21 shown in fig3 and 4 . the flex area 37 permits flexing the end 81 to cause material to flow from opening 39 . the extension 77 at the rear of the cap prevents overflexing of the cap . another view of the dispenser head is shown in fig2 . a side view is shown for clarity in fig2 with the cap 35 open , and in fig2 with the cap 35 closed . a front view of the container showing the flat end 71 of the cap 35 is shown in fig2 . a front view with the cap open is shown in fig2 . fig2 shows the dispenser head 81 and container body 5 in molded condition after the cap has been connected with the cap blade 73 inserted in the receiver 77 , and before the molded body 5 is filled with contents and sealed . fig3 shows the applicator shown in fig2 after the container body 5 is filled and sealed . fig3 shows the unfilled container on which the cap is assembled . the body 5 , wall 7 and wall 27 , and the parts underlying the applicator surfaces 11 and 13 are made of structural material . the applicator surfaces 11 and 13 are coated with compliant material which is soft to the touch . fig3 is a side view of the structure shown in fig3 showing the layers of compliant material 11 and 13 which form the applicator surface . fig3 is a rear view showing how the separately molded cap 35 is connected with the connector blade 73 mounted in the recess 75 on the rear downward extension 77 of the applicator head . the applicator head and body 5 are molded in one piece with side actions forming the rear of the wall 7 . the flex area 37 , the flow channel 23 which may be solid or compliant , and the openings in the extension 77 are molded with side actions . fig3 is a top view showing the receiver 75 and the recess 79 for receiving the connector blade of the cap . fig3 shows the apparatus formed in the mold with the first shot of structural material in which the container 5 , the flow channel 23 , the upper wall 27 , the rear extension 77 and the receiver 75 are formed with a first shot of material . fig3 shows the structure formed in the mold in the first shot with the cored out areas 83 and 85 at the rear of the applicator head , and the cored out recess 79 in the receiver 75 . fig3 is a side view of the apparatus in the mold with a core 87 positioned within the container 5 and the flow channel 23 , with the upper part 88 representing the front half of the mold and the lower part 89 representing the back half of the mold . fig3 shows how a second shot of compliant material is added to form the applicator surfaces 11 and 13 . fig3 is a detail of the molding of the cap 53 with the plug post 67 and reinforcements 69 connected to the top 57 of the cap , and the double hinge piece 29 molded with living hinges 33 and 31 which connect the cap to the connector blade 73 . fig4 shows the cap 35 with modified snap side extensions 91 to hold the cap closed . the relief 71 on the end of the cap allows the compliant material 11 to be seen , and also allows the user to open the cap . fig4 is an inverted detail of the cap 35 showing the snap extensions 91 held in the complementary snap receivers 93 formed on the back of wall 7 . fig4 is a detail of the cap snap 91 and the receiver 93 on the dispenser head . as shown in fig4 , the cap extension 91 locks and snaps past the dispenser head wall 7 to hold the cap 35 closed . as shown in fig4 , one of the inward cap extensions 95 , which extends inward from the cap snap 91 , fits in the recess 93 formed in the wall 7 of the dispenser head . fig4 shows rotating the cap 35 downward to snap the inward extensions 95 in the recesses 93 . fig4 shows the inward extending snaps 95 in the cap 35 , which fit within the recesses 93 on sides of the wall 7 . fig4 - 50 show details of a preferred compliant valve , such as shown in fig6 , 9 and 11 - 13 , that can be used with any dispenser head . as shown in fig4 , the applicator head 51 is made of structural material . that includes the color 3 , the wall 7 , the flow tube 23 , the base 25 and the upper part 27 . compliant material 11 and 3 is added in an annular ring . central stepped recesses 101 and 103 are formed in the applicators 11 and 13 . valve 47 is made out of compliant material . a stem 105 of the valve 107 is pressed within the flow tube 23 . longitudinal ridges on the stem provide flow channels 107 around the stem on the inside of the flow tube 23 . material 109 flows through the channels 107 . the valve 47 is made of a compliant disc . a central 111 is thick and fits within the recess 101 . a thinner outer portion 113 rests against the ledge 103 . in fig4 the valve 47 is shown not fully pushed into the recesses for clarity on the distinctions between the parts . the valve 47 is also shown in dash lines to show the flexibility of the upper disc . in fig4 the valve 47 is shown seated with outer thin area 113 , seated against the ledge 103 . the rounded wall 115 helps to distribute the material outwardly on the applicator surfaces 11 and 13 . the side view in fig4 shows that the valve is completely recessed below the applicator surfaces 11 and 13 . fig5 shows the thin outer flange 113 of valve 47 resting on the recess surface 103 to close the valve until pressure is exerted on the material to flow the material outward across the curved surface 115 onto the applicator surfaces 11 and 13 . welded areas 117 in two or more places around the valve stem maintain the flow channel 107 while holding the valve stem 105 fixed within the flow tube 23 . fig5 shows a flat head embodiment 118 with the cap 119 and applicator head section 121 in the closed position using snap 123 . the applicator head 121 is fused , or concurrently formed with the content section 5 . the lower end 60 of the body 5 is welded , fused , or crimped and sealed after the body has been filled with the contents . fig5 shows the applicator 118 and head section 121 with the cap 119 in the open position . the snap portion 125 of cap 119 clips onto the snap projection 124 . the contents from the container body 5 are distributed onto the flexible contact surface 129 through the dispenser hole 39 . double hinge 127 allows the cap 119 to be positioned away from the contact surface during use . the application contact surface 129 and the rim 130 are formed of an elastic plastimer with a similar base formulation to the polypropylene or polyethylene container 5 and cap 119 . as shown in fig5 , the applicator head section 121 is formed from two shots of material . the first shot of material forms the tube 5 , the head 121 , the cap 119 and snap 125 , and the central applicator support area 131 . a second shot of compliant material laminates on the applicator area 131 to form the contact surface 129 and the surrounding support 132 . fig5 depicts the applicator area 131 suspended within the head section 121 by connector elements 133 , which form flow paths 132 for flowing material to laminate the applicator support area 131 . the second shot of material fills flow paths 132 to form a compliant membrane 134 . in fig5 the applicator area 131 is shown suspended inside the head section 121 by a compliant membrane 134 between the applicator area 131 and the head section 121 . the first shot molds the applicator head 121 and floating applicator support area 131 . the applicator support area 131 is connected by one or more straps 133 to the applicator head section 121 . the second shot forms a contact surface 129 that is compliant . the second shot also forms an unsupported membrane 134 between the applicator support area 131 and the head section 121 . fig5 and 57 show the conformable floating contact surface 129 and membrane 134 flexing in response to a force 135 applied to the contact surface 129 . because the contact surface 129 created by the second shot is compliant and unsupported around the outer edge of the head section 121 created by the first shot , the applicator surface 129 can conform to forces presented to its surface . while the invention has been described with reference to specific embodiments , modifications and variations of the invention may be constructed without departing from the scope of the invention .	1
as used in the specification and claims , the singular form “ a ”, “ an ” and “ the ” include plural references unless the context clearly dictates otherwise . for example , the term “ a bacterium ” includes a plurality of unicellular microorganisms of the same species . as used herein , “ monogastric ” is intended to encompass any animal having one stomach . examples of monogastric animals include , but are not limited to , horses , emu , ostrich , dog , cat , swine , bear , turkey , chickens , ducks , quail , pheasants , reptiles , and humans . pre - ruminant animals such as young cattle , buffalo , bison , and elk are also encompassed by the term monogastric as these animals are born monogastric and then develop into true ruminants as adults . in a preferred embodiment of the invention , the fibro - biotic is administered to livestock that are fed a fiber diet . as used herein the term fiber refers to the soluble and insoluble components of feed that are not digested by enzymes in the livestock gastrointestinal tract . the primary sources of fiber include such cell wall materials as cellulose , hemicelluloses , lignin , and pectins , along with gums and mucilages from plant material . the term “ crude fiber ” is defined as loss on ignition of dried residue remaining after digestion of sample with 1 . 25 percent sulfuric acid and 1 . 25 percent sodium hydroxide under specific conditions . typical conditions and methods are described in the official method of analysis of the association of official analytical chemists . the undissolved residue is rinsed with dilute sulfuric acid , deionized water , and ethanol , then reduced to ash . the crude fiber value includes the amount of cellulose and some indigestible lignins but does not distinguish between digestible and indigestible fiber . “ neutral detergent fiber ” and “ acid detergent fiber ” as used herein are analyses that involve the solubilization of non - fiber components of the feed in boiling detergent solution , with the residual material described as neutral detergent fiber or acid detergent fiber depending on the solution used . neutral detergent fiber ( ndf ) analysis and acid detergent fiber ( adf ) analysis originally described by p . j . van soest ( agricultural handbook no . 379 entitled forage fiber analyses ( apparatus , reagents , procedures , and some applications ); pages 1 - 20 ; by h . k . goering and p . j . van soest ; agricultural research service of the united states department of agriculture ) is incorporated herein by reference . typically , acid detergent fiber is measured by boiling the sample in an acid detergent solution . the mash is filtered . the residue contains wall fiber , primarily cellulose , lignin and silica . neutral detergent fiber is typically measured by boiling the sample in a neutral detergent solution . the wash is filtered . the residue contains all of the structural plant parts , including cellulose , hemicellulose , and lignin . as used herein the term “ fibro - biotic ” refers to live bacteria when fed to a livestock , increases fiber digestion for said livestock . as used herein the term “ isolated bacterium strain ” means that the strain might be cultivated in vitro in a culture comprising said strain . as used herein the term “ suitable nutrient medium ” means a medium , such as lab broth , mrs broth , or wilkens - calgren broth in which bacteria might be cultivated . initially , 122 bacteria isolates from human excrement was provided from natick soldier center ( natick , mass .). the 122 isolates were initially sequenced for approximately half of a 16s rrna gene allowing for grouping by sequence similarity . the isolates were then characterized by api anaerobe identification system ( biomérieux , inc ., lombard , ill .) and bbl crystal anaerobe identification system ( bd diagnostics , eden prairie , minn .) for their ability to grow on cellulose and xylan . six bacterial strains ( isolates sd cmc 3f , rf cell 1b2 , sd cc 2c , sd cc 1c , sd cc 1b , and rf cell 1b1 ) were capable of growing on cellulose or xylan and were identified as bacteroides ovatus strains . more particularly , strains sd cmc 3f , rf cell 1b2 , sd cc 1c , and sd cc 1b grew on cellulose and sd cc 2c and rf cell 1b1 grew on xylan . bacterial strain sd cc2a was characterized as a bacteroides xylanisolvens strain and also grew on cellulose . to determine the effectiveness of the six selected bacterial stains , forty - eight female pic ( pig improvement corporation , lexington , ky .) grower sus scrofa scrofa livestock were used to establish the effects feeding fiber utilizing bacteria with standard and high fiber diets . treatments were arranged as a 2 × 4 factorial with 2 diets and 4 bacterial treatments . sus scrofa scrofa ( having an initial average body weight of 61 . 1 kg ) were randomly assigned to experimental treatments and housed in two rooms with individual pens at the iowa state university swine nutrition farm . the sus scrofa scrofa were fed diet compositions presented in table 1 and consisted of control ( 3331 kcal / kg metabolizable energy , 14 % crude protein , 6 . 3 % hemicellulose and 2 . 7 % cellulose ) and high fiber ( 3300 kcal / kg metabolizable energy , 14 % crude protein , 10 . 4 % hemicellulose and 7 . 7 % cellulose ). the livestock were fed ad libitum and had free access to water and were adapted to the pens and diets for a period of seven days . all procedures involving animal handling and testing were reviewed and approved by the iowa state university committee on animal care ( approval # 9 - 06 - 6207 - s ). while distiller &# 39 ; s dried grains with solubles and soybean hulls constitute fiber addition to the animal feed , it is contemplated that other fiber sources such as corn germ meal , wheat middlings , bran from any grain , alfalfa , corn gluten feed , brewer &# 39 ; s grain , dried apple pomace , dried citrus pulp , dried citrus peel , sugar beet pulp , soya bean hulls , pectin residue , and other fiber - added sources would be more readily digested with the fibro - biotic . the bacterial feed treatments consisted of either no bacteria supplement ( a ) or one of three bacteroides isolates ( b , c , and d ) ( table 2 ). prior to bacterial treatment and after adaptation , livestock were acclimated to take 20 ml of a 50 : 50 mixture of food grade glycerol ( sigma ) and wilkens - chalgren broth orally via a syringe at 0900 daily for two weeks . it is contemplated that other carriers would be suitable to orally deliver the fibro - bacterial . a suitable carrier would encourage the livestock to ingest the carrier with the fibro - bacteria . ideally , the carrier would be of a viscosity wherein the fibro - bacteria would confer even mixture . in one embodiment of the invention the fibro - biotic is administered with a glycerol carrier . the fibro - bacteria were grown anaerobically in 100 ml of wilkens - calgren broth ( fisher scientific , inc , pittsburg , pa .) ( 1 ml of overnight bacterial growth inoculated into 100 ml of broth ) for 24 h at 38 ° c . ( final concentration was 1 × 10 9 bacterial cells / ml broth ). bacterial doses were prepared each morning by mixing 10 ml of the bacterial culture with 10 ml of sterile anaerobic glycerol ( feed grade , fisher scientific ), dose of bacteria was 1 × 10 10 bacterial cells . the treatment with no bacteria had broth processed the same way as described above without inoculation of initial broth . thus control livestock receive the same volume dose but with no bacterial cells in it . in a coy anaerobic chamber ( coy laboratory products , grass lake , mich .) the glycerol - bacteria mixture was placed in sterile 20 ml syringes . filled syringes were placed , by treatment , into mitsubishi anaeropak boxes , without gas generator , ( fisher scientific ) and seal prior to transport to the farm . sus scrofa scrofa livestock were dosed orally at in the morning , daily throughout the experiment . prior to sampling , three weeks post treatment initiation ; 24 pigs at a time were moved into metabolism crates ( 1 . 2 × 2 . 4 m ) for 11 days . on days 7 to 11 total dietary intake , fecal output , and urinary output were measured . on these five days samples were taken of feed and feed refusals and 10 % of the fecal output of each pig was pooled in order to determine nutrient digestibilities . blood was collected from the jugular vein into vacuum containers containing sodium heparin ( becton dickinson , franklin lakes , n . j .) on days 1 and 11 and the resulting plasma was stored at − 20 ° c . until analyzed for plasma energy metabolites and insulin . feed , feed refusals , and fecal samples were dried prior to chemical analysis . carbon , nitrogen and sulfur were analyzed using a variomax cns analyzer ( elementar analysensysteme gmbh , hanau , germany ). other nutrients were analyzed on feed , feed refusals , and feces by minnesota valley testing laboratories ( new ulm , minn .) using aoac approved methods for ash , crude fiber , acid detergent lignin and crude protein . data were analyzed as a 2 × 2 × 4 randomized block design with 2 groups of pigs , 2 dietary treatments and 4 bacterial treatments . statistics were performed using proc glm of sas ; no interactions were significant ( two - way − group × diet , group × bacteria , diet × bacteria and three way , group × diet × bacteria ) so they were removed from the final model . as detail supra , pigs were fed a fibro - biotic supplement detailed in table 2 for a period of 36 days . digestibility of nutrients was determined on feed and pooled fecal sample for each subject . digestibility of neutral detergent fiber and acid detergent fiber were examined daily . culture effluent subsamples and feed and inoculum samples were dried overnight in pre - weighed aluminum pans for dry fecal matter determination as is known in the art . ndf and adf on the feed , inoculum and dried effluents from each culture were determined as detailed supra . digestibilities ( dm , ndf and adf ) were estimated for each culture by calculating total dm , ndf and adf input and output from total feed weight and total inoculum and effluent volumes . calculations of percentage of fiber digestibility were calculated as follows : intake nutrient was calculated as the percentage of nutrient in the feed multiplied by the grams of feed per day . fecal fiber was calculated by percentage of nutrient in the feces multiplied by grams of feces per day . plasma glucose concentrations were determined using an enzymatic kit ( gahk20 , sigma chemical ) based on hexokinase activity . plasma cholesterol and triglycerides were quantified using enzymatic kits ( c7510 and t7531 , respectively , pointe scientific , canton , mich .). the intra - and interassay cv for the cholesterol assay were 0 . 8 % and 1 . 1 %, respectively , and the intra - and interassay cv for the triglyceride assay were 1 . 0 % and 2 . 9 %, respectively . serum insulin concentrations were determined using a porcine - specific insulin elisa kit ( 10 - 1129 - 01 , alpco , windham , n . h .). the insulin elisa has a range of detection of 0 . 02 to 1 . 5 ng / ml and intra - and interassay cv less than 10 %. as detailed in fig2 , and table 3 , administering bacteroides strain sd cmc 3f as a feed supplement to sus scrofa scrofa on a control diet increased digestibility percentage of crude fiber by 4 . 3 percent when compared to no fibro - biotic supplement . by utilizing sd cmc 3f as a feed supplement in conjunction with a control diet , neutral detergent fiber digestibility increased by 7 . 29 percent when compared against no fibro - biotic supplement . by utilizing sd cmc 3f as a feed supplement in conjunction with a control diet , acid detergent fiber digestibility increased by 3 . 38 percent when compared against no fibro - biotic supplement . by utilizing sd cmc 3f as a feed supplement in conjunction with a control diet , lignin digestibility increased by 12 . 43 percent when compared against no fibro - biotic supplement . as detailed in fig4 , and table 4 , administering bacteroides strain sd cmc 3f as a feed supplement to sus scrofa scrofa on a control diet increased digestibility percentage of crude fiber by 3 . 56 percent when compared to no fibro - biotic supplement . by utilizing sd cmc 3f as a feed supplement in conjunction with a control diet , neutral detergent fiber digestibility increased by 1 . 76 percent when compared against no fibro - biotic supplement . by utilizing sd cmc 3f as a feed supplement in conjunction with a control diet , acid detergent fiber digestibility increased by 5 . 08 percent when compared against no fibro - biotic supplement . by utilizing sd cmc 3f as a feed supplement in conjunction with a control diet , surprisingly lignin digestibility decreased by 1 . 05 percent when compared against no fibro - biotic supplement . as detail supra , sus scrofa scrofa were fed fibro - biotics detailed in table 2 for a period of 11 days . digestibility of neutral detergent fiber and acid detergent fiber were examined daily . culture effluent subsamples and feed and inoculum samples were dried overnight in pre - weighed aluminum pans for dry fecal matter determination as is known in the art . ndf and adf on the feed , inoculum and dried effluents from each culture were determined using analytic methods listed supra . digestibilities ( dm , ndf and adf ) were estimated for each culture by calculating total dm , ndf and adf input and output from total feed weight and total inoculum and effluent volumes . as detailed in fig1 and table 3 and 4 , average fecal output of sus scrofa scrofa on a control diet supplemented with fibro - biotic b had a decrease in 199 . 71 grams of daily fecal output compared to those fed only a control diet . with the fibro - biotic b supplement , this was an approximate 39 % decrease in daily fecal output when the livestock was on a control diet . similarly , the average fecal output of sus scrofa scrofa on a high fiber diet supplemented with fibro - biotic b had a decrease in 130 . 5 grams of daily fecal output compared to those fed only a high fiber diet . with the fibro - biotic b supplement , this was an approximate 18 % decrease in daily fecal output when the livestock was on a high fiber diet . while the invention has been described with reference to details of the illustrated embodiment , these details are not intended to limit the scope of the invention as defined in the appended claims . the embodiment of the invention in which exclusive property or privilege is claimed is defined as follows :	2
