code
stringlengths
2k
1.04M
repo_path
stringlengths
5
517
parsed_code
stringlengths
0
1.04M
quality_prob
float64
0.02
0.95
learning_prob
float64
0.02
0.93
import csv from django.contrib import admin from vaas.manager.models import Director, Backend, Probe, TimeProfile from vaas.manager.forms import DirectorModelForm from django.contrib.auth.models import User from django.contrib.auth.models import Group from taggit.models import Tag from taggit.admin import TagAdmin from tastypie.models import ApiKey from django.utils.html import format_html from vaas.monitor.models import BackendStatus from vaas.manager.signals import switch_state_and_reload from django.http import HttpResponse from django.utils.encoding import smart_str from vaas.external.audit import AuditableModelAdmin try: admin.site.unregister(Group) admin.site.unregister(User) admin.site.unregister(ApiKey) admin.site.unregister(Tag) admin.site.unregister(TagAdmin) except: pass def enable_backend(modeladmin, request, queryset): switch_state_and_reload(queryset, True) def disable_backend(modeladmin, request, queryset): switch_state_and_reload(queryset, False) def switch_backend_status(modeladmin, request, queryset): enabledSet = Backend.objects.filter(pk__in=map(lambda backend: backend.pk, queryset.filter(enabled=True))) disabledSet = Backend.objects.filter(pk__in=map(lambda backend: backend.pk, queryset.filter(enabled=False))) switch_state_and_reload(disabledSet, True) switch_state_and_reload(enabledSet, False) def export_to_csv(modeladmin, request, queryset): response = HttpResponse(content_type='text/csv') response['Content-Disposition'] = 'attachment; filename=backend_list.csv' writer = csv.writer(response, csv.excel) response.write('\ufeff'.encode('utf8')) writer.writerow([ smart_str("id"), smart_str("address"), smart_str("port"), smart_str("director"), smart_str("dc"), smart_str("status"), smart_str("enabled"), smart_str("inherit_time_profile"), smart_str("weight"), smart_str("tags") ]) backend_status_list = BackendStatus.objects.all() for obj in queryset: status_list = list(filter( lambda backend_status: backend_status.address == obj.address and backend_status.port == obj.port, backend_status_list )) status = 'unknown' if len(status_list) == 1: status = status_list[0].status writer.writerow([ smart_str(obj.pk), smart_str(obj.address), smart_str(obj.port), smart_str(obj.director), smart_str(obj.dc), smart_str(status), smart_str(obj.enabled), smart_str(obj.inherit_time_profile), smart_str(obj.weight), smart_str(obj.tags.all()) ]) return response def enable_director(modeladmin, request, queryset): switch_state_and_reload(queryset, True) def disable_director(modeladmin, request, queryset): switch_state_and_reload(queryset, False) class DirectorAdmin(AuditableModelAdmin): search_fields = ['name', 'route_expression'] form = DirectorModelForm list_display = ( 'name', 'service', 'service_mesh_label', 'get_clusters', 'route_expression', 'probe', 'protocol', 'custom_enabled', 'virtual',) list_filter = ['cluster__name', 'service'] actions = [enable_director, disable_director] def get_clusters(self, obj): """Return string with newline separated clusters for directory passed as argument""" return "\n".join([cluster.name for cluster in obj.cluster.all()]) get_clusters.short_description = 'Clusters' def get_form(self, request, obj=None, **kwargs): form = super(DirectorAdmin, self).get_form(request, obj, **kwargs) form.base_fields['cluster'].widget.can_add_related = False return form def custom_enabled(self, obj): if obj.enabled: return format_html( "<div class='span13 text-center'>" + "<a class='btn btn-xs btn-success' href='#'><i class='glyphicon glyphicon-ok-sign'></i></a>" + "</div>" ) else: return format_html( "<div class='span13 text-center'><a class='btn btn-xs' href='#'>" + "<i class='glyphicon glyphicon-ban-circle'>" + "</i></a></div>" ) custom_enabled.short_description = 'Enabled' class BackendAdmin(AuditableModelAdmin): search_fields = ['address', 'director__name', 'tags__name'] list_display = ('address', 'port', 'director', 'dc', 'is_healthy', 'custom_enabled', 'get_tags') list_filter = ['director__name', 'director__service', 'director__cluster__name', 'dc__symbol'] actions = [enable_backend, disable_backend, switch_backend_status, export_to_csv] fieldsets = ( (None, { 'fields': ('address', 'port', 'director', 'dc', 'weight', 'tags', 'inherit_time_profile') }), ('Advanced options', { 'fields': ('max_connections', 'connect_timeout', 'first_byte_timeout', 'between_bytes_timeout') }), ) backend_status_list = [] def get_form(self, request, obj=None, **kwargs): form = super(BackendAdmin, self).get_form(request, obj, **kwargs) form.base_fields['dc'].widget.can_add_related = False return form def get_list_display(self, request): self.backend_status_list = BackendStatus.objects.all() return super(BackendAdmin, self).get_list_display(request) def get_tags(self, obj): return ", ".join([tag.name for tag in obj.tags.all()]) get_tags.short_description = 'Tags' def custom_enabled(self, obj): if obj.enabled: return format_html( "<div class='span13 text-center'>" + "<a class='btn btn-xs btn-success' href='#'><i class='glyphicon glyphicon-ok-sign'></i></a>" + "</div>" ) else: return format_html( "<div class='span13 text-center'><a class='btn btn-xs' href='#'>" + "<i class='glyphicon glyphicon-ban-circle'>" + "</i></a></div>" ) custom_enabled.short_description = 'Enabled' def is_healthy(self, obj): status_list = list(filter( lambda backend_status: backend_status.address == obj.address and backend_status.port == obj.port, self.backend_status_list )) if len(status_list) == 1: if status_list[0].status == 'Healthy': return format_html( "<div class='span13 text-center'><a class='btn btn-xs btn-success' href='#'>" + "<i class='glyphicon glyphicon-ok'> </i></a></div>" ) else: return format_html( "<div class='span13 text-center'><a class='btn btn-xs btn-danger' href='#'>" + "<i class='glyphicon glyphicon-off'> </i></a></div>" ) else: return format_html( "<div class='span13 text-center'><a class='btn btn-xs' href='#'>" + "<i class='glyphicon glyphicon-off'></i></a></div>" ) class Media: js = ('js/switch-inherit-profile.js',) class ProbeAdmin(admin.ModelAdmin): fieldsets = ( (None, { 'fields': ('name', 'url', 'expected_response', 'start_as_healthy') }), ('Advanced options', { 'classes': ('collapse',), 'fields': ('interval', 'timeout', 'window', 'threshold') }), ) class TimeProfileAdmin(admin.ModelAdmin): list_display = ('name', 'max_connections', 'connect_timeout', 'first_byte_timeout', 'between_bytes_timeout') admin.site.register(Director, DirectorAdmin) admin.site.register(Backend, BackendAdmin) admin.site.register(Probe, ProbeAdmin) admin.site.register(TimeProfile, TimeProfileAdmin)
vaas-app/src/vaas/manager/admin.py
import csv from django.contrib import admin from vaas.manager.models import Director, Backend, Probe, TimeProfile from vaas.manager.forms import DirectorModelForm from django.contrib.auth.models import User from django.contrib.auth.models import Group from taggit.models import Tag from taggit.admin import TagAdmin from tastypie.models import ApiKey from django.utils.html import format_html from vaas.monitor.models import BackendStatus from vaas.manager.signals import switch_state_and_reload from django.http import HttpResponse from django.utils.encoding import smart_str from vaas.external.audit import AuditableModelAdmin try: admin.site.unregister(Group) admin.site.unregister(User) admin.site.unregister(ApiKey) admin.site.unregister(Tag) admin.site.unregister(TagAdmin) except: pass def enable_backend(modeladmin, request, queryset): switch_state_and_reload(queryset, True) def disable_backend(modeladmin, request, queryset): switch_state_and_reload(queryset, False) def switch_backend_status(modeladmin, request, queryset): enabledSet = Backend.objects.filter(pk__in=map(lambda backend: backend.pk, queryset.filter(enabled=True))) disabledSet = Backend.objects.filter(pk__in=map(lambda backend: backend.pk, queryset.filter(enabled=False))) switch_state_and_reload(disabledSet, True) switch_state_and_reload(enabledSet, False) def export_to_csv(modeladmin, request, queryset): response = HttpResponse(content_type='text/csv') response['Content-Disposition'] = 'attachment; filename=backend_list.csv' writer = csv.writer(response, csv.excel) response.write('\ufeff'.encode('utf8')) writer.writerow([ smart_str("id"), smart_str("address"), smart_str("port"), smart_str("director"), smart_str("dc"), smart_str("status"), smart_str("enabled"), smart_str("inherit_time_profile"), smart_str("weight"), smart_str("tags") ]) backend_status_list = BackendStatus.objects.all() for obj in queryset: status_list = list(filter( lambda backend_status: backend_status.address == obj.address and backend_status.port == obj.port, backend_status_list )) status = 'unknown' if len(status_list) == 1: status = status_list[0].status writer.writerow([ smart_str(obj.pk), smart_str(obj.address), smart_str(obj.port), smart_str(obj.director), smart_str(obj.dc), smart_str(status), smart_str(obj.enabled), smart_str(obj.inherit_time_profile), smart_str(obj.weight), smart_str(obj.tags.all()) ]) return response def enable_director(modeladmin, request, queryset): switch_state_and_reload(queryset, True) def disable_director(modeladmin, request, queryset): switch_state_and_reload(queryset, False) class DirectorAdmin(AuditableModelAdmin): search_fields = ['name', 'route_expression'] form = DirectorModelForm list_display = ( 'name', 'service', 'service_mesh_label', 'get_clusters', 'route_expression', 'probe', 'protocol', 'custom_enabled', 'virtual',) list_filter = ['cluster__name', 'service'] actions = [enable_director, disable_director] def get_clusters(self, obj): """Return string with newline separated clusters for directory passed as argument""" return "\n".join([cluster.name for cluster in obj.cluster.all()]) get_clusters.short_description = 'Clusters' def get_form(self, request, obj=None, **kwargs): form = super(DirectorAdmin, self).get_form(request, obj, **kwargs) form.base_fields['cluster'].widget.can_add_related = False return form def custom_enabled(self, obj): if obj.enabled: return format_html( "<div class='span13 text-center'>" + "<a class='btn btn-xs btn-success' href='#'><i class='glyphicon glyphicon-ok-sign'></i></a>" + "</div>" ) else: return format_html( "<div class='span13 text-center'><a class='btn btn-xs' href='#'>" + "<i class='glyphicon glyphicon-ban-circle'>" + "</i></a></div>" ) custom_enabled.short_description = 'Enabled' class BackendAdmin(AuditableModelAdmin): search_fields = ['address', 'director__name', 'tags__name'] list_display = ('address', 'port', 'director', 'dc', 'is_healthy', 'custom_enabled', 'get_tags') list_filter = ['director__name', 'director__service', 'director__cluster__name', 'dc__symbol'] actions = [enable_backend, disable_backend, switch_backend_status, export_to_csv] fieldsets = ( (None, { 'fields': ('address', 'port', 'director', 'dc', 'weight', 'tags', 'inherit_time_profile') }), ('Advanced options', { 'fields': ('max_connections', 'connect_timeout', 'first_byte_timeout', 'between_bytes_timeout') }), ) backend_status_list = [] def get_form(self, request, obj=None, **kwargs): form = super(BackendAdmin, self).get_form(request, obj, **kwargs) form.base_fields['dc'].widget.can_add_related = False return form def get_list_display(self, request): self.backend_status_list = BackendStatus.objects.all() return super(BackendAdmin, self).get_list_display(request) def get_tags(self, obj): return ", ".join([tag.name for tag in obj.tags.all()]) get_tags.short_description = 'Tags' def custom_enabled(self, obj): if obj.enabled: return format_html( "<div class='span13 text-center'>" + "<a class='btn btn-xs btn-success' href='#'><i class='glyphicon glyphicon-ok-sign'></i></a>" + "</div>" ) else: return format_html( "<div class='span13 text-center'><a class='btn btn-xs' href='#'>" + "<i class='glyphicon glyphicon-ban-circle'>" + "</i></a></div>" ) custom_enabled.short_description = 'Enabled' def is_healthy(self, obj): status_list = list(filter( lambda backend_status: backend_status.address == obj.address and backend_status.port == obj.port, self.backend_status_list )) if len(status_list) == 1: if status_list[0].status == 'Healthy': return format_html( "<div class='span13 text-center'><a class='btn btn-xs btn-success' href='#'>" + "<i class='glyphicon glyphicon-ok'> </i></a></div>" ) else: return format_html( "<div class='span13 text-center'><a class='btn btn-xs btn-danger' href='#'>" + "<i class='glyphicon glyphicon-off'> </i></a></div>" ) else: return format_html( "<div class='span13 text-center'><a class='btn btn-xs' href='#'>" + "<i class='glyphicon glyphicon-off'></i></a></div>" ) class Media: js = ('js/switch-inherit-profile.js',) class ProbeAdmin(admin.ModelAdmin): fieldsets = ( (None, { 'fields': ('name', 'url', 'expected_response', 'start_as_healthy') }), ('Advanced options', { 'classes': ('collapse',), 'fields': ('interval', 'timeout', 'window', 'threshold') }), ) class TimeProfileAdmin(admin.ModelAdmin): list_display = ('name', 'max_connections', 'connect_timeout', 'first_byte_timeout', 'between_bytes_timeout') admin.site.register(Director, DirectorAdmin) admin.site.register(Backend, BackendAdmin) admin.site.register(Probe, ProbeAdmin) admin.site.register(TimeProfile, TimeProfileAdmin)
0.410284
0.07538
from datetime import timedelta import logging from aiohttp.client_exceptions import ClientError from pyeconet import EcoNetApiInterface from pyeconet.equipment import EquipmentType from pyeconet.errors import ( GenericHTTPError, InvalidCredentialsError, InvalidResponseFormat, PyeconetError, ) from openpeerpower.const import CONF_EMAIL, CONF_PASSWORD, TEMP_FAHRENHEIT from openpeerpower.core import callback from openpeerpower.exceptions import ConfigEntryNotReady from openpeerpower.helpers.dispatcher import dispatcher_send from openpeerpower.helpers.entity import Entity from openpeerpower.helpers.event import async_track_time_interval from .const import API_CLIENT, DOMAIN, EQUIPMENT _LOGGER = logging.getLogger(__name__) PLATFORMS = ["climate", "binary_sensor", "sensor", "water_heater"] PUSH_UPDATE = "econet.push_update" INTERVAL = timedelta(minutes=60) async def async_setup(opp, config): """Set up the EcoNet component.""" opp.data[DOMAIN] = {} opp.data[DOMAIN][API_CLIENT] = {} opp.data[DOMAIN][EQUIPMENT] = {} return True async def async_setup_entry(opp, config_entry): """Set up EcoNet as config entry.""" email = config_entry.data[CONF_EMAIL] password = config_entry.data[CONF_PASSWORD] try: api = await EcoNetApiInterface.login(email, password=password) except InvalidCredentialsError: _LOGGER.error("Invalid credentials provided") return False except PyeconetError as err: _LOGGER.error("Config entry failed: %s", err) raise ConfigEntryNotReady from err try: equipment = await api.get_equipment_by_type( [EquipmentType.WATER_HEATER, EquipmentType.THERMOSTAT] ) except (ClientError, GenericHTTPError, InvalidResponseFormat) as err: raise ConfigEntryNotReady from err opp.data[DOMAIN][API_CLIENT][config_entry.entry_id] = api opp.data[DOMAIN][EQUIPMENT][config_entry.entry_id] = equipment opp.config_entries.async_setup_platforms(config_entry, PLATFORMS) api.subscribe() def update_published(): """Handle a push update.""" dispatcher_send(opp, PUSH_UPDATE) for _eqip in equipment[EquipmentType.WATER_HEATER]: _eqip.set_update_callback(update_published) for _eqip in equipment[EquipmentType.THERMOSTAT]: _eqip.set_update_callback(update_published) async def resubscribe(now): """Resubscribe to the MQTT updates.""" await opp.async_add_executor_job(api.unsubscribe) api.subscribe() async def fetch_update(now): """Fetch the latest changes from the API.""" await api.refresh_equipment() config_entry.async_on_unload(async_track_time_interval(opp, resubscribe, INTERVAL)) config_entry.async_on_unload( async_track_time_interval(opp, fetch_update, INTERVAL + timedelta(minutes=1)) ) return True async def async_unload_entry(opp, entry): """Unload a EcoNet config entry.""" unload_ok = await opp.config_entries.async_unload_platforms(entry, PLATFORMS) if unload_ok: opp.data[DOMAIN][API_CLIENT].pop(entry.entry_id) opp.data[DOMAIN][EQUIPMENT].pop(entry.entry_id) return unload_ok class EcoNetEntity(Entity): """Define a base EcoNet entity.""" def __init__(self, econet): """Initialize.""" self._econet = econet async def async_added_to_opp(self): """Subscribe to device events.""" await super().async_added_to_opp() self.async_on_remove( self.opp.helpers.dispatcher.async_dispatcher_connect( PUSH_UPDATE, self.on_update_received ) ) @callback def on_update_received(self): """Update was pushed from the ecoent API.""" self.async_write_op_state() @property def available(self): """Return if the the device is online or not.""" return self._econet.connected @property def device_info(self): """Return device registry information for this entity.""" return { "identifiers": {(DOMAIN, self._econet.device_id)}, "manufacturer": "Rheem", "name": self._econet.device_name, } @property def name(self): """Return the name of the entity.""" return self._econet.device_name @property def unique_id(self): """Return the unique ID of the entity.""" return f"{self._econet.device_id}_{self._econet.device_name}" @property def temperature_unit(self): """Return the unit of measurement.""" return TEMP_FAHRENHEIT @property def should_poll(self) -> bool: """Return True if entity has to be polled for state. False if entity pushes its state to HA. """ return False
openpeerpower/components/econet/__init__.py
from datetime import timedelta import logging from aiohttp.client_exceptions import ClientError from pyeconet import EcoNetApiInterface from pyeconet.equipment import EquipmentType from pyeconet.errors import ( GenericHTTPError, InvalidCredentialsError, InvalidResponseFormat, PyeconetError, ) from openpeerpower.const import CONF_EMAIL, CONF_PASSWORD, TEMP_FAHRENHEIT from openpeerpower.core import callback from openpeerpower.exceptions import ConfigEntryNotReady from openpeerpower.helpers.dispatcher import dispatcher_send from openpeerpower.helpers.entity import Entity from openpeerpower.helpers.event import async_track_time_interval from .const import API_CLIENT, DOMAIN, EQUIPMENT _LOGGER = logging.getLogger(__name__) PLATFORMS = ["climate", "binary_sensor", "sensor", "water_heater"] PUSH_UPDATE = "econet.push_update" INTERVAL = timedelta(minutes=60) async def async_setup(opp, config): """Set up the EcoNet component.""" opp.data[DOMAIN] = {} opp.data[DOMAIN][API_CLIENT] = {} opp.data[DOMAIN][EQUIPMENT] = {} return True async def async_setup_entry(opp, config_entry): """Set up EcoNet as config entry.""" email = config_entry.data[CONF_EMAIL] password = config_entry.data[CONF_PASSWORD] try: api = await EcoNetApiInterface.login(email, password=password) except InvalidCredentialsError: _LOGGER.error("Invalid credentials provided") return False except PyeconetError as err: _LOGGER.error("Config entry failed: %s", err) raise ConfigEntryNotReady from err try: equipment = await api.get_equipment_by_type( [EquipmentType.WATER_HEATER, EquipmentType.THERMOSTAT] ) except (ClientError, GenericHTTPError, InvalidResponseFormat) as err: raise ConfigEntryNotReady from err opp.data[DOMAIN][API_CLIENT][config_entry.entry_id] = api opp.data[DOMAIN][EQUIPMENT][config_entry.entry_id] = equipment opp.config_entries.async_setup_platforms(config_entry, PLATFORMS) api.subscribe() def update_published(): """Handle a push update.""" dispatcher_send(opp, PUSH_UPDATE) for _eqip in equipment[EquipmentType.WATER_HEATER]: _eqip.set_update_callback(update_published) for _eqip in equipment[EquipmentType.THERMOSTAT]: _eqip.set_update_callback(update_published) async def resubscribe(now): """Resubscribe to the MQTT updates.""" await opp.async_add_executor_job(api.unsubscribe) api.subscribe() async def fetch_update(now): """Fetch the latest changes from the API.""" await api.refresh_equipment() config_entry.async_on_unload(async_track_time_interval(opp, resubscribe, INTERVAL)) config_entry.async_on_unload( async_track_time_interval(opp, fetch_update, INTERVAL + timedelta(minutes=1)) ) return True async def async_unload_entry(opp, entry): """Unload a EcoNet config entry.""" unload_ok = await opp.config_entries.async_unload_platforms(entry, PLATFORMS) if unload_ok: opp.data[DOMAIN][API_CLIENT].pop(entry.entry_id) opp.data[DOMAIN][EQUIPMENT].pop(entry.entry_id) return unload_ok class EcoNetEntity(Entity): """Define a base EcoNet entity.""" def __init__(self, econet): """Initialize.""" self._econet = econet async def async_added_to_opp(self): """Subscribe to device events.""" await super().async_added_to_opp() self.async_on_remove( self.opp.helpers.dispatcher.async_dispatcher_connect( PUSH_UPDATE, self.on_update_received ) ) @callback def on_update_received(self): """Update was pushed from the ecoent API.""" self.async_write_op_state() @property def available(self): """Return if the the device is online or not.""" return self._econet.connected @property def device_info(self): """Return device registry information for this entity.""" return { "identifiers": {(DOMAIN, self._econet.device_id)}, "manufacturer": "Rheem", "name": self._econet.device_name, } @property def name(self): """Return the name of the entity.""" return self._econet.device_name @property def unique_id(self): """Return the unique ID of the entity.""" return f"{self._econet.device_id}_{self._econet.device_name}" @property def temperature_unit(self): """Return the unit of measurement.""" return TEMP_FAHRENHEIT @property def should_poll(self) -> bool: """Return True if entity has to be polled for state. False if entity pushes its state to HA. """ return False
0.750553
0.079639
from flask_wtf import FlaskForm from wtforms import SelectField, DecimalField, StringField, TextAreaField, DateField, FileField, MultipleFileField, PasswordField, SubmitField from wtforms.validators import DataRequired, Length, Email, EqualTo persons_choices = list(range(1,13)) # From 1 to 12 people choice for i in range(0, len(persons_choices)): persons_choices[i] = (str(persons_choices[i]), str(persons_choices[i])) class SearchForm(FlaskForm): address = StringField('Posizione') start_date = DateField('Inizio Soggiorno', format='%d/%m/%Y', validators=[DataRequired()]) end_date = DateField('Fine Soggiorno', format='%d/%m/%Y', validators=[DataRequired()]) persons = SelectField('Numero di Persone', choices=persons_choices, validators=[DataRequired()]) submit = SubmitField('Cerca') class RegistrationForm(FlaskForm): name = StringField('Nome', validators=[DataRequired(), Length(min=2, max=30)]) surname = StringField('Cognome', validators=[DataRequired(), Length(min=2, max=30)]) username = StringField('Username', validators=[DataRequired(), Length(min=2, max=20)]) email = StringField('Email', validators=[DataRequired(), Length(min=2,max=40), Email()]) privilege = SelectField('Tipologia', choices=[('True', 'Proprietario'), ('False', 'Affittuario')], validators=[DataRequired()]) birth_date = DateField('Data di nascita', format='%d/%m/%Y') password = PasswordField('Password', validators=[DataRequired(), Length(min=5,max=20)]) confirm_password = PasswordField('<PASSWORD>', validators=[DataRequired(), EqualTo('password')]) register = SubmitField('Registrati') class LoginForm(FlaskForm): username_email = StringField('Username/Email', validators=[DataRequired(), Length(min=2,max=40)]) password = PasswordField('Password', validators=[DataRequired(), Length(min=5,max=20)]) login = SubmitField('Accedi') class ProfilePictureForm(FlaskForm): image = FileField() class AddRoomForm(FlaskForm): name = StringField('Nome', validators=[DataRequired(), Length(min=5, max=20)]) description = TextAreaField('Descrizione opzionale') address = StringField('Posizione', validators=[DataRequired()]) available_from = DateField('Inizio disponibilità', format='%d/%m/%Y') available_to = DateField('Fine disponibilità', format='%d/%m/%Y') price = DecimalField('Prezzo', validators=[DataRequired()]) max_persons = SelectField('Numero massimo di Persone', choices=persons_choices, validators=[DataRequired()]) pictures = MultipleFileField('Immagini della stanza') submit = SubmitField('Aggiungi stanza') class PrenotationForm(FlaskForm): start_date = DateField('Inizio prenotazione', format='%d/%m/%Y', validators=[DataRequired()]) end_date = DateField('Fine prenotazione', format='%d/%m/%Y', validators=[DataRequired()]) persons = SelectField('Numero di Persone', choices=persons_choices, validators=[DataRequired()]) submit = SubmitField('Prenota')
ecommerce/forms.py
from flask_wtf import FlaskForm from wtforms import SelectField, DecimalField, StringField, TextAreaField, DateField, FileField, MultipleFileField, PasswordField, SubmitField from wtforms.validators import DataRequired, Length, Email, EqualTo persons_choices = list(range(1,13)) # From 1 to 12 people choice for i in range(0, len(persons_choices)): persons_choices[i] = (str(persons_choices[i]), str(persons_choices[i])) class SearchForm(FlaskForm): address = StringField('Posizione') start_date = DateField('Inizio Soggiorno', format='%d/%m/%Y', validators=[DataRequired()]) end_date = DateField('Fine Soggiorno', format='%d/%m/%Y', validators=[DataRequired()]) persons = SelectField('Numero di Persone', choices=persons_choices, validators=[DataRequired()]) submit = SubmitField('Cerca') class RegistrationForm(FlaskForm): name = StringField('Nome', validators=[DataRequired(), Length(min=2, max=30)]) surname = StringField('Cognome', validators=[DataRequired(), Length(min=2, max=30)]) username = StringField('Username', validators=[DataRequired(), Length(min=2, max=20)]) email = StringField('Email', validators=[DataRequired(), Length(min=2,max=40), Email()]) privilege = SelectField('Tipologia', choices=[('True', 'Proprietario'), ('False', 'Affittuario')], validators=[DataRequired()]) birth_date = DateField('Data di nascita', format='%d/%m/%Y') password = PasswordField('Password', validators=[DataRequired(), Length(min=5,max=20)]) confirm_password = PasswordField('<PASSWORD>', validators=[DataRequired(), EqualTo('password')]) register = SubmitField('Registrati') class LoginForm(FlaskForm): username_email = StringField('Username/Email', validators=[DataRequired(), Length(min=2,max=40)]) password = PasswordField('Password', validators=[DataRequired(), Length(min=5,max=20)]) login = SubmitField('Accedi') class ProfilePictureForm(FlaskForm): image = FileField() class AddRoomForm(FlaskForm): name = StringField('Nome', validators=[DataRequired(), Length(min=5, max=20)]) description = TextAreaField('Descrizione opzionale') address = StringField('Posizione', validators=[DataRequired()]) available_from = DateField('Inizio disponibilità', format='%d/%m/%Y') available_to = DateField('Fine disponibilità', format='%d/%m/%Y') price = DecimalField('Prezzo', validators=[DataRequired()]) max_persons = SelectField('Numero massimo di Persone', choices=persons_choices, validators=[DataRequired()]) pictures = MultipleFileField('Immagini della stanza') submit = SubmitField('Aggiungi stanza') class PrenotationForm(FlaskForm): start_date = DateField('Inizio prenotazione', format='%d/%m/%Y', validators=[DataRequired()]) end_date = DateField('Fine prenotazione', format='%d/%m/%Y', validators=[DataRequired()]) persons = SelectField('Numero di Persone', choices=persons_choices, validators=[DataRequired()]) submit = SubmitField('Prenota')
0.358129
0.199639
import ctypes from numpy.ctypeslib import ndpointer import os import time def getMatching_fast(numNodes,nodes1, nodes2, weights): numEdges=len(nodes1); PMlib=ctypes.CDLL("%s/PMlib.so"%"/".join((os.path.realpath(__file__)).split("/")[:-1])) PMlib.pyMatching.argtypes = [ctypes.c_int,ctypes.c_int,ctypes.POINTER(ctypes.c_int),ctypes.POINTER(ctypes.c_int),ctypes.POINTER(ctypes.c_int)] PMlib.pyMatching.restype = ndpointer(dtype=ctypes.c_int, shape=(numNodes,)) # initialize ctypes array and fill with edge data n1=(ctypes.c_int*numEdges)(); n2=(ctypes.c_int*numEdges)(); w=(ctypes.c_int*numEdges)(); for i in range(numEdges): n1[i],n2[i],w[i]=nodes1[i],nodes2[i],weights[i] result=PMlib.pyMatching(ctypes.c_int(numNodes),ctypes.c_int(numEdges),n1,n2,w) return result def getMatching(numNodes,graphArray): mtime0 = time.time() numEdges=len(graphArray); PMlib=ctypes.CDLL("%s/PMlib.so"%"/".join((os.path.realpath(__file__)).split("/")[:-1])) PMlib.pyMatching.argtypes = [ctypes.c_int,ctypes.c_int,ctypes.POINTER(ctypes.c_int),ctypes.POINTER(ctypes.c_int),ctypes.POINTER(ctypes.c_int)] PMlib.pyMatching.restype = ndpointer(dtype=ctypes.c_int, shape=(numNodes,)) # initialize ctypes array and fill with edge data nodes1=(ctypes.c_int*numEdges)(); nodes2=(ctypes.c_int*numEdges)(); weights=(ctypes.c_int*numEdges)(); #c_int_array = ctypes.c_int*numEdges # nodes1 = c_int_array(*[graphArray[i][0] for i in range(numEdges)]) for i in range(numEdges): nodes1[i]=graphArray[i][0] nodes2[i]=graphArray[i][1] weights[i]=graphArray[i][2] # mtime1 = time.time() # print "matching overhead = ", mtime1-mtime0 result=PMlib.pyMatching(ctypes.c_int(numNodes),ctypes.c_int(numEdges),nodes1,nodes2,weights) # mtime2 = time.time() # print "matching time = ",mtime2 - mtime1 return result # pyInterface.o # example.o # misc.o # PMduals.o # PMexpand.o # PMinit.o # PMinterface.o # PMmain.o # PMrepair.o # PMshrink.o # MinCost/MinCost.o # GEOM/GPMinit.o # GEOM/GPMinterface.o # GEOM/GPMkdtree.o # GEOM/GPMmain.o #compile all these files as: # g++ -c -fPIC filename.cpp -lrt # then compile all .o files into a shared library # g++ -shared filename1.o filename2.o .... -o PMlib.so -lrt # NOTE: the -lrt must come AFTER the filename
project/CodePy2/extra/blossom5/pyMatch.py
import ctypes from numpy.ctypeslib import ndpointer import os import time def getMatching_fast(numNodes,nodes1, nodes2, weights): numEdges=len(nodes1); PMlib=ctypes.CDLL("%s/PMlib.so"%"/".join((os.path.realpath(__file__)).split("/")[:-1])) PMlib.pyMatching.argtypes = [ctypes.c_int,ctypes.c_int,ctypes.POINTER(ctypes.c_int),ctypes.POINTER(ctypes.c_int),ctypes.POINTER(ctypes.c_int)] PMlib.pyMatching.restype = ndpointer(dtype=ctypes.c_int, shape=(numNodes,)) # initialize ctypes array and fill with edge data n1=(ctypes.c_int*numEdges)(); n2=(ctypes.c_int*numEdges)(); w=(ctypes.c_int*numEdges)(); for i in range(numEdges): n1[i],n2[i],w[i]=nodes1[i],nodes2[i],weights[i] result=PMlib.pyMatching(ctypes.c_int(numNodes),ctypes.c_int(numEdges),n1,n2,w) return result def getMatching(numNodes,graphArray): mtime0 = time.time() numEdges=len(graphArray); PMlib=ctypes.CDLL("%s/PMlib.so"%"/".join((os.path.realpath(__file__)).split("/")[:-1])) PMlib.pyMatching.argtypes = [ctypes.c_int,ctypes.c_int,ctypes.POINTER(ctypes.c_int),ctypes.POINTER(ctypes.c_int),ctypes.POINTER(ctypes.c_int)] PMlib.pyMatching.restype = ndpointer(dtype=ctypes.c_int, shape=(numNodes,)) # initialize ctypes array and fill with edge data nodes1=(ctypes.c_int*numEdges)(); nodes2=(ctypes.c_int*numEdges)(); weights=(ctypes.c_int*numEdges)(); #c_int_array = ctypes.c_int*numEdges # nodes1 = c_int_array(*[graphArray[i][0] for i in range(numEdges)]) for i in range(numEdges): nodes1[i]=graphArray[i][0] nodes2[i]=graphArray[i][1] weights[i]=graphArray[i][2] # mtime1 = time.time() # print "matching overhead = ", mtime1-mtime0 result=PMlib.pyMatching(ctypes.c_int(numNodes),ctypes.c_int(numEdges),nodes1,nodes2,weights) # mtime2 = time.time() # print "matching time = ",mtime2 - mtime1 return result # pyInterface.o # example.o # misc.o # PMduals.o # PMexpand.o # PMinit.o # PMinterface.o # PMmain.o # PMrepair.o # PMshrink.o # MinCost/MinCost.o # GEOM/GPMinit.o # GEOM/GPMinterface.o # GEOM/GPMkdtree.o # GEOM/GPMmain.o #compile all these files as: # g++ -c -fPIC filename.cpp -lrt # then compile all .o files into a shared library # g++ -shared filename1.o filename2.o .... -o PMlib.so -lrt # NOTE: the -lrt must come AFTER the filename
0.119794
0.224013
# Export this package's modules as members: from .accelerator import * from .bandwidth_package import * from .bandwidth_package_attachment import * from .endpoint_group import * from .forwarding_rule import * from .get_accelerators import * from .get_bandwidth_packages import * from .get_endpoint_groups import * from .get_forwarding_rules import * from .get_ip_sets import * from .get_listeners import * from .ip_set import * from .listener import * from ._inputs import * from . import outputs def _register_module(): import pulumi from .. import _utilities class Module(pulumi.runtime.ResourceModule): _version = _utilities.get_semver_version() def version(self): return Module._version def construct(self, name: str, typ: str, urn: str) -> pulumi.Resource: if typ == "alicloud:ga/accelerator:Accelerator": return Accelerator(name, pulumi.ResourceOptions(urn=urn)) elif typ == "alicloud:ga/bandwidthPackage:BandwidthPackage": return BandwidthPackage(name, pulumi.ResourceOptions(urn=urn)) elif typ == "alicloud:ga/bandwidthPackageAttachment:BandwidthPackageAttachment": return BandwidthPackageAttachment(name, pulumi.ResourceOptions(urn=urn)) elif typ == "alicloud:ga/endpointGroup:EndpointGroup": return EndpointGroup(name, pulumi.ResourceOptions(urn=urn)) elif typ == "alicloud:ga/forwardingRule:ForwardingRule": return ForwardingRule(name, pulumi.ResourceOptions(urn=urn)) elif typ == "alicloud:ga/ipSet:IpSet": return IpSet(name, pulumi.ResourceOptions(urn=urn)) elif typ == "alicloud:ga/listener:Listener": return Listener(name, pulumi.ResourceOptions(urn=urn)) else: raise Exception(f"unknown resource type {typ}") _module_instance = Module() pulumi.runtime.register_resource_module("alicloud", "ga/accelerator", _module_instance) pulumi.runtime.register_resource_module("alicloud", "ga/bandwidthPackage", _module_instance) pulumi.runtime.register_resource_module("alicloud", "ga/bandwidthPackageAttachment", _module_instance) pulumi.runtime.register_resource_module("alicloud", "ga/endpointGroup", _module_instance) pulumi.runtime.register_resource_module("alicloud", "ga/forwardingRule", _module_instance) pulumi.runtime.register_resource_module("alicloud", "ga/ipSet", _module_instance) pulumi.runtime.register_resource_module("alicloud", "ga/listener", _module_instance) _register_module()
sdk/python/pulumi_alicloud/ga/__init__.py
# Export this package's modules as members: from .accelerator import * from .bandwidth_package import * from .bandwidth_package_attachment import * from .endpoint_group import * from .forwarding_rule import * from .get_accelerators import * from .get_bandwidth_packages import * from .get_endpoint_groups import * from .get_forwarding_rules import * from .get_ip_sets import * from .get_listeners import * from .ip_set import * from .listener import * from ._inputs import * from . import outputs def _register_module(): import pulumi from .. import _utilities class Module(pulumi.runtime.ResourceModule): _version = _utilities.get_semver_version() def version(self): return Module._version def construct(self, name: str, typ: str, urn: str) -> pulumi.Resource: if typ == "alicloud:ga/accelerator:Accelerator": return Accelerator(name, pulumi.ResourceOptions(urn=urn)) elif typ == "alicloud:ga/bandwidthPackage:BandwidthPackage": return BandwidthPackage(name, pulumi.ResourceOptions(urn=urn)) elif typ == "alicloud:ga/bandwidthPackageAttachment:BandwidthPackageAttachment": return BandwidthPackageAttachment(name, pulumi.ResourceOptions(urn=urn)) elif typ == "alicloud:ga/endpointGroup:EndpointGroup": return EndpointGroup(name, pulumi.ResourceOptions(urn=urn)) elif typ == "alicloud:ga/forwardingRule:ForwardingRule": return ForwardingRule(name, pulumi.ResourceOptions(urn=urn)) elif typ == "alicloud:ga/ipSet:IpSet": return IpSet(name, pulumi.ResourceOptions(urn=urn)) elif typ == "alicloud:ga/listener:Listener": return Listener(name, pulumi.ResourceOptions(urn=urn)) else: raise Exception(f"unknown resource type {typ}") _module_instance = Module() pulumi.runtime.register_resource_module("alicloud", "ga/accelerator", _module_instance) pulumi.runtime.register_resource_module("alicloud", "ga/bandwidthPackage", _module_instance) pulumi.runtime.register_resource_module("alicloud", "ga/bandwidthPackageAttachment", _module_instance) pulumi.runtime.register_resource_module("alicloud", "ga/endpointGroup", _module_instance) pulumi.runtime.register_resource_module("alicloud", "ga/forwardingRule", _module_instance) pulumi.runtime.register_resource_module("alicloud", "ga/ipSet", _module_instance) pulumi.runtime.register_resource_module("alicloud", "ga/listener", _module_instance) _register_module()
0.315841
0.066025
from datetime import datetime from graph import Graph class NearestNeighbour: def __init__(self, start, graph): ''' Solution of shortest path problem using nearest neighbour algorithm ''' self.start = start self.graph = graph self.followedRoute = [] self.routeCost = 0 def nearest_neighbour(self, origin, neighbours): ''' Returns the nearest neighbour of a vertice origin ''' lowest_cost = float('Inf') nearest = None for neighbour in neighbours: cost = self.graph.cost(origin, neighbour) if cost < lowest_cost: lowest_cost = cost nearest = neighbour return nearest def solve(self): ''' Executes the algorithm ''' missing = list(self.graph.vertices()) # towns to be visited currentTown = self.start self.followedRoute.append(currentTown) missing.remove(currentTown) while len(missing) > 0: closest = self.nearest_neighbour(currentTown, missing) self.followedRoute.append(closest) self.routeCost += self.graph.cost(currentTown, closest) currentTown = closest missing.remove(currentTown) # remove visited town # add the last one self.followedRoute.append(self.start) self.routeCost += self.graph.cost(currentTown, self.start) def test(max_runs=5): results = [] for run in range(max_runs): print('Run:', run) graph = Graph('data/test.json') solution = NearestNeighbour('0', graph) start_time = datetime.now() solution.solve() end_time = datetime.now() elapsed_time = end_time - start_time print("Elapsed Time:", str(elapsed_time), "ms") print("Cost:", solution.routeCost) print("Path:", solution.followedRoute) results.append([elapsed_time, solution]) return results test()
src/nearest_neighbour.py
from datetime import datetime from graph import Graph class NearestNeighbour: def __init__(self, start, graph): ''' Solution of shortest path problem using nearest neighbour algorithm ''' self.start = start self.graph = graph self.followedRoute = [] self.routeCost = 0 def nearest_neighbour(self, origin, neighbours): ''' Returns the nearest neighbour of a vertice origin ''' lowest_cost = float('Inf') nearest = None for neighbour in neighbours: cost = self.graph.cost(origin, neighbour) if cost < lowest_cost: lowest_cost = cost nearest = neighbour return nearest def solve(self): ''' Executes the algorithm ''' missing = list(self.graph.vertices()) # towns to be visited currentTown = self.start self.followedRoute.append(currentTown) missing.remove(currentTown) while len(missing) > 0: closest = self.nearest_neighbour(currentTown, missing) self.followedRoute.append(closest) self.routeCost += self.graph.cost(currentTown, closest) currentTown = closest missing.remove(currentTown) # remove visited town # add the last one self.followedRoute.append(self.start) self.routeCost += self.graph.cost(currentTown, self.start) def test(max_runs=5): results = [] for run in range(max_runs): print('Run:', run) graph = Graph('data/test.json') solution = NearestNeighbour('0', graph) start_time = datetime.now() solution.solve() end_time = datetime.now() elapsed_time = end_time - start_time print("Elapsed Time:", str(elapsed_time), "ms") print("Cost:", solution.routeCost) print("Path:", solution.followedRoute) results.append([elapsed_time, solution]) return results test()
0.805594
0.495545
from __future__ import unicode_literals """Convienent utilities.""" # ## Imports import sys from codecs import iterencode from inspect import isfunction, isclass from operator import methodcaller from collections import deque, namedtuple from collections.abc import Sized, Iterable from pkg_resources import iter_entry_points from xml.sax.saxutils import quoteattr try: # pragma: no cover from html.parser import HTMLParser except ImportError: # pragma: no cover from HTMLParser import HTMLParser # ## Python Cross-Compatibility # # These allow us to detect relevant version differences for code generation, and overcome some of the minor # differences in labels between Python 2 and Python 3 compatible runtimes. # # The differences, in practice, are minor, and are easily overcome through a small block of version-dependant # code. Handily, even built-in labels are not sacrosanct; they can be easily assigned to and re-mapped. # try: # Python 2 from types import StringTypes as stringy try: from cStringIO import StringIO except: # pragma: no cover from StringIO import StringIO # This never really happens. Still, nice to be defensive. bytes = str str = unicode py = 2 reduce = reduce except: # Python 3 from io import StringIO stringy = str bytes = bytes str = str py = 3 # There are some additional complications for the Pypy runtime. try: from sys import pypy_version_info pypy = True except ImportError: pypy = False # ## Type Definitions # A tuple representing a single step of fancy iteration. Iteration = namedtuple('Iteration', ['first', 'last', 'index', 'total', 'value']) # ## Simple Utility Functions def stream(input, encoding=None, errors='strict'): """Safely iterate a template generator, ignoring ``None`` values and optionally stream encoding. Used internally by ``cinje.flatten``, this allows for easy use of a template generator as a WSGI body. """ input = (i for i in input if i) # Omits `None` (empty wrappers) and empty chunks. if encoding: # Automatically, and iteratively, encode the text if requested. input = iterencode(input, encoding, errors=errors) return input def flatten(input, file=None, encoding=None, errors='strict'): """Return a flattened representation of a cinje chunk stream. This has several modes of operation. If no `file` argument is given, output will be returned as a string. The type of string will be determined by the presence of an `encoding`; if one is given the returned value is a binary string, otherwise the native unicode representation. If a `file` is present, chunks will be written iteratively through repeated calls to `file.write()`, and the amount of data (characters or bytes) written returned. The type of string written will be determined by `encoding`, just as the return value is when not writing to a file-like object. The `errors` argument is passed through when encoding. We can highly recommend using the various stremaing IO containers available in the [`io`](https://docs.python.org/3/library/io.html) module, though [`tempfile`](https://docs.python.org/3/library/tempfile.html) classes are also quite useful. """ input = stream(input, encoding, errors) if file is None: # Exit early if we're not writing to a file. return b''.join(input) if encoding else ''.join(input) counter = 0 for chunk in input: file.write(chunk) counter += len(chunk) return counter def fragment(string, name="anonymous", **context): """Translate a template fragment into a callable function. **Note:** Use of this function is discouraged everywhere except tests, as no caching is implemented at this time. Only one function may be declared, either manually, or automatically. If automatic defintition is chosen the resulting function takes no arguments. Additional keyword arguments are passed through as global variables. """ if isinstance(string, bytes): string = string.decode('utf-8') if ": def" in string or ":def" in string: code = string.encode('utf8').decode('cinje') name = None else: code = ": def {name}\n\n{string}".format( name = name, string = string, ).encode('utf8').decode('cinje') environ = dict(context) exec(code, environ) if name is None: # We need to dig it out of the `__tmpl__` list. if __debug__ and not environ.get('__tmpl__', None): raise RuntimeError("Template fragment does not contain a function: " + repr(environ.get('__tmpl__', None)) + \ "\n\n" + code) return environ[environ['__tmpl__'][-1]] # Super secret sauce: you _can_ define more than one function... return environ[name] def interruptable(iterable): """Allow easy catching of a generator interrupting operation when using "yield from".""" for i in iterable: if i is None: return yield i def iterate(obj): """Loop over an iterable and track progress, including first and last state. On each iteration yield an Iteration named tuple with the first and last flags, current element index, total iterable length (if possible to acquire), and value, in that order. for iteration in iterate(something): iteration.value # Do something. You can unpack these safely: for first, last, index, total, value in iterate(something): pass If you want to unpack the values you are iterating across, you can by wrapping the nested unpacking in parenthesis: for first, last, index, total, (foo, bar, baz) in iterate(something): pass Even if the length of the iterable can't be reliably determined this function will still capture the "last" state of the final loop iteration. (Basically: this works with generators.) This process is about 10x slower than simple enumeration on CPython 3.4, so only use it where you actually need to track state. Use `enumerate()` elsewhere. """ global next, Iteration next = next Iteration = Iteration total = len(obj) if isinstance(obj, Sized) else None iterator = iter(obj) first = True last = False i = 0 try: value = next(iterator) except StopIteration: return while True: try: next_value = next(iterator) except StopIteration: last = True yield Iteration(first, last, i, total, value) if last: return value = next_value i += 1 first = False def xmlargs(_source=None, **values): from cinje.helpers import bless # Optimize by binding these names to the local scope, saving a lookup on each call. global str, Iterable, stringy str = str Iterable = Iterable stringy = stringy ejoin = " ".join parts = [] pappend = parts.append # If a data source is provided it overrides the keyword arguments which are treated as defaults. if _source: values.update(_source) for k in sorted(values): # We technically allow non-string values for keys. They're just converted to strings first. key = str(k).rstrip('_').replace('__', ':').replace('_', '-') value = values[k] # We skip empty, None, False, and other falsy values other than zero. if k[0] == '_' or (not value and (value is False or value != 0)): # False == 0, so, uh, work around that. continue if value is True: # For explicitly True values, we don't have a value for the attribute. pappend(key) continue # Non-string iterables (such as lists, sets, tuples, etc.) are treated as space-separated strings. if isinstance(value, Iterable) and not isinstance(value, stringy): value = ejoin(str(i) for i in value) pappend(key + "=" + quoteattr(str(value))) return bless(" " + ejoin(parts)) if parts else '' def chunk(line, mapping={None: 'text', '${': 'escape', '#{': 'bless', '&{': 'args', '%{': 'format', '@{': 'json'}): """Chunkify and "tag" a block of text into plain text and code sections. The first delimeter is blank to represent text sections, and keep the indexes aligned with the tags. Values are yielded in the form (tag, text). """ skipping = 0 # How many closing parenthesis will we need to skip? start = None # Starting position of current match. last = 0 i = 0 text = line.line while i < len(text): if start is not None: if text[i] == '{': skipping += 1 elif text[i] == '}': if skipping: skipping -= 1 else: yield line.clone(kind=mapping[text[start-2:start]], line=text[start:i]) start = None last = i = i + 1 continue elif text[i:i+2] in mapping: if last is not None and last != i: yield line.clone(kind=mapping[None], line=text[last:i]) last = None start = i = i + 2 continue i += 1 if last < len(text): yield line.clone(kind=mapping[None], line=text[last:]) def ensure_buffer(context, separate=True): if 'text' in context.flag or 'buffer' not in context.flag: return if separate: yield Line(0, "") yield Line(0, "_buffer = []") if not pypy: yield Line(0, "__w, __ws = _buffer.extend, _buffer.append") yield Line(0, "") context.flag.add('text') # ## Common Classes class Line(object): """A rich description for a line of input, allowing for annotation.""" __slots__ = ('number', 'line', 'scope', 'kind', 'continued') def __init__(self, number, line, scope=None, kind=None): if isinstance(line, bytes): line = line.decode('utf-8') self.number = number self.line = line self.scope = scope self.kind = kind self.continued = self.stripped.endswith('\\') if not kind: self.process() super(Line, self).__init__() def process(self): if self.stripped.startswith('#') and not self.stripped.startswith('#{'): self.kind = 'comment' elif self.stripped.startswith(':'): self.kind = 'code' self.line = self.stripped[1:].lstrip() else: self.kind = 'text' @property def stripped(self): return self.line.strip() @property def partitioned(self): prefix, _, remainder = self.stripped.partition(' ') return prefix.rstrip(), remainder.lstrip() def __repr__(self): return '{0.__class__.__name__}({0.number}, {0.kind}, "{0.stripped}")'.format(self) def __bytes__(self): return str(self).encode('utf8') def __str__(self): if self.scope is None: return self.line return '\t' * self.scope + self.line.lstrip() if py == 2: # pragma: no cover __unicode__ = __str__ __str__ = __bytes__ del __bytes__ def clone(self, **kw): values = dict( number = self.number, line = self.line, scope = self.scope, kind = self.kind, ) values.update(kw) instance = self.__class__(**values) return instance class Lines(object): """Iterate input lines of source, with the ability to push lines back.""" __slots__ = ['Line', 'source', 'buffer'] def __init__(self, input=None, Line=Line): self.Line = Line if input is None: self.source = None self.buffer = deque() elif hasattr(input, 'readlines'): self.source = list(self.Line(i + 1, j) for i, j in enumerate(input.readlines())) self.buffer = deque(self.source) else: self.source = list(self.Line(i + 1, j) for i, j in enumerate(input.split('\n'))) self.buffer = deque(self.source) super(Lines, self).__init__() @property def count(self): return len(self.buffer) def __len__(self): return self.count def __repr__(self): return 'Lines({0.count})'.format(self) def __iter__(self): return self def __next__(self): return self.next() def __str__(self): return "\n".join(str(i) for i in self) def next(self): if not self.buffer: raise StopIteration() return self.buffer.popleft() def peek(self): return self.buffer[0] if self.buffer else None def push(self, *lines): self.buffer.extendleft((i if isinstance(i, self.Line) else self.Line(self.buffer[0].number if self.buffer else 0, i)) for i in reversed(lines)) def reset(self): self.buffer = deque(self.source) def append(self, *lines): self.buffer.extend((i if isinstance(i, self.Line) else self.Line(self.buffer[-1].number if self.buffer else 0, i)) for i in lines) class Context(object): """The processing context for translating cinje source into Python source. This is the primary entry point for translation. """ __slots__ = ('input', 'scope', 'flag', '_handler', 'templates', 'handlers', 'mapping') def __init__(self, input): self.input = Lines(input.decode('utf8') if isinstance(input, bytes) else input) self.scope = 0 self.flag = set() self._handler = [] self.handlers = [] self.templates = [] self.mapping = None for translator in map(methodcaller('load'), iter_entry_points('cinje.translator')): self.handlers.append(translator) def __repr__(self): return "Context({!r}, {}, {})".format(self.input, self.scope, self.flag) def prepare(self): """Prepare the ordered list of transformers and reset context state to initial.""" self.scope = 0 self.mapping = deque([0]) self._handler = [i() for i in sorted(self.handlers, key=lambda handler: handler.priority)] @property def stream(self): """The workhorse of cinje: transform input lines and emit output lines. After constructing an instance with a set of input lines iterate this property to generate the template. """ if 'init' not in self.flag: root = True self.prepare() else: root = False # Track which lines were generated in response to which lines of source code. # The end result is that there is one entry here for every line emitted, each integer representing the source # line number that triggered it. If any lines are returned with missing line numbers, they're inferred from # the last entry already in the list. # Fun fact: this list is backwards; we optimize by using a deque and appending to the left edge. this updates # the head of a linked list; the whole thing needs to be reversed to make sense. mapping = self.mapping for line in self.input: handler = self.classify(line) if line.kind == 'code' and line.stripped == 'end': # Exit the current child scope. return assert handler, "Unable to identify handler for line; this should be impossible!" self.input.push(line) # Put it back so it can be consumed by the handler. for line in handler(self): # This re-indents the code to match, if missing explicit scope. if root: mapping.appendleft(line.number or mapping[0]) # Track source line number. if line.scope is None: line = line.clone(scope=self.scope) yield line def classify(self, line): """Identify the correct handler for a given line of input.""" for handler in self._handler: if handler.match(self, line): return handler class Pipe(object): """An object representing a pipe-able callable, optionally with preserved arguments. Using this you can custruct custom subclasses (define a method named "callable") or use it as a decorator: @Pipe def s(text): return str(text) """ __slots__ = ('callable', 'args', 'kwargs') def __init__(self, callable, *args, **kw): super(Pipe, self).__init__() self.callable = callable self.args = args if args else () self.kwargs = kw if kw else {} def __repr__(self): return "Pipe({self.callable!r}{0}{1})".format( (', ' + ', '.join(repr(i) for i in self.args)) if self.args else '', (', ' + ', '.join("{0}={1!r}".format(i, j) for i, j in self.kwargs.items())) if self.kwargs else '', self = self, ) def __ror__(self, other): """The main machinery of the Pipe, calling the chosen callable with the recorded arguments.""" return self.callable(*(self.args + (other, )), **self.kwargs) def __call__(self, *args, **kw): """Allow for the preserved args and kwargs to be updated, returning a mutated copy. This allows for usage with arguments, as in the following example: "Hello!" | encode('utf8') This also allows for easy construction of custom mutated copies for use later, a la: utf8 = encode('utf8') "Hello!" | utf8 """ return self.__class__(self.callable, *args, **kw) # ## Tag Stripper class MLStripper(HTMLParser): def __init__(self): self.reset() self.strict = False self.convert_charrefs = True self.fed = [] def handle_data(self, d): self.fed.append(d) def get_data(self): return ''.join(self.fed) def strip_tags(html): s = MLStripper() s.feed(html) return s.get_data()
cinje/util.py
from __future__ import unicode_literals """Convienent utilities.""" # ## Imports import sys from codecs import iterencode from inspect import isfunction, isclass from operator import methodcaller from collections import deque, namedtuple from collections.abc import Sized, Iterable from pkg_resources import iter_entry_points from xml.sax.saxutils import quoteattr try: # pragma: no cover from html.parser import HTMLParser except ImportError: # pragma: no cover from HTMLParser import HTMLParser # ## Python Cross-Compatibility # # These allow us to detect relevant version differences for code generation, and overcome some of the minor # differences in labels between Python 2 and Python 3 compatible runtimes. # # The differences, in practice, are minor, and are easily overcome through a small block of version-dependant # code. Handily, even built-in labels are not sacrosanct; they can be easily assigned to and re-mapped. # try: # Python 2 from types import StringTypes as stringy try: from cStringIO import StringIO except: # pragma: no cover from StringIO import StringIO # This never really happens. Still, nice to be defensive. bytes = str str = unicode py = 2 reduce = reduce except: # Python 3 from io import StringIO stringy = str bytes = bytes str = str py = 3 # There are some additional complications for the Pypy runtime. try: from sys import pypy_version_info pypy = True except ImportError: pypy = False # ## Type Definitions # A tuple representing a single step of fancy iteration. Iteration = namedtuple('Iteration', ['first', 'last', 'index', 'total', 'value']) # ## Simple Utility Functions def stream(input, encoding=None, errors='strict'): """Safely iterate a template generator, ignoring ``None`` values and optionally stream encoding. Used internally by ``cinje.flatten``, this allows for easy use of a template generator as a WSGI body. """ input = (i for i in input if i) # Omits `None` (empty wrappers) and empty chunks. if encoding: # Automatically, and iteratively, encode the text if requested. input = iterencode(input, encoding, errors=errors) return input def flatten(input, file=None, encoding=None, errors='strict'): """Return a flattened representation of a cinje chunk stream. This has several modes of operation. If no `file` argument is given, output will be returned as a string. The type of string will be determined by the presence of an `encoding`; if one is given the returned value is a binary string, otherwise the native unicode representation. If a `file` is present, chunks will be written iteratively through repeated calls to `file.write()`, and the amount of data (characters or bytes) written returned. The type of string written will be determined by `encoding`, just as the return value is when not writing to a file-like object. The `errors` argument is passed through when encoding. We can highly recommend using the various stremaing IO containers available in the [`io`](https://docs.python.org/3/library/io.html) module, though [`tempfile`](https://docs.python.org/3/library/tempfile.html) classes are also quite useful. """ input = stream(input, encoding, errors) if file is None: # Exit early if we're not writing to a file. return b''.join(input) if encoding else ''.join(input) counter = 0 for chunk in input: file.write(chunk) counter += len(chunk) return counter def fragment(string, name="anonymous", **context): """Translate a template fragment into a callable function. **Note:** Use of this function is discouraged everywhere except tests, as no caching is implemented at this time. Only one function may be declared, either manually, or automatically. If automatic defintition is chosen the resulting function takes no arguments. Additional keyword arguments are passed through as global variables. """ if isinstance(string, bytes): string = string.decode('utf-8') if ": def" in string or ":def" in string: code = string.encode('utf8').decode('cinje') name = None else: code = ": def {name}\n\n{string}".format( name = name, string = string, ).encode('utf8').decode('cinje') environ = dict(context) exec(code, environ) if name is None: # We need to dig it out of the `__tmpl__` list. if __debug__ and not environ.get('__tmpl__', None): raise RuntimeError("Template fragment does not contain a function: " + repr(environ.get('__tmpl__', None)) + \ "\n\n" + code) return environ[environ['__tmpl__'][-1]] # Super secret sauce: you _can_ define more than one function... return environ[name] def interruptable(iterable): """Allow easy catching of a generator interrupting operation when using "yield from".""" for i in iterable: if i is None: return yield i def iterate(obj): """Loop over an iterable and track progress, including first and last state. On each iteration yield an Iteration named tuple with the first and last flags, current element index, total iterable length (if possible to acquire), and value, in that order. for iteration in iterate(something): iteration.value # Do something. You can unpack these safely: for first, last, index, total, value in iterate(something): pass If you want to unpack the values you are iterating across, you can by wrapping the nested unpacking in parenthesis: for first, last, index, total, (foo, bar, baz) in iterate(something): pass Even if the length of the iterable can't be reliably determined this function will still capture the "last" state of the final loop iteration. (Basically: this works with generators.) This process is about 10x slower than simple enumeration on CPython 3.4, so only use it where you actually need to track state. Use `enumerate()` elsewhere. """ global next, Iteration next = next Iteration = Iteration total = len(obj) if isinstance(obj, Sized) else None iterator = iter(obj) first = True last = False i = 0 try: value = next(iterator) except StopIteration: return while True: try: next_value = next(iterator) except StopIteration: last = True yield Iteration(first, last, i, total, value) if last: return value = next_value i += 1 first = False def xmlargs(_source=None, **values): from cinje.helpers import bless # Optimize by binding these names to the local scope, saving a lookup on each call. global str, Iterable, stringy str = str Iterable = Iterable stringy = stringy ejoin = " ".join parts = [] pappend = parts.append # If a data source is provided it overrides the keyword arguments which are treated as defaults. if _source: values.update(_source) for k in sorted(values): # We technically allow non-string values for keys. They're just converted to strings first. key = str(k).rstrip('_').replace('__', ':').replace('_', '-') value = values[k] # We skip empty, None, False, and other falsy values other than zero. if k[0] == '_' or (not value and (value is False or value != 0)): # False == 0, so, uh, work around that. continue if value is True: # For explicitly True values, we don't have a value for the attribute. pappend(key) continue # Non-string iterables (such as lists, sets, tuples, etc.) are treated as space-separated strings. if isinstance(value, Iterable) and not isinstance(value, stringy): value = ejoin(str(i) for i in value) pappend(key + "=" + quoteattr(str(value))) return bless(" " + ejoin(parts)) if parts else '' def chunk(line, mapping={None: 'text', '${': 'escape', '#{': 'bless', '&{': 'args', '%{': 'format', '@{': 'json'}): """Chunkify and "tag" a block of text into plain text and code sections. The first delimeter is blank to represent text sections, and keep the indexes aligned with the tags. Values are yielded in the form (tag, text). """ skipping = 0 # How many closing parenthesis will we need to skip? start = None # Starting position of current match. last = 0 i = 0 text = line.line while i < len(text): if start is not None: if text[i] == '{': skipping += 1 elif text[i] == '}': if skipping: skipping -= 1 else: yield line.clone(kind=mapping[text[start-2:start]], line=text[start:i]) start = None last = i = i + 1 continue elif text[i:i+2] in mapping: if last is not None and last != i: yield line.clone(kind=mapping[None], line=text[last:i]) last = None start = i = i + 2 continue i += 1 if last < len(text): yield line.clone(kind=mapping[None], line=text[last:]) def ensure_buffer(context, separate=True): if 'text' in context.flag or 'buffer' not in context.flag: return if separate: yield Line(0, "") yield Line(0, "_buffer = []") if not pypy: yield Line(0, "__w, __ws = _buffer.extend, _buffer.append") yield Line(0, "") context.flag.add('text') # ## Common Classes class Line(object): """A rich description for a line of input, allowing for annotation.""" __slots__ = ('number', 'line', 'scope', 'kind', 'continued') def __init__(self, number, line, scope=None, kind=None): if isinstance(line, bytes): line = line.decode('utf-8') self.number = number self.line = line self.scope = scope self.kind = kind self.continued = self.stripped.endswith('\\') if not kind: self.process() super(Line, self).__init__() def process(self): if self.stripped.startswith('#') and not self.stripped.startswith('#{'): self.kind = 'comment' elif self.stripped.startswith(':'): self.kind = 'code' self.line = self.stripped[1:].lstrip() else: self.kind = 'text' @property def stripped(self): return self.line.strip() @property def partitioned(self): prefix, _, remainder = self.stripped.partition(' ') return prefix.rstrip(), remainder.lstrip() def __repr__(self): return '{0.__class__.__name__}({0.number}, {0.kind}, "{0.stripped}")'.format(self) def __bytes__(self): return str(self).encode('utf8') def __str__(self): if self.scope is None: return self.line return '\t' * self.scope + self.line.lstrip() if py == 2: # pragma: no cover __unicode__ = __str__ __str__ = __bytes__ del __bytes__ def clone(self, **kw): values = dict( number = self.number, line = self.line, scope = self.scope, kind = self.kind, ) values.update(kw) instance = self.__class__(**values) return instance class Lines(object): """Iterate input lines of source, with the ability to push lines back.""" __slots__ = ['Line', 'source', 'buffer'] def __init__(self, input=None, Line=Line): self.Line = Line if input is None: self.source = None self.buffer = deque() elif hasattr(input, 'readlines'): self.source = list(self.Line(i + 1, j) for i, j in enumerate(input.readlines())) self.buffer = deque(self.source) else: self.source = list(self.Line(i + 1, j) for i, j in enumerate(input.split('\n'))) self.buffer = deque(self.source) super(Lines, self).__init__() @property def count(self): return len(self.buffer) def __len__(self): return self.count def __repr__(self): return 'Lines({0.count})'.format(self) def __iter__(self): return self def __next__(self): return self.next() def __str__(self): return "\n".join(str(i) for i in self) def next(self): if not self.buffer: raise StopIteration() return self.buffer.popleft() def peek(self): return self.buffer[0] if self.buffer else None def push(self, *lines): self.buffer.extendleft((i if isinstance(i, self.Line) else self.Line(self.buffer[0].number if self.buffer else 0, i)) for i in reversed(lines)) def reset(self): self.buffer = deque(self.source) def append(self, *lines): self.buffer.extend((i if isinstance(i, self.Line) else self.Line(self.buffer[-1].number if self.buffer else 0, i)) for i in lines) class Context(object): """The processing context for translating cinje source into Python source. This is the primary entry point for translation. """ __slots__ = ('input', 'scope', 'flag', '_handler', 'templates', 'handlers', 'mapping') def __init__(self, input): self.input = Lines(input.decode('utf8') if isinstance(input, bytes) else input) self.scope = 0 self.flag = set() self._handler = [] self.handlers = [] self.templates = [] self.mapping = None for translator in map(methodcaller('load'), iter_entry_points('cinje.translator')): self.handlers.append(translator) def __repr__(self): return "Context({!r}, {}, {})".format(self.input, self.scope, self.flag) def prepare(self): """Prepare the ordered list of transformers and reset context state to initial.""" self.scope = 0 self.mapping = deque([0]) self._handler = [i() for i in sorted(self.handlers, key=lambda handler: handler.priority)] @property def stream(self): """The workhorse of cinje: transform input lines and emit output lines. After constructing an instance with a set of input lines iterate this property to generate the template. """ if 'init' not in self.flag: root = True self.prepare() else: root = False # Track which lines were generated in response to which lines of source code. # The end result is that there is one entry here for every line emitted, each integer representing the source # line number that triggered it. If any lines are returned with missing line numbers, they're inferred from # the last entry already in the list. # Fun fact: this list is backwards; we optimize by using a deque and appending to the left edge. this updates # the head of a linked list; the whole thing needs to be reversed to make sense. mapping = self.mapping for line in self.input: handler = self.classify(line) if line.kind == 'code' and line.stripped == 'end': # Exit the current child scope. return assert handler, "Unable to identify handler for line; this should be impossible!" self.input.push(line) # Put it back so it can be consumed by the handler. for line in handler(self): # This re-indents the code to match, if missing explicit scope. if root: mapping.appendleft(line.number or mapping[0]) # Track source line number. if line.scope is None: line = line.clone(scope=self.scope) yield line def classify(self, line): """Identify the correct handler for a given line of input.""" for handler in self._handler: if handler.match(self, line): return handler class Pipe(object): """An object representing a pipe-able callable, optionally with preserved arguments. Using this you can custruct custom subclasses (define a method named "callable") or use it as a decorator: @Pipe def s(text): return str(text) """ __slots__ = ('callable', 'args', 'kwargs') def __init__(self, callable, *args, **kw): super(Pipe, self).__init__() self.callable = callable self.args = args if args else () self.kwargs = kw if kw else {} def __repr__(self): return "Pipe({self.callable!r}{0}{1})".format( (', ' + ', '.join(repr(i) for i in self.args)) if self.args else '', (', ' + ', '.join("{0}={1!r}".format(i, j) for i, j in self.kwargs.items())) if self.kwargs else '', self = self, ) def __ror__(self, other): """The main machinery of the Pipe, calling the chosen callable with the recorded arguments.""" return self.callable(*(self.args + (other, )), **self.kwargs) def __call__(self, *args, **kw): """Allow for the preserved args and kwargs to be updated, returning a mutated copy. This allows for usage with arguments, as in the following example: "Hello!" | encode('utf8') This also allows for easy construction of custom mutated copies for use later, a la: utf8 = encode('utf8') "Hello!" | utf8 """ return self.__class__(self.callable, *args, **kw) # ## Tag Stripper class MLStripper(HTMLParser): def __init__(self): self.reset() self.strict = False self.convert_charrefs = True self.fed = [] def handle_data(self, d): self.fed.append(d) def get_data(self): return ''.join(self.fed) def strip_tags(html): s = MLStripper() s.feed(html) return s.get_data()
0.585694
0.291312
import hashlib import base64 from glados.models import TinyURL from elasticsearch_dsl import Search from django.http import JsonResponse from datetime import datetime, timedelta, timezone from glados.usage_statistics import glados_server_statistics from glados.models import ESTinyURLUsageRecord from glados.es_connection import DATA_CONNECTION, MONITORING_CONNECTION DAYS_TO_LIVE = 7 def process_shorten_url_request(request): if request.method == "POST": long_url = request.POST.get('long_url', '') short_url, expiration_str = shorten_url(long_url) resp_data = { 'hash': short_url, 'expires': expiration_str } return JsonResponse(resp_data) else: return JsonResponse({'error': 'this is only available via POST'}) def process_extend_url_request(request, hash): long_url, expiration_str = get_original_url(hash) resp_data = { 'long_url': long_url, 'expiration_date': expiration_str } return JsonResponse(resp_data) # given a long url, it shortens it and saves it in elastic, it returns the hash obtained def shorten_url(long_url): hex_digest = hashlib.md5(long_url.encode('utf-8')).digest() # replace / and + to avoid routing problems url_hash = base64.b64encode(hex_digest).decode('utf-8').replace('/', '_').replace('+', '-') # save this in elastic if it doesn't exist s = Search(index='chembl_glados_tiny_url')\ .extra(track_total_hits=True).using(DATA_CONNECTION).filter('query_string', query='"' + url_hash + '"') response = s.execute() if response.hits.total.value == 0: dt = datetime.now() td = timedelta(days=DAYS_TO_LIVE) expiration_date = dt + td expires = expiration_date.timestamp() * 1000 tinyURL = TinyURL(long_url=long_url, hash=url_hash, expires=expires) tinyURL.indexing() expiration_date_str = expiration_date.replace(tzinfo=timezone.utc).isoformat() else: try: expires = response.hits[0].expires expiration_date = datetime.utcfromtimestamp(expires / 1000) expiration_date_str = expiration_date.replace(tzinfo=timezone.utc).isoformat() except AttributeError: expiration_date_str = 'Never' glados_server_statistics.record_tiny_url_usage(ESTinyURLUsageRecord.URL_SHORTENED) return url_hash, expiration_date_str def get_original_url(url_hash): # look here in elastic s = Search(index='chembl_glados_tiny_url')\ .extra(track_total_hits=True).using(DATA_CONNECTION).filter('query_string', query='"' + url_hash + '"') response = s.execute(ignore_cache=True) if response.hits.total.value == 0: return None, None try: expires = response.hits[0].expires expiration_date = datetime.utcfromtimestamp(expires / 1000) now = datetime.now() expired = now > expiration_date if expired: return None, None else: url = response.hits[0].long_url glados_server_statistics.record_tiny_url_usage(ESTinyURLUsageRecord.URL_EXPANDED) expiration_date_str = expiration_date.replace(tzinfo=timezone.utc).isoformat() return url, expiration_date_str except AttributeError: # no expiration time means that it never expires url = response.hits[0].long_url glados_server_statistics.record_tiny_url_usage(ESTinyURLUsageRecord.URL_EXPANDED) return url, None
src/glados/api/chembl/url_shortening/url_shortener.py
import hashlib import base64 from glados.models import TinyURL from elasticsearch_dsl import Search from django.http import JsonResponse from datetime import datetime, timedelta, timezone from glados.usage_statistics import glados_server_statistics from glados.models import ESTinyURLUsageRecord from glados.es_connection import DATA_CONNECTION, MONITORING_CONNECTION DAYS_TO_LIVE = 7 def process_shorten_url_request(request): if request.method == "POST": long_url = request.POST.get('long_url', '') short_url, expiration_str = shorten_url(long_url) resp_data = { 'hash': short_url, 'expires': expiration_str } return JsonResponse(resp_data) else: return JsonResponse({'error': 'this is only available via POST'}) def process_extend_url_request(request, hash): long_url, expiration_str = get_original_url(hash) resp_data = { 'long_url': long_url, 'expiration_date': expiration_str } return JsonResponse(resp_data) # given a long url, it shortens it and saves it in elastic, it returns the hash obtained def shorten_url(long_url): hex_digest = hashlib.md5(long_url.encode('utf-8')).digest() # replace / and + to avoid routing problems url_hash = base64.b64encode(hex_digest).decode('utf-8').replace('/', '_').replace('+', '-') # save this in elastic if it doesn't exist s = Search(index='chembl_glados_tiny_url')\ .extra(track_total_hits=True).using(DATA_CONNECTION).filter('query_string', query='"' + url_hash + '"') response = s.execute() if response.hits.total.value == 0: dt = datetime.now() td = timedelta(days=DAYS_TO_LIVE) expiration_date = dt + td expires = expiration_date.timestamp() * 1000 tinyURL = TinyURL(long_url=long_url, hash=url_hash, expires=expires) tinyURL.indexing() expiration_date_str = expiration_date.replace(tzinfo=timezone.utc).isoformat() else: try: expires = response.hits[0].expires expiration_date = datetime.utcfromtimestamp(expires / 1000) expiration_date_str = expiration_date.replace(tzinfo=timezone.utc).isoformat() except AttributeError: expiration_date_str = 'Never' glados_server_statistics.record_tiny_url_usage(ESTinyURLUsageRecord.URL_SHORTENED) return url_hash, expiration_date_str def get_original_url(url_hash): # look here in elastic s = Search(index='chembl_glados_tiny_url')\ .extra(track_total_hits=True).using(DATA_CONNECTION).filter('query_string', query='"' + url_hash + '"') response = s.execute(ignore_cache=True) if response.hits.total.value == 0: return None, None try: expires = response.hits[0].expires expiration_date = datetime.utcfromtimestamp(expires / 1000) now = datetime.now() expired = now > expiration_date if expired: return None, None else: url = response.hits[0].long_url glados_server_statistics.record_tiny_url_usage(ESTinyURLUsageRecord.URL_EXPANDED) expiration_date_str = expiration_date.replace(tzinfo=timezone.utc).isoformat() return url, expiration_date_str except AttributeError: # no expiration time means that it never expires url = response.hits[0].long_url glados_server_statistics.record_tiny_url_usage(ESTinyURLUsageRecord.URL_EXPANDED) return url, None
0.464416
0.101857
from __future__ import absolute_import, print_function, division from uuid import uuid4 from random import Random from itertools import product from .hive import Hive from .flower import Flower from .game_state import rngs, GameState from hiveminder._util import even_q_in_range as in_range class SynchronousExecutor(object): def __init__(self, max_workers=None): pass def map(self, func, *iterables, **kwargs): return map(func, *iterables) def make_hives(n, board_width, board_height, rng): all_possible_sites = list(product(range(1, board_width - 1), range(1, board_height - 1))) return tuple(Hive(*site) for site in rng.sample(all_possible_sites, n)) def make_flowers(n, hives, board_width, board_height, rng, game_params): all_tiles = set(product(range(1, board_width - 1), range(1, board_height - 1))) reachable_tiles = set() occupied_tiles = set() radius = min(game_params.initial_energy // 2, max(board_width, board_height)) for hive in hives: occupied_tiles = occupied_tiles | set(in_range(hive.x, hive.y, 1)) reachable_tiles = reachable_tiles | set(in_range(hive.x, hive.y, radius)) all_possible_sites = all_tiles & (reachable_tiles - occupied_tiles) return tuple(Flower(*site, game_params=game_params, expires=game_params.flower_lifespan) for site in rng.sample(all_possible_sites, n)) def initialise_game(game_params, boards, board_width, board_height, num_hives, num_flowers, game_length, seed=None): game_id = str(uuid4()) rng = Random(seed) rngs[game_id] = rng hives = [make_hives(num_hives, board_width, board_height, rng) for _ in range(boards)] flowers = [make_flowers(num_flowers, board_hives, board_width, board_height, rng, game_params) for board_hives in hives] return GameState(game_params=game_params, game_id=game_id, boards=boards, board_width=board_width, board_height=board_height, hives=hives, flowers=flowers, game_length=game_length) def game(board_width, board_height, num_hives, num_flowers, game_length, algos, game_params, pool=SynchronousExecutor()): algo_names = list(algos.keys()) algos = list(algos.values()) game_state = initialise_game(game_params, len(algos), board_width=board_width, board_height=board_height, num_hives=num_hives, num_flowers=num_flowers, game_length=game_length) def prepare_algo(i, algo, board): if algo.on_start_game is not None: board_json = board.to_json() algo.on_start_game(board_json['boardWidth'], board_json['boardHeight'], board_json['hives'], board_json['flowers'], len(algos), i, game_state.game_id, game_params) list(pool.map(prepare_algo, range(len(algos)), algos, game_state.boards)) crashed = [dict(headon={}, collided={}, exhausted={}, gobbled={}, seeds={})] * len(algos) landed_bees = [{}] * len(algos) lost_volants = [{}] * len(algos) received_volants = [{}] * len(algos) while not game_state.game_over(): assert len(algos) == len(game_state.boards) assert len(algos) == len(crashed) gamestate_json = game_state.to_json() scores = [board['score'] for board in gamestate_json['boards']] print(dict(zip(algo_names, scores))) def call_algo(i, algo): return algo.fn(gamestate_json['boards'][i]['boardWidth'], gamestate_json['boards'][i]['boardHeight'], gamestate_json['boards'][i]['hives'], gamestate_json['boards'][i]['flowers'], gamestate_json['boards'][i]['inflight'], {classification: {crashed_id: crashed_item.to_json() for crashed_id, crashed_item in crashes.items()} for classification, crashes in crashed[i].items()}, {volant_id: volant.to_json() for volant_id, volant in lost_volants[i].items()}, {volant_id: volant.to_json() for volant_id, volant in received_volants[i].items()}, {bee_id: bee.to_json() for bee_id, bee in landed_bees[i].items()}, scores, i, gamestate_json['gameId'], game_state.turn_num) commands = list(pool.map(call_algo, *zip(*enumerate(algos)))) game_state, crashed, landed_bees, lost_volants, received_volants = game_state.turn(commands) scores = [board['score'] for board in gamestate_json['boards']] print_game_result(game_state, algo_names) def farewell_algo(i, algo, board): if algo.on_game_over is not None: board_json = board.to_json() algo.on_game_over(board_json['boardWidth'], board_json['boardHeight'], board_json['hives'], board_json['flowers'], board_json['inflight'], {classification: {crashed_id: crashed_item.to_json() for crashed_id, crashed_item in crashes.items()} for classification, crashes in crashed[i].items()}, {volant_id: volant.to_json() for volant_id, volant in lost_volants[i].items()}, {volant_id: volant.to_json() for volant_id, volant in received_volants[i].items()}, {bee_id: bee.to_json() for bee_id, bee in landed_bees[i].items()}, scores, i, game_state.game_id, game_state.turn_num) list(pool.map(farewell_algo, range(len(algos)), algos, game_state.boards)) return game_state def print_game_result(game_state, algo_names): winners = calculate_winner(game_state) if len(winners) == 1: print_single_winner(game_state, winners[0], algo_names) else: print_multiple_winners(game_state, winners, algo_names) def calculate_winner(game_state): scores = [board.calculate_score() for board in game_state.boards] max_score = max(scores) return [i for i, score in enumerate(scores) if score == max_score] def print_single_winner(game_state, winner, algo_names): winner_name = algo_names[winner] print('Congratulations to {}! You have won!'.format(winner_name)) print_scores(game_state, algo_names) print_stats_table(game_state, algo_names) def print_multiple_winners(game_state, winners, algo_names): print('We have a tie between {}!'.format(' and '.join([algo_names[i] for i in winners]))) print_scores(game_state, algo_names) print_stats_table(game_state, algo_names) def print_scores(game_state, algo_names): print('Final scores were:') for i, player in enumerate(algo_names): print('\t{}:\t{}'.format(player.ljust(20, ' '), game_state.boards[i].calculate_score())) def print_stats_table(gamestate_json, algo_names): print ('Breakdown of scores as follows:\n') summary_tables = {algo_name: gamestate_json.boards[i].summary() for i, algo_name in enumerate(algo_names)} keys = list(summary_tables.values())[0].keys() max_key_length = max(len(k) for k in keys) col_width = 15 print('Algo Name'.ljust(max_key_length + 5, ' ') + '| ' + ' |'.join([algo_name.rjust(col_width, ' ') for algo_name in summary_tables.keys()])) print('-' * (max_key_length + 7 + (col_width + 2) * len(algo_names))) for key in keys: print(key.ljust(max_key_length + 5) + '| ' + ' |'.join([str(table[key]).rjust(col_width, ' ') for table in summary_tables.values()]))
hiveminder/game.py
from __future__ import absolute_import, print_function, division from uuid import uuid4 from random import Random from itertools import product from .hive import Hive from .flower import Flower from .game_state import rngs, GameState from hiveminder._util import even_q_in_range as in_range class SynchronousExecutor(object): def __init__(self, max_workers=None): pass def map(self, func, *iterables, **kwargs): return map(func, *iterables) def make_hives(n, board_width, board_height, rng): all_possible_sites = list(product(range(1, board_width - 1), range(1, board_height - 1))) return tuple(Hive(*site) for site in rng.sample(all_possible_sites, n)) def make_flowers(n, hives, board_width, board_height, rng, game_params): all_tiles = set(product(range(1, board_width - 1), range(1, board_height - 1))) reachable_tiles = set() occupied_tiles = set() radius = min(game_params.initial_energy // 2, max(board_width, board_height)) for hive in hives: occupied_tiles = occupied_tiles | set(in_range(hive.x, hive.y, 1)) reachable_tiles = reachable_tiles | set(in_range(hive.x, hive.y, radius)) all_possible_sites = all_tiles & (reachable_tiles - occupied_tiles) return tuple(Flower(*site, game_params=game_params, expires=game_params.flower_lifespan) for site in rng.sample(all_possible_sites, n)) def initialise_game(game_params, boards, board_width, board_height, num_hives, num_flowers, game_length, seed=None): game_id = str(uuid4()) rng = Random(seed) rngs[game_id] = rng hives = [make_hives(num_hives, board_width, board_height, rng) for _ in range(boards)] flowers = [make_flowers(num_flowers, board_hives, board_width, board_height, rng, game_params) for board_hives in hives] return GameState(game_params=game_params, game_id=game_id, boards=boards, board_width=board_width, board_height=board_height, hives=hives, flowers=flowers, game_length=game_length) def game(board_width, board_height, num_hives, num_flowers, game_length, algos, game_params, pool=SynchronousExecutor()): algo_names = list(algos.keys()) algos = list(algos.values()) game_state = initialise_game(game_params, len(algos), board_width=board_width, board_height=board_height, num_hives=num_hives, num_flowers=num_flowers, game_length=game_length) def prepare_algo(i, algo, board): if algo.on_start_game is not None: board_json = board.to_json() algo.on_start_game(board_json['boardWidth'], board_json['boardHeight'], board_json['hives'], board_json['flowers'], len(algos), i, game_state.game_id, game_params) list(pool.map(prepare_algo, range(len(algos)), algos, game_state.boards)) crashed = [dict(headon={}, collided={}, exhausted={}, gobbled={}, seeds={})] * len(algos) landed_bees = [{}] * len(algos) lost_volants = [{}] * len(algos) received_volants = [{}] * len(algos) while not game_state.game_over(): assert len(algos) == len(game_state.boards) assert len(algos) == len(crashed) gamestate_json = game_state.to_json() scores = [board['score'] for board in gamestate_json['boards']] print(dict(zip(algo_names, scores))) def call_algo(i, algo): return algo.fn(gamestate_json['boards'][i]['boardWidth'], gamestate_json['boards'][i]['boardHeight'], gamestate_json['boards'][i]['hives'], gamestate_json['boards'][i]['flowers'], gamestate_json['boards'][i]['inflight'], {classification: {crashed_id: crashed_item.to_json() for crashed_id, crashed_item in crashes.items()} for classification, crashes in crashed[i].items()}, {volant_id: volant.to_json() for volant_id, volant in lost_volants[i].items()}, {volant_id: volant.to_json() for volant_id, volant in received_volants[i].items()}, {bee_id: bee.to_json() for bee_id, bee in landed_bees[i].items()}, scores, i, gamestate_json['gameId'], game_state.turn_num) commands = list(pool.map(call_algo, *zip(*enumerate(algos)))) game_state, crashed, landed_bees, lost_volants, received_volants = game_state.turn(commands) scores = [board['score'] for board in gamestate_json['boards']] print_game_result(game_state, algo_names) def farewell_algo(i, algo, board): if algo.on_game_over is not None: board_json = board.to_json() algo.on_game_over(board_json['boardWidth'], board_json['boardHeight'], board_json['hives'], board_json['flowers'], board_json['inflight'], {classification: {crashed_id: crashed_item.to_json() for crashed_id, crashed_item in crashes.items()} for classification, crashes in crashed[i].items()}, {volant_id: volant.to_json() for volant_id, volant in lost_volants[i].items()}, {volant_id: volant.to_json() for volant_id, volant in received_volants[i].items()}, {bee_id: bee.to_json() for bee_id, bee in landed_bees[i].items()}, scores, i, game_state.game_id, game_state.turn_num) list(pool.map(farewell_algo, range(len(algos)), algos, game_state.boards)) return game_state def print_game_result(game_state, algo_names): winners = calculate_winner(game_state) if len(winners) == 1: print_single_winner(game_state, winners[0], algo_names) else: print_multiple_winners(game_state, winners, algo_names) def calculate_winner(game_state): scores = [board.calculate_score() for board in game_state.boards] max_score = max(scores) return [i for i, score in enumerate(scores) if score == max_score] def print_single_winner(game_state, winner, algo_names): winner_name = algo_names[winner] print('Congratulations to {}! You have won!'.format(winner_name)) print_scores(game_state, algo_names) print_stats_table(game_state, algo_names) def print_multiple_winners(game_state, winners, algo_names): print('We have a tie between {}!'.format(' and '.join([algo_names[i] for i in winners]))) print_scores(game_state, algo_names) print_stats_table(game_state, algo_names) def print_scores(game_state, algo_names): print('Final scores were:') for i, player in enumerate(algo_names): print('\t{}:\t{}'.format(player.ljust(20, ' '), game_state.boards[i].calculate_score())) def print_stats_table(gamestate_json, algo_names): print ('Breakdown of scores as follows:\n') summary_tables = {algo_name: gamestate_json.boards[i].summary() for i, algo_name in enumerate(algo_names)} keys = list(summary_tables.values())[0].keys() max_key_length = max(len(k) for k in keys) col_width = 15 print('Algo Name'.ljust(max_key_length + 5, ' ') + '| ' + ' |'.join([algo_name.rjust(col_width, ' ') for algo_name in summary_tables.keys()])) print('-' * (max_key_length + 7 + (col_width + 2) * len(algo_names))) for key in keys: print(key.ljust(max_key_length + 5) + '| ' + ' |'.join([str(table[key]).rjust(col_width, ' ') for table in summary_tables.values()]))
0.621771
0.250638
from typing import Any import pathlib import json import pytest from _pytest.monkeypatch import MonkeyPatch from django.utils import timezone from django.conf import settings from weather.libs.api.open_weather_map import OpenWeatherMap from weather.libs.api.request_flow_controller import RequestFlowController @pytest.fixture def country_fake_data() -> dict[str, Any]: return { 'name': 'France', 'country_code': 'FR', } @pytest.fixture def city_fake_data() -> dict[str, Any]: return { 'city_id': 123456, 'name': 'Rennes', } @pytest.fixture def ocean_fake_data() -> dict[str, Any]: return { 'name': 'Atlantic Ocean', } @pytest.fixture def location_fake_data() -> dict[str, Any]: return { 'lat': 48.10618240499252, 'lon': -1.6479917725717026, } @pytest.fixture def weather_fake_data() -> dict[str, Any]: return { 'weather_id': 123456, 'state': 'Cloudy', 'description': 'It\'s means that\'s cloudy bro.', } @pytest.fixture def measure_fake_data() -> dict[str, Any]: return { 'measure_num': 1, 'created_at': timezone.now(), 'measured_at': timezone.now(), 'tz_timestamp': -43000, 'wind_speed': 42.8, 'wind_deg': 45, 'wind_gust': 45.2, 'visibility': 1000, 'temp': 14.5, 'feels_like': 12.14, 'temp_min': 8.6, 'temp_max': 14.5, 'pressure': 10, 'humidity': 5, 'sea_level': 10, 'ground_level': 12, } @pytest.fixture def current_weather_fake_data() -> list[dict[str, Any]]: data: list[dict[str, Any]] = json.loads( ( settings.BASE_DIR / 'weather' / 'tests' / '__samples__' / 'weather_fake_data.json' ).read_text() ) return data @pytest.fixture def fake_token() -> str: return '<KEY>' @pytest.fixture def fake_owm( fake_token: str, tmp_path: pathlib.Path, monkeypatch: MonkeyPatch ) -> OpenWeatherMap: monkeypatch.setattr(settings, 'BASE_DIR', tmp_path) return OpenWeatherMap(token=fake_token, calls_per_min=4)
weather/tests/conftest.py
from typing import Any import pathlib import json import pytest from _pytest.monkeypatch import MonkeyPatch from django.utils import timezone from django.conf import settings from weather.libs.api.open_weather_map import OpenWeatherMap from weather.libs.api.request_flow_controller import RequestFlowController @pytest.fixture def country_fake_data() -> dict[str, Any]: return { 'name': 'France', 'country_code': 'FR', } @pytest.fixture def city_fake_data() -> dict[str, Any]: return { 'city_id': 123456, 'name': 'Rennes', } @pytest.fixture def ocean_fake_data() -> dict[str, Any]: return { 'name': 'Atlantic Ocean', } @pytest.fixture def location_fake_data() -> dict[str, Any]: return { 'lat': 48.10618240499252, 'lon': -1.6479917725717026, } @pytest.fixture def weather_fake_data() -> dict[str, Any]: return { 'weather_id': 123456, 'state': 'Cloudy', 'description': 'It\'s means that\'s cloudy bro.', } @pytest.fixture def measure_fake_data() -> dict[str, Any]: return { 'measure_num': 1, 'created_at': timezone.now(), 'measured_at': timezone.now(), 'tz_timestamp': -43000, 'wind_speed': 42.8, 'wind_deg': 45, 'wind_gust': 45.2, 'visibility': 1000, 'temp': 14.5, 'feels_like': 12.14, 'temp_min': 8.6, 'temp_max': 14.5, 'pressure': 10, 'humidity': 5, 'sea_level': 10, 'ground_level': 12, } @pytest.fixture def current_weather_fake_data() -> list[dict[str, Any]]: data: list[dict[str, Any]] = json.loads( ( settings.BASE_DIR / 'weather' / 'tests' / '__samples__' / 'weather_fake_data.json' ).read_text() ) return data @pytest.fixture def fake_token() -> str: return '<KEY>' @pytest.fixture def fake_owm( fake_token: str, tmp_path: pathlib.Path, monkeypatch: MonkeyPatch ) -> OpenWeatherMap: monkeypatch.setattr(settings, 'BASE_DIR', tmp_path) return OpenWeatherMap(token=fake_token, calls_per_min=4)
0.656438
0.239272
import tkinter as tk from Data import Data from EditClient import EditClient class Client(tk.Frame): def __init__(self, master=None, client_id=None): super().__init__(master) self.id = client_id self.create_table() def create_table(self): global data data = Data() data.clientById(self.id) data.contractByClient(self.id) label1 = tk.Label(self.master, text=data.client[0]["name"]) label1.grid(row=0, column=0) label2 = tk.Label(self.master, text="rg: "+data.client[0]["rg"]) label2.grid(row=1, column=0) label3 = tk.Label(self.master, text="gênero: "+data.client[0]["gender"]) label3.grid(row=2, column=0) label4 = tk.Label(self.master, text="nascimento: "+data.client[0]["born"]) label4.grid(row=3, column=0) labelframe1 = tk.LabelFrame(self.master, text="Informações adicionais") labelframe1.grid(row=0, column=1) label5 = tk.Label(labelframe1, text=data.client[0]["info"]) label5.grid() labelframe2 = tk.LabelFrame(self.master, text="Contratos") labelframe2.grid(row=4, column=0) for line in data.contract: label6 = tk.Label(labelframe2, text=data.contract[0]["name"]) label6.grid() if(data.contract[0]["price"]=="None"): label7 = tk.Label(labelframe2, text=data.contract[0]["monthly_price"]) label7.grid(row=1, column=0) else: label7 = tk.Label(labelframe2, text=data.contract[0]["price"]) label7.grid(row=1, column=0) label8 = tk.Label(labelframe2, text=data.contract[0]["start"] +\ " até " + data.contract[0]["end"]) label8.grid(row=2, column=0) button1 = tk.Button(self.master, text="Editar", command=self.edit_client) button1.grid() def edit_client(self): root = tk.Tk() edit = EditClient(master=root, id_client=data.client[0]["id"]) edit.addButtons() #root = tk.Tk() #app = Client(root, 1) #app.mainloop() #data = Data() #data.db.close()
broker-manager/Client.py
import tkinter as tk from Data import Data from EditClient import EditClient class Client(tk.Frame): def __init__(self, master=None, client_id=None): super().__init__(master) self.id = client_id self.create_table() def create_table(self): global data data = Data() data.clientById(self.id) data.contractByClient(self.id) label1 = tk.Label(self.master, text=data.client[0]["name"]) label1.grid(row=0, column=0) label2 = tk.Label(self.master, text="rg: "+data.client[0]["rg"]) label2.grid(row=1, column=0) label3 = tk.Label(self.master, text="gênero: "+data.client[0]["gender"]) label3.grid(row=2, column=0) label4 = tk.Label(self.master, text="nascimento: "+data.client[0]["born"]) label4.grid(row=3, column=0) labelframe1 = tk.LabelFrame(self.master, text="Informações adicionais") labelframe1.grid(row=0, column=1) label5 = tk.Label(labelframe1, text=data.client[0]["info"]) label5.grid() labelframe2 = tk.LabelFrame(self.master, text="Contratos") labelframe2.grid(row=4, column=0) for line in data.contract: label6 = tk.Label(labelframe2, text=data.contract[0]["name"]) label6.grid() if(data.contract[0]["price"]=="None"): label7 = tk.Label(labelframe2, text=data.contract[0]["monthly_price"]) label7.grid(row=1, column=0) else: label7 = tk.Label(labelframe2, text=data.contract[0]["price"]) label7.grid(row=1, column=0) label8 = tk.Label(labelframe2, text=data.contract[0]["start"] +\ " até " + data.contract[0]["end"]) label8.grid(row=2, column=0) button1 = tk.Button(self.master, text="Editar", command=self.edit_client) button1.grid() def edit_client(self): root = tk.Tk() edit = EditClient(master=root, id_client=data.client[0]["id"]) edit.addButtons() #root = tk.Tk() #app = Client(root, 1) #app.mainloop() #data = Data() #data.db.close()
0.169303
0.137301
import numpy as np import scipy as sp import scipy.spatial from ..point_set import PointSet from ..misc.interior_points import find_interior_points class Boundary(PointSet): """ Parent class for all "Boundaries" This class should never be used directly Always instantiate Boundaries through the child classes Methods: __init__: pre-initialization routine must be provided by child class __init2__: post-initialization routine to be called at end of child init compute_quadrature: the workhorse for this class - computes quadrature nodes and weights must be provided by child class find_interior_points: computes which points of target are interior to target or not """ def __init__(self, x=None, y=None, c=None): super(Boundary, self).__init__(x, y, c) # end __init__ function definition def find_interior_points(self, target): """ Computes interior/exterior points via cauchy sum + brute force search near to boundary, using matplotlib.path and treating the boundary as a discrete polygon for the brute force search if the boundary type has a simple way to deal with this, this method should be overwritten by the child class """ return find_interior_points(self, target) def decorate(self, decoration_name, *args, **kwargs): """ Function for calling boundary decoraters (Not sure this is necessary?) """ getattr(self, decoration_name)(args, kwargs) # Decorations shared across boundary classes def stack_normal(self): if not hasattr(self, 'normal_stacked'): self.stacked_normal = np.column_stack([self.normal_x, self.normal_y]) self.stacked_normal_T = self.stacked_normal.T self.normal_stacked = True def get_stacked_normal(self, T=True): self.stack_normal() return self.stacked_normal_T if T else self.stacked_normal def FMM_preparations(self): if not hasattr(self, 'prepared_for_FMM'): self.stack_boundary() self.stack_normal() self.prepared_for_FMM = True
pybie2d/boundaries/boundary.py
import numpy as np import scipy as sp import scipy.spatial from ..point_set import PointSet from ..misc.interior_points import find_interior_points class Boundary(PointSet): """ Parent class for all "Boundaries" This class should never be used directly Always instantiate Boundaries through the child classes Methods: __init__: pre-initialization routine must be provided by child class __init2__: post-initialization routine to be called at end of child init compute_quadrature: the workhorse for this class - computes quadrature nodes and weights must be provided by child class find_interior_points: computes which points of target are interior to target or not """ def __init__(self, x=None, y=None, c=None): super(Boundary, self).__init__(x, y, c) # end __init__ function definition def find_interior_points(self, target): """ Computes interior/exterior points via cauchy sum + brute force search near to boundary, using matplotlib.path and treating the boundary as a discrete polygon for the brute force search if the boundary type has a simple way to deal with this, this method should be overwritten by the child class """ return find_interior_points(self, target) def decorate(self, decoration_name, *args, **kwargs): """ Function for calling boundary decoraters (Not sure this is necessary?) """ getattr(self, decoration_name)(args, kwargs) # Decorations shared across boundary classes def stack_normal(self): if not hasattr(self, 'normal_stacked'): self.stacked_normal = np.column_stack([self.normal_x, self.normal_y]) self.stacked_normal_T = self.stacked_normal.T self.normal_stacked = True def get_stacked_normal(self, T=True): self.stack_normal() return self.stacked_normal_T if T else self.stacked_normal def FMM_preparations(self): if not hasattr(self, 'prepared_for_FMM'): self.stack_boundary() self.stack_normal() self.prepared_for_FMM = True
0.730866
0.356251
from __future__ import annotations from typing import Dict class BaseHoradricError(Exception): """ Base error for Horadric projects """ text_code: str = None error_template: str = None def __init_subclass__(cls, **kwargs): if cls.text_code is None: raise ValueError("`text_code` must be set") if cls.error_template is None: raise ValueError("`error_template must be set`") def __init__(self, **kwargs): """ Only kwargs because templating """ self.kwargs: dict = kwargs def __str__(self): return self.error_template.format(**self.kwargs) class BaseLogicError(BaseHoradricError): # TODO: remove checks for base errors text_code: str = "logic_error" error_template: str = "Some logic error" class BaseHttpError(BaseHoradricError): text_code: str = "http_error" error_template: str = "Some http error" code: int = 500 class NotModified(BaseHttpError): code = 304 text_code = "not_modified" error_template = "Not Modified" class BadRequestFormat(BaseHttpError): # https://developer.mozilla.org/en-US/docs/Web/HTTP/Status/415 code = 415 text_code = "bad_request_format" error_template = "Bad request mimetype: {format_}" def __init__(self, format_): # type: (str) -> None super(BadRequestFormat, self).__init__(format_=format_) class RequestParsingError(BaseHttpError): code = 400 text_code = "request_parsing_error" error_template = "Request parsing error for format: {format_}" def __init__(self, format_): # type: (str) -> None super(RequestParsingError, self).__init__(format_=format_) class BadResponseFormat(BaseHttpError): # https://developer.mozilla.org/en-US/docs/Web/HTTP/Status/406 code = 406 text_code = "bad_response_format" error_template = "Bad response format: {format_}" def __init__(self, format_): # type: (str) -> None super(BadResponseFormat, self).__init__(format_=format_) class RequestValidationError(BaseHttpError): code = 400 text_code = "request_validation_error" error_template = "Request validation errors: {errors}" def __init__(self, errors: Dict[str, str]) -> None: super(RequestValidationError, self).__init__(errors=errors)
open_horadric_lib/base/exception.py
from __future__ import annotations from typing import Dict class BaseHoradricError(Exception): """ Base error for Horadric projects """ text_code: str = None error_template: str = None def __init_subclass__(cls, **kwargs): if cls.text_code is None: raise ValueError("`text_code` must be set") if cls.error_template is None: raise ValueError("`error_template must be set`") def __init__(self, **kwargs): """ Only kwargs because templating """ self.kwargs: dict = kwargs def __str__(self): return self.error_template.format(**self.kwargs) class BaseLogicError(BaseHoradricError): # TODO: remove checks for base errors text_code: str = "logic_error" error_template: str = "Some logic error" class BaseHttpError(BaseHoradricError): text_code: str = "http_error" error_template: str = "Some http error" code: int = 500 class NotModified(BaseHttpError): code = 304 text_code = "not_modified" error_template = "Not Modified" class BadRequestFormat(BaseHttpError): # https://developer.mozilla.org/en-US/docs/Web/HTTP/Status/415 code = 415 text_code = "bad_request_format" error_template = "Bad request mimetype: {format_}" def __init__(self, format_): # type: (str) -> None super(BadRequestFormat, self).__init__(format_=format_) class RequestParsingError(BaseHttpError): code = 400 text_code = "request_parsing_error" error_template = "Request parsing error for format: {format_}" def __init__(self, format_): # type: (str) -> None super(RequestParsingError, self).__init__(format_=format_) class BadResponseFormat(BaseHttpError): # https://developer.mozilla.org/en-US/docs/Web/HTTP/Status/406 code = 406 text_code = "bad_response_format" error_template = "Bad response format: {format_}" def __init__(self, format_): # type: (str) -> None super(BadResponseFormat, self).__init__(format_=format_) class RequestValidationError(BaseHttpError): code = 400 text_code = "request_validation_error" error_template = "Request validation errors: {errors}" def __init__(self, errors: Dict[str, str]) -> None: super(RequestValidationError, self).__init__(errors=errors)
0.709019
0.095687
import telebot import socks, socket import config import time import stats_getter import image_maker import db import requests.exceptions as rqst_expts print('modules imported') bot = telebot.TeleBot(config.tg_token) # socks.setdefaultproxy(socks.PROXY_TYPE_SOCKS5, '192.168.127.12', 1080) telebot.apihelper.proxy = {'https': 'socks5h://172.16.17.32:32125'} if bot: print('bot started') else: print('bot start failed') user_list = [] lfm_username = '' period_table = {'period_week': '7day', 'period_month': '1month', 'period_3month': '3month', 'period_6month': '6month', 'period_year': '12month', 'period_overall': 'overall'} def generate_pic(username, period): top_artists = stats_getter.get_top_artist(username, period) image_report = image_maker.make_report_image_bytes(top_artists, with_frame=True) # stats_getter.save_image(image_report, 'image_report') return image_report @bot.message_handler(content_types='text') def answer(message): global user_list if not any(user['chat_id'] == message.chat.id for user in user_list): print('New chat, id: {}'.format(message.chat.id)) user_list.append({'chat_id': message.chat.id}) bot.send_message(message.chat.id, 'Привет! Введите имя пользователя с помощью команды /username') else: if '/username' in message.text and message.text.find(' ') > 0: username = message.text[message.text.find(' ')+1:len(message.text)] for user in user_list: if user.get('chat_id') == message.chat.id: print('We got user with id ({})'.format(message.chat.id)) user.update({'lastfm_username': username}) print(user) keyboard = telebot.types.InlineKeyboardMarkup() cb_period_week = telebot.types.InlineKeyboardButton(text="Неделя", callback_data="period_week") cb_period_month = telebot.types.InlineKeyboardButton(text="Месяц", callback_data="period_month") cb_period_month_three = telebot.types.InlineKeyboardButton(text="3 месяца", callback_data="period_3month") cb_period_month_six = telebot.types.InlineKeyboardButton(text="Полгода", callback_data="period_6month") cb_period_year = telebot.types.InlineKeyboardButton(text="Год", callback_data="period_year") cb_period_overall = telebot.types.InlineKeyboardButton(text="За все время", callback_data="period_overall") keyboard.add(cb_period_week, cb_period_month, cb_period_month_three, cb_period_month_six, cb_period_year, cb_period_overall) answer_msg = "Выберите период статистики:" bot.send_message(message.chat.id, answer_msg, reply_markup=keyboard) else: current_user = next(user for user in user_list if user["chat_id"] == message.chat.id) if 'lastfm_username' in current_user: answer_msg = "Вы случайно не {}? Попробуйте еще раз. Например: \n <a href='https://example.com'>This is an example</a>"\ .format(current_user['lastfm_username'], current_user['lastfm_username'], current_user['lastfm_username'], ) else: answer_msg = "Что-то не так с именем пользователя. Попробуйте еще раз. Например: \n " \ "[/username ph1l74](/username ph1l74)" bot.send_message(message.chat.id, answer_msg) @bot.callback_query_handler(func=lambda call: True) def callback_inline(call): global period_table, user_list if call.message: username = '' for user in user_list: if user.get('chat_id') == call.message.chat.id: username = user.get('lastfm_username') break period = period_table[call.data] if len(username) > 0 and period: image = generate_pic(username=username, period=period) bot.send_photo(call.message.chat.id, image) # bot.send_message(call.message.chat.id, answer_msg) else: bot.send_message(call.message.chat.id, 'Простите, но вы не ввели имя пользователя Last FM. \ Наберите команду: /username и введите имя пользователя, например: \n /username filatique') def test_db(chat_id): db.get_user_by_chat_id(db_config=config.db, tg_chat_id=chat_id) while True: try: bot.polling(none_stop="True", timeout=10) except AttributeError: print('Attribute Error') bot.polling(none_stop="True", timeout=10) except ConnectionResetError: print('Connection Reset Error. Retry in 5 secs...') time.sleep(5) bot.polling(none_stop="True", timeout=10) except ConnectionError: print('Connection Error. Retry in 5 secs...') time.sleep(5) bot.polling(none_stop="True", timeout=10) except rqst_expts.ConnectTimeout: print('Connection Timeout Error. Retry in 5 secs...') time.sleep(5) bot.polling(none_stop="True", timeout=10)
main.py
import telebot import socks, socket import config import time import stats_getter import image_maker import db import requests.exceptions as rqst_expts print('modules imported') bot = telebot.TeleBot(config.tg_token) # socks.setdefaultproxy(socks.PROXY_TYPE_SOCKS5, '192.168.127.12', 1080) telebot.apihelper.proxy = {'https': 'socks5h://172.16.17.32:32125'} if bot: print('bot started') else: print('bot start failed') user_list = [] lfm_username = '' period_table = {'period_week': '7day', 'period_month': '1month', 'period_3month': '3month', 'period_6month': '6month', 'period_year': '12month', 'period_overall': 'overall'} def generate_pic(username, period): top_artists = stats_getter.get_top_artist(username, period) image_report = image_maker.make_report_image_bytes(top_artists, with_frame=True) # stats_getter.save_image(image_report, 'image_report') return image_report @bot.message_handler(content_types='text') def answer(message): global user_list if not any(user['chat_id'] == message.chat.id for user in user_list): print('New chat, id: {}'.format(message.chat.id)) user_list.append({'chat_id': message.chat.id}) bot.send_message(message.chat.id, 'Привет! Введите имя пользователя с помощью команды /username') else: if '/username' in message.text and message.text.find(' ') > 0: username = message.text[message.text.find(' ')+1:len(message.text)] for user in user_list: if user.get('chat_id') == message.chat.id: print('We got user with id ({})'.format(message.chat.id)) user.update({'lastfm_username': username}) print(user) keyboard = telebot.types.InlineKeyboardMarkup() cb_period_week = telebot.types.InlineKeyboardButton(text="Неделя", callback_data="period_week") cb_period_month = telebot.types.InlineKeyboardButton(text="Месяц", callback_data="period_month") cb_period_month_three = telebot.types.InlineKeyboardButton(text="3 месяца", callback_data="period_3month") cb_period_month_six = telebot.types.InlineKeyboardButton(text="Полгода", callback_data="period_6month") cb_period_year = telebot.types.InlineKeyboardButton(text="Год", callback_data="period_year") cb_period_overall = telebot.types.InlineKeyboardButton(text="За все время", callback_data="period_overall") keyboard.add(cb_period_week, cb_period_month, cb_period_month_three, cb_period_month_six, cb_period_year, cb_period_overall) answer_msg = "Выберите период статистики:" bot.send_message(message.chat.id, answer_msg, reply_markup=keyboard) else: current_user = next(user for user in user_list if user["chat_id"] == message.chat.id) if 'lastfm_username' in current_user: answer_msg = "Вы случайно не {}? Попробуйте еще раз. Например: \n <a href='https://example.com'>This is an example</a>"\ .format(current_user['lastfm_username'], current_user['lastfm_username'], current_user['lastfm_username'], ) else: answer_msg = "Что-то не так с именем пользователя. Попробуйте еще раз. Например: \n " \ "[/username ph1l74](/username ph1l74)" bot.send_message(message.chat.id, answer_msg) @bot.callback_query_handler(func=lambda call: True) def callback_inline(call): global period_table, user_list if call.message: username = '' for user in user_list: if user.get('chat_id') == call.message.chat.id: username = user.get('lastfm_username') break period = period_table[call.data] if len(username) > 0 and period: image = generate_pic(username=username, period=period) bot.send_photo(call.message.chat.id, image) # bot.send_message(call.message.chat.id, answer_msg) else: bot.send_message(call.message.chat.id, 'Простите, но вы не ввели имя пользователя Last FM. \ Наберите команду: /username и введите имя пользователя, например: \n /username filatique') def test_db(chat_id): db.get_user_by_chat_id(db_config=config.db, tg_chat_id=chat_id) while True: try: bot.polling(none_stop="True", timeout=10) except AttributeError: print('Attribute Error') bot.polling(none_stop="True", timeout=10) except ConnectionResetError: print('Connection Reset Error. Retry in 5 secs...') time.sleep(5) bot.polling(none_stop="True", timeout=10) except ConnectionError: print('Connection Error. Retry in 5 secs...') time.sleep(5) bot.polling(none_stop="True", timeout=10) except rqst_expts.ConnectTimeout: print('Connection Timeout Error. Retry in 5 secs...') time.sleep(5) bot.polling(none_stop="True", timeout=10)
0.17692
0.142143
import re class ModelInflector(object): def __new__(cls, model): try: return _inflectors[cls] except KeyError: inflector = super(ModelInflector, cls).__new__(cls, model) _inflectors[model] = inflector return inflector def __init__(self, model): self.model = model register_inflections(self) def all_inflections(self): return { 'model_singular': self.model_singular, 'model_plural': self.model_plural, 'table_singular': self.table_singular, 'table_plural': self.table_plural, 'human_singular': self.human_singular, 'human_plural': self.human_plural, 'title_singular': self.title_singular, 'title_plural': self.title_plural, } @property def model_singular(self): return self.model.__name__ @property def model_plural(self): return self.title_plural.replace(' ', '') @property def table_singular(self): return self.underscore_from_camelcase(self.model_singular) @property def table_plural(self): return self.model.__tablename__ @property def human_singular(self): return self.title_singular.lower() @property def human_plural(self): return self.title_plural.lower() @property def title_singular(self): return self.titleize_from_camelcase(self.model.__name__) @property def title_plural(self): return self.model.__tablename__.replace('_', ' ').title() # Helpers @classmethod def underscore_from_camelcase(cls, s): s1 = re.sub(r'(.)([A-Z][a-z]+)', r'\1_\2', s) return re.sub(r'([a-z0-9])([A-Z])', r'\1_\2', s1).lower() @classmethod def titleize_from_camelcase(cls, s): s1 = re.sub(r'(.)([A-Z][a-z]+)', r'\1 \2', s) return re.sub(r'([a-z0-9])([A-Z])', r'\1 \2', s1) def __repr__(self): return ( 'ModelInflector({model}):\n' ' model: {model_singular} {model_plural}\n' ' table: {table_singular} {table_plural}\n' ' human: {human_singular} {human_plural}\n' ' title: {title_singular} {title_plural}\n')\ .format(model=self.model, **self.all_inflections()) class ModelInflectorDescriptor(object): cache_attribute = '_cached_inflector' def __get__(self, obj, cls): model_inflector = getattr(cls, self.cache_attribute, None) if model_inflector is None: model_inflector = ModelInflector(cls) setattr(cls, self.cache_attribute, model_inflector) return model_inflector # { <model class>: <ModelInflector()> } _inflectors = {} # { <inflection>: <model class> } _inflection_to_model = {} def register_inflections(inflector): for mode, value in inflector.all_inflections().items(): _inflection_to_model[value] = inflector.model def get_model(s): return _inflection_to_model.get(s, None)
src/ggrc/models/inflector.py
import re class ModelInflector(object): def __new__(cls, model): try: return _inflectors[cls] except KeyError: inflector = super(ModelInflector, cls).__new__(cls, model) _inflectors[model] = inflector return inflector def __init__(self, model): self.model = model register_inflections(self) def all_inflections(self): return { 'model_singular': self.model_singular, 'model_plural': self.model_plural, 'table_singular': self.table_singular, 'table_plural': self.table_plural, 'human_singular': self.human_singular, 'human_plural': self.human_plural, 'title_singular': self.title_singular, 'title_plural': self.title_plural, } @property def model_singular(self): return self.model.__name__ @property def model_plural(self): return self.title_plural.replace(' ', '') @property def table_singular(self): return self.underscore_from_camelcase(self.model_singular) @property def table_plural(self): return self.model.__tablename__ @property def human_singular(self): return self.title_singular.lower() @property def human_plural(self): return self.title_plural.lower() @property def title_singular(self): return self.titleize_from_camelcase(self.model.__name__) @property def title_plural(self): return self.model.__tablename__.replace('_', ' ').title() # Helpers @classmethod def underscore_from_camelcase(cls, s): s1 = re.sub(r'(.)([A-Z][a-z]+)', r'\1_\2', s) return re.sub(r'([a-z0-9])([A-Z])', r'\1_\2', s1).lower() @classmethod def titleize_from_camelcase(cls, s): s1 = re.sub(r'(.)([A-Z][a-z]+)', r'\1 \2', s) return re.sub(r'([a-z0-9])([A-Z])', r'\1 \2', s1) def __repr__(self): return ( 'ModelInflector({model}):\n' ' model: {model_singular} {model_plural}\n' ' table: {table_singular} {table_plural}\n' ' human: {human_singular} {human_plural}\n' ' title: {title_singular} {title_plural}\n')\ .format(model=self.model, **self.all_inflections()) class ModelInflectorDescriptor(object): cache_attribute = '_cached_inflector' def __get__(self, obj, cls): model_inflector = getattr(cls, self.cache_attribute, None) if model_inflector is None: model_inflector = ModelInflector(cls) setattr(cls, self.cache_attribute, model_inflector) return model_inflector # { <model class>: <ModelInflector()> } _inflectors = {} # { <inflection>: <model class> } _inflection_to_model = {} def register_inflections(inflector): for mode, value in inflector.all_inflections().items(): _inflection_to_model[value] = inflector.model def get_model(s): return _inflection_to_model.get(s, None)
0.575588
0.168173
import pandas as pd import numpy as np from os import path from copy import deepcopy import argparse import os parser = argparse.ArgumentParser(description="Argparser for Pytorch 3D CNN") # Mandatory arguments parser.add_argument("generalist_model_path", type=str, help="Path to the model trained on the whole data.") parser.add_argument("specialist_model_path", type=str, help="Path to the model trained on the eldest subjects.") parser.add_argument("fusion_path", type=str, help="Path to the output directory containing the fused results.") parser.add_argument("--split", type=int, default=None, nargs='+', help="Will process the list of folds wanted. Default behaviour will process all available folds " "in the generalist model directory.") def mean_fuse_results(gen_df, spe_df, age_limit=40): fusion_df = deepcopy(gen_df) for participant in gen_df.index.values: gen_age = gen_df.loc[participant, 'predicted_age'] if gen_age > age_limit: spe_age = spe_df.loc[participant, 'predicted_age'] fusion_df.loc[participant, 'predicted_age'] = (spe_age + gen_age) / 2 return fusion_df def evaluate_spearman(df): from scipy.stats import spearmanr simple_correlation, _ = spearmanr(df.true_age, df.predicted_age) difference_correlation, _ = spearmanr(df.true_age, df.predicted_age.astype(float) - df.true_age.astype(float)) return simple_correlation, difference_correlation def evaluate_age_limits(gen_df, spe_df): age_limits = np.arange(30, 89) results_df = pd.DataFrame(index=age_limits, columns=['MAE_mean', 'Spearman_mean']) for age_limit in age_limits: mean_df = mean_fuse_results(gen_df, spe_df, age_limit=age_limit) MAE = np.mean(np.abs(mean_df.predicted_age - mean_df.true_age)) _, diff_Spearman = evaluate_spearman(mean_df) results_df.loc[age_limit, 'MAE_mean'] = MAE results_df.loc[age_limit, 'Spearman_mean'] = diff_Spearman return results_df def main(options): if options.split is None: split_dirs = [split_dir for split_dir in os.listdir(options.generalist_model_path) if split_dir.split('_')[0] == "fold"] options.split = sorted([int(split_dir.split('_')[1]) for split_dir in split_dirs]) for fold in options.split: print(fold, type(fold)) gen_tv_df = pd.read_csv(path.join(options.generalist_model_path, 'fold_%i' % fold, 'performances_train', 'best_loss', 'valid_subject_level_result.tsv'), sep='\t') spe_tv_df = pd.read_csv(path.join(options.specialist_model_path, 'fold_%i' % fold, 'performances_train', 'best_loss', 'valid_subject_level_result.tsv'), sep='\t') gen_tv_df.set_index('participant_id', inplace=True) spe_tv_df.set_index('participant_id', inplace=True) results_df = evaluate_age_limits(gen_tv_df, spe_tv_df) MAE_mean = results_df.MAE_mean.astype(float) age_limit = MAE_mean.idxmin() print("Min MAE %.2f for age %i" %(MAE_mean.min(), age_limit)) gen_v_df = pd.read_csv(path.join(options.generalist_model_path, 'fold_%i' % fold, 'performances_val', 'best_loss', 'valid_subject_level_result.tsv'), sep='\t') spe_v_df = pd.read_csv(path.join(options.specialist_model_path, 'fold_%i' % fold, 'performances_val', 'best_loss', 'valid_subject_level_result.tsv'), sep='\t') gen_v_df.set_index('participant_id', inplace=True) spe_v_df.set_index('participant_id', inplace=True) fusion_df = mean_fuse_results(gen_v_df, spe_v_df, age_limit=age_limit) MAE = np.mean(np.abs(fusion_df.predicted_age - fusion_df.true_age)) _, r = evaluate_spearman(fusion_df) print("Fusion, MAE: %.2f, r: %.2f" % (MAE, r)) MAE = np.mean(np.abs(gen_v_df.predicted_age - gen_v_df.true_age)) _, r = evaluate_spearman(gen_v_df) print("Generalist, MAE: %.2f, r: %2f" % (MAE, r)) results_path = path.join(options.fusion_path, 'fold_%i' % fold, 'performances_val', 'best_loss') if not path.exists(results_path): os.makedirs(results_path) fusion_df.to_csv(path.join(results_path, 'valid_subject_level_result.tsv'), sep='\t') if __name__ == "__main__": commandline = parser.parse_known_args() options = commandline[0] if commandline[1]: print("unknown arguments: %s" % parser.parse_known_args()[1]) main(options)
src/deep/fuse_cnn6layer.py
import pandas as pd import numpy as np from os import path from copy import deepcopy import argparse import os parser = argparse.ArgumentParser(description="Argparser for Pytorch 3D CNN") # Mandatory arguments parser.add_argument("generalist_model_path", type=str, help="Path to the model trained on the whole data.") parser.add_argument("specialist_model_path", type=str, help="Path to the model trained on the eldest subjects.") parser.add_argument("fusion_path", type=str, help="Path to the output directory containing the fused results.") parser.add_argument("--split", type=int, default=None, nargs='+', help="Will process the list of folds wanted. Default behaviour will process all available folds " "in the generalist model directory.") def mean_fuse_results(gen_df, spe_df, age_limit=40): fusion_df = deepcopy(gen_df) for participant in gen_df.index.values: gen_age = gen_df.loc[participant, 'predicted_age'] if gen_age > age_limit: spe_age = spe_df.loc[participant, 'predicted_age'] fusion_df.loc[participant, 'predicted_age'] = (spe_age + gen_age) / 2 return fusion_df def evaluate_spearman(df): from scipy.stats import spearmanr simple_correlation, _ = spearmanr(df.true_age, df.predicted_age) difference_correlation, _ = spearmanr(df.true_age, df.predicted_age.astype(float) - df.true_age.astype(float)) return simple_correlation, difference_correlation def evaluate_age_limits(gen_df, spe_df): age_limits = np.arange(30, 89) results_df = pd.DataFrame(index=age_limits, columns=['MAE_mean', 'Spearman_mean']) for age_limit in age_limits: mean_df = mean_fuse_results(gen_df, spe_df, age_limit=age_limit) MAE = np.mean(np.abs(mean_df.predicted_age - mean_df.true_age)) _, diff_Spearman = evaluate_spearman(mean_df) results_df.loc[age_limit, 'MAE_mean'] = MAE results_df.loc[age_limit, 'Spearman_mean'] = diff_Spearman return results_df def main(options): if options.split is None: split_dirs = [split_dir for split_dir in os.listdir(options.generalist_model_path) if split_dir.split('_')[0] == "fold"] options.split = sorted([int(split_dir.split('_')[1]) for split_dir in split_dirs]) for fold in options.split: print(fold, type(fold)) gen_tv_df = pd.read_csv(path.join(options.generalist_model_path, 'fold_%i' % fold, 'performances_train', 'best_loss', 'valid_subject_level_result.tsv'), sep='\t') spe_tv_df = pd.read_csv(path.join(options.specialist_model_path, 'fold_%i' % fold, 'performances_train', 'best_loss', 'valid_subject_level_result.tsv'), sep='\t') gen_tv_df.set_index('participant_id', inplace=True) spe_tv_df.set_index('participant_id', inplace=True) results_df = evaluate_age_limits(gen_tv_df, spe_tv_df) MAE_mean = results_df.MAE_mean.astype(float) age_limit = MAE_mean.idxmin() print("Min MAE %.2f for age %i" %(MAE_mean.min(), age_limit)) gen_v_df = pd.read_csv(path.join(options.generalist_model_path, 'fold_%i' % fold, 'performances_val', 'best_loss', 'valid_subject_level_result.tsv'), sep='\t') spe_v_df = pd.read_csv(path.join(options.specialist_model_path, 'fold_%i' % fold, 'performances_val', 'best_loss', 'valid_subject_level_result.tsv'), sep='\t') gen_v_df.set_index('participant_id', inplace=True) spe_v_df.set_index('participant_id', inplace=True) fusion_df = mean_fuse_results(gen_v_df, spe_v_df, age_limit=age_limit) MAE = np.mean(np.abs(fusion_df.predicted_age - fusion_df.true_age)) _, r = evaluate_spearman(fusion_df) print("Fusion, MAE: %.2f, r: %.2f" % (MAE, r)) MAE = np.mean(np.abs(gen_v_df.predicted_age - gen_v_df.true_age)) _, r = evaluate_spearman(gen_v_df) print("Generalist, MAE: %.2f, r: %2f" % (MAE, r)) results_path = path.join(options.fusion_path, 'fold_%i' % fold, 'performances_val', 'best_loss') if not path.exists(results_path): os.makedirs(results_path) fusion_df.to_csv(path.join(results_path, 'valid_subject_level_result.tsv'), sep='\t') if __name__ == "__main__": commandline = parser.parse_known_args() options = commandline[0] if commandline[1]: print("unknown arguments: %s" % parser.parse_known_args()[1]) main(options)
0.604049
0.196132
from typing import Any, Dict, List, Optional, Tuple, Union, cast import kornia.augmentation as K import pytorch_lightning as pl import torch import torchvision.transforms as T from einops import rearrange from kornia.contrib import compute_padding, extract_tensor_patches from torch.utils.data import DataLoader, Dataset from torch.utils.data._utils.collate import default_collate from ..datasets import InriaAerialImageLabeling from ..samplers.utils import _to_tuple from .utils import dataset_split DEFAULT_AUGS = K.AugmentationSequential( K.RandomHorizontalFlip(p=0.5), K.RandomVerticalFlip(p=0.5), data_keys=["input", "mask"], ) def collate_wrapper(batch: List[Dict[str, Any]]) -> Dict[str, Any]: """Flatten wrapper.""" r_batch: Dict[str, Any] = default_collate(batch) # type: ignore[no-untyped-call] r_batch["image"] = torch.flatten(r_batch["image"], 0, 1) if "mask" in r_batch: r_batch["mask"] = torch.flatten(r_batch["mask"], 0, 1) return r_batch class InriaAerialImageLabelingDataModule(pl.LightningDataModule): """LightningDataModule implementation for the InriaAerialImageLabeling dataset. Uses the train/test splits from the dataset and further splits the train split into train/val splits. .. versionadded:: 0.3 """ h, w = 5000, 5000 def __init__( self, root_dir: str, batch_size: int = 32, num_workers: int = 0, val_split_pct: float = 0.1, test_split_pct: float = 0.1, patch_size: Union[int, Tuple[int, int]] = 512, num_patches_per_tile: int = 32, augmentations: K.AugmentationSequential = DEFAULT_AUGS, predict_on: str = "test", ) -> None: """Initialize a LightningDataModule for InriaAerialImageLabeling based DataLoaders. Args: root_dir: The ``root`` arugment to pass to the InriaAerialImageLabeling Dataset classes batch_size: The batch size used in the train DataLoader (val_batch_size == test_batch_size == 1) num_workers: The number of workers to use in all created DataLoaders val_split_pct: What percentage of the dataset to use as a validation set test_split_pct: What percentage of the dataset to use as a test set patch_size: Size of random patch from image and mask (height, width) num_patches_per_tile: Number of random patches per sample augmentations: Default augmentations applied predict_on: Directory/Dataset of images to run inference on """ super().__init__() # type: ignore[no-untyped-call] self.root_dir = root_dir self.batch_size = batch_size self.num_workers = num_workers self.val_split_pct = val_split_pct self.test_split_pct = test_split_pct self.patch_size = cast(Tuple[int, int], _to_tuple(patch_size)) self.num_patches_per_tile = num_patches_per_tile self.augmentations = augmentations self.predict_on = predict_on self.random_crop = K.AugmentationSequential( K.RandomCrop(self.patch_size, p=1.0, keepdim=False), data_keys=["input", "mask"], ) def patch_sample(self, sample: Dict[str, Any]) -> Dict[str, Any]: """Extract patches from single sample.""" assert sample["image"].ndim == 3 _, h, w = sample["image"].shape padding = compute_padding((h, w), self.patch_size) sample["original_shape"] = (h, w) sample["patch_shape"] = self.patch_size sample["padding"] = padding sample["image"] = extract_tensor_patches( sample["image"].unsqueeze(0), self.patch_size, self.patch_size, padding=padding, ) sample["image"] = rearrange(sample["image"], "() t c h w -> t () c h w") return sample def preprocess(self, sample: Dict[str, Any]) -> Dict[str, Any]: """Transform a single sample from the Dataset.""" # RGB is int32 so divide by 255 sample["image"] = sample["image"] / 255.0 sample["image"] = torch.clip(sample["image"], min=0.0, max=1.0) if "mask" in sample: sample["mask"] = rearrange(sample["mask"], "h w -> () h w") return sample def n_random_crop(self, sample: Dict[str, Any]) -> Dict[str, Any]: """Get n random crops.""" images, masks = [], [] for _ in range(self.num_patches_per_tile): image, mask = sample["image"], sample["mask"] # RandomCrop needs image and mask to be in float mask = mask.to(torch.float) image, mask = self.random_crop(image, mask) images.append(image.squeeze()) masks.append(mask.squeeze(0).long()) sample["image"] = torch.stack(images) # (t,c,h,w) sample["mask"] = torch.stack(masks) # (t, 1, h, w) return sample def setup(self, stage: Optional[str] = None) -> None: """Initialize the main ``Dataset`` objects. This method is called once per GPU per run. """ train_transforms = T.Compose([self.preprocess, self.n_random_crop]) test_transforms = T.Compose([self.preprocess, self.patch_sample]) train_dataset = InriaAerialImageLabeling( self.root_dir, split="train", transforms=train_transforms ) self.train_dataset: Dataset[Any] self.val_dataset: Dataset[Any] self.test_dataset: Dataset[Any] if self.val_split_pct > 0.0: if self.test_split_pct > 0.0: self.train_dataset, self.val_dataset, self.test_dataset = dataset_split( train_dataset, val_pct=self.val_split_pct, test_pct=self.test_split_pct, ) else: self.train_dataset, self.val_dataset = dataset_split( train_dataset, val_pct=self.val_split_pct ) self.test_dataset = self.val_dataset else: self.train_dataset = train_dataset self.val_dataset = train_dataset self.test_dataset = train_dataset assert self.predict_on == "test" self.predict_dataset = InriaAerialImageLabeling( self.root_dir, self.predict_on, transforms=test_transforms ) def train_dataloader(self) -> DataLoader[Any]: """Return a DataLoader for training.""" return DataLoader( self.train_dataset, batch_size=self.batch_size, num_workers=self.num_workers, collate_fn=collate_wrapper, shuffle=True, ) def val_dataloader(self) -> DataLoader[Any]: """Return a DataLoader for validation.""" return DataLoader( self.val_dataset, batch_size=1, num_workers=self.num_workers, collate_fn=collate_wrapper, shuffle=False, ) def test_dataloader(self) -> DataLoader[Any]: """Return a DataLoader for testing.""" return DataLoader( self.test_dataset, batch_size=1, num_workers=self.num_workers, collate_fn=collate_wrapper, shuffle=False, ) def predict_dataloader(self) -> DataLoader[Any]: """Return a DataLoader for prediction.""" return DataLoader( self.predict_dataset, batch_size=1, num_workers=self.num_workers, collate_fn=collate_wrapper, shuffle=False, ) def on_after_batch_transfer( self, batch: Dict[str, Any], dataloader_idx: int ) -> Dict[str, Any]: """Apply augmentations to batch after transferring to GPU. Args: batch (dict): A batch of data that needs to be altered or augmented. dataloader_idx (int): The index of the dataloader to which the batch belongs. Returns: dict: A batch of data """ # Training if ( hasattr(self, "trainer") and self.trainer is not None and hasattr(self.trainer, "training") and self.trainer.training and self.augmentations is not None ): batch["mask"] = batch["mask"].to(torch.float) batch["image"], batch["mask"] = self.augmentations( batch["image"], batch["mask"] ) batch["mask"] = batch["mask"].to(torch.long) # Validation if "mask" in batch: batch["mask"] = rearrange(batch["mask"], "b () h w -> b h w") return batch
torchgeo/datamodules/inria.py
from typing import Any, Dict, List, Optional, Tuple, Union, cast import kornia.augmentation as K import pytorch_lightning as pl import torch import torchvision.transforms as T from einops import rearrange from kornia.contrib import compute_padding, extract_tensor_patches from torch.utils.data import DataLoader, Dataset from torch.utils.data._utils.collate import default_collate from ..datasets import InriaAerialImageLabeling from ..samplers.utils import _to_tuple from .utils import dataset_split DEFAULT_AUGS = K.AugmentationSequential( K.RandomHorizontalFlip(p=0.5), K.RandomVerticalFlip(p=0.5), data_keys=["input", "mask"], ) def collate_wrapper(batch: List[Dict[str, Any]]) -> Dict[str, Any]: """Flatten wrapper.""" r_batch: Dict[str, Any] = default_collate(batch) # type: ignore[no-untyped-call] r_batch["image"] = torch.flatten(r_batch["image"], 0, 1) if "mask" in r_batch: r_batch["mask"] = torch.flatten(r_batch["mask"], 0, 1) return r_batch class InriaAerialImageLabelingDataModule(pl.LightningDataModule): """LightningDataModule implementation for the InriaAerialImageLabeling dataset. Uses the train/test splits from the dataset and further splits the train split into train/val splits. .. versionadded:: 0.3 """ h, w = 5000, 5000 def __init__( self, root_dir: str, batch_size: int = 32, num_workers: int = 0, val_split_pct: float = 0.1, test_split_pct: float = 0.1, patch_size: Union[int, Tuple[int, int]] = 512, num_patches_per_tile: int = 32, augmentations: K.AugmentationSequential = DEFAULT_AUGS, predict_on: str = "test", ) -> None: """Initialize a LightningDataModule for InriaAerialImageLabeling based DataLoaders. Args: root_dir: The ``root`` arugment to pass to the InriaAerialImageLabeling Dataset classes batch_size: The batch size used in the train DataLoader (val_batch_size == test_batch_size == 1) num_workers: The number of workers to use in all created DataLoaders val_split_pct: What percentage of the dataset to use as a validation set test_split_pct: What percentage of the dataset to use as a test set patch_size: Size of random patch from image and mask (height, width) num_patches_per_tile: Number of random patches per sample augmentations: Default augmentations applied predict_on: Directory/Dataset of images to run inference on """ super().__init__() # type: ignore[no-untyped-call] self.root_dir = root_dir self.batch_size = batch_size self.num_workers = num_workers self.val_split_pct = val_split_pct self.test_split_pct = test_split_pct self.patch_size = cast(Tuple[int, int], _to_tuple(patch_size)) self.num_patches_per_tile = num_patches_per_tile self.augmentations = augmentations self.predict_on = predict_on self.random_crop = K.AugmentationSequential( K.RandomCrop(self.patch_size, p=1.0, keepdim=False), data_keys=["input", "mask"], ) def patch_sample(self, sample: Dict[str, Any]) -> Dict[str, Any]: """Extract patches from single sample.""" assert sample["image"].ndim == 3 _, h, w = sample["image"].shape padding = compute_padding((h, w), self.patch_size) sample["original_shape"] = (h, w) sample["patch_shape"] = self.patch_size sample["padding"] = padding sample["image"] = extract_tensor_patches( sample["image"].unsqueeze(0), self.patch_size, self.patch_size, padding=padding, ) sample["image"] = rearrange(sample["image"], "() t c h w -> t () c h w") return sample def preprocess(self, sample: Dict[str, Any]) -> Dict[str, Any]: """Transform a single sample from the Dataset.""" # RGB is int32 so divide by 255 sample["image"] = sample["image"] / 255.0 sample["image"] = torch.clip(sample["image"], min=0.0, max=1.0) if "mask" in sample: sample["mask"] = rearrange(sample["mask"], "h w -> () h w") return sample def n_random_crop(self, sample: Dict[str, Any]) -> Dict[str, Any]: """Get n random crops.""" images, masks = [], [] for _ in range(self.num_patches_per_tile): image, mask = sample["image"], sample["mask"] # RandomCrop needs image and mask to be in float mask = mask.to(torch.float) image, mask = self.random_crop(image, mask) images.append(image.squeeze()) masks.append(mask.squeeze(0).long()) sample["image"] = torch.stack(images) # (t,c,h,w) sample["mask"] = torch.stack(masks) # (t, 1, h, w) return sample def setup(self, stage: Optional[str] = None) -> None: """Initialize the main ``Dataset`` objects. This method is called once per GPU per run. """ train_transforms = T.Compose([self.preprocess, self.n_random_crop]) test_transforms = T.Compose([self.preprocess, self.patch_sample]) train_dataset = InriaAerialImageLabeling( self.root_dir, split="train", transforms=train_transforms ) self.train_dataset: Dataset[Any] self.val_dataset: Dataset[Any] self.test_dataset: Dataset[Any] if self.val_split_pct > 0.0: if self.test_split_pct > 0.0: self.train_dataset, self.val_dataset, self.test_dataset = dataset_split( train_dataset, val_pct=self.val_split_pct, test_pct=self.test_split_pct, ) else: self.train_dataset, self.val_dataset = dataset_split( train_dataset, val_pct=self.val_split_pct ) self.test_dataset = self.val_dataset else: self.train_dataset = train_dataset self.val_dataset = train_dataset self.test_dataset = train_dataset assert self.predict_on == "test" self.predict_dataset = InriaAerialImageLabeling( self.root_dir, self.predict_on, transforms=test_transforms ) def train_dataloader(self) -> DataLoader[Any]: """Return a DataLoader for training.""" return DataLoader( self.train_dataset, batch_size=self.batch_size, num_workers=self.num_workers, collate_fn=collate_wrapper, shuffle=True, ) def val_dataloader(self) -> DataLoader[Any]: """Return a DataLoader for validation.""" return DataLoader( self.val_dataset, batch_size=1, num_workers=self.num_workers, collate_fn=collate_wrapper, shuffle=False, ) def test_dataloader(self) -> DataLoader[Any]: """Return a DataLoader for testing.""" return DataLoader( self.test_dataset, batch_size=1, num_workers=self.num_workers, collate_fn=collate_wrapper, shuffle=False, ) def predict_dataloader(self) -> DataLoader[Any]: """Return a DataLoader for prediction.""" return DataLoader( self.predict_dataset, batch_size=1, num_workers=self.num_workers, collate_fn=collate_wrapper, shuffle=False, ) def on_after_batch_transfer( self, batch: Dict[str, Any], dataloader_idx: int ) -> Dict[str, Any]: """Apply augmentations to batch after transferring to GPU. Args: batch (dict): A batch of data that needs to be altered or augmented. dataloader_idx (int): The index of the dataloader to which the batch belongs. Returns: dict: A batch of data """ # Training if ( hasattr(self, "trainer") and self.trainer is not None and hasattr(self.trainer, "training") and self.trainer.training and self.augmentations is not None ): batch["mask"] = batch["mask"].to(torch.float) batch["image"], batch["mask"] = self.augmentations( batch["image"], batch["mask"] ) batch["mask"] = batch["mask"].to(torch.long) # Validation if "mask" in batch: batch["mask"] = rearrange(batch["mask"], "b () h w -> b h w") return batch
0.962488
0.531027
__author__ = "<EMAIL> (Tim 'mithro' Ansell)" import datetime import json import time import urllib import urllib2 import argparse parser = argparse.ArgumentParser() parser.add_argument( "--server", help="server to register on", action="store", default="http://localhost:8000/tracker/endpoint/register") parser.add_argument( "--secret", help="secret to use to register", action="store", default="move me to config.private.json") parser.add_argument( "--group", help="group to register on the server", action="store", default="example") parser.add_argument( "--ip", help="IP to pretend to be", action="store", default="") if __name__ == "__main__": args = parser.parse_args() while True: data = { "overall_clients": 0, "overall_bitrate": 0, "overall_cbitrate": 0, } totals = [('ogg_high', 4, 1e6, 2e6)] for name, clients, bitrate, streambitrate in totals: fixed_name = name.replace('http-', '').replace('-', '_') data[fixed_name+"_clients"] = int(clients) data[fixed_name+"_bitrate"] = float(bitrate) data[fixed_name+"_cbitrate"] = float(bitrate) data["overall_clients"] += clients data["overall_bitrate"] += bitrate data["overall_cbitrate"] += clients*streambitrate for group in args.group.split(','): try: req = urllib2.Request( args.server, urllib.urlencode(( ('secret', args.secret), ('group', group), ('data', json.dumps(data)), ('REMOTE_ADDR', args.ip), ))) r = urllib2.urlopen(req) except urllib2.HTTPError, e: print e print e.read() raise print "Registered", group, "at", datetime.datetime.now(), "result", r.read().strip() time.sleep(1)
tools/register/fake_register.py
__author__ = "<EMAIL> (Tim 'mithro' Ansell)" import datetime import json import time import urllib import urllib2 import argparse parser = argparse.ArgumentParser() parser.add_argument( "--server", help="server to register on", action="store", default="http://localhost:8000/tracker/endpoint/register") parser.add_argument( "--secret", help="secret to use to register", action="store", default="move me to config.private.json") parser.add_argument( "--group", help="group to register on the server", action="store", default="example") parser.add_argument( "--ip", help="IP to pretend to be", action="store", default="") if __name__ == "__main__": args = parser.parse_args() while True: data = { "overall_clients": 0, "overall_bitrate": 0, "overall_cbitrate": 0, } totals = [('ogg_high', 4, 1e6, 2e6)] for name, clients, bitrate, streambitrate in totals: fixed_name = name.replace('http-', '').replace('-', '_') data[fixed_name+"_clients"] = int(clients) data[fixed_name+"_bitrate"] = float(bitrate) data[fixed_name+"_cbitrate"] = float(bitrate) data["overall_clients"] += clients data["overall_bitrate"] += bitrate data["overall_cbitrate"] += clients*streambitrate for group in args.group.split(','): try: req = urllib2.Request( args.server, urllib.urlencode(( ('secret', args.secret), ('group', group), ('data', json.dumps(data)), ('REMOTE_ADDR', args.ip), ))) r = urllib2.urlopen(req) except urllib2.HTTPError, e: print e print e.read() raise print "Registered", group, "at", datetime.datetime.now(), "result", r.read().strip() time.sleep(1)
0.150465
0.081666
import os import argparse import torch import rlcard from rlcard.agents import RandomAgent from rlcard.utils import get_device, set_seed, tournament, Logger, plot_curve from Agent.HelperTwo import HelperAgent from Utils import get_first, get_single, get_dead_actions, get_none_1_none, get_two_continue, get_1_gap, get_two_same, get_three_same, get_three_continue def reshape_reward(trajectory, payoff): ''' Reorganize the trajectory to make it RL friendly Args: trajectory (list): A list of trajectories payoffs (list): A list of payoffs for the players. Each entry corresponds to one player Returns: (list): A new trajectories that can be fed into RL algorithms. ''' new_trajectories = [[]] for i in range(0, len(trajectory)-2, 2): reward = 0 # 设置是否结束 if i ==len(trajectory)-3: done = True else: done = False # 获取当前状态 current_state = trajectory[i] good_0_actions = get_first(current_state['obs'][0]) good_1_actions = get_single(current_state['obs'][0]) + get_dead_actions(current_state) # 最好的行为:单张+死牌+听碰杠吃 good_2_actions = get_none_1_none(current_state['obs'][0]) # 次的行为:空有空 good_3_actions = get_two_continue(current_state['obs'][0]) + get_1_gap(current_state['obs'][0]) # 有空有+两个连续的 good_4_actions = get_two_same(current_state['obs'][0]) + get_three_same( current_state['obs'][0]) + get_three_continue( current_state['obs'][0]) # 次次行为,拆掉连续的 legal_actions = current_state['legal_actions'] legal_actions = sorted(legal_actions) c_good_0 = [] c_good_1 = [] c_good_2 = [] c_good_3 = [] c_good_4 = [] c_others = [] c_legal_actions = [] # 计算不同的出牌等级 for j in legal_actions: c_legal_actions.append(j) if j in good_0_actions: c_good_0.append(j) elif j in good_1_actions: c_good_1.append(j) elif j in good_2_actions: c_good_2.append(j) elif j in good_3_actions: c_good_3.append(j) elif j in good_4_actions: c_good_4.append(j) else: c_others.append(j) action_make = trajectory[i + 1] # 查看正确的行为在哪一层次 if action_make in c_good_0: reward = 1 elif action_make in c_good_1: reward = 0.8 elif action_make in c_good_2: reward = 0.6 elif action_make in c_others: reward = 0.4 elif action_make in c_good_3: reward = 0.2 elif action_make in c_good_4: reward = 0 transition = trajectory[i:i+3].copy() transition.insert(2, reward) transition.append(done) new_trajectories[0].append(transition) return new_trajectories def save_model(dueling_agent, epoch, score): save = { 'net': dueling_agent.q_estimator.qnet.state_dict(), 'optimizer': dueling_agent.q_estimator.optimizer.state_dict(), 'epoch': epoch } torch.save(save, os.path.join(os.getcwd(), 'TrainedModel/DQNwithrewardhelper', str(epoch) + '_' + str(score).replace(".", "-") + '_' + 'DQNwithrewardhelper.pth')) def train(args): # Check whether gpu is available device = get_device() # Seed numpy, torch, random set_seed(args.seed) # Make the environment with seed env = rlcard.make(args.env, config={'seed': args.seed}) # Initialize the agent and use random agents as opponents if args.algorithm == 'dqn': from rlcard.agents import DQNAgent agent = DQNAgent(num_actions=env.num_actions, state_shape=env.state_shape[0], mlp_layers=[64, 64], learning_rate=0.00001, device=device) elif args.algorithm == 'nfsp': from rlcard.agents import NFSPAgent agent = NFSPAgent(num_actions=env.num_actions, state_shape=env.state_shape[0], hidden_layers_sizes=[64, 64], q_mlp_layers=[64, 64], device=device) agents = [agent] for _ in range(env.num_players - 1): agents.append(RandomAgent(num_actions=env.num_actions)) env.set_agents(agents) env_learn = rlcard.make(args.env, config={'seed': args.seed}) agents_learn = [HelperAgent(num_actions=env_learn.num_actions)] for _ in range(env.num_players - 1): agents_learn.append(RandomAgent(num_actions=env.num_actions)) env_learn.set_agents(agents_learn) # Start training with Logger(args.log_dir) as logger: for episode in range(args.num_episodes): if args.algorithm == 'nfsp': agents[0].sample_episode_policy() # Generate data from the environment trajectories, payoffs = env_learn.run(is_training=True) # Reorganaize the data to be state, action, reward, next_state, done trajectories = reshape_reward(trajectories[0], payoffs[0]) # Feed transitions into agent memory, and train the agent # Here, we assume that DQN always plays the first position # and the other players play randomly (if any) for ts in trajectories[0]: agent.feed(ts) # Evaluate the performance. Play with random agents. if episode % args.evaluate_every == 0: score = tournament(env, args.num_eval_games)[0] save_model(agents[0], episode, score) logger.log_performance(env.timestep, score) # Get the paths csv_path, fig_path = logger.csv_path, logger.fig_path # Plot the learning curve plot_curve(csv_path, fig_path, args.algorithm) # Save model save_path = os.path.join(args.log_dir, 'model.pth') torch.save(agent, save_path) print('TrainedModel saved in', save_path) if __name__ == '__main__': parser = argparse.ArgumentParser("DQN/NFSP example in RLCard") parser.add_argument('--env', type=str, default='mahjong', choices=['blackjack', 'leduc-holdem', 'limit-holdem', 'doudizhu', 'mahjong', 'no-limit-holdem', 'uno', 'gin-rummy']) parser.add_argument('--algorithm', type=str, default='dqn', choices=['dqn', 'nfsp']) parser.add_argument('--cuda', type=str, default='') parser.add_argument('--seed', type=int, default=42) parser.add_argument('--num_episodes', type=int, default=100000) parser.add_argument('--num_eval_games', type=int, default=2000) parser.add_argument('--evaluate_every', type=int, default=300) parser.add_argument('--log_dir', type=str, default='experiments/mahjong_nfsp_result/') args = parser.parse_args(args=[]) os.environ["CUDA_VISIBLE_DEVICES"] = args.cuda train(args)
RLCardDQN.py
import os import argparse import torch import rlcard from rlcard.agents import RandomAgent from rlcard.utils import get_device, set_seed, tournament, Logger, plot_curve from Agent.HelperTwo import HelperAgent from Utils import get_first, get_single, get_dead_actions, get_none_1_none, get_two_continue, get_1_gap, get_two_same, get_three_same, get_three_continue def reshape_reward(trajectory, payoff): ''' Reorganize the trajectory to make it RL friendly Args: trajectory (list): A list of trajectories payoffs (list): A list of payoffs for the players. Each entry corresponds to one player Returns: (list): A new trajectories that can be fed into RL algorithms. ''' new_trajectories = [[]] for i in range(0, len(trajectory)-2, 2): reward = 0 # 设置是否结束 if i ==len(trajectory)-3: done = True else: done = False # 获取当前状态 current_state = trajectory[i] good_0_actions = get_first(current_state['obs'][0]) good_1_actions = get_single(current_state['obs'][0]) + get_dead_actions(current_state) # 最好的行为:单张+死牌+听碰杠吃 good_2_actions = get_none_1_none(current_state['obs'][0]) # 次的行为:空有空 good_3_actions = get_two_continue(current_state['obs'][0]) + get_1_gap(current_state['obs'][0]) # 有空有+两个连续的 good_4_actions = get_two_same(current_state['obs'][0]) + get_three_same( current_state['obs'][0]) + get_three_continue( current_state['obs'][0]) # 次次行为,拆掉连续的 legal_actions = current_state['legal_actions'] legal_actions = sorted(legal_actions) c_good_0 = [] c_good_1 = [] c_good_2 = [] c_good_3 = [] c_good_4 = [] c_others = [] c_legal_actions = [] # 计算不同的出牌等级 for j in legal_actions: c_legal_actions.append(j) if j in good_0_actions: c_good_0.append(j) elif j in good_1_actions: c_good_1.append(j) elif j in good_2_actions: c_good_2.append(j) elif j in good_3_actions: c_good_3.append(j) elif j in good_4_actions: c_good_4.append(j) else: c_others.append(j) action_make = trajectory[i + 1] # 查看正确的行为在哪一层次 if action_make in c_good_0: reward = 1 elif action_make in c_good_1: reward = 0.8 elif action_make in c_good_2: reward = 0.6 elif action_make in c_others: reward = 0.4 elif action_make in c_good_3: reward = 0.2 elif action_make in c_good_4: reward = 0 transition = trajectory[i:i+3].copy() transition.insert(2, reward) transition.append(done) new_trajectories[0].append(transition) return new_trajectories def save_model(dueling_agent, epoch, score): save = { 'net': dueling_agent.q_estimator.qnet.state_dict(), 'optimizer': dueling_agent.q_estimator.optimizer.state_dict(), 'epoch': epoch } torch.save(save, os.path.join(os.getcwd(), 'TrainedModel/DQNwithrewardhelper', str(epoch) + '_' + str(score).replace(".", "-") + '_' + 'DQNwithrewardhelper.pth')) def train(args): # Check whether gpu is available device = get_device() # Seed numpy, torch, random set_seed(args.seed) # Make the environment with seed env = rlcard.make(args.env, config={'seed': args.seed}) # Initialize the agent and use random agents as opponents if args.algorithm == 'dqn': from rlcard.agents import DQNAgent agent = DQNAgent(num_actions=env.num_actions, state_shape=env.state_shape[0], mlp_layers=[64, 64], learning_rate=0.00001, device=device) elif args.algorithm == 'nfsp': from rlcard.agents import NFSPAgent agent = NFSPAgent(num_actions=env.num_actions, state_shape=env.state_shape[0], hidden_layers_sizes=[64, 64], q_mlp_layers=[64, 64], device=device) agents = [agent] for _ in range(env.num_players - 1): agents.append(RandomAgent(num_actions=env.num_actions)) env.set_agents(agents) env_learn = rlcard.make(args.env, config={'seed': args.seed}) agents_learn = [HelperAgent(num_actions=env_learn.num_actions)] for _ in range(env.num_players - 1): agents_learn.append(RandomAgent(num_actions=env.num_actions)) env_learn.set_agents(agents_learn) # Start training with Logger(args.log_dir) as logger: for episode in range(args.num_episodes): if args.algorithm == 'nfsp': agents[0].sample_episode_policy() # Generate data from the environment trajectories, payoffs = env_learn.run(is_training=True) # Reorganaize the data to be state, action, reward, next_state, done trajectories = reshape_reward(trajectories[0], payoffs[0]) # Feed transitions into agent memory, and train the agent # Here, we assume that DQN always plays the first position # and the other players play randomly (if any) for ts in trajectories[0]: agent.feed(ts) # Evaluate the performance. Play with random agents. if episode % args.evaluate_every == 0: score = tournament(env, args.num_eval_games)[0] save_model(agents[0], episode, score) logger.log_performance(env.timestep, score) # Get the paths csv_path, fig_path = logger.csv_path, logger.fig_path # Plot the learning curve plot_curve(csv_path, fig_path, args.algorithm) # Save model save_path = os.path.join(args.log_dir, 'model.pth') torch.save(agent, save_path) print('TrainedModel saved in', save_path) if __name__ == '__main__': parser = argparse.ArgumentParser("DQN/NFSP example in RLCard") parser.add_argument('--env', type=str, default='mahjong', choices=['blackjack', 'leduc-holdem', 'limit-holdem', 'doudizhu', 'mahjong', 'no-limit-holdem', 'uno', 'gin-rummy']) parser.add_argument('--algorithm', type=str, default='dqn', choices=['dqn', 'nfsp']) parser.add_argument('--cuda', type=str, default='') parser.add_argument('--seed', type=int, default=42) parser.add_argument('--num_episodes', type=int, default=100000) parser.add_argument('--num_eval_games', type=int, default=2000) parser.add_argument('--evaluate_every', type=int, default=300) parser.add_argument('--log_dir', type=str, default='experiments/mahjong_nfsp_result/') args = parser.parse_args(args=[]) os.environ["CUDA_VISIBLE_DEVICES"] = args.cuda train(args)
0.550124
0.234275
import argparse from colorama import Fore import csv import psycopg2 import psycopg2.extras import re import signal import sys def main(): # parse the command line arguments parser = argparse.ArgumentParser( description="Add ORCID identifiers to items for a given author name from CSV. Respects the author order from the dc.contributor.author field." ) parser.add_argument( "--author-field-name", "-f", help="Name of column with author names.", default="dc.contributor.author", ) parser.add_argument( "--csv-file", "-i", help="CSV file containing author names and ORCID identifiers.", required=True, type=argparse.FileType("r", encoding="UTF-8"), ) parser.add_argument("--database-name", "-db", help="Database name", required=True) parser.add_argument( "--database-user", "-u", help="Database username", required=True ) parser.add_argument( "--database-pass", "-p", help="Database password", required=True ) parser.add_argument( "--debug", "-d", help="Print debug messages to standard error (stderr).", action="store_true", ) parser.add_argument( "--dry-run", "-n", help="Only print changes that would be made.", action="store_true", ) parser.add_argument( "--orcid-field-name", "-o", help='Name of column with creators in "Name: 0000-0000-0000-0000" format.', default="cg.creator.identifier", ) args = parser.parse_args() # set the signal handler for SIGINT (^C) so we can exit cleanly signal.signal(signal.SIGINT, signal_handler) # connect to database try: conn_string = "dbname={0} user={1} password={2} host=localhost".format( args.database_name, args.database_user, args.database_pass ) conn = psycopg2.connect(conn_string) if args.debug: sys.stderr.write(Fore.GREEN + "Connected to the database.\n" + Fore.RESET) except psycopg2.OperationalError: sys.stderr.write(Fore.RED + "Unable to connect to the database.\n" + Fore.RESET) # close output file before we exit args.csv_file.close() exit(1) # open the CSV reader = csv.DictReader(args.csv_file) # iterate over rows in the CSV for row in reader: author_name = row[args.author_field_name] if args.debug: sys.stderr.write( Fore.GREEN + "Finding items with author name: {0}\n".format(author_name) + Fore.RESET ) with conn: # cursor will be closed after this block exits # see: http://initd.org/psycopg/docs/usage.html#with-statement with conn.cursor() as cursor: # find all item metadata records with this author name # metadata_field_id 3 is author sql = "SELECT dspace_object_id, place FROM metadatavalue WHERE dspace_object_id IN (SELECT uuid FROM item) AND metadata_field_id=3 AND text_value=%s" # remember that tuples with one item need a comma after them! cursor.execute(sql, (author_name,)) records_with_author_name = cursor.fetchall() if len(records_with_author_name) >= 0: if args.debug: sys.stderr.write( Fore.GREEN + "Found {0} items.\n".format(len(records_with_author_name)) + Fore.RESET ) # extract cg.creator.identifier text to add from CSV and strip leading/trailing whitespace text_value = row[args.orcid_field_name].strip() # extract the ORCID identifier from the cg.creator.identifier text field in the CSV orcid_identifier_pattern = re.compile( r"[A-Z0-9]{4}-[A-Z0-9]{4}-[A-Z0-9]{4}-[A-Z0-9]{4}" ) orcid_identifier_match = orcid_identifier_pattern.search(text_value) # sanity check to make sure we extracted the ORCID identifier from the cg.creator.identifier text in the CSV if orcid_identifier_match is None: if args.debug: sys.stderr.write( Fore.YELLOW + 'Skipping invalid ORCID identifier in "{0}".\n'.format( text_value ) + Fore.RESET ) continue # we only expect one ORCID identifier, so if it matches it will be group "0" # see: https://docs.python.org/3/library/re.html orcid_identifier = orcid_identifier_match.group(0) # iterate over results for current author name to add cg.creator.identifier metadata for record in records_with_author_name: dspace_object_id = record[0] # "place" is the order of a metadata value so we can add the cg.creator.identifier metadata matching the author order place = record[1] confidence = -1 # get the metadata_field_id for the cg.creator.identifier field sql = "SELECT metadata_field_id FROM metadatafieldregistry WHERE metadata_schema_id=2 AND element='creator' AND qualifier='identifier'" cursor.execute(sql) metadata_field_id = cursor.fetchall()[0] # check if there is an existing cg.creator.identifier with this author's ORCID identifier for this item (without restricting the "place") # note that the SQL here is quoted differently to allow us to use LIKE with % wildcards with our paremeter subsitution sql = "SELECT * from metadatavalue WHERE dspace_object_id=%s AND metadata_field_id=%s AND text_value LIKE '%%' || %s || '%%' AND confidence=%s AND dspace_object_id IN (SELECT uuid FROM item)" # Adapt Python’s uuid.UUID type to PostgreSQL's uuid # See: https://www.psycopg.org/docs/extras.html psycopg2.extras.register_uuid() cursor.execute( sql, ( dspace_object_id, metadata_field_id, orcid_identifier, confidence, ), ) records_with_orcid_identifier = cursor.fetchall() if len(records_with_orcid_identifier) == 0: if args.dry_run: print( 'Would add ORCID identifier "{0}" to item {1}.'.format( text_value, dspace_object_id ) ) continue print( 'Adding ORCID identifier "{0}" to item {1}.'.format( text_value, dspace_object_id ) ) # metadatavalue IDs come from a PostgreSQL sequence that increments when you call it cursor.execute("SELECT nextval('metadatavalue_seq')") metadata_value_id = cursor.fetchone()[0] sql = "INSERT INTO metadatavalue (metadata_value_id, dspace_object_id, metadata_field_id, text_value, place, confidence) VALUES (%s, %s, %s, %s, %s, %s)" cursor.execute( sql, ( metadata_value_id, dspace_object_id, metadata_field_id, text_value, place, confidence, ), ) else: if args.debug: sys.stderr.write( Fore.GREEN + "Item {0} already has an ORCID identifier for {1}.\n".format( dspace_object_id, text_value ) + Fore.RESET ) if args.debug: sys.stderr.write(Fore.GREEN + "Disconnecting from database.\n" + Fore.RESET) # close the database connection before leaving conn.close() # close output file before we exit args.csv_file.close() def signal_handler(signal, frame): sys.exit(1) if __name__ == "__main__": main()
ilri/add-orcid-identifiers-csv.py
import argparse from colorama import Fore import csv import psycopg2 import psycopg2.extras import re import signal import sys def main(): # parse the command line arguments parser = argparse.ArgumentParser( description="Add ORCID identifiers to items for a given author name from CSV. Respects the author order from the dc.contributor.author field." ) parser.add_argument( "--author-field-name", "-f", help="Name of column with author names.", default="dc.contributor.author", ) parser.add_argument( "--csv-file", "-i", help="CSV file containing author names and ORCID identifiers.", required=True, type=argparse.FileType("r", encoding="UTF-8"), ) parser.add_argument("--database-name", "-db", help="Database name", required=True) parser.add_argument( "--database-user", "-u", help="Database username", required=True ) parser.add_argument( "--database-pass", "-p", help="Database password", required=True ) parser.add_argument( "--debug", "-d", help="Print debug messages to standard error (stderr).", action="store_true", ) parser.add_argument( "--dry-run", "-n", help="Only print changes that would be made.", action="store_true", ) parser.add_argument( "--orcid-field-name", "-o", help='Name of column with creators in "Name: 0000-0000-0000-0000" format.', default="cg.creator.identifier", ) args = parser.parse_args() # set the signal handler for SIGINT (^C) so we can exit cleanly signal.signal(signal.SIGINT, signal_handler) # connect to database try: conn_string = "dbname={0} user={1} password={2} host=localhost".format( args.database_name, args.database_user, args.database_pass ) conn = psycopg2.connect(conn_string) if args.debug: sys.stderr.write(Fore.GREEN + "Connected to the database.\n" + Fore.RESET) except psycopg2.OperationalError: sys.stderr.write(Fore.RED + "Unable to connect to the database.\n" + Fore.RESET) # close output file before we exit args.csv_file.close() exit(1) # open the CSV reader = csv.DictReader(args.csv_file) # iterate over rows in the CSV for row in reader: author_name = row[args.author_field_name] if args.debug: sys.stderr.write( Fore.GREEN + "Finding items with author name: {0}\n".format(author_name) + Fore.RESET ) with conn: # cursor will be closed after this block exits # see: http://initd.org/psycopg/docs/usage.html#with-statement with conn.cursor() as cursor: # find all item metadata records with this author name # metadata_field_id 3 is author sql = "SELECT dspace_object_id, place FROM metadatavalue WHERE dspace_object_id IN (SELECT uuid FROM item) AND metadata_field_id=3 AND text_value=%s" # remember that tuples with one item need a comma after them! cursor.execute(sql, (author_name,)) records_with_author_name = cursor.fetchall() if len(records_with_author_name) >= 0: if args.debug: sys.stderr.write( Fore.GREEN + "Found {0} items.\n".format(len(records_with_author_name)) + Fore.RESET ) # extract cg.creator.identifier text to add from CSV and strip leading/trailing whitespace text_value = row[args.orcid_field_name].strip() # extract the ORCID identifier from the cg.creator.identifier text field in the CSV orcid_identifier_pattern = re.compile( r"[A-Z0-9]{4}-[A-Z0-9]{4}-[A-Z0-9]{4}-[A-Z0-9]{4}" ) orcid_identifier_match = orcid_identifier_pattern.search(text_value) # sanity check to make sure we extracted the ORCID identifier from the cg.creator.identifier text in the CSV if orcid_identifier_match is None: if args.debug: sys.stderr.write( Fore.YELLOW + 'Skipping invalid ORCID identifier in "{0}".\n'.format( text_value ) + Fore.RESET ) continue # we only expect one ORCID identifier, so if it matches it will be group "0" # see: https://docs.python.org/3/library/re.html orcid_identifier = orcid_identifier_match.group(0) # iterate over results for current author name to add cg.creator.identifier metadata for record in records_with_author_name: dspace_object_id = record[0] # "place" is the order of a metadata value so we can add the cg.creator.identifier metadata matching the author order place = record[1] confidence = -1 # get the metadata_field_id for the cg.creator.identifier field sql = "SELECT metadata_field_id FROM metadatafieldregistry WHERE metadata_schema_id=2 AND element='creator' AND qualifier='identifier'" cursor.execute(sql) metadata_field_id = cursor.fetchall()[0] # check if there is an existing cg.creator.identifier with this author's ORCID identifier for this item (without restricting the "place") # note that the SQL here is quoted differently to allow us to use LIKE with % wildcards with our paremeter subsitution sql = "SELECT * from metadatavalue WHERE dspace_object_id=%s AND metadata_field_id=%s AND text_value LIKE '%%' || %s || '%%' AND confidence=%s AND dspace_object_id IN (SELECT uuid FROM item)" # Adapt Python’s uuid.UUID type to PostgreSQL's uuid # See: https://www.psycopg.org/docs/extras.html psycopg2.extras.register_uuid() cursor.execute( sql, ( dspace_object_id, metadata_field_id, orcid_identifier, confidence, ), ) records_with_orcid_identifier = cursor.fetchall() if len(records_with_orcid_identifier) == 0: if args.dry_run: print( 'Would add ORCID identifier "{0}" to item {1}.'.format( text_value, dspace_object_id ) ) continue print( 'Adding ORCID identifier "{0}" to item {1}.'.format( text_value, dspace_object_id ) ) # metadatavalue IDs come from a PostgreSQL sequence that increments when you call it cursor.execute("SELECT nextval('metadatavalue_seq')") metadata_value_id = cursor.fetchone()[0] sql = "INSERT INTO metadatavalue (metadata_value_id, dspace_object_id, metadata_field_id, text_value, place, confidence) VALUES (%s, %s, %s, %s, %s, %s)" cursor.execute( sql, ( metadata_value_id, dspace_object_id, metadata_field_id, text_value, place, confidence, ), ) else: if args.debug: sys.stderr.write( Fore.GREEN + "Item {0} already has an ORCID identifier for {1}.\n".format( dspace_object_id, text_value ) + Fore.RESET ) if args.debug: sys.stderr.write(Fore.GREEN + "Disconnecting from database.\n" + Fore.RESET) # close the database connection before leaving conn.close() # close output file before we exit args.csv_file.close() def signal_handler(signal, frame): sys.exit(1) if __name__ == "__main__": main()
0.380874
0.117623
from MoinMoin.script import MoinScript class PluginScript(MoinScript): """\ Purpose: ======== This tool allows you to disable user accounts via a command line interface. Detailed Instructions: ====================== General syntax: moin [options] account disable [disable-options] [options] usually should be: --config-dir=/path/to/my/cfg/ --wiki-url=http://wiki.example.org/ [disable-options] see below: 0. Verify that you really want to disable the account. While there is a disable script, no such enable script exists. 1. To disable the user 'JohnSmith': moin ... account disable --name JohnSmith 2. To disable the user 'JohnSmith', based on his UID '1198872910.78.56322': moin ... account disable --uid 1198872910.78.56322 """ def __init__(self, argv, def_values): MoinScript.__init__(self, argv, def_values) self.parser.add_option( "--uid", metavar="UID", dest="uid", help="Disable the user with user id UID." ) self.parser.add_option( "--name", metavar="NAME", dest="uname", help="Disable the user with user name NAME." ) def mainloop(self): # we don't expect non-option arguments if len(self.args) != 0: self.parser.error("incorrect number of arguments") flags_given = self.options.uid or self.options.uname if not flags_given: self.parser.print_help() import sys sys.exit(1) self.init_request() request = self.request from MoinMoin import user if self.options.uid: u = user.User(request, self.options.uid) elif self.options.uname: u = user.User(request, None, self.options.uname) if not u.exists(): print 'This user "%s" does not exists!' % u.name return print " %-20s %-25s %-35s" % (u.id, u.name, u.email), if not u.disabled: # only disable once u.disabled = 1 u.name = "%s-%s" % (u.name, u.id) if u.email: u.email = "%s-%s" % (u.email, u.id) u.subscribed_pages = "" # avoid using email u.save() print "- disabled." else: print "- is already disabled."