in accordance with the instant invention there is provided a process for depressing non - sulfide minerals in a flotation system by adding to the flotation system an effective amount of crosslinked starch . starches , or starch - containing natural substances , which can be utilized in the instant invention include , but are not limited to , corn , waxy corn , waxy maize , tapioca , potato , sorghum , wheat , rice , sago , amylomaize , arrowroot and the like . additionally , starches , such as those listed above , which have been modified may be utilized . examples of various modifications include starches which have been acidified , oxidized , fluidized , enzyme converted , dextrinized , esterified , etherified , grafted , block polymerized and the like . what is meant by these terms is , in esterification for example , the starch is reacted with acetic anhydride or maleic anhydride to become esterified . the starch or modified starch is crosslinked with an appropriate bifunctional crosslinking agent . suitable crosslinking agents able to react with two or more hydroxyl groups include phosphorus oxychloride , trimetaphosphates , epichlorohydrin , dicarboxylic acid anhydride , n , n &# 39 ;- methylenebisacrylamide ; 2 , 4 , 6 - trichloro - s - triazine and the like . the degree of crosslinking should be such that there are 500 to 10 , 000 anhydroglucose units ( agu ) per crosslink . to obtain this level of crosslinking about 0 . 001 to 0 . 15 percent , based on the starch , of crosslinking reagent should be employed , preferably 0 . 01 to 0 . 15 percent . the crosslinking agent is added to a granular starch suspension generally having a solids content on the order of 35 to 45 %. the crosslinking reaction lasts from one to twenty - four hours at a temperature within the range of 10 ° to 110 ° c . with the ph controlled between ph 7 to 12 . if the suspension is a swelling one , such as an aqueous suspension , the swelling under strongly alkaline conditions can be controlled by the presence of high concentrations ( 10 to 30 %) of sodium chloride or sulfate . the swelling of the starch results from the alkali hydroxide , ammonium hydroxide , amine or alkali carbonate generally employed to maintain the ph . conditions under this reaction are generally chosen to prevent gelatinization so that the reaction product can be isolated in granule form . to obtain a higher degree of substitution , the crosslinking reaction may be carried out in a non - swelling suspension , such as isopropanol , or by blending the reagents with a starch having a 5 to 20 % moisture content without any suspending medium . additionally , the crosslinking reaction can occur in a cooked aqueous starch solution where the starch has gelatinized ; in this reaction the temperature must be maintained between 60 ° and 100 ° c ., and the gelatinized starch can also be dried on a heated drum . although the effective amount of the crosslinked starch necessary to obtain effective depression may vary depending upon the mineral to be treated , the degree of substitution and similar variables , generally an effective amount will be 0 . 25 to 2 . 5 pounds of crosslinked starch per ton of ore and preferably 0 . 5 to 1 . 5 pounds per ton of ore . the ores which can be treated are believed to be all non - sulfide ores with special emphasis being given to the separation of siliceous gangue particles from oxidic iron values , of copper minerals from molybdenite , of galena from chalcopyrite and sphalerite , of apatite from ilmenite , of fluorspar from calcite and of sylvite from halite in the presence of clays . the following specific examples illustrate certain aspects of the present invention and , more particularly , point out methods of evaluating the process for depressing non - sulfide minerals in a flotation system . however , the examples are set forth for illustration only and are not to be construed as limitations on the present invention except as set forth in the appended claims . all parts and percentages are by weight unless otherwise specified . 600 parts of crude iron ore having a particle size of minus 10 mesh are mixed with 400 ml . of deionized water , 5 . 0 ml . of a 2 % sodium silicate &# 34 ; n &# 34 ; solution and 1 . 8 ml . of a 25 % naoh solution . the resulting mixture is subjected to grinding in a rod mill for 50 minutes and thereafter is transferred into a 8 liter cylinder . to this cylinder there are added 200 ml . of 0 . 05 % ca ( oh ) 2 solution and an amount of deionized water sufficient to fill the cylinder to the 8 liter mark . the cylinder mixture is subjected to mechanical stirring for 1 minute during which time there is added 6 . 9 parts of a 1 % causticized corn starch solution ( 0 . 011 naoh based on starch ) as the desliming aid . the stirring is then stopped and the mixture is allowed to settle for 12 minutes , after which approximately 7 liters of the supernatant layer is syphoned off and filtered , resulting in the slime product . the remaining 1 liter underflow is transferred to a flotation bowl and water containing 17 ppm of calcium as caco 3 is added to the bowl until the level reaches the lip . the pulp is briefly agitated at 1200 rpm and thereafter the ph is adjusted to approximately 10 . 6 through the addition of 5 - 10 drops of 10 % naoh . 27 . 3 parts of a 1 % causticized starch solution is then added as a depressant and a two - minute conditioning time is allowed . 4 . 9 parts of a 1 % solution of a commercially available collector is added , 30 seconds of conditioning is allowed followed by a four - minute float . after the float , 3 . 3 parts of a 1 % solution of a commercially available collector is added , 30 seconds of conditioning is allowed followed by a four - minute float . after the float , 3 . 3 parts of a 1 % solution of a commercially available collector is again added , 30 seconds of conditioning is allowed and then followed by a second four - minute float . the froth collected from the first and second floats is labeled the rougher float and the remainder in the flotation bowl is labeled the rougher concentrate . the rougher float is transferred to a second flotation bowl to which there is added 13 . 6 parts of a 1 % causticized corn starch solution as a depressant . two minutes of conditioning is allowed before air is introduced into this bowl for 3 - 4 minutes . the froth collected is labeled the final froth . the underflow from the scavenger float is further conditioned for 30 seconds with 1 . 4 parts of a 1 % solution of a commercially available collector and thereafter floated for 3 minutes . the middling float sequence is repeated a second time and the combined froth from these two float is labeled the middling froth . the underflow remaining is combined with the rougher concentrate and labeled the concentrate . the experimental procedure set forth above is followed in every material detail employing as the depressant 1 . 5 pounds of causticized starch per long ton of iron ore in the flotation steps . test results are set forth in table i . the experimental procedure set forth above is followed in every material detail employing as the depressant 0 . 75 pound of causticized starch per long ton of iron ore in the flotation steps . test results are set forth in table i . the experimental procedure set forth above is followed in every material detail employing as the depressant 1 . 5 pounds of crosslinked starch per long ton of iron ore in the flotation steps wherein the crosslinked starch is an ethoxylated cornstarch crosslinked with epichlorohydrin and mixed with 7 . 7 % naoh in a blender for 15 seconds . test results are set forth in table i . the procedure of example 1 is followed in every material detail except that 0 . 75 pound of crosslinked starch is employed as the depressant are set forth in table i . the experimental procedure set forth above is followed in every material detail employing as the depressant 1 . 5 pounds of ethoxylated corn starch mixed with 7 . 7 % naoh in a blender for 15 seconds per long ton of iron ore in the flotation steps . test results are set forth in table i . the procedure of example 1 is followed in every material detail except that 1 . 0 pound of crosslinked starch is employed as the depressant per long ton of iron ore . test results are set forth in table ii . the procedure of example 3 is followed in every material detail except that the crosslinked cornstarch is mixed with 2 % naoh and blended for 5 seconds . test results are set forth in table ii . table i__________________________________________________________________________desliming - flotation performance of oxidized iron ore weight % calcu - % fe assaydose concen - final middl . lated final middl . examplelb / lt slime trate froth froth head slime conc . froth froth__________________________________________________________________________comp . a1 . 5 21 . 56 41 . 89 32 . 51 4 . 03 35 . 52 10 . 8 66 . 5 12 . 2 34 . 51 1 . 5 18 . 22 44 . 68 32 . 95 4 . 14 36 . 40 9 . 0 65 . 8 12 . 4 30 . 9comp . c1 . 5 18 . 02 38 . 04 36 . 25 7 . 69 36 . 54 9 . 4 67 . 8 14 . 3 51 . 1comp . b 0 . 75 18 . 37 39 . 22 37 . 54 4 . 85 36 . 68 9 . 1 67 . 7 16 . 2 49 . 22 0 . 75 21 . 46 41 . 19 32 . 87 4 . 47 36 . 23 10 . 1 67 . 7 14 . 3 39 . 6__________________________________________________________________________ fe distributioninsol final middl . type of causti - % naoh basedexampleconc . slime conc . froth froth cized starch on starch__________________________________________________________________________comp . a4 . 21 6 . 53 78 . 40 11 . 5 3 . 91 corn starch 0 . 0111 5 . 67 4 . 50 80 . 77 11 . 21 3 . 50 ethoxylated corn 7 . 7 crosslinkedcomp . c3 . 51 4 . 62 70 . 58 14 . 17 10 . 62 ethoxylated corn 7 . 7 non - crosslinkedcomp . b3 . 83 4 . 55 72 . 38 16 . 57 6 . 49 corn starch 0 . 0112 4 . 45 5 . 96 76 . 18 12 . 47 4 . 88 ethoxylated cross - 7 . 7 linked starch__________________________________________________________________________ table ii__________________________________________________________________________desliming - flotation performance of oxidized iron ore weight % calcu - % fe assaydose concen - final middl . lated final middl . examplelb / lt slime trate froth froth head slime conc . froth froth__________________________________________________________________________3 1 . 0 20 . 6 35 . 9 36 . 5 7 . 0 36 . 43 10 . 0 67 . 0 19 . 3 46 . 94 1 . 0 22 . 5 31 . 4 37 . 8 8 . 3 36 . 62 9 . 9 67 . 8 23 . 0 53 . 1__________________________________________________________________________ fe distributioninsol final middl . type of causti - % naoh basedexampleconc . slime conc . froth froth cized starch on starch__________________________________________________________________________3 3 . 35 5 . 65 66 . 01 19 . 32 9 . 00 ethoxylated cross - 7 . 7 linked corn4 2 . 85 6 . 09 58 . 14 23 . 76 12 . 01 ethoxylated cross - 2 . 0 linked corn__________________________________________________________________________ when the experimental procedure set forth above is employed in the flotation process wherein copper is separated from molybdenite , depression performance substantially equivalent to that achieved in an iron ore flotation system is obtained employing a n , n &# 39 ;- methylenebisacrylamide crosslinked amylomaize starch . when the experimental procedure set forth above is employed in the flotation process wherein galena is separated from chalcopyrite and sphalerite , depression performance substantially equivalent to that achieved in an iron ore flotation system is obtained employing an epichlorohydrin crosslinked dextrinized potato starch . when the experimental procedure set forth above is employed in the flotation process wherein apatite is separated from ilmenite , depression performance substantially equivalent to that achieved in an iron ore flotation system is obtained employing a trimetaphosphate crosslinked sorghum starch . when the experimental procedure set forth above is employed in the flotation process wherein fluorspar is separated from calcite , depression performance substantially equivalent to that achieved in an iron ore flotation system is obtained employing an epichlorohydrin crosslinked etherified rice starch . when the experimental procedure set forth above is employed in the flotation process wherein sylvite is separated from halite and clay , depression performance substantially equivalent to that achieved in an iron ore flotation system is obtained employing a n , n &# 39 ;- methylenebisacrylamide crosslinked tapioca starch .	1
this invention relates to a new soluble form of amphotericin b which is believed to be a complex of amphotericin b comprising amphotericin b and the anion of an organic mono - or polycarboxylic acid of up to 20 carbon atoms . examples of such acids are acetic , oxalic , propanoic , malonic , 2 - methylpropanoic , butanoic , succinic , 2 , 2 - dimethylbutanoic , fumaric , citric , malic , glutaric , pentanoic , hexanoic , octanoic , nonoic , decanoic , hendecanoic , dodecanoic , palmitic , ricinoleic , oleic , stearic , or ethylenediaminetetraacettic acid . this type of aphotericin b may be prepared by adding the organic carboxylic acid to a substantially anhydrous ( not over about 1 % water ) alcoholic solution of amphotericin . methanol is a preferred alcohol although any water soluble or partially water miscible alcohol may be used , such as ethanol , propanol or butanol . the mixture of amphotericin b and the organic carboxylic acid ( containing excess acid , typically from about 0 . 5 to about 20 mols of acid per mol of amphotericin b ) is agitated for a short time , typically from about 2 minutes to about 30 minutes , and the ph then adjusted to neutral . the mixture is then heated moderately to from about 35 ° c to about 65 ° c while mixing for a period of from about 0 . 5 to about 2 hours . the ph is then readjusted to neutral and the mixture cooled slowly over a period of from about 0 . 5 to about 4 hours . the solid is filtered and dried . the amphotericin b complex of the present invention is soluble in water under both strongly acid and strongly alkaline conditions while exhibiting diminished solubility at neutral or near neutral ph . maximum solubility of the amphotericin b complexes of the present invention occur at about ph 2 and at about ph 10 . the complexes of the present invention are less soluble in methanol than amphotericin b . forty mg of the complexes of the present invention are soluble in 750 ml of methanol whereas 100 mg of amphotericin b are soluble in 750 ml of methanol . the following example illustrates the present invention without , however , limiting the same thereto . all temperatures in this application are expressed in degrees centigrade unless otherwise indicated . 42 . 64 g of amphotericin b containing 40 . 0 g activity are solubilized in 10 . 0 l of methanol by means of 7 . 0 ml of 5 . 8 n hcl . the solution is filtered . to this solution is added a solution of 400 ml of methanol containing 40 g of succinic acid . the ph drops to 4 . 05 and is adjusted to 7 . 0 with 29 . 6 ml of concentrated ammonia . the crystal suspension which forms is heated to 45 °- 50 ° c , slurried for 60 minutes , cooled to room temperature over a 2 - hour period , filtered and dried overnight at 45 °- 50 ° c . the resulting crystalline complex weighs 34 . 2 g . this complex has a solubility in water of 28 . 0 g / l at ph 2 . amphotericin b , on the other hand , has a solubility in water of less than 1 gram / l at ph 2 . the complex has an x - ray pattern and u . v . absorption at 405 millimicrons ( e 1 1 ) in methanol of 1649 ; pure amphotericin b dissolved in methanol has a e 1 1 u . v . absorption value of 1800 at 405 millimicrons . one hundred mg of this complex when added to 80 ml of methanol and the ph adjusted to 9 . 5 ( with triethylamine ) are soluble to the extent of 35 %, whereas 100 mg of amphotericin b are completely soluble in 80 ml of methanol . the above amphotericin b - succinic acid complex of the present invention has a biological activity of 1000 - 1250γ / mg while amphotericin b has a bioloiical activity of 920γ / mg . the test method used in establishing the biological activity is that described by platt et al ., analytical microbiology , volume ii , academic press , 1972 , editor f . kavangh , 4 . 2 iv , pp . 163 - 170 . the assay organism is candida tropicalis , atcc no . 13803 .	2
( 1 ) the difference between the refractive index of the lens and the refractive index of the adhesive agent is made smaller than 0 . 1 . ( 2 ) the finish roughness of the cemented surface of the lens in the smoothing step is made higher than mesh # 1400 . and , without performing the polishing step that usually follows the smoothing step , the lens surface is put into adhesion with the polished surface of another lens . it is to be noted that the use of resin pellets of mesh # 1500 gives a surface roughness of 0 . 2 to 0 . 3 microns . in a case where no adhesive agent of proper refractive index can be obtained , an adhesive layer may be formed on the target surface by evaporating a material of intermediate refractive index between the refractive indices of the material of the lens element and the adhesive agent . even in this case , an equivalent result is effected . the surface is usually polished to a roughness on a dimensional order that is less than the wavelength , for example , 0 . 5 microns or less . if the adhesive agent and the lens on which the adhesive agent is applied have exactly the same refractive index , however , their boundary does not cause light to refract at all . even if the lens surface has minute concave and convex portions , therefore , they do not optically give any influence to the cemented refracting surface between the adhesive agent layer and the polished surface of the target lens . but , because , in reality , the available adhesive agent is few in number of kinds , in a case where the coincidence of the refractive indices is insufficient , it is important to limit the surface roughness to less than a certain level . from the experiments , it has been found that , in the actual practice , the above - cited conditions ( 1 ) and ( 2 ) in combination suffice for a satisfactory result . it is to be noted that this example is applicable to all optical instruments of the type in which a plurality of objects of different refractive indices are cemented together and the light rays passing through the cemented portions are utilized . therefore , it is not confined to the shape of the object to be cemented . it will be appreciated that the subject is solved by relying only on the correlation of the refractive indices of the two substances on either side of the cemented surface as the boundary , and the finish roughness of the cemented surface . by the way , the photographic zoom lenses used in bench tests of the invention were for a video camera , each comprising twelve or fourteen component lenses , of which two or three are in the cemented form . however , the test result depends on the state in which light passes through the cemented lens , in other words , the position at which the cemented lens is used in the photographic lens . some of the photographic lenses for the ordinary monitor camera have showed a good result with a finish roughness of mesh # 1200 or even # 1000 . fig1 ( a ) shows a step prior to the cementing , and fig1 ( b ) shows a step subsequent to the cementing . reference numeral 1 denotes a negative meniscus - shaped glass lens of which the outer surface 1a and the cemented surface 1b undergo the polishing step . reference numeral 2 denotes a positive glass lens having a refractive index different from that of the lens 1 . though its outer surface 2a undergoes up to the polishing step , its cemented surface 2b does not go beyond the smoothing step . in the ordinary cemented lenses , the refractive index of the positive lens is lower than that of the negative lens , while the adhesive agent of high refractive index is hardly available . therefore , the positive lens is chosen to be made as the rough surface . this surface has to be finished to a roughness of at least mesh # 1400 . in some cases , a higher number in mesh has to be chosen depending on the performance of the lens . reference numeral 3 denotes the adhesive agent . what is used here is of the ultraviolet ray setting type as is sold under the trade name : hard lock op , type no . op - 1045k from denki kagaku kogyo k . k . in fig1 ( b ), the axial thickness of the adhesive agent layer is depicted in exaggerated scale . as has been described above , limitations have been laid on the refractive index and the finish roughness . if these conditions are not satisfied , a deterioration of the image quality is found , which originates from the cemented surface . this is caused to appear by the extraordinary scattering and a decrease of transmittance in the treated surface . the cementing operation may be carried out without the necessity of altering the conventional way . so , the concave surface is put beneath , then coated with an adhesive agent layer , then the convex surface is gradually pressed against it , then centering is carried out , and then the adhesive agent is hardened by exposing to ultraviolet rays . the thus - made cemented lens is used as the component lens y or z or both in the zoom lens of fig3 . in reality , the refractive indices of the glass materials and adhesive agents sold in the market fall in a somewhat limited range . to satisfy the condition ( 1 ) at all times , therefore , a measure may be taken that the smoothed surface of the lens is further treated to form an intermediate layer by applying a coating of another material 4 ( for example , cerium fluoride ) thereon . in this case , as shown in fig2 ( a ), the cemented surface 2b of the lens element 2 is first smoothed to a finish of mesh # 1400 or more , and then a coating of such a material 4 that the difference from the refractive index n of the adhesive agent 3 is reduced to 0 . 1 or less is applied to the cemented surface 2b . it is after this that the two lenses 1 and 2 are brought into cementing contact as shown in fig2 ( b ). the invention is applicable also to cemented triplets or higher , and can be utilized in manufacturing cemented prisms . furthermore , it can be utilized in manufacturing replica type aspheric lenses and filters . according to the invention described above , one of the steps of the process for manufacturing cemented lenses or like other optics can be omitted , thereby giving an advantage that the production cost can be reduced by a significant amount , while nevertheless not involving such a problem that the image quality is caused to deteriorate . in turn , the decrease of the production cost provides a possibility of making a lens design with the use of a positively increased number of cemented lens members . also , when mounting all the lens elements in fixedly secured relation to the lens barrel , since any of the cemented members has substantially two elements , to keep hold of only one element is sufficient . even this can contribute to a reduction of the cost .	8