MoinMoin/script/account/disable.py
from MoinMoin.script import MoinScript class PluginScript(MoinScript): """\ Purpose: ======== This tool allows you to disable user accounts via a command line interface. Detailed Instructions: ====================== General syntax: moin [options] account disable [disable-options] [options] usually should be: --config-dir=/path/to/my/cfg/ --wiki-url=http://wiki.example.org/ [disable-options] see below: 0. Verify that you really want to disable the account. While there is a disable script, no such enable script exists. 1. To disable the user 'JohnSmith': moin ... account disable --name JohnSmith 2. To disable the user 'JohnSmith', based on his UID '1198872910.78.56322': moin ... account disable --uid 1198872910.78.56322 """ def __init__(self, argv, def_values): MoinScript.__init__(self, argv, def_values) self.parser.add_option( "--uid", metavar="UID", dest="uid", help="Disable the user with user id UID." ) self.parser.add_option( "--name", metavar="NAME", dest="uname", help="Disable the user with user name NAME." ) def mainloop(self): # we don't expect non-option arguments if len(self.args) != 0: self.parser.error("incorrect number of arguments") flags_given = self.options.uid or self.options.uname if not flags_given: self.parser.print_help() import sys sys.exit(1) self.init_request() request = self.request from MoinMoin import user if self.options.uid: u = user.User(request, self.options.uid) elif self.options.uname: u = user.User(request, None, self.options.uname) if not u.exists(): print 'This user "%s" does not exists!' % u.name return print " %-20s %-25s %-35s" % (u.id, u.name, u.email), if not u.disabled: # only disable once u.disabled = 1 u.name = "%s-%s" % (u.name, u.id) if u.email: u.email = "%s-%s" % (u.email, u.id) u.subscribed_pages = "" # avoid using email u.save() print "- disabled." else: print "- is already disabled."
0.53437
0.113973
import torch import torch.nn as nn from hyper import cfg class Conv2dAuto(nn.Conv2d): def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) self.padding = (self.kernel_size[0] // 2, self.kernel_size[1] // 2) def activation_func(activation): return nn.ModuleDict([ ['relu', nn.ReLU(inplace=True)], ['leaky_relu', nn.LeakyReLU(negative_slope=0.01, inplace=True)], ['selu', nn.SELU(inplace=True)], ['none', nn.Identity()] ])[activation] class CNNet(nn.Module): def __init__(self, in_dim = 32, in_chans = 3, filters = [32, 32, 64, 128, 1], kernels = [5, 3, 3, 3, 1], dim_s = [1,1,2,2,1], activation = "selu", drop_p = 0.1): super().__init__() self.convs = nn.ModuleList([Conv2dAuto(in_channels = in_chans, out_channels = filters[0], stride = dim_s[0], kernel_size = kernels[0])] + [Conv2dAuto(in_channels = filters[i-1], out_channels = filters[i], stride = dim_s[i], kernel_size = kernels[i]) for i in range(1, len(filters))]) self.batch_norms = nn.ModuleList([nn.BatchNorm2d(num_features= filters[i]) for i in range(len(filters))]) self.setup(torch.rand(1,in_chans, in_dim, in_dim)) self.denses = nn.ModuleList([nn.Linear(in_features = self.lin_in_shape, out_features=128), nn.Linear(in_features = 128, out_features=4)]) self.act = activation_func(activation) self.drop = nn.Dropout(p=drop_p) def setup(self, x): for l in self.convs: x = l(x) self.lin_in_shape = x.shape[-1]*x.shape[-2]*x.shape[-3] def forward(self, x): for l, b in zip(self.convs, self.batch_norms): x = self.drop(self.act(b(l(x)))) x = x.view(-1, self.lin_in_shape) x = self.denses[0](x) x = self.act(x) x = self.drop(x) x = self.denses[1](x) return x class FCNet(nn.Module): def __init__(self, in_dim = 32, in_chans = None, layer_dims = [128, 64, 4], activation = "selu", drop_p = 0.1): super().__init__() self.layer_dims = [in_dim] + layer_dims self.denses = nn.ModuleList([nn.Linear(in_features = self.layer_dims[i], out_features = self.layer_dims[i+1]) for i in range(len(layer_dims))]) self.bns = nn.ModuleList([nn.BatchNorm1d(num_features= self.layer_dims[i + 1]) for i in range(len(layer_dims) - 1)]) self.act = activation_func(activation) self.drop = nn.Dropout(p=drop_p) def forward(self, x): for i, l in enumerate(self.denses): x = l(x) if not i == len(self.denses) - 1: x = self.bns[i](x) x = self.act(x) if not i == len(self.denses) - 1: x = self.drop(x) return x nets = {"cnn" : CNNet, "fcn" : FCNet}
models.py
import torch import torch.nn as nn from hyper import cfg class Conv2dAuto(nn.Conv2d): def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) self.padding = (self.kernel_size[0] // 2, self.kernel_size[1] // 2) def activation_func(activation): return nn.ModuleDict([ ['relu', nn.ReLU(inplace=True)], ['leaky_relu', nn.LeakyReLU(negative_slope=0.01, inplace=True)], ['selu', nn.SELU(inplace=True)], ['none', nn.Identity()] ])[activation] class CNNet(nn.Module): def __init__(self, in_dim = 32, in_chans = 3, filters = [32, 32, 64, 128, 1], kernels = [5, 3, 3, 3, 1], dim_s = [1,1,2,2,1], activation = "selu", drop_p = 0.1): super().__init__() self.convs = nn.ModuleList([Conv2dAuto(in_channels = in_chans, out_channels = filters[0], stride = dim_s[0], kernel_size = kernels[0])] + [Conv2dAuto(in_channels = filters[i-1], out_channels = filters[i], stride = dim_s[i], kernel_size = kernels[i]) for i in range(1, len(filters))]) self.batch_norms = nn.ModuleList([nn.BatchNorm2d(num_features= filters[i]) for i in range(len(filters))]) self.setup(torch.rand(1,in_chans, in_dim, in_dim)) self.denses = nn.ModuleList([nn.Linear(in_features = self.lin_in_shape, out_features=128), nn.Linear(in_features = 128, out_features=4)]) self.act = activation_func(activation) self.drop = nn.Dropout(p=drop_p) def setup(self, x): for l in self.convs: x = l(x) self.lin_in_shape = x.shape[-1]*x.shape[-2]*x.shape[-3] def forward(self, x): for l, b in zip(self.convs, self.batch_norms): x = self.drop(self.act(b(l(x)))) x = x.view(-1, self.lin_in_shape) x = self.denses[0](x) x = self.act(x) x = self.drop(x) x = self.denses[1](x) return x class FCNet(nn.Module): def __init__(self, in_dim = 32, in_chans = None, layer_dims = [128, 64, 4], activation = "selu", drop_p = 0.1): super().__init__() self.layer_dims = [in_dim] + layer_dims self.denses = nn.ModuleList([nn.Linear(in_features = self.layer_dims[i], out_features = self.layer_dims[i+1]) for i in range(len(layer_dims))]) self.bns = nn.ModuleList([nn.BatchNorm1d(num_features= self.layer_dims[i + 1]) for i in range(len(layer_dims) - 1)]) self.act = activation_func(activation) self.drop = nn.Dropout(p=drop_p) def forward(self, x): for i, l in enumerate(self.denses): x = l(x) if not i == len(self.denses) - 1: x = self.bns[i](x) x = self.act(x) if not i == len(self.denses) - 1: x = self.drop(x) return x nets = {"cnn" : CNNet, "fcn" : FCNet}
0.923135
0.47524
__author__ = "<NAME>" __copyright__ = "Copyright 2020, Xilinx" __email__ = "<EMAIL>" from setuptools import setup, find_packages, Distribution from setuptools.command.build_ext import build_ext from distutils.file_util import copy_file import os # Requirement required = [ 'pynq>=2.6.0' ] # Extend package files by directory or by file def extend_package(data_list): for data in data_list: if os.path.isdir(data): package_files.extend( [os.path.join("..", root, f) for root, _, files in os.walk(data) for f in files] ) elif os.path.isfile(data): package_files.append(os.path.join("..", data)) # Extend package files package_files = [] extend_package( ["embeddedsw/XilinxProcessorIPLib/drivers/v_hdmi_common/src", "embeddedsw/XilinxProcessorIPLib/drivers/v_hdmirxss/src", "embeddedsw/XilinxProcessorIPLib/drivers/v_hdmirx/src", "embeddedsw/XilinxProcessorIPLib/drivers/v_hdmitxss/src", "embeddedsw/XilinxProcessorIPLib/drivers/v_hdmitx/src", "embeddedsw/XilinxProcessorIPLib/drivers/video_common/src", "embeddedsw/XilinxProcessorIPLib/drivers/vphy/src", "embeddedsw/XilinxProcessorIPLib/drivers/vtc/src", "embeddedsw/XilinxProcessorIPLib/drivers/iic/src", "embeddedsw/XilinxProcessorIPLib/drivers/gpio/src", "embeddedsw/XilinxProcessorIPLib/drivers/iicps/src", "embeddedsw/XilinxProcessorIPLib/drivers/scugic/src", "embeddedsw/XilinxProcessorIPLib/drivers/axivdma/src", "embeddedsw/XilinxProcessorIPLib/drivers/mipicsiss/src", "embeddedsw/XilinxProcessorIPLib/drivers/csi/src", "embeddedsw/XilinxProcessorIPLib/drivers/dphy/src", "embeddedsw/lib/bsp/standalone/src", "embeddedsw_lib.mk", "common", "_pcam5c", 'pcam5c' ]) class BuildExtension(build_ext): def run_make(self, src_path, dst_path, output_lib): self.spawn(['make', 'PYNQ_BUILD_ARCH={}'.format("aarch64"), '-C', src_path]) os.makedirs(os.path.join(self.build_lib, dst_path), exist_ok=True) copy_file(src_path + output_lib, os.path.join(self.build_lib, dst_path, output_lib)) def run(self): self.run_make("_pcam5c/", "pcam5c", "libpcam5c.so") build_ext.run(self) # Enforce platform-dependent distribution class BinaryDistribution(Distribution): def has_ext_modules(self): return True setup(name='pynq_zu_pcam5c', version="1.0", description='pcam5 driver for Pynq-ZU', author='<NAME>', author_email='<EMAIL>', url='https://github.com/Xilinx/PYNQ-ZU', packages=find_packages(), cmdclass={ "build_ext": BuildExtension, }, distclass=BinaryDistribution, python_requires='>=3.6.0', install_requires=required, package_data={ 'pcam5c': package_files, }, entry_points={ "pynq.lib": "pcam5c = pcam5c" }, ext_modules=[], zip_safe=False, license="BSD 3-Clause" )
Pynq-ZU/packages/pcam5c/setup.py
__author__ = "<NAME>" __copyright__ = "Copyright 2020, Xilinx" __email__ = "<EMAIL>" from setuptools import setup, find_packages, Distribution from setuptools.command.build_ext import build_ext from distutils.file_util import copy_file import os # Requirement required = [ 'pynq>=2.6.0' ] # Extend package files by directory or by file def extend_package(data_list): for data in data_list: if os.path.isdir(data): package_files.extend( [os.path.join("..", root, f) for root, _, files in os.walk(data) for f in files] ) elif os.path.isfile(data): package_files.append(os.path.join("..", data)) # Extend package files package_files = [] extend_package( ["embeddedsw/XilinxProcessorIPLib/drivers/v_hdmi_common/src", "embeddedsw/XilinxProcessorIPLib/drivers/v_hdmirxss/src", "embeddedsw/XilinxProcessorIPLib/drivers/v_hdmirx/src", "embeddedsw/XilinxProcessorIPLib/drivers/v_hdmitxss/src", "embeddedsw/XilinxProcessorIPLib/drivers/v_hdmitx/src", "embeddedsw/XilinxProcessorIPLib/drivers/video_common/src", "embeddedsw/XilinxProcessorIPLib/drivers/vphy/src", "embeddedsw/XilinxProcessorIPLib/drivers/vtc/src", "embeddedsw/XilinxProcessorIPLib/drivers/iic/src", "embeddedsw/XilinxProcessorIPLib/drivers/gpio/src", "embeddedsw/XilinxProcessorIPLib/drivers/iicps/src", "embeddedsw/XilinxProcessorIPLib/drivers/scugic/src", "embeddedsw/XilinxProcessorIPLib/drivers/axivdma/src", "embeddedsw/XilinxProcessorIPLib/drivers/mipicsiss/src", "embeddedsw/XilinxProcessorIPLib/drivers/csi/src", "embeddedsw/XilinxProcessorIPLib/drivers/dphy/src", "embeddedsw/lib/bsp/standalone/src", "embeddedsw_lib.mk", "common", "_pcam5c", 'pcam5c' ]) class BuildExtension(build_ext): def run_make(self, src_path, dst_path, output_lib): self.spawn(['make', 'PYNQ_BUILD_ARCH={}'.format("aarch64"), '-C', src_path]) os.makedirs(os.path.join(self.build_lib, dst_path), exist_ok=True) copy_file(src_path + output_lib, os.path.join(self.build_lib, dst_path, output_lib)) def run(self): self.run_make("_pcam5c/", "pcam5c", "libpcam5c.so") build_ext.run(self) # Enforce platform-dependent distribution class BinaryDistribution(Distribution): def has_ext_modules(self): return True setup(name='pynq_zu_pcam5c', version="1.0", description='pcam5 driver for Pynq-ZU', author='<NAME>', author_email='<EMAIL>', url='https://github.com/Xilinx/PYNQ-ZU', packages=find_packages(), cmdclass={ "build_ext": BuildExtension, }, distclass=BinaryDistribution, python_requires='>=3.6.0', install_requires=required, package_data={ 'pcam5c': package_files, }, entry_points={ "pynq.lib": "pcam5c = pcam5c" }, ext_modules=[], zip_safe=False, license="BSD 3-Clause" )
0.412175
0.067393
from typing import List from .device import DeviceModel from .gate import GateModel from .room import RoomModel from .sampleData import SampleDataModel from .reciveData import ReciveDataModel import json import time import copy #Recive data format #{"Gate":"BRAMKA2","Device":"DEVICE1","RSSI":-27} class TestDataModel: def __init__(self, dev: DeviceModel, gates: List[GateModel], room: RoomModel, samples=[]): self.recive_data = None self.device = dev self.gates = gates self.room = room self.sample_data_list = samples if len(samples) == 0: self.addStartSamples() def addSample(self, data): try: self.recive_data = ReciveDataModel(data["Gate"], data["Device"], data["RSSI"], time.strftime("%Y%m%d%H%M%S")) except Exception as e: print(e) return # Zwracanie id bramki w z której są dane number_gate = 0 for g in self.gates: if g.name == self.recive_data.gate_name: break else: number_gate += 1 if number_gate > len(self.gates): print("Not search gate {} in list {}".format(g.name, self.gates)) return last_sample = copy.deepcopy(self.sample_data_list[-1]) last_sample.samples[number_gate] = self.recive_data.rssi actual_sample = SampleDataModel(self.recive_data.time, last_sample.samples) self.sample_data_list.append(actual_sample) def getJson(self): return {"Room":self.room.getJsonModel(), "Device":self.device.getJson(), "Gates": [g.getJson() for g in self.gates], "Samples":[s.getJson() for s in self.sample_data_list]} def getJsonText(self): return json.dumps(self.getJson()) def addStartSamples(self): iter_gates = len(self.gates) for i in range(iter_gates): sample = SampleDataModel(time.strftime("%Y%m%d%H%M%S"), [0 for x in range(iter_gates)]) self.sample_data_list.append(sample) #Properties @property def gates(self): return self._gates @gates.setter def gates(self, g): if len(g) < 3: raise Exception('To few gates') else: self._gates = g def __str__(self): return self.getJsonText()
src/db_interface/testData.py
from typing import List from .device import DeviceModel from .gate import GateModel from .room import RoomModel from .sampleData import SampleDataModel from .reciveData import ReciveDataModel import json import time import copy #Recive data format #{"Gate":"BRAMKA2","Device":"DEVICE1","RSSI":-27} class TestDataModel: def __init__(self, dev: DeviceModel, gates: List[GateModel], room: RoomModel, samples=[]): self.recive_data = None self.device = dev self.gates = gates self.room = room self.sample_data_list = samples if len(samples) == 0: self.addStartSamples() def addSample(self, data): try: self.recive_data = ReciveDataModel(data["Gate"], data["Device"], data["RSSI"], time.strftime("%Y%m%d%H%M%S")) except Exception as e: print(e) return # Zwracanie id bramki w z której są dane number_gate = 0 for g in self.gates: if g.name == self.recive_data.gate_name: break else: number_gate += 1 if number_gate > len(self.gates): print("Not search gate {} in list {}".format(g.name, self.gates)) return last_sample = copy.deepcopy(self.sample_data_list[-1]) last_sample.samples[number_gate] = self.recive_data.rssi actual_sample = SampleDataModel(self.recive_data.time, last_sample.samples) self.sample_data_list.append(actual_sample) def getJson(self): return {"Room":self.room.getJsonModel(), "Device":self.device.getJson(), "Gates": [g.getJson() for g in self.gates], "Samples":[s.getJson() for s in self.sample_data_list]} def getJsonText(self): return json.dumps(self.getJson()) def addStartSamples(self): iter_gates = len(self.gates) for i in range(iter_gates): sample = SampleDataModel(time.strftime("%Y%m%d%H%M%S"), [0 for x in range(iter_gates)]) self.sample_data_list.append(sample) #Properties @property def gates(self): return self._gates @gates.setter def gates(self, g): if len(g) < 3: raise Exception('To few gates') else: self._gates = g def __str__(self): return self.getJsonText()
0.529507
0.133387
import re,json,datetime,requests,encodings,os,weather,random from multiprocessing import Process from flask import Flask from flask import request import function,Baidu_Text_transAPI def send_private_msg(user_id, message, group_id='', auto_escape='False'): user_id = str(user_id) message = str(message) group_id = str(group_id) if group_id == '': # 私聊 sand_message_user = "http://127.0.0.1:5700/" + "send_private_msg?" + "user_id=" + user_id + "&" + "message=" + message + "&" + "auto_ecscape=" + auto_escape return_user = requests.post(sand_message_user) else: # 通过群发 sand_message_user = "http://127.0.0.1:5700/" + "send_private_msg?" + "user_id=" + user_id + "&" + "group_id=" + group_id + "&" + "message=" + message + "&" + "auto_ecscape=" + auto_escape return_user = requests.post(sand_message_user) return return_user # 发送群信息 def send_group_msg(group_id, message, auto_escape=''): group_id = str(group_id) message = str(message) sand_message_user = "http://127.0.0.1:5700/" + "send_group_msg?" + "group_id=" + group_id + "&" + "message=" + message + "&" + "auto_ecscape=" + auto_escape return_user = requests.post(sand_message_user) return return_user # 发送合并转发 ( 群 ) def send_group_forward_msg(group_id, messages): sand_message_user = "http://127.0.0.1:5700/" + "send_group_forward_msg?" + "group_id=" + group_id + "&" + "message=" + messages # 发送消息 # TODO 发送信息还在写 def send_msg(message,user_id='', group_id='', message_type='', auto_escape=''): #sand_message_user = pass # 撤回消息 def delete_msg(message_id): sand_message_user = "http://127.0.0.1:5700/" + "delete_msg?" + "message_id=" + message_id return_user = requests.post(sand_message_user) return return_user # 获取消息 def get_msg(message_id): sand_message_user = "http://127.0.0.1:5700/" + "set_group_kick?" + "message_id=" + message_id return_user = requests.post(sand_message_user) return return_user # 这里是json信息,需要解析 """ 响应数据 字段 类型 说明 message_id int32 消息id real_id int32 消息真实id sender object 发送者 time int32 发送时间 message message 消息内容 raw_message message 原始消息内容 """ # 获取合并转发内容 def get_forward_msg(message_id): sand_message_user = "http://127.0.0.1:5700/" + "get_forward_msg?" + "message_id=" + message_id return_user = requests.post(sand_message_user) return return_user # 此处同上 # 获取图片信息 def get_image(file): sand_message_user = "http://127.0.0.1:5700/" + "get_image?" + "file=" + file return_user = requests.post(sand_message_user) return return_user # 群组踢人 def set_group_kick(group_id, user_id, reject_add_request='false'): sand_message_user = "http://127.0.0.1:5700/" + "set_group_kick?" + "group_if=" + group_id + "&" + "user_id=" + user_id + "&" + "reject_add_request=" + reject_add_request return_user = requests.post(sand_message_user) return return_user # 群组单人禁言 def set_group_ban(group_id, user_id, duration='30 * 60'): # 最后一个参数为禁言时间,单位s,0秒表示取消禁言 sand_message_user = "http://127.0.0.1:5700/" + "set_group_ban?" + "group_id=" + group_id + "&" + "user_id=" + user_id + "&" + "duration=" + duration return_user = requests.post(sand_message_user) # 无响应数据 #晚间10:00报时加天气预报 def weather_sand(user_id, message, group_id='', auto_escape='False'): message = weather.return_main() user_id = str(user_id) message = str(message) group_id = str(group_id) if group_id == '': # 私聊 sand_message_user = "http://127.0.0.1:5700/" + "send_private_msg?" + "user_id=" + user_id + "&" + "message=" + message + "&" + "auto_ecscape=" + auto_escape return_user = requests.post(sand_message_user) else: # 通过群发 sand_message_user = "http://127.0.0.1:5700/" + "send_private_msg?" + "user_id=" + user_id + "&" + "group_id=" + group_id + "&" + "message=" + message + "&" + "auto_ecscape=" + auto_escape return_user = requests.post(sand_message_user) return return_user app = Flask(__name__) @app.route("/", methods=["GET", "POST"]) def hello_world(): global time_i main_into = request.json post_type = main_into["post_type"] if post_type == "message": function.log_in(str(main_into)) message_input = main_into["message"] message_type = main_into["message_type"] check = str(filter(main_into, message_type)) with open('json__/main.json', 'r', encoding='utf-8') as main_json: main_json_0 = json.load(main_json) for key_0 in main_json_0: value_0 = main_json_0[key_0] if "g" in key_0: mode_0 = value_0["mode"] type_0 = mode_0["type"] get_msg_0 = value_0["get_msg"] from_0 = mode_0["from"] if from_0 == "all": if type_0 == "include": if get_msg_0 in message_input: event_0 = value_0["event"] if event_0 == "g-s": sand_msg_0 = value_0["return_msg"] if message_type == "group": group_id = main_into["group_id"] return_0 = send_group_msg(group_id, sand_msg_0) elif message_type == "private": user_id = main_into["user_id"] return_0 = send_private_msg(user_id, sand_msg_0) else: pass else: pass elif type_0 == "exact": if get_msg_0 == message_input: event_0 = value_0["event"] if event_0 == "g-s": sand_msg_0 = value_0["return_msg"] if message_type == "group": group_id = main_into["group_id"] return_0 = send_group_msg(group_id, sand_msg_0) elif message_type == "private": user_id = main_into["user_id"] return_0 = send_private_msg(user_id, sand_msg_0) else: pass else: pass else: # TODO 这里要加其他的mode pass elif from_0 == "private": pass elif from_0 == "group": pass else: print("WRROW") else: pass if message_input == "/help": if message_type == "group": group_id = main_into["group_id"] message_out = "欢迎使用机器人小鸽(目前处于测试开发阶段)\n现有功能:\n1.AI(差不多可以用)\n2.签到(也在开发)\n3.天气预报(输入/天气即可获取)\n4.翻译(格式:/翻译:balabala(目前仅支持中翻英)\n#更多功能测试中,还未上线,有建议可以在空间下留言(格式:/留言:balabala)" return_0 = send_group_msg(group_id, message_out) else: pass elif message_input == "签到123456": now_time = datetime.datetime.now().strftime('%R') now_time_hour = datetime.datetime.now().strftime('%H') now_time_hour_print = int(now_time_hour[-1]) ran_nub = str(random.randint(1, 9)) if 0 <= now_time_hour_print < 6: time_i = "time1" elif 6 <= now_time_hour_print < 12: time_i = "time2" elif 12 <= now_time_hour_print < 18: time_i = "time3" elif 18 <= now_time_hour_print <= 24: time_i = "time4" else: print("ERROW:79") time_0 = time_i with open('json/yuju.json', 'r') as yuju: yuju_input = json.load(yuju) input_msg1 = yuju_input["qiandao"] input_msg2 = input_msg1[time_0] input_msg3 = input_msg2[ran_nub] if message_type == "group": group_id = main_into["group_id"] message_out = input_msg3 return_0 = send_group_msg(group_id, message_out) else: pass elif message_input == "/天气": message_out = weather.main() if message_type == "group": group_id = main_into["group_id"] return_0 = send_group_msg(group_id, message_out) else: user_id = main_into["user_id"] return_0 = send_private_msg(user_id, message_out) elif "/留言:" in message_input: with open('liuyan.txt', 'a') as liuyan: if message_type == "private": user_id = main_into["user_id"] write_into = "from:" + str(user_id) + "\n" + "message:" + str(message_input) write_into.replace('/留言:', '') liuyan.write(write_into) message_out = "留言添加成功" return_0 = send_private_msg(user_id, message_out) else: pass elif "/fy/" in message_input: query_0 = message_input.replace('/fy/', '') return_ans = Baidu_Text_transAPI.transport(query_0) return_ans2 = json.loads(return_ans) ans_msg = return_ans2["trans_result"] ans_msg_src = ans_msg[0]["src"] ans_msg_dst = ans_msg[0]["dst"] if message_type == "private": user_id = main_into["user_id"] message_out = "翻译:" + ans_msg_src + "\n" + "结果:" + ans_msg_dst return_0 = send_private_msg(user_id, message_out) else: group_id = main_into["group_id"] user_id = main_into["user_id"] message_out = "[CQ:at,qq=" + str( user_id) + "]" + "\n" + "翻译:" + ans_msg_src + "\n" + "结果:" + ans_msg_dst return_0 = send_group_msg(group_id, message_out) elif message_input == "/get_p_0": message_out_1 = function.get_p_p_2() if message_out_1 == "ERROR": print("ERROW") message_out_0 = "错误" else: message_out_0 = str(message_out_1) message_out = "[CQ:image,file=" + message_out_0 + ",type=show,id=40000]" print(message_out) if message_type == "group": group_id = main_into["group_id"] return_0 = send_group_msg(group_id, message_out) elif message_type == "private": user_id = main_into["user_id"] return_0 = send_private_msg(user_id, message_out) elif message_input == "": pass elif message_input == "": pass elif message_input == "": pass elif message_input == "": pass elif message_input == "": pass elif message_input == "": pass elif message_input == "": pass elif "小鸽" in message_input: if message_type == "group": group_id = main_into["group_id"] message_input1 = message_input.replace("小鸽", "") message_out = function.ai_msg2(message_input1) if str(message_out) == "None": message_out = function.ai_msg(message_input) else: pass return_0 = send_group_msg(group_id, message_out) else: pass else: if message_type == "private": user_id = function.main_into["user_id"] try: message_input1 = message_input.replace("小鸽", "") except: pass message_out = function.ai_msg2(message_input) if str(message_out) == "None": message_out = function.ai_msg(message_input) else: pass return_0 = send_private_msg(user_id, message_out) else: pass else: pass return '' if __name__ == '__main__': app.run(host='127.0.0.1',port=5701,debug=False)
try.py
import re,json,datetime,requests,encodings,os,weather,random from multiprocessing import Process from flask import Flask from flask import request import function,Baidu_Text_transAPI def send_private_msg(user_id, message, group_id='', auto_escape='False'): user_id = str(user_id) message = str(message) group_id = str(group_id) if group_id == '': # 私聊 sand_message_user = "http://127.0.0.1:5700/" + "send_private_msg?" + "user_id=" + user_id + "&" + "message=" + message + "&" + "auto_ecscape=" + auto_escape return_user = requests.post(sand_message_user) else: # 通过群发 sand_message_user = "http://127.0.0.1:5700/" + "send_private_msg?" + "user_id=" + user_id + "&" + "group_id=" + group_id + "&" + "message=" + message + "&" + "auto_ecscape=" + auto_escape return_user = requests.post(sand_message_user) return return_user # 发送群信息 def send_group_msg(group_id, message, auto_escape=''): group_id = str(group_id) message = str(message) sand_message_user = "http://127.0.0.1:5700/" + "send_group_msg?" + "group_id=" + group_id + "&" + "message=" + message + "&" + "auto_ecscape=" + auto_escape return_user = requests.post(sand_message_user) return return_user # 发送合并转发 ( 群 ) def send_group_forward_msg(group_id, messages): sand_message_user = "http://127.0.0.1:5700/" + "send_group_forward_msg?" + "group_id=" + group_id + "&" + "message=" + messages # 发送消息 # TODO 发送信息还在写 def send_msg(message,user_id='', group_id='', message_type='', auto_escape=''): #sand_message_user = pass # 撤回消息 def delete_msg(message_id): sand_message_user = "http://127.0.0.1:5700/" + "delete_msg?" + "message_id=" + message_id return_user = requests.post(sand_message_user) return return_user # 获取消息 def get_msg(message_id): sand_message_user = "http://127.0.0.1:5700/" + "set_group_kick?" + "message_id=" + message_id return_user = requests.post(sand_message_user) return return_user # 这里是json信息,需要解析 """ 响应数据 字段 类型 说明 message_id int32 消息id real_id int32 消息真实id sender object 发送者 time int32 发送时间 message message 消息内容 raw_message message 原始消息内容 """ # 获取合并转发内容 def get_forward_msg(message_id): sand_message_user = "http://127.0.0.1:5700/" + "get_forward_msg?" + "message_id=" + message_id return_user = requests.post(sand_message_user) return return_user # 此处同上 # 获取图片信息 def get_image(file): sand_message_user = "http://127.0.0.1:5700/" + "get_image?" + "file=" + file return_user = requests.post(sand_message_user) return return_user # 群组踢人 def set_group_kick(group_id, user_id, reject_add_request='false'): sand_message_user = "http://127.0.0.1:5700/" + "set_group_kick?" + "group_if=" + group_id + "&" + "user_id=" + user_id + "&" + "reject_add_request=" + reject_add_request return_user = requests.post(sand_message_user) return return_user # 群组单人禁言 def set_group_ban(group_id, user_id, duration='30 * 60'): # 最后一个参数为禁言时间,单位s,0秒表示取消禁言 sand_message_user = "http://127.0.0.1:5700/" + "set_group_ban?" + "group_id=" + group_id + "&" + "user_id=" + user_id + "&" + "duration=" + duration return_user = requests.post(sand_message_user) # 无响应数据 #晚间10:00报时加天气预报 def weather_sand(user_id, message, group_id='', auto_escape='False'): message = weather.return_main() user_id = str(user_id) message = str(message) group_id = str(group_id) if group_id == '': # 私聊 sand_message_user = "http://127.0.0.1:5700/" + "send_private_msg?" + "user_id=" + user_id + "&" + "message=" + message + "&" + "auto_ecscape=" + auto_escape return_user = requests.post(sand_message_user) else: # 通过群发 sand_message_user = "http://127.0.0.1:5700/" + "send_private_msg?" + "user_id=" + user_id + "&" + "group_id=" + group_id + "&" + "message=" + message + "&" + "auto_ecscape=" + auto_escape return_user = requests.post(sand_message_user) return return_user app = Flask(__name__) @app.route("/", methods=["GET", "POST"]) def hello_world(): global time_i main_into = request.json post_type = main_into["post_type"] if post_type == "message": function.log_in(str(main_into)) message_input = main_into["message"] message_type = main_into["message_type"] check = str(filter(main_into, message_type)) with open('json__/main.json', 'r', encoding='utf-8') as main_json: main_json_0 = json.load(main_json) for key_0 in main_json_0: value_0 = main_json_0[key_0] if "g" in key_0: mode_0 = value_0["mode"] type_0 = mode_0["type"] get_msg_0 = value_0["get_msg"] from_0 = mode_0["from"] if from_0 == "all": if type_0 == "include": if get_msg_0 in message_input: event_0 = value_0["event"] if event_0 == "g-s": sand_msg_0 = value_0["return_msg"] if message_type == "group": group_id = main_into["group_id"] return_0 = send_group_msg(group_id, sand_msg_0) elif message_type == "private": user_id = main_into["user_id"] return_0 = send_private_msg(user_id, sand_msg_0) else: pass else: pass elif type_0 == "exact": if get_msg_0 == message_input: event_0 = value_0["event"] if event_0 == "g-s": sand_msg_0 = value_0["return_msg"] if message_type == "group": group_id = main_into["group_id"] return_0 = send_group_msg(group_id, sand_msg_0) elif message_type == "private": user_id = main_into["user_id"] return_0 = send_private_msg(user_id, sand_msg_0) else: pass else: pass else: # TODO 这里要加其他的mode pass elif from_0 == "private": pass elif from_0 == "group": pass else: print("WRROW") else: pass if message_input == "/help": if message_type == "group": group_id = main_into["group_id"] message_out = "欢迎使用机器人小鸽(目前处于测试开发阶段)\n现有功能:\n1.AI(差不多可以用)\n2.签到(也在开发)\n3.天气预报(输入/天气即可获取)\n4.翻译(格式:/翻译:balabala(目前仅支持中翻英)\n#更多功能测试中,还未上线,有建议可以在空间下留言(格式:/留言:balabala)" return_0 = send_group_msg(group_id, message_out) else: pass elif message_input == "签到123456": now_time = datetime.datetime.now().strftime('%R') now_time_hour = datetime.datetime.now().strftime('%H') now_time_hour_print = int(now_time_hour[-1]) ran_nub = str(random.randint(1, 9)) if 0 <= now_time_hour_print < 6: time_i = "time1" elif 6 <= now_time_hour_print < 12: time_i = "time2" elif 12 <= now_time_hour_print < 18: time_i = "time3" elif 18 <= now_time_hour_print <= 24: time_i = "time4" else: print("ERROW:79") time_0 = time_i with open('json/yuju.json', 'r') as yuju: yuju_input = json.load(yuju) input_msg1 = yuju_input["qiandao"] input_msg2 = input_msg1[time_0] input_msg3 = input_msg2[ran_nub] if message_type == "group": group_id = main_into["group_id"] message_out = input_msg3 return_0 = send_group_msg(group_id, message_out) else: pass elif message_input == "/天气": message_out = weather.main() if message_type == "group": group_id = main_into["group_id"] return_0 = send_group_msg(group_id, message_out) else: user_id = main_into["user_id"] return_0 = send_private_msg(user_id, message_out) elif "/留言:" in message_input: with open('liuyan.txt', 'a') as liuyan: if message_type == "private": user_id = main_into["user_id"] write_into = "from:" + str(user_id) + "\n" + "message:" + str(message_input) write_into.replace('/留言:', '') liuyan.write(write_into) message_out = "留言添加成功" return_0 = send_private_msg(user_id, message_out) else: pass elif "/fy/" in message_input: query_0 = message_input.replace('/fy/', '') return_ans = Baidu_Text_transAPI.transport(query_0) return_ans2 = json.loads(return_ans) ans_msg = return_ans2["trans_result"] ans_msg_src = ans_msg[0]["src"] ans_msg_dst = ans_msg[0]["dst"] if message_type == "private": user_id = main_into["user_id"] message_out = "翻译:" + ans_msg_src + "\n" + "结果:" + ans_msg_dst return_0 = send_private_msg(user_id, message_out) else: group_id = main_into["group_id"] user_id = main_into["user_id"] message_out = "[CQ:at,qq=" + str( user_id) + "]" + "\n" + "翻译:" + ans_msg_src + "\n" + "结果:" + ans_msg_dst return_0 = send_group_msg(group_id, message_out) elif message_input == "/get_p_0": message_out_1 = function.get_p_p_2() if message_out_1 == "ERROR": print("ERROW") message_out_0 = "错误" else: message_out_0 = str(message_out_1) message_out = "[CQ:image,file=" + message_out_0 + ",type=show,id=40000]" print(message_out) if message_type == "group": group_id = main_into["group_id"] return_0 = send_group_msg(group_id, message_out) elif message_type == "private": user_id = main_into["user_id"] return_0 = send_private_msg(user_id, message_out) elif message_input == "": pass elif message_input == "": pass elif message_input == "": pass elif message_input == "": pass elif message_input == "": pass elif message_input == "": pass elif message_input == "": pass elif "小鸽" in message_input: if message_type == "group": group_id = main_into["group_id"] message_input1 = message_input.replace("小鸽", "") message_out = function.ai_msg2(message_input1) if str(message_out) == "None": message_out = function.ai_msg(message_input) else: pass return_0 = send_group_msg(group_id, message_out) else: pass else: if message_type == "private": user_id = function.main_into["user_id"] try: message_input1 = message_input.replace("小鸽", "") except: pass message_out = function.ai_msg2(message_input) if str(message_out) == "None": message_out = function.ai_msg(message_input) else: pass return_0 = send_private_msg(user_id, message_out) else: pass else: pass return '' if __name__ == '__main__': app.run(host='127.0.0.1',port=5701,debug=False)
0.07922
0.047492
Modifiers = { u'PR':0x0002, u'PB':0x0001, u'PRO':0x000, u'AB':0x0400, u'ST':0x0008, u'FN':0x0010, # don't think there are any with these values u'OP':0x8000, # optional u'HN':0x10000, # harness u'GN':0x20000, # generator u'AT':0x40000, # adt } Operators = { u'OR':u'||', u'AND':u'&&', u'BINOR':u'|', u'BINAND':u'&', u'XOR':u'^', u'EQUALS':u'==', u'NOTEQUALS':u'!=', u'LESS':u'<', u'GREATER':u'>', u'LESSEQUALS':u'<=', u'GREATEREQUALS':u'>=', u'LSHIFT':u'<<', u'RSIGNEDSHIFT':u'>>', u'RUNSIGNEDSHIFT':u'>>>', u'PLUS':u'+', u'MINUS':u'-', u'TIMES':u'*', u'DIVIDE':u'/', u'REMAINDER':u'%', } AssignOperators = { u'ASSIGN':u'=', u'STAR':u'*=', u'SLASH':u'/=', u'REM':u'%=', u'PLUS':u'+=', u'MINUS':u'-=', u'LSHIFT':u'<<=', u'RSIGNEDSHIFT':u'>>=', u'RUNSIGNEDSHIFT':u'>>>=', u'AND':u'&=', u'XOR':u'^=', u'OR':u'|=', # expand for Sketch u'_STAR':u'*', u'_SLASH':u'/', u'_REM':u'%', u'_PLUS':u'+', u'_MINUS':u'-', u'_LSHIFT':u'<<', u'_RSIGNEDSHIFT':u'>>', u'_RUNSIGNEDSHIFT':u'>>>', u'_AND':u'&', u'_XOR':u'^', u'_OR':u'|', } field = { u"@t": u"FieldDeclaration", u"type": { u"@t": u"ReferenceType", u"type": { u"@t": u"ClassOrInterfaceType", u"name": u"A", }, }, u"variables": { u"@e": [ { u"@t": u"VariableDeclarator", u"id": { u"name": u"a", }, } ] }, } JAVA_LANG = [ # interfaces u'java.lang.Appendable', u'java.lang.AutoCloseable', u'java.lang.CharSequence', u'java.lang.Cloneable', u'java.lang.Comparable', u'java.lang.Iterable', u'java.lang.Readable', u'java.lang.Runnable', # u'java.lang.Thread$UncaughtExceptionHandler', # classes u'java.lang.Boolean', u'java.lang.Byte', u'java.lang.Character', # u'java.lang.Character$Subset', # u'java.lang.Character$UnicodeBlock' u'java.lang.Class', u'java.lang.ClassLoader', u'java.lang.ClassValue', u'java.lang.Compiler', u'java.lang.Double', u'java.lang.Enum', u'java.lang.Float', u'java.lang.InheritableThreadLocal', u'java.lang.Integer', u'java.lang.Long', u'java.lang.Math', u'java.lang.Number', # u'java.lang.Object', u'java.lang.Package', u'java.lang.Process', u'java.lang.ProcessBuilder', # u'java.lang.ProcessBuilder$Redirect', u'java.lang.Runtime', u'java.lang.RuntimePermission', u'java.lang.SecurityManager', u'java.lang.Short', u'java.lang.StackTraceElement', u'java.lang.StrictMath', u'java.lang.String', u'java.lang.StringBuffer', u'java.lang.StringBuilder', u'java.lang.System', u'java.lang.Thread', u'java.lang.ThreadGroup', u'java.lang.ThreadLocal', u'java.lang.Throwable', u'java.lang.Void', ] DESCRIPTOR_TYPES = { u'B': u'byte', # signed byte u'C': u'char', # Unicode character code point in the Basic Multilingual Plane, encoded with UTF-16 u'D': u'double', # double-precision floating-point value u'F': u'float', # single-precision floating-point value u'I': u'int', # integer u'J': u'long', # long integer u'L': u'ClassName', # ;referencean instance of class ClassName u'S': u'short', # signed short u'V': u'void', # void u'Z': u'boolean', # true or false u'[': u'reference', # one array dimension } PRIMITIVES = [u'void', u'bit', u'boolean', u'this', u'char', u'byte', u'short', u'int', u'long', u'float', u'double',] def _import(): from .importdeclaration import ImportDeclaration from .body.classorinterfacedeclaration import ClassOrInterfaceDeclaration from .body.fielddeclaration import FieldDeclaration from .body.methoddeclaration import MethodDeclaration from .body.axiomdeclaration import AxiomDeclaration from .expr.nameexpr import NameExpr from .expr.qualifiednameexpr import QualifiedNameExpr from .type.referencetype import ReferenceType from .comments.javadoccomment import JavadocComment from .comments.linecomment import LineComment from .comments.blockcomment import BlockComment return locals()
jskparser/ast/__init__.py
Modifiers = { u'PR':0x0002, u'PB':0x0001, u'PRO':0x000, u'AB':0x0400, u'ST':0x0008, u'FN':0x0010, # don't think there are any with these values u'OP':0x8000, # optional u'HN':0x10000, # harness u'GN':0x20000, # generator u'AT':0x40000, # adt } Operators = { u'OR':u'||', u'AND':u'&&', u'BINOR':u'|', u'BINAND':u'&', u'XOR':u'^', u'EQUALS':u'==', u'NOTEQUALS':u'!=', u'LESS':u'<', u'GREATER':u'>', u'LESSEQUALS':u'<=', u'GREATEREQUALS':u'>=', u'LSHIFT':u'<<', u'RSIGNEDSHIFT':u'>>', u'RUNSIGNEDSHIFT':u'>>>', u'PLUS':u'+', u'MINUS':u'-', u'TIMES':u'*', u'DIVIDE':u'/', u'REMAINDER':u'%', } AssignOperators = { u'ASSIGN':u'=', u'STAR':u'*=', u'SLASH':u'/=', u'REM':u'%=', u'PLUS':u'+=', u'MINUS':u'-=', u'LSHIFT':u'<<=', u'RSIGNEDSHIFT':u'>>=', u'RUNSIGNEDSHIFT':u'>>>=', u'AND':u'&=', u'XOR':u'^=', u'OR':u'|=', # expand for Sketch u'_STAR':u'*', u'_SLASH':u'/', u'_REM':u'%', u'_PLUS':u'+', u'_MINUS':u'-', u'_LSHIFT':u'<<', u'_RSIGNEDSHIFT':u'>>', u'_RUNSIGNEDSHIFT':u'>>>', u'_AND':u'&', u'_XOR':u'^', u'_OR':u'|', } field = { u"@t": u"FieldDeclaration", u"type": { u"@t": u"ReferenceType", u"type": { u"@t": u"ClassOrInterfaceType", u"name": u"A", }, }, u"variables": { u"@e": [ { u"@t": u"VariableDeclarator", u"id": { u"name": u"a", }, } ] }, } JAVA_LANG = [ # interfaces u'java.lang.Appendable', u'java.lang.AutoCloseable', u'java.lang.CharSequence', u'java.lang.Cloneable', u'java.lang.Comparable', u'java.lang.Iterable', u'java.lang.Readable', u'java.lang.Runnable', # u'java.lang.Thread$UncaughtExceptionHandler', # classes u'java.lang.Boolean', u'java.lang.Byte', u'java.lang.Character', # u'java.lang.Character$Subset', # u'java.lang.Character$UnicodeBlock' u'java.lang.Class', u'java.lang.ClassLoader', u'java.lang.ClassValue', u'java.lang.Compiler', u'java.lang.Double', u'java.lang.Enum', u'java.lang.Float', u'java.lang.InheritableThreadLocal', u'java.lang.Integer', u'java.lang.Long', u'java.lang.Math', u'java.lang.Number', # u'java.lang.Object', u'java.lang.Package', u'java.lang.Process', u'java.lang.ProcessBuilder', # u'java.lang.ProcessBuilder$Redirect', u'java.lang.Runtime', u'java.lang.RuntimePermission', u'java.lang.SecurityManager', u'java.lang.Short', u'java.lang.StackTraceElement', u'java.lang.StrictMath', u'java.lang.String', u'java.lang.StringBuffer', u'java.lang.StringBuilder', u'java.lang.System', u'java.lang.Thread', u'java.lang.ThreadGroup', u'java.lang.ThreadLocal', u'java.lang.Throwable', u'java.lang.Void', ] DESCRIPTOR_TYPES = { u'B': u'byte', # signed byte u'C': u'char', # Unicode character code point in the Basic Multilingual Plane, encoded with UTF-16 u'D': u'double', # double-precision floating-point value u'F': u'float', # single-precision floating-point value u'I': u'int', # integer u'J': u'long', # long integer u'L': u'ClassName', # ;referencean instance of class ClassName u'S': u'short', # signed short u'V': u'void', # void u'Z': u'boolean', # true or false u'[': u'reference', # one array dimension } PRIMITIVES = [u'void', u'bit', u'boolean', u'this', u'char', u'byte', u'short', u'int', u'long', u'float', u'double',] def _import(): from .importdeclaration import ImportDeclaration from .body.classorinterfacedeclaration import ClassOrInterfaceDeclaration from .body.fielddeclaration import FieldDeclaration from .body.methoddeclaration import MethodDeclaration from .body.axiomdeclaration import AxiomDeclaration from .expr.nameexpr import NameExpr from .expr.qualifiednameexpr import QualifiedNameExpr from .type.referencetype import ReferenceType from .comments.javadoccomment import JavadocComment from .comments.linecomment import LineComment from .comments.blockcomment import BlockComment return locals()
0.401219
0.146789
import click import torchvision.models.resnet as resnet from artlearn.common_utils import ( LOG_DIR, MODEL_DIR, get_dataloaders, ArtistLearner ) @click.command() @click.option('--mode', type=str, default='sgd', help='Which optimizer you wish to use, currently supports ' 'SGD and ADAM. Default is SGD.') @click.option('-e', '--epochs', type=int, default=80, help='Number of epochs with which to train. Default is 80.') @click.option('-l', '--lr', type=float, default=1e-3, help='The learning rate to use for the optimizer. ' 'Default is 1e-3.') @click.option('-m', '--momentum', type=float, default=0.9, help='If using SGD, the momentum to use. Default is 0.9.') @click.option('-a', '--log-after', type=int, default=80, help='Number of iterations within an epoch to log out stats ' 'after. Default is 80.') @click.option('--log-path', envvar='ART_LOG_PATH', type=str, default=LOG_DIR, help='Absolute path to write logs out to.') @click.option('--model-path', envvar='ART_MODEL_PATH', type=str, default=MODEL_DIR, help='Absolute path to write model files out to.') @click.option('-n', '--name', type=str, help='Name override for the model and log files. Otherwise, ' 'named after its parameters in the form: ' '{mode}_e_{epochs}_lr_{lr}_m_{momentum}') @click.option('-p', '--pretrained', is_flag=True) def train(mode, epochs, lr, momentum, log_after, log_path, model_path, name, pretrained): train, test, val = get_dataloaders() network = resnet.resnet18(pretrained=pretrained) learner = ArtistLearner(network, mode, epochs, train, test, val, lr=lr, momentum=momentum, log_after=log_after, log_path=log_path, model_path=model_path, model_name=name) learner.train_and_validate() def main(): train() if __name__ == '__main__': main()
artlearn/cli/command.py
import click import torchvision.models.resnet as resnet from artlearn.common_utils import ( LOG_DIR, MODEL_DIR, get_dataloaders, ArtistLearner ) @click.command() @click.option('--mode', type=str, default='sgd', help='Which optimizer you wish to use, currently supports ' 'SGD and ADAM. Default is SGD.') @click.option('-e', '--epochs', type=int, default=80, help='Number of epochs with which to train. Default is 80.') @click.option('-l', '--lr', type=float, default=1e-3, help='The learning rate to use for the optimizer. ' 'Default is 1e-3.') @click.option('-m', '--momentum', type=float, default=0.9, help='If using SGD, the momentum to use. Default is 0.9.') @click.option('-a', '--log-after', type=int, default=80, help='Number of iterations within an epoch to log out stats ' 'after. Default is 80.') @click.option('--log-path', envvar='ART_LOG_PATH', type=str, default=LOG_DIR, help='Absolute path to write logs out to.') @click.option('--model-path', envvar='ART_MODEL_PATH', type=str, default=MODEL_DIR, help='Absolute path to write model files out to.') @click.option('-n', '--name', type=str, help='Name override for the model and log files. Otherwise, ' 'named after its parameters in the form: ' '{mode}_e_{epochs}_lr_{lr}_m_{momentum}') @click.option('-p', '--pretrained', is_flag=True) def train(mode, epochs, lr, momentum, log_after, log_path, model_path, name, pretrained): train, test, val = get_dataloaders() network = resnet.resnet18(pretrained=pretrained) learner = ArtistLearner(network, mode, epochs, train, test, val, lr=lr, momentum=momentum, log_after=log_after, log_path=log_path, model_path=model_path, model_name=name) learner.train_and_validate() def main(): train() if __name__ == '__main__': main()
0.751648
0.109777
import logging import unittest from webkitpy.common.system.filesystem_mock import MockFileSystem from webkitpy.common.system.executive_mock import MockExecutive2 from webkitpy.common.system.outputcapture import OutputCapture from webkitpy.common.system.systemhost_mock import MockSystemHost from webkitpy.port import Port from webkitpy.port.server_process_mock import MockServerProcess from webkitpy.port.xvfbdriver import XvfbDriver from webkitpy.tool.mocktool import MockOptions _log = logging.getLogger(__name__) class XvfbDriverTest(unittest.TestCase): def make_driver(self, worker_number=0, xorg_running=False, executive=None): port = Port(MockSystemHost(log_executive=True, executive=executive), 'xvfbdrivertestport', options=MockOptions(configuration='Release')) port._config.build_directory = lambda configuration: "/mock-build" port._test_runner_process_constructor = MockServerProcess if xorg_running: port._executive._running_pids['Xorg'] = 108 driver = XvfbDriver(port, worker_number=worker_number, pixel_tests=True) driver._startup_delay_secs = 0 driver._xvfb_screen_depth = lambda: '24' driver._xvfb_pipe = lambda: (3, 4) driver._xvfb_read_display_id = lambda x: 1 driver._xvfb_close_pipe = lambda p: None driver._port_server_environment = port.setup_environ_for_server(port.driver_name()) return driver def cleanup_driver(self, driver): # Setting _xvfb_process member to None is necessary as the Driver object is stopped on deletion, # killing the Xvfb process if present. Thus, this method should only be called from tests that do not # intend to test the behavior of XvfbDriver.stop. driver._xvfb_process = None def assertDriverStartSuccessful(self, driver, expected_logs, expected_display, pixel_tests=False): OutputCapture().assert_outputs(self, driver.start, [pixel_tests, []], expected_logs=expected_logs) self.assertTrue(driver._server_process.started) self.assertEqual(driver._server_process.env['DISPLAY'], expected_display) self.assertEqual(driver._server_process.env['GDK_BACKEND'], 'x11') def test_start(self): driver = self.make_driver() expected_logs = ("MOCK popen: ['Xvfb', '-displayfd', '4', '-screen', '0', '1024x768x24', '-nolisten', 'tcp'], env=%s\n" % driver._port_server_environment) self.assertDriverStartSuccessful(driver, expected_logs=expected_logs, expected_display=":1") self.cleanup_driver(driver) def test_start_arbitrary_worker_number(self): driver = self.make_driver(worker_number=17) expected_logs = ("MOCK popen: ['Xvfb', '-displayfd', '4', '-screen', '0', '1024x768x24', '-nolisten', 'tcp'], env=%s\n" % driver._port_server_environment) self.assertDriverStartSuccessful(driver, expected_logs=expected_logs, expected_display=":1", pixel_tests=True) self.cleanup_driver(driver) def test_stop(self): port = Port(MockSystemHost(log_executive=True), 'xvfbdrivertestport', options=MockOptions(configuration='Release')) port._executive.kill_process = lambda x: _log.info("MOCK kill_process pid: " + str(x)) driver = XvfbDriver(port, worker_number=0, pixel_tests=True) class FakeXvfbProcess(object): pid = 1234 driver._xvfb_process = FakeXvfbProcess() expected_logs = "MOCK kill_process pid: 1234\n" OutputCapture().assert_outputs(self, driver.stop, [], expected_logs=expected_logs) self.assertIsNone(driver._xvfb_process)
Tools/Scripts/webkitpy/port/xvfbdriver_unittest.py
import logging import unittest from webkitpy.common.system.filesystem_mock import MockFileSystem from webkitpy.common.system.executive_mock import MockExecutive2 from webkitpy.common.system.outputcapture import OutputCapture from webkitpy.common.system.systemhost_mock import MockSystemHost from webkitpy.port import Port from webkitpy.port.server_process_mock import MockServerProcess from webkitpy.port.xvfbdriver import XvfbDriver from webkitpy.tool.mocktool import MockOptions _log = logging.getLogger(__name__) class XvfbDriverTest(unittest.TestCase): def make_driver(self, worker_number=0, xorg_running=False, executive=None): port = Port(MockSystemHost(log_executive=True, executive=executive), 'xvfbdrivertestport', options=MockOptions(configuration='Release')) port._config.build_directory = lambda configuration: "/mock-build" port._test_runner_process_constructor = MockServerProcess if xorg_running: port._executive._running_pids['Xorg'] = 108 driver = XvfbDriver(port, worker_number=worker_number, pixel_tests=True) driver._startup_delay_secs = 0 driver._xvfb_screen_depth = lambda: '24' driver._xvfb_pipe = lambda: (3, 4) driver._xvfb_read_display_id = lambda x: 1 driver._xvfb_close_pipe = lambda p: None driver._port_server_environment = port.setup_environ_for_server(port.driver_name()) return driver def cleanup_driver(self, driver): # Setting _xvfb_process member to None is necessary as the Driver object is stopped on deletion, # killing the Xvfb process if present. Thus, this method should only be called from tests that do not # intend to test the behavior of XvfbDriver.stop. driver._xvfb_process = None def assertDriverStartSuccessful(self, driver, expected_logs, expected_display, pixel_tests=False): OutputCapture().assert_outputs(self, driver.start, [pixel_tests, []], expected_logs=expected_logs) self.assertTrue(driver._server_process.started) self.assertEqual(driver._server_process.env['DISPLAY'], expected_display) self.assertEqual(driver._server_process.env['GDK_BACKEND'], 'x11') def test_start(self): driver = self.make_driver() expected_logs = ("MOCK popen: ['Xvfb', '-displayfd', '4', '-screen', '0', '1024x768x24', '-nolisten', 'tcp'], env=%s\n" % driver._port_server_environment) self.assertDriverStartSuccessful(driver, expected_logs=expected_logs, expected_display=":1") self.cleanup_driver(driver) def test_start_arbitrary_worker_number(self): driver = self.make_driver(worker_number=17) expected_logs = ("MOCK popen: ['Xvfb', '-displayfd', '4', '-screen', '0', '1024x768x24', '-nolisten', 'tcp'], env=%s\n" % driver._port_server_environment) self.assertDriverStartSuccessful(driver, expected_logs=expected_logs, expected_display=":1", pixel_tests=True) self.cleanup_driver(driver) def test_stop(self): port = Port(MockSystemHost(log_executive=True), 'xvfbdrivertestport', options=MockOptions(configuration='Release')) port._executive.kill_process = lambda x: _log.info("MOCK kill_process pid: " + str(x)) driver = XvfbDriver(port, worker_number=0, pixel_tests=True) class FakeXvfbProcess(object): pid = 1234 driver._xvfb_process = FakeXvfbProcess() expected_logs = "MOCK kill_process pid: 1234\n" OutputCapture().assert_outputs(self, driver.stop, [], expected_logs=expected_logs) self.assertIsNone(driver._xvfb_process)
0.596786
0.260683
# standard library imports from string import ascii_uppercase, digits from typing import Tuple # third-party imports from iso3166 import countries # local imports from .identifier import Identifier from .luhn import luhn from .micutils import get_mic_record _ALPHABET = digits + ascii_uppercase class MIC(Identifier): """Market Identifier Code A unique identification code used to identify securities trading exchanges, regulated and non-regulated trading markets. Each MIC is a four alpha character code, defined in ISO 10383. """ __slots__ = () # noinspection PyMissingConstructor def __init__(self, mic: str) -> None: """ Args: mic (str): string representation of the MIC Returns: :class:`MIC` instance Raises: TypeError: given `mic` is not an instance of str ValueError: given `mic` not found in the registry """ if not isinstance(mic, str): raise TypeError("Argument must be instance of 'str'.") mic = mic.strip() try: get_mic_record(mic) except KeyError: raise ValueError(f"Unknown MIC: '{mic}'.") self._id = mic def __str__(self) -> str: """str(self)""" return self._id class ISIN(Identifier): """International Securities Identification Number An International Securities Identification Number uniquely identifies a tradable financial asset, a.k.a security. As defined in ISO 6166, each ISIN consists of a two-letter ISO 3166-1 Country Code for the issuing country, followed by nine alpha-numeric characters (the National Securities Identifying Number, or NSIN, which identifies the security), and one numerical check digit, calculated by the Luhn algorithm. """ __slots__ = () @staticmethod def calc_check_digit(country_code: str, nsin: str) -> str: """Calculate ISIN check digit.""" return str(luhn(country_code + nsin)) @property def country_code(self) -> str: """Return the ISIN's Country Code.""" return self._id[:2] @property def check_digit(self) -> str: """Return the ISIN's check digits.""" return self._id[-1] @property def nsin(self) -> str: """Return the ISIN's National Securities Identifying Number.""" return self._id[2:-1] def elements(self) -> Tuple[str, str, str]: """Return the ISIN's Country Code, National Securities Identifying Number and check digit as tuple.""" return self.country_code, self.nsin, self.check_digit # noinspection PyMissingConstructor def __init__(self, *args: str) -> None: """Instances of :class:`ISIN` can be created in two ways, by providing a Unicode string representation of an ISIN or by providing a country code and a national securities identifying number. **1. Form** Args: isin (str): string representation of an ISIN Returns: instance of :class:`ISIN` Raises: TypeError: given `isin` is not a `Unicode string` ValueError: given `isin` contains an unknown country code ValueError: given `isin` contains a wrong check digit ValueError: given `isin` must be 12 characters long ValueError: given `isin` contains invalid character(s) **2. Form** Args: country_code (str): 2-character country code according to ISO 3166 nsin (str): national securities identifying number Returns: instance of :class:`ISIN` Raises: TypeError: invalid number of arguments TypeError: given `country_code` is not a `Unicode string` ValueError: given `country_code` contains an invalid or unknown country code TypeError: given `nsin` is not a `Unicode string` ValueError: length of given `nsin` not valid ValueError: given `nsin` contains invalid character(s) """ n_args = len(args) if n_args == 1: arg0 = args[0] if not isinstance(arg0, str): raise TypeError("Argument must be instance of 'str'.") arg0 = arg0.strip() if len(arg0) != 12: raise ValueError('Invalid ISIN format: ' 'given string must be 12 characters long.') country_code = arg0[:2] try: countries.get(country_code) except KeyError: raise ValueError(f"Unknown country code: '{country_code}'.") nsin = arg0[2:-1] check_digit = self.__class__.calc_check_digit(country_code, nsin) if check_digit != arg0[-1]: raise ValueError("Wrong check digit; should be " f"'{check_digit}'.") self._id = arg0 elif n_args == 2: arg0 = args[0] if not isinstance(arg0, str): raise TypeError("Country code must be instance of 'str'.") if len(arg0) != 2: raise ValueError("Country code must be a 2-character string.") country_code = arg0 try: countries.get(country_code) except KeyError: raise ValueError(f"Unknown country code: '{country_code}'.") arg1 = args[1] if isinstance(arg1, str): len_nsin = len(arg1) if len_nsin == 9: nsin = arg1 elif 6 <= len_nsin < 9: nsin = arg1.rjust(9, '0') else: raise ValueError("Given NSIN must contain between 6 and 9" " characters.") else: raise TypeError("Given nsin must be instance of 'str'.") check_digit = self.__class__.calc_check_digit(country_code, nsin) self._id = ''.join((country_code, nsin, check_digit)) else: raise TypeError('Invalid number of arguments.') def __str__(self) -> str: """str(self)""" return self._id
src/identifiers/finance.py
# standard library imports from string import ascii_uppercase, digits from typing import Tuple # third-party imports from iso3166 import countries # local imports from .identifier import Identifier from .luhn import luhn from .micutils import get_mic_record _ALPHABET = digits + ascii_uppercase class MIC(Identifier): """Market Identifier Code A unique identification code used to identify securities trading exchanges, regulated and non-regulated trading markets. Each MIC is a four alpha character code, defined in ISO 10383. """ __slots__ = () # noinspection PyMissingConstructor def __init__(self, mic: str) -> None: """ Args: mic (str): string representation of the MIC Returns: :class:`MIC` instance Raises: TypeError: given `mic` is not an instance of str ValueError: given `mic` not found in the registry """ if not isinstance(mic, str): raise TypeError("Argument must be instance of 'str'.") mic = mic.strip() try: get_mic_record(mic) except KeyError: raise ValueError(f"Unknown MIC: '{mic}'.") self._id = mic def __str__(self) -> str: """str(self)""" return self._id class ISIN(Identifier): """International Securities Identification Number An International Securities Identification Number uniquely identifies a tradable financial asset, a.k.a security. As defined in ISO 6166, each ISIN consists of a two-letter ISO 3166-1 Country Code for the issuing country, followed by nine alpha-numeric characters (the National Securities Identifying Number, or NSIN, which identifies the security), and one numerical check digit, calculated by the Luhn algorithm. """ __slots__ = () @staticmethod def calc_check_digit(country_code: str, nsin: str) -> str: """Calculate ISIN check digit.""" return str(luhn(country_code + nsin)) @property def country_code(self) -> str: """Return the ISIN's Country Code.""" return self._id[:2] @property def check_digit(self) -> str: """Return the ISIN's check digits.""" return self._id[-1] @property def nsin(self) -> str: """Return the ISIN's National Securities Identifying Number.""" return self._id[2:-1] def elements(self) -> Tuple[str, str, str]: """Return the ISIN's Country Code, National Securities Identifying Number and check digit as tuple.""" return self.country_code, self.nsin, self.check_digit # noinspection PyMissingConstructor def __init__(self, *args: str) -> None: """Instances of :class:`ISIN` can be created in two ways, by providing a Unicode string representation of an ISIN or by providing a country code and a national securities identifying number. **1. Form** Args: isin (str): string representation of an ISIN Returns: instance of :class:`ISIN` Raises: TypeError: given `isin` is not a `Unicode string` ValueError: given `isin` contains an unknown country code ValueError: given `isin` contains a wrong check digit ValueError: given `isin` must be 12 characters long ValueError: given `isin` contains invalid character(s) **2. Form** Args: country_code (str): 2-character country code according to ISO 3166 nsin (str): national securities identifying number Returns: instance of :class:`ISIN` Raises: TypeError: invalid number of arguments TypeError: given `country_code` is not a `Unicode string` ValueError: given `country_code` contains an invalid or unknown country code TypeError: given `nsin` is not a `Unicode string` ValueError: length of given `nsin` not valid ValueError: given `nsin` contains invalid character(s) """ n_args = len(args) if n_args == 1: arg0 = args[0] if not isinstance(arg0, str): raise TypeError("Argument must be instance of 'str'.") arg0 = arg0.strip() if len(arg0) != 12: raise ValueError('Invalid ISIN format: ' 'given string must be 12 characters long.') country_code = arg0[:2] try: countries.get(country_code) except KeyError: raise ValueError(f"Unknown country code: '{country_code}'.") nsin = arg0[2:-1] check_digit = self.__class__.calc_check_digit(country_code, nsin) if check_digit != arg0[-1]: raise ValueError("Wrong check digit; should be " f"'{check_digit}'.") self._id = arg0 elif n_args == 2: arg0 = args[0] if not isinstance(arg0, str): raise TypeError("Country code must be instance of 'str'.") if len(arg0) != 2: raise ValueError("Country code must be a 2-character string.") country_code = arg0 try: countries.get(country_code) except KeyError: raise ValueError(f"Unknown country code: '{country_code}'.") arg1 = args[1] if isinstance(arg1, str): len_nsin = len(arg1) if len_nsin == 9: nsin = arg1 elif 6 <= len_nsin < 9: nsin = arg1.rjust(9, '0') else: raise ValueError("Given NSIN must contain between 6 and 9" " characters.") else: raise TypeError("Given nsin must be instance of 'str'.") check_digit = self.__class__.calc_check_digit(country_code, nsin) self._id = ''.join((country_code, nsin, check_digit)) else: raise TypeError('Invalid number of arguments.') def __str__(self) -> str: """str(self)""" return self._id
0.915639
0.540985
import numpy as np import matplotlib.pyplot as plt from . import transform def plot_pulse(pulse, m=1000, ptype='ex', phase='linear', omega_range=[-np.pi, np.pi], linewidth=2, fontsize='x-large', labelsize='large'): figs = [] n = len(pulse) fig, ax = plt.subplots() ax.plot(pulse.real, label=r'$B_{1, \mathrm{x}}$', linewidth=linewidth) ax.plot(pulse.imag, label=r'$B_{1, \mathrm{y}}$', linewidth=linewidth) ax.set_title(r'$B_1$ (Energy={0:.3g}, Peak={1:.3g})'.format( np.sum(np.abs(pulse)**2), np.max(np.abs(pulse))), fontsize=fontsize) ax.set_xlabel('Time', fontsize=fontsize) ax.legend(fontsize=fontsize) ax.yaxis.set_tick_params(labelsize=labelsize) ax.xaxis.set_tick_params(labelsize=labelsize) figs.append(fig) omega = np.linspace(omega_range[0], omega_range[1], m) psi_z = np.exp(-1j * np.outer(omega, np.arange(n))) a, b = transform.forward_slr(pulse) alpha = psi_z @ a beta = psi_z @ b if ptype == 'se': m_xy = beta**2 m_xy *= np.exp(1j * omega * (n - 1)) fig, ax = plt.subplots() ax.set_title(r'$M_{\mathrm{xy}}$') ax.set_xlabel(r'$\omega$ [radian]') ax.plot(omega, np.real(m_xy), label=r'$M_{\mathrm{x}}$', linewidth=linewidth) ax.plot(omega, np.imag(m_xy), label=r'$M_{\mathrm{y}}$', linewidth=linewidth) ax.legend(fontsize=fontsize) ax.yaxis.set_tick_params(labelsize=labelsize) ax.xaxis.set_tick_params(labelsize=labelsize) figs.append(fig) else: m_xy = 2 * alpha.conjugate() * beta m_z = np.abs(alpha)**2 - np.abs(beta)**2 if phase == 'linear': m_xy *= np.exp(1j * omega * n / 2) fig, ax = plt.subplots() ax.set_title(r'$|M_{\mathrm{xy}}|$', fontsize=fontsize) ax.set_xlabel(r'$\omega$ [radian]', fontsize=fontsize) ax.plot(omega, np.abs(m_xy), linewidth=linewidth) ax.yaxis.set_tick_params(labelsize=labelsize) ax.xaxis.set_tick_params(labelsize=labelsize) figs.append(fig) fig, ax = plt.subplots() ax.set_title(r'$\angle M_{\mathrm{xy}}$', fontsize=fontsize) ax.set_xlabel(r'$\omega$ [radian]', fontsize=fontsize) ax.plot(omega, np.angle(m_xy), linewidth=linewidth) ax.yaxis.set_tick_params(labelsize=labelsize) ax.xaxis.set_tick_params(labelsize=labelsize) figs.append(fig) fig, ax = plt.subplots() ax.set_title(r'$M_{\mathrm{z}}$', fontsize=fontsize) ax.set_xlabel(r'$\omega$ [radian]', fontsize=fontsize) ax.plot(omega, m_z, linewidth=linewidth) ax.yaxis.set_tick_params(labelsize=labelsize) ax.xaxis.set_tick_params(labelsize=labelsize) figs.append(fig) return figs def plot_slr_pulses(pulse_slr, pulse_slfrank, m=1000, ptype='ex', phase='linear', omega_range=[-np.pi, np.pi], fontsize='x-large', labelsize='large'): n = len(pulse_slr) fig, axs = plt.subplots(2, 2) axs[0][0].plot(pulse_slr.real, linewidth=0.5, label='SLR', color='tab:orange') axs[0][0].plot(pulse_slfrank.real, linewidth=0.5, label='SLfRank', color='tab:blue') axs[0][0].set_title(r'$B_{1}$') axs[0][0].set_xlabel('Time') axs[0][0].legend() omega = np.linspace(omega_range[0], omega_range[1], m) psi_z = np.exp(-1j * np.outer(omega, np.arange(n))) a_slr, b_slr = transform.forward_slr(pulse_slr) alpha_slr = psi_z @ a_slr beta_slr = psi_z @ b_slr a_slfrank, b_slfrank = transform.forward_slr(pulse_slfrank) alpha_slfrank = psi_z @ a_slfrank beta_slfrank = psi_z @ b_slfrank if ptype == 'se': m_xy_slr = beta_slr**2 m_xy_slr *= np.exp(1j * omega * (n - 1)) m_z_slr = 2 * np.imag(alpha_slr * beta_slr) m_xy_slfrank = beta_slfrank**2 m_xy_slfrank *= np.exp(1j * omega * (n - 1)) m_z_slfrank = 2 * np.imag(alpha_slfrank * beta_slfrank) axs[1][0].set_title(r'$M_{\mathrm{x}}$') axs[1][0].set_xlabel(r'$\omega$ [radian]') axs[1][0].plot(omega, np.real(m_xy_slr), linewidth=0.5, label=r'SLR', color='tab:orange') axs[1][0].plot(omega, np.real(m_xy_slfrank), linewidth=0.5, label='SLfRank', color='tab:blue') axs[1][1].set_title(r'$M_{\mathrm{y}}$') axs[1][1].set_xlabel(r'$\omega$ [radian]') axs[1][1].plot(omega, np.imag(m_xy_slr), linewidth=0.5, label=r'SLR', color='tab:orange') axs[1][1].plot(omega, np.imag(m_xy_slfrank), linewidth=0.5, label='SLfRank', color='tab:blue') axs[0][1].set_title(r'$M_{\mathrm{z}}$') axs[0][1].set_xlabel(r'$\omega$ [radian]') axs[0][1].plot(omega, m_z_slr, linewidth=0.5, label=r'SLR', color='tab:orange') axs[0][1].plot(omega, m_z_slfrank, linewidth=0.5, label='SLfRank', color='tab:blue') else: m_xy_slr = 2 * alpha_slr.conjugate() * beta_slr m_z_slr = np.abs(alpha_slr)**2 - np.abs(beta_slr)**2 m_xy_slfrank = 2 * alpha_slfrank.conjugate() * beta_slfrank m_z_slfrank = np.abs(alpha_slfrank)**2 - np.abs(beta_slfrank)**2 if phase == 'linear': m_xy_slr *= np.exp(1j * omega * n / 2) m_xy_slfrank *= np.exp(1j * omega * n / 2) axs[1][0].set_title(r'$|M_{\mathrm{xy}}|$') axs[1][0].set_xlabel(r'$\omega$ [radian]') axs[1][0].plot(omega, np.abs(m_xy_slr), linewidth=0.5, label=r'SLR', color='tab:orange') axs[1][0].plot(omega, np.abs(m_xy_slfrank), linewidth=0.5, label=r'SLfRank', color='tab:blue') axs[1][1].set_title(r'$\angle M_{\mathrm{xy}}$') axs[1][1].set_xlabel(r'$\omega$ [radian]') axs[1][1].plot(omega, np.angle(m_xy_slr), linewidth=0.5, label=r'SLR', color='tab:orange') axs[1][1].plot(omega, np.angle(m_xy_slfrank), linewidth=0.5, label=r'SLfRank', color='tab:blue') axs[0][1].set_title(r'$M_{\mathrm{z}}$') axs[0][1].set_xlabel(r'$\omega$ [radian]') axs[0][1].plot(omega, m_z_slr, linewidth=0.5, label=r'SLR', color='tab:orange') axs[0][1].plot(omega, m_z_slfrank, linewidth=0.5, label=r'SLfRank', color='tab:blue') return fig
slfrank/plot.py
import numpy as np import matplotlib.pyplot as plt from . import transform def plot_pulse(pulse, m=1000, ptype='ex', phase='linear', omega_range=[-np.pi, np.pi], linewidth=2, fontsize='x-large', labelsize='large'): figs = [] n = len(pulse) fig, ax = plt.subplots() ax.plot(pulse.real, label=r'$B_{1, \mathrm{x}}$', linewidth=linewidth) ax.plot(pulse.imag, label=r'$B_{1, \mathrm{y}}$', linewidth=linewidth) ax.set_title(r'$B_1$ (Energy={0:.3g}, Peak={1:.3g})'.format( np.sum(np.abs(pulse)**2), np.max(np.abs(pulse))), fontsize=fontsize) ax.set_xlabel('Time', fontsize=fontsize) ax.legend(fontsize=fontsize) ax.yaxis.set_tick_params(labelsize=labelsize) ax.xaxis.set_tick_params(labelsize=labelsize) figs.append(fig) omega = np.linspace(omega_range[0], omega_range[1], m) psi_z = np.exp(-1j * np.outer(omega, np.arange(n))) a, b = transform.forward_slr(pulse) alpha = psi_z @ a beta = psi_z @ b if ptype == 'se': m_xy = beta**2 m_xy *= np.exp(1j * omega * (n - 1)) fig, ax = plt.subplots() ax.set_title(r'$M_{\mathrm{xy}}$') ax.set_xlabel(r'$\omega$ [radian]') ax.plot(omega, np.real(m_xy), label=r'$M_{\mathrm{x}}$', linewidth=linewidth) ax.plot(omega, np.imag(m_xy), label=r'$M_{\mathrm{y}}$', linewidth=linewidth) ax.legend(fontsize=fontsize) ax.yaxis.set_tick_params(labelsize=labelsize) ax.xaxis.set_tick_params(labelsize=labelsize) figs.append(fig) else: m_xy = 2 * alpha.conjugate() * beta m_z = np.abs(alpha)**2 - np.abs(beta)**2 if phase == 'linear': m_xy *= np.exp(1j * omega * n / 2) fig, ax = plt.subplots() ax.set_title(r'$|M_{\mathrm{xy}}|$', fontsize=fontsize) ax.set_xlabel(r'$\omega$ [radian]', fontsize=fontsize) ax.plot(omega, np.abs(m_xy), linewidth=linewidth) ax.yaxis.set_tick_params(labelsize=labelsize) ax.xaxis.set_tick_params(labelsize=labelsize) figs.append(fig) fig, ax = plt.subplots() ax.set_title(r'$\angle M_{\mathrm{xy}}$', fontsize=fontsize) ax.set_xlabel(r'$\omega$ [radian]', fontsize=fontsize) ax.plot(omega, np.angle(m_xy), linewidth=linewidth) ax.yaxis.set_tick_params(labelsize=labelsize) ax.xaxis.set_tick_params(labelsize=labelsize) figs.append(fig) fig, ax = plt.subplots() ax.set_title(r'$M_{\mathrm{z}}$', fontsize=fontsize) ax.set_xlabel(r'$\omega$ [radian]', fontsize=fontsize) ax.plot(omega, m_z, linewidth=linewidth) ax.yaxis.set_tick_params(labelsize=labelsize) ax.xaxis.set_tick_params(labelsize=labelsize) figs.append(fig) return figs def plot_slr_pulses(pulse_slr, pulse_slfrank, m=1000, ptype='ex', phase='linear', omega_range=[-np.pi, np.pi], fontsize='x-large', labelsize='large'): n = len(pulse_slr) fig, axs = plt.subplots(2, 2) axs[0][0].plot(pulse_slr.real, linewidth=0.5, label='SLR', color='tab:orange') axs[0][0].plot(pulse_slfrank.real, linewidth=0.5, label='SLfRank', color='tab:blue') axs[0][0].set_title(r'$B_{1}$') axs[0][0].set_xlabel('Time') axs[0][0].legend() omega = np.linspace(omega_range[0], omega_range[1], m) psi_z = np.exp(-1j * np.outer(omega, np.arange(n))) a_slr, b_slr = transform.forward_slr(pulse_slr) alpha_slr = psi_z @ a_slr beta_slr = psi_z @ b_slr a_slfrank, b_slfrank = transform.forward_slr(pulse_slfrank) alpha_slfrank = psi_z @ a_slfrank beta_slfrank = psi_z @ b_slfrank if ptype == 'se': m_xy_slr = beta_slr**2 m_xy_slr *= np.exp(1j * omega * (n - 1)) m_z_slr = 2 * np.imag(alpha_slr * beta_slr) m_xy_slfrank = beta_slfrank**2 m_xy_slfrank *= np.exp(1j * omega * (n - 1)) m_z_slfrank = 2 * np.imag(alpha_slfrank * beta_slfrank) axs[1][0].set_title(r'$M_{\mathrm{x}}$') axs[1][0].set_xlabel(r'$\omega$ [radian]') axs[1][0].plot(omega, np.real(m_xy_slr), linewidth=0.5, label=r'SLR', color='tab:orange') axs[1][0].plot(omega, np.real(m_xy_slfrank), linewidth=0.5, label='SLfRank', color='tab:blue') axs[1][1].set_title(r'$M_{\mathrm{y}}$') axs[1][1].set_xlabel(r'$\omega$ [radian]') axs[1][1].plot(omega, np.imag(m_xy_slr), linewidth=0.5, label=r'SLR', color='tab:orange') axs[1][1].plot(omega, np.imag(m_xy_slfrank), linewidth=0.5, label='SLfRank', color='tab:blue') axs[0][1].set_title(r'$M_{\mathrm{z}}$') axs[0][1].set_xlabel(r'$\omega$ [radian]') axs[0][1].plot(omega, m_z_slr, linewidth=0.5, label=r'SLR', color='tab:orange') axs[0][1].plot(omega, m_z_slfrank, linewidth=0.5, label='SLfRank', color='tab:blue') else: m_xy_slr = 2 * alpha_slr.conjugate() * beta_slr m_z_slr = np.abs(alpha_slr)**2 - np.abs(beta_slr)**2 m_xy_slfrank = 2 * alpha_slfrank.conjugate() * beta_slfrank m_z_slfrank = np.abs(alpha_slfrank)**2 - np.abs(beta_slfrank)**2 if phase == 'linear': m_xy_slr *= np.exp(1j * omega * n / 2) m_xy_slfrank *= np.exp(1j * omega * n / 2) axs[1][0].set_title(r'$|M_{\mathrm{xy}}|$') axs[1][0].set_xlabel(r'$\omega$ [radian]') axs[1][0].plot(omega, np.abs(m_xy_slr), linewidth=0.5, label=r'SLR', color='tab:orange') axs[1][0].plot(omega, np.abs(m_xy_slfrank), linewidth=0.5, label=r'SLfRank', color='tab:blue') axs[1][1].set_title(r'$\angle M_{\mathrm{xy}}$') axs[1][1].set_xlabel(r'$\omega$ [radian]') axs[1][1].plot(omega, np.angle(m_xy_slr), linewidth=0.5, label=r'SLR', color='tab:orange') axs[1][1].plot(omega, np.angle(m_xy_slfrank), linewidth=0.5, label=r'SLfRank', color='tab:blue') axs[0][1].set_title(r'$M_{\mathrm{z}}$') axs[0][1].set_xlabel(r'$\omega$ [radian]') axs[0][1].plot(omega, m_z_slr, linewidth=0.5, label=r'SLR', color='tab:orange') axs[0][1].plot(omega, m_z_slfrank, linewidth=0.5, label=r'SLfRank', color='tab:blue') return fig
0.682891
0.657525
"""Command line options.""" import click from renku.core.errors import RenkuException from .git import set_git_isolation def install_completion(ctx, attr, value): # pragma: no cover """Install completion for the current shell.""" import click_completion.core if not value or ctx.resilient_parsing: return value shell, path = click_completion.core.install() click.secho("{0} completion installed in {1}".format(shell, path), fg="green") ctx.exit() option_isolation = click.option( "--isolation", is_flag=True, default=False, callback=lambda ctx, param, value: set_git_isolation(value), help="Set up the isolation for invoking of the given command.", ) def check_siblings(graph, outputs): """Check that all outputs have their siblings listed.""" siblings = set() for node in outputs: siblings |= graph.siblings(node) siblings = {node.path for node in siblings} missing = siblings - {node.path for node in outputs} missing = {m for m in missing if all(not m.startswith(node.path) for node in outputs)} if missing: msg = "Include the files above in the command " "or use the --with-siblings option." raise RenkuException( "There are missing output siblings:\n\n" "\t{0}\n\n{1}".format("\n\t".join(click.style(path, fg="red") for path in missing), msg,), ) return outputs def with_siblings(graph, outputs): """Include all missing siblings.""" siblings = set() for node in outputs: siblings |= graph.siblings(node) return siblings option_check_siblings = click.option( "--check-siblings", "siblings", flag_value=check_siblings, default=True, help=check_siblings.__doc__, ) option_with_siblings = click.option( "--with-siblings", "siblings", flag_value=with_siblings, default=True, help=with_siblings.__doc__, ) def option_siblings(func): """Combine siblings options.""" return option_check_siblings(option_with_siblings(func)) option_external_storage_requested = click.option( "external_storage_requested", "--external-storage/--no-external-storage", " /-S", is_flag=True, default=True, help="Use an external file storage service.", )
renku/core/commands/options.py
"""Command line options.""" import click from renku.core.errors import RenkuException from .git import set_git_isolation def install_completion(ctx, attr, value): # pragma: no cover """Install completion for the current shell.""" import click_completion.core if not value or ctx.resilient_parsing: return value shell, path = click_completion.core.install() click.secho("{0} completion installed in {1}".format(shell, path), fg="green") ctx.exit() option_isolation = click.option( "--isolation", is_flag=True, default=False, callback=lambda ctx, param, value: set_git_isolation(value), help="Set up the isolation for invoking of the given command.", ) def check_siblings(graph, outputs): """Check that all outputs have their siblings listed.""" siblings = set() for node in outputs: siblings |= graph.siblings(node) siblings = {node.path for node in siblings} missing = siblings - {node.path for node in outputs} missing = {m for m in missing if all(not m.startswith(node.path) for node in outputs)} if missing: msg = "Include the files above in the command " "or use the --with-siblings option." raise RenkuException( "There are missing output siblings:\n\n" "\t{0}\n\n{1}".format("\n\t".join(click.style(path, fg="red") for path in missing), msg,), ) return outputs def with_siblings(graph, outputs): """Include all missing siblings.""" siblings = set() for node in outputs: siblings |= graph.siblings(node) return siblings option_check_siblings = click.option( "--check-siblings", "siblings", flag_value=check_siblings, default=True, help=check_siblings.__doc__, ) option_with_siblings = click.option( "--with-siblings", "siblings", flag_value=with_siblings, default=True, help=with_siblings.__doc__, ) def option_siblings(func): """Combine siblings options.""" return option_check_siblings(option_with_siblings(func)) option_external_storage_requested = click.option( "external_storage_requested", "--external-storage/--no-external-storage", " /-S", is_flag=True, default=True, help="Use an external file storage service.", )
0.715722
0.276346
import os import tempfile import time import genomepy.utils import pysam import ananse.utils # prep test_dir = os.path.dirname(os.path.dirname(__file__)) outdir = os.path.join(test_dir, "output") genomepy.utils.mkdir_p(outdir) def write_file(filename, lines): with open(filename, "w") as f: for line in lines: if not line.endswith("\n"): line = line + "\n" f.write(line) def write_bam(filename, lines): tmp_sam = os.path.join(outdir, "tmp.sam") write_file(tmp_sam, lines) pysam.view(tmp_sam, "-b", "-o", filename, catch_stdout=False) genomepy.utils.rm_rf(tmp_sam) def compare_contents(file1, file2, ftype="bed"): if ftype == "bed": with open(file1) as f: contents1 = f.readlines() with open(file2) as f: contents2 = f.readlines() else: contents1 = pysam.view(file1) contents2 = pysam.view(file2) return contents1 == contents2 # test BED functions unsorted_bed = os.path.join(outdir, "unsorted.bed") write_file(unsorted_bed, ["chr1\t817046\t817246\n", "chr1\t778558\t778758\n"]) sorted_bed = os.path.join(outdir, "sorted.bed") write_file(sorted_bed, ["chr1\t778558\t778758\n", "chr1\t817046\t817246\n"]) second_bed = os.path.join(outdir, "second.bed") write_file(second_bed, ["chr1\t827457\t827657\n"]) def test_bed_sort(): assert not compare_contents(unsorted_bed, sorted_bed, ftype="bed") ananse.utils.bed_sort(unsorted_bed) assert compare_contents(unsorted_bed, sorted_bed, ftype="bed") def test_bed_merge(): merged_bed = os.path.join(outdir, "merged.bed") # 1 bed = nothing changes ananse.utils.bed_merge([sorted_bed], merged_bed) assert compare_contents(sorted_bed, merged_bed, ftype="bed") # >1 bed, same content ananse.utils.bed_merge([unsorted_bed, sorted_bed], merged_bed) assert compare_contents(sorted_bed, merged_bed, ftype="bed") with open(merged_bed) as mb: assert len(mb.readlines()) == 2 # >1 beds, different content ananse.utils.bed_merge([unsorted_bed, second_bed], merged_bed) with open(merged_bed) as mb: assert len(mb.readlines()) == 3 # test BAM functions h0 = "@HD VN:1.6 SO:coordinate" h1 = "@SQ SN:chr1 LN:50000" line1 = ( "read1 147 chr1 10003 40 11S90M = 10048 -46 " + "CCCTACCCTCTCCCTATCCCTAACCCTAACCCCAACCCTAACCCTATCCCCAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA " + "A77--7-7---7-7---A77---AA7----<7-AAJAA-7JJFF<--F-A-AFFFF<FJJJJF-AFJF7F-JJJFJFFFJFF<FJJJJFJJFJJFFFFFAA " ) line2 = ( "read2 83 chr1 10004 30 2S45M1D54M = 10074 -30 " + "ATCCCTAACCCTAACCCTAACCCTAACCCTACCCCTACCCCTAACCCAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT " + "--JAA7F-FAFA-7JJFA--F<7-FF<<FAF7<7F7A-FFAF7-FJJJFJJ----J<JFA-JAF7JFJFJF<<JFJF<JJJFFJJJAAAA-JFFFA-FAA- " ) line3 = ( "read3 163 chr1 10027 40 100M = 10032 105 " + "ACCCGAACCCTAACCCTAACCCTAACCCTAACCCGAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCAACCCTAACCCGAACCCA " + "AAFFFJJJJJJJJJJJFJJJFJJJFJFJJFJJJJ<-FJJFJAFFJA7AFAJJJJFJFJ-<F-AAJJ<FF7-J-AAJ--<JJJ--AAJ-77-AA-7A<-A- " ) unsorted_bam = os.path.join(outdir, "unsorted.bam") write_bam(unsorted_bam, [h0, h1, line2, line1]) sorted_bam = os.path.join(outdir, "sorted.bam") write_bam(sorted_bam, [h0, h1, line1, line2]) second_bam = os.path.join(outdir, "second.bam") write_bam(second_bam, [h0, h1, line3]) def test_bam_index(): ncores = os.cpu_count() # test max cores genomepy.utils.rm_rf(f"{sorted_bam}.bai") assert not os.path.exists(f"{sorted_bam}.bai") ananse.utils.bam_index(sorted_bam, ncore=ncores) assert os.path.exists(f"{sorted_bam}.bai") # test force t0 = os.path.getmtime(f"{sorted_bam}.bai") time.sleep(1) ananse.utils.bam_index(sorted_bam, force=False, ncore=ncores) t1 = os.path.getmtime(f"{sorted_bam}.bai") assert t0 == t1 ananse.utils.bam_index(sorted_bam, force=True, ncore=ncores) t1 = os.path.getmtime(f"{sorted_bam}.bai") assert t0 != t1 def test_bam_sort(): ncores = -999 # test min cores assert not compare_contents(sorted_bam, unsorted_bam, ftype="bam") ananse.utils.bam_sort(unsorted_bam, ncore=ncores) assert compare_contents(sorted_bam, unsorted_bam, ftype="bam") assert os.path.exists(f"{unsorted_bam}.bai") # bam is indexed # bam is identical to the already sorted bam ananse.utils.bam_index(sorted_bam, force=False) assert os.path.getsize(f"{unsorted_bam}.bai") == os.path.getsize( f"{sorted_bam}.bai" ) def test_bam_merge(): ncores = min(2, os.cpu_count()) # test average cores merged_bam = os.path.join(outdir, "merged.bam") # 1 bam: copy ananse.utils.bam_merge([sorted_bam], merged_bam, ncore=ncores) assert compare_contents(sorted_bam, merged_bam, ftype="bam") assert os.path.getsize(f"{sorted_bam}.bai") == os.path.getsize(f"{merged_bam}.bai") # >1 bam: merge ananse.utils.bam_merge([sorted_bam, second_bam], merged_bam, ncore=ncores) l1 = pysam.view(sorted_bam).strip().split("\n") l2 = pysam.view(second_bam).strip().split("\n") l3 = pysam.view(merged_bam).strip().split("\n") assert len(l1) + len(l2) == len(l3) == 3 def test_mosdepth(): bed_input = os.path.join(outdir, "mosdepth_input.bed") write_file(bed_input, ["chr1\t10003\t10203\n", "chr1\t10203\t10403\n"]) # bam = sorted & indexed (required) bam_input = os.path.join(outdir, "mosdepth_input.bam") write_bam(bam_input, [h0, h1, line1, line2, line3]) ananse.utils.bam_index(bam_input, ncore=os.cpu_count()) bed_output = os.path.join(outdir, "mosdepth_output.bed") ananse.utils.mosdepth(bed_input, bam_input, bed_output, ncore=1) with open(bed_output) as f: score = f.readlines()[0].strip().split("\t")[3] assert score == "1.00" # test other functions def test_cleanpath(): path = "./tests/continuous_integration/test_02_utils.py" expected = __file__ res = ananse.utils.cleanpath(path) assert res == expected path = "~/../.." expected = "/" res = ananse.utils.cleanpath(path) assert res == expected def test_mytmpdir(): tmpdir = ananse.utils.mytmpdir() assert os.path.exists(tmpdir) assert tempfile.gettempdir() in tmpdir def test_clean_tmp(): tmpdir = ananse.utils.mytmpdir() assert os.path.exists(tmpdir) ananse.utils.clean_tmp() assert not os.path.exists(tmpdir)
tests/continuous_integration/test_02_utils.py
import os import tempfile import time import genomepy.utils import pysam import ananse.utils # prep test_dir = os.path.dirname(os.path.dirname(__file__)) outdir = os.path.join(test_dir, "output") genomepy.utils.mkdir_p(outdir) def write_file(filename, lines): with open(filename, "w") as f: for line in lines: if not line.endswith("\n"): line = line + "\n" f.write(line) def write_bam(filename, lines): tmp_sam = os.path.join(outdir, "tmp.sam") write_file(tmp_sam, lines) pysam.view(tmp_sam, "-b", "-o", filename, catch_stdout=False) genomepy.utils.rm_rf(tmp_sam) def compare_contents(file1, file2, ftype="bed"): if ftype == "bed": with open(file1) as f: contents1 = f.readlines() with open(file2) as f: contents2 = f.readlines() else: contents1 = pysam.view(file1) contents2 = pysam.view(file2) return contents1 == contents2 # test BED functions unsorted_bed = os.path.join(outdir, "unsorted.bed") write_file(unsorted_bed, ["chr1\t817046\t817246\n", "chr1\t778558\t778758\n"]) sorted_bed = os.path.join(outdir, "sorted.bed") write_file(sorted_bed, ["chr1\t778558\t778758\n", "chr1\t817046\t817246\n"]) second_bed = os.path.join(outdir, "second.bed") write_file(second_bed, ["chr1\t827457\t827657\n"]) def test_bed_sort(): assert not compare_contents(unsorted_bed, sorted_bed, ftype="bed") ananse.utils.bed_sort(unsorted_bed) assert compare_contents(unsorted_bed, sorted_bed, ftype="bed") def test_bed_merge(): merged_bed = os.path.join(outdir, "merged.bed") # 1 bed = nothing changes ananse.utils.bed_merge([sorted_bed], merged_bed) assert compare_contents(sorted_bed, merged_bed, ftype="bed") # >1 bed, same content ananse.utils.bed_merge([unsorted_bed, sorted_bed], merged_bed) assert compare_contents(sorted_bed, merged_bed, ftype="bed") with open(merged_bed) as mb: assert len(mb.readlines()) == 2 # >1 beds, different content ananse.utils.bed_merge([unsorted_bed, second_bed], merged_bed) with open(merged_bed) as mb: assert len(mb.readlines()) == 3 # test BAM functions h0 = "@HD VN:1.6 SO:coordinate" h1 = "@SQ SN:chr1 LN:50000" line1 = ( "read1 147 chr1 10003 40 11S90M = 10048 -46 " + "CCCTACCCTCTCCCTATCCCTAACCCTAACCCCAACCCTAACCCTATCCCCAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA " + "A77--7-7---7-7---A77---AA7----<7-AAJAA-7JJFF<--F-A-AFFFF<FJJJJF-AFJF7F-JJJFJFFFJFF<FJJJJFJJFJJFFFFFAA " ) line2 = ( "read2 83 chr1 10004 30 2S45M1D54M = 10074 -30 " + "ATCCCTAACCCTAACCCTAACCCTAACCCTACCCCTACCCCTAACCCAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT " + "--JAA7F-FAFA-7JJFA--F<7-FF<<FAF7<7F7A-FFAF7-FJJJFJJ----J<JFA-JAF7JFJFJF<<JFJF<JJJFFJJJAAAA-JFFFA-FAA- " ) line3 = ( "read3 163 chr1 10027 40 100M = 10032 105 " + "ACCCGAACCCTAACCCTAACCCTAACCCTAACCCGAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCAACCCTAACCCGAACCCA " + "AAFFFJJJJJJJJJJJFJJJFJJJFJFJJFJJJJ<-FJJFJAFFJA7AFAJJJJFJFJ-<F-AAJJ<FF7-J-AAJ--<JJJ--AAJ-77-AA-7A<-A- " ) unsorted_bam = os.path.join(outdir, "unsorted.bam") write_bam(unsorted_bam, [h0, h1, line2, line1]) sorted_bam = os.path.join(outdir, "sorted.bam") write_bam(sorted_bam, [h0, h1, line1, line2]) second_bam = os.path.join(outdir, "second.bam") write_bam(second_bam, [h0, h1, line3]) def test_bam_index(): ncores = os.cpu_count() # test max cores genomepy.utils.rm_rf(f"{sorted_bam}.bai") assert not os.path.exists(f"{sorted_bam}.bai") ananse.utils.bam_index(sorted_bam, ncore=ncores) assert os.path.exists(f"{sorted_bam}.bai") # test force t0 = os.path.getmtime(f"{sorted_bam}.bai") time.sleep(1) ananse.utils.bam_index(sorted_bam, force=False, ncore=ncores) t1 = os.path.getmtime(f"{sorted_bam}.bai") assert t0 == t1 ananse.utils.bam_index(sorted_bam, force=True, ncore=ncores) t1 = os.path.getmtime(f"{sorted_bam}.bai") assert t0 != t1 def test_bam_sort(): ncores = -999 # test min cores assert not compare_contents(sorted_bam, unsorted_bam, ftype="bam") ananse.utils.bam_sort(unsorted_bam, ncore=ncores) assert compare_contents(sorted_bam, unsorted_bam, ftype="bam") assert os.path.exists(f"{unsorted_bam}.bai") # bam is indexed # bam is identical to the already sorted bam ananse.utils.bam_index(sorted_bam, force=False) assert os.path.getsize(f"{unsorted_bam}.bai") == os.path.getsize( f"{sorted_bam}.bai" ) def test_bam_merge(): ncores = min(2, os.cpu_count()) # test average cores merged_bam = os.path.join(outdir, "merged.bam") # 1 bam: copy ananse.utils.bam_merge([sorted_bam], merged_bam, ncore=ncores) assert compare_contents(sorted_bam, merged_bam, ftype="bam") assert os.path.getsize(f"{sorted_bam}.bai") == os.path.getsize(f"{merged_bam}.bai") # >1 bam: merge ananse.utils.bam_merge([sorted_bam, second_bam], merged_bam, ncore=ncores) l1 = pysam.view(sorted_bam).strip().split("\n") l2 = pysam.view(second_bam).strip().split("\n") l3 = pysam.view(merged_bam).strip().split("\n") assert len(l1) + len(l2) == len(l3) == 3 def test_mosdepth(): bed_input = os.path.join(outdir, "mosdepth_input.bed") write_file(bed_input, ["chr1\t10003\t10203\n", "chr1\t10203\t10403\n"]) # bam = sorted & indexed (required) bam_input = os.path.join(outdir, "mosdepth_input.bam") write_bam(bam_input, [h0, h1, line1, line2, line3]) ananse.utils.bam_index(bam_input, ncore=os.cpu_count()) bed_output = os.path.join(outdir, "mosdepth_output.bed") ananse.utils.mosdepth(bed_input, bam_input, bed_output, ncore=1) with open(bed_output) as f: score = f.readlines()[0].strip().split("\t")[3] assert score == "1.00" # test other functions def test_cleanpath(): path = "./tests/continuous_integration/test_02_utils.py" expected = __file__ res = ananse.utils.cleanpath(path) assert res == expected path = "~/../.." expected = "/" res = ananse.utils.cleanpath(path) assert res == expected def test_mytmpdir(): tmpdir = ananse.utils.mytmpdir() assert os.path.exists(tmpdir) assert tempfile.gettempdir() in tmpdir def test_clean_tmp(): tmpdir = ananse.utils.mytmpdir() assert os.path.exists(tmpdir) ananse.utils.clean_tmp() assert not os.path.exists(tmpdir)
0.375134
0.412767
from unittest.mock import Mock import pytest from fastapi import HTTPException, status from tests.unit.time_manager.helpers import get_token_from_user from time_manager.db.sql.user import User from time_manager.routers.common import get_user_dao, oauth2_scheme from time_manager.schemas.user import UserDB from time_manager.utils.auth import get_password_hash authorized_user = UserDB(id=1, username="AAA", hashed_password="a", email="a<EMAIL>") @pytest.mark.parametrize( "oauth2_result, dao_result, expected_status", [ ( HTTPException(status_code=status.HTTP_401_UNAUTHORIZED), [], status.HTTP_401_UNAUTHORIZED, ), ( get_token_from_user(user=authorized_user), [User(id=1, username="QWERTY", hashed_password="<PASSWORD>", email="a<EMAIL>")], status.HTTP_200_OK, ), ("", [], status.HTTP_401_UNAUTHORIZED), ( get_token_from_user(user=authorized_user), [], status.HTTP_401_UNAUTHORIZED, ), ], ) def test_logout(oauth2_result, dao_result, expected_status, client, app): mock_oath2_scheme = Mock() oauth2_throw = False if isinstance(oauth2_result, Exception): oauth2_throw = True mock_oath2_scheme.side_effect = oauth2_result else: mock_oath2_scheme.return_value = oauth2_result app.dependency_overrides[oauth2_scheme] = lambda: mock_oath2_scheme() dao = Mock() dao.filter.return_value = iter(dao_result) app.dependency_overrides[get_user_dao] = lambda: dao response = client.delete("/logout") assert mock_oath2_scheme.call_count == 1 # dao.filter is called only when the token is set in either # a header or a cookie assert dao.filter.call_count == 0 if oauth2_throw else 1 assert response.status_code == expected_status assert response.cookies.get("Authorization", default=None) is None @pytest.mark.parametrize( "credentials, expected_result, expected_status", [ ({"username": "u1", "assword": "p1"}, [], status.HTTP_422_UNPROCESSABLE_ENTITY), ({"username": "u1", "password": "p1"}, [], status.HTTP_401_UNAUTHORIZED), ( {"username": "u1", "password": "p1"}, [ User( id=1, username="u1", hashed_password=get_password_hash("p1"), email="a@a.a", ) ], status.HTTP_200_OK, ), ], ) def test_login(credentials, expected_result, expected_status, unauthorized_client, app): dao = Mock() dao.filter.return_value = iter(expected_result) app.dependency_overrides[get_user_dao] = lambda: dao response = unauthorized_client.post("/login", json=credentials) assert response.status_code == expected_status assert dao.call_count <= 1 if dao.call_count: assert dao.call_args.args[0].dict() == credentials if expected_status == status.HTTP_200_OK: assert response.cookies.get("Authorization", default=None) is not None assert "Bearer" in response.cookies["Authorization"]
tests/unit/time_manager/routers/test_auth.py
from unittest.mock import Mock import pytest from fastapi import HTTPException, status from tests.unit.time_manager.helpers import get_token_from_user from time_manager.db.sql.user import User from time_manager.routers.common import get_user_dao, oauth2_scheme from time_manager.schemas.user import UserDB from time_manager.utils.auth import get_password_hash authorized_user = UserDB(id=1, username="AAA", hashed_password="a", email="a<EMAIL>") @pytest.mark.parametrize( "oauth2_result, dao_result, expected_status", [ ( HTTPException(status_code=status.HTTP_401_UNAUTHORIZED), [], status.HTTP_401_UNAUTHORIZED, ), ( get_token_from_user(user=authorized_user), [User(id=1, username="QWERTY", hashed_password="<PASSWORD>", email="a<EMAIL>")], status.HTTP_200_OK, ), ("", [], status.HTTP_401_UNAUTHORIZED), ( get_token_from_user(user=authorized_user), [], status.HTTP_401_UNAUTHORIZED, ), ], ) def test_logout(oauth2_result, dao_result, expected_status, client, app): mock_oath2_scheme = Mock() oauth2_throw = False if isinstance(oauth2_result, Exception): oauth2_throw = True mock_oath2_scheme.side_effect = oauth2_result else: mock_oath2_scheme.return_value = oauth2_result app.dependency_overrides[oauth2_scheme] = lambda: mock_oath2_scheme() dao = Mock() dao.filter.return_value = iter(dao_result) app.dependency_overrides[get_user_dao] = lambda: dao response = client.delete("/logout") assert mock_oath2_scheme.call_count == 1 # dao.filter is called only when the token is set in either # a header or a cookie assert dao.filter.call_count == 0 if oauth2_throw else 1 assert response.status_code == expected_status assert response.cookies.get("Authorization", default=None) is None @pytest.mark.parametrize( "credentials, expected_result, expected_status", [ ({"username": "u1", "assword": "p1"}, [], status.HTTP_422_UNPROCESSABLE_ENTITY), ({"username": "u1", "password": "p1"}, [], status.HTTP_401_UNAUTHORIZED), ( {"username": "u1", "password": "p1"}, [ User( id=1, username="u1", hashed_password=get_password_hash("p1"), email="a@a.a", ) ], status.HTTP_200_OK, ), ], ) def test_login(credentials, expected_result, expected_status, unauthorized_client, app): dao = Mock() dao.filter.return_value = iter(expected_result) app.dependency_overrides[get_user_dao] = lambda: dao response = unauthorized_client.post("/login", json=credentials) assert response.status_code == expected_status assert dao.call_count <= 1 if dao.call_count: assert dao.call_args.args[0].dict() == credentials if expected_status == status.HTTP_200_OK: assert response.cookies.get("Authorization", default=None) is not None assert "Bearer" in response.cookies["Authorization"]
0.707607
0.298095
import pandas as pd import lightgbm as lgb from sklearn.metrics import roc_auc_score from Utils import Profiler from IPython.display import display from Estimators import LGBM profile = Profiler() profile.Start() print("Loading resampled train data") train_X = pd.read_csv("../input/AllData_v4_os.train") train_X.pop("Unnamed: 0") print("Loading resampled train labels") train_y = pd.read_csv("../input/AllData_v4_os.label") train_y = train_y.pop("TARGET") print("Loading resampled validation data") valid_X = pd.read_csv("../input/AllData_v4_os_valid.train") valid_X.pop("Unnamed: 0") print("Loading resampled validation labels") valid_y = pd.read_csv("../input/AllData_v4_os_valid.label") valid_y = valid_y.pop("TARGET") print("Loading application test data") test_X = pd.read_csv("../input/AllData_v4.test") print("train_y shape: " + str(train_y.shape)) print("train_X shape: " + str(train_X.shape)) print("valid_y shape: " + str(valid_y.shape)) print("valid_X shape: " + str(valid_X.shape)) print("test_X shape: " + str(test_X.shape)) lgb_train = lgb.Dataset(train_X, train_y) lgb_test = lgb.Dataset(valid_X) # Define estimator parameters params = {'task' :'train', 'objective' :'binary', 'learning_rate' :0.1, 'num_leaves' :31, 'max_depth' :8, 'min_data_in_leaf' :20, 'min_sum_hessian_in_leaf' :0.001, 'lambda_l1' :0, 'lambda_l2' :0, 'scale_pos_weight' :1, 'metric' :'auc', 'verbose' :-1} # Parameters that are to be supplied to cross-validation cv_params = { "train_set" : lgb_train, "num_boost_round" : 10000, "nfold" : 5, "early_stopping_rounds" : 50, "verbose_eval" : 10 } # Step 1 print("Performing Gridsearch Step-1") param_grid = {"num_leaves" : range(10,101,10)} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = gs_results # Step 2 print("Performing Gridsearch Step-2") param_grid = {"max_depth" : range(3,10,1)} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = pd.concat([gs_summary, gs_results], ignore_index=True) # Step 3 print("Performing Gridsearch Step-3") param_grid = {"min_data_in_leaf" : range(10,81,10)} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = pd.concat([gs_summary, gs_results], ignore_index=True) # Step 4 print("Performing Gridsearch Step-4") param_grid = {"lambda_l1" : [i/10.0 for i in range(0,8)]} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = pd.concat([gs_summary, gs_results], ignore_index=True) # Step 5 print("Performing Gridsearch Step-5") param_grid = {"lambda_l2" : [i/10.0 for i in range(0,8)]} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = pd.concat([gs_summary, gs_results], ignore_index=True) # Step 6 print("Performing Gridsearch Step-6") param_grid = {"scale_pos_weight" : [92/8, 1]} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = pd.concat([gs_summary, gs_results], ignore_index=True) # Step 7 print("Performing Gridsearch Step-7") param_grid = {"learning_rate" : [0.01,0.02, 0.03,0.05,0.08,0.1]} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = pd.concat([gs_summary, gs_results], ignore_index=True) print('All Iterations') display(gs_summary) print('Best parameters: ') best_cv = gs_results.loc[gs_results['result'].idxmax()] display(best_cv) profile.End() print('Time elapsed: %s mins' %str(profile.ElapsedMinutes)) # Save CV process gs_summary.to_csv('../AllData_v4_OS_LGBM_GS.csv') # Generate model by best iteration print("Model training started...") model = lgb.train(params=params, train_set=lgb_train, num_boost_round=int(best_cv[1]/0.8), verbose_eval=1) print("Model training completed...") # Save model for possible coded ensemble model.save_model('GridSearch/AllData_v4_OS_LGBM_Model', num_iteration=best_cv[1]) print("Predicting validation set...") valid_preds = model.predict(valid_X) print("Validation set prediction completed...") print("Predicting test set...") test_preds = model.predict(test_X) print("Test set prediction completed...") auc = roc_auc_score(valid_y, valid_preds) print("Validation AUC: " + str(auc)) valid_preds = pd.DataFrame(valid_preds) valid_preds.to_csv("GridSearch/AllData_v4_OS_GS_LGBM_ValidPreds.csv", index=False) sub = pd.read_csv('../input/sample_submission.csv') sub['TARGET'] = test_preds sub.to_csv('GridSearch/AllData_v4_OS_GS_LGBM_Preds.csv', index=False)
LightGBM_AllData_v4_OS_CV_GS.py
import pandas as pd import lightgbm as lgb from sklearn.metrics import roc_auc_score from Utils import Profiler from IPython.display import display from Estimators import LGBM profile = Profiler() profile.Start() print("Loading resampled train data") train_X = pd.read_csv("../input/AllData_v4_os.train") train_X.pop("Unnamed: 0") print("Loading resampled train labels") train_y = pd.read_csv("../input/AllData_v4_os.label") train_y = train_y.pop("TARGET") print("Loading resampled validation data") valid_X = pd.read_csv("../input/AllData_v4_os_valid.train") valid_X.pop("Unnamed: 0") print("Loading resampled validation labels") valid_y = pd.read_csv("../input/AllData_v4_os_valid.label") valid_y = valid_y.pop("TARGET") print("Loading application test data") test_X = pd.read_csv("../input/AllData_v4.test") print("train_y shape: " + str(train_y.shape)) print("train_X shape: " + str(train_X.shape)) print("valid_y shape: " + str(valid_y.shape)) print("valid_X shape: " + str(valid_X.shape)) print("test_X shape: " + str(test_X.shape)) lgb_train = lgb.Dataset(train_X, train_y) lgb_test = lgb.Dataset(valid_X) # Define estimator parameters params = {'task' :'train', 'objective' :'binary', 'learning_rate' :0.1, 'num_leaves' :31, 'max_depth' :8, 'min_data_in_leaf' :20, 'min_sum_hessian_in_leaf' :0.001, 'lambda_l1' :0, 'lambda_l2' :0, 'scale_pos_weight' :1, 'metric' :'auc', 'verbose' :-1} # Parameters that are to be supplied to cross-validation cv_params = { "train_set" : lgb_train, "num_boost_round" : 10000, "nfold" : 5, "early_stopping_rounds" : 50, "verbose_eval" : 10 } # Step 1 print("Performing Gridsearch Step-1") param_grid = {"num_leaves" : range(10,101,10)} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = gs_results # Step 2 print("Performing Gridsearch Step-2") param_grid = {"max_depth" : range(3,10,1)} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = pd.concat([gs_summary, gs_results], ignore_index=True) # Step 3 print("Performing Gridsearch Step-3") param_grid = {"min_data_in_leaf" : range(10,81,10)} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = pd.concat([gs_summary, gs_results], ignore_index=True) # Step 4 print("Performing Gridsearch Step-4") param_grid = {"lambda_l1" : [i/10.0 for i in range(0,8)]} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = pd.concat([gs_summary, gs_results], ignore_index=True) # Step 5 print("Performing Gridsearch Step-5") param_grid = {"lambda_l2" : [i/10.0 for i in range(0,8)]} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = pd.concat([gs_summary, gs_results], ignore_index=True) # Step 6 print("Performing Gridsearch Step-6") param_grid = {"scale_pos_weight" : [92/8, 1]} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = pd.concat([gs_summary, gs_results], ignore_index=True) # Step 7 print("Performing Gridsearch Step-7") param_grid = {"learning_rate" : [0.01,0.02, 0.03,0.05,0.08,0.1]} lgbm = LGBM(params) gs_results, params = lgbm.gridsearch(param_grid, cv_params) gs_summary = pd.concat([gs_summary, gs_results], ignore_index=True) print('All Iterations') display(gs_summary) print('Best parameters: ') best_cv = gs_results.loc[gs_results['result'].idxmax()] display(best_cv) profile.End() print('Time elapsed: %s mins' %str(profile.ElapsedMinutes)) # Save CV process gs_summary.to_csv('../AllData_v4_OS_LGBM_GS.csv') # Generate model by best iteration print("Model training started...") model = lgb.train(params=params, train_set=lgb_train, num_boost_round=int(best_cv[1]/0.8), verbose_eval=1) print("Model training completed...") # Save model for possible coded ensemble model.save_model('GridSearch/AllData_v4_OS_LGBM_Model', num_iteration=best_cv[1]) print("Predicting validation set...") valid_preds = model.predict(valid_X) print("Validation set prediction completed...") print("Predicting test set...") test_preds = model.predict(test_X) print("Test set prediction completed...") auc = roc_auc_score(valid_y, valid_preds) print("Validation AUC: " + str(auc)) valid_preds = pd.DataFrame(valid_preds) valid_preds.to_csv("GridSearch/AllData_v4_OS_GS_LGBM_ValidPreds.csv", index=False) sub = pd.read_csv('../input/sample_submission.csv') sub['TARGET'] = test_preds sub.to_csv('GridSearch/AllData_v4_OS_GS_LGBM_Preds.csv', index=False)
0.331228
0.141489
import unittest, sys from PyQt4 import QtCore, QtGui from datafinder.core.search_restriction import SearchRestrictionParser from datafinder.gui.user.dialogs.search_dialog.search_query_editor import SearchQueryEditor, SearchQueryAnalyzer __version__ = "$Revision-Id:$" class SearchQueryEditorTestCase(unittest.TestCase): """ Tests the auto completion text edit module. """ _availableProperties = ["Content", "Date time", "Content type descriptor"] _availableComparisonOperators = ["=", "<", ">", ">=", "<=", "is"] _availableConjuntionsOperators = ["AND", "OR"] _application = QtGui.QApplication(sys.argv) def setUp(self): """ Setups the test fixture. """ self.autoComplEdit = SearchQueryEditor(None) self.autoComplEdit.registerCompleter(QtGui.QCompleter(self._availableProperties), SearchQueryAnalyzer.PROPERTY_TYPE) completer = QtGui.QCompleter(self._availableComparisonOperators) completer.setCaseSensitivity(QtCore.Qt.CaseInsensitive) self.autoComplEdit.registerCompleter(completer, SearchQueryAnalyzer.COMPARISON_TYPE) completer = QtGui.QCompleter(self._availableConjuntionsOperators) completer.setCaseSensitivity(QtCore.Qt.CaseInsensitive) self.autoComplEdit.registerCompleter(completer, SearchQueryAnalyzer.CONJUNCTION_TYPE) self.autoComplEdit.registerCompleter(QtGui.QCompleter(["''"]), SearchQueryAnalyzer.LITERAL_TYPE) self._searchQueryAnalyzer = SearchQueryAnalyzer(SearchRestrictionParser(), dict()) self.autoComplEdit._searchQueryAnalyzer = self._searchQueryAnalyzer def testPropertyCompletion(self): """ Tests auto completion for property names. """ self.autoComplEdit.setText("Con") self._requestAutocompletionAtPosition(3) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "Content") self.autoComplEdit.setText("Conz") self._requestAutocompletionAtPosition(4) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "") def _requestAutocompletionAtPosition(self, position): """ Sets the cursor position in the text editor. """ textCursor = self.autoComplEdit.textCursor() textCursor.setPosition(position) self.autoComplEdit.setTextCursor(textCursor) self._searchQueryAnalyzer.analyze(unicode(self.autoComplEdit.toPlainText())) self.autoComplEdit.keyPressEvent(QtGui.QKeyEvent(QtCore.QEvent.KeyPress, QtCore.Qt.Key_Space, QtCore.Qt.ControlModifier)) def testConjunctionCompletion(self): """ Tests the completion of conjunction operators. """ self.autoComplEdit.setText("Content = 'tada' ") self._requestAutocompletionAtPosition(17) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "AND") def testComparisonCompletion(self): """ Tests the completion of comparison operators. """ self.autoComplEdit.setText("Content >") self._requestAutocompletionAtPosition(9) completions = list() i = 0 while self.autoComplEdit.completer().setCurrentRow(i): completions.append(self.autoComplEdit.completer().currentCompletion()) i += 1 self.assertEquals(completions, [">", ">="]) def testPropertyCompletionAfterConjunction(self): """ Tests auto completion for property names after a conjunction. """ self.autoComplEdit.setText("Content = 'tada' and C") self._requestAutocompletionAtPosition(22) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "Content") def testMultipleCompletion(self): """ Tests the multiple use of auto completion in one query. """ self.autoComplEdit.setText("") self._requestAutocompletionAtPosition(0) self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content ") self._requestAutocompletionAtPosition(7) self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content ") self._requestAutocompletionAtPosition(8) self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content = ") self._requestAutocompletionAtPosition(10) self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content = '' ") self._requestAutocompletionAtPosition(0) self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content = '' ") self._requestAutocompletionAtPosition(4) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "Content") self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content = '' ") self.autoComplEdit.setText("Content = '' ") self._requestAutocompletionAtPosition(8) self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content = = '' ") def testConjunctionRecognition(self): """ Tests the recognition of conjunction terms when already a character is typed. """ self.autoComplEdit.setText("Content = 'Peter hhg' o") self._requestAutocompletionAtPosition(23) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "OR") def testConjunctionRecognitionWithNoTokenUnderCursor(self): """ Tests the recognition of conjunction terms with no token under the cursor. """ self.autoComplEdit.setText("Content = 'Peter hhg' AND Content = '<NAME>hg'") self._requestAutocompletionAtPosition(22) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "AND") def testConjunctionRecognitionWithTokenUnderCursor(self): """ Tests the recognition of conjunction terms with token under the cursor. """ self.autoComplEdit.setText("Content = 'Peter hhg' AND NOT Content = 'Peter hhg'") self._requestAutocompletionAtPosition(24) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "AND")
test/unittest/datafinder_test/gui/user/dialogs/search_dialog/search_query_editor_test.py
import unittest, sys from PyQt4 import QtCore, QtGui from datafinder.core.search_restriction import SearchRestrictionParser from datafinder.gui.user.dialogs.search_dialog.search_query_editor import SearchQueryEditor, SearchQueryAnalyzer __version__ = "$Revision-Id:$" class SearchQueryEditorTestCase(unittest.TestCase): """ Tests the auto completion text edit module. """ _availableProperties = ["Content", "Date time", "Content type descriptor"] _availableComparisonOperators = ["=", "<", ">", ">=", "<=", "is"] _availableConjuntionsOperators = ["AND", "OR"] _application = QtGui.QApplication(sys.argv) def setUp(self): """ Setups the test fixture. """ self.autoComplEdit = SearchQueryEditor(None) self.autoComplEdit.registerCompleter(QtGui.QCompleter(self._availableProperties), SearchQueryAnalyzer.PROPERTY_TYPE) completer = QtGui.QCompleter(self._availableComparisonOperators) completer.setCaseSensitivity(QtCore.Qt.CaseInsensitive) self.autoComplEdit.registerCompleter(completer, SearchQueryAnalyzer.COMPARISON_TYPE) completer = QtGui.QCompleter(self._availableConjuntionsOperators) completer.setCaseSensitivity(QtCore.Qt.CaseInsensitive) self.autoComplEdit.registerCompleter(completer, SearchQueryAnalyzer.CONJUNCTION_TYPE) self.autoComplEdit.registerCompleter(QtGui.QCompleter(["''"]), SearchQueryAnalyzer.LITERAL_TYPE) self._searchQueryAnalyzer = SearchQueryAnalyzer(SearchRestrictionParser(), dict()) self.autoComplEdit._searchQueryAnalyzer = self._searchQueryAnalyzer def testPropertyCompletion(self): """ Tests auto completion for property names. """ self.autoComplEdit.setText("Con") self._requestAutocompletionAtPosition(3) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "Content") self.autoComplEdit.setText("Conz") self._requestAutocompletionAtPosition(4) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "") def _requestAutocompletionAtPosition(self, position): """ Sets the cursor position in the text editor. """ textCursor = self.autoComplEdit.textCursor() textCursor.setPosition(position) self.autoComplEdit.setTextCursor(textCursor) self._searchQueryAnalyzer.analyze(unicode(self.autoComplEdit.toPlainText())) self.autoComplEdit.keyPressEvent(QtGui.QKeyEvent(QtCore.QEvent.KeyPress, QtCore.Qt.Key_Space, QtCore.Qt.ControlModifier)) def testConjunctionCompletion(self): """ Tests the completion of conjunction operators. """ self.autoComplEdit.setText("Content = 'tada' ") self._requestAutocompletionAtPosition(17) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "AND") def testComparisonCompletion(self): """ Tests the completion of comparison operators. """ self.autoComplEdit.setText("Content >") self._requestAutocompletionAtPosition(9) completions = list() i = 0 while self.autoComplEdit.completer().setCurrentRow(i): completions.append(self.autoComplEdit.completer().currentCompletion()) i += 1 self.assertEquals(completions, [">", ">="]) def testPropertyCompletionAfterConjunction(self): """ Tests auto completion for property names after a conjunction. """ self.autoComplEdit.setText("Content = 'tada' and C") self._requestAutocompletionAtPosition(22) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "Content") def testMultipleCompletion(self): """ Tests the multiple use of auto completion in one query. """ self.autoComplEdit.setText("") self._requestAutocompletionAtPosition(0) self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content ") self._requestAutocompletionAtPosition(7) self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content ") self._requestAutocompletionAtPosition(8) self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content = ") self._requestAutocompletionAtPosition(10) self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content = '' ") self._requestAutocompletionAtPosition(0) self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content = '' ") self._requestAutocompletionAtPosition(4) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "Content") self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content = '' ") self.autoComplEdit.setText("Content = '' ") self._requestAutocompletionAtPosition(8) self.autoComplEdit.insertCompletion(self.autoComplEdit.completer().currentCompletion()) self.assertEquals(self.autoComplEdit.toPlainText(), "Content = = '' ") def testConjunctionRecognition(self): """ Tests the recognition of conjunction terms when already a character is typed. """ self.autoComplEdit.setText("Content = 'Peter hhg' o") self._requestAutocompletionAtPosition(23) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "OR") def testConjunctionRecognitionWithNoTokenUnderCursor(self): """ Tests the recognition of conjunction terms with no token under the cursor. """ self.autoComplEdit.setText("Content = 'Peter hhg' AND Content = '<NAME>hg'") self._requestAutocompletionAtPosition(22) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "AND") def testConjunctionRecognitionWithTokenUnderCursor(self): """ Tests the recognition of conjunction terms with token under the cursor. """ self.autoComplEdit.setText("Content = 'Peter hhg' AND NOT Content = 'Peter hhg'") self._requestAutocompletionAtPosition(24) self.assertEquals(self.autoComplEdit.completer().currentCompletion(), "AND")
0.502686
0.203727
from unittest import TestCase,mock from http import HTTPStatus from gw_proxy._to_sync.anish_agarwal.API_SaaS_VPS_Client import API_SaaS_VPS_Client class test_Rest_API_SaaS_VPs(TestCase): @mock.patch('requests.get') def test_proxy_for_brotli_encoded_sites(self, mockget): # Mock response headers = { "Date" : "Sun, 01 Mar 2020 11:22:05 GMT", "Expires" : "-1", "Cache-Control" : "private, max-age=0", "Content-Type" : "text/html; charset=UTF-8", "Strict-Transport-Security" : "max-age=31536000", "Accept-CH" : "DPR", "Accept-CH-Lifetime" : "2592000", "P3P" : "CP=\"This is not a P3P policy! See g.co/p3phelp for more info.\"", "Content-Encoding" : "br", "Content-Length" : "65251", "X-XSS-Protection" : "0", "X-Frame-Options" : "SAMEORIGIN", "Set-Cookie" : "1P_JAR=2020-03-01-11; expires=Tue, 31-Mar-2020 11:22:06 GMT; path=/; domain=.google.com; Secure; SameSite=none, NID=199=UsFpcFnQ21COTv9q0Scd3ZUVZBDiHmy0Wts3igOy3v8iHYmlDnv7PbiF_JyecNwwWTUlzjNfp6-b50Igyf0c9CbkirOK9azAy6HWh1TLzCTSUJHbw6_tfZexErwcYNu1F9fXeIOUDJWUrC21DVSJsWg1cCpPrc9d71IbO-9X1dE; expires=Mon, 31-Aug-2020 11:22:05 GMT; path=/; domain=.google.com; Secure; HttpOnly; SameSite=none", "Alt-Svc" : "quic=\":443\"; ma=2592000; v=\"46,43\",h3-Q050=\":443\"; ma=2592000,h3-Q049=\":443\"; ma=2592000,h3-Q048=\":443\"; ma=2592000,h3-Q046=\":443\"; ma=2592000,h3-Q043=\":443\"; ma=2592000" } params = {'headers.return_value': headers} response = mock.Mock(**params) response.headers = headers response.content = b'some-test-bytes-string' mockget.return_value = response # The request body = {} path = '/' method = 'GET' domain_prefix = 'https://google.com' self.request_headers = { 'accept' : 'text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,image/apng,*/*;q=0.8,application/signed-exchange;v=b3;q=0.9', 'User-Agent' : 'Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/80.0.3987.122 Safari/537.36', 'accept-encoding' : 'gzip,deflate,br' } requestContext = { "resourcePath" : "/", "httpMethod" : "GET", "path" : "/", "protocol" : "HTTP/1.1", "domainPrefix" : domain_prefix, "domainName" : domain_prefix } event = { "body" : body, "path" : path, "headers" : headers, "httpMethod" : method, "requestContext" : requestContext } api_saas_vps_client = API_SaaS_VPS_Client(event) result = api_saas_vps_client.request_get() assert result['isBase64Encoded'] == True assert result['headers']['Content-Encoding'] == 'br' assert result['statusCode'] == HTTPStatus.OK.value assert result['body'] == 'c29tZS10ZXN0LWJ5dGVzLXN0cmluZw==' @mock.patch('requests.get') def test_proxy_for_gzip_encoded_sites(self, mockget): # Mock response headers = { "Date" : "Sun, 01 Mar 2020 11:22:05 GMT", "Expires" : "-1", "Cache-Control" : "private, max-age=0", "Content-Type" : "text/html; charset=UTF-8", "Content-Encoding" : "gzip", "Content-Length" : "65251", "X-XSS-Protection" : "0", "X-Frame-Options" : "SAMEORIGIN", "Set-Cookie" : "1P_JAR=2020-03-01-11; expires=Tue, 31-Mar-2020 11:22:06 GMT; path=/; domain=.google.com; Secure; SameSite=none, NID=199=UsFpcFnQ21COTv9q0Scd3ZUVZBDiHmy0Wts3igOy3v8iHYmlDnv7PbiF_JyecNwwWTUlzjNfp6-b50Igyf0c9CbkirOK9azAy6HWh1TLzCTSUJHbw6_tfZexErwcYNu1F9fXeIOUDJWUrC21DVSJsWg1cCpPrc9d71IbO-9X1dE; expires=Mon, 31-Aug-2020 11:22:05 GMT; path=/; domain=.google.com; Secure; HttpOnly; SameSite=none", "Alt-Svc" : "quic=\":443\"; ma=2592000; v=\"46,43\",h3-Q050=\":443\"; ma=2592000,h3-Q049=\":443\"; ma=2592000,h3-Q048=\":443\"; ma=2592000,h3-Q046=\":443\"; ma=2592000,h3-Q043=\":443\"; ma=2592000" } params = {'headers.return_value': headers} response = mock.Mock(**params) response.headers = headers response.content = b'some-test-bytes-string' mockget.return_value = response # The request body = {} path = '/' method = 'GET' domain_prefix = 'https://google.com' self.request_headers = { 'accept' : 'text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,image/apng,*/*;q=0.8,application/signed-exchange;v=b3;q=0.9', 'User-Agent' : 'Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/80.0.3987.122 Safari/537.36', 'accept-encoding' : 'gzip,deflate,br' } requestContext = { "resourcePath" : "/", "httpMethod" : "GET", "path" : "/", "protocol" : "HTTP/1.1", "domainPrefix" : domain_prefix, "domainName" : domain_prefix } event = { "body" : body, "path" : path, "headers" : headers, "httpMethod" : method, "requestContext" : requestContext } api_saas_vps_client = API_SaaS_VPS_Client(event) result = api_saas_vps_client.request_get() assert result['isBase64Encoded'] == True assert 'Content-Encoding' not in result['headers'] assert result['statusCode'] == HTTPStatus.OK.value assert result['body'] == 'c29tZS10ZXN0LWJ5dGVzLXN0cmluZw==' @mock.patch('requests.get') def test_proxy_for_unencoded_sites(self, mockget): # Mock response headers = { "Date" : "Sun, 01 Mar 2020 11:22:05 GMT", "Expires" : "-1", "Cache-Control" : "private, max-age=0", "Content-Type" : "text/html", "Content-Length" : "65251", "X-XSS-Protection" : "0", "X-Frame-Options" : "SAMEORIGIN", "Set-Cookie" : "1P_JAR=2020-03-01-11; expires=Tue, 31-Mar-2020 11:22:06 GMT; path=/; domain=.google.com; Secure; SameSite=none, NID=199=UsFpcFnQ21COTv9q0Scd3ZUVZBDiHmy0Wts3igOy3v8iHYmlDnv7PbiF_JyecNwwWTUlzjNfp6-b50Igyf0c9CbkirOK9azAy6HWh1TLzCTSUJHbw6_tfZexErwcYNu1F9fXeIOUDJWUrC21DVSJsWg1cCpPrc9d71IbO-9X1dE; expires=Mon, 31-Aug-2020 11:22:05 GMT; path=/; domain=.google.com; Secure; HttpOnly; SameSite=none", "Alt-Svc" : "quic=\":443\"; ma=2592000; v=\"46,43\",h3-Q050=\":443\"; ma=2592000,h3-Q049=\":443\"; ma=2592000,h3-Q048=\":443\"; ma=2592000,h3-Q046=\":443\"; ma=2592000,h3-Q043=\":443\"; ma=2592000" } params = {'headers.return_value': headers} response = mock.Mock(**params) response.headers = headers response.text = 'some-test-bytes-string' mockget.return_value = response # The request body = {} path = '/' method = 'GET' domain_prefix = 'https://google.com' self.request_headers = { 'accept' : 'text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,image/apng,*/*;q=0.8,application/signed-exchange;v=b3;q=0.9', 'User-Agent' : 'Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/80.0.3987.122 Safari/537.36', 'accept-encoding' : 'gzip,deflate,br' } requestContext = { "resourcePath" : "/", "httpMethod" : "GET", "path" : "/", "protocol" : "HTTP/1.1", "domainPrefix" : domain_prefix, "domainName" : domain_prefix } event = { "body" : body, "path" : path, "headers" : headers, "httpMethod" : method, "requestContext" : requestContext } api_saas_vps_client = API_SaaS_VPS_Client(event) result = api_saas_vps_client.request_get() assert result['isBase64Encoded'] == False assert 'Content-Encoding' not in result['headers'] assert result['statusCode'] == HTTPStatus.OK.value assert result['body'] == 'some-test-bytes-string'
tests/_to_sync/anish_agarwal/test_Rest_API__SaaS_VPs.py
from unittest import TestCase,mock from http import HTTPStatus from gw_proxy._to_sync.anish_agarwal.API_SaaS_VPS_Client import API_SaaS_VPS_Client class test_Rest_API_SaaS_VPs(TestCase): @mock.patch('requests.get') def test_proxy_for_brotli_encoded_sites(self, mockget): # Mock response headers = { "Date" : "Sun, 01 Mar 2020 11:22:05 GMT", "Expires" : "-1", "Cache-Control" : "private, max-age=0", "Content-Type" : "text/html; charset=UTF-8", "Strict-Transport-Security" : "max-age=31536000", "Accept-CH" : "DPR", "Accept-CH-Lifetime" : "2592000", "P3P" : "CP=\"This is not a P3P policy! See g.co/p3phelp for more info.\"", "Content-Encoding" : "br", "Content-Length" : "65251", "X-XSS-Protection" : "0", "X-Frame-Options" : "SAMEORIGIN", "Set-Cookie" : "1P_JAR=2020-03-01-11; expires=Tue, 31-Mar-2020 11:22:06 GMT; path=/; domain=.google.com; Secure; SameSite=none, NID=199=UsFpcFnQ21COTv9q0Scd3ZUVZBDiHmy0Wts3igOy3v8iHYmlDnv7PbiF_JyecNwwWTUlzjNfp6-b50Igyf0c9CbkirOK9azAy6HWh1TLzCTSUJHbw6_tfZexErwcYNu1F9fXeIOUDJWUrC21DVSJsWg1cCpPrc9d71IbO-9X1dE; expires=Mon, 31-Aug-2020 11:22:05 GMT; path=/; domain=.google.com; Secure; HttpOnly; SameSite=none", "Alt-Svc" : "quic=\":443\"; ma=2592000; v=\"46,43\",h3-Q050=\":443\"; ma=2592000,h3-Q049=\":443\"; ma=2592000,h3-Q048=\":443\"; ma=2592000,h3-Q046=\":443\"; ma=2592000,h3-Q043=\":443\"; ma=2592000" } params = {'headers.return_value': headers} response = mock.Mock(**params) response.headers = headers response.content = b'some-test-bytes-string' mockget.return_value = response # The request body = {} path = '/' method = 'GET' domain_prefix = 'https://google.com' self.request_headers = { 'accept' : 'text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,image/apng,*/*;q=0.8,application/signed-exchange;v=b3;q=0.9', 'User-Agent' : 'Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/80.0.3987.122 Safari/537.36', 'accept-encoding' : 'gzip,deflate,br' } requestContext = { "resourcePath" : "/", "httpMethod" : "GET", "path" : "/", "protocol" : "HTTP/1.1", "domainPrefix" : domain_prefix, "domainName" : domain_prefix } event = { "body" : body, "path" : path, "headers" : headers, "httpMethod" : method, "requestContext" : requestContext } api_saas_vps_client = API_SaaS_VPS_Client(event) result = api_saas_vps_client.request_get() assert result['isBase64Encoded'] == True assert result['headers']['Content-Encoding'] == 'br' assert result['statusCode'] == HTTPStatus.OK.value assert result['body'] == 'c29tZS10ZXN0LWJ5dGVzLXN0cmluZw==' @mock.patch('requests.get') def test_proxy_for_gzip_encoded_sites(self, mockget): # Mock response headers = { "Date" : "Sun, 01 Mar 2020 11:22:05 GMT", "Expires" : "-1", "Cache-Control" : "private, max-age=0", "Content-Type" : "text/html; charset=UTF-8", "Content-Encoding" : "gzip", "Content-Length" : "65251", "X-XSS-Protection" : "0", "X-Frame-Options" : "SAMEORIGIN", "Set-Cookie" : "1P_JAR=2020-03-01-11; expires=Tue, 31-Mar-2020 11:22:06 GMT; path=/; domain=.google.com; Secure; SameSite=none, NID=199=UsFpcFnQ21COTv9q0Scd3ZUVZBDiHmy0Wts3igOy3v8iHYmlDnv7PbiF_JyecNwwWTUlzjNfp6-b50Igyf0c9CbkirOK9azAy6HWh1TLzCTSUJHbw6_tfZexErwcYNu1F9fXeIOUDJWUrC21DVSJsWg1cCpPrc9d71IbO-9X1dE; expires=Mon, 31-Aug-2020 11:22:05 GMT; path=/; domain=.google.com; Secure; HttpOnly; SameSite=none", "Alt-Svc" : "quic=\":443\"; ma=2592000; v=\"46,43\",h3-Q050=\":443\"; ma=2592000,h3-Q049=\":443\"; ma=2592000,h3-Q048=\":443\"; ma=2592000,h3-Q046=\":443\"; ma=2592000,h3-Q043=\":443\"; ma=2592000" } params = {'headers.return_value': headers} response = mock.Mock(**params) response.headers = headers response.content = b'some-test-bytes-string' mockget.return_value = response # The request body = {} path = '/' method = 'GET' domain_prefix = 'https://google.com' self.request_headers = { 'accept' : 'text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,image/apng,*/*;q=0.8,application/signed-exchange;v=b3;q=0.9', 'User-Agent' : 'Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/80.0.3987.122 Safari/537.36', 'accept-encoding' : 'gzip,deflate,br' } requestContext = { "resourcePath" : "/", "httpMethod" : "GET", "path" : "/", "protocol" : "HTTP/1.1", "domainPrefix" : domain_prefix, "domainName" : domain_prefix } event = { "body" : body, "path" : path, "headers" : headers, "httpMethod" : method, "requestContext" : requestContext } api_saas_vps_client = API_SaaS_VPS_Client(event) result = api_saas_vps_client.request_get() assert result['isBase64Encoded'] == True assert 'Content-Encoding' not in result['headers'] assert result['statusCode'] == HTTPStatus.OK.value assert result['body'] == 'c29tZS10ZXN0LWJ5dGVzLXN0cmluZw==' @mock.patch('requests.get') def test_proxy_for_unencoded_sites(self, mockget): # Mock response headers = { "Date" : "Sun, 01 Mar 2020 11:22:05 GMT", "Expires" : "-1", "Cache-Control" : "private, max-age=0", "Content-Type" : "text/html", "Content-Length" : "65251", "X-XSS-Protection" : "0", "X-Frame-Options" : "SAMEORIGIN", "Set-Cookie" : "1P_JAR=2020-03-01-11; expires=Tue, 31-Mar-2020 11:22:06 GMT; path=/; domain=.google.com; Secure; SameSite=none, NID=199=UsFpcFnQ21COTv9q0Scd3ZUVZBDiHmy0Wts3igOy3v8iHYmlDnv7PbiF_JyecNwwWTUlzjNfp6-b50Igyf0c9CbkirOK9azAy6HWh1TLzCTSUJHbw6_tfZexErwcYNu1F9fXeIOUDJWUrC21DVSJsWg1cCpPrc9d71IbO-9X1dE; expires=Mon, 31-Aug-2020 11:22:05 GMT; path=/; domain=.google.com; Secure; HttpOnly; SameSite=none", "Alt-Svc" : "quic=\":443\"; ma=2592000; v=\"46,43\",h3-Q050=\":443\"; ma=2592000,h3-Q049=\":443\"; ma=2592000,h3-Q048=\":443\"; ma=2592000,h3-Q046=\":443\"; ma=2592000,h3-Q043=\":443\"; ma=2592000" } params = {'headers.return_value': headers} response = mock.Mock(**params) response.headers = headers response.text = 'some-test-bytes-string' mockget.return_value = response # The request body = {} path = '/' method = 'GET' domain_prefix = 'https://google.com' self.request_headers = { 'accept' : 'text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,image/apng,*/*;q=0.8,application/signed-exchange;v=b3;q=0.9', 'User-Agent' : 'Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/80.0.3987.122 Safari/537.36', 'accept-encoding' : 'gzip,deflate,br' } requestContext = { "resourcePath" : "/", "httpMethod" : "GET", "path" : "/", "protocol" : "HTTP/1.1", "domainPrefix" : domain_prefix, "domainName" : domain_prefix } event = { "body" : body, "path" : path, "headers" : headers, "httpMethod" : method, "requestContext" : requestContext } api_saas_vps_client = API_SaaS_VPS_Client(event) result = api_saas_vps_client.request_get() assert result['isBase64Encoded'] == False assert 'Content-Encoding' not in result['headers'] assert result['statusCode'] == HTTPStatus.OK.value assert result['body'] == 'some-test-bytes-string'
0.437223
0.153771
import unittest import sys import json from unittest import TestCase from ovs.lib.tests.mockups import StorageDriverModule, StorageDriverClient from ovs.plugin.provider.configuration import Configuration from ovs.extensions.storage.persistentfactory import PersistentFactory from ovs.extensions.storage.persistent.dummystore import DummyPersistentStore from ovs.extensions.storage.volatilefactory import VolatileFactory from ovs.extensions.storage.volatile.dummystore import DummyVolatileStore class MDSServices(TestCase): """ This test class will validate the various scenarios of the delete snapshots logic """ VDisk = None MDSService = None ServiceType = None MDSServiceVDisk = None VPool = None PMachine = None Service = None StorageRouter = None StorageDriver = None BackendType = None VolatileMutex = None MDSServiceController = None logLevel = None @classmethod def setUpClass(cls): """ Sets up the unittest, mocking a certain set of 3rd party libraries and extensions. This makes sure the unittests can be executed without those libraries installed """ # Load dummy stores PersistentFactory.store = DummyPersistentStore() VolatileFactory.store = DummyVolatileStore() # Replace mocked classes sys.modules['ovs.extensions.storageserver.storagedriver'] = StorageDriverModule # Import required modules/classes after mocking is done from ovs.dal.hybrids.vdisk import VDisk from ovs.dal.hybrids.service import Service from ovs.dal.hybrids.vpool import VPool from ovs.dal.hybrids.storagerouter import StorageRouter from ovs.dal.hybrids.pmachine import PMachine from ovs.dal.hybrids.servicetype import ServiceType from ovs.dal.hybrids.storagedriver import StorageDriver from ovs.dal.hybrids.backendtype import BackendType from ovs.dal.hybrids.j_mdsservice import MDSService from ovs.dal.hybrids.j_mdsservicevdisk import MDSServiceVDisk from ovs.extensions.generic.volatilemutex import VolatileMutex from ovs.lib.mdsservice import MDSServiceController # Globalize mocked classes global VDisk global VPool global Service global StorageRouter global StorageDriver global BackendType global PMachine global MDSService global ServiceType global MDSServiceVDisk global VolatileMutex global MDSServiceController _ = VDisk(), VPool(), Service(), MDSService(), MDSServiceVDisk(), ServiceType(), \ StorageRouter(), StorageDriver(), BackendType(), PMachine(), \ VolatileMutex('dummy'), MDSServiceController # Configuration def _get(key): c = PersistentFactory.get_client() if c.exists(key): return c.get(key) return None def _get_int(key): return int(Configuration.get(key)) Configuration.get = staticmethod(_get) Configuration.getInt = staticmethod(_get_int) # Cleaning storage VolatileFactory.store.clean() PersistentFactory.store.clean() @classmethod def setUp(cls): """ (Re)Sets the stores on every test """ PersistentFactory.store = DummyPersistentStore() PersistentFactory.store.clean() VolatileFactory.store = DummyVolatileStore() VolatileFactory.store.clean() @classmethod def tearDownClass(cls): """ Clean up the unittest """ pass def _generate_nc_function(self, address, mds_service): """ Generates the lambda that will return the address or ip """ _ = self if address is True: return lambda s: mds_service.service.storagerouter.ip return lambda s: int(mds_service.service.ports[0]) def _generate_bc_function(self, _configs): """ Generates the lambda that will return the config list """ _ = self return lambda s: _configs def _build_service_structure(self, structure): """ Builds an MDS service structure """ vpools = {} storagerouters = {} storagedrivers = {} services = {} mds_services = {} service_type = ServiceType() service_type.name = 'MetadataServer' service_type.save() for vpool_id in structure['vpools']: vpool = VPool() vpool.name = str(vpool_id) vpool.backend_type = BackendType() vpool.save() vpools[vpool_id] = vpool for sr_id in structure['storagerouters']: storagerouter = StorageRouter() storagerouter.name = str(sr_id) storagerouter.ip = '10.0.0.{0}'.format(sr_id) storagerouter.pmachine = PMachine() storagerouter.save() storagerouters[sr_id] = storagerouter for sd_info in structure['storagedrivers']: sd_id, vpool_id, sr_id = sd_info storagedriver = StorageDriver() storagedriver.vpool = vpools[vpool_id] storagedriver.storagerouter = storagerouters[sr_id] storagedriver.name = str(sd_id) storagedriver.mountpoint_temp = '/' storagedriver.mountpoint_foc = '/' storagedriver.mountpoint_readcache2 = '/' storagedriver.mountpoint_writecache = '/' storagedriver.mountpoint_readcache1 = '/' storagedriver.mountpoint_temp = '/' storagedriver.mountpoint_md = '/' storagedriver.mountpoint_bfs = '/' storagedriver.mountpoint = '/' storagedriver.cluster_ip = storagerouters[sr_id].ip storagedriver.storage_ip = '127.0.0.1' storagedriver.storagedriver_id = str(sd_id) storagedriver.ports = [1, 2, 3] storagedriver.save() storagedrivers[sd_id] = storagedriver for mds_info in structure['mds_services']: mds_id, sd_id = mds_info sd = storagedrivers[sd_id] s_id = '{0}-{1}'.format(sd.storagerouter.name, mds_id) service = Service() service.name = s_id service.storagerouter = sd.storagerouter service.ports = [mds_id] service.type = service_type service.save() services[s_id] = service mds_service = MDSService() mds_service.service = service mds_service.number = 0 mds_service.capacity = 10 mds_service.vpool = sd.vpool mds_service.save() mds_services[mds_id] = mds_service return vpools, storagerouters, storagedrivers, services, mds_services, service_type def _create_vdisks_for_mds_service(self, amount, start_id, mds_service=None, vpool=None): """ Generates vdisks and appends them to a given mds_service """ vdisks = {} for i in xrange(start_id, start_id + amount): disk = VDisk() disk.name = str(i) disk.devicename = 'disk_{0}'.format(i) disk.volume_id = 'disk_{0}'.format(i) disk.vpool = mds_service.vpool if mds_service is not None else vpool disk.size = 0 disk.save() disk.reload_client() if mds_service is not None: storagedriver_id = None for sd in mds_service.vpool.storagedrivers: if sd.storagerouter_guid == mds_service.service.storagerouter_guid: storagedriver_id = sd.storagedriver_id junction = MDSServiceVDisk() junction.vdisk = disk junction.mds_service = mds_service junction.is_master = True junction.save() config = type('MDSNodeConfig', (), {'address': self._generate_nc_function(True, mds_service), 'port': self._generate_nc_function(False, mds_service)})() mds_backend_config = type('MDSMetaDataBackendConfig', (), {'node_configs': self._generate_bc_function([config])})() StorageDriverClient.metadata_backend_config['disk_{0}'.format(i)] = mds_backend_config StorageDriverClient.catch_up['disk_{0}'.format(i)] = 50 StorageDriverClient.vrouter_id['disk_{0}'.format(i)] = storagedriver_id vdisks[i] = disk return vdisks def test_load_calculation(self): """ Validates whether the load calculation works """ vpools, storagerouters, storagedrivers, services, mds_services, _ = self._build_service_structure( {'vpools': [1], 'storagerouters': [1], 'storagedrivers': [(1, 1, 1)], # (<id>, <vpool_id>, <sr_id>) 'mds_services': [(1, 1)]} # (<id>, <sd_id>) ) mds_service = mds_services[1] self._create_vdisks_for_mds_service(2, 1, mds_service=mds_service) load, load_plus = MDSServiceController.get_mds_load(mds_service) self.assertEqual(load, 20, 'There should be a 20% load. {0}'.format(load)) self.assertEqual(load_plus, 30, 'There should be a 30% plus load. {0}'.format(load_plus)) self._create_vdisks_for_mds_service(3, 3, mds_service=mds_service) load, load_plus = MDSServiceController.get_mds_load(mds_service) self.assertEqual(load, 50, 'There should be a 50% load. {0}'.format(load)) self.assertEqual(load_plus, 60, 'There should be a 60% plus load. {0}'.format(load_plus)) self._create_vdisks_for_mds_service(5, 6, mds_service=mds_service) load, load_plus = MDSServiceController.get_mds_load(mds_service) self.assertEqual(load, 100, 'There should be a 100% load. {0}'.format(load)) self.assertEqual(load_plus, 110, 'There should be a 110% plus load. {0}'.format(load_plus)) mds_service.capacity = -1 mds_service.save() load, load_plus = MDSServiceController.get_mds_load(mds_service) self.assertEqual(load, 50, 'There should be a 50% load. {0}'.format(load)) self.assertEqual(load_plus, 50, 'There should be a 50% plus load. {0}'.format(load_plus)) mds_service.capacity = 0 mds_service.save() load, load_plus = MDSServiceController.get_mds_load(mds_service) self.assertEqual(load, float('inf'), 'There should be infinite load. {0}'.format(load)) self.assertEqual(load_plus, float('inf'), 'There should be infinite plus load. {0}'.format(load_plus)) def test_storagedriver_config_set(self): """ Validates whether storagedriver configuration is generated as expected """ PersistentFactory.get_client().set('ovs.storagedriver.mds.safety', '3') vpools, storagerouters, storagedrivers, services, mds_services, _ = self._build_service_structure( {'vpools': [1, 2], 'storagerouters': [1, 2, 3, 4, 5, 6], 'storagedrivers': [(1, 1, 1), (2, 1, 2), (3, 1, 3), (4, 1, 4), (5, 2, 4), (6, 2, 5), (7, 2, 6)], # (<id>, <vpool_id>, <sr_id>) 'mds_services': [(1, 1), (2, 1), (3, 2), (4, 3), (5, 4), (6, 5), (7, 6), (8, 7), (9, 7)]} # (<id>, <sd_id>) ) vdisks = {} start_id = 1 for mds_service in mds_services.itervalues(): vdisks.update(self._create_vdisks_for_mds_service(10, start_id, mds_service=mds_service)) start_id += 10 mds_services[1].capacity = 11 # on 1, vpool 1 mds_services[1].save() mds_services[2].capacity = 20 # on 1, vpool 1 mds_services[2].save() mds_services[3].capacity = 12 # on 2, vpool 1 mds_services[3].save() mds_services[4].capacity = 14 # on 3, vpool 1 mds_services[4].save() mds_services[5].capacity = 16 # on 4, vpool 1 mds_services[5].save() mds_services[6].capacity = 11 # on 4, vpool 2 mds_services[6].save() mds_services[7].capacity = 13 # on 5, vpool 2 mds_services[7].save() mds_services[8].capacity = 19 # on 6, vpool 2 mds_services[8].save() mds_services[9].capacity = 15 # on 6, vpool 2 mds_services[9].save() config = MDSServiceController.get_mds_storagedriver_config_set(vpools[1]) expected = {storagerouters[1].guid: [{'host': '10.0.0.1', 'port': 2}, {'host': '10.0.0.4', 'port': 5}, {'host': '10.0.0.3', 'port': 4}], storagerouters[2].guid: [{'host': '10.0.0.2', 'port': 3}, {'host': '10.0.0.1', 'port': 2}, {'host': '10.0.0.4', 'port': 5}], storagerouters[3].guid: [{'host': '10.0.0.3', 'port': 4}, {'host': '10.0.0.1', 'port': 2}, {'host': '10.0.0.4', 'port': 5}], storagerouters[4].guid: [{'host': '10.0.0.4', 'port': 5}, {'host': '10.0.0.1', 'port': 2}, {'host': '10.0.0.3', 'port': 4}]} self.assertDictEqual(config, expected, 'Test 1. Got:\n{0}'.format(json.dumps(config, indent=2))) mds_services[2].capacity = 10 # on 1, vpool 1 mds_services[2].save() config = MDSServiceController.get_mds_storagedriver_config_set(vpools[1]) expected = {storagerouters[1].guid: [{'host': '10.0.0.1', 'port': 1}, {'host': '10.0.0.4', 'port': 5}, {'host': '10.0.0.3', 'port': 4}], storagerouters[2].guid: [{'host': '10.0.0.2', 'port': 3}, {'host': '10.0.0.4', 'port': 5}, {'host': '10.0.0.3', 'port': 4}], storagerouters[3].guid: [{'host': '10.0.0.3', 'port': 4}, {'host': '10.0.0.4', 'port': 5}, {'host': '10.0.0.2', 'port': 3}], storagerouters[4].guid: [{'host': '10.0.0.4', 'port': 5}, {'host': '10.0.0.3', 'port': 4}, {'host': '10.0.0.2', 'port': 3}]} self.assertDictEqual(config, expected, 'Test 2. Got:\n{0}'.format(json.dumps(config, indent=2))) def test_syncreality(self): """ Validates whether reality is synced to the model as expected """ def _generate_backend_config(_scenario, _vdisks, _mds_services): """ Injects a backend config that would be returned by the storagedriver """ for disk_id in _scenario: configs = [] for mds_id in _scenario[disk_id]: config = type('MDSNodeConfig', (), {'address': self._generate_nc_function(True, _mds_services[mds_id]), 'port': self._generate_nc_function(False, _mds_services[mds_id])})() configs.append(config) mds_backend_config = type('MDSMetaDataBackendConfig', (), {'node_configs': self._generate_bc_function(configs)})() StorageDriverClient.metadata_backend_config[_vdisks[disk_id].volume_id] = mds_backend_config def _validate_scenario(_scenario, _vdisks, _mds_services): """ Validates a scenario with the model """ for disk_id in _scenario: expected_mds_services = [] for mds_id in _scenario[disk_id]: expected_mds_services.append(_mds_services[mds_id]) disk = _vdisks[disk_id] self.assertEqual(len(disk.mds_services), len(expected_mds_services)) for junction in disk.mds_services: self.assertIn(junction.mds_service, expected_mds_services) def _test_scenario(scenario, _vdisks, _mds_services): """ Executes a testrun for a given scenario """ _generate_backend_config(scenario, _vdisks, _mds_services) for vdisk_id in _vdisks: MDSServiceController.sync_vdisk_to_reality(_vdisks[vdisk_id]) _validate_scenario(scenario, _vdisks, _mds_services) vpools, _, _, _, mds_services, _ = self._build_service_structure( {'vpools': [1], 'storagerouters': [1, 2, 3, 4], 'storagedrivers': [(1, 1, 1), (2, 1, 2), (3, 1, 3), (4, 1, 4)], # (<id>, <vpool_id>, <sr_id>) 'mds_services': [(1, 1), (2, 1), (3, 2), (4, 3), (5, 4)]} # (<id>, <sd_id>) ) vdisks = self._create_vdisks_for_mds_service(5, 1, vpool=vpools[1]) _test_scenario({1: [1, 3, 4], 2: [1, 2], 3: [1, 3, 4], 4: [3, 4, 5], 5: [1, 4, 5]}, vdisks, mds_services) _test_scenario({1: [1, 2], 2: [1, 2, 3, 4, 5], 3: [1, 2], 4: [5], 5: [1, 4, 5]}, vdisks, mds_services) def test_ensure_safety(self): """ Validates whether the ensure_safety call works as expected """ def _generate_mds_service_load_repr(_mds_service): """ Generates a load representing thing for a given mds_service """ masters, slaves = 0, 0 for _junction in _mds_service.vdisks: if _junction.is_master: masters += 1 else: slaves += 1 capacity = _mds_service.capacity if capacity == -1: capacity = 'infinite' _load, _ = MDSServiceController.get_mds_load(_mds_service) if _load == float('inf'): _load = 'infinite' else: _load = round(_load, 2) return [_mds_service.service.storagerouter.ip, _mds_service.service.ports[0], masters, slaves, capacity, _load] def _check_reality(_configs, _loads, _vdisks, _mds_services, test=True, display=False): """ Validates 'reality' with an expected config/load """ reality_configs = [] for _vdisk_id in _vdisks: reality_configs.append(_vdisks[_vdisk_id].info['metadata_backend_config']) if display is True: for c in reality_configs: print c if test is True: self.assertListEqual(reality_configs, _configs) reality_loads = [] for mds_id in _mds_services: reality_loads.append(_generate_mds_service_load_repr(_mds_services[mds_id])) if display is True: for l in reality_loads: print l if test is True: self.assertListEqual(reality_loads, _loads) PersistentFactory.get_client().set('ovs.storagedriver.mds.safety', '3') PersistentFactory.get_client().set('ovs.storagedriver.mds.maxload', '75') PersistentFactory.get_client().set('ovs.storagedriver.mds.tlogs', '100') vpools, storagerouters, storagedrivers, _, mds_services, service_type = self._build_service_structure( {'vpools': [1], 'storagerouters': [1, 2, 3, 4], 'storagedrivers': [(1, 1, 1), (2, 1, 2), (3, 1, 3), (4, 1, 4)], # (<id>, <vpool_id>, <sr_id>) 'mds_services': [(1, 1), (2, 2), (3, 3), (4, 4)]} # (<id>, <sd_id>) ) vdisks = {} start_id = 1 for mds_service in mds_services.itervalues(): vdisks.update(self._create_vdisks_for_mds_service(2, start_id, mds_service=mds_service)) start_id += 2 # Validate the start configuration which is simple, each disk has only its default local master configs = [[{'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.2', 'port': 2}], [{'ip': '10.0.0.2', 'port': 2}], [{'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.4', 'port': 4}]] loads = [['10.0.0.1', 1, 2, 0, 10, 20.0], ['10.0.0.2', 2, 2, 0, 10, 20.0], ['10.0.0.3', 3, 2, 0, 10, 20.0], ['10.0.0.4', 4, 2, 0, 10, 20.0]] _check_reality(configs, loads, vdisks, mds_services) # Validate first run. Each disk should now have sufficient nodes, since there are plenty of MDS services available configs = [[{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.2', 'port': 2}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.2', 'port': 2}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.2', 'port': 2}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}]] loads = [['10.0.0.1', 1, 2, 5, 10, 70.0], ['10.0.0.2', 2, 2, 4, 10, 60.0], ['10.0.0.3', 3, 2, 4, 10, 60.0], ['10.0.0.4', 4, 2, 3, 10, 50.0]] for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # Validate whether this extra (unnessecairy) run doesn't change anything, preventing reconfiguring over and # over again for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # Validating whether an overloaded node will cause correct rebalancing mds_services[2].capacity = 2 mds_services[2].save() configs = [[{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}]] loads = [['10.0.0.1', 1, 2, 5, 10, 70.0], ['10.0.0.2', 2, 2, 0, 2, 100.0], ['10.0.0.3', 3, 2, 5, 10, 70.0], ['10.0.0.4', 4, 2, 5, 10, 70.0]] for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # Validate whether the overloaded services are still handled. In this case, causing a reoder of the slaves as # ordered in the model configs = [[{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}]] loads = [['10.0.0.1', 1, 2, 5, 10, 70.0], ['10.0.0.2', 2, 2, 0, 2, 100.0], ['10.0.0.3', 3, 2, 5, 10, 70.0], ['10.0.0.4', 4, 2, 5, 10, 70.0]] for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # Again, validating whether a subsequent run doesn't give unexpected changes for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # A MDS service will be added (next to the overloaded service), this should cause the expected rebalancing s_id = '{0}-5'.format(storagerouters[2].name) service = Service() service.name = s_id service.storagerouter = storagerouters[2] service.ports = [5] service.type = service_type service.save() mds_service = MDSService() mds_service.service = service mds_service.number = 0 mds_service.capacity = 10 mds_service.vpool = vpools[1] mds_service.save() mds_services[5] = mds_service configs = [[{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.2', 'port': 5}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.2', 'port': 5}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.2', 'port': 5}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}]] loads = [['10.0.0.1', 1, 2, 5, 10, 70.0], ['10.0.0.2', 2, 2, 0, 2, 100.0], ['10.0.0.3', 3, 2, 5, 10, 70.0], ['10.0.0.4', 4, 2, 5, 10, 70.0], ['10.0.0.2', 5, 0, 3, 10, 30.0]] for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # If the tlogs are not catched up, nothing should be changed for vdisk_id in [3, 4]: StorageDriverClient.catch_up[vdisks[vdisk_id].volume_id] = 1000 for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # The next run, after tlogs are catched up, a master switch should be executed for vdisk_id in [3, 4]: StorageDriverClient.catch_up[vdisks[vdisk_id].volume_id] = 50 configs = [[{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 5}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.2', 'port': 5}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}]] loads = [['10.0.0.1', 1, 2, 5, 10, 70.0], ['10.0.0.2', 2, 1, 0, 2, 50.0], ['10.0.0.3', 3, 2, 5, 10, 70.0], ['10.0.0.4', 4, 2, 5, 10, 70.0], ['10.0.0.2', 5, 1, 1, 10, 20.0]] for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # Validate whether a volume migration makes the master follow StorageDriverClient.vrouter_id[vdisks[1].volume_id] = storagedrivers[3].storagedriver_id configs = [[{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.2', 'port': 5}], [{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 5}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.2', 'port': 5}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}]] loads = [['10.0.0.1', 1, 1, 6, 10, 70.0], ['10.0.0.2', 2, 1, 0, 2, 50.0], ['10.0.0.3', 3, 3, 4, 10, 70.0], ['10.0.0.4', 4, 2, 4, 10, 60.0], ['10.0.0.2', 5, 1, 2, 10, 30.0]] for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # Validates if a second run doesn't change anything for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) if __name__ == '__main__': suite = unittest.TestLoader().loadTestsFromTestCase(MDSServices) unittest.TextTestRunner(verbosity=2).run(suite)
ovs/lib/tests/test_mdsservice.py
import unittest import sys import json from unittest import TestCase from ovs.lib.tests.mockups import StorageDriverModule, StorageDriverClient from ovs.plugin.provider.configuration import Configuration from ovs.extensions.storage.persistentfactory import PersistentFactory from ovs.extensions.storage.persistent.dummystore import DummyPersistentStore from ovs.extensions.storage.volatilefactory import VolatileFactory from ovs.extensions.storage.volatile.dummystore import DummyVolatileStore class MDSServices(TestCase): """ This test class will validate the various scenarios of the delete snapshots logic """ VDisk = None MDSService = None ServiceType = None MDSServiceVDisk = None VPool = None PMachine = None Service = None StorageRouter = None StorageDriver = None BackendType = None VolatileMutex = None MDSServiceController = None logLevel = None @classmethod def setUpClass(cls): """ Sets up the unittest, mocking a certain set of 3rd party libraries and extensions. This makes sure the unittests can be executed without those libraries installed """ # Load dummy stores PersistentFactory.store = DummyPersistentStore() VolatileFactory.store = DummyVolatileStore() # Replace mocked classes sys.modules['ovs.extensions.storageserver.storagedriver'] = StorageDriverModule # Import required modules/classes after mocking is done from ovs.dal.hybrids.vdisk import VDisk from ovs.dal.hybrids.service import Service from ovs.dal.hybrids.vpool import VPool from ovs.dal.hybrids.storagerouter import StorageRouter from ovs.dal.hybrids.pmachine import PMachine from ovs.dal.hybrids.servicetype import ServiceType from ovs.dal.hybrids.storagedriver import StorageDriver from ovs.dal.hybrids.backendtype import BackendType from ovs.dal.hybrids.j_mdsservice import MDSService from ovs.dal.hybrids.j_mdsservicevdisk import MDSServiceVDisk from ovs.extensions.generic.volatilemutex import VolatileMutex from ovs.lib.mdsservice import MDSServiceController # Globalize mocked classes global VDisk global VPool global Service global StorageRouter global StorageDriver global BackendType global PMachine global MDSService global ServiceType global MDSServiceVDisk global VolatileMutex global MDSServiceController _ = VDisk(), VPool(), Service(), MDSService(), MDSServiceVDisk(), ServiceType(), \ StorageRouter(), StorageDriver(), BackendType(), PMachine(), \ VolatileMutex('dummy'), MDSServiceController # Configuration def _get(key): c = PersistentFactory.get_client() if c.exists(key): return c.get(key) return None def _get_int(key): return int(Configuration.get(key)) Configuration.get = staticmethod(_get) Configuration.getInt = staticmethod(_get_int) # Cleaning storage VolatileFactory.store.clean() PersistentFactory.store.clean() @classmethod def setUp(cls): """ (Re)Sets the stores on every test """ PersistentFactory.store = DummyPersistentStore() PersistentFactory.store.clean() VolatileFactory.store = DummyVolatileStore() VolatileFactory.store.clean() @classmethod def tearDownClass(cls): """ Clean up the unittest """ pass def _generate_nc_function(self, address, mds_service): """ Generates the lambda that will return the address or ip """ _ = self if address is True: return lambda s: mds_service.service.storagerouter.ip return lambda s: int(mds_service.service.ports[0]) def _generate_bc_function(self, _configs): """ Generates the lambda that will return the config list """ _ = self return lambda s: _configs def _build_service_structure(self, structure): """ Builds an MDS service structure """ vpools = {} storagerouters = {} storagedrivers = {} services = {} mds_services = {} service_type = ServiceType() service_type.name = 'MetadataServer' service_type.save() for vpool_id in structure['vpools']: vpool = VPool() vpool.name = str(vpool_id) vpool.backend_type = BackendType() vpool.save() vpools[vpool_id] = vpool for sr_id in structure['storagerouters']: storagerouter = StorageRouter() storagerouter.name = str(sr_id) storagerouter.ip = '10.0.0.{0}'.format(sr_id) storagerouter.pmachine = PMachine() storagerouter.save() storagerouters[sr_id] = storagerouter for sd_info in structure['storagedrivers']: sd_id, vpool_id, sr_id = sd_info storagedriver = StorageDriver() storagedriver.vpool = vpools[vpool_id] storagedriver.storagerouter = storagerouters[sr_id] storagedriver.name = str(sd_id) storagedriver.mountpoint_temp = '/' storagedriver.mountpoint_foc = '/' storagedriver.mountpoint_readcache2 = '/' storagedriver.mountpoint_writecache = '/' storagedriver.mountpoint_readcache1 = '/' storagedriver.mountpoint_temp = '/' storagedriver.mountpoint_md = '/' storagedriver.mountpoint_bfs = '/' storagedriver.mountpoint = '/' storagedriver.cluster_ip = storagerouters[sr_id].ip storagedriver.storage_ip = '127.0.0.1' storagedriver.storagedriver_id = str(sd_id) storagedriver.ports = [1, 2, 3] storagedriver.save() storagedrivers[sd_id] = storagedriver for mds_info in structure['mds_services']: mds_id, sd_id = mds_info sd = storagedrivers[sd_id] s_id = '{0}-{1}'.format(sd.storagerouter.name, mds_id) service = Service() service.name = s_id service.storagerouter = sd.storagerouter service.ports = [mds_id] service.type = service_type service.save() services[s_id] = service mds_service = MDSService() mds_service.service = service mds_service.number = 0 mds_service.capacity = 10 mds_service.vpool = sd.vpool mds_service.save() mds_services[mds_id] = mds_service return vpools, storagerouters, storagedrivers, services, mds_services, service_type def _create_vdisks_for_mds_service(self, amount, start_id, mds_service=None, vpool=None): """ Generates vdisks and appends them to a given mds_service """ vdisks = {} for i in xrange(start_id, start_id + amount): disk = VDisk() disk.name = str(i) disk.devicename = 'disk_{0}'.format(i) disk.volume_id = 'disk_{0}'.format(i) disk.vpool = mds_service.vpool if mds_service is not None else vpool disk.size = 0 disk.save() disk.reload_client() if mds_service is not None: storagedriver_id = None for sd in mds_service.vpool.storagedrivers: if sd.storagerouter_guid == mds_service.service.storagerouter_guid: storagedriver_id = sd.storagedriver_id junction = MDSServiceVDisk() junction.vdisk = disk junction.mds_service = mds_service junction.is_master = True junction.save() config = type('MDSNodeConfig', (), {'address': self._generate_nc_function(True, mds_service), 'port': self._generate_nc_function(False, mds_service)})() mds_backend_config = type('MDSMetaDataBackendConfig', (), {'node_configs': self._generate_bc_function([config])})() StorageDriverClient.metadata_backend_config['disk_{0}'.format(i)] = mds_backend_config StorageDriverClient.catch_up['disk_{0}'.format(i)] = 50 StorageDriverClient.vrouter_id['disk_{0}'.format(i)] = storagedriver_id vdisks[i] = disk return vdisks def test_load_calculation(self): """ Validates whether the load calculation works """ vpools, storagerouters, storagedrivers, services, mds_services, _ = self._build_service_structure( {'vpools': [1], 'storagerouters': [1], 'storagedrivers': [(1, 1, 1)], # (<id>, <vpool_id>, <sr_id>) 'mds_services': [(1, 1)]} # (<id>, <sd_id>) ) mds_service = mds_services[1] self._create_vdisks_for_mds_service(2, 1, mds_service=mds_service) load, load_plus = MDSServiceController.get_mds_load(mds_service) self.assertEqual(load, 20, 'There should be a 20% load. {0}'.format(load)) self.assertEqual(load_plus, 30, 'There should be a 30% plus load. {0}'.format(load_plus)) self._create_vdisks_for_mds_service(3, 3, mds_service=mds_service) load, load_plus = MDSServiceController.get_mds_load(mds_service) self.assertEqual(load, 50, 'There should be a 50% load. {0}'.format(load)) self.assertEqual(load_plus, 60, 'There should be a 60% plus load. {0}'.format(load_plus)) self._create_vdisks_for_mds_service(5, 6, mds_service=mds_service) load, load_plus = MDSServiceController.get_mds_load(mds_service) self.assertEqual(load, 100, 'There should be a 100% load. {0}'.format(load)) self.assertEqual(load_plus, 110, 'There should be a 110% plus load. {0}'.format(load_plus)) mds_service.capacity = -1 mds_service.save() load, load_plus = MDSServiceController.get_mds_load(mds_service) self.assertEqual(load, 50, 'There should be a 50% load. {0}'.format(load)) self.assertEqual(load_plus, 50, 'There should be a 50% plus load. {0}'.format(load_plus)) mds_service.capacity = 0 mds_service.save() load, load_plus = MDSServiceController.get_mds_load(mds_service) self.assertEqual(load, float('inf'), 'There should be infinite load. {0}'.format(load)) self.assertEqual(load_plus, float('inf'), 'There should be infinite plus load. {0}'.format(load_plus)) def test_storagedriver_config_set(self): """ Validates whether storagedriver configuration is generated as expected """ PersistentFactory.get_client().set('ovs.storagedriver.mds.safety', '3') vpools, storagerouters, storagedrivers, services, mds_services, _ = self._build_service_structure( {'vpools': [1, 2], 'storagerouters': [1, 2, 3, 4, 5, 6], 'storagedrivers': [(1, 1, 1), (2, 1, 2), (3, 1, 3), (4, 1, 4), (5, 2, 4), (6, 2, 5), (7, 2, 6)], # (<id>, <vpool_id>, <sr_id>) 'mds_services': [(1, 1), (2, 1), (3, 2), (4, 3), (5, 4), (6, 5), (7, 6), (8, 7), (9, 7)]} # (<id>, <sd_id>) ) vdisks = {} start_id = 1 for mds_service in mds_services.itervalues(): vdisks.update(self._create_vdisks_for_mds_service(10, start_id, mds_service=mds_service)) start_id += 10 mds_services[1].capacity = 11 # on 1, vpool 1 mds_services[1].save() mds_services[2].capacity = 20 # on 1, vpool 1 mds_services[2].save() mds_services[3].capacity = 12 # on 2, vpool 1 mds_services[3].save() mds_services[4].capacity = 14 # on 3, vpool 1 mds_services[4].save() mds_services[5].capacity = 16 # on 4, vpool 1 mds_services[5].save() mds_services[6].capacity = 11 # on 4, vpool 2 mds_services[6].save() mds_services[7].capacity = 13 # on 5, vpool 2 mds_services[7].save() mds_services[8].capacity = 19 # on 6, vpool 2 mds_services[8].save() mds_services[9].capacity = 15 # on 6, vpool 2 mds_services[9].save() config = MDSServiceController.get_mds_storagedriver_config_set(vpools[1]) expected = {storagerouters[1].guid: [{'host': '10.0.0.1', 'port': 2}, {'host': '10.0.0.4', 'port': 5}, {'host': '10.0.0.3', 'port': 4}], storagerouters[2].guid: [{'host': '10.0.0.2', 'port': 3}, {'host': '10.0.0.1', 'port': 2}, {'host': '10.0.0.4', 'port': 5}], storagerouters[3].guid: [{'host': '10.0.0.3', 'port': 4}, {'host': '10.0.0.1', 'port': 2}, {'host': '10.0.0.4', 'port': 5}], storagerouters[4].guid: [{'host': '10.0.0.4', 'port': 5}, {'host': '10.0.0.1', 'port': 2}, {'host': '10.0.0.3', 'port': 4}]} self.assertDictEqual(config, expected, 'Test 1. Got:\n{0}'.format(json.dumps(config, indent=2))) mds_services[2].capacity = 10 # on 1, vpool 1 mds_services[2].save() config = MDSServiceController.get_mds_storagedriver_config_set(vpools[1]) expected = {storagerouters[1].guid: [{'host': '10.0.0.1', 'port': 1}, {'host': '10.0.0.4', 'port': 5}, {'host': '10.0.0.3', 'port': 4}], storagerouters[2].guid: [{'host': '10.0.0.2', 'port': 3}, {'host': '10.0.0.4', 'port': 5}, {'host': '10.0.0.3', 'port': 4}], storagerouters[3].guid: [{'host': '10.0.0.3', 'port': 4}, {'host': '10.0.0.4', 'port': 5}, {'host': '10.0.0.2', 'port': 3}], storagerouters[4].guid: [{'host': '10.0.0.4', 'port': 5}, {'host': '10.0.0.3', 'port': 4}, {'host': '10.0.0.2', 'port': 3}]} self.assertDictEqual(config, expected, 'Test 2. Got:\n{0}'.format(json.dumps(config, indent=2))) def test_syncreality(self): """ Validates whether reality is synced to the model as expected """ def _generate_backend_config(_scenario, _vdisks, _mds_services): """ Injects a backend config that would be returned by the storagedriver """ for disk_id in _scenario: configs = [] for mds_id in _scenario[disk_id]: config = type('MDSNodeConfig', (), {'address': self._generate_nc_function(True, _mds_services[mds_id]), 'port': self._generate_nc_function(False, _mds_services[mds_id])})() configs.append(config) mds_backend_config = type('MDSMetaDataBackendConfig', (), {'node_configs': self._generate_bc_function(configs)})() StorageDriverClient.metadata_backend_config[_vdisks[disk_id].volume_id] = mds_backend_config def _validate_scenario(_scenario, _vdisks, _mds_services): """ Validates a scenario with the model """ for disk_id in _scenario: expected_mds_services = [] for mds_id in _scenario[disk_id]: expected_mds_services.append(_mds_services[mds_id]) disk = _vdisks[disk_id] self.assertEqual(len(disk.mds_services), len(expected_mds_services)) for junction in disk.mds_services: self.assertIn(junction.mds_service, expected_mds_services) def _test_scenario(scenario, _vdisks, _mds_services): """ Executes a testrun for a given scenario """ _generate_backend_config(scenario, _vdisks, _mds_services) for vdisk_id in _vdisks: MDSServiceController.sync_vdisk_to_reality(_vdisks[vdisk_id]) _validate_scenario(scenario, _vdisks, _mds_services) vpools, _, _, _, mds_services, _ = self._build_service_structure( {'vpools': [1], 'storagerouters': [1, 2, 3, 4], 'storagedrivers': [(1, 1, 1), (2, 1, 2), (3, 1, 3), (4, 1, 4)], # (<id>, <vpool_id>, <sr_id>) 'mds_services': [(1, 1), (2, 1), (3, 2), (4, 3), (5, 4)]} # (<id>, <sd_id>) ) vdisks = self._create_vdisks_for_mds_service(5, 1, vpool=vpools[1]) _test_scenario({1: [1, 3, 4], 2: [1, 2], 3: [1, 3, 4], 4: [3, 4, 5], 5: [1, 4, 5]}, vdisks, mds_services) _test_scenario({1: [1, 2], 2: [1, 2, 3, 4, 5], 3: [1, 2], 4: [5], 5: [1, 4, 5]}, vdisks, mds_services) def test_ensure_safety(self): """ Validates whether the ensure_safety call works as expected """ def _generate_mds_service_load_repr(_mds_service): """ Generates a load representing thing for a given mds_service """ masters, slaves = 0, 0 for _junction in _mds_service.vdisks: if _junction.is_master: masters += 1 else: slaves += 1 capacity = _mds_service.capacity if capacity == -1: capacity = 'infinite' _load, _ = MDSServiceController.get_mds_load(_mds_service) if _load == float('inf'): _load = 'infinite' else: _load = round(_load, 2) return [_mds_service.service.storagerouter.ip, _mds_service.service.ports[0], masters, slaves, capacity, _load] def _check_reality(_configs, _loads, _vdisks, _mds_services, test=True, display=False): """ Validates 'reality' with an expected config/load """ reality_configs = [] for _vdisk_id in _vdisks: reality_configs.append(_vdisks[_vdisk_id].info['metadata_backend_config']) if display is True: for c in reality_configs: print c if test is True: self.assertListEqual(reality_configs, _configs) reality_loads = [] for mds_id in _mds_services: reality_loads.append(_generate_mds_service_load_repr(_mds_services[mds_id])) if display is True: for l in reality_loads: print l if test is True: self.assertListEqual(reality_loads, _loads) PersistentFactory.get_client().set('ovs.storagedriver.mds.safety', '3') PersistentFactory.get_client().set('ovs.storagedriver.mds.maxload', '75') PersistentFactory.get_client().set('ovs.storagedriver.mds.tlogs', '100') vpools, storagerouters, storagedrivers, _, mds_services, service_type = self._build_service_structure( {'vpools': [1], 'storagerouters': [1, 2, 3, 4], 'storagedrivers': [(1, 1, 1), (2, 1, 2), (3, 1, 3), (4, 1, 4)], # (<id>, <vpool_id>, <sr_id>) 'mds_services': [(1, 1), (2, 2), (3, 3), (4, 4)]} # (<id>, <sd_id>) ) vdisks = {} start_id = 1 for mds_service in mds_services.itervalues(): vdisks.update(self._create_vdisks_for_mds_service(2, start_id, mds_service=mds_service)) start_id += 2 # Validate the start configuration which is simple, each disk has only its default local master configs = [[{'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.2', 'port': 2}], [{'ip': '10.0.0.2', 'port': 2}], [{'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.4', 'port': 4}]] loads = [['10.0.0.1', 1, 2, 0, 10, 20.0], ['10.0.0.2', 2, 2, 0, 10, 20.0], ['10.0.0.3', 3, 2, 0, 10, 20.0], ['10.0.0.4', 4, 2, 0, 10, 20.0]] _check_reality(configs, loads, vdisks, mds_services) # Validate first run. Each disk should now have sufficient nodes, since there are plenty of MDS services available configs = [[{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.2', 'port': 2}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.2', 'port': 2}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.2', 'port': 2}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}]] loads = [['10.0.0.1', 1, 2, 5, 10, 70.0], ['10.0.0.2', 2, 2, 4, 10, 60.0], ['10.0.0.3', 3, 2, 4, 10, 60.0], ['10.0.0.4', 4, 2, 3, 10, 50.0]] for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # Validate whether this extra (unnessecairy) run doesn't change anything, preventing reconfiguring over and # over again for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # Validating whether an overloaded node will cause correct rebalancing mds_services[2].capacity = 2 mds_services[2].save() configs = [[{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}]] loads = [['10.0.0.1', 1, 2, 5, 10, 70.0], ['10.0.0.2', 2, 2, 0, 2, 100.0], ['10.0.0.3', 3, 2, 5, 10, 70.0], ['10.0.0.4', 4, 2, 5, 10, 70.0]] for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # Validate whether the overloaded services are still handled. In this case, causing a reoder of the slaves as # ordered in the model configs = [[{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}]] loads = [['10.0.0.1', 1, 2, 5, 10, 70.0], ['10.0.0.2', 2, 2, 0, 2, 100.0], ['10.0.0.3', 3, 2, 5, 10, 70.0], ['10.0.0.4', 4, 2, 5, 10, 70.0]] for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # Again, validating whether a subsequent run doesn't give unexpected changes for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # A MDS service will be added (next to the overloaded service), this should cause the expected rebalancing s_id = '{0}-5'.format(storagerouters[2].name) service = Service() service.name = s_id service.storagerouter = storagerouters[2] service.ports = [5] service.type = service_type service.save() mds_service = MDSService() mds_service.service = service mds_service.number = 0 mds_service.capacity = 10 mds_service.vpool = vpools[1] mds_service.save() mds_services[5] = mds_service configs = [[{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.2', 'port': 5}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.2', 'port': 5}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.2', 'port': 5}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}]] loads = [['10.0.0.1', 1, 2, 5, 10, 70.0], ['10.0.0.2', 2, 2, 0, 2, 100.0], ['10.0.0.3', 3, 2, 5, 10, 70.0], ['10.0.0.4', 4, 2, 5, 10, 70.0], ['10.0.0.2', 5, 0, 3, 10, 30.0]] for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # If the tlogs are not catched up, nothing should be changed for vdisk_id in [3, 4]: StorageDriverClient.catch_up[vdisks[vdisk_id].volume_id] = 1000 for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # The next run, after tlogs are catched up, a master switch should be executed for vdisk_id in [3, 4]: StorageDriverClient.catch_up[vdisks[vdisk_id].volume_id] = 50 configs = [[{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 5}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.2', 'port': 5}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}]] loads = [['10.0.0.1', 1, 2, 5, 10, 70.0], ['10.0.0.2', 2, 1, 0, 2, 50.0], ['10.0.0.3', 3, 2, 5, 10, 70.0], ['10.0.0.4', 4, 2, 5, 10, 70.0], ['10.0.0.2', 5, 1, 1, 10, 20.0]] for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # Validate whether a volume migration makes the master follow StorageDriverClient.vrouter_id[vdisks[1].volume_id] = storagedrivers[3].storagedriver_id configs = [[{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.2', 'port': 5}], [{'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 5}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.3', 'port': 3}], [{'ip': '10.0.0.2', 'port': 2}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}, {'ip': '10.0.0.4', 'port': 4}], [{'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.1', 'port': 1}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.2', 'port': 5}], [{'ip': '10.0.0.4', 'port': 4}, {'ip': '10.0.0.3', 'port': 3}, {'ip': '10.0.0.1', 'port': 1}]] loads = [['10.0.0.1', 1, 1, 6, 10, 70.0], ['10.0.0.2', 2, 1, 0, 2, 50.0], ['10.0.0.3', 3, 3, 4, 10, 70.0], ['10.0.0.4', 4, 2, 4, 10, 60.0], ['10.0.0.2', 5, 1, 2, 10, 30.0]] for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) # Validates if a second run doesn't change anything for vdisk_id in sorted(vdisks.keys()): MDSServiceController.ensure_safety(vdisks[vdisk_id]) _check_reality(configs, loads, vdisks, mds_services) if __name__ == '__main__': suite = unittest.TestLoader().loadTestsFromTestCase(MDSServices) unittest.TextTestRunner(verbosity=2).run(suite)
0.459561
0.294481
from multiprocessing.sharedctypes import Value from pprint import pprint import cv2 import numpy as np from functools import cached_property from itertools import count from collections import defaultdict from skimage.metrics import structural_similarity as ssim from tuning import hyperparams # Used to assign unique ids to the entity. counter = count() class Tracker: ''' Singleton in charge of tracking objects moving in the scenes, by associating newly detected blobs with the previously detected entities. ''' def __init__(self, context): ''' Parameters: - context: The parent IntrusionDetection object, which some global scene information ''' self.context = context self.entities_by_frame = defaultdict(list) def get_entities(self, frame_index) -> list['Entity']: ''' Retrieve all entities detected in a particular frame ''' return self.entities_by_frame[frame_index] def track_frame(self, blobs: list['Blob'], frame_index: int, frame, bg_diff): ''' Tries to associate newly detected blobs with previous entities. In doing so, it updates the classification scores by running an heuristic function. Parameters: - blobs: A list of the newly detected Blob objects - frame_index: the index of the current frame - frame: The current frame image - bg_diff: The difference between the current frame and the detected background ''' current_entities = [] for b in blobs: for e in self.entities_by_frame[frame_index - 1]: if b.similar(e.blob) and e not in current_entities: e.update(b) current_entities.append(e) break else: current_entities.append(Entity(b, frame_index)) for e in current_entities: e.compute_scores(frame, bg_diff, self.context.bg) self.entities_by_frame[frame_index] = current_entities return self.entities_by_frame[frame_index] class Entity(object): ''' Track the evolution of a single blob over time. ''' @property def blob(self) -> 'Blob': ''' The latest blob object associated with this entity. ''' return self._blob @property def speedX(self) -> float: ''' How much the blob's centroid has moved along the X axis. ''' return self._speedX @property def speedY(self) -> float: ''' How much the blob's centroid has moved along the Y axis. ''' return self._speedY @property def color(self): ''' A utility function used to label the detected object's class with color (BGR). Returns: - An RGB triplet: Blue for a person class, Red for a false object, Green for a true object. ''' if self.classification == 'person': return (255, 0, 0) if self.classification == 'true_o': return (0, 255, 0) if self.classification == 'false_o': return (0, 0, 255) else: return ValueError('Class not found') @property def id(self) -> str: ''' The unique id associated with the entity. The id is in the format #FXXXX_YYYY where XXXX corresponds to the frame index where the entity is initially detected, and YYYY is a progressive unique integer. ''' return self._id def __init__(self, blob: 'Blob', frameNumber): self._id = f'#F{frameNumber:04}_{counter.__next__():04}' # print('Creating Entity', self._id) self._blob = blob self._prev_blob = blob self._speedX = 0.0 self._speedY = 0.0 self._personScore = 0.0 self._objectScore = 0.0 @property def classification(self) -> str: ''' Returns the detected class of the entity. ''' if self._personScore > 0: return 'person' elif self._objectScore > 0: return 'true_o' else: return 'false_o' @staticmethod def CSVHeader() -> str: return 'id; area; perimeter; aspect; centroidX; centroidY; boundingRectX; boundingRectY; boundingRectH; boundingRectW; classification' def toCSV(self, sep='; ') -> str: ''' Return all the geometric properties related to the entity's shape. ''' return sep.join([self.id] + list( map(lambda x: str(int(1000 * x) / (1000.0)), [ self.blob.area, self.blob.perimeter, self.blob.aspect, self.blob.centroid[0], self.blob.centroid[1], ])) + [ str(self.blob.bounding_rect)[1:-1].replace(', ', sep), self.classification ]) def __repr__(self) -> str: return f'{self._id}\tclass: {self.classification}\tps: {self._personScore}\tos: {self._objectScore}' def update(self, blob: 'Blob'): ''' Evolve the entity's history with a new blob, and recompute it's speed. ''' self._prev_blob = self._blob self._blob = blob self._speedX = self._blob.centroid[0] - self._prev_blob.centroid[0] self._speedY = self._blob.centroid[1] - self._prev_blob.centroid[1] def compute_scores(self, frame, diff, bg): ''' Update the classification scores with the heuristic. ''' if abs(self.speedX) > 1 or abs(self.speedY) > 1: self._personScore = min(self._personScore + 1, 40) else: self._personScore = max(self._personScore - 1, -40) if self._check_contour_similarity(frame, diff): self._objectScore = min(self._objectScore + 1, 40) else: self._objectScore = max(self._objectScore - 1, -40) def _check_contour_similarity(self, frame, diff, match_threshold=0.2) -> bool: ''' Private function used to detect true or false object, by using the structural similarity index measure. Parameters: - frame: the original frame - diff: the frame after background subtraction Returns: - True if the detected similarity greater or equal to the provided threshold. ''' x, y, w, h = self.blob.bounding_rect if (w < 7 or h < 7): return False frame_roi = frame[y:y + h, x:x + w, 0] diff_roi = diff[y:y + h, x:x + w] ssim_score = ssim(frame_roi, diff_roi, data_range=diff_roi.max() - diff_roi.min()) return ssim_score >= match_threshold class Blob: ''' Represents a single blob, without making any temporal assumption. ''' @cached_property def aspect(self): x, y, w, h = cv2.boundingRect(self._contour) return float(w) / h @cached_property def solidity(self): area = cv2.contourArea(self._contour) hull = cv2.convexHull(self._contour) hull_area = cv2.contourArea(hull) return float(area) / (hull_area + 0.00001) @cached_property def extent(self): area = cv2.contourArea(self._contour) _, _, w, h = cv2.boundingRect(self._contour) return float(area) / (w * h) @cached_property def moments(self): return cv2.moments(self._contour) @cached_property def centroid(self): return (self.moments['m10'] / (self.moments['m00'] + 0.00001), self.moments['m01'] / (self.moments['m00'] + 0.00001)) @cached_property def perimeter(self): return cv2.arcLength(self._contour, True) @cached_property def area(self): return cv2.contourArea(self._contour) @cached_property def bounding_rect(self): return cv2.boundingRect(self._contour) @property def contour(self): return self._contour def corner(self, corner_code): ''' Obtain the coordinates of a corner of the bounding rect. Parameters: - corner_code: Must be one of 'tl', 'tr', 'bl', 'br' (t = top, b = bottom, l = left, r = right) ''' x, y, h, w = self.bounding_rect if corner_code == 'br': return (x + w, y + h) elif corner_code == 'bl': return (x, y + h) elif corner_code == 'tl': return (x, y) elif corner_code == 'tr': return (x + w, y) else: raise ValueError('Expected one of (tl, tr, bl, br)') def intersection_area(self, other): ''' Compute the intersection area between this blob's contour and another one. ''' sx, sy = self.corner(corner_code='br') ox, oy = other.corner(corner_code='br') blank = np.zeros((max(sy, oy), max(sx, ox))) image1 = cv2.drawContours(blank.copy(), [self.contour], 0, 1, thickness=cv2.FILLED) image2 = cv2.drawContours(blank.copy(), [other.contour], 0, 1, thickness=cv2.FILLED) intersectionArea = cv2.countNonZero(cv2.bitwise_and(image1, image2)) return intersectionArea # intersection_threshold = 15 # perimeter_threshold = 0 # aspect_threshold = 1.9 # extent_threshold = 0.25 # solidity_threshold = 0.2 def similar( self, other: 'Blob', intersection_threshold: float = \ hyperparams['tracking']['intersection_threshold'], aspect_threshold: float = \ hyperparams['tracking']['aspect_threshold'], extent_threshold: float = \ hyperparams['tracking']['extent_threshold'], solidity_threshold: float = \ hyperparams['tracking']['solidity_threshold'], ): ''' Check if the provided blob is similar to the current one. ''' intersection = self.intersection_area(other) return all([ intersection > intersection_threshold, abs(self.aspect - other.aspect) <= aspect_threshold, abs(self.extent - other.extent) <= extent_threshold, abs(self.solidity - other.solidity) <= solidity_threshold, ]) def __str__(self) -> str: return f'Centroid: {self.centroid}\tArea: {self.area}' def __repr__(self) -> str: return f'Centroid: {self.centroid}\tArea: {self.area}' def __init__(self, contour): ''' Parameters: - contour: the blob's contour ''' self._contour = contour
lib.py
from multiprocessing.sharedctypes import Value from pprint import pprint import cv2 import numpy as np from functools import cached_property from itertools import count from collections import defaultdict from skimage.metrics import structural_similarity as ssim from tuning import hyperparams # Used to assign unique ids to the entity. counter = count() class Tracker: ''' Singleton in charge of tracking objects moving in the scenes, by associating newly detected blobs with the previously detected entities. ''' def __init__(self, context): ''' Parameters: - context: The parent IntrusionDetection object, which some global scene information ''' self.context = context self.entities_by_frame = defaultdict(list) def get_entities(self, frame_index) -> list['Entity']: ''' Retrieve all entities detected in a particular frame ''' return self.entities_by_frame[frame_index] def track_frame(self, blobs: list['Blob'], frame_index: int, frame, bg_diff): ''' Tries to associate newly detected blobs with previous entities. In doing so, it updates the classification scores by running an heuristic function. Parameters: - blobs: A list of the newly detected Blob objects - frame_index: the index of the current frame - frame: The current frame image - bg_diff: The difference between the current frame and the detected background ''' current_entities = [] for b in blobs: for e in self.entities_by_frame[frame_index - 1]: if b.similar(e.blob) and e not in current_entities: e.update(b) current_entities.append(e) break else: current_entities.append(Entity(b, frame_index)) for e in current_entities: e.compute_scores(frame, bg_diff, self.context.bg) self.entities_by_frame[frame_index] = current_entities return self.entities_by_frame[frame_index] class Entity(object): ''' Track the evolution of a single blob over time. ''' @property def blob(self) -> 'Blob': ''' The latest blob object associated with this entity. ''' return self._blob @property def speedX(self) -> float: ''' How much the blob's centroid has moved along the X axis. ''' return self._speedX @property def speedY(self) -> float: ''' How much the blob's centroid has moved along the Y axis. ''' return self._speedY @property def color(self): ''' A utility function used to label the detected object's class with color (BGR). Returns: - An RGB triplet: Blue for a person class, Red for a false object, Green for a true object. ''' if self.classification == 'person': return (255, 0, 0) if self.classification == 'true_o': return (0, 255, 0) if self.classification == 'false_o': return (0, 0, 255) else: return ValueError('Class not found') @property def id(self) -> str: ''' The unique id associated with the entity. The id is in the format #FXXXX_YYYY where XXXX corresponds to the frame index where the entity is initially detected, and YYYY is a progressive unique integer. ''' return self._id def __init__(self, blob: 'Blob', frameNumber): self._id = f'#F{frameNumber:04}_{counter.__next__():04}' # print('Creating Entity', self._id) self._blob = blob self._prev_blob = blob self._speedX = 0.0 self._speedY = 0.0 self._personScore = 0.0 self._objectScore = 0.0 @property def classification(self) -> str: ''' Returns the detected class of the entity. ''' if self._personScore > 0: return 'person' elif self._objectScore > 0: return 'true_o' else: return 'false_o' @staticmethod def CSVHeader() -> str: return 'id; area; perimeter; aspect; centroidX; centroidY; boundingRectX; boundingRectY; boundingRectH; boundingRectW; classification' def toCSV(self, sep='; ') -> str: ''' Return all the geometric properties related to the entity's shape. ''' return sep.join([self.id] + list( map(lambda x: str(int(1000 * x) / (1000.0)), [ self.blob.area, self.blob.perimeter, self.blob.aspect, self.blob.centroid[0], self.blob.centroid[1], ])) + [ str(self.blob.bounding_rect)[1:-1].replace(', ', sep), self.classification ]) def __repr__(self) -> str: return f'{self._id}\tclass: {self.classification}\tps: {self._personScore}\tos: {self._objectScore}' def update(self, blob: 'Blob'): ''' Evolve the entity's history with a new blob, and recompute it's speed. ''' self._prev_blob = self._blob self._blob = blob self._speedX = self._blob.centroid[0] - self._prev_blob.centroid[0] self._speedY = self._blob.centroid[1] - self._prev_blob.centroid[1] def compute_scores(self, frame, diff, bg): ''' Update the classification scores with the heuristic. ''' if abs(self.speedX) > 1 or abs(self.speedY) > 1: self._personScore = min(self._personScore + 1, 40) else: self._personScore = max(self._personScore - 1, -40) if self._check_contour_similarity(frame, diff): self._objectScore = min(self._objectScore + 1, 40) else: self._objectScore = max(self._objectScore - 1, -40) def _check_contour_similarity(self, frame, diff, match_threshold=0.2) -> bool: ''' Private function used to detect true or false object, by using the structural similarity index measure. Parameters: - frame: the original frame - diff: the frame after background subtraction Returns: - True if the detected similarity greater or equal to the provided threshold. ''' x, y, w, h = self.blob.bounding_rect if (w < 7 or h < 7): return False frame_roi = frame[y:y + h, x:x + w, 0] diff_roi = diff[y:y + h, x:x + w] ssim_score = ssim(frame_roi, diff_roi, data_range=diff_roi.max() - diff_roi.min()) return ssim_score >= match_threshold class Blob: ''' Represents a single blob, without making any temporal assumption. ''' @cached_property def aspect(self): x, y, w, h = cv2.boundingRect(self._contour) return float(w) / h @cached_property def solidity(self): area = cv2.contourArea(self._contour) hull = cv2.convexHull(self._contour) hull_area = cv2.contourArea(hull) return float(area) / (hull_area + 0.00001) @cached_property def extent(self): area = cv2.contourArea(self._contour) _, _, w, h = cv2.boundingRect(self._contour) return float(area) / (w * h) @cached_property def moments(self): return cv2.moments(self._contour) @cached_property def centroid(self): return (self.moments['m10'] / (self.moments['m00'] + 0.00001), self.moments['m01'] / (self.moments['m00'] + 0.00001)) @cached_property def perimeter(self): return cv2.arcLength(self._contour, True) @cached_property def area(self): return cv2.contourArea(self._contour) @cached_property def bounding_rect(self): return cv2.boundingRect(self._contour) @property def contour(self): return self._contour def corner(self, corner_code): ''' Obtain the coordinates of a corner of the bounding rect. Parameters: - corner_code: Must be one of 'tl', 'tr', 'bl', 'br' (t = top, b = bottom, l = left, r = right) ''' x, y, h, w = self.bounding_rect if corner_code == 'br': return (x + w, y + h) elif corner_code == 'bl': return (x, y + h) elif corner_code == 'tl': return (x, y) elif corner_code == 'tr': return (x + w, y) else: raise ValueError('Expected one of (tl, tr, bl, br)') def intersection_area(self, other): ''' Compute the intersection area between this blob's contour and another one. ''' sx, sy = self.corner(corner_code='br') ox, oy = other.corner(corner_code='br') blank = np.zeros((max(sy, oy), max(sx, ox))) image1 = cv2.drawContours(blank.copy(), [self.contour], 0, 1, thickness=cv2.FILLED) image2 = cv2.drawContours(blank.copy(), [other.contour], 0, 1, thickness=cv2.FILLED) intersectionArea = cv2.countNonZero(cv2.bitwise_and(image1, image2)) return intersectionArea # intersection_threshold = 15 # perimeter_threshold = 0 # aspect_threshold = 1.9 # extent_threshold = 0.25 # solidity_threshold = 0.2 def similar( self, other: 'Blob', intersection_threshold: float = \ hyperparams['tracking']['intersection_threshold'], aspect_threshold: float = \ hyperparams['tracking']['aspect_threshold'], extent_threshold: float = \ hyperparams['tracking']['extent_threshold'], solidity_threshold: float = \ hyperparams['tracking']['solidity_threshold'], ): ''' Check if the provided blob is similar to the current one. ''' intersection = self.intersection_area(other) return all([ intersection > intersection_threshold, abs(self.aspect - other.aspect) <= aspect_threshold, abs(self.extent - other.extent) <= extent_threshold, abs(self.solidity - other.solidity) <= solidity_threshold, ]) def __str__(self) -> str: return f'Centroid: {self.centroid}\tArea: {self.area}' def __repr__(self) -> str: return f'Centroid: {self.centroid}\tArea: {self.area}' def __init__(self, contour): ''' Parameters: - contour: the blob's contour ''' self._contour = contour
0.799638
0.443962
import numpy as np import warnings class ObjectiveFunction( object ): """ The `ObjectiveFunction` class defines an objective function. """ def __init__(self,definition=None): self.definition = definition self.parameters = [] self.global_minimum = None self.subject_to = [] def add_parameter(self,parameter): if not isinstance(parameter,ObjectiveFunctionParameter): warnings.warn('Please use the ObjectiveFunctionParameter class.') return self.parameters.append(parameter) self.update_dimension() def add_subject(self,subject): if not callable(subject): warnings.warn('Subject must be a callable function returning a boolean.') return self.subject_to.append(subject) def update_dimension(self): self.dimension = len(self.parameters) def evaluate(self,parameters=[]): if not parameters: parameters = self.parameters return self.definition( parameters ) def determine_feasibility(self,parameters=[]): if not parameters: parameters = self.parameters feasibility = [] for parameter in parameters: feasibility.append( parameter.is_feasible() ) for subject in self.subject_to: feasibility.append( subject(parameters) ) return np.mean(feasibility) class MultiObjectiveFunction( ObjectiveFunction ): """ The `MultiObjectiveFunction` class defines various objective functions. """ def __init__(self): super(MultiObjectiveFunction, self).__init__() self.objective_functions = [] def add_objective_function(self,objective_function): if not isinstance(objective_function,ObjectiveFunction): warnings.warn('Please use the ObjectiveFunction class.') return self.objective_functions.append(objective_function) self.update_objective_dimension() def update_objective_dimension(self): self.objective_dimension = len(self.objective_functions) def evaluate(self,parameters=[]): if not parameters: parameters = self.parameters f = [] for objective_function in self.objective_functions: f.append( objective_function.evaluate(parameters=parameters) ) return f def determine_feasibility(self,parameters=[]): if not parameters: parameters = self.parameters feasibility = [] for parameter in parameters: feasibility.append( parameter.is_feasible() ) for subject in self.subject_to: feasibility.append( subject(parameters) ) feasibility = [np.mean(feasibility)] for objective_function in self.objective_functions: feasibility.append( objective_function.determine_feasibility(parameters=parameters) ) return np.mean(feasibility) class ObjectiveFunctionParameter( object ): """ The `ObjectiveFunctionParameter` class defines a parameter for the ObjectiveFunction. """ def __init__(self, subject_to=lambda x:(x>-np.inf and x<np.inf), mapping=lambda x:x): self.subject_to = subject_to self.mapping = mapping self.value = None self.mapping_parameter = None # between 0 and 1 (for binary optimzers) self.true_value = None self.bits = 8 self.code = None self.label = '' def set_random_value(self): self.mapping_parameter = np.random.random() self.value = self.mapping( self.mapping_parameter ) self.update_binary_representation() def set_mapping_parameter(self,value): self.mapping_parameter = value self.value = self.mapping( self.mapping_parameter ) self.update_binary_representation() def set_binary_code(self,code): self.code = code self.update_values() def update_values(self): # https://de.mathworks.com/matlabcentral/answers/25549-convert-floating-point-to-binary self.mapping_parameter = np.dot(self.code,[2.0**p for p in np.arange(-1,-(self.bits+1),-1)]) self.value = self.mapping( self.mapping_parameter ) def update_binary_representation(self): # https://de.mathworks.com/matlabcentral/answers/25549-convert-floating-point-to-binary self.code = [np.fix(np.fmod(self.mapping_parameter * 2.0**p, 2)) for p in np.arange(1,self.bits+1)] def is_feasible(self): return self.subject_to( self.value )
src/picasso/utils/optimization/objective_functions.py
import numpy as np import warnings class ObjectiveFunction( object ): """ The `ObjectiveFunction` class defines an objective function. """ def __init__(self,definition=None): self.definition = definition self.parameters = [] self.global_minimum = None self.subject_to = [] def add_parameter(self,parameter): if not isinstance(parameter,ObjectiveFunctionParameter): warnings.warn('Please use the ObjectiveFunctionParameter class.') return self.parameters.append(parameter) self.update_dimension() def add_subject(self,subject): if not callable(subject): warnings.warn('Subject must be a callable function returning a boolean.') return self.subject_to.append(subject) def update_dimension(self): self.dimension = len(self.parameters) def evaluate(self,parameters=[]): if not parameters: parameters = self.parameters return self.definition( parameters ) def determine_feasibility(self,parameters=[]): if not parameters: parameters = self.parameters feasibility = [] for parameter in parameters: feasibility.append( parameter.is_feasible() ) for subject in self.subject_to: feasibility.append( subject(parameters) ) return np.mean(feasibility) class MultiObjectiveFunction( ObjectiveFunction ): """ The `MultiObjectiveFunction` class defines various objective functions. """ def __init__(self): super(MultiObjectiveFunction, self).__init__() self.objective_functions = [] def add_objective_function(self,objective_function): if not isinstance(objective_function,ObjectiveFunction): warnings.warn('Please use the ObjectiveFunction class.') return self.objective_functions.append(objective_function) self.update_objective_dimension() def update_objective_dimension(self): self.objective_dimension = len(self.objective_functions) def evaluate(self,parameters=[]): if not parameters: parameters = self.parameters f = [] for objective_function in self.objective_functions: f.append( objective_function.evaluate(parameters=parameters) ) return f def determine_feasibility(self,parameters=[]): if not parameters: parameters = self.parameters feasibility = [] for parameter in parameters: feasibility.append( parameter.is_feasible() ) for subject in self.subject_to: feasibility.append( subject(parameters) ) feasibility = [np.mean(feasibility)] for objective_function in self.objective_functions: feasibility.append( objective_function.determine_feasibility(parameters=parameters) ) return np.mean(feasibility) class ObjectiveFunctionParameter( object ): """ The `ObjectiveFunctionParameter` class defines a parameter for the ObjectiveFunction. """ def __init__(self, subject_to=lambda x:(x>-np.inf and x<np.inf), mapping=lambda x:x): self.subject_to = subject_to self.mapping = mapping self.value = None self.mapping_parameter = None # between 0 and 1 (for binary optimzers) self.true_value = None self.bits = 8 self.code = None self.label = '' def set_random_value(self): self.mapping_parameter = np.random.random() self.value = self.mapping( self.mapping_parameter ) self.update_binary_representation() def set_mapping_parameter(self,value): self.mapping_parameter = value self.value = self.mapping( self.mapping_parameter ) self.update_binary_representation() def set_binary_code(self,code): self.code = code self.update_values() def update_values(self): # https://de.mathworks.com/matlabcentral/answers/25549-convert-floating-point-to-binary self.mapping_parameter = np.dot(self.code,[2.0**p for p in np.arange(-1,-(self.bits+1),-1)]) self.value = self.mapping( self.mapping_parameter ) def update_binary_representation(self): # https://de.mathworks.com/matlabcentral/answers/25549-convert-floating-point-to-binary self.code = [np.fix(np.fmod(self.mapping_parameter * 2.0**p, 2)) for p in np.arange(1,self.bits+1)] def is_feasible(self): return self.subject_to( self.value )
0.62395
0.336195
from __future__ import division import math import types import torch import utils import random import numbers import numpy as np import scipy as sp from scipy import misc from PIL import Image, ImageOps, ImageDraw class Compose(object): """Composes several transforms together. Args: transforms (List[Transform]): list of transforms to compose. Example: >>> transforms.Compose([ >>> transforms.CenterCrop(10), >>> transforms.ToTensor(), >>> ]) """ def __init__(self, transforms): self.transforms = transforms def __call__(self, input): for t in self.transforms: input = t(input) return input class ToTensor(object): """Converts a PIL.Image (RGB) or numpy.ndarray (H x W x C) in the range [0, 255] to a torch.FloatTensor of shape (C x H x W) in the range [0.0, 1.0].""" def __call__(self, input): for key in input.keys(): value = input[key] if isinstance(value, np.ndarray): # handle numpy array input[key] = torch.from_numpy(value) else: # handle PIL Image tmp = torch.ByteTensor(torch.ByteStorage.from_buffer(value.tobytes())) value = tmp.view(value.size[1], value.size[0], len(value.mode)) # put it from HWC to CHW format # yikes, this transpose takes 80% of the loading time/CPU value = value.transpose(0, 1).transpose(0, 2).contiguous() input[key] = value.float().div(255) return input class ToPILImage(object): """Converts a torch.*Tensor of range [0, 1] and shape C x H x W or numpy ndarray of dtype=uint8, range[0, 255] and shape H x W x C to a PIL.Image of range [0, 255] """ def __call__(self, input): if isinstance(input['img'], np.ndarray): # handle numpy array input['img'] = Image.fromarray(input['img']) else: npimg = input['img'].mul(255).byte().numpy() npimg = np.transpose(npimg, (1,2,0)) input['img'] = Image.fromarray(npimg) return input class Normalize(object): """Given mean: (R, G, B) and std: (R, G, B), will normalize each channel of the torch.*Tensor, i.e. channel = (channel - mean) / std """ def __init__(self, mean, std): self.mean = mean self.std = std def __call__(self, input): # TODO: make efficient for t, m, s in zip(input['img'], self.mean, self.std): t.sub_(m).div_(s) return input class Scale(object): """Rescales the input PIL.Image to the given 'size'. 'size' will be the size of the smaller edge. For example, if height > width, then image will be rescaled to (size * height / width, size) size: size of the smaller edge interpolation: Default: PIL.Image.BILINEAR """ def __init__(self, size, interpolation=Image.BILINEAR): self.size = size self.interpolation = interpolation def __call__(self, input): w, h = input['img'].size if (w <= h and w == self.size) or (h <= w and h == self.size): return input if w < h: ow = self.size oh = int(self.size * h / w) input['img'] = input['img'].resize((ow, oh), self.interpolation) return input else: oh = self.size ow = int(self.size * w / h) input['img'] = input['img'].resize((ow, oh), self.interpolation) return input class CenterCrop(object): """Crops the given PIL.Image at the center to have a region of the given size. size can be a tuple (target_height, target_width) or an integer, in which case the target will be of a square shape (size, size) """ def __init__(self, size): if isinstance(size, numbers.Number): self.size = (int(size), int(size)) else: self.size = size def __call__(self, input): w, h = input['img'].size th, tw = self.size x1 = int(round((w - tw) / 2.)) y1 = int(round((h - th) / 2.)) input['img'] = input['img'].crop((x1, y1, x1 + tw, y1 + th)) return input class Pad(object): """Pads the given PIL.Image on all sides with the given "pad" value""" def __init__(self, padding, fill=0): assert isinstance(padding, numbers.Number) assert isinstance(fill, numbers.Number) self.padding = padding self.fill = fill def __call__(self, input): input['img'] = ImageOps.expand(input['img'], border=self.padding, fill=self.fill) return input class Lambda(object): """Applies a lambda as a transform.""" def __init__(self, lambd): assert type(lambd) is types.LambdaType self.lambd = lambd def __call__(self, input): input['img'] = self.lambd(img) return input class RandomCrop(object): """Crops the given PIL.Image at a random location to have a region of the given size. size can be a tuple (target_height, target_width) or an integer, in which case the target will be of a square shape (size, size) """ def __init__(self, size, padding=0): if isinstance(size, numbers.Number): self.size = (int(size), int(size)) else: self.size = size self.padding = padding def __call__(self, input): if self.padding > 0: input['img'] = ImageOps.expand(img, border=self.padding, fill=0) w, h = input['img'].size th, tw = self.size if w == tw and h == th: return input x1 = random.randint(0, w - tw) y1 = random.randint(0, h - th) input['img'] = input['img'].crop((x1, y1, x1 + tw, y1 + th)) return input class RandomHorizontalFlip(object): """Randomly horizontally flips the given PIL.Image with a probability of 0.5 """ def __call__(self, input): if random.random() < 0.5: input['img'] = input['img'].transpose(Image.FLIP_LEFT_RIGHT) input['tgt'] = input['tgt'].transpose(Image.FLIP_LEFT_RIGHT) input['loc'][0] = input['loc'][0] - math.ceil(input['img'].size[0]/2) return input class RandomSizedCrop(object): """Random crop the given PIL.Image to a random size of (0.08 to 1.0) of the original size and and a random aspect ratio of 3/4 to 4/3 of the original aspect ratio This is popularly used to train the Inception networks size: size of the smaller edge interpolation: Default: PIL.Image.BILINEAR """ def __init__(self, size, interpolation=Image.BILINEAR): self.size = size self.interpolation = interpolation def __call__(self, input): for attempt in range(10): area = input['img'].size[0] * input['img'].size[1] target_area = random.uniform(0.08, 1.0) * area aspect_ratio = random.uniform(3. / 4, 4. / 3) w = int(round(math.sqrt(target_area * aspect_ratio))) h = int(round(math.sqrt(target_area / aspect_ratio))) if random.random() < 0.5: w, h = h, w if w <= input['img'].size[0] and h <= input['img'].size[1]: x1 = random.randint(0, input['img'].size[0] - w) y1 = random.randint(0, input['img'].size[1] - h) input['img'] = input['img'].crop((x1, y1, x1 + w, y1 + h)) assert(input['img'].size == (w, h)) input['img'] = input['img'].resize((self.size, self.size), self.interpolation) return input # Fallback scale = Scale(self.size, interpolation=self.interpolation) crop = CenterCrop(self.size) return crop(scale(input)) class NormalizeLandmarks(object): """ max-min normalization of landmarks to range [-1,1]""" def __init__(self,xsize,ysize): self.xsize = xsize self.ysize = ysize def __call__(self, input): valid_points = [v for v in input['loc'] if v[0] != 0 and v[1] != 0] mean = np.mean(valid_points,axis = 0) for i in range(input['loc'].shape[0]): input['loc'][i][0] = -1 + (input['loc'][i][0] * 2. )/(inputx_res) input['loc'][i][1] = -1 + (input['loc'][i][1] * 2. )/(inputy_res) return input class AffineCrop(object): def __init__(self,nlandmark,ix,iy,ox,oy,rangle=0,rscale=0,rtrans=0,gauss=1): self.rangle=rangle self.rscale=rscale self.rtrans=rtrans self.nlandmark=nlandmark self.ix = ix self.iy = iy self.ox = ox self.oy = oy self.utils = utils self.gauss = gauss def __call__(self, input): angle = self.rangle*(2*torch.rand(1)[0] - 1) grad_angle = angle * math.pi / 180 scale = 1+self.rscale*(2*torch.rand(1)[0] - 1) transx = self.rtrans*(2*torch.rand(1)[0] - 1) transy = self.rtrans*(2*torch.rand(1)[0] - 1) img = input['img'] size = img.size h, w = size[0], size[1] centerX, centerY = int(w/2), int(h/2) # perform rotation img = img.rotate(angle, Image.BICUBIC) # perform translation img = img.transform(img.size, Image.AFFINE, (1, 0, transx, 0, 1, transy)) # perform scaling img = img.resize((int(math.ceil(scale*h)) , int(math.ceil(scale*w))) , Image.ANTIALIAS) w, h = img.size x1 = int(round((w - self.ix) / 2.)) y1 = int(round((h - self.ix) / 2.)) input['img'] = img.crop((x1, y1, x1 + self.ix, y1 + self.iy)) if (np.sum(input['loc']) != 0): occ = input['occ'] loc = input['loc'] newloc = np.ones((3,loc.shape[1]+1)) newloc[0:2,0:loc.shape[1]] = loc newloc[0,loc.shape[1]] = centerY newloc[1,loc.shape[1]] = centerX trans_matrix = np.array([[1,0,-1*transx],[0,1,-1*transy],[0,0,1]]) scale_matrix = np.array([[scale,0,0],[0,scale,0],[0,0,1]]) angle_matrix = np.array([[math.cos(grad_angle),math.sin(grad_angle),0],[-math.sin(grad_angle),math.cos(grad_angle),0],[0,0,1]]) # perform rotation newloc[0,:] = newloc[0,:] - centerY newloc[1,:] = newloc[1,:] - centerX newloc = np.dot(angle_matrix, newloc) newloc[0,:] = newloc[0,:] + centerY newloc[1,:] = newloc[1,:] + centerX # perform translation newloc = np.dot(trans_matrix, newloc) # perform scaling newloc = np.dot(scale_matrix, newloc) newloc[0,:] = newloc[0,:] - y1 newloc[1,:] = newloc[1,:] - x1 input['loc'] = newloc[0:2,:] for i in range(input['loc'].shape[1]): if ~((input['loc'][0,i] == np.nan) & (input['loc'][1,i] == np.nan)): if ((input['loc'][0,i] < 0) | (input['loc'][0,i] > self.iy) | (input['loc'][1,i] < 0) | (input['loc'][1,i] > self.ix)): input['loc'][:,i] = np.nan input['occ'][i] = 0 # generate heatmaps input['tgt'] = np.zeros((self.nlandmark+1, self.ox, self.oy)) for i in range(self.nlandmark): if (not np.isnan(input['loc'][:,i][0]) and not np.isnan(input['loc'][:,i][1])): tmp = self.utils.gaussian(np.array([self.ix,self.iy]),input['loc'][:,i],self.gauss) scaled_tmp = sp.misc.imresize(tmp, [self.ox, self.oy]) scaled_tmp = (scaled_tmp - min(scaled_tmp.flatten()) ) / ( max(scaled_tmp.flatten()) - min(scaled_tmp.flatten())) else: scaled_tmp = np.zeros([self.ox,self.oy]) input['tgt'][i] = scaled_tmp tmp = self.utils.gaussian(np.array([self.iy,self.ix]),input['loc'][:,-1],4*self.gauss) scaled_tmp = sp.misc.imresize(tmp, [self.ox, self.oy]) scaled_tmp = (scaled_tmp - min(scaled_tmp.flatten()) ) / ( max(scaled_tmp.flatten()) - min(scaled_tmp.flatten())) input['tgt'][self.nlandmark] = scaled_tmp return input
datasets/transforms.py
from __future__ import division import math import types import torch import utils import random import numbers import numpy as np import scipy as sp from scipy import misc from PIL import Image, ImageOps, ImageDraw class Compose(object): """Composes several transforms together. Args: transforms (List[Transform]): list of transforms to compose. Example: >>> transforms.Compose([ >>> transforms.CenterCrop(10), >>> transforms.ToTensor(), >>> ]) """ def __init__(self, transforms): self.transforms = transforms def __call__(self, input): for t in self.transforms: input = t(input) return input class ToTensor(object): """Converts a PIL.Image (RGB) or numpy.ndarray (H x W x C) in the range [0, 255] to a torch.FloatTensor of shape (C x H x W) in the range [0.0, 1.0].""" def __call__(self, input): for key in input.keys(): value = input[key] if isinstance(value, np.ndarray): # handle numpy array input[key] = torch.from_numpy(value) else: # handle PIL Image tmp = torch.ByteTensor(torch.ByteStorage.from_buffer(value.tobytes())) value = tmp.view(value.size[1], value.size[0], len(value.mode)) # put it from HWC to CHW format # yikes, this transpose takes 80% of the loading time/CPU value = value.transpose(0, 1).transpose(0, 2).contiguous() input[key] = value.float().div(255) return input class ToPILImage(object): """Converts a torch.*Tensor of range [0, 1] and shape C x H x W or numpy ndarray of dtype=uint8, range[0, 255] and shape H x W x C to a PIL.Image of range [0, 255] """ def __call__(self, input): if isinstance(input['img'], np.ndarray): # handle numpy array input['img'] = Image.fromarray(input['img']) else: npimg = input['img'].mul(255).byte().numpy() npimg = np.transpose(npimg, (1,2,0)) input['img'] = Image.fromarray(npimg) return input class Normalize(object): """Given mean: (R, G, B) and std: (R, G, B), will normalize each channel of the torch.*Tensor, i.e. channel = (channel - mean) / std """ def __init__(self, mean, std): self.mean = mean self.std = std def __call__(self, input): # TODO: make efficient for t, m, s in zip(input['img'], self.mean, self.std): t.sub_(m).div_(s) return input class Scale(object): """Rescales the input PIL.Image to the given 'size'. 'size' will be the size of the smaller edge. For example, if height > width, then image will be rescaled to (size * height / width, size) size: size of the smaller edge interpolation: Default: PIL.Image.BILINEAR """ def __init__(self, size, interpolation=Image.BILINEAR): self.size = size self.interpolation = interpolation def __call__(self, input): w, h = input['img'].size if (w <= h and w == self.size) or (h <= w and h == self.size): return input if w < h: ow = self.size oh = int(self.size * h / w) input['img'] = input['img'].resize((ow, oh), self.interpolation) return input else: oh = self.size ow = int(self.size * w / h) input['img'] = input['img'].resize((ow, oh), self.interpolation) return input class CenterCrop(object): """Crops the given PIL.Image at the center to have a region of the given size. size can be a tuple (target_height, target_width) or an integer, in which case the target will be of a square shape (size, size) """ def __init__(self, size): if isinstance(size, numbers.Number): self.size = (int(size), int(size)) else: self.size = size def __call__(self, input): w, h = input['img'].size th, tw = self.size x1 = int(round((w - tw) / 2.)) y1 = int(round((h - th) / 2.)) input['img'] = input['img'].crop((x1, y1, x1 + tw, y1 + th)) return input class Pad(object): """Pads the given PIL.Image on all sides with the given "pad" value""" def __init__(self, padding, fill=0): assert isinstance(padding, numbers.Number) assert isinstance(fill, numbers.Number) self.padding = padding self.fill = fill def __call__(self, input): input['img'] = ImageOps.expand(input['img'], border=self.padding, fill=self.fill) return input class Lambda(object): """Applies a lambda as a transform.""" def __init__(self, lambd): assert type(lambd) is types.LambdaType self.lambd = lambd def __call__(self, input): input['img'] = self.lambd(img) return input class RandomCrop(object): """Crops the given PIL.Image at a random location to have a region of the given size. size can be a tuple (target_height, target_width) or an integer, in which case the target will be of a square shape (size, size) """ def __init__(self, size, padding=0): if isinstance(size, numbers.Number): self.size = (int(size), int(size)) else: self.size = size self.padding = padding def __call__(self, input): if self.padding > 0: input['img'] = ImageOps.expand(img, border=self.padding, fill=0) w, h = input['img'].size th, tw = self.size if w == tw and h == th: return input x1 = random.randint(0, w - tw) y1 = random.randint(0, h - th) input['img'] = input['img'].crop((x1, y1, x1 + tw, y1 + th)) return input class RandomHorizontalFlip(object): """Randomly horizontally flips the given PIL.Image with a probability of 0.5 """ def __call__(self, input): if random.random() < 0.5: input['img'] = input['img'].transpose(Image.FLIP_LEFT_RIGHT) input['tgt'] = input['tgt'].transpose(Image.FLIP_LEFT_RIGHT) input['loc'][0] = input['loc'][0] - math.ceil(input['img'].size[0]/2) return input class RandomSizedCrop(object): """Random crop the given PIL.Image to a random size of (0.08 to 1.0) of the original size and and a random aspect ratio of 3/4 to 4/3 of the original aspect ratio This is popularly used to train the Inception networks size: size of the smaller edge interpolation: Default: PIL.Image.BILINEAR """ def __init__(self, size, interpolation=Image.BILINEAR): self.size = size self.interpolation = interpolation def __call__(self, input): for attempt in range(10): area = input['img'].size[0] * input['img'].size[1] target_area = random.uniform(0.08, 1.0) * area aspect_ratio = random.uniform(3. / 4, 4. / 3) w = int(round(math.sqrt(target_area * aspect_ratio))) h = int(round(math.sqrt(target_area / aspect_ratio))) if random.random() < 0.5: w, h = h, w if w <= input['img'].size[0] and h <= input['img'].size[1]: x1 = random.randint(0, input['img'].size[0] - w) y1 = random.randint(0, input['img'].size[1] - h) input['img'] = input['img'].crop((x1, y1, x1 + w, y1 + h)) assert(input['img'].size == (w, h)) input['img'] = input['img'].resize((self.size, self.size), self.interpolation) return input # Fallback scale = Scale(self.size, interpolation=self.interpolation) crop = CenterCrop(self.size) return crop(scale(input)) class NormalizeLandmarks(object): """ max-min normalization of landmarks to range [-1,1]""" def __init__(self,xsize,ysize): self.xsize = xsize self.ysize = ysize def __call__(self, input): valid_points = [v for v in input['loc'] if v[0] != 0 and v[1] != 0] mean = np.mean(valid_points,axis = 0) for i in range(input['loc'].shape[0]): input['loc'][i][0] = -1 + (input['loc'][i][0] * 2. )/(inputx_res) input['loc'][i][1] = -1 + (input['loc'][i][1] * 2. )/(inputy_res) return input class AffineCrop(object): def __init__(self,nlandmark,ix,iy,ox,oy,rangle=0,rscale=0,rtrans=0,gauss=1): self.rangle=rangle self.rscale=rscale self.rtrans=rtrans self.nlandmark=nlandmark self.ix = ix self.iy = iy self.ox = ox self.oy = oy self.utils = utils self.gauss = gauss def __call__(self, input): angle = self.rangle*(2*torch.rand(1)[0] - 1) grad_angle = angle * math.pi / 180 scale = 1+self.rscale*(2*torch.rand(1)[0] - 1) transx = self.rtrans*(2*torch.rand(1)[0] - 1) transy = self.rtrans*(2*torch.rand(1)[0] - 1) img = input['img'] size = img.size h, w = size[0], size[1] centerX, centerY = int(w/2), int(h/2) # perform rotation img = img.rotate(angle, Image.BICUBIC) # perform translation img = img.transform(img.size, Image.AFFINE, (1, 0, transx, 0, 1, transy)) # perform scaling img = img.resize((int(math.ceil(scale*h)) , int(math.ceil(scale*w))) , Image.ANTIALIAS) w, h = img.size x1 = int(round((w - self.ix) / 2.)) y1 = int(round((h - self.ix) / 2.)) input['img'] = img.crop((x1, y1, x1 + self.ix, y1 + self.iy)) if (np.sum(input['loc']) != 0): occ = input['occ'] loc = input['loc'] newloc = np.ones((3,loc.shape[1]+1)) newloc[0:2,0:loc.shape[1]] = loc newloc[0,loc.shape[1]] = centerY newloc[1,loc.shape[1]] = centerX trans_matrix = np.array([[1,0,-1*transx],[0,1,-1*transy],[0,0,1]]) scale_matrix = np.array([[scale,0,0],[0,scale,0],[0,0,1]]) angle_matrix = np.array([[math.cos(grad_angle),math.sin(grad_angle),0],[-math.sin(grad_angle),math.cos(grad_angle),0],[0,0,1]]) # perform rotation newloc[0,:] = newloc[0,:] - centerY newloc[1,:] = newloc[1,:] - centerX newloc = np.dot(angle_matrix, newloc) newloc[0,:] = newloc[0,:] + centerY newloc[1,:] = newloc[1,:] + centerX # perform translation newloc = np.dot(trans_matrix, newloc) # perform scaling newloc = np.dot(scale_matrix, newloc) newloc[0,:] = newloc[0,:] - y1 newloc[1,:] = newloc[1,:] - x1 input['loc'] = newloc[0:2,:] for i in range(input['loc'].shape[1]): if ~((input['loc'][0,i] == np.nan) & (input['loc'][1,i] == np.nan)): if ((input['loc'][0,i] < 0) | (input['loc'][0,i] > self.iy) | (input['loc'][1,i] < 0) | (input['loc'][1,i] > self.ix)): input['loc'][:,i] = np.nan input['occ'][i] = 0 # generate heatmaps input['tgt'] = np.zeros((self.nlandmark+1, self.ox, self.oy)) for i in range(self.nlandmark): if (not np.isnan(input['loc'][:,i][0]) and not np.isnan(input['loc'][:,i][1])): tmp = self.utils.gaussian(np.array([self.ix,self.iy]),input['loc'][:,i],self.gauss) scaled_tmp = sp.misc.imresize(tmp, [self.ox, self.oy]) scaled_tmp = (scaled_tmp - min(scaled_tmp.flatten()) ) / ( max(scaled_tmp.flatten()) - min(scaled_tmp.flatten())) else: scaled_tmp = np.zeros([self.ox,self.oy]) input['tgt'][i] = scaled_tmp tmp = self.utils.gaussian(np.array([self.iy,self.ix]),input['loc'][:,-1],4*self.gauss) scaled_tmp = sp.misc.imresize(tmp, [self.ox, self.oy]) scaled_tmp = (scaled_tmp - min(scaled_tmp.flatten()) ) / ( max(scaled_tmp.flatten()) - min(scaled_tmp.flatten())) input['tgt'][self.nlandmark] = scaled_tmp return input
0.543833
0.471832
import logging from lxml import etree try: from PIL import Image except ImportError: import Image import zipfile import shutil import os from os.path import join import tempfile from namespaces import nsprefixes from StringIO import StringIO log = logging.getLogger(__name__) # Record template directory's location which is just 'template' for a docx # developer or 'site-packages/docx-template' if you have installed docx template_dir = join(os.path.dirname(__file__), 'pptx_template') # installed if not os.path.isdir(template_dir): template_dir = join(os.path.dirname(__file__), 'pptx_template') # dev def relationshiplist(): relationshiplist = [ ['http://schemas.openxmlformats.org/officeDocument/2006/relationships/theme', 'theme/theme1.xml'], ['http://schemas.openxmlformats.org/officeDocument/2006/relationships/slideMaster', 'slideMasters/slideMaster1.xml'], ['http://schemas.openxmlformats.org/officeDocument/2006/relationships/slide', 'slides/slide1.xml'], ] return relationshiplist def contenttypes(): # FIXME - doesn't quite work...read from string as temp hack... #types = makeelement('Types',nsprefix='ct') types = etree.fromstring('''<Types xmlns="http://schemas.openxmlformats.org/package/2006/content-types"></Types>''') parts = { '/_rels/.rels': 'application/vnd.openxmlformats-package.relationships+xml', '/ppt/_rels/presentation.xml.rels': 'application/vnd.openxmlformats-package.relationships+xml', '/ppt/presentation.xml': 'application/vnd.openxmlformats-officedocument.presentationml.presentation.main+xml', '/ppt/slides/_rels/slide1.xml.rels': 'application/vnd.openxmlformats-package.relationships+xml', '/ppt/slides/slide1.xml': 'application/vnd.openxmlformats-officedocument.presentationml.slide+xml', '/ppt/theme/theme1.xml': 'application/vnd.openxmlformats-officedocument.theme+xml', '/ppt/slideMasters/slideMaster1.xml': 'application/vnd.openxmlformats-officedocument.presentationml.slideMaster+xml', '/ppt/slideMasters/_rels/slideMaster1.xml.rels': 'application/vnd.openxmlformats-package.relationships+xml' } for i in range(1, 13): path1 = '/ppt/slideLayouts/slideLayout' + str(i) + '.xml' path2 = '/ppt/slideLayouts/_rels/slideLayout' + str(i) + '.xml.rels' parts[path1] = 'application/vnd.openxmlformats-officedocument.presentationml.slideLayout+xml' parts[path2] = 'application/vnd.openxmlformats-package.relationships+xml' for part in parts: types.append(makeelement('Override', nsprefix=None, attributes={'PartName': part, 'ContentType': parts[part]})) # Add support for filetypes filetypes = {'rels': 'application/vnd.openxmlformats-package.relationships+xml', 'xml': 'application/xml', 'jpeg': 'image/jpeg', 'gif': 'image/gif', 'png': 'image/png'} for extension in filetypes: types.append(makeelement('Default', nsprefix=None, attributes={'Extension': extension, 'ContentType': filetypes[extension]})) return types def pptrelationships(relationshiplist): '''Generate a ppt relationships file''' # Default list of relationships # FIXME: using string hack instead of making element #relationships = makeelement('Relationships',nsprefix='pr') relationships = etree.fromstring( '''<Relationships xmlns="http://schemas.openxmlformats.org/package/2006/relationships"> </Relationships>''' ) count = 0 for relationship in relationshiplist: # Relationship IDs (rId) start at 1. relationships.append(makeelement('Relationship', attributes={'Id': 'rId' + str(count + 1), 'Type': relationship[0], 'Target': relationship[1]}, nsprefix=None)) count += 1 return relationships def makeelement(tagname, tagtext=None, nsprefix='p', attributes=None, attrnsprefix=None): '''Create an element & return it''' # Deal with list of nsprefix by making namespacemap namespacemap = None if isinstance(nsprefix, list): namespacemap = {} for prefix in nsprefix: namespacemap[prefix] = nsprefixes[prefix] nsprefix = nsprefix[0] # FIXME: rest of code below expects a single prefix elif nsprefix: namespacemap = {nsprefix: nsprefixes[nsprefix]} else: # For when namespace = None nsprefix = 'p' namespace = '{' + nsprefixes[nsprefix] + '}' newelement = etree.Element(namespace + tagname, nsmap=namespacemap) # Add attributes with namespaces if attributes: # If they haven't bothered setting attribute namespace, use an empty string # (equivalent of no namespace) if not attrnsprefix: # Quick hack: it seems every element that has a 'w' nsprefix for its tag uses the same prefix for it's attributes if nsprefix == 'w': attributenamespace = namespace else: attributenamespace = '' else: attributenamespace = '{' + nsprefixes[attrnsprefix] + '}' for tagattribute in attributes: newelement.set(attributenamespace + tagattribute, attributes[tagattribute]) if tagtext: newelement.text = tagtext return newelement def picture(picname, slide_rels, picdescription='No Description', pixelwidth=None, pixelheight=None, nochangeaspect=True, nochangearrowheads=True, template=template_dir, align='center', scale=1): '''Take a relationshiplist, picture file name, and return a paragraph containing the image and an updated relationshiplist''' # http://openxmldeveloper.org/articles/462.aspx # Create an image. Size may be specified, otherwise it will based on the # pixel size of image. Return a paragraph containing the picture''' # Copy the file into the media dir media_dir = join(template, 'ppt', 'media') if not os.path.isdir(media_dir): os.mkdir(media_dir) new_picname = join(media_dir, os.path.basename(picname)) shutil.copyfile(picname, new_picname) picname = new_picname # Check if the user has specified a size if not pixelwidth or not pixelheight: # If not, get info from the picture itself pixelwidth, pixelheight = Image.open(picname).size[0:2] picname = os.path.basename(picname) # OpenXML measures on-screen objects in English Metric Units # 1cm = 36000 EMUs emuperpixel = 12667 width = str(int(pixelwidth * emuperpixel * scale)) height = str(int(pixelheight * emuperpixel * scale)) # Set relationship ID to the first available picid = len(slide_rels) + 1 picrelid = 'rId' + str(picid) slide_rels.append([nsprefixes['i'], '../media/' + picname, str(picid)]) # There are 3 main elements inside a picture # 1. The Blipfill - specifies how the image fills the picture area (stretch, tile, etc.) blipfill = makeelement('blipFill') blipfill.append(makeelement('blip', nsprefix='a', attrnsprefix='r', attributes={'embed': picrelid})) stretch = makeelement('stretch', nsprefix='a') stretch.append(makeelement('fillRect', nsprefix='a')) blipfill.append(stretch) # 2. The non visual picture properties nvpicpr = makeelement('nvPicPr', nsprefix='p') cnvpr = makeelement('cNvPr', nsprefix='p', attributes={'id': '37', 'name': 'BLAH'}) nvpicpr.append(cnvpr) cnvpicpr = makeelement('cNvPicPr') nvpicpr.append(cnvpicpr) nvpicpr.append(makeelement('nvPr')) # 3. The Shape properties sppr = makeelement('spPr') xfrm = makeelement('xfrm', nsprefix='a') xfrm.append(makeelement('off', nsprefix='a', attributes={'x': '1405440', 'y': '1820520'})) xfrm.append(makeelement('ext', nsprefix='a', attributes={'cx': width, 'cy': height})) prstgeom = makeelement('prstGeom', nsprefix='a', attributes={'prst': 'rect'}) prstgeom.append(makeelement('avLst', nsprefix='a')) sppr.append(xfrm) sppr.append(prstgeom) # Add our 3 parts to the picture element pic = makeelement('pic', nsprefix='p') pic.append(nvpicpr) pic.append(blipfill) pic.append(sppr) return slide_rels, pic def savepptx(document, output, slides, media_files, pptrelationships, contenttypes=contenttypes(), template=template_dir): '''Save a modified document''' assert os.path.isdir(template) docxfile = zipfile.ZipFile(output, mode='w', compression=zipfile.ZIP_DEFLATED) # Serialize our trees into out zip file ''' treesandfiles = {document:'ppt/presentation.xml', contenttypes:'[Content_Types].xml', pptrelationships:'ppt/_rels/presentation.xml.rels'} for tree in treesandfiles: log.info('Saving: '+treesandfiles[tree] ) treestring = etree.tostring(tree, pretty_print=True) docxfile.writestr(treesandfiles[tree],treestring) ''' for slide in slides: treestring = etree.tostring(slide.slide, pretty_print=True) parser = etree.XMLParser(ns_clean=True) tree = etree.parse(StringIO(treestring), parser) treestring = etree.tostring(tree, pretty_print=True) docxfile.writestr('ppt/slides/slide' + str(slide.number) + '.xml', treestring) rels_tree = etree.fromstring('''<Relationships xmlns="http://schemas.openxmlformats.org/package/2006/relationships"></Relationships>''') for rel in slide.relationships: rel_el = (etree.Element('Relationship')) rel_el.set('Id', 'rId' + rel[2]) rel_el.set('Type', rel[0]) rel_el.set('Target', rel[1]) rels_tree.append(rel_el) rels_string = etree.tostring(rels_tree, pretty_print=True) docxfile.writestr('ppt/slides/_rels/slide' + str(slide.number) + '.xml.rels', rels_string) # Add & compress support files allowed = ['.xml', '.rels'] for dirpath, dirnames, filenames in os.walk(template): for filename in filenames: ext = os.path.splitext(filename)[1] if ext in allowed or filename in allowed or filename in media_files: doc_file = os.path.join(dirpath, filename) archivename = doc_file[len(template) + 1:] docxfile.write(doc_file, archivename) docxfile.close() def slide(): sld = makeelement('sld', nsprefix=['p', 'r', 'a']) csld = makeelement('cSld') sptree = makeelement('spTree') nvgrpsppr = makeelement('nvGrpSpPr') cnvpr = makeelement('cNvPr', attributes={'id': '1', 'name': ''}) cnvgrpsppr = makeelement('cNvGrpSpPr') nvpr = makeelement('nvPr') nvgrpsppr.append(cnvpr) nvgrpsppr.append(cnvgrpsppr) nvgrpsppr.append(nvpr) sptree.append(nvgrpsppr) grpsppr = makeelement('grpSpPr') xfrm = makeelement('xfrm', nsprefix='a') xfrm.append(makeelement('off', attributes={'x': '0', 'y': '0'}, nsprefix='a')) xfrm.append(makeelement('ext', attributes={'cx': '0', 'cy': '0'}, nsprefix='a')) xfrm.append(makeelement('chOff', attributes={'x': '0', 'y': '0'}, nsprefix='a')) xfrm.append(makeelement('chExt', attributes={'cx': '0', 'cy': '0'}, nsprefix='a')) grpsppr.append(xfrm) sptree.append(grpsppr) csld.append(sptree) sld.append(csld) clrmapovr = makeelement('clrMapOvr') clrmapovr.append(makeelement('masterClrMapping', nsprefix='a')) sld.append(clrmapovr) return sld def text_box(text): sp = makeelement('sp') nvsppr = makeelement('nvSpPr') nvsppr.append(makeelement('cNvPr', attributes={'id': '37', 'name': 'TextShape 1'})) nvsppr.append(makeelement('cNvSpPr', attributes={'txBox': '1'})) nvsppr.append(makeelement('nvPr')) sp.append(nvsppr) sppr = makeelement('spPr') xfrm = makeelement('xfrm', nsprefix='a') xfrm.append(makeelement('off', nsprefix='a', attributes={'x': '0', 'y': '332656'})) xfrm.append(makeelement('ext', nsprefix='a', attributes={'cx': '9144000', 'cy': '1262160'})) sppr.append(xfrm) prstgeom = makeelement('prstGeom', nsprefix='a', attributes={'prst': 'rect'}) prstgeom.append(makeelement('avLst', nsprefix='a')) sppr.append(prstgeom) sp.append(sppr) txbody = makeelement('txBody') txbody.append(makeelement('bodyPr', nsprefix='a', attributes={'anchor': 'ctr', 'bIns': '0', 'lIns': '0', 'rIns': '0', 'tIns': '0', 'wrap': 'none'})) p = makeelement('p', nsprefix='a') p.append(makeelement('pPr', nsprefix='a', attributes={'algn': 'ctr'})) r = makeelement('r', nsprefix='a') r.append(makeelement('rPr', nsprefix='a', attributes={'lang': 'en-GB'})) r.append(makeelement('t', nsprefix='a', tagtext=text)) # this is where the text goes. p.append(r) p.append(makeelement('endParaRPr', nsprefix='a')) txbody.append(p) sp.append(txbody) return sp class Slide(object): def __init__(self): self.slide = slide() self.relationships = [ [nsprefixes['sl'], '../slideLayouts/slideLayout2.xml', '1'] ] self.number = None self.media_files = [] return @classmethod def create(cls, template_dir): slide = cls() slide.template_dir = template_dir return slide def add_picture(self, picname, *args, **kwargs): extension = os.path.splitext(picname)[1] if extension not in ['.jpg', '.jpeg', '.png']: raise ValueError self.relationships, pic = picture(picname, slide_rels=self.relationships, template=self.template_dir, *args, **kwargs) self.slide.xpath('/p:sld/p:cSld/p:spTree', namespaces=nsprefixes)[0].append(pic) self.media_files.append(os.path.basename(picname)) def add_text_box(self, text): self.slide.xpath('/p:sld/p:cSld/p:spTree', namespaces=nsprefixes)[0].append( text_box(text)) class Document(object): def __init__(self): self.relationshiplist = relationshiplist() self.slide_rels = [] # Each member of this list will be a list of relationships for a particular slide. Each relationship is itself a list, whose first member is the Type of the relationship (a namespace) and whose second member is the Target for the relationship. self.tmpdir = tempfile.mkdtemp() self.template_dir = os.path.join(self.tmpdir, 'template') shutil.copytree(template_dir, self.template_dir) # we copy our template files to a temp location return @classmethod def create(cls): doc = cls() doc.presentation = makeelement('presentation') master_id_list = makeelement('sldMasterIdLst') master_id_list.append(makeelement('sldMasterId', attributes={'id': '2147483648', '{' + nsprefixes['r'] + '}' + 'id': 'rId2'})) doc.presentation.append(master_id_list) doc.presentation.append(makeelement('sldIdLst')) doc.presentation.append(makeelement('sldSz', attributes={'cx': '10080625', 'cy': '7559675'})) doc.presentation.append(makeelement('notesSz', attributes={'cx': '7559675', 'cy': '10691812'})) doc.slides = [] return doc def add_slide(self): slide = Slide.create(template_dir=self.template_dir) slide.number = len(self.slides) + 1 self.slides.append(slide) slide_list = self.presentation.xpath('/p:presentation/p:sldIdLst', namespaces=nsprefixes)[0] slide_list.append(makeelement('sldId', attributes={'id': str(256 + len(self.slides) - 1), '{' + nsprefixes['r'] + '}' + 'id': 'rId' + str(3 + len(self.slides) - 1)})) return slide def save(self, filename, *args, **kwargs): media_files = [] for slide in self.slides: media_files += slide.media_files suffix = '.pptx' if filename[-5:] != suffix: filename = filename + suffix return savepptx(document=self.presentation, slides=self.slides, media_files=media_files, template=self.template_dir, output=filename, pptrelationships=pptrelationships(self.relationshiplist), *args, **kwargs) def get_file_object(self, *args, **kwargs): '''Get the document as a file-like object.''' filedir = tempfile.mkdtemp() filepath = os.path.join(filedir, 'rendered_pptx.pptx') self.save(filename=filepath) f = open(filepath) shutil.rmtree(filedir) return f def get_as_string(self, *args, **kwargs): return self.get_file_object(*args, **kwargs).read() def close(self): shutil.rmtree(self.tmpdir)
openxml/pptx.py
import logging from lxml import etree try: from PIL import Image except ImportError: import Image import zipfile import shutil import os from os.path import join import tempfile from namespaces import nsprefixes from StringIO import StringIO log = logging.getLogger(__name__) # Record template directory's location which is just 'template' for a docx # developer or 'site-packages/docx-template' if you have installed docx template_dir = join(os.path.dirname(__file__), 'pptx_template') # installed if not os.path.isdir(template_dir): template_dir = join(os.path.dirname(__file__), 'pptx_template') # dev def relationshiplist(): relationshiplist = [ ['http://schemas.openxmlformats.org/officeDocument/2006/relationships/theme', 'theme/theme1.xml'], ['http://schemas.openxmlformats.org/officeDocument/2006/relationships/slideMaster', 'slideMasters/slideMaster1.xml'], ['http://schemas.openxmlformats.org/officeDocument/2006/relationships/slide', 'slides/slide1.xml'], ] return relationshiplist def contenttypes(): # FIXME - doesn't quite work...read from string as temp hack... #types = makeelement('Types',nsprefix='ct') types = etree.fromstring('''<Types xmlns="http://schemas.openxmlformats.org/package/2006/content-types"></Types>''') parts = { '/_rels/.rels': 'application/vnd.openxmlformats-package.relationships+xml', '/ppt/_rels/presentation.xml.rels': 'application/vnd.openxmlformats-package.relationships+xml', '/ppt/presentation.xml': 'application/vnd.openxmlformats-officedocument.presentationml.presentation.main+xml', '/ppt/slides/_rels/slide1.xml.rels': 'application/vnd.openxmlformats-package.relationships+xml', '/ppt/slides/slide1.xml': 'application/vnd.openxmlformats-officedocument.presentationml.slide+xml', '/ppt/theme/theme1.xml': 'application/vnd.openxmlformats-officedocument.theme+xml', '/ppt/slideMasters/slideMaster1.xml': 'application/vnd.openxmlformats-officedocument.presentationml.slideMaster+xml', '/ppt/slideMasters/_rels/slideMaster1.xml.rels': 'application/vnd.openxmlformats-package.relationships+xml' } for i in range(1, 13): path1 = '/ppt/slideLayouts/slideLayout' + str(i) + '.xml' path2 = '/ppt/slideLayouts/_rels/slideLayout' + str(i) + '.xml.rels' parts[path1] = 'application/vnd.openxmlformats-officedocument.presentationml.slideLayout+xml' parts[path2] = 'application/vnd.openxmlformats-package.relationships+xml' for part in parts: types.append(makeelement('Override', nsprefix=None, attributes={'PartName': part, 'ContentType': parts[part]})) # Add support for filetypes filetypes = {'rels': 'application/vnd.openxmlformats-package.relationships+xml', 'xml': 'application/xml', 'jpeg': 'image/jpeg', 'gif': 'image/gif', 'png': 'image/png'} for extension in filetypes: types.append(makeelement('Default', nsprefix=None, attributes={'Extension': extension, 'ContentType': filetypes[extension]})) return types def pptrelationships(relationshiplist): '''Generate a ppt relationships file''' # Default list of relationships # FIXME: using string hack instead of making element #relationships = makeelement('Relationships',nsprefix='pr') relationships = etree.fromstring( '''<Relationships xmlns="http://schemas.openxmlformats.org/package/2006/relationships"> </Relationships>''' ) count = 0 for relationship in relationshiplist: # Relationship IDs (rId) start at 1. relationships.append(makeelement('Relationship', attributes={'Id': 'rId' + str(count + 1), 'Type': relationship[0], 'Target': relationship[1]}, nsprefix=None)) count += 1 return relationships def makeelement(tagname, tagtext=None, nsprefix='p', attributes=None, attrnsprefix=None): '''Create an element & return it''' # Deal with list of nsprefix by making namespacemap namespacemap = None if isinstance(nsprefix, list): namespacemap = {} for prefix in nsprefix: namespacemap[prefix] = nsprefixes[prefix] nsprefix = nsprefix[0] # FIXME: rest of code below expects a single prefix elif nsprefix: namespacemap = {nsprefix: nsprefixes[nsprefix]} else: # For when namespace = None nsprefix = 'p' namespace = '{' + nsprefixes[nsprefix] + '}' newelement = etree.Element(namespace + tagname, nsmap=namespacemap) # Add attributes with namespaces if attributes: # If they haven't bothered setting attribute namespace, use an empty string # (equivalent of no namespace) if not attrnsprefix: # Quick hack: it seems every element that has a 'w' nsprefix for its tag uses the same prefix for it's attributes if nsprefix == 'w': attributenamespace = namespace else: attributenamespace = '' else: attributenamespace = '{' + nsprefixes[attrnsprefix] + '}' for tagattribute in attributes: newelement.set(attributenamespace + tagattribute, attributes[tagattribute]) if tagtext: newelement.text = tagtext return newelement def picture(picname, slide_rels, picdescription='No Description', pixelwidth=None, pixelheight=None, nochangeaspect=True, nochangearrowheads=True, template=template_dir, align='center', scale=1): '''Take a relationshiplist, picture file name, and return a paragraph containing the image and an updated relationshiplist''' # http://openxmldeveloper.org/articles/462.aspx # Create an image. Size may be specified, otherwise it will based on the # pixel size of image. Return a paragraph containing the picture''' # Copy the file into the media dir media_dir = join(template, 'ppt', 'media') if not os.path.isdir(media_dir): os.mkdir(media_dir) new_picname = join(media_dir, os.path.basename(picname)) shutil.copyfile(picname, new_picname) picname = new_picname # Check if the user has specified a size if not pixelwidth or not pixelheight: # If not, get info from the picture itself pixelwidth, pixelheight = Image.open(picname).size[0:2] picname = os.path.basename(picname) # OpenXML measures on-screen objects in English Metric Units # 1cm = 36000 EMUs emuperpixel = 12667 width = str(int(pixelwidth * emuperpixel * scale)) height = str(int(pixelheight * emuperpixel * scale)) # Set relationship ID to the first available picid = len(slide_rels) + 1 picrelid = 'rId' + str(picid) slide_rels.append([nsprefixes['i'], '../media/' + picname, str(picid)]) # There are 3 main elements inside a picture # 1. The Blipfill - specifies how the image fills the picture area (stretch, tile, etc.) blipfill = makeelement('blipFill') blipfill.append(makeelement('blip', nsprefix='a', attrnsprefix='r', attributes={'embed': picrelid})) stretch = makeelement('stretch', nsprefix='a') stretch.append(makeelement('fillRect', nsprefix='a')) blipfill.append(stretch) # 2. The non visual picture properties nvpicpr = makeelement('nvPicPr', nsprefix='p') cnvpr = makeelement('cNvPr', nsprefix='p', attributes={'id': '37', 'name': 'BLAH'}) nvpicpr.append(cnvpr) cnvpicpr = makeelement('cNvPicPr') nvpicpr.append(cnvpicpr) nvpicpr.append(makeelement('nvPr')) # 3. The Shape properties sppr = makeelement('spPr') xfrm = makeelement('xfrm', nsprefix='a') xfrm.append(makeelement('off', nsprefix='a', attributes={'x': '1405440', 'y': '1820520'})) xfrm.append(makeelement('ext', nsprefix='a', attributes={'cx': width, 'cy': height})) prstgeom = makeelement('prstGeom', nsprefix='a', attributes={'prst': 'rect'}) prstgeom.append(makeelement('avLst', nsprefix='a')) sppr.append(xfrm) sppr.append(prstgeom) # Add our 3 parts to the picture element pic = makeelement('pic', nsprefix='p') pic.append(nvpicpr) pic.append(blipfill) pic.append(sppr) return slide_rels, pic def savepptx(document, output, slides, media_files, pptrelationships, contenttypes=contenttypes(), template=template_dir): '''Save a modified document''' assert os.path.isdir(template) docxfile = zipfile.ZipFile(output, mode='w', compression=zipfile.ZIP_DEFLATED) # Serialize our trees into out zip file ''' treesandfiles = {document:'ppt/presentation.xml', contenttypes:'[Content_Types].xml', pptrelationships:'ppt/_rels/presentation.xml.rels'} for tree in treesandfiles: log.info('Saving: '+treesandfiles[tree] ) treestring = etree.tostring(tree, pretty_print=True) docxfile.writestr(treesandfiles[tree],treestring) ''' for slide in slides: treestring = etree.tostring(slide.slide, pretty_print=True) parser = etree.XMLParser(ns_clean=True) tree = etree.parse(StringIO(treestring), parser) treestring = etree.tostring(tree, pretty_print=True) docxfile.writestr('ppt/slides/slide' + str(slide.number) + '.xml', treestring) rels_tree = etree.fromstring('''<Relationships xmlns="http://schemas.openxmlformats.org/package/2006/relationships"></Relationships>''') for rel in slide.relationships: rel_el = (etree.Element('Relationship')) rel_el.set('Id', 'rId' + rel[2]) rel_el.set('Type', rel[0]) rel_el.set('Target', rel[1]) rels_tree.append(rel_el) rels_string = etree.tostring(rels_tree, pretty_print=True) docxfile.writestr('ppt/slides/_rels/slide' + str(slide.number) + '.xml.rels', rels_string) # Add & compress support files allowed = ['.xml', '.rels'] for dirpath, dirnames, filenames in os.walk(template): for filename in filenames: ext = os.path.splitext(filename)[1] if ext in allowed or filename in allowed or filename in media_files: doc_file = os.path.join(dirpath, filename) archivename = doc_file[len(template) + 1:] docxfile.write(doc_file, archivename) docxfile.close() def slide(): sld = makeelement('sld', nsprefix=['p', 'r', 'a']) csld = makeelement('cSld') sptree = makeelement('spTree') nvgrpsppr = makeelement('nvGrpSpPr') cnvpr = makeelement('cNvPr', attributes={'id': '1', 'name': ''}) cnvgrpsppr = makeelement('cNvGrpSpPr') nvpr = makeelement('nvPr') nvgrpsppr.append(cnvpr) nvgrpsppr.append(cnvgrpsppr) nvgrpsppr.append(nvpr) sptree.append(nvgrpsppr) grpsppr = makeelement('grpSpPr') xfrm = makeelement('xfrm', nsprefix='a') xfrm.append(makeelement('off', attributes={'x': '0', 'y': '0'}, nsprefix='a')) xfrm.append(makeelement('ext', attributes={'cx': '0', 'cy': '0'}, nsprefix='a')) xfrm.append(makeelement('chOff', attributes={'x': '0', 'y': '0'}, nsprefix='a')) xfrm.append(makeelement('chExt', attributes={'cx': '0', 'cy': '0'}, nsprefix='a')) grpsppr.append(xfrm) sptree.append(grpsppr) csld.append(sptree) sld.append(csld) clrmapovr = makeelement('clrMapOvr') clrmapovr.append(makeelement('masterClrMapping', nsprefix='a')) sld.append(clrmapovr) return sld def text_box(text): sp = makeelement('sp') nvsppr = makeelement('nvSpPr') nvsppr.append(makeelement('cNvPr', attributes={'id': '37', 'name': 'TextShape 1'})) nvsppr.append(makeelement('cNvSpPr', attributes={'txBox': '1'})) nvsppr.append(makeelement('nvPr')) sp.append(nvsppr) sppr = makeelement('spPr') xfrm = makeelement('xfrm', nsprefix='a') xfrm.append(makeelement('off', nsprefix='a', attributes={'x': '0', 'y': '332656'})) xfrm.append(makeelement('ext', nsprefix='a', attributes={'cx': '9144000', 'cy': '1262160'})) sppr.append(xfrm) prstgeom = makeelement('prstGeom', nsprefix='a', attributes={'prst': 'rect'}) prstgeom.append(makeelement('avLst', nsprefix='a')) sppr.append(prstgeom) sp.append(sppr) txbody = makeelement('txBody') txbody.append(makeelement('bodyPr', nsprefix='a', attributes={'anchor': 'ctr', 'bIns': '0', 'lIns': '0', 'rIns': '0', 'tIns': '0', 'wrap': 'none'})) p = makeelement('p', nsprefix='a') p.append(makeelement('pPr', nsprefix='a', attributes={'algn': 'ctr'})) r = makeelement('r', nsprefix='a') r.append(makeelement('rPr', nsprefix='a', attributes={'lang': 'en-GB'})) r.append(makeelement('t', nsprefix='a', tagtext=text)) # this is where the text goes. p.append(r) p.append(makeelement('endParaRPr', nsprefix='a')) txbody.append(p) sp.append(txbody) return sp class Slide(object): def __init__(self): self.slide = slide() self.relationships = [ [nsprefixes['sl'], '../slideLayouts/slideLayout2.xml', '1'] ] self.number = None self.media_files = [] return @classmethod def create(cls, template_dir): slide = cls() slide.template_dir = template_dir return slide def add_picture(self, picname, *args, **kwargs): extension = os.path.splitext(picname)[1] if extension not in ['.jpg', '.jpeg', '.png']: raise ValueError self.relationships, pic = picture(picname, slide_rels=self.relationships, template=self.template_dir, *args, **kwargs) self.slide.xpath('/p:sld/p:cSld/p:spTree', namespaces=nsprefixes)[0].append(pic) self.media_files.append(os.path.basename(picname)) def add_text_box(self, text): self.slide.xpath('/p:sld/p:cSld/p:spTree', namespaces=nsprefixes)[0].append( text_box(text)) class Document(object): def __init__(self): self.relationshiplist = relationshiplist() self.slide_rels = [] # Each member of this list will be a list of relationships for a particular slide. Each relationship is itself a list, whose first member is the Type of the relationship (a namespace) and whose second member is the Target for the relationship. self.tmpdir = tempfile.mkdtemp() self.template_dir = os.path.join(self.tmpdir, 'template') shutil.copytree(template_dir, self.template_dir) # we copy our template files to a temp location return @classmethod def create(cls): doc = cls() doc.presentation = makeelement('presentation') master_id_list = makeelement('sldMasterIdLst') master_id_list.append(makeelement('sldMasterId', attributes={'id': '2147483648', '{' + nsprefixes['r'] + '}' + 'id': 'rId2'})) doc.presentation.append(master_id_list) doc.presentation.append(makeelement('sldIdLst')) doc.presentation.append(makeelement('sldSz', attributes={'cx': '10080625', 'cy': '7559675'})) doc.presentation.append(makeelement('notesSz', attributes={'cx': '7559675', 'cy': '10691812'})) doc.slides = [] return doc def add_slide(self): slide = Slide.create(template_dir=self.template_dir) slide.number = len(self.slides) + 1 self.slides.append(slide) slide_list = self.presentation.xpath('/p:presentation/p:sldIdLst', namespaces=nsprefixes)[0] slide_list.append(makeelement('sldId', attributes={'id': str(256 + len(self.slides) - 1), '{' + nsprefixes['r'] + '}' + 'id': 'rId' + str(3 + len(self.slides) - 1)})) return slide def save(self, filename, *args, **kwargs): media_files = [] for slide in self.slides: media_files += slide.media_files suffix = '.pptx' if filename[-5:] != suffix: filename = filename + suffix return savepptx(document=self.presentation, slides=self.slides, media_files=media_files, template=self.template_dir, output=filename, pptrelationships=pptrelationships(self.relationshiplist), *args, **kwargs) def get_file_object(self, *args, **kwargs): '''Get the document as a file-like object.''' filedir = tempfile.mkdtemp() filepath = os.path.join(filedir, 'rendered_pptx.pptx') self.save(filename=filepath) f = open(filepath) shutil.rmtree(filedir) return f def get_as_string(self, *args, **kwargs): return self.get_file_object(*args, **kwargs).read() def close(self): shutil.rmtree(self.tmpdir)
0.267983
0.084041
import os import warnings import logging import re from typing import Dict, Union, List, Any, NoReturn from aitool.datasets import PATH as DATA_PATH from aitool import is_file_exist, load_lines, prepare_data, load_json chinese_family_name = set() File_Bag = ['https://pcg-xyj-1258344701.cos.ap-guangzhou.myqcloud.com/aitool/words.zip', os.path.join(DATA_PATH, 'nlp', 'words')] File_Chinese_Family_Name = os.path.join(DATA_PATH, 'nlp', 'words', 'Names', 'Chinese_family_name.txt') def has_family_name(name: str) -> bool: if not chinese_family_name: if not is_file_exist(File_Chinese_Family_Name): prepare_data(*File_Bag, packed=True) for item in load_lines(File_Chinese_Family_Name): chinese_family_name.add(item) if len(name) > 0 and name[0] in chinese_family_name: return True return False word_common = set() DIR_THUOCL = os.path.join(DATA_PATH, 'nlp', 'words', 'THUOCL') FILE_XINHUA_CI = os.path.join(DATA_PATH, 'nlp', 'words', 'XINHUA', 'ci.json') def init_word_common(threshold: int = 10) -> NoReturn: if not is_file_exist(DIR_THUOCL) or not is_file_exist(FILE_XINHUA_CI): prepare_data(*File_Bag, packed=True) files = os.listdir(DIR_THUOCL) for file in files: with open(os.path.join(DIR_THUOCL, file), 'r') as fin: for line in fin: w, f = line.strip().split('\t') if eval(f) > threshold: word_common.add(w) data = load_json(FILE_XINHUA_CI) for line in data: word_common.add(line['ci']) def is_common_word(text: str) -> bool: if not word_common: init_word_common() if text in word_common: return True return False word_stop = set() FILE_STOPWORDS = os.path.join(DATA_PATH, 'nlp', 'words', 'stopwords.txt') def init_word_stop() -> NoReturn: with open(FILE_STOPWORDS, 'r') as fin: for line in fin: word = line.strip() word_stop.add(word) def is_stop_word(text: str) -> bool: if not word_stop: init_word_stop() if text in word_stop: return True return False relationship_title = {} FILE_RELATIONSHIP = os.path.join(DATA_PATH, 'nlp', 'words', 'Names', 'relationship.txt') def init_relationship_title() -> NoReturn: if not is_file_exist(FILE_RELATIONSHIP): prepare_data(*File_Bag, packed=True) relationship_title_addition = {'店长', '法师', '醫生', '大力士', '护士', '父亲', '天后', '教练', '保安', '计师', '管事', '知事', '道长', '妃', '母亲', '头目', '乞丐', '妻', '局长', '官员', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', ''} data = set(load_lines(FILE_RELATIONSHIP)) | relationship_title_addition for item in data: item_len = len(item) if item_len not in relationship_title: relationship_title[item_len] = set() relationship_title[item_len].add(item) def is_relationship_title(text: str) -> bool: if not relationship_title: init_relationship_title() text_len = len(text) for title_len, title_items in relationship_title.items(): if title_len + 1 != text_len: continue if text[:-1] in title_items or text[1:] in title_items: return True return False def is_contains_english(text: str) -> bool: for c in text: _ord = ord(c) if 65 <= _ord <= 90 or 97 <= _ord <= 122: return True return False cut_until_char_delimiter = set('(([〔【') def cut_until_char(text: str, delimiter: Union[tuple, str, list] = cut_until_char_delimiter) -> str: for index, char in enumerate(text): if char in delimiter: return text[:index] return text delete_char_discard = set(')〕--”—.“《)') def delete_char(text: str, discard: Union[tuple, str, list] = delete_char_discard): new_text = '' for char in text: if char not in discard: new_text += char return new_text nick_name_prefix = set('小大老阿男女') nick_name_postfix_1 = set('哥姐总') nick_name_postfix_2 = set('甲乙丙丁戊己庚辛壬癸一二三四五六七八九十') def is_nick_name(text: str, ) -> bool: if len(text) == 2: if text[0] in nick_name_prefix or text[-1] in nick_name_postfix_1: return True if text[0] in nick_name_postfix_2 or text[1] in nick_name_postfix_2: return True if len(text) == 3: if text[0] in nick_name_postfix_2 and text[1] in nick_name_postfix_2: return True return False def is_contains_figure(text: str) -> bool: for char in text: if char.isdigit(): return True return False age_describes = ['童年', '老奶奶', '幼年', '老年', '少年', ] def delete_age_describe(text: str) -> str: for describe in age_describes: text = text.replace(describe, '') return text def is_contains_chinese(strs) -> bool: for _char in strs: if '\u4e00' <= _char <= '\u9fff': return True return False def is_all_chinese(text: str) -> bool: for char in text: if (not is_contains_chinese(char)) and (char not in '·‧:∙:'): return False return True black_name = {'未知', '收废品员', '开发商', '理发师', '小棉袄', '大高个', '地下党', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', ''} def is_black_name(text: str) -> bool: warnings.warn("is_black_name will be deprecated " "because black_name should be disassemble to relationship_title", DeprecationWarning) if text in black_name: return True return False def clean_role(text: str) -> (str, int): score = 10 text = cut_until_char(text) text = delete_char(text) text = delete_age_describe(text) if not text: return '', -100 if not is_contains_chinese: return '', -100 if has_family_name(text): score -= 1 if is_common_word(text): score -= 1 if is_relationship_title(text): score -= 1 if is_contains_english(text): score -= 1 if is_nick_name(text): score -= 1 if is_contains_figure(text): score -= 1 if is_all_chinese(text): score += 1 if is_black_name(text): score -= 1 logging.info('{}, {}'.format(text, score)) return text, score def clean_alias(text: str) -> (str, int): score = 13 if not text: return '', -100 if not is_contains_chinese: score -= 5 if is_common_word(text): score -= 5 if is_relationship_title(text): score -= 3 if is_contains_english(text): score -= 1 if is_nick_name(text): score -= 1 if is_contains_figure(text): score -= 1 if is_all_chinese(text): score += 1 logging.info('{}, {}'.format(text, score)) return text, score import sys from unicodedata import category punctuation_chars = set([chr(i) for i in range(sys.maxunicode) if category(chr(i)).startswith("P")]) punctuation_chars |= set(['`', ' ']) def is_punctuation(char): return char in punctuation_chars def select_nested_text( text: str, deep_add: tuple = ('《',), deep_reduce: tuple = ('》',) ) -> str: new_text = '' deep = 0 for char in text: if char in deep_reduce and deep > 0: deep -= 1 if deep != 0: new_text += char if char in deep_add: deep += 1 return new_text def delete_nested_text( text: str, deep_add: tuple = ('(', '(', '[', '【',), deep_reduce: tuple = (')', ')', ']', '】',) ) -> str: # 删除以()、()修饰的嵌套成分 new_text = '' deep = 0 for char in text: if char in deep_add: deep += 1 if deep == 0: new_text += char if char in deep_reduce and deep > 0: deep -= 1 return new_text pattern_1 = re.compile(r'(全|第)[1-90一二三四五六七八九十零〇]+(章|季|集|部分|部|卷)') pattern_2 = re.compile(r'[::]*[(([]*(结局一|结局二|结局三|法国版|完全版|剧场版|电影版|剧场剪辑版|印度版|合体版+|合体版|重置版|合体剧场版|原版|正序版|精编版|粤语版|总集篇|电视剧版|电视剧|全集|动画版)[))\]]*') pattern_3 = re.compile(r'[1-90一二三四五六七八九十零〇]+$') def get_core_ip(ip: str) -> str: ip = delete_nested_text(ip) ip = re.sub(pattern_1, '', ip) ip = re.sub(pattern_2, '', ip) ip = re.sub(pattern_3, '', ip) ip = ip.split(' ')[0] ip = ip.split('-')[0] return ip def is_sub_ip(ip: str) -> bool: if re.search(pattern_1, ip): return True if re.findall(pattern_2, ip): return True if re.findall(pattern_3, ip): return True return False if __name__ == '__main__': print(has_family_name('项羽')) print(has_family_name('翼德')) print(is_contains_english('小bird')) print(is_contains_english('项羽')) print(cut_until_char('A(B')) print(cut_until_char('【AB')) print(is_common_word('汽车')) print(is_common_word('唐三')) print(is_relationship_title('张老师')) print(is_relationship_title('唐三')) print(clean_role('汽车')) print(clean_role('唐三')) print(clean_role('唐三(主角)')) print(get_core_ip('托马斯和他的朋友们第十九部分')) print(get_core_ip('托马斯和他的朋友们19')) print(get_core_ip('托马斯和他的朋友们结局一')) print(get_core_ip('托马斯和他的朋友们(结局一))')) print(get_core_ip('托马斯 和他的朋友们:(结局一)')) print(get_core_ip('斗罗大陆(全14卷)')) print(get_core_ip('一')) print(is_sub_ip('托马斯和他的朋友们第十九部分')) print(is_sub_ip('托马斯和他的朋友们19')) print(is_sub_ip('托马斯和他的朋友们结局一')) print(is_sub_ip('托马斯和他的朋友们(结局一))')) print(is_sub_ip('托马斯 和他的朋友们:(结局一)')) print(is_sub_ip('斗罗大陆(全14卷)')) print(is_sub_ip('一')) print(select_nested_text('《xxxx》')) print(is_stop_word('的')) print(is_stop_word('匿'))
aitool/task_customized/ip_enhance/filter.py
import os import warnings import logging import re from typing import Dict, Union, List, Any, NoReturn from aitool.datasets import PATH as DATA_PATH from aitool import is_file_exist, load_lines, prepare_data, load_json chinese_family_name = set() File_Bag = ['https://pcg-xyj-1258344701.cos.ap-guangzhou.myqcloud.com/aitool/words.zip', os.path.join(DATA_PATH, 'nlp', 'words')] File_Chinese_Family_Name = os.path.join(DATA_PATH, 'nlp', 'words', 'Names', 'Chinese_family_name.txt') def has_family_name(name: str) -> bool: if not chinese_family_name: if not is_file_exist(File_Chinese_Family_Name): prepare_data(*File_Bag, packed=True) for item in load_lines(File_Chinese_Family_Name): chinese_family_name.add(item) if len(name) > 0 and name[0] in chinese_family_name: return True return False word_common = set() DIR_THUOCL = os.path.join(DATA_PATH, 'nlp', 'words', 'THUOCL') FILE_XINHUA_CI = os.path.join(DATA_PATH, 'nlp', 'words', 'XINHUA', 'ci.json') def init_word_common(threshold: int = 10) -> NoReturn: if not is_file_exist(DIR_THUOCL) or not is_file_exist(FILE_XINHUA_CI): prepare_data(*File_Bag, packed=True) files = os.listdir(DIR_THUOCL) for file in files: with open(os.path.join(DIR_THUOCL, file), 'r') as fin: for line in fin: w, f = line.strip().split('\t') if eval(f) > threshold: word_common.add(w) data = load_json(FILE_XINHUA_CI) for line in data: word_common.add(line['ci']) def is_common_word(text: str) -> bool: if not word_common: init_word_common() if text in word_common: return True return False word_stop = set() FILE_STOPWORDS = os.path.join(DATA_PATH, 'nlp', 'words', 'stopwords.txt') def init_word_stop() -> NoReturn: with open(FILE_STOPWORDS, 'r') as fin: for line in fin: word = line.strip() word_stop.add(word) def is_stop_word(text: str) -> bool: if not word_stop: init_word_stop() if text in word_stop: return True return False relationship_title = {} FILE_RELATIONSHIP = os.path.join(DATA_PATH, 'nlp', 'words', 'Names', 'relationship.txt') def init_relationship_title() -> NoReturn: if not is_file_exist(FILE_RELATIONSHIP): prepare_data(*File_Bag, packed=True) relationship_title_addition = {'店长', '法师', '醫生', '大力士', '护士', '父亲', '天后', '教练', '保安', '计师', '管事', '知事', '道长', '妃', '母亲', '头目', '乞丐', '妻', '局长', '官员', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', ''} data = set(load_lines(FILE_RELATIONSHIP)) | relationship_title_addition for item in data: item_len = len(item) if item_len not in relationship_title: relationship_title[item_len] = set() relationship_title[item_len].add(item) def is_relationship_title(text: str) -> bool: if not relationship_title: init_relationship_title() text_len = len(text) for title_len, title_items in relationship_title.items(): if title_len + 1 != text_len: continue if text[:-1] in title_items or text[1:] in title_items: return True return False def is_contains_english(text: str) -> bool: for c in text: _ord = ord(c) if 65 <= _ord <= 90 or 97 <= _ord <= 122: return True return False cut_until_char_delimiter = set('(([〔【') def cut_until_char(text: str, delimiter: Union[tuple, str, list] = cut_until_char_delimiter) -> str: for index, char in enumerate(text): if char in delimiter: return text[:index] return text delete_char_discard = set(')〕--”—.“《)') def delete_char(text: str, discard: Union[tuple, str, list] = delete_char_discard): new_text = '' for char in text: if char not in discard: new_text += char return new_text nick_name_prefix = set('小大老阿男女') nick_name_postfix_1 = set('哥姐总') nick_name_postfix_2 = set('甲乙丙丁戊己庚辛壬癸一二三四五六七八九十') def is_nick_name(text: str, ) -> bool: if len(text) == 2: if text[0] in nick_name_prefix or text[-1] in nick_name_postfix_1: return True if text[0] in nick_name_postfix_2 or text[1] in nick_name_postfix_2: return True if len(text) == 3: if text[0] in nick_name_postfix_2 and text[1] in nick_name_postfix_2: return True return False def is_contains_figure(text: str) -> bool: for char in text: if char.isdigit(): return True return False age_describes = ['童年', '老奶奶', '幼年', '老年', '少年', ] def delete_age_describe(text: str) -> str: for describe in age_describes: text = text.replace(describe, '') return text def is_contains_chinese(strs) -> bool: for _char in strs: if '\u4e00' <= _char <= '\u9fff': return True return False def is_all_chinese(text: str) -> bool: for char in text: if (not is_contains_chinese(char)) and (char not in '·‧:∙:'): return False return True black_name = {'未知', '收废品员', '开发商', '理发师', '小棉袄', '大高个', '地下党', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', '', ''} def is_black_name(text: str) -> bool: warnings.warn("is_black_name will be deprecated " "because black_name should be disassemble to relationship_title", DeprecationWarning) if text in black_name: return True return False def clean_role(text: str) -> (str, int): score = 10 text = cut_until_char(text) text = delete_char(text) text = delete_age_describe(text) if not text: return '', -100 if not is_contains_chinese: return '', -100 if has_family_name(text): score -= 1 if is_common_word(text): score -= 1 if is_relationship_title(text): score -= 1 if is_contains_english(text): score -= 1 if is_nick_name(text): score -= 1 if is_contains_figure(text): score -= 1 if is_all_chinese(text): score += 1 if is_black_name(text): score -= 1 logging.info('{}, {}'.format(text, score)) return text, score def clean_alias(text: str) -> (str, int): score = 13 if not text: return '', -100 if not is_contains_chinese: score -= 5 if is_common_word(text): score -= 5 if is_relationship_title(text): score -= 3 if is_contains_english(text): score -= 1 if is_nick_name(text): score -= 1 if is_contains_figure(text): score -= 1 if is_all_chinese(text): score += 1 logging.info('{}, {}'.format(text, score)) return text, score import sys from unicodedata import category punctuation_chars = set([chr(i) for i in range(sys.maxunicode) if category(chr(i)).startswith("P")]) punctuation_chars |= set(['`', ' ']) def is_punctuation(char): return char in punctuation_chars def select_nested_text( text: str, deep_add: tuple = ('《',), deep_reduce: tuple = ('》',) ) -> str: new_text = '' deep = 0 for char in text: if char in deep_reduce and deep > 0: deep -= 1 if deep != 0: new_text += char if char in deep_add: deep += 1 return new_text def delete_nested_text( text: str, deep_add: tuple = ('(', '(', '[', '【',), deep_reduce: tuple = (')', ')', ']', '】',) ) -> str: # 删除以()、()修饰的嵌套成分 new_text = '' deep = 0 for char in text: if char in deep_add: deep += 1 if deep == 0: new_text += char if char in deep_reduce and deep > 0: deep -= 1 return new_text pattern_1 = re.compile(r'(全|第)[1-90一二三四五六七八九十零〇]+(章|季|集|部分|部|卷)') pattern_2 = re.compile(r'[::]*[(([]*(结局一|结局二|结局三|法国版|完全版|剧场版|电影版|剧场剪辑版|印度版|合体版+|合体版|重置版|合体剧场版|原版|正序版|精编版|粤语版|总集篇|电视剧版|电视剧|全集|动画版)[))\]]*') pattern_3 = re.compile(r'[1-90一二三四五六七八九十零〇]+$') def get_core_ip(ip: str) -> str: ip = delete_nested_text(ip) ip = re.sub(pattern_1, '', ip) ip = re.sub(pattern_2, '', ip) ip = re.sub(pattern_3, '', ip) ip = ip.split(' ')[0] ip = ip.split('-')[0] return ip def is_sub_ip(ip: str) -> bool: if re.search(pattern_1, ip): return True if re.findall(pattern_2, ip): return True if re.findall(pattern_3, ip): return True return False if __name__ == '__main__': print(has_family_name('项羽')) print(has_family_name('翼德')) print(is_contains_english('小bird')) print(is_contains_english('项羽')) print(cut_until_char('A(B')) print(cut_until_char('【AB')) print(is_common_word('汽车')) print(is_common_word('唐三')) print(is_relationship_title('张老师')) print(is_relationship_title('唐三')) print(clean_role('汽车')) print(clean_role('唐三')) print(clean_role('唐三(主角)')) print(get_core_ip('托马斯和他的朋友们第十九部分')) print(get_core_ip('托马斯和他的朋友们19')) print(get_core_ip('托马斯和他的朋友们结局一')) print(get_core_ip('托马斯和他的朋友们(结局一))')) print(get_core_ip('托马斯 和他的朋友们:(结局一)')) print(get_core_ip('斗罗大陆(全14卷)')) print(get_core_ip('一')) print(is_sub_ip('托马斯和他的朋友们第十九部分')) print(is_sub_ip('托马斯和他的朋友们19')) print(is_sub_ip('托马斯和他的朋友们结局一')) print(is_sub_ip('托马斯和他的朋友们(结局一))')) print(is_sub_ip('托马斯 和他的朋友们:(结局一)')) print(is_sub_ip('斗罗大陆(全14卷)')) print(is_sub_ip('一')) print(select_nested_text('《xxxx》')) print(is_stop_word('的')) print(is_stop_word('匿'))
0.483648
0.10786