the implementation of the present invention is described below through specific embodiments , and those skilled in the art can easily understand other advantages and efficacy of the present invention based on the disclosure of the specification . referring to fig1 , fig2 , and fig3 , the present invention provides an adjustable coolant quick coupler , which includes a coolant supplier seat 1 , an intubation device 2 , a transmission seat 3 , a connecting device 4 , and a regulator assembly 5 . an end of the coolant supplier seat 1 is provided with a tank 10 and two holes 11 . the two holes 11 are respectively located at two opposite angles of the tank 10 , and each hole 11 has a positioning pillar 12 . referring to fig4 , an other end of the coolant supplier seat 1 is provided with a flow - in channel 13 and a flow - out channel 14 , which are respectively communicated with the tank 10 . a side of the coolant supplier seat 1 has a flow - in hole 15 and a flow - out hole 16 , in which the flow - in hole 15 is communicated with the flow - in channel 13 , and the flow - out hole 16 is communicated with the flow - out channel 14 . an other end of the coolant supplier seat 1 further has a flow - in quantity adjusting hole 17 and a flow - out quantity adjusting hole 18 , in which the flow - in quantity adjusting hole 17 is communicated with the flow - in channel 13 , and the flow - out quantity adjusting hole 18 is communicated with the flow - out channel 14 . the intubation device 2 has a stopper 20 , a flow - in tube 21 , a flow - out tube 22 , an elastic 23 , and a stop pillar 24 . the stopper 20 is disposed between the tank 10 and the flow - in channel 13 and the flow - out channel 14 . the stopper 20 has a first through hole 200 and a second through hole 201 respectively corresponding to the flow - in channel 13 and the flow - out channel 14 . an end of the flow - in tube 21 is disposed in the flow - in channel 13 and has an inlet hole 210 . an other end of the flow - in tube 21 passes through the first through hole 200 , extends into the tank 10 , and has a plurality of outlet holes 211 . the outlet holes 211 are communicated with the inlet hole 210 . the flow - in tube 21 is sleeved with a plurality of leak - proof washers 212 . an end of the flow - out tube 22 is disposed in the flow - out channel 14 and has an outlet hole 220 . an other end of the flow - out tube 22 passes through the second through hole 201 , extends into the tank 10 , and has a plurality of inlet holes 221 . the inlet holes 221 are communicated with the outlet hole 220 . the flow - out tube 22 is sleeved with a plurality of leak - proof washers 222 . the elastic 23 and the stop pillar 24 are disposed in the tank 10 . the elastic 23 may be a spring . an end of the elastic 23 pushes against the stopper 20 , and an other end of the elastic 23 pushes against the stop pillar 24 . the stop pillar 24 has a first stop hole 240 and a second stop hole 241 . the first stop hole 240 is provided for the end of the flow - in tube 21 having the outlet holes 211 to extend therein , so that the stop pillar 24 can optionally seal the outlet holes 211 . the leak - proof washers 212 generate a better sealing effect between the first stop hole 240 and the flow - in tube 21 . the second stop hole 241 is provided for the end of the flow - out tube 22 having the inlet holes 221 to extend therein , so that the stop pillar 24 can optionally seal the inlet holes 221 . the leak - proof washers 222 generate a better sealing effect between the second stop hole 241 and the flow - out tube 22 . an end of the transmission seat 3 has a recess 30 and two positioning holes 31 . the positioning holes 31 are located at two opposite angles of the recess 30 , and each positioning hole 31 can be optionally inserted by the corresponding positioning pillar 12 , so as to connect and position the coolant supplier seat 1 and the transmission seat 3 . a side of the transmission seat 3 has a fluid outlet hole 32 and a fluid inlet hole 33 , which are respectively communicated with the recess 30 . the side of the transmission seat 3 further has a switching part 34 , in which the switching part 34 has a fluid inlet tube 340 communicated with the fluid inlet hole 33 and a fluid outlet tube 341 communicated with the fluid outlet hole 32 . the connecting device 4 has a washer 40 , two elastics 41 , two flow retaining pillars 42 , and a bearing pillar 43 . the washer 40 , the elastics 41 , the flow retaining pillars 42 , and the bearing pillar 43 are disposed in the recess 30 . the bearing pillar 43 has a first hole 430 and a second hole 431 at positions respectively corresponding to the fluid outlet hole 32 and the fluid inlet hole 33 . the bearing pillar 43 has a liquid flow - out hole 432 and a liquid flow - in hole 433 in a periphery thereof at positions corresponding to the fluid outlet hole 32 and the fluid inlet hole 33 . the liquid flow - out hole 432 is communicated with the first hole 430 , and the liquid flow - in hole 433 is communicated with the second hole 431 . the bearing pillar 43 is sleeved with a leak - proof washer 434 , so as to generate a better sealing effect between the bearing pillar 43 and the recess 30 . the two flow retaining pillars 42 are respectively disposed in the first hole 430 and the second hole 431 , and used for optionally sealing the first hole 430 , the second hole 431 , the liquid flow - out hole 432 , and the liquid flow - in hole 433 . an end of each elastic 41 pushes against the washer 40 , and an other end of the elastic 41 pushes against the corresponding flow retaining pillar 42 . the elastic 41 may be a spring . the flow retaining pillars 42 are sleeved with leak - proof washers 420 , so as to generate a better sealing effect between the flow retaining pillars 42 and the first hole 430 and the second hole 431 . the regulator assembly 5 has a flow - in quantity adjusting button 50 and a flow - out quantity adjusting button 51 . an end of the flow - in quantity adjusting button 50 is disposed in the flow - in quantity adjusting hole 17 , corresponds to the flow - in hole 15 , and has a flow guiding end 501 . an other end of the flow - in quantity adjusting button 50 has an adjusting portion 500 . the flow - in quantity adjusting button 50 is sleeved with a leak - proof washer 502 , so as to avoid leakage at the flow - in quantity adjusting hole 17 . an end of the flow - out quantity adjusting button 51 is disposed in the flow - out quantity adjusting hole 18 , corresponds to the flow - out hole 16 . an other end of the flow - out quantity adjusting button 51 has an adjusting portion 510 . the flow - out quantity adjusting button 51 is sleeved with the leak - proof washer 510 , so as to avoid leakage at the flow - out quantity adjusting hole 18 . referring to fig4 , the coolant supplier seat 1 may be connected to one coolant supplier , and the transmission seat 3 may be connected to a rack having electronic components that need heat dissipation . when the coolant supplier seat 1 is connected to the transmission seat 3 , the positioning pillar 12 is inserted into the positioning hole 31 , so that the transmission seat 3 and the coolant supplier seat 1 are well positioned and connected with each other . an end portion of the stop pillar 24 is pushed against by the bearing pillar 43 , so that the stop pillar 24 is withdrawn into the tank 10 , and compresses the elastic 23 . an end of the flow - in tube 21 having the outlet holes 211 is inserted into the first hole 430 , so that the flow retaining pillar 42 located in the first hole 430 is withdrawn into the recess 30 , and compress the elastic 41 , so that the outlet holes 211 are communicated with the fluid outlet hole 32 . similarly , the end of the flow - out tube 22 having the inlet holes 221 is inserted into the second hole 431 , so that the stop pillar 24 is withdrawn into the recess , and the inlet holes 221 are communicated with the fluid inlet hole 33 . coolant at a low temperature from the coolant supplier flows through the flow - in hole 15 , the inlet hole 210 , the flow - in tube 21 , the outlet holes 211 , the liquid flow - out hole 432 , the fluid outlet hole 32 , and the fluid outlet tube 341 , so as to reach the electronic components that need heat dissipation , so that heat exchange occurs between the coolant and the electronic components . thus , the electronic components dissipate heats and are cooled down , and then after the heat exchange , the coolant turns into coolant at a high temperature . the coolant at a high temperature flows through the fluid inlet tube 340 , the fluid inlet hole 33 , the liquid flow - in hole 433 , the inlet holes 221 , the flow - out tube 22 , the outlet hole 220 , and the flow - out hole 16 , so as to flow back to the coolant supplier , so that the coolant at a high temperature is cooled down to become coolant at a low temperature , which is used for a next heat exchange cycle . when the rack needs to be disconnected from the coolant supplier , the coolant supplier seat 1 and the transmission seat 3 are directly disconnected from each other , and then the compressed elastics 23 and 41 respectively force the stop pillar 24 and the flow retaining pillars 42 to return to the initial positions , and the stop pillar 24 seals the outlet holes 211 of the flow - in tube 21 and the inlet holes 221 of the flow - out tube 22 , and the flow retaining pillars 42 seal the first hole 430 , the second hole 431 , the liquid flow - out hole 432 , and the liquid flow - in hole 433 , thereby stopping the flowing of the coolant , and preventing leakage of the coolant when the rack is disconnected from the coolant supplier . in addition , referring to fig5 , when the coolant flows in the coolant supplier seat 1 and the transmission seat 3 , by using certain tools to combine with the adjusting portions 500 and 510 , the position of the flow guiding end 501 in the flow - in channel 13 can be adjusted , so as to further control the opening of the flow - in hole 15 , or the position of the flow - out quantity adjusting button 51 in the flow - out channel 14 can be adjusted , so as to further control the opening of the flow - out hole 16 , thereby controlling and changing the quantity of flow - out coolant and the quantity of flow - in coolant , and achieving a better effect of heat dissipation for the electronic components . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .	8
the description of the present invention is further provided as follows with reference to the specific embodiments , and features and advantages of the present invention will become more apparent from the following description . however , these embodiments are only exemplary , but not forming any limitation to the scope of the present invention . it should be understood by a person skilled in the art that modifications or alternatives to details and forms of the technical solution of the present invention without deviation from the spirit and scope of the present invention will be allowed , while those modification and alternatives should all fall within the scope of the present invention . in the invention , the term “ per pig ” refers to the amount of vaccine each pig injected . in the invention , the term “ tcid 50 ” refers to 50 % tissue culture infective dose , a way to represent viral infectivity . minimum essential medium ( mem ) liquid medium is prepared with mem dry powdered medium purchased from life technologies , corp . according to the instruction . dulbecco &# 39 ; s modified eagle &# 39 ; s medium ( dmem ) in the present invention is prepared with reference to the preparation method from appendix a of gb / t18641 - 2002 diagnostic techniques for aujeszk &# 39 ; s disease . in the present invention , the term “ pbs ” is the abbreviation for phosphate buffer saline , and 0 . 01 mm ph 7 . 4 pbs as used in the present invention is prepared as described in molecular cloning : laboratory manuals , 3 rd edition . the prv hn1201 strain ( pseudorabies virus , strain hn1201 ) used in the embodiments is deposited in the china center for type culture collection on may 20 , 2013 , of which the accession number is cctcc no . v 201311 and the address is wuhan university , wuhan , china . the prv hn1202 strain ( pseudorabies virus , strain hn1202 ) used in the embodiments is deposited in the china center for type culture collection on aug . 26 , 2013 , of which the accession number is cctcc no . v 201335 and the address is wuhan university , wuhan , china . in the following specific embodiments , the description of the present invention is further provided with examples of prv hn1201 strain , nvdc - prv - bj strain , nvdcprv - heb strain , nvdc - prv - sd strain and hn1202 strain . 1 . 1 construction of a transfer vector for recombinant prv hn1201gfp virus according to the sequence of us segment ( gi / ge / 11k / 28k ) to be deleted , the homologous arms were designed at its two ends , called usa and usb , respectively . usa and usb were cloned into puc19 vector and named pucusab . then gfp gene was cloned into pucusab , to obtain a transfer vector for recombinant virus which was called pucusa - gfp - b . the homologous arms in the transfer vector are sequences of two sides of us , therefore the recombinant virus obtained after recombination , was us segment deleted , which comprised gi / ge / 11k / 28k . fig1 is a schematic diagram showing construction of the transfer vector , and fig2 shows the location of the homologous arms , usa and usb in the genome . two pairs of primers were designed for amplifying the homologous arms at two sides of segment to be deleted according to the gene sequence of hn1201 virus : the upstream and downstream primers for the homologous arm usa at the left side are , respectively : the upstream and downstream primers for the homologous arm usb at the right side are , respectively : vero cells were transfected with prv hn1201 , and part of supernatant was harvested when the cytopathic effect of cells reached to 80 %, for extracting genomic dna of virus by using geneaid viral nucleic acid extraction kit as the template for amplification of the homologous arms . usa and usb were amplified through pcr method by using takara primestar , of which the system and condition is as follows : usa and usb fragments amplified by pcr were separated by electrophoresis on agarose gel , and the target fragments were recovered with tiangen gel recovery kit . usa fragment and puc19 vector was digested by both of ecor i and xbai , and the target fragments were recovered , connected by t4 dna ligase , and the product was transformed into dh5α . the transformation mix was spread onto plates containing ampicillin , and incubated at 37 ° c . overnight . a single colony was picked to extract the plasmid and the plasmid was identified using enzyme digestion , and the correct plasmid after identification was named pucusa . pucusa and usb was digested by both of sali and hindiii , and the target fragments were recovered , linked by t4 dna ligase , and the product was transformed into dh5α . the transformation mix was spread onto plates containing ampicillin , and incubated at 37 ° c . overnight . a single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion , and the correct plasmid after identification was named pucusab . the pacgfp - c1 plasmid ( purchased from clontech , catalog no . 632470 ) was digested by bgl ii and sma i , and the linearized vector was recovered , linked by t4 dna ligase after filling - in with dna polymerase i large ( klenow ) fragment , and transformed into the competent cell dh5α to obtain mcs deleted gfp plasmid , named pacgfpδmcs . the primers for amplifying gfp were designed according to the sequence of pacgfp - c 1 vector . gfp gene was amplified with pacgfpδmcs plasmid as the template , of which the system and condition is as follows : a target band was recovered by electrophoresis on agarose gel for further linking . gfp was digested with both of sal and sph i , and the target fragments were recovered , linked to pucusb plasmid which had been through the same double enzyme digestion , and the product was transformed into the competent cell dh5α . the transformation mix was spread onto plates containing ampicillin , and incubated at 37 ° c . overnight . a single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion , and the correct plasmid after identification was named pucusa - gfp - b . 1 . 2 . 1 acquisition of recombinant virus through co - transfection of vero cells with the transfer vector and hn1201 dna co - transfection of vero cells was conducted by using lipofectin technique , wherein 3 μg prv - hn1201 viral genomic dna and 5 μg the transfer vector pucusa - gfp - b was transfected , in accordance with procedures of lipofectamine 2000 protocol ( invitrogen , catalog no . 11668030 ). cells were incubated at 37 ° c . in an incubator containing 5 % co 2 . the supernatant of cell culture , i . e . p0 recombinant virus , named rprv - gfp - us −, was collected 36 - 48 h after transfection , or until the cytopathic effect was visible and infected cells exhibited fluorescence . when infected with the obtained p0 recombinant virus rprv - gfp - us −, vero cells infected were covered with 2 % agarose with low melting point . after 48 h when the cytopathic effect became apparent and infected cells exhibited obvious fluorescence , a plaque with a green fluorescence was picked and freeze - thawed 3 times in − 70 ° c ., inoculated at 10 - fold serial dilutions into vero cells previously laid in six - well plates . such plaque with a green fluorescence was continued to be picked for purification . after 8 rounds of plaques purification , a purified recombinant virus rprv - gfp - us − which was free of wild - type virus hn1201 and with deletion of gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) was obtained . 1 . 3 deletion of gfp label gene in the gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) segment - deleted recombinant virus pbs185 plasmid expressing cre enzyme ( purchased from addgene , cre enzyme recognizes loxp sites at downstream of usa and upstream of usb , wherein usa and usb are homology arms , and deletes sequence between two loxp sites ) and genomic dna of recombinant virus rprv - gfp - us − was co - transfected into vero cells , with the results showing relatively obvious cytopathic effect and more single fluorescence 24 h after transfection . after serial dilution , p0 virus harvested was inoculated for plaque screening ; fluorescence - negative plaque was picked for the next round of purification . after 2 rounds of screening and purification , a fluorescence - negative virus was obtained , and named vprv - us −. pcr identification result after extraction and purification of viral genomic dna , showed deletion of gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) segment , and indicated that gfp label gene had been deleted . the result showed a successful purification of gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) segment - deleted virus containing no gfp label gene . the viral genome of gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) segment - deleted virus and wild - type virus , was extracted and identified by pcr , with the following primers : the size of pcr amplification product of the wild - type virus was 6286 bp , the size of pcr amplification fragment of gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) segment - deleted virus was 1960 bp . pcr assay result confirmed that orf of gi / ge / us9 / us2 ( i . e . gi / ge / 11k / 28k ) segment had been completely missing . 2 . 1 construction of a transfer vector for recombinant prv hn1201gfp virus according to the sequence of tk gene to be deleted , the homologous arms at its two ends were designed , called tka and tkb , respectively . tka and tkb were cloned into puc19 vector and named puctkab . then gfp gene was cloned into puctkab , to obtain a transfer vector for recombinant virus which was called puctka - gfp - b . the homologous arms in the transfer vector are sequences of two sides of tk , therefore the recombinant virus obtained after recombination , was tk gene deleted . fig4 shows the location of homologous arms , tka and tkb in the genome . two pairs of primers were designed for amplifying the homologous arms at two sides of tk gene according to the gene sequence of hn1201 virus : the upstream and downstream primers for the homologous arm tka at the left side are , respectively : tkaf : ccg gaattc gtagtgccggttgcccacgtaca ( the underline portion refers to the ecor i cutting site ) tkar : ctag tctaga ataacttcgtatagtacacattatacgaagttat cgctcaggctgccgttctgc ( the underline portion refers to the xba i cutting site , lowercase letters refer to the loxp site ) the upstream and downstream primers for the homologous arm tkb at the right side are , respectively : vero cells were transfected with prv hn1201 , and part of supernatant was harvested when the cytopathic effect of cells reached to 80 %, for extracting genomic dna of virus by using geneaid viral nucleic acid extraction kit as the template for amplification of the homologous arms . tka and tkb were amplified through pcr method by using takara primestar , of which the system and condition is as follows : tka and tkb fragments amplified by pcr were separated by electrophoresis on agarose gel , and the target fragments were recovered with tiangen gel recovery kit . tka fragment and puc19 vector was digested with both of ecor i and xbai , and the target fragments were recovered , linked by t4 dna ligase , and the product transformed into dh5α . the transformation mix was spread onto plates containing ampicillin , and incubated at 37 ° c . overnight . a single colony was picked to extract the plasmid and the plasmid was identified after enzyme digestion , and the correct plasmid after identification was named puctka . puctka and tkb was digested with both of sali and hindiii , and the target fragments were recovered , linked by t4 dna ligase , and the product transformed into dh5α . the transformation mix was spread onto plates containing ampicillin , and incubated at 37 ° c . overnight . a single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion , and the correct plasmid after identification was named puctkab . the pacgfp - c1 plasmid ( purchased from clontech , catalog no . 632470 ) was digested with bgl ii and sma i , and the linearized vector was recovered , linked by t4 dna ligase after filling - in with dna polymerase i large ( klenow ) fragment , and the product was transformed into the competent cell dh5α to obtain mcs deleted gfp plasmid , named pacgfpδmcs . the primers for amplifying gfp were designed according to the sequence of pacgfp - c 1 vector . gfp gene was amplified with the template of pacgfpδmcs plasmid , of which the system and condition is as follows : a target band was recovered by electrophoresis on agarose gel for further linking . gfp was digested with both of sal and sph i , and the target fragments were recovered , linked to puctkab plasmid which had been through the same double enzyme digestion , and the linked product was transformed into the competent cell dh5α . the transformation mix was spread onto plates containing ampicillin , and incubated at 37 ° c . overnight . a single colony was picked to extract the plasmid and the plasmid was identified by sequencing after enzyme digestion , and the correct plasmid after identification was named puctka - gfp - b . 2 . 2 . 1 acquisition of recombinant virus through co - transfection of vero cells with the transfer vector and vprv - gi - ge - 11k - 28k − dna co - transfection of vero cells was conducted by using lipofectin technique , wherein 3 μg vprv - gi - ge - 11k - 28k − viral genomic dna and 5 μg the transfer vector puctka - gfp - b was transfected , in accordance with procedures of lipofectamine 2000 protocol ( invitrogen , catalog no . 11668030 ). cells were incubated at 37 ° c . in an incubator containing 5 % co 2 . the supernatant of cell culture , i . e . p0 recombinant virus , named rprv - gfp - gi - ge - 11k - 28k - tk −, was collected 36 - 48 h after transfection , or until the cytopathic effect was visible and infected cells exhibited fluorescence . when infected with the obtained p0 recombinant virus rprv - gfp - gi - ge - 11k - 28k - tk −, vero cells infected were covered with 2 % agarose with low melting point . after 48 h when the cytopathic effect became apparent and infected cells exhibited obvious fluorescence , a plaque with a green fluorescence was picked and freeze - thawed 3 times in − 70 ° c ., inoculated at 10 - fold serial dilutions into vero cells previously laid in six - well plates . such plaque with a green fluorescence was continued to be picked for purification . after 11 rounds of plaques purification , a purified recombinant virus rprv - gfp - gi - ge - 11k - 28k - tk − which was free of prv - gi - ge - 11k - 28k - tk − and with deletion of five genes was obtained . 2 . 3 deletion of gfp label gene in gi / ge / 11k / 28k / tk deleted recombinant virus the pbs185 plasmid expressing cre enzyme ( purchased from addgene , cre enzyme recognizes mutated loxp sites at downstream of tka and upstream of tkb , wherein tka and tkb are homology arms , and deletes sequence between two loxp sites ) and genomic dna of recombinant virus rprv - gfp - gi - ge - 11k - 28k - tk − was co - transfected into vero cells , with the results showing relatively obvious cytopathic effect and more single fluorescence 24 h after transfection . after serial dilution , p0 virus harvested was inoculated for plaque screening ; fluorescence - negative plaque was picked for the next round of purification . after 2 rounds of screening and purification , a fluorescence - negative virus was obtained , and named prv - gi - ge - 11k - 28k - tk −. pcr identification result after extraction and purification of viral genomic dna , showed deletion of tk gene , and also indicated that gfp label gene had been deleted . the result showed a successful purification of gi - ge - 11k - 28k - tk − deleted virus containing no gfp label gene . the primers used for identifying deletion of gi / ge / 11k / 28k were the same as above . the viral genome of gi / ge / 11k / 28k / tk − deleted virus and wild - type virus , was extracted and identified by pcr , with the following primers : the size of pcr amplification product of the wild - type virus was 1566 bp , the size of pcr amplification fragment of tk deleted virus was 742 bp ( refer to fig5 ). prv hn1201 strain with deletion of gi / ge was prepared by reference to the method in example 1 of cn103756977a . 25 7 - day - old piglets which were negative for pseudorabies antibodies and pseudorabies antigen were randomly divided into 5 groups ( a , b , c , d and blank control group ), each with 5 piglets . grouping conditions and challenge conditions are shown in table 1 . after inoculation of virus , the temperature of piglets was determined daily , and clinical signs and death status were observed . the results are shown in table 2 . it showed in the results that inoculation with prv hn1201 strain in 7 - day - old piglets could lead to 100 % death ( 5 / 5 ) of inoculated piglets , while the virulence of prv hn1201 strain with deletion of gi / ge / 11k / 28k was significantly decreased , which could only make the temperature of 2 piglets increased , without any clinical signs . inoculation with prv hn1201 strain with deletion of gi / ge in 7 - day - old piglets could still lead to common clinical signs such as increased body temperature and depression etc ., indicating remaining virulence ; while prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk gene had completely lost its virulence . the virus seed of prv hn1201 strain with deletion of gi / ge / 11k / 28k prepared in example 1 , prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk prepared in example 2 and prv hn1201 strain with deletion of gi / ge prepared in example 3 was diluted at 5 × 10 4 fold , and then inoculated into a monolayer of st cell . after 1 h adhesion , 1000 ml of dmem medium containing 2 % fetal calf serum was added into st cell , which was then placed at 37 ° c . in a roller bottle with a rotation speed of 6 rph . the cell medium containing viruses was harvested when the cytopathic effect of cells reached to 80 %; the viruses were harvested after 2 times of freezing - thawing the medium and the virus titer was assessed . the virus solution was preserved at low temperature . 40 g of sucrose and 8 g of gelatin was added into every 100 ml of deionized water , and the solution was autoclaved ( under 121 ° c . for 30 min ) after fully melted . the virus solution prepared and preserved in example 5 . 1 was mixed with the protective agent prepared and preserved in example 5 . 2 at a volume ratio of 1 : 1 , distributed into sterilized bottles , each of which containing 2 . 6 ml and the mixed virus solution was freeze - dried . the vaccine was tested and determined to be free of contamination of bacterium and exogenous viruses and the content of virus was consistent with that before freeze - drying . the batch number of prv hn1201 strain with deletion of gi / ge / 11k / 28k prepared in example 1 , prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk prepared in example 2 and prv hn1201 strain with deletion of gi / ge prepared in example 3 were 20140501 , 20140502 and 20140503 , respectively . 12 9 - day - old piglets which were negative for prv antibodies and prv antigens were randomly divided into 5 groups , each with 5 piglets , and the piglets were injected with the vaccines prepared in example 5 according to table 3 . the vaccine control group was inoculated with the live prv vaccine , bartha k - 61 strain purchased from hipra , spain , batch no . 42rh , at the dosage from the protocol . the blank control group was inoculated with 1 ml / piglet of dmem medium . the piglets were challenged with 1 × 10 7 . 0 tcid 50 / piglet of prv hn1201 strain on day 28 after immunization . after challenge , the body temperature of piglets was determined daily , and in the meanwhile clinical signs and death status were observed ( the results are shown in table 3 ), the blood of piglets in all the experimental groups and control groups was collected respectively before challenge . the piglets were challenged with 1 × 10 7 . 0 tcid 50 / piglet ( 1 ml piglet ) of prv hn1201 strain on day 28 after immunization . after challenge , the body temperature of piglets was determined daily , and in the meanwhile clinical signs and death status were observed ( the results are shown in table 5 ). the result from table 5 indicated that immunizing piglets with the gene - deleted prv vaccines prepared in example 5 can blocked virus infection ( i . e . displaying clinical signs ), and provide 100 % ( 5 / 5 ) protection rate for piglets , while all the piglets in the blank control group died by day 5 after challenge , therefore the prv vaccines in three experimental groups can provide excellent protection , showing excellent immune protection and safety ; meanwhile it indicated that either deletion of gi / ge / 11k / 28k or deletion of gi / ge / 11k / 28k / tk for prv strain would not affect the immunogenicity . for the vaccine group with only deletion of gi / ge , the clinical signs such as increased body temperature could not be avoided , while the vaccine still possessed good immunogenicity . whereas the commercial vaccines in the prior art cannot provide a full protection to pigs . construction of gene - deleted variant strains of nvdc - prv - bj strain , nvdcprv - heb strain and nvdc - prv - sd strain , hn1202 prv variant strain gi / ge / 11k / 28k genes and gi / ge / 11k / 28k / tk genes were deleted from the parent strains , nvdc - prv - bj strain , nvdc - prv - heb strain and nvdc - prv - sd strain ( xiuling yu , zhi zhou , dongmei hu , et al . pathogenic pseudorabies virus , china , 2012 emerging infectious diseases , www . cdc . gov / eid ol . 20 , no . 1 , january 2014 ) ( the applicant promises to open it to public for 20 year from the patent application date according to provisions of guidelines for patent examination ), hn1202 strain ( deposited in the china center for type culture collection on aug . 26 , 2013 , of which the accession number is cctcc no . v 201335 and the address is wuhan university , wuhan , china ), according to methods in example 1 and 2 . the names of the attenuated strains obtained were nvdc - prv - bj with deletion of gi / ge / 11k / 28k / tk , nvdcprv - heb with deletion of gi / ge / 11k / 28k / tk , nvdc - prv - sd with deletion of gi / ge / 11k / 28k / tk , and prvhn1202 with deletion of gi / ge / 11k / 28k / tk . the deletion of genes was verified through comparison of pcr results with that of parent strains respectively . preparation of vaccine compositions of the attenuated variant strains of nvdc - prv - bj strain , nvdc - prv - heb strain and nvdc - prv - sd strain , hn1202 prv strain each attenuated vaccine strains prepared in example 7 was proliferated according to the method from example 5 . 1 , mixed with the protective agent ( prepared by adding 40 g of sucrose and 8 g of gelatin into every 100 ml of deionized water , and autoclaved ( under 121 ° c . for 30 min ) after fully melted ) at a volume ratio of 1 : 1 and the mixed vaccine compositions were freeze - dried . the batch numbers of nvdc - prv - bj strain with deletion of gi / ge / 11k / 28k / tk , nvdcprv - heb strain with deletion of gi / ge / 11k / 28k / tk , nvdc - prv - sd strain with deletion of gi / ge / 11k / 28k / tk and prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk were q01 , q02 , q03 and q04 , respectively . pathogenicity test was conducted according to the method in example 4 , in which the piglets were randomly divided into 5 groups , each with 5 piglets , inoculated with 1 ml ( 10 7 . 0 tcid 50 / ml ) of nvdc - prv - bj strain with deletion of gi / ge / 11k / 28k / tk , nvdc - prv - heb strain with deletion of gi / ge / 11k / 28k / tk , nvdc - prv - sd strain with deletion of gi / ge / 11k / 28k / tk , and prv hn1202 strain with deletion of gi / ge / 11k / 28k / tk by intranasal instillation , respectively . the results showed that all the piglets were alive in each group , with normal body temperature and no clinical signs . it proved that the virulence of mutated prv strain was reduced through deletion of gi / ge / 11k / 28k / tk genes . immunogenicity assay of the vaccines prepared in example 8 was conducted according to the method and dose in example 6 , in the meanwhile the piglets in the vaccine control group were inoculated with the live prv vaccine , hb - 98 strain batch no . 1308011 - 1 ( purchased from china animal husbandry industry co ., ltd . chengdu medical equipments factory ). the piglets were challenged with 1 × 10 7 . 0 tcid 50 / piglet of prv hn1201 strain on day 28 after immunization . after challenge , the body temperature of piglets was determined daily , and in the meanwhile clinical signs and death status were observed ( the results are shown in table 6 ). the result from table 6 indicated that immunizing piglets with the prv vaccines prepared in example 8 can block virus infection ( i . e . displaying clinical signs ), and provide 100 % ( 5 / 5 ) protection rate for piglets , while the vaccine control group can only provide 80 % ( 4 / 5 ) protection rate for piglets , and all the piglets in the blank control group died by day 5 after challenge , therefore the prv vaccines of the present invention can provide excellent protection . in addition , the piglets exhibited substantially no clinical signs , indicating excellent immune protection of the prv vaccines relative to live vaccines in the prior art . 15 piglets at the age of around 13 days which were negative for prv antigens and prv antibodies were randomly divided into 5 groups , each with 5 piglets . groups 1 - 3 were injected with the vaccine prepared in example 5 , which is prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk , with batch no . 20140502 , the live prv vaccine bartha k - 61 strain , with batch no . 66kr , purchased from hipra , spain , and the live prv vaccine , k - 61 , with batch no . 195 - b59b purchased from boehringer ingelheim ( us ) respectively . all the dose for immunization is 1 ml / piglet ( for commercial vaccine , 1 piglet dosage / piglet , according to protocols ; the prv hn1201 with deletion of gi / ge / 11k / 28k / tk vaccine , 10 6 . 0 tcid 50 / piglet ). the blank control group was inoculated with 1 ml / piglet of dmem medium . the blood of piglets was collected on day 8 , 10 , 12 , 14 and 21 after immunization , and gb antibody was determined according to the protocol of gb elisa antibody detection kit ( purchased from biochek , batch no . fs5763 , expiry date : jan . 7 , 2015 ) after the serum was separated . the detailed results of detection are shown in table 7 below . in conclusion , the antibody test results showed that , all gb antibodies turned positive on day 12 after immunization with prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk , while not all the gb antibodies had turned positive on day 21 after immunization with the two control vaccine . it showed that prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk could provide earlier immune protection . monitoring of ge antibodies after immunization with four genes deleted strain vaccine and challenge . 15 piglets at the age of around 13 days which were negative for prv antigens and prv antibodies were randomly divided into 3 groups , each with 5 piglets . groups 1 - 3 were injected with the vaccine prepared in example 5 , which is prv hn1201 strain with deletion of gi / ge / 11k / 28k / tk , with batch no . 20140502 , the live prv vaccine , bartha k - 61 strain , with batch no . 66kr , purchased from hipra , spain , and the live prv vaccine , k - 61 , with batch no . 195 - b59b purchased from boehringer ingelheim ( us ). all the dose for immunization is 1 ml / piglet ( for commercial vaccine , 1 piglet dosage / piglet , according to protocols ; the prv hn1201 with deletion of gi / ge / 11k / 28k / tk vaccine , 10 6 . 0 tcid 50 / piglet ). the piglets were challenged with 10 7 . 0 tcid 50 / piglet , 1 ml / piglet of prv hn1201 strain on day 21 after immunization . the blood of piglets was collected daily continuously from day 7 to day 14 after challenge , and ge antibody was determined according to the protocol of ge elisa antibody detection kit ( purchased from idexx co ., batch no . ak650 , expiry date : jun . 13 , 2015 ) after the serum was separated . the results showed that ge antibody was still negative ( if the value of s / n is less or equal to 0 . 60 , the sample should be determined as prv ge antibody positive ) on day 14 after challenge when the piglets were immunized with the vaccine prepared in example 5 , prv hn1201 with deletion of gi / ge / 11k / 28k / tk with batch no . 20140502 , while ge antibody became positive at different level when the piglets were immunized with the two commercial vaccines . the detailed results of deletion are shown in table 8 below . the above results indicated that the vaccine strains in the present invention has a better immunogenicity than commercial vaccine in the prior art , and after immunization therewith a faster generation of the antibody can be achieved , and the effective amplification of virus in the body of pigs can be blocked , and ge antibody is negative . those are only preferred embodiments of the present invention as described above , which cannot be used to limit the present invention . any change , substitution or modification etc ., which are within the spirit and principle of the invention , should be included within the scope of protection of the present invention .	0
fig2 illustrates a cross - sectional side elevation view of one embodiment of the present spar platform 200 . although the present embodiments are described herein with reference to a truss spar platform , those of ordinary skill in the art will appreciate that the present embodiments encompass any floating production and / or drilling platform or vessel having an open centerwell configuration . as shown in fig2 , the spar platform 200 includes a hull 202 having a centerwell 204 . the centerwell 204 has an upper end that is open to the atmosphere , and a lower end that is open to the sea . a plurality of airtight and watertight barriers 206 , 208 , 210 extend substantially horizontally across the centerwell 204 . in a specific embodiment , one or more of the barriers 206 , 208 , 210 may be in the form of a non - airtight / watertight deck . for simplicity , in the description below the barriers 206 , 208 , 210 will be referred to as decks , even though in certain embodiments one or more of these barriers 206 , 208 , 210 may not be airtight or watertight . the first and second decks 206 , 208 define a first airtight and watertight fixed buoyancy chamber 216 between them . the second and third decks 208 , 210 define a second airtight and watertight fixed buoyancy chamber 218 between them . one or more support or guide frames 214 may be provided across the centerwell 204 below the third deck 210 . in the illustrated embodiment , two support or guide frames 214 are provided , with the lowermost frame 214 being located near the lower end of the centerwell 204 , as shown in fig2 and 4 . those of ordinary skill in the art will appreciate that fewer or more support or guide frames 214 may be provided . the function of the support or guide frames 214 is discussed in detail below . a plurality of sleeves 224 extend in a substantially vertical ( axial ) direction through the centerwell 204 , from the uppermost deck 206 to the bottom of the centerwell 204 . in the illustrated embodiment , five sleeves 224 are shown , but it will be appreciated that fewer or more sleeves 224 could be provided . one of the sleeves 224 , preferably near the center of the centerwell 204 , may be a moon pool sleeve 224 a ( see fig3 and 4 ), and it may be larger in diameter than the other sleeves 224 so as to provide a moon pool 225 that extends downwardly from the uppermost deck 206 to the lower end of the centerwell 204 . the sleeves 224 , 224 a are supported by the support or guide frames 214 as the sleeves extend through the centerwell 204 below the decks 206 , 208 , 210 . the sleeves 224 are advantageously dimensioned to receive and accommodate risers 227 , which may be top - tensioned risers ( ttrs ), bottom - tensioned risers ( btrs ), or steel catenary risers ( scrs ), either with or without riser casings ( not shown ). the ttrs may be supported by a top - tensioned riser support frame 229 with associated conventional riser tensioners ( not shown ), as is well - known in the art . other containment tubes and / or pull tubes ( not shown ), such as those for catenary risers , umbilicals , moon pools and / or caissons , may also be provided in the centerwell 204 . the hull 202 includes a plurality of buoyancy tanks or hard tanks 226 surrounding the centerwell 204 . the buoyancy tanks 226 may be selectively and controllable filled with air or water , by conventional means , to provide varying degrees of buoyancy to the platform 200 . the buoyancy tanks 226 extend down to a truss structure 230 , which extends down to a ballasted keel 232 . the ballasted keel 232 at the bottom of the truss structure 230 lowers the center of gravity of the platform 200 and improves the stability of the platform 200 . one or more mooring lines ( not shown ) may be used to keep the platform 200 over its station . those of ordinary skill in the art will appreciate that certain embodiments of the present spar platform may not include a truss structure or a ballasted keel . as described above , the decks 206 , 208 , 210 are airtight and watertight . accordingly , the intersections of the sleeves 224 , 224 a with the decks 206 , 208 , 210 are similarly airtight and watertight . for example , the sleeves 224 , 224 a may be welded to the decks 206 , 208 , 210 in an airtight and watertight fashion . those of ordinary skill in the art will appreciate that as used herein the term “ sleeve ” encompasses both continuous and segmented structures . thus , each sleeve 224 , 224 a may comprise a single unitary length of material extending from the uppermost deck 206 to the lowermost support or guide frame 214 , or each sleeve 224 , 224 a may be constructed of a plurality of shorter segments that may be connected together and / or connected to the decks 206 , 208 , 210 and guide frames 214 . in embodiments where the sleeve ( s ) 224 , 224 a are constructed of a plurality of shorter segments , openings in the deck ( s ) 206 , 208 , 210 may be considered to be part of the sleeves . in certain embodiments , the airtight and watertight buoyancy chambers 216 , 218 are filled with air , thus adding buoyancy to the spar platform 200 . because the sleeves 224 , 224 a passing through the fixed buoyancy chambers 216 , 218 are likewise airtight and watertight , as are the junctures between the sleeves 224 , 224 a and the decks 206 , 208 , 210 , any water in the sleeves 224 will not seep into the fixed buoyancy chambers 216 , 218 and interfere with their buoyancy contribution to the spar platform 200 . furthermore , the sleeves 224 have open upper ends in the uppermost deck 206 , so that any water accumulating on the uppermost deck 206 is drained through the sleeves 224 and into the sea . a variable buoyancy compartment 220 , defined below the lowermost deck 210 , has an open bottom coinciding with the open bottom of the centerwell 204 . because this variable buoyancy compartment 220 , also referred to as a compressed air over water chamber , is open to the sea , seawater 222 may move in and out of the compartment 220 naturally . the amount of air and water in the variable buoyancy compartment 220 may be adjusted by adding air from a source of compressed air ( not shown ) or by bleeding air from the compartment 220 to the sea or to the atmosphere . the provision of compressed air and the bleeding of air may be performed by conventional mechanisms that are well - known in the art , and therefore need not be described in this specification . by controllably changing the ratio of air to water within the compartment 220 , the buoyancy contribution of the variable buoyancy compartment 220 to the platform 200 may be controllably adjusted . because the sleeves 224 passing through the variable buoyancy compartment 220 are airtight and watertight , any air and / or water in the sleeves 224 will not seep into the variable buoyancy open bottom compartment 220 and interfere with its buoyancy contribution to the spar platform 200 . in certain embodiments the sleeves 224 are open at both ends . the sleeves 224 are thus at least partially filled with seawater that enters through the lower end of each sleeve 224 . as mentioned above , the sleeves 224 also advantageously act as drains for the uppermost deck 206 . water or other liquids collecting on the deck 206 may drain through the open upper ends of the sleeves 224 and drain down through the sleeves 224 to the level of seawater contained in each sleeve 224 . the drainage advantageously prevents excessive accumulation of liquids on the deck 206 , which could increase the weight at the upper end of the platform 200 and possibly upset the balance of the platform 200 , or cause sloshing or other detrimental effects . the embodiments described above advantageously provide watertight compartments 216 , 218 in the centerwell 204 that increase the buoyancy of the spar platform 200 . sealing off the lower part of the centerwell 204 by at least one watertight and airtight transverse barrier or deck also advantageously helps to reduce the diameter and size of the spar platform 200 , thereby generating weight savings . the reduction in weight and volume also enhances the ability for the spar platform 200 to be built and transported in one piece using existing heavy lift vessels . the embodiments described above also advantageously provide the variable buoyancy or compressed air over water compartment 220 . the adjustable buoyancy of the variable buoyancy compartment 220 provides a simple and effective means for adjusting the buoyancy of the spar platform 200 as conditions aboard the platform 200 change . for example , as risers and / or topside equipment is added or removed over the life of the platform 200 , the buoyancy of the variable buoyancy compartment 220 may be adjusted to maintain the balance of the platform 200 . the compressed air buoyancy system is also advantageously simpler than a water ballast system using marine ballast pumps . although the illustrated embodiment includes three airtight and watertight decks 206 , 208 , 210 and two airtight and watertight compartments 216 , 218 in the centerwell 204 , those of ordinary skill in the art will appreciate that the present embodiments encompass a centerwell having any number of airtight and watertight decks and compartments . specifically , the advantages of the present spar platform , as described above , may be realized by employing only a single airtight and watertight transverse barrier or deck ( e . g . the deck 206 shown in the drawings ). in such an embodiment , the single barrier divides the centerwell into an upper portion that is open to the atmosphere , and a lower portion , open to the sea , that provides the variable buoyancy compartment 220 , and there are no buoyancy chambers defined between two or more decks . similarly , if only two airtight and watertight barriers or decks are provided , there will be a single buoyancy chamber defined between them . in another embodiment , three or more such barriers or decks may be provided , with a buoyancy chamber defined between each adjacent pair of barriers or decks . in an alternative embodiment of the present spar platform a lower end of the centerwell may be sealed by an airtight and watertight barrier . the airtight and watertight barrier may be substantially identical to the decks 206 , 208 , 210 described above and illustrated in fig2 and 3 . in this embodiment seawater may not flow in and out of the centerwell naturally as in the embodiment of fig2 - 4 . however , in certain embodiments having a closed lower end seawater may be added to and / or removed from the centerwell to adjust the buoyancy of the platform . the seawater may be added and / or removed using , for example , pumps ( not shown ). as in the embodiment of fig2 , airtight and watertight sleeves may extend through the centerwell , and in certain embodiments the sleeves may extend from the uppermost barrier or deck to the lowermost barrier or deck . the above description presents the best mode contemplated for carrying out the present invention , and of the manner and process of making and using it , in such full , clear , concise , and exact terms as to enable any person skilled in the art to which it pertains to make and use this spar platform . the present invention is , however , susceptible to modifications and alternate constructions , in addition to those discussed above , that are fully equivalent . consequently , the present invention is not limited to the particular embodiments disclosed herein . on the contrary , the present invention encompasses all modifications and alternate constructions coming within the spirit and scope of the invention , as generally expressed by the following claims , which particularly point out and distinctly claim the subject matter of the invention .	1
the first embodiment of the invention relates to the formation of an improved metal contact to a doped thin polysilicon layer , such as used on the p - channel thin film transistor ( tft ) of a sram cell . part of the contact structure is formed at the same time as the p - channel thin film transistors ( tft ) is formed on the sram cell . however , it should be well understood by those skilled in the art that the method can be equally applied to other semiconductor integrated circuits requiring good low resistance contact to thin polysilicon films . it should also be noted that although the process relates to making a contact to a tft , that to simplify the drawings only the contact portion of the substrate is shown in the figs . however , to fully understand the meaning of the various layer present in the contact structure , reference will be made from time to time to the method of using the various layers in the thin film transistor structure that also are present in the figs . it should also be noted that the tft and the contacts are usually formed on the sram chip after first forming the array of n - channel fet and the word and bit lines from an earlier use of a first and second polysilicon layer . to better understand the invention for making the reduced area metal contact to a thin polysilicon layer , a brief description is given of the fabrication of the initial sram device process . however , since these structures are not critical to understanding the invention , they are also not depicted in any of the drawing . the process for making a sram circuit starts by providing a semiconductor substrate , such as on a p - doped single crystal silicon substrate . device areas are formed and electrically isolated by forming a field oxide . typically , the electrically isolated device areas are formed by selectively oxidizing the regions around the device areas , for example , by using a conventional local oxidation of silicon ( locos ) process . the n - channel fets , usually referred to as pass transistors , are formed by growing a gate oxide on the device areas and then using a patterned first polysilicon layer to form the field effect transistor gate electrodes and the word lines . the source and drain areas are formed adjacent to the gate electrodes usually by ion implantation . a first insulating layer is deposited to electrically insulate the n - fets and word lines from the next level of patterned second polysilicon layer , which is used to form the bit lines that contact some of the source / drain areas on the n - channel fet . however , it should be noted that when the second polysilicon layer is patterned , a portion of the second polysilicon is used in the sram cell areas as a buffer layer whereon the metal contact , of this invention , are made to the thin polysilicon layer of the tft . this buffer layer 14 , shown in fig4 b in cross section , and labeled 14 in the top view of fig3 is formed at the same time and from the same patterned second polysilicon layer 14 shown in fig4 a that forms the bit line 14 for the fet . the completed contact in fig6 is through region 6 -- 6 &# 39 ; in fig3 . referring now to fig4 b , a partially completed contact structure is shown on a portion of the substrate 10 . shown is the first insulating layer 12 , which is typically deposited by low pressure chemical vapor deposition ( cvd ) in a reactor , for example , by the dissociation of a tetraethosiloxane ( teos ) at a temperature of between about 700 ° to 850 ° c . the preferred thickness of layer 12 is between about 700 to 3500 angstroms . the buffer layer 14 , on which the metal contact will be formed , is patterned from the second polysilicon layer 14 , as shown in fig4 b and is also indicated in the elevational view of fig3 . the preferred thickness of the buffer layer 14 is between about 1500 to 3000 angstroms . the second insulating layer 16 , over the buffer layer 14 is also shown in fig4 b . the insulating layer 16 is usually a cvd silicon oxide and deposited by cvd , for example , by using reactant gas mixture containing silane ( sih 4 ) or teos and the preferred thickness of insulating layer 16 is between about 700 to 3000 angstroms . a third polysilicon layer is deposited and patterned to form the gate electrode of the tft , but is not shown in the figs because the layer is not directly used in making the metal contact . however , the third polysilicon layer is important for forming an n + dopant gate electrodes for the p - channel thin film transistor ( tft ). a third insulating layer 18 is then deposited to form a relatively thin gate oxide on the tft gate electrode . this gate oxide layer , however , extends over the buffer layer 14 , and is shown in fig4 b . typically the gate oxide 18 is formed by a high temperature ( 800 ° c .) low pressure chemical vapor deposition ( lpcvd ) using a gas mixture of dichlorosilane ( sicl 2 h 2 ) and nitrous oxide ( n 2 o ), and the preferred thickness of layer 18 is between about 50 to 500 angstroms . now important to the invention , a first contact opening 3 is anisotropically and selectively plasma etched in the third and second insulating layer 18 and 16 to the n + polysilicon buffer layer 14 . for example , the opening can be in a reactive ion etcher using a etch gas mixture containing carbon tetrafluoride ( cf 4 ) and hydrogen ( h 2 ). alternatively , a trifluoromethane ( chf 3 ) gas can also be used . however , the etch stop is not critical to the invention , since the buffer layer 14 is relatively thick . still referring to fig4 b , a blanket thin fourth polysilicon layer 20 is deposited to form the channel layer for the thin film transistor ( tft ). typically , layer 20 is deposited at a low temperature to form a thin amorphous silicon layer , but for the purpose of this invention is simply referred to as a thin polysilicon layer . this thin polysilicon layer 20 also extends over the second insulating layer 16 and in the first contact opening 3 , and makes contact to buffer layer 14 in the opening . the preferred thickness of layer 20 is between about 50 to 700 angstroms and is usually lightly doped n - type ( e . g . 1 . 0 e 16 to 1 . 0 e 18 atoms / cm 3 ) for the channel region over the tft gate electrode regions ( not shown in the figs ). the fourth polysilicon layer 20 is then doped selectively by forming a photoresist implant mask and ion implanting with a p type dopant , such as boron 11 ( b 11 ) isotopes . the implant mask prevents implantation of b 11 in the channel regions of the tft , but forms a p + electrically conductive layer 20 elsewhere on the substrate , and in particular over and in the first contact opening 3 , as shown in fig4 b . typically , the p + / n + junction formed between layers 20 and 14 forms a poor ( non - ohmic ) electrical contact , as described and used in the prior art and shown in fig2 . as will become apparent soon , this invention eliminates the p + / n + junction problem while reducing the metal contact area on the integrated circuit . the fourth polysilicon layer 20 is patterned using conventional photolithographic techniques and plasma etching to define the channel width over the tft gate electrode ( not shown ) and to form the tft source / drain areas ( also not shown ) and to form the p + conducting stripe that connect the source of the tft to the metal contact area over the first opening 3 , as shown in fig4 b . the portion of layer 20 that connects to the tft source is designated 20 &# 39 ; on the left of the contact opening 3 to indicate the direction of the conducting stripe that connects to the source area of the tft that is out of view in fig4 . referring next to fig5 a fourth insulating layer 22 is deposited over the patterned fourth polysilicon layer and elsewhere on the substrate surface . the layer 22 is preferably composed of a borophoshosilicate glass ( bpsg ), and is deposited , for example , by chemical vapor deposition ( cvd ) using a reactant gas mixture , such as , silane ( sih 4 ) and oxygen ( o 2 ) or silane nitrous oxide ( n 2 o ) while adding dopant gases , such as phosphine ( ph 3 ) and a diborane ( 6 ) ( b 2 h 6 ). the preferred thickness of layer 22 is between about 8000 to 13000 angstroms . the bpsg has a low flow temperature and can be annealed to provide a leveling effect that forms a more planar surface of the insulating layer 22 . this generally improve the photoresist image and provides a better process etch step that is now performed . however , this annealing step is not essential to the success of the invention . now an important feature of the invention is the formation of a second contact opening 5 in the bpsg layer that is aligned to and over the first contact opening 3 , as shown in fig5 and in the elevational view of fig3 . the second contact opening 5 is smaller in size ( width ) than the first contact opening 3 and is anisotropically etched to the surface of the of the buffer layer 14 , as shown in fig5 . the etching is preferably done in a reactive ion etcher ( rie ) or in a high plasma density etcher . the etch gas having a good etch selectivity of silicon oxide to silicon is preferred . for example , a gas mixture containing carbon tetrafluoride ( cf 4 ) and hydrogen ( h 2 ) or alternatively , a trifluoromethane ( chf 3 ) gas can also be used . however , the etch step is not very critical because of the buffer layer 14 which provides a barrier to over - etching into the first insulating layer 12 . the remaining p + polysilicon layer 20 on the bottom surface of layer 14 or the exposed portions of polysilicon layer 20 on the sidewall of opening 5 can be easily contacted for making good electrical connections . referring now to fig6 a first metal layer 30 is deposited on the fourth insulating layer 22 and in the contact opening 5 , and thereby making electrical contact directly to the thin polysilicon layer 20 . the first metal layer 30 is preferably aluminium ( al ) metal or an aluminium copper alloy , and preferably the al is deposited after first forming a penetration barrier layer on the surface in the contact opening 5 . for example a refractory metal , such as tungsten ( w ), titanium ( ti ), can be used . alternatively , a tungsten plug can be formed in the opening 5 to serve as a contact and a barrier layer . for example , the tungsten can be deposited by chemical vapor deposition using a reactant gas mixture containing tungsten hexafluoride ( wf 6 ). the tungsten is then etched back to the surface of insulating layer 22 to form w plugs . an aluminium layer can then be deposited and patterned by conventional means to form the interconnecting first level of wiring . the aluminium can be deposited by any one of several means , such as by sputtering deposition or physical vapor evaporation . as mentioned earlier , the first metal layer 30 contacts directly the thin p + fourth polysilicon layer 20 in the contact opening 5 ( fig5 ). this result in a very low ohmic contact resistance compared to the method of the prior art . by way of example , a current / voltage ( i - v ) trace is shown in fig1 between two contacts built by the prior art . as clearly seen in fig1 the i - v trace 50 is very non ohmic and shows the p + / n + diode characteristics of the back to back diodes formed from the two contacts . the break down voltage being about 3 . 0 to 4 . 0 volts . on the other hand , a current - voltage trace between two contacts built by the method of this invention is shown in fig1 . as is clearly seen in fig1 the i - v trace 60 has ohmic characteristics . also the current scale on the vertical axis in fig1 , for the prior art , is in nanoamperes ( 1 × 10 - 9 amps . ), while the current scale in fig1 for the current invention is in micoamperes ( 1 × 10 - 6 amps .). the dramatic improvement in current characteristics is best illustrated by plotting the i - v trace of fig1 on the plot in fig1 , as shown labeled 70 in fig1 . the trace 70 for the present invention is essentially vertical in fig1 showing the much lower contact resistance for similar sheet resistance p + films . the measurements were made between two contacts similar to the contacts shown in fig1 and 7 for the conventional and contact of this invention , respectively . the patterned polysilicon layer between contacts was about 1 . 0 micrometer in width and about 100 micrometers in length . the polysilicon layer was about 300 angstroms thick and was implanted with bf 2 ions at a dose of 1 . 0 e 15 / cm 2 and an implant energy of about 25 . 0 kev . the resultant sheet resistance ( r s ) was 3500 to 5000 ohms / square . a second important contribution of the invention is the area reduction of the metal contact which substantially increases the packing density of devices on the integrated circuit . given the same design ground rules for the prior art contact structure , shown in fig1 and the metal contact structure of the present invention , shown in fig3 the invention result in about a 28 percent reduction in area . referring now more specifically to fig7 through 10 , a second embodiment is shown for forming a self - aligning contact that further reduces the area of the metal contact . many of the process steps in the second embodiment are the same as the process in the first embodiment , and their discussion are not repeated in the same detail . similar structures and layer in both embodiments are also consistently labeled the same . referring now to fig7 an elevational view is shown of the self - aligned metal contact for the completed structure shown in fig1 . the series of partially completed structures shown in fig8 through 10 are for cross sectional view through the region 10 -- 10 &# 39 ; as depicted in fig7 . the method for making the self - aligned reduced area metal contact of this second embodiment is the same as the first embodiment up to but not including the step for forming the first contact opening 5 in fig4 . briefly , the process up to the first contact opening consist of forming a first insulating layer 12 on a p - silicon substrate 10 . a buffer layer 14 is then formed from an n + doped second polysilicon layer 14 , as shown in fig8 . the buffer layer 14 is then insulated by a second insulating layer 16 and an n + doped third polysilicon ( not shown ) is patterned to form a gate electrode for the thin film transistor , which is also not shown in the fig . a thin gate oxide is formed on the tft gate electrode by depositing a third insulating layer 18 , which is also formed over the second insulating layer 16 and over the buffer layer 14 , as shown in fig8 . now as shown in fig8 the first contact opening 5 in fig4 b of the first embodiment is omitted in the insulating layers 18 and 16 of the second embodiment . instead the channel layer is formed by the method of the first embodiment by depositing a fourth polysilicon layer 20 , and similar to the first embodiment , the layer is selectively ion implanted with p + dopant ( b 11 ) to from the p + source / drain areas of the p - channel tft , and the p + doped regions over the buffer layer 14 . the fourth polysilicon layer is then patterned to define the channel layer over the tft , the source / drain areas and the connecting p + stripe 20 &# 39 ; from the tft source ( not shown ) to the buffer layer 14 . a fourth insulating layer 22 composed of bpsg is deposited next , as shown in fig9 . the layer thickness and deposition methods are the same as in the first embodiment . now as shown in fig1 , a single contact opening 7 is formed in layer 22 by conventional photoresist masking and anisotropic etching . the opening 7 is aligned over the buffer layer 14 , and is etched through layers 22 , 20 , 18 and 16 to the surface of the buffer layer 14 . the etch stop is not critical because of the relatively thick buffer layer . a metal layer 30 is deposited over the insulating layer 22 and in the contact opening 7 and then patterned by conventional means to form the first metal wiring level and complete the self - aligned metal contact having reduce area . the preferred metal is an aluminium or aluminium copper alloy with a barrier layer such a tungsten or a tungsten plug process , as in the first embodiment . also , the metal layer 30 can be composed of titanium and titanium nitride ( ti and tin ) or aluminum - silicon - copper ( alsicu ) alloy and tin , and is deposited to a thickness of between about 4000 and 6000 angstroms . several important features relating to the second embodiment are discussed . the p + connecting stripe 20 &# 39 ; is self - aligned to the metal in the opening 7 at the sidewall region location labeled c in fig1 . this contact has a low ohmic resistance , comparable in value to the metal contact of the first embodiment . because a single contact is used the layout design ground rules can be even tighter than in the first embodiment , thereby reducing further the area required for making the contact . for example , the reduction in area of the buffer layer 14 of fig1 is further reduced over the prior art design layout of fig1 by about 43 percent . still another important feature is the elevation of the p + connect layer 20 &# 39 ; above the surface of the buffer layer 14 by at least the thickness of layer 16 and 18 . this provides considerable latitude in over or under etching the contact opening 7 and still provide good contacts , and thereby makes the process very manufacturable . while the invention has been particularly shown and described with reference to the preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made without departing from the spirit and scope of the invention . for example , while the invention was direct at making good low resistance ohmic contacts for p - channel thin film transistor commonly used on sram cells , the process is equally applicable to other thin film structure where a good contact between p + and n + polysilicon layers are required .	7
i . obtaining and expressing cdnas for the human gm - csf receptor β chain the term &# 34 ; effectively homologous &# 34 ; as used herein means that the nucleotide sequence is capable of being detected by a hybridization probe derived from a cdna clone of the invention . the exact numerical measure of homology necessary to detect nucleic acids coding for a receptor β chain depends on several factors including ( 1 ) the homology of the probe to non - β chain coding sequences associated with the target nucleic acids , ( 2 ) the stringency of the hydridization conditions , ( 3 ) whether single stranded or double stranded probes are employed , ( 4 ) whether rna or dna probes are employed , ( 5 ) the measures taken to reduce nonspecific binding of the probe , ( 6 ) the nature of the method used to label the probe , ( 7 ) the fraction of guanidine and cytosine bases in the probe , ( 8 ) the distribution of mismatches between probe and target , ( 9 ) the size of the probe , and the like . preferably , an effectively homologous nucleic acid sequence is at least seventy percent ( 70 %) homologous to the cdna of the invention . more preferably , an effectively homologous nucleic acid is at least ninety percent ( 90 %) homologous to the cdna of the invention . most particularly , an effectively homologous nucleic acid sequence is one whose cdna can be isolated by a probe based on the nucleic acid sequence of fig1 using a standard hybridization protocol with no more than a few false positive signals , e . g . less than a hundred . there is an extensive literature that provides guidance in selecting conditions for such hybridizations , e . g . hames et al , nucleic acid hybridization : a practical approach ( irl press , washington , d . c ., 1985 ); gray et al , proc . natl . acad . sci ., vol . 80 , pgs . 5842 - 5846 ( 1983 ); kafatos et al , nucleic acids research , vol . 7 , pgs . 1541 - 1552 ( 1979 ); and williams , genetic engineering , vol . 1 , pgs . 1 - 59 ( 1981 ), to name a few . by way of example , the nucleic acid of fig1 can be used as a probe in colony hybridization assays as described by benton and davis , science , vol . 196 , pg . 180 ( 1977 ). preferably , low stringency conditions are employed for the probe employed ( dissociation temperature depends on probe length ). for example , for a probe of about 20 - 40 bases a typical prehybridization , hybridization , and wash protocol is as follows : ( 1 ) prehybridization : incubate nitrocellulose filters containing the denatured target dna for 3 - 4 hours at 55 ° c . in 5 × denhardt &# 39 ; s solution , 5 × sspe ( 20 × sspe consists of 174 g nacl , 27 , 6 g nah 2 po 4 -- h 2 o , and 7 . 4 g edta in 800 ml h 2 o adjusted to ph 7 . 4 with 10n naoh ), 0 . 1 % sds , and 100 μg / ml denatured salmon sperm dna , ( 2 ) hybridization : incubate filters in prehybridization solution plus probe at 55 ° c . for 2 hours , ( 3 ) wash : three 15 minute washes in 300 - 500 ml volumes of 6 × ssc and 0 . 1 % sds at room temperature , followed by a final 1 - 1 . 5 minute wash in 300 - 500 ml of 1 × ssc and 0 . 1 % sds at 55 ° c . other equivalent procedures , e . g . employing organic solvents such as formamide , are well known in the art . homology as the term is used herein is a measure of similarity between two nucleotide ( or amino acid ) sequences . homology is expressed as the fraction or percentage of matching bases ( or amino acids ) after two sequences ( possibly of unequal length ) have been aligned . the term alignment is used in the sense defined by sankoff and kruskal in chapter one of time warps , string edits , and macromolecules : the theory and practice of sequence comparison ( addison - wesley , reading , ma , 1983 ). roughly , two sequences are aligned by maximizing the number of matching bases ( or amino acids ) between the two sequences with the insertion of a minimal number of &# 34 ; blank &# 34 ; or &# 34 ; null &# 34 ; bases into either sequence to bring about the maximum overlap . given two sequences , algorithms are available for computing their homology , e . g . needleham and wunsch , j . mol . biol ., vol . 48 , pgs . 443 - 453 ( 1970 ); and sankoff and kruskal ( cited above ) pgs . 23 - 29 . also , commercial services and software packages are available for performing such comparisons , e . g . intelligenetics , inc . ( mountain view , ca ); and university of wisconsin genetics computer group ( madison , wis .). probes based on the nucleic acid sequence of fig1 can be synthesized on commercially available dna synthesizers , e . g . applied biosystems model 381a , using standard techniques , e . g . gait , oligonucleotide synthesis : a practical approach , ( irl press , washington d . c ., 1984 ). it is preferable that the probe be at least 18 - 30 bases long . more preferably , the probe is at least 100 - 200 bases long . probes of the invention can be labeled in a variety of ways standard in the art , e . g . radioactive labels , berent et al , biotechniques , pgs . 208 - 220 ( may / june 1985 ), meinkoth et al , anal . biochem ., vol . 138 , pgs . 267 - 284 ( 1984 ), szostak et al , meth . enzymol ., vol . 68 , pgs . 419 - 429 ( 1979 ), and the like , and non - radioactive labels , chu et al , dna , vol . 4 , pgs . 327 - 331 ( 1985 ), jablonski et al , nucleic acids research , vol . 14 , pgs . 6115 - 6128 ( 1986 ), and the like . hybridization probes can also be used to screen candidate sources of β chain mrna prior to library construction , e . g . by rna blotting , maniatis et al , molecular cloning : a laboratory manual , pgs . 202 - 203 ( cold spring harbor laboratory , n . y ., 1982 ); or hames and higgins , eds ., pgs . 139 - 143 in nucleic acids hybridization ( irl press , washington d . c ., 1985 ). sources of mrna encoding the desired polypeptides include cell populations or cell lines that express , or can be induced to express , large numbers of gm - csf receptors on their surfaces , e . g . in excess of 3 - 5000 . preferably , the α and β chains of the gm - csf receptor are co - transfected into a mammalian expression system ( i . e . host - expression vector combination ). many reviews are available which provide guidance for making choices and / or modifications of specific mammalian expression systems , e . g . to name a few , kucherlapati et al ., critical reviews in biochemistry , vol . 16 , issue 4 , pgs . 349 - 379 ( 1984 ), and banerji et al ., genetic engineering , vol . 5 , pgs . 19 - 31 ( 1983 ) review methods for transfecting and transforming mammalian cells ; reznikoff and gold , eds ., maximizing gene expression ( butterworths , boston , 1986 ) review selected topics in gene expression in e . coli , yeast , and mammalian cells ; and thilly , mammalian cell technology ( butterworths , boston , 1986 ) reviews mammalian expression systems . likewise , many reviews are available which describe techniques and conditions for linking and / or manipulating specific cdnas and expression control sequences to create and / or modify expression vectors suitable for use with the present invention , e . g . maniatis et al ., molecular cloning : a laboratory manual ( cold spring harbor laboratory , n . y ., 1982 ); glover , dna cloning : a practical approach , vol . i and ii ( irl press , oxford , 1985 ), and perbal , a practical guide to molecular cloning ( john wiley & amp ; sons , n . y . 1984 ), to name only a few . several dna tumor viruses have been used as vectors for mammalian hosts . particularly important are the numerous vectors which comprise sv40 replication , transcription , and / or translation control sequences coupled to bacterial replication control sequences , e . g . the pcd vectors developed by okayama and berg , disclosed in mol . cell . biol ., vol . 2 , pgs . 161 - 170 ( 1982 ) and mol . cell . biol ., vol . 3 , pgs . 280 - 289 ( 1983 ), both of which are incorporated herein by reference ; the sv40 vectors disclosed by hamer in genetic engineering , vol . 2 , pgs . 83 - 100 ( 1980 ), and u . s . pat . no . 4 , 599 , 308 , both of which are incorporated herein by reference ; and the vectors additionally containing adenovirus regulatory elements , disclosed by kaufman and sharp , in mol . cell . biol ., vol . 2 , pgs . 1304 - 1319 ( 1982 ), and clark et al ., in u . s . pat . no . 4 , 675 , 285 , both of which are incorporated herein by reference . cos7 monkey cells , described by gluzman , cell , vol . 23 , pgs . 175 - 182 ( 1981 ) and available from the atcc ( accession no . crl 1651 ), are usually the preferred hosts for the above vectors . sv40 - based vectors suitable for mammalian receptor expression have been developed by aruffo and seed , proc . natl . acad . sci ., vol . 84 , pgs . 3365 - 3369 and 8573 - 8577 ( 1987 ). binding assays are accomplished by letting a ligand of unknown specificity or affinity compete with a known amount or concentration of labeled human gm - csf for receptor binding sites of a sample of cells transfected or transformed with pkh97 and pkh125 , or their equivalents . preferably , the gm - csf is labeled by radioiodianation using standard protocols , e . g . reaction with 1 , 3 , 4 , 6 - tetrachloro - 3α , 6α - diphenylglycouril described by fraker et al , biochem biophys . res . commun ., vol . 80 , pgs . 849 - 857 ( 1978 )( and available from pierce chemical co . as iodogen ). generally , the binding assay is conducted as described by lowenthal et al , j . immunol ., vol 140 , pgs . 456 - 464 ( 1988 ), which is incorporated by reference . briefly , aliquots of cells are incubated in the presence of 125 i - labeled human gm - csf in a final volume of 200 μl culture medium in microfuge tubes at 4 ° c . cell - bound 125 i - labeled gm - csf was separated from non - bound 125 i - labeled gm - csf by centrifugation through an oil gradient ( 10 , 000 × g for 2 min ). nonspecific binding is measured in the presence of a 100 - fold excess of partially purified unlabeled human gm - csf . example i . construction of cdna library from tf - 1 cells and isolation of pkh97 and pkh125 poly ( a ) + rna isolated from tf - 1 cells ( kitamura et al , j . cell . physiol ., vol . 140 , pgs . 323 - 334 ( 1989 )) by the guanidium isothianate method ( chirgwin et al , biochemistry , vol . 18 , pgs . 5294 - 5299 ( 1978 )) was converted to double - stranded cdna using oligo ( dt ) primers . after bst xi linkers were ligated to both ends of the cdnas , the cdnas were digested with xba i ( the 3 &# 39 ; region fortuitously containing a unique xba i site ) and re - cloned into bst xi / xba i - digested pme18 , an sv40 - based mammalian expression vector ( see fig3 ). pkh97 was isolated by using probes constructed from initially isolated truncated cdnas . the trucated cdnas were isolated using a 32 p - labeled mouse interleukin - 3 receptor cdna fragment ( described in itoh et al , science , vol . 247 , pgs . 324 - 334 ( 1990 )) as a hybridization probe under low stringency conditions ( hybridization at 42 ° c . with 6xsspe in the presence of 20 % formamide and washing at 50 ° c . with 2xsspe ). pkh97 was transfected into cos 7 cell by a standard protocol , e . g . as described by yokota et al , proc . natl . acad . sci ., vol . 84 , pgs . 7388 - 7392 ( 1987 ) ( 5 μg of plasmid dna were transfected into semi - confluent cos 7 cells by the deae - dextran method ; 72 hours after transfection , the cells were harvested for binding assays , using iodinated cytokines as described below ). no specific binding was displayed by any of the following human cytokines at the following concentrations : il - 2 ( 1 nm ), il - 3 ( 20 nm ), il - 4 ( 1 nm ), il - 5 ( 5 nm ), gm - csf ( 20 nm ), and epo ( 10 nm ). a cdna encoding the α chain of the human gm - csf receptor was isolated from the same library using the polymerase chain reaction with specific oligonucleotide primers corresponding to the 5 &# 39 ;- untranslated and the 3 &# 39 ;- untranslated regions of the cdna described by gearing et al , embo j ., vol . 8 , pgs . 3667 - 3676 ( 1989 ). the isolated cdna was inserted into pme18 to give pkh125 . a total of 5 μg of equal amounts of pkh97 and pkh125 plasmid dna was transfected into semi - confluent cos 7 cells by the deae - dextran method . 72 hours after transfection , the cells were harvested and analyzed in gm - csf binding assays . duplicates of 2 × 10 5 cos 7 cells in 0 . 1 ml of rpmi 1640 containing 10 % fetal calf serum , 2 mm edta , 0 . 02 % sodium azide and 20 mm hepes ( ph 7 . 4 ) were incubated for 3 h at 4 ° c . with various concentrations of 125 i - labeled human gm - csf with or without an excess amount of non - labeled human gm - csf . the cell - bound radioactivity was measured by separating the cells from free ligand by centrifugation through an oil layer , as described by schreurs et al , growth factors , vol . 2 , pgs . 221 - 233 ( 1990 ). gm - csf was iodinated by a standard protocol , chiba et al , leukemia , vol . 4 , pgs . 22 - 36 ( 1990 ). briefly , 5 μg of e . coli - produced human gm - csf was incubated in 30 - 50 μl of 50 mm sodium borate buffer ( ph 8 . 0 ) with 1 mci of the dried bolton and hunter reagent for 12 - 16 h at 4 ° c . glycine was added to 2 . 5 mg / ml to stop the reaction and the iodinated gm - csf was separated from the free bolton and hunter reagent by a pd - 10 column . the iodinated human gm - csf had a specific radioactivity of 4 - 8 × 10 7 cpm / μg and was stable for about two months in hepes - buffered hank &# 39 ; s balanced salt solution containing 0 . 1 % gelatin , 0 . 1 % bovine serum albumin , and 0 . 02 % sodium azide . fig2 a shows the receptor binding data . open circles correspond cos 7 cells ( controls ) transfected with pkh125 and pme18 ( same vector as pkh97 , but without the cdna insert ). closed circles correspond to cos 7 cells transfected with pkh125 and pkh97 . the scatchard plots of the binding data are shown . the inserted graphs show equilibrium binding profiles . as can be seen from the data both high ( k d = 120 pm ) and low ( k d = 6 . 6 nm ) affinity binding sites are indicated ( the k d values being computed by the ligand program , de lean et al , mol . pharmacol ., vol . 21 , pgs . 5 - 16 ( 1982 )). a dna fragment containing the neomycin - resistance gene , neo , was inserted into pkh97 to form pkh97neo . nih3t3 cells were stably transfected with pkh97neo and pkh125 by the calcium - phosphate procedure , described by chen and okayama , mol . cell . biol ., vol . 7 , pgs . 2745 - 2752 ( 1987 ), which reference is incorporated by reference . stable transfectants were selected by 1 mg / ml of g418 . fig2 b shows the binding data for the transfected nih3t3 cells . as above , the open circles correspond to to control nih3t3 cells transfected with pkh97neo and pme18 . closed circles correspond to nih3t3 cells transfected with pkh97neo and pkh125 . the latter displayed high affinity binding with a k d of 170 pm . labeled gm - csf association and dissociation rates were also examined in the transfected nih3t3 cells . fig3 a and 3b illustrates the data . open circles correspond to nih3t3 cells expressing only the α chain . closed circles correspond to nih 3t3 cells expressing both the α chain and β chain of the gm - csf receptor . the latter displayed a much slower rate of dissociation ( t 1 / 2 = 2 min versus t 1 / 2 = 360 min ). example iv . use of co - transfected cos 7 cells to screen for gm - csf antagonists aliquots of cos 7 cells co - transfected with pkh97 and pkh125 as described above are distributed to wells of microtiter plates in 200 μl of medium containing 125 i - labeled human gm - csf at concentrations of 100 pm , 500 pm , and 1 nm . 100 μl samples of microbial supernatants free of cells are added to the transfected cos 7 cells at each of the different concentrations of 125 i - labeled gm - csf . after incubating for 3 hours the cos 7 cells are harvested and assayed for bound radioactivity . cos 7 cells with low counts of bound radioactivity correspond microbial samples containing candidate antagonists or agonists of human gm - csf . the descriptions of the foregoing embodiments of the invention have been presented for purpose of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed , and obviously many modifications and variations are possible in light of the above teaching . the embodiments were chosen and described in order to best explain the principles of the invention to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto . applicants have deposited pkh97 and pkh125 with the american type culture collection , rockville , md , usa ( atcc ), under accession numbers 40847 and 40848 , respectively . these deposits were made under conditions as provided under atcc &# 39 ; s agreement for culture deposit for patent purposes , which assures that the deposit will be made available to the us commissioner of patents and trademarks pursuant to 35 usc 122 and 37 cfr 1 . 14 , and will be made available to the public upon issue of a u . s . patent , which requires that the deposit be maintained . availability of the deposited plasmids is not to be construed as a license to practice the invention in contravention of the rights granted under the authority of any government in accordance with its patent laws .	2
a first embodiment of an electronic system according to the present invention is illustrated in fig1 . an vehicle alternator 10 generates electrical energy at a nominal voltage of approximately 12 volts dc . emitter 12 of first n - p - n bipolar junction transistor ( bjt ) 14 is connected to the output of alternator 10 . preferably , bjt 14 is the parallel combination of seven d44vh7 power transistors from general electric corporation . collector 16 of bjt 14 is connected to one side of electrically - heated catalyst ( ehc ) 18 . the other side of ehc 18 is connected to ground . base 20 of bjt 14 is connected to source 22 of p - channel insulated - gate field - effect transistor ( fet ) 24 . fet 24 is preferably one or more power mosfets such as the si9407dy from siliconix , connected in parallel as necessary to provide adequate base drive to bjt 14 . gate 28 of fet 24 is connected to collector 32 of a second n - p - n bjt 30 . bjt 30 is preferably a common signal transistor such as a 2n2222 or equivalent . gate 28 of fet 24 is also connected via resistor 38 to both drain 26 of fet 24 and the output of alternator 10 . emitter 36 of bjt 30 is connected to ground . base 34 of bjt 30 is disposed to receive an electrical command representing a desire for current to be provided to ehc 18 . preferably , base 34 is connected to an engine controller 39 , which has responsibility for controlling emissions on the vehicle . as bjt 30 is configured in this embodiment of the present invention , a &# 34 ; high &# 34 ; level signal at base 34 will represent a command for current to be provided to ehc 18 . on the other hand , a &# 34 ; low &# 34 ; level signal will represent that current is not to be provided to ehc 18 . a diode 42 is connected between the output of alternator 10 and 12 - volt battery 40 and other loads 41 . 12 - volt battery 40 is a standard component on almost all automobiles . other loads 41 include a rear - window defroster grid , headlamps , and all other electrical loads on the vehicle . preferably , diode 42 is a schottky diode such as a 84cnq045 from international rectifier . the system illustrated in fig1 operates as follows . alternator 10 generates electrical energy for a vehicle . alternator 10 is the electrical energy source for all loads on the vehicle , including ehc 18 , 12 - volt battery 40 and other loads 41 . as has previously been discussed , ehc 18 can draw over 100 amperes . as a result , the total demand for electrical current by ehc 18 , 12 - volt battery 40 and other loads 41 can easily outstrip the current - generating capacity of alternator 10 . the present invention allows current to be diverted to ehc 18 for as long as needed , then provided to 12 - volt battery 40 and other loads 41 . a command signal to cause current to be diverted to ehc 18 is provided at base 34 of bjt 30 by engine controller 39 . if engine controller 39 wishes current to be diverted to ehc 18 , engine controller 39 will provide a &# 34 ; high &# 34 ; signal at base 34 . that signal causes bjt 30 to conduct , causing current flow into collector 32 and out of emitter 36 to ground . this current flow causes collector 32 to assume a &# 34 ; low &# 34 ; voltage of near zero volts . when collector 32 assumes the low voltage just described , gate 28 of fet 24 also assumes this low voltage , being connected to collector 32 . because gate 28 has assumed a low voltage , fet 24 conducts . thus , current flows into drain 26 and out of source 22 . this current has only one path to take , namely into base 20 of bjt 14 . as a result , bjt 14 conducts . it should be noted that bjt 14 is configured in &# 34 ; inverted mode &# 34 ;. when bjt 14 is supplied a large amount of base current while connected in inverted mode , current flows into emitter 12 and out of collector 16 with a very low voltage drop across the junction between emitter 12 and collector 16 . the voltage drop can be on the order of 0 . 1 volt . the very low voltage drop is advantageous because of the high current which will flow through ehc 18 when bjt 14 conducts . the low voltage drop helps assure that a minimum of power is dissipated as the high current flows through the junction between emitter 12 and collector 16 . diode 42 assures that current flows predominantly to ehc 18 and not to 12 - volt battery 40 or other loads 41 . current will flow through diode 42 only if anode 44 is one diode drop higher in voltage than cathode 46 . therefore , current will flow to battery 40 and other loads 41 only to the extent that alternator 10 can generate all of the current drawn by ehc 18 and continue to maintain a voltage at least one diode drop higher than 12 - volt battery 40 . thus , only excess current not required by ehc 18 goes to 12 - volt battery 40 and other loads 41 . thus , it can be seen that when engine controller 39 causes base 34 of bjt 30 to go high , all or almost all of the current generated by alternator 10 is diverted through ehc 18 . only excess current goes to 12 - volt battery 40 and other loads 41 . when engine controller 39 no longer wishes current to flow through ehc 18 ( i . e , when ehc 18 is warm ), engine controller 39 will cause base 34 of bjt 30 to go &# 34 ; low &# 34 ;. this turns off bjt 30 . collector 32 of bjt 30 and gate 28 of fet 24 then go &# 34 ; high &# 34 ;. fet 24 therefore turns off , stopping current flow into base 20 of bjt 14 . bjt 14 therefore turns off , stopping current flow to ehc 18 . now , assuming that alternator 10 is generating voltage at least one diode drop greater than the voltage of 12 - volt battery 40 and other loads 41 , all of alternator 10 &# 39 ; s current will flow to 12 - volt battery 40 and other loads 41 . it should be noted that in fig1 drain 26 of fet 24 can be connected to 12 - volt battery 40 and other loads 41 , rather than to the output of alternator 10 . however , connecting the circuit in this fashion entails the possibility that when the entire system is turned off , current will leak from 12 - volt battery 40 through bjt 30 . in such an event , 12 - volt battery 40 can inadvertently be run down , a disadvantageous situation in a vehicle . a second embodiment of the present invention is illustrated in fig2 . alternator 50 can be a device with a nominal 12 volt output or with an output which can range from 12 volts to a higher voltage such as 35 volts . one side of ehc 52 is connected to the output of alternator 50 . drain 56 of n - channel field - effect transistor ( fet ) 54 is connected to a second side of ehc 52 . source 58 of fet 54 is connected to ground . fet 54 is preferably a power mosfet with a very low &# 34 ; on &# 34 ; resistance between drain 56 and source 58 . examples of such mosfets are high cell density mosfets ( such as two motorola mtp75n05hd mosfets connected in parallel ) and so - called &# 34 ; trench - mosfets &# 34 ; ( such as two siliconix smp60n06 - 08 mosfets connected in parallel ). gate 60 of fet 54 is coupled to output 66 of a pair of bipolar junction transistors ( bjts ) 62 and 64 configured in a push - pull configuration . preferably , bjt 62 is a common n - p - n signal transistor such as a 2n2222 or equivalent . bjt 64 is preferably a common p - n - p signal transistor such as a 2n2907 or equivalent . input 68 of the push - pull configuration is preferably connected to engine controller 71 , which has responsibility for controlling emissions from the vehicle . a resistor 72 couples output 66 of the push - pull configuration of bjts 62 and 6 . 4 also with gate 76 of a p - channel field - effect transistor ( fet ) 74 . gate 76 is the input of a hybrid darlington combination of fet 74 and an n - p - n bipolar junction transistor ( bjt ) 82 . bjt 82 is preferably selected to be a power transistor with a very low collector - to - emitter voltage drop when bjt 82 is in saturation . for example , bjt 82 could be a parallel combination of seven d44vh7 power transistors from general electric . collector 88 of bjt 82 is connected to the output of alternator 50 , while emitter 86 of bjt 82 is connected to electrical loads comprising 12 - volt battery 90 and other loads 92 . source 80 of fet 74 is connected to the output of alternator 50 and drain 78 of fet 74 is connected to base 84 of bjt 82 . a zener diode 94 , preferably having a rating of 15 volts , is connected between the output of alternator 50 and gate 76 of fet 74 . zener diode 94 protects the darlington combination of fet 74 and bjt 82 in the event that alternator 50 puts out a voltage above about 18 volts . operation of this embodiment of the present invention is as follows . alternator 50 is the source for electrical power for ehc 52 , 12 - volt battery 90 and other loads 92 . when engine controller 71 desires current to flow to ehc 52 instead of to 12 - volt battery 90 and other loads 92 , engine controller 71 causes a &# 34 ; high &# 34 ; signal to be generated at input 68 of the push - pull combination of bjts 62 and 64 . this causes bjt 62 to turn &# 34 ; on &# 34 ;. thus , a &# 34 ; high &# 34 ; voltage is applied to gate 60 of fet 54 . fet 54 turns on , allowing current flow from alternator 50 through ehc 52 . because bjt 62 is on , a high voltage is also applied to gate 76 of fet 74 . fet 74 , being a p - channel fet , is thus off . because fet 74 is off , bjt 82 is also off . as a result , alternator 50 is isolated from 12 - volt battery 90 and other loads 92 . therefore , it can be seen that when engine controller 71 supplies a high signal at input 68 , current from alternator 50 is diverted to ehc 52 . furthermore , 12 - volt battery 90 and other loads 92 are isolated from alternator 50 . once ehc 52 is warm , engine controller 71 will force input 68 of the push - pull combination of bjts 62 and 64 to go low . bjt 62 thus will stop conducting and bjt 64 will start conducting . bjt 64 will draw current through zener diode 94 and resistor 72 . one consequence of bjt 64 conducting is that gate 60 of fet 54 will be at a low voltage . as a result , fet 54 will be off , and will therefore draw essentially no current through ehc 52 . another consequence of bjt 64 conducting is that the current drawn through zener diode 94 will cause gate 76 of fet 74 to be at a substantially lower voltage than source 80 . fet 74 , being a p - channel device , will therefore turn on . this will provide base current for bjt 82 , preferably enough to drive bjt 82 deeply into saturation . with bjt 82 deeply in saturation , current can flow from alternator 50 to 12 - volt battery 90 and other loads 92 with little power dissipation across the junction between collector 88 and emitter 86 of bjt 82 . it can therefore be seen that when engine controller 71 causes input 68 of the push - pull combination of bjts 62 and 64 to go low , current can flow from alternator 50 to 12 - volt battery 90 and other loads 92 . furthermore , essentially no current flows through ehc 52 . it was noted that in this embodiment of the present invention , alternator 50 can be a device with a nominal 12 - volt output or a device with an output which can range from 12 volts to a higher voltage , say 35 volts . the higher voltage can be invoked while diversion of current to ehc 52 occurs , for faster heating of ehc 52 . a third embodiment of the present invention is illustrated in fig3 . here , one side of ehc 118 is connected to the output of a nominal 12 - volt alternator 110 . the other side of ehc 118 is connected to collector 112 of n - p - n bipolar junction transistor ( bjt ) 114 . preferably , bjt 114 is a parallel combination of seven d44vh7 power transistors from general electric corporation . base 120 of bjt 114 is coupled via base resistor 119 to source 122 of p - channel field effect transistor ( fet ) 124 . fet 124 is preferably one or more power mosfets such as the si9407dy from siliconix , connected in parallel as necessary to provide adequate base drive to bjt 114 . drain 126 of fet 124 is connected to anode 144 of diode 142 . diode 142 is preferably a schottky diode , such as the 84cnq045 from international rectifier . cathode 146 of diode 142 is connected to 12 - volt battery 140 and other loads 141 . drain 126 of fet 124 is further coupled via resistor 138 to gate 128 of fet 124 and to collector 132 of n - p - n bipolar junction transistor ( bjt ) 130 . bjt 130 is preferably a common signal transistor such as a 2n2222 or equivalent . base 134 of bjt 130 is connected to engine controller 139 , which has responsibility for controlling emissions on the vehicle . when engine controller 139 desires current to be diverted to ehc 118 , engine controller 139 causes base 134 of bjt 130 to go &# 34 ; high &# 34 ;. bjt 130 is thus turned on , further turning on fet 124 and bjt 114 . current therefore flows through ehc 118 . further , unless alternator 110 can supply all of ehc 118 &# 39 ; s current requirements and maintain a voltage at least one diode drop above the voltage of 12 - volt battery 140 , no current will flow from alternator 110 to 12 - volt battery 140 and other loads 141 . thus , only excess current not required by ehc 118 is supplied to 12 - volt battery 140 and other loads 141 . when engine controller 139 instead no longer requires current to be diverted to ehc 118 , engine controller 139 causes base 134 of bjt 130 to go &# 34 ; low &# 34 ;. bjt 130 , fet 124 , and bjt 114 are thus turned off . current no longer flows through ehc 118 , but instead through diode 142 to 12 - volt battery 140 and other loads 141 . various other modifications and variations will no doubt occur to those skilled in the arts to which this invention pertains . such variations which generally rely on the teachings through which this disclosure has advanced the art are properly considered within the scope of this invention . this disclosure should thus be considered illustrative , not limiting ; the scope of the invention is instead defined by the following claims .	8
turning now to fig1 and 2 , a system for ultrasound therapy comprising an ultrasound therapy transducer head 10 coupled to an external controller 11 is shown . as can be seen , ultrasound transducer head 10 comprises a housing 12 that physically supports and protects internal ultrasound therapy source components . an acoustically transparent membrane 13 is provided at one end of the housing 12 . an ultrasound source 14 that emits ultrasonic radiation 15 ( i . e . acoustic signals or sound waves ) that pass through the membrane 13 for application to a target region 16 of a subject selected for ultrasound therapy is mounted within the housing 12 . the ultrasound source 14 comprises an array of piezoelectric transducer elements 20 , only a small number of which are shown for illustrative purposes only . each transducer element 20 has an impedance backing 21 thereon comprised of material with different impedance properties than the ultrasonic impendence properties of the associated transducer element 20 . a connection layer 22 in the form of a flex circuit or circuit board provides a mechanical mount for the transducer elements 20 and the impendance backing 21 as well as electrical connections between driving electronics 24 and the transducer elements 20 . the driving electronics 24 also communicate with temperature sensing electronics 26 and a heat exchanger 28 disposed within the housing 20 as well as with the external controller 11 . a coupling fluid reservoir 32 filled with a coupling fluid 34 is provided in the housing 12 adjacent the membrane 13 . a temperature sensor 36 is positioned within the coupling fluid reservoir 32 and communicates with the temperature sensing electronics 26 . the distal end of each transducer element 20 extends into the coupling fluid reservoir 32 and is immersed in the coupling fluid 34 . an acoustic power sensing arrangement 38 spaced from the array of transducer elements 20 is also disposed in the coupling fluid reservoir 32 and is positioned so that ultrasonic radiation emitted by the transducer elements 20 passes through the acoustic power sensing arrangement 38 before exiting the housing 12 via the membrane 13 . the acoustic power sensing arrangement 38 is connected to a switching circuit 42 which in turn is connected to a voltage measuring circuit 44 . the voltage measuring circuit 44 communicates with the external controller 11 . turning now to fig1 to 4 , the acoustic power sensing arrangement 38 , switching circuit 42 and voltage measuring circuit 44 are better illustrated . in this embodiment , the acoustic power sensing arrangement 38 comprises a polarized piezoelectric membrane 40 formed of polyvinylidene fluoride ( pvdf ). as is known , membranes of this nature are commonly used in hydrophones to measure ultrasound pressure waves in a medium such as water . a set of upper electrodes 40 a in the form of generally parallel , laterally spaced strips and a set of lower electrodes 40 b similarly in the form of generally parallel , laterally spaced strips are provided on opposite sides of the piezoelectric membrane 40 . the electrode strips 40 a of the upper set are generally orthogonal to the electrode strips 40 b of the lower set . the upper electrode strips 40 a and the lower electrode strips 40 b overlap to form electrode pairs , with each electrode pair being aligned with a respective one of the transducer elements 20 . switching circuit 42 comprises a pair of multiplexers 42 a and 42 b . each channel of multiplexer 42 a is connected to a respective one of the upper electrode strips 40 a and each channel of the multiplexer 42 b is connected to a respective one of the lower electrode strips 40 b . the multiplexers 42 a and 42 b receive address data from the external controller 11 allowing the voltage developed between each electrode pair to be readout . the voltage measuring circuit 44 comprises an amplifier 44 a receiving input from the multiplexers 42 a and 42 b . the amplifier 44 a provides output to an analog - to - digital converter 44 b which in turn provides output to a memory 44 c . memory 44 c communicates with the external controller 11 . in this embodiment , the transducer elements 20 are arranged in groups with each group comprising forty - eight ( 48 ) transducer elements 20 although this number may be increased or decreased as desired . the driving electronics 24 in this embodiment are formed of discrete components and comprise a digital circuit 50 and an analog circuit 52 for each group of transducer elements 20 . fig5 better illustrates one of the digital circuits 50 and one of the analog circuits 52 . the digital circuit 50 comprises an address counter 60 , an address counter memory 62 , forty - eight ( 48 ) digital waveform memories 64 ( only one of which is shown ), forty - eight ( 48 ) waveform digital - to - analog converters ( dacs ) 66 ( only one of which is shown ) and a reference voltage dac 68 . the address counter memory 62 , the digital waveform memories 64 and the reference voltage dac 68 are connected to the external controller 11 via a 16 - bit high speed data bus 70 . the address counter 60 and the waveform dacs 66 are connected to the external controller 11 via or logic 72 that is driven by a run clock 74 . the address counter 60 , address counter memory 62 , digital waveform memories 64 , waveform dacs 66 and reference voltage dac 68 also communicate with the external controller 11 via control lines 76 . each digital waveform memory 64 in this embodiment comprises 64k × 10 bit static random access memory ( ram ) that stores a digital waveform received from the external controller 11 via the high speed data bus 70 . the digital values of the digital waveform at sampled time points are directly and serially loaded into each digital waveform memory 66 via the high speed data bus 70 . the frequencies , amplitudes and phases of digital waveforms loaded into the digital waveform memories 66 by the external controller are selected so that the ultrasonic radiation 15 output by the ultrasound therapy transducer head 10 provides the desired therapeutic ultrasound to the subject . parallel loading of the digital waveform into each digital waveform memory 64 is also feasible and will reduce the time required for the digital waveform loading procedure . the address counter memory 62 supplies rolling memory addresses to the address counter 60 at 20 mhz as the external controller 11 outputs data onto the high speed data bus 70 which in turn enables the digital waveform memories 64 so that the digital waveform data is stored in the proper digital waveform memories 64 . each digital waveform memory 64 is also addressed by the address counter 60 to ensure synchronization during output of digital waveforms by the digital waveform memories . once the digital waveform memories 64 have been loaded with the desired digital waveforms , each digital waveform memory is used to provide 10 - bit digital waveform data to its associated waveform dac 66 during the sonication . each waveform dac 66 converts the 10 - bit digital waveform seen at its input to an analog signal with a dynamic range of 0 to 1 volt . the waveform dac 66 is fast enough to allow adequate time resolution . during the sonication , the run clock 74 to the address counter 60 and the waveform dacs 66 is switched to a higher frequency oscillator ( for example 65 mhz ) to allow for adequate time resolution . each waveform dac 66 may also have additional features such as power down lines to allow individual channels to be disabled in the event of a channel down condition . such a channel down condition occurs for example if the channel driving line becomes disconnected from its associated transducer element 20 or if the transducer element 20 is damaged . the reference voltage dac 68 and its associated latch ( not shown ) are used to set the reference voltage for all the waveform dacs 66 . this allows the total power level of the ultrasound source 14 to be adjusted in real time during sonication without requiring reloading of the digital waveform memories 66 . the analog circuit 52 comprises forty - eight ( 48 ) amplication circuits ( only one of which is shown ), each of which receives the analog signal output of an associated waveform dac 66 and outputs a corresponding analog radio frequency ( rf ) signal that is applied to the channel driving line extending to an associated transducer element 20 . the advantages of having each transducer element 20 connected to its own driving line include the reduction of the driving system size , cost , and power loss when the energy is transmitted from the driving electronics to the transducer element array . one of the amplification circuits is better illustrated in fig6 and comprises a first op - amp stage 80 that provides a voltage gain to the analog signal , and a second op - amp stage 82 that provides a high current analog signal output . in this embodiment , the first op - amp stage 80 applies a voltage gain of eleven ( 11 ) to the dac analog output signal augmenting the voltage swing from 0 to 11 volts . the op - amp stage 80 cuts out high frequencies and can be used to cut the quantization noise frequency . the signal output by the op - amp stage 80 is high - pass filtered with a first order resistor - capacitor ( rc ) circuit 84 to remove dc offset . the second op - amp stage 82 employs a high power op - amp to amplify the voltage , in this embodiment by a gain of two ( 2 ), and provide a high current analog output signal with a maximum peak - to - peak voltage swing of 22 volts . the components shown in the shaded region of fig5 represent the circuitry of the digital and analog circuits 50 and 52 that is repeated for each of the forty - eight ( 48 ) channels . the digital and analog circuits 50 and 52 can be constructed from discrete components or can be constructed using application specific integrated circuit ( asic ) chips . the digital circuit 50 can be combined on one asic chip 90 and the analog circuit 52 on another asic chip 92 as shown in fig7 . alternatively , both the digital and analog circuits 50 and 52 can be combined on one chip 96 using a multiple - chip package ( mcp ) process as shown in fig8 . the op - amp stages 80 and 82 can be embedded in the module by integrating semiconductor intellectual property ( sip ) blocks with asic / memories . the chip 90 or 96 may include a line that allows the status of the digital waveform memories 64 to be monitored to assure that each digital waveform is properly loaded . the external controller 11 in this embodiment comprises a computing device such as for example , a microsoft windows based personal computer ( pc ) with a ni pci - 6534 ( national instruments , austin , tex . ), an 80 mbytes / second data transfer rate , and a 32 - bit digital i / o board . the i / o board is controlled through a program executing on the computing device that uses the dynamic link library ( dll ) supplied by the i / o board manufacturer . binary data on thirty - two ( 32 ) data lines can be simultaneously transmitted for example at 20 mhz if an 80 mbytes / s transfer rate is desired . of the 32 data lines , 16 data lines form the high speed data bus 70 for transmitting digital waveform values , etc . to the driving electronics 24 . the other 16 data lines are used as the control lines 76 for selecting , programming and manipulating different components of the driving electronics 24 and for higher level functions such as powering on and off individual digital circuits 50 and / or individual channels of the digital circuits 50 . the analog circuits 52 can be controlled by the external controller 11 for example through a parallel port . the external controller 11 can control electronic components of the ultrasound transducer head 10 via a serial port , universal serial bus ( usb ) or other suitable communications protocol . each operation or instruction issued by the external controller 11 is coded with a specific 16 - bit word that is used to directly control the appropriate component elements . 16 - bit data arguments can be sent by the electronic components to the external controller 11 when required . during operation , when the ultrasound transducer head 10 is conditioned to output ultrasonic radiation 15 , the digital waveform data in each digital waveform memory 64 is output to its associated digital waveform dac 66 and converted into an analog signal . each analog signal is input to its associated amplification circuit resulting in an output rf signal that is fed to its associated transducer element 20 . in response , each transducer element 20 outputs a beam of ultrasonic radiation corresponding to the digital waveform . the ultrasound beam transmitted by each transducer element 20 passes through the acoustic power sensing arrangement 38 before exiting the transducer head 10 via the membrane 13 . as each ultrasound beam passes through the acoustic power sensing arrangement , a varying voltage is formed in the piezoelectric membrane 40 between the electrode pair aligned with the transducer element 20 that is outputting the ultrasound beam as a result of the pressure variation created across the piezoelectric membrane 40 . when the controller 11 addresses an electrode pair by enabling the multiplexers 42 a and 42 b connected to the upper and lower electrode strips 40 a and 40 b forming the electrode pair , the voltage across the piezoelectric membrane 40 between the electrode pair is sensed by the amplifier 44 a . amplifier 44 a in turn outputs a voltage signal to the analog - to - digital converter 44 b which converts the voltage signal to a digital value for storage in the memory 44 c . since the sensed voltage is proportional to the ultrasound pressure wave , the acoustic power delivered by each transducer element 20 can be measured . these measurements can be relative or they can be calibrated to provide absolute power measurements . the generated voltage measurement signal output from the memory 44 c by the voltage measuring circuit 44 is used by the external controller 11 to assure the proper operation of the transducer elements 20 and / or the driving electronics 24 allowing the ultrasonic radiation 15 output by the ultrasound therapy transducer head 10 to be precisely controlled . the generated voltage measurement signal may also be used to assure proper operation of the software executed by the external controller 11 during generation and loading of digital waveforms , to measure , display and / or control the amplitude of the emitted ultrasound beams , to measure , display and / or control the phase of the emitted ultrasound beams , and as a feedback signal to assure desired operation of the ultrasound therapy transducer head 10 such as by adjusting ultrasound beam amplitudes to stabilize power output . the temperature sensing electronics 26 in this embodiment monitor the temperature of the coupling fluid 34 via temperature sensor 36 and the temperature of the driving electronics 24 via another temperature sensor ( not shown ) and provide output to the heat exchanger 28 . in response to output from the temperature sensing electronics 26 , the heat exchanger cools the coupling fluid 34 and / or the driving electronics 24 by circulating coolant through the housing 12 thereby to control temperature within the housing 12 and assure stable and reliable operation of the ultrasound therapy transducer head 10 . the temperature sensing electronics 26 can signal the heat exchanger 28 so that it operates generally continuously to maintain a desired temperature within the housing or can cycle the heat exchanger 28 . if desired , the temperature sensing electronics 26 may store temperature measurement and control data for transfer to the external controller 11 . if desired , the ultrasound therapy transducer head 10 may further comprise a controller to maintain and control the performance of the ultrasound therapy transducer head . memory may be provided to store sonication , control and / or safety limit data as well as other data generated during ultrasound therapy transducer head monitoring . additional electronics to enable automatic control and provide enhanced safety may also be included . by integrating the array of transducer elements 20 with driving electronics 24 using custom integrated circuits in the transducer housing 12 and by using piezoelectric film technology integrated into the transducer housing 12 to monitor acoustic power output , the manufacturing costs of the ultrasound therapy transducer head 10 are significantly reduced providing for the ability to make ultrasound therapy systems that are not feasible with the current approaches . although the driving electronics 24 are described above as being connected to the array of transducer elements 20 via the connection layer 22 , if desired , the driving electronics 24 may be directly connected to the transducer elements 20 obviating the need for the connection layer . if the connection layer does not provide the mechanical mounting then additional material is used to provide the mechanical mounting for the transducer elements 20 . also , if desired , the acoustic power sensing arrangement 38 can be positioned directly on the transducer element array face rather than being spaced from it as shown . the form of the driving electronics 24 can of course vary from the examples described above and illustrated in the drawings . for example , if desired the amplification circuits may only include the high power op - amps . the analog output provided to the amplification circuits may be generated by individual waveform generators . in the example of fig7 , it is possible to realize only the digital circuits 50 in asics while using discrete components for the analog circuits 52 . although embodiments have been described above with reference to the drawings , those of skill in the art will appreciate that variation and modifications may be made without departing from the spirit and scope thereof as defined by the appended claims .	0
as shown in fig1 - 4 , a container 10 is made up of a neck portion 12 and a body portion 24 . the neck 12 is provided with an open mouth 16 and an opposed opening into the body portion 24 . circumscribing the neck portion 12 is a helical thread 14 which is defined by a slot 26 which receives the thread of a closure or container cap ( not shown ). disposed within the thread 14 is a pair of recesses 20 a and 20 b which are spaced from each other a total of 180 °. the recesses 20 a and 20 b are in alignment with and formed by the fingers 32 a , 32 b , 32 c , and 32 d as shown in fig5 a . a latching lug 22 may also be provided for engagement with a mating latching lug on a closure ( not shown ). as shown in fig5 and 5 a , a mold 30 of the preferred embodiment is comprised of only two sections which are , in fact , halves , one half is identifiable as 30 a and the other as 30 b . molds 30 a and 30 b are horizontally movable by virtue of the fact that there are but two sections . when three or more sections are used , the mold sections move apart axially instead of horizontally . when the molds are in a closed position , as shown in fig5 they define a cavity ( not shown ) for the mold of the body portion 24 of the container 10 and grasp the neck portion 12 therein and form the helical threads 14 . helical thread 14 has a pitch in the range of 0 to 8 threads per inch . as shown in fig5 a , the recessed portions 20 a and 20 b in the helical thread 14 are formed by the fingers 32 a , 32 b , 32 c and 32 d of the mold halves 30 a and 30 b , respectively . the horizontal recess formed by recessed portions 20 a and 20 b comprise a first notch disposed on a first side of the slot and a second notch disposed on a second side of the slot with the first notch juxtaposed relative to the second notch so as to horizontally traverse the slot . in the preferred embodiment , a container 10 with a neck finish 12 of the present invention is formed by placing a parison of a selected moldable material , such as , for example polyethylene terephthalate ( pet ), or high density polyethylene ( hdpe ), within a cavity of the mold . the preferred embodiment also creates the mold cavity upon the bringing together of the mold halves 30 a and 30 b , as shown in fig5 . alternate embodiments using more than two mold sections create a mold cavity when their mold sections are brought together axially . a vertically molded core ( not shown ) of a molding device is inserted into the cavity thereby engaging with the parison . in a form of compression - molding , the parison is next formed into a preselected configuration defined by the spatial relationship of the core and the cavity in the mold 30 resulting in the formation of a container 10 . additionally , a blow - molding process can be used to create the container 10 . after the container 10 has been formed , the mold halves 30 a and 30 b are then horizontally separated as the mold halves 30 a and 30 b move horizontally away from the container . furthermore , at the initial separation of the mold halves , the fingers 32 a , 32 b , 32 c and 32 d form the recesses 20 a and 20 b in the helical thread 14 in order to allow clearance of the mold from the neck finish and avoid distortion of the helical thread 14 , even if the helical threads 14 are of a steep pitch , as the halves 30 a and 30 b separate . the foregoing detailed description is given primarily for clearness of understanding and no unnecessary limitations are to be understood therefrom for modifications will become obvious to those skilled in the art upon reading this disclosure and may be made without departing from the spirit of the invention and scope of the appended claims .	1
fig1 shows a mill constructed according to the principles of the invention with a lower housing 10 , a supply chamber 12 surmounting the lower housing , and a cover 14 for the supply chamber . the cover 14 is shaped in a downward cone and its surface is pierced by openings in the form of circular segments interrupted by spoke - like gussets . the openings are used to charge feedstock into the supply chamber 12 whose bottom acts as a filling funnel for the mill . the gussets of the cover 14 carry a central portion 16 which bears , in a manner to be more fully described below , the driveshaft of the mill . the lower housing 10 sits , with its lower edge 11 , upon a receiving container for the flour ; the container is not shown for the sake of clarity of illustration . the housing 10 also bears integral flying buttresses 18 which secure an upper millstone 20 , cast in situ , against rotation . the upper millstone closes off the lower face of the funnel - like supply chamber 12 . the upper surface of the millstone 20 is also shaped in the form of a funnel and angles off into a supply orifice 22 centrally disposed in the millstone . two feed slots 24 are formed in the wall of the supply orifice 22 . the feedslots 24 start at the upper end of the orifice 22 and have an initial cross - section which corresponds to the largest possible kernal size of the grain to be milled . from the upper end of the orifice 22 the feedslots 24 run downwardly in a spiral in the inner periphery of the orifice 22 . the cross - section of the feedslots 24 narrows as they proceed downward until the feedslots 24 completely disappear at the lower end of the orifice 22 . this characteristic of the feedslots 24 is shown in fig1 and 2 . a lower millstone 30 is borne on a crosspin 28 passing through driveshaft 26 ; the crosspin secures the shaft and the millstone 30 into a jointly rotating assembly . the driveshaft 26 rises through the supply orifice 22 of the upper millstone 20 and through an opening in the central cover portion 16 . that portion of the shaft 26 above the cover 16 is threaded and engaged by an adjusting nut 32 ; the nut 32 bears on a thrust bearing plate 34 supported on the cover portion 16 . by relative rotation of the nut 32 and the shaft 26 the spacing between the upper and nether millstones 20 and 30 may be adjusted to provide a desired milling gap 21 . in the region of the supply orifice 22 of the upper millstone 20 , a hob 36 is formed on the driveshaft 26 ; the length of the hob 36 corresponding substantially to the thickness of the millstone 20 . the hob comprises a large number of teeth 38 jutting peripherally from the surface of the driveshaft in parallel planes orthogonal to the centerline of the shaft 26 . the individual cutters , or teeth , 38 are each separated from the adjoining teeth by gaps ; these gaps are aligned in the several planes in which the teeth are located in such a manner that they form a plurality of grooves 40 along lines parallel to the shaft centerline . in the upper surface of the lower millstone 30 , the surface turned toward the milling face of the upper millstone in the assembly , a spiral groove 42 is provided in the central portion of the surface . this spiral groove 42 leads from the outer edge of a supply cavity 44 , into which the orifice 22 discharges , into a circular depression 46 intermediate between the center and the outer perimeter of the millstone 30 , as shown in fig3 . opposite the spiral groove 42 a number of flutes 48 are provided in the lower face of the upper millstone 20 , running from the supply cavity 44 toward a circular depression 47 coincident with the depression 46 of the lower millstone . the flutes 48 run substantially radially , but are , as shown in fig2 slightly angled with respect to the true radii , so that they oppose the spiral of the groove 42 . the circular depression 46 in the midrange of the lower millstone 30 is adjoined by the fine - milling region with a large number of outwardly spiralling furrows 50 . the furrows 50 become shallower as they approach the outer perimeter of the millstone . in a similar fashion , a plurality of spiral furrows 51 radiate from the circular depression 47 of the upper millstone 20 ; the furrows 51 are formed identically to the furrows 50 but their curvature runs counter in sense to the latter . exterior to the regions of the furrows 50 and 51 , the lower and upper millstones 30 and 20 are also provided with superimposed flat surfaces 52 , the spacing between which determines the milling gap 21 of the milling apparatus and which is adjustible by means of the nut 32 . the milling apparatus of fig1 described above , operates in the following fashion : the feedstock , which is to be reduced to flour , is poured through the openings provided in cover 14 into the funnel - like interior of the supply chamber 12 . the sloping bottom of the chamber 12 guides the feedstock into the supply orifice 22 in the upper millstone 20 . the kernels of the feed are fed down the spiralling supply grooves 24 in the wall of the orifice 22 until they are arrested by the narrowing gap between the grooves and the hob 36 . the kernels so arrested drop into the next axial groove 40 in the hob , as it rotates into the appropriate alignment , and are broken by the advancing teeth 38 and reduced in size until they can fall through between the teeth 38 and the sidewalls of the feed slots 24 . one , or more , reductions in the size of the kernels produce pieces small enough to pass through the annulus between the outer periphery of the hob 36 and the orifice 22 , into the supply cavity 44 . the pre - milled feedstock lands in the spiral groove 42 of the lower , rotating millstone and is conveyed radially outwardly as they are further reduced in size by shearing between the edges of the groove 42 and of the flutes 48 in the upper millstone 20 , above . the , now much smaller , feed passes into the furrows 50 and 51 via the circular depressions 46 and 47 which form a toroidal chamber in the interface between the two millstones . the feed is further reduced in size by the action of the furrows 50 and 51 and passes into the region of the milling space defined by flat portions 52 of the millstones , where it is finally reduced to a size corresponding to the milling gap 21 . the milled flour exits radially into a circular chamber 54 defined by the lower housing 10 , whence it falls into a receptacle upon which the housing 10 is supported . upwardly directed vents 56 allow for the unrestricted discharge of air retained in the flour ; they are inwardly protected by a deflector ring 58 , so that the flour cannot escape via the vents 56 . the deflector ring 58 sits at the inner edge of the vents 56 , and does , thereby , prevent the flour existing at the periphery of the millstones from passing through the vents 56 . in the commonly utilized speed range , the flour leaves the gap 21 between the millstones with a very low velocity . the flour inpacting on the deflector ring 58 , therefore , falls downward . should a small proportion of the flour be deflected upward , it will strike the inner surface of the housing 10 adjoining the deflector ring 58 , and will not , again , escape through the vents 56 . the vents 56 serve only to equalize the pressure difference which may arise during the milling process . another embodiment of the millstones of the invention is shown in the illustrating of fig4 and 5 , incorporating a metering mechanism for the control of the amount of feed supplied to the fine - milling region of the millstones . while they are not directly illustrated , pre - milling devices , such as the hob 36 or the spiral groove 42 and its cooperating flutes 48 may also be provided with this embodiment but are omitted for clarity . the assembly of fig4 comprises a lower millstone 130 and an upper millstone 120 , with the stone 130 rigidly affixed to a driveshaft 126 , by means of which it rotated against the upper stone , which is stationary in a housing not shown . a supply orifice 122 pierces the center of the upper millstone 120 , the diameter of this orifice is indicated by broken outline in the view of fig5 which shows the upper face of the lower millstone 130 . feedstock passes from a housing , through the orifice 122 , and into the milling space between the superposed millstones . the lower millstone 130 , as shown in fig5 differs from millstones of the prior art through its lack of a central supply cavity ; a supply cavity 144 is provided , in the form of an annular depression in the upper surface of the stone , adjacent to a substantially flat surface portion underlying the orifice 122 . the depressed supply cavity 144 is sufficiently removed from the driveshaft 126 , that it is completely covered by the upper millstone 120 in the assembly . a pair of metering channels 160 interconnect the base of the supply orifice 122 and the cavity 144 and control the transfer of grain . these metering channels begin in the flat surface portion underlying the orifice and spiral outwardly , discharging into the cavity 144 . the curvature of the channels 160 is so chosen that , with the millstone 130 rotating in its normal sense , the grains falling thereinto are forced radially outward by their inertia and the frictional forces in the channels . exterior to the cavity 144 , a number of spiral furrows 150 interrupt the surface of the millstone 130 ; their depth decreasing toward the outer edge of the stone . these furrows 150 are formed in a manner similar to furrows 50 of fig3 but differ from those in branching into paired furrows 150 &# 39 ; midway between the cavity 144 and the stone periphery . during the rotation of the millstone 130 , opposite the stationary upper millstone 120 , the cereal grains are fed from the cavity 144 into the furrows 150 where they are broken by shear forces exerted by the co - operating millstones , as the grain size is reduced the particles travel outwardly until they enter the furrows 150 &# 39 ; whose function is to evenly distribute the already ground feed over the perimeter of the millstones . in the stationary , upper millstone 120 corresponding furrows 151 are provided , also with reducing depth at increased radial distances . these furrows are formed with their curvature counter to the curvature of the furrows 150 in the lower millstone 130 , whereby the milling action between the two bodies is improved , through the encounter by the partly milled grains of a large number of intersecting edges . beyond the outer limits of the spiralling furrows 150 and 151 , the almost completely milled feedgrains pass through a fine - milling region defined by parallel , flat surface portions 152 , prior to exiting from milling gap 121 at the outer perimeter . many variations are possible in the design of the above embodiment of the invention . in particular , the number and depth of the metering channels 160 can be adapted to the type and desired feedrate of the cereal . the metering channels may also be formed without the spiral alignment , though this promotes the transport of the feed into the supply cavity . it is also possible to provide the metering channels in the lower face of the upper millstone 120 , opening directly from the sidewall of supply orifice 122 , with the motion of the grain impelled by the rotation of the nether millstone . the form and arrangement of the metering channels 160 , as shown in fig4 and 5 is preferred , due to the gravitational assist in admitting the grain thereto . in fig6 through 10 additional embodiments of the millstones of the invention are illustrated . these embodiments show differing developments of the spiral furrows located in the finish milling region of the apparatus . it is understood that the pre - milling components of fig1 through 3 , as well as the metering channels shown in fig4 and 5 , may be equally adapted to the embodiments described below . while the furrows 50 and 51 , and corresponding furrows 150 and 151 , of the previously described embodiments show only a negligible curvature of such furrows , and are present in large numbers , those furrows shown in fig6 through 11 show substantially greater curvature , and are present in much smaller numbers . some of these embodiments incorporate furrows which describe a number of revolutions around the rotational axis of the mill , while others show only a single furrow in the fine - milling region , in particular in the embodiment shown in fig6 , 8 , 10 and 11 ; the embodiment of fig9 shows three furrows in each of the two millstones . turning now to fig6 we see a millstone 220 with a peripheral , flat milling surface 252 and a central cavity 244 . a supply orifice 222 leads directly into the cavity 244 . a spiral furrow 251 extends -- with constant incremental curvature -- from the cavity 244 to the region 252 of the millstone 220 . preferably the depth and / or the slope of the furrow 251 reduces toward the edge of the millstone 220 . a lower millstone 230 is provided to mate with the stone 220 of fig6 ; the features of the lower millstone are , generally , the same as the upper millstone , but the direction of curvature of its furrows 250 is reversed in relation to the curvature of furrows 251 . fig7 is a transverse section through the millstones 220 and 230 and indicates the counter - rotational direction of their respective furrows 251 and 250 with respect to one another . the relative position of the two millstones , as illustrated in fig8 arises from a rotational displacement of the millstone 230 with respect to the position shown in fig7 . fig9 illustrates a further development of a millstone which , in contrast to the millstone 220 shown in fig6 encompasses three concentrically spiralling furrows 251 , 251 &# 39 ; and 251 &# 34 ;. the furrows 251 , 251 &# 39 ; and 251 &# 34 ; also lead from the supply cavity 244 and extend to the outer perimeter of the millstone 220 . the slope and / or the depth of the furrows may be reduced toward the perimeter -- from the inside to the outside -- as in the embodiment of fig6 . in principle the mating millstone 230 also shows a similar form , but with the furrows spiralling counter to the furrows in the millstone 220 of fig9 . the millstones of the embodiment of fig9 are also provided with a peripheral , flat fine - milling surface 252 , as well as an orifice 222 in the upper stone leading to a central cavity 144 . fig1 and 11 illustrate the manner in which the crossings , or intersections , a , b , c , and d , of the co - operating furrows 250 and 251 travel outward when one of the stones is rotated in the direction of the arrow . in fig1 the millstones 220 and 230 have been rotated , relative to one another , by 45 °. the spiral furrows 250 and 251 may be provided with a variety of cross - sections , including , for example , square , triangular , or trapezoidal sections . in all embodiments of the invention the millstones may be manufactured by any of the methods of the prior art . a particularly simple and economical method applicable to the strongly sculptured milling faces of the stones of the invention , is the casting of ceramically bound abrasives into molds . the invention has been described above with reference to its preferred embodiments , minor changes in the arrangement , spacing and forming of the several features of the milling apparatus of the invention shall be deemed to be encompassed by the disclosure herein : the scope of the invention being delimited only by the appended claims . for example , it is possible to provide the opposing milling surfaces of the paired millstones with shapes other than planar , in particular they may be formed in conical shapes . in such an embodiment one millstone would have a conically convex milling face , while the mating stone would be provided with a milling face in the form of a funnel .	1
embodiments of the invention are discussed in detail below . in describing embodiments , specific terminology is employed for the sake of clarity . however , the invention is not intended to be limited to the specific terminology so selected . while specific embodiments are discussed , it should be understood that this is done for illustration purposes only . a person skilled in the relevant art will recognize that other components and configurations can be used without departing from the spirit and scope of the invention . the invention described herein differs from that described in the parent application primarily in that whereas the latter requires a puzzle board , the former does not referring to fig1 - 2 , embodiments of puzzles 10 according to the present invention are shown . as shown in fig1 , the shape may be pentagonal and consist of pieces 21 , 22 , 23 , 24 , 25 , 26 or it may assume any of the shapes depicted in fig2 . each of the pieces 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 can have a different geometric shape , for example , with different amounts of “ sides ” or edges defining the geometric shape ; e . g ., hexagon , heptagon , octagon , nonagon , and decagon , among many others . each of the puzzle pieces can have a different geometric shape from each other , for example , with different amounts of “ sides ” or edges defining the geometric shape . the number of sides or edges of the puzzle piece is equal to the number of sides of the geometric shape to be formed with the puzzle pieces . the number of sides of the shape should at least be five . when the puzzle pieces are manipulated and arranged together , they form the corresponding geometric shape with the same number of sides of each of the puzzle pieces that form the geometric shape . one of ordinary skill in the art will understand based on this disclosure that the invention is not limited to any specific shape or configuration of puzzle , or number , shape , and appearance of puzzle pieces . the puzzle pieces are adapted such that they are not required to fit into a cutout . rather , each puzzle piece can define an outer periphery that has the same , or substantially the same , shape as the outer periphery of the corresponding geometric shape . for example , as shown in fig2 , the geometric shape is a pentagon , 10 . puzzle pieces 21 , 22 , 23 , 24 , 25 and 26 , individually , do not mirror the specific shape of the pentagon , 10 . rather , the pieces 21 , 22 , 23 , 24 , 25 and 26 have the same number of sides as the geometric shape , 10 . the user , after recognizing puzzle pieces with the same number of sides as the geometric shape 10 , can manipulate the pieces 21 , 22 , 23 , 24 , 25 and 26 to form the geometric shape , as shown in fig2 . the pieces fit together or mate with one another . the puzzle pieces have a different shape from the geometric shape to the formed but have the same number of sides as the corresponding geometric shape . the invention provides that any equilateral polygon of n sides , where n is greater than or equal to five , can be deconstructed into k polygons of n sides , where k is greater than or equal to 1 . n and k are integers . the puzzle and its various parts can be constructed using any number of techniques in the art . for example , embodiments can be constructed from paper , cardboard , plastic , or wood . alternatively , embodiments can be implemented in electronic form , such as an internet - based format , a smartphone app , or a computer program , where the various parts of the puzzle are depicted on the screen of a computer , tablet , smartphone , or other device . accordingly , the invention should not be limited to embodiment in any specific form or media . the various mathematical relationships described above can be used to guide the players in assembling the puzzle . for example , the players can count the number of sides or points on each puzzle piece to determine which puzzle the piece fits into . other mathematical relationships may be used to correlate the puzzle pieces and the corresponding geometric shape . for example , and without limitation , the pieces may have an image of a bug , animal , number , object , or other item that includes the same number of certain parts ( e . g ., legs ) as the sides of the geometric shape to be formed . one of ordinary skill in the art will appreciate based on this disclosure that a variety of different shapes or images can be used to correlate the puzzle pieces with the corresponding geometric shape . the various mathematical relationships described above can be used to guide the players in assembling the puzzle or geometrical shape 10 . for example , the players can count the number of sides or points on each puzzle piece to determine which geometric shape is to be formed . the shape alone of the geometric shape and puzzle pieces can also be used to guide the player in assembling the puzzle 10 . the embodiments illustrated and discussed in this specification are intended only to teach those skilled in the art the best way known to the inventors to make and use the invention . nothing in this specification should be considered as limiting the scope of the present invention . all examples presented are representative and non - limiting . the above - described embodiments of the invention may be modified or varied , without departing from the invention , as appreciated by those skilled in the art in light of the above teachings . it is therefore to be understood that , within the scope of the claims and their equivalents , the invention may be practiced otherwise than as specifically described .	6

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.