import logging from copy import deepcopy from typing import Optional import numpy as np import scipy.linalg as linalg from ...misc import restack from ...misc import unstack from ...model.dynamical_system.boundary_value_problem import MultipleBoundaryValueProblem from ...model.dynamical_system.flow_problem import LinearFlow from ...model.dynamical_system.initial_value_problem import InitialValueProblem from ...model.optimization.optimal_control import LQOptimalControl from ...model.variables.time_function import Time from ...solver_container import solver_container_factory from ..base_solver import BaseSolver from ..base_solver import TimeSolution logger = logging.getLogger(__name__) class MultipleShooting(BaseSolver): """Solver for solving MultipleBoundaryValueProblems with a multiple shooting approach.""" def __init__(self, bvp: MultipleBoundaryValueProblem, flow_problem: LinearFlow, ivp_problem: InitialValueProblem, shooting_nodes, stepsize=1e-1, *args, **kwargs): if not isinstance(bvp, MultipleBoundaryValueProblem): raise TypeError(bvp) if not isinstance(flow_problem, LinearFlow): raise TypeError(flow_problem) if not isinstance(ivp_problem, InitialValueProblem): raise TypeError(ivp_problem) self._bvp = bvp self._shooting_nodes = shooting_nodes self._n_shooting_nodes = len(shooting_nodes) self._boundary_values = bvp.boundary_values.boundary_values self._bvp_nodes = bvp.nodes self._check_shooting_nodes() self._intervals = zip(self._shooting_nodes, self._shooting_nodes[1:]) self._final_time = self._shooting_nodes[-1] self._inner_nodes = shooting_nodes[1:-1] self._dynamical_system = bvp.dynamical_system self._dynamical_system.reset() self._variables = self._dynamical_system.variables self._nn = self._dynamical_system.nn self._flow_problem = flow_problem self._ivp_problem = ivp_problem self._stepsize = stepsize super().__init__(*args, **kwargs) def _init_solver(self, time_interval: Optional[Time], flow_abs_tol: Optional[float] = None, flow_rel_tol: Optional[float] = None) -> None: self._set_t2s() self._set_d_as() self._init_flow_solver() self._flows = self._get_homogeneous_flows(flow_abs_tol, flow_rel_tol) self._set_gis() self._shooting_values = self._get_shooting_values() if time_interval is None: time_interval = self._variables.time self._time_interval = time_interval if time_interval.grid is None: time_interval.grid = self._shooting_nodes self._solution_time_grid = time_interval.grid def _init_flow_solver(self) -> None: time_interval = deepcopy(self._bvp.time_interval) time_interval.grid = self._shooting_nodes stepsize = 1. / (self._n_shooting_nodes - 1) logger.debug("Creating flow solver with time_interval: {}".format( time_interval.grid)) self._flow_solver = solver_container_factory.get_solver_container( self._flow_problem).default_solver.solver(self._flow_problem, time_interval, stepsize, rel_tol=self.rel_tol, abs_tol=self.abs_tol) def _get_homogeneous_flows(self, abs_tol: Optional[float] = None, rel_tol: Optional[float] = None) -> np.ndarray: flow_solver = self._flow_solver if abs_tol is not None: flow_solver.abs_tol = abs_tol if rel_tol is not None: flow_solver.rel_tol = rel_tol return flow_solver.get_homogeneous_flows() def _get_shooting_values(self) -> np.ndarray: n = self._nn rank = self._dynamical_system.rank shooting_values = np.zeros((n, n, self._n_shooting_nodes), order='F') j = 0 indices = np.array([], dtype=int) for i, node in enumerate(self._shooting_nodes): if node in self._bvp_nodes: shooting_values[..., i] = self._boundary_values[..., j] indices = np.append(indices, [i]) j += 1 z_gamma = self._bvp.boundary_values.z_gamma projected_values = np.einsum('ai, ajr,jkr->ikr', z_gamma, shooting_values, self._t2s) self._boundary_indices = indices return projected_values.reshape(rank, rank * self._n_shooting_nodes, order='F') def _check_shooting_nodes(self) -> None: for node in self._bvp_nodes: if node not in self._shooting_nodes: raise ValueError( "Shooting nodes {}\nhave to include boundary value nodes {}" .format(self._shooting_nodes, self._bvp_nodes)) @property def bvp(self) -> MultipleBoundaryValueProblem: return self._bvp def _get_shooting_matrix(self) -> np.ndarray: gis = self._gis jis = self._compute_jis() dim = self._dynamical_system.rank * self._n_shooting_nodes shooting_matrix = np.zeros((dim, dim), order='F') # TODO: Inefficient, probably needs low level implementation diag = linalg.block_diag(*(gis[..., i] for i in range(gis.shape[-1]))) shooting_matrix[:diag.shape[0], :diag.shape[1]] = -diag for i in range(self._n_shooting_nodes)[:-1]: size = self._dynamical_system.rank * i sizep1 = self._dynamical_system.rank * (i + 1) sizep2 = self._dynamical_system.rank * (i + 2) shooting_matrix[size:sizep1, sizep1:sizep2] = jis[..., i] shooting_matrix[sizep1:, :] = self._shooting_values return shooting_matrix def _get_mesh(self, stepsize: float) -> np.ndarray: mesh = np.concatenate((np.arange(t_lower, t_upper, stepsize) for t_lower, t_upper in self._intervals)) return mesh def _set_gis(self) -> None: t2 = self._t2s t2_1 = t2[:, :, 1:] t2_e = t2[:, :, :-1] gis = np.einsum('jir,jkr,klr->ilr', t2_1, self._flows, t2_e) self._gis: np.ndarray = gis def _compute_jis(self) -> np.ndarray: # TODO: only works in the linear case rank = self._dynamical_system.rank ntemp = self._n_shooting_nodes - 1 return np.array(ntemp * (np.identity(rank), )).T def _set_t2s(self) -> None: rank = self._dynamical_system.rank t2s = np.zeros((self._nn, rank, self._n_shooting_nodes), order='F') for i, node in enumerate(self._shooting_nodes): t2s[:, :, i] = self._dynamical_system.t2(node) self._t2s = t2s def _newton_step(self, current_node_states: np.ndarray, rhs: np.ndarray) -> np.ndarray: shooting_matrix = self._get_shooting_matrix() lin_sys_sol = np.linalg.solve(shooting_matrix, rhs) next_nodes = current_node_states - restack(lin_sys_sol, current_node_states.shape) return next_nodes def _get_newton_rhs(self, current_node_states: np.ndarray) -> np.ndarray: current_x_d = self._get_x_d(current_node_states) boundary_node_states = current_x_d[..., self._boundary_indices] bound_res = self._bvp.boundary_values.residual(boundary_node_states) computed_node_states = self._forward_projected_nodes( current_node_states) diffs = current_node_states[..., 1:] - computed_node_states[..., :-1] res_b = unstack(diffs) return np.concatenate((res_b, bound_res), axis=0) def _forward_projected_nodes(self, node_values: np.ndarray) -> np.ndarray: solver = self._flow_solver lift_up = self._get_x_d(node_values) sol = solver.forward_solve_differential(lift_up) return self._project_values(sol) def _get_initial_guess(self, initial_guess: Optional[np.ndarray] = None ) -> np.ndarray: shape = self._dynamical_system.variables.shape + ( self._n_shooting_nodes, ) if initial_guess is None: initial_guess = np.zeros(shape, order='F') elif initial_guess.shape != shape: raise ValueError( "initial_guess.shape is {} but should equal {}".format( initial_guess.shape, shape)) return initial_guess def _project_values(self, values: np.ndarray) -> np.ndarray: return np.einsum('ijr,i...r->j...r', self._t2s, values) def _run(self, time_interval=None, initial_guess=None, dynamic_update=False, *args, **kwargs) -> TimeSolution: logger.info('''MultipleShooting solver initialized with\n shooting_nodes: {}\n boundary_nodes: {}\n'''.format(self._shooting_nodes, self._bvp_nodes)) self._init_solver(time_interval, *args, **kwargs) initial_guess = self._get_initial_guess(initial_guess) projected_values = self._project_values(initial_guess) for i in range(self.max_iter): residual = self._get_newton_rhs(projected_values) if self.abort(residual): break projected_values = self._newton_step(projected_values, residual) x_d = self._get_x_d(projected_values) full_node_values = x_d - np.einsum('ijr,j...r->i...r', self._das, x_d) - self._fas node_solution = TimeSolution(self._shooting_nodes, full_node_values) if dynamic_update: time_grid_solution = deepcopy(node_solution) time_grid_solution.dynamic_update = self._get_intermediate_values else: time_grid_solution = self._get_intermediate_values( node_solution, self._solution_time_grid) self._bvp.variables.current_values = time_grid_solution return time_grid_solution def _get_intermediate_values(self, node_solution: np.ndarray, time_grid: np.ndarray) -> TimeSolution: # this is rather slow, but it's an inherent disadvantage of the shooting approach logger.debug( "Getting intermediate values on time grid of size: {}".format( time_grid.size)) idsize = time_grid.size idx = np.append( np.searchsorted(time_grid, node_solution.time_grid, 'left'), idsize) solution = np.zeros( (*node_solution.solution.shape[:-1], time_grid.size)) f_columns = self._bvp.boundary_values.n_inhom self._ivp_problem.init_solver(stepsize=self._stepsize, f_columns=f_columns, abs_tol=self.abs_tol, rel_tol=self.abs_tol) # TODO: Also compute backwards for better stability / difference to node points for i, node in enumerate(node_solution.time_grid): loweridx = idx[i] upperidx = idx[i + 1] grid = time_grid[loweridx:upperidx] t0 = node if grid.size == 0: continue x0 = node_solution(node) tf = grid[-1] interval = Time(t0, tf, grid) x0_times = self._ivp_problem.solve(interval, x0) if node in grid or x0_times.solution.shape[-1] == 1: idx_increment = 0 else: idx_increment = 1 logger.debug("x0_timesshape: {}".format(x0_times.solution.shape)) solution[..., loweridx:upperidx] = np.atleast_2d( x0_times.solution.T).T[..., idx_increment:] return TimeSolution(time_grid, solution) def _get_x_d(self, projected_values: np.ndarray) -> np.ndarray: return np.einsum('ijr,j...r->i...r', self._t2s, projected_values) def _set_d_as(self) -> None: das = np.zeros((self._nn, self._nn, self._n_shooting_nodes), order='F') shape = self._dynamical_system.variables.shape fas = np.zeros((*shape, self._n_shooting_nodes), order='F') self._dynamical_system.init_rank() for i, node in enumerate(self._shooting_nodes): das[:, :, i] = self._dynamical_system.d_a(node) fas[..., i] = self._dynamical_system.f_a(node) self._das = das self._fas = fas solver_container_factory.register_solver(MultipleBoundaryValueProblem, MultipleShooting, default=True) solver_container_factory.register_solver( LQOptimalControl, MultipleShooting, default=True, creator_function=LQOptimalControl.get_bvp)
src/pymloc/solvers/dynamical_systems/multiple_shooting.py
import logging from copy import deepcopy from typing import Optional import numpy as np import scipy.linalg as linalg from ...misc import restack from ...misc import unstack from ...model.dynamical_system.boundary_value_problem import MultipleBoundaryValueProblem from ...model.dynamical_system.flow_problem import LinearFlow from ...model.dynamical_system.initial_value_problem import InitialValueProblem from ...model.optimization.optimal_control import LQOptimalControl from ...model.variables.time_function import Time from ...solver_container import solver_container_factory from ..base_solver import BaseSolver from ..base_solver import TimeSolution logger = logging.getLogger(__name__) class MultipleShooting(BaseSolver): """Solver for solving MultipleBoundaryValueProblems with a multiple shooting approach.""" def __init__(self, bvp: MultipleBoundaryValueProblem, flow_problem: LinearFlow, ivp_problem: InitialValueProblem, shooting_nodes, stepsize=1e-1, *args, **kwargs): if not isinstance(bvp, MultipleBoundaryValueProblem): raise TypeError(bvp) if not isinstance(flow_problem, LinearFlow): raise TypeError(flow_problem) if not isinstance(ivp_problem, InitialValueProblem): raise TypeError(ivp_problem) self._bvp = bvp self._shooting_nodes = shooting_nodes self._n_shooting_nodes = len(shooting_nodes) self._boundary_values = bvp.boundary_values.boundary_values self._bvp_nodes = bvp.nodes self._check_shooting_nodes() self._intervals = zip(self._shooting_nodes, self._shooting_nodes[1:]) self._final_time = self._shooting_nodes[-1] self._inner_nodes = shooting_nodes[1:-1] self._dynamical_system = bvp.dynamical_system self._dynamical_system.reset() self._variables = self._dynamical_system.variables self._nn = self._dynamical_system.nn self._flow_problem = flow_problem self._ivp_problem = ivp_problem self._stepsize = stepsize super().__init__(*args, **kwargs) def _init_solver(self, time_interval: Optional[Time], flow_abs_tol: Optional[float] = None, flow_rel_tol: Optional[float] = None) -> None: self._set_t2s() self._set_d_as() self._init_flow_solver() self._flows = self._get_homogeneous_flows(flow_abs_tol, flow_rel_tol) self._set_gis() self._shooting_values = self._get_shooting_values() if time_interval is None: time_interval = self._variables.time self._time_interval = time_interval if time_interval.grid is None: time_interval.grid = self._shooting_nodes self._solution_time_grid = time_interval.grid def _init_flow_solver(self) -> None: time_interval = deepcopy(self._bvp.time_interval) time_interval.grid = self._shooting_nodes stepsize = 1. / (self._n_shooting_nodes - 1) logger.debug("Creating flow solver with time_interval: {}".format( time_interval.grid)) self._flow_solver = solver_container_factory.get_solver_container( self._flow_problem).default_solver.solver(self._flow_problem, time_interval, stepsize, rel_tol=self.rel_tol, abs_tol=self.abs_tol) def _get_homogeneous_flows(self, abs_tol: Optional[float] = None, rel_tol: Optional[float] = None) -> np.ndarray: flow_solver = self._flow_solver if abs_tol is not None: flow_solver.abs_tol = abs_tol if rel_tol is not None: flow_solver.rel_tol = rel_tol return flow_solver.get_homogeneous_flows() def _get_shooting_values(self) -> np.ndarray: n = self._nn rank = self._dynamical_system.rank shooting_values = np.zeros((n, n, self._n_shooting_nodes), order='F') j = 0 indices = np.array([], dtype=int) for i, node in enumerate(self._shooting_nodes): if node in self._bvp_nodes: shooting_values[..., i] = self._boundary_values[..., j] indices = np.append(indices, [i]) j += 1 z_gamma = self._bvp.boundary_values.z_gamma projected_values = np.einsum('ai, ajr,jkr->ikr', z_gamma, shooting_values, self._t2s) self._boundary_indices = indices return projected_values.reshape(rank, rank * self._n_shooting_nodes, order='F') def _check_shooting_nodes(self) -> None: for node in self._bvp_nodes: if node not in self._shooting_nodes: raise ValueError( "Shooting nodes {}\nhave to include boundary value nodes {}" .format(self._shooting_nodes, self._bvp_nodes)) @property def bvp(self) -> MultipleBoundaryValueProblem: return self._bvp def _get_shooting_matrix(self) -> np.ndarray: gis = self._gis jis = self._compute_jis() dim = self._dynamical_system.rank * self._n_shooting_nodes shooting_matrix = np.zeros((dim, dim), order='F') # TODO: Inefficient, probably needs low level implementation diag = linalg.block_diag(*(gis[..., i] for i in range(gis.shape[-1]))) shooting_matrix[:diag.shape[0], :diag.shape[1]] = -diag for i in range(self._n_shooting_nodes)[:-1]: size = self._dynamical_system.rank * i sizep1 = self._dynamical_system.rank * (i + 1) sizep2 = self._dynamical_system.rank * (i + 2) shooting_matrix[size:sizep1, sizep1:sizep2] = jis[..., i] shooting_matrix[sizep1:, :] = self._shooting_values return shooting_matrix def _get_mesh(self, stepsize: float) -> np.ndarray: mesh = np.concatenate((np.arange(t_lower, t_upper, stepsize) for t_lower, t_upper in self._intervals)) return mesh def _set_gis(self) -> None: t2 = self._t2s t2_1 = t2[:, :, 1:] t2_e = t2[:, :, :-1] gis = np.einsum('jir,jkr,klr->ilr', t2_1, self._flows, t2_e) self._gis: np.ndarray = gis def _compute_jis(self) -> np.ndarray: # TODO: only works in the linear case rank = self._dynamical_system.rank ntemp = self._n_shooting_nodes - 1 return np.array(ntemp * (np.identity(rank), )).T def _set_t2s(self) -> None: rank = self._dynamical_system.rank t2s = np.zeros((self._nn, rank, self._n_shooting_nodes), order='F') for i, node in enumerate(self._shooting_nodes): t2s[:, :, i] = self._dynamical_system.t2(node) self._t2s = t2s def _newton_step(self, current_node_states: np.ndarray, rhs: np.ndarray) -> np.ndarray: shooting_matrix = self._get_shooting_matrix() lin_sys_sol = np.linalg.solve(shooting_matrix, rhs) next_nodes = current_node_states - restack(lin_sys_sol, current_node_states.shape) return next_nodes def _get_newton_rhs(self, current_node_states: np.ndarray) -> np.ndarray: current_x_d = self._get_x_d(current_node_states) boundary_node_states = current_x_d[..., self._boundary_indices] bound_res = self._bvp.boundary_values.residual(boundary_node_states) computed_node_states = self._forward_projected_nodes( current_node_states) diffs = current_node_states[..., 1:] - computed_node_states[..., :-1] res_b = unstack(diffs) return np.concatenate((res_b, bound_res), axis=0) def _forward_projected_nodes(self, node_values: np.ndarray) -> np.ndarray: solver = self._flow_solver lift_up = self._get_x_d(node_values) sol = solver.forward_solve_differential(lift_up) return self._project_values(sol) def _get_initial_guess(self, initial_guess: Optional[np.ndarray] = None ) -> np.ndarray: shape = self._dynamical_system.variables.shape + ( self._n_shooting_nodes, ) if initial_guess is None: initial_guess = np.zeros(shape, order='F') elif initial_guess.shape != shape: raise ValueError( "initial_guess.shape is {} but should equal {}".format( initial_guess.shape, shape)) return initial_guess def _project_values(self, values: np.ndarray) -> np.ndarray: return np.einsum('ijr,i...r->j...r', self._t2s, values) def _run(self, time_interval=None, initial_guess=None, dynamic_update=False, *args, **kwargs) -> TimeSolution: logger.info('''MultipleShooting solver initialized with\n shooting_nodes: {}\n boundary_nodes: {}\n'''.format(self._shooting_nodes, self._bvp_nodes)) self._init_solver(time_interval, *args, **kwargs) initial_guess = self._get_initial_guess(initial_guess) projected_values = self._project_values(initial_guess) for i in range(self.max_iter): residual = self._get_newton_rhs(projected_values) if self.abort(residual): break projected_values = self._newton_step(projected_values, residual) x_d = self._get_x_d(projected_values) full_node_values = x_d - np.einsum('ijr,j...r->i...r', self._das, x_d) - self._fas node_solution = TimeSolution(self._shooting_nodes, full_node_values) if dynamic_update: time_grid_solution = deepcopy(node_solution) time_grid_solution.dynamic_update = self._get_intermediate_values else: time_grid_solution = self._get_intermediate_values( node_solution, self._solution_time_grid) self._bvp.variables.current_values = time_grid_solution return time_grid_solution def _get_intermediate_values(self, node_solution: np.ndarray, time_grid: np.ndarray) -> TimeSolution: # this is rather slow, but it's an inherent disadvantage of the shooting approach logger.debug( "Getting intermediate values on time grid of size: {}".format( time_grid.size)) idsize = time_grid.size idx = np.append( np.searchsorted(time_grid, node_solution.time_grid, 'left'), idsize) solution = np.zeros( (*node_solution.solution.shape[:-1], time_grid.size)) f_columns = self._bvp.boundary_values.n_inhom self._ivp_problem.init_solver(stepsize=self._stepsize, f_columns=f_columns, abs_tol=self.abs_tol, rel_tol=self.abs_tol) # TODO: Also compute backwards for better stability / difference to node points for i, node in enumerate(node_solution.time_grid): loweridx = idx[i] upperidx = idx[i + 1] grid = time_grid[loweridx:upperidx] t0 = node if grid.size == 0: continue x0 = node_solution(node) tf = grid[-1] interval = Time(t0, tf, grid) x0_times = self._ivp_problem.solve(interval, x0) if node in grid or x0_times.solution.shape[-1] == 1: idx_increment = 0 else: idx_increment = 1 logger.debug("x0_timesshape: {}".format(x0_times.solution.shape)) solution[..., loweridx:upperidx] = np.atleast_2d( x0_times.solution.T).T[..., idx_increment:] return TimeSolution(time_grid, solution) def _get_x_d(self, projected_values: np.ndarray) -> np.ndarray: return np.einsum('ijr,j...r->i...r', self._t2s, projected_values) def _set_d_as(self) -> None: das = np.zeros((self._nn, self._nn, self._n_shooting_nodes), order='F') shape = self._dynamical_system.variables.shape fas = np.zeros((*shape, self._n_shooting_nodes), order='F') self._dynamical_system.init_rank() for i, node in enumerate(self._shooting_nodes): das[:, :, i] = self._dynamical_system.d_a(node) fas[..., i] = self._dynamical_system.f_a(node) self._das = das self._fas = fas solver_container_factory.register_solver(MultipleBoundaryValueProblem, MultipleShooting, default=True) solver_container_factory.register_solver( LQOptimalControl, MultipleShooting, default=True, creator_function=LQOptimalControl.get_bvp)
0.76555
0.282833
import numpy as np import cbh def test_fragmentation_cbh1(): test_smiles = "C1=C[C@H]2C[C@@H]1CC2" assert sorted(cbh.get_components_scheme1(test_smiles)) == sorted("CC C=C CC CC CC CC CC CC".split()) return def test_fragmentation_cbh2(): test_smiles = "C1=C[C@H]2C[C@@H]1CC2" assert sorted(cbh.get_components_scheme2(test_smiles)) == sorted("C=CC C=CC CCC CCC CCC CC(C)C CC(C)C".split()) return def test_fragmentation_reaction_cbh1(): reactants, products = ["C1=CC=CC1", "C=C"], ["C1=C[C@H]2C[C@@H]1CC2"] left, right = cbh.cbh_n(reactants, products, 1) assert sorted(left) == sorted(['C', 'C', 'C', 'C', 'C=C', 'C=C']) assert sorted(right) == sorted(['CC', 'CC', 'CC', 'CC']) return def test_fragmentation_reaction_cbh2(): reactants, products = ["C1=CC=CC1", "C=C"], ["C1=C[C@H]2C[C@@H]1CC2"] left, right = cbh.cbh_n(reactants, products, 2) assert sorted(left) == sorted(['C=CC', 'C=CC', 'CC', 'CC', 'CC', 'CC']) assert sorted(right) == sorted(['CC(C)C', 'CC(C)C', 'CCC', 'CCC']) return def test_split_smiles(): assert cbh.split_smiles("CC.CC") == ["CC", "CC"] assert cbh.split_smiles("2;CC", num_sep=";") == ["CC", "CC"] assert cbh.split_smiles(["CC", "CC.CC"]) == ["CC", "CC", "CC"] return def test_get_components_scheme1(): smiles = "C=[NH+]C" components = ["C=[NH2+]", "C[NH3+]"] output = cbh.get_components_scheme1("C=[NH+]C") assert sorted(components) == sorted(output) smiles = "C#[N+]C" components = ["C#[NH+]", "C[NH3+]"] output = cbh.get_components_scheme1(smiles) assert sorted(components) == sorted(output) smiles = "CC(=O)[O-]" components = ["CC", "C=O", "C[O-]"] output = cbh.get_components_scheme1(smiles) assert sorted(components) == sorted(output) smiles = "C[S+](C)C" components = ['C[SH2+]', 'C[SH2+]', 'C[SH2+]'] output = cbh.get_components_scheme1(smiles) assert sorted(components) == sorted(output) return def test_get_components_scheme2(): fun = cbh.get_components_scheme2 # getting the right number of H on N smiles = "CCc1c[nH]c2ccccc12" components = ['CCC', 'C=CN', 'CNC', 'C=CC', 'C=CC', 'C=CC', 'C=CC', 'C=C(C)C', 'C=C(C)C', 'C=C(C)N'] output = fun(smiles) assert sorted(components) == sorted(output) # connected smiles smiles = "C1CO1" components = ['CCO', 'CCO', 'COC'] output = fun(smiles) assert sorted(components) == sorted(output) return if __name__ == "__main__": print("use python3 -m pytest test.py")
test.py
import numpy as np import cbh def test_fragmentation_cbh1(): test_smiles = "C1=C[C@H]2C[C@@H]1CC2" assert sorted(cbh.get_components_scheme1(test_smiles)) == sorted("CC C=C CC CC CC CC CC CC".split()) return def test_fragmentation_cbh2(): test_smiles = "C1=C[C@H]2C[C@@H]1CC2" assert sorted(cbh.get_components_scheme2(test_smiles)) == sorted("C=CC C=CC CCC CCC CCC CC(C)C CC(C)C".split()) return def test_fragmentation_reaction_cbh1(): reactants, products = ["C1=CC=CC1", "C=C"], ["C1=C[C@H]2C[C@@H]1CC2"] left, right = cbh.cbh_n(reactants, products, 1) assert sorted(left) == sorted(['C', 'C', 'C', 'C', 'C=C', 'C=C']) assert sorted(right) == sorted(['CC', 'CC', 'CC', 'CC']) return def test_fragmentation_reaction_cbh2(): reactants, products = ["C1=CC=CC1", "C=C"], ["C1=C[C@H]2C[C@@H]1CC2"] left, right = cbh.cbh_n(reactants, products, 2) assert sorted(left) == sorted(['C=CC', 'C=CC', 'CC', 'CC', 'CC', 'CC']) assert sorted(right) == sorted(['CC(C)C', 'CC(C)C', 'CCC', 'CCC']) return def test_split_smiles(): assert cbh.split_smiles("CC.CC") == ["CC", "CC"] assert cbh.split_smiles("2;CC", num_sep=";") == ["CC", "CC"] assert cbh.split_smiles(["CC", "CC.CC"]) == ["CC", "CC", "CC"] return def test_get_components_scheme1(): smiles = "C=[NH+]C" components = ["C=[NH2+]", "C[NH3+]"] output = cbh.get_components_scheme1("C=[NH+]C") assert sorted(components) == sorted(output) smiles = "C#[N+]C" components = ["C#[NH+]", "C[NH3+]"] output = cbh.get_components_scheme1(smiles) assert sorted(components) == sorted(output) smiles = "CC(=O)[O-]" components = ["CC", "C=O", "C[O-]"] output = cbh.get_components_scheme1(smiles) assert sorted(components) == sorted(output) smiles = "C[S+](C)C" components = ['C[SH2+]', 'C[SH2+]', 'C[SH2+]'] output = cbh.get_components_scheme1(smiles) assert sorted(components) == sorted(output) return def test_get_components_scheme2(): fun = cbh.get_components_scheme2 # getting the right number of H on N smiles = "CCc1c[nH]c2ccccc12" components = ['CCC', 'C=CN', 'CNC', 'C=CC', 'C=CC', 'C=CC', 'C=CC', 'C=C(C)C', 'C=C(C)C', 'C=C(C)N'] output = fun(smiles) assert sorted(components) == sorted(output) # connected smiles smiles = "C1CO1" components = ['CCO', 'CCO', 'COC'] output = fun(smiles) assert sorted(components) == sorted(output) return if __name__ == "__main__": print("use python3 -m pytest test.py")
0.760828
0.456834
import subprocess, json, re, csv, sys, functools from jubatus.recommender import client from jubatus.recommender import types from jubatus.common import Datum def partial_commit_json(): dump =subprocess.check_output( ['git', 'log', '--pretty=format:{%n \"commit\": \"%H\",%n \"author\": \"%an <%ae>\",%n \"date\": \"%ad\",%n \"message\": \"%f\"%n},'] ).decode('UTF-8') return json.loads("[" + dump[:-1] + "]") def update_files_per_revision(): dump =subprocess.check_output( ['git', '--no-pager', 'log', '--name-only', '--format=\'%H', '--pretty=format:'] ).decode('UTF-8') chunk=[] for x in re.split('\n\n', dump): chunk.append([xx for xx in re.split('\n', x) if len(xx)!=0]) return chunk def merge(j, f): return dict([('author', j['author']), ('message', j['message']), ('commit', j['commit']),('date', j['date']),('files', f)]) def get_log_as_json(): return list(map(merge, partial_commit_json(), update_files_per_revision())) log_as_json = get_log_as_json() commits=[revision['commit'] for revision in log_as_json] files=list(functools.reduce(lambda acc,e: acc.union(e['files']), log_as_json,set())) log_csv={} # initialize the matrix(file, commit). its elements are zero. for f in files: log_csv.update([(f, [0 for x in range(len(commits))])]) for commit_index in range(len(log_as_json)): commit = log_as_json[commit_index] for f in commit['files']: log_csv[f][commit_index]=1 recommender = client.Recommender("127.0.0.1", 9199, "my_recommender") for filename,cmts in log_csv.items(): d={} for i in range(len(cmts)): d.update([(commits[i], cmts[i])]) recommender.update_row(filename, Datum(d)) relation_map={} for f in files: r = [x.id for x in recommender.similar_row_from_id(f, 4)] # print(r[0] + ' -> ' + ', '.join(r[1:])) relation_map.update([(f, [x for x in r[1:]])]) print(relation_map) # print(relation_map) # [file1, file2, ll] sorted_names=sorted(relation_map.keys()) def create_link(name): def get_index_by_name(name): return sorted_names.index(name) idx=get_index_by_name(name) related_indice=[get_index_by_name(n) for n in relation_map[name] if (n in sorted_names)] return [{'source': idx, 'target': i, 'value': 1} for i in related_indice if i > idx] a = [create_link(n) for n in sorted_names] with open('hoge.json', 'w') as f: json.dump({'nodes': [{'name': name, 'group': 1} for name in sorted_names], 'links': [e for aa in a for e in aa]}, f,indent=2)
gitlog_json_print.py
import subprocess, json, re, csv, sys, functools from jubatus.recommender import client from jubatus.recommender import types from jubatus.common import Datum def partial_commit_json(): dump =subprocess.check_output( ['git', 'log', '--pretty=format:{%n \"commit\": \"%H\",%n \"author\": \"%an <%ae>\",%n \"date\": \"%ad\",%n \"message\": \"%f\"%n},'] ).decode('UTF-8') return json.loads("[" + dump[:-1] + "]") def update_files_per_revision(): dump =subprocess.check_output( ['git', '--no-pager', 'log', '--name-only', '--format=\'%H', '--pretty=format:'] ).decode('UTF-8') chunk=[] for x in re.split('\n\n', dump): chunk.append([xx for xx in re.split('\n', x) if len(xx)!=0]) return chunk def merge(j, f): return dict([('author', j['author']), ('message', j['message']), ('commit', j['commit']),('date', j['date']),('files', f)]) def get_log_as_json(): return list(map(merge, partial_commit_json(), update_files_per_revision())) log_as_json = get_log_as_json() commits=[revision['commit'] for revision in log_as_json] files=list(functools.reduce(lambda acc,e: acc.union(e['files']), log_as_json,set())) log_csv={} # initialize the matrix(file, commit). its elements are zero. for f in files: log_csv.update([(f, [0 for x in range(len(commits))])]) for commit_index in range(len(log_as_json)): commit = log_as_json[commit_index] for f in commit['files']: log_csv[f][commit_index]=1 recommender = client.Recommender("127.0.0.1", 9199, "my_recommender") for filename,cmts in log_csv.items(): d={} for i in range(len(cmts)): d.update([(commits[i], cmts[i])]) recommender.update_row(filename, Datum(d)) relation_map={} for f in files: r = [x.id for x in recommender.similar_row_from_id(f, 4)] # print(r[0] + ' -> ' + ', '.join(r[1:])) relation_map.update([(f, [x for x in r[1:]])]) print(relation_map) # print(relation_map) # [file1, file2, ll] sorted_names=sorted(relation_map.keys()) def create_link(name): def get_index_by_name(name): return sorted_names.index(name) idx=get_index_by_name(name) related_indice=[get_index_by_name(n) for n in relation_map[name] if (n in sorted_names)] return [{'source': idx, 'target': i, 'value': 1} for i in related_indice if i > idx] a = [create_link(n) for n in sorted_names] with open('hoge.json', 'w') as f: json.dump({'nodes': [{'name': name, 'group': 1} for name in sorted_names], 'links': [e for aa in a for e in aa]}, f,indent=2)
0.174868
0.12692
from django.shortcuts import render from helpers import download import pandas as pd import os cwd = os.getcwd() perf_data_path = cwd + "/perf_data/" current_release = [os.getenv('CUR_RELEASE')] # Create your views here. def monitoring_overview(request): return render(request, "monitoring_overview.html") def cur_regression(request): cur_href_links, _, cur_release_dates, _, _, _ = download.download_benchmark_csv(60) latency_none_mtls_base_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_mtls_baseline', 'p90') latency_none_mtls_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_mtls_both', 'p90') latency_none_plaintext_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_plaintext_both', 'p90') latency_v2_stats_nullvm_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-stats-nullvm_both', 'p90') latency_v2_stats_wasm_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-stats-wasm_both', 'p90') latency_v2_sd_nologging_nullvm_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-sd-nologging-nullvm_both', 'p90') latency_v2_sd_full_nullvm_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-sd-full-nullvm_both', 'p90') latency_none_security_authz_ip_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_authz_ip_both', 'p90') latency_none_security_authz_path_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_authz_path_both', 'p90') latency_none_security_authz_jwt_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_authz_jwt_both', 'p90') latency_none_security_peer_authn_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_peer_authn_both', 'p90') latency_none_mtls_base_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_mtls_baseline', 'p99') latency_none_mtls_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_mtls_both', 'p99') latency_none_plaintext_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_plaintext_both', 'p99') latency_v2_stats_nullvm_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-stats-nullvm_both', 'p99') latency_v2_stats_wasm_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-stats-wasm_both', 'p99') latency_v2_sd_nologging_nullvm_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-sd-nologging-nullvm_both', 'p99') latency_v2_sd_full_nullvm_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-sd-full-nullvm_both', 'p99') latency_none_security_authz_ip_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_authz_ip_both', 'p99') latency_none_security_authz_path_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_authz_path_both', 'p99') latency_none_security_authz_jwt_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_authz_jwt_both', 'p99') latency_none_security_peer_authn_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_peer_authn_both', 'p99') context = {'current_release': current_release, 'latency_none_mtls_base_p90': latency_none_mtls_base_p90, 'latency_none_mtls_both_p90': latency_none_mtls_both_p90, 'latency_none_plaintext_both_p90': latency_none_plaintext_both_p90, 'latency_v2_stats_nullvm_both_p90': latency_v2_stats_nullvm_both_p90, 'latency_v2_stats_wasm_both_p90': latency_v2_stats_wasm_both_p90, 'latency_v2_sd_nologging_nullvm_both_p90': latency_v2_sd_nologging_nullvm_both_p90, 'latency_v2_sd_full_nullvm_both_p90': latency_v2_sd_full_nullvm_both_p90, 'latency_none_security_authz_ip_both_p90': latency_none_security_authz_ip_both_p90, 'latency_none_security_authz_path_both_p90': latency_none_security_authz_path_both_p90, 'latency_none_security_authz_jwt_both_p90': latency_none_security_authz_jwt_both_p90, 'latency_none_security_peer_authn_both_p90': latency_none_security_peer_authn_both_p90, 'latency_none_mtls_base_p99': latency_none_mtls_base_p99, 'latency_none_mtls_both_p99': latency_none_mtls_both_p99, 'latency_none_plaintext_both_p99': latency_none_plaintext_both_p99, 'latency_v2_stats_nullvm_both_p99': latency_v2_stats_nullvm_both_p99, 'latency_v2_stats_wasm_both_p99': latency_v2_stats_wasm_both_p99, 'latency_v2_sd_nologging_nullvm_both_p99': latency_v2_sd_nologging_nullvm_both_p99, 'latency_v2_sd_full_nullvm_both_p99': latency_v2_sd_full_nullvm_both_p99, 'latency_none_security_authz_ip_both_p99': latency_none_security_authz_ip_both_p99, 'latency_none_security_authz_path_both_p99': latency_none_security_authz_path_both_p99, 'latency_none_security_authz_jwt_both_p99': latency_none_security_authz_jwt_both_p99, 'latency_none_security_peer_authn_both_p99': latency_none_security_peer_authn_both_p99, } return render(request, "cur_regression.html", context=context) # Create your views here. def master_regression(request): _, _, _, master_href_links, _, master_release_dates = download.download_benchmark_csv(60) latency_none_mtls_base_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_mtls_baseline', 'p90') latency_none_mtls_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_mtls_both', 'p90') latency_none_plaintext_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_plaintext_both', 'p90') latency_v2_stats_nullvm_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-stats-nullvm_both', 'p90') latency_v2_stats_wasm_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-stats-wasm_both', 'p90') latency_v2_sd_nologging_nullvm_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-sd-nologging-nullvm_both', 'p90') latency_v2_sd_full_nullvm_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-sd-full-nullvm_both', 'p90') latency_none_security_authz_ip_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_security_authz_ip_both', 'p90') latency_none_security_authz_path_both_p90_master = get_telemetry_mode_y_series( master_href_links, master_release_dates, '_none_security_authz_path_both', 'p90') latency_none_security_authz_jwt_both_p90_master = get_telemetry_mode_y_series( master_href_links, master_release_dates, '_none_security_authz_jwt_both', 'p90') latency_none_security_peer_authn_both_p90_master = get_telemetry_mode_y_series( master_href_links, master_release_dates, '_none_security_peer_authn_both', 'p90') latency_none_mtls_base_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_mtls_baseline', 'p99') latency_none_mtls_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_mtls_both', 'p99') latency_none_plaintext_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_plaintext_both', 'p99') latency_v2_stats_nullvm_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-stats-nullvm_both', 'p99') latency_v2_stats_wasm_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-stats-wasm_both', 'p99') latency_v2_sd_nologging_nullvm_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-sd-nologging-nullvm_both', 'p99') latency_v2_sd_full_nullvm_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-sd-full-nullvm_both', 'p99') latency_none_security_authz_ip_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_security_authz_ip_both', 'p99') latency_none_security_authz_path_both_p99_master = get_telemetry_mode_y_series( master_href_links, master_release_dates, '_none_security_authz_path_both', 'p99') latency_none_security_authz_jwt_both_p99_master = get_telemetry_mode_y_series( master_href_links, master_release_dates, '_none_security_authz_jwt_both', 'p99') latency_none_security_peer_authn_both_p99_master = get_telemetry_mode_y_series( master_href_links, master_release_dates, '_none_security_peer_authn_both', 'p99') context = {'latency_none_mtls_base_p90_master': latency_none_mtls_base_p90_master, 'latency_none_mtls_both_p90_master': latency_none_mtls_both_p90_master, 'latency_none_plaintext_both_p90_master': latency_none_plaintext_both_p90_master, 'latency_v2_stats_nullvm_both_p90_master': latency_v2_stats_nullvm_both_p90_master, 'latency_v2_stats_wasm_both_p90_master': latency_v2_stats_wasm_both_p90_master, 'latency_v2_sd_nologging_nullvm_both_p90_master': latency_v2_sd_nologging_nullvm_both_p90_master, 'latency_v2_sd_full_nullvm_both_p90_master': latency_v2_sd_full_nullvm_both_p90_master, 'latency_none_security_authz_ip_both_p90_master': latency_none_security_authz_ip_both_p90_master, 'latency_none_security_authz_path_both_p90_master': latency_none_security_authz_path_both_p90_master, 'latency_none_security_authz_jwt_both_p90_master': latency_none_security_authz_jwt_both_p90_master, 'latency_none_security_peer_authn_both_p90_master': latency_none_security_peer_authn_both_p90_master, 'latency_none_mtls_base_p99_master': latency_none_mtls_base_p99_master, 'latency_none_mtls_both_p99_master': latency_none_mtls_both_p99_master, 'latency_none_plaintext_both_p99_master': latency_none_plaintext_both_p99_master, 'latency_v2_stats_nullvm_both_p99_master': latency_v2_stats_nullvm_both_p99_master, 'latency_v2_stats_wasm_both_p99_master': latency_v2_stats_wasm_both_p99_master, 'latency_v2_sd_nologging_nullvm_both_p99_master': latency_v2_sd_nologging_nullvm_both_p99_master, 'latency_v2_sd_full_nullvm_both_p99_master': latency_v2_sd_full_nullvm_both_p99_master, 'latency_none_security_authz_ip_both_p99_master': latency_none_security_authz_ip_both_p99_master, 'latency_none_security_authz_path_both_p99_master': latency_none_security_authz_path_both_p99_master, 'latency_none_security_authz_jwt_both_p99_master': latency_none_security_authz_jwt_both_p99_master, 'latency_none_security_peer_authn_both_p99_master': latency_none_security_peer_authn_both_p99_master, } return render(request, "master_regression.html", context=context) # Helpers def get_latency_y_data_point(df, telemetry_mode, quantiles): y_series_data = [] data = df.query('ActualQPS == 1000 and NumThreads == 16 and Labels.str.endswith(@telemetry_mode)') quantile_data = data.get(quantiles) if quantile_data is None or len(quantile_data) == 0: y_series_data.append('null') else: y_series_data.append(data[quantiles].head(1).values[0] / 1000) return y_series_data def get_telemetry_mode_y_series(release_href_links, release_dates, telemetry_mode, quantiles): trending_data = [[]] * len(release_href_links) for i in range(len(release_href_links)): release_year = release_dates[i][0:4] release_month = release_dates[i][4:6] release_date = release_dates[i][6:] release_list = [release_year, release_month, release_date] try: href_parts = release_href_links[i].split("/") benchmark_test_id = href_parts[4] df = pd.read_csv(perf_data_path + benchmark_test_id + "_benchmark.csv") except Exception as e: print(e) trending_data[i] = release_list + ["null"] else: trending_data[i] = release_list + [get_latency_y_data_point(df, telemetry_mode, quantiles)] return trending_data
perf_dashboard/regressions/views.py
from django.shortcuts import render from helpers import download import pandas as pd import os cwd = os.getcwd() perf_data_path = cwd + "/perf_data/" current_release = [os.getenv('CUR_RELEASE')] # Create your views here. def monitoring_overview(request): return render(request, "monitoring_overview.html") def cur_regression(request): cur_href_links, _, cur_release_dates, _, _, _ = download.download_benchmark_csv(60) latency_none_mtls_base_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_mtls_baseline', 'p90') latency_none_mtls_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_mtls_both', 'p90') latency_none_plaintext_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_plaintext_both', 'p90') latency_v2_stats_nullvm_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-stats-nullvm_both', 'p90') latency_v2_stats_wasm_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-stats-wasm_both', 'p90') latency_v2_sd_nologging_nullvm_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-sd-nologging-nullvm_both', 'p90') latency_v2_sd_full_nullvm_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-sd-full-nullvm_both', 'p90') latency_none_security_authz_ip_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_authz_ip_both', 'p90') latency_none_security_authz_path_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_authz_path_both', 'p90') latency_none_security_authz_jwt_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_authz_jwt_both', 'p90') latency_none_security_peer_authn_both_p90 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_peer_authn_both', 'p90') latency_none_mtls_base_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_mtls_baseline', 'p99') latency_none_mtls_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_mtls_both', 'p99') latency_none_plaintext_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_plaintext_both', 'p99') latency_v2_stats_nullvm_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-stats-nullvm_both', 'p99') latency_v2_stats_wasm_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-stats-wasm_both', 'p99') latency_v2_sd_nologging_nullvm_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-sd-nologging-nullvm_both', 'p99') latency_v2_sd_full_nullvm_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_v2-sd-full-nullvm_both', 'p99') latency_none_security_authz_ip_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_authz_ip_both', 'p99') latency_none_security_authz_path_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_authz_path_both', 'p99') latency_none_security_authz_jwt_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_authz_jwt_both', 'p99') latency_none_security_peer_authn_both_p99 = get_telemetry_mode_y_series(cur_href_links, cur_release_dates, '_none_security_peer_authn_both', 'p99') context = {'current_release': current_release, 'latency_none_mtls_base_p90': latency_none_mtls_base_p90, 'latency_none_mtls_both_p90': latency_none_mtls_both_p90, 'latency_none_plaintext_both_p90': latency_none_plaintext_both_p90, 'latency_v2_stats_nullvm_both_p90': latency_v2_stats_nullvm_both_p90, 'latency_v2_stats_wasm_both_p90': latency_v2_stats_wasm_both_p90, 'latency_v2_sd_nologging_nullvm_both_p90': latency_v2_sd_nologging_nullvm_both_p90, 'latency_v2_sd_full_nullvm_both_p90': latency_v2_sd_full_nullvm_both_p90, 'latency_none_security_authz_ip_both_p90': latency_none_security_authz_ip_both_p90, 'latency_none_security_authz_path_both_p90': latency_none_security_authz_path_both_p90, 'latency_none_security_authz_jwt_both_p90': latency_none_security_authz_jwt_both_p90, 'latency_none_security_peer_authn_both_p90': latency_none_security_peer_authn_both_p90, 'latency_none_mtls_base_p99': latency_none_mtls_base_p99, 'latency_none_mtls_both_p99': latency_none_mtls_both_p99, 'latency_none_plaintext_both_p99': latency_none_plaintext_both_p99, 'latency_v2_stats_nullvm_both_p99': latency_v2_stats_nullvm_both_p99, 'latency_v2_stats_wasm_both_p99': latency_v2_stats_wasm_both_p99, 'latency_v2_sd_nologging_nullvm_both_p99': latency_v2_sd_nologging_nullvm_both_p99, 'latency_v2_sd_full_nullvm_both_p99': latency_v2_sd_full_nullvm_both_p99, 'latency_none_security_authz_ip_both_p99': latency_none_security_authz_ip_both_p99, 'latency_none_security_authz_path_both_p99': latency_none_security_authz_path_both_p99, 'latency_none_security_authz_jwt_both_p99': latency_none_security_authz_jwt_both_p99, 'latency_none_security_peer_authn_both_p99': latency_none_security_peer_authn_both_p99, } return render(request, "cur_regression.html", context=context) # Create your views here. def master_regression(request): _, _, _, master_href_links, _, master_release_dates = download.download_benchmark_csv(60) latency_none_mtls_base_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_mtls_baseline', 'p90') latency_none_mtls_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_mtls_both', 'p90') latency_none_plaintext_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_plaintext_both', 'p90') latency_v2_stats_nullvm_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-stats-nullvm_both', 'p90') latency_v2_stats_wasm_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-stats-wasm_both', 'p90') latency_v2_sd_nologging_nullvm_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-sd-nologging-nullvm_both', 'p90') latency_v2_sd_full_nullvm_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-sd-full-nullvm_both', 'p90') latency_none_security_authz_ip_both_p90_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_security_authz_ip_both', 'p90') latency_none_security_authz_path_both_p90_master = get_telemetry_mode_y_series( master_href_links, master_release_dates, '_none_security_authz_path_both', 'p90') latency_none_security_authz_jwt_both_p90_master = get_telemetry_mode_y_series( master_href_links, master_release_dates, '_none_security_authz_jwt_both', 'p90') latency_none_security_peer_authn_both_p90_master = get_telemetry_mode_y_series( master_href_links, master_release_dates, '_none_security_peer_authn_both', 'p90') latency_none_mtls_base_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_mtls_baseline', 'p99') latency_none_mtls_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_mtls_both', 'p99') latency_none_plaintext_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_plaintext_both', 'p99') latency_v2_stats_nullvm_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-stats-nullvm_both', 'p99') latency_v2_stats_wasm_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-stats-wasm_both', 'p99') latency_v2_sd_nologging_nullvm_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-sd-nologging-nullvm_both', 'p99') latency_v2_sd_full_nullvm_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_v2-sd-full-nullvm_both', 'p99') latency_none_security_authz_ip_both_p99_master = get_telemetry_mode_y_series(master_href_links, master_release_dates, '_none_security_authz_ip_both', 'p99') latency_none_security_authz_path_both_p99_master = get_telemetry_mode_y_series( master_href_links, master_release_dates, '_none_security_authz_path_both', 'p99') latency_none_security_authz_jwt_both_p99_master = get_telemetry_mode_y_series( master_href_links, master_release_dates, '_none_security_authz_jwt_both', 'p99') latency_none_security_peer_authn_both_p99_master = get_telemetry_mode_y_series( master_href_links, master_release_dates, '_none_security_peer_authn_both', 'p99') context = {'latency_none_mtls_base_p90_master': latency_none_mtls_base_p90_master, 'latency_none_mtls_both_p90_master': latency_none_mtls_both_p90_master, 'latency_none_plaintext_both_p90_master': latency_none_plaintext_both_p90_master, 'latency_v2_stats_nullvm_both_p90_master': latency_v2_stats_nullvm_both_p90_master, 'latency_v2_stats_wasm_both_p90_master': latency_v2_stats_wasm_both_p90_master, 'latency_v2_sd_nologging_nullvm_both_p90_master': latency_v2_sd_nologging_nullvm_both_p90_master, 'latency_v2_sd_full_nullvm_both_p90_master': latency_v2_sd_full_nullvm_both_p90_master, 'latency_none_security_authz_ip_both_p90_master': latency_none_security_authz_ip_both_p90_master, 'latency_none_security_authz_path_both_p90_master': latency_none_security_authz_path_both_p90_master, 'latency_none_security_authz_jwt_both_p90_master': latency_none_security_authz_jwt_both_p90_master, 'latency_none_security_peer_authn_both_p90_master': latency_none_security_peer_authn_both_p90_master, 'latency_none_mtls_base_p99_master': latency_none_mtls_base_p99_master, 'latency_none_mtls_both_p99_master': latency_none_mtls_both_p99_master, 'latency_none_plaintext_both_p99_master': latency_none_plaintext_both_p99_master, 'latency_v2_stats_nullvm_both_p99_master': latency_v2_stats_nullvm_both_p99_master, 'latency_v2_stats_wasm_both_p99_master': latency_v2_stats_wasm_both_p99_master, 'latency_v2_sd_nologging_nullvm_both_p99_master': latency_v2_sd_nologging_nullvm_both_p99_master, 'latency_v2_sd_full_nullvm_both_p99_master': latency_v2_sd_full_nullvm_both_p99_master, 'latency_none_security_authz_ip_both_p99_master': latency_none_security_authz_ip_both_p99_master, 'latency_none_security_authz_path_both_p99_master': latency_none_security_authz_path_both_p99_master, 'latency_none_security_authz_jwt_both_p99_master': latency_none_security_authz_jwt_both_p99_master, 'latency_none_security_peer_authn_both_p99_master': latency_none_security_peer_authn_both_p99_master, } return render(request, "master_regression.html", context=context) # Helpers def get_latency_y_data_point(df, telemetry_mode, quantiles): y_series_data = [] data = df.query('ActualQPS == 1000 and NumThreads == 16 and Labels.str.endswith(@telemetry_mode)') quantile_data = data.get(quantiles) if quantile_data is None or len(quantile_data) == 0: y_series_data.append('null') else: y_series_data.append(data[quantiles].head(1).values[0] / 1000) return y_series_data def get_telemetry_mode_y_series(release_href_links, release_dates, telemetry_mode, quantiles): trending_data = [[]] * len(release_href_links) for i in range(len(release_href_links)): release_year = release_dates[i][0:4] release_month = release_dates[i][4:6] release_date = release_dates[i][6:] release_list = [release_year, release_month, release_date] try: href_parts = release_href_links[i].split("/") benchmark_test_id = href_parts[4] df = pd.read_csv(perf_data_path + benchmark_test_id + "_benchmark.csv") except Exception as e: print(e) trending_data[i] = release_list + ["null"] else: trending_data[i] = release_list + [get_latency_y_data_point(df, telemetry_mode, quantiles)] return trending_data
0.353205
0.147647
import argparse import logging from opti_models.benchmarks.imagenet_torch_benchmark import main logging.basicConfig(level=logging.INFO) def parse_args(): # Default args path = "/usr/local/opti_models/imagenetv2-top-images-format-val" parser = argparse.ArgumentParser(description='Simple speed benchmark, based on pyTorch models') parser.add_argument('--model-name', type=str, help="Name of the model to test", default='resnet18') parser.add_argument( '--path-to-images', default=path, type=str, help=f"Path to the validation images, default: {path}" ) parser.add_argument('--size', default=(224, 224), nargs='+', type=int, help="Input shape, default=(224, 224)") parser.add_argument('--batch-size', default=1, type=int, help="Size of the batch of images, default=1") parser.add_argument('--workers', default=1, type=int, help="Number of workers, default=1") return parser.parse_args() def bench_all(): from opti_models.models.backbones.backbone_factory import show_available_backbones included_names = [name for name in show_available_backbones()] excluded_names = [ 'efficientnet_b1b', 'efficientnet_b2b', 'efficientnet_b3b', 'efficientnet_b4b', 'efficientnet_b5b', 'efficientnet_b6b', 'efficientnet_b7b', 'efficientnet_b0c', 'efficientnet_b1c', 'efficientnet_b2c', 'efficientnet_b3c', 'efficientnet_b4c', 'efficientnet_b5c', 'efficientnet_b6c', 'efficientnet_b7c', 'efficientnet_b8c', ] model_names = [name for name in included_names if name not in excluded_names] for i, model_name in enumerate(model_names): logging.info(f"\t{i + 1}/{len(model_names)}: {model_name.upper()}") args = parse_args() args.model_name = model_name if model_name == "genet_large": args.in_size = (256, 256) elif model_name == 'inception_v3': args.in_size = (299, 299) try: main(args=args) except Exception as e: logging.info(f"\tCan't bench {model_name} \n{repr(e)}") logging.info(f"-" * 100) if __name__ == '__main__': bench_all()
tests/t_bench_torch.py
import argparse import logging from opti_models.benchmarks.imagenet_torch_benchmark import main logging.basicConfig(level=logging.INFO) def parse_args(): # Default args path = "/usr/local/opti_models/imagenetv2-top-images-format-val" parser = argparse.ArgumentParser(description='Simple speed benchmark, based on pyTorch models') parser.add_argument('--model-name', type=str, help="Name of the model to test", default='resnet18') parser.add_argument( '--path-to-images', default=path, type=str, help=f"Path to the validation images, default: {path}" ) parser.add_argument('--size', default=(224, 224), nargs='+', type=int, help="Input shape, default=(224, 224)") parser.add_argument('--batch-size', default=1, type=int, help="Size of the batch of images, default=1") parser.add_argument('--workers', default=1, type=int, help="Number of workers, default=1") return parser.parse_args() def bench_all(): from opti_models.models.backbones.backbone_factory import show_available_backbones included_names = [name for name in show_available_backbones()] excluded_names = [ 'efficientnet_b1b', 'efficientnet_b2b', 'efficientnet_b3b', 'efficientnet_b4b', 'efficientnet_b5b', 'efficientnet_b6b', 'efficientnet_b7b', 'efficientnet_b0c', 'efficientnet_b1c', 'efficientnet_b2c', 'efficientnet_b3c', 'efficientnet_b4c', 'efficientnet_b5c', 'efficientnet_b6c', 'efficientnet_b7c', 'efficientnet_b8c', ] model_names = [name for name in included_names if name not in excluded_names] for i, model_name in enumerate(model_names): logging.info(f"\t{i + 1}/{len(model_names)}: {model_name.upper()}") args = parse_args() args.model_name = model_name if model_name == "genet_large": args.in_size = (256, 256) elif model_name == 'inception_v3': args.in_size = (299, 299) try: main(args=args) except Exception as e: logging.info(f"\tCan't bench {model_name} \n{repr(e)}") logging.info(f"-" * 100) if __name__ == '__main__': bench_all()
0.433022
0.129375
import discord import datetime import time import psutil import sys from discord.ext import commands start_time = time.time() class Utility(commands.Cog): def __init__(self, bot): self.bot = bot # def restart_program(): # python = sys.executable # os.execl(python, python, * sys.argv) # Status Cycle @commands.command() @commands.is_owner() async def online(self, ctx, *, cactivity = ""): await self.bot.change_presence(status=discord.Status.online, activity=discord.Game(name=f'{cactivity}', type=3)) @commands.command() @commands.is_owner() async def idle(self, ctx, *, cactivity = ""): await self.bot.change_presence(status=discord.Status.idle, activity=discord.Game(name=f'{cactivity}', type=3)) @commands.command() @commands.is_owner() async def dnd(self, ctx, *, cactivity = ""): await self.bot.change_presence(status=discord.Status.dnd, activity=discord.Game(name=f'{cactivity}', type=3)) # Utility @commands.command(pass_context=True) async def status(self, ctx): # Time current_time = time.time() difference = int(round(current_time - start_time)) utime = str(datetime.timedelta(seconds=difference)) embed = discord.Embed( colour = discord.Colour.green() ) # PSUtil - RAM Usage dict(psutil.virtual_memory()._asdict()) usedmem = psutil.virtual_memory().used/1024/1024 # activemem = psutil.virtual_memory().active tmem = psutil.virtual_memory().total/1024/1024 pmem = round((usedmem/tmem)*100) # PSUtil - Swap Memory Usage # dict(psutil.swap_memory()._asdict()) # uswap = psutil.swap_memory().used/1024/1024 # tswap = psutil.swap_memory().total/1024/1024 # pswap = round((uswap/tswap)*100) #Bot Prefix Read with open (f"./prefix.txt", "r") as botprefix: prefix = botprefix.read() # PSUtil Operating System if psutil.LINUX: os = 'Linux' elif psutil.MACOS: os = 'MacOS' elif psutil.WINDOWS: os = 'Windows' else: os = 'Unknown' embed.set_author(name='System Monitor') embed.add_field(name="CPU Usage", value=f'{psutil.cpu_percent()}%', inline=True) embed.add_field(name="CPU Cores", value=psutil.cpu_count(), inline=True) embed.add_field(name="RAM Usage", value=f'{round(usedmem)}/{round(tmem)}MB ({round(pmem)}%)', inline=True) embed.add_field(name="Operating System", value=os, inline=True) # embed.add_field(name="Swap Usage", value=f'{round(uswap)}/{round(tswap)}MB ({round(pmem)}%)', inline=True) embed.add_field(name="Uptime", value=f'{utime}', inline=True) embed.add_field(name='API Latency', value=f'{round(self.bot.latency * 1000)} ms', inline=True) embed.add_field(name='Bot Prefix', value=f"`{prefix}`", inline=False) embed.set_footer(text="Bot by SilentVOEZ") await ctx.send(embed=embed) botprefix.close() # @commands.command() # @commands.is_owner() # async def reboot(self, ctx): # await ctx.send('Rebooting...') # restart_program() @commands.command() @commands.is_owner() async def e(self, ctx): print(f"---EMERGENCY SHUTDOWN REQUESTED BY {ctx.author}---") await ctx.send("**--EMERGENCY SHUTDOWN--**") await ctx.bot.logout() def setup(bot): bot.add_cog(Utility(bot))
plugins/utility.py
import discord import datetime import time import psutil import sys from discord.ext import commands start_time = time.time() class Utility(commands.Cog): def __init__(self, bot): self.bot = bot # def restart_program(): # python = sys.executable # os.execl(python, python, * sys.argv) # Status Cycle @commands.command() @commands.is_owner() async def online(self, ctx, *, cactivity = ""): await self.bot.change_presence(status=discord.Status.online, activity=discord.Game(name=f'{cactivity}', type=3)) @commands.command() @commands.is_owner() async def idle(self, ctx, *, cactivity = ""): await self.bot.change_presence(status=discord.Status.idle, activity=discord.Game(name=f'{cactivity}', type=3)) @commands.command() @commands.is_owner() async def dnd(self, ctx, *, cactivity = ""): await self.bot.change_presence(status=discord.Status.dnd, activity=discord.Game(name=f'{cactivity}', type=3)) # Utility @commands.command(pass_context=True) async def status(self, ctx): # Time current_time = time.time() difference = int(round(current_time - start_time)) utime = str(datetime.timedelta(seconds=difference)) embed = discord.Embed( colour = discord.Colour.green() ) # PSUtil - RAM Usage dict(psutil.virtual_memory()._asdict()) usedmem = psutil.virtual_memory().used/1024/1024 # activemem = psutil.virtual_memory().active tmem = psutil.virtual_memory().total/1024/1024 pmem = round((usedmem/tmem)*100) # PSUtil - Swap Memory Usage # dict(psutil.swap_memory()._asdict()) # uswap = psutil.swap_memory().used/1024/1024 # tswap = psutil.swap_memory().total/1024/1024 # pswap = round((uswap/tswap)*100) #Bot Prefix Read with open (f"./prefix.txt", "r") as botprefix: prefix = botprefix.read() # PSUtil Operating System if psutil.LINUX: os = 'Linux' elif psutil.MACOS: os = 'MacOS' elif psutil.WINDOWS: os = 'Windows' else: os = 'Unknown' embed.set_author(name='System Monitor') embed.add_field(name="CPU Usage", value=f'{psutil.cpu_percent()}%', inline=True) embed.add_field(name="CPU Cores", value=psutil.cpu_count(), inline=True) embed.add_field(name="RAM Usage", value=f'{round(usedmem)}/{round(tmem)}MB ({round(pmem)}%)', inline=True) embed.add_field(name="Operating System", value=os, inline=True) # embed.add_field(name="Swap Usage", value=f'{round(uswap)}/{round(tswap)}MB ({round(pmem)}%)', inline=True) embed.add_field(name="Uptime", value=f'{utime}', inline=True) embed.add_field(name='API Latency', value=f'{round(self.bot.latency * 1000)} ms', inline=True) embed.add_field(name='Bot Prefix', value=f"`{prefix}`", inline=False) embed.set_footer(text="Bot by SilentVOEZ") await ctx.send(embed=embed) botprefix.close() # @commands.command() # @commands.is_owner() # async def reboot(self, ctx): # await ctx.send('Rebooting...') # restart_program() @commands.command() @commands.is_owner() async def e(self, ctx): print(f"---EMERGENCY SHUTDOWN REQUESTED BY {ctx.author}---") await ctx.send("**--EMERGENCY SHUTDOWN--**") await ctx.bot.logout() def setup(bot): bot.add_cog(Utility(bot))
0.184915
0.053675
import warnings import pulumi import pulumi.runtime from typing import Any, Mapping, Optional, Sequence, Union, overload from . import _utilities __all__ = ['PipelineArgs', 'Pipeline'] @pulumi.input_type class PipelineArgs: def __init__(__self__, *, is_exposed: pulumi.Input[bool], is_paused: pulumi.Input[bool], pipeline_config: pulumi.Input[str], pipeline_config_format: pulumi.Input[str], pipeline_name: pulumi.Input[str], team_name: pulumi.Input[str]): """ The set of arguments for constructing a Pipeline resource. """ pulumi.set(__self__, "is_exposed", is_exposed) pulumi.set(__self__, "is_paused", is_paused) pulumi.set(__self__, "pipeline_config", pipeline_config) pulumi.set(__self__, "pipeline_config_format", pipeline_config_format) pulumi.set(__self__, "pipeline_name", pipeline_name) pulumi.set(__self__, "team_name", team_name) @property @pulumi.getter(name="isExposed") def is_exposed(self) -> pulumi.Input[bool]: return pulumi.get(self, "is_exposed") @is_exposed.setter def is_exposed(self, value: pulumi.Input[bool]): pulumi.set(self, "is_exposed", value) @property @pulumi.getter(name="isPaused") def is_paused(self) -> pulumi.Input[bool]: return pulumi.get(self, "is_paused") @is_paused.setter def is_paused(self, value: pulumi.Input[bool]): pulumi.set(self, "is_paused", value) @property @pulumi.getter(name="pipelineConfig") def pipeline_config(self) -> pulumi.Input[str]: return pulumi.get(self, "pipeline_config") @pipeline_config.setter def pipeline_config(self, value: pulumi.Input[str]): pulumi.set(self, "pipeline_config", value) @property @pulumi.getter(name="pipelineConfigFormat") def pipeline_config_format(self) -> pulumi.Input[str]: return pulumi.get(self, "pipeline_config_format") @pipeline_config_format.setter def pipeline_config_format(self, value: pulumi.Input[str]): pulumi.set(self, "pipeline_config_format", value) @property @pulumi.getter(name="pipelineName") def pipeline_name(self) -> pulumi.Input[str]: return pulumi.get(self, "pipeline_name") @pipeline_name.setter def pipeline_name(self, value: pulumi.Input[str]): pulumi.set(self, "pipeline_name", value) @property @pulumi.getter(name="teamName") def team_name(self) -> pulumi.Input[str]: return pulumi.get(self, "team_name") @team_name.setter def team_name(self, value: pulumi.Input[str]): pulumi.set(self, "team_name", value) @pulumi.input_type class _PipelineState: def __init__(__self__, *, is_exposed: Optional[pulumi.Input[bool]] = None, is_paused: Optional[pulumi.Input[bool]] = None, json: Optional[pulumi.Input[str]] = None, pipeline_config: Optional[pulumi.Input[str]] = None, pipeline_config_format: Optional[pulumi.Input[str]] = None, pipeline_name: Optional[pulumi.Input[str]] = None, team_name: Optional[pulumi.Input[str]] = None, yaml: Optional[pulumi.Input[str]] = None): """ Input properties used for looking up and filtering Pipeline resources. """ if is_exposed is not None: pulumi.set(__self__, "is_exposed", is_exposed) if is_paused is not None: pulumi.set(__self__, "is_paused", is_paused) if json is not None: pulumi.set(__self__, "json", json) if pipeline_config is not None: pulumi.set(__self__, "pipeline_config", pipeline_config) if pipeline_config_format is not None: pulumi.set(__self__, "pipeline_config_format", pipeline_config_format) if pipeline_name is not None: pulumi.set(__self__, "pipeline_name", pipeline_name) if team_name is not None: pulumi.set(__self__, "team_name", team_name) if yaml is not None: pulumi.set(__self__, "yaml", yaml) @property @pulumi.getter(name="isExposed") def is_exposed(self) -> Optional[pulumi.Input[bool]]: return pulumi.get(self, "is_exposed") @is_exposed.setter def is_exposed(self, value: Optional[pulumi.Input[bool]]): pulumi.set(self, "is_exposed", value) @property @pulumi.getter(name="isPaused") def is_paused(self) -> Optional[pulumi.Input[bool]]: return pulumi.get(self, "is_paused") @is_paused.setter def is_paused(self, value: Optional[pulumi.Input[bool]]): pulumi.set(self, "is_paused", value) @property @pulumi.getter def json(self) -> Optional[pulumi.Input[str]]: return pulumi.get(self, "json") @json.setter def json(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "json", value) @property @pulumi.getter(name="pipelineConfig") def pipeline_config(self) -> Optional[pulumi.Input[str]]: return pulumi.get(self, "pipeline_config") @pipeline_config.setter def pipeline_config(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "pipeline_config", value) @property @pulumi.getter(name="pipelineConfigFormat") def pipeline_config_format(self) -> Optional[pulumi.Input[str]]: return pulumi.get(self, "pipeline_config_format") @pipeline_config_format.setter def pipeline_config_format(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "pipeline_config_format", value) @property @pulumi.getter(name="pipelineName") def pipeline_name(self) -> Optional[pulumi.Input[str]]: return pulumi.get(self, "pipeline_name") @pipeline_name.setter def pipeline_name(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "pipeline_name", value) @property @pulumi.getter(name="teamName") def team_name(self) -> Optional[pulumi.Input[str]]: return pulumi.get(self, "team_name") @team_name.setter def team_name(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "team_name", value) @property @pulumi.getter def yaml(self) -> Optional[pulumi.Input[str]]: return pulumi.get(self, "yaml") @yaml.setter def yaml(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "yaml", value) class Pipeline(pulumi.CustomResource): @overload def __init__(__self__, resource_name: str, opts: Optional[pulumi.ResourceOptions] = None, is_exposed: Optional[pulumi.Input[bool]] = None, is_paused: Optional[pulumi.Input[bool]] = None, pipeline_config: Optional[pulumi.Input[str]] = None, pipeline_config_format: Optional[pulumi.Input[str]] = None, pipeline_name: Optional[pulumi.Input[str]] = None, team_name: Optional[pulumi.Input[str]] = None, __props__=None): """ Create a Pipeline resource with the given unique name, props, and options. :param str resource_name: The name of the resource. :param pulumi.ResourceOptions opts: Options for the resource. """ ... @overload def __init__(__self__, resource_name: str, args: PipelineArgs, opts: Optional[pulumi.ResourceOptions] = None): """ Create a Pipeline resource with the given unique name, props, and options. :param str resource_name: The name of the resource. :param PipelineArgs args: The arguments to use to populate this resource's properties. :param pulumi.ResourceOptions opts: Options for the resource. """ ... def __init__(__self__, resource_name: str, *args, **kwargs): resource_args, opts = _utilities.get_resource_args_opts(PipelineArgs, pulumi.ResourceOptions, *args, **kwargs) if resource_args is not None: __self__._internal_init(resource_name, opts, **resource_args.__dict__) else: __self__._internal_init(resource_name, *args, **kwargs) def _internal_init(__self__, resource_name: str, opts: Optional[pulumi.ResourceOptions] = None, is_exposed: Optional[pulumi.Input[bool]] = None, is_paused: Optional[pulumi.Input[bool]] = None, pipeline_config: Optional[pulumi.Input[str]] = None, pipeline_config_format: Optional[pulumi.Input[str]] = None, pipeline_name: Optional[pulumi.Input[str]] = None, team_name: Optional[pulumi.Input[str]] = None, __props__=None): if opts is None: opts = pulumi.ResourceOptions() if not isinstance(opts, pulumi.ResourceOptions): raise TypeError('Expected resource options to be a ResourceOptions instance') if opts.version is None: opts.version = _utilities.get_version() if opts.plugin_download_url is None: opts.plugin_download_url = _utilities.get_plugin_download_url() if opts.id is None: if __props__ is not None: raise TypeError('__props__ is only valid when passed in combination with a valid opts.id to get an existing resource') __props__ = PipelineArgs.__new__(PipelineArgs) if is_exposed is None and not opts.urn: raise TypeError("Missing required property 'is_exposed'") __props__.__dict__["is_exposed"] = is_exposed if is_paused is None and not opts.urn: raise TypeError("Missing required property 'is_paused'") __props__.__dict__["is_paused"] = is_paused if pipeline_config is None and not opts.urn: raise TypeError("Missing required property 'pipeline_config'") __props__.__dict__["pipeline_config"] = pipeline_config if pipeline_config_format is None and not opts.urn: raise TypeError("Missing required property 'pipeline_config_format'") __props__.__dict__["pipeline_config_format"] = pipeline_config_format if pipeline_name is None and not opts.urn: raise TypeError("Missing required property 'pipeline_name'") __props__.__dict__["pipeline_name"] = pipeline_name if team_name is None and not opts.urn: raise TypeError("Missing required property 'team_name'") __props__.__dict__["team_name"] = team_name __props__.__dict__["json"] = None __props__.__dict__["yaml"] = None super(Pipeline, __self__).__init__( 'concourse:index/pipeline:Pipeline', resource_name, __props__, opts) @staticmethod def get(resource_name: str, id: pulumi.Input[str], opts: Optional[pulumi.ResourceOptions] = None, is_exposed: Optional[pulumi.Input[bool]] = None, is_paused: Optional[pulumi.Input[bool]] = None, json: Optional[pulumi.Input[str]] = None, pipeline_config: Optional[pulumi.Input[str]] = None, pipeline_config_format: Optional[pulumi.Input[str]] = None, pipeline_name: Optional[pulumi.Input[str]] = None, team_name: Optional[pulumi.Input[str]] = None, yaml: Optional[pulumi.Input[str]] = None) -> 'Pipeline': """ Get an existing Pipeline resource's state with the given name, id, and optional extra properties used to qualify the lookup. :param str resource_name: The unique name of the resulting resource. :param pulumi.Input[str] id: The unique provider ID of the resource to lookup. :param pulumi.ResourceOptions opts: Options for the resource. """ opts = pulumi.ResourceOptions.merge(opts, pulumi.ResourceOptions(id=id)) __props__ = _PipelineState.__new__(_PipelineState) __props__.__dict__["is_exposed"] = is_exposed __props__.__dict__["is_paused"] = is_paused __props__.__dict__["json"] = json __props__.__dict__["pipeline_config"] = pipeline_config __props__.__dict__["pipeline_config_format"] = pipeline_config_format __props__.__dict__["pipeline_name"] = pipeline_name __props__.__dict__["team_name"] = team_name __props__.__dict__["yaml"] = yaml return Pipeline(resource_name, opts=opts, __props__=__props__) @property @pulumi.getter(name="isExposed") def is_exposed(self) -> pulumi.Output[bool]: return pulumi.get(self, "is_exposed") @property @pulumi.getter(name="isPaused") def is_paused(self) -> pulumi.Output[bool]: return pulumi.get(self, "is_paused") @property @pulumi.getter def json(self) -> pulumi.Output[str]: return pulumi.get(self, "json") @property @pulumi.getter(name="pipelineConfig") def pipeline_config(self) -> pulumi.Output[str]: return pulumi.get(self, "pipeline_config") @property @pulumi.getter(name="pipelineConfigFormat") def pipeline_config_format(self) -> pulumi.Output[str]: return pulumi.get(self, "pipeline_config_format") @property @pulumi.getter(name="pipelineName") def pipeline_name(self) -> pulumi.Output[str]: return pulumi.get(self, "pipeline_name") @property @pulumi.getter(name="teamName") def team_name(self) -> pulumi.Output[str]: return pulumi.get(self, "team_name") @property @pulumi.getter def yaml(self) -> pulumi.Output[str]: return pulumi.get(self, "yaml")
sdk/python/pulumiverse_concourse/pipeline.py
import warnings import pulumi import pulumi.runtime from typing import Any, Mapping, Optional, Sequence, Union, overload from . import _utilities __all__ = ['PipelineArgs', 'Pipeline'] @pulumi.input_type class PipelineArgs: def __init__(__self__, *, is_exposed: pulumi.Input[bool], is_paused: pulumi.Input[bool], pipeline_config: pulumi.Input[str], pipeline_config_format: pulumi.Input[str], pipeline_name: pulumi.Input[str], team_name: pulumi.Input[str]): """ The set of arguments for constructing a Pipeline resource. """ pulumi.set(__self__, "is_exposed", is_exposed) pulumi.set(__self__, "is_paused", is_paused) pulumi.set(__self__, "pipeline_config", pipeline_config) pulumi.set(__self__, "pipeline_config_format", pipeline_config_format) pulumi.set(__self__, "pipeline_name", pipeline_name) pulumi.set(__self__, "team_name", team_name) @property @pulumi.getter(name="isExposed") def is_exposed(self) -> pulumi.Input[bool]: return pulumi.get(self, "is_exposed") @is_exposed.setter def is_exposed(self, value: pulumi.Input[bool]): pulumi.set(self, "is_exposed", value) @property @pulumi.getter(name="isPaused") def is_paused(self) -> pulumi.Input[bool]: return pulumi.get(self, "is_paused") @is_paused.setter def is_paused(self, value: pulumi.Input[bool]): pulumi.set(self, "is_paused", value) @property @pulumi.getter(name="pipelineConfig") def pipeline_config(self) -> pulumi.Input[str]: return pulumi.get(self, "pipeline_config") @pipeline_config.setter def pipeline_config(self, value: pulumi.Input[str]): pulumi.set(self, "pipeline_config", value) @property @pulumi.getter(name="pipelineConfigFormat") def pipeline_config_format(self) -> pulumi.Input[str]: return pulumi.get(self, "pipeline_config_format") @pipeline_config_format.setter def pipeline_config_format(self, value: pulumi.Input[str]): pulumi.set(self, "pipeline_config_format", value) @property @pulumi.getter(name="pipelineName") def pipeline_name(self) -> pulumi.Input[str]: return pulumi.get(self, "pipeline_name") @pipeline_name.setter def pipeline_name(self, value: pulumi.Input[str]): pulumi.set(self, "pipeline_name", value) @property @pulumi.getter(name="teamName") def team_name(self) -> pulumi.Input[str]: return pulumi.get(self, "team_name") @team_name.setter def team_name(self, value: pulumi.Input[str]): pulumi.set(self, "team_name", value) @pulumi.input_type class _PipelineState: def __init__(__self__, *, is_exposed: Optional[pulumi.Input[bool]] = None, is_paused: Optional[pulumi.Input[bool]] = None, json: Optional[pulumi.Input[str]] = None, pipeline_config: Optional[pulumi.Input[str]] = None, pipeline_config_format: Optional[pulumi.Input[str]] = None, pipeline_name: Optional[pulumi.Input[str]] = None, team_name: Optional[pulumi.Input[str]] = None, yaml: Optional[pulumi.Input[str]] = None): """ Input properties used for looking up and filtering Pipeline resources. """ if is_exposed is not None: pulumi.set(__self__, "is_exposed", is_exposed) if is_paused is not None: pulumi.set(__self__, "is_paused", is_paused) if json is not None: pulumi.set(__self__, "json", json) if pipeline_config is not None: pulumi.set(__self__, "pipeline_config", pipeline_config) if pipeline_config_format is not None: pulumi.set(__self__, "pipeline_config_format", pipeline_config_format) if pipeline_name is not None: pulumi.set(__self__, "pipeline_name", pipeline_name) if team_name is not None: pulumi.set(__self__, "team_name", team_name) if yaml is not None: pulumi.set(__self__, "yaml", yaml) @property @pulumi.getter(name="isExposed") def is_exposed(self) -> Optional[pulumi.Input[bool]]: return pulumi.get(self, "is_exposed") @is_exposed.setter def is_exposed(self, value: Optional[pulumi.Input[bool]]): pulumi.set(self, "is_exposed", value) @property @pulumi.getter(name="isPaused") def is_paused(self) -> Optional[pulumi.Input[bool]]: return pulumi.get(self, "is_paused") @is_paused.setter def is_paused(self, value: Optional[pulumi.Input[bool]]): pulumi.set(self, "is_paused", value) @property @pulumi.getter def json(self) -> Optional[pulumi.Input[str]]: return pulumi.get(self, "json") @json.setter def json(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "json", value) @property @pulumi.getter(name="pipelineConfig") def pipeline_config(self) -> Optional[pulumi.Input[str]]: return pulumi.get(self, "pipeline_config") @pipeline_config.setter def pipeline_config(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "pipeline_config", value) @property @pulumi.getter(name="pipelineConfigFormat") def pipeline_config_format(self) -> Optional[pulumi.Input[str]]: return pulumi.get(self, "pipeline_config_format") @pipeline_config_format.setter def pipeline_config_format(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "pipeline_config_format", value) @property @pulumi.getter(name="pipelineName") def pipeline_name(self) -> Optional[pulumi.Input[str]]: return pulumi.get(self, "pipeline_name") @pipeline_name.setter def pipeline_name(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "pipeline_name", value) @property @pulumi.getter(name="teamName") def team_name(self) -> Optional[pulumi.Input[str]]: return pulumi.get(self, "team_name") @team_name.setter def team_name(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "team_name", value) @property @pulumi.getter def yaml(self) -> Optional[pulumi.Input[str]]: return pulumi.get(self, "yaml") @yaml.setter def yaml(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "yaml", value) class Pipeline(pulumi.CustomResource): @overload def __init__(__self__, resource_name: str, opts: Optional[pulumi.ResourceOptions] = None, is_exposed: Optional[pulumi.Input[bool]] = None, is_paused: Optional[pulumi.Input[bool]] = None, pipeline_config: Optional[pulumi.Input[str]] = None, pipeline_config_format: Optional[pulumi.Input[str]] = None, pipeline_name: Optional[pulumi.Input[str]] = None, team_name: Optional[pulumi.Input[str]] = None, __props__=None): """ Create a Pipeline resource with the given unique name, props, and options. :param str resource_name: The name of the resource. :param pulumi.ResourceOptions opts: Options for the resource. """ ... @overload def __init__(__self__, resource_name: str, args: PipelineArgs, opts: Optional[pulumi.ResourceOptions] = None): """ Create a Pipeline resource with the given unique name, props, and options. :param str resource_name: The name of the resource. :param PipelineArgs args: The arguments to use to populate this resource's properties. :param pulumi.ResourceOptions opts: Options for the resource. """ ... def __init__(__self__, resource_name: str, *args, **kwargs): resource_args, opts = _utilities.get_resource_args_opts(PipelineArgs, pulumi.ResourceOptions, *args, **kwargs) if resource_args is not None: __self__._internal_init(resource_name, opts, **resource_args.__dict__) else: __self__._internal_init(resource_name, *args, **kwargs) def _internal_init(__self__, resource_name: str, opts: Optional[pulumi.ResourceOptions] = None, is_exposed: Optional[pulumi.Input[bool]] = None, is_paused: Optional[pulumi.Input[bool]] = None, pipeline_config: Optional[pulumi.Input[str]] = None, pipeline_config_format: Optional[pulumi.Input[str]] = None, pipeline_name: Optional[pulumi.Input[str]] = None, team_name: Optional[pulumi.Input[str]] = None, __props__=None): if opts is None: opts = pulumi.ResourceOptions() if not isinstance(opts, pulumi.ResourceOptions): raise TypeError('Expected resource options to be a ResourceOptions instance') if opts.version is None: opts.version = _utilities.get_version() if opts.plugin_download_url is None: opts.plugin_download_url = _utilities.get_plugin_download_url() if opts.id is None: if __props__ is not None: raise TypeError('__props__ is only valid when passed in combination with a valid opts.id to get an existing resource') __props__ = PipelineArgs.__new__(PipelineArgs) if is_exposed is None and not opts.urn: raise TypeError("Missing required property 'is_exposed'") __props__.__dict__["is_exposed"] = is_exposed if is_paused is None and not opts.urn: raise TypeError("Missing required property 'is_paused'") __props__.__dict__["is_paused"] = is_paused if pipeline_config is None and not opts.urn: raise TypeError("Missing required property 'pipeline_config'") __props__.__dict__["pipeline_config"] = pipeline_config if pipeline_config_format is None and not opts.urn: raise TypeError("Missing required property 'pipeline_config_format'") __props__.__dict__["pipeline_config_format"] = pipeline_config_format if pipeline_name is None and not opts.urn: raise TypeError("Missing required property 'pipeline_name'") __props__.__dict__["pipeline_name"] = pipeline_name if team_name is None and not opts.urn: raise TypeError("Missing required property 'team_name'") __props__.__dict__["team_name"] = team_name __props__.__dict__["json"] = None __props__.__dict__["yaml"] = None super(Pipeline, __self__).__init__( 'concourse:index/pipeline:Pipeline', resource_name, __props__, opts) @staticmethod def get(resource_name: str, id: pulumi.Input[str], opts: Optional[pulumi.ResourceOptions] = None, is_exposed: Optional[pulumi.Input[bool]] = None, is_paused: Optional[pulumi.Input[bool]] = None, json: Optional[pulumi.Input[str]] = None, pipeline_config: Optional[pulumi.Input[str]] = None, pipeline_config_format: Optional[pulumi.Input[str]] = None, pipeline_name: Optional[pulumi.Input[str]] = None, team_name: Optional[pulumi.Input[str]] = None, yaml: Optional[pulumi.Input[str]] = None) -> 'Pipeline': """ Get an existing Pipeline resource's state with the given name, id, and optional extra properties used to qualify the lookup. :param str resource_name: The unique name of the resulting resource. :param pulumi.Input[str] id: The unique provider ID of the resource to lookup. :param pulumi.ResourceOptions opts: Options for the resource. """ opts = pulumi.ResourceOptions.merge(opts, pulumi.ResourceOptions(id=id)) __props__ = _PipelineState.__new__(_PipelineState) __props__.__dict__["is_exposed"] = is_exposed __props__.__dict__["is_paused"] = is_paused __props__.__dict__["json"] = json __props__.__dict__["pipeline_config"] = pipeline_config __props__.__dict__["pipeline_config_format"] = pipeline_config_format __props__.__dict__["pipeline_name"] = pipeline_name __props__.__dict__["team_name"] = team_name __props__.__dict__["yaml"] = yaml return Pipeline(resource_name, opts=opts, __props__=__props__) @property @pulumi.getter(name="isExposed") def is_exposed(self) -> pulumi.Output[bool]: return pulumi.get(self, "is_exposed") @property @pulumi.getter(name="isPaused") def is_paused(self) -> pulumi.Output[bool]: return pulumi.get(self, "is_paused") @property @pulumi.getter def json(self) -> pulumi.Output[str]: return pulumi.get(self, "json") @property @pulumi.getter(name="pipelineConfig") def pipeline_config(self) -> pulumi.Output[str]: return pulumi.get(self, "pipeline_config") @property @pulumi.getter(name="pipelineConfigFormat") def pipeline_config_format(self) -> pulumi.Output[str]: return pulumi.get(self, "pipeline_config_format") @property @pulumi.getter(name="pipelineName") def pipeline_name(self) -> pulumi.Output[str]: return pulumi.get(self, "pipeline_name") @property @pulumi.getter(name="teamName") def team_name(self) -> pulumi.Output[str]: return pulumi.get(self, "team_name") @property @pulumi.getter def yaml(self) -> pulumi.Output[str]: return pulumi.get(self, "yaml")
0.832883
0.058158
import argparse import asyncio from datetime import datetime import logging from bncs import BnetClient, ChatEventType, ClientStatus, LocalHashingProvider, BncsProduct class SampleBnetClient(BnetClient): async def _handle_chat_event(self, packet): event = await super()._handle_chat_event(packet) if event.eid == ChatEventType.UserTalk: print(f"<{event.username}> {event.text}") elif event.eid == ChatEventType.UserEmote: print(f"<{event.username} {event.text}>") elif event.eid == ChatEventType.WhisperSent: print(f"<To {event.username}> {event.text}") elif event.eid == ChatEventType.UserWhisper: print(f"<From {event.username}> {event.text}") async def main(args): config = { "username": args.username, "password": <PASSWORD>, "product": args.product, "server": args.server, "keys": args.keys.split(',') if args.keys else [] } client = SampleBnetClient(**config) if args.hashes: platform = client.config["platform"] product = BncsProduct.get(args.product) our_key = (platform, product.code) files = { our_key: product.hashes[platform] } # By only loading the hash files for our platform+product, we don't waste time loading stuff we don't need. client.hashing_provider = LocalHashingProvider(args.hashes, files) await client.hashing_provider.preload([our_key], True) await client.hashing_provider.connect() def get_user_input(): return input() try: await client.full_connect_and_join() if hasattr(client.hashing_provider, 'connected'): client.hashing_provider.disconnect("done") if client.status == ClientStatus.Chatting: while client.connected: raw_input = await asyncio.get_event_loop().run_in_executor(None, get_user_input) is_local_cmd = True if raw_input[0] == '/': args = raw_input[1:].split(' ') cmd = args.pop(0).lower() if cmd == "exit": client.disconnect("Quit") break elif cmd == "channels": product = client.state["product"].code if len(args) == 0 else args[0] channels = await client.request_channel_list(product) print(f"Channels available for '{product}':") for i in range(0, len(channels), 3): print(f"\t{', '.join(c for c in channels[i:i+3])}") elif cmd == "filetime": if len(args) == 0: print("Command usage: /filetime <filename>") else: ft = await client.get_filetime(args[0]) print(f"Filetime for '{args[0]}': {ft}") elif cmd == "profile": user = None if len(args) == 0 else args[0] data = await client.request_profile(user) if data: user = user or client.state["account_name"] print(f"Profile for '{user}': {data}") else: print("Profile request returned no data") elif cmd == "accountinfo": data = await client.request_account_keys() if data: print(f"Account info: {data}") else: print("No account info returned") elif cmd == "ad": platform, product = args[0].split('\\') if len(args) == 1 else (None, None) banner = await client.check_ad(platform=platform, product=product) print(f"Current ad banner: {banner}") elif cmd == "news": news, motd = await client.get_news_info() latest = news[-1] if len(news) > 0 else None print(f"Server MotD: {motd}") print(f"Latest news: {datetime.utcfromtimestamp(latest[0]).isoformat()} -> " + str(latest[1].split('\n'))) else: is_local_cmd = False if not is_local_cmd: await client.send_command(raw_input) finally: if client and client.connected: client.disconnect("dead") await client.wait_closed() if client.hashing_provider and hasattr(client.hashing_provider, 'connected') \ and client.hashing_provider.connected: client.hashing_provider.disconnect("dead") await client.hashing_provider.wait_closed() if __name__ == "__main__": logging.basicConfig(level=logging.DEBUG) parser = argparse.ArgumentParser() parser.add_argument("username", help="Name of the account to login as") parser.add_argument("password", help="Password for the account") parser.add_argument("--server", help="Hostname or IP of the Battle.net server", default='useast.battle.net') parser.add_argument("--product", help="4-digit code of the game to emulate (ex: WAR3, SEXP)", default='DRTL') parser.add_argument("--keys", help="Comma separated list of CD keys for the emulated product") parser.add_argument("--hashes", help="Path to directory containing game hash files") aa = parser.parse_args() try: asyncio.run(main(aa)) except KeyboardInterrupt: pass
scripts/bncs_client.py
import argparse import asyncio from datetime import datetime import logging from bncs import BnetClient, ChatEventType, ClientStatus, LocalHashingProvider, BncsProduct class SampleBnetClient(BnetClient): async def _handle_chat_event(self, packet): event = await super()._handle_chat_event(packet) if event.eid == ChatEventType.UserTalk: print(f"<{event.username}> {event.text}") elif event.eid == ChatEventType.UserEmote: print(f"<{event.username} {event.text}>") elif event.eid == ChatEventType.WhisperSent: print(f"<To {event.username}> {event.text}") elif event.eid == ChatEventType.UserWhisper: print(f"<From {event.username}> {event.text}") async def main(args): config = { "username": args.username, "password": <PASSWORD>, "product": args.product, "server": args.server, "keys": args.keys.split(',') if args.keys else [] } client = SampleBnetClient(**config) if args.hashes: platform = client.config["platform"] product = BncsProduct.get(args.product) our_key = (platform, product.code) files = { our_key: product.hashes[platform] } # By only loading the hash files for our platform+product, we don't waste time loading stuff we don't need. client.hashing_provider = LocalHashingProvider(args.hashes, files) await client.hashing_provider.preload([our_key], True) await client.hashing_provider.connect() def get_user_input(): return input() try: await client.full_connect_and_join() if hasattr(client.hashing_provider, 'connected'): client.hashing_provider.disconnect("done") if client.status == ClientStatus.Chatting: while client.connected: raw_input = await asyncio.get_event_loop().run_in_executor(None, get_user_input) is_local_cmd = True if raw_input[0] == '/': args = raw_input[1:].split(' ') cmd = args.pop(0).lower() if cmd == "exit": client.disconnect("Quit") break elif cmd == "channels": product = client.state["product"].code if len(args) == 0 else args[0] channels = await client.request_channel_list(product) print(f"Channels available for '{product}':") for i in range(0, len(channels), 3): print(f"\t{', '.join(c for c in channels[i:i+3])}") elif cmd == "filetime": if len(args) == 0: print("Command usage: /filetime <filename>") else: ft = await client.get_filetime(args[0]) print(f"Filetime for '{args[0]}': {ft}") elif cmd == "profile": user = None if len(args) == 0 else args[0] data = await client.request_profile(user) if data: user = user or client.state["account_name"] print(f"Profile for '{user}': {data}") else: print("Profile request returned no data") elif cmd == "accountinfo": data = await client.request_account_keys() if data: print(f"Account info: {data}") else: print("No account info returned") elif cmd == "ad": platform, product = args[0].split('\\') if len(args) == 1 else (None, None) banner = await client.check_ad(platform=platform, product=product) print(f"Current ad banner: {banner}") elif cmd == "news": news, motd = await client.get_news_info() latest = news[-1] if len(news) > 0 else None print(f"Server MotD: {motd}") print(f"Latest news: {datetime.utcfromtimestamp(latest[0]).isoformat()} -> " + str(latest[1].split('\n'))) else: is_local_cmd = False if not is_local_cmd: await client.send_command(raw_input) finally: if client and client.connected: client.disconnect("dead") await client.wait_closed() if client.hashing_provider and hasattr(client.hashing_provider, 'connected') \ and client.hashing_provider.connected: client.hashing_provider.disconnect("dead") await client.hashing_provider.wait_closed() if __name__ == "__main__": logging.basicConfig(level=logging.DEBUG) parser = argparse.ArgumentParser() parser.add_argument("username", help="Name of the account to login as") parser.add_argument("password", help="Password for the account") parser.add_argument("--server", help="Hostname or IP of the Battle.net server", default='useast.battle.net') parser.add_argument("--product", help="4-digit code of the game to emulate (ex: WAR3, SEXP)", default='DRTL') parser.add_argument("--keys", help="Comma separated list of CD keys for the emulated product") parser.add_argument("--hashes", help="Path to directory containing game hash files") aa = parser.parse_args() try: asyncio.run(main(aa)) except KeyboardInterrupt: pass
0.273671
0.158597
import sys, threading, time, random, socket def server(): # Establish port via command-line argument port = int(sys.argv[1]) # Create file object to read RS DNS table RSFile = open("PROJI-DNSRS.txt", "r") # Initialize dictionary for DNS table DNSTable = {} # Store RS DNS table in dictionary for line in RSFile: hostname, IPAddress, flag = line.split() hostname = hostname.lower() DNSTable[hostname] = hostname + " " + IPAddress + " " + flag if flag == "NS": TSHostname = hostname + " - " + flag print("Creating DNS dictionary: " + str(DNSTable) + "\n") try: serverSocket = socket.socket(socket.AF_INET, socket.SOCK_STREAM) print("RS server socket created: port " + str(port) + "\n") except socket.error as socketError: print('RS socket already open, error: {}\n'.format(socketError)) exit() serverBinding = ('', port) serverSocket.bind(serverBinding) serverSocket.listen(1) RSHostname = socket.gethostname() print("RS server hostname: {}".format(RSHostname)) localhostIP = (socket.gethostbyname(RSHostname)) print("RS server IP address: {}".format(localhostIP)) while True: clientSocketID, address = serverSocket.accept() print("Received client connection request from: {}".format(address)) # Server greeting message to client greeting = "Welcome to CS 352 RS server! Socket to me!" clientSocketID.send(greeting.encode('utf-8')) # Receive hostname query from the client queryFromClient = clientSocketID.recv(256) # The client is done querying if queryFromClient == "shutdownRSServer": print("Received shutdown command...") clientSocketID.close() break # If hostname is in dictionary, send hostname information elif queryFromClient in DNSTable: clientSocketID.send(str(DNSTable[queryFromClient]).encode('utf-8')) # Hostname not in dictionary, send TS server information else: clientSocketID.send(TSHostname.encode('utf-8')) # Close the client socket connection print("\nClosing socket connection.\n") clientSocketID.close() # Close server socket and shutdown server serverSocket.close() exit() if __name__ == "__main__": thread = threading.Thread(name='server', target = server) thread.start() sleepTime = random.random() * 5 print("\nRS server thread executed, sleep time: " + str(sleepTime) + " sec\n") time.sleep(sleepTime)
anthonyProject1/rs.py
import sys, threading, time, random, socket def server(): # Establish port via command-line argument port = int(sys.argv[1]) # Create file object to read RS DNS table RSFile = open("PROJI-DNSRS.txt", "r") # Initialize dictionary for DNS table DNSTable = {} # Store RS DNS table in dictionary for line in RSFile: hostname, IPAddress, flag = line.split() hostname = hostname.lower() DNSTable[hostname] = hostname + " " + IPAddress + " " + flag if flag == "NS": TSHostname = hostname + " - " + flag print("Creating DNS dictionary: " + str(DNSTable) + "\n") try: serverSocket = socket.socket(socket.AF_INET, socket.SOCK_STREAM) print("RS server socket created: port " + str(port) + "\n") except socket.error as socketError: print('RS socket already open, error: {}\n'.format(socketError)) exit() serverBinding = ('', port) serverSocket.bind(serverBinding) serverSocket.listen(1) RSHostname = socket.gethostname() print("RS server hostname: {}".format(RSHostname)) localhostIP = (socket.gethostbyname(RSHostname)) print("RS server IP address: {}".format(localhostIP)) while True: clientSocketID, address = serverSocket.accept() print("Received client connection request from: {}".format(address)) # Server greeting message to client greeting = "Welcome to CS 352 RS server! Socket to me!" clientSocketID.send(greeting.encode('utf-8')) # Receive hostname query from the client queryFromClient = clientSocketID.recv(256) # The client is done querying if queryFromClient == "shutdownRSServer": print("Received shutdown command...") clientSocketID.close() break # If hostname is in dictionary, send hostname information elif queryFromClient in DNSTable: clientSocketID.send(str(DNSTable[queryFromClient]).encode('utf-8')) # Hostname not in dictionary, send TS server information else: clientSocketID.send(TSHostname.encode('utf-8')) # Close the client socket connection print("\nClosing socket connection.\n") clientSocketID.close() # Close server socket and shutdown server serverSocket.close() exit() if __name__ == "__main__": thread = threading.Thread(name='server', target = server) thread.start() sleepTime = random.random() * 5 print("\nRS server thread executed, sleep time: " + str(sleepTime) + " sec\n") time.sleep(sleepTime)
0.228156
0.063657
import os import pytest from click.testing import CliRunner from cogctl.cli.main import cli from functools import partial @pytest.fixture def cogctl(): """Set up a test runner from the true root of the application, instead of testing individual commands directly. """ runner = CliRunner() with runner.isolated_filesystem(): yield partial(runner.invoke, cli, catch_exceptions=False) @pytest.fixture def config_file(cogctl): with open("config", "w") as f: f.write("""\ [defaults] profile = default_profile [default_profile] host = default_host password = <PASSWORD> port = 4000 secure = false user = default_user [testing] host = cog.testing.com password = <PASSWORD> port = 1234 secure = true user = tester [new-style] url = https://cog.newstyle.com:1234 user = new_user password = <PASSWORD> """) return "{}/{}".format(os.getcwd(), "config") def test_list_profiles(cogctl, config_file): result = cogctl(["--config-file", config_file, "profile"]) assert result.exit_code == 0 assert result.output == """\ Profile: default_profile (default) User: default_user URL: http://default_host:4000 Profile: new-style User: new_user URL: https://cog.newstyle.com:1234 Profile: testing User: tester URL: https://cog.testing.com:1234 """ def test_add_new_profile(cogctl, config_file): result = cogctl(["--config-file", config_file, "profile", "create", "my_new_profile", "https://myserver.com:1234", "my_user", "my_password"]) assert result.exit_code == 0 assert result.output == "" with open(config_file) as f: contents = f.read() assert contents == """\ [defaults] profile = default_profile [default_profile] host = default_host password = <PASSWORD> port = 4000 secure = false user = default_user [testing] host = cog.testing.com password = <PASSWORD> port = 1234 secure = true user = tester [new-style] url = https://cog.newstyle.com:1234 user = new_user password = <PASSWORD> [my_new_profile] password = <PASSWORD> url = https://myserver.com:1234 user = my_user """ def test_change_default_profile(cogctl, config_file): result = cogctl(["--config-file", config_file, "profile", "default", "testing"]) assert result.exit_code == 0 assert result.output == "" with open(config_file) as f: contents = f.read() assert contents == """\ [defaults] profile = testing [default_profile] host = default_host password = <PASSWORD> port = 4000 secure = false user = default_user [testing] host = cog.testing.com password = <PASSWORD> port = 1234 secure = true user = tester [new-style] url = https://cog.newstyle.com:1234 user = new_user password = <PASSWORD> """ def test_change_default_invalid_profile(cogctl, config_file): result = cogctl(["--config-file", config_file, "profile", "default", "missing"]) assert result.exit_code == 2 assert result.output == """\ Usage: cli profile default [OPTIONS] NAME Error: Invalid value for \"name\": \"missing\" was not found """ with open(config_file) as f: contents = f.read() assert contents == """\ [defaults] profile = default_profile [default_profile] host = default_host password = <PASSWORD> port = 4000 secure = false user = default_user [testing] host = cog.testing.com password = <PASSWORD> port = 1234 secure = true user = tester [new-style] url = https://cog.newstyle.com:1234 user = new_user password = <PASSWORD> """
tests/cogctl/cli/test_profile.py
import os import pytest from click.testing import CliRunner from cogctl.cli.main import cli from functools import partial @pytest.fixture def cogctl(): """Set up a test runner from the true root of the application, instead of testing individual commands directly. """ runner = CliRunner() with runner.isolated_filesystem(): yield partial(runner.invoke, cli, catch_exceptions=False) @pytest.fixture def config_file(cogctl): with open("config", "w") as f: f.write("""\ [defaults] profile = default_profile [default_profile] host = default_host password = <PASSWORD> port = 4000 secure = false user = default_user [testing] host = cog.testing.com password = <PASSWORD> port = 1234 secure = true user = tester [new-style] url = https://cog.newstyle.com:1234 user = new_user password = <PASSWORD> """) return "{}/{}".format(os.getcwd(), "config") def test_list_profiles(cogctl, config_file): result = cogctl(["--config-file", config_file, "profile"]) assert result.exit_code == 0 assert result.output == """\ Profile: default_profile (default) User: default_user URL: http://default_host:4000 Profile: new-style User: new_user URL: https://cog.newstyle.com:1234 Profile: testing User: tester URL: https://cog.testing.com:1234 """ def test_add_new_profile(cogctl, config_file): result = cogctl(["--config-file", config_file, "profile", "create", "my_new_profile", "https://myserver.com:1234", "my_user", "my_password"]) assert result.exit_code == 0 assert result.output == "" with open(config_file) as f: contents = f.read() assert contents == """\ [defaults] profile = default_profile [default_profile] host = default_host password = <PASSWORD> port = 4000 secure = false user = default_user [testing] host = cog.testing.com password = <PASSWORD> port = 1234 secure = true user = tester [new-style] url = https://cog.newstyle.com:1234 user = new_user password = <PASSWORD> [my_new_profile] password = <PASSWORD> url = https://myserver.com:1234 user = my_user """ def test_change_default_profile(cogctl, config_file): result = cogctl(["--config-file", config_file, "profile", "default", "testing"]) assert result.exit_code == 0 assert result.output == "" with open(config_file) as f: contents = f.read() assert contents == """\ [defaults] profile = testing [default_profile] host = default_host password = <PASSWORD> port = 4000 secure = false user = default_user [testing] host = cog.testing.com password = <PASSWORD> port = 1234 secure = true user = tester [new-style] url = https://cog.newstyle.com:1234 user = new_user password = <PASSWORD> """ def test_change_default_invalid_profile(cogctl, config_file): result = cogctl(["--config-file", config_file, "profile", "default", "missing"]) assert result.exit_code == 2 assert result.output == """\ Usage: cli profile default [OPTIONS] NAME Error: Invalid value for \"name\": \"missing\" was not found """ with open(config_file) as f: contents = f.read() assert contents == """\ [defaults] profile = default_profile [default_profile] host = default_host password = <PASSWORD> port = 4000 secure = false user = default_user [testing] host = cog.testing.com password = <PASSWORD> port = 1234 secure = true user = tester [new-style] url = https://cog.newstyle.com:1234 user = new_user password = <PASSWORD> """
0.441191
0.297052
from __future__ import annotations from bfassist.sql import * from bfassist.master.league import LeaguePlayers, LeaguePlayer, LineUp # noinspection PyUnusedLocal def __preload__(forClient: bool = True): pass # noinspection PyUnusedLocal def __postload__(forClient: bool = True): pass def pyPlayerToSQL(inPlayer: LeaguePlayer): if inPlayer is not None: return inPlayer.getKeyhash() else: return "" def pyLineUpToSQL(inLineUp: LineUp): return ";".join([keyhash.replace(';', '\\&r01') if keyhash else '' for keyhash in inLineUp.lineUp]) def sqlPlayerToPy(sql: str): if sql in LeaguePlayers: return LeaguePlayers[sql] else: return str(sql) def sqlLineUpToPy(sql: str): lineUp = LineUp() for keyhash in set([x.replace('\\&r01', ';') for x in sql.split(';')]): if keyhash in LeaguePlayers: lineUp[keyhash] = LeaguePlayers[keyhash] return lineUp class LeagueTeam(DBStorable, table="teams", live=False): """ Class that represents a team participating in a league season. :param TeamName: The name of this team. :param TeamLeader: The team leader of this team. :param TeamPlayers: The league livePlayers of this team as line-up. :param ActiveSeasons: Names of the seasons this team was active. note:: Author(s): Mitch """ def __init__(self, TeamName: str, ActiveSeasons: set, TeamLeader: LeaguePlayer = None, TeamPlayers: LineUp = None): if not self.initialised: self.addConversions( (pyPlayerToSQL, sqlPlayerToPy), (pyLineUpToSQL, sqlLineUpToPy) ) self.STeamName = TeamName, VARCHAR(32), PRIMARY_KEY self.SActiveSeasons = ActiveSeasons, TINYTEXT self.STeamLeader = TeamLeader, VARCHAR(32) if TeamPlayers: self.STeamPlayers = TeamPlayers, TEXT else: self.STeamPlayers = LineUp(), TEXT self.insertToDB() def __str__(self): return self.getTeamName() + "\n\nTeam Leader:\t" + str(self.getTeamLeader()) + "\n\nLine Up:\n\n" +\ str(self.getTeamPlayers()) LeagueTeams = LeagueTeam.storageDict
bfassist/master/league/teams.py
from __future__ import annotations from bfassist.sql import * from bfassist.master.league import LeaguePlayers, LeaguePlayer, LineUp # noinspection PyUnusedLocal def __preload__(forClient: bool = True): pass # noinspection PyUnusedLocal def __postload__(forClient: bool = True): pass def pyPlayerToSQL(inPlayer: LeaguePlayer): if inPlayer is not None: return inPlayer.getKeyhash() else: return "" def pyLineUpToSQL(inLineUp: LineUp): return ";".join([keyhash.replace(';', '\\&r01') if keyhash else '' for keyhash in inLineUp.lineUp]) def sqlPlayerToPy(sql: str): if sql in LeaguePlayers: return LeaguePlayers[sql] else: return str(sql) def sqlLineUpToPy(sql: str): lineUp = LineUp() for keyhash in set([x.replace('\\&r01', ';') for x in sql.split(';')]): if keyhash in LeaguePlayers: lineUp[keyhash] = LeaguePlayers[keyhash] return lineUp class LeagueTeam(DBStorable, table="teams", live=False): """ Class that represents a team participating in a league season. :param TeamName: The name of this team. :param TeamLeader: The team leader of this team. :param TeamPlayers: The league livePlayers of this team as line-up. :param ActiveSeasons: Names of the seasons this team was active. note:: Author(s): Mitch """ def __init__(self, TeamName: str, ActiveSeasons: set, TeamLeader: LeaguePlayer = None, TeamPlayers: LineUp = None): if not self.initialised: self.addConversions( (pyPlayerToSQL, sqlPlayerToPy), (pyLineUpToSQL, sqlLineUpToPy) ) self.STeamName = TeamName, VARCHAR(32), PRIMARY_KEY self.SActiveSeasons = ActiveSeasons, TINYTEXT self.STeamLeader = TeamLeader, VARCHAR(32) if TeamPlayers: self.STeamPlayers = TeamPlayers, TEXT else: self.STeamPlayers = LineUp(), TEXT self.insertToDB() def __str__(self): return self.getTeamName() + "\n\nTeam Leader:\t" + str(self.getTeamLeader()) + "\n\nLine Up:\n\n" +\ str(self.getTeamPlayers()) LeagueTeams = LeagueTeam.storageDict
0.551815
0.143038
import os from datetime import date from django.core.management import setup_environ try: from scielomanager import settings except ImportError: BASE_PATH = os.path.abspath(os.path.join(os.path.dirname(__file__), '..', '..')) BASE_PATH_APP = os.path.abspath(os.path.join(os.path.dirname(__file__), '..', '..', 'scielomanager')) from sys import path path.append(BASE_PATH) path.append(BASE_PATH_APP) import settings setup_environ(settings) from django.core import exceptions from django.db.utils import DatabaseError, IntegrityError from django.db import transaction from django.db.models import Q from django.contrib.auth.models import User from journalmanager.models import * import choices logger = logging.getLogger(__name__) def _config_logging(logging_level='INFO', logging_file=None): allowed_levels = { 'DEBUG': logging.DEBUG, 'INFO': logging.INFO, 'WARNING': logging.WARNING, 'ERROR': logging.ERROR, 'CRITICAL': logging.CRITICAL } formatter = logging.Formatter('%(asctime)s - %(name)s - %(levelname)s - %(message)s') logger.setLevel(allowed_levels.get(logging_level, 'INFO')) if logging_file: hl = logging.FileHandler(logging_file, mode='a') else: hl = logging.StreamHandler() hl.setFormatter(formatter) hl.setLevel(allowed_levels.get(logging_level, 'INFO')) logger.addHandler(hl) return logger class Catalog(object): def __init__(self, collection, user=None): """ data must be a Xylose object """ self.user = User.objects.get(pk=1) if user is None else user try: self.collection = Collection.objects.get(acronym=collection) except: raise ValueError('Collection do no exists: %s' % collection) def _load_language(self, language): language = Language.objects.get_or_create( iso_code=language, name=choices.LANG_DICT.get(language, '###NOT FOUND###') )[0] return language def _load_journal_mission(self, journal, missions): if missions is None: return for language, description in missions.items(): mission = JournalMission() language = self._load_language(language) mission.language = language mission.description = description journal.missions.add(mission) def _load_journal_subject_areas(self, journal, areas): if areas is None: return for area in areas: try: studyarea = StudyArea.objects.get(study_area=area) except: logger.warning('Invalid study area (%s) for the journal (%s), nothing was assigned' % ( area, journal.title) ) journal.study_areas.add(studyarea) def _load_journal_textlanguage(self, journal, languages): if languages is None: return for language in languages: language = self._load_language(language) journal.languages.add(language) def _load_journal_abstractlanguage(self, journal, languages): if languages is None: return for language in languages: language = self._load_language(language) journal.abstract_keyword_languages.add(language) def _load_journal_status_history(self, journal, status_history): ## cleanup before deploy the new status history timeline = JournalTimeline.objects.filter( journal=journal, collection=self.collection ).delete() if status_history is None: return for st_date, status, reason in status_history: if len(st_date) == 4: st_date += '-01-01' if len(st_date) == 7: st_date += '-01' defaults = { 'created_by': self.user, } try: timeline = JournalTimeline.objects.get_or_create( journal=journal, collection=self.collection, since=st_date, status=status, reason=reason, defaults=defaults)[0] except exceptions.ValidationError: logger.warning('Invalid timeline (%s) for the journal (%s), nothing was assigned' % ( ', '.join([st_date, status, reason]), journal.title) ) try: membership = Membership.objects.get_or_create( journal=journal, collection=self.collection, since=st_date, status=status, reason=reason, defaults=defaults ) except IntegrityError: logger.warning('Invalid membership (%s) for the journal (%s), nothing was assigned' % ( ', '.join([st_date, status, reason]), journal.title) ) """ models.Membership sempre replica o registro salvo para o JournalTimeline. No momento da importação esse comportamento é indesejado, para contorná-lo é realizada a exclusão dos registros inseridos verificando a data da execução da importação """ JournalTimeline.objects.filter( journal=journal, collection=self.collection, since__month=date.today().month, since__year=date.today().year).delete() def _load_journal_other_titles(self, journal, data): for title in data.other_titles or []: title = JournalTitle() title.title = title title.category = 'other' journal.other_titles.add(title) # NLM/Medline Title if data.title_nlm: title = JournalTitle() title.title = data.title_nlm title.category = 'abbrev_nlm' journal.other_titles.add(title) def _load_journal_use_license(self, journal, permission): if permission is None: return use_license = UseLicense.objects.get_or_create( license_code=permission['id'].upper())[0] if 'text' in permission and permission['text']: use_license.disclaimer = permission['text'] if 'url' in permission and permission['url']: use_license.reference_url = permission['url'] use_license.save() journal.use_license = use_license def _load_journal_sponsor(self, journal, data): """ Function: load_sponsor Retorna um objeto Sponsor() caso a gravação do mesmo em banco de dados for concluida """ if data.sponsors is None: return for sponsor in data.sponsors: db_sponsor = Sponsor.objects.get_or_create(name=sponsor)[0] db_sponsor.collections.add(self.collection) db_sponsor.save() journal.sponsor.add(db_sponsor) def _load_journal_membership(self, journal): if journal.is_member(self.collection): return journal.join(self.collection, self.user) def _post_save_journal(self, journal, data): """ Este método existe para dados que só podem ser associados a um journal já persisitido, como por exemplo métodos que dependem da existência de um PK definido. """ journal.created = data.creation_date or data.processing_date journal.updated = data.update_date self._load_journal_textlanguage(journal, data.languages) self._load_journal_abstractlanguage(journal, data.abstract_languages) self._load_journal_subject_areas(journal, data.subject_areas) self._load_journal_mission(journal, data.mission) self._load_journal_other_titles(journal, data) self._load_journal_status_history(journal, data.status_history) self._load_journal_use_license(journal, data.permissions) self._load_journal_sponsor(journal, data) self._load_journal_membership(journal) try: journal.save() except DatabaseError as e: logger.error(e.message) transaction.rollback() except IntegrityError as e: logger.error(e.message) transaction.rollback() @transaction.commit_on_success def load_journal(self, data): issns = set() issns.add(data.scielo_issn) issns.add(data.print_issn) issns.add(data.electronic_issn) try: journal = Journal.objects.get( Q(print_issn__in=issns) | Q(eletronic_issn__in=issns)) logger.info('Journal already exists, skiping journal creation') return journal except exceptions.ObjectDoesNotExist: logger.info('Journal do no exists, creating journal') logger.info('Importing Journal (%s)' % data.title) journal = Journal() journal.creator_id = self.user.pk journal.collection = self.collection journal.scielo_issn = 'electronic' if data.scielo_issn == data.electronic_issn else 'print' journal.print_issn = data.print_issn or '' journal.eletronic_issn = data.electronic_issn or '' journal.title = data.title or '' journal.title_iso = data.abbreviated_iso_title or '' journal.short_title = data.abbreviated_title or '' journal.medline_title = data.title_nlm or '' journal.acronym = data.acronym journal.subject_descriptors = '\n'.join(data.subject_descriptors or []) journal.index_coverage = '\n'.join(data.subject_descriptors or []) journal.copyrighter = data.copyrighter or '' journal.init_year = data.first_year or '' journal.init_vol = data.first_volume or '' journal.init_num = data.first_number or '' journal.final_year = data.last_year or '' journal.final_vol = data.last_volume or '' journal.final_num = data.last_number or '' journal.cnn_code = data.cnn_code or '' journal.frequency = data.periodicity[0] if data.periodicity else '' journal.url_online_submission = data.submission_url or '' journal.url_journal = data.institutional_url or data.url() or '' journal.pub_status = data.current_status or '' journal.editorial_standard = data.editorial_standard[0] if data.editorial_standard else '' journal.ctrl_vocabulary = data.controlled_vocabulary[0] if data.controlled_vocabulary else '' journal.pub_level = data.publication_level[0] if data.publication_level else '' journal.secs_code = data.secs_code or '' journal.publisher_name = '; '.join(data.publisher_name) if data.publisher_name else '' journal.publisher_country = data.publisher_country[0] if data.publisher_country else '' journal.publisher_state = data.publisher_state or '' journal.publisher_city = data.publisher_city or '' journal.editor_address = data.editor_address or '' journal.editor_email = data.editor_email or '' journal.is_indexed_scie = data.is_indexed_in_scie journal.is_indexed_ssci = data.is_indexed_in_ssci journal.is_indexed_aehci = data.is_indexed_in_ahci try: journal.save(force_insert=True) except DatabaseError as e: logger.error(e.message) logger.error('Journal (%s) not imported' % (data.title)) transaction.rollback() return except IntegrityError as e: logger.error(e.message) logger.error('Journal (%s) not imported' % (data.title)) transaction.rollback() return self._post_save_journal(journal, data) logger.info('Journal (%s) created' % data.title) return journal def _load_issue_sections(self, issue, sections): if sections is None: return None for code, texts in sections.items(): for language, text in texts.items(): language = self._load_language(language) try: section = Section.objects.get( journal=issue.journal, legacy_code=code, ) sectiontitle = SectionTitle.objects.get_or_create( section=section, language=language, title=text ) except exceptions.ObjectDoesNotExist: section = Section() section.legacy_code = code section.journal = issue.journal section.save(force_insert=True) sectiontitle = SectionTitle.objects.get_or_create( section=section, language=language, title=text ) issue.section.add(section) def _load_issue_titles(self, issue, titles): if titles is None: return None for language, title in titles.items(): language = self._load_language(language) issuetitle = IssueTitle() issuetitle.title = title issuetitle.issue = issue issuetitle.language = language issuetitle.save(force_insert=True) def _load_issue_use_license(self, issue, permission): if permission is None: return None use_license = UseLicense.objects.get_or_create( license_code=permission['id'].upper())[0] if 'text' in permission and permission['text']: use_license.disclaimer = permission['text'] if 'url' in permission and permission['url']: use_license.reference_url = permission['url'] use_license.save() issue.use_license = use_license def _post_save_issue(self, issue, data): issue.order = int(data.order) issue.created = data.creation_date or data.processing_date issue.updated = data.update_date self._load_issue_titles(issue, data.titles) self._load_issue_sections(issue, data.sections) self._load_issue_use_license(issue, data.permissions) try: issue.save(auto_order=False) except DatabaseError as e: logger.error(e.message) transaction.rollback() except IntegrityError as e: transaction.rollback() logger.error(e.message) transaction.rollback() def _issue_exists(self, journal, data): spe = data.number.replace('spe', '') if data.type == 'special' else None suppl = ' '.join([ data.supplement_volume or '', data.supplement_number or '' ]).strip() if data.type == 'supplement' else None try: issue = Issue.objects.get( journal=journal, publication_year=data.publication_date[:4], volume=data.volume or '', number=data.number or '', type=data.type, spe_text=spe, suppl_text=suppl) logger.info('Issue already exists, skiping issue creation') return issue except exceptions.ObjectDoesNotExist: logger.info('Issue do not exists, creating issue') return None @transaction.commit_on_success def load_issue(self, data): if data.type == 'ahead' or data.type == 'pressrelease': logger.info('Issue (%s) will not be imported' % data.type) return journal = self.load_journal(data.journal) if not journal: return self._load_journal_status_history(journal, data.journal.status_history) logger.info('Importing Issue (%s)' % (data.label)) try: issue = self._issue_exists(journal, data) or Issue() except exceptions.MultipleObjectsReturned as e: logger.error('Multiple issues found this new issue will not be created') transaction.rollback() return spe = data.number.replace('spe', '') if data.type == 'special' else None suppl = ' '.join([ data.supplement_volume or '', data.supplement_number or '' ]).strip() if data.type == 'supplement' else None issue.journal = journal issue.publication_year = data.publication_date[:4] issue.volume = data.volume or '' issue.number = data.number or '' issue.type = data.type if data.type == 'special': issue.number = data.number.replace('spe', '') if data.number else '' issue.spe_text = spe if data.type == 'supplement' and suppl: issue.suppl_text = suppl issue.is_press_release = data.is_press_release issue.total_documents = data.total_documents or 0 issue.publication_start_month = data.start_month or 0 issue.publication_end_month = data.end_month or 0 issue.is_marked_up = data.is_marked_up issue.ctrl_vocabulary = data.controlled_vocabulary[0] if data.controlled_vocabulary else '' issue.editorial_standard = data.editorial_standard[0] if data.editorial_standard else '' try: issue.save(force_insert=True) except DatabaseError as e: logger.error(e.message) logger.error('Issue (%s) not imported' % (data.label)) transaction.rollback() return except IntegrityError as e: logger.error(e.message) logger.error('Issue (%s) not imported' % (data.label)) transaction.rollback() return self._post_save_issue(issue, data) logger.info('Issue (%s) created' % (data.label))
scielomanager/tools/import_data/importer.py
import os from datetime import date from django.core.management import setup_environ try: from scielomanager import settings except ImportError: BASE_PATH = os.path.abspath(os.path.join(os.path.dirname(__file__), '..', '..')) BASE_PATH_APP = os.path.abspath(os.path.join(os.path.dirname(__file__), '..', '..', 'scielomanager')) from sys import path path.append(BASE_PATH) path.append(BASE_PATH_APP) import settings setup_environ(settings) from django.core import exceptions from django.db.utils import DatabaseError, IntegrityError from django.db import transaction from django.db.models import Q from django.contrib.auth.models import User from journalmanager.models import * import choices logger = logging.getLogger(__name__) def _config_logging(logging_level='INFO', logging_file=None): allowed_levels = { 'DEBUG': logging.DEBUG, 'INFO': logging.INFO, 'WARNING': logging.WARNING, 'ERROR': logging.ERROR, 'CRITICAL': logging.CRITICAL } formatter = logging.Formatter('%(asctime)s - %(name)s - %(levelname)s - %(message)s') logger.setLevel(allowed_levels.get(logging_level, 'INFO')) if logging_file: hl = logging.FileHandler(logging_file, mode='a') else: hl = logging.StreamHandler() hl.setFormatter(formatter) hl.setLevel(allowed_levels.get(logging_level, 'INFO')) logger.addHandler(hl) return logger class Catalog(object): def __init__(self, collection, user=None): """ data must be a Xylose object """ self.user = User.objects.get(pk=1) if user is None else user try: self.collection = Collection.objects.get(acronym=collection) except: raise ValueError('Collection do no exists: %s' % collection) def _load_language(self, language): language = Language.objects.get_or_create( iso_code=language, name=choices.LANG_DICT.get(language, '###NOT FOUND###') )[0] return language def _load_journal_mission(self, journal, missions): if missions is None: return for language, description in missions.items(): mission = JournalMission() language = self._load_language(language) mission.language = language mission.description = description journal.missions.add(mission) def _load_journal_subject_areas(self, journal, areas): if areas is None: return for area in areas: try: studyarea = StudyArea.objects.get(study_area=area) except: logger.warning('Invalid study area (%s) for the journal (%s), nothing was assigned' % ( area, journal.title) ) journal.study_areas.add(studyarea) def _load_journal_textlanguage(self, journal, languages): if languages is None: return for language in languages: language = self._load_language(language) journal.languages.add(language) def _load_journal_abstractlanguage(self, journal, languages): if languages is None: return for language in languages: language = self._load_language(language) journal.abstract_keyword_languages.add(language) def _load_journal_status_history(self, journal, status_history): ## cleanup before deploy the new status history timeline = JournalTimeline.objects.filter( journal=journal, collection=self.collection ).delete() if status_history is None: return for st_date, status, reason in status_history: if len(st_date) == 4: st_date += '-01-01' if len(st_date) == 7: st_date += '-01' defaults = { 'created_by': self.user, } try: timeline = JournalTimeline.objects.get_or_create( journal=journal, collection=self.collection, since=st_date, status=status, reason=reason, defaults=defaults)[0] except exceptions.ValidationError: logger.warning('Invalid timeline (%s) for the journal (%s), nothing was assigned' % ( ', '.join([st_date, status, reason]), journal.title) ) try: membership = Membership.objects.get_or_create( journal=journal, collection=self.collection, since=st_date, status=status, reason=reason, defaults=defaults ) except IntegrityError: logger.warning('Invalid membership (%s) for the journal (%s), nothing was assigned' % ( ', '.join([st_date, status, reason]), journal.title) ) """ models.Membership sempre replica o registro salvo para o JournalTimeline. No momento da importação esse comportamento é indesejado, para contorná-lo é realizada a exclusão dos registros inseridos verificando a data da execução da importação """ JournalTimeline.objects.filter( journal=journal, collection=self.collection, since__month=date.today().month, since__year=date.today().year).delete() def _load_journal_other_titles(self, journal, data): for title in data.other_titles or []: title = JournalTitle() title.title = title title.category = 'other' journal.other_titles.add(title) # NLM/Medline Title if data.title_nlm: title = JournalTitle() title.title = data.title_nlm title.category = 'abbrev_nlm' journal.other_titles.add(title) def _load_journal_use_license(self, journal, permission): if permission is None: return use_license = UseLicense.objects.get_or_create( license_code=permission['id'].upper())[0] if 'text' in permission and permission['text']: use_license.disclaimer = permission['text'] if 'url' in permission and permission['url']: use_license.reference_url = permission['url'] use_license.save() journal.use_license = use_license def _load_journal_sponsor(self, journal, data): """ Function: load_sponsor Retorna um objeto Sponsor() caso a gravação do mesmo em banco de dados for concluida """ if data.sponsors is None: return for sponsor in data.sponsors: db_sponsor = Sponsor.objects.get_or_create(name=sponsor)[0] db_sponsor.collections.add(self.collection) db_sponsor.save() journal.sponsor.add(db_sponsor) def _load_journal_membership(self, journal): if journal.is_member(self.collection): return journal.join(self.collection, self.user) def _post_save_journal(self, journal, data): """ Este método existe para dados que só podem ser associados a um journal já persisitido, como por exemplo métodos que dependem da existência de um PK definido. """ journal.created = data.creation_date or data.processing_date journal.updated = data.update_date self._load_journal_textlanguage(journal, data.languages) self._load_journal_abstractlanguage(journal, data.abstract_languages) self._load_journal_subject_areas(journal, data.subject_areas) self._load_journal_mission(journal, data.mission) self._load_journal_other_titles(journal, data) self._load_journal_status_history(journal, data.status_history) self._load_journal_use_license(journal, data.permissions) self._load_journal_sponsor(journal, data) self._load_journal_membership(journal) try: journal.save() except DatabaseError as e: logger.error(e.message) transaction.rollback() except IntegrityError as e: logger.error(e.message) transaction.rollback() @transaction.commit_on_success def load_journal(self, data): issns = set() issns.add(data.scielo_issn) issns.add(data.print_issn) issns.add(data.electronic_issn) try: journal = Journal.objects.get( Q(print_issn__in=issns) | Q(eletronic_issn__in=issns)) logger.info('Journal already exists, skiping journal creation') return journal except exceptions.ObjectDoesNotExist: logger.info('Journal do no exists, creating journal') logger.info('Importing Journal (%s)' % data.title) journal = Journal() journal.creator_id = self.user.pk journal.collection = self.collection journal.scielo_issn = 'electronic' if data.scielo_issn == data.electronic_issn else 'print' journal.print_issn = data.print_issn or '' journal.eletronic_issn = data.electronic_issn or '' journal.title = data.title or '' journal.title_iso = data.abbreviated_iso_title or '' journal.short_title = data.abbreviated_title or '' journal.medline_title = data.title_nlm or '' journal.acronym = data.acronym journal.subject_descriptors = '\n'.join(data.subject_descriptors or []) journal.index_coverage = '\n'.join(data.subject_descriptors or []) journal.copyrighter = data.copyrighter or '' journal.init_year = data.first_year or '' journal.init_vol = data.first_volume or '' journal.init_num = data.first_number or '' journal.final_year = data.last_year or '' journal.final_vol = data.last_volume or '' journal.final_num = data.last_number or '' journal.cnn_code = data.cnn_code or '' journal.frequency = data.periodicity[0] if data.periodicity else '' journal.url_online_submission = data.submission_url or '' journal.url_journal = data.institutional_url or data.url() or '' journal.pub_status = data.current_status or '' journal.editorial_standard = data.editorial_standard[0] if data.editorial_standard else '' journal.ctrl_vocabulary = data.controlled_vocabulary[0] if data.controlled_vocabulary else '' journal.pub_level = data.publication_level[0] if data.publication_level else '' journal.secs_code = data.secs_code or '' journal.publisher_name = '; '.join(data.publisher_name) if data.publisher_name else '' journal.publisher_country = data.publisher_country[0] if data.publisher_country else '' journal.publisher_state = data.publisher_state or '' journal.publisher_city = data.publisher_city or '' journal.editor_address = data.editor_address or '' journal.editor_email = data.editor_email or '' journal.is_indexed_scie = data.is_indexed_in_scie journal.is_indexed_ssci = data.is_indexed_in_ssci journal.is_indexed_aehci = data.is_indexed_in_ahci try: journal.save(force_insert=True) except DatabaseError as e: logger.error(e.message) logger.error('Journal (%s) not imported' % (data.title)) transaction.rollback() return except IntegrityError as e: logger.error(e.message) logger.error('Journal (%s) not imported' % (data.title)) transaction.rollback() return self._post_save_journal(journal, data) logger.info('Journal (%s) created' % data.title) return journal def _load_issue_sections(self, issue, sections): if sections is None: return None for code, texts in sections.items(): for language, text in texts.items(): language = self._load_language(language) try: section = Section.objects.get( journal=issue.journal, legacy_code=code, ) sectiontitle = SectionTitle.objects.get_or_create( section=section, language=language, title=text ) except exceptions.ObjectDoesNotExist: section = Section() section.legacy_code = code section.journal = issue.journal section.save(force_insert=True) sectiontitle = SectionTitle.objects.get_or_create( section=section, language=language, title=text ) issue.section.add(section) def _load_issue_titles(self, issue, titles): if titles is None: return None for language, title in titles.items(): language = self._load_language(language) issuetitle = IssueTitle() issuetitle.title = title issuetitle.issue = issue issuetitle.language = language issuetitle.save(force_insert=True) def _load_issue_use_license(self, issue, permission): if permission is None: return None use_license = UseLicense.objects.get_or_create( license_code=permission['id'].upper())[0] if 'text' in permission and permission['text']: use_license.disclaimer = permission['text'] if 'url' in permission and permission['url']: use_license.reference_url = permission['url'] use_license.save() issue.use_license = use_license def _post_save_issue(self, issue, data): issue.order = int(data.order) issue.created = data.creation_date or data.processing_date issue.updated = data.update_date self._load_issue_titles(issue, data.titles) self._load_issue_sections(issue, data.sections) self._load_issue_use_license(issue, data.permissions) try: issue.save(auto_order=False) except DatabaseError as e: logger.error(e.message) transaction.rollback() except IntegrityError as e: transaction.rollback() logger.error(e.message) transaction.rollback() def _issue_exists(self, journal, data): spe = data.number.replace('spe', '') if data.type == 'special' else None suppl = ' '.join([ data.supplement_volume or '', data.supplement_number or '' ]).strip() if data.type == 'supplement' else None try: issue = Issue.objects.get( journal=journal, publication_year=data.publication_date[:4], volume=data.volume or '', number=data.number or '', type=data.type, spe_text=spe, suppl_text=suppl) logger.info('Issue already exists, skiping issue creation') return issue except exceptions.ObjectDoesNotExist: logger.info('Issue do not exists, creating issue') return None @transaction.commit_on_success def load_issue(self, data): if data.type == 'ahead' or data.type == 'pressrelease': logger.info('Issue (%s) will not be imported' % data.type) return journal = self.load_journal(data.journal) if not journal: return self._load_journal_status_history(journal, data.journal.status_history) logger.info('Importing Issue (%s)' % (data.label)) try: issue = self._issue_exists(journal, data) or Issue() except exceptions.MultipleObjectsReturned as e: logger.error('Multiple issues found this new issue will not be created') transaction.rollback() return spe = data.number.replace('spe', '') if data.type == 'special' else None suppl = ' '.join([ data.supplement_volume or '', data.supplement_number or '' ]).strip() if data.type == 'supplement' else None issue.journal = journal issue.publication_year = data.publication_date[:4] issue.volume = data.volume or '' issue.number = data.number or '' issue.type = data.type if data.type == 'special': issue.number = data.number.replace('spe', '') if data.number else '' issue.spe_text = spe if data.type == 'supplement' and suppl: issue.suppl_text = suppl issue.is_press_release = data.is_press_release issue.total_documents = data.total_documents or 0 issue.publication_start_month = data.start_month or 0 issue.publication_end_month = data.end_month or 0 issue.is_marked_up = data.is_marked_up issue.ctrl_vocabulary = data.controlled_vocabulary[0] if data.controlled_vocabulary else '' issue.editorial_standard = data.editorial_standard[0] if data.editorial_standard else '' try: issue.save(force_insert=True) except DatabaseError as e: logger.error(e.message) logger.error('Issue (%s) not imported' % (data.label)) transaction.rollback() return except IntegrityError as e: logger.error(e.message) logger.error('Issue (%s) not imported' % (data.label)) transaction.rollback() return self._post_save_issue(issue, data) logger.info('Issue (%s) created' % (data.label))
0.339061
0.084417
import copy class Layer(object): def __init__(self, medium, thickness, name="Unnamed Layer"): self.thickness = thickness self.medium = copy.deepcopy(medium) self.name = name self.hooks = { 'pre_update_frequency': [] } def update_frequency(self, omega): for f in self.hooks['pre_update_frequency']: f(self) self.medium.update_frequency(omega) def register(self, hook_name): if self.hooks.get(hook_name) is None: raise ValueError(f"Invalid hook name. Use one of : {','.join(self.hooks.keys())}") def decorator(func): self.hooks[hook_name].append(func) return decorator def __str__(self): return f'{self.name} - {self.thickness}m of {self.medium.name} (self.medium.MEDIUM_TYPE)' class StochasticLayer(Layer): def __init__(self, medium, thickness, stochastic_param, pdf, name="Unnamed Layer"): """ medium -- medium object thickness -- layer's thickness stochastic_param -- name of the stochastic parameter pdf -- probability density function from which are drawn the random samples name -- optional layer's name Please note that the pdf is a **function handle** that must return a sample per call (and accepts no argument) """ super().__init__(medium, thickness, name) self.stochastic_param = stochastic_param self.pdf = pdf # useful for type lookup and guards self.__medium_params = dict(self.medium.EXPECTED_PARAMS+self.medium.OPT_PARAMS) if self.stochastic_param == 'thickness': setattr(self, 'new_draw', self.__draw_thickness) self.initial_param_value = self.thickness elif self.stochastic_param in self.__medium_params.keys(): self.initial_param_value = getattr(self.medium, self.stochastic_param) setattr(self, 'new_draw', self.__draw_medium_parameter) else: raise ValueError('Unable to draw a parameter undefined in the layer') def __draw_thickness(self): draw = float(self.pdf()) self.thickness = draw return draw def __draw_medium_parameter(self): draw = self.pdf() expected_type = self.__medium_params[self.stochastic_param] if type(draw) == expected_type: setattr(self.medium, self.stochastic_param, draw) self.medium.omega = -1 else: raise TypeError(f'Draw of type {type(draw)} but expected type {expected_type}') return draw def __str__(self): return f'{self.name} - {self.thickness}m of {self.medium.name} (self.medium.MEDIUM_TYPE)' def reinit(self): if self.stochastic_param == 'thickness': self.thickness = self.initial_param_value else: setattr(self.medium, self.stochastic_param, self.initial_param_value)
pymls/layers/layer.py
import copy class Layer(object): def __init__(self, medium, thickness, name="Unnamed Layer"): self.thickness = thickness self.medium = copy.deepcopy(medium) self.name = name self.hooks = { 'pre_update_frequency': [] } def update_frequency(self, omega): for f in self.hooks['pre_update_frequency']: f(self) self.medium.update_frequency(omega) def register(self, hook_name): if self.hooks.get(hook_name) is None: raise ValueError(f"Invalid hook name. Use one of : {','.join(self.hooks.keys())}") def decorator(func): self.hooks[hook_name].append(func) return decorator def __str__(self): return f'{self.name} - {self.thickness}m of {self.medium.name} (self.medium.MEDIUM_TYPE)' class StochasticLayer(Layer): def __init__(self, medium, thickness, stochastic_param, pdf, name="Unnamed Layer"): """ medium -- medium object thickness -- layer's thickness stochastic_param -- name of the stochastic parameter pdf -- probability density function from which are drawn the random samples name -- optional layer's name Please note that the pdf is a **function handle** that must return a sample per call (and accepts no argument) """ super().__init__(medium, thickness, name) self.stochastic_param = stochastic_param self.pdf = pdf # useful for type lookup and guards self.__medium_params = dict(self.medium.EXPECTED_PARAMS+self.medium.OPT_PARAMS) if self.stochastic_param == 'thickness': setattr(self, 'new_draw', self.__draw_thickness) self.initial_param_value = self.thickness elif self.stochastic_param in self.__medium_params.keys(): self.initial_param_value = getattr(self.medium, self.stochastic_param) setattr(self, 'new_draw', self.__draw_medium_parameter) else: raise ValueError('Unable to draw a parameter undefined in the layer') def __draw_thickness(self): draw = float(self.pdf()) self.thickness = draw return draw def __draw_medium_parameter(self): draw = self.pdf() expected_type = self.__medium_params[self.stochastic_param] if type(draw) == expected_type: setattr(self.medium, self.stochastic_param, draw) self.medium.omega = -1 else: raise TypeError(f'Draw of type {type(draw)} but expected type {expected_type}') return draw def __str__(self): return f'{self.name} - {self.thickness}m of {self.medium.name} (self.medium.MEDIUM_TYPE)' def reinit(self): if self.stochastic_param == 'thickness': self.thickness = self.initial_param_value else: setattr(self.medium, self.stochastic_param, self.initial_param_value)
0.812682
0.317347
from Canvas import * from math import * def split_cities(filename): # Reading in a file and parsing the data before storing each specific part of the data in a list of dictionaries. city = [] f = open(filename, "r") line = f.readline() while line != "": line = line[:-1] splitlines = line.split() city = city + [{"x": int(splitlines[0]), "y": int(splitlines[1]), "name": splitlines[2]}] line = f.readline() f.close() return city def draw(cities, length): # Iterating through each city in the array and finding the corresponding x and y co-ordinate # The co-ordinates are past as a parameter to the plot points function which draws a point for the city # Then a line is created from the city just drawn to the next city in the array in order to show the path taken. city = cities[0] plot_points(city) x = city["x"] y = city["y"] i = 1 while i < len(cities): city1 = cities[i] plot_points(city1) x1 = city1["x"] y1 = city1["y"] create_line(x, y, x1, y1) x = x1 y = y1 i = i + 1 city1 = cities[0] x1 = city1["x"] y1 = city1["y"] create_line(x, y, x1, y1) create_text(200, 220, text="Tour length = %d" % length) def plot_points(city): # Defining how to plot a point for cities on a canvas. x = city["x"] y = city["y"] name = city["name"] create_oval(x-3, y-3, x+3, y+3) create_text(x-3, y+3, text=name) def nearest_city(cities, i): # Algorithm to find the next nearest city # Like a min/max algorithm, iterates through all remaining cities comparing one to the next and storing the nearest. city = cities[i] nearest = i + 1 d = distance(city, cities[i+1]) i = i + 1 while i < len(cities) - 1: newd = distance(city, cities[i+1]) if newd < d: d = newd nearest = i + 1 i = i + 1 return nearest def tour_order(cities): i = 0 while i < len(cities) - 2: second = nearest_city(cities, i) temp = cities[i+1] cities[i+1] = cities[second] cities[second] = temp i = i + 1 def length_tour(cities): # Iterating through each city to calculate the total length of the tour # Calling the function distance inside this function to do so. length = 0 i = 0 while i < len(cities)-1: length = length + distance(cities[i], cities[i+1]) i = i + 1 length = length + distance(cities[len(cities)-1], cities[0]) return length def distance(city1, city2): # Calculating the distance between two cities x1 = city1["x"] y1 = city1["y"] x2 = city2["x"] y2 = city2["y"] return int(sqrt((x1-x2)*(x1-x2) + (y1-y2)*(y1-y2))) cities = split_cities("Cities.txt") tour_order(cities) draw(cities, length_tour(cities)) complete()
nearestneighbour.py
from Canvas import * from math import * def split_cities(filename): # Reading in a file and parsing the data before storing each specific part of the data in a list of dictionaries. city = [] f = open(filename, "r") line = f.readline() while line != "": line = line[:-1] splitlines = line.split() city = city + [{"x": int(splitlines[0]), "y": int(splitlines[1]), "name": splitlines[2]}] line = f.readline() f.close() return city def draw(cities, length): # Iterating through each city in the array and finding the corresponding x and y co-ordinate # The co-ordinates are past as a parameter to the plot points function which draws a point for the city # Then a line is created from the city just drawn to the next city in the array in order to show the path taken. city = cities[0] plot_points(city) x = city["x"] y = city["y"] i = 1 while i < len(cities): city1 = cities[i] plot_points(city1) x1 = city1["x"] y1 = city1["y"] create_line(x, y, x1, y1) x = x1 y = y1 i = i + 1 city1 = cities[0] x1 = city1["x"] y1 = city1["y"] create_line(x, y, x1, y1) create_text(200, 220, text="Tour length = %d" % length) def plot_points(city): # Defining how to plot a point for cities on a canvas. x = city["x"] y = city["y"] name = city["name"] create_oval(x-3, y-3, x+3, y+3) create_text(x-3, y+3, text=name) def nearest_city(cities, i): # Algorithm to find the next nearest city # Like a min/max algorithm, iterates through all remaining cities comparing one to the next and storing the nearest. city = cities[i] nearest = i + 1 d = distance(city, cities[i+1]) i = i + 1 while i < len(cities) - 1: newd = distance(city, cities[i+1]) if newd < d: d = newd nearest = i + 1 i = i + 1 return nearest def tour_order(cities): i = 0 while i < len(cities) - 2: second = nearest_city(cities, i) temp = cities[i+1] cities[i+1] = cities[second] cities[second] = temp i = i + 1 def length_tour(cities): # Iterating through each city to calculate the total length of the tour # Calling the function distance inside this function to do so. length = 0 i = 0 while i < len(cities)-1: length = length + distance(cities[i], cities[i+1]) i = i + 1 length = length + distance(cities[len(cities)-1], cities[0]) return length def distance(city1, city2): # Calculating the distance between two cities x1 = city1["x"] y1 = city1["y"] x2 = city2["x"] y2 = city2["y"] return int(sqrt((x1-x2)*(x1-x2) + (y1-y2)*(y1-y2))) cities = split_cities("Cities.txt") tour_order(cities) draw(cities, length_tour(cities)) complete()
0.532425
0.515986
import os from PyQt5.QtGui import QIcon, QCloseEvent from PyQt5.QtWidgets import QDesktopWidget, QMainWindow, QStackedWidget, QFileDialog, QWidget from src.controller_factory import ControllerFactory from src.message_type import MessageType from src.rocket_packet.rocket_packet_parser_factory import RocketPacketVersionException from src.ui import utils from src.ui.configdialog import ConfigDialog from src.ui.console_message_listener import ConsoleMessageListener from src.ui.homewidget import HomeWidget from src.ui.menu_bar import MenuBar from src.ui.real_time_widget import RealTimeWidget from src.ui.replay_widget import ReplayWidget from src.ui.status_bar import StatusBar from src.ui.tabs_widget import TabsWidget from src.ui.motor_widget import MotorWidget class MainWindow(QMainWindow): def __init__(self, parent=None): super().__init__(parent) self.central_widget = QStackedWidget() self.setCentralWidget(self.central_widget) self.home_widget = HomeWidget(self.new_acquisition, self.load_flight_data, self) self.real_time_widget = RealTimeWidget(self) self.replay_widget = ReplayWidget(self) self.motor_widget = MotorWidget(self) self.tab_widget = TabsWidget(self) self.central_widget.addWidget(self.home_widget) self.central_widget.addWidget(self.tab_widget) self.controller_factory = ControllerFactory() self.active_controller = None self.real_time_controller = None self.replay_controller = None self.status_bar = StatusBar(self) self.setStatusBar(self.status_bar) self.menu_bar = self.create_menu_bar() self.config_dialog = None self.console = ConsoleMessageListener() self.setWindowIcon(QIcon("src/resources/logo.jpg")) self.setWindowTitle("GAUL BaseStation") self.set_stylesheet("src/resources/mainwindow.css") def create_menu_bar(self): menu_bar = MenuBar(self) menu_bar.set_new_acquisition_callback(self.new_acquisition) menu_bar.set_save_as_callback(self.save_as) menu_bar.set_load_flight_data_callback(self.load_flight_data) menu_bar.set_open_simulation_callback(self.add_simulation) menu_bar.set_edit_preferences_callback(self.open_preferences) menu_bar.set_on_exit_callback(self.close) self.setMenuBar(menu_bar) return menu_bar def new_acquisition(self): deactivated = True if self.active_controller is not None: deactivated = self.active_controller.deactivate() if deactivated: try: self.open_real_time() self.active_controller.activate("") except RocketPacketVersionException as error: self.status_bar.notify(str(error), MessageType.ERROR) def save_as(self): # TODO pass def load_flight_data(self): filename, _ = QFileDialog.getOpenFileName(caption="Open File", directory="./src/resources/", filter="All Files (*);; CSV Files (*.csv)") if filename: deactivated = True if self.active_controller is not None: deactivated = self.active_controller.deactivate() if deactivated: self.open_replay() self.active_controller.activate(filename) def add_simulation(self): filename, _ = QFileDialog.getOpenFileName(caption="Open File", directory="./src/resources/", filter="All Files (*);; CSV Files (*.csv)") if filename: self.active_controller.add_open_rocket_simulation(filename) def open_preferences(self): config_path = os.path.join(os.getcwd(), "config.ini") if self.config_dialog is None: self.config_dialog = ConfigDialog(self) self.config_dialog.open(config_path) def open_real_time(self): if self.real_time_controller is None: self.real_time_controller = self.controller_factory.create_real_time_controller(self.real_time_widget, self.motor_widget, self.console) self.real_time_controller.register_message_listener(self.status_bar) self.active_controller = self.real_time_controller self.tab_widget.clearTabs() self.tab_widget.addWidget(self.real_time_widget, "General") self.open_widget(self.tab_widget) self.menu_bar.set_real_time_mode() def open_replay(self): if self.replay_controller is None: self.replay_controller = self.controller_factory.create_replay_controller(self.replay_widget, self.motor_widget) self.replay_controller.register_message_listener(self.status_bar) self.active_controller = self.replay_controller self.tab_widget.clearTabs() self.tab_widget.addWidget(self.replay_widget, "General") self.tab_widget.addWidget(self.motor_widget, "Motor") self.open_widget(self.tab_widget) self.menu_bar.set_replay_mode() def open_widget(self, widget: QWidget): self.central_widget.setCurrentWidget(widget) self.set_stylesheet("src/resources/data_widget.css") self.showMaximized() self.status_bar.clear() def set_stylesheet(self, stylesheet_path): stylesheet = utils.read_stylesheet(stylesheet_path) self.setStyleSheet(stylesheet) def closeEvent(self, event: QCloseEvent): if self.active_controller is not None: self.active_controller.on_close(event) else: event.accept() def center(self): window_geometry = self.frameGeometry() screen_center_point = QDesktopWidget().screenGeometry(self).center() window_geometry.moveCenter(screen_center_point) self.move(window_geometry.topLeft())
BaseStation/src/ui/mainwindow.py
import os from PyQt5.QtGui import QIcon, QCloseEvent from PyQt5.QtWidgets import QDesktopWidget, QMainWindow, QStackedWidget, QFileDialog, QWidget from src.controller_factory import ControllerFactory from src.message_type import MessageType from src.rocket_packet.rocket_packet_parser_factory import RocketPacketVersionException from src.ui import utils from src.ui.configdialog import ConfigDialog from src.ui.console_message_listener import ConsoleMessageListener from src.ui.homewidget import HomeWidget from src.ui.menu_bar import MenuBar from src.ui.real_time_widget import RealTimeWidget from src.ui.replay_widget import ReplayWidget from src.ui.status_bar import StatusBar from src.ui.tabs_widget import TabsWidget from src.ui.motor_widget import MotorWidget class MainWindow(QMainWindow): def __init__(self, parent=None): super().__init__(parent) self.central_widget = QStackedWidget() self.setCentralWidget(self.central_widget) self.home_widget = HomeWidget(self.new_acquisition, self.load_flight_data, self) self.real_time_widget = RealTimeWidget(self) self.replay_widget = ReplayWidget(self) self.motor_widget = MotorWidget(self) self.tab_widget = TabsWidget(self) self.central_widget.addWidget(self.home_widget) self.central_widget.addWidget(self.tab_widget) self.controller_factory = ControllerFactory() self.active_controller = None self.real_time_controller = None self.replay_controller = None self.status_bar = StatusBar(self) self.setStatusBar(self.status_bar) self.menu_bar = self.create_menu_bar() self.config_dialog = None self.console = ConsoleMessageListener() self.setWindowIcon(QIcon("src/resources/logo.jpg")) self.setWindowTitle("GAUL BaseStation") self.set_stylesheet("src/resources/mainwindow.css") def create_menu_bar(self): menu_bar = MenuBar(self) menu_bar.set_new_acquisition_callback(self.new_acquisition) menu_bar.set_save_as_callback(self.save_as) menu_bar.set_load_flight_data_callback(self.load_flight_data) menu_bar.set_open_simulation_callback(self.add_simulation) menu_bar.set_edit_preferences_callback(self.open_preferences) menu_bar.set_on_exit_callback(self.close) self.setMenuBar(menu_bar) return menu_bar def new_acquisition(self): deactivated = True if self.active_controller is not None: deactivated = self.active_controller.deactivate() if deactivated: try: self.open_real_time() self.active_controller.activate("") except RocketPacketVersionException as error: self.status_bar.notify(str(error), MessageType.ERROR) def save_as(self): # TODO pass def load_flight_data(self): filename, _ = QFileDialog.getOpenFileName(caption="Open File", directory="./src/resources/", filter="All Files (*);; CSV Files (*.csv)") if filename: deactivated = True if self.active_controller is not None: deactivated = self.active_controller.deactivate() if deactivated: self.open_replay() self.active_controller.activate(filename) def add_simulation(self): filename, _ = QFileDialog.getOpenFileName(caption="Open File", directory="./src/resources/", filter="All Files (*);; CSV Files (*.csv)") if filename: self.active_controller.add_open_rocket_simulation(filename) def open_preferences(self): config_path = os.path.join(os.getcwd(), "config.ini") if self.config_dialog is None: self.config_dialog = ConfigDialog(self) self.config_dialog.open(config_path) def open_real_time(self): if self.real_time_controller is None: self.real_time_controller = self.controller_factory.create_real_time_controller(self.real_time_widget, self.motor_widget, self.console) self.real_time_controller.register_message_listener(self.status_bar) self.active_controller = self.real_time_controller self.tab_widget.clearTabs() self.tab_widget.addWidget(self.real_time_widget, "General") self.open_widget(self.tab_widget) self.menu_bar.set_real_time_mode() def open_replay(self): if self.replay_controller is None: self.replay_controller = self.controller_factory.create_replay_controller(self.replay_widget, self.motor_widget) self.replay_controller.register_message_listener(self.status_bar) self.active_controller = self.replay_controller self.tab_widget.clearTabs() self.tab_widget.addWidget(self.replay_widget, "General") self.tab_widget.addWidget(self.motor_widget, "Motor") self.open_widget(self.tab_widget) self.menu_bar.set_replay_mode() def open_widget(self, widget: QWidget): self.central_widget.setCurrentWidget(widget) self.set_stylesheet("src/resources/data_widget.css") self.showMaximized() self.status_bar.clear() def set_stylesheet(self, stylesheet_path): stylesheet = utils.read_stylesheet(stylesheet_path) self.setStyleSheet(stylesheet) def closeEvent(self, event: QCloseEvent): if self.active_controller is not None: self.active_controller.on_close(event) else: event.accept() def center(self): window_geometry = self.frameGeometry() screen_center_point = QDesktopWidget().screenGeometry(self).center() window_geometry.moveCenter(screen_center_point) self.move(window_geometry.topLeft())
0.212968
0.060863
import unittest import webtest import json from models.questions import QuestionRepository from handlers.items.items_json import ItemsJSON from handlers.items.new_item import NewItem from handlers.items.add_more import AddMore from handlers.items.update import Update from handlers.helpers import Ready import main class ItemsTestCase(unittest.TestCase): TEST_ITEM = "Content for question " HEADER_FOR_ITEM = "Header for question " NUMBER_OF_QUESTIONS = 100 PAGE_SIZE = 40 def retrieve_first_n_items(self, number_of_items): response = self.testapp.get('%s?n=%d' % (ItemsJSON.URL, number_of_items)) self.assertEqual(response.status_int, 200) items = response.json['old'] self.assertIsNotNone(items) return items def retrieve_first_n_items_before_item_with_id(self, item_id, number_of_items): response = self.testapp.get("%s?before=%d&n=%d" % (ItemsJSON.URL, item_id, number_of_items)) self.assertEqual(response.status_int, 200) items = response.json['old'] self.assertIsNotNone(items) return items def retrieve_first_n_items_updated_after_given_timestamp(self, n, timestamp): response = self.testapp.get("%s?n=%d&timestamp=%f" % (ItemsJSON.URL, n, timestamp)) self.assertEqual(response.status_int, 200) items = response.json['new'] self.assertIsNotNone(items) return items def retrieve_all_items(self): response = self.testapp.get(ItemsJSON.URL) self.assertEqual(response.status_int, 200) items = response.json['old'] self.assertIsNotNone(items) return items def add_more_items(self, number_of_items=None): if not number_of_items: response = self.testapp.get(AddMore.URL) else: response = self.testapp.get('%s?n=%d' % (AddMore.URL, number_of_items)) self.assertEqual(response.status_int, 200) self.assertEqual(response.body, "OK") def update_items(self, items_ids): request_url = '%s?' % Update.URL param_separator = '' for item_id in items_ids: request_url += '%sid=%d' % (param_separator, item_id) param_separator = '&' response = self.testapp.get(request_url) self.assertEqual(response.status_int, 200) self.assertEqual(response.body, "OK") def setUp(self): QuestionRepository.create_table() QuestionRepository.truncate() self.testapp = webtest.TestApp(main.app) def test_checking_that_app_is_ready(self): response = self.testapp.get(Ready.URL) self.assertEqual(response.status_int, 200) self.assertEqual(response.body, "OK") def test_each_question_has_unique_id(self): QuestionRepository.populate(2) items = self.retrieve_all_items() self.assertEqual(len(items), 2) self.assertNotEqual(items[0][u'id'], items[1][u'id']) def test_each_question_has_timestamp_encoded_as_float(self): QuestionRepository.populate(2) items = self.retrieve_all_items() self.assertEqual(len(items), 2) self.assertEqual(len(items), 2) self.assertGreater(items[0][u'created'], items[1][u'created']) def test_each_question_has_updated_field_that_is_equal_to_timestamp_field(self): QuestionRepository.populate(1) items = self.retrieve_all_items() self.assertEqual(len(items), 1) self.assertEqual(len(items), 1) self.assertEqual(items[0][u'created'], items[0][u'updated']) def test_retrieving_items_using_json(self): QuestionRepository.populate(5) items = self.retrieve_all_items() self.assertEqual(len(items), 5) self.assertEqual(len(items), 5) for record_index, record in enumerate(items): self.assertEqual(record[u'content'], "%s%d" % (self.TEST_ITEM, 5 - record_index - 1), "record_index:%d, record:%s" % (record_index, record)) self.assertEqual(record[u'header'], "%s%d" % (self.HEADER_FOR_ITEM, 5 - record_index - 1), "record_index:%d, record:%s" % (record_index, record)) def test_retrieving_first_n_items_posted_before_item_with_given_id(self): QuestionRepository.populate(15) items = self.retrieve_first_n_items(5) self.assertEqual(len(items), 5) oldest_item_id = items[4][u'id'] self.assertEqual('11', oldest_item_id) items = self.retrieve_first_n_items_before_item_with_id(int(oldest_item_id), 5) self.assertEqual(len(items), 5) self.assertEqual('10', items[0][u'id']) self.assertEqual('6', items[4][u'id']) def test_retrieving_first_n_items(self): QuestionRepository.populate(20) items = self.retrieve_first_n_items(10) self.assertEqual(len(items), 10) def test_retrieving_first_n_items_when_number_of_available_items_less_than_n(self): QuestionRepository.populate(5) items = self.retrieve_first_n_items(10) self.assertEqual(len(items), 5) def test_posting_new_item_using_json(self): json_item = [{'header': 'new item header', 'content': 'new item'}] response = self.testapp.post(NewItem.URL, json.dumps(json_item), {'Content-Type': 'application/json'}) self.assertEqual(response.status_int, 200) items = self.retrieve_all_items() self.assertEqual(len(items), 1) item = items[0] self.assertEqual(item[u'content'], "new item") self.assertEqual(item[u'header'], "new item header") def test_retrieving_first_n_items_posted_after_item_with_given_id(self): QuestionRepository.populate(10) items = self.retrieve_first_n_items(5) most_recent_item_id = items[0][u'id'] most_recent_item_updated = items[0][u'updated'] self.assertEqual('10', most_recent_item_id) oldest_item_id = items[4][u'id'] self.assertEqual('6', oldest_item_id) number_of_new_items = 5 QuestionRepository.populate(number_of_new_items) new_items = self.retrieve_first_n_items_updated_after_given_timestamp(number_of_new_items, most_recent_item_updated) self.assertEqual(len(new_items), number_of_new_items) self.assertEqual('11', new_items[0][u'id']) self.assertEqual('15', new_items[4][u'id']) def test_retrieving_updated_items(self): QuestionRepository.populate(10) items = self.retrieve_first_n_items(5) most_recent_item_id = items[0][u'id'] most_recent_item_updated = items[0][u'updated'] self.assertEqual('10', most_recent_item_id) oldest_item_id = items[4][u'id'] self.assertEqual('6', oldest_item_id) number_of_new_items = 5 QuestionRepository.populate(number_of_new_items) list_of_items_to_be_updated = [6, 8, 10] QuestionRepository.update_items(list_of_items_to_be_updated) new_items = self.retrieve_first_n_items_updated_after_given_timestamp(number_of_new_items, most_recent_item_updated) self.assertEqual(len(new_items), number_of_new_items) self.assertEqual('11', new_items[0][u'id']) self.assertEqual('15', new_items[4][u'id']) new_items = self.retrieve_first_n_items_updated_after_given_timestamp(len(list_of_items_to_be_updated), new_items[4][u'updated']) self.assertEqual(len(new_items), len(list_of_items_to_be_updated)) self.assertIn(int(new_items[0][u'id']), list_of_items_to_be_updated) self.assertIn(int(new_items[1][u'id']), list_of_items_to_be_updated) self.assertIn(int(new_items[2][u'id']), list_of_items_to_be_updated) def test_retrieving_updated_items_when_no_new_items_have_been_added(self): QuestionRepository.populate(10) items = self.retrieve_first_n_items(5) most_recent_item_updated = items[0][u'updated'] most_recent_item_id = items[0][u'id'] self.assertEqual('10', most_recent_item_id) oldest_item_id = items[4][u'id'] self.assertEqual('6', oldest_item_id) list_of_items_to_be_updated = [6, 8, 10] QuestionRepository.update_items(list_of_items_to_be_updated) new_items = self.retrieve_first_n_items_updated_after_given_timestamp(5, most_recent_item_updated) self.assertEqual(len(new_items), len(list_of_items_to_be_updated)) self.assertIn(int(new_items[0][u'id']), list_of_items_to_be_updated) self.assertIn(int(new_items[1][u'id']), list_of_items_to_be_updated) self.assertIn(int(new_items[2][u'id']), list_of_items_to_be_updated) def test_adding_an_answer_to_a_question(self): QuestionRepository.populate(2) items = self.retrieve_all_items() self.assertEqual(len(items), 2) item = items[0] self.assertIsNone(item[u'answer']) QuestionRepository.update_item(item[u'id'], item[u'header'], item[u'content'], "New Answer") items = self.retrieve_all_items() item = items[0] self.assertIsNotNone(item[u'answer']) self.assertEqual("New Answer", item[u'answer']) self.assertGreater(item[u'updated'], item[u'created']) def test_adding_more_items_to_the_database_using_add_more_get_request_with_default_number_of_items(self): QuestionRepository.populate(10) items = self.retrieve_all_items() self.assertEqual(len(items), 10) item = items[0] self.assertEqual('10', item[u'id']) self.add_more_items() items = self.retrieve_all_items() self.assertEqual(len(items), 20) item = items[0] self.assertEqual('20', item[u'id']) def test_adding_more_items_to_the_database_using_add_more_get_request_with_explicit_number_of_items(self): QuestionRepository.populate(10) items = self.retrieve_all_items() self.assertEqual(len(items), 10) item = items[0] self.assertEqual('10', item[u'id']) self.add_more_items(50) items = self.retrieve_all_items() self.assertEqual(len(items), 60) item = items[0] self.assertEqual('60', item[u'id']) def test_updating_selected_items_using_get_request(self): QuestionRepository.populate(5) updated = ItemsJSON.timestamp_to_float(QuestionRepository.all().get().updated) self.update_items([5, 3, 1]) new_items = self.retrieve_first_n_items_updated_after_given_timestamp(5, updated) self.assertEqual(3, len(new_items))
Support/GoogleAppEngineAppMock/handlers/items/tests/test_items.py
import unittest import webtest import json from models.questions import QuestionRepository from handlers.items.items_json import ItemsJSON from handlers.items.new_item import NewItem from handlers.items.add_more import AddMore from handlers.items.update import Update from handlers.helpers import Ready import main class ItemsTestCase(unittest.TestCase): TEST_ITEM = "Content for question " HEADER_FOR_ITEM = "Header for question " NUMBER_OF_QUESTIONS = 100 PAGE_SIZE = 40 def retrieve_first_n_items(self, number_of_items): response = self.testapp.get('%s?n=%d' % (ItemsJSON.URL, number_of_items)) self.assertEqual(response.status_int, 200) items = response.json['old'] self.assertIsNotNone(items) return items def retrieve_first_n_items_before_item_with_id(self, item_id, number_of_items): response = self.testapp.get("%s?before=%d&n=%d" % (ItemsJSON.URL, item_id, number_of_items)) self.assertEqual(response.status_int, 200) items = response.json['old'] self.assertIsNotNone(items) return items def retrieve_first_n_items_updated_after_given_timestamp(self, n, timestamp): response = self.testapp.get("%s?n=%d&timestamp=%f" % (ItemsJSON.URL, n, timestamp)) self.assertEqual(response.status_int, 200) items = response.json['new'] self.assertIsNotNone(items) return items def retrieve_all_items(self): response = self.testapp.get(ItemsJSON.URL) self.assertEqual(response.status_int, 200) items = response.json['old'] self.assertIsNotNone(items) return items def add_more_items(self, number_of_items=None): if not number_of_items: response = self.testapp.get(AddMore.URL) else: response = self.testapp.get('%s?n=%d' % (AddMore.URL, number_of_items)) self.assertEqual(response.status_int, 200) self.assertEqual(response.body, "OK") def update_items(self, items_ids): request_url = '%s?' % Update.URL param_separator = '' for item_id in items_ids: request_url += '%sid=%d' % (param_separator, item_id) param_separator = '&' response = self.testapp.get(request_url) self.assertEqual(response.status_int, 200) self.assertEqual(response.body, "OK") def setUp(self): QuestionRepository.create_table() QuestionRepository.truncate() self.testapp = webtest.TestApp(main.app) def test_checking_that_app_is_ready(self): response = self.testapp.get(Ready.URL) self.assertEqual(response.status_int, 200) self.assertEqual(response.body, "OK") def test_each_question_has_unique_id(self): QuestionRepository.populate(2) items = self.retrieve_all_items() self.assertEqual(len(items), 2) self.assertNotEqual(items[0][u'id'], items[1][u'id']) def test_each_question_has_timestamp_encoded_as_float(self): QuestionRepository.populate(2) items = self.retrieve_all_items() self.assertEqual(len(items), 2) self.assertEqual(len(items), 2) self.assertGreater(items[0][u'created'], items[1][u'created']) def test_each_question_has_updated_field_that_is_equal_to_timestamp_field(self): QuestionRepository.populate(1) items = self.retrieve_all_items() self.assertEqual(len(items), 1) self.assertEqual(len(items), 1) self.assertEqual(items[0][u'created'], items[0][u'updated']) def test_retrieving_items_using_json(self): QuestionRepository.populate(5) items = self.retrieve_all_items() self.assertEqual(len(items), 5) self.assertEqual(len(items), 5) for record_index, record in enumerate(items): self.assertEqual(record[u'content'], "%s%d" % (self.TEST_ITEM, 5 - record_index - 1), "record_index:%d, record:%s" % (record_index, record)) self.assertEqual(record[u'header'], "%s%d" % (self.HEADER_FOR_ITEM, 5 - record_index - 1), "record_index:%d, record:%s" % (record_index, record)) def test_retrieving_first_n_items_posted_before_item_with_given_id(self): QuestionRepository.populate(15) items = self.retrieve_first_n_items(5) self.assertEqual(len(items), 5) oldest_item_id = items[4][u'id'] self.assertEqual('11', oldest_item_id) items = self.retrieve_first_n_items_before_item_with_id(int(oldest_item_id), 5) self.assertEqual(len(items), 5) self.assertEqual('10', items[0][u'id']) self.assertEqual('6', items[4][u'id']) def test_retrieving_first_n_items(self): QuestionRepository.populate(20) items = self.retrieve_first_n_items(10) self.assertEqual(len(items), 10) def test_retrieving_first_n_items_when_number_of_available_items_less_than_n(self): QuestionRepository.populate(5) items = self.retrieve_first_n_items(10) self.assertEqual(len(items), 5) def test_posting_new_item_using_json(self): json_item = [{'header': 'new item header', 'content': 'new item'}] response = self.testapp.post(NewItem.URL, json.dumps(json_item), {'Content-Type': 'application/json'}) self.assertEqual(response.status_int, 200) items = self.retrieve_all_items() self.assertEqual(len(items), 1) item = items[0] self.assertEqual(item[u'content'], "new item") self.assertEqual(item[u'header'], "new item header") def test_retrieving_first_n_items_posted_after_item_with_given_id(self): QuestionRepository.populate(10) items = self.retrieve_first_n_items(5) most_recent_item_id = items[0][u'id'] most_recent_item_updated = items[0][u'updated'] self.assertEqual('10', most_recent_item_id) oldest_item_id = items[4][u'id'] self.assertEqual('6', oldest_item_id) number_of_new_items = 5 QuestionRepository.populate(number_of_new_items) new_items = self.retrieve_first_n_items_updated_after_given_timestamp(number_of_new_items, most_recent_item_updated) self.assertEqual(len(new_items), number_of_new_items) self.assertEqual('11', new_items[0][u'id']) self.assertEqual('15', new_items[4][u'id']) def test_retrieving_updated_items(self): QuestionRepository.populate(10) items = self.retrieve_first_n_items(5) most_recent_item_id = items[0][u'id'] most_recent_item_updated = items[0][u'updated'] self.assertEqual('10', most_recent_item_id) oldest_item_id = items[4][u'id'] self.assertEqual('6', oldest_item_id) number_of_new_items = 5 QuestionRepository.populate(number_of_new_items) list_of_items_to_be_updated = [6, 8, 10] QuestionRepository.update_items(list_of_items_to_be_updated) new_items = self.retrieve_first_n_items_updated_after_given_timestamp(number_of_new_items, most_recent_item_updated) self.assertEqual(len(new_items), number_of_new_items) self.assertEqual('11', new_items[0][u'id']) self.assertEqual('15', new_items[4][u'id']) new_items = self.retrieve_first_n_items_updated_after_given_timestamp(len(list_of_items_to_be_updated), new_items[4][u'updated']) self.assertEqual(len(new_items), len(list_of_items_to_be_updated)) self.assertIn(int(new_items[0][u'id']), list_of_items_to_be_updated) self.assertIn(int(new_items[1][u'id']), list_of_items_to_be_updated) self.assertIn(int(new_items[2][u'id']), list_of_items_to_be_updated) def test_retrieving_updated_items_when_no_new_items_have_been_added(self): QuestionRepository.populate(10) items = self.retrieve_first_n_items(5) most_recent_item_updated = items[0][u'updated'] most_recent_item_id = items[0][u'id'] self.assertEqual('10', most_recent_item_id) oldest_item_id = items[4][u'id'] self.assertEqual('6', oldest_item_id) list_of_items_to_be_updated = [6, 8, 10] QuestionRepository.update_items(list_of_items_to_be_updated) new_items = self.retrieve_first_n_items_updated_after_given_timestamp(5, most_recent_item_updated) self.assertEqual(len(new_items), len(list_of_items_to_be_updated)) self.assertIn(int(new_items[0][u'id']), list_of_items_to_be_updated) self.assertIn(int(new_items[1][u'id']), list_of_items_to_be_updated) self.assertIn(int(new_items[2][u'id']), list_of_items_to_be_updated) def test_adding_an_answer_to_a_question(self): QuestionRepository.populate(2) items = self.retrieve_all_items() self.assertEqual(len(items), 2) item = items[0] self.assertIsNone(item[u'answer']) QuestionRepository.update_item(item[u'id'], item[u'header'], item[u'content'], "New Answer") items = self.retrieve_all_items() item = items[0] self.assertIsNotNone(item[u'answer']) self.assertEqual("New Answer", item[u'answer']) self.assertGreater(item[u'updated'], item[u'created']) def test_adding_more_items_to_the_database_using_add_more_get_request_with_default_number_of_items(self): QuestionRepository.populate(10) items = self.retrieve_all_items() self.assertEqual(len(items), 10) item = items[0] self.assertEqual('10', item[u'id']) self.add_more_items() items = self.retrieve_all_items() self.assertEqual(len(items), 20) item = items[0] self.assertEqual('20', item[u'id']) def test_adding_more_items_to_the_database_using_add_more_get_request_with_explicit_number_of_items(self): QuestionRepository.populate(10) items = self.retrieve_all_items() self.assertEqual(len(items), 10) item = items[0] self.assertEqual('10', item[u'id']) self.add_more_items(50) items = self.retrieve_all_items() self.assertEqual(len(items), 60) item = items[0] self.assertEqual('60', item[u'id']) def test_updating_selected_items_using_get_request(self): QuestionRepository.populate(5) updated = ItemsJSON.timestamp_to_float(QuestionRepository.all().get().updated) self.update_items([5, 3, 1]) new_items = self.retrieve_first_n_items_updated_after_given_timestamp(5, updated) self.assertEqual(3, len(new_items))
0.490968
0.331904
from __future__ import print_function import os import shutil import sys import time from unittest import TestCase import unittest from sitcpy.cui import CuiServer, SessionThread, CommandClient from sitcpy.rbcp_server import default_pseudo_arg_parser, RbcpServer,\ PseudoDevice from sitcpy.templates.cui_project import daq from sitcpy.templates.cui_project.daq import DaqCommandHandler from sitcpy.templates.cui_project.pseudo import PseudoDataGenerator,\ PseudoRbcpCommandHandler PROMPT = "daq$ " class DaqTest(TestCase): def setUp(self): # pseudo args = default_pseudo_arg_parser().parse_args([]) command_port = args.port data_port = args.dataport rbcp_server = RbcpServer() data_generator = PseudoDataGenerator() rbcp_command_handler = PseudoRbcpCommandHandler("pdev$ ") rbcp_command_handler.bind(rbcp_server, data_generator) self.pdev = PseudoDevice(rbcp_command_handler, data_generator, rbcp_server, command_port, data_port) self.pdev.start() # daq self.run_no_txt_path = os.path.join( os.path.dirname(daq.__file__), "run_no.txt") if os.path.isfile(self.run_no_txt_path): os.remove(self.run_no_txt_path) self.log_dir = "log" shutil.rmtree(self.log_dir, ignore_errors=True) self.handler = DaqCommandHandler(PROMPT) self.server = CuiServer(SessionThread, self.handler, 5050) self.server.start() self.cli = CommandClient(PROMPT, "localhost", 5050) def tearDown(self): self.cli.close() self.server.stop() self.server.join() self.pdev.stop() if os.path.isfile(self.run_no_txt_path): os.remove(self.run_no_txt_path) shutil.rmtree(self.log_dir, ignore_errors=True) def test_commands(self): res = self.cli.send_command("reload").strip() self.assertTrue(res.startswith("OK:")) res = self.cli.send_command("reload _file_not_found_error_").strip() self.assertTrue(res.startswith("NG:")) # stat res = self.cli.send_command("stat").strip() self.assertTrue(len(res.splitlines()) > 5) for val in res.splitlines(): if val: self.assertEqual(len(val.split("=", 1)), 2) # rawsave res = self.cli.send_command("rawsave").strip() self.assertEqual(res, "off") res = self.cli.send_command("rawsave off").strip() self.assertEqual(res, "OK:off") res = self.cli.send_command("rawsave").strip() self.assertEqual(res, "off") res = self.cli.send_command("rawsave on").strip() self.assertEqual(res, "OK:on") res = self.cli.send_command("rawsave").strip() self.assertEqual(res, "on") # runno res = self.cli.send_command("runno 1").strip() self.assertEqual(res, "OK:1") res = self.cli.send_command("runno").strip() self.assertEqual(res, "1") res = self.cli.send_command("runno 2").strip() self.assertEqual(res, "OK:2") # exit res = self.cli.send_command("exit") self.assertTrue(res is None) def test_daq(self): self.assertFalse(os.path.isdir(self.log_dir)) self.cli.send_command("rawsave on") res = self.cli.send_command("stat").strip() print("===== stat before daq") print(res) print("/=====") res = self.cli.send_command("run 100").strip() self.assertTrue(res.startswith("NG:")) res = self.cli.send_command("run").strip() print("=====") print(res) print("/=====") time.sleep(1) res = self.cli.send_command("stat").strip() print("===== stat during daq") print(res) print("/=====") res = self.cli.send_command("run").strip() self.assertTrue(res.startswith("NG:")) time.sleep(1) res = self.cli.send_command("stop 100").strip() self.assertTrue(res.startswith("NG:")) res = self.cli.send_command("stop").strip() print("=====") print(res) print("/=====") res = self.cli.send_command("stat").strip() print("===== stat after daq") print(res) print("/=====") self.assertTrue(os.path.isdir(self.log_dir)) if __name__ == "__main__": print("python version: {0}.{1}.{2}".format(sys.version_info[0], sys.version_info[1], sys.version_info[2])) print("default encoding: {0}".format(sys.getdefaultencoding())) print() unittest.main()
tests/test_cui_project.py
from __future__ import print_function import os import shutil import sys import time from unittest import TestCase import unittest from sitcpy.cui import CuiServer, SessionThread, CommandClient from sitcpy.rbcp_server import default_pseudo_arg_parser, RbcpServer,\ PseudoDevice from sitcpy.templates.cui_project import daq from sitcpy.templates.cui_project.daq import DaqCommandHandler from sitcpy.templates.cui_project.pseudo import PseudoDataGenerator,\ PseudoRbcpCommandHandler PROMPT = "daq$ " class DaqTest(TestCase): def setUp(self): # pseudo args = default_pseudo_arg_parser().parse_args([]) command_port = args.port data_port = args.dataport rbcp_server = RbcpServer() data_generator = PseudoDataGenerator() rbcp_command_handler = PseudoRbcpCommandHandler("pdev$ ") rbcp_command_handler.bind(rbcp_server, data_generator) self.pdev = PseudoDevice(rbcp_command_handler, data_generator, rbcp_server, command_port, data_port) self.pdev.start() # daq self.run_no_txt_path = os.path.join( os.path.dirname(daq.__file__), "run_no.txt") if os.path.isfile(self.run_no_txt_path): os.remove(self.run_no_txt_path) self.log_dir = "log" shutil.rmtree(self.log_dir, ignore_errors=True) self.handler = DaqCommandHandler(PROMPT) self.server = CuiServer(SessionThread, self.handler, 5050) self.server.start() self.cli = CommandClient(PROMPT, "localhost", 5050) def tearDown(self): self.cli.close() self.server.stop() self.server.join() self.pdev.stop() if os.path.isfile(self.run_no_txt_path): os.remove(self.run_no_txt_path) shutil.rmtree(self.log_dir, ignore_errors=True) def test_commands(self): res = self.cli.send_command("reload").strip() self.assertTrue(res.startswith("OK:")) res = self.cli.send_command("reload _file_not_found_error_").strip() self.assertTrue(res.startswith("NG:")) # stat res = self.cli.send_command("stat").strip() self.assertTrue(len(res.splitlines()) > 5) for val in res.splitlines(): if val: self.assertEqual(len(val.split("=", 1)), 2) # rawsave res = self.cli.send_command("rawsave").strip() self.assertEqual(res, "off") res = self.cli.send_command("rawsave off").strip() self.assertEqual(res, "OK:off") res = self.cli.send_command("rawsave").strip() self.assertEqual(res, "off") res = self.cli.send_command("rawsave on").strip() self.assertEqual(res, "OK:on") res = self.cli.send_command("rawsave").strip() self.assertEqual(res, "on") # runno res = self.cli.send_command("runno 1").strip() self.assertEqual(res, "OK:1") res = self.cli.send_command("runno").strip() self.assertEqual(res, "1") res = self.cli.send_command("runno 2").strip() self.assertEqual(res, "OK:2") # exit res = self.cli.send_command("exit") self.assertTrue(res is None) def test_daq(self): self.assertFalse(os.path.isdir(self.log_dir)) self.cli.send_command("rawsave on") res = self.cli.send_command("stat").strip() print("===== stat before daq") print(res) print("/=====") res = self.cli.send_command("run 100").strip() self.assertTrue(res.startswith("NG:")) res = self.cli.send_command("run").strip() print("=====") print(res) print("/=====") time.sleep(1) res = self.cli.send_command("stat").strip() print("===== stat during daq") print(res) print("/=====") res = self.cli.send_command("run").strip() self.assertTrue(res.startswith("NG:")) time.sleep(1) res = self.cli.send_command("stop 100").strip() self.assertTrue(res.startswith("NG:")) res = self.cli.send_command("stop").strip() print("=====") print(res) print("/=====") res = self.cli.send_command("stat").strip() print("===== stat after daq") print(res) print("/=====") self.assertTrue(os.path.isdir(self.log_dir)) if __name__ == "__main__": print("python version: {0}.{1}.{2}".format(sys.version_info[0], sys.version_info[1], sys.version_info[2])) print("default encoding: {0}".format(sys.getdefaultencoding())) print() unittest.main()
0.301568
0.121842
import logging import os import time from socket import gethostname from flask import g, Flask, jsonify, request, send_from_directory, render_template from werkzeug.middleware.proxy_fix import ProxyFix from wbc.exceptions import WBCApiError, WBCHtmlError from wbc.views.healthcheck import Healthcheck from wbc.views.api import Document, Issue, Search, Suggest from wbc.views.html import DocumentHTML, HomeHTML, SearchHTML from .assets import register_assets from .common import get_app_version app = Flask(import_name=__name__) # config # @see http://stackoverflow.com/a/37331139/5446110 app.config['SEND_FILE_MAX_AGE_DEFAULT'] = 365 * 86400 # a year # healthcheck app.add_url_rule('/healthcheck', view_func=Healthcheck.as_view('healthcheck')) # API app.add_url_rule('/api/v1/documents/<int:document_id>', view_func=Document.as_view('documents')) app.add_url_rule('/api/v1/documents/<int:document_id>.txt', view_func=Document.as_view('documents.txt')) app.add_url_rule('/api/v1/issues/<int:issue_id>', view_func=Issue.as_view('issues')) app.add_url_rule('/api/v1/search', view_func=Search.as_view('search')) app.add_url_rule('/api/v1/suggest', view_func=Suggest.as_view('suggest')) # HTML app.add_url_rule('/', view_func=HomeHTML.as_view('home.html')) app.add_url_rule('/document/<int:document_id>.html', view_func=DocumentHTML.as_view('documents-short.html')) app.add_url_rule('/document/<int:document_id>/<string:name>.html', view_func=DocumentHTML.as_view('documents.html')) app.add_url_rule('/search', view_func=SearchHTML.as_view('search.html')) # favicon root_path = app.root_path @app.route('/favicon.ico') def favicon(): return send_from_directory(os.path.join(root_path, 'static'), filename='img/favicon.ico', mimetype='image/vnd.microsoft.icon') # robots.txt and sitemaps @app.route('/robots.txt') def robots(): return send_from_directory(os.path.join(root_path, 'static'), filename='robots.txt', mimetype='text/plain', cache_timeout=86400) # @see http://flask.pocoo.org/snippets/57/ @app.route('/sitemap.xml', defaults={'sitemap_id': 'index'}) @app.route('/sitemap-<string:sitemap_id>.xml') def sitemap(sitemap_id): """ :type sitemap_id str :rtype: flask.wrappers.ResponseBase """ return send_from_directory(os.path.join(root_path, 'sitemap'), filename='sitemap-{}.xml'.format(sitemap_id), mimetype='text/xml', cache_timeout=86400, add_etags=False) # errors handling @app.errorhandler(WBCApiError) def handle_bad_api_request(e): """ :type e WBCApiError """ return jsonify( error=True, details=e.get_message() ), e.get_response_code() # errors handling @app.errorhandler(WBCHtmlError) def handle_bad_html_request(e): """ :type e WBCHtmlError """ return render_template('error.html', message=e.get_message(), code=e.get_response_code()), e.get_response_code() @app.errorhandler(404) def handle_not_found(e): # API requests - return error messages as JSON if request.path.startswith('/api'): return handle_bad_api_request(WBCApiError('API end-point not found', 404)) # emit HTML else: return '<strong>HTTP 404</strong> not found', 404 # measure response time @app.before_request def app_before_request(): g.start = time.time() hostname = gethostname() # cache to avoid uname syscall on each request @app.after_request def app_after_request(response): """ :type response flask.wrappers.ResponseBase :rtype: flask.wrappers.ResponseBase """ response.headers.set('X-Backend-Response-Time', '{:.4f}'.format(time.time() - g.start)) response.headers.set('X-Served-By', hostname) return response # setup logging is_debug = os.environ.get('DEBUG') logging.basicConfig( level=logging.DEBUG if is_debug else logging.INFO, format='%(asctime)s %(name)-25s %(levelname)-8s %(message)s', datefmt="%Y-%m-%d %H:%M:%S" ) # emit git hash and register a helper function for templates app.logger.info('{} is now running using code {}'.format(app.name, get_app_version())) app.jinja_env.globals.update(get_app_version=get_app_version) # register assets register_assets(app) # ProxyFix app.wsgi_app = ProxyFix(app.wsgi_app)
app/wbc/__init__.py
import logging import os import time from socket import gethostname from flask import g, Flask, jsonify, request, send_from_directory, render_template from werkzeug.middleware.proxy_fix import ProxyFix from wbc.exceptions import WBCApiError, WBCHtmlError from wbc.views.healthcheck import Healthcheck from wbc.views.api import Document, Issue, Search, Suggest from wbc.views.html import DocumentHTML, HomeHTML, SearchHTML from .assets import register_assets from .common import get_app_version app = Flask(import_name=__name__) # config # @see http://stackoverflow.com/a/37331139/5446110 app.config['SEND_FILE_MAX_AGE_DEFAULT'] = 365 * 86400 # a year # healthcheck app.add_url_rule('/healthcheck', view_func=Healthcheck.as_view('healthcheck')) # API app.add_url_rule('/api/v1/documents/<int:document_id>', view_func=Document.as_view('documents')) app.add_url_rule('/api/v1/documents/<int:document_id>.txt', view_func=Document.as_view('documents.txt')) app.add_url_rule('/api/v1/issues/<int:issue_id>', view_func=Issue.as_view('issues')) app.add_url_rule('/api/v1/search', view_func=Search.as_view('search')) app.add_url_rule('/api/v1/suggest', view_func=Suggest.as_view('suggest')) # HTML app.add_url_rule('/', view_func=HomeHTML.as_view('home.html')) app.add_url_rule('/document/<int:document_id>.html', view_func=DocumentHTML.as_view('documents-short.html')) app.add_url_rule('/document/<int:document_id>/<string:name>.html', view_func=DocumentHTML.as_view('documents.html')) app.add_url_rule('/search', view_func=SearchHTML.as_view('search.html')) # favicon root_path = app.root_path @app.route('/favicon.ico') def favicon(): return send_from_directory(os.path.join(root_path, 'static'), filename='img/favicon.ico', mimetype='image/vnd.microsoft.icon') # robots.txt and sitemaps @app.route('/robots.txt') def robots(): return send_from_directory(os.path.join(root_path, 'static'), filename='robots.txt', mimetype='text/plain', cache_timeout=86400) # @see http://flask.pocoo.org/snippets/57/ @app.route('/sitemap.xml', defaults={'sitemap_id': 'index'}) @app.route('/sitemap-<string:sitemap_id>.xml') def sitemap(sitemap_id): """ :type sitemap_id str :rtype: flask.wrappers.ResponseBase """ return send_from_directory(os.path.join(root_path, 'sitemap'), filename='sitemap-{}.xml'.format(sitemap_id), mimetype='text/xml', cache_timeout=86400, add_etags=False) # errors handling @app.errorhandler(WBCApiError) def handle_bad_api_request(e): """ :type e WBCApiError """ return jsonify( error=True, details=e.get_message() ), e.get_response_code() # errors handling @app.errorhandler(WBCHtmlError) def handle_bad_html_request(e): """ :type e WBCHtmlError """ return render_template('error.html', message=e.get_message(), code=e.get_response_code()), e.get_response_code() @app.errorhandler(404) def handle_not_found(e): # API requests - return error messages as JSON if request.path.startswith('/api'): return handle_bad_api_request(WBCApiError('API end-point not found', 404)) # emit HTML else: return '<strong>HTTP 404</strong> not found', 404 # measure response time @app.before_request def app_before_request(): g.start = time.time() hostname = gethostname() # cache to avoid uname syscall on each request @app.after_request def app_after_request(response): """ :type response flask.wrappers.ResponseBase :rtype: flask.wrappers.ResponseBase """ response.headers.set('X-Backend-Response-Time', '{:.4f}'.format(time.time() - g.start)) response.headers.set('X-Served-By', hostname) return response # setup logging is_debug = os.environ.get('DEBUG') logging.basicConfig( level=logging.DEBUG if is_debug else logging.INFO, format='%(asctime)s %(name)-25s %(levelname)-8s %(message)s', datefmt="%Y-%m-%d %H:%M:%S" ) # emit git hash and register a helper function for templates app.logger.info('{} is now running using code {}'.format(app.name, get_app_version())) app.jinja_env.globals.update(get_app_version=get_app_version) # register assets register_assets(app) # ProxyFix app.wsgi_app = ProxyFix(app.wsgi_app)
0.350088
0.047448
def sisalampotila(): sisanyt = tempread.read_temp_in() return sisanyt def main(day, month, year, hour): # Setup-osa import lukeminen #Muodostetaan str-tyyppinen päiväys muodossa "dd.mm.yy" Nordpoolin hintatietojen lukemiseksi if day < 10: day = str(day) day = str("0"+day) if month < 10: month = str(month) month = str("0"+month) pvm = str("{}.{}.{}".format(day, month, year)) print(pvm) tiedot = lukeminen.luetiedot(pvm) minimi = lukeminen.minimi(tiedot) min_delta = lukeminen.min_delta(tiedot, minimi) # Etsitään ohjelma-tilan alut ja loput print("emptying csv-file\n") open("tasklists/tasklist-prog.csv", "w").close() print("entering loop") h=0 while(True): print("h=", h) for rivi in min_delta[h:]: print(rivi) h+=1 print("h=", h) if rivi > 0.19: f = open("tasklists/tasklist-prog.csv", "w") # Tähän alkuhetken tallennus f.write("start,{:d}-{:d}-{:d},{:d}:{:d}:{:d}\n".format(int(year), int(month), int(day), h-1, 0, 0)) for rivi in min_delta[h-1:]: print(rivi) h+=1 if rivi < 0.19: f = open("tasklists/tasklist-prog.csv", "a") # Tähän päättymishetken tallennus f.write("end,{:d}-{:d}-{:d},{:d}:{:d}:{:d}\n".format(int(year), int(month), int(day), h-1, 0, 0)) print("stop") # Tähän päättymishetken tallennus break break # ongelmatilanne, jossa päivän viimeinen luku ei ole alle Pd tai Pdd, jolloin looppi jää avoimeksi. if h==24: break #Ratkaistaan prog-tilan aikaväli, jonka jälkeen lasketaan mihin lämpötilaan rakennus pitää lämmittää ennen välin alkua. #Välin aikana lasketaan milloin pitää lämmittää lisää jotta lämpötila pysyy Tmin yläpuolella.
tulkinta.py
def sisalampotila(): sisanyt = tempread.read_temp_in() return sisanyt def main(day, month, year, hour): # Setup-osa import lukeminen #Muodostetaan str-tyyppinen päiväys muodossa "dd.mm.yy" Nordpoolin hintatietojen lukemiseksi if day < 10: day = str(day) day = str("0"+day) if month < 10: month = str(month) month = str("0"+month) pvm = str("{}.{}.{}".format(day, month, year)) print(pvm) tiedot = lukeminen.luetiedot(pvm) minimi = lukeminen.minimi(tiedot) min_delta = lukeminen.min_delta(tiedot, minimi) # Etsitään ohjelma-tilan alut ja loput print("emptying csv-file\n") open("tasklists/tasklist-prog.csv", "w").close() print("entering loop") h=0 while(True): print("h=", h) for rivi in min_delta[h:]: print(rivi) h+=1 print("h=", h) if rivi > 0.19: f = open("tasklists/tasklist-prog.csv", "w") # Tähän alkuhetken tallennus f.write("start,{:d}-{:d}-{:d},{:d}:{:d}:{:d}\n".format(int(year), int(month), int(day), h-1, 0, 0)) for rivi in min_delta[h-1:]: print(rivi) h+=1 if rivi < 0.19: f = open("tasklists/tasklist-prog.csv", "a") # Tähän päättymishetken tallennus f.write("end,{:d}-{:d}-{:d},{:d}:{:d}:{:d}\n".format(int(year), int(month), int(day), h-1, 0, 0)) print("stop") # Tähän päättymishetken tallennus break break # ongelmatilanne, jossa päivän viimeinen luku ei ole alle Pd tai Pdd, jolloin looppi jää avoimeksi. if h==24: break #Ratkaistaan prog-tilan aikaväli, jonka jälkeen lasketaan mihin lämpötilaan rakennus pitää lämmittää ennen välin alkua. #Välin aikana lasketaan milloin pitää lämmittää lisää jotta lämpötila pysyy Tmin yläpuolella.
0.128881
0.26011
import numpy def fill_in_zeros(fwd_rvs_align_list, ref_len, nt): """ Generate alignment counts for every nucleotide in the reference :param fwd_rvs_align_list: list of sorted forwards and reverse alignments :param ref_len: number of nucleotides in the reference sequence (int) :param nt: length of the aligned reads (int) :return: reference_x_axis ([0,0,...] (list(int)) - length of refseq seq, fwd_alignment_y_axis [2,4,5.2,6,....] (list(float)) - sense strand alignment count (positive), fwd_rvs_align_list [-3,-4,-5.6,...] (list(float)) - antisense strand alignment count (negative) """ sorted_fwd_alignment = fwd_rvs_align_list[0] sorted_rvs_alignment = fwd_rvs_align_list[1] fwd_alignment_y_axis = [0] * ref_len revs_alignment_y_axis = [0] * ref_len reference_x_axis = list(range(0, ref_len)) #Note alignment position for graphing is in the centre of the read (and not the 5' end) for i in sorted_fwd_alignment: fwd_alignment_y_axis[i[0] + int(nt / 2)] = i[1] for i in sorted_rvs_alignment: revs_alignment_y_axis[i[0] - int(nt / 2)] = i[1] # #Coverage per nucleotide instead - maybe use? # for i in sorted_fwd_alignment: # for j in range(nt): # fwd_alignment_y_axis[i[0]+j]+=i[1] # for i in sorted_rvs_alignment: # for j in range(nt): # revs_alignment_y_axis[i[0]-j]+=i[1] return reference_x_axis, fwd_alignment_y_axis, revs_alignment_y_axis def calc_alignments_by_strand(fwd_rvs_align_list): """ :param fwd_rvs_align_list: list of sorted forwards and reverse alignments :return: Total RPMR aligned for fwd and rvs strands (float) """ sorted_fwd_alignment = fwd_rvs_align_list[0] sorted_rvs_alignment = fwd_rvs_align_list[1] fwd_align_count = 0 rvs_align_count = 0 for i in sorted_fwd_alignment: fwd_align_count += i[1] for i in sorted_rvs_alignment: rvs_align_count -= i[1] return fwd_align_count, rvs_align_count def smooth(x, window_len, window='hamming'): """ Smoothing function from scipy cookbook :param x: :param window_len: :param window: :return: """ if x.ndim != 1: raise ValueError("smooth only accepts 1 dimension arrays.") if x.size < window_len: raise ValueError("Input vector needs to be bigger than window size.") if window_len < 6: return x if not window in ['flat', 'hanning', 'hamming', 'bartlett', 'blackman']: raise ValueError("Window is one of 'flat', 'hanning', 'hamming', 'bartlett', 'blackman'") s = numpy.r_[x[window_len - 1:0:-1], x, x[-1:-window_len:-1]] if window == 'flat': # moving average w = numpy.ones(window_len, 'd') else: w = eval('numpy.' + window + '(window_len)') y = numpy.convolve(w / w.sum(), s, mode='valid') return y[int(window_len / 2 - 1):-int(window_len / 2)]
scram_modules/post_process.py
import numpy def fill_in_zeros(fwd_rvs_align_list, ref_len, nt): """ Generate alignment counts for every nucleotide in the reference :param fwd_rvs_align_list: list of sorted forwards and reverse alignments :param ref_len: number of nucleotides in the reference sequence (int) :param nt: length of the aligned reads (int) :return: reference_x_axis ([0,0,...] (list(int)) - length of refseq seq, fwd_alignment_y_axis [2,4,5.2,6,....] (list(float)) - sense strand alignment count (positive), fwd_rvs_align_list [-3,-4,-5.6,...] (list(float)) - antisense strand alignment count (negative) """ sorted_fwd_alignment = fwd_rvs_align_list[0] sorted_rvs_alignment = fwd_rvs_align_list[1] fwd_alignment_y_axis = [0] * ref_len revs_alignment_y_axis = [0] * ref_len reference_x_axis = list(range(0, ref_len)) #Note alignment position for graphing is in the centre of the read (and not the 5' end) for i in sorted_fwd_alignment: fwd_alignment_y_axis[i[0] + int(nt / 2)] = i[1] for i in sorted_rvs_alignment: revs_alignment_y_axis[i[0] - int(nt / 2)] = i[1] # #Coverage per nucleotide instead - maybe use? # for i in sorted_fwd_alignment: # for j in range(nt): # fwd_alignment_y_axis[i[0]+j]+=i[1] # for i in sorted_rvs_alignment: # for j in range(nt): # revs_alignment_y_axis[i[0]-j]+=i[1] return reference_x_axis, fwd_alignment_y_axis, revs_alignment_y_axis def calc_alignments_by_strand(fwd_rvs_align_list): """ :param fwd_rvs_align_list: list of sorted forwards and reverse alignments :return: Total RPMR aligned for fwd and rvs strands (float) """ sorted_fwd_alignment = fwd_rvs_align_list[0] sorted_rvs_alignment = fwd_rvs_align_list[1] fwd_align_count = 0 rvs_align_count = 0 for i in sorted_fwd_alignment: fwd_align_count += i[1] for i in sorted_rvs_alignment: rvs_align_count -= i[1] return fwd_align_count, rvs_align_count def smooth(x, window_len, window='hamming'): """ Smoothing function from scipy cookbook :param x: :param window_len: :param window: :return: """ if x.ndim != 1: raise ValueError("smooth only accepts 1 dimension arrays.") if x.size < window_len: raise ValueError("Input vector needs to be bigger than window size.") if window_len < 6: return x if not window in ['flat', 'hanning', 'hamming', 'bartlett', 'blackman']: raise ValueError("Window is one of 'flat', 'hanning', 'hamming', 'bartlett', 'blackman'") s = numpy.r_[x[window_len - 1:0:-1], x, x[-1:-window_len:-1]] if window == 'flat': # moving average w = numpy.ones(window_len, 'd') else: w = eval('numpy.' + window + '(window_len)') y = numpy.convolve(w / w.sum(), s, mode='valid') return y[int(window_len / 2 - 1):-int(window_len / 2)]
0.646125
0.468912
import collections import boto3 import botocore import logging import os import uuid logger = logging.getLogger(__name__) def downloadFile(srcFile, destFile): ''' Download file from S3 ''' s3 = boto3.resource('s3') bucket, key = find_bucket_key(srcFile) try: s3.meta.client.download_file(bucket, key, destFile) except botocore.exceptions.ClientError as e: logger.warn(e) def exists(s3path): ''' Return true is s3path is an object, else false ''' s3 = boto3.resource('s3') bucket, key = find_bucket_key(s3path) try: s3.Object(bucket, key).load() except botocore.exceptions.ClientError as e: if e.response['Error']['Code'] == "404": # The object does not exist. return False else: # Something else has gone wrong. raise # The object does exist. return True def uploadFile(srcFile, destFile): ''' Upload a file to S3 ''' s3 = boto3.resource('s3') bucket, key = find_bucket_key(destFile) s3.meta.client.upload_file(srcFile, bucket, key, ExtraArgs={'ServerSideEncryption': 'AES256'}) def find_bucket_key(s3path): """ This is a helper function that given an s3 path such that the path is of the form: bucket/key It will return the bucket and the key represented by the s3 path, eg if s3path == s3://bmsrd-ngs-data/P-234 """ if s3path.startswith('s3://'): s3path = s3path[5:] s3components = s3path.split('/') bucket = s3components[0] s3key = "" if len(s3components) > 1: s3key = '/'.join(s3components[1:]) return bucket, s3key def listFiles(s3_cache_dir, suffix=None): ''' Return a list of files in s3_cache_dir ''' files = [] bucketName, folder = find_bucket_key(s3_cache_dir) s3bucket = 's3://%s/' % bucketName s3 = boto3.resource('s3') bucket = s3.Bucket(bucketName) for obj in bucket.objects.filter(Prefix=folder + '/'): if suffix: if obj.key.endswith(suffix): files.append(s3bucket + obj.key) else: files.append(s3bucket + obj.key) return files def readSamples(sampleSheetFile): ''' readSamples reads in a sampleSheetFile consisting of three columns: name, bamfile, reference :param sampleSheetFile: tab-delimited file :return: list of {name, bam, reference} dictionaries ''' if os.path.isfile(sampleSheetFile) is False: logger.error("%s does not exist", sampleSheetFile) return False logger.info("Reading %s", sampleSheetFile) sampleNames = [] samples = [] with open(sampleSheetFile, 'r') as f: for line in f: line = line.rstrip('\r\n') if len(line) == 0 or line.startswith('#'): continue fields = line.split('\t') if len(fields) != 3: logger.error("Expected 3 columns in samplesheet, but found %s", len(fields)) return False sampleNames.append(fields[0]) sample = {"name": fields[0], "bam": fields[1], "reference": fields[2]} samples.append(sample) duplicates = [item for item, count in collections.Counter(sampleNames).items() if count > 1] if duplicates: logger.error("Duplicate sampleids found in %s", sampleSheetFile) for dup in duplicates: logger.error(dup) return False logger.info("Read %d samples.", len(samples)) return samples def generate_working_dir(working_dir_base): """ Creates a unique working directory to combat job multitenancy :param working_dir_base: base working directory :return: a unique subfolder in working_dir_base with a uuid """ working_dir = os.path.join(working_dir_base, str(uuid.uuid4())) try: os.mkdir(working_dir) except Exception as e: return working_dir_base return working_dir def delete_working_dir(working_dir): """ Deletes working directory :param working_dir: working directory """ try: shutil.rmtree(working_dir) except Exception as e: print ('Can\'t delete %s' % working_dir)
common.py
import collections import boto3 import botocore import logging import os import uuid logger = logging.getLogger(__name__) def downloadFile(srcFile, destFile): ''' Download file from S3 ''' s3 = boto3.resource('s3') bucket, key = find_bucket_key(srcFile) try: s3.meta.client.download_file(bucket, key, destFile) except botocore.exceptions.ClientError as e: logger.warn(e) def exists(s3path): ''' Return true is s3path is an object, else false ''' s3 = boto3.resource('s3') bucket, key = find_bucket_key(s3path) try: s3.Object(bucket, key).load() except botocore.exceptions.ClientError as e: if e.response['Error']['Code'] == "404": # The object does not exist. return False else: # Something else has gone wrong. raise # The object does exist. return True def uploadFile(srcFile, destFile): ''' Upload a file to S3 ''' s3 = boto3.resource('s3') bucket, key = find_bucket_key(destFile) s3.meta.client.upload_file(srcFile, bucket, key, ExtraArgs={'ServerSideEncryption': 'AES256'}) def find_bucket_key(s3path): """ This is a helper function that given an s3 path such that the path is of the form: bucket/key It will return the bucket and the key represented by the s3 path, eg if s3path == s3://bmsrd-ngs-data/P-234 """ if s3path.startswith('s3://'): s3path = s3path[5:] s3components = s3path.split('/') bucket = s3components[0] s3key = "" if len(s3components) > 1: s3key = '/'.join(s3components[1:]) return bucket, s3key def listFiles(s3_cache_dir, suffix=None): ''' Return a list of files in s3_cache_dir ''' files = [] bucketName, folder = find_bucket_key(s3_cache_dir) s3bucket = 's3://%s/' % bucketName s3 = boto3.resource('s3') bucket = s3.Bucket(bucketName) for obj in bucket.objects.filter(Prefix=folder + '/'): if suffix: if obj.key.endswith(suffix): files.append(s3bucket + obj.key) else: files.append(s3bucket + obj.key) return files def readSamples(sampleSheetFile): ''' readSamples reads in a sampleSheetFile consisting of three columns: name, bamfile, reference :param sampleSheetFile: tab-delimited file :return: list of {name, bam, reference} dictionaries ''' if os.path.isfile(sampleSheetFile) is False: logger.error("%s does not exist", sampleSheetFile) return False logger.info("Reading %s", sampleSheetFile) sampleNames = [] samples = [] with open(sampleSheetFile, 'r') as f: for line in f: line = line.rstrip('\r\n') if len(line) == 0 or line.startswith('#'): continue fields = line.split('\t') if len(fields) != 3: logger.error("Expected 3 columns in samplesheet, but found %s", len(fields)) return False sampleNames.append(fields[0]) sample = {"name": fields[0], "bam": fields[1], "reference": fields[2]} samples.append(sample) duplicates = [item for item, count in collections.Counter(sampleNames).items() if count > 1] if duplicates: logger.error("Duplicate sampleids found in %s", sampleSheetFile) for dup in duplicates: logger.error(dup) return False logger.info("Read %d samples.", len(samples)) return samples def generate_working_dir(working_dir_base): """ Creates a unique working directory to combat job multitenancy :param working_dir_base: base working directory :return: a unique subfolder in working_dir_base with a uuid """ working_dir = os.path.join(working_dir_base, str(uuid.uuid4())) try: os.mkdir(working_dir) except Exception as e: return working_dir_base return working_dir def delete_working_dir(working_dir): """ Deletes working directory :param working_dir: working directory """ try: shutil.rmtree(working_dir) except Exception as e: print ('Can\'t delete %s' % working_dir)
0.341363
0.109658
import tensorflow as tf import numpy as np class PatrollerValue(object): def __init__(self, args, scope): with tf.variable_scope(scope): self.args = args self.row_num = self.args.row_num self.column_num = self.args.column_num self.in_channel = self.args.pa_state_size self.id_action = { 0: 'still', 1: 'up', 2: 'down', 3: 'left', 4: 'right' } self.variables = [] # Input placeholders self.input_state = tf.placeholder(tf.float32, [None, self.row_num, self.column_num, self.in_channel]) self.state_values_target = tf.placeholder(tf.float32) # 4-D, [batch_size, row, col, state_channel] [-1, 7, 7, 10] self.learning_rate = tf.placeholder(tf.float32) # Build Graph with tf.variable_scope('conv-maxpool-0'): if self.args.row_num == 7: filter_shape = [4, 4, self.in_channel, 16] elif self.args.row_num == 5: filter_shape = [3, 3, self.in_channel, 16] elif self.args.row_num == 3: filter_shape = [2, 2, self.in_channel, 16] self.W0 = tf.get_variable(name='weights', initializer=tf.truncated_normal(filter_shape, stddev=0.001)) self.b0 = tf.get_variable(name='bias', initializer=tf.zeros([16])) self.conv0 = tf.nn.conv2d(self.input_state, self.W0, strides=[1, 1, 1, 1], padding="SAME") self.conv0 = tf.nn.relu(tf.nn.bias_add(self.conv0, self.b0), name="relu") # Batch x 7 x 7 x 16 self.variables.append(self.W0) self.variables.append(self.b0) with tf.variable_scope('conv-maxpool-1'): filter_shape = [2, 2, 16, 32] self.W1 = tf.get_variable(name='weights', initializer=tf.truncated_normal(filter_shape, stddev=0.001)) self.b1 = tf.get_variable(name='bias', initializer=tf.zeros([32])) self.conv1 = tf.nn.conv2d(self.conv0, self.W1, strides=[1, 2, 2, 1], padding="SAME") self.conv1 = tf.nn.relu(tf.nn.bias_add(self.conv1, self.b1), name="relu") # Batch x 4 x 4 x 32 self.variables.append(self.W1) self.variables.append(self.b1) with tf.variable_scope('fc0'): if self.args.row_num == 7: self.Wf0 = tf.get_variable(name='weights', initializer=tf.truncated_normal([4 * 4 * 32, 64], stddev=0.001)) self.fc0 = tf.reshape(self.conv1, [-1, 4 * 4 * 32]) elif self.args.row_num == 5: self.Wf0 = tf.get_variable(name='weights', initializer=tf.truncated_normal([3 * 3 * 32, 64], stddev=0.001)) self.fc0 = tf.reshape(self.conv1, [-1, 3 * 3 * 32]) elif self.args.row_num == 3: self.Wf0 = tf.get_variable(name='weights', initializer=tf.truncated_normal([2 * 2 * 32, 64], stddev=0.001)) self.fc0 = tf.reshape(self.conv1, [-1, 2 * 2 * 32]) # self.Wf0 = tf.get_variable(name='weights', # initializer=tf.truncated_normal([4 * 4 * 32, 64], stddev=0.001)) self.bf0 = tf.get_variable(name='bias', initializer=tf.zeros([64])) # self.fc0 = tf.reshape(self.conv1, [-1, 4 * 4 * 32]) self.fc0 = tf.add(tf.matmul(self.fc0, self.Wf0), self.bf0) self.fc0 = tf.nn.relu(self.fc0) self.variables.append(self.Wf0) self.variables.append(self.bf0) with tf.variable_scope('out'): self.Wo = tf.get_variable(name='weights', initializer=tf.truncated_normal([64, 1])) self.bo = tf.get_variable(name='bias', initializer=tf.zeros([1])) self.state_values = tf.reshape(tf.add(tf.matmul(self.fc0, self.Wo), self.bo), [-1]) # batch_size self.variables.append(self.Wo) self.variables.append(self.bo) # Train operation self.loss = tf.reduce_mean(tf.square(self.state_values - self.state_values_target)) self.train_op = tf.train.RMSPropOptimizer(learning_rate=self.learning_rate, momentum=0.95, epsilon=0.01).minimize(self.loss) def get_state_value(self, sess, states): state_values = sess.run(self.state_values, {self.input_state: states}) return state_values def save(self, sess, filename): saver = tf.train.Saver(self.variables) saver.save(sess, filename) def load(self, sess, filename): saver = tf.train.Saver(self.variables) saver.restore(sess, filename)
AC_patroller/patroller_value_network.py
import tensorflow as tf import numpy as np class PatrollerValue(object): def __init__(self, args, scope): with tf.variable_scope(scope): self.args = args self.row_num = self.args.row_num self.column_num = self.args.column_num self.in_channel = self.args.pa_state_size self.id_action = { 0: 'still', 1: 'up', 2: 'down', 3: 'left', 4: 'right' } self.variables = [] # Input placeholders self.input_state = tf.placeholder(tf.float32, [None, self.row_num, self.column_num, self.in_channel]) self.state_values_target = tf.placeholder(tf.float32) # 4-D, [batch_size, row, col, state_channel] [-1, 7, 7, 10] self.learning_rate = tf.placeholder(tf.float32) # Build Graph with tf.variable_scope('conv-maxpool-0'): if self.args.row_num == 7: filter_shape = [4, 4, self.in_channel, 16] elif self.args.row_num == 5: filter_shape = [3, 3, self.in_channel, 16] elif self.args.row_num == 3: filter_shape = [2, 2, self.in_channel, 16] self.W0 = tf.get_variable(name='weights', initializer=tf.truncated_normal(filter_shape, stddev=0.001)) self.b0 = tf.get_variable(name='bias', initializer=tf.zeros([16])) self.conv0 = tf.nn.conv2d(self.input_state, self.W0, strides=[1, 1, 1, 1], padding="SAME") self.conv0 = tf.nn.relu(tf.nn.bias_add(self.conv0, self.b0), name="relu") # Batch x 7 x 7 x 16 self.variables.append(self.W0) self.variables.append(self.b0) with tf.variable_scope('conv-maxpool-1'): filter_shape = [2, 2, 16, 32] self.W1 = tf.get_variable(name='weights', initializer=tf.truncated_normal(filter_shape, stddev=0.001)) self.b1 = tf.get_variable(name='bias', initializer=tf.zeros([32])) self.conv1 = tf.nn.conv2d(self.conv0, self.W1, strides=[1, 2, 2, 1], padding="SAME") self.conv1 = tf.nn.relu(tf.nn.bias_add(self.conv1, self.b1), name="relu") # Batch x 4 x 4 x 32 self.variables.append(self.W1) self.variables.append(self.b1) with tf.variable_scope('fc0'): if self.args.row_num == 7: self.Wf0 = tf.get_variable(name='weights', initializer=tf.truncated_normal([4 * 4 * 32, 64], stddev=0.001)) self.fc0 = tf.reshape(self.conv1, [-1, 4 * 4 * 32]) elif self.args.row_num == 5: self.Wf0 = tf.get_variable(name='weights', initializer=tf.truncated_normal([3 * 3 * 32, 64], stddev=0.001)) self.fc0 = tf.reshape(self.conv1, [-1, 3 * 3 * 32]) elif self.args.row_num == 3: self.Wf0 = tf.get_variable(name='weights', initializer=tf.truncated_normal([2 * 2 * 32, 64], stddev=0.001)) self.fc0 = tf.reshape(self.conv1, [-1, 2 * 2 * 32]) # self.Wf0 = tf.get_variable(name='weights', # initializer=tf.truncated_normal([4 * 4 * 32, 64], stddev=0.001)) self.bf0 = tf.get_variable(name='bias', initializer=tf.zeros([64])) # self.fc0 = tf.reshape(self.conv1, [-1, 4 * 4 * 32]) self.fc0 = tf.add(tf.matmul(self.fc0, self.Wf0), self.bf0) self.fc0 = tf.nn.relu(self.fc0) self.variables.append(self.Wf0) self.variables.append(self.bf0) with tf.variable_scope('out'): self.Wo = tf.get_variable(name='weights', initializer=tf.truncated_normal([64, 1])) self.bo = tf.get_variable(name='bias', initializer=tf.zeros([1])) self.state_values = tf.reshape(tf.add(tf.matmul(self.fc0, self.Wo), self.bo), [-1]) # batch_size self.variables.append(self.Wo) self.variables.append(self.bo) # Train operation self.loss = tf.reduce_mean(tf.square(self.state_values - self.state_values_target)) self.train_op = tf.train.RMSPropOptimizer(learning_rate=self.learning_rate, momentum=0.95, epsilon=0.01).minimize(self.loss) def get_state_value(self, sess, states): state_values = sess.run(self.state_values, {self.input_state: states}) return state_values def save(self, sess, filename): saver = tf.train.Saver(self.variables) saver.save(sess, filename) def load(self, sess, filename): saver = tf.train.Saver(self.variables) saver.restore(sess, filename)
0.819026
0.31258
import json import math import os from bnlcrl import visualize as vis from bnlcrl.utils import convert_types, defaults_file, read_json parms = defaults_file(suffix='delta') DAT_DIR = parms['dat_dir'] CONFIG_DIR = parms['config_dir'] DEFAULTS_FILE = parms['defaults_file'] class DeltaFinder: def __init__(self, **kwargs): # Check importable libs: self._check_imports() # Get input variables: d = read_json(DEFAULTS_FILE) self.server_info = d['server_info'] self.parameters = convert_types(d['parameters']) self.default_e_min = self.parameters['e_min']['type'](self.parameters['e_min']['default']) self.default_e_max = self.parameters['e_max']['type'](self.parameters['e_max']['default']) for key, default_val in self.parameters.items(): if key in kwargs.keys(): setattr(self, key, self.parameters[key]['type'](kwargs[key])) elif not hasattr(self, key) or getattr(self, key) is None: setattr(self, key, default_val['default']) self.characteristic_value = None self.analytical_delta = None self.closest_energy = None self.content = None self.raw_content = None self.method = None # can be 'file', 'server', 'calculation' self.output = None self.elements = self.formula.split(',') self.element = self.elements[-1] if self.outfile: self.save_to_file() return if not self.data_file: self.method = 'server' self._request_from_server() else: self.method = 'file' self.data_file = os.path.join(DAT_DIR, self.data_file) if self.calc_delta: if self.available_libs['periodictable']: self.method = 'calculation' self.calculate_delta() self.characteristic_value = self.analytical_delta self.closest_energy = self.energy else: raise ValueError('"periodictable" library is not available. Install it if you want to use it.') else: self._find_characteristic_value() if self.verbose: self.print_info() if self.save_output: return_dict = {} for k in d['cli_functions']['find_delta']['returns']: return_dict[k] = getattr(self, k) file_name = '{}.json'.format(_output_file_name(self.elements, self.characteristic)) with open(file_name, 'w') as f: json.dump(return_dict, f) def calculate_delta(self): rho = getattr(self.periodictable, self.formula).density z = getattr(self.periodictable, self.formula).number mass = getattr(self.periodictable, self.formula).mass z_over_a = z / mass wl = 2 * math.pi * 1973 / self.energy # lambda= (2pi (hc))/E self.analytical_delta = 2.7e-6 * wl ** 2 * rho * z_over_a def print_info(self): msg = 'Found {}={} for the closest energy={} eV from {}.' print(msg.format(self.characteristic, self.characteristic_value, self.closest_energy, self.method)) def save_to_file(self): self.e_min = self.default_e_min self.e_max = self.e_min counter = 0 try: os.remove(self.outfile) except: pass while self.e_max < self.default_e_max: self.e_max += self.n_points * self.e_step if self.e_max > self.default_e_max: self.e_max = self.default_e_max self._request_from_server() if counter > 0: # Get rid of headers (2 first rows) and the first data row to avoid data overlap: content = self.content.split('\n') self.content = '\n'.join(content[3:]) with open(self.outfile, 'a') as f: f.write(self.content) counter += 1 self.e_min = self.e_max if self.verbose: print('Data from {} eV to {} eV saved to the <{}> file.'.format( self.default_e_min, self.default_e_max, self.outfile)) print('Energy step: {} eV, number of points/chunk: {}, number of chunks {}.'.format( self.e_step, self.n_points, counter)) def _check_imports(self): self.available_libs = { 'numpy': None, 'periodictable': None, 'requests': None, } for key in self.available_libs.keys(): try: __import__(key) setattr(self, key, __import__(key)) self.available_libs[key] = True except: self.available_libs[key] = False def _find_characteristic_value(self): skiprows = 2 energy_column = 0 characteristic_value_column = 1 error_msg = 'Error! Use energy range from {} to {} eV.' if self.use_numpy and self.available_libs['numpy']: if self.data_file: data = self.numpy.loadtxt(self.data_file, skiprows=skiprows) self.default_e_min = data[0, energy_column] self.default_e_max = data[-1, energy_column] try: idx_previous = self.numpy.where(data[:, energy_column] <= self.energy)[0][-1] idx_next = self.numpy.where(data[:, energy_column] > self.energy)[0][0] except IndexError: raise Exception(error_msg.format(self.default_e_min, self.default_e_max)) idx = idx_previous if abs(data[idx_previous, energy_column] - self.energy) <= abs( data[idx_next, energy_column] - self.energy) else idx_next self.characteristic_value = data[idx][characteristic_value_column] self.closest_energy = data[idx][energy_column] else: raise Exception('Processing with NumPy is only possible with the specified file, not content.') else: if not self.content: with open(self.data_file, 'r') as f: self.raw_content = f.read() else: if type(self.content) != list: self.raw_content = self.content self.content = self.raw_content.strip().split('\n') energies = [] characteristic_values = [] for i in range(skiprows, len(self.content)): energies.append(float(self.content[i].split()[energy_column])) characteristic_values.append(float(self.content[i].split()[characteristic_value_column])) self.default_e_min = energies[0] self.default_e_max = energies[-1] indices_previous = [] indices_next = [] try: for i in range(len(energies)): if energies[i] <= self.energy: indices_previous.append(i) else: indices_next.append(i) idx_previous = indices_previous[-1] idx_next = indices_next[0] except IndexError: raise Exception(error_msg.format(self.default_e_min, self.default_e_max)) idx = idx_previous if abs(energies[idx_previous] - self.energy) <= abs( energies[idx_next] - self.energy) else idx_next self.characteristic_value = characteristic_values[idx] self.closest_energy = energies[idx] if self.characteristic == 'atten': self.characteristic_value *= 1e-6 # Atten Length (microns) def _get_remote_file_content(self): get_url = '{}{}'.format(self.server_info['server'], self.file_name) r = self.requests.get(get_url) self.content = r.text return self.content def _get_remote_file_name(self, formula=None): if self.precise: e_min = self.energy - 1.0 e_max = self.energy + 1.0 else: e_min = self.e_min e_max = self.e_max payload = { self.server_info[self.characteristic]['fields']['density']: -1, self.server_info[self.characteristic]['fields']['formula']: formula, self.server_info[self.characteristic]['fields']['material']: 'Enter Formula', self.server_info[self.characteristic]['fields']['max']: e_max, self.server_info[self.characteristic]['fields']['min']: e_min, self.server_info[self.characteristic]['fields']['npts']: self.n_points, self.server_info[self.characteristic]['fields']['output']: 'Text File', self.server_info[self.characteristic]['fields']['scan']: 'Energy', } if self.characteristic == 'atten': payload[self.server_info[self.characteristic]['fields']['fixed']] = 90.0 payload[self.server_info[self.characteristic]['fields']['plot']] = 'Log' payload[self.server_info[self.characteristic]['fields']['output']] = 'Plot', elif self.characteristic == 'transmission': payload[self.server_info[self.characteristic]['fields']['plot']] = 'Linear' payload[self.server_info[self.characteristic]['fields']['output']] = 'Plot', payload[self.server_info[self.characteristic]['fields']['thickness']] = self.thickness # um r = self.requests.post( '{}{}'.format(self.server_info['server'], self.server_info[self.characteristic]['post_url']), payload ) content = r.text # The file name should be something like '/tmp/xray2565.dat': try: self.file_name = str( content.split('{}='.format(self.server_info[self.characteristic]['file_tag']))[1] .split('>')[0] .replace('"', '') ) except: raise Exception('\n\nFile name cannot be found! Server response:\n<{}>'.format(content.strip())) def _request_from_server(self): if self.available_libs['requests']: d = [] for f in self.formula.split(','): # to support multiple chemical elements comma-separated list self._get_remote_file_name(formula=f) r = self._get_remote_file_content() d.append(r) if self.plot or self.save: df, columns = vis.to_dataframe(d, self.elements) if df is not None and columns is not None: file_name = _output_file_name(self.elements, self.characteristic) if self.plot: vis.plot_data( df=df, elements=self.elements, property=self.characteristic, thickness=self.thickness, e_min=self.e_min, e_max=self.e_max, n_points=self.n_points, file_name=file_name, x_label=columns[0], show_plot=self.show_plot, ) if self.save: vis.save_to_csv(df=df, file_name=file_name) else: msg = 'Cannot use online resource <{}> to get {}. Use local file instead.' raise Exception(msg.format(self.server_info['server'], self.characteristic)) def _output_file_name(elements, characteristic): return '{}_{}'.format(','.join(elements), characteristic) if len(elements) > 1 else characteristic
bnlcrl/delta_finder.py
import json import math import os from bnlcrl import visualize as vis from bnlcrl.utils import convert_types, defaults_file, read_json parms = defaults_file(suffix='delta') DAT_DIR = parms['dat_dir'] CONFIG_DIR = parms['config_dir'] DEFAULTS_FILE = parms['defaults_file'] class DeltaFinder: def __init__(self, **kwargs): # Check importable libs: self._check_imports() # Get input variables: d = read_json(DEFAULTS_FILE) self.server_info = d['server_info'] self.parameters = convert_types(d['parameters']) self.default_e_min = self.parameters['e_min']['type'](self.parameters['e_min']['default']) self.default_e_max = self.parameters['e_max']['type'](self.parameters['e_max']['default']) for key, default_val in self.parameters.items(): if key in kwargs.keys(): setattr(self, key, self.parameters[key]['type'](kwargs[key])) elif not hasattr(self, key) or getattr(self, key) is None: setattr(self, key, default_val['default']) self.characteristic_value = None self.analytical_delta = None self.closest_energy = None self.content = None self.raw_content = None self.method = None # can be 'file', 'server', 'calculation' self.output = None self.elements = self.formula.split(',') self.element = self.elements[-1] if self.outfile: self.save_to_file() return if not self.data_file: self.method = 'server' self._request_from_server() else: self.method = 'file' self.data_file = os.path.join(DAT_DIR, self.data_file) if self.calc_delta: if self.available_libs['periodictable']: self.method = 'calculation' self.calculate_delta() self.characteristic_value = self.analytical_delta self.closest_energy = self.energy else: raise ValueError('"periodictable" library is not available. Install it if you want to use it.') else: self._find_characteristic_value() if self.verbose: self.print_info() if self.save_output: return_dict = {} for k in d['cli_functions']['find_delta']['returns']: return_dict[k] = getattr(self, k) file_name = '{}.json'.format(_output_file_name(self.elements, self.characteristic)) with open(file_name, 'w') as f: json.dump(return_dict, f) def calculate_delta(self): rho = getattr(self.periodictable, self.formula).density z = getattr(self.periodictable, self.formula).number mass = getattr(self.periodictable, self.formula).mass z_over_a = z / mass wl = 2 * math.pi * 1973 / self.energy # lambda= (2pi (hc))/E self.analytical_delta = 2.7e-6 * wl ** 2 * rho * z_over_a def print_info(self): msg = 'Found {}={} for the closest energy={} eV from {}.' print(msg.format(self.characteristic, self.characteristic_value, self.closest_energy, self.method)) def save_to_file(self): self.e_min = self.default_e_min self.e_max = self.e_min counter = 0 try: os.remove(self.outfile) except: pass while self.e_max < self.default_e_max: self.e_max += self.n_points * self.e_step if self.e_max > self.default_e_max: self.e_max = self.default_e_max self._request_from_server() if counter > 0: # Get rid of headers (2 first rows) and the first data row to avoid data overlap: content = self.content.split('\n') self.content = '\n'.join(content[3:]) with open(self.outfile, 'a') as f: f.write(self.content) counter += 1 self.e_min = self.e_max if self.verbose: print('Data from {} eV to {} eV saved to the <{}> file.'.format( self.default_e_min, self.default_e_max, self.outfile)) print('Energy step: {} eV, number of points/chunk: {}, number of chunks {}.'.format( self.e_step, self.n_points, counter)) def _check_imports(self): self.available_libs = { 'numpy': None, 'periodictable': None, 'requests': None, } for key in self.available_libs.keys(): try: __import__(key) setattr(self, key, __import__(key)) self.available_libs[key] = True except: self.available_libs[key] = False def _find_characteristic_value(self): skiprows = 2 energy_column = 0 characteristic_value_column = 1 error_msg = 'Error! Use energy range from {} to {} eV.' if self.use_numpy and self.available_libs['numpy']: if self.data_file: data = self.numpy.loadtxt(self.data_file, skiprows=skiprows) self.default_e_min = data[0, energy_column] self.default_e_max = data[-1, energy_column] try: idx_previous = self.numpy.where(data[:, energy_column] <= self.energy)[0][-1] idx_next = self.numpy.where(data[:, energy_column] > self.energy)[0][0] except IndexError: raise Exception(error_msg.format(self.default_e_min, self.default_e_max)) idx = idx_previous if abs(data[idx_previous, energy_column] - self.energy) <= abs( data[idx_next, energy_column] - self.energy) else idx_next self.characteristic_value = data[idx][characteristic_value_column] self.closest_energy = data[idx][energy_column] else: raise Exception('Processing with NumPy is only possible with the specified file, not content.') else: if not self.content: with open(self.data_file, 'r') as f: self.raw_content = f.read() else: if type(self.content) != list: self.raw_content = self.content self.content = self.raw_content.strip().split('\n') energies = [] characteristic_values = [] for i in range(skiprows, len(self.content)): energies.append(float(self.content[i].split()[energy_column])) characteristic_values.append(float(self.content[i].split()[characteristic_value_column])) self.default_e_min = energies[0] self.default_e_max = energies[-1] indices_previous = [] indices_next = [] try: for i in range(len(energies)): if energies[i] <= self.energy: indices_previous.append(i) else: indices_next.append(i) idx_previous = indices_previous[-1] idx_next = indices_next[0] except IndexError: raise Exception(error_msg.format(self.default_e_min, self.default_e_max)) idx = idx_previous if abs(energies[idx_previous] - self.energy) <= abs( energies[idx_next] - self.energy) else idx_next self.characteristic_value = characteristic_values[idx] self.closest_energy = energies[idx] if self.characteristic == 'atten': self.characteristic_value *= 1e-6 # Atten Length (microns) def _get_remote_file_content(self): get_url = '{}{}'.format(self.server_info['server'], self.file_name) r = self.requests.get(get_url) self.content = r.text return self.content def _get_remote_file_name(self, formula=None): if self.precise: e_min = self.energy - 1.0 e_max = self.energy + 1.0 else: e_min = self.e_min e_max = self.e_max payload = { self.server_info[self.characteristic]['fields']['density']: -1, self.server_info[self.characteristic]['fields']['formula']: formula, self.server_info[self.characteristic]['fields']['material']: 'Enter Formula', self.server_info[self.characteristic]['fields']['max']: e_max, self.server_info[self.characteristic]['fields']['min']: e_min, self.server_info[self.characteristic]['fields']['npts']: self.n_points, self.server_info[self.characteristic]['fields']['output']: 'Text File', self.server_info[self.characteristic]['fields']['scan']: 'Energy', } if self.characteristic == 'atten': payload[self.server_info[self.characteristic]['fields']['fixed']] = 90.0 payload[self.server_info[self.characteristic]['fields']['plot']] = 'Log' payload[self.server_info[self.characteristic]['fields']['output']] = 'Plot', elif self.characteristic == 'transmission': payload[self.server_info[self.characteristic]['fields']['plot']] = 'Linear' payload[self.server_info[self.characteristic]['fields']['output']] = 'Plot', payload[self.server_info[self.characteristic]['fields']['thickness']] = self.thickness # um r = self.requests.post( '{}{}'.format(self.server_info['server'], self.server_info[self.characteristic]['post_url']), payload ) content = r.text # The file name should be something like '/tmp/xray2565.dat': try: self.file_name = str( content.split('{}='.format(self.server_info[self.characteristic]['file_tag']))[1] .split('>')[0] .replace('"', '') ) except: raise Exception('\n\nFile name cannot be found! Server response:\n<{}>'.format(content.strip())) def _request_from_server(self): if self.available_libs['requests']: d = [] for f in self.formula.split(','): # to support multiple chemical elements comma-separated list self._get_remote_file_name(formula=f) r = self._get_remote_file_content() d.append(r) if self.plot or self.save: df, columns = vis.to_dataframe(d, self.elements) if df is not None and columns is not None: file_name = _output_file_name(self.elements, self.characteristic) if self.plot: vis.plot_data( df=df, elements=self.elements, property=self.characteristic, thickness=self.thickness, e_min=self.e_min, e_max=self.e_max, n_points=self.n_points, file_name=file_name, x_label=columns[0], show_plot=self.show_plot, ) if self.save: vis.save_to_csv(df=df, file_name=file_name) else: msg = 'Cannot use online resource <{}> to get {}. Use local file instead.' raise Exception(msg.format(self.server_info['server'], self.characteristic)) def _output_file_name(elements, characteristic): return '{}_{}'.format(','.join(elements), characteristic) if len(elements) > 1 else characteristic
0.418222
0.19475
import logging from . import mixin from . import core from . import Constructs from .decorators import ( _display_or_return, _inplace_enabled, _inplace_enabled_define_and_cleanup, _manage_log_level_via_verbosity, ) logger = logging.getLogger(__name__) class Domain(mixin.FieldDomain, mixin.Container, core.Domain): """A domain of the CF data model. The domain represents a set of discrete "locations" in what generally would be a multi-dimensional space, either in the real world or in a model's simulated world. These locations correspond to individual data array elements of a field construct The domain is defined collectively by the following constructs of the CF data model: domain axis, dimension coordinate, auxiliary coordinate, cell measure, coordinate reference and domain ancillary constructs. .. versionadded:: (cfdm) 1.7.0 """ def __new__(cls, *args, **kwargs): """This must be overridden in subclasses. .. versionadded:: (cfdm) 1.7.0 """ instance = super().__new__(cls) instance._Constructs = Constructs return instance def __repr__(self): """Called by the `repr` built-in function. x.__repr__() <==> repr(x) """ shape = sorted( [ domain_axis.get_size(None) for domain_axis in self.domain_axes(todict=True).values() ] ) shape = str(shape) shape = shape[1:-1] return f"<{self.__class__.__name__}: {{{shape}}}>" def __str__(self): """Called by the `str` built-in function. x.__str__() <==> str(x) """ def _print_item(self, cid, variable, axes): """Private function called by __str__.""" x = [variable.identity(default=f"key%{cid}")] if variable.has_data(): shape = [axis_names[axis] for axis in axes] shape = str(tuple(shape)).replace("'", "") shape = shape.replace(",)", ")") x.append(shape) elif ( variable.construct_type in ("auxiliary_coordinate", "domain_ancillary") and variable.has_bounds() and variable.bounds.has_data() ): # Construct has no data but it does have bounds shape = [axis_names[axis] for axis in axes] shape.extend( [str(n) for n in variable.bounds.data.shape[len(axes) :]] ) shape = str(tuple(shape)).replace("'", "") shape = shape.replace(",)", ")") x.append(shape) elif ( hasattr(variable, "nc_get_external") and variable.nc_get_external() ): ncvar = variable.nc_get_variable(None) if ncvar is not None: x.append(f" (external variable: ncvar%{ncvar}") else: x.append(" (external variable)") if variable.has_data(): x.append(f" = {variable.data}") elif ( variable.construct_type in ("auxiliary_coordinate", "domain_ancillary") and variable.has_bounds() and variable.bounds.has_data() ): # Construct has no data but it does have bounds data x.append(f" = {variable.bounds.data}") return "".join(x) string = [] axis_names = self._unique_domain_axis_identities() construct_data_axes = self.constructs.data_axes() x = [] dimension_coordinates = self.dimension_coordinates(todict=True) for axis_cid in sorted(self.domain_axes(todict=True)): for cid, dim in dimension_coordinates.items(): if construct_data_axes[cid] == (axis_cid,): name = dim.identity(default=f"key%{0}") y = "{0}({1})".format(name, dim.get_data().size) if y != axis_names[axis_cid]: y = "{0}({1})".format(name, axis_names[axis_cid]) if dim.has_data(): y += " = {0}".format(dim.get_data()) x.append(y) if x: x = "\n : ".join(x) string.append(f"Dimension coords: {x}") # Auxiliary coordinates x = [ _print_item(self, cid, v, construct_data_axes[cid]) for cid, v in sorted( self.auxiliary_coordinates(todict=True).items() ) ] if x: x = "\n : ".join(x) string.append(f"Auxiliary coords: {x}") # Cell measures x = [ _print_item(self, cid, v, construct_data_axes[cid]) for cid, v in sorted(self.cell_measures(todict=True).items()) ] if x: x = "\n : ".join(x) string.append(f"Cell measures : {x}") # Coordinate references x = sorted( [ str(ref) for ref in list( self.coordinate_references(todict=True).values() ) ] ) if x: x = "\n : ".join(x) string.append(f"Coord references: {x}") # Domain ancillary variables x = [ _print_item(self, cid, anc, construct_data_axes[cid]) for cid, anc in sorted( self.domain_ancillaries(todict=True).items() ) ] if x: x = "\n : ".join(x) string.append(f"Domain ancils : {x}") return "\n".join(string) @_display_or_return def _dump_axes(self, axis_names, display=True, _level=0): """Returns a string description of the field's domain axes. :Parameters: display: `bool`, optional If False then return the description as a string. By default the description is printed. _level: `int`, optional :Returns: `str` A string containing the description. **Examples:** """ indent1 = " " * _level w = sorted( [ f"{indent1}Domain Axis: {axis_names[axis]}" for axis in self.domain_axes(todict=True) ] ) return "\n".join(w) def _one_line_description(self, axis_names_sizes=None): """Return a one-line description of the domain. :Returns: `str` The description. """ if axis_names_sizes is None: axis_names_sizes = self._unique_domain_axis_identities() axis_names = ", ".join(sorted(axis_names_sizes.values())) return f"{self.identity('')}{{{axis_names}}}" @_inplace_enabled(default=False) def apply_masking(self, inplace=False): """Apply masking as defined by the CF conventions. Masking is applied to all metadata constructs with data. Masking is applied according to any of the following criteria that are applicable: * where data elements are equal to the value of the ``missing_value`` property; * where data elements are equal to the value of the ``_FillValue`` property; * where data elements are strictly less than the value of the ``valid_min`` property; * where data elements are strictly greater than the value of the ``valid_max`` property; * where data elements are within the inclusive range specified by the two values of ``valid_range`` property. If any of the above properties have not been set the no masking is applied for that method. Elements that are already masked remain so. .. note:: If using the `apply_masking` method on a construct that has been read from a dataset with the ``mask=False`` parameter to the `read` function, then the mask defined in the dataset can only be recreated if the ``missing_value``, ``_FillValue``, ``valid_min``, ``valid_max``, and ``valid_range`` properties have not been updated. .. versionadded:: (cfdm) 1.8.9.0 .. seealso:: `{{package}}.Data.apply_masking`, `read`, `write` :Parameters: {{inplace: `bool`, optional}} :Returns: `Domain` or `None` A new domain construct with masked values, or `None` if the operation was in-place. **Examples:** >>> d = cfdm.example_field(0).domain >>> x = d.construct('longitude') >>> x.data[[0, -1]] = cfdm.masked >>> print(x.data.array) [-- 67.5 112.5 157.5 202.5 247.5 292.5 --] >>> cfdm.write(d, 'masked.nc') >>> no_mask = {{package}}.read('masked.nc', domain=True, mask=False)[0] >>> no_mask_x = no_mask.construct('longitude') >>> print(no_mask_x.data.array) [9.96920997e+36 6.75000000e+01 1.12500000e+02 1.57500000e+02 2.02500000e+02 2.47500000e+02 2.92500000e+02 9.96920997e+36] >>> masked = no_mask.apply_masking() >>> masked_x = masked.construct('longitude') >>> print(masked_x.data.array) [-- 67.5 112.5 157.5 202.5 247.5 """ d = _inplace_enabled_define_and_cleanup(self) # Apply masking to the metadata constructs d._apply_masking_constructs() return d def climatological_time_axes(self): """Return all axes which are climatological time axes. This is ascertained by inspecting the values returned by each coordinate construct's `is_climatology` method. .. versionadded:: (cfdm) 1.8.9.0 :Returns: `set` The keys of the domain axis constructs that are climatological time axes. **Examples:** >>> d = cfdm.example_field(0) >>> d.climatological_time_axes() set() """ data_axes = self.constructs.data_axes() out = [] for ckey, c in self.coordinates(todict=True).items(): if not c.is_climatology(): continue out.extend(data_axes.get(ckey, ())) return set(out) @_display_or_return def dump(self, display=True, _level=0, _title=None): """A full description of the domain. The domain components are described without abbreviation with the exception of data arrays, which are abbreviated to their first and last values. .. versionadded:: (cfdm) 1.7.0 :Parameters: display: `bool`, optional If False then return the description as a string. By default the description is printed. *Parameter example:* ``f.dump()`` is equivalent to ``print f.dump(display=False)``. :Returns: `str` or `None` If *display* is True then the description is printed and `None` is returned. Otherwise the description is returned as a string. """ axis_to_name = self._unique_domain_axis_identities() construct_name = self._unique_construct_names() construct_data_axes = self.constructs.data_axes() string = [] # Domain axes axes = self._dump_axes(axis_to_name, display=False, _level=_level) if axes: string.append(axes) # Dimension coordinates dimension_coordinates = self.dimension_coordinates(todict=True) for cid, value in sorted(dimension_coordinates.items()): string.append("") string.append( value.dump( display=False, _level=_level, _title=f"Dimension coordinate: {construct_name[cid]}", _axes=construct_data_axes[cid], _axis_names=axis_to_name, ) ) # Auxiliary coordinates auxiliary_coordinates = self.auxiliary_coordinates(todict=True) for cid, value in sorted(auxiliary_coordinates.items()): string.append("") string.append( value.dump( display=False, _level=_level, _title=f"Auxiliary coordinate: {construct_name[cid]}", _axes=construct_data_axes[cid], _axis_names=axis_to_name, ) ) # Domain ancillaries for cid, value in sorted(self.domain_ancillaries(todict=True).items()): string.append("") string.append( value.dump( display=False, _level=_level, _title=f"Domain ancillary: {construct_name[cid]}", _axes=construct_data_axes[cid], _axis_names=axis_to_name, ) ) # Coordinate references for cid, value in sorted( self.coordinate_references(todict=True).items() ): string.append("") string.append( value.dump( display=False, _level=_level, _title=f"Coordinate reference: {construct_name[cid]}", _construct_names=construct_name, _auxiliary_coordinates=tuple(auxiliary_coordinates), _dimension_coordinates=tuple(dimension_coordinates), ) ) # Cell measures for cid, value in sorted(self.cell_measures(todict=True).items()): string.append("") string.append( value.dump( display=False, _key=cid, _level=_level, _title=f"Cell measure: {construct_name[cid]}", _axes=construct_data_axes[cid], _axis_names=axis_to_name, ) ) string.append("") return "\n".join(string) @_manage_log_level_via_verbosity def equals( self, other, rtol=None, atol=None, verbose=None, ignore_data_type=False, ignore_fill_value=False, ignore_compression=True, ignore_type=False, ): """Whether two domains are the same. .. versionadded:: (cfdm) 1.7.0 :Returns: `bool` **Examples:** >>> d.equals(d) True >>> d.equals(d.copy()) True >>> d.equals('not a domain') False """ pp = super()._equals_preprocess( other, verbose=verbose, ignore_type=ignore_type ) if pp is True or pp is False: return pp other = pp # ------------------------------------------------------------ # Check the constructs # ------------------------------------------------------------ if not self._equals( self.constructs, other.constructs, rtol=rtol, atol=atol, verbose=verbose, ignore_data_type=ignore_data_type, ignore_fill_value=ignore_fill_value, ignore_compression=ignore_compression, ): logger.info( f"{self.__class__.__name__}: Different metadata constructs" ) return False return True def get_filenames(self): """Return the file names containing the metadata construct data. :Returns: `set` The file names in normalized, absolute form. If all of the data are in memory then an empty `set` is returned. **Examples:** >>> d = {{package}}.example_field(0).domain >>> {{package}}.write(d, 'temp_file.nc') >>> e = {{package}}.read('temp_file.nc', domain=True)[0] >>> e.get_filenames() {'temp_file.nc'} """ out = set() for c in self.constructs.filter_by_data().values(): out.update(c.get_filenames()) return out
cfdm/domain.py
import logging from . import mixin from . import core from . import Constructs from .decorators import ( _display_or_return, _inplace_enabled, _inplace_enabled_define_and_cleanup, _manage_log_level_via_verbosity, ) logger = logging.getLogger(__name__) class Domain(mixin.FieldDomain, mixin.Container, core.Domain): """A domain of the CF data model. The domain represents a set of discrete "locations" in what generally would be a multi-dimensional space, either in the real world or in a model's simulated world. These locations correspond to individual data array elements of a field construct The domain is defined collectively by the following constructs of the CF data model: domain axis, dimension coordinate, auxiliary coordinate, cell measure, coordinate reference and domain ancillary constructs. .. versionadded:: (cfdm) 1.7.0 """ def __new__(cls, *args, **kwargs): """This must be overridden in subclasses. .. versionadded:: (cfdm) 1.7.0 """ instance = super().__new__(cls) instance._Constructs = Constructs return instance def __repr__(self): """Called by the `repr` built-in function. x.__repr__() <==> repr(x) """ shape = sorted( [ domain_axis.get_size(None) for domain_axis in self.domain_axes(todict=True).values() ] ) shape = str(shape) shape = shape[1:-1] return f"<{self.__class__.__name__}: {{{shape}}}>" def __str__(self): """Called by the `str` built-in function. x.__str__() <==> str(x) """ def _print_item(self, cid, variable, axes): """Private function called by __str__.""" x = [variable.identity(default=f"key%{cid}")] if variable.has_data(): shape = [axis_names[axis] for axis in axes] shape = str(tuple(shape)).replace("'", "") shape = shape.replace(",)", ")") x.append(shape) elif ( variable.construct_type in ("auxiliary_coordinate", "domain_ancillary") and variable.has_bounds() and variable.bounds.has_data() ): # Construct has no data but it does have bounds shape = [axis_names[axis] for axis in axes] shape.extend( [str(n) for n in variable.bounds.data.shape[len(axes) :]] ) shape = str(tuple(shape)).replace("'", "") shape = shape.replace(",)", ")") x.append(shape) elif ( hasattr(variable, "nc_get_external") and variable.nc_get_external() ): ncvar = variable.nc_get_variable(None) if ncvar is not None: x.append(f" (external variable: ncvar%{ncvar}") else: x.append(" (external variable)") if variable.has_data(): x.append(f" = {variable.data}") elif ( variable.construct_type in ("auxiliary_coordinate", "domain_ancillary") and variable.has_bounds() and variable.bounds.has_data() ): # Construct has no data but it does have bounds data x.append(f" = {variable.bounds.data}") return "".join(x) string = [] axis_names = self._unique_domain_axis_identities() construct_data_axes = self.constructs.data_axes() x = [] dimension_coordinates = self.dimension_coordinates(todict=True) for axis_cid in sorted(self.domain_axes(todict=True)): for cid, dim in dimension_coordinates.items(): if construct_data_axes[cid] == (axis_cid,): name = dim.identity(default=f"key%{0}") y = "{0}({1})".format(name, dim.get_data().size) if y != axis_names[axis_cid]: y = "{0}({1})".format(name, axis_names[axis_cid]) if dim.has_data(): y += " = {0}".format(dim.get_data()) x.append(y) if x: x = "\n : ".join(x) string.append(f"Dimension coords: {x}") # Auxiliary coordinates x = [ _print_item(self, cid, v, construct_data_axes[cid]) for cid, v in sorted( self.auxiliary_coordinates(todict=True).items() ) ] if x: x = "\n : ".join(x) string.append(f"Auxiliary coords: {x}") # Cell measures x = [ _print_item(self, cid, v, construct_data_axes[cid]) for cid, v in sorted(self.cell_measures(todict=True).items()) ] if x: x = "\n : ".join(x) string.append(f"Cell measures : {x}") # Coordinate references x = sorted( [ str(ref) for ref in list( self.coordinate_references(todict=True).values() ) ] ) if x: x = "\n : ".join(x) string.append(f"Coord references: {x}") # Domain ancillary variables x = [ _print_item(self, cid, anc, construct_data_axes[cid]) for cid, anc in sorted( self.domain_ancillaries(todict=True).items() ) ] if x: x = "\n : ".join(x) string.append(f"Domain ancils : {x}") return "\n".join(string) @_display_or_return def _dump_axes(self, axis_names, display=True, _level=0): """Returns a string description of the field's domain axes. :Parameters: display: `bool`, optional If False then return the description as a string. By default the description is printed. _level: `int`, optional :Returns: `str` A string containing the description. **Examples:** """ indent1 = " " * _level w = sorted( [ f"{indent1}Domain Axis: {axis_names[axis]}" for axis in self.domain_axes(todict=True) ] ) return "\n".join(w) def _one_line_description(self, axis_names_sizes=None): """Return a one-line description of the domain. :Returns: `str` The description. """ if axis_names_sizes is None: axis_names_sizes = self._unique_domain_axis_identities() axis_names = ", ".join(sorted(axis_names_sizes.values())) return f"{self.identity('')}{{{axis_names}}}" @_inplace_enabled(default=False) def apply_masking(self, inplace=False): """Apply masking as defined by the CF conventions. Masking is applied to all metadata constructs with data. Masking is applied according to any of the following criteria that are applicable: * where data elements are equal to the value of the ``missing_value`` property; * where data elements are equal to the value of the ``_FillValue`` property; * where data elements are strictly less than the value of the ``valid_min`` property; * where data elements are strictly greater than the value of the ``valid_max`` property; * where data elements are within the inclusive range specified by the two values of ``valid_range`` property. If any of the above properties have not been set the no masking is applied for that method. Elements that are already masked remain so. .. note:: If using the `apply_masking` method on a construct that has been read from a dataset with the ``mask=False`` parameter to the `read` function, then the mask defined in the dataset can only be recreated if the ``missing_value``, ``_FillValue``, ``valid_min``, ``valid_max``, and ``valid_range`` properties have not been updated. .. versionadded:: (cfdm) 1.8.9.0 .. seealso:: `{{package}}.Data.apply_masking`, `read`, `write` :Parameters: {{inplace: `bool`, optional}} :Returns: `Domain` or `None` A new domain construct with masked values, or `None` if the operation was in-place. **Examples:** >>> d = cfdm.example_field(0).domain >>> x = d.construct('longitude') >>> x.data[[0, -1]] = cfdm.masked >>> print(x.data.array) [-- 67.5 112.5 157.5 202.5 247.5 292.5 --] >>> cfdm.write(d, 'masked.nc') >>> no_mask = {{package}}.read('masked.nc', domain=True, mask=False)[0] >>> no_mask_x = no_mask.construct('longitude') >>> print(no_mask_x.data.array) [9.96920997e+36 6.75000000e+01 1.12500000e+02 1.57500000e+02 2.02500000e+02 2.47500000e+02 2.92500000e+02 9.96920997e+36] >>> masked = no_mask.apply_masking() >>> masked_x = masked.construct('longitude') >>> print(masked_x.data.array) [-- 67.5 112.5 157.5 202.5 247.5 """ d = _inplace_enabled_define_and_cleanup(self) # Apply masking to the metadata constructs d._apply_masking_constructs() return d def climatological_time_axes(self): """Return all axes which are climatological time axes. This is ascertained by inspecting the values returned by each coordinate construct's `is_climatology` method. .. versionadded:: (cfdm) 1.8.9.0 :Returns: `set` The keys of the domain axis constructs that are climatological time axes. **Examples:** >>> d = cfdm.example_field(0) >>> d.climatological_time_axes() set() """ data_axes = self.constructs.data_axes() out = [] for ckey, c in self.coordinates(todict=True).items(): if not c.is_climatology(): continue out.extend(data_axes.get(ckey, ())) return set(out) @_display_or_return def dump(self, display=True, _level=0, _title=None): """A full description of the domain. The domain components are described without abbreviation with the exception of data arrays, which are abbreviated to their first and last values. .. versionadded:: (cfdm) 1.7.0 :Parameters: display: `bool`, optional If False then return the description as a string. By default the description is printed. *Parameter example:* ``f.dump()`` is equivalent to ``print f.dump(display=False)``. :Returns: `str` or `None` If *display* is True then the description is printed and `None` is returned. Otherwise the description is returned as a string. """ axis_to_name = self._unique_domain_axis_identities() construct_name = self._unique_construct_names() construct_data_axes = self.constructs.data_axes() string = [] # Domain axes axes = self._dump_axes(axis_to_name, display=False, _level=_level) if axes: string.append(axes) # Dimension coordinates dimension_coordinates = self.dimension_coordinates(todict=True) for cid, value in sorted(dimension_coordinates.items()): string.append("") string.append( value.dump( display=False, _level=_level, _title=f"Dimension coordinate: {construct_name[cid]}", _axes=construct_data_axes[cid], _axis_names=axis_to_name, ) ) # Auxiliary coordinates auxiliary_coordinates = self.auxiliary_coordinates(todict=True) for cid, value in sorted(auxiliary_coordinates.items()): string.append("") string.append( value.dump( display=False, _level=_level, _title=f"Auxiliary coordinate: {construct_name[cid]}", _axes=construct_data_axes[cid], _axis_names=axis_to_name, ) ) # Domain ancillaries for cid, value in sorted(self.domain_ancillaries(todict=True).items()): string.append("") string.append( value.dump( display=False, _level=_level, _title=f"Domain ancillary: {construct_name[cid]}", _axes=construct_data_axes[cid], _axis_names=axis_to_name, ) ) # Coordinate references for cid, value in sorted( self.coordinate_references(todict=True).items() ): string.append("") string.append( value.dump( display=False, _level=_level, _title=f"Coordinate reference: {construct_name[cid]}", _construct_names=construct_name, _auxiliary_coordinates=tuple(auxiliary_coordinates), _dimension_coordinates=tuple(dimension_coordinates), ) ) # Cell measures for cid, value in sorted(self.cell_measures(todict=True).items()): string.append("") string.append( value.dump( display=False, _key=cid, _level=_level, _title=f"Cell measure: {construct_name[cid]}", _axes=construct_data_axes[cid], _axis_names=axis_to_name, ) ) string.append("") return "\n".join(string) @_manage_log_level_via_verbosity def equals( self, other, rtol=None, atol=None, verbose=None, ignore_data_type=False, ignore_fill_value=False, ignore_compression=True, ignore_type=False, ): """Whether two domains are the same. .. versionadded:: (cfdm) 1.7.0 :Returns: `bool` **Examples:** >>> d.equals(d) True >>> d.equals(d.copy()) True >>> d.equals('not a domain') False """ pp = super()._equals_preprocess( other, verbose=verbose, ignore_type=ignore_type ) if pp is True or pp is False: return pp other = pp # ------------------------------------------------------------ # Check the constructs # ------------------------------------------------------------ if not self._equals( self.constructs, other.constructs, rtol=rtol, atol=atol, verbose=verbose, ignore_data_type=ignore_data_type, ignore_fill_value=ignore_fill_value, ignore_compression=ignore_compression, ): logger.info( f"{self.__class__.__name__}: Different metadata constructs" ) return False return True def get_filenames(self): """Return the file names containing the metadata construct data. :Returns: `set` The file names in normalized, absolute form. If all of the data are in memory then an empty `set` is returned. **Examples:** >>> d = {{package}}.example_field(0).domain >>> {{package}}.write(d, 'temp_file.nc') >>> e = {{package}}.read('temp_file.nc', domain=True)[0] >>> e.get_filenames() {'temp_file.nc'} """ out = set() for c in self.constructs.filter_by_data().values(): out.update(c.get_filenames()) return out
0.830525
0.406037
from unittest import TestCase, main from tempfile import mkstemp from os import close, remove from os.path import exists import pandas as pd from qiita_core.util import qiita_test_checker import qiita_db as qdb @qiita_test_checker() class TestSQL(TestCase): """Tests that the database triggers and procedures work properly""" def setUp(self): self._files_to_remove = [] def tearDown(self): for fp in self._files_to_remove: if exists(fp): remove(fp) def test_find_artifact_roots_is_root(self): """Correctly returns the root if the artifact is already the root""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.find_artifact_roots(%s)" qdb.sql_connection.TRN.add(sql, [1]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[1]] self.assertEqual(obs, exp) def test_find_artifact_roots_is_child(self): """Correctly returns the root if the artifact is a child""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.find_artifact_roots(%s)" qdb.sql_connection.TRN.add(sql, [4]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[1]] self.assertEqual(obs, exp) def test_find_artifact_roots_is_child_multiple_parents_one_root(self): """Correctly returns the roots if the children has multiple parents but a single root """ fd, fp = mkstemp(suffix='_table.biom') close(fd) self._files_to_remove.append(fp) with open(fp, 'w') as f: f.write("test") fp = [(fp, 7)] params = qdb.software.Parameters.from_default_params( qdb.software.DefaultParameters(10), {'input_data': 2}) new = qdb.artifact.Artifact.create( fp, "BIOM", parents=[qdb.artifact.Artifact(2), qdb.artifact.Artifact(3)], processing_parameters=params) self._files_to_remove.extend([x['fp'] for x in new.filepaths]) with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.find_artifact_roots(%s)" qdb.sql_connection.TRN.add(sql, [new.id]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[1]] self.assertEqual(obs, exp) def _create_root_artifact(self): """Creates a new root artifact""" metadata = pd.DataFrame.from_dict( {'SKB8.640193': {'center_name': 'ANL', 'primer': 'GTGCCAGCMGCCGCGGTAA', 'barcode': 'GTCCGCAAGTTA', 'run_prefix': "s_G1_L001_sequences", 'platform': 'Illumina', 'target_gene': '16S rRNA', 'target_subfragment': 'V4', 'instrument_model': 'Illumina MiSeq', 'library_construction_protocol': 'AAAA', 'experiment_design_description': 'BBBB'}}, orient='index', dtype=str) pt = qdb.metadata_template.prep_template.PrepTemplate.create( metadata, qdb.study.Study(1), "18S") fd, fp = mkstemp(suffix='_seqs.fastq') close(fd) self._files_to_remove.append(fp) with open(fp, 'w') as f: f.write("test") fp = [(fp, 1)] new_root = qdb.artifact.Artifact.create(fp, "FASTQ", prep_template=pt) self._files_to_remove.extend([x['fp'] for x in new_root.filepaths]) return new_root def _create_child_artifact(self, parents): """Creates a new artifact with the given parents""" # Add a child of 2 roots fd, fp = mkstemp(suffix='_seqs.fna') close(fd) self._files_to_remove.append(fp) with open(fp, 'w') as f: f.write("test") fp = [(fp, 4)] params = qdb.software.Parameters.from_default_params( qdb.software.DefaultParameters(1), {'input_data': 2}) new = qdb.artifact.Artifact.create( fp, "Demultiplexed", parents=parents, processing_parameters=params) return new def test_find_artifact_roots_is_root_without_children(self): """Correctly returns the root if the artifact is already the root and doesn't have any children """ sql = "SELECT * FROM qiita.find_artifact_roots(%s)" # Add a new root new_root = self._create_root_artifact() with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add(sql, [new_root.id]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[new_root.id]] self.assertEqual(obs, exp) def test_find_artifact_roots_is_child_multiple_parents_multiple_root(self): """Correctly returns the roots if the children has multiple roots""" sql = "SELECT * FROM qiita.find_artifact_roots(%s)" new_root = self._create_root_artifact() # Add a child of 2 roots fd, fp = mkstemp(suffix='_seqs.fna') close(fd) self._files_to_remove.append(fp) with open(fp, 'w') as f: f.write("test") fp = [(fp, 4)] params = qdb.software.Parameters.from_default_params( qdb.software.DefaultParameters(1), {'input_data': 2}) new = qdb.artifact.Artifact.create( fp, "Demultiplexed", parents=[qdb.artifact.Artifact(1), new_root], processing_parameters=params) self._files_to_remove.extend([x['fp'] for x in new.filepaths]) with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add(sql, [new.id]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[1], [new_root.id]] self.assertCountEqual(obs, exp) def test_artifact_ancestry_root(self): """Correctly returns the ancestry of a root artifact""" sql = "SELECT * FROM qiita.artifact_ancestry(%s)" with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add(sql, [1]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [] self.assertEqual(obs, exp) def test_artifact_ancestry_leaf(self): """Correctly returns the ancestry of a leaf artifact""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.artifact_ancestry(%s)" qdb.sql_connection.TRN.add(sql, [4]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[4, 2], [2, 1]] self.assertCountEqual(obs, exp) def test_artifact_ancestry_leaf_multiple_parents(self): """Correctly returns the ancestry of a leaf artifact w multiple parents """ root = self._create_root_artifact() parent1 = self._create_child_artifact([root]) parent2 = self._create_child_artifact([root]) child = self._create_child_artifact([parent1, parent2]) with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.artifact_ancestry(%s)" qdb.sql_connection.TRN.add(sql, [child.id]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[child.id, parent1.id], [child.id, parent2.id], [parent1.id, root.id], [parent2.id, root.id]] self.assertCountEqual(obs, exp) def test_artifact_ancestry_middle(self): """Correctly returns the ancestry of an artifact in the middle of the DAG""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.artifact_ancestry(%s)" qdb.sql_connection.TRN.add(sql, [2]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[2, 1]] self.assertEqual(obs, exp) def test_artifact_descendants_leaf(self): """Correctly returns the descendants of a leaf artifact""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.artifact_descendants(%s)" qdb.sql_connection.TRN.add(sql, [4]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [] self.assertEqual(obs, exp) def test_artifact_descendants_root(self): """Correctly returns the descendants of a root artifact""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.artifact_descendants(%s)" qdb.sql_connection.TRN.add(sql, [1]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[2, 1], [3, 1], [4, 2], [5, 2], [6, 2]] self.assertCountEqual(obs, exp) def test_artifact_descendants_middle(self): """Correctly returns the descendants of an artifact in the middle of the DAG""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.artifact_descendants(%s)" qdb.sql_connection.TRN.add(sql, [2]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[4, 2], [5, 2], [6, 2]] self.assertCountEqual(obs, exp) def test_isnumeric(self): """Test SQL function isnumeric""" exp = [['', False], ['.', False], ['.0', True], ['0.', True], ['0', True], ['1', True], ['123', True], ['123.456', True], ['abc', False], ['1..2', False], ['1.2.3.4', False], ['1x234', False], ['1.234e-5', True]] sql = ("WITH test(x) AS (" "VALUES (''), ('.'), ('.0'), ('0.'), ('0'), ('1'), ('123'), " "('123.456'), ('abc'), ('1..2'), ('1.2.3.4'), ('1x234'), " "('1.234e-5')) SELECT x, isnumeric(x) FROM test;") with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add(sql) obs = qdb.sql_connection.TRN.execute_fetchindex() self.assertEqual(exp, obs) def test_artifact_descendants_with_jobs(self): """Test SQL function artifact_descendants_with_jobs""" exp = [['c350b068-add7-49a5-8846-604ac032cc88', 1, 2], ['d883dab4-503b-45c2-815d-2126ff52dede', 1, 3], ['a4c4b9b9-20ca-47f5-bd30-725cce71df2b', 2, 4], ['624dce65-43a5-4156-a4b6-6c1d02114b67', 2, 5], ['81bbe8d0-b4c2-42eb-ada9-f07c1c91e59f', 2, 6]] sql = """SELECT * FROM qiita.artifact_descendants_with_jobs(1)""" with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add(sql) obs = qdb.sql_connection.TRN.execute_fetchindex() # lopping on results to not test the job id as is randomly generated for e, o in zip(exp, obs): self.assertEqual(e[1:], o[1:]) if __name__ == '__main__': main()
qiita_db/test/test_sql.py
from unittest import TestCase, main from tempfile import mkstemp from os import close, remove from os.path import exists import pandas as pd from qiita_core.util import qiita_test_checker import qiita_db as qdb @qiita_test_checker() class TestSQL(TestCase): """Tests that the database triggers and procedures work properly""" def setUp(self): self._files_to_remove = [] def tearDown(self): for fp in self._files_to_remove: if exists(fp): remove(fp) def test_find_artifact_roots_is_root(self): """Correctly returns the root if the artifact is already the root""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.find_artifact_roots(%s)" qdb.sql_connection.TRN.add(sql, [1]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[1]] self.assertEqual(obs, exp) def test_find_artifact_roots_is_child(self): """Correctly returns the root if the artifact is a child""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.find_artifact_roots(%s)" qdb.sql_connection.TRN.add(sql, [4]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[1]] self.assertEqual(obs, exp) def test_find_artifact_roots_is_child_multiple_parents_one_root(self): """Correctly returns the roots if the children has multiple parents but a single root """ fd, fp = mkstemp(suffix='_table.biom') close(fd) self._files_to_remove.append(fp) with open(fp, 'w') as f: f.write("test") fp = [(fp, 7)] params = qdb.software.Parameters.from_default_params( qdb.software.DefaultParameters(10), {'input_data': 2}) new = qdb.artifact.Artifact.create( fp, "BIOM", parents=[qdb.artifact.Artifact(2), qdb.artifact.Artifact(3)], processing_parameters=params) self._files_to_remove.extend([x['fp'] for x in new.filepaths]) with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.find_artifact_roots(%s)" qdb.sql_connection.TRN.add(sql, [new.id]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[1]] self.assertEqual(obs, exp) def _create_root_artifact(self): """Creates a new root artifact""" metadata = pd.DataFrame.from_dict( {'SKB8.640193': {'center_name': 'ANL', 'primer': 'GTGCCAGCMGCCGCGGTAA', 'barcode': 'GTCCGCAAGTTA', 'run_prefix': "s_G1_L001_sequences", 'platform': 'Illumina', 'target_gene': '16S rRNA', 'target_subfragment': 'V4', 'instrument_model': 'Illumina MiSeq', 'library_construction_protocol': 'AAAA', 'experiment_design_description': 'BBBB'}}, orient='index', dtype=str) pt = qdb.metadata_template.prep_template.PrepTemplate.create( metadata, qdb.study.Study(1), "18S") fd, fp = mkstemp(suffix='_seqs.fastq') close(fd) self._files_to_remove.append(fp) with open(fp, 'w') as f: f.write("test") fp = [(fp, 1)] new_root = qdb.artifact.Artifact.create(fp, "FASTQ", prep_template=pt) self._files_to_remove.extend([x['fp'] for x in new_root.filepaths]) return new_root def _create_child_artifact(self, parents): """Creates a new artifact with the given parents""" # Add a child of 2 roots fd, fp = mkstemp(suffix='_seqs.fna') close(fd) self._files_to_remove.append(fp) with open(fp, 'w') as f: f.write("test") fp = [(fp, 4)] params = qdb.software.Parameters.from_default_params( qdb.software.DefaultParameters(1), {'input_data': 2}) new = qdb.artifact.Artifact.create( fp, "Demultiplexed", parents=parents, processing_parameters=params) return new def test_find_artifact_roots_is_root_without_children(self): """Correctly returns the root if the artifact is already the root and doesn't have any children """ sql = "SELECT * FROM qiita.find_artifact_roots(%s)" # Add a new root new_root = self._create_root_artifact() with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add(sql, [new_root.id]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[new_root.id]] self.assertEqual(obs, exp) def test_find_artifact_roots_is_child_multiple_parents_multiple_root(self): """Correctly returns the roots if the children has multiple roots""" sql = "SELECT * FROM qiita.find_artifact_roots(%s)" new_root = self._create_root_artifact() # Add a child of 2 roots fd, fp = mkstemp(suffix='_seqs.fna') close(fd) self._files_to_remove.append(fp) with open(fp, 'w') as f: f.write("test") fp = [(fp, 4)] params = qdb.software.Parameters.from_default_params( qdb.software.DefaultParameters(1), {'input_data': 2}) new = qdb.artifact.Artifact.create( fp, "Demultiplexed", parents=[qdb.artifact.Artifact(1), new_root], processing_parameters=params) self._files_to_remove.extend([x['fp'] for x in new.filepaths]) with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add(sql, [new.id]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[1], [new_root.id]] self.assertCountEqual(obs, exp) def test_artifact_ancestry_root(self): """Correctly returns the ancestry of a root artifact""" sql = "SELECT * FROM qiita.artifact_ancestry(%s)" with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add(sql, [1]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [] self.assertEqual(obs, exp) def test_artifact_ancestry_leaf(self): """Correctly returns the ancestry of a leaf artifact""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.artifact_ancestry(%s)" qdb.sql_connection.TRN.add(sql, [4]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[4, 2], [2, 1]] self.assertCountEqual(obs, exp) def test_artifact_ancestry_leaf_multiple_parents(self): """Correctly returns the ancestry of a leaf artifact w multiple parents """ root = self._create_root_artifact() parent1 = self._create_child_artifact([root]) parent2 = self._create_child_artifact([root]) child = self._create_child_artifact([parent1, parent2]) with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.artifact_ancestry(%s)" qdb.sql_connection.TRN.add(sql, [child.id]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[child.id, parent1.id], [child.id, parent2.id], [parent1.id, root.id], [parent2.id, root.id]] self.assertCountEqual(obs, exp) def test_artifact_ancestry_middle(self): """Correctly returns the ancestry of an artifact in the middle of the DAG""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.artifact_ancestry(%s)" qdb.sql_connection.TRN.add(sql, [2]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[2, 1]] self.assertEqual(obs, exp) def test_artifact_descendants_leaf(self): """Correctly returns the descendants of a leaf artifact""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.artifact_descendants(%s)" qdb.sql_connection.TRN.add(sql, [4]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [] self.assertEqual(obs, exp) def test_artifact_descendants_root(self): """Correctly returns the descendants of a root artifact""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.artifact_descendants(%s)" qdb.sql_connection.TRN.add(sql, [1]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[2, 1], [3, 1], [4, 2], [5, 2], [6, 2]] self.assertCountEqual(obs, exp) def test_artifact_descendants_middle(self): """Correctly returns the descendants of an artifact in the middle of the DAG""" with qdb.sql_connection.TRN: sql = "SELECT * FROM qiita.artifact_descendants(%s)" qdb.sql_connection.TRN.add(sql, [2]) obs = qdb.sql_connection.TRN.execute_fetchindex() exp = [[4, 2], [5, 2], [6, 2]] self.assertCountEqual(obs, exp) def test_isnumeric(self): """Test SQL function isnumeric""" exp = [['', False], ['.', False], ['.0', True], ['0.', True], ['0', True], ['1', True], ['123', True], ['123.456', True], ['abc', False], ['1..2', False], ['1.2.3.4', False], ['1x234', False], ['1.234e-5', True]] sql = ("WITH test(x) AS (" "VALUES (''), ('.'), ('.0'), ('0.'), ('0'), ('1'), ('123'), " "('123.456'), ('abc'), ('1..2'), ('1.2.3.4'), ('1x234'), " "('1.234e-5')) SELECT x, isnumeric(x) FROM test;") with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add(sql) obs = qdb.sql_connection.TRN.execute_fetchindex() self.assertEqual(exp, obs) def test_artifact_descendants_with_jobs(self): """Test SQL function artifact_descendants_with_jobs""" exp = [['c350b068-add7-49a5-8846-604ac032cc88', 1, 2], ['d883dab4-503b-45c2-815d-2126ff52dede', 1, 3], ['a4c4b9b9-20ca-47f5-bd30-725cce71df2b', 2, 4], ['624dce65-43a5-4156-a4b6-6c1d02114b67', 2, 5], ['81bbe8d0-b4c2-42eb-ada9-f07c1c91e59f', 2, 6]] sql = """SELECT * FROM qiita.artifact_descendants_with_jobs(1)""" with qdb.sql_connection.TRN: qdb.sql_connection.TRN.add(sql) obs = qdb.sql_connection.TRN.execute_fetchindex() # lopping on results to not test the job id as is randomly generated for e, o in zip(exp, obs): self.assertEqual(e[1:], o[1:]) if __name__ == '__main__': main()
0.539226
0.364806
from melody.constraints.abstract_constraint import AbstractConstraint from structure.note import Note from tonalmodel.chromatic_scale import ChromaticScale from tonalmodel.diatonic_pitch import DiatonicPitch class ScalarPitchConstraint(AbstractConstraint): """ Class representing constraints to ensure some one note is scalar (to the contextual tonality), or within some subset of tones of the tonality. """ def __init__(self, note, scalar_roles=list()): ''' Constraint constuctor. :param note: Actor affected by constraint. :param scalar_roles: List of integer indices to tones in the current tonality, to which the actor must conform. ''' AbstractConstraint.__init__(self, [note]) self.__scalar_notes = list(scalar_roles) @property def actor_note(self): return self.actors[0] @property def scalar_roles(self): return self.__scalar_notes def clone(self, new_actors=None): pass def verify(self, parameter_map): contextual_note = parameter_map[self.actor_note] if contextual_note.note is None: return False tone = contextual_note.note.diatonic_pitch.diatonic_tone if len(self.scalar_roles) == 0: return tone in contextual_note.policy_context.harmonic_context.tonality.annotation else: index = contextual_note.policy_context.harmonic_context.tonality.annotation.index(tone) return index in self.scalar_roles def values(self, p_map, v_note): if v_note != self.actor_note: raise Exception('v_note {0} not in ScalarConstraint actors.'.format(v_note.note)) policy_context = p_map[self.actor_note].policy_context tones = list(policy_context.harmonic_context.tonality.annotation) tones = tones[:-1] # remove final note (same as first) if len(self.scalar_roles) != 0: tones = [tones[i] for i in self.scalar_roles] if p_map[v_note].note is not None: tone = p_map[v_note].note.diatonic_pitch.diatonic_tone return {self.actor_note} if tone in tones else None pitch_range = policy_context.pitch_range start_partition = max(ChromaticScale.index_to_location(pitch_range.start_index)[0] - 1, 0) end_partition = min(ChromaticScale.index_to_location(pitch_range.end_index)[0] + 1, ChromaticScale.CHROMATIC_END[0]) valid_set = set() for tone in tones: for j in range(start_partition, end_partition + 1): pitch = DiatonicPitch(j, tone) if pitch_range.is_pitch_inbounds(pitch): note = Note(pitch, self.actor_note.base_duration, self.actor_note.num_dots) valid_set.add(note) return valid_set
melody/constraints/scalar_pitch_constraint.py
from melody.constraints.abstract_constraint import AbstractConstraint from structure.note import Note from tonalmodel.chromatic_scale import ChromaticScale from tonalmodel.diatonic_pitch import DiatonicPitch class ScalarPitchConstraint(AbstractConstraint): """ Class representing constraints to ensure some one note is scalar (to the contextual tonality), or within some subset of tones of the tonality. """ def __init__(self, note, scalar_roles=list()): ''' Constraint constuctor. :param note: Actor affected by constraint. :param scalar_roles: List of integer indices to tones in the current tonality, to which the actor must conform. ''' AbstractConstraint.__init__(self, [note]) self.__scalar_notes = list(scalar_roles) @property def actor_note(self): return self.actors[0] @property def scalar_roles(self): return self.__scalar_notes def clone(self, new_actors=None): pass def verify(self, parameter_map): contextual_note = parameter_map[self.actor_note] if contextual_note.note is None: return False tone = contextual_note.note.diatonic_pitch.diatonic_tone if len(self.scalar_roles) == 0: return tone in contextual_note.policy_context.harmonic_context.tonality.annotation else: index = contextual_note.policy_context.harmonic_context.tonality.annotation.index(tone) return index in self.scalar_roles def values(self, p_map, v_note): if v_note != self.actor_note: raise Exception('v_note {0} not in ScalarConstraint actors.'.format(v_note.note)) policy_context = p_map[self.actor_note].policy_context tones = list(policy_context.harmonic_context.tonality.annotation) tones = tones[:-1] # remove final note (same as first) if len(self.scalar_roles) != 0: tones = [tones[i] for i in self.scalar_roles] if p_map[v_note].note is not None: tone = p_map[v_note].note.diatonic_pitch.diatonic_tone return {self.actor_note} if tone in tones else None pitch_range = policy_context.pitch_range start_partition = max(ChromaticScale.index_to_location(pitch_range.start_index)[0] - 1, 0) end_partition = min(ChromaticScale.index_to_location(pitch_range.end_index)[0] + 1, ChromaticScale.CHROMATIC_END[0]) valid_set = set() for tone in tones: for j in range(start_partition, end_partition + 1): pitch = DiatonicPitch(j, tone) if pitch_range.is_pitch_inbounds(pitch): note = Note(pitch, self.actor_note.base_duration, self.actor_note.num_dots) valid_set.add(note) return valid_set
0.93488
0.459197
import argparse import os from os.path import abspath, dirname, join import re from typing import Tuple import pandas as pd from ncmagics import japanmap def parse_args() -> dict: """parse_args. Set directory path from stdin. Args: Returns: dict: """ parser = argparse.ArgumentParser() parser.add_argument( "-d", "--dir", help="set directory which contained csv files.", type=str) p = parser.parse_args() args = {"dir": p.dir} return args def _cat_path(dir_path: str, files: str) -> str: """_cat_path. used in mkfile_list() to make abspath. Args: dir_path (str): dir_path files (str): files Returns: str: """ abs_path = join(dir_path, files) return abs_path def mkfile_list(dirpath: str) -> list: """mkfile_list. get csv list and sort by datetime order. using _cat_path() to convert abspath Args: dirpath (str): dirpath Returns: list: """ csv_list = sorted([ _cat_path(dirpath, i) for i in os.listdir(dirpath) if "initialdata" not in i ]) return csv_list def read_csv(csvfile: str) -> Tuple[ pd.Series, pd.Series, pd.Series]: """read_csv. read cyclone center location from csvfile. Args: csvfile (str): csvfile Returns: Tuple[ pd.Series, pd.Series, pd.Series]: """ df = pd.read_csv(csvfile, header=0) lat = df["latitude"] lon = df["longitude"] prmsl = df["prmsl center (hPa)"] return lat, lon, prmsl def mk_title_outname(dir_name: str) -> Tuple[str, str]: """mk_title_outname. Args: dir_name (str): dir_name Returns: Tuple[str, str]: """ dir_name_has_datetime = re.search("[0-9]{8}", dir_name) if dir_name_has_datetime: dir_datetime = dir_name_has_datetime.group() else: dir_datetime = "" outname = join(abspath(dirname(__file__)) + "/trackdatafig/" + dir_datetime + "/compare_trackdata") title = ("compare cyclone center trackdata" + dir_datetime) return outname, title def main(): """main plot cyclone center location on near japan map. """ args = parse_args() dirpath = abspath(join(dirname(__file__), args["dir"])) mkfile_list(dirpath) csv_list = mkfile_list(dirpath) plt_map = japanmap.JpMap(color=True) # plot model's initial data. label = "initial data" initialdata = join(abspath(dirname(__file__)) + "/" + args["dir"] + "/initialdata.csv") lat, lon, prmsl = read_csv(initialdata) plt_map.color_list.insert(0, '#696969') plt_map.plot_data(lat, lon, str(label)) plt_map.plot_prmsl_circle(lat, lon, prmsl) # plot forecast data. for data in csv_list: data_has_datetime = re.search("[0-9]{10}", data) if data_has_datetime: label = data_has_datetime.group() else: continue lat, lon, prmsl = read_csv(data) plt_map.plot_data(lon, lat, str(label)) plt_map.plot_prmsl_circle(lon, lat, prmsl) # picture title and outname outname, title = mk_title_outname(args["dir"]) plt_map.save_fig(outname, title) if __name__ == "__main__": main()
main/plotcyclone_loc_dir.py
import argparse import os from os.path import abspath, dirname, join import re from typing import Tuple import pandas as pd from ncmagics import japanmap def parse_args() -> dict: """parse_args. Set directory path from stdin. Args: Returns: dict: """ parser = argparse.ArgumentParser() parser.add_argument( "-d", "--dir", help="set directory which contained csv files.", type=str) p = parser.parse_args() args = {"dir": p.dir} return args def _cat_path(dir_path: str, files: str) -> str: """_cat_path. used in mkfile_list() to make abspath. Args: dir_path (str): dir_path files (str): files Returns: str: """ abs_path = join(dir_path, files) return abs_path def mkfile_list(dirpath: str) -> list: """mkfile_list. get csv list and sort by datetime order. using _cat_path() to convert abspath Args: dirpath (str): dirpath Returns: list: """ csv_list = sorted([ _cat_path(dirpath, i) for i in os.listdir(dirpath) if "initialdata" not in i ]) return csv_list def read_csv(csvfile: str) -> Tuple[ pd.Series, pd.Series, pd.Series]: """read_csv. read cyclone center location from csvfile. Args: csvfile (str): csvfile Returns: Tuple[ pd.Series, pd.Series, pd.Series]: """ df = pd.read_csv(csvfile, header=0) lat = df["latitude"] lon = df["longitude"] prmsl = df["prmsl center (hPa)"] return lat, lon, prmsl def mk_title_outname(dir_name: str) -> Tuple[str, str]: """mk_title_outname. Args: dir_name (str): dir_name Returns: Tuple[str, str]: """ dir_name_has_datetime = re.search("[0-9]{8}", dir_name) if dir_name_has_datetime: dir_datetime = dir_name_has_datetime.group() else: dir_datetime = "" outname = join(abspath(dirname(__file__)) + "/trackdatafig/" + dir_datetime + "/compare_trackdata") title = ("compare cyclone center trackdata" + dir_datetime) return outname, title def main(): """main plot cyclone center location on near japan map. """ args = parse_args() dirpath = abspath(join(dirname(__file__), args["dir"])) mkfile_list(dirpath) csv_list = mkfile_list(dirpath) plt_map = japanmap.JpMap(color=True) # plot model's initial data. label = "initial data" initialdata = join(abspath(dirname(__file__)) + "/" + args["dir"] + "/initialdata.csv") lat, lon, prmsl = read_csv(initialdata) plt_map.color_list.insert(0, '#696969') plt_map.plot_data(lat, lon, str(label)) plt_map.plot_prmsl_circle(lat, lon, prmsl) # plot forecast data. for data in csv_list: data_has_datetime = re.search("[0-9]{10}", data) if data_has_datetime: label = data_has_datetime.group() else: continue lat, lon, prmsl = read_csv(data) plt_map.plot_data(lon, lat, str(label)) plt_map.plot_prmsl_circle(lon, lat, prmsl) # picture title and outname outname, title = mk_title_outname(args["dir"]) plt_map.save_fig(outname, title) if __name__ == "__main__": main()
0.549641
0.213142
import unittest import logging # project from stackstate_checks.splunk.config import SplunkInstanceConfig, SplunkSavedSearch from stackstate_checks.splunk.client import FinalizeException from test_splunk_instance_config import MockedCommittableState, mock_defaults from stackstate_checks.splunk.saved_search_helper import SavedSearches from stackstate_checks.base import AgentCheck from stackstate_checks.base.errors import CheckException class MockSplunkClient(object): def __init__(self): self.saved_searches_result = [] self.saved_search_results_results = {} self.dispatch_results = {} self.finalized = [] self.max_parallel_searches = 999 self.parallel_searches = 0 def saved_searches(self): return self.saved_searches_result def saved_search_results(self, search_id, saved_search): self.parallel_searches -= 1 return self.saved_search_results_results[search_id] def dispatch(self, saved_search, splunk_app, ignore_saved_search_errors, parameters): self.parallel_searches += 1 assert self.parallel_searches <= self.max_parallel_searches return self.dispatch_results[saved_search.name] def finalize_sid(self, search_id, saved_search): self.finalized.append(search_id) return class MockSplunkClientFailFinalize(MockSplunkClient): def __init__(self, *args, **kwargs): super(MockSplunkClientFailFinalize, self).__init__(*args, **kwargs) def finalize_sid(self, search_id, saved_search): self.finalized.append(search_id) raise FinalizeException(0, "Broken") base_instance = { 'url': 'http://localhost:8089', 'authentication': { 'basic_auth': { 'username': "adminNew", 'password': "<PASSWORD>" } }, 'tags': ['mytag', 'mytag2'] } class MockServiceCheck(object): def __init__(self): self.results = [] self.ret_val = 0 def _service_check(status, tags=None, hostname=None, message=None): self.results.append([status, tags, hostname, message]) self.function = _service_check class MockProcessData(object): def __init__(self): self.results = [] self.ret_val = 0 def _process_data(saved_search, response): self.results.append(response) return self.ret_val self.function = _process_data class TestSplunkInstanceConfig(unittest.TestCase): def setUp(self): self.log = logging.getLogger('%s' % __name__) self.committable_state = MockedCommittableState({}) self.mock_service_check = MockServiceCheck() self.mock_process_data = MockProcessData() self.mock_splunk_client = MockSplunkClient() def test_no_saved_searches(self): searches = SavedSearches(SplunkInstanceConfig(base_instance, {}, mock_defaults), self.mock_splunk_client, []) searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_process_data.results == [] assert self.mock_service_check.results == [[AgentCheck.OK, None, None, None]] def test_process_data(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search1'}), SplunkSavedSearch(instance, {'name': 'search2'})]) self.mock_splunk_client.dispatch_results['search1'] = 'sid1' self.mock_splunk_client.dispatch_results['search2'] = 'sid2' data1 = {'messages': [], 'results': [{'data': 'result1'}]} data2 = {'messages': [], 'results': [{'data': 'result2'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] self.mock_splunk_client.saved_search_results_results['sid2'] = [data2] searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_process_data.results == [data1, data2] assert self.mock_service_check.results == [[AgentCheck.OK, None, None, None]] def test_store_and_finalize_sids(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'breaking'})]) # Dispatch should succeed, but not the result retrieval self.mock_splunk_client.dispatch_results['breaking'] = 'sid1' issue = True try: searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) issue = False except Exception: issue = True assert issue assert self.mock_service_check.results == [] assert self.committable_state.state == {'sid_breaking': 'sid1'} # Make sure it now runs correctly data1 = {'messages': [], 'results': [{'data': 'result1'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] # Run again, this finalizes and reruns the search searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_splunk_client.finalized == ['sid1'] assert self.mock_service_check.results == [[AgentCheck.OK, None, None, None]] assert self.committable_state.state == {'sid_breaking': 'sid1'} def test_keep_sid_when_finalize_fails(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) mock_splunk_client = MockSplunkClientFailFinalize() searches = SavedSearches(instance, mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'breaking'})]) # Dispatch should succeed, but not the result retrieval mock_splunk_client.dispatch_results['breaking'] = 'sid1' issue = None try: searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) issue = False except Exception: issue = True assert issue assert self.mock_service_check.results == [] assert self.committable_state.state == {'sid_breaking': 'sid1'} # Run again, this will trigger an issue during finalize issue2 = None try: searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) issue2 = False except FinalizeException: issue2 = True assert issue2 assert mock_splunk_client.finalized == ['sid1'] assert self.mock_service_check.results == [] assert self.committable_state.state == {'sid_breaking': 'sid1'} def test_incomplete_data(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search1'}), SplunkSavedSearch(instance, {'name': 'search2'})]) self.mock_splunk_client.dispatch_results['search1'] = 'sid1' self.mock_splunk_client.dispatch_results['search2'] = 'sid2' data1 = {'messages': [], 'results': [{'data': 'result1'}]} data2 = {'messages': [], 'results': [{'data': 'result2'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] self.mock_splunk_client.saved_search_results_results['sid2'] = [data2] self.mock_process_data.ret_val = 1 issue = None try: searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) issue = False except CheckException: issue = True assert issue assert self.mock_process_data.results == [data1] assert self.mock_service_check.results == [] def test_partially_incomplete_data(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search1'})]) self.mock_splunk_client.dispatch_results['search1'] = 'sid1' self.mock_splunk_client.dispatch_results['search2'] = 'sid2' data1 = {'messages': [], 'results': [{'data': 'result1'}, {'data': 'result2'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] self.mock_process_data.ret_val = 1 searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_process_data.results == [data1] assert self.mock_service_check.results == [[AgentCheck.WARNING, ['mytag', 'mytag2'], None, "The saved search 'search1' contained 1 incomplete records"]] def test_partially_incomplete_and_incomplete(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search1'}), SplunkSavedSearch(instance, {'name': 'search2'})]) self.mock_splunk_client.dispatch_results['search1'] = 'sid1' self.mock_splunk_client.dispatch_results['search2'] = 'sid2' data1 = {'messages': [], 'results': [{'data': 'result1'}, {'data': 'result1_2'}]} data2 = {'messages': [], 'results': [{'data': 'result2'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] self.mock_splunk_client.saved_search_results_results['sid2'] = [data2] self.mock_process_data.ret_val = 1 issue = None try: searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) issue = False except CheckException: issue = True assert issue assert self.mock_process_data.results == [data1, data2] assert self.mock_service_check.results == [[AgentCheck.WARNING, ['mytag', 'mytag2'], None, "The saved search 'search1' contained 1 incomplete records"]] def test_wildcard_topology(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'match': 'comp.*'}), SplunkSavedSearch(instance, {'match': 'rel.*'})]) self.mock_splunk_client.saved_searches_result = ["components", "relations"] self.mock_splunk_client.dispatch_results['components'] = 'sid1' self.mock_splunk_client.dispatch_results['relations'] = 'sid2' data1 = {'messages': [], 'results': [{'data': 'result1'}]} data2 = {'messages': [], 'results': [{'data': 'result2'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] self.mock_splunk_client.saved_search_results_results['sid2'] = [data2] searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert len(self.mock_process_data.results) == 2 assert self.mock_service_check.results == [[AgentCheck.OK, None, None, None]] # Now drop all saved searches and see them disappear self.mock_splunk_client.saved_searches_result = [] self.mock_process_data = MockProcessData() self.mock_service_check = MockServiceCheck() searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_process_data.results == [] assert self.mock_service_check.results == [[AgentCheck.OK, None, None, None]] def test_does_not_exceed_parallel_dispatches(self): saved_searches_parallel = 2 instance = { 'url': 'http://localhost:8089', 'saved_searches_parallel': saved_searches_parallel, 'authentication': { 'basic_auth': { 'username': "adminNew", 'password': "<PASSWORD>" } }, 'tags': ['mytag', 'mytag2'] } instance = SplunkInstanceConfig(instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search1'}), SplunkSavedSearch(instance, {'name': 'search2'}), SplunkSavedSearch(instance, {'name': 'search3'}), SplunkSavedSearch(instance, {'name': 'search4'}) ]) self.mock_splunk_client.max_parallel_searches = saved_searches_parallel self.mock_splunk_client.dispatch_results['search1'] = 'sid1' self.mock_splunk_client.dispatch_results['search2'] = 'sid2' self.mock_splunk_client.dispatch_results['search3'] = 'sid3' self.mock_splunk_client.dispatch_results['search4'] = 'sid4' self.mock_splunk_client.saved_search_results_results['sid1'] = [] self.mock_splunk_client.saved_search_results_results['sid2'] = [] self.mock_splunk_client.saved_search_results_results['sid3'] = [] self.mock_splunk_client.saved_search_results_results['sid4'] = [] searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_process_data.results == [] assert self.mock_service_check.results == [[AgentCheck.OK, None, None, None]] def test_ignore_saved_search_errors_continue(self): """ When 1 saved search fails with Check Exception, the code should continue and send topology if issues are ignored. """ instance = { 'url': 'http://localhost:8089', 'ignore_saved_search_errors': True, 'authentication': { 'basic_auth': { 'username': "adminNew", 'password': "<PASSWORD>" } }, 'tags': ['mytag', 'mytag2'] } instance = SplunkInstanceConfig(instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search_broken'}), SplunkSavedSearch(instance, {'name': 'search1'})]) self.mock_splunk_client.dispatch_results['search_broken'] = 'sid_broken' self.mock_splunk_client.dispatch_results['search1'] = 'sid1' data1 = {'messages': [], 'results': [{'data': 'result1'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_process_data.results == [data1] assert self.mock_service_check.results == [[AgentCheck.WARNING, ['mytag', 'mytag2'], None, "'sid_broken'"]] def test_no_ignore_saved_search_errors_breaks(self): """ When 1 saved search fails with Check Exception, the code should continue and send topology if issues are ignored. """ instance = { 'url': 'http://localhost:8089', 'ignore_saved_search_errors': False, 'authentication': { 'basic_auth': { 'username': "adminNew", 'password': "<PASSWORD>" } }, 'tags': ['mytag', 'mytag2'] } instance = SplunkInstanceConfig(instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search_broken'}), SplunkSavedSearch(instance, {'name': 'search1'})]) self.mock_splunk_client.dispatch_results['search_broken'] = 'sid_broken' self.mock_splunk_client.dispatch_results['search1'] = 'sid1' data1 = {'messages': [], 'results': [{'data': 'result1'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] issue = True try: searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) issue = False except Exception: issue = True assert issue assert self.mock_process_data.results == [] assert self.mock_service_check.results == [] def test_incomplete_and_failing_produce_warnings(self): """ When both saved search fails with Check Exception, the code should continue and send topology. """ instance = { 'url': 'http://localhost:8089', 'authentication': { 'basic_auth': { 'username': "admin", 'password': "<PASSWORD>" } }, 'ignore_saved_search_errors': True, } instance = SplunkInstanceConfig(instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search1'}), SplunkSavedSearch(instance, {'name': 'search_broken'})]) self.mock_splunk_client.dispatch_results['search1'] = 'sid1' self.mock_splunk_client.dispatch_results['search_broken'] = 'broken_sid' data1 = {'messages': [], 'results': [{'data': 'result1'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] self.mock_process_data.ret_val = 1 searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_service_check.results == [ [AgentCheck.WARNING, [], None, "All result of saved search 'search1' contained incomplete data"], [AgentCheck.WARNING, [], None, "'broken_sid'"]]
splunk_base/tests/test_saved_search_helper.py
import unittest import logging # project from stackstate_checks.splunk.config import SplunkInstanceConfig, SplunkSavedSearch from stackstate_checks.splunk.client import FinalizeException from test_splunk_instance_config import MockedCommittableState, mock_defaults from stackstate_checks.splunk.saved_search_helper import SavedSearches from stackstate_checks.base import AgentCheck from stackstate_checks.base.errors import CheckException class MockSplunkClient(object): def __init__(self): self.saved_searches_result = [] self.saved_search_results_results = {} self.dispatch_results = {} self.finalized = [] self.max_parallel_searches = 999 self.parallel_searches = 0 def saved_searches(self): return self.saved_searches_result def saved_search_results(self, search_id, saved_search): self.parallel_searches -= 1 return self.saved_search_results_results[search_id] def dispatch(self, saved_search, splunk_app, ignore_saved_search_errors, parameters): self.parallel_searches += 1 assert self.parallel_searches <= self.max_parallel_searches return self.dispatch_results[saved_search.name] def finalize_sid(self, search_id, saved_search): self.finalized.append(search_id) return class MockSplunkClientFailFinalize(MockSplunkClient): def __init__(self, *args, **kwargs): super(MockSplunkClientFailFinalize, self).__init__(*args, **kwargs) def finalize_sid(self, search_id, saved_search): self.finalized.append(search_id) raise FinalizeException(0, "Broken") base_instance = { 'url': 'http://localhost:8089', 'authentication': { 'basic_auth': { 'username': "adminNew", 'password': "<PASSWORD>" } }, 'tags': ['mytag', 'mytag2'] } class MockServiceCheck(object): def __init__(self): self.results = [] self.ret_val = 0 def _service_check(status, tags=None, hostname=None, message=None): self.results.append([status, tags, hostname, message]) self.function = _service_check class MockProcessData(object): def __init__(self): self.results = [] self.ret_val = 0 def _process_data(saved_search, response): self.results.append(response) return self.ret_val self.function = _process_data class TestSplunkInstanceConfig(unittest.TestCase): def setUp(self): self.log = logging.getLogger('%s' % __name__) self.committable_state = MockedCommittableState({}) self.mock_service_check = MockServiceCheck() self.mock_process_data = MockProcessData() self.mock_splunk_client = MockSplunkClient() def test_no_saved_searches(self): searches = SavedSearches(SplunkInstanceConfig(base_instance, {}, mock_defaults), self.mock_splunk_client, []) searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_process_data.results == [] assert self.mock_service_check.results == [[AgentCheck.OK, None, None, None]] def test_process_data(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search1'}), SplunkSavedSearch(instance, {'name': 'search2'})]) self.mock_splunk_client.dispatch_results['search1'] = 'sid1' self.mock_splunk_client.dispatch_results['search2'] = 'sid2' data1 = {'messages': [], 'results': [{'data': 'result1'}]} data2 = {'messages': [], 'results': [{'data': 'result2'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] self.mock_splunk_client.saved_search_results_results['sid2'] = [data2] searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_process_data.results == [data1, data2] assert self.mock_service_check.results == [[AgentCheck.OK, None, None, None]] def test_store_and_finalize_sids(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'breaking'})]) # Dispatch should succeed, but not the result retrieval self.mock_splunk_client.dispatch_results['breaking'] = 'sid1' issue = True try: searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) issue = False except Exception: issue = True assert issue assert self.mock_service_check.results == [] assert self.committable_state.state == {'sid_breaking': 'sid1'} # Make sure it now runs correctly data1 = {'messages': [], 'results': [{'data': 'result1'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] # Run again, this finalizes and reruns the search searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_splunk_client.finalized == ['sid1'] assert self.mock_service_check.results == [[AgentCheck.OK, None, None, None]] assert self.committable_state.state == {'sid_breaking': 'sid1'} def test_keep_sid_when_finalize_fails(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) mock_splunk_client = MockSplunkClientFailFinalize() searches = SavedSearches(instance, mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'breaking'})]) # Dispatch should succeed, but not the result retrieval mock_splunk_client.dispatch_results['breaking'] = 'sid1' issue = None try: searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) issue = False except Exception: issue = True assert issue assert self.mock_service_check.results == [] assert self.committable_state.state == {'sid_breaking': 'sid1'} # Run again, this will trigger an issue during finalize issue2 = None try: searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) issue2 = False except FinalizeException: issue2 = True assert issue2 assert mock_splunk_client.finalized == ['sid1'] assert self.mock_service_check.results == [] assert self.committable_state.state == {'sid_breaking': 'sid1'} def test_incomplete_data(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search1'}), SplunkSavedSearch(instance, {'name': 'search2'})]) self.mock_splunk_client.dispatch_results['search1'] = 'sid1' self.mock_splunk_client.dispatch_results['search2'] = 'sid2' data1 = {'messages': [], 'results': [{'data': 'result1'}]} data2 = {'messages': [], 'results': [{'data': 'result2'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] self.mock_splunk_client.saved_search_results_results['sid2'] = [data2] self.mock_process_data.ret_val = 1 issue = None try: searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) issue = False except CheckException: issue = True assert issue assert self.mock_process_data.results == [data1] assert self.mock_service_check.results == [] def test_partially_incomplete_data(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search1'})]) self.mock_splunk_client.dispatch_results['search1'] = 'sid1' self.mock_splunk_client.dispatch_results['search2'] = 'sid2' data1 = {'messages': [], 'results': [{'data': 'result1'}, {'data': 'result2'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] self.mock_process_data.ret_val = 1 searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_process_data.results == [data1] assert self.mock_service_check.results == [[AgentCheck.WARNING, ['mytag', 'mytag2'], None, "The saved search 'search1' contained 1 incomplete records"]] def test_partially_incomplete_and_incomplete(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search1'}), SplunkSavedSearch(instance, {'name': 'search2'})]) self.mock_splunk_client.dispatch_results['search1'] = 'sid1' self.mock_splunk_client.dispatch_results['search2'] = 'sid2' data1 = {'messages': [], 'results': [{'data': 'result1'}, {'data': 'result1_2'}]} data2 = {'messages': [], 'results': [{'data': 'result2'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] self.mock_splunk_client.saved_search_results_results['sid2'] = [data2] self.mock_process_data.ret_val = 1 issue = None try: searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) issue = False except CheckException: issue = True assert issue assert self.mock_process_data.results == [data1, data2] assert self.mock_service_check.results == [[AgentCheck.WARNING, ['mytag', 'mytag2'], None, "The saved search 'search1' contained 1 incomplete records"]] def test_wildcard_topology(self): instance = SplunkInstanceConfig(base_instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'match': 'comp.*'}), SplunkSavedSearch(instance, {'match': 'rel.*'})]) self.mock_splunk_client.saved_searches_result = ["components", "relations"] self.mock_splunk_client.dispatch_results['components'] = 'sid1' self.mock_splunk_client.dispatch_results['relations'] = 'sid2' data1 = {'messages': [], 'results': [{'data': 'result1'}]} data2 = {'messages': [], 'results': [{'data': 'result2'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] self.mock_splunk_client.saved_search_results_results['sid2'] = [data2] searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert len(self.mock_process_data.results) == 2 assert self.mock_service_check.results == [[AgentCheck.OK, None, None, None]] # Now drop all saved searches and see them disappear self.mock_splunk_client.saved_searches_result = [] self.mock_process_data = MockProcessData() self.mock_service_check = MockServiceCheck() searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_process_data.results == [] assert self.mock_service_check.results == [[AgentCheck.OK, None, None, None]] def test_does_not_exceed_parallel_dispatches(self): saved_searches_parallel = 2 instance = { 'url': 'http://localhost:8089', 'saved_searches_parallel': saved_searches_parallel, 'authentication': { 'basic_auth': { 'username': "adminNew", 'password': "<PASSWORD>" } }, 'tags': ['mytag', 'mytag2'] } instance = SplunkInstanceConfig(instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search1'}), SplunkSavedSearch(instance, {'name': 'search2'}), SplunkSavedSearch(instance, {'name': 'search3'}), SplunkSavedSearch(instance, {'name': 'search4'}) ]) self.mock_splunk_client.max_parallel_searches = saved_searches_parallel self.mock_splunk_client.dispatch_results['search1'] = 'sid1' self.mock_splunk_client.dispatch_results['search2'] = 'sid2' self.mock_splunk_client.dispatch_results['search3'] = 'sid3' self.mock_splunk_client.dispatch_results['search4'] = 'sid4' self.mock_splunk_client.saved_search_results_results['sid1'] = [] self.mock_splunk_client.saved_search_results_results['sid2'] = [] self.mock_splunk_client.saved_search_results_results['sid3'] = [] self.mock_splunk_client.saved_search_results_results['sid4'] = [] searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_process_data.results == [] assert self.mock_service_check.results == [[AgentCheck.OK, None, None, None]] def test_ignore_saved_search_errors_continue(self): """ When 1 saved search fails with Check Exception, the code should continue and send topology if issues are ignored. """ instance = { 'url': 'http://localhost:8089', 'ignore_saved_search_errors': True, 'authentication': { 'basic_auth': { 'username': "adminNew", 'password': "<PASSWORD>" } }, 'tags': ['mytag', 'mytag2'] } instance = SplunkInstanceConfig(instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search_broken'}), SplunkSavedSearch(instance, {'name': 'search1'})]) self.mock_splunk_client.dispatch_results['search_broken'] = 'sid_broken' self.mock_splunk_client.dispatch_results['search1'] = 'sid1' data1 = {'messages': [], 'results': [{'data': 'result1'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_process_data.results == [data1] assert self.mock_service_check.results == [[AgentCheck.WARNING, ['mytag', 'mytag2'], None, "'sid_broken'"]] def test_no_ignore_saved_search_errors_breaks(self): """ When 1 saved search fails with Check Exception, the code should continue and send topology if issues are ignored. """ instance = { 'url': 'http://localhost:8089', 'ignore_saved_search_errors': False, 'authentication': { 'basic_auth': { 'username': "adminNew", 'password': "<PASSWORD>" } }, 'tags': ['mytag', 'mytag2'] } instance = SplunkInstanceConfig(instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search_broken'}), SplunkSavedSearch(instance, {'name': 'search1'})]) self.mock_splunk_client.dispatch_results['search_broken'] = 'sid_broken' self.mock_splunk_client.dispatch_results['search1'] = 'sid1' data1 = {'messages': [], 'results': [{'data': 'result1'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] issue = True try: searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) issue = False except Exception: issue = True assert issue assert self.mock_process_data.results == [] assert self.mock_service_check.results == [] def test_incomplete_and_failing_produce_warnings(self): """ When both saved search fails with Check Exception, the code should continue and send topology. """ instance = { 'url': 'http://localhost:8089', 'authentication': { 'basic_auth': { 'username': "admin", 'password': "<PASSWORD>" } }, 'ignore_saved_search_errors': True, } instance = SplunkInstanceConfig(instance, {}, mock_defaults) searches = SavedSearches(instance, self.mock_splunk_client, [SplunkSavedSearch(instance, {'name': 'search1'}), SplunkSavedSearch(instance, {'name': 'search_broken'})]) self.mock_splunk_client.dispatch_results['search1'] = 'sid1' self.mock_splunk_client.dispatch_results['search_broken'] = 'broken_sid' data1 = {'messages': [], 'results': [{'data': 'result1'}]} self.mock_splunk_client.saved_search_results_results['sid1'] = [data1] self.mock_process_data.ret_val = 1 searches.run_saved_searches(self.mock_process_data.function, self.mock_service_check.function, self.log, self.committable_state) assert self.mock_service_check.results == [ [AgentCheck.WARNING, [], None, "All result of saved search 'search1' contained incomplete data"], [AgentCheck.WARNING, [], None, "'broken_sid'"]]
0.603114
0.219526
from shutil import copytree, move from tempfile import TemporaryDirectory from pathlib import Path from unittest import skip from capanno_utils.repo_config import tools_dir_name from tests.test_base import TestBase from capanno_utils.add_content import main as add_content_main from capanno_utils.helpers.get_paths import * # @skip('') class TestAddToolMain(TestBase): # @skip('') def test_add_tool(self): with TemporaryDirectory(prefix='test_add_tool_') as tmp_dir: self.make_empty_tools_index(tmp_dir) tool_name = 'test_1' tool_version = 'fake.1' add_content_main(['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version, "--has-primary"]) return # @skip('') def test_add_tool_with_subtools(self): with TemporaryDirectory(prefix='test_add_w_subtools_') as tmp_dir: self.make_empty_tools_index(tmp_dir) tool_name = 'test_2' tool_version = 'fake.2' subtools = ['subtool1', 'subtool2', 'subtool3'] add_content_main(['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version] + subtools) return # @skip('') def test_add_tool_with_biotools_id(self): with TemporaryDirectory(prefix='with_biotools_') as tmp_dir: self.make_empty_tools_index(tmp_dir) tool_name = 'test_biotools' tool_version = 'fake.3' biotools_id = 'malvirus' subtools = ['subtool1', 'subtool2', 'subtool3'] options = ['--biotoolsID', biotools_id] add_content_main(['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version] + subtools + options) return def test_add_tool_with_subtools_with_init_urls(self): cwl_url = 'https://raw.githubusercontent.com/common-workflow-library/bio-cwl-tools/release/bandage/bandage-image.cwl' tool_name = 'test_biotools' tool_version = 'fake.3' biotools_id = 'malvirus' subtools = ['subtool1', 'subtool2', 'subtool3'] options = ['--biotoolsID', biotools_id] init_cwl = ['--init-cwl', f"subtool1={cwl_url}", f"subtool2={cwl_url}"] with TemporaryDirectory(prefix='add_with_url') as tmp_dir: self.make_empty_tools_index(tmp_dir) add_content_main( ['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version] + subtools + options + init_cwl) def test_add_tool_with_subtools_with_init_url_main_only(self): cwl_url = 'https://raw.githubusercontent.com/common-workflow-library/bio-cwl-tools/release/bandage/bandage-image.cwl' tool_name = 'test_biotools' tool_version = 'fake.3' biotools_id = 'malvirus' options = ['--biotoolsID', biotools_id, '--has-primary'] init_cwl = ['--init-cwl', cwl_url] with TemporaryDirectory(prefix='add_with_url') as tmp_dir: self.make_empty_tools_index(tmp_dir) add_content_main( ['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version] + options + init_cwl) # @skip('') def test_add_subtool(self): with TemporaryDirectory(prefix='add_subtool_') as tmp_dir: self.make_empty_tools_index(tmp_dir) tool_name = 'test_4' tool_version = 'fake.4' subtool_name = 'new_subtool' add_content_main(['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version]) add_content_main(['-p', tmp_dir, 'subtool', tool_name, tool_version, subtool_name, '-u']) return def test_add_tool_with_existing_cwl_url(self): cwl_url = 'https://raw.githubusercontent.com/common-workflow-library/bio-cwl-tools/release/bandage/bandage-image.cwl' biotools_id = 'bandage' tool_name = 'bandage' tool_version = 'fake.6' subtool_name = 'image' with TemporaryDirectory(prefix='add_tool_with_cwl_') as tmp_dir: self.make_empty_tools_index(tmp_dir) add_content_main(['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version, '--biotoolsID', biotools_id]) add_content_main(['-p', tmp_dir, 'subtool', tool_name, tool_version, subtool_name, '-u', '--init-cwl', cwl_url]) assert True return def test_add_tool_instance(self): tool_name = 'STAR' tool_version = '2.5' subtool_name = 'alignReads' tool_directory = get_main_tool_dir(tool_name, base_dir=self.test_content_dir) with TemporaryDirectory() as tmp_dir: self.make_empty_tools_index(tmp_dir, add_identifiers=['TL_8ab263.82', 'TL_8ab263_a4.82']) tool_temp_path = Path(tmp_dir) / tools_dir_name / tool_name copytree(tool_directory, tool_temp_path) add_content_main(['-p', tmp_dir, 'tool-instance', tool_name, tool_version, subtool_name]) assert True # Just provides a place for a breakpoint to take a look.at tmp_dir return def test_add_tool_instance_main(self): tool_name = 'cat' tool_version = '8.x' tool_directory = get_main_tool_dir(tool_name, base_dir=self.test_content_dir) with TemporaryDirectory() as tmp_dir: self.make_empty_tools_index(tmp_dir, add_identifiers=['TL_d077f2.47', 'TL_d077f2_54.47']) tool_temp_path = Path(tmp_dir) / tools_dir_name / tool_name copytree(tool_directory, tool_temp_path) add_content_main(['-p', tmp_dir, 'tool-instance', tool_name, tool_version]) assert True # Just provides a place for a breakpoint to take a look.at tmp_dir return def test_add_tool_with_wdl_url(self): wdl_url = 'https://github.com/broadinstitute/warp/raw/develop/tasks/skylab/CreateCountMatrix.wdl' tool_name = 'who_cares' tool_version = 'fake.fake' subtool_name = 'test_wdl_subtool' with TemporaryDirectory(prefix='add_tool_with_wdl') as tmp_dir: self.make_empty_tools_index(tmp_dir) add_content_main( ['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version]) add_content_main( ['-p', tmp_dir, 'subtool', tool_name, tool_version, subtool_name, '-u', '--init-wdl', wdl_url]) assert True return # @skip('') class TestAddScriptMain(TestBase): def test_add_common_script(self): with TemporaryDirectory() as tmp_dir: group_name = 'test_group1' project_name = 'fake_project_1' script_version = '1.nope' file_name = "some_filename" add_content_main(['-p', tmp_dir, 'common-script', group_name, project_name, script_version, file_name]) return def test_add_script(self): with TemporaryDirectory() as tmp_dir: group_name = 'test_group2' project_name = 'fake_project_2' script_name = 'new_script_2' script_version = '2.nope' add_content_main(['-p', tmp_dir, 'script', group_name, project_name, script_version, script_name]) return
tests/test_add_content.py
from shutil import copytree, move from tempfile import TemporaryDirectory from pathlib import Path from unittest import skip from capanno_utils.repo_config import tools_dir_name from tests.test_base import TestBase from capanno_utils.add_content import main as add_content_main from capanno_utils.helpers.get_paths import * # @skip('') class TestAddToolMain(TestBase): # @skip('') def test_add_tool(self): with TemporaryDirectory(prefix='test_add_tool_') as tmp_dir: self.make_empty_tools_index(tmp_dir) tool_name = 'test_1' tool_version = 'fake.1' add_content_main(['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version, "--has-primary"]) return # @skip('') def test_add_tool_with_subtools(self): with TemporaryDirectory(prefix='test_add_w_subtools_') as tmp_dir: self.make_empty_tools_index(tmp_dir) tool_name = 'test_2' tool_version = 'fake.2' subtools = ['subtool1', 'subtool2', 'subtool3'] add_content_main(['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version] + subtools) return # @skip('') def test_add_tool_with_biotools_id(self): with TemporaryDirectory(prefix='with_biotools_') as tmp_dir: self.make_empty_tools_index(tmp_dir) tool_name = 'test_biotools' tool_version = 'fake.3' biotools_id = 'malvirus' subtools = ['subtool1', 'subtool2', 'subtool3'] options = ['--biotoolsID', biotools_id] add_content_main(['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version] + subtools + options) return def test_add_tool_with_subtools_with_init_urls(self): cwl_url = 'https://raw.githubusercontent.com/common-workflow-library/bio-cwl-tools/release/bandage/bandage-image.cwl' tool_name = 'test_biotools' tool_version = 'fake.3' biotools_id = 'malvirus' subtools = ['subtool1', 'subtool2', 'subtool3'] options = ['--biotoolsID', biotools_id] init_cwl = ['--init-cwl', f"subtool1={cwl_url}", f"subtool2={cwl_url}"] with TemporaryDirectory(prefix='add_with_url') as tmp_dir: self.make_empty_tools_index(tmp_dir) add_content_main( ['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version] + subtools + options + init_cwl) def test_add_tool_with_subtools_with_init_url_main_only(self): cwl_url = 'https://raw.githubusercontent.com/common-workflow-library/bio-cwl-tools/release/bandage/bandage-image.cwl' tool_name = 'test_biotools' tool_version = 'fake.3' biotools_id = 'malvirus' options = ['--biotoolsID', biotools_id, '--has-primary'] init_cwl = ['--init-cwl', cwl_url] with TemporaryDirectory(prefix='add_with_url') as tmp_dir: self.make_empty_tools_index(tmp_dir) add_content_main( ['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version] + options + init_cwl) # @skip('') def test_add_subtool(self): with TemporaryDirectory(prefix='add_subtool_') as tmp_dir: self.make_empty_tools_index(tmp_dir) tool_name = 'test_4' tool_version = 'fake.4' subtool_name = 'new_subtool' add_content_main(['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version]) add_content_main(['-p', tmp_dir, 'subtool', tool_name, tool_version, subtool_name, '-u']) return def test_add_tool_with_existing_cwl_url(self): cwl_url = 'https://raw.githubusercontent.com/common-workflow-library/bio-cwl-tools/release/bandage/bandage-image.cwl' biotools_id = 'bandage' tool_name = 'bandage' tool_version = 'fake.6' subtool_name = 'image' with TemporaryDirectory(prefix='add_tool_with_cwl_') as tmp_dir: self.make_empty_tools_index(tmp_dir) add_content_main(['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version, '--biotoolsID', biotools_id]) add_content_main(['-p', tmp_dir, 'subtool', tool_name, tool_version, subtool_name, '-u', '--init-cwl', cwl_url]) assert True return def test_add_tool_instance(self): tool_name = 'STAR' tool_version = '2.5' subtool_name = 'alignReads' tool_directory = get_main_tool_dir(tool_name, base_dir=self.test_content_dir) with TemporaryDirectory() as tmp_dir: self.make_empty_tools_index(tmp_dir, add_identifiers=['TL_8ab263.82', 'TL_8ab263_a4.82']) tool_temp_path = Path(tmp_dir) / tools_dir_name / tool_name copytree(tool_directory, tool_temp_path) add_content_main(['-p', tmp_dir, 'tool-instance', tool_name, tool_version, subtool_name]) assert True # Just provides a place for a breakpoint to take a look.at tmp_dir return def test_add_tool_instance_main(self): tool_name = 'cat' tool_version = '8.x' tool_directory = get_main_tool_dir(tool_name, base_dir=self.test_content_dir) with TemporaryDirectory() as tmp_dir: self.make_empty_tools_index(tmp_dir, add_identifiers=['TL_d077f2.47', 'TL_d077f2_54.47']) tool_temp_path = Path(tmp_dir) / tools_dir_name / tool_name copytree(tool_directory, tool_temp_path) add_content_main(['-p', tmp_dir, 'tool-instance', tool_name, tool_version]) assert True # Just provides a place for a breakpoint to take a look.at tmp_dir return def test_add_tool_with_wdl_url(self): wdl_url = 'https://github.com/broadinstitute/warp/raw/develop/tasks/skylab/CreateCountMatrix.wdl' tool_name = 'who_cares' tool_version = 'fake.fake' subtool_name = 'test_wdl_subtool' with TemporaryDirectory(prefix='add_tool_with_wdl') as tmp_dir: self.make_empty_tools_index(tmp_dir) add_content_main( ['--no-refresh-index', '-p', tmp_dir, 'tool', tool_name, tool_version]) add_content_main( ['-p', tmp_dir, 'subtool', tool_name, tool_version, subtool_name, '-u', '--init-wdl', wdl_url]) assert True return # @skip('') class TestAddScriptMain(TestBase): def test_add_common_script(self): with TemporaryDirectory() as tmp_dir: group_name = 'test_group1' project_name = 'fake_project_1' script_version = '1.nope' file_name = "some_filename" add_content_main(['-p', tmp_dir, 'common-script', group_name, project_name, script_version, file_name]) return def test_add_script(self): with TemporaryDirectory() as tmp_dir: group_name = 'test_group2' project_name = 'fake_project_2' script_name = 'new_script_2' script_version = '2.nope' add_content_main(['-p', tmp_dir, 'script', group_name, project_name, script_version, script_name]) return
0.386416
0.176476
import tkinter as tk import tkinter.ttk as ttk import TestUrl import sys import tkinter.filedialog import Tools class TestUrlFrame(tk.Frame): def __init__(self, master=None): tk.Frame.__init__(self, master) self.root = master self.param1_filepath = tk.StringVar() self.param2_filepath = tk.StringVar() self.url_value = tk.StringVar() self.url_value.set("http://localhost:3000/login/loginSub") self.reqheaders_value = tk.StringVar() self.creatPage() def creatPage(self): tk.Label(self, text="测试URL:").grid( row=0, column=0, sticky='W') self.url_entry = tk.Entry(self, width=60, textvariable=self.url_value) self.url_entry.grid(row=0, column=1, sticky='W') tk.Label(self, text="提交方式:").grid(row=1, column=0, sticky='W') self.httpsub_combox = ttk.Combobox(self) self.httpsub_combox['values'] = ["GET", "POST"] self.httpsub_combox.grid(row=1, column=1, sticky='W') tk.Label(self, text="头部信息:").grid(row=2, column=0, sticky='W') # 创建文本框text,设置宽度100,high不是高度,是文本显示的行数设置为2行 self.reqheaders_text = tk.Text(self, width=60, height=8) self.reqheaders_text.insert( 1.0, {"User-Agent": "Mozilla/5.0 (Windows NT 6.3; Win64; x64)" "AppleWebKit/537.36 (KHTML, like Gecko)" "Chrome/65.0.3325.181 Safari/537.36", "Referer": "http://localhost:3000/"}) self.reqheaders_text.grid(row=2, column=1, sticky='W') # 创建文本框侧边滚动条,主要方法有两个,将滚动条command方法设置为文本框的yview,将文本框['yscrollcommand']设置为滚动条的set方法 self.sl1 = tk.Scrollbar(self, orient=tk.VERTICAL, command=self.reqheaders_text.yview) self.sl1.grid(row=2, column=2, sticky=tk.N+tk.S) self.reqheaders_text['yscrollcommand'] = self.sl1.set # 参数选择frame初始化 self.initParamFrm() self.res_text = tk.Text(self, width=60, height=12) self.res_text.grid(row=4, column=1) # 参数选择frame初始化 def initParamFrm(self): self.param_frame = tk.Frame(self) self.param_frame.grid(row=3, column=0, columnspan=2, sticky='W') tk.Label(self.param_frame, text="参数1名:").grid( row=0, column=0, sticky='W') self.param1key_entry = tk.Entry(self.param_frame, width=10) self.param1key_entry.grid(row=0, column=1, sticky='W') tk.Label(self.param_frame, text="参数1测试值选择:",).grid( row=0, column=2, sticky='W') self.param1_entry = tk.Entry( self.param_frame, textvariable=self.param1_filepath, width=30) self.param1_entry.grid(row=0, column=3, sticky='W') tk.Button(self.param_frame, text="文件选择", # command=lambda: self.selectPath(self.param1_filepath)).grid(row=0, column=4) command=lambda: Tools.Tools.selectPath(self.param1_filepath)).grid(row=0, column=4) tk.Label(self.param_frame, text="参数2名:").grid( row=1, column=0, sticky='W') self.param2key_entry = tk.Entry(self.param_frame, width=10) self.param2key_entry.grid(row=1, column=1, sticky='W') tk.Label(self.param_frame, text="参数2测试值选择:").grid( row=1, column=2, sticky='W') self.param2_entry = tk.Entry( self.param_frame, textvariable=self.param2_filepath, width=30) self.param2_entry.grid(row=1, column=3, sticky='W') tk.Button(self.param_frame, text="文件选择", command=lambda: Tools.Tools.selectPath(self.param2_filepath)).grid(row=1, column=4) self.btn = tk.Button(self, text="btn", width=6, command=self._go) self.btn.grid() def getBack(self): self.url = self.url_entry.get() self.headers = eval(self.reqheaders_text.get('0.0', 'end')) print(self.param1_entry.get()) return self.url, self.headers # 原始的文件选择方法 移到了Tools文件里 # def selectPath(self, en): # path = tkinter.filedialog.askopenfilename() # en.set(path) def _go(self): url, headers = self.getBack() param1_key = self.param1key_entry.get() param2_key = self.param2key_entry.get() param1_value = Tools.Tools.returnJson2List(self.param1_filepath.get()) param2_value = Tools.Tools.returnJson2List(self.param2_filepath.get()) # self.url = self.url_entry.get() # self.headers = eval(self.reqheaders_text.get('0.0', 'end')) # self.f = TestUrl.ReadFile("D:/projects/python36/Tool-Set/1.json") ok_num = 0 # 成功用例计数 fail_num = 0 # 失败用例计数 ok_list = [] # 成功用例列表,若为字典的话因为值不同导致被覆盖 fail_list = [] # 失败用例列表 try: for i in param1_value: for j in param2_value: params = {param1_key: i, param2_key: j} try: test_login = TestUrl.TLoginPOST(url, headers, params) t_req = test_login.get_back() # 由于字典的键为code 所以会不断进行覆盖,变成了更新而不是拼接 item = dict(t_req, **i) if t_req["code"] == "200": ok_num += 1 ok_list.append(item) else: fail_num += 1 fail_list.append(item) num = ok_num + fail_num except: t = '%s%s' % ("连接错误!", sys.exc_info()[0]) print(t) self.res_text.delete(1.0, "end") self.res_text.insert(1.0, t) t = '%s%s%s%s%s%s%s%s%s%s%s%s%s' % ("共测试", num, "个用例,", "\n", "其中成功", ok_num, "个,失败", fail_num, "个", "\n", "成功的用例为:", "\n", ok_list) self.res_text.delete(1.0, "end") self.res_text.insert(1.0, t) except: print('文件读取错误!') if __name__ == '__main__': root = tk.Tk() root.title("Tool Set") width = 600 height = 660 root.geometry( '%dx%d+%d+%d' % (width, height, (root.winfo_screenwidth() - width)/2, (root.winfo_screenheight() - height)/2)) frm = TestUrlFrame(root) frm.grid() root.mainloop()
TestUrlFrame.py
import tkinter as tk import tkinter.ttk as ttk import TestUrl import sys import tkinter.filedialog import Tools class TestUrlFrame(tk.Frame): def __init__(self, master=None): tk.Frame.__init__(self, master) self.root = master self.param1_filepath = tk.StringVar() self.param2_filepath = tk.StringVar() self.url_value = tk.StringVar() self.url_value.set("http://localhost:3000/login/loginSub") self.reqheaders_value = tk.StringVar() self.creatPage() def creatPage(self): tk.Label(self, text="测试URL:").grid( row=0, column=0, sticky='W') self.url_entry = tk.Entry(self, width=60, textvariable=self.url_value) self.url_entry.grid(row=0, column=1, sticky='W') tk.Label(self, text="提交方式:").grid(row=1, column=0, sticky='W') self.httpsub_combox = ttk.Combobox(self) self.httpsub_combox['values'] = ["GET", "POST"] self.httpsub_combox.grid(row=1, column=1, sticky='W') tk.Label(self, text="头部信息:").grid(row=2, column=0, sticky='W') # 创建文本框text,设置宽度100,high不是高度,是文本显示的行数设置为2行 self.reqheaders_text = tk.Text(self, width=60, height=8) self.reqheaders_text.insert( 1.0, {"User-Agent": "Mozilla/5.0 (Windows NT 6.3; Win64; x64)" "AppleWebKit/537.36 (KHTML, like Gecko)" "Chrome/65.0.3325.181 Safari/537.36", "Referer": "http://localhost:3000/"}) self.reqheaders_text.grid(row=2, column=1, sticky='W') # 创建文本框侧边滚动条,主要方法有两个,将滚动条command方法设置为文本框的yview,将文本框['yscrollcommand']设置为滚动条的set方法 self.sl1 = tk.Scrollbar(self, orient=tk.VERTICAL, command=self.reqheaders_text.yview) self.sl1.grid(row=2, column=2, sticky=tk.N+tk.S) self.reqheaders_text['yscrollcommand'] = self.sl1.set # 参数选择frame初始化 self.initParamFrm() self.res_text = tk.Text(self, width=60, height=12) self.res_text.grid(row=4, column=1) # 参数选择frame初始化 def initParamFrm(self): self.param_frame = tk.Frame(self) self.param_frame.grid(row=3, column=0, columnspan=2, sticky='W') tk.Label(self.param_frame, text="参数1名:").grid( row=0, column=0, sticky='W') self.param1key_entry = tk.Entry(self.param_frame, width=10) self.param1key_entry.grid(row=0, column=1, sticky='W') tk.Label(self.param_frame, text="参数1测试值选择:",).grid( row=0, column=2, sticky='W') self.param1_entry = tk.Entry( self.param_frame, textvariable=self.param1_filepath, width=30) self.param1_entry.grid(row=0, column=3, sticky='W') tk.Button(self.param_frame, text="文件选择", # command=lambda: self.selectPath(self.param1_filepath)).grid(row=0, column=4) command=lambda: Tools.Tools.selectPath(self.param1_filepath)).grid(row=0, column=4) tk.Label(self.param_frame, text="参数2名:").grid( row=1, column=0, sticky='W') self.param2key_entry = tk.Entry(self.param_frame, width=10) self.param2key_entry.grid(row=1, column=1, sticky='W') tk.Label(self.param_frame, text="参数2测试值选择:").grid( row=1, column=2, sticky='W') self.param2_entry = tk.Entry( self.param_frame, textvariable=self.param2_filepath, width=30) self.param2_entry.grid(row=1, column=3, sticky='W') tk.Button(self.param_frame, text="文件选择", command=lambda: Tools.Tools.selectPath(self.param2_filepath)).grid(row=1, column=4) self.btn = tk.Button(self, text="btn", width=6, command=self._go) self.btn.grid() def getBack(self): self.url = self.url_entry.get() self.headers = eval(self.reqheaders_text.get('0.0', 'end')) print(self.param1_entry.get()) return self.url, self.headers # 原始的文件选择方法 移到了Tools文件里 # def selectPath(self, en): # path = tkinter.filedialog.askopenfilename() # en.set(path) def _go(self): url, headers = self.getBack() param1_key = self.param1key_entry.get() param2_key = self.param2key_entry.get() param1_value = Tools.Tools.returnJson2List(self.param1_filepath.get()) param2_value = Tools.Tools.returnJson2List(self.param2_filepath.get()) # self.url = self.url_entry.get() # self.headers = eval(self.reqheaders_text.get('0.0', 'end')) # self.f = TestUrl.ReadFile("D:/projects/python36/Tool-Set/1.json") ok_num = 0 # 成功用例计数 fail_num = 0 # 失败用例计数 ok_list = [] # 成功用例列表,若为字典的话因为值不同导致被覆盖 fail_list = [] # 失败用例列表 try: for i in param1_value: for j in param2_value: params = {param1_key: i, param2_key: j} try: test_login = TestUrl.TLoginPOST(url, headers, params) t_req = test_login.get_back() # 由于字典的键为code 所以会不断进行覆盖,变成了更新而不是拼接 item = dict(t_req, **i) if t_req["code"] == "200": ok_num += 1 ok_list.append(item) else: fail_num += 1 fail_list.append(item) num = ok_num + fail_num except: t = '%s%s' % ("连接错误!", sys.exc_info()[0]) print(t) self.res_text.delete(1.0, "end") self.res_text.insert(1.0, t) t = '%s%s%s%s%s%s%s%s%s%s%s%s%s' % ("共测试", num, "个用例,", "\n", "其中成功", ok_num, "个,失败", fail_num, "个", "\n", "成功的用例为:", "\n", ok_list) self.res_text.delete(1.0, "end") self.res_text.insert(1.0, t) except: print('文件读取错误!') if __name__ == '__main__': root = tk.Tk() root.title("Tool Set") width = 600 height = 660 root.geometry( '%dx%d+%d+%d' % (width, height, (root.winfo_screenwidth() - width)/2, (root.winfo_screenheight() - height)/2)) frm = TestUrlFrame(root) frm.grid() root.mainloop()
0.145692
0.109135
import argparse import glob import json import os import shutil from q2t.thermo import get_thermo from q2t.qchem import QChem from q2t.mol import str_to_rmg_mol, geo_to_rmg_mol, geo_to_xyz_str def main(): args = parse_args() if args.bacs is not None: with open(args.bacs) as f: bacs = json.load(f) else: bacs = None with open(args.identifier_file) as f: identifiers = [line.strip() for line in f if line.strip()] if args.exceptions_file is not None: with open(args.exceptions_file) as f: exceptions = {line.strip() for line in f if line.strip()} else: exceptions = set() if args.energy_dir is None: optfreq_logs = {int(os.path.basename(log).split('.')[0]): log for log in glob.iglob(os.path.join(args.optfreq_dir, '[0-9]*.out'))} energy_logs = {i: None for i in optfreq_logs} else: energy_logs = {int(os.path.basename(log).split('.')[0]): log for log in glob.iglob(os.path.join(args.energy_dir, '[0-9]*.out'))} optfreq_logs = {i: os.path.join(args.optfreq_dir, '{}.out'.format(i)) for i in energy_logs} out_dir = args.out_dir scr_dir = os.path.join(out_dir, 'SYMM_SCRATCH') if not os.path.exists(out_dir): os.makedirs(out_dir) if not os.path.exists(scr_dir): os.mkdir(scr_dir) thermo, geos = {}, {} for i, energy_log in energy_logs.iteritems(): optfreq_log = optfreq_logs[i] identifier = identifiers[i] try: geo = QChem(logfile=optfreq_log).get_geometry() except IOError: print('Missing optfreq file {}!'.format(optfreq_log)) continue mol_check = str_to_rmg_mol(identifier, single_bonds=True) mol = geo_to_rmg_mol(geo) if identifier in exceptions or mol_check.isIsomorphic(mol): thermo[identifier] = get_thermo(optfreq_log, args.freq_level, args.model_chemistry, energy_log=energy_log, mol=mol, bacs=bacs, soc=args.soc, infer_symmetry=args.symmetry, infer_chirality=args.chirality, unique_id=str(i), scr_dir=scr_dir) geos[identifier] = geo else: print('Ignored {}: {} does not match parsed geometry!'.format(optfreq_log, identifier)) shutil.rmtree(scr_dir) hpath = os.path.join(out_dir, 'hf298.csv') spath = os.path.join(out_dir, 's298.csv') cpath = os.path.join(out_dir, 'cp.csv') gpath = os.path.join(out_dir, 'geos.xyz') with open(hpath, 'w') as hf, open(spath, 'w') as sf, open(cpath, 'w') as cf, open(gpath, 'w') as gf: for identifier in thermo: hf298, s298, cp = thermo[identifier] geo = geos[identifier] hf.write('{} {}\n'.format(identifier, hf298)) sf.write('{} {}\n'.format(identifier, s298)) cf.write('{0} {1[0]} {1[1]} {1[2]} {1[3]} {1[4]} {1[5]} {1[6]}\n'.format(identifier, cp)) gf.write(geo_to_xyz_str(geo)) def parse_args(): parser = argparse.ArgumentParser(formatter_class=argparse.ArgumentDefaultsHelpFormatter) parser.add_argument('identifier_file', help='File containing molecule identifiers in order') parser.add_argument('optfreq_dir', help='Directory containing Q-Chem optfreq jobs') parser.add_argument('out_dir', help='Output directory') parser.add_argument('--energy_dir', help='Directory containing Molpro energy jobs (optional)') parser.add_argument('--model_chemistry', default='ccsd(t)-f12a/cc-pvdz-f12', help='Level of theory for energy') parser.add_argument('--freq_level', default='wb97x-d3/def2-tzvp', help='Level of theory for frequencies') parser.add_argument('--soc', action='store_true', help='Use spin-orbit corrections') parser.add_argument('--exceptions_file', help='File containing molecule identifiers that override ' 'match checking of true and parsed geometry') parser.add_argument('--bacs', help='.json file containing BACs in kcal/mol') parser.add_argument('--symmetry', action='store_true', help='Infer symmetry') parser.add_argument('--chirality', action='store_true', help='Infer chirality') return parser.parse_args() if __name__ == '__main__': main()
compute_thermo.py
import argparse import glob import json import os import shutil from q2t.thermo import get_thermo from q2t.qchem import QChem from q2t.mol import str_to_rmg_mol, geo_to_rmg_mol, geo_to_xyz_str def main(): args = parse_args() if args.bacs is not None: with open(args.bacs) as f: bacs = json.load(f) else: bacs = None with open(args.identifier_file) as f: identifiers = [line.strip() for line in f if line.strip()] if args.exceptions_file is not None: with open(args.exceptions_file) as f: exceptions = {line.strip() for line in f if line.strip()} else: exceptions = set() if args.energy_dir is None: optfreq_logs = {int(os.path.basename(log).split('.')[0]): log for log in glob.iglob(os.path.join(args.optfreq_dir, '[0-9]*.out'))} energy_logs = {i: None for i in optfreq_logs} else: energy_logs = {int(os.path.basename(log).split('.')[0]): log for log in glob.iglob(os.path.join(args.energy_dir, '[0-9]*.out'))} optfreq_logs = {i: os.path.join(args.optfreq_dir, '{}.out'.format(i)) for i in energy_logs} out_dir = args.out_dir scr_dir = os.path.join(out_dir, 'SYMM_SCRATCH') if not os.path.exists(out_dir): os.makedirs(out_dir) if not os.path.exists(scr_dir): os.mkdir(scr_dir) thermo, geos = {}, {} for i, energy_log in energy_logs.iteritems(): optfreq_log = optfreq_logs[i] identifier = identifiers[i] try: geo = QChem(logfile=optfreq_log).get_geometry() except IOError: print('Missing optfreq file {}!'.format(optfreq_log)) continue mol_check = str_to_rmg_mol(identifier, single_bonds=True) mol = geo_to_rmg_mol(geo) if identifier in exceptions or mol_check.isIsomorphic(mol): thermo[identifier] = get_thermo(optfreq_log, args.freq_level, args.model_chemistry, energy_log=energy_log, mol=mol, bacs=bacs, soc=args.soc, infer_symmetry=args.symmetry, infer_chirality=args.chirality, unique_id=str(i), scr_dir=scr_dir) geos[identifier] = geo else: print('Ignored {}: {} does not match parsed geometry!'.format(optfreq_log, identifier)) shutil.rmtree(scr_dir) hpath = os.path.join(out_dir, 'hf298.csv') spath = os.path.join(out_dir, 's298.csv') cpath = os.path.join(out_dir, 'cp.csv') gpath = os.path.join(out_dir, 'geos.xyz') with open(hpath, 'w') as hf, open(spath, 'w') as sf, open(cpath, 'w') as cf, open(gpath, 'w') as gf: for identifier in thermo: hf298, s298, cp = thermo[identifier] geo = geos[identifier] hf.write('{} {}\n'.format(identifier, hf298)) sf.write('{} {}\n'.format(identifier, s298)) cf.write('{0} {1[0]} {1[1]} {1[2]} {1[3]} {1[4]} {1[5]} {1[6]}\n'.format(identifier, cp)) gf.write(geo_to_xyz_str(geo)) def parse_args(): parser = argparse.ArgumentParser(formatter_class=argparse.ArgumentDefaultsHelpFormatter) parser.add_argument('identifier_file', help='File containing molecule identifiers in order') parser.add_argument('optfreq_dir', help='Directory containing Q-Chem optfreq jobs') parser.add_argument('out_dir', help='Output directory') parser.add_argument('--energy_dir', help='Directory containing Molpro energy jobs (optional)') parser.add_argument('--model_chemistry', default='ccsd(t)-f12a/cc-pvdz-f12', help='Level of theory for energy') parser.add_argument('--freq_level', default='wb97x-d3/def2-tzvp', help='Level of theory for frequencies') parser.add_argument('--soc', action='store_true', help='Use spin-orbit corrections') parser.add_argument('--exceptions_file', help='File containing molecule identifiers that override ' 'match checking of true and parsed geometry') parser.add_argument('--bacs', help='.json file containing BACs in kcal/mol') parser.add_argument('--symmetry', action='store_true', help='Infer symmetry') parser.add_argument('--chirality', action='store_true', help='Infer chirality') return parser.parse_args() if __name__ == '__main__': main()
0.331877
0.172712
"""Utility code for converting between absl logging output and log protos.""" import contextlib import datetime import pathlib import re import sys import typing from absl import logging from labm8.py import app from labm8.py import labdate from labm8.py.internal import logging_pb2 FLAGS = app.FLAGS # A regular expression to match the components of an absl logging prefix. See: # https://github.com/abseil/abseil-py/blob/e69e200f680a20c50e0e2cd9e74e9850ff69b856/absl/logging/__init__.py#L554-L583 ABSL_LOGGING_LINE_RE = re.compile( r"(?P<lvl>[IWEF])(?P<timestamp>\d\d\d\d \d\d:\d\d:\d\d.\d\d\d\d\d\d) " r"(?P<thread_id>\d+) (?P<filename>[^:]+):(?P<lineno>\d+)] " r"(?P<contents>.*)", ) # Convert a single letter absl logging prefix to a LogRecord.LogLevel. Since # absl logging uses the same prefix for logging.DEBUG and logging.INFO, this # conversion is lossy, as LogRecord.DEBUG is never returned. ABSL_LEVEL_TO_LOG_RECORD_LEVEL = { "I": logging_pb2.LogRecord.INFO, "W": logging_pb2.LogRecord.WARNING, "E": logging_pb2.LogRecord.ERROR, "F": logging_pb2.LogRecord.FATAL, } def DatetimeFromAbslTimestamp( timestamp: str, year: int = datetime.datetime.utcnow().year, ) -> datetime.datetime: """Convert absl logging timestamp to datetime. WARNING: Absl logs do not include the year, so if parsing logs from previous years, be sure to set the year argument! The default value assumes the logs are from the current year. Args: timestamp: The string timestamp. year: The year, as an integer. E.g. 2019. Returns: A datetime. """ dt = datetime.datetime.strptime(str(year) + timestamp, "%Y%m%d %H:%M:%S.%f") return dt def ConertAbslLogToProtos( logs: str, year: int = datetime.datetime.utcnow().year, ) -> typing.List[logging_pb2.LogRecord]: """Convert the output of logging with absl logging to LogRecord protos. WARNING: Absl logs do not include the year, so if parsing logs from previous years, be sure to set the year argument! The default value assumes the logs are from the current year. Args: logs: The output from logging with absl. year: The year, as an integer. E.g. 2019. Returns: A list of LogRecord messages. """ records = [] starting_match = None lines_buffer = [] def ConvertOne() -> logging_pb2.LogRecord: """Convert the current starting_match and lines_buffer into a LogRecord.""" if starting_match: records.append( logging_pb2.LogRecord( level=ABSL_LEVEL_TO_LOG_RECORD_LEVEL[starting_match.group("lvl")], date_unix_epoch_ms=labdate.MillisecondsTimestamp( DatetimeFromAbslTimestamp( starting_match.group("timestamp"), year=year, ), ), thread_id=int(starting_match.group("thread_id")), file_name=starting_match.group("filename"), line_number=int(starting_match.group("lineno")), message="\n".join( [starting_match.group("contents")] + lines_buffer, ).rstrip(), ), ) for line in logs.split("\n"): m = ABSL_LOGGING_LINE_RE.match(line) if m: ConvertOne() starting_match = None lines_buffer = [] starting_match = m elif line and not starting_match: raise ValueError(f"Failed to parse logging output at line: '{line}'") else: lines_buffer.append(line) ConvertOne() return records def StartTeeLogsToFile( program_name: str = None, log_dir: str = None, file_log_level: int = logging.DEBUG, ) -> None: """Log messages to file as well as stderr. Args: program_name: The name of the program. log_dir: The directory to log to. file_log_level: The minimum verbosity level to log to file to. Raises: FileNotFoundError: If the requested log_dir does not exist. """ if not pathlib.Path(log_dir).is_dir(): raise FileNotFoundError(f"Log directory not found: '{log_dir}'") old_verbosity = logging.get_verbosity() logging.set_verbosity(file_log_level) logging.set_stderrthreshold(old_verbosity) logging.get_absl_handler().start_logging_to_file(program_name, log_dir) # The Absl logging handler function start_logging_to_file() sets logtostderr # to False. Re-enable whatever value it was before the call. FLAGS.logtostderr = False def StopTeeLogsToFile(): """Stop logging messages to file as well as stderr.""" logging.get_absl_handler().flush() logging.get_absl_handler().stream = sys.stderr FLAGS.logtostderr = True @contextlib.contextmanager def TeeLogsToFile( program_name: str = None, log_dir: str = None, file_log_level: int = logging.DEBUG, ): """Temporarily enable logging to file. Args: program_name: The name of the program. log_dir: The directory to log to. file_log_level: The minimum verbosity level to log to file to. """ try: StartTeeLogsToFile(program_name, log_dir, file_log_level) yield finally: StopTeeLogsToFile()
labm8/py/logutil.py
"""Utility code for converting between absl logging output and log protos.""" import contextlib import datetime import pathlib import re import sys import typing from absl import logging from labm8.py import app from labm8.py import labdate from labm8.py.internal import logging_pb2 FLAGS = app.FLAGS # A regular expression to match the components of an absl logging prefix. See: # https://github.com/abseil/abseil-py/blob/e69e200f680a20c50e0e2cd9e74e9850ff69b856/absl/logging/__init__.py#L554-L583 ABSL_LOGGING_LINE_RE = re.compile( r"(?P<lvl>[IWEF])(?P<timestamp>\d\d\d\d \d\d:\d\d:\d\d.\d\d\d\d\d\d) " r"(?P<thread_id>\d+) (?P<filename>[^:]+):(?P<lineno>\d+)] " r"(?P<contents>.*)", ) # Convert a single letter absl logging prefix to a LogRecord.LogLevel. Since # absl logging uses the same prefix for logging.DEBUG and logging.INFO, this # conversion is lossy, as LogRecord.DEBUG is never returned. ABSL_LEVEL_TO_LOG_RECORD_LEVEL = { "I": logging_pb2.LogRecord.INFO, "W": logging_pb2.LogRecord.WARNING, "E": logging_pb2.LogRecord.ERROR, "F": logging_pb2.LogRecord.FATAL, } def DatetimeFromAbslTimestamp( timestamp: str, year: int = datetime.datetime.utcnow().year, ) -> datetime.datetime: """Convert absl logging timestamp to datetime. WARNING: Absl logs do not include the year, so if parsing logs from previous years, be sure to set the year argument! The default value assumes the logs are from the current year. Args: timestamp: The string timestamp. year: The year, as an integer. E.g. 2019. Returns: A datetime. """ dt = datetime.datetime.strptime(str(year) + timestamp, "%Y%m%d %H:%M:%S.%f") return dt def ConertAbslLogToProtos( logs: str, year: int = datetime.datetime.utcnow().year, ) -> typing.List[logging_pb2.LogRecord]: """Convert the output of logging with absl logging to LogRecord protos. WARNING: Absl logs do not include the year, so if parsing logs from previous years, be sure to set the year argument! The default value assumes the logs are from the current year. Args: logs: The output from logging with absl. year: The year, as an integer. E.g. 2019. Returns: A list of LogRecord messages. """ records = [] starting_match = None lines_buffer = [] def ConvertOne() -> logging_pb2.LogRecord: """Convert the current starting_match and lines_buffer into a LogRecord.""" if starting_match: records.append( logging_pb2.LogRecord( level=ABSL_LEVEL_TO_LOG_RECORD_LEVEL[starting_match.group("lvl")], date_unix_epoch_ms=labdate.MillisecondsTimestamp( DatetimeFromAbslTimestamp( starting_match.group("timestamp"), year=year, ), ), thread_id=int(starting_match.group("thread_id")), file_name=starting_match.group("filename"), line_number=int(starting_match.group("lineno")), message="\n".join( [starting_match.group("contents")] + lines_buffer, ).rstrip(), ), ) for line in logs.split("\n"): m = ABSL_LOGGING_LINE_RE.match(line) if m: ConvertOne() starting_match = None lines_buffer = [] starting_match = m elif line and not starting_match: raise ValueError(f"Failed to parse logging output at line: '{line}'") else: lines_buffer.append(line) ConvertOne() return records def StartTeeLogsToFile( program_name: str = None, log_dir: str = None, file_log_level: int = logging.DEBUG, ) -> None: """Log messages to file as well as stderr. Args: program_name: The name of the program. log_dir: The directory to log to. file_log_level: The minimum verbosity level to log to file to. Raises: FileNotFoundError: If the requested log_dir does not exist. """ if not pathlib.Path(log_dir).is_dir(): raise FileNotFoundError(f"Log directory not found: '{log_dir}'") old_verbosity = logging.get_verbosity() logging.set_verbosity(file_log_level) logging.set_stderrthreshold(old_verbosity) logging.get_absl_handler().start_logging_to_file(program_name, log_dir) # The Absl logging handler function start_logging_to_file() sets logtostderr # to False. Re-enable whatever value it was before the call. FLAGS.logtostderr = False def StopTeeLogsToFile(): """Stop logging messages to file as well as stderr.""" logging.get_absl_handler().flush() logging.get_absl_handler().stream = sys.stderr FLAGS.logtostderr = True @contextlib.contextmanager def TeeLogsToFile( program_name: str = None, log_dir: str = None, file_log_level: int = logging.DEBUG, ): """Temporarily enable logging to file. Args: program_name: The name of the program. log_dir: The directory to log to. file_log_level: The minimum verbosity level to log to file to. """ try: StartTeeLogsToFile(program_name, log_dir, file_log_level) yield finally: StopTeeLogsToFile()
0.730001
0.442275
import flask import json import logging import mock import testtools from shakenfist.daemons import external_api logging.basicConfig(level=logging.DEBUG) class FakeResponse(object): def __init__(self, status_code, text): self.status_code = status_code self.text = text class ExternalApiTestCase(testtools.TestCase): def setUp(self): super(ExternalApiTestCase, self).setUp() self.add_event = mock.patch( 'shakenfist.db.add_event') self.mock_add_event = self.add_event.start() external_api.TESTING = True external_api.app.testing = True external_api.app.debug = False self.client = external_api.app.test_client() def test_get_root(self): resp = self.client.get('/') self.assertEqual('Shaken Fist REST API service', resp.get_data().decode('utf-8')) self.assertEqual(200, resp.status_code) self.assertEqual('text/plain; charset=utf-8', resp.content_type) @mock.patch('shakenfist.db.get_instance', return_value=None) def test_get_instance_not_found(self, mock_get_instance): resp = self.client.get('/instances/foo') self.assertEqual({'error': 'instance not found', 'status': 404}, resp.get_json()) self.assertEqual(404, resp.status_code) self.assertEqual('application/json', resp.content_type) @mock.patch('shakenfist.db.get_instance', return_value={'uuid': '123', 'name': 'banana'}) def test_get_instance(self, mock_get_instance): resp = self.client.get('/instances/foo') self.assertEqual({'uuid': '123', 'name': 'banana'}, resp.get_json()) self.assertEqual(200, resp.status_code) self.assertEqual('application/json', resp.content_type) @mock.patch('shakenfist.db.get_instance', return_value={'uuid': '123', 'name': 'banana', 'node': 'notthisone', 'disk_spec': [{ 'base': 'cirros', 'size': 8 }], 'block_devices': None}) @mock.patch('shakenfist.config.parsed', return_value={'INCLUDE_TRACEBACKS': '1', 'NODE_NAME': 'thisone', 'STORAGE_PATH': '/a/b/c'}) @mock.patch('requests.request', return_value=FakeResponse(200, '{"fakestuff": "here"}')) def test_delete_instance(self, mock_request, mock_get_config, mock_get_instance): resp = self.client.delete('/instances/foo') mock_request.assert_called_with( 'DELETE', 'http://notthisone:1/instances/foo', data='{}') self.assertEqual({'fakestuff': 'here'}, resp.get_json()) self.assertEqual(200, resp.status_code)
shakenfist/tests/test_daemons_external_api.py
import flask import json import logging import mock import testtools from shakenfist.daemons import external_api logging.basicConfig(level=logging.DEBUG) class FakeResponse(object): def __init__(self, status_code, text): self.status_code = status_code self.text = text class ExternalApiTestCase(testtools.TestCase): def setUp(self): super(ExternalApiTestCase, self).setUp() self.add_event = mock.patch( 'shakenfist.db.add_event') self.mock_add_event = self.add_event.start() external_api.TESTING = True external_api.app.testing = True external_api.app.debug = False self.client = external_api.app.test_client() def test_get_root(self): resp = self.client.get('/') self.assertEqual('Shaken Fist REST API service', resp.get_data().decode('utf-8')) self.assertEqual(200, resp.status_code) self.assertEqual('text/plain; charset=utf-8', resp.content_type) @mock.patch('shakenfist.db.get_instance', return_value=None) def test_get_instance_not_found(self, mock_get_instance): resp = self.client.get('/instances/foo') self.assertEqual({'error': 'instance not found', 'status': 404}, resp.get_json()) self.assertEqual(404, resp.status_code) self.assertEqual('application/json', resp.content_type) @mock.patch('shakenfist.db.get_instance', return_value={'uuid': '123', 'name': 'banana'}) def test_get_instance(self, mock_get_instance): resp = self.client.get('/instances/foo') self.assertEqual({'uuid': '123', 'name': 'banana'}, resp.get_json()) self.assertEqual(200, resp.status_code) self.assertEqual('application/json', resp.content_type) @mock.patch('shakenfist.db.get_instance', return_value={'uuid': '123', 'name': 'banana', 'node': 'notthisone', 'disk_spec': [{ 'base': 'cirros', 'size': 8 }], 'block_devices': None}) @mock.patch('shakenfist.config.parsed', return_value={'INCLUDE_TRACEBACKS': '1', 'NODE_NAME': 'thisone', 'STORAGE_PATH': '/a/b/c'}) @mock.patch('requests.request', return_value=FakeResponse(200, '{"fakestuff": "here"}')) def test_delete_instance(self, mock_request, mock_get_config, mock_get_instance): resp = self.client.delete('/instances/foo') mock_request.assert_called_with( 'DELETE', 'http://notthisone:1/instances/foo', data='{}') self.assertEqual({'fakestuff': 'here'}, resp.get_json()) self.assertEqual(200, resp.status_code)
0.435421
0.080033
from ui_styles import Style from Social_GUI import * #GLOBALS USED IN UI_FUNCTIONS GLOBAL_STATE = 0 GLOBAL_TITLE_BAR = True #COUNT INITIAL MENU count = 1 #LINKS GUI TOGETHER class MainWindow(QMainWindow): def __init__(self): #CREATE GUI WINDOW QMainWindow.__init__(self) self.ui = Ui_MainWindow() self.ui.setupUi(self) self.setWindowTitle('Main Window') UIFunctions.labelTitle(self, "Social Distance Detector") #START AND MIN SIZE startSize = QSize(850, 800) self.resize(startSize) self.setMinimumSize(startSize) #LINK MENUS BELOW #TOGGLE MENU SIZE self.ui.btn_toggle_menu.clicked.connect(lambda: UIFunctions.toggleMenu(self, 220, True)) #CREATE CUSTOM MENUS self.ui.stackedWidget.setMinimumWidth(20) UIFunctions.addNewMenu(self, "HOME", "btn_home", "url(:/16x16/icons/16x16/cil-home.png)", True) UIFunctions.addNewMenu(self, "Advance Settings", "btn_advance", "url(:/16x16/icons/16x16/cil-equalizer.png)", False) # START MENU UIFunctions.selectStandardMenu(self, "btn_home") #START PAGE self.ui.stackedWidget.setCurrentWidget(self.ui.page_home) # MOVE WINDOW / MAXIMIZE / RESTORE def moveWindow(event): # IF MAXIMIZED CHANGE TO NORMAL if UIFunctions.returStatus() == 1: UIFunctions.maximize_restore(self) # MOVE WINDOW if event.buttons() == Qt.LeftButton: self.move(self.pos() + event.globalPos() - self.dragPos) self.dragPos = event.globalPos() event.accept() #LOAD DEFINITIONS UIFunctions.uiDefinitions(self) # MOV EVENT AND SHOW GUI self.ui.frame_label_top_btns.mouseMoveEvent = moveWindow self.show() def Button(self): # GET CLICKED btnWidget = self.sender() # PAGE HOME if btnWidget.objectName() == "btn_home": self.ui.stackedWidget.setCurrentWidget(self.ui.page_home) UIFunctions.resetStyle(self, "btn_home") UIFunctions.labelPage(self, "Home") btnWidget.setStyleSheet(UIFunctions.selectMenu(btnWidget.styleSheet())) # PAGE WIDGETS if btnWidget.objectName() == "btn_advance": self.ui.stackedWidget.setCurrentWidget(self.ui.page_widgets) UIFunctions.resetStyle(self, "btn_advance") UIFunctions.labelPage(self, "Advance Settings") btnWidget.setStyleSheet(UIFunctions.selectMenu(btnWidget.styleSheet())) #MOUSE EVENT def mousePressEvent(self, event): self.dragPos = event.globalPos() #RESIZE EVENT def resizeEvent(self, event): return super(MainWindow, self).resizeEvent(event) class UIFunctions(MainWindow): #GLOBALS GLOBAL_STATE = 0 GLOBAL_TITLE_BAR = True #MAXIMIZE/RESTORE def maximize_restore(self): global GLOBAL_STATE status = GLOBAL_STATE if status == 0: self.showMaximized() GLOBAL_STATE = 1 self.ui.horizontalLayout.setContentsMargins(0, 0, 0, 0) self.ui.btn_maximize_restore.setToolTip("Restore") self.ui.btn_maximize_restore.setIcon(QtGui.QIcon(u":/16x16/icons/16x16/cil-window-restore.png")) self.ui.frame_top_btns.setStyleSheet("background-color: rgb(27, 29, 35)") self.ui.frame_size_grip.hide() else: GLOBAL_STATE = 0 self.showNormal() self.resize(self.width()+1, self.height()+1) self.ui.horizontalLayout.setContentsMargins(10, 10, 10, 10) self.ui.btn_maximize_restore.setToolTip("Maximize") self.ui.btn_maximize_restore.setIcon(QtGui.QIcon(u":/16x16/icons/16x16/cil-window-maximize.png")) self.ui.frame_top_btns.setStyleSheet("background-color: rgba(27, 29, 35, 200)") self.ui.frame_size_grip.show() #RETURN STATUS def returStatus(): return GLOBAL_STATE #SET STATUS def setStatus(status): global GLOBAL_STATE GLOBAL_STATE = status #ENABLE MAXIMUM SIZE def enableMaximumSize(self, width, height): if width != '' and height != '': self.setMaximumSize(QSize(width, height)) self.ui.frame_size_grip.hide() self.ui.btn_maximize_restore.hide() #TOGGLE MENU def toggleMenu(self, maxWidth, enable): if enable: # GET WIDTH width = self.ui.frame_left_menu.width() maxExtend = maxWidth standard = 70 # SET MAX WIDTH if width == 70: widthExtended = maxExtend else: widthExtended = standard # ANIMATION self.animation = QPropertyAnimation(self.ui.frame_left_menu, b"minimumWidth") self.animation.setDuration(300) self.animation.setStartValue(width) self.animation.setEndValue(widthExtended) self.animation.setEasingCurve(QtCore.QEasingCurve.InOutQuart) self.animation.start() # LABEL TITLE def labelTitle(self, text): self.ui.label_title_bar_top.setText(text) #DYNAMIC MENUS def addNewMenu(self, name, objName, icon, isTopMenu): font = QFont() font.setFamily(u"Segoe UI") button = QPushButton(str(count),self) button.setObjectName(objName) sizePolicy3 = QSizePolicy(QSizePolicy.Expanding, QSizePolicy.Fixed) sizePolicy3.setHorizontalStretch(0) sizePolicy3.setVerticalStretch(0) sizePolicy3.setHeightForWidth(button.sizePolicy().hasHeightForWidth()) button.setSizePolicy(sizePolicy3) button.setMinimumSize(QSize(0, 70)) button.setLayoutDirection(Qt.LeftToRight) button.setFont(font) button.setStyleSheet(Style.style_bt_standard.replace('ICON_REPLACE', icon)) button.setText(name) button.setToolTip(name) button.clicked.connect(self.Button) if isTopMenu: self.ui.layout_menus.addWidget(button) else: self.ui.layout_menu_bottom.addWidget(button) #SELECT MENU def selectMenu(getStyle): select = getStyle + ("QPushButton { border-right: 7px solid rgb(44, 49, 60); }") return select # DESELECT MENU def deselectMenu(getStyle): deselect = getStyle.replace("QPushButton { border-right: 7px solid rgb(44, 49, 60); }", "") return deselect #START SELECTION def selectStandardMenu(self, widget): for w in self.ui.frame_left_menu.findChildren(QPushButton): if w.objectName() == widget: w.setStyleSheet(UIFunctions.selectMenu(w.styleSheet())) #RESET SELECTION def resetStyle(self, widget): for w in self.ui.frame_left_menu.findChildren(QPushButton): if w.objectName() != widget: w.setStyleSheet(UIFunctions.deselectMenu(w.styleSheet())) #CHANGE PAGE LABEL TEXT def labelPage(self, text): newText = '| ' + text.upper() self.ui.label_top_info_2.setText(newText) #USER ICON def userIcon(self, initialsTooltip, icon, showHide): if showHide: # SET TEXT self.ui.label_user_icon.setText(initialsTooltip) # SET ICON if icon: style = self.ui.label_user_icon.styleSheet() setIcon = "QLabel { background-image: " + icon + "; }" self.ui.label_user_icon.setStyleSheet(style + setIcon) self.ui.label_user_icon.setText('') self.ui.label_user_icon.setToolTip(initialsTooltip) else: self.ui.label_user_icon.hide() def uiDefinitions(self): #DOUBLE CLICK MAXIMIZES WINDOW def doubleClickMaximizeRestore(event): # IF DOUBLE CLICK CHANGE STATUS if event.type() == QtCore.QEvent.MouseButtonDblClick: QtCore.QTimer.singleShot(250, lambda: UIFunctions.maximize_restore(self)) #MAXIMIZE WINDOW ON TITLE BAR WHEN DOUBLE CLICK if GLOBAL_TITLE_BAR: self.setWindowFlags(QtCore.Qt.FramelessWindowHint) self.setAttribute(QtCore.Qt.WA_TranslucentBackground) self.ui.frame_label_top_btns.mouseDoubleClickEvent = doubleClickMaximizeRestore #SHADOW self.shadow = QGraphicsDropShadowEffect(self) self.shadow.setBlurRadius(17) self.shadow.setXOffset(0) self.shadow.setYOffset(0) self.shadow.setColor(QColor(0, 0, 0, 150)) self.ui.frame_main.setGraphicsEffect(self.shadow) #RESIZE WINDOW self.sizegrip = QSizeGrip(self.ui.frame_size_grip) self.sizegrip.setStyleSheet("width: 20px; height: 20px; margin 0px; padding: 0px;") #MINIMIZE self.ui.btn_minimize.clicked.connect(lambda: self.showMinimized()) #MAXIMIZE/RESTORE self.ui.btn_maximize_restore.clicked.connect(lambda: UIFunctions.maximize_restore(self)) #CLOSE APPLICATION self.ui.btn_close.clicked.connect(lambda: self.close())
ui_functions.py
from ui_styles import Style from Social_GUI import * #GLOBALS USED IN UI_FUNCTIONS GLOBAL_STATE = 0 GLOBAL_TITLE_BAR = True #COUNT INITIAL MENU count = 1 #LINKS GUI TOGETHER class MainWindow(QMainWindow): def __init__(self): #CREATE GUI WINDOW QMainWindow.__init__(self) self.ui = Ui_MainWindow() self.ui.setupUi(self) self.setWindowTitle('Main Window') UIFunctions.labelTitle(self, "Social Distance Detector") #START AND MIN SIZE startSize = QSize(850, 800) self.resize(startSize) self.setMinimumSize(startSize) #LINK MENUS BELOW #TOGGLE MENU SIZE self.ui.btn_toggle_menu.clicked.connect(lambda: UIFunctions.toggleMenu(self, 220, True)) #CREATE CUSTOM MENUS self.ui.stackedWidget.setMinimumWidth(20) UIFunctions.addNewMenu(self, "HOME", "btn_home", "url(:/16x16/icons/16x16/cil-home.png)", True) UIFunctions.addNewMenu(self, "Advance Settings", "btn_advance", "url(:/16x16/icons/16x16/cil-equalizer.png)", False) # START MENU UIFunctions.selectStandardMenu(self, "btn_home") #START PAGE self.ui.stackedWidget.setCurrentWidget(self.ui.page_home) # MOVE WINDOW / MAXIMIZE / RESTORE def moveWindow(event): # IF MAXIMIZED CHANGE TO NORMAL if UIFunctions.returStatus() == 1: UIFunctions.maximize_restore(self) # MOVE WINDOW if event.buttons() == Qt.LeftButton: self.move(self.pos() + event.globalPos() - self.dragPos) self.dragPos = event.globalPos() event.accept() #LOAD DEFINITIONS UIFunctions.uiDefinitions(self) # MOV EVENT AND SHOW GUI self.ui.frame_label_top_btns.mouseMoveEvent = moveWindow self.show() def Button(self): # GET CLICKED btnWidget = self.sender() # PAGE HOME if btnWidget.objectName() == "btn_home": self.ui.stackedWidget.setCurrentWidget(self.ui.page_home) UIFunctions.resetStyle(self, "btn_home") UIFunctions.labelPage(self, "Home") btnWidget.setStyleSheet(UIFunctions.selectMenu(btnWidget.styleSheet())) # PAGE WIDGETS if btnWidget.objectName() == "btn_advance": self.ui.stackedWidget.setCurrentWidget(self.ui.page_widgets) UIFunctions.resetStyle(self, "btn_advance") UIFunctions.labelPage(self, "Advance Settings") btnWidget.setStyleSheet(UIFunctions.selectMenu(btnWidget.styleSheet())) #MOUSE EVENT def mousePressEvent(self, event): self.dragPos = event.globalPos() #RESIZE EVENT def resizeEvent(self, event): return super(MainWindow, self).resizeEvent(event) class UIFunctions(MainWindow): #GLOBALS GLOBAL_STATE = 0 GLOBAL_TITLE_BAR = True #MAXIMIZE/RESTORE def maximize_restore(self): global GLOBAL_STATE status = GLOBAL_STATE if status == 0: self.showMaximized() GLOBAL_STATE = 1 self.ui.horizontalLayout.setContentsMargins(0, 0, 0, 0) self.ui.btn_maximize_restore.setToolTip("Restore") self.ui.btn_maximize_restore.setIcon(QtGui.QIcon(u":/16x16/icons/16x16/cil-window-restore.png")) self.ui.frame_top_btns.setStyleSheet("background-color: rgb(27, 29, 35)") self.ui.frame_size_grip.hide() else: GLOBAL_STATE = 0 self.showNormal() self.resize(self.width()+1, self.height()+1) self.ui.horizontalLayout.setContentsMargins(10, 10, 10, 10) self.ui.btn_maximize_restore.setToolTip("Maximize") self.ui.btn_maximize_restore.setIcon(QtGui.QIcon(u":/16x16/icons/16x16/cil-window-maximize.png")) self.ui.frame_top_btns.setStyleSheet("background-color: rgba(27, 29, 35, 200)") self.ui.frame_size_grip.show() #RETURN STATUS def returStatus(): return GLOBAL_STATE #SET STATUS def setStatus(status): global GLOBAL_STATE GLOBAL_STATE = status #ENABLE MAXIMUM SIZE def enableMaximumSize(self, width, height): if width != '' and height != '': self.setMaximumSize(QSize(width, height)) self.ui.frame_size_grip.hide() self.ui.btn_maximize_restore.hide() #TOGGLE MENU def toggleMenu(self, maxWidth, enable): if enable: # GET WIDTH width = self.ui.frame_left_menu.width() maxExtend = maxWidth standard = 70 # SET MAX WIDTH if width == 70: widthExtended = maxExtend else: widthExtended = standard # ANIMATION self.animation = QPropertyAnimation(self.ui.frame_left_menu, b"minimumWidth") self.animation.setDuration(300) self.animation.setStartValue(width) self.animation.setEndValue(widthExtended) self.animation.setEasingCurve(QtCore.QEasingCurve.InOutQuart) self.animation.start() # LABEL TITLE def labelTitle(self, text): self.ui.label_title_bar_top.setText(text) #DYNAMIC MENUS def addNewMenu(self, name, objName, icon, isTopMenu): font = QFont() font.setFamily(u"Segoe UI") button = QPushButton(str(count),self) button.setObjectName(objName) sizePolicy3 = QSizePolicy(QSizePolicy.Expanding, QSizePolicy.Fixed) sizePolicy3.setHorizontalStretch(0) sizePolicy3.setVerticalStretch(0) sizePolicy3.setHeightForWidth(button.sizePolicy().hasHeightForWidth()) button.setSizePolicy(sizePolicy3) button.setMinimumSize(QSize(0, 70)) button.setLayoutDirection(Qt.LeftToRight) button.setFont(font) button.setStyleSheet(Style.style_bt_standard.replace('ICON_REPLACE', icon)) button.setText(name) button.setToolTip(name) button.clicked.connect(self.Button) if isTopMenu: self.ui.layout_menus.addWidget(button) else: self.ui.layout_menu_bottom.addWidget(button) #SELECT MENU def selectMenu(getStyle): select = getStyle + ("QPushButton { border-right: 7px solid rgb(44, 49, 60); }") return select # DESELECT MENU def deselectMenu(getStyle): deselect = getStyle.replace("QPushButton { border-right: 7px solid rgb(44, 49, 60); }", "") return deselect #START SELECTION def selectStandardMenu(self, widget): for w in self.ui.frame_left_menu.findChildren(QPushButton): if w.objectName() == widget: w.setStyleSheet(UIFunctions.selectMenu(w.styleSheet())) #RESET SELECTION def resetStyle(self, widget): for w in self.ui.frame_left_menu.findChildren(QPushButton): if w.objectName() != widget: w.setStyleSheet(UIFunctions.deselectMenu(w.styleSheet())) #CHANGE PAGE LABEL TEXT def labelPage(self, text): newText = '| ' + text.upper() self.ui.label_top_info_2.setText(newText) #USER ICON def userIcon(self, initialsTooltip, icon, showHide): if showHide: # SET TEXT self.ui.label_user_icon.setText(initialsTooltip) # SET ICON if icon: style = self.ui.label_user_icon.styleSheet() setIcon = "QLabel { background-image: " + icon + "; }" self.ui.label_user_icon.setStyleSheet(style + setIcon) self.ui.label_user_icon.setText('') self.ui.label_user_icon.setToolTip(initialsTooltip) else: self.ui.label_user_icon.hide() def uiDefinitions(self): #DOUBLE CLICK MAXIMIZES WINDOW def doubleClickMaximizeRestore(event): # IF DOUBLE CLICK CHANGE STATUS if event.type() == QtCore.QEvent.MouseButtonDblClick: QtCore.QTimer.singleShot(250, lambda: UIFunctions.maximize_restore(self)) #MAXIMIZE WINDOW ON TITLE BAR WHEN DOUBLE CLICK if GLOBAL_TITLE_BAR: self.setWindowFlags(QtCore.Qt.FramelessWindowHint) self.setAttribute(QtCore.Qt.WA_TranslucentBackground) self.ui.frame_label_top_btns.mouseDoubleClickEvent = doubleClickMaximizeRestore #SHADOW self.shadow = QGraphicsDropShadowEffect(self) self.shadow.setBlurRadius(17) self.shadow.setXOffset(0) self.shadow.setYOffset(0) self.shadow.setColor(QColor(0, 0, 0, 150)) self.ui.frame_main.setGraphicsEffect(self.shadow) #RESIZE WINDOW self.sizegrip = QSizeGrip(self.ui.frame_size_grip) self.sizegrip.setStyleSheet("width: 20px; height: 20px; margin 0px; padding: 0px;") #MINIMIZE self.ui.btn_minimize.clicked.connect(lambda: self.showMinimized()) #MAXIMIZE/RESTORE self.ui.btn_maximize_restore.clicked.connect(lambda: UIFunctions.maximize_restore(self)) #CLOSE APPLICATION self.ui.btn_close.clicked.connect(lambda: self.close())
0.224906
0.044995
import numpy as np import sys class Softmax: def forward_vec(self, scores, win_idx): """ Compute forward propagation. - scores: ndarray(p,). Vector of class scores - win_idx: int. Index of ground truth """ # Keep scores for backprop self.scores= scores # Keep win_idx for backprop self.win_idx= win_idx # Softmax h= np.exp(scores) self.softmax_result= h return h[win_idx]/np.sum(h) def forward(self, scores, win_idx): """ Compute forward propagation. - scores: ndarray(p,m). Matrix with class scores as columns. - win_idx: ndarray(m,). Vector with ground truth """ # For numerical stability # scores -= np.max(scores) # Keep scoes for backprop self.scores= scores # Keep win_idx for backprop self.win_idx= win_idx # Softmax # h= np.exp(scores) # sys.stderr.write(str(h.shape)) h= np.exp(scores - np.max(scores)) self.softmax_result= h col_idx= np.arange(scores.shape[1]) ground_truths= h[win_idx, col_idx] return ground_truths/np.sum(h, axis=0) def backward_vec(self, up_grad): """ Compute local gradient and backprop - up_grad: ndarray(1). Upstream gradient """ h= self.softmax_result # Local gradient # For j != win_idx loc_grad= h * ((-h[self.win_idx])/np.sum(h)**2) # For j== win_idx loc_grad[self.win_idx]= loc_grad[self.win_idx] / ((-h[self.win_idx])/np.sum(h)**2) * ((np.sum(h)-h[self.win_idx])/np.sum(h)**2) return up_grad*loc_grad def backward(self, up_grad): """ Compute local gradient and backprop - up_grad: ndarray(m,). Upstream gradient """ h= self.softmax_result col_idx= np.arange(h.shape[1]) # Local gradient h_sum= np.sum(h, axis=0) den= ((-h[self.win_idx, col_idx])/h_sum**2) # sys.stderr.write(str(den)) # For j != win_idx loc_grad= np.array(h * den, dtype=np.double) # For j== win_idx loc_grad[self.win_idx]= loc_grad[self.win_idx] / den * ((h_sum-h[self.win_idx, col_idx])/h_sum**2) return loc_grad*up_grad
old/test/src/nodes/softmax.py
import numpy as np import sys class Softmax: def forward_vec(self, scores, win_idx): """ Compute forward propagation. - scores: ndarray(p,). Vector of class scores - win_idx: int. Index of ground truth """ # Keep scores for backprop self.scores= scores # Keep win_idx for backprop self.win_idx= win_idx # Softmax h= np.exp(scores) self.softmax_result= h return h[win_idx]/np.sum(h) def forward(self, scores, win_idx): """ Compute forward propagation. - scores: ndarray(p,m). Matrix with class scores as columns. - win_idx: ndarray(m,). Vector with ground truth """ # For numerical stability # scores -= np.max(scores) # Keep scoes for backprop self.scores= scores # Keep win_idx for backprop self.win_idx= win_idx # Softmax # h= np.exp(scores) # sys.stderr.write(str(h.shape)) h= np.exp(scores - np.max(scores)) self.softmax_result= h col_idx= np.arange(scores.shape[1]) ground_truths= h[win_idx, col_idx] return ground_truths/np.sum(h, axis=0) def backward_vec(self, up_grad): """ Compute local gradient and backprop - up_grad: ndarray(1). Upstream gradient """ h= self.softmax_result # Local gradient # For j != win_idx loc_grad= h * ((-h[self.win_idx])/np.sum(h)**2) # For j== win_idx loc_grad[self.win_idx]= loc_grad[self.win_idx] / ((-h[self.win_idx])/np.sum(h)**2) * ((np.sum(h)-h[self.win_idx])/np.sum(h)**2) return up_grad*loc_grad def backward(self, up_grad): """ Compute local gradient and backprop - up_grad: ndarray(m,). Upstream gradient """ h= self.softmax_result col_idx= np.arange(h.shape[1]) # Local gradient h_sum= np.sum(h, axis=0) den= ((-h[self.win_idx, col_idx])/h_sum**2) # sys.stderr.write(str(den)) # For j != win_idx loc_grad= np.array(h * den, dtype=np.double) # For j== win_idx loc_grad[self.win_idx]= loc_grad[self.win_idx] / den * ((h_sum-h[self.win_idx, col_idx])/h_sum**2) return loc_grad*up_grad
0.404625
0.397938
from selenium import webdriver from selenium.webdriver.support.ui import WebDriverWait from selenium.webdriver.common.keys import Keys import time import re import redis def main(key,address): data = [] driver = webdriver.Chrome("D:/Program Files/python/chromedriver.exe") driver2 = webdriver.Chrome("D:/Program Files/python/chromedriver.exe") pool = redis.ConnectionPool(host='127.0.0.1',password='') r = redis.Redis(connection_pool=pool) try: driver.get("https://www.liepin.com/zhaopin") driver.implicitly_wait(3) # list down selector = driver.find_element_by_xpath('//*[@id="sojob"]/div[1]/form/div[1]/div/div/ul/li[1]/span/em') selector.click() cityPanel1 = driver.find_element_by_xpath('//*[@id="sojob"]/div[10]/div[2]') # city select 依旧不同场景选择城市 citys = cityPanel1.find_elements_by_tag_name('a') for c in citys: if c.text == address: c.click() driver.find_element_by_xpath('//*[@id="sojob"]/div[10]/div[3]/a[1]').click() break if c.text == '广东' and address == '佛山': c.click() cityPanel2 = driver.find_element_by_xpath('//*[@id="sojob"]/div[10]/div[2]') city2s = cityPanel2.find_elements_by_tag_name('a') for c2 in city2s: if c2.text == '佛山': c2.click() driver.find_element_by_xpath('//*[@id="sojob"]/div[10]/div[3]/a[1]').click() break break # type1 type1 = driver.find_element_by_xpath('//*[@id="sojob"]/div[1]/form/div[2]/div/div[1]/dl[6]/dd[2]/ul/li[3]/a') driver.execute_script("arguments[0].click();", type1) # type2 type2 = driver.find_element_by_xpath('//*[@id="sojob"]/div[1]/form/div[2]/div/div[1]/dl[6]/dd[1]/ul/li[4]/a') driver.execute_script("arguments[0].click();", type2) # query keyInput = driver.find_element_by_xpath('//*[@id="sojob"]/div[1]/form/div[1]/div/div/div[1]/input') keyInput.send_keys(key) keyInput.send_keys(Keys.ENTER) #get list elems = driver.find_elements_by_xpath('//*[@id="sojob"]/div[2]/div/div[1]/div[1]/ul/li') for i in elems: name = i.find_element_by_xpath('./div/div/h3/a') url = name.get_attribute('href') company = i.find_element_by_xpath('./div/div[2]/p[1]/a') salary = i.find_element_by_xpath('./div/div[1]/p[1]/span[1]') e = { 'type':'liepin' ,'key':key,'name':name.text,'url': url,'company':company.text,'salary':salary.text,'detail':'','address':''} driver2.get(url) driver2.implicitly_wait(2) try: e['detail'] = driver2.find_element_by_xpath('//*[@id="job-view-enterprise"]/div/div/div[1]/div[1]/div[3]/div').text e['address'] = driver2.find_element_by_xpath('//*[@id="job-view-enterprise"]/div/div/div[2]/div[2]/div/div[1]/div/ul[1]/li[3]').text except Exception as err: print(err) r.hset('liepin',e['company']+' '+e['name'],str(e)) data.append(e) # next while True: elemNext = None try: pagebar = driver.find_element_by_xpath('//*[@id="sojob"]/div[2]/div/div[1]/div[1]/div/div') pagebtns = pagebar.find_elements_by_tag_name('a') for i in pagebtns: if i.text == '下一页': elemNext = i break except Exception as err: print(err) continue if elemNext is None or elemNext.get_attribute('class') != '': break driver.execute_script("arguments[0].click();", elemNext) time.sleep(2) temp = driver.find_elements_by_xpath('//*[@id="sojob"]/div[2]/div/div[1]/div[1]/ul/li') for j in temp: name = j.find_element_by_xpath('./div/div/h3/a') url = name.get_attribute('href') company = j.find_element_by_xpath('./div/div[2]/p[1]/a') salary = j.find_element_by_xpath('./div/div[1]/p[1]/span[1]') e = { 'type':'liepin' ,'key':key,'name':name.text,'url': url,'company':company.text,'salary':salary.text,'detail':'','address':''} driver2.get(url) driver2.implicitly_wait(2) try: e['detail'] = driver2.find_element_by_xpath('//*[@id="job-view-enterprise"]/div/div/div[1]/div[1]/div[3]/div').text e['address'] = driver2.find_element_by_xpath('//*[@id="job-view-enterprise"]/div/div/div[2]/div[2]/div/div[1]/div/ul[1]/li[3]').text except Exception as err: print(err) r.hset('liepin',e['company']+' '+e['name'],str(e)) data.append(e) except Exception as err: print(err) return data finally: driver.quit() driver2.quit() pool.disconnect() return data main('c#','广州')
py/liepin_Craw.py
from selenium import webdriver from selenium.webdriver.support.ui import WebDriverWait from selenium.webdriver.common.keys import Keys import time import re import redis def main(key,address): data = [] driver = webdriver.Chrome("D:/Program Files/python/chromedriver.exe") driver2 = webdriver.Chrome("D:/Program Files/python/chromedriver.exe") pool = redis.ConnectionPool(host='127.0.0.1',password='') r = redis.Redis(connection_pool=pool) try: driver.get("https://www.liepin.com/zhaopin") driver.implicitly_wait(3) # list down selector = driver.find_element_by_xpath('//*[@id="sojob"]/div[1]/form/div[1]/div/div/ul/li[1]/span/em') selector.click() cityPanel1 = driver.find_element_by_xpath('//*[@id="sojob"]/div[10]/div[2]') # city select 依旧不同场景选择城市 citys = cityPanel1.find_elements_by_tag_name('a') for c in citys: if c.text == address: c.click() driver.find_element_by_xpath('//*[@id="sojob"]/div[10]/div[3]/a[1]').click() break if c.text == '广东' and address == '佛山': c.click() cityPanel2 = driver.find_element_by_xpath('//*[@id="sojob"]/div[10]/div[2]') city2s = cityPanel2.find_elements_by_tag_name('a') for c2 in city2s: if c2.text == '佛山': c2.click() driver.find_element_by_xpath('//*[@id="sojob"]/div[10]/div[3]/a[1]').click() break break # type1 type1 = driver.find_element_by_xpath('//*[@id="sojob"]/div[1]/form/div[2]/div/div[1]/dl[6]/dd[2]/ul/li[3]/a') driver.execute_script("arguments[0].click();", type1) # type2 type2 = driver.find_element_by_xpath('//*[@id="sojob"]/div[1]/form/div[2]/div/div[1]/dl[6]/dd[1]/ul/li[4]/a') driver.execute_script("arguments[0].click();", type2) # query keyInput = driver.find_element_by_xpath('//*[@id="sojob"]/div[1]/form/div[1]/div/div/div[1]/input') keyInput.send_keys(key) keyInput.send_keys(Keys.ENTER) #get list elems = driver.find_elements_by_xpath('//*[@id="sojob"]/div[2]/div/div[1]/div[1]/ul/li') for i in elems: name = i.find_element_by_xpath('./div/div/h3/a') url = name.get_attribute('href') company = i.find_element_by_xpath('./div/div[2]/p[1]/a') salary = i.find_element_by_xpath('./div/div[1]/p[1]/span[1]') e = { 'type':'liepin' ,'key':key,'name':name.text,'url': url,'company':company.text,'salary':salary.text,'detail':'','address':''} driver2.get(url) driver2.implicitly_wait(2) try: e['detail'] = driver2.find_element_by_xpath('//*[@id="job-view-enterprise"]/div/div/div[1]/div[1]/div[3]/div').text e['address'] = driver2.find_element_by_xpath('//*[@id="job-view-enterprise"]/div/div/div[2]/div[2]/div/div[1]/div/ul[1]/li[3]').text except Exception as err: print(err) r.hset('liepin',e['company']+' '+e['name'],str(e)) data.append(e) # next while True: elemNext = None try: pagebar = driver.find_element_by_xpath('//*[@id="sojob"]/div[2]/div/div[1]/div[1]/div/div') pagebtns = pagebar.find_elements_by_tag_name('a') for i in pagebtns: if i.text == '下一页': elemNext = i break except Exception as err: print(err) continue if elemNext is None or elemNext.get_attribute('class') != '': break driver.execute_script("arguments[0].click();", elemNext) time.sleep(2) temp = driver.find_elements_by_xpath('//*[@id="sojob"]/div[2]/div/div[1]/div[1]/ul/li') for j in temp: name = j.find_element_by_xpath('./div/div/h3/a') url = name.get_attribute('href') company = j.find_element_by_xpath('./div/div[2]/p[1]/a') salary = j.find_element_by_xpath('./div/div[1]/p[1]/span[1]') e = { 'type':'liepin' ,'key':key,'name':name.text,'url': url,'company':company.text,'salary':salary.text,'detail':'','address':''} driver2.get(url) driver2.implicitly_wait(2) try: e['detail'] = driver2.find_element_by_xpath('//*[@id="job-view-enterprise"]/div/div/div[1]/div[1]/div[3]/div').text e['address'] = driver2.find_element_by_xpath('//*[@id="job-view-enterprise"]/div/div/div[2]/div[2]/div/div[1]/div/ul[1]/li[3]').text except Exception as err: print(err) r.hset('liepin',e['company']+' '+e['name'],str(e)) data.append(e) except Exception as err: print(err) return data finally: driver.quit() driver2.quit() pool.disconnect() return data main('c#','广州')
0.062653
0.049131
import pymongo, datetime from bson.objectid import ObjectId import ast #db = pymongo.Connection('localhost', 27017)['sicki3'] db = pymongo.Connection('localhost', 3002)['meteor'] # source collections #economics = db.economics event = db.event #host = db.host #location = db.location #'metaData': metaData = db.'metaData': metaData #metrics = db.metrics #pathogen = db.pathogen # update entries from the other collections eid_events = event.find() meta = { 'rank' : { 'eha': True, 'expert': False, 'top': True, 'auto': False }, 'votes': { 'up': 0, 'down': 0 }, 'userId': 0, 'reviewer': 'eha', 'submitted': '' } print meta count = 0 #dates = ['startDate','startDateISO','refStartDate','endDate','endDateISO','refEndDate'] for eid in eid_events: #print eid['eventName'] count += 1 # Load host cursor = db.host.find ({'eventName': eid['eventName']}) for value in cursor: eid_host = value #print eid_host['hostTaxOrder'] # Load economics cursor = db.economics.find ({'eventName': eid['eventName']}) for value in cursor: eid_economics = value #print eid_economics['avgAgeDeath'] # Load pathogens cursor = db.pathogen.find ({'eventName': eid['eventName']}) for value in cursor: eid_pathogen = value #print eid_pathogen['pathogenClass'] # Load locations cursor = db.location.find ({'eventName': eid['eventName']}) for value in cursor: eid_location = value #print eid_location['locationNation'] # Load SI matches cursor = db.match_key_si.find ({'jonesEIDID': eid['eidID']}) # print type(db.match_key_si.findOne({}, {'jonesEIDID':1})) for value in cursor: eid_match = value print eid_match['jonesEIDID'] id = eid.get('_id') eid_body = { # Meta Data 'meta': { 'rank' : { 'eha': True, 'expert': False, 'top': True, 'auto': False }, 'votes': { 'up': 0, 'down': 0 }, 'userId': 0, 'reviewer': eid['reviewer'], 'submitted': '' }, # Calculated fields 'commentsCount': 0, #Calculated field 'refsCount': 0, #Calculated field # Relational fields # populate refs when matched with the original jones refs 'refs': ast.literal_eval(eid_match['jonesSources']), #Calculated field 'comments' : [], #Calculated field # Quoted value 'valQuote': {}, # original data from Jones et al SI # Value object 'val' : { 'sickiID':{ 'val':'', 'valQuote': eid['eidID'], 'ref': 'ehaID', 'meta': meta }, 'eventName':{ 'val':'', 'valQuote': eid['eventName'], 'refBlob': eid['refEventName'], 'ref': [], 'meta': meta }, 'disease':{ 'val': eid['diseaseVal'], 'valQuote': eid['disease'], 'icd10':eid['ICD10Val'], 'ref':[], 'refBlob': eid['refDisease'], 'meta': meta }, 'eid':{ 'val':'', 'valQuote': eid['eid'], 'ref':[], 'refBlob': eid['refEID'], 'meta': meta }, 'eidCategory':{ 'val':'', 'valQuote': eid['eidCategory'], 'ref':[], 'refBlob': eid['refEIDCategory'], 'meta': meta }, 'abstract': { 'val':'', 'valQuote': eid['Abstract'], 'ref':[], 'refBlob': eid['refAbstract'], 'meta': meta }, 'notes': { 'val':'', 'valQuote': eid['notes'], 'ref':[], 'refBlob': eid['refNotes'], 'meta': meta }, 'transmissionModel': { 'val':eid['transitionModelVal'], 'valQuote': eid['transitionModel'], 'ref':[], 'refBlob': eid['refTransitionModel'], 'meta': meta }, 'zoonoticType': { 'val':eid['zoonoticTypeVal'], 'valQuote': eid['zoonoticType'], 'ref':[], 'refBlob': eid['refZoonoticType'], 'meta': meta }, 'sampleType': { 'val':eid['sampleTypeVal'], 'valQuote': eid['sampleType'], 'ref':[], 'refBlob': eid['refSampleType'], 'meta': meta }, 'driver': { 'val':eid['driverVal'], 'valQuote': eid['driver'], 'ref':[], 'refBlob': eid['refDriver'], 'meta': meta }, ## Pathogens 'pathogens':{ 'drugResistance': { 'val':'', 'valQuote': eid_pathogen['pathogenDrugResistance'], 'ref':[], 'refBlob': eid_pathogen['refPathogenDrugResistance'], 'meta': meta }, 'reportedName': { 'val':'', 'valQuote': eid_pathogen['pathogenReportedName'], 'ref':[], 'refBlob': eid_pathogen['refPathogenReportedName'], 'meta': meta }, 'class': { 'val':'', 'valQuote': eid_pathogen['pathogenClass'], 'ref':[], 'refBlob': eid_pathogen['refPathogenClass'], 'meta': meta }, 'family': { 'val':'', 'valQuote': eid_pathogen['pathogenFamily'], 'ref':[], 'refBlob': eid_pathogen['refPathogenFamily'], 'meta': meta }, 'species': { 'val':'', 'valQuote': eid_pathogen['pathogenSpecies'], 'ref':[], 'refBlob': eid_pathogen['refPathogenSpecies'], 'meta': meta }, 'authority': { 'val':'', 'valQuote': eid_pathogen['pathogenAuthority'], 'ref':[], 'refBlob': eid_pathogen['refPathogenAuthority'], 'meta': meta }, 'taxOrder': { 'val':'', 'valQuote': eid_pathogen['pathogenTaxOrder'], 'ref':[], 'refBlob': eid_pathogen['refPathogenTaxOrder'], 'meta': meta }, 'genus': { 'val':'', 'valQuote': eid_pathogen['pathogenGenus'], 'ref':[], 'refBlob': eid_pathogen['refPathogenGenus'], 'meta': meta }, 'subSpecies': { 'val':'', 'valQuote': eid_pathogen['pathogenSubSpecies'], 'ref':[], 'refBlob': eid_pathogen['refPathogenSubSpecies'], 'meta': meta } }, #pathogens ## Locations 'locations':{ 'name': { 'val':'', 'valQuote': eid_location['locationLocationName'], 'ref':[], 'refBlob': eid_location['refLocationLocationName'], 'meta': meta }, 'placeName': { 'val':'', 'valQuote': eid_location['locationPlaceName'], 'ref':[], 'refBlob': eid_location['refLocationPlaceName'], 'meta': meta }, 'latitude': { 'val':'', 'valQuote': eid_location['locationLatitude'], 'ref':[], 'refBlob': eid_location['refLocationLatitude'], 'meta': meta }, 'longitude': { 'val':'', 'valQuote': eid_location['locationLongitude'], 'ref':[], 'refBlob': eid_location['refLocationLongitude'], 'meta': meta }, 'city': { 'val':'', 'valQuote': eid_location['locationCity'], 'ref':[], 'refBlob': eid_location['refLocationCity'], 'meta': meta }, 'subnationalRegion': { 'val':'', 'valQuote': eid_location['locationSubnationalRegion'], 'ref':[], 'refBlob': eid_location['refLocationSubnationalRegion'], 'meta': meta }, 'nation': { 'val':'', 'valQuote': eid_location['locationNation'], 'ref':[], 'refBlob': eid_location['refLocationNation'], 'meta': meta }, 'continent': { 'val':'', 'valQuote': eid_location['locationContinent'], 'ref':[], 'refBlob': eid_location['refLocationContinent'], 'meta': meta } }, #locations ## Hosts 'hosts':{ 'sex': { 'val':'', 'valQuote': eid['hostSex'], 'ref':[], 'refBlob': eid['refHostSex'], 'meta': meta }, 'domesticationStatus': { 'val':'', 'valQuote': eid['domesticationStatus'], 'ref':[], 'refBlob': eid['refDomesticationStatus'], 'meta': meta }, 'age': { 'val':eid['hostAgeVal'], 'valQuote': eid['hostAge'], 'ref':[], 'refBlob': eid['refHostAge'], 'meta': meta }, 'hostUse': { 'val':'', 'valQuote': eid['hostUse'], 'ref':[], 'refBlob': eid['refHostUse'], 'meta': meta }, 'reportedName': { 'val':'', 'valQuote': eid_host['hostReportedName'], 'ref':[], 'refBlob': eid_host['refHostReportedName'], 'meta': meta }, 'class': { 'val':'', 'valQuote': eid_host['hostClass'], 'ref':[], 'refBlob': eid_host['refHostClass'], 'meta': meta }, 'family': { 'val':'', 'valQuote': eid_host['hostFamily'], 'ref':[], 'refBlob': eid_host['refHostFamily'], 'meta': meta }, 'species': { 'val':'', 'valQuote': eid_host['hostSpecies'], 'ref':[], 'refBlob': eid_host['refHostSpecies'], 'meta': meta }, 'authority': { 'val':'', 'valQuote': eid_host['hostAuthority'], 'ref':[], 'refBlob': eid_host['refHostAuthority'], 'meta': meta }, 'taxOrder': { 'val':'', 'valQuote': eid_host['hostTaxOrder'], 'ref':[], 'refBlob': eid_host['refHostTaxOrder'], 'meta': meta }, 'genus': { 'val':'', 'valQuote': eid_host['hostGenus'], 'ref':[], 'refBlob': eid_host['refHostGenus'], 'meta': meta }, 'subSpecies': { 'val':'', 'valQuote': eid_host['hostSubSpecies'], 'ref':[], 'refBlob': eid_host['refHostSubSpecies'], 'meta': meta } }, #hosts ## Dates 'dates':{ 'startDate':{ 'val':'', 'valQuote': eid['startDate'], 'valForm': eid['startDateISO'], 'ref':[], 'refBlob': eid['refStartDate'], 'meta': meta }, 'endDate':{ 'val':'', 'valQuote': eid['endDate'], 'valForm': eid['endDateISO'], 'ref':[], 'refBlob': eid['refEndDate'], 'meta': meta }, 'duration': { 'val':'', 'valQuote': eid['duration'], 'ref':[], 'refBlob': eid['refDuration'], 'meta': meta } }, #dates ## Characteristics 'characteristics':{ 'numberInfected': { 'val':eid['numberInfectedVal'], 'valQuote': eid['numberInfected'], 'ref':[], 'refBlob': eid['refNumberInfected'], 'meta': meta }, 'prevalence': { 'val':'', 'valQuote': eid['prevalence'], 'ref':[], 'refBlob': eid['refPrevalence'], 'meta': meta }, 'symptomsReported': { 'val':eid['SymptomsReportedVal'], 'valQuote': eid['symptomsReported'], 'ref':[], 'refBlob': eid['refSymptomsReported'], 'meta': meta }, 'numberOfDeaths': { 'val':eid['numberOfDeathsVal'], 'valQuote': eid['numberOfDeaths'], 'ref':[], 'refBlob': eid['refNumberofDeaths'], 'meta': meta }, }, #characteristics ## Contacts 'contacts':{ 'firstName': '', 'lastName': '', 'email': '', 'affiliation': '', 'userID': '', 'blob': { 'val': eid['contact'], 'ref':[], 'refBlob': eid['refContact'] }, 'meta': meta }, # contacts ## Economics 'economics':{ 'avgAgeInfected': { 'val':'', 'valQuote': eid_economics['avgAgeOfInfected'], 'ref':[], 'refBlob': eid_economics['refAvgAgeOfInfected'], 'meta': meta}, 'avgAgeDeath': { 'val':'', 'valQuote': eid_economics['avgAgeDeath'], 'ref':[], 'refBlob': eid_economics['refAvgAgeDeath'], 'meta': meta}, 'tradeTravelRestrictions': { 'val':'', 'valQuote': eid_economics['tradeTravelRestrictions'], 'ref':[], 'refBlob': eid_economics['refTradeTravelRestrictions'], 'meta': meta}, 'numHospitalized': { 'val':'', 'valQuote': eid_economics['numHospitalizedInEvent'], 'ref':[], 'refBlob': eid_economics['refNumHospInEvent'], 'meta': meta}, 'avgCostPerTreatment': { 'val':'', 'valQuote': eid_economics['avgCosPerTreatmentInEvent'], 'ref':[], 'refBlob': eid_economics['refAvgCostTreatmentInEvent'], 'meta': meta }, 'perCapitaNatGDPEventYear': { 'val':'', 'valQuote': eid_economics['perCapitaNationalGDPInYearOfEvent'], 'ref':[], 'refBlob': eid_economics['refPerCapitaNationalGDPInYearOfEvent'], 'meta': meta }, 'avgLifeExpectEventCountryYear': { 'val':'', 'valQuote': eid_economics['avgLifeExpectancyInCountryAndYearOfEvent'], 'ref':[], 'refBlob': eid_economics['refAvgLifeExpectancyInCountryAndYearOfEvent'], 'meta': meta } } # economics } # value object } #body #fix the OjectID format eid_body['_id'] = str(ObjectId()) #print eid_body['refs'][0] #print count #['sickiID'] #['meta']['reviewer'] db.entries.insert(eid_body)
stats2sicki.py
import pymongo, datetime from bson.objectid import ObjectId import ast #db = pymongo.Connection('localhost', 27017)['sicki3'] db = pymongo.Connection('localhost', 3002)['meteor'] # source collections #economics = db.economics event = db.event #host = db.host #location = db.location #'metaData': metaData = db.'metaData': metaData #metrics = db.metrics #pathogen = db.pathogen # update entries from the other collections eid_events = event.find() meta = { 'rank' : { 'eha': True, 'expert': False, 'top': True, 'auto': False }, 'votes': { 'up': 0, 'down': 0 }, 'userId': 0, 'reviewer': 'eha', 'submitted': '' } print meta count = 0 #dates = ['startDate','startDateISO','refStartDate','endDate','endDateISO','refEndDate'] for eid in eid_events: #print eid['eventName'] count += 1 # Load host cursor = db.host.find ({'eventName': eid['eventName']}) for value in cursor: eid_host = value #print eid_host['hostTaxOrder'] # Load economics cursor = db.economics.find ({'eventName': eid['eventName']}) for value in cursor: eid_economics = value #print eid_economics['avgAgeDeath'] # Load pathogens cursor = db.pathogen.find ({'eventName': eid['eventName']}) for value in cursor: eid_pathogen = value #print eid_pathogen['pathogenClass'] # Load locations cursor = db.location.find ({'eventName': eid['eventName']}) for value in cursor: eid_location = value #print eid_location['locationNation'] # Load SI matches cursor = db.match_key_si.find ({'jonesEIDID': eid['eidID']}) # print type(db.match_key_si.findOne({}, {'jonesEIDID':1})) for value in cursor: eid_match = value print eid_match['jonesEIDID'] id = eid.get('_id') eid_body = { # Meta Data 'meta': { 'rank' : { 'eha': True, 'expert': False, 'top': True, 'auto': False }, 'votes': { 'up': 0, 'down': 0 }, 'userId': 0, 'reviewer': eid['reviewer'], 'submitted': '' }, # Calculated fields 'commentsCount': 0, #Calculated field 'refsCount': 0, #Calculated field # Relational fields # populate refs when matched with the original jones refs 'refs': ast.literal_eval(eid_match['jonesSources']), #Calculated field 'comments' : [], #Calculated field # Quoted value 'valQuote': {}, # original data from Jones et al SI # Value object 'val' : { 'sickiID':{ 'val':'', 'valQuote': eid['eidID'], 'ref': 'ehaID', 'meta': meta }, 'eventName':{ 'val':'', 'valQuote': eid['eventName'], 'refBlob': eid['refEventName'], 'ref': [], 'meta': meta }, 'disease':{ 'val': eid['diseaseVal'], 'valQuote': eid['disease'], 'icd10':eid['ICD10Val'], 'ref':[], 'refBlob': eid['refDisease'], 'meta': meta }, 'eid':{ 'val':'', 'valQuote': eid['eid'], 'ref':[], 'refBlob': eid['refEID'], 'meta': meta }, 'eidCategory':{ 'val':'', 'valQuote': eid['eidCategory'], 'ref':[], 'refBlob': eid['refEIDCategory'], 'meta': meta }, 'abstract': { 'val':'', 'valQuote': eid['Abstract'], 'ref':[], 'refBlob': eid['refAbstract'], 'meta': meta }, 'notes': { 'val':'', 'valQuote': eid['notes'], 'ref':[], 'refBlob': eid['refNotes'], 'meta': meta }, 'transmissionModel': { 'val':eid['transitionModelVal'], 'valQuote': eid['transitionModel'], 'ref':[], 'refBlob': eid['refTransitionModel'], 'meta': meta }, 'zoonoticType': { 'val':eid['zoonoticTypeVal'], 'valQuote': eid['zoonoticType'], 'ref':[], 'refBlob': eid['refZoonoticType'], 'meta': meta }, 'sampleType': { 'val':eid['sampleTypeVal'], 'valQuote': eid['sampleType'], 'ref':[], 'refBlob': eid['refSampleType'], 'meta': meta }, 'driver': { 'val':eid['driverVal'], 'valQuote': eid['driver'], 'ref':[], 'refBlob': eid['refDriver'], 'meta': meta }, ## Pathogens 'pathogens':{ 'drugResistance': { 'val':'', 'valQuote': eid_pathogen['pathogenDrugResistance'], 'ref':[], 'refBlob': eid_pathogen['refPathogenDrugResistance'], 'meta': meta }, 'reportedName': { 'val':'', 'valQuote': eid_pathogen['pathogenReportedName'], 'ref':[], 'refBlob': eid_pathogen['refPathogenReportedName'], 'meta': meta }, 'class': { 'val':'', 'valQuote': eid_pathogen['pathogenClass'], 'ref':[], 'refBlob': eid_pathogen['refPathogenClass'], 'meta': meta }, 'family': { 'val':'', 'valQuote': eid_pathogen['pathogenFamily'], 'ref':[], 'refBlob': eid_pathogen['refPathogenFamily'], 'meta': meta }, 'species': { 'val':'', 'valQuote': eid_pathogen['pathogenSpecies'], 'ref':[], 'refBlob': eid_pathogen['refPathogenSpecies'], 'meta': meta }, 'authority': { 'val':'', 'valQuote': eid_pathogen['pathogenAuthority'], 'ref':[], 'refBlob': eid_pathogen['refPathogenAuthority'], 'meta': meta }, 'taxOrder': { 'val':'', 'valQuote': eid_pathogen['pathogenTaxOrder'], 'ref':[], 'refBlob': eid_pathogen['refPathogenTaxOrder'], 'meta': meta }, 'genus': { 'val':'', 'valQuote': eid_pathogen['pathogenGenus'], 'ref':[], 'refBlob': eid_pathogen['refPathogenGenus'], 'meta': meta }, 'subSpecies': { 'val':'', 'valQuote': eid_pathogen['pathogenSubSpecies'], 'ref':[], 'refBlob': eid_pathogen['refPathogenSubSpecies'], 'meta': meta } }, #pathogens ## Locations 'locations':{ 'name': { 'val':'', 'valQuote': eid_location['locationLocationName'], 'ref':[], 'refBlob': eid_location['refLocationLocationName'], 'meta': meta }, 'placeName': { 'val':'', 'valQuote': eid_location['locationPlaceName'], 'ref':[], 'refBlob': eid_location['refLocationPlaceName'], 'meta': meta }, 'latitude': { 'val':'', 'valQuote': eid_location['locationLatitude'], 'ref':[], 'refBlob': eid_location['refLocationLatitude'], 'meta': meta }, 'longitude': { 'val':'', 'valQuote': eid_location['locationLongitude'], 'ref':[], 'refBlob': eid_location['refLocationLongitude'], 'meta': meta }, 'city': { 'val':'', 'valQuote': eid_location['locationCity'], 'ref':[], 'refBlob': eid_location['refLocationCity'], 'meta': meta }, 'subnationalRegion': { 'val':'', 'valQuote': eid_location['locationSubnationalRegion'], 'ref':[], 'refBlob': eid_location['refLocationSubnationalRegion'], 'meta': meta }, 'nation': { 'val':'', 'valQuote': eid_location['locationNation'], 'ref':[], 'refBlob': eid_location['refLocationNation'], 'meta': meta }, 'continent': { 'val':'', 'valQuote': eid_location['locationContinent'], 'ref':[], 'refBlob': eid_location['refLocationContinent'], 'meta': meta } }, #locations ## Hosts 'hosts':{ 'sex': { 'val':'', 'valQuote': eid['hostSex'], 'ref':[], 'refBlob': eid['refHostSex'], 'meta': meta }, 'domesticationStatus': { 'val':'', 'valQuote': eid['domesticationStatus'], 'ref':[], 'refBlob': eid['refDomesticationStatus'], 'meta': meta }, 'age': { 'val':eid['hostAgeVal'], 'valQuote': eid['hostAge'], 'ref':[], 'refBlob': eid['refHostAge'], 'meta': meta }, 'hostUse': { 'val':'', 'valQuote': eid['hostUse'], 'ref':[], 'refBlob': eid['refHostUse'], 'meta': meta }, 'reportedName': { 'val':'', 'valQuote': eid_host['hostReportedName'], 'ref':[], 'refBlob': eid_host['refHostReportedName'], 'meta': meta }, 'class': { 'val':'', 'valQuote': eid_host['hostClass'], 'ref':[], 'refBlob': eid_host['refHostClass'], 'meta': meta }, 'family': { 'val':'', 'valQuote': eid_host['hostFamily'], 'ref':[], 'refBlob': eid_host['refHostFamily'], 'meta': meta }, 'species': { 'val':'', 'valQuote': eid_host['hostSpecies'], 'ref':[], 'refBlob': eid_host['refHostSpecies'], 'meta': meta }, 'authority': { 'val':'', 'valQuote': eid_host['hostAuthority'], 'ref':[], 'refBlob': eid_host['refHostAuthority'], 'meta': meta }, 'taxOrder': { 'val':'', 'valQuote': eid_host['hostTaxOrder'], 'ref':[], 'refBlob': eid_host['refHostTaxOrder'], 'meta': meta }, 'genus': { 'val':'', 'valQuote': eid_host['hostGenus'], 'ref':[], 'refBlob': eid_host['refHostGenus'], 'meta': meta }, 'subSpecies': { 'val':'', 'valQuote': eid_host['hostSubSpecies'], 'ref':[], 'refBlob': eid_host['refHostSubSpecies'], 'meta': meta } }, #hosts ## Dates 'dates':{ 'startDate':{ 'val':'', 'valQuote': eid['startDate'], 'valForm': eid['startDateISO'], 'ref':[], 'refBlob': eid['refStartDate'], 'meta': meta }, 'endDate':{ 'val':'', 'valQuote': eid['endDate'], 'valForm': eid['endDateISO'], 'ref':[], 'refBlob': eid['refEndDate'], 'meta': meta }, 'duration': { 'val':'', 'valQuote': eid['duration'], 'ref':[], 'refBlob': eid['refDuration'], 'meta': meta } }, #dates ## Characteristics 'characteristics':{ 'numberInfected': { 'val':eid['numberInfectedVal'], 'valQuote': eid['numberInfected'], 'ref':[], 'refBlob': eid['refNumberInfected'], 'meta': meta }, 'prevalence': { 'val':'', 'valQuote': eid['prevalence'], 'ref':[], 'refBlob': eid['refPrevalence'], 'meta': meta }, 'symptomsReported': { 'val':eid['SymptomsReportedVal'], 'valQuote': eid['symptomsReported'], 'ref':[], 'refBlob': eid['refSymptomsReported'], 'meta': meta }, 'numberOfDeaths': { 'val':eid['numberOfDeathsVal'], 'valQuote': eid['numberOfDeaths'], 'ref':[], 'refBlob': eid['refNumberofDeaths'], 'meta': meta }, }, #characteristics ## Contacts 'contacts':{ 'firstName': '', 'lastName': '', 'email': '', 'affiliation': '', 'userID': '', 'blob': { 'val': eid['contact'], 'ref':[], 'refBlob': eid['refContact'] }, 'meta': meta }, # contacts ## Economics 'economics':{ 'avgAgeInfected': { 'val':'', 'valQuote': eid_economics['avgAgeOfInfected'], 'ref':[], 'refBlob': eid_economics['refAvgAgeOfInfected'], 'meta': meta}, 'avgAgeDeath': { 'val':'', 'valQuote': eid_economics['avgAgeDeath'], 'ref':[], 'refBlob': eid_economics['refAvgAgeDeath'], 'meta': meta}, 'tradeTravelRestrictions': { 'val':'', 'valQuote': eid_economics['tradeTravelRestrictions'], 'ref':[], 'refBlob': eid_economics['refTradeTravelRestrictions'], 'meta': meta}, 'numHospitalized': { 'val':'', 'valQuote': eid_economics['numHospitalizedInEvent'], 'ref':[], 'refBlob': eid_economics['refNumHospInEvent'], 'meta': meta}, 'avgCostPerTreatment': { 'val':'', 'valQuote': eid_economics['avgCosPerTreatmentInEvent'], 'ref':[], 'refBlob': eid_economics['refAvgCostTreatmentInEvent'], 'meta': meta }, 'perCapitaNatGDPEventYear': { 'val':'', 'valQuote': eid_economics['perCapitaNationalGDPInYearOfEvent'], 'ref':[], 'refBlob': eid_economics['refPerCapitaNationalGDPInYearOfEvent'], 'meta': meta }, 'avgLifeExpectEventCountryYear': { 'val':'', 'valQuote': eid_economics['avgLifeExpectancyInCountryAndYearOfEvent'], 'ref':[], 'refBlob': eid_economics['refAvgLifeExpectancyInCountryAndYearOfEvent'], 'meta': meta } } # economics } # value object } #body #fix the OjectID format eid_body['_id'] = str(ObjectId()) #print eid_body['refs'][0] #print count #['sickiID'] #['meta']['reviewer'] db.entries.insert(eid_body)
0.248443
0.127925
import dataclasses import glob import json import logging import os import shutil import site import subprocess import sys from dataclasses import dataclass, field from logging import Logger from pathlib import Path from typing import ( Any, Dict, Iterable, List, Optional, Sequence, Set, Type, TypeVar, Union, ) import psutil from .. import command_arguments, dataclasses_merge, find_directories from ..filesystem import expand_global_root, expand_relative_path from ..find_directories import ( BINARY_NAME, CONFIGURATION_FILE, get_relative_local_root, LOCAL_CONFIGURATION_FILE, LOG_DIRECTORY, ) from . import ( exceptions, ide_features as ide_features_module, platform_aware, python_version as python_version_module, search_path as search_path_module, shared_memory as shared_memory_module, site_packages, unwatched, ) LOG: Logger = logging.getLogger(__name__) T = TypeVar("T") def _get_optional_value(source: Optional[T], default: T) -> T: return source if source is not None else default def _expand_and_get_existent_ignore_all_errors_path( ignore_all_errors: Iterable[str], project_root: str ) -> List[str]: expanded_ignore_paths = [] for path in ignore_all_errors: expanded = glob.glob(expand_global_root(path, global_root=project_root)) if not expanded: expanded_ignore_paths.append(path) else: expanded_ignore_paths.extend(expanded) paths = [] for path in expanded_ignore_paths: if os.path.exists(path): paths.append(path) else: LOG.warning(f"Nonexistent paths passed in to `ignore_all_errors`: `{path}`") if _is_glob(path): LOG.warning( f"Within `ignore_all_errors`, no matches found to glob pattern: `{path}`" ) else: LOG.warning( f"Nonexistent paths passed in to `ignore_all_errors`: `{path}`" ) return paths def _is_glob(path: str) -> bool: if ("*" in path) or ("?" in path) or (("[" in path) and ("]" in path)): return True return False @dataclasses.dataclass class ExtensionElement: suffix: str include_suffix_in_module_qualifier: bool def command_line_argument(self) -> str: options = "" if self.include_suffix_in_module_qualifier: options = "$" + "include_suffix_in_module_qualifier" return self.suffix + options @staticmethod def from_json(json: Union[str, Dict[str, Union[str, bool]]]) -> "ExtensionElement": if isinstance(json, str): return ExtensionElement( suffix=json, include_suffix_in_module_qualifier=False ) elif isinstance(json, dict): include_suffix_in_module_qualifier = False if "include_suffix_in_module_qualifier" in json: value = json["include_suffix_in_module_qualifier"] if isinstance(value, bool): include_suffix_in_module_qualifier = value if "suffix" in json: suffix = json["suffix"] if isinstance(suffix, str): return ExtensionElement( suffix=suffix, include_suffix_in_module_qualifier=include_suffix_in_module_qualifier, ) raise exceptions.InvalidConfiguration(f"Invalid extension element: {json}") def get_default_site_roots() -> List[str]: try: return [site.getusersitepackages()] + site.getsitepackages() except AttributeError: # There are a few Python versions that ship with a broken venv, # where `getsitepackages` is not available. LOG.warning( "Either `site.getusersitepackages()` or `site.getsitepackages()` " + "is not available in your virtualenv. This is a known virtualenv " + 'bug and as a workaround please explicitly specify `"site_root"` ' + "in your Pyre configuration." ) return [] @dataclasses_merge.dataclass_merge @dataclass(frozen=True) class PartialConfiguration: binary: Optional[str] = None buck_mode: Optional[platform_aware.PlatformAware[str]] = field( default=None, metadata={"merge_policy": platform_aware.PlatformAware.merge_optional}, ) do_not_ignore_errors_in: Sequence[str] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) dot_pyre_directory: Optional[Path] = None excludes: Sequence[str] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) extensions: Sequence[ExtensionElement] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) ide_features: Optional[ide_features_module.IdeFeatures] = field( default=None, metadata={"merge_policy": ide_features_module.IdeFeatures.merge_optional}, ) ignore_all_errors: Sequence[str] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) isolation_prefix: Optional[str] = None logger: Optional[str] = None number_of_workers: Optional[int] = None oncall: Optional[str] = None other_critical_files: Sequence[str] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) pysa_version_hash: Optional[str] = None python_version: Optional[python_version_module.PythonVersion] = None search_path: Sequence[search_path_module.RawElement] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) shared_memory: shared_memory_module.SharedMemory = ( shared_memory_module.SharedMemory() ) site_package_search_strategy: Optional[site_packages.SearchStrategy] = None site_roots: Optional[Sequence[str]] = None source_directories: Optional[Sequence[search_path_module.RawElement]] = field( default=None, metadata={"merge_policy": dataclasses_merge.Policy.RAISE_WHEN_OVERWRITTEN}, ) strict: Optional[bool] = None taint_models_path: Sequence[str] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) targets: Optional[Sequence[str]] = field( default=None, metadata={"merge_policy": dataclasses_merge.Policy.RAISE_WHEN_OVERWRITTEN}, ) typeshed: Optional[str] = None unwatched_dependency: Optional[unwatched.UnwatchedDependency] = None use_buck2: Optional[bool] = None version_hash: Optional[str] = None @staticmethod def _get_depreacted_map() -> Dict[str, str]: return {"do_not_check": "ignore_all_errors"} @staticmethod def _get_extra_keys() -> Set[str]: return { "create_open_source_configuration", "saved_state", "stable_client", "taint_models_path", "unstable_client", } @staticmethod def from_command_arguments( arguments: command_arguments.CommandArguments, ) -> "PartialConfiguration": strict: Optional[bool] = True if arguments.strict else None source_directories = [ search_path_module.SimpleRawElement(element) for element in arguments.source_directories ] or None targets: Optional[List[str]] = ( arguments.targets if len(arguments.targets) > 0 else None ) python_version_string = arguments.python_version ide_features = ( ide_features_module.IdeFeatures( hover_enabled=arguments.enable_hover, go_to_definition_enabled=arguments.enable_go_to_definition, find_symbols_enabled=arguments.enable_find_symbols, ) if arguments.enable_hover is not None or arguments.enable_go_to_definition is not None else None ) return PartialConfiguration( binary=arguments.binary, buck_mode=platform_aware.PlatformAware.from_json( arguments.buck_mode, "buck_mode" ), do_not_ignore_errors_in=arguments.do_not_ignore_errors_in, dot_pyre_directory=arguments.dot_pyre_directory, excludes=arguments.exclude, extensions=[], ide_features=ide_features, ignore_all_errors=[], isolation_prefix=arguments.isolation_prefix, logger=arguments.logger, number_of_workers=arguments.number_of_workers, oncall=None, other_critical_files=[], pysa_version_hash=None, python_version=( python_version_module.PythonVersion.from_string(python_version_string) if python_version_string is not None else None ), search_path=[ search_path_module.SimpleRawElement(element) for element in arguments.search_path ], shared_memory=shared_memory_module.SharedMemory( heap_size=arguments.shared_memory_heap_size, dependency_table_power=arguments.shared_memory_dependency_table_power, hash_table_power=arguments.shared_memory_hash_table_power, ), site_package_search_strategy=None, site_roots=None, source_directories=source_directories, strict=strict, taint_models_path=[], targets=targets, typeshed=arguments.typeshed, unwatched_dependency=None, use_buck2=arguments.use_buck2, version_hash=None, ) @staticmethod def from_string(contents: str) -> "PartialConfiguration": def is_list_of_string(elements: object) -> bool: return isinstance(elements, list) and all( isinstance(element, str) for element in elements ) def ensure_option_type( json: Dict[str, Any], name: str, expected_type: Type[T] ) -> Optional[T]: result = json.pop(name, None) if result is None: return None elif isinstance(result, expected_type): return result raise exceptions.InvalidConfiguration( f"Configuration field `{name}` is expected to have type " f"{expected_type} but got: `{result}`." ) def ensure_optional_string_or_string_dict( json: Dict[str, Any], name: str ) -> Optional[Union[Dict[str, str], str]]: result = json.pop(name, None) if result is None: return None elif isinstance(result, str): return result elif isinstance(result, Dict): for value in result.values(): if not isinstance(value, str): raise exceptions.InvalidConfiguration( f"Configuration field `{name}` is expected to be a " + f"dict of strings but got `{result}`." ) return result raise exceptions.InvalidConfiguration( f"Configuration field `{name}` is expected to be a string or a " + f"dict of strings but got `{result}`." ) def ensure_optional_string_list( json: Dict[str, Any], name: str ) -> Optional[List[str]]: result = json.pop(name, None) if result is None: return None elif is_list_of_string(result): return result raise exceptions.InvalidConfiguration( f"Configuration field `{name}` is expected to be a list of " + f"strings but got `{result}`." ) def ensure_string_list( json: Dict[str, Any], name: str, allow_single_string: bool = False ) -> List[str]: result = json.pop(name, []) if allow_single_string and isinstance(result, str): result = [result] if is_list_of_string(result): return result raise exceptions.InvalidConfiguration( f"Configuration field `{name}` is expected to be a list of " + f"strings but got `{result}`." ) def ensure_list(json: Dict[str, object], name: str) -> List[object]: result = json.pop(name, []) if isinstance(result, list): return result raise exceptions.InvalidConfiguration( f"Configuration field `{name}` is expected to be a list but got `{result}`." ) try: configuration_json = json.loads(contents) dot_pyre_directory = ensure_option_type( configuration_json, "dot_pyre_directory", str ) search_path_json = configuration_json.pop("search_path", []) if isinstance(search_path_json, list): search_path = [ search_path_module.create_raw_element(json) for json in search_path_json ] else: search_path = [search_path_module.create_raw_element(search_path_json)] python_version_json = configuration_json.pop("python_version", None) if python_version_json is None: python_version = None elif isinstance(python_version_json, str): python_version = python_version_module.PythonVersion.from_string( python_version_json ) else: raise exceptions.InvalidConfiguration( "Expect python version to be a string but got" + f"'{python_version_json}'" ) shared_memory_json = ensure_option_type( configuration_json, "shared_memory", dict ) if shared_memory_json is None: shared_memory = shared_memory_module.SharedMemory() else: shared_memory = shared_memory_module.SharedMemory( heap_size=ensure_option_type(shared_memory_json, "heap_size", int), dependency_table_power=ensure_option_type( shared_memory_json, "dependency_table_power", int ), hash_table_power=ensure_option_type( shared_memory_json, "hash_table_power", int ), ) for unrecognized_key in shared_memory_json: LOG.warning(f"Unrecognized configuration item: {unrecognized_key}") source_directories_json = ensure_option_type( configuration_json, "source_directories", list ) if isinstance(source_directories_json, list): source_directories = [ search_path_module.create_raw_element(json) for json in source_directories_json ] else: source_directories = None site_package_search_strategy_json = ensure_option_type( configuration_json, "site_package_search_strategy", str ) if site_package_search_strategy_json is None: site_package_search_strategy = None else: site_package_search_strategy = site_packages.SearchStrategy.from_string( site_package_search_strategy_json ) if site_package_search_strategy is None: raise exceptions.InvalidConfiguration( "Invalid value for `site_package_search_strategy`: " f"{site_package_search_strategy_json}. Available choices: " f"{[str(x) for x in site_packages.SearchStrategy]}." ) ide_features_json = ensure_option_type( configuration_json, "ide_features", dict ) if ide_features_json is None: ide_features = None else: ide_features = ide_features_module.IdeFeatures.create_from_json( ide_features_json ) unwatched_dependency_json = ensure_option_type( configuration_json, "unwatched_dependency", dict ) if unwatched_dependency_json is None: unwatched_dependency = None else: unwatched_dependency = unwatched.UnwatchedDependency.from_json( unwatched_dependency_json ) partial_configuration = PartialConfiguration( binary=ensure_option_type(configuration_json, "binary", str), buck_mode=platform_aware.PlatformAware.from_json( ensure_optional_string_or_string_dict( configuration_json, "buck_mode" ), "buck_mode", ), do_not_ignore_errors_in=ensure_string_list( configuration_json, "do_not_ignore_errors_in" ), dot_pyre_directory=Path(dot_pyre_directory) if dot_pyre_directory is not None else None, excludes=ensure_string_list( configuration_json, "exclude", allow_single_string=True ), extensions=[ # pyre-fixme[6]: we did not fully verify the type of `json` ExtensionElement.from_json(json) for json in ensure_list(configuration_json, "extensions") ], ide_features=ide_features, ignore_all_errors=ensure_string_list( configuration_json, "ignore_all_errors" ), isolation_prefix=ensure_option_type( configuration_json, "isolation_prefix", str ), logger=ensure_option_type(configuration_json, "logger", str), number_of_workers=ensure_option_type( configuration_json, "workers", int ), oncall=ensure_option_type(configuration_json, "oncall", str), other_critical_files=ensure_string_list( configuration_json, "critical_files" ), pysa_version_hash=ensure_option_type( configuration_json, "pysa_version", str ), python_version=python_version, search_path=search_path, shared_memory=shared_memory, site_package_search_strategy=site_package_search_strategy, site_roots=ensure_optional_string_list( configuration_json, "site_roots" ), source_directories=source_directories, strict=ensure_option_type(configuration_json, "strict", bool), taint_models_path=ensure_string_list( configuration_json, "taint_models_path", allow_single_string=True ), targets=ensure_optional_string_list(configuration_json, "targets"), typeshed=ensure_option_type(configuration_json, "typeshed", str), unwatched_dependency=unwatched_dependency, use_buck2=ensure_option_type(configuration_json, "use_buck2", bool), version_hash=ensure_option_type(configuration_json, "version", str), ) # Check for deprecated and unused keys for ( deprecated_key, replacement_key, ) in PartialConfiguration._get_depreacted_map().items(): if deprecated_key in configuration_json: configuration_json.pop(deprecated_key) LOG.warning( f"Configuration file uses deprecated item `{deprecated_key}`. " f"Please migrate to its replacement `{replacement_key}`" ) extra_keys = PartialConfiguration._get_extra_keys() for unrecognized_key in configuration_json: if unrecognized_key not in extra_keys: LOG.warning(f"Unrecognized configuration item: {unrecognized_key}") return partial_configuration except json.JSONDecodeError as error: raise exceptions.InvalidConfiguration(f"Invalid JSON file: {error}") @staticmethod def from_file(path: Path) -> "PartialConfiguration": try: contents = path.read_text(encoding="utf-8") return PartialConfiguration.from_string(contents) except OSError as error: raise exceptions.InvalidConfiguration(f"Error when reading {path}: {error}") def expand_relative_paths(self, root: str) -> "PartialConfiguration": binary = self.binary if binary is not None: binary = expand_relative_path(root, binary) logger = self.logger if logger is not None: logger = expand_relative_path(root, logger) source_directories = self.source_directories if source_directories is not None: source_directories = [ path.expand_relative_root(root) for path in source_directories ] typeshed = self.typeshed if typeshed is not None: typeshed = expand_relative_path(root, typeshed) unwatched_dependency = self.unwatched_dependency if unwatched_dependency is not None: files = unwatched_dependency.files unwatched_dependency = unwatched.UnwatchedDependency( change_indicator=unwatched_dependency.change_indicator, files=unwatched.UnwatchedFiles( root=expand_relative_path(root, files.root), checksum_path=files.checksum_path, ), ) return PartialConfiguration( binary=binary, buck_mode=self.buck_mode, do_not_ignore_errors_in=[ expand_relative_path(root, path) for path in self.do_not_ignore_errors_in ], dot_pyre_directory=self.dot_pyre_directory, excludes=self.excludes, extensions=self.extensions, ide_features=self.ide_features, ignore_all_errors=[ expand_relative_path(root, path) for path in self.ignore_all_errors ], isolation_prefix=self.isolation_prefix, logger=logger, number_of_workers=self.number_of_workers, oncall=self.oncall, other_critical_files=[ expand_relative_path(root, path) for path in self.other_critical_files ], pysa_version_hash=self.pysa_version_hash, python_version=self.python_version, search_path=[path.expand_relative_root(root) for path in self.search_path], shared_memory=self.shared_memory, site_package_search_strategy=self.site_package_search_strategy, site_roots=self.site_roots, source_directories=source_directories, strict=self.strict, taint_models_path=[ expand_relative_path(root, path) for path in self.taint_models_path ], targets=self.targets, typeshed=typeshed, unwatched_dependency=unwatched_dependency, use_buck2=self.use_buck2, version_hash=self.version_hash, ) def merge_partial_configurations( base: PartialConfiguration, override: PartialConfiguration ) -> PartialConfiguration: try: # pyre-ignore[16]: Pyre does not understand `dataclass_merge` return PartialConfiguration.merge(base, override) except dataclasses_merge.DataclassMergeError as error: raise exceptions.InvalidConfiguration(str(error)) @dataclass(frozen=True) class Configuration: project_root: str dot_pyre_directory: Path binary: Optional[str] = None buck_mode: Optional[platform_aware.PlatformAware[str]] = None do_not_ignore_errors_in: Sequence[str] = field(default_factory=list) excludes: Sequence[str] = field(default_factory=list) extensions: Sequence[ExtensionElement] = field(default_factory=list) ide_features: Optional[ide_features_module.IdeFeatures] = None ignore_all_errors: Sequence[str] = field(default_factory=list) isolation_prefix: Optional[str] = None logger: Optional[str] = None number_of_workers: Optional[int] = None oncall: Optional[str] = None other_critical_files: Sequence[str] = field(default_factory=list) pysa_version_hash: Optional[str] = None python_version: Optional[python_version_module.PythonVersion] = None relative_local_root: Optional[str] = None search_path: Sequence[search_path_module.RawElement] = field(default_factory=list) shared_memory: shared_memory_module.SharedMemory = ( shared_memory_module.SharedMemory() ) site_package_search_strategy: site_packages.SearchStrategy = ( site_packages.SearchStrategy.NONE ) site_roots: Optional[Sequence[str]] = None source_directories: Optional[Sequence[search_path_module.RawElement]] = None strict: bool = False taint_models_path: Sequence[str] = field(default_factory=list) targets: Optional[Sequence[str]] = None typeshed: Optional[str] = None unwatched_dependency: Optional[unwatched.UnwatchedDependency] = None use_buck2: bool = False version_hash: Optional[str] = None @staticmethod def from_partial_configuration( project_root: Path, relative_local_root: Optional[str], partial_configuration: PartialConfiguration, ) -> "Configuration": search_path = partial_configuration.search_path return Configuration( project_root=str(project_root), dot_pyre_directory=_get_optional_value( partial_configuration.dot_pyre_directory, project_root / LOG_DIRECTORY ), binary=partial_configuration.binary, buck_mode=partial_configuration.buck_mode, do_not_ignore_errors_in=partial_configuration.do_not_ignore_errors_in, excludes=partial_configuration.excludes, extensions=partial_configuration.extensions, ide_features=partial_configuration.ide_features, ignore_all_errors=partial_configuration.ignore_all_errors, isolation_prefix=partial_configuration.isolation_prefix, logger=partial_configuration.logger, number_of_workers=partial_configuration.number_of_workers, oncall=partial_configuration.oncall, other_critical_files=partial_configuration.other_critical_files, pysa_version_hash=partial_configuration.pysa_version_hash, python_version=partial_configuration.python_version, relative_local_root=relative_local_root, search_path=[ path.expand_global_root(str(project_root)) for path in search_path ], shared_memory=partial_configuration.shared_memory, site_package_search_strategy=partial_configuration.site_package_search_strategy or site_packages.SearchStrategy.NONE, site_roots=partial_configuration.site_roots, source_directories=partial_configuration.source_directories, strict=_get_optional_value(partial_configuration.strict, default=False), taint_models_path=partial_configuration.taint_models_path, targets=partial_configuration.targets, typeshed=partial_configuration.typeshed, unwatched_dependency=partial_configuration.unwatched_dependency, use_buck2=_get_optional_value( partial_configuration.use_buck2, default=False ), version_hash=partial_configuration.version_hash, ) @property def log_directory(self) -> str: if self.relative_local_root is None: return str(self.dot_pyre_directory) return str(self.dot_pyre_directory / self.relative_local_root) @property def local_root(self) -> Optional[str]: if self.relative_local_root is None: return None return os.path.join(self.project_root, self.relative_local_root) def to_json(self) -> Dict[str, object]: """ This method is for display purpose only. Do *NOT* expect this method to produce JSONs that can be de-serialized back into configurations. """ binary = self.binary buck_mode = self.buck_mode isolation_prefix = self.isolation_prefix logger = self.logger number_of_workers = self.number_of_workers oncall = self.oncall pysa_version_hash = self.pysa_version_hash python_version = self.python_version relative_local_root = self.relative_local_root source_directories = self.source_directories site_package_search_strategy = self.site_package_search_strategy site_roots = self.site_roots targets = self.targets typeshed = self.typeshed unwatched_dependency = self.unwatched_dependency version_hash = self.version_hash return { "global_root": self.project_root, "dot_pyre_directory": str(self.dot_pyre_directory), **({"binary": binary} if binary is not None else {}), **({"buck_mode": buck_mode.to_json()} if buck_mode is not None else {}), "do_not_ignore_errors_in": list(self.do_not_ignore_errors_in), "excludes": list(self.excludes), "extensions": list(self.extensions), "ignore_all_errors": list(self.ignore_all_errors), **( {"isolation_prefix": isolation_prefix} if isolation_prefix is not None else {} ), **({"logger": logger} if logger is not None else {}), **({"oncall": oncall} if oncall is not None else {}), **({"workers": number_of_workers} if number_of_workers is not None else {}), "other_critical_files": list(self.other_critical_files), **( {"pysa_version_hash": pysa_version_hash} if pysa_version_hash is not None else {} ), **( {"python_version": python_version.to_string()} if python_version is not None else {} ), **( {"relative_local_root": relative_local_root} if relative_local_root is not None else {} ), "search_path": [str(path) for path in self.search_path], **( {"shared_memory": self.shared_memory.to_json()} if self.shared_memory != shared_memory_module.SharedMemory() else {} ), **( {"site_package_search_strategy": site_package_search_strategy} if site_package_search_strategy is not None else {} ), "site_roots": site_roots if site_roots is not None else [], **( {"source_directories": [str(path) for path in source_directories]} if source_directories is not None else {} ), "strict": self.strict, "taint_models_path": list(self.taint_models_path), **({"targets": list(targets)} if targets is not None else {}), **({"typeshed": typeshed} if typeshed is not None else {}), **( {"unwatched_dependency": unwatched_dependency.to_json()} if unwatched_dependency is not None else {} ), "use_buck2": self.use_buck2, **({"version_hash": version_hash} if version_hash is not None else {}), } def get_existent_unwatched_dependency( self, ) -> Optional[unwatched.UnwatchedDependency]: unwatched_dependency = self.unwatched_dependency if unwatched_dependency is None: return None unwatched_root = Path(unwatched_dependency.files.root) try: if not unwatched_root.is_dir(): LOG.warning( "Nonexistent directory passed in to `unwatched_dependency`: " f"`{unwatched_root}`" ) return None checksum_path = unwatched_root / unwatched_dependency.files.checksum_path if not checksum_path.is_file(): LOG.warning( "Nonexistent file passed in to `unwatched_dependency`: " f"`{checksum_path}`" ) return None return self.unwatched_dependency except PermissionError as error: LOG.warning(str(error)) return None def get_site_roots(self) -> Sequence[str]: site_roots = self.site_roots if site_roots is not None: return site_roots return get_default_site_roots() def expand_and_get_existent_search_paths( self, ) -> List[search_path_module.Element]: site_roots = self.get_site_roots() existent_paths = search_path_module.process_raw_elements( self.search_path, site_roots ) site_packages_paths = site_packages.search_for_paths( self.site_package_search_strategy, site_roots ) typeshed_root = self.get_typeshed_respecting_override() if typeshed_root is None: return existent_paths + site_packages_paths typeshed_paths: List[search_path_module.Element] = [ search_path_module.SimpleElement(str(element)) for element in find_directories.find_typeshed_search_paths( Path(typeshed_root) ) ] return existent_paths + site_packages_paths + typeshed_paths def expand_and_get_existent_source_directories( self, ) -> List[search_path_module.Element]: source_directories = self.source_directories if source_directories is not None: return search_path_module.process_raw_elements( source_directories, self.get_site_roots() ) else: return [] def get_existent_do_not_ignore_errors_in_paths(self) -> List[str]: """ This is a separate method because we want to check for existing files at the time this is called, not when the configuration is constructed. """ ignore_paths = [ expand_global_root(path, global_root=self.project_root) for path in self.do_not_ignore_errors_in ] paths = [] for path in ignore_paths: if os.path.exists(path): paths.append(path) else: LOG.debug( "Filtering out nonexistent paths in `do_not_ignore_errors_in`: " f"{path}" ) return paths def get_existent_ignore_all_errors_paths(self) -> List[str]: """ This is a separate method because we want to check for existing files at the time this is called, not when the configuration is constructed. """ return _expand_and_get_existent_ignore_all_errors_path( self.ignore_all_errors, self.project_root ) def get_binary_respecting_override(self) -> Optional[str]: binary = self.binary if binary is not None: return binary LOG.info(f"No binary specified, looking for `{BINARY_NAME}` in PATH") binary_candidate = shutil.which(BINARY_NAME) if binary_candidate is None: binary_candidate_name = os.path.join( os.path.dirname(sys.argv[0]), BINARY_NAME ) binary_candidate = shutil.which(binary_candidate_name) if binary_candidate is not None: return binary_candidate return None def get_typeshed_respecting_override(self) -> Optional[str]: typeshed = self.typeshed if typeshed is not None: return typeshed LOG.info("No typeshed specified, looking for it...") auto_determined_typeshed = find_directories.find_typeshed() if auto_determined_typeshed is None: LOG.warning( "Could not find a suitable typeshed. Types for Python builtins " "and standard libraries may be missing!" ) return None else: LOG.info(f"Found: `{auto_determined_typeshed}`") return str(auto_determined_typeshed) def get_version_hash_respecting_override(self) -> Optional[str]: overriding_version_hash = os.getenv("PYRE_VERSION_HASH") if overriding_version_hash: LOG.warning(f"Version hash overridden with `{overriding_version_hash}`") return overriding_version_hash return self.version_hash def get_binary_version(self) -> Optional[str]: binary = self.get_binary_respecting_override() if binary is None: return None status = subprocess.run( [binary, "-version"], stdout=subprocess.PIPE, universal_newlines=True ) return status.stdout.strip() if status.returncode == 0 else None def get_number_of_workers(self) -> int: number_of_workers = self.number_of_workers if number_of_workers is not None and number_of_workers > 0: return number_of_workers # pyre-fixme[28]: Unexpected keyword argument `logical`. number_of_physical_cores = psutil.cpu_count(logical=False) if number_of_physical_cores is None: default_number_of_workers = 1 else: default_number_of_workers = max(1, number_of_physical_cores - 1) LOG.info( "Could not determine the number of Pyre workers from configuration. " f"Auto-set the value to {default_number_of_workers}." ) if default_number_of_workers <= 1: LOG.info( "Consider setting the `--sequential` flag instead when the number " "of parallel workers is not greater than 1." ) return default_number_of_workers def is_hover_enabled(self) -> bool: if self.ide_features is None: return ide_features_module.IdeFeatures.DEFAULT_HOVER_ENABLED return self.ide_features.is_hover_enabled() def is_go_to_definition_enabled(self) -> bool: if self.ide_features is None: return ide_features_module.IdeFeatures.DEFAULT_GO_TO_DEFINITION_ENABLED return self.ide_features.is_go_to_definition_enabled() def is_find_symbols_enabled(self) -> bool: if self.ide_features is None: return ide_features_module.IdeFeatures.DEFAULT_FIND_SYMBOLS_ENABLED return self.ide_features.is_find_symbols_enabled() def get_valid_extension_suffixes(self) -> List[str]: vaild_extensions = [] for extension in self.extensions: if not extension.suffix.startswith("."): LOG.warning( "Filtering out extension which does not start with `.`: " f"`{extension.suffix}`" ) else: vaild_extensions.append(extension.command_line_argument()) return vaild_extensions def get_isolation_prefix_respecting_override(self) -> Optional[str]: """We need this to disable an isolation prefix set in a configuration. Merely omitting the CLI flag would not disable the isolation prefix because we would just fall back to the configuration value. With this, we can pass `--isolation-prefix ''` as a CLI argument or override `isolation_prefix` as `""` in a local configuration.""" return None if self.isolation_prefix == "" else self.isolation_prefix def get_python_version(self) -> python_version_module.PythonVersion: python_version = self.python_version if python_version is not None: return python_version else: version_info = sys.version_info return python_version_module.PythonVersion( major=version_info.major, minor=version_info.minor, micro=version_info.micro, ) def create_configuration( arguments: command_arguments.CommandArguments, base_directory: Path ) -> Configuration: local_root_argument = arguments.local_configuration search_base = ( base_directory if local_root_argument is None else base_directory / local_root_argument ) found_root = find_directories.find_global_and_local_root(search_base) # If the local root was explicitly specified but does not exist, return an # error instead of falling back to current directory. if local_root_argument is not None: if found_root is None: raise exceptions.InvalidConfiguration( "A local configuration path was explicitly specified, but no" + f" {CONFIGURATION_FILE} file was found in {search_base}" + " or its parents." ) elif found_root.local_root is None: raise exceptions.InvalidConfiguration( "A local configuration path was explicitly specified, but no" + f" {LOCAL_CONFIGURATION_FILE} file was found in {search_base}" + " or its parents." ) command_argument_configuration = PartialConfiguration.from_command_arguments( arguments ).expand_relative_paths(str(Path.cwd())) if found_root is None: project_root = Path.cwd() relative_local_root = None partial_configuration = command_argument_configuration else: project_root = found_root.global_root relative_local_root = None partial_configuration = PartialConfiguration.from_file( project_root / CONFIGURATION_FILE ).expand_relative_paths(str(project_root)) local_root = found_root.local_root if local_root is not None: relative_local_root = get_relative_local_root(project_root, local_root) partial_configuration = merge_partial_configurations( base=partial_configuration, override=PartialConfiguration.from_file( local_root / LOCAL_CONFIGURATION_FILE ).expand_relative_paths(str(local_root)), ) partial_configuration = merge_partial_configurations( base=partial_configuration, override=command_argument_configuration, ) return Configuration.from_partial_configuration( project_root, relative_local_root, partial_configuration ) def check_nested_local_configuration(configuration: Configuration) -> None: """ Raises `InvalidConfiguration` if the check fails. """ local_root = configuration.local_root if local_root is None: return def is_subdirectory(child: Path, parent: Path) -> bool: return parent == child or parent in child.parents # We search from the parent of the local root, looking for another local # configuration file that lives above the current one local_root_path = Path(local_root).resolve() current_directory = local_root_path.parent while True: found_root = find_directories.find_global_and_local_root(current_directory) if found_root is None: break nesting_local_root = found_root.local_root if nesting_local_root is None: break nesting_configuration = PartialConfiguration.from_file( nesting_local_root / LOCAL_CONFIGURATION_FILE ).expand_relative_paths(str(nesting_local_root)) nesting_ignored_all_errors_path = ( _expand_and_get_existent_ignore_all_errors_path( nesting_configuration.ignore_all_errors, str(found_root.global_root) ) ) if not any( is_subdirectory(child=local_root_path, parent=Path(path)) for path in nesting_ignored_all_errors_path ): error_message = ( "Local configuration is nested under another local configuration at " f"`{nesting_local_root}`.\nPlease add `{local_root_path}` to the " "`ignore_all_errors` field of the parent, or combine the sources " "into a single configuration, or split the parent configuration to " "avoid inconsistent errors." ) raise exceptions.InvalidConfiguration(error_message) current_directory = nesting_local_root.parent
client/configuration/configuration.py
import dataclasses import glob import json import logging import os import shutil import site import subprocess import sys from dataclasses import dataclass, field from logging import Logger from pathlib import Path from typing import ( Any, Dict, Iterable, List, Optional, Sequence, Set, Type, TypeVar, Union, ) import psutil from .. import command_arguments, dataclasses_merge, find_directories from ..filesystem import expand_global_root, expand_relative_path from ..find_directories import ( BINARY_NAME, CONFIGURATION_FILE, get_relative_local_root, LOCAL_CONFIGURATION_FILE, LOG_DIRECTORY, ) from . import ( exceptions, ide_features as ide_features_module, platform_aware, python_version as python_version_module, search_path as search_path_module, shared_memory as shared_memory_module, site_packages, unwatched, ) LOG: Logger = logging.getLogger(__name__) T = TypeVar("T") def _get_optional_value(source: Optional[T], default: T) -> T: return source if source is not None else default def _expand_and_get_existent_ignore_all_errors_path( ignore_all_errors: Iterable[str], project_root: str ) -> List[str]: expanded_ignore_paths = [] for path in ignore_all_errors: expanded = glob.glob(expand_global_root(path, global_root=project_root)) if not expanded: expanded_ignore_paths.append(path) else: expanded_ignore_paths.extend(expanded) paths = [] for path in expanded_ignore_paths: if os.path.exists(path): paths.append(path) else: LOG.warning(f"Nonexistent paths passed in to `ignore_all_errors`: `{path}`") if _is_glob(path): LOG.warning( f"Within `ignore_all_errors`, no matches found to glob pattern: `{path}`" ) else: LOG.warning( f"Nonexistent paths passed in to `ignore_all_errors`: `{path}`" ) return paths def _is_glob(path: str) -> bool: if ("*" in path) or ("?" in path) or (("[" in path) and ("]" in path)): return True return False @dataclasses.dataclass class ExtensionElement: suffix: str include_suffix_in_module_qualifier: bool def command_line_argument(self) -> str: options = "" if self.include_suffix_in_module_qualifier: options = "$" + "include_suffix_in_module_qualifier" return self.suffix + options @staticmethod def from_json(json: Union[str, Dict[str, Union[str, bool]]]) -> "ExtensionElement": if isinstance(json, str): return ExtensionElement( suffix=json, include_suffix_in_module_qualifier=False ) elif isinstance(json, dict): include_suffix_in_module_qualifier = False if "include_suffix_in_module_qualifier" in json: value = json["include_suffix_in_module_qualifier"] if isinstance(value, bool): include_suffix_in_module_qualifier = value if "suffix" in json: suffix = json["suffix"] if isinstance(suffix, str): return ExtensionElement( suffix=suffix, include_suffix_in_module_qualifier=include_suffix_in_module_qualifier, ) raise exceptions.InvalidConfiguration(f"Invalid extension element: {json}") def get_default_site_roots() -> List[str]: try: return [site.getusersitepackages()] + site.getsitepackages() except AttributeError: # There are a few Python versions that ship with a broken venv, # where `getsitepackages` is not available. LOG.warning( "Either `site.getusersitepackages()` or `site.getsitepackages()` " + "is not available in your virtualenv. This is a known virtualenv " + 'bug and as a workaround please explicitly specify `"site_root"` ' + "in your Pyre configuration." ) return [] @dataclasses_merge.dataclass_merge @dataclass(frozen=True) class PartialConfiguration: binary: Optional[str] = None buck_mode: Optional[platform_aware.PlatformAware[str]] = field( default=None, metadata={"merge_policy": platform_aware.PlatformAware.merge_optional}, ) do_not_ignore_errors_in: Sequence[str] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) dot_pyre_directory: Optional[Path] = None excludes: Sequence[str] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) extensions: Sequence[ExtensionElement] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) ide_features: Optional[ide_features_module.IdeFeatures] = field( default=None, metadata={"merge_policy": ide_features_module.IdeFeatures.merge_optional}, ) ignore_all_errors: Sequence[str] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) isolation_prefix: Optional[str] = None logger: Optional[str] = None number_of_workers: Optional[int] = None oncall: Optional[str] = None other_critical_files: Sequence[str] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) pysa_version_hash: Optional[str] = None python_version: Optional[python_version_module.PythonVersion] = None search_path: Sequence[search_path_module.RawElement] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) shared_memory: shared_memory_module.SharedMemory = ( shared_memory_module.SharedMemory() ) site_package_search_strategy: Optional[site_packages.SearchStrategy] = None site_roots: Optional[Sequence[str]] = None source_directories: Optional[Sequence[search_path_module.RawElement]] = field( default=None, metadata={"merge_policy": dataclasses_merge.Policy.RAISE_WHEN_OVERWRITTEN}, ) strict: Optional[bool] = None taint_models_path: Sequence[str] = field( default_factory=list, metadata={"merge_policy": dataclasses_merge.Policy.PREPEND}, ) targets: Optional[Sequence[str]] = field( default=None, metadata={"merge_policy": dataclasses_merge.Policy.RAISE_WHEN_OVERWRITTEN}, ) typeshed: Optional[str] = None unwatched_dependency: Optional[unwatched.UnwatchedDependency] = None use_buck2: Optional[bool] = None version_hash: Optional[str] = None @staticmethod def _get_depreacted_map() -> Dict[str, str]: return {"do_not_check": "ignore_all_errors"} @staticmethod def _get_extra_keys() -> Set[str]: return { "create_open_source_configuration", "saved_state", "stable_client", "taint_models_path", "unstable_client", } @staticmethod def from_command_arguments( arguments: command_arguments.CommandArguments, ) -> "PartialConfiguration": strict: Optional[bool] = True if arguments.strict else None source_directories = [ search_path_module.SimpleRawElement(element) for element in arguments.source_directories ] or None targets: Optional[List[str]] = ( arguments.targets if len(arguments.targets) > 0 else None ) python_version_string = arguments.python_version ide_features = ( ide_features_module.IdeFeatures( hover_enabled=arguments.enable_hover, go_to_definition_enabled=arguments.enable_go_to_definition, find_symbols_enabled=arguments.enable_find_symbols, ) if arguments.enable_hover is not None or arguments.enable_go_to_definition is not None else None ) return PartialConfiguration( binary=arguments.binary, buck_mode=platform_aware.PlatformAware.from_json( arguments.buck_mode, "buck_mode" ), do_not_ignore_errors_in=arguments.do_not_ignore_errors_in, dot_pyre_directory=arguments.dot_pyre_directory, excludes=arguments.exclude, extensions=[], ide_features=ide_features, ignore_all_errors=[], isolation_prefix=arguments.isolation_prefix, logger=arguments.logger, number_of_workers=arguments.number_of_workers, oncall=None, other_critical_files=[], pysa_version_hash=None, python_version=( python_version_module.PythonVersion.from_string(python_version_string) if python_version_string is not None else None ), search_path=[ search_path_module.SimpleRawElement(element) for element in arguments.search_path ], shared_memory=shared_memory_module.SharedMemory( heap_size=arguments.shared_memory_heap_size, dependency_table_power=arguments.shared_memory_dependency_table_power, hash_table_power=arguments.shared_memory_hash_table_power, ), site_package_search_strategy=None, site_roots=None, source_directories=source_directories, strict=strict, taint_models_path=[], targets=targets, typeshed=arguments.typeshed, unwatched_dependency=None, use_buck2=arguments.use_buck2, version_hash=None, ) @staticmethod def from_string(contents: str) -> "PartialConfiguration": def is_list_of_string(elements: object) -> bool: return isinstance(elements, list) and all( isinstance(element, str) for element in elements ) def ensure_option_type( json: Dict[str, Any], name: str, expected_type: Type[T] ) -> Optional[T]: result = json.pop(name, None) if result is None: return None elif isinstance(result, expected_type): return result raise exceptions.InvalidConfiguration( f"Configuration field `{name}` is expected to have type " f"{expected_type} but got: `{result}`." ) def ensure_optional_string_or_string_dict( json: Dict[str, Any], name: str ) -> Optional[Union[Dict[str, str], str]]: result = json.pop(name, None) if result is None: return None elif isinstance(result, str): return result elif isinstance(result, Dict): for value in result.values(): if not isinstance(value, str): raise exceptions.InvalidConfiguration( f"Configuration field `{name}` is expected to be a " + f"dict of strings but got `{result}`." ) return result raise exceptions.InvalidConfiguration( f"Configuration field `{name}` is expected to be a string or a " + f"dict of strings but got `{result}`." ) def ensure_optional_string_list( json: Dict[str, Any], name: str ) -> Optional[List[str]]: result = json.pop(name, None) if result is None: return None elif is_list_of_string(result): return result raise exceptions.InvalidConfiguration( f"Configuration field `{name}` is expected to be a list of " + f"strings but got `{result}`." ) def ensure_string_list( json: Dict[str, Any], name: str, allow_single_string: bool = False ) -> List[str]: result = json.pop(name, []) if allow_single_string and isinstance(result, str): result = [result] if is_list_of_string(result): return result raise exceptions.InvalidConfiguration( f"Configuration field `{name}` is expected to be a list of " + f"strings but got `{result}`." ) def ensure_list(json: Dict[str, object], name: str) -> List[object]: result = json.pop(name, []) if isinstance(result, list): return result raise exceptions.InvalidConfiguration( f"Configuration field `{name}` is expected to be a list but got `{result}`." ) try: configuration_json = json.loads(contents) dot_pyre_directory = ensure_option_type( configuration_json, "dot_pyre_directory", str ) search_path_json = configuration_json.pop("search_path", []) if isinstance(search_path_json, list): search_path = [ search_path_module.create_raw_element(json) for json in search_path_json ] else: search_path = [search_path_module.create_raw_element(search_path_json)] python_version_json = configuration_json.pop("python_version", None) if python_version_json is None: python_version = None elif isinstance(python_version_json, str): python_version = python_version_module.PythonVersion.from_string( python_version_json ) else: raise exceptions.InvalidConfiguration( "Expect python version to be a string but got" + f"'{python_version_json}'" ) shared_memory_json = ensure_option_type( configuration_json, "shared_memory", dict ) if shared_memory_json is None: shared_memory = shared_memory_module.SharedMemory() else: shared_memory = shared_memory_module.SharedMemory( heap_size=ensure_option_type(shared_memory_json, "heap_size", int), dependency_table_power=ensure_option_type( shared_memory_json, "dependency_table_power", int ), hash_table_power=ensure_option_type( shared_memory_json, "hash_table_power", int ), ) for unrecognized_key in shared_memory_json: LOG.warning(f"Unrecognized configuration item: {unrecognized_key}") source_directories_json = ensure_option_type( configuration_json, "source_directories", list ) if isinstance(source_directories_json, list): source_directories = [ search_path_module.create_raw_element(json) for json in source_directories_json ] else: source_directories = None site_package_search_strategy_json = ensure_option_type( configuration_json, "site_package_search_strategy", str ) if site_package_search_strategy_json is None: site_package_search_strategy = None else: site_package_search_strategy = site_packages.SearchStrategy.from_string( site_package_search_strategy_json ) if site_package_search_strategy is None: raise exceptions.InvalidConfiguration( "Invalid value for `site_package_search_strategy`: " f"{site_package_search_strategy_json}. Available choices: " f"{[str(x) for x in site_packages.SearchStrategy]}." ) ide_features_json = ensure_option_type( configuration_json, "ide_features", dict ) if ide_features_json is None: ide_features = None else: ide_features = ide_features_module.IdeFeatures.create_from_json( ide_features_json ) unwatched_dependency_json = ensure_option_type( configuration_json, "unwatched_dependency", dict ) if unwatched_dependency_json is None: unwatched_dependency = None else: unwatched_dependency = unwatched.UnwatchedDependency.from_json( unwatched_dependency_json ) partial_configuration = PartialConfiguration( binary=ensure_option_type(configuration_json, "binary", str), buck_mode=platform_aware.PlatformAware.from_json( ensure_optional_string_or_string_dict( configuration_json, "buck_mode" ), "buck_mode", ), do_not_ignore_errors_in=ensure_string_list( configuration_json, "do_not_ignore_errors_in" ), dot_pyre_directory=Path(dot_pyre_directory) if dot_pyre_directory is not None else None, excludes=ensure_string_list( configuration_json, "exclude", allow_single_string=True ), extensions=[ # pyre-fixme[6]: we did not fully verify the type of `json` ExtensionElement.from_json(json) for json in ensure_list(configuration_json, "extensions") ], ide_features=ide_features, ignore_all_errors=ensure_string_list( configuration_json, "ignore_all_errors" ), isolation_prefix=ensure_option_type( configuration_json, "isolation_prefix", str ), logger=ensure_option_type(configuration_json, "logger", str), number_of_workers=ensure_option_type( configuration_json, "workers", int ), oncall=ensure_option_type(configuration_json, "oncall", str), other_critical_files=ensure_string_list( configuration_json, "critical_files" ), pysa_version_hash=ensure_option_type( configuration_json, "pysa_version", str ), python_version=python_version, search_path=search_path, shared_memory=shared_memory, site_package_search_strategy=site_package_search_strategy, site_roots=ensure_optional_string_list( configuration_json, "site_roots" ), source_directories=source_directories, strict=ensure_option_type(configuration_json, "strict", bool), taint_models_path=ensure_string_list( configuration_json, "taint_models_path", allow_single_string=True ), targets=ensure_optional_string_list(configuration_json, "targets"), typeshed=ensure_option_type(configuration_json, "typeshed", str), unwatched_dependency=unwatched_dependency, use_buck2=ensure_option_type(configuration_json, "use_buck2", bool), version_hash=ensure_option_type(configuration_json, "version", str), ) # Check for deprecated and unused keys for ( deprecated_key, replacement_key, ) in PartialConfiguration._get_depreacted_map().items(): if deprecated_key in configuration_json: configuration_json.pop(deprecated_key) LOG.warning( f"Configuration file uses deprecated item `{deprecated_key}`. " f"Please migrate to its replacement `{replacement_key}`" ) extra_keys = PartialConfiguration._get_extra_keys() for unrecognized_key in configuration_json: if unrecognized_key not in extra_keys: LOG.warning(f"Unrecognized configuration item: {unrecognized_key}") return partial_configuration except json.JSONDecodeError as error: raise exceptions.InvalidConfiguration(f"Invalid JSON file: {error}") @staticmethod def from_file(path: Path) -> "PartialConfiguration": try: contents = path.read_text(encoding="utf-8") return PartialConfiguration.from_string(contents) except OSError as error: raise exceptions.InvalidConfiguration(f"Error when reading {path}: {error}") def expand_relative_paths(self, root: str) -> "PartialConfiguration": binary = self.binary if binary is not None: binary = expand_relative_path(root, binary) logger = self.logger if logger is not None: logger = expand_relative_path(root, logger) source_directories = self.source_directories if source_directories is not None: source_directories = [ path.expand_relative_root(root) for path in source_directories ] typeshed = self.typeshed if typeshed is not None: typeshed = expand_relative_path(root, typeshed) unwatched_dependency = self.unwatched_dependency if unwatched_dependency is not None: files = unwatched_dependency.files unwatched_dependency = unwatched.UnwatchedDependency( change_indicator=unwatched_dependency.change_indicator, files=unwatched.UnwatchedFiles( root=expand_relative_path(root, files.root), checksum_path=files.checksum_path, ), ) return PartialConfiguration( binary=binary, buck_mode=self.buck_mode, do_not_ignore_errors_in=[ expand_relative_path(root, path) for path in self.do_not_ignore_errors_in ], dot_pyre_directory=self.dot_pyre_directory, excludes=self.excludes, extensions=self.extensions, ide_features=self.ide_features, ignore_all_errors=[ expand_relative_path(root, path) for path in self.ignore_all_errors ], isolation_prefix=self.isolation_prefix, logger=logger, number_of_workers=self.number_of_workers, oncall=self.oncall, other_critical_files=[ expand_relative_path(root, path) for path in self.other_critical_files ], pysa_version_hash=self.pysa_version_hash, python_version=self.python_version, search_path=[path.expand_relative_root(root) for path in self.search_path], shared_memory=self.shared_memory, site_package_search_strategy=self.site_package_search_strategy, site_roots=self.site_roots, source_directories=source_directories, strict=self.strict, taint_models_path=[ expand_relative_path(root, path) for path in self.taint_models_path ], targets=self.targets, typeshed=typeshed, unwatched_dependency=unwatched_dependency, use_buck2=self.use_buck2, version_hash=self.version_hash, ) def merge_partial_configurations( base: PartialConfiguration, override: PartialConfiguration ) -> PartialConfiguration: try: # pyre-ignore[16]: Pyre does not understand `dataclass_merge` return PartialConfiguration.merge(base, override) except dataclasses_merge.DataclassMergeError as error: raise exceptions.InvalidConfiguration(str(error)) @dataclass(frozen=True) class Configuration: project_root: str dot_pyre_directory: Path binary: Optional[str] = None buck_mode: Optional[platform_aware.PlatformAware[str]] = None do_not_ignore_errors_in: Sequence[str] = field(default_factory=list) excludes: Sequence[str] = field(default_factory=list) extensions: Sequence[ExtensionElement] = field(default_factory=list) ide_features: Optional[ide_features_module.IdeFeatures] = None ignore_all_errors: Sequence[str] = field(default_factory=list) isolation_prefix: Optional[str] = None logger: Optional[str] = None number_of_workers: Optional[int] = None oncall: Optional[str] = None other_critical_files: Sequence[str] = field(default_factory=list) pysa_version_hash: Optional[str] = None python_version: Optional[python_version_module.PythonVersion] = None relative_local_root: Optional[str] = None search_path: Sequence[search_path_module.RawElement] = field(default_factory=list) shared_memory: shared_memory_module.SharedMemory = ( shared_memory_module.SharedMemory() ) site_package_search_strategy: site_packages.SearchStrategy = ( site_packages.SearchStrategy.NONE ) site_roots: Optional[Sequence[str]] = None source_directories: Optional[Sequence[search_path_module.RawElement]] = None strict: bool = False taint_models_path: Sequence[str] = field(default_factory=list) targets: Optional[Sequence[str]] = None typeshed: Optional[str] = None unwatched_dependency: Optional[unwatched.UnwatchedDependency] = None use_buck2: bool = False version_hash: Optional[str] = None @staticmethod def from_partial_configuration( project_root: Path, relative_local_root: Optional[str], partial_configuration: PartialConfiguration, ) -> "Configuration": search_path = partial_configuration.search_path return Configuration( project_root=str(project_root), dot_pyre_directory=_get_optional_value( partial_configuration.dot_pyre_directory, project_root / LOG_DIRECTORY ), binary=partial_configuration.binary, buck_mode=partial_configuration.buck_mode, do_not_ignore_errors_in=partial_configuration.do_not_ignore_errors_in, excludes=partial_configuration.excludes, extensions=partial_configuration.extensions, ide_features=partial_configuration.ide_features, ignore_all_errors=partial_configuration.ignore_all_errors, isolation_prefix=partial_configuration.isolation_prefix, logger=partial_configuration.logger, number_of_workers=partial_configuration.number_of_workers, oncall=partial_configuration.oncall, other_critical_files=partial_configuration.other_critical_files, pysa_version_hash=partial_configuration.pysa_version_hash, python_version=partial_configuration.python_version, relative_local_root=relative_local_root, search_path=[ path.expand_global_root(str(project_root)) for path in search_path ], shared_memory=partial_configuration.shared_memory, site_package_search_strategy=partial_configuration.site_package_search_strategy or site_packages.SearchStrategy.NONE, site_roots=partial_configuration.site_roots, source_directories=partial_configuration.source_directories, strict=_get_optional_value(partial_configuration.strict, default=False), taint_models_path=partial_configuration.taint_models_path, targets=partial_configuration.targets, typeshed=partial_configuration.typeshed, unwatched_dependency=partial_configuration.unwatched_dependency, use_buck2=_get_optional_value( partial_configuration.use_buck2, default=False ), version_hash=partial_configuration.version_hash, ) @property def log_directory(self) -> str: if self.relative_local_root is None: return str(self.dot_pyre_directory) return str(self.dot_pyre_directory / self.relative_local_root) @property def local_root(self) -> Optional[str]: if self.relative_local_root is None: return None return os.path.join(self.project_root, self.relative_local_root) def to_json(self) -> Dict[str, object]: """ This method is for display purpose only. Do *NOT* expect this method to produce JSONs that can be de-serialized back into configurations. """ binary = self.binary buck_mode = self.buck_mode isolation_prefix = self.isolation_prefix logger = self.logger number_of_workers = self.number_of_workers oncall = self.oncall pysa_version_hash = self.pysa_version_hash python_version = self.python_version relative_local_root = self.relative_local_root source_directories = self.source_directories site_package_search_strategy = self.site_package_search_strategy site_roots = self.site_roots targets = self.targets typeshed = self.typeshed unwatched_dependency = self.unwatched_dependency version_hash = self.version_hash return { "global_root": self.project_root, "dot_pyre_directory": str(self.dot_pyre_directory), **({"binary": binary} if binary is not None else {}), **({"buck_mode": buck_mode.to_json()} if buck_mode is not None else {}), "do_not_ignore_errors_in": list(self.do_not_ignore_errors_in), "excludes": list(self.excludes), "extensions": list(self.extensions), "ignore_all_errors": list(self.ignore_all_errors), **( {"isolation_prefix": isolation_prefix} if isolation_prefix is not None else {} ), **({"logger": logger} if logger is not None else {}), **({"oncall": oncall} if oncall is not None else {}), **({"workers": number_of_workers} if number_of_workers is not None else {}), "other_critical_files": list(self.other_critical_files), **( {"pysa_version_hash": pysa_version_hash} if pysa_version_hash is not None else {} ), **( {"python_version": python_version.to_string()} if python_version is not None else {} ), **( {"relative_local_root": relative_local_root} if relative_local_root is not None else {} ), "search_path": [str(path) for path in self.search_path], **( {"shared_memory": self.shared_memory.to_json()} if self.shared_memory != shared_memory_module.SharedMemory() else {} ), **( {"site_package_search_strategy": site_package_search_strategy} if site_package_search_strategy is not None else {} ), "site_roots": site_roots if site_roots is not None else [], **( {"source_directories": [str(path) for path in source_directories]} if source_directories is not None else {} ), "strict": self.strict, "taint_models_path": list(self.taint_models_path), **({"targets": list(targets)} if targets is not None else {}), **({"typeshed": typeshed} if typeshed is not None else {}), **( {"unwatched_dependency": unwatched_dependency.to_json()} if unwatched_dependency is not None else {} ), "use_buck2": self.use_buck2, **({"version_hash": version_hash} if version_hash is not None else {}), } def get_existent_unwatched_dependency( self, ) -> Optional[unwatched.UnwatchedDependency]: unwatched_dependency = self.unwatched_dependency if unwatched_dependency is None: return None unwatched_root = Path(unwatched_dependency.files.root) try: if not unwatched_root.is_dir(): LOG.warning( "Nonexistent directory passed in to `unwatched_dependency`: " f"`{unwatched_root}`" ) return None checksum_path = unwatched_root / unwatched_dependency.files.checksum_path if not checksum_path.is_file(): LOG.warning( "Nonexistent file passed in to `unwatched_dependency`: " f"`{checksum_path}`" ) return None return self.unwatched_dependency except PermissionError as error: LOG.warning(str(error)) return None def get_site_roots(self) -> Sequence[str]: site_roots = self.site_roots if site_roots is not None: return site_roots return get_default_site_roots() def expand_and_get_existent_search_paths( self, ) -> List[search_path_module.Element]: site_roots = self.get_site_roots() existent_paths = search_path_module.process_raw_elements( self.search_path, site_roots ) site_packages_paths = site_packages.search_for_paths( self.site_package_search_strategy, site_roots ) typeshed_root = self.get_typeshed_respecting_override() if typeshed_root is None: return existent_paths + site_packages_paths typeshed_paths: List[search_path_module.Element] = [ search_path_module.SimpleElement(str(element)) for element in find_directories.find_typeshed_search_paths( Path(typeshed_root) ) ] return existent_paths + site_packages_paths + typeshed_paths def expand_and_get_existent_source_directories( self, ) -> List[search_path_module.Element]: source_directories = self.source_directories if source_directories is not None: return search_path_module.process_raw_elements( source_directories, self.get_site_roots() ) else: return [] def get_existent_do_not_ignore_errors_in_paths(self) -> List[str]: """ This is a separate method because we want to check for existing files at the time this is called, not when the configuration is constructed. """ ignore_paths = [ expand_global_root(path, global_root=self.project_root) for path in self.do_not_ignore_errors_in ] paths = [] for path in ignore_paths: if os.path.exists(path): paths.append(path) else: LOG.debug( "Filtering out nonexistent paths in `do_not_ignore_errors_in`: " f"{path}" ) return paths def get_existent_ignore_all_errors_paths(self) -> List[str]: """ This is a separate method because we want to check for existing files at the time this is called, not when the configuration is constructed. """ return _expand_and_get_existent_ignore_all_errors_path( self.ignore_all_errors, self.project_root ) def get_binary_respecting_override(self) -> Optional[str]: binary = self.binary if binary is not None: return binary LOG.info(f"No binary specified, looking for `{BINARY_NAME}` in PATH") binary_candidate = shutil.which(BINARY_NAME) if binary_candidate is None: binary_candidate_name = os.path.join( os.path.dirname(sys.argv[0]), BINARY_NAME ) binary_candidate = shutil.which(binary_candidate_name) if binary_candidate is not None: return binary_candidate return None def get_typeshed_respecting_override(self) -> Optional[str]: typeshed = self.typeshed if typeshed is not None: return typeshed LOG.info("No typeshed specified, looking for it...") auto_determined_typeshed = find_directories.find_typeshed() if auto_determined_typeshed is None: LOG.warning( "Could not find a suitable typeshed. Types for Python builtins " "and standard libraries may be missing!" ) return None else: LOG.info(f"Found: `{auto_determined_typeshed}`") return str(auto_determined_typeshed) def get_version_hash_respecting_override(self) -> Optional[str]: overriding_version_hash = os.getenv("PYRE_VERSION_HASH") if overriding_version_hash: LOG.warning(f"Version hash overridden with `{overriding_version_hash}`") return overriding_version_hash return self.version_hash def get_binary_version(self) -> Optional[str]: binary = self.get_binary_respecting_override() if binary is None: return None status = subprocess.run( [binary, "-version"], stdout=subprocess.PIPE, universal_newlines=True ) return status.stdout.strip() if status.returncode == 0 else None def get_number_of_workers(self) -> int: number_of_workers = self.number_of_workers if number_of_workers is not None and number_of_workers > 0: return number_of_workers # pyre-fixme[28]: Unexpected keyword argument `logical`. number_of_physical_cores = psutil.cpu_count(logical=False) if number_of_physical_cores is None: default_number_of_workers = 1 else: default_number_of_workers = max(1, number_of_physical_cores - 1) LOG.info( "Could not determine the number of Pyre workers from configuration. " f"Auto-set the value to {default_number_of_workers}." ) if default_number_of_workers <= 1: LOG.info( "Consider setting the `--sequential` flag instead when the number " "of parallel workers is not greater than 1." ) return default_number_of_workers def is_hover_enabled(self) -> bool: if self.ide_features is None: return ide_features_module.IdeFeatures.DEFAULT_HOVER_ENABLED return self.ide_features.is_hover_enabled() def is_go_to_definition_enabled(self) -> bool: if self.ide_features is None: return ide_features_module.IdeFeatures.DEFAULT_GO_TO_DEFINITION_ENABLED return self.ide_features.is_go_to_definition_enabled() def is_find_symbols_enabled(self) -> bool: if self.ide_features is None: return ide_features_module.IdeFeatures.DEFAULT_FIND_SYMBOLS_ENABLED return self.ide_features.is_find_symbols_enabled() def get_valid_extension_suffixes(self) -> List[str]: vaild_extensions = [] for extension in self.extensions: if not extension.suffix.startswith("."): LOG.warning( "Filtering out extension which does not start with `.`: " f"`{extension.suffix}`" ) else: vaild_extensions.append(extension.command_line_argument()) return vaild_extensions def get_isolation_prefix_respecting_override(self) -> Optional[str]: """We need this to disable an isolation prefix set in a configuration. Merely omitting the CLI flag would not disable the isolation prefix because we would just fall back to the configuration value. With this, we can pass `--isolation-prefix ''` as a CLI argument or override `isolation_prefix` as `""` in a local configuration.""" return None if self.isolation_prefix == "" else self.isolation_prefix def get_python_version(self) -> python_version_module.PythonVersion: python_version = self.python_version if python_version is not None: return python_version else: version_info = sys.version_info return python_version_module.PythonVersion( major=version_info.major, minor=version_info.minor, micro=version_info.micro, ) def create_configuration( arguments: command_arguments.CommandArguments, base_directory: Path ) -> Configuration: local_root_argument = arguments.local_configuration search_base = ( base_directory if local_root_argument is None else base_directory / local_root_argument ) found_root = find_directories.find_global_and_local_root(search_base) # If the local root was explicitly specified but does not exist, return an # error instead of falling back to current directory. if local_root_argument is not None: if found_root is None: raise exceptions.InvalidConfiguration( "A local configuration path was explicitly specified, but no" + f" {CONFIGURATION_FILE} file was found in {search_base}" + " or its parents." ) elif found_root.local_root is None: raise exceptions.InvalidConfiguration( "A local configuration path was explicitly specified, but no" + f" {LOCAL_CONFIGURATION_FILE} file was found in {search_base}" + " or its parents." ) command_argument_configuration = PartialConfiguration.from_command_arguments( arguments ).expand_relative_paths(str(Path.cwd())) if found_root is None: project_root = Path.cwd() relative_local_root = None partial_configuration = command_argument_configuration else: project_root = found_root.global_root relative_local_root = None partial_configuration = PartialConfiguration.from_file( project_root / CONFIGURATION_FILE ).expand_relative_paths(str(project_root)) local_root = found_root.local_root if local_root is not None: relative_local_root = get_relative_local_root(project_root, local_root) partial_configuration = merge_partial_configurations( base=partial_configuration, override=PartialConfiguration.from_file( local_root / LOCAL_CONFIGURATION_FILE ).expand_relative_paths(str(local_root)), ) partial_configuration = merge_partial_configurations( base=partial_configuration, override=command_argument_configuration, ) return Configuration.from_partial_configuration( project_root, relative_local_root, partial_configuration ) def check_nested_local_configuration(configuration: Configuration) -> None: """ Raises `InvalidConfiguration` if the check fails. """ local_root = configuration.local_root if local_root is None: return def is_subdirectory(child: Path, parent: Path) -> bool: return parent == child or parent in child.parents # We search from the parent of the local root, looking for another local # configuration file that lives above the current one local_root_path = Path(local_root).resolve() current_directory = local_root_path.parent while True: found_root = find_directories.find_global_and_local_root(current_directory) if found_root is None: break nesting_local_root = found_root.local_root if nesting_local_root is None: break nesting_configuration = PartialConfiguration.from_file( nesting_local_root / LOCAL_CONFIGURATION_FILE ).expand_relative_paths(str(nesting_local_root)) nesting_ignored_all_errors_path = ( _expand_and_get_existent_ignore_all_errors_path( nesting_configuration.ignore_all_errors, str(found_root.global_root) ) ) if not any( is_subdirectory(child=local_root_path, parent=Path(path)) for path in nesting_ignored_all_errors_path ): error_message = ( "Local configuration is nested under another local configuration at " f"`{nesting_local_root}`.\nPlease add `{local_root_path}` to the " "`ignore_all_errors` field of the parent, or combine the sources " "into a single configuration, or split the parent configuration to " "avoid inconsistent errors." ) raise exceptions.InvalidConfiguration(error_message) current_directory = nesting_local_root.parent
0.720172
0.126488
import math, os, signal, hashlib from glob import glob from filechunkio import FileChunkIO from boto import connect_s3 from boto.s3.key import Key from gevent import sleep from gevent.pool import Pool from gevent.event import Event from ufyr.decorators import retry CHUNK_SIZE = 80000000 #10Mb pool = Pool(4) s3 = connect_s3() bucket = s3.get_bucket('i-haz-a-bucket') closure = Event() def signal_handler(*args): ''' Function container to catch SIGTERM and translate it to a graceful closure ''' print "SETTING CLOSURE", closure closure.set() def save_pid(): with open('/tmp/uploader.pid', 'w') as f: f.write(str(os.getpid())) def do_upload(_file): ''' Given a filepath, upload it using the appropriate s3 method ''' if closure.is_set(): return if os.path.isfile(_file): if os.stat(_file).st_size <= CHUNK_SIZE: upload_file(_file) else: upload_large_file(_file) def traverse_file_path(filepath): ''' Given a filepath, yield files in that path. Is recursive, will only return files. ''' if closure.is_set(): raise StopIteration files = glob(os.path.join(filepath, '*')) for _file in files: if os.path.isfile(_file) and bucket.get_key(_file) is None: yield _file else: for __file in traverse_file_path(_file): yield __file @retry(limit=3, interval=(90, 120)) def upload_file(filepath): ''' Simple upload - straight out of the boto docs ''' print 'UPLOAD SMALL FILE', filepath md5 = md5_from_file(filepath) key = Key(bucket, filepath) key.set_contents_from_filename(filepath) print 'UPLOAD COMPLETE', filepath return '"%s"'%md5 == key.etag @retry(limit=3, interval=(90, 120)) def upload_large_file(filepath): ''' Big upload - also straight out of the docs ''' print 'UPLOAD LARGE FILE', filepath uploader = bucket.initiate_multipart_upload(filepath) hashval = b'' _i = 0 try: file_size = os.stat(filepath).st_size chunk_count = int(math.ceil(file_size/CHUNK_SIZE)) for i in range(chunk_count + 1): offset = CHUNK_SIZE * i _bytes = min(CHUNK_SIZE, file_size - offset) with FileChunkIO(filepath, 'r', offset=offset, bytes=_bytes) as fp: hashval += hashlib.md5(fp.read()).digest() fp.seek(0) print str((float(CHUNK_SIZE) * i / float(file_size))*100) + '% complete\r' uploader.upload_part_from_file(fp, part_num=i+1) _i += 1 uploader.complete_upload() key = bucket.get_key(uploader.key_name) print 'UPLOAD COMPLETE', filepath return key.etag == '"%s-%d"'%(hashlib.md5(hashval).hexdigest(), _i) except: uploader.cancel_upload() raise def md5_from_file(_file): return hashlib.md5(_get_file_contents(_file)).hexdigest() def _get_file_contents(_file): with open(_file, 'rb') as f: return f.read() if __name__ == '__main__': save_pid() signal.signal(signal.SIGTERM, signal_handler) pool.map(do_upload, traverse_file_path(argv[1]))
ufyr/s3_uploader.py
import math, os, signal, hashlib from glob import glob from filechunkio import FileChunkIO from boto import connect_s3 from boto.s3.key import Key from gevent import sleep from gevent.pool import Pool from gevent.event import Event from ufyr.decorators import retry CHUNK_SIZE = 80000000 #10Mb pool = Pool(4) s3 = connect_s3() bucket = s3.get_bucket('i-haz-a-bucket') closure = Event() def signal_handler(*args): ''' Function container to catch SIGTERM and translate it to a graceful closure ''' print "SETTING CLOSURE", closure closure.set() def save_pid(): with open('/tmp/uploader.pid', 'w') as f: f.write(str(os.getpid())) def do_upload(_file): ''' Given a filepath, upload it using the appropriate s3 method ''' if closure.is_set(): return if os.path.isfile(_file): if os.stat(_file).st_size <= CHUNK_SIZE: upload_file(_file) else: upload_large_file(_file) def traverse_file_path(filepath): ''' Given a filepath, yield files in that path. Is recursive, will only return files. ''' if closure.is_set(): raise StopIteration files = glob(os.path.join(filepath, '*')) for _file in files: if os.path.isfile(_file) and bucket.get_key(_file) is None: yield _file else: for __file in traverse_file_path(_file): yield __file @retry(limit=3, interval=(90, 120)) def upload_file(filepath): ''' Simple upload - straight out of the boto docs ''' print 'UPLOAD SMALL FILE', filepath md5 = md5_from_file(filepath) key = Key(bucket, filepath) key.set_contents_from_filename(filepath) print 'UPLOAD COMPLETE', filepath return '"%s"'%md5 == key.etag @retry(limit=3, interval=(90, 120)) def upload_large_file(filepath): ''' Big upload - also straight out of the docs ''' print 'UPLOAD LARGE FILE', filepath uploader = bucket.initiate_multipart_upload(filepath) hashval = b'' _i = 0 try: file_size = os.stat(filepath).st_size chunk_count = int(math.ceil(file_size/CHUNK_SIZE)) for i in range(chunk_count + 1): offset = CHUNK_SIZE * i _bytes = min(CHUNK_SIZE, file_size - offset) with FileChunkIO(filepath, 'r', offset=offset, bytes=_bytes) as fp: hashval += hashlib.md5(fp.read()).digest() fp.seek(0) print str((float(CHUNK_SIZE) * i / float(file_size))*100) + '% complete\r' uploader.upload_part_from_file(fp, part_num=i+1) _i += 1 uploader.complete_upload() key = bucket.get_key(uploader.key_name) print 'UPLOAD COMPLETE', filepath return key.etag == '"%s-%d"'%(hashlib.md5(hashval).hexdigest(), _i) except: uploader.cancel_upload() raise def md5_from_file(_file): return hashlib.md5(_get_file_contents(_file)).hexdigest() def _get_file_contents(_file): with open(_file, 'rb') as f: return f.read() if __name__ == '__main__': save_pid() signal.signal(signal.SIGTERM, signal_handler) pool.map(do_upload, traverse_file_path(argv[1]))
0.296043
0.101768
import numpy as np import matplotlib.pyplot as plt import matplotlib as mpl FIN = './data/model/model_%d.npy' FOUT = './results/rescaled_contacts.svg' P = np.array([0.93,0.91]) S = np.array([0.72,0.81]) F = np.array([0.33,0.23]) #VAR = 4*(F*P*(1-P) + (1-F)*S*(1-S)) VAR = np.array([1,1]) mpl.rcParams['xtick.labelsize'] = 7 mpl.rcParams['ytick.labelsize'] = 5 def build_data(M,idx): D = np.zeros((4,4,)) for (i,j) in enumerate(range(4,0,-1)): D[i,:] = M[j][idx] D[1,3:] = 0 D[2,2:] = 0 D[3,1:] = 0 return D def predicted(D): scale = D.sum(axis=1) print(D) print('scale',scale) print('scale',scale[:,None],scale[0]) R = np.tile(D[0,:],(4,1)) * scale[:,None] / scale[0] R[D==0] = 0 return R def plot_rescale(ax,A,R,err,width=0.25,width2=0.23,labels=None,ylabel=[None,None,None]): aerr = np.sqrt(A*err) rerr = np.sqrt(R*err) for (j,i) in enumerate(range(1,4)): #print(f'axis: {j}') #print('actual',A[i,:]) #print('predicted',R[i,:]) #print('actual_err',aerr) #print('pred_err',rerr) _plot_rescale(ax[j],A[i,:],R[i,:],aerr[i,:],rerr[i,:],labels=labels,ylabel=ylabel[j]) def _plot_rescale(ax,data,pred,err1,err2,width=0.25,width2=0.23,labels=None,ylabel='#contacts'): ind = np.arange(4) #ax.grid(zorder=-1) ax.bar(ind-0.5*width,data,yerr=err1,width=width,ecolor='black', capsize=1,label='Empirical') ax.bar(ind+0.5*width,pred,yerr=err2,width=width2,ecolor='black', capsize=1,label='Predicted') ax.set_xlim([-0.5,3.5]) ax.set_xticks(ind) if labels: ax.set_xticklabels(labels) ax.legend(fontsize=6) ax.set_ylabel('# contacts',fontsize=7) ax.set_ylabel('# contacts',fontsize=7) if ylabel: ax.set_title(ylabel,fontsize=7) def run(cfg,fout=None,source_data=None): M = dict([(i,np.load(FIN%i)) for i in range(1,5)]) print(VAR) #print('M3',M[3]) #print('M4',M[4]) for i in range(1,5): print(f'M{i}',M[i]) C = build_data(M,1) RC = predicted(C) print('RC',RC) G = build_data(M,2) RG = predicted(G) _label = ['$\mathbb{%s}^1$','$\mathbb{%s}^2$','$\mathbb{%s}^3$','$\mathbb{%s}^4$'] clabel = [l%'C' for l in _label] glabel = [l%'G' for l in _label] #s = '# contacts scaled by %s' s = 'scaled by %s' ylabel = [s%'$\mathbb{M}^3$',s%'$\mathbb{M}^2$',s%'$\mathbb{M}^1$'] fig,ax = plt.subplots(3,2,figsize=(3.5,4)) plot_rescale(ax[:,0],C,RC,VAR[0],labels=clabel,ylabel=ylabel) plot_rescale(ax[:,1],G,RG,VAR[1],labels=glabel,ylabel=ylabel) #ax[0,0].set_title('Chemical synapses',fontsize=7) #ax[0,1].set_title('Gap junctions',fontsize=7) plt.tight_layout() plt.savefig(FOUT) plt.show() if __name__=="__main__": run(1)
scripts/model_rescale.py
import numpy as np import matplotlib.pyplot as plt import matplotlib as mpl FIN = './data/model/model_%d.npy' FOUT = './results/rescaled_contacts.svg' P = np.array([0.93,0.91]) S = np.array([0.72,0.81]) F = np.array([0.33,0.23]) #VAR = 4*(F*P*(1-P) + (1-F)*S*(1-S)) VAR = np.array([1,1]) mpl.rcParams['xtick.labelsize'] = 7 mpl.rcParams['ytick.labelsize'] = 5 def build_data(M,idx): D = np.zeros((4,4,)) for (i,j) in enumerate(range(4,0,-1)): D[i,:] = M[j][idx] D[1,3:] = 0 D[2,2:] = 0 D[3,1:] = 0 return D def predicted(D): scale = D.sum(axis=1) print(D) print('scale',scale) print('scale',scale[:,None],scale[0]) R = np.tile(D[0,:],(4,1)) * scale[:,None] / scale[0] R[D==0] = 0 return R def plot_rescale(ax,A,R,err,width=0.25,width2=0.23,labels=None,ylabel=[None,None,None]): aerr = np.sqrt(A*err) rerr = np.sqrt(R*err) for (j,i) in enumerate(range(1,4)): #print(f'axis: {j}') #print('actual',A[i,:]) #print('predicted',R[i,:]) #print('actual_err',aerr) #print('pred_err',rerr) _plot_rescale(ax[j],A[i,:],R[i,:],aerr[i,:],rerr[i,:],labels=labels,ylabel=ylabel[j]) def _plot_rescale(ax,data,pred,err1,err2,width=0.25,width2=0.23,labels=None,ylabel='#contacts'): ind = np.arange(4) #ax.grid(zorder=-1) ax.bar(ind-0.5*width,data,yerr=err1,width=width,ecolor='black', capsize=1,label='Empirical') ax.bar(ind+0.5*width,pred,yerr=err2,width=width2,ecolor='black', capsize=1,label='Predicted') ax.set_xlim([-0.5,3.5]) ax.set_xticks(ind) if labels: ax.set_xticklabels(labels) ax.legend(fontsize=6) ax.set_ylabel('# contacts',fontsize=7) ax.set_ylabel('# contacts',fontsize=7) if ylabel: ax.set_title(ylabel,fontsize=7) def run(cfg,fout=None,source_data=None): M = dict([(i,np.load(FIN%i)) for i in range(1,5)]) print(VAR) #print('M3',M[3]) #print('M4',M[4]) for i in range(1,5): print(f'M{i}',M[i]) C = build_data(M,1) RC = predicted(C) print('RC',RC) G = build_data(M,2) RG = predicted(G) _label = ['$\mathbb{%s}^1$','$\mathbb{%s}^2$','$\mathbb{%s}^3$','$\mathbb{%s}^4$'] clabel = [l%'C' for l in _label] glabel = [l%'G' for l in _label] #s = '# contacts scaled by %s' s = 'scaled by %s' ylabel = [s%'$\mathbb{M}^3$',s%'$\mathbb{M}^2$',s%'$\mathbb{M}^1$'] fig,ax = plt.subplots(3,2,figsize=(3.5,4)) plot_rescale(ax[:,0],C,RC,VAR[0],labels=clabel,ylabel=ylabel) plot_rescale(ax[:,1],G,RG,VAR[1],labels=glabel,ylabel=ylabel) #ax[0,0].set_title('Chemical synapses',fontsize=7) #ax[0,1].set_title('Gap junctions',fontsize=7) plt.tight_layout() plt.savefig(FOUT) plt.show() if __name__=="__main__": run(1)
0.195057
0.413951
from collections import namedtuple from operator import add, contains from typing import AbstractSet, Callable, Tuple from unittest.mock import patch import numpy as np import pandas as pd import pytest from ... import expressions as exp, frontend from ...datalog import DatalogProgram, Fact, Implication from ...exceptions import NeuroLangException, WrongArgumentsInPredicateError from ...expression_walker import ExpressionBasicEvaluator from ...regions import ExplicitVBR, SphericalVolume from ...type_system import Unknown from .. import query_resolution, query_resolution_expressions as qre def test_symbol_management(): class Solver(DatalogProgram, ExpressionBasicEvaluator): pass neurolang = query_resolution.QueryBuilderBase(Solver()) sym = neurolang.new_symbol(int) assert sym.expression.type is int sym_ = neurolang.new_symbol(type_=(float, int)) assert sym_.expression.type is Tuple[float, int] assert sym.expression.name != sym_.expression.name a = neurolang.new_symbol(int, name="a") assert a.expression.name == "a" b = neurolang.add_symbol(1, name="b") assert "b" in neurolang.symbols assert b.value == 1 assert b.type is int assert neurolang.symbols.b == b with pytest.raises(AttributeError): assert neurolang.symbols.c @neurolang.add_symbol def id(x: int) -> int: return x assert "id" in neurolang.symbols assert id == neurolang.symbols.id assert id == neurolang.symbols["id"] assert id.type == Callable[[int], int] f = neurolang.new_symbol() new_expression = f(..., 1) assert isinstance(new_expression.expression, exp.FunctionApplication) assert new_expression.expression.functor == f.expression assert isinstance(new_expression.expression.args[0], exp.Symbol) assert new_expression.expression.args[0].is_fresh assert isinstance(new_expression.expression.args[1], exp.Constant) assert new_expression.expression.args[1].value == 1 def test_symbol_environment(): class Solver(DatalogProgram, ExpressionBasicEvaluator): pass neurolang = query_resolution.QueryBuilderBase(Solver()) b = neurolang.add_symbol(1, name="b") neurolang.symbols._dynamic_mode = True assert "c" not in neurolang.symbols c = neurolang.symbols.c assert c.type is Unknown assert c.expression.name == "c" del neurolang.symbols.b assert b not in neurolang.symbols neurolang.symbols._dynamic_mode = False with neurolang.environment as e: assert "c" not in e c = e.c assert c.type is Unknown assert c.expression.name == "c" e.d = 5 assert e.d.value == 5 assert e.d.type is int assert neurolang.symbols.d.value == 5 assert neurolang.symbols.d.type is int with neurolang.scope as e: assert "f" not in e f = e.f assert f.type is Unknown assert f.expression.name == "f" e.g = 5 assert e.g.value == 5 assert e.g.type is int assert "f" not in neurolang.symbols assert "g" not in neurolang.symbols def test_add_set(): neurolang = frontend.NeurolangDL() s = neurolang.add_tuple_set(range(10), int) res = neurolang[s] assert s.type is AbstractSet[int] assert res.type is AbstractSet[int] assert res.value == frozenset((i,) for i in range(10)) assert isinstance(repr(res), str) v = frozenset(zip(("a", "b", "c"), range(3))) s = neurolang.add_tuple_set(v, (str, int)) res = neurolang[s] assert s.type is AbstractSet[Tuple[str, int]] assert res.type is AbstractSet[Tuple[str, int]] assert res.value == v assert isinstance(repr(res), str) v = pd.DataFrame([[0, 's', .1], [1, 'p', .3]], columns=['A', 'B', 'C']) s = neurolang.add_tuple_set(v) res = neurolang[s] assert s.type is AbstractSet[Tuple[int, str, float]] assert res.type is AbstractSet[Tuple[int, str, float]] assert res.value == set(v.itertuples(index=False)) assert isinstance(repr(res), str) def test_add_set_neurolangdl(): neurolang = frontend.NeurolangDL() s = neurolang.add_tuple_set(range(10), int) res = neurolang[s] assert s.type is AbstractSet[int] assert res.type is AbstractSet[int] assert res.value == frozenset((i,) for i in range(10)) v = frozenset(zip(("a", "b", "c"), range(3))) s = neurolang.add_tuple_set(v, (str, int)) res = neurolang[s] assert s.type is AbstractSet[Tuple[str, int]] assert res.type is AbstractSet[Tuple[str, int]] assert res.value == v def test_query_regions_from_region_set(): neurolang = frontend.NeurolangDL() central = ExplicitVBR(np.array([[0, 0, 5], [1, 1, 8]]), np.eye(4)) i1 = ExplicitVBR(np.array([[0, 0, 2], [1, 1, 3]]), np.eye(4)) i2 = ExplicitVBR(np.array([[0, 0, -1], [1, 1, 2]]), np.eye(4)) i3 = ExplicitVBR(np.array([[0, 0, -10], [1, 1, -5]]), np.eye(4)) regions_ = {(i1,), (i2,), (i3,)} regions = neurolang.add_tuple_set(regions_) x = neurolang.new_region_symbol(name="x") query_result = neurolang.query( (x,), regions(x) & neurolang.symbols.inferior_of(x, central) ) assert len(query_result) == len(regions) assert query_result.to_unnamed() == {(i1,), (i2,), (i3,)} def test_query_new_predicate(): neurolang = frontend.NeurolangDL() central = ExplicitVBR(np.array([[0, 0, 5], [1, 1, 8]]), np.eye(4)) inferior_posterior = ExplicitVBR( np.array([[0, -10, -10], [1, -5, -5]]), np.eye(4) ) inferior_central = ExplicitVBR( np.array([[0, 0, -1], [1, 1, 2]]), np.eye(4) ) inferior_anterior = ExplicitVBR( np.array([[0, 2, 2], [1, 5, 3]]), np.eye(4) ) regions_ = { (inferior_posterior,), (inferior_central,), (inferior_anterior,), } regions = neurolang.add_tuple_set(regions_) def posterior_and_inferior(y, z): return neurolang.symbols.anatomical_posterior_of( y, z ) & neurolang.symbols.anatomical_inferior_of(y, z) x = neurolang.new_region_symbol(name="x") query_result = neurolang.query( (x,), regions(x) & posterior_and_inferior(x, central) ) assert len(query_result) == 1 assert next(iter(query_result)) == (inferior_posterior,) def test_query_single_symbol(): neurolang = frontend.NeurolangDL() s = neurolang.add_tuple_set( [(i,) for i in range(5)] ) with neurolang.scope as e: e.q[e.x] = s(e.x) res = neurolang.query(e.x, e.q(e.x)) assert res.to_unnamed() == {(i,) for i in range(5)} def test_query_wrong_head_arguments(): neurolang = frontend.NeurolangDL() s = neurolang.add_tuple_set( [(i, i) for i in range(5)] ) with neurolang.scope as e: e.q[e.x, e.y] = s(e.x, e.y) with pytest.raises(WrongArgumentsInPredicateError): neurolang.query((e.x, e.y, e.z), e.q(e.x, e.y, e.z)) with pytest.raises(NeuroLangException): neurolang.query((e.x, e.y, e.z), e.q(e.x, e.y)) @pytest.mark.skip() def test_load_spherical_volume_first_order(): neurolang = frontend.RegionFrontend() inferior = ExplicitVBR(np.array([[0, 0, 0], [1, 1, 1]]), np.eye(4)) neurolang.add_region(inferior, name="inferior_region") neurolang.sphere((0, 0, 0), 0.5, name="unit_sphere") assert neurolang.symbols["unit_sphere"].value == SphericalVolume( (0, 0, 0), 0.5 ) x = neurolang.new_region_symbol(name="x") query = neurolang.query( x, neurolang.symbols.overlapping(x, neurolang.symbols.unit_sphere) ) query_result = query.do() assert len(query_result.value) == 1 assert next(iter(query_result.value)) == inferior neurolang.make_implicit_regions_explicit(np.eye(4), (500, 500, 500)) query = neurolang.query( x, neurolang.symbols.overlapping(x, neurolang.symbols.unit_sphere) ) query_result = query.do() sphere_constant = neurolang.symbols["unit_sphere"].value assert ( isinstance(sphere_constant, ExplicitVBR) and np.array_equal(sphere_constant.affine, np.eye(4)) and sphere_constant.image_dim == (500, 500, 500) and np.array_equal(sphere_constant.voxels, [[0, 0, 0]]) ) assert len(query_result.value) == 1 assert next(iter(query_result.value)) == inferior def test_load_spherical_volume_datalog(): neurolang = frontend.NeurolangDL() inferior = ExplicitVBR(np.array([[0, 0, 0], [1, 1, 1]]), np.eye(4)) regions = neurolang.add_tuple_set( {(inferior, "inferior_region")}, name="regions" ) neurolang.sphere((0, 0, 0), 0.5, name="unit_sphere") assert neurolang.symbols["unit_sphere"].value == SphericalVolume( (0, 0, 0), 0.5 ) q = neurolang.new_symbol() x = neurolang.new_region_symbol(name="x") n = neurolang.new_region_symbol(name="n") query = neurolang.query( q(x), neurolang.symbols.overlapping(x, neurolang.symbols.unit_sphere) & regions(x, n), ) assert len(query.value) == 1 assert next(iter(query.value))[0] == inferior neurolang.make_implicit_regions_explicit(np.eye(4), (500, 500, 500)) query = neurolang.query( q(x), neurolang.symbols.overlapping(x, neurolang.symbols.unit_sphere) & regions(x, n), ) assert len(query.value) == 1 assert next(iter(query.value))[0] == inferior sphere_constant = neurolang.symbols["unit_sphere"].value assert ( isinstance(sphere_constant, ExplicitVBR) and np.array_equal(sphere_constant.affine, np.eye(4)) and sphere_constant.image_dim == (500, 500, 500) and np.array_equal(sphere_constant.voxels, [[0, 0, 0]]) ) def test_neurolang_dl_query(): neurolang = frontend.NeurolangDL() r = neurolang.new_symbol(name="r") x = neurolang.new_symbol(name="x") y = neurolang.new_symbol(name="y") z = neurolang.new_symbol(name="z") dataset = {(i, i * 2) for i in range(10)} q = neurolang.add_tuple_set(dataset, name="q") sol = neurolang.query((x, y), q(x, y)).to_unnamed() assert sol == dataset sol = neurolang.query(tuple(), q(x, x)) assert sol assert neurolang.query(q(x, x)) sol = neurolang.query(tuple(), q(100, x)) assert not sol assert not neurolang.query(q(100, x)) sol = neurolang.query((x,), q(x, y) & q(y, z)).to_unnamed() res = set((x,) for x in range(5)) assert sol == res r[x, y] = q(x, y) r[x, z] = r[x, y] & q(y, z) sol = neurolang.query((y,), r(1, y)).to_unnamed() assert sol == set((x,) for x in (2, 4, 8, 16)) def test_neurolang_dl_solve_all(): neurolang = frontend.NeurolangDL() r = neurolang.new_symbol(name="r") x = neurolang.new_symbol(name="x") dataset = {(i, i * 2) for i in range(10)} q = neurolang.add_tuple_set(dataset, name="q") r[x] = q(x, x) sol = neurolang.solve_all() assert sol["q"].to_unnamed() == dataset assert sol["r"].to_unnamed() == set((i,) for i, j in dataset if i == j) assert len(sol) == 2 assert neurolang.predicate_parameter_names(r) == ("x",) def test_neurolange_dl_get_param_names(): neurolang = frontend.NeurolangDL() r = neurolang.new_symbol(name="r") x = neurolang.new_symbol(name="x") dataset = {(i, i * 2) for i in range(10)} q = neurolang.add_tuple_set(dataset, name="q") r[x] = q(x, x) @neurolang.add_symbol def test_fun(x: int) -> int: """ HELP TEST """ return 0 assert neurolang.predicate_parameter_names("q") == ("0", "1") assert neurolang.predicate_parameter_names(q) == ("0", "1") assert neurolang.predicate_parameter_names(r) == ("x",) assert neurolang.symbols[r].predicate_parameter_names == ("x",) assert r[x].help() is not None assert neurolang.symbols["test_fun"].help().strip() == "HELP TEST" def test_neurolange_dl_named_sets(): neurolang = frontend.NeurolangDL() r = neurolang.new_symbol(name="r") s = neurolang.new_symbol(name="s") x = neurolang.new_symbol(name="x") y = neurolang.new_symbol(name="y") dataset = {(i, i * 2) for i in range(10)} q = neurolang.add_tuple_set(dataset, name="q") r[x] = q(x, x) s[x, y] = q(x, x) & (y == x) res = neurolang.solve_all() assert res["r"].columns == ("x",) assert res["r"].row_type == Tuple[int] assert res["r"].to_unnamed() == {(i,) for i, j in dataset if i == j} def test_neurolange_dl_negation(): neurolang = frontend.NeurolangDL() s = neurolang.new_symbol(name="s") x = neurolang.new_symbol(name="x") y = neurolang.new_symbol(name="y") dataset = {(i, i * 2) for i in range(10)} q = neurolang.add_tuple_set(dataset, name="q") s[x, y] = ~q(x, x) & q(x, y) res = neurolang.solve_all() assert res["s"].to_unnamed() == {(i, j) for i, j in dataset if i != j} def test_neurolang_dl_datalog_code_list_symbols(): neurolang = frontend.NeurolangDL() original_symbols = set(neurolang.symbols) neurolang.execute_datalog_program( """ A(4, 5) A(5, 6) A(6, 5) B(x,y) :- A(x, y) B(x,y) :- B(x, z),A(z, y) C(x) :- B(x, y), y == 5 D("x") """ ) assert set(neurolang.symbols) == {"A", "B", "C", "D"} | original_symbols def test_neurolang_dl_datalog_code(): neurolang = frontend.NeurolangDL() neurolang.execute_datalog_program( """ A(4, 5) A(5, 6) A(6, 5) B(x,y) :- A(x, y) B(x,y) :- B(x, z),A(z, y) C(x) :- B(x, y), y == 5 D("x") """ ) res = neurolang.solve_all() assert res["A"].row_type == Tuple[int, int] assert res["A"].to_unnamed() == {(4, 5), (5, 6), (6, 5)} assert res["B"].to_unnamed() == { (4, 5), (5, 6), (6, 5), (4, 6), (5, 5), (6, 6), } assert res["C"].to_unnamed() == {(4,), (5,), (6,)} assert res["D"].to_unnamed() == { ("x",), } def test_neurolang_dl_aggregation(): neurolang = frontend.NeurolangDL() q = neurolang.new_symbol(name="q") p = neurolang.new_symbol(name="p") r = neurolang.new_symbol(name="r") x = neurolang.new_symbol(name="x") y = neurolang.new_symbol(name="y") @neurolang.add_symbol def sum_(x): return sum(x) for i in range(10): q[i % 2, i] = True p[x, sum_(y)] = q[x, y] sol = neurolang.query(r(x, y), p(x, y)) res_q = {(0, 2 + 4 + 6 + 8), (1, 1 + 3 + 5 + 7 + 9)} assert len(sol) == 2 assert sol[r] == res_q assert sol[p] == res_q def test_neurolang_dl_aggregation_direct_query(): neurolang = frontend.NeurolangDL() q = neurolang.new_symbol(name="q") p = neurolang.new_symbol(name="p") x = neurolang.new_symbol(name="x") y = neurolang.new_symbol(name="y") @neurolang.add_symbol def sum_(x): return sum(x) for i in range(10): q[i % 2, i] = True p[x, sum_(y)] = q[x, y] sol = neurolang.query((x, y), p(x, y)).to_unnamed() res_q = {(0, 2 + 4 + 6 + 8), (1, 1 + 3 + 5 + 7 + 9)} assert sol == res_q def test_neurolang_dl_aggregation_environment(): neurolang = frontend.NeurolangDL() @neurolang.add_symbol def sum_(x): return sum(x) with neurolang.environment as e: for i in range(10): e.q[i % 2, i] = True e.p[e.x, sum_(e.y)] = e.q[e.x, e.y] sol = neurolang.query(e.r(e.x, e.y), e.p(e.x, e.y)) res_q = {(0, 2 + 4 + 6 + 8), (1, 1 + 3 + 5 + 7 + 9)} assert len(sol) == 2 assert sol["r"] == res_q assert sol["p"] == res_q def test_neurolang_dl_aggregation_environment_direct_query(): neurolang = frontend.NeurolangDL() @neurolang.add_symbol def sum_(x): return sum(x) with neurolang.environment as e: for i in range(10): e.q[i % 2, i] = True e.p[e.x, sum_(e.y)] = e.q[e.x, e.y] sol = neurolang.query((e.x, e.y), e.p(e.x, e.y)).to_unnamed() res_q = {(0, 2 + 4 + 6 + 8), (1, 1 + 3 + 5 + 7 + 9)} assert sol == res_q def test_aggregation_number_of_arrivals(): neurolang = frontend.NeurolangDL() @neurolang.add_symbol def agg_count(x) -> int: return len(x) with neurolang.environment as e: e.A[0, 1] = True e.A[1, 2] = True e.A[2, 3] = True e.reachable[e.x, e.y] = e.A[e.x, e.y] e.reachable[e.x, e.y] = e.reachable[e.x, e.z] & e.A[e.z, e.y] e.count_destinations[e.x, agg_count(e.y)] = e.reachable[e.x, e.y] res = neurolang.query((e.x, e.c), e.count_destinations(e.x, e.c)) assert res.to_unnamed() == {(0, 3), (1, 2), (2, 1)} def test_frontend_operators(): neurolang = frontend.NeurolangDL() a = neurolang.new_symbol(name='a') b = a + 1 assert isinstance(b, qre.Operation) assert b.expression.functor == exp.Constant(add) assert b.expression.args == (a.expression, exp.Constant(1)) c = 1 + a assert isinstance(c, qre.Operation) assert c.expression.functor == exp.Constant(add) assert c.expression.args == (exp.Constant(1), a.expression) def test_neurolang_dl_attribute_access(): neurolang = frontend.NeurolangDL() one_element = namedtuple("t", ("x", "y"))(1, 2) a = neurolang.add_tuple_set([(one_element,)], name="a") with neurolang.scope as e: e.q[e.x] = a[e.x] e.r[e.y] = a[e.w] & (e.y == e.w.x) res = neurolang.solve_all() q = res["q"] r = res["r"] assert len(q) == 1 el = next(q.to_unnamed().itervalues())[0] assert el == one_element assert r.to_unnamed() == {(one_element.x,)} def test_neurolang_dl_set_destroy(): neurolang = frontend.NeurolangDL() contains_ = neurolang.add_symbol(contains) a = neurolang.add_tuple_set([(frozenset((0, 1, 2)),)], name="a") with neurolang.scope as e: e.q[e.y] = a[e.x] & contains_(e.x, e.y) res = neurolang.solve_all() q = res["q"].to_unnamed() assert len(q) == 3 assert set(q) == {(0,), (1,), (2,)} @pytest.mark.skip @patch( "neurolang.frontend.neurosynth_utils." "NeuroSynthHandler.ns_region_set_from_term" ) def test_neurosynth_region(mock_ns_regions): mock_ns_regions.return_value = { ExplicitVBR(np.array([[1, 0, 0], [1, 1, 0]]), np.eye(4)) } neurolang = frontend.NeurolangDL() s = neurolang.load_neurosynth_term_regions( "gambling", 10, "gambling_regions" ) res = neurolang[s] mock_ns_regions.assert_called() assert res.type is AbstractSet[Tuple[ExplicitVBR]] assert res.value == frozenset((t,) for t in mock_ns_regions.return_value) def test_translate_expression_to_fronted_expression(): qr = frontend.NeurolangDL() tr = qre.TranslateExpressionToFrontEndExpression(qr) assert tr.walk(exp.Constant(1)) == 1 symbol_exp = exp.Symbol("a") symbol_fe = tr.walk(symbol_exp) assert symbol_fe.expression == symbol_exp assert symbol_fe.query_builder == tr.query_builder fa_exp = symbol_exp(exp.Constant(1)) fa_fe = symbol_fe(1) fa_fe_tr = tr.walk(fa_exp) assert fa_fe_tr.expression == fa_exp assert fa_fe_tr == fa_fe fact_exp = Fact(fa_exp) fact_fe = tr.walk(fact_exp) assert fact_fe.expression == fact_exp assert fact_fe.consequent == fa_fe imp_exp = Implication( symbol_exp(exp.Symbol("x")), exp.Symbol("b")(exp.Symbol("x")) ) imp_fe = tr.walk(imp_exp) assert imp_fe.expression == imp_exp assert imp_fe.consequent == tr.walk(imp_exp.consequent) assert imp_fe.antecedent == tr.walk(imp_exp.antecedent) def test_first_column_sugar_body_s(): qr = frontend.NeurolangDL() qr.add_tuple_set({ ('one', 1), ('two', 2) }, name='dd') with qr.scope as e: e.s[e.x] = (e.x == e.y) & e.dd('one', e.y) e.r[e.x] = (e.x == (e.dd.s['one'])) res_all = qr.solve_all() assert res_all['r'] == res_all['s'] def test_first_column_sugar_head_s(): qr = frontend.NeurolangDL() qr.add_tuple_set({ (1, 'one'), (2, 'two') }, name='dd') with qr.scope as e: e.r.s['one'] = e.dd('one') res_all = qr.solve_all() assert set(res_all['r']) == {('one', 1)} def test_head_constant(): qr = frontend.NeurolangDL() qr.add_tuple_set({ (1,) }, name='dd') with qr.scope as e: e.r['one', e.x] = e.dd(e.x) res_all = qr.solve_all() assert set(res_all['r']) == {('one', 1)}
neurolang/frontend/tests/test_frontend.py
from collections import namedtuple from operator import add, contains from typing import AbstractSet, Callable, Tuple from unittest.mock import patch import numpy as np import pandas as pd import pytest from ... import expressions as exp, frontend from ...datalog import DatalogProgram, Fact, Implication from ...exceptions import NeuroLangException, WrongArgumentsInPredicateError from ...expression_walker import ExpressionBasicEvaluator from ...regions import ExplicitVBR, SphericalVolume from ...type_system import Unknown from .. import query_resolution, query_resolution_expressions as qre def test_symbol_management(): class Solver(DatalogProgram, ExpressionBasicEvaluator): pass neurolang = query_resolution.QueryBuilderBase(Solver()) sym = neurolang.new_symbol(int) assert sym.expression.type is int sym_ = neurolang.new_symbol(type_=(float, int)) assert sym_.expression.type is Tuple[float, int] assert sym.expression.name != sym_.expression.name a = neurolang.new_symbol(int, name="a") assert a.expression.name == "a" b = neurolang.add_symbol(1, name="b") assert "b" in neurolang.symbols assert b.value == 1 assert b.type is int assert neurolang.symbols.b == b with pytest.raises(AttributeError): assert neurolang.symbols.c @neurolang.add_symbol def id(x: int) -> int: return x assert "id" in neurolang.symbols assert id == neurolang.symbols.id assert id == neurolang.symbols["id"] assert id.type == Callable[[int], int] f = neurolang.new_symbol() new_expression = f(..., 1) assert isinstance(new_expression.expression, exp.FunctionApplication) assert new_expression.expression.functor == f.expression assert isinstance(new_expression.expression.args[0], exp.Symbol) assert new_expression.expression.args[0].is_fresh assert isinstance(new_expression.expression.args[1], exp.Constant) assert new_expression.expression.args[1].value == 1 def test_symbol_environment(): class Solver(DatalogProgram, ExpressionBasicEvaluator): pass neurolang = query_resolution.QueryBuilderBase(Solver()) b = neurolang.add_symbol(1, name="b") neurolang.symbols._dynamic_mode = True assert "c" not in neurolang.symbols c = neurolang.symbols.c assert c.type is Unknown assert c.expression.name == "c" del neurolang.symbols.b assert b not in neurolang.symbols neurolang.symbols._dynamic_mode = False with neurolang.environment as e: assert "c" not in e c = e.c assert c.type is Unknown assert c.expression.name == "c" e.d = 5 assert e.d.value == 5 assert e.d.type is int assert neurolang.symbols.d.value == 5 assert neurolang.symbols.d.type is int with neurolang.scope as e: assert "f" not in e f = e.f assert f.type is Unknown assert f.expression.name == "f" e.g = 5 assert e.g.value == 5 assert e.g.type is int assert "f" not in neurolang.symbols assert "g" not in neurolang.symbols def test_add_set(): neurolang = frontend.NeurolangDL() s = neurolang.add_tuple_set(range(10), int) res = neurolang[s] assert s.type is AbstractSet[int] assert res.type is AbstractSet[int] assert res.value == frozenset((i,) for i in range(10)) assert isinstance(repr(res), str) v = frozenset(zip(("a", "b", "c"), range(3))) s = neurolang.add_tuple_set(v, (str, int)) res = neurolang[s] assert s.type is AbstractSet[Tuple[str, int]] assert res.type is AbstractSet[Tuple[str, int]] assert res.value == v assert isinstance(repr(res), str) v = pd.DataFrame([[0, 's', .1], [1, 'p', .3]], columns=['A', 'B', 'C']) s = neurolang.add_tuple_set(v) res = neurolang[s] assert s.type is AbstractSet[Tuple[int, str, float]] assert res.type is AbstractSet[Tuple[int, str, float]] assert res.value == set(v.itertuples(index=False)) assert isinstance(repr(res), str) def test_add_set_neurolangdl(): neurolang = frontend.NeurolangDL() s = neurolang.add_tuple_set(range(10), int) res = neurolang[s] assert s.type is AbstractSet[int] assert res.type is AbstractSet[int] assert res.value == frozenset((i,) for i in range(10)) v = frozenset(zip(("a", "b", "c"), range(3))) s = neurolang.add_tuple_set(v, (str, int)) res = neurolang[s] assert s.type is AbstractSet[Tuple[str, int]] assert res.type is AbstractSet[Tuple[str, int]] assert res.value == v def test_query_regions_from_region_set(): neurolang = frontend.NeurolangDL() central = ExplicitVBR(np.array([[0, 0, 5], [1, 1, 8]]), np.eye(4)) i1 = ExplicitVBR(np.array([[0, 0, 2], [1, 1, 3]]), np.eye(4)) i2 = ExplicitVBR(np.array([[0, 0, -1], [1, 1, 2]]), np.eye(4)) i3 = ExplicitVBR(np.array([[0, 0, -10], [1, 1, -5]]), np.eye(4)) regions_ = {(i1,), (i2,), (i3,)} regions = neurolang.add_tuple_set(regions_) x = neurolang.new_region_symbol(name="x") query_result = neurolang.query( (x,), regions(x) & neurolang.symbols.inferior_of(x, central) ) assert len(query_result) == len(regions) assert query_result.to_unnamed() == {(i1,), (i2,), (i3,)} def test_query_new_predicate(): neurolang = frontend.NeurolangDL() central = ExplicitVBR(np.array([[0, 0, 5], [1, 1, 8]]), np.eye(4)) inferior_posterior = ExplicitVBR( np.array([[0, -10, -10], [1, -5, -5]]), np.eye(4) ) inferior_central = ExplicitVBR( np.array([[0, 0, -1], [1, 1, 2]]), np.eye(4) ) inferior_anterior = ExplicitVBR( np.array([[0, 2, 2], [1, 5, 3]]), np.eye(4) ) regions_ = { (inferior_posterior,), (inferior_central,), (inferior_anterior,), } regions = neurolang.add_tuple_set(regions_) def posterior_and_inferior(y, z): return neurolang.symbols.anatomical_posterior_of( y, z ) & neurolang.symbols.anatomical_inferior_of(y, z) x = neurolang.new_region_symbol(name="x") query_result = neurolang.query( (x,), regions(x) & posterior_and_inferior(x, central) ) assert len(query_result) == 1 assert next(iter(query_result)) == (inferior_posterior,) def test_query_single_symbol(): neurolang = frontend.NeurolangDL() s = neurolang.add_tuple_set( [(i,) for i in range(5)] ) with neurolang.scope as e: e.q[e.x] = s(e.x) res = neurolang.query(e.x, e.q(e.x)) assert res.to_unnamed() == {(i,) for i in range(5)} def test_query_wrong_head_arguments(): neurolang = frontend.NeurolangDL() s = neurolang.add_tuple_set( [(i, i) for i in range(5)] ) with neurolang.scope as e: e.q[e.x, e.y] = s(e.x, e.y) with pytest.raises(WrongArgumentsInPredicateError): neurolang.query((e.x, e.y, e.z), e.q(e.x, e.y, e.z)) with pytest.raises(NeuroLangException): neurolang.query((e.x, e.y, e.z), e.q(e.x, e.y)) @pytest.mark.skip() def test_load_spherical_volume_first_order(): neurolang = frontend.RegionFrontend() inferior = ExplicitVBR(np.array([[0, 0, 0], [1, 1, 1]]), np.eye(4)) neurolang.add_region(inferior, name="inferior_region") neurolang.sphere((0, 0, 0), 0.5, name="unit_sphere") assert neurolang.symbols["unit_sphere"].value == SphericalVolume( (0, 0, 0), 0.5 ) x = neurolang.new_region_symbol(name="x") query = neurolang.query( x, neurolang.symbols.overlapping(x, neurolang.symbols.unit_sphere) ) query_result = query.do() assert len(query_result.value) == 1 assert next(iter(query_result.value)) == inferior neurolang.make_implicit_regions_explicit(np.eye(4), (500, 500, 500)) query = neurolang.query( x, neurolang.symbols.overlapping(x, neurolang.symbols.unit_sphere) ) query_result = query.do() sphere_constant = neurolang.symbols["unit_sphere"].value assert ( isinstance(sphere_constant, ExplicitVBR) and np.array_equal(sphere_constant.affine, np.eye(4)) and sphere_constant.image_dim == (500, 500, 500) and np.array_equal(sphere_constant.voxels, [[0, 0, 0]]) ) assert len(query_result.value) == 1 assert next(iter(query_result.value)) == inferior def test_load_spherical_volume_datalog(): neurolang = frontend.NeurolangDL() inferior = ExplicitVBR(np.array([[0, 0, 0], [1, 1, 1]]), np.eye(4)) regions = neurolang.add_tuple_set( {(inferior, "inferior_region")}, name="regions" ) neurolang.sphere((0, 0, 0), 0.5, name="unit_sphere") assert neurolang.symbols["unit_sphere"].value == SphericalVolume( (0, 0, 0), 0.5 ) q = neurolang.new_symbol() x = neurolang.new_region_symbol(name="x") n = neurolang.new_region_symbol(name="n") query = neurolang.query( q(x), neurolang.symbols.overlapping(x, neurolang.symbols.unit_sphere) & regions(x, n), ) assert len(query.value) == 1 assert next(iter(query.value))[0] == inferior neurolang.make_implicit_regions_explicit(np.eye(4), (500, 500, 500)) query = neurolang.query( q(x), neurolang.symbols.overlapping(x, neurolang.symbols.unit_sphere) & regions(x, n), ) assert len(query.value) == 1 assert next(iter(query.value))[0] == inferior sphere_constant = neurolang.symbols["unit_sphere"].value assert ( isinstance(sphere_constant, ExplicitVBR) and np.array_equal(sphere_constant.affine, np.eye(4)) and sphere_constant.image_dim == (500, 500, 500) and np.array_equal(sphere_constant.voxels, [[0, 0, 0]]) ) def test_neurolang_dl_query(): neurolang = frontend.NeurolangDL() r = neurolang.new_symbol(name="r") x = neurolang.new_symbol(name="x") y = neurolang.new_symbol(name="y") z = neurolang.new_symbol(name="z") dataset = {(i, i * 2) for i in range(10)} q = neurolang.add_tuple_set(dataset, name="q") sol = neurolang.query((x, y), q(x, y)).to_unnamed() assert sol == dataset sol = neurolang.query(tuple(), q(x, x)) assert sol assert neurolang.query(q(x, x)) sol = neurolang.query(tuple(), q(100, x)) assert not sol assert not neurolang.query(q(100, x)) sol = neurolang.query((x,), q(x, y) & q(y, z)).to_unnamed() res = set((x,) for x in range(5)) assert sol == res r[x, y] = q(x, y) r[x, z] = r[x, y] & q(y, z) sol = neurolang.query((y,), r(1, y)).to_unnamed() assert sol == set((x,) for x in (2, 4, 8, 16)) def test_neurolang_dl_solve_all(): neurolang = frontend.NeurolangDL() r = neurolang.new_symbol(name="r") x = neurolang.new_symbol(name="x") dataset = {(i, i * 2) for i in range(10)} q = neurolang.add_tuple_set(dataset, name="q") r[x] = q(x, x) sol = neurolang.solve_all() assert sol["q"].to_unnamed() == dataset assert sol["r"].to_unnamed() == set((i,) for i, j in dataset if i == j) assert len(sol) == 2 assert neurolang.predicate_parameter_names(r) == ("x",) def test_neurolange_dl_get_param_names(): neurolang = frontend.NeurolangDL() r = neurolang.new_symbol(name="r") x = neurolang.new_symbol(name="x") dataset = {(i, i * 2) for i in range(10)} q = neurolang.add_tuple_set(dataset, name="q") r[x] = q(x, x) @neurolang.add_symbol def test_fun(x: int) -> int: """ HELP TEST """ return 0 assert neurolang.predicate_parameter_names("q") == ("0", "1") assert neurolang.predicate_parameter_names(q) == ("0", "1") assert neurolang.predicate_parameter_names(r) == ("x",) assert neurolang.symbols[r].predicate_parameter_names == ("x",) assert r[x].help() is not None assert neurolang.symbols["test_fun"].help().strip() == "HELP TEST" def test_neurolange_dl_named_sets(): neurolang = frontend.NeurolangDL() r = neurolang.new_symbol(name="r") s = neurolang.new_symbol(name="s") x = neurolang.new_symbol(name="x") y = neurolang.new_symbol(name="y") dataset = {(i, i * 2) for i in range(10)} q = neurolang.add_tuple_set(dataset, name="q") r[x] = q(x, x) s[x, y] = q(x, x) & (y == x) res = neurolang.solve_all() assert res["r"].columns == ("x",) assert res["r"].row_type == Tuple[int] assert res["r"].to_unnamed() == {(i,) for i, j in dataset if i == j} def test_neurolange_dl_negation(): neurolang = frontend.NeurolangDL() s = neurolang.new_symbol(name="s") x = neurolang.new_symbol(name="x") y = neurolang.new_symbol(name="y") dataset = {(i, i * 2) for i in range(10)} q = neurolang.add_tuple_set(dataset, name="q") s[x, y] = ~q(x, x) & q(x, y) res = neurolang.solve_all() assert res["s"].to_unnamed() == {(i, j) for i, j in dataset if i != j} def test_neurolang_dl_datalog_code_list_symbols(): neurolang = frontend.NeurolangDL() original_symbols = set(neurolang.symbols) neurolang.execute_datalog_program( """ A(4, 5) A(5, 6) A(6, 5) B(x,y) :- A(x, y) B(x,y) :- B(x, z),A(z, y) C(x) :- B(x, y), y == 5 D("x") """ ) assert set(neurolang.symbols) == {"A", "B", "C", "D"} | original_symbols def test_neurolang_dl_datalog_code(): neurolang = frontend.NeurolangDL() neurolang.execute_datalog_program( """ A(4, 5) A(5, 6) A(6, 5) B(x,y) :- A(x, y) B(x,y) :- B(x, z),A(z, y) C(x) :- B(x, y), y == 5 D("x") """ ) res = neurolang.solve_all() assert res["A"].row_type == Tuple[int, int] assert res["A"].to_unnamed() == {(4, 5), (5, 6), (6, 5)} assert res["B"].to_unnamed() == { (4, 5), (5, 6), (6, 5), (4, 6), (5, 5), (6, 6), } assert res["C"].to_unnamed() == {(4,), (5,), (6,)} assert res["D"].to_unnamed() == { ("x",), } def test_neurolang_dl_aggregation(): neurolang = frontend.NeurolangDL() q = neurolang.new_symbol(name="q") p = neurolang.new_symbol(name="p") r = neurolang.new_symbol(name="r") x = neurolang.new_symbol(name="x") y = neurolang.new_symbol(name="y") @neurolang.add_symbol def sum_(x): return sum(x) for i in range(10): q[i % 2, i] = True p[x, sum_(y)] = q[x, y] sol = neurolang.query(r(x, y), p(x, y)) res_q = {(0, 2 + 4 + 6 + 8), (1, 1 + 3 + 5 + 7 + 9)} assert len(sol) == 2 assert sol[r] == res_q assert sol[p] == res_q def test_neurolang_dl_aggregation_direct_query(): neurolang = frontend.NeurolangDL() q = neurolang.new_symbol(name="q") p = neurolang.new_symbol(name="p") x = neurolang.new_symbol(name="x") y = neurolang.new_symbol(name="y") @neurolang.add_symbol def sum_(x): return sum(x) for i in range(10): q[i % 2, i] = True p[x, sum_(y)] = q[x, y] sol = neurolang.query((x, y), p(x, y)).to_unnamed() res_q = {(0, 2 + 4 + 6 + 8), (1, 1 + 3 + 5 + 7 + 9)} assert sol == res_q def test_neurolang_dl_aggregation_environment(): neurolang = frontend.NeurolangDL() @neurolang.add_symbol def sum_(x): return sum(x) with neurolang.environment as e: for i in range(10): e.q[i % 2, i] = True e.p[e.x, sum_(e.y)] = e.q[e.x, e.y] sol = neurolang.query(e.r(e.x, e.y), e.p(e.x, e.y)) res_q = {(0, 2 + 4 + 6 + 8), (1, 1 + 3 + 5 + 7 + 9)} assert len(sol) == 2 assert sol["r"] == res_q assert sol["p"] == res_q def test_neurolang_dl_aggregation_environment_direct_query(): neurolang = frontend.NeurolangDL() @neurolang.add_symbol def sum_(x): return sum(x) with neurolang.environment as e: for i in range(10): e.q[i % 2, i] = True e.p[e.x, sum_(e.y)] = e.q[e.x, e.y] sol = neurolang.query((e.x, e.y), e.p(e.x, e.y)).to_unnamed() res_q = {(0, 2 + 4 + 6 + 8), (1, 1 + 3 + 5 + 7 + 9)} assert sol == res_q def test_aggregation_number_of_arrivals(): neurolang = frontend.NeurolangDL() @neurolang.add_symbol def agg_count(x) -> int: return len(x) with neurolang.environment as e: e.A[0, 1] = True e.A[1, 2] = True e.A[2, 3] = True e.reachable[e.x, e.y] = e.A[e.x, e.y] e.reachable[e.x, e.y] = e.reachable[e.x, e.z] & e.A[e.z, e.y] e.count_destinations[e.x, agg_count(e.y)] = e.reachable[e.x, e.y] res = neurolang.query((e.x, e.c), e.count_destinations(e.x, e.c)) assert res.to_unnamed() == {(0, 3), (1, 2), (2, 1)} def test_frontend_operators(): neurolang = frontend.NeurolangDL() a = neurolang.new_symbol(name='a') b = a + 1 assert isinstance(b, qre.Operation) assert b.expression.functor == exp.Constant(add) assert b.expression.args == (a.expression, exp.Constant(1)) c = 1 + a assert isinstance(c, qre.Operation) assert c.expression.functor == exp.Constant(add) assert c.expression.args == (exp.Constant(1), a.expression) def test_neurolang_dl_attribute_access(): neurolang = frontend.NeurolangDL() one_element = namedtuple("t", ("x", "y"))(1, 2) a = neurolang.add_tuple_set([(one_element,)], name="a") with neurolang.scope as e: e.q[e.x] = a[e.x] e.r[e.y] = a[e.w] & (e.y == e.w.x) res = neurolang.solve_all() q = res["q"] r = res["r"] assert len(q) == 1 el = next(q.to_unnamed().itervalues())[0] assert el == one_element assert r.to_unnamed() == {(one_element.x,)} def test_neurolang_dl_set_destroy(): neurolang = frontend.NeurolangDL() contains_ = neurolang.add_symbol(contains) a = neurolang.add_tuple_set([(frozenset((0, 1, 2)),)], name="a") with neurolang.scope as e: e.q[e.y] = a[e.x] & contains_(e.x, e.y) res = neurolang.solve_all() q = res["q"].to_unnamed() assert len(q) == 3 assert set(q) == {(0,), (1,), (2,)} @pytest.mark.skip @patch( "neurolang.frontend.neurosynth_utils." "NeuroSynthHandler.ns_region_set_from_term" ) def test_neurosynth_region(mock_ns_regions): mock_ns_regions.return_value = { ExplicitVBR(np.array([[1, 0, 0], [1, 1, 0]]), np.eye(4)) } neurolang = frontend.NeurolangDL() s = neurolang.load_neurosynth_term_regions( "gambling", 10, "gambling_regions" ) res = neurolang[s] mock_ns_regions.assert_called() assert res.type is AbstractSet[Tuple[ExplicitVBR]] assert res.value == frozenset((t,) for t in mock_ns_regions.return_value) def test_translate_expression_to_fronted_expression(): qr = frontend.NeurolangDL() tr = qre.TranslateExpressionToFrontEndExpression(qr) assert tr.walk(exp.Constant(1)) == 1 symbol_exp = exp.Symbol("a") symbol_fe = tr.walk(symbol_exp) assert symbol_fe.expression == symbol_exp assert symbol_fe.query_builder == tr.query_builder fa_exp = symbol_exp(exp.Constant(1)) fa_fe = symbol_fe(1) fa_fe_tr = tr.walk(fa_exp) assert fa_fe_tr.expression == fa_exp assert fa_fe_tr == fa_fe fact_exp = Fact(fa_exp) fact_fe = tr.walk(fact_exp) assert fact_fe.expression == fact_exp assert fact_fe.consequent == fa_fe imp_exp = Implication( symbol_exp(exp.Symbol("x")), exp.Symbol("b")(exp.Symbol("x")) ) imp_fe = tr.walk(imp_exp) assert imp_fe.expression == imp_exp assert imp_fe.consequent == tr.walk(imp_exp.consequent) assert imp_fe.antecedent == tr.walk(imp_exp.antecedent) def test_first_column_sugar_body_s(): qr = frontend.NeurolangDL() qr.add_tuple_set({ ('one', 1), ('two', 2) }, name='dd') with qr.scope as e: e.s[e.x] = (e.x == e.y) & e.dd('one', e.y) e.r[e.x] = (e.x == (e.dd.s['one'])) res_all = qr.solve_all() assert res_all['r'] == res_all['s'] def test_first_column_sugar_head_s(): qr = frontend.NeurolangDL() qr.add_tuple_set({ (1, 'one'), (2, 'two') }, name='dd') with qr.scope as e: e.r.s['one'] = e.dd('one') res_all = qr.solve_all() assert set(res_all['r']) == {('one', 1)} def test_head_constant(): qr = frontend.NeurolangDL() qr.add_tuple_set({ (1,) }, name='dd') with qr.scope as e: e.r['one', e.x] = e.dd(e.x) res_all = qr.solve_all() assert set(res_all['r']) == {('one', 1)}
0.847747
0.589864
import os import numpy as np import pandas as pd from detectron2.data import DatasetCatalog, MetadataCatalog def setup_cls_data_catalog(cfg): """ register datasetcatalog and metadata_catalog """ # register dataset_catalog dataset_dict_fn = SpineClsDatasetFunction(cfg, "train") DatasetCatalog.register("spine_cls_train", dataset_dict_fn) dataset_dict_fn = SpineClsDatasetFunction(cfg, "test") DatasetCatalog.register("spine_cls_test", dataset_dict_fn) # register metadata_catalog classes = cfg.MODEL.CLASSIFIER.CLASSES MetadataCatalog.get("spine_cls_train").thing_classes = classes MetadataCatalog.get("spine_cls_test").thing_classes = classes print( MetadataCatalog.get("spine_cls_train"), "\n", MetadataCatalog.get("spine_cls_test") ) class SpineClsDatasetFunction: def __init__(self, cfg, mode="train"): assert mode in ["train", "test"] self.mode = mode self.cfg = cfg def __call__(self): """ return list[dict] """ cfg = self.cfg disease_classes = cfg.MODEL.CLASSIFIER.CLASSES data_folder = cfg.SPINE.TRAIN_DATA_FOLDER if self.mode == "train" else cfg.SPINE.TEST_DATA_FOLDER metadata = cfg.SPINE.TRAIN_METADATA if self.mode == "train" else cfg.SPINE.TEST_METADATA metadata = pd.read_csv(metadata) metadata = metadata[["image_id", "image_height", "image_width"]] metadata = metadata.set_index("image_id") metadata = metadata.to_dict(orient="index") annotations = cfg.SPINE.TRAIN_ANNOTATION if self.mode == "train" else cfg.SPINE.TEST_ANNOTATION annotations = pd.read_csv(annotations) abnormal_only = "Abnormal" in disease_classes if abnormal_only: assert len(disease_classes) == 1 dataset_dict = [] for image_id, rows in annotations.groupby("image_id"): instance_dict = {} instance_dict["file_name"] = os.path.join(data_folder, f"{image_id}.png") instance_dict["image_id"] = image_id instance_dict["height"] = metadata[image_id]["image_height"] instance_dict["width"] = metadata[image_id]["image_width"] classes = rows["lesion_type"].unique().tolist() if abnormal_only: label = 0. if "No finding" in classes else 1. labels = np.array([label]) else: labels = np.array([0.0]*len(disease_classes)) for label in classes: if (label not in disease_classes) and "Other disease" in disease_classes: label = "Other disease" labels[disease_classes.index(label)] = 1. instance_dict["classes"] = labels dataset_dict.append(instance_dict) return dataset_dict
spine/classification/cls_dataset_dict.py
import os import numpy as np import pandas as pd from detectron2.data import DatasetCatalog, MetadataCatalog def setup_cls_data_catalog(cfg): """ register datasetcatalog and metadata_catalog """ # register dataset_catalog dataset_dict_fn = SpineClsDatasetFunction(cfg, "train") DatasetCatalog.register("spine_cls_train", dataset_dict_fn) dataset_dict_fn = SpineClsDatasetFunction(cfg, "test") DatasetCatalog.register("spine_cls_test", dataset_dict_fn) # register metadata_catalog classes = cfg.MODEL.CLASSIFIER.CLASSES MetadataCatalog.get("spine_cls_train").thing_classes = classes MetadataCatalog.get("spine_cls_test").thing_classes = classes print( MetadataCatalog.get("spine_cls_train"), "\n", MetadataCatalog.get("spine_cls_test") ) class SpineClsDatasetFunction: def __init__(self, cfg, mode="train"): assert mode in ["train", "test"] self.mode = mode self.cfg = cfg def __call__(self): """ return list[dict] """ cfg = self.cfg disease_classes = cfg.MODEL.CLASSIFIER.CLASSES data_folder = cfg.SPINE.TRAIN_DATA_FOLDER if self.mode == "train" else cfg.SPINE.TEST_DATA_FOLDER metadata = cfg.SPINE.TRAIN_METADATA if self.mode == "train" else cfg.SPINE.TEST_METADATA metadata = pd.read_csv(metadata) metadata = metadata[["image_id", "image_height", "image_width"]] metadata = metadata.set_index("image_id") metadata = metadata.to_dict(orient="index") annotations = cfg.SPINE.TRAIN_ANNOTATION if self.mode == "train" else cfg.SPINE.TEST_ANNOTATION annotations = pd.read_csv(annotations) abnormal_only = "Abnormal" in disease_classes if abnormal_only: assert len(disease_classes) == 1 dataset_dict = [] for image_id, rows in annotations.groupby("image_id"): instance_dict = {} instance_dict["file_name"] = os.path.join(data_folder, f"{image_id}.png") instance_dict["image_id"] = image_id instance_dict["height"] = metadata[image_id]["image_height"] instance_dict["width"] = metadata[image_id]["image_width"] classes = rows["lesion_type"].unique().tolist() if abnormal_only: label = 0. if "No finding" in classes else 1. labels = np.array([label]) else: labels = np.array([0.0]*len(disease_classes)) for label in classes: if (label not in disease_classes) and "Other disease" in disease_classes: label = "Other disease" labels[disease_classes.index(label)] = 1. instance_dict["classes"] = labels dataset_dict.append(instance_dict) return dataset_dict
0.479747
0.324423
import numpy as np import glob from scipy.interpolate import interp1d import multiprocessing as mp from bisect import bisect def GetWaveNumbers(StartWavelength=300, EndWavelength=30000, Resolution=100000): ''' Returns the wavelengths corresponding to the resolution and in units of cm. ''' WaveLengthValues = [] #Converting values to StartWavelength = StartWavelength*1.0e-7 #nm to cm EndWavelength = EndWavelength*1.0e-7 #nm to cm WaveLengthValues = [StartWavelength] while WaveLengthValues[-1]<EndWavelength: WaveLengthValues.append(WaveLengthValues[-1]+WaveLengthValues[-1]/Resolution) WaveLengthValues = np.array(WaveLengthValues) WaveNumberRange = 1./WaveLengthValues WaveNumberRange = np.array(sorted(WaveNumberRange)) return WaveLengthValues, WaveNumberRange def BinModel(nu_HR,abs_HR,nu_Grid): ''' This function takes a cross-section at high resolution: nu_HR is the wavenumber in increasing order abs_HR is the absorption cross-section in an increasing order The stepsize in the WaveNumberGrid is not expected to be the equal ''' InterpValues = np.zeros(len(nu_Grid)) Start = 0 i = 0 while i<len(nu_Grid): StartIndex = bisect(nu_HR, Start) StopIndex = bisect(nu_HR, nu_Grid[i]) InterpValues[i] = np.mean(abs_HR[StartIndex:StopIndex]) Start=nu_Grid[i] i+=1 NanIndex = np.isnan(InterpValues) InterpValues[NanIndex] = 0.0 return InterpValues def SymplecticInterpolation(nu_HR,abs_HR,nu_Grid): ''' This function takes a cross-section at high resolution: nu_HR is the wavenumber in increasing order abs_HR is the absorption cross-section in an increasing order The stepsize in the WaveNumberGrid is not expected to be the equal ''' #Assert the Wavenumber is strictly increasing assert nu_HR[-1]>nu_HR[0], "The high resolution nu should also be strictly increasing." assert nu_Grid[-1]>nu_Grid[0], "The low resolution wavenumber should also be strictly increasing." InterpolatedValues = np.zeros(len(nu_Grid)) for i in range(len(nu_Grid)): if i+1<len(nu_Grid): StepSize= nu_Grid[i+1] - nu_Grid[i] SelectIndex = np.abs(nu_HR-nu_Grid[i])<StepSize/2.0 InterpolatedValues[i] = np.mean(abs_HR[SelectIndex]) NanIndex = np.isnan(InterpolatedValues) InterpolatedValues[NanIndex] = 0.0 return InterpolatedValues
lib/CrossSectionFunctions.py
import numpy as np import glob from scipy.interpolate import interp1d import multiprocessing as mp from bisect import bisect def GetWaveNumbers(StartWavelength=300, EndWavelength=30000, Resolution=100000): ''' Returns the wavelengths corresponding to the resolution and in units of cm. ''' WaveLengthValues = [] #Converting values to StartWavelength = StartWavelength*1.0e-7 #nm to cm EndWavelength = EndWavelength*1.0e-7 #nm to cm WaveLengthValues = [StartWavelength] while WaveLengthValues[-1]<EndWavelength: WaveLengthValues.append(WaveLengthValues[-1]+WaveLengthValues[-1]/Resolution) WaveLengthValues = np.array(WaveLengthValues) WaveNumberRange = 1./WaveLengthValues WaveNumberRange = np.array(sorted(WaveNumberRange)) return WaveLengthValues, WaveNumberRange def BinModel(nu_HR,abs_HR,nu_Grid): ''' This function takes a cross-section at high resolution: nu_HR is the wavenumber in increasing order abs_HR is the absorption cross-section in an increasing order The stepsize in the WaveNumberGrid is not expected to be the equal ''' InterpValues = np.zeros(len(nu_Grid)) Start = 0 i = 0 while i<len(nu_Grid): StartIndex = bisect(nu_HR, Start) StopIndex = bisect(nu_HR, nu_Grid[i]) InterpValues[i] = np.mean(abs_HR[StartIndex:StopIndex]) Start=nu_Grid[i] i+=1 NanIndex = np.isnan(InterpValues) InterpValues[NanIndex] = 0.0 return InterpValues def SymplecticInterpolation(nu_HR,abs_HR,nu_Grid): ''' This function takes a cross-section at high resolution: nu_HR is the wavenumber in increasing order abs_HR is the absorption cross-section in an increasing order The stepsize in the WaveNumberGrid is not expected to be the equal ''' #Assert the Wavenumber is strictly increasing assert nu_HR[-1]>nu_HR[0], "The high resolution nu should also be strictly increasing." assert nu_Grid[-1]>nu_Grid[0], "The low resolution wavenumber should also be strictly increasing." InterpolatedValues = np.zeros(len(nu_Grid)) for i in range(len(nu_Grid)): if i+1<len(nu_Grid): StepSize= nu_Grid[i+1] - nu_Grid[i] SelectIndex = np.abs(nu_HR-nu_Grid[i])<StepSize/2.0 InterpolatedValues[i] = np.mean(abs_HR[SelectIndex]) NanIndex = np.isnan(InterpolatedValues) InterpolatedValues[NanIndex] = 0.0 return InterpolatedValues
0.493897
0.494141
from os import path signature = db.Table(db,'auth_signature', Field('created_on','datetime',default=request.now, writable=False,readable=False, label=T('Created on')), Field('created_by','reference %s' % auth.settings.table_user_name,default=auth.user_id, writable=False,readable=False, label=T('Created by')), Field('modified_on','datetime',update=request.now,default=request.now, writable=False,readable=False, label=T('Modified on')), Field('modified_by','reference %s' % auth.settings.table_user_name, default=auth.user_id,update=auth.user_id, writable=False,readable=False, label=T('Modified by')) ) db._common_fields.append(signature) #db._common_fields is a list of fields that should belong to all the tables db.define_table('contact', Field('name', label=T('Contact name')), Field('trade_register_number', label=T('Trade register number')), Field('description', 'text', label=T('Description')), Field('address', 'text', label=T('Address')), Field('google_maps_plan_url', 'text', label=T('Google maps plan url')), Field('telephone', label=T('Telephone')), Field('fax', label=T('Fax')), Field('mobile', label=T('Mobile')), Field('website', label=T('Website')), Field('email', label=T('Email')), Field('contact_form_email', label=T('Contact form email')), Field('contact_form_cc', label=T('Contact form cc')), Field('contact_form_bcc', label=T('Contact form cci')), Field('show_in_address_component', 'boolean', default=True, label=T('Show in address component')), Field('show_in_contact_form', 'boolean', default=True, label=T('Show in contact form')) ) db.contact.website.requires = IS_EMPTY_OR(IS_URL()) db.contact.email.requires = IS_EMPTY_OR(IS_EMAIL()) db.contact.contact_form_email.requires = IS_EMPTY_OR(IS_EMAIL()) db.contact.contact_form_cc.requires = IS_EMPTY_OR(IS_EMAIL()) db.contact.contact_form_bcc.requires = IS_EMPTY_OR(IS_EMAIL()) db.define_table('website_parameters', Field('last_fixture_date', 'date', label=T('Last fixture date'), comment=T('When last_fixture_date < current date, we apply the fixtures (see models/x_fixtures.py)')), Field('website_name_long', label=T('Website name long'), comment=T('Shown in the banner footer')), Field('website_name', label=T('Website name'), comment=T('Shown in top left logo')), Field('website_title', label=T('Website title'), comment=T('Displayed instead of the banner if "with_banner"=False')), Field('website_subtitle', label=T('Website subtitle'), comment=T('Shown in the banner footer')), Field('website_url', label=T('Url'), comment=T('URL of the website')), Field('force_language', label=T('Force a language (en, it, es, fr, ...)')), Field('booking_form_email', label=T('Booking form email'), comment=T('Messages of the booking form will be sent to this email')), Field('booking_form_cc', label=T('Booking form cc'), comment=T('Messages of the booking form will be cc to this email')), Field('booking_form_bcc', label=T('Booking form cci'), comment=T('Messages of the booking form will be cci to this email')), Field('max_old_news_to_show', 'integer',label=T('Max number of old news'), comment=T('How many old news (date < current date) shall we show?')), Field('max_gallery_images_to_show', 'integer',label=T('Max number of images in gallery'), comment=T('How many maximum images shall we show in photo gallery?')), Field('mailserver_url', label=T('Mail server url'), comment=T('URL of the mailserver (used to send email in forms)')), Field('mailserver_port', 'integer', label=T('Mail server port'), comment=T('Port of the mailserver (used to send email in forms)')), Field('mailserver_sender_mail', label=T('Mail server sender email'), comment=T('Sender email adress of the mailserver (used to send email in forms)')), Field('mailserver_sender_login', label=T('Mail server sender login'), comment=T('Login of the mailserver (used to send email in forms)')), Field('mailserver_sender_pass', label=T('Mail server sender pass'), comment=T('Pass of the mailserver (used to send email in forms)')), Field('google_analytics_id', label=T('Google analytics id'), comment=T('Your Google Analytics account ID')), Field('navbar_inverse', 'boolean', default=True, label=T('Inverse navbar color')), Field('with_banner', 'boolean', default=True, label=T('Show a banner'), comment=T('If False, we display website_title instead')), Field('with_specific_banner', 'boolean', label=T('Use the specific banner'), comment=T('Include the content of "views/specificbanner.html"')), Field('add_website_name_as_logo', 'boolean', label=T('Add the website name as a logo'), comment=T('Will be displayed at the top left corner')), Field('custom_bootstrap_css_file', label=T('Name of the custom bootstrap CSS file')), Field('banner_image_always', label=T('Banner image always shown'), comment=T('URI of the image which will be always shown in the banner')), Field('banner_image_desktop', label=T('Banner image shown on desktop mode'), comment=T('URI of the image which will be shown in the banner on desktop mode onlw')), Field('banner_image_tablet', label=T('Banner image shown on tablet mode'), comment=T('URI of the image which will be shown in the banner on tablet mode only')), Field('banner_image_phone', label=T('Banner image shown on phone mode'), comment=T('URI of the image which will be shown in the banner on phone mode only')), Field('banner_image_background_gradient_from', label=T('Banner image background gradient from'), comment=T('Start color to display a gradient behind banner image')), Field('banner_image_background_gradient_to', label=T('Banner image background gradient to'), comment=T('End color to display a gradient behind banner image')), Field('seo_website_title', label=T('SEO : Website title'), comment=T('Displayed in <title> tag of the HTML source code')), Field('seo_meta_author', label=T('SEO : Meta "author"'), comment=T('Displayed in <meta author> tag of the HTML source code')), Field('seo_meta_description', label=T('SEO : Meta "description"'), comment=T('Displayed in <meta description> tag of the HTML source code')), Field('seo_meta_keywords', label=T('SEO : Meta "keywords"'), comment=T('Displayed in <meta keywords> tag of the HTML source code')), Field('seo_meta_generator', label=T('SEO : Meta "generator"'), comment=T('Displayed in <meta generator> tag of the HTML source code')), Field('show_booking_menu', 'boolean', default=True, label=T('Show booking menu'), comment=T('Show the booking menu (to manage booking requests)')), Field('show_event_menu', 'boolean', default=True, label=T('Show event menu'), comment=T('Show the event menu (to manage events on a calendar)')), Field('disqus_shortname', default=True, label=T('Disqus shortname'), comment=T('Add here your disqus shortname to activate comments on your pages. Note : you need to fill "website_url" too!')) ) db.website_parameters.website_url.requires = IS_EMPTY_OR(IS_URL()) db.website_parameters.mailserver_sender_mail.requires = IS_EMPTY_OR(IS_EMAIL()) db.website_parameters.booking_form_email.requires = IS_EMPTY_OR(IS_EMAIL()) db.website_parameters.booking_form_cc.requires = IS_EMPTY_OR(IS_EMAIL()) db.website_parameters.booking_form_bcc.requires = IS_EMPTY_OR(IS_EMAIL()) db.define_table('page_component', Field('controller', readable=False, writable=False, default='default', label=T('Component controller')), Field('name', unique=False, readable=False, writable=False, label=T('Component name')), Field('description', readable=False, writable=False, label=T('Component description')), Field('ajax', 'boolean', readable=False, writable=False, default=False, label=T('Component with Ajax')), Field('ajax_trap', 'boolean', readable=False, writable=False, default=False, label=T('Component with Ajax trap')), Field('container_class', readable=False, writable=False, label=T('Class of the container'), comment=T('For example "hidden-phone"')), Field('parent', 'reference page_component', label=T('Parent')), Field('rank', 'integer', readable=True, writable=True, default=0, label=T('Rank')), ) db.page_component.parent.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(description)s', zero=T('<Empty>'))) db.define_table('page', Field('parent', 'reference page', label=T('Parent')), Field('title', unique=True, notnull=True, label=T('Title')), Field('rank', 'integer', readable=True, writable=True, default=0, label=T('Rank')), Field('subtitle', label=T('Subtitle')), Field('url', unique=True, readable=True, writable=True, label=T('Url')), Field('content', 'text', label=T('Content')), Field('is_index', 'boolean', readable=True, writable=True, default=False, label=T('Is index')), Field('is_enabled', 'boolean', readable=True, writable=True, default=True, label=T('Is enabled')), Field('left_sidebar_enabled', 'boolean', default=False, label=T('Left sidebar')), Field('right_sidebar_enabled', 'boolean', default=False, label=T('Right sidebar')), Field('header_component', 'reference page_component', label=T('Header component')), Field('left_sidebar_component', 'reference page_component', label=T('Left sidebar component')), Field('right_sidebar_component', 'reference page_component', label=T('Right sidebar component')), Field('left_footer_component', 'reference page_component', label=T('Left footer component')), Field('middle_footer_component', 'reference page_component', label=T('Middle footer component')), Field('right_footer_component', 'reference page_component', label=T('Right footer component')), Field('central_component', 'reference page_component', label=T('Central component')), Field('allow_disqus', 'boolean', label=T('Allow disqus (must be configured in website_parameters)')), Field('max_content_height', 'integer', readable=True, writable=True, default=0, label=T('Max height (in pixels) of the page content (0 = no max height)')), format='%(title)s' ) db.page.parent.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page.id, '%(title)s', zero=T('<Empty>'))) db.page.header_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.left_sidebar_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.right_sidebar_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.left_footer_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.right_footer_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.middle_footer_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.central_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.url.compute = lambda row: IS_SLUG()(row.title)[0] pageSelector = HierarchicalSelect(db, db.page, db.page.title, db.page.rank) db.page.parent.widget = pageSelector.widget db.define_table('image', Field('page', 'reference page', label=T('Page')), Field('name', notnull=True, label=T('Name')), Field('alt', label=T('Alt')), Field('comment', label=T('Comment')), Field('file', 'upload', uploadfolder=path.join( request.folder,'static','images','photo_gallery' ), autodelete=True, label=T('File')), Field('thumb', 'text', readable=False, writable=False, label=T('Thumb')), Field('show_in_gallery', 'boolean', readable=True, writable=True, default=True, label=T('Show in gallery')), Field('show_in_banner', 'boolean', readable=True, writable=True, default=False, label=T('Show in banner')), format='%(name)s' ) db.image.page.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page.id, '%(title)s', zero=T('<Empty>'))) db.image.alt.compute = lambda row: row.name.capitalize() #db.image.page.widget = pageSelector.widget db.define_table('registered_user', Field('first_name', label=T('First name')), Field('last_name', label=T('Last name')), Field('email', unique=True, requires=[IS_EMAIL(), IS_NOT_IN_DB(db, 'registered_user.email')], label=T('Email')), Field('subscribe_to_newsletter', 'boolean', default=True, label=T("User want to receive newsletter emails")), format='%(email)s' ) db.define_table('news', Field('title', label=T('Title')), Field('date','date',default=request.now,label=T('Date')), Field('text','text',label=T('News content')), Field('published_on', 'datetime', default=request.now), Field('send_mail', 'boolean', readable=True, writable=True, default=False, label=T('Send an email to the registered users to inform them')), Field('mail_sent', 'boolean', readable=False, writable=False, default=False, label=T('An email has been send to the registered users')), Field('max_content_height', 'integer', readable=True, writable=True, default=0, label=T('Max height (in pixels) of the news content (0 = no max height)')), format='%(text)s' ) db.define_table('file', Field('page', 'reference page', label=T('Page')), Field('title', label=T('Title'), notnull=True), Field('comment', label=T('Comment')), Field('file', 'upload', uploadfolder=path.join( request.folder,'static','uploaded_files' ), notnull=True, autodelete=True, label=T('File')), Field('protected', 'boolean', readable=True, writable=True, default=False, label=T('Protected (visible only for authorized users)')), Field('size', 'double', readable=False, writable=False, label=T('Size')), format='%(title)s' ) db.file.page.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page.id, '%(title)s', zero=T('<Empty>'))) db.file.size.compute = lambda row: path.getsize(path.join(request.folder,'static','uploaded_files',row.file)) #db.file.page.widget = pageSelector.widget ## after defining tables, uncomment below to enable auditing auth.enable_record_versioning(db)
web2py-appliances-master/TinyWebsite/models/db__website.py
from os import path signature = db.Table(db,'auth_signature', Field('created_on','datetime',default=request.now, writable=False,readable=False, label=T('Created on')), Field('created_by','reference %s' % auth.settings.table_user_name,default=auth.user_id, writable=False,readable=False, label=T('Created by')), Field('modified_on','datetime',update=request.now,default=request.now, writable=False,readable=False, label=T('Modified on')), Field('modified_by','reference %s' % auth.settings.table_user_name, default=auth.user_id,update=auth.user_id, writable=False,readable=False, label=T('Modified by')) ) db._common_fields.append(signature) #db._common_fields is a list of fields that should belong to all the tables db.define_table('contact', Field('name', label=T('Contact name')), Field('trade_register_number', label=T('Trade register number')), Field('description', 'text', label=T('Description')), Field('address', 'text', label=T('Address')), Field('google_maps_plan_url', 'text', label=T('Google maps plan url')), Field('telephone', label=T('Telephone')), Field('fax', label=T('Fax')), Field('mobile', label=T('Mobile')), Field('website', label=T('Website')), Field('email', label=T('Email')), Field('contact_form_email', label=T('Contact form email')), Field('contact_form_cc', label=T('Contact form cc')), Field('contact_form_bcc', label=T('Contact form cci')), Field('show_in_address_component', 'boolean', default=True, label=T('Show in address component')), Field('show_in_contact_form', 'boolean', default=True, label=T('Show in contact form')) ) db.contact.website.requires = IS_EMPTY_OR(IS_URL()) db.contact.email.requires = IS_EMPTY_OR(IS_EMAIL()) db.contact.contact_form_email.requires = IS_EMPTY_OR(IS_EMAIL()) db.contact.contact_form_cc.requires = IS_EMPTY_OR(IS_EMAIL()) db.contact.contact_form_bcc.requires = IS_EMPTY_OR(IS_EMAIL()) db.define_table('website_parameters', Field('last_fixture_date', 'date', label=T('Last fixture date'), comment=T('When last_fixture_date < current date, we apply the fixtures (see models/x_fixtures.py)')), Field('website_name_long', label=T('Website name long'), comment=T('Shown in the banner footer')), Field('website_name', label=T('Website name'), comment=T('Shown in top left logo')), Field('website_title', label=T('Website title'), comment=T('Displayed instead of the banner if "with_banner"=False')), Field('website_subtitle', label=T('Website subtitle'), comment=T('Shown in the banner footer')), Field('website_url', label=T('Url'), comment=T('URL of the website')), Field('force_language', label=T('Force a language (en, it, es, fr, ...)')), Field('booking_form_email', label=T('Booking form email'), comment=T('Messages of the booking form will be sent to this email')), Field('booking_form_cc', label=T('Booking form cc'), comment=T('Messages of the booking form will be cc to this email')), Field('booking_form_bcc', label=T('Booking form cci'), comment=T('Messages of the booking form will be cci to this email')), Field('max_old_news_to_show', 'integer',label=T('Max number of old news'), comment=T('How many old news (date < current date) shall we show?')), Field('max_gallery_images_to_show', 'integer',label=T('Max number of images in gallery'), comment=T('How many maximum images shall we show in photo gallery?')), Field('mailserver_url', label=T('Mail server url'), comment=T('URL of the mailserver (used to send email in forms)')), Field('mailserver_port', 'integer', label=T('Mail server port'), comment=T('Port of the mailserver (used to send email in forms)')), Field('mailserver_sender_mail', label=T('Mail server sender email'), comment=T('Sender email adress of the mailserver (used to send email in forms)')), Field('mailserver_sender_login', label=T('Mail server sender login'), comment=T('Login of the mailserver (used to send email in forms)')), Field('mailserver_sender_pass', label=T('Mail server sender pass'), comment=T('Pass of the mailserver (used to send email in forms)')), Field('google_analytics_id', label=T('Google analytics id'), comment=T('Your Google Analytics account ID')), Field('navbar_inverse', 'boolean', default=True, label=T('Inverse navbar color')), Field('with_banner', 'boolean', default=True, label=T('Show a banner'), comment=T('If False, we display website_title instead')), Field('with_specific_banner', 'boolean', label=T('Use the specific banner'), comment=T('Include the content of "views/specificbanner.html"')), Field('add_website_name_as_logo', 'boolean', label=T('Add the website name as a logo'), comment=T('Will be displayed at the top left corner')), Field('custom_bootstrap_css_file', label=T('Name of the custom bootstrap CSS file')), Field('banner_image_always', label=T('Banner image always shown'), comment=T('URI of the image which will be always shown in the banner')), Field('banner_image_desktop', label=T('Banner image shown on desktop mode'), comment=T('URI of the image which will be shown in the banner on desktop mode onlw')), Field('banner_image_tablet', label=T('Banner image shown on tablet mode'), comment=T('URI of the image which will be shown in the banner on tablet mode only')), Field('banner_image_phone', label=T('Banner image shown on phone mode'), comment=T('URI of the image which will be shown in the banner on phone mode only')), Field('banner_image_background_gradient_from', label=T('Banner image background gradient from'), comment=T('Start color to display a gradient behind banner image')), Field('banner_image_background_gradient_to', label=T('Banner image background gradient to'), comment=T('End color to display a gradient behind banner image')), Field('seo_website_title', label=T('SEO : Website title'), comment=T('Displayed in <title> tag of the HTML source code')), Field('seo_meta_author', label=T('SEO : Meta "author"'), comment=T('Displayed in <meta author> tag of the HTML source code')), Field('seo_meta_description', label=T('SEO : Meta "description"'), comment=T('Displayed in <meta description> tag of the HTML source code')), Field('seo_meta_keywords', label=T('SEO : Meta "keywords"'), comment=T('Displayed in <meta keywords> tag of the HTML source code')), Field('seo_meta_generator', label=T('SEO : Meta "generator"'), comment=T('Displayed in <meta generator> tag of the HTML source code')), Field('show_booking_menu', 'boolean', default=True, label=T('Show booking menu'), comment=T('Show the booking menu (to manage booking requests)')), Field('show_event_menu', 'boolean', default=True, label=T('Show event menu'), comment=T('Show the event menu (to manage events on a calendar)')), Field('disqus_shortname', default=True, label=T('Disqus shortname'), comment=T('Add here your disqus shortname to activate comments on your pages. Note : you need to fill "website_url" too!')) ) db.website_parameters.website_url.requires = IS_EMPTY_OR(IS_URL()) db.website_parameters.mailserver_sender_mail.requires = IS_EMPTY_OR(IS_EMAIL()) db.website_parameters.booking_form_email.requires = IS_EMPTY_OR(IS_EMAIL()) db.website_parameters.booking_form_cc.requires = IS_EMPTY_OR(IS_EMAIL()) db.website_parameters.booking_form_bcc.requires = IS_EMPTY_OR(IS_EMAIL()) db.define_table('page_component', Field('controller', readable=False, writable=False, default='default', label=T('Component controller')), Field('name', unique=False, readable=False, writable=False, label=T('Component name')), Field('description', readable=False, writable=False, label=T('Component description')), Field('ajax', 'boolean', readable=False, writable=False, default=False, label=T('Component with Ajax')), Field('ajax_trap', 'boolean', readable=False, writable=False, default=False, label=T('Component with Ajax trap')), Field('container_class', readable=False, writable=False, label=T('Class of the container'), comment=T('For example "hidden-phone"')), Field('parent', 'reference page_component', label=T('Parent')), Field('rank', 'integer', readable=True, writable=True, default=0, label=T('Rank')), ) db.page_component.parent.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(description)s', zero=T('<Empty>'))) db.define_table('page', Field('parent', 'reference page', label=T('Parent')), Field('title', unique=True, notnull=True, label=T('Title')), Field('rank', 'integer', readable=True, writable=True, default=0, label=T('Rank')), Field('subtitle', label=T('Subtitle')), Field('url', unique=True, readable=True, writable=True, label=T('Url')), Field('content', 'text', label=T('Content')), Field('is_index', 'boolean', readable=True, writable=True, default=False, label=T('Is index')), Field('is_enabled', 'boolean', readable=True, writable=True, default=True, label=T('Is enabled')), Field('left_sidebar_enabled', 'boolean', default=False, label=T('Left sidebar')), Field('right_sidebar_enabled', 'boolean', default=False, label=T('Right sidebar')), Field('header_component', 'reference page_component', label=T('Header component')), Field('left_sidebar_component', 'reference page_component', label=T('Left sidebar component')), Field('right_sidebar_component', 'reference page_component', label=T('Right sidebar component')), Field('left_footer_component', 'reference page_component', label=T('Left footer component')), Field('middle_footer_component', 'reference page_component', label=T('Middle footer component')), Field('right_footer_component', 'reference page_component', label=T('Right footer component')), Field('central_component', 'reference page_component', label=T('Central component')), Field('allow_disqus', 'boolean', label=T('Allow disqus (must be configured in website_parameters)')), Field('max_content_height', 'integer', readable=True, writable=True, default=0, label=T('Max height (in pixels) of the page content (0 = no max height)')), format='%(title)s' ) db.page.parent.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page.id, '%(title)s', zero=T('<Empty>'))) db.page.header_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.left_sidebar_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.right_sidebar_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.left_footer_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.right_footer_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.middle_footer_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.central_component.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page_component.id, '%(name)s - %(description)s', zero=T('<Empty>'))) db.page.url.compute = lambda row: IS_SLUG()(row.title)[0] pageSelector = HierarchicalSelect(db, db.page, db.page.title, db.page.rank) db.page.parent.widget = pageSelector.widget db.define_table('image', Field('page', 'reference page', label=T('Page')), Field('name', notnull=True, label=T('Name')), Field('alt', label=T('Alt')), Field('comment', label=T('Comment')), Field('file', 'upload', uploadfolder=path.join( request.folder,'static','images','photo_gallery' ), autodelete=True, label=T('File')), Field('thumb', 'text', readable=False, writable=False, label=T('Thumb')), Field('show_in_gallery', 'boolean', readable=True, writable=True, default=True, label=T('Show in gallery')), Field('show_in_banner', 'boolean', readable=True, writable=True, default=False, label=T('Show in banner')), format='%(name)s' ) db.image.page.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page.id, '%(title)s', zero=T('<Empty>'))) db.image.alt.compute = lambda row: row.name.capitalize() #db.image.page.widget = pageSelector.widget db.define_table('registered_user', Field('first_name', label=T('First name')), Field('last_name', label=T('Last name')), Field('email', unique=True, requires=[IS_EMAIL(), IS_NOT_IN_DB(db, 'registered_user.email')], label=T('Email')), Field('subscribe_to_newsletter', 'boolean', default=True, label=T("User want to receive newsletter emails")), format='%(email)s' ) db.define_table('news', Field('title', label=T('Title')), Field('date','date',default=request.now,label=T('Date')), Field('text','text',label=T('News content')), Field('published_on', 'datetime', default=request.now), Field('send_mail', 'boolean', readable=True, writable=True, default=False, label=T('Send an email to the registered users to inform them')), Field('mail_sent', 'boolean', readable=False, writable=False, default=False, label=T('An email has been send to the registered users')), Field('max_content_height', 'integer', readable=True, writable=True, default=0, label=T('Max height (in pixels) of the news content (0 = no max height)')), format='%(text)s' ) db.define_table('file', Field('page', 'reference page', label=T('Page')), Field('title', label=T('Title'), notnull=True), Field('comment', label=T('Comment')), Field('file', 'upload', uploadfolder=path.join( request.folder,'static','uploaded_files' ), notnull=True, autodelete=True, label=T('File')), Field('protected', 'boolean', readable=True, writable=True, default=False, label=T('Protected (visible only for authorized users)')), Field('size', 'double', readable=False, writable=False, label=T('Size')), format='%(title)s' ) db.file.page.requires = IS_EMPTY_OR(IS_IN_DB(db, db.page.id, '%(title)s', zero=T('<Empty>'))) db.file.size.compute = lambda row: path.getsize(path.join(request.folder,'static','uploaded_files',row.file)) #db.file.page.widget = pageSelector.widget ## after defining tables, uncomment below to enable auditing auth.enable_record_versioning(db)
0.417628
0.094929
import sqlite3 import dataclasses from typing import Generator, List from src.helpers import helpers # type: ignore from src.logger import config_logger #type: ignore @dataclasses.dataclass class BackupReader(config_logger.Logger): """Read data from Outlook 2016 Backup folder. Attributes: backup_location: A string of backup folder location. profile_data_location: A string of data folder location based on user. """ profile_data_location: str filter_hidden = '/.' @property def db_location(self): sqlitedb = 'Outlook.sqlite' try: return helpers.Helper.test_location( self.profile_data_location + sqlitedb, 'file') except FileNotFoundError: self.logger.warning(f'Missing {sqlitedb}, is the database missing?') raise FileNotFoundError def get_mails_from_database(self) -> Generator: self.logger.info('Getting emails from database') db_connection = self._connect_to_database(self.db_location) mails = self._get_mails(db_connection) for mail in mails: yield self._get_info_from_email(dict(mail)) def get_mails_amount(self) -> int: db_connection = self._connect_to_database(self.db_location) mails = self._get_mails(db_connection) return len(list(mails)) def _get_info_from_email(self, mail: dict) -> dict: return { 'content_path' : mail.get('PathToDataFile'), 'subject' : mail.get('Message_ThreadTopic'), 'time' : mail.get('Message_TimeReceived'), 'sender' : {'email': mail.get('Message_SenderAddressList'), 'name': mail.get('Message_SenderList')}, 'recipients' : self._merge_recipients( mail.get('Message_ToRecipientAddressList'), mail.get('Message_RecipientList')), 'cc' : mail.get('Message_CCRecipientAddressList'), 'type' : mail.get('Message_type'), 'id': mail.get('Threads_ThreadID'), } def _merge_recipients(self, emails: str, names: str) -> List: try: emails_split = emails.split(';') names_split = names.split(';') except AttributeError: return [None] recipients = [] for email, name in zip(emails_split, names_split): recipients.append({ 'email': email, 'name': name }) return recipients def _connect_to_database(self, db_location): db_connection = sqlite3.connect(db_location) db_connection.row_factory = sqlite3.Row return db_connection.cursor() def _get_mails(self, db_connection): return db_connection.execute('SELECT * FROM Mail') def _get_tables(self, db_connection): return db_connection.execute("SELECT * FROM sqlite_schema WHERE type IN ('table','view') AND name NOT LIKE 'sqlite_%' ")
src/backupreader/reader.py
import sqlite3 import dataclasses from typing import Generator, List from src.helpers import helpers # type: ignore from src.logger import config_logger #type: ignore @dataclasses.dataclass class BackupReader(config_logger.Logger): """Read data from Outlook 2016 Backup folder. Attributes: backup_location: A string of backup folder location. profile_data_location: A string of data folder location based on user. """ profile_data_location: str filter_hidden = '/.' @property def db_location(self): sqlitedb = 'Outlook.sqlite' try: return helpers.Helper.test_location( self.profile_data_location + sqlitedb, 'file') except FileNotFoundError: self.logger.warning(f'Missing {sqlitedb}, is the database missing?') raise FileNotFoundError def get_mails_from_database(self) -> Generator: self.logger.info('Getting emails from database') db_connection = self._connect_to_database(self.db_location) mails = self._get_mails(db_connection) for mail in mails: yield self._get_info_from_email(dict(mail)) def get_mails_amount(self) -> int: db_connection = self._connect_to_database(self.db_location) mails = self._get_mails(db_connection) return len(list(mails)) def _get_info_from_email(self, mail: dict) -> dict: return { 'content_path' : mail.get('PathToDataFile'), 'subject' : mail.get('Message_ThreadTopic'), 'time' : mail.get('Message_TimeReceived'), 'sender' : {'email': mail.get('Message_SenderAddressList'), 'name': mail.get('Message_SenderList')}, 'recipients' : self._merge_recipients( mail.get('Message_ToRecipientAddressList'), mail.get('Message_RecipientList')), 'cc' : mail.get('Message_CCRecipientAddressList'), 'type' : mail.get('Message_type'), 'id': mail.get('Threads_ThreadID'), } def _merge_recipients(self, emails: str, names: str) -> List: try: emails_split = emails.split(';') names_split = names.split(';') except AttributeError: return [None] recipients = [] for email, name in zip(emails_split, names_split): recipients.append({ 'email': email, 'name': name }) return recipients def _connect_to_database(self, db_location): db_connection = sqlite3.connect(db_location) db_connection.row_factory = sqlite3.Row return db_connection.cursor() def _get_mails(self, db_connection): return db_connection.execute('SELECT * FROM Mail') def _get_tables(self, db_connection): return db_connection.execute("SELECT * FROM sqlite_schema WHERE type IN ('table','view') AND name NOT LIKE 'sqlite_%' ")
0.635901
0.134208
from Bio import SeqIO import os import glob import argparse def main(): parser = argparse.ArgumentParser(description='Merges Phyluce UCEs from SPAdes and rnaSPAdes') parser.add_argument('-o', type=str, help='Output Folder', required=True) parser.add_argument('-i', type=str, help='Input folder of merged fastas', required=True) args = parser.parse_args() print("Counts merged_uces into a summary file in {} directory".format(args.o)) count_uces(args.o, args.i) def count_uces(output_directory, input_directory): # Gather each specimen file produced from the Phyluce merged_fastas = glob.glob(os.path.join(input_directory, "*_merged.fasta")) # Put all the contigs into a single dictionary specimen_dict = {} for fasta in merged_fastas: specimen = os.path.basename(fasta) specimen_name = specimen.replace("_merged.fasta", "").replace("-","_") with open(fasta) as f: count = 0 abyss_count = 0 spades_count = 0 rnaspades_count = 0 abyss_u_count = 0 for seq in SeqIO.parse(fasta, 'fasta'): if "_AU" in seq.id[-3:]: abyss_u_count += 1 elif "_A" in seq.id[-2:]: abyss_count += 1 elif "_R" in seq.id[-2:]: rnaspades_count += 1 elif "_S" in seq.id[-2:]: spades_count += 1 count += 1 if specimen_name in specimen_dict: specimen_dict[specimen_name] = [count, abyss_count, abyss_u_count, spades_count, rnaspades_count] else: specimen_dict[specimen_name] = [count, abyss_count, abyss_u_count, spades_count, rnaspades_count] output_file = os.path.join(output_directory, "merged_uce_summary.csv") with open(output_file, "w") as g: g.write("Specimen, Merged Targets, Abyss Contribution, Abyss Unmerged Contribution, SPAdes Contribution, rnaSPAdes Contribution\n") for key, value in specimen_dict.items(): g.write("{},{},{},{},{},{}\n".format(key, value[0],value[1],value[2],value[3],value[4])) if __name__ == "__main__": main()
pipeline_files/count_uces.py
from Bio import SeqIO import os import glob import argparse def main(): parser = argparse.ArgumentParser(description='Merges Phyluce UCEs from SPAdes and rnaSPAdes') parser.add_argument('-o', type=str, help='Output Folder', required=True) parser.add_argument('-i', type=str, help='Input folder of merged fastas', required=True) args = parser.parse_args() print("Counts merged_uces into a summary file in {} directory".format(args.o)) count_uces(args.o, args.i) def count_uces(output_directory, input_directory): # Gather each specimen file produced from the Phyluce merged_fastas = glob.glob(os.path.join(input_directory, "*_merged.fasta")) # Put all the contigs into a single dictionary specimen_dict = {} for fasta in merged_fastas: specimen = os.path.basename(fasta) specimen_name = specimen.replace("_merged.fasta", "").replace("-","_") with open(fasta) as f: count = 0 abyss_count = 0 spades_count = 0 rnaspades_count = 0 abyss_u_count = 0 for seq in SeqIO.parse(fasta, 'fasta'): if "_AU" in seq.id[-3:]: abyss_u_count += 1 elif "_A" in seq.id[-2:]: abyss_count += 1 elif "_R" in seq.id[-2:]: rnaspades_count += 1 elif "_S" in seq.id[-2:]: spades_count += 1 count += 1 if specimen_name in specimen_dict: specimen_dict[specimen_name] = [count, abyss_count, abyss_u_count, spades_count, rnaspades_count] else: specimen_dict[specimen_name] = [count, abyss_count, abyss_u_count, spades_count, rnaspades_count] output_file = os.path.join(output_directory, "merged_uce_summary.csv") with open(output_file, "w") as g: g.write("Specimen, Merged Targets, Abyss Contribution, Abyss Unmerged Contribution, SPAdes Contribution, rnaSPAdes Contribution\n") for key, value in specimen_dict.items(): g.write("{},{},{},{},{},{}\n".format(key, value[0],value[1],value[2],value[3],value[4])) if __name__ == "__main__": main()
0.3492
0.192767
import time import sys urunler = { "1":("su", 1), "2":("çay", 2), "3":("kahve", 3), "4":("enerji içeceği", 5), "5":("paket portakal suyu", 7), "6":("taze portakal suyu", 11), } def input(mesaj): sys.stdout.write(mesaj) sys.stdout.flush() girdiler = [] while True: girdi = sys.stdin.read(1) if girdi == "\n": break else: girdiler.append(girdi) return "".join(girdiler) def sonsuz_girdi(mesaj, beklenen): while True: girdi = input(mesaj) if girdi in beklenen: return girdi else: print("Bir hata var burada") def sayisal_sonsuz_girdi(mesaj): while True: girdi = input(mesaj) if girdi.isdigit(): return int(girdi) else: print("Bir hata var burada") def karsilama(): print("\n".join(karsilama_str())) def karsilama_str(): degerler = [] degerler.append("Hoşgeldiniz") degerler.append("Ürünler:") for anahtar, deger in urunler.items(): degerler.append(" ".join((anahtar, "|", str(deger)))) return degerler def veda(): print("Tekrar bekleriz") time.sleep(2) print("\n"*23) if __name__ == "__main__": import signal import argparse kasa = 0 def _usr1_handler(signal, context): print("Kasa para:", kasa, file=sys.stderr, flush=True) signal.signal(signal.SIGUSR1, _usr1_handler) parser = argparse.ArgumentParser(description=' ## '.join(karsilama_str()+ ["", "Hata kodu 1 = yetersiz bakiye"])) parser.add_argument("-p", '--para',type=int, help='girilen para') parser.add_argument("-u", '--urun',type=int, help='istenen urun') if len(sys.argv) >1: argumanlar = parser.parse_args() urun_girdi = argumanlar.urun urun, fiyat = urunler[str(urun_girdi)] para_girdi = argumanlar.para if fiyat > para_girdi: exit(1) else: print("Ürününüzü Alınız", urun) print("Para Üstü", para_girdi - fiyat) exit() else: while True: karsilama() para_girdi = sayisal_sonsuz_girdi("Lütfen Para giriniz: ") urun_girdi = sonsuz_girdi("Ürün Seçiniz: ", urunler) urun, fiyat = urunler[urun_girdi] if fiyat > para_girdi: print("Paranız yetesiz geldiğinden iade edilmiştir", para_girdi) else: kasa += fiyat print("Ürününüzü Alınız", urun) print("Para Üstü", para_girdi - fiyat) veda()
basit_otomat_v1.py
import time import sys urunler = { "1":("su", 1), "2":("çay", 2), "3":("kahve", 3), "4":("enerji içeceği", 5), "5":("paket portakal suyu", 7), "6":("taze portakal suyu", 11), } def input(mesaj): sys.stdout.write(mesaj) sys.stdout.flush() girdiler = [] while True: girdi = sys.stdin.read(1) if girdi == "\n": break else: girdiler.append(girdi) return "".join(girdiler) def sonsuz_girdi(mesaj, beklenen): while True: girdi = input(mesaj) if girdi in beklenen: return girdi else: print("Bir hata var burada") def sayisal_sonsuz_girdi(mesaj): while True: girdi = input(mesaj) if girdi.isdigit(): return int(girdi) else: print("Bir hata var burada") def karsilama(): print("\n".join(karsilama_str())) def karsilama_str(): degerler = [] degerler.append("Hoşgeldiniz") degerler.append("Ürünler:") for anahtar, deger in urunler.items(): degerler.append(" ".join((anahtar, "|", str(deger)))) return degerler def veda(): print("Tekrar bekleriz") time.sleep(2) print("\n"*23) if __name__ == "__main__": import signal import argparse kasa = 0 def _usr1_handler(signal, context): print("Kasa para:", kasa, file=sys.stderr, flush=True) signal.signal(signal.SIGUSR1, _usr1_handler) parser = argparse.ArgumentParser(description=' ## '.join(karsilama_str()+ ["", "Hata kodu 1 = yetersiz bakiye"])) parser.add_argument("-p", '--para',type=int, help='girilen para') parser.add_argument("-u", '--urun',type=int, help='istenen urun') if len(sys.argv) >1: argumanlar = parser.parse_args() urun_girdi = argumanlar.urun urun, fiyat = urunler[str(urun_girdi)] para_girdi = argumanlar.para if fiyat > para_girdi: exit(1) else: print("Ürününüzü Alınız", urun) print("Para Üstü", para_girdi - fiyat) exit() else: while True: karsilama() para_girdi = sayisal_sonsuz_girdi("Lütfen Para giriniz: ") urun_girdi = sonsuz_girdi("Ürün Seçiniz: ", urunler) urun, fiyat = urunler[urun_girdi] if fiyat > para_girdi: print("Paranız yetesiz geldiğinden iade edilmiştir", para_girdi) else: kasa += fiyat print("Ürününüzü Alınız", urun) print("Para Üstü", para_girdi - fiyat) veda()
0.056379
0.188641
import matplotlib.pyplot as plt from matplotlib import style from sklearn.decomposition import PCA import multiprocessing from MulticoreTSNE import MulticoreTSNE import numpy as np import pandas as pd import seaborn as sns from collections import defaultdict from scipy.cluster import hierarchy from mpl_toolkits.axes_grid1 import make_axes_locatable import os from .palettes import pallete_50 class Visualize(): '''class for embedding visualization''' def __init__(self): self.X = None self.position_flag = False def fit_tsne(self, perplexity=30, learning_rate=1000, early_exaggeration=12, metric='correlation', n_comp=False, multicore=True, fdr=None, sample_variance=None): """ Embedding of single cell data with t-distributed stochastic neighborhood embedding (tSNE) for 2D visualization. By default, we use Multicore-tsne implementation by <NAME> https://github.com/DmitryUlyanov/Multicore-TSNE>, if number of processors is great than 1. Otherwise, scikit-learn implementation is used. Default parametes by scikit-learn are used. Parameters ---------- perplexity : float, optional (default: 30) The perplexity is related to the number of nearest neighbors that is used in other manifold learning algorithms. Larger datasets usually require a larger perplexity. Consider selecting a value between 5 and 50. The choice is not extremely critical since t-SNE is quite insensitive to this parameter. early_exaggeration : 'float', optional (default: 12.0) Controls how tight natural clusters in the original space are in the embedded space and how much space will be between them. For larger values, the space between natural clusters will be larger in the embedded space. Again, the choice of this parameter is not very critical. If the cost function increases during initial optimization, the early exaggeration factor or the learning rate might be too high. learning_rate : 'float', optional (default: 1000) Note that the R-package "Rtsne" uses a default of 200. The learning rate can be a critical parameter. It should be between 100 and 1000. If the cost function increases during initial optimization, the early exaggeration factor or the learning rate might be too high. If the cost function gets stuck in a bad local minimum increasing the learning rate helps sometimes. Returns ------- Updated insance self, with self.embedding containing 2D t-SNE coordianates """ if self.X is None: raise ValueError('Nothing to plot, please fit the data first') else: self.selected_genes = self.select_genes(fdr, sample_variance) self.X_vis = self.X.copy( )[:, self.normal_genes.isin(self.selected_genes)] if not self._selection_flag: print( 'Criterium for selection of genes undefined, please select FDR < 1 OR sample variance > 0') print(' ') if n_comp: pca = PCA(n_components=n_comp, svd_solver='full') self.X_vis = pca.fit_transform(self.X_vis) n_jobs = multiprocessing.cpu_count() if n_jobs > 1 and multicore: tsne = MulticoreTSNE(n_jobs=n_jobs, init='random', metric=metric, perplexity=perplexity, learning_rate=learning_rate, early_exaggeration=early_exaggeration) print( 'computing t-SNE, using Multicore t-SNE for {0} jobs'.format(n_jobs)) # need to transform to float64 for MulticoreTSNE... self.embedding = tsne.fit_transform(self.X_vis.astype('float64')) else: print('computing t-SNE, using scikit-learn implementation') tsne = manifold.TSNE(n_components=2, init='pca', random_state=0, metric='correlation', perplexity=perplexity) self.embedding = tsne.fit_transform(self.X_vis) print('atribute embedding is updated with t-SNE coordinates') if n_comp: self.X_vis = self.X.copy( )[:, self.normal_genes.isin(self.selected_genes)] return def fit_pca(self, n_comp=2, fdr=None, sample_variance=None): '''2D PCA of the Data based on first 2 principal components''' if not self._selection_flag: print( 'Criterium for selection of genes undefined, please select FDR < 1 OR sample variance > 0') print(' ') if self.X is None: raise ValueError('Nothing to plot, please fit the data first') else: self.selected_genes = self.select_genes(fdr, sample_variance) self.X_vis = self.X.copy( )[:, self.normal_genes.isin(self.selected_genes)] pca = PCA(n_components=n_comp, svd_solver='full') self.embedding = pca.fit_transform(self.X_vis) print('atribute embedding is updated with t-SNE coordinates') return def plot(self, path=False, title=False, labels=False, palette=pallete_50, gene=False, data=False, size=4.5, fontsize=13.5, legend=False, legendcol=5, points=5, xytitle='t-SNE', tight=False ): "Ploting labels" fontsize = size*2.7 if labels is not False: if not palette: palette = sns.color_palette("husl", len(set(labels))+1) if 0 in labels or 200001 in labels: palette = palette else: palette = self.palette_hierarchy with sns.plotting_context("paper", font_scale=1.5): self.style() g = sns.lmplot(x='x', y='y', fit_reg=False, scatter_kws={'s': points, 'alpha': 1}, hue='label', data=pd.DataFrame(self.embedding, columns=['x', 'y']) .join(pd.Series(labels, name='label')), height=size, palette=sns.set_palette(palette), legend=False) g.set(yticks=[], xticks=[]) if legend is not False: if title: sep = 1.05 else: sep = 1.0 if type(legend) is list: plt.legend(legend, loc='lower center', bbox_to_anchor=(0.5, sep), ncol=legendcol, frameon=True, markerscale=size//2, fontsize=size+3) elif legend is True: plt.legend(loc='lower center', bbox_to_anchor=(0.5, sep), ncol=legendcol, frameon=True, markerscale=np.floor(size/2.), fontsize=size+3.0) plt.xlabel(xytitle + '1', fontsize=fontsize) plt.ylabel(xytitle + '2', fontsize=fontsize) plt.autoscale(enable=True, axis='both', tight=tight) elif type(gene) is list: if gene[0] == 'library': color = (self.X3.T > 0).sum() else: color = self.X3[gene].T.mean() self.style() fig = plt.figure(figsize=(size, size + 0.5), dpi=100) g = plt.scatter(self.embedding[:, 0], self.embedding[:, 1], s=points, c=color, alpha=1, cmap='coolwarm' ) plt.xlabel(xytitle + '1', fontsize=fontsize) plt.ylabel(xytitle + '2', fontsize=fontsize) plt.gca().set_xticks([]) plt.gca().set_yticks([]) plt.autoscale(enable=True, axis='both', tight=tight) divider = make_axes_locatable(plt.gca()) cax = divider.append_axes("right", "2.5%", pad="1%") if gene[0] == 'library': plt.colorbar(g, cax=cax, label='library complexity') else: plt.colorbar(g, cax=cax, label='log2(1+TPM)') elif type(gene) is tuple: n = len(gene) nrow = int(np.sqrt(n)) ncol = int(np.ceil(n / nrow)) if (n % 2 != 0 and n > 3) or nrow * ncol < n: ncol = ncol+1 if n < 4: fig, axs = plt.subplots(nrow, ncol, dpi=100, figsize=(ncol*size*1.5, nrow*size*1.5) ) else: fig, axs = plt.subplots(nrow, ncol, dpi=100, figsize=(ncol*size, nrow*size) ) if nrow*ncol > n: for i in range(ncol*nrow - n): fig.delaxes(axs[-1][-(i+1)]) if type(axs) != np.ndarray: axs = [axs] else: axs = axs.ravel() for i in range(n): if i < n: if type(gene[i]) is list: marker = gene[i] else: marker = [gene[i]] if marker[0] == 'library': color = (self.X3.T > 0).sum() else: color = self.X3[marker].T.mean() self.style() g = axs[i].scatter(self.embedding[:, 0], self.embedding[:, 1], s=points, c=color, alpha=1, cmap='coolwarm' ) axs[i].set_xticks([]) axs[i].set_yticks([]) axs[i].autoscale(enable=True, axis='both', tight=tight) divider = make_axes_locatable(axs[i]) cax = divider.append_axes("right", "2.5%", pad="1%") if marker[0] == 'library': fig.colorbar(g, cax=cax, label='library complexity') else: fig.colorbar(g, cax=cax) if title: axs[i].set_title(title) else: if len(marker) < 2: axs[i].set_title( str(marker[0]), fontsize=fontsize-2) elif len(marker) > 1: axs[i].set_title( 'list starting with ' + str(marker[0]), fontsize=fontsize-2) if i % ncol == 0: axs[i].set_ylabel(xytitle+'2', fontsize=fontsize) if ((i // ncol) + 1) == nrow: axs[i].set_xlabel(xytitle+'1', fontsize=fontsize) else: with sns.plotting_context("paper", font_scale=1.5): self.style() g = sns.lmplot(x='x', y='y', fit_reg=False, scatter_kws={'s': points, 'alpha': .9, 'color': 'black'}, hue=None, data=pd.DataFrame(self.embedding, columns=['x', 'y']), height=size, aspect=1, legend=False, ) g.set(yticks=[], xticks=[]) plt.xlabel(xytitle + '1', fontsize=fontsize) plt.ylabel(xytitle + '2', fontsize=fontsize) plt.autoscale(enable=True, axis='both', tight=tight) sns.despine(top=False, right=False, left=False, bottom=False) if title: plt.title(title) if path: plt.savefig(path, bbox_inches='tight') plt.show() def _get_cluster_classes(self, den, label='ivl'): cluster_idxs = defaultdict(list) for c, pi in zip(den['color_list'], den['icoord']): for leg in pi[1:3]: i = (leg - 5.0) / 10.0 if abs(i - int(i)) < 1e-5: cluster_idxs[c].append(int(i)) cluster_classes = {} for c, l in cluster_idxs.items(): i_l = [den[label][i] for i in l] cluster_classes[c] = i_l return cluster_classes def visual_hierarchy(self, thrs=None, path=False, palette=pallete_50, cell_label=False, value_range=5): # thrs is te threshold in dendrogram # cell_label if one wants to add extra info in columns colors self.style_mp_stat() pop = pd.DataFrame(self.X_vis, index=self.normal_cells, columns=self.selected_genes) pop = pop.T palette_clust = palette Y = self.h2 X = self.h1 if thrs is None: thrs = 0.5*max(Y[:, 2]) else: thrs = thrs hierarchy.set_link_color_palette(palette_clust) denC = hierarchy.dendrogram( Y, labels=pop.columns, color_threshold=thrs, no_plot=True) clustersC = self._get_cluster_classes(denC) clusterC = [] for i in pop.columns: included = False for j in clustersC.keys(): if i in clustersC[j]: clusterC.append(j) included = True if not included: clusterC.append(None) if cell_label: gC = sns.clustermap(pop, linewidths=0, xticklabels=False, yticklabels=False, cbar_kws={"orientation": "vertical"}, center=0, figsize=(8, 6), vmin=-value_range, vmax=value_range, col_colors=[clusterC, cell_label], col_linkage=Y, row_linkage=X, cmap='coolwarm') gC.cax.set_visible(True) else: gC = sns.clustermap(pop, linewidths=0, xticklabels=False, yticklabels=False, vmin=-value_range, vmax=value_range, cbar_kws={"orientation": "vertical"}, center=0, figsize=(7, 7), col_colors=clusterC, col_linkage=Y, row_linkage=X, cmap='coolwarm') if path: plt.savefig(path, bbox_inches='tight') tabC = pd.DataFrame() for i in set(denC['color_list']): color_cluster = pd.Series(clusterC).apply( lambda x: x == str(i)).astype(int).values.tolist() tabC[i] = color_cluster if len(tabC.index) == len(pop.columns): tabC.index = pop.columns tabC = tabC[list(set(tabC.columns.tolist()) & set(palette_clust))] plt.show() for i in range(0, tabC.shape[1]): tabC.T.iloc[i] = tabC.T.iloc[i]*(i+1) excase = tabC.loc[tabC.T.sum() < 1].index.tolist() if len(excase) > 0: for i in excase: self.embedding = np.delete( self.embedding, pd.Index(excase).get_loc(i), axis=0) tabC = tabC.copy() tabC.drop(excase, axis=0, inplace=True) self.labels_hierarchy = tabC.T.sum().tolist() self.palette_hierarchy = tabC.columns.tolist() else: print('threshold too small') def get_cluster_info(self, labels=False, cluster=False, genes=10, plot_genes=True): self.style() cl = pd.DataFrame({'cluster': labels}, index=self.normal_cells) if cluster is 'all': return cl elif type(cluster) is int: cl_n = cl.loc[cl['cluster'] == cluster].index.tolist() cl[cl['cluster'] != cluster] = 200000 cl[cl['cluster'] == cluster] = 200001 print('The cluster', cluster, 'has', len(cl_n), 'cells') self.plot(labels=cl['cluster'].tolist(), palette=['#d8dcd6', '#49759c']) print('The top', genes, 'highly expressed signal-like genes in this cluster are:') top = self.X3.loc[self.normal_cells, self.normal_genes].loc[cl_n, :].mean()\ .sort_values(ascending=False)[:genes].index.tolist() for i in top: print(i) if plot_genes: self.plot(gene=tuple(top)) else: print('Select right cluster option') def get_gene_info(self, labels=False, gene=False, path=False, legend=False, size=6.5): self.style() if 0 in labels or 200001 in labels: palette = pallete_50 else: palette = self.palette_hierarchy cl = pd.DataFrame({'cluster': labels}, index=self.normal_cells) cl2 = [self.X3[gene].T.mean()[cl.loc[cl['cluster'] == i].index] for i in pd.unique(labels)] if type(legend) is list: order = legend index_lab = legend else: order = sorted(pd.unique(labels)) index_lab = pd.unique(labels) cl2 = pd.DataFrame(cl2, index=index_lab) fig = plt.figure(figsize=[size, 5]) sns.violinplot(data=cl2.T, orient='v', inner=None, order=order, palette=palette,linewidth=0.5) sns.stripplot(data=cl2.T, color="black", size=1.5, order=order) if legend: plt.xticks(rotation=45) plt.xlabel('Cluster') plt.ylabel('log2(1+TPM)') if path: plt.savefig(os.path.splitext(path)[ 0]+'_violin'+os.path.splitext(path)[1], bbox_inches='tight') # ------Fig2 ------------ cl['gene'] = self.X3[gene].T.mean() palette2 = [] pal_list = cl.copy() for i in sorted(pd.unique(cl['cluster'])): if cl[cl['cluster'] == i]['gene'].var() < 0.0000000001: cl.drop(cl[cl['cluster'] == i].index, axis=0, inplace=True) else: palette2.append( palette[sorted(pd.unique(pal_list['cluster'])).index(i)]) if len(palette2) > 0: palette = palette2 sns.set(style="white", rc={"axes.facecolor": (0, 0, 0, 0)}) g = sns.FacetGrid(cl, row="cluster", hue="cluster", aspect=8.5, height=.7, palette=palette) g.map(sns.kdeplot, "gene", clip_on=False, shade=True, alpha=1, lw=1.5, bw=.13) g.map(plt.axhline, y=0, lw=2, clip_on=False) down, up = plt.ylim() for i in g.row_names: if type(legend) is list: mi = legend[g.row_names.index(i)] g.axes[g.row_names.index(i),0].set_ylabel(mi,y=down*1.2, labelpad=20, color=palette[g.row_names.index(i)], fontsize='medium',rotation=0) else: mi = i g.axes[g.row_names.index(i),0].set_ylabel('cluster '+str(mi),y=down*1.2, labelpad=20, color=palette[g.row_names.index(i)], fontsize='medium',rotation=0) if len(palette) < 11 and len(palette) > 5: g.fig.subplots_adjust(hspace=-0.7, top=0.70, bottom=0.05) elif len(palette) < 6: g.fig.subplots_adjust(hspace=-0.6, top=0.85, bottom=0.05) else: g.fig.subplots_adjust(hspace=-0.7, top=0.50, bottom=0.05) g.set_titles("") g.set(yticks=[]) g.despine(bottom=True, left=True) plt.xlabel('log2(1+TPM)') if path: plt.savefig(os.path.splitext(path)[0]+'_ridge'+os.path.splitext(path)[1], bbox_inches='tight') self.style() plt.show()
randomly/visualization.py
import matplotlib.pyplot as plt from matplotlib import style from sklearn.decomposition import PCA import multiprocessing from MulticoreTSNE import MulticoreTSNE import numpy as np import pandas as pd import seaborn as sns from collections import defaultdict from scipy.cluster import hierarchy from mpl_toolkits.axes_grid1 import make_axes_locatable import os from .palettes import pallete_50 class Visualize(): '''class for embedding visualization''' def __init__(self): self.X = None self.position_flag = False def fit_tsne(self, perplexity=30, learning_rate=1000, early_exaggeration=12, metric='correlation', n_comp=False, multicore=True, fdr=None, sample_variance=None): """ Embedding of single cell data with t-distributed stochastic neighborhood embedding (tSNE) for 2D visualization. By default, we use Multicore-tsne implementation by <NAME> https://github.com/DmitryUlyanov/Multicore-TSNE>, if number of processors is great than 1. Otherwise, scikit-learn implementation is used. Default parametes by scikit-learn are used. Parameters ---------- perplexity : float, optional (default: 30) The perplexity is related to the number of nearest neighbors that is used in other manifold learning algorithms. Larger datasets usually require a larger perplexity. Consider selecting a value between 5 and 50. The choice is not extremely critical since t-SNE is quite insensitive to this parameter. early_exaggeration : 'float', optional (default: 12.0) Controls how tight natural clusters in the original space are in the embedded space and how much space will be between them. For larger values, the space between natural clusters will be larger in the embedded space. Again, the choice of this parameter is not very critical. If the cost function increases during initial optimization, the early exaggeration factor or the learning rate might be too high. learning_rate : 'float', optional (default: 1000) Note that the R-package "Rtsne" uses a default of 200. The learning rate can be a critical parameter. It should be between 100 and 1000. If the cost function increases during initial optimization, the early exaggeration factor or the learning rate might be too high. If the cost function gets stuck in a bad local minimum increasing the learning rate helps sometimes. Returns ------- Updated insance self, with self.embedding containing 2D t-SNE coordianates """ if self.X is None: raise ValueError('Nothing to plot, please fit the data first') else: self.selected_genes = self.select_genes(fdr, sample_variance) self.X_vis = self.X.copy( )[:, self.normal_genes.isin(self.selected_genes)] if not self._selection_flag: print( 'Criterium for selection of genes undefined, please select FDR < 1 OR sample variance > 0') print(' ') if n_comp: pca = PCA(n_components=n_comp, svd_solver='full') self.X_vis = pca.fit_transform(self.X_vis) n_jobs = multiprocessing.cpu_count() if n_jobs > 1 and multicore: tsne = MulticoreTSNE(n_jobs=n_jobs, init='random', metric=metric, perplexity=perplexity, learning_rate=learning_rate, early_exaggeration=early_exaggeration) print( 'computing t-SNE, using Multicore t-SNE for {0} jobs'.format(n_jobs)) # need to transform to float64 for MulticoreTSNE... self.embedding = tsne.fit_transform(self.X_vis.astype('float64')) else: print('computing t-SNE, using scikit-learn implementation') tsne = manifold.TSNE(n_components=2, init='pca', random_state=0, metric='correlation', perplexity=perplexity) self.embedding = tsne.fit_transform(self.X_vis) print('atribute embedding is updated with t-SNE coordinates') if n_comp: self.X_vis = self.X.copy( )[:, self.normal_genes.isin(self.selected_genes)] return def fit_pca(self, n_comp=2, fdr=None, sample_variance=None): '''2D PCA of the Data based on first 2 principal components''' if not self._selection_flag: print( 'Criterium for selection of genes undefined, please select FDR < 1 OR sample variance > 0') print(' ') if self.X is None: raise ValueError('Nothing to plot, please fit the data first') else: self.selected_genes = self.select_genes(fdr, sample_variance) self.X_vis = self.X.copy( )[:, self.normal_genes.isin(self.selected_genes)] pca = PCA(n_components=n_comp, svd_solver='full') self.embedding = pca.fit_transform(self.X_vis) print('atribute embedding is updated with t-SNE coordinates') return def plot(self, path=False, title=False, labels=False, palette=pallete_50, gene=False, data=False, size=4.5, fontsize=13.5, legend=False, legendcol=5, points=5, xytitle='t-SNE', tight=False ): "Ploting labels" fontsize = size*2.7 if labels is not False: if not palette: palette = sns.color_palette("husl", len(set(labels))+1) if 0 in labels or 200001 in labels: palette = palette else: palette = self.palette_hierarchy with sns.plotting_context("paper", font_scale=1.5): self.style() g = sns.lmplot(x='x', y='y', fit_reg=False, scatter_kws={'s': points, 'alpha': 1}, hue='label', data=pd.DataFrame(self.embedding, columns=['x', 'y']) .join(pd.Series(labels, name='label')), height=size, palette=sns.set_palette(palette), legend=False) g.set(yticks=[], xticks=[]) if legend is not False: if title: sep = 1.05 else: sep = 1.0 if type(legend) is list: plt.legend(legend, loc='lower center', bbox_to_anchor=(0.5, sep), ncol=legendcol, frameon=True, markerscale=size//2, fontsize=size+3) elif legend is True: plt.legend(loc='lower center', bbox_to_anchor=(0.5, sep), ncol=legendcol, frameon=True, markerscale=np.floor(size/2.), fontsize=size+3.0) plt.xlabel(xytitle + '1', fontsize=fontsize) plt.ylabel(xytitle + '2', fontsize=fontsize) plt.autoscale(enable=True, axis='both', tight=tight) elif type(gene) is list: if gene[0] == 'library': color = (self.X3.T > 0).sum() else: color = self.X3[gene].T.mean() self.style() fig = plt.figure(figsize=(size, size + 0.5), dpi=100) g = plt.scatter(self.embedding[:, 0], self.embedding[:, 1], s=points, c=color, alpha=1, cmap='coolwarm' ) plt.xlabel(xytitle + '1', fontsize=fontsize) plt.ylabel(xytitle + '2', fontsize=fontsize) plt.gca().set_xticks([]) plt.gca().set_yticks([]) plt.autoscale(enable=True, axis='both', tight=tight) divider = make_axes_locatable(plt.gca()) cax = divider.append_axes("right", "2.5%", pad="1%") if gene[0] == 'library': plt.colorbar(g, cax=cax, label='library complexity') else: plt.colorbar(g, cax=cax, label='log2(1+TPM)') elif type(gene) is tuple: n = len(gene) nrow = int(np.sqrt(n)) ncol = int(np.ceil(n / nrow)) if (n % 2 != 0 and n > 3) or nrow * ncol < n: ncol = ncol+1 if n < 4: fig, axs = plt.subplots(nrow, ncol, dpi=100, figsize=(ncol*size*1.5, nrow*size*1.5) ) else: fig, axs = plt.subplots(nrow, ncol, dpi=100, figsize=(ncol*size, nrow*size) ) if nrow*ncol > n: for i in range(ncol*nrow - n): fig.delaxes(axs[-1][-(i+1)]) if type(axs) != np.ndarray: axs = [axs] else: axs = axs.ravel() for i in range(n): if i < n: if type(gene[i]) is list: marker = gene[i] else: marker = [gene[i]] if marker[0] == 'library': color = (self.X3.T > 0).sum() else: color = self.X3[marker].T.mean() self.style() g = axs[i].scatter(self.embedding[:, 0], self.embedding[:, 1], s=points, c=color, alpha=1, cmap='coolwarm' ) axs[i].set_xticks([]) axs[i].set_yticks([]) axs[i].autoscale(enable=True, axis='both', tight=tight) divider = make_axes_locatable(axs[i]) cax = divider.append_axes("right", "2.5%", pad="1%") if marker[0] == 'library': fig.colorbar(g, cax=cax, label='library complexity') else: fig.colorbar(g, cax=cax) if title: axs[i].set_title(title) else: if len(marker) < 2: axs[i].set_title( str(marker[0]), fontsize=fontsize-2) elif len(marker) > 1: axs[i].set_title( 'list starting with ' + str(marker[0]), fontsize=fontsize-2) if i % ncol == 0: axs[i].set_ylabel(xytitle+'2', fontsize=fontsize) if ((i // ncol) + 1) == nrow: axs[i].set_xlabel(xytitle+'1', fontsize=fontsize) else: with sns.plotting_context("paper", font_scale=1.5): self.style() g = sns.lmplot(x='x', y='y', fit_reg=False, scatter_kws={'s': points, 'alpha': .9, 'color': 'black'}, hue=None, data=pd.DataFrame(self.embedding, columns=['x', 'y']), height=size, aspect=1, legend=False, ) g.set(yticks=[], xticks=[]) plt.xlabel(xytitle + '1', fontsize=fontsize) plt.ylabel(xytitle + '2', fontsize=fontsize) plt.autoscale(enable=True, axis='both', tight=tight) sns.despine(top=False, right=False, left=False, bottom=False) if title: plt.title(title) if path: plt.savefig(path, bbox_inches='tight') plt.show() def _get_cluster_classes(self, den, label='ivl'): cluster_idxs = defaultdict(list) for c, pi in zip(den['color_list'], den['icoord']): for leg in pi[1:3]: i = (leg - 5.0) / 10.0 if abs(i - int(i)) < 1e-5: cluster_idxs[c].append(int(i)) cluster_classes = {} for c, l in cluster_idxs.items(): i_l = [den[label][i] for i in l] cluster_classes[c] = i_l return cluster_classes def visual_hierarchy(self, thrs=None, path=False, palette=pallete_50, cell_label=False, value_range=5): # thrs is te threshold in dendrogram # cell_label if one wants to add extra info in columns colors self.style_mp_stat() pop = pd.DataFrame(self.X_vis, index=self.normal_cells, columns=self.selected_genes) pop = pop.T palette_clust = palette Y = self.h2 X = self.h1 if thrs is None: thrs = 0.5*max(Y[:, 2]) else: thrs = thrs hierarchy.set_link_color_palette(palette_clust) denC = hierarchy.dendrogram( Y, labels=pop.columns, color_threshold=thrs, no_plot=True) clustersC = self._get_cluster_classes(denC) clusterC = [] for i in pop.columns: included = False for j in clustersC.keys(): if i in clustersC[j]: clusterC.append(j) included = True if not included: clusterC.append(None) if cell_label: gC = sns.clustermap(pop, linewidths=0, xticklabels=False, yticklabels=False, cbar_kws={"orientation": "vertical"}, center=0, figsize=(8, 6), vmin=-value_range, vmax=value_range, col_colors=[clusterC, cell_label], col_linkage=Y, row_linkage=X, cmap='coolwarm') gC.cax.set_visible(True) else: gC = sns.clustermap(pop, linewidths=0, xticklabels=False, yticklabels=False, vmin=-value_range, vmax=value_range, cbar_kws={"orientation": "vertical"}, center=0, figsize=(7, 7), col_colors=clusterC, col_linkage=Y, row_linkage=X, cmap='coolwarm') if path: plt.savefig(path, bbox_inches='tight') tabC = pd.DataFrame() for i in set(denC['color_list']): color_cluster = pd.Series(clusterC).apply( lambda x: x == str(i)).astype(int).values.tolist() tabC[i] = color_cluster if len(tabC.index) == len(pop.columns): tabC.index = pop.columns tabC = tabC[list(set(tabC.columns.tolist()) & set(palette_clust))] plt.show() for i in range(0, tabC.shape[1]): tabC.T.iloc[i] = tabC.T.iloc[i]*(i+1) excase = tabC.loc[tabC.T.sum() < 1].index.tolist() if len(excase) > 0: for i in excase: self.embedding = np.delete( self.embedding, pd.Index(excase).get_loc(i), axis=0) tabC = tabC.copy() tabC.drop(excase, axis=0, inplace=True) self.labels_hierarchy = tabC.T.sum().tolist() self.palette_hierarchy = tabC.columns.tolist() else: print('threshold too small') def get_cluster_info(self, labels=False, cluster=False, genes=10, plot_genes=True): self.style() cl = pd.DataFrame({'cluster': labels}, index=self.normal_cells) if cluster is 'all': return cl elif type(cluster) is int: cl_n = cl.loc[cl['cluster'] == cluster].index.tolist() cl[cl['cluster'] != cluster] = 200000 cl[cl['cluster'] == cluster] = 200001 print('The cluster', cluster, 'has', len(cl_n), 'cells') self.plot(labels=cl['cluster'].tolist(), palette=['#d8dcd6', '#49759c']) print('The top', genes, 'highly expressed signal-like genes in this cluster are:') top = self.X3.loc[self.normal_cells, self.normal_genes].loc[cl_n, :].mean()\ .sort_values(ascending=False)[:genes].index.tolist() for i in top: print(i) if plot_genes: self.plot(gene=tuple(top)) else: print('Select right cluster option') def get_gene_info(self, labels=False, gene=False, path=False, legend=False, size=6.5): self.style() if 0 in labels or 200001 in labels: palette = pallete_50 else: palette = self.palette_hierarchy cl = pd.DataFrame({'cluster': labels}, index=self.normal_cells) cl2 = [self.X3[gene].T.mean()[cl.loc[cl['cluster'] == i].index] for i in pd.unique(labels)] if type(legend) is list: order = legend index_lab = legend else: order = sorted(pd.unique(labels)) index_lab = pd.unique(labels) cl2 = pd.DataFrame(cl2, index=index_lab) fig = plt.figure(figsize=[size, 5]) sns.violinplot(data=cl2.T, orient='v', inner=None, order=order, palette=palette,linewidth=0.5) sns.stripplot(data=cl2.T, color="black", size=1.5, order=order) if legend: plt.xticks(rotation=45) plt.xlabel('Cluster') plt.ylabel('log2(1+TPM)') if path: plt.savefig(os.path.splitext(path)[ 0]+'_violin'+os.path.splitext(path)[1], bbox_inches='tight') # ------Fig2 ------------ cl['gene'] = self.X3[gene].T.mean() palette2 = [] pal_list = cl.copy() for i in sorted(pd.unique(cl['cluster'])): if cl[cl['cluster'] == i]['gene'].var() < 0.0000000001: cl.drop(cl[cl['cluster'] == i].index, axis=0, inplace=True) else: palette2.append( palette[sorted(pd.unique(pal_list['cluster'])).index(i)]) if len(palette2) > 0: palette = palette2 sns.set(style="white", rc={"axes.facecolor": (0, 0, 0, 0)}) g = sns.FacetGrid(cl, row="cluster", hue="cluster", aspect=8.5, height=.7, palette=palette) g.map(sns.kdeplot, "gene", clip_on=False, shade=True, alpha=1, lw=1.5, bw=.13) g.map(plt.axhline, y=0, lw=2, clip_on=False) down, up = plt.ylim() for i in g.row_names: if type(legend) is list: mi = legend[g.row_names.index(i)] g.axes[g.row_names.index(i),0].set_ylabel(mi,y=down*1.2, labelpad=20, color=palette[g.row_names.index(i)], fontsize='medium',rotation=0) else: mi = i g.axes[g.row_names.index(i),0].set_ylabel('cluster '+str(mi),y=down*1.2, labelpad=20, color=palette[g.row_names.index(i)], fontsize='medium',rotation=0) if len(palette) < 11 and len(palette) > 5: g.fig.subplots_adjust(hspace=-0.7, top=0.70, bottom=0.05) elif len(palette) < 6: g.fig.subplots_adjust(hspace=-0.6, top=0.85, bottom=0.05) else: g.fig.subplots_adjust(hspace=-0.7, top=0.50, bottom=0.05) g.set_titles("") g.set(yticks=[]) g.despine(bottom=True, left=True) plt.xlabel('log2(1+TPM)') if path: plt.savefig(os.path.splitext(path)[0]+'_ridge'+os.path.splitext(path)[1], bbox_inches='tight') self.style() plt.show()
0.840292
0.63484
import logging from programmingtheiot.common.IDataMessageListener import IDataMessageListener from programmingtheiot.data.ActuatorData import ActuatorData from programmingtheiot.cda.sim.HumidifierActuatorSimTask import HumidifierActuatorSimTask from programmingtheiot.cda.sim.HvacActuatorSimTask import HvacActuatorSimTask class ActuatorAdapterManager(object): """ Shell representation of class for student implementation. Handling All Actuators - invoking respective classes depending on input : Simulator or Emulator Sending respective commands to do actuation from either of three devices via appropriate method - Simulator or Emulator """ useEmulator = None dataMsgListener = None def __init__(self, useEmulator: bool = False): self.useEmulator = useEmulator if(self.useEmulator == True): logging.info("Emulators will be used") humidifierModule = __import__('programmingtheiot.cda.emulated.HumidifierEmulatorTask', fromlist = ['HumidifierEmulatorTask']) hueClazz = getattr(humidifierModule, 'HumidifierEmulatorTask') self.humidifierEmulator = hueClazz() hvacModule = __import__('programmingtheiot.cda.emulated.HvacEmulatorTask', fromlist = ['HvacEmulatorTask']) hueClazz = getattr(hvacModule, 'HvacEmulatorTask') self.hvacEmulator = hueClazz() LedDisplayModule = __import__('programmingtheiot.cda.emulated.LedDisplayEmulatorTask', fromlist = ['LedDisplayEmulatorTask']) hueClazz = getattr(LedDisplayModule, 'LedDisplayEmulatorTask') self.LedDisplayEmulator = hueClazz() else: logging.info("Testing ActuatorAdapterManager class [using simulators]...") # create the humidifier actuator self.humidifierActuator = HumidifierActuatorSimTask() # create the HVAC actuator self.hvacActuator = HvacActuatorSimTask() pass """Getting Actuator value from Simulator/Emulator as per self.useEmulator flag""" def sendActuatorCommand(self, data: ActuatorData) -> bool: logging.info("Actuator command received. Processing...") if(self.useEmulator == False): if(data.type == data.HUMIDIFIER_ACTUATOR_TYPE): if(data.getCommand()==0): logging.info("Emulating HUMIDIFIER actuator OFF:") logging.info("---------------------------------------") return False else: logging.info("Emulating HUMIDIFIER actuator ON:") logging.info(" Humidifier value : %s", data.getValue()) return True elif (data.type == data.HVAC_ACTUATOR_TYPE): if(data.getCommand()==0): logging.info("Emulating HVAC actuator OFF:") logging.info("---------------------------------------") return False else: logging.info("Emulating HVAC actuator ON:") logging.info(" HVAC value : %s", data.getValue()) return True elif(self.useEmulator == True): if(data.type == data.HUMIDIFIER_ACTUATOR_TYPE): if(data.getCommand()==0): logging.info("Emulating HUMIDIFIER actuator OFF:") logging.info("---------------------------------------") return False else: logging.info("Emulating HUMIDIFIER actuator ON:") logging.info(" Humidifier value : %s",data.getValue()) self.humidifierEmulator._handleActuation(data.getCommand(), data.getValue()) return True elif (data.type == data.HVAC_ACTUATOR_TYPE): if(data.getCommand()==0): logging.info("Emulating HVAC actuator OFF:") logging.info("---------------------------------------") return False else: logging.info("Emulating HVAC actuator ON:") logging.info(" HVAC value : %s",data.getValue()) self.hvacEmulator._handleActuation(data.getCommand(), data.getValue()) return True def setDataMessageListener(self, listener: IDataMessageListener) -> bool: if( listener != None): self.dataMsgListener = listener else: self.dataMsgListener = False pass
src/main/python/programmingtheiot/cda/system/ActuatorAdapterManager.py
import logging from programmingtheiot.common.IDataMessageListener import IDataMessageListener from programmingtheiot.data.ActuatorData import ActuatorData from programmingtheiot.cda.sim.HumidifierActuatorSimTask import HumidifierActuatorSimTask from programmingtheiot.cda.sim.HvacActuatorSimTask import HvacActuatorSimTask class ActuatorAdapterManager(object): """ Shell representation of class for student implementation. Handling All Actuators - invoking respective classes depending on input : Simulator or Emulator Sending respective commands to do actuation from either of three devices via appropriate method - Simulator or Emulator """ useEmulator = None dataMsgListener = None def __init__(self, useEmulator: bool = False): self.useEmulator = useEmulator if(self.useEmulator == True): logging.info("Emulators will be used") humidifierModule = __import__('programmingtheiot.cda.emulated.HumidifierEmulatorTask', fromlist = ['HumidifierEmulatorTask']) hueClazz = getattr(humidifierModule, 'HumidifierEmulatorTask') self.humidifierEmulator = hueClazz() hvacModule = __import__('programmingtheiot.cda.emulated.HvacEmulatorTask', fromlist = ['HvacEmulatorTask']) hueClazz = getattr(hvacModule, 'HvacEmulatorTask') self.hvacEmulator = hueClazz() LedDisplayModule = __import__('programmingtheiot.cda.emulated.LedDisplayEmulatorTask', fromlist = ['LedDisplayEmulatorTask']) hueClazz = getattr(LedDisplayModule, 'LedDisplayEmulatorTask') self.LedDisplayEmulator = hueClazz() else: logging.info("Testing ActuatorAdapterManager class [using simulators]...") # create the humidifier actuator self.humidifierActuator = HumidifierActuatorSimTask() # create the HVAC actuator self.hvacActuator = HvacActuatorSimTask() pass """Getting Actuator value from Simulator/Emulator as per self.useEmulator flag""" def sendActuatorCommand(self, data: ActuatorData) -> bool: logging.info("Actuator command received. Processing...") if(self.useEmulator == False): if(data.type == data.HUMIDIFIER_ACTUATOR_TYPE): if(data.getCommand()==0): logging.info("Emulating HUMIDIFIER actuator OFF:") logging.info("---------------------------------------") return False else: logging.info("Emulating HUMIDIFIER actuator ON:") logging.info(" Humidifier value : %s", data.getValue()) return True elif (data.type == data.HVAC_ACTUATOR_TYPE): if(data.getCommand()==0): logging.info("Emulating HVAC actuator OFF:") logging.info("---------------------------------------") return False else: logging.info("Emulating HVAC actuator ON:") logging.info(" HVAC value : %s", data.getValue()) return True elif(self.useEmulator == True): if(data.type == data.HUMIDIFIER_ACTUATOR_TYPE): if(data.getCommand()==0): logging.info("Emulating HUMIDIFIER actuator OFF:") logging.info("---------------------------------------") return False else: logging.info("Emulating HUMIDIFIER actuator ON:") logging.info(" Humidifier value : %s",data.getValue()) self.humidifierEmulator._handleActuation(data.getCommand(), data.getValue()) return True elif (data.type == data.HVAC_ACTUATOR_TYPE): if(data.getCommand()==0): logging.info("Emulating HVAC actuator OFF:") logging.info("---------------------------------------") return False else: logging.info("Emulating HVAC actuator ON:") logging.info(" HVAC value : %s",data.getValue()) self.hvacEmulator._handleActuation(data.getCommand(), data.getValue()) return True def setDataMessageListener(self, listener: IDataMessageListener) -> bool: if( listener != None): self.dataMsgListener = listener else: self.dataMsgListener = False pass
0.201892
0.192558
import json from abc import ABC, abstractmethod from argparse import ArgumentParser from logging import Logger from typing import Dict, Any from pyspark.sql import SparkSession import sys # abstract class for jobs class Job(ABC): def __init__(self, spark=None, init_conf=None): self.spark = self._prepare_spark(spark) self.logger = self._prepare_logger() self.dbutils = self.get_dbutils() if init_conf: self.conf = init_conf else: self.conf = self._provide_config() self._log_conf() @staticmethod def _prepare_spark(spark) -> SparkSession: if not spark: return SparkSession.builder.getOrCreate() else: return spark @staticmethod def _get_dbutils(spark: SparkSession): try: from pyspark.dbutils import DBUtils # noqa if "dbutils" not in locals(): utils = DBUtils(spark) return utils else: return locals().get("dbutils") except ImportError: return None def get_dbutils(self): utils = self._get_dbutils(self.spark) if not utils: self.logger.warn("No DBUtils defined in the runtime") else: self.logger.info("DBUtils class initialized") return utils def _provide_config(self): self.logger.info("Reading configuration from --conf-file job option") conf_file = self._get_conf_file() if not conf_file: self.logger.info( "No conf file was provided, setting configuration to empty dict." "Please override configuration in subclass init method" ) return {} else: self.logger.info( f"Conf file was provided, reading configuration from {conf_file}" ) return self._read_config(conf_file) @staticmethod def _get_conf_file(): p = ArgumentParser() p.add_argument("--conf-file", required=False, type=str) namespace = p.parse_known_args(sys.argv[1:])[0] return namespace.conf_file def _read_config(self, conf_file) -> Dict[str, Any]: raw_content = "".join( self.spark.read.format("text").load(conf_file).toPandas()["value"].tolist() ) config = json.loads(raw_content) return config def _prepare_logger(self) -> Logger: log4j_logger = self.spark._jvm.org.apache.log4j # noqa return log4j_logger.LogManager.getLogger(self.__class__.__name__) def _log_conf(self): # log parameters self.logger.info("Launching job with configuration parameters:") for key, item in self.conf.items(): self.logger.info("\t Parameter: %-30s with value => %-30s" % (key, item)) @abstractmethod def launch(self): """ Main method of the job. :return: """ pass
code/common.py
import json from abc import ABC, abstractmethod from argparse import ArgumentParser from logging import Logger from typing import Dict, Any from pyspark.sql import SparkSession import sys # abstract class for jobs class Job(ABC): def __init__(self, spark=None, init_conf=None): self.spark = self._prepare_spark(spark) self.logger = self._prepare_logger() self.dbutils = self.get_dbutils() if init_conf: self.conf = init_conf else: self.conf = self._provide_config() self._log_conf() @staticmethod def _prepare_spark(spark) -> SparkSession: if not spark: return SparkSession.builder.getOrCreate() else: return spark @staticmethod def _get_dbutils(spark: SparkSession): try: from pyspark.dbutils import DBUtils # noqa if "dbutils" not in locals(): utils = DBUtils(spark) return utils else: return locals().get("dbutils") except ImportError: return None def get_dbutils(self): utils = self._get_dbutils(self.spark) if not utils: self.logger.warn("No DBUtils defined in the runtime") else: self.logger.info("DBUtils class initialized") return utils def _provide_config(self): self.logger.info("Reading configuration from --conf-file job option") conf_file = self._get_conf_file() if not conf_file: self.logger.info( "No conf file was provided, setting configuration to empty dict." "Please override configuration in subclass init method" ) return {} else: self.logger.info( f"Conf file was provided, reading configuration from {conf_file}" ) return self._read_config(conf_file) @staticmethod def _get_conf_file(): p = ArgumentParser() p.add_argument("--conf-file", required=False, type=str) namespace = p.parse_known_args(sys.argv[1:])[0] return namespace.conf_file def _read_config(self, conf_file) -> Dict[str, Any]: raw_content = "".join( self.spark.read.format("text").load(conf_file).toPandas()["value"].tolist() ) config = json.loads(raw_content) return config def _prepare_logger(self) -> Logger: log4j_logger = self.spark._jvm.org.apache.log4j # noqa return log4j_logger.LogManager.getLogger(self.__class__.__name__) def _log_conf(self): # log parameters self.logger.info("Launching job with configuration parameters:") for key, item in self.conf.items(): self.logger.info("\t Parameter: %-30s with value => %-30s" % (key, item)) @abstractmethod def launch(self): """ Main method of the job. :return: """ pass
0.489015
0.069164
import csv import json import urllib # starting static list of universities and their locations to reduce Google Places API call frequency univ_locations = {'Texas A&M University Corpus Christi': 'us-tx', 'University of Texas at Arlington': 'us-tx', 'University of Houston': 'us-tx', 'Michigan Technological University': 'us-mi', 'Rice University': 'us-tx', 'University of Connecticut': 'us-ct', 'University of Florida': 'us-fl', 'Stanford University': 'us-ca', 'Texas A&M University': 'us-tx', 'University of North Texas': 'us-tx', 'University of Texas Medical Branch': 'us-tx', 'University of North Carolina, Chapel Hill': 'us-nc', 'Drake University': 'us-ia', 'Brown University': 'us-ri', 'University of California, Berkeley': 'us-ca', 'University of Texas at El Paso': 'us-tx', 'University of Texas at Dallas': 'us-tx', 'California Institute of Technology': 'us-ca', 'Clarkson University': 'us-ny', 'University of California, Los Angeles': 'us-ca', 'University of Memphis': 'us-tn', 'College of Physicians & Surgeons, Columbia University': 'us-tx', 'University of California, Santa Barbara': 'us-ca', 'Massachusetts Institute of Technology': 'us-ma', 'University of Texas Health Science Center at Houston': 'us-tx', 'Los Alamos National Laboratory': 'us-nm', 'Texas Tech University': 'us-tx', 'Texas A&M University-Kingsville': 'us-tx', 'Arizona State University': 'us-az', 'Vanderbilt University': 'us-tn', 'The Pennsylvania University': 'us-pa', 'North Carolina State University at Raleigh': 'us-nc', 'University of Texas Southwestern Medical Center': 'us-tx', 'University of Pittsburgh': 'us-pa', 'University of Michigan': 'us-mi', 'University of Pennsylvania': 'us-pa', 'National Renewable Energy Laboratory': 'us-co', 'University of California-Riverside': 'us-ca', 'University of California, Santa Cruz': 'us-ca', 'Vassar College': 'us-ny', 'City University of New York': 'us-ny', 'California State University-Northridge': 'us-ca', 'University of Virginia': 'us-va', 'Missouri University of Science and Technology': 'us-mo', 'Institute for Computational Engineering and Science': 'us-tx', '<NAME>. and <NAME> School of Geosciences': 'us-tx', 'Princeton University': 'us-nj', 'University of Iowa': 'us-ia', 'University of Kentucky': 'us-ky', 'Texas Tech University Health Sciences Center, El Paso': 'us-tx', 'Fox Chase Cancer Center': 'us-pa', 'Old Dominion University': 'us-va', 'Brooklyn College': 'us-ny', 'Texas Advanced Computing Center': 'us-tx', 'Yale University': 'us-ct', 'University of California, Davis': 'us-ca', 'University of Central Florida': 'us-fl', 'UTHealth': 'us-tx', 'Louisiana State University': 'us-la', 'Columbia University': 'us-ny', 'Binghamton University': 'us-ny', 'Oregon State University': 'us-or', 'University of Oklahoma': 'us-ok', 'University of Washington': 'us-wa', 'Purdue University': 'us-in', 'Institute for Fusion Studies': 'us-tx', 'Oregon Health and Science University': 'us-or', 'University of Notre Dame': 'us-in', 'Department of Economics': 'us-tx', 'University of Missouri': 'us-mo', 'Department of Electrical and Computer Engineering': 'us-tx', 'New Mexico Institute of Mining and Technology': 'us-nm', 'Harvard University': 'us-ma', 'SUNY at Binghamton': 'us-ny', 'Offshore Technology Research Center': 'us-tx', 'University of Texas M. D. Anderson Cancer Center': 'us-tx', 'University of California, San Diego': 'us-ca', 'Boston College': 'us-ma', 'Northwestern University': 'us-il', 'Department of Mechanical Engineering': 'us-tx', 'University of Maryland, College Park': 'us-md', 'College of Engineering': 'us-tx', 'Brandeis University': 'us-ma', 'Salk Institute for Biological Studies': 'us-ca', 'University of Colorado': 'us-co', 'University of Wisconsin': 'us-wi', 'University of Delaware': 'us-de', 'Georgia Institute of Technology': 'us-ga', 'Department of Aerospace Engineering and Engineering Mechanics': 'us-tx', 'New Mexico State University': 'us-nm', 'University of Chicago': 'us-il', 'College of Charleston': 'us-sc', 'California State University Northridge': 'us-ca','University of Texas at Austin': 'us-tx', 'Pennsylvania State University': 'us-pa', 'Tufts University': 'us-ma', 'Department of Chemical Engineering': 'us-tx', 'Rochester Institute of Technology': 'us-ny', 'South Dakota State University': 'us-sd', 'George Mason University': 'us-va', 'University of Alabama, Huntsville': 'us-al', 'University of Georgia': 'us-ga', 'University of Nevada-Las Vegas': 'us-nv', 'Washington University in St. Louis': 'us-wa', 'University of Texas at San Antonio': 'us-tx', 'Iowa State University': 'us-ia', 'University of California, Irvine': 'us-ca', 'University of Nebraska, Omaha': 'us-ne', 'Indiana University': 'us-in', 'University of Illinois': 'us-il', 'Johns Hopkins University': 'us-md', 'Bowling Green State University': 'us-oh', 'University of Tennessee, Knoxville': 'us-tn', 'Department of Chemistry and Biochemistry': 'us-tx', 'Jackson State University': 'us-ms', 'Department of Psychology': 'us-tx', 'Department of Physics': 'us-tx', 'Department of Petroleum and Geosystems Engineering': 'us-tx', 'Center for Aeromechanics Research': 'us-tx', 'Center for Energy and Environmental Resources': 'us-tx', 'Center for Research in Water Resources': 'us-tx', 'San Francisco State University': 'us-ca', 'Ohio State University': 'us-oh', 'University of Denver': 'us-co', 'Boston University': 'us-ma', 'Haverford College': 'us-pa', 'Rensselaer Polytechnic Institute': 'us-ny', 'Cornell University': 'us-ny', 'SUNY at Albany': 'us-ny', 'University of Wisconsin-Milwaukee': 'us-wi', 'University of Oregon': 'us-or', 'Carnegie Mellon University': 'us-pa', 'Tennessee Technological University': 'us-tn', 'Rutgers University': 'us-nj', 'University of Nebraska at Lincoln': 'us-ne', 'University of Massachusetts, Amherst': 'us-ma', 'Drexel University': 'us-pa', 'Harvey Mudd College': 'us-ca', 'University of South Carolina': 'us-sc'} # Makes a new base university_states.csv file from static structure def refresh_csv(): write_univ_states_csv(univ_locations, True) # Returns a parsable list of jobs running on Stampede2 from a certain institution. def get_jobs_by_institution(target_institution): with open('institution_job_mappings.csv') as csv_file: csv_reader = csv.reader(csv_file, delimiter = '\t') next(csv_reader) for line in csv_reader: if (line[0] == target_institution): job_string = line[1] jobs_list = build_job_array(job_string) if (DEBUG): print jobs_list return jobs_list return "That institution is not currently running any jobs on Stampede2." # Makes an array out of the string holding the list of jobs. def build_job_array(job_string): job_string = job_string.lstrip("['") job_string = job_string.rstrip("']") jobs_list = job_string.split("', '") return jobs_list # Returns the number of jobs running on Stampede2 from a certain university. def getCount(target_institution): inst_data = [] with open('institution_job_mappings.csv') as csv_file: csv_reader = csv.reader(csv_file, delimiter = '\t') for line in csv_reader: if(line[0] == target_institution): return len(build_job_array(get_jobs_by_institution(target_institution))) return 0 def rebuild_array(): with open('university_states.csv') as csv_file: csv_reader = csv.reader(csv_file, delimiter = '\t') for line in csv_reader: institution = line[0] if not institution in univ_locations.keys(): univ_locations[institution] = line[1] def add_new_universities(): rebuild_array() university_info = {} addresses = [] # DO NOT EDIT THIS KEY API_key = "<KEY>" with open('institution_job_mappings.csv') as csv_file: csv_reader = csv.reader(csv_file, delimiter = '\t') next(csv_reader) for line in csv_reader: institution = line[0] if not institution in univ_locations.keys(): # make api call to get univerity location print institution keys = institution.split() search_string = '%20'.join(keys) # print search_string request_url = "https://maps.googleapis.com/maps/api/place/findplacefromtext/json?input=" + search_string + "&inputtype=textquery&fields=formatted_address&key=" + API_key response = urllib.urlopen(request_url) data = json.loads( response.read()) # print data if (len(data['candidates']) > 2): address_components = data['candidates'][0]['formatted_address'].split(', ') addresses.append(address_components) state = address_components[-2][0:2] university_info[institution] = "us-" + state.encode('utf-8').lower() write_univ_states_csv(university_info, False) def write_univ_states_csv(locations_list, initial): # Make dictionary keys = locations_list.keys() univ_states = [] for institution in keys: info = {'Institution' : institution, 'State' : locations_list[institution]} univ_states.append(info) # Write info out to csv if (len(univ_states) > 0): list_keys = sorted(univ_states[0].keys()) if (initial): with open('university_states.csv', 'w')as output_file: dict_writer = csv.DictWriter( output_file, list_keys, delimiter = '\t' ) dict_writer.writeheader() dict_writer.writerows( univ_states ) else: with open('university_states.csv', 'a')as output_file: dict_writer = csv.DictWriter( output_file, keys, delimiter = '\t' ) dict_writer.writerows( univ_states ) write_state_count_csv() def write_state_count_csv(): state_count = {} with open('university_states.csv') as csv_file: csv_reader = csv.reader(csv_file, delimiter = '\t') next(csv_reader) for line in csv_reader: state = line[1] if not state in state_count.keys(): state_count[state] = 1 else: state_count[state] += 1 state_count_array = [] for state in sorted(state_count): info = {'State' : state, 'Count' : state_count[state]} state_count_array.append(info) with open('state_count.csv', 'w')as output_file: keys = sorted(state_count_array[0].keys(), reverse = True) dict_writer = csv.DictWriter( output_file, keys, delimiter = '\t' ) dict_writer.writeheader() dict_writer.writerows( state_count_array ) def main(): refresh_csv() add_new_universities() main()
project_organizer.py
import csv import json import urllib # starting static list of universities and their locations to reduce Google Places API call frequency univ_locations = {'Texas A&M University Corpus Christi': 'us-tx', 'University of Texas at Arlington': 'us-tx', 'University of Houston': 'us-tx', 'Michigan Technological University': 'us-mi', 'Rice University': 'us-tx', 'University of Connecticut': 'us-ct', 'University of Florida': 'us-fl', 'Stanford University': 'us-ca', 'Texas A&M University': 'us-tx', 'University of North Texas': 'us-tx', 'University of Texas Medical Branch': 'us-tx', 'University of North Carolina, Chapel Hill': 'us-nc', 'Drake University': 'us-ia', 'Brown University': 'us-ri', 'University of California, Berkeley': 'us-ca', 'University of Texas at El Paso': 'us-tx', 'University of Texas at Dallas': 'us-tx', 'California Institute of Technology': 'us-ca', 'Clarkson University': 'us-ny', 'University of California, Los Angeles': 'us-ca', 'University of Memphis': 'us-tn', 'College of Physicians & Surgeons, Columbia University': 'us-tx', 'University of California, Santa Barbara': 'us-ca', 'Massachusetts Institute of Technology': 'us-ma', 'University of Texas Health Science Center at Houston': 'us-tx', 'Los Alamos National Laboratory': 'us-nm', 'Texas Tech University': 'us-tx', 'Texas A&M University-Kingsville': 'us-tx', 'Arizona State University': 'us-az', 'Vanderbilt University': 'us-tn', 'The Pennsylvania University': 'us-pa', 'North Carolina State University at Raleigh': 'us-nc', 'University of Texas Southwestern Medical Center': 'us-tx', 'University of Pittsburgh': 'us-pa', 'University of Michigan': 'us-mi', 'University of Pennsylvania': 'us-pa', 'National Renewable Energy Laboratory': 'us-co', 'University of California-Riverside': 'us-ca', 'University of California, Santa Cruz': 'us-ca', 'Vassar College': 'us-ny', 'City University of New York': 'us-ny', 'California State University-Northridge': 'us-ca', 'University of Virginia': 'us-va', 'Missouri University of Science and Technology': 'us-mo', 'Institute for Computational Engineering and Science': 'us-tx', '<NAME>. and <NAME> School of Geosciences': 'us-tx', 'Princeton University': 'us-nj', 'University of Iowa': 'us-ia', 'University of Kentucky': 'us-ky', 'Texas Tech University Health Sciences Center, El Paso': 'us-tx', 'Fox Chase Cancer Center': 'us-pa', 'Old Dominion University': 'us-va', 'Brooklyn College': 'us-ny', 'Texas Advanced Computing Center': 'us-tx', 'Yale University': 'us-ct', 'University of California, Davis': 'us-ca', 'University of Central Florida': 'us-fl', 'UTHealth': 'us-tx', 'Louisiana State University': 'us-la', 'Columbia University': 'us-ny', 'Binghamton University': 'us-ny', 'Oregon State University': 'us-or', 'University of Oklahoma': 'us-ok', 'University of Washington': 'us-wa', 'Purdue University': 'us-in', 'Institute for Fusion Studies': 'us-tx', 'Oregon Health and Science University': 'us-or', 'University of Notre Dame': 'us-in', 'Department of Economics': 'us-tx', 'University of Missouri': 'us-mo', 'Department of Electrical and Computer Engineering': 'us-tx', 'New Mexico Institute of Mining and Technology': 'us-nm', 'Harvard University': 'us-ma', 'SUNY at Binghamton': 'us-ny', 'Offshore Technology Research Center': 'us-tx', 'University of Texas M. D. Anderson Cancer Center': 'us-tx', 'University of California, San Diego': 'us-ca', 'Boston College': 'us-ma', 'Northwestern University': 'us-il', 'Department of Mechanical Engineering': 'us-tx', 'University of Maryland, College Park': 'us-md', 'College of Engineering': 'us-tx', 'Brandeis University': 'us-ma', 'Salk Institute for Biological Studies': 'us-ca', 'University of Colorado': 'us-co', 'University of Wisconsin': 'us-wi', 'University of Delaware': 'us-de', 'Georgia Institute of Technology': 'us-ga', 'Department of Aerospace Engineering and Engineering Mechanics': 'us-tx', 'New Mexico State University': 'us-nm', 'University of Chicago': 'us-il', 'College of Charleston': 'us-sc', 'California State University Northridge': 'us-ca','University of Texas at Austin': 'us-tx', 'Pennsylvania State University': 'us-pa', 'Tufts University': 'us-ma', 'Department of Chemical Engineering': 'us-tx', 'Rochester Institute of Technology': 'us-ny', 'South Dakota State University': 'us-sd', 'George Mason University': 'us-va', 'University of Alabama, Huntsville': 'us-al', 'University of Georgia': 'us-ga', 'University of Nevada-Las Vegas': 'us-nv', 'Washington University in St. Louis': 'us-wa', 'University of Texas at San Antonio': 'us-tx', 'Iowa State University': 'us-ia', 'University of California, Irvine': 'us-ca', 'University of Nebraska, Omaha': 'us-ne', 'Indiana University': 'us-in', 'University of Illinois': 'us-il', 'Johns Hopkins University': 'us-md', 'Bowling Green State University': 'us-oh', 'University of Tennessee, Knoxville': 'us-tn', 'Department of Chemistry and Biochemistry': 'us-tx', 'Jackson State University': 'us-ms', 'Department of Psychology': 'us-tx', 'Department of Physics': 'us-tx', 'Department of Petroleum and Geosystems Engineering': 'us-tx', 'Center for Aeromechanics Research': 'us-tx', 'Center for Energy and Environmental Resources': 'us-tx', 'Center for Research in Water Resources': 'us-tx', 'San Francisco State University': 'us-ca', 'Ohio State University': 'us-oh', 'University of Denver': 'us-co', 'Boston University': 'us-ma', 'Haverford College': 'us-pa', 'Rensselaer Polytechnic Institute': 'us-ny', 'Cornell University': 'us-ny', 'SUNY at Albany': 'us-ny', 'University of Wisconsin-Milwaukee': 'us-wi', 'University of Oregon': 'us-or', 'Carnegie Mellon University': 'us-pa', 'Tennessee Technological University': 'us-tn', 'Rutgers University': 'us-nj', 'University of Nebraska at Lincoln': 'us-ne', 'University of Massachusetts, Amherst': 'us-ma', 'Drexel University': 'us-pa', 'Harvey Mudd College': 'us-ca', 'University of South Carolina': 'us-sc'} # Makes a new base university_states.csv file from static structure def refresh_csv(): write_univ_states_csv(univ_locations, True) # Returns a parsable list of jobs running on Stampede2 from a certain institution. def get_jobs_by_institution(target_institution): with open('institution_job_mappings.csv') as csv_file: csv_reader = csv.reader(csv_file, delimiter = '\t') next(csv_reader) for line in csv_reader: if (line[0] == target_institution): job_string = line[1] jobs_list = build_job_array(job_string) if (DEBUG): print jobs_list return jobs_list return "That institution is not currently running any jobs on Stampede2." # Makes an array out of the string holding the list of jobs. def build_job_array(job_string): job_string = job_string.lstrip("['") job_string = job_string.rstrip("']") jobs_list = job_string.split("', '") return jobs_list # Returns the number of jobs running on Stampede2 from a certain university. def getCount(target_institution): inst_data = [] with open('institution_job_mappings.csv') as csv_file: csv_reader = csv.reader(csv_file, delimiter = '\t') for line in csv_reader: if(line[0] == target_institution): return len(build_job_array(get_jobs_by_institution(target_institution))) return 0 def rebuild_array(): with open('university_states.csv') as csv_file: csv_reader = csv.reader(csv_file, delimiter = '\t') for line in csv_reader: institution = line[0] if not institution in univ_locations.keys(): univ_locations[institution] = line[1] def add_new_universities(): rebuild_array() university_info = {} addresses = [] # DO NOT EDIT THIS KEY API_key = "<KEY>" with open('institution_job_mappings.csv') as csv_file: csv_reader = csv.reader(csv_file, delimiter = '\t') next(csv_reader) for line in csv_reader: institution = line[0] if not institution in univ_locations.keys(): # make api call to get univerity location print institution keys = institution.split() search_string = '%20'.join(keys) # print search_string request_url = "https://maps.googleapis.com/maps/api/place/findplacefromtext/json?input=" + search_string + "&inputtype=textquery&fields=formatted_address&key=" + API_key response = urllib.urlopen(request_url) data = json.loads( response.read()) # print data if (len(data['candidates']) > 2): address_components = data['candidates'][0]['formatted_address'].split(', ') addresses.append(address_components) state = address_components[-2][0:2] university_info[institution] = "us-" + state.encode('utf-8').lower() write_univ_states_csv(university_info, False) def write_univ_states_csv(locations_list, initial): # Make dictionary keys = locations_list.keys() univ_states = [] for institution in keys: info = {'Institution' : institution, 'State' : locations_list[institution]} univ_states.append(info) # Write info out to csv if (len(univ_states) > 0): list_keys = sorted(univ_states[0].keys()) if (initial): with open('university_states.csv', 'w')as output_file: dict_writer = csv.DictWriter( output_file, list_keys, delimiter = '\t' ) dict_writer.writeheader() dict_writer.writerows( univ_states ) else: with open('university_states.csv', 'a')as output_file: dict_writer = csv.DictWriter( output_file, keys, delimiter = '\t' ) dict_writer.writerows( univ_states ) write_state_count_csv() def write_state_count_csv(): state_count = {} with open('university_states.csv') as csv_file: csv_reader = csv.reader(csv_file, delimiter = '\t') next(csv_reader) for line in csv_reader: state = line[1] if not state in state_count.keys(): state_count[state] = 1 else: state_count[state] += 1 state_count_array = [] for state in sorted(state_count): info = {'State' : state, 'Count' : state_count[state]} state_count_array.append(info) with open('state_count.csv', 'w')as output_file: keys = sorted(state_count_array[0].keys(), reverse = True) dict_writer = csv.DictWriter( output_file, keys, delimiter = '\t' ) dict_writer.writeheader() dict_writer.writerows( state_count_array ) def main(): refresh_csv() add_new_universities() main()
0.469763
0.412353
import shutil import sklearn import torch from ignite.contrib.handlers import ProgressBar from ignite.engine import Engine, Events from ignite.handlers import ModelCheckpoint, EarlyStopping from torch.utils.data import DataLoader from typing import Optional from slp.util import system from slp.util import types DEVICE = 'cuda' if torch.cuda.is_available() else 'cpu' #DEVICE = 'cpu' class CheckpointHandler(ModelCheckpoint): """Augment ignite ModelCheckpoint Handler with copying the best file to a {filename_prefix}_{experiment_name}.best.pth. This helps for automatic testing etc. Args: engine (ignite.engine.Engine): The trainer engine to_save (dict): The objects to save """ def __call__(self, engine: Engine, to_save: types.GenericDict) -> None: super(CheckpointHandler, self).__call__(engine, to_save) # Select model with best loss _, paths = self._saved[-1] for src in paths: splitted = src.split('_') fname_prefix = splitted[0] name = splitted[1] dst = f'{fname_prefix}_{name}.best.pth' shutil.copy(src, dst) class EvaluationHandler(object): def __init__(self, pbar: Optional[ProgressBar] = None, validate_every: int = 1, early_stopping: Optional[EarlyStopping] = None): self.validate_every = validate_every self.print_fn = pbar.log_message if pbar is not None else print self.early_stopping = early_stopping def predict_testset(self, model, test_loader): # import pdb; pdb.set_trace() model.eval() model.to(DEVICE) y_pred = []; y_true=[] with torch.no_grad(): for index, batch in enumerate(test_loader): x, y, l = batch pred = model(x, l) y_pred.append(pred) y_true.append(y) # yp = [y[0].max(0)[1].item() for y in y_pred] yp = [] for i in range(len(y_pred)): for j in range(len(y_pred[0])): yp.append(y_pred[i][j].max(0)[1].item()) yt = [] # yt = [y.item() for y in y_true] for i in range(len(y_true)): for j in range(len(y_true[0])): yt.append(y_true[i][j].item()) f1 = sklearn.metrics.f1_score(yp, yt, average='macro') uar = sklearn.metrics.recall_score(yp, yt, average='macro') print("F1: {}".format(f1)) print("UAR: {}".format(uar)) return 1 def __call__(self, engine: Engine, model, evaluator: Engine, dataloader: DataLoader, test_loader: DataLoader, validation: bool = True): if engine.state.epoch % self.validate_every != 0: return evaluator.run(dataloader) system.print_separator(n=35, print_fn=self.print_fn) metrics = evaluator.state.metrics phase = 'Validation' if validation else 'Training' self.print_fn('Epoch {} {} results' .format(engine.state.epoch, phase)) system.print_separator(symbol='-', n=35, print_fn=self.print_fn) for name, value in metrics.items(): self.print_fn('{:<15} {:<15}'.format(name, value)) if validation and self.early_stopping: loss = self.early_stopping.best_score patience = self.early_stopping.patience cntr = self.early_stopping.counter self.print_fn('{:<15} {:<15}'.format('best loss', -loss)) self.print_fn('{:<15} {:<15}'.format('patience left', patience - cntr)) system.print_separator(n=35, print_fn=self.print_fn) self.predict_testset(model, test_loader) def attach(self, model, trainer: Engine, evaluator: Engine, dataloader: DataLoader, test_loader:DataLoader, validation: bool = True): trainer.add_event_handler( Events.EPOCH_COMPLETED, self, model, evaluator, dataloader, test_loader, validation=validation)
slp/trainer/handlers_test.py
import shutil import sklearn import torch from ignite.contrib.handlers import ProgressBar from ignite.engine import Engine, Events from ignite.handlers import ModelCheckpoint, EarlyStopping from torch.utils.data import DataLoader from typing import Optional from slp.util import system from slp.util import types DEVICE = 'cuda' if torch.cuda.is_available() else 'cpu' #DEVICE = 'cpu' class CheckpointHandler(ModelCheckpoint): """Augment ignite ModelCheckpoint Handler with copying the best file to a {filename_prefix}_{experiment_name}.best.pth. This helps for automatic testing etc. Args: engine (ignite.engine.Engine): The trainer engine to_save (dict): The objects to save """ def __call__(self, engine: Engine, to_save: types.GenericDict) -> None: super(CheckpointHandler, self).__call__(engine, to_save) # Select model with best loss _, paths = self._saved[-1] for src in paths: splitted = src.split('_') fname_prefix = splitted[0] name = splitted[1] dst = f'{fname_prefix}_{name}.best.pth' shutil.copy(src, dst) class EvaluationHandler(object): def __init__(self, pbar: Optional[ProgressBar] = None, validate_every: int = 1, early_stopping: Optional[EarlyStopping] = None): self.validate_every = validate_every self.print_fn = pbar.log_message if pbar is not None else print self.early_stopping = early_stopping def predict_testset(self, model, test_loader): # import pdb; pdb.set_trace() model.eval() model.to(DEVICE) y_pred = []; y_true=[] with torch.no_grad(): for index, batch in enumerate(test_loader): x, y, l = batch pred = model(x, l) y_pred.append(pred) y_true.append(y) # yp = [y[0].max(0)[1].item() for y in y_pred] yp = [] for i in range(len(y_pred)): for j in range(len(y_pred[0])): yp.append(y_pred[i][j].max(0)[1].item()) yt = [] # yt = [y.item() for y in y_true] for i in range(len(y_true)): for j in range(len(y_true[0])): yt.append(y_true[i][j].item()) f1 = sklearn.metrics.f1_score(yp, yt, average='macro') uar = sklearn.metrics.recall_score(yp, yt, average='macro') print("F1: {}".format(f1)) print("UAR: {}".format(uar)) return 1 def __call__(self, engine: Engine, model, evaluator: Engine, dataloader: DataLoader, test_loader: DataLoader, validation: bool = True): if engine.state.epoch % self.validate_every != 0: return evaluator.run(dataloader) system.print_separator(n=35, print_fn=self.print_fn) metrics = evaluator.state.metrics phase = 'Validation' if validation else 'Training' self.print_fn('Epoch {} {} results' .format(engine.state.epoch, phase)) system.print_separator(symbol='-', n=35, print_fn=self.print_fn) for name, value in metrics.items(): self.print_fn('{:<15} {:<15}'.format(name, value)) if validation and self.early_stopping: loss = self.early_stopping.best_score patience = self.early_stopping.patience cntr = self.early_stopping.counter self.print_fn('{:<15} {:<15}'.format('best loss', -loss)) self.print_fn('{:<15} {:<15}'.format('patience left', patience - cntr)) system.print_separator(n=35, print_fn=self.print_fn) self.predict_testset(model, test_loader) def attach(self, model, trainer: Engine, evaluator: Engine, dataloader: DataLoader, test_loader:DataLoader, validation: bool = True): trainer.add_event_handler( Events.EPOCH_COMPLETED, self, model, evaluator, dataloader, test_loader, validation=validation)
0.850065
0.259996
import autograd.numpy as np from autograd import hessian from scipy.optimize import minimize import matplotlib.pyplot as plt from matplotlib import rcParams, rcParamsDefault from scipy.optimize import brentq from autograd import grad from experiments.visualization.visualization_utils import get_figsize def func_sine(X): return np.sin(X) def plot_admissible_region(X0, xlim, ylim, func_to_convex, l_thresh, u_thresh, left_range, right_range): rcParams['pdf.fonttype'] = 42 rcParams['ps.fonttype'] = 42 rcParams.update({'legend.fontsize': 5.4}) rcParams.update({'font.size': 5.8}) # textwidth is 506.295, columnwidth is 241.14749 fig = plt.figure(figsize=get_figsize(columnwidth=506.295, wf=0.32, hf=0.42)) ax = fig.gca() ax.set_xlim(xlim) ax.set_ylim(ylim) # Make data X = np.arange(xlim[0], xlim[1], 0.01) Y = func_to_convex(X) # Plot the sine in the domain ax.plot(X, Y, label="$sin(x)$", color="black", linewidth=0.9) ax.plot(X0, func_to_convex(X0), 'o', label="$x_0$", color="black", markersize=3) ax.axvspan(xmin=left_range, xmax=right_range, edgecolor="none", facecolor="grey", alpha=0.25) plt.xticks([left_range, right_range]) ax.hlines(y=u_thresh, xmin=xlim[0], xmax=xlim[1], colors='tab:blue', linestyles="--", label='$U$', linewidth=0.9) ax.hlines(y=l_thresh, xmin=xlim[0], xmax=xlim[1], colors='tab:red', linestyles="--", label='$L$', linewidth=0.9) ax.spines['right'].set_visible(False) ax.spines['top'].set_visible(False) ax.spines['bottom'].set_linewidth(0.5) ax.spines['left'].set_linewidth(0.5) ax.tick_params(width=0.5) handles, labels = ax.get_legend_handles_labels() plt.legend(handles, labels, loc='upper center', bbox_to_anchor=(0.5, 1.34), ncol=4, columnspacing=1, handlelength=1.7, frameon=False) plt.subplots_adjust(top=0.82, bottom=0.18, left=0.09, right=0.96, hspace=0.08, wspace=0.2) fig_file_name = "sine_admissible_region.pdf" plt.savefig(fig_file_name) plt.close(fig) rcParams.update(rcParamsDefault) def plot_2d_convex_diff(X0, xlim, ylim, func_to_convex, l_thresh, u_thresh, func_g_convex, func_h_convex, func_g_minus_l_tangent, left_range, right_range): rcParams['pdf.fonttype'] = 42 rcParams['ps.fonttype'] = 42 rcParams.update({'legend.fontsize': 5.4}) rcParams.update({'font.size': 5.8}) # textwidth is 506.295, columnwidth is 241.14749 fig = plt.figure(figsize=get_figsize(columnwidth=506.295, wf=0.32, hf=0.42)) ax = fig.gca() ax.set_xlim(xlim) ax.set_ylim(ylim) # Make data X = np.arange(xlim[0], xlim[1], 0.01) Y = func_to_convex(X) # Plot the sine in the domain ax.plot(X, Y, color="black", linewidth=0.9) ax.plot(X0, func_to_convex(X0), 'o', color="black", markersize=3) g_convex_val = func_g_convex(X) h_convex_val = func_h_convex(X) ax.plot(X, g_convex_val, label=r"$\breve{g}(x)$", color="tab:orange", linewidth=0.9) ax.plot(X, h_convex_val, label=r"$\breve{h}(x)$", color="tab:green", linewidth=0.9) g_minus_l_tangent_val = func_g_minus_l_tangent(X) ax.fill_between(X, g_convex_val, u_thresh, where=g_convex_val < u_thresh, color='orange', alpha=0.5, interpolate=True) ax.fill_between(X, h_convex_val, g_minus_l_tangent_val, where=h_convex_val < g_minus_l_tangent_val, color='green', alpha=0.3, interpolate=True) ax.axvline(x=left_range, ymin=-1, ymax=1, linestyle=":", color="grey", linewidth=0.8) ax.axvline(x=right_range, ymin=-1, ymax=1, linestyle=":", color="grey", linewidth=0.8) plt.xticks([left_range, right_range]) ax.hlines(y=u_thresh, xmin=xlim[0], xmax=xlim[1], colors='tab:blue', linestyles="--", linewidth=0.9) ax.hlines(y=l_thresh, xmin=xlim[0], xmax=xlim[1], colors='tab:red', linestyles="--", linewidth=0.9) ax.plot(X, g_minus_l_tangent_val, label=r"$f(x_0)+\nabla f(x_0)^T (x-x_0) - L$", color="grey", linestyle="-.", linewidth=0.9) ax.spines['right'].set_visible(False) ax.spines['top'].set_visible(False) ax.spines['bottom'].set_linewidth(0.5) ax.spines['left'].set_linewidth(0.5) ax.tick_params(width=0.5) handles, labels = ax.get_legend_handles_labels() plt.legend(handles, labels, loc='upper center', bbox_to_anchor=(0.5, 1.36), ncol=3, columnspacing=0.8, handlelength=1.7, frameon=False, handletextpad=0.8) plt.subplots_adjust(top=0.82, bottom=0.18, left=0.09, right=0.96, hspace=0.08, wspace=0.2) fig_file_name = "sine_convex_diff.pdf" plt.savefig(fig_file_name) plt.close(fig) rcParams.update(rcParamsDefault) def plot_2d_concave_diff(X0, xlim, ylim, func_to_concave, l_thresh, u_thresh, func_g_concave, func_h_concave, func_g_minus_u_tangent, left_range, right_range): rcParams['pdf.fonttype'] = 42 rcParams['ps.fonttype'] = 42 rcParams.update({'legend.fontsize': 5.4}) rcParams.update({'font.size': 5.8}) # textwidth is 506.295, columnwidth is 241.14749 fig = plt.figure(figsize=get_figsize(columnwidth=506.295, wf=0.32, hf=0.42)) ax = fig.gca() ax.set_xlim(xlim) ax.set_ylim(ylim) # Make data X = np.arange(xlim[0], xlim[1], 0.01) Y = func_to_concave(X) # Plot the sine in the domain ax.plot(X, Y, color="black", linewidth=0.9) ax.plot(X0, func_to_concave(X0), 'o', color="black", markersize=3) g_concave_val = func_g_concave(X) h_concave_val = func_h_concave(X) ax.plot(X, g_concave_val, label="$\hat{g}(x)$", color="tab:green", linewidth=0.9) ax.plot(X, h_concave_val, label="$\hat{h}(x)$", color="tab:orange", linewidth=0.9) g_minus_u_tangent_val = func_g_minus_u_tangent(X) ax.fill_between(X, g_concave_val, l_thresh, where=g_concave_val > l_thresh, color='green', alpha=0.5, interpolate=True) ax.fill_between(X, h_concave_val, g_minus_u_tangent_val, where=h_concave_val > g_minus_u_tangent_val, color='orange', alpha=0.3, interpolate=True) ax.axvline(x=left_range, ymin=-1, ymax=1, linestyle=":", color="grey", linewidth=0.8) ax.axvline(x=right_range, ymin=-1, ymax=1, linestyle=":", color="grey", linewidth=0.8) plt.xticks([left_range, right_range]) ax.hlines(y=u_thresh, xmin=xlim[0], xmax=xlim[1], colors='tab:blue', linestyles="--", linewidth=0.9) ax.hlines(y=l_thresh, xmin=xlim[0], xmax=xlim[1], colors='tab:red', linestyles="--", linewidth=0.9) ax.plot(X, g_minus_u_tangent_val, label=r"$f(x_0) +\nabla f(x_0)^T (x-x_0) - U$", color="grey", linestyle="-.", linewidth=0.9) ax.spines['right'].set_visible(False) ax.spines['top'].set_visible(False) ax.spines['bottom'].set_linewidth(0.5) ax.spines['left'].set_linewidth(0.5) ax.tick_params(width=0.5) handles, labels = ax.get_legend_handles_labels() plt.legend(handles, labels, loc='upper center', bbox_to_anchor=(0.5, 1.38), ncol=3, columnspacing=0.8, handlelength=1.7, frameon=False, handletextpad=0.8) plt.subplots_adjust(top=0.82, bottom=0.18, left=0.09, right=0.96, hspace=0.08, wspace=0.2) fig_file_name = "sine_concave_diff.pdf" plt.savefig(fig_file_name) plt.close(fig) rcParams.update(rcParamsDefault) # Minimize this function over x in a specific neighborhood around X0 def func_min_eigenvalue(x, args): hess = args eigenvalues, eigenvector = np.linalg.eig(hess(x)) min_eigenvalue = np.min(eigenvalues) return min_eigenvalue # Maximize this function over x in a specific neighborhood around X0 def func_max_eigenvalue(x, args): hess = args eigenvalues, eigenvector = np.linalg.eig(hess(x)) max_eigenvalue = np.max(eigenvalues) return -1.0 * max_eigenvalue def func_min_max_eigenvalues(func_to_convex, X0, domain): hess = hessian(func_to_convex) sol_min = minimize(func_min_eigenvalue, X0, args=hess, bounds=domain) sol_max = minimize(func_max_eigenvalue, X0, args=hess, bounds=domain) min_eigenvalue = sol_min.fun minimizing_point = sol_min.x max_eigenvalue = -1.0 * sol_max.fun maximizing_point = sol_max.x return min_eigenvalue, minimizing_point, max_eigenvalue, maximizing_point def find_min_and_max_eigenvalues(func_to_convex, domain): min_eigenvalue = np.inf max_eigenvalue = -np.inf # Start the optimization process from multiple points in the domain, then choose the max and min rand_start_points = np.random.uniform(domain[0][0], domain[0][1], (10, len(domain))) for start_point in rand_start_points: start_point = np.array(start_point, dtype=np.float32) min_eigenvalue_temp, minimizing_point, max_eigenvalue_temp, maximizing_point = func_min_max_eigenvalues(func_to_convex, start_point, domain) min_eigenvalue = np.minimum(min_eigenvalue, min_eigenvalue_temp) max_eigenvalue = np.maximum(max_eigenvalue, max_eigenvalue_temp) assert (min_eigenvalue <= max_eigenvalue) print("max_eigenvalue:", max_eigenvalue) print("min_eigenvalue:", min_eigenvalue) return min_eigenvalue, max_eigenvalue def admissible_region(X0, func_to_convex, xlim=None, ylim=None): l_thresh = func_to_convex(X0) - 0.2 u_thresh = func_to_convex(X0) + 0.2 func = lambda x: func_to_convex(x) - l_thresh lower_thresh_root_left, lower_thresh_root_right = brentq(func, X0 - 2, X0), brentq(func, X0, X0 + 2) plot_admissible_region(X0, xlim, ylim, func_to_convex, l_thresh, u_thresh, lower_thresh_root_left, lower_thresh_root_right) def convex_diff(X0, min_eigenvalue, func_to_convex, xlim=None, ylim=None): l_thresh = func_to_convex(X0) - 0.2 u_thresh = func_to_convex(X0) + 0.2 search_roots_distance = 10 eig = min_eigenvalue g_convex = lambda x: func_to_convex(x) + 0.5 * np.abs(eig) * (x - X0) * (x - X0) h_convex = lambda x: 0.5 * np.abs(eig) * (x - X0) * (x - X0) grad_func_to_convex = grad(func_to_convex) g_minus_l_tangent = lambda x: func_to_convex(X0) + grad_func_to_convex(X0) * (x - X0) - l_thresh # Condition 1: g(x) < U. # Check where g(x) = U and write in title func = lambda x: g_convex(x) - u_thresh upper_thresh_root_left, upper_thresh_root_right = brentq(func, X0 - search_roots_distance, X0), brentq(func, X0, X0 + search_roots_distance) assert upper_thresh_root_left <= upper_thresh_root_right, str(upper_thresh_root_left) + "," + str(upper_thresh_root_right) upper_safe_zone_size = upper_thresh_root_right - upper_thresh_root_left # Condition 2: Tangent g(x)-L bigger than h(x) # Check where Tangent g(x)-L = h(x) and write in figure title func = lambda x: g_minus_l_tangent(x) - h_convex(x) lower_thresh_root_left, lower_thresh_root_right = brentq(func, X0 - search_roots_distance, X0), brentq(func, X0, X0 + search_roots_distance) assert lower_thresh_root_left <= lower_thresh_root_right, str(lower_thresh_root_left) + "," + str(lower_thresh_root_right) lower_safe_zone_size = lower_thresh_root_right - lower_thresh_root_left if upper_safe_zone_size == 0 or lower_safe_zone_size == 0: safe_zone_size = 0 else: safe_zone_size = np.minimum(upper_thresh_root_right, lower_thresh_root_right) - np.maximum(upper_thresh_root_left, lower_thresh_root_left) assert safe_zone_size >= 0, str(safe_zone_size) plot_2d_convex_diff(X0, xlim, ylim, func_to_convex, l_thresh, u_thresh, g_convex, h_convex, g_minus_l_tangent, np.maximum(lower_thresh_root_left, upper_thresh_root_left), np.minimum(lower_thresh_root_right, upper_thresh_root_right)) return safe_zone_size, upper_safe_zone_size, lower_safe_zone_size def concave_diff(X0, max_eigenvalue, func_to_concave, xlim=None, ylim=None): l_thresh = func_to_concave(X0) - 0.2 u_thresh = func_to_concave(X0) + 0.2 search_roots_distance = 10 g_concave = lambda x: func_to_concave(x) - 0.5 * max_eigenvalue * (x - X0) * (x - X0) h_concave = lambda x: -0.5 * max_eigenvalue * (x - X0) * (x - X0) grad_func_to_convex = grad(func_to_concave) g_minus_u_tangent = lambda x: func_to_concave(X0) + grad_func_to_convex(X0) * (x - X0) - u_thresh # Condition 1: g(x) > L. # Check where g(x) = L and write in title func = lambda x: g_concave(x) - l_thresh lower_thresh_root_left, lower_thresh_root_right = brentq(func, X0 - search_roots_distance, X0), brentq(func, X0, X0 + search_roots_distance) assert lower_thresh_root_left <= lower_thresh_root_right, str(lower_thresh_root_left) + "," + str(lower_thresh_root_right) lower_safe_zone_size = lower_thresh_root_right - lower_thresh_root_left # Condition 2: Tangent g(x)-U smaller than h(x) # Check where Tangent g(x)-U = h(x) and write in figure title func = lambda x: g_minus_u_tangent(x) - h_concave(x) upper_thresh_root_left, upper_thresh_root_right = brentq(func, X0 - search_roots_distance, X0), brentq(func, X0, X0 + search_roots_distance) assert upper_thresh_root_left <= upper_thresh_root_right, str(upper_thresh_root_left) + "," + str(upper_thresh_root_right) upper_safe_zone_size = upper_thresh_root_right - upper_thresh_root_left if upper_safe_zone_size == 0 or lower_safe_zone_size == 0: safe_zone_size = 0 else: safe_zone_size = np.minimum(upper_thresh_root_right, lower_thresh_root_right) - np.maximum( upper_thresh_root_left, lower_thresh_root_left) assert safe_zone_size >= 0, str(safe_zone_size) plot_2d_concave_diff(X0, xlim, ylim, func_to_concave, l_thresh, u_thresh, g_concave, h_concave, g_minus_u_tangent, np.maximum(lower_thresh_root_left, upper_thresh_root_left), np.minimum(lower_thresh_root_right, upper_thresh_root_right)) return safe_zone_size, upper_safe_zone_size, lower_safe_zone_size if __name__ == "__main__": # Figure 1 X0 = 0.5 * np.pi domain = ((X0 - 3, X0 + 3),) xlim = [X0 - 2.1, X0 + 2.1] ylim = [-0.5, 1.5] X0 = np.array([X0]) min_eigenvalue, max_eigenvalue = find_min_and_max_eigenvalues(func_sine, domain) # Plot the concave and convex diffs convex_diff(X0, min_eigenvalue, func_sine, xlim=xlim, ylim=ylim) concave_diff(X0, max_eigenvalue, func_sine, xlim=xlim, ylim=ylim) admissible_region(X0, func_sine, xlim=xlim, ylim=ylim)
experiments/visualization/plot_sine_convex_vs_concave.py
import autograd.numpy as np from autograd import hessian from scipy.optimize import minimize import matplotlib.pyplot as plt from matplotlib import rcParams, rcParamsDefault from scipy.optimize import brentq from autograd import grad from experiments.visualization.visualization_utils import get_figsize def func_sine(X): return np.sin(X) def plot_admissible_region(X0, xlim, ylim, func_to_convex, l_thresh, u_thresh, left_range, right_range): rcParams['pdf.fonttype'] = 42 rcParams['ps.fonttype'] = 42 rcParams.update({'legend.fontsize': 5.4}) rcParams.update({'font.size': 5.8}) # textwidth is 506.295, columnwidth is 241.14749 fig = plt.figure(figsize=get_figsize(columnwidth=506.295, wf=0.32, hf=0.42)) ax = fig.gca() ax.set_xlim(xlim) ax.set_ylim(ylim) # Make data X = np.arange(xlim[0], xlim[1], 0.01) Y = func_to_convex(X) # Plot the sine in the domain ax.plot(X, Y, label="$sin(x)$", color="black", linewidth=0.9) ax.plot(X0, func_to_convex(X0), 'o', label="$x_0$", color="black", markersize=3) ax.axvspan(xmin=left_range, xmax=right_range, edgecolor="none", facecolor="grey", alpha=0.25) plt.xticks([left_range, right_range]) ax.hlines(y=u_thresh, xmin=xlim[0], xmax=xlim[1], colors='tab:blue', linestyles="--", label='$U$', linewidth=0.9) ax.hlines(y=l_thresh, xmin=xlim[0], xmax=xlim[1], colors='tab:red', linestyles="--", label='$L$', linewidth=0.9) ax.spines['right'].set_visible(False) ax.spines['top'].set_visible(False) ax.spines['bottom'].set_linewidth(0.5) ax.spines['left'].set_linewidth(0.5) ax.tick_params(width=0.5) handles, labels = ax.get_legend_handles_labels() plt.legend(handles, labels, loc='upper center', bbox_to_anchor=(0.5, 1.34), ncol=4, columnspacing=1, handlelength=1.7, frameon=False) plt.subplots_adjust(top=0.82, bottom=0.18, left=0.09, right=0.96, hspace=0.08, wspace=0.2) fig_file_name = "sine_admissible_region.pdf" plt.savefig(fig_file_name) plt.close(fig) rcParams.update(rcParamsDefault) def plot_2d_convex_diff(X0, xlim, ylim, func_to_convex, l_thresh, u_thresh, func_g_convex, func_h_convex, func_g_minus_l_tangent, left_range, right_range): rcParams['pdf.fonttype'] = 42 rcParams['ps.fonttype'] = 42 rcParams.update({'legend.fontsize': 5.4}) rcParams.update({'font.size': 5.8}) # textwidth is 506.295, columnwidth is 241.14749 fig = plt.figure(figsize=get_figsize(columnwidth=506.295, wf=0.32, hf=0.42)) ax = fig.gca() ax.set_xlim(xlim) ax.set_ylim(ylim) # Make data X = np.arange(xlim[0], xlim[1], 0.01) Y = func_to_convex(X) # Plot the sine in the domain ax.plot(X, Y, color="black", linewidth=0.9) ax.plot(X0, func_to_convex(X0), 'o', color="black", markersize=3) g_convex_val = func_g_convex(X) h_convex_val = func_h_convex(X) ax.plot(X, g_convex_val, label=r"$\breve{g}(x)$", color="tab:orange", linewidth=0.9) ax.plot(X, h_convex_val, label=r"$\breve{h}(x)$", color="tab:green", linewidth=0.9) g_minus_l_tangent_val = func_g_minus_l_tangent(X) ax.fill_between(X, g_convex_val, u_thresh, where=g_convex_val < u_thresh, color='orange', alpha=0.5, interpolate=True) ax.fill_between(X, h_convex_val, g_minus_l_tangent_val, where=h_convex_val < g_minus_l_tangent_val, color='green', alpha=0.3, interpolate=True) ax.axvline(x=left_range, ymin=-1, ymax=1, linestyle=":", color="grey", linewidth=0.8) ax.axvline(x=right_range, ymin=-1, ymax=1, linestyle=":", color="grey", linewidth=0.8) plt.xticks([left_range, right_range]) ax.hlines(y=u_thresh, xmin=xlim[0], xmax=xlim[1], colors='tab:blue', linestyles="--", linewidth=0.9) ax.hlines(y=l_thresh, xmin=xlim[0], xmax=xlim[1], colors='tab:red', linestyles="--", linewidth=0.9) ax.plot(X, g_minus_l_tangent_val, label=r"$f(x_0)+\nabla f(x_0)^T (x-x_0) - L$", color="grey", linestyle="-.", linewidth=0.9) ax.spines['right'].set_visible(False) ax.spines['top'].set_visible(False) ax.spines['bottom'].set_linewidth(0.5) ax.spines['left'].set_linewidth(0.5) ax.tick_params(width=0.5) handles, labels = ax.get_legend_handles_labels() plt.legend(handles, labels, loc='upper center', bbox_to_anchor=(0.5, 1.36), ncol=3, columnspacing=0.8, handlelength=1.7, frameon=False, handletextpad=0.8) plt.subplots_adjust(top=0.82, bottom=0.18, left=0.09, right=0.96, hspace=0.08, wspace=0.2) fig_file_name = "sine_convex_diff.pdf" plt.savefig(fig_file_name) plt.close(fig) rcParams.update(rcParamsDefault) def plot_2d_concave_diff(X0, xlim, ylim, func_to_concave, l_thresh, u_thresh, func_g_concave, func_h_concave, func_g_minus_u_tangent, left_range, right_range): rcParams['pdf.fonttype'] = 42 rcParams['ps.fonttype'] = 42 rcParams.update({'legend.fontsize': 5.4}) rcParams.update({'font.size': 5.8}) # textwidth is 506.295, columnwidth is 241.14749 fig = plt.figure(figsize=get_figsize(columnwidth=506.295, wf=0.32, hf=0.42)) ax = fig.gca() ax.set_xlim(xlim) ax.set_ylim(ylim) # Make data X = np.arange(xlim[0], xlim[1], 0.01) Y = func_to_concave(X) # Plot the sine in the domain ax.plot(X, Y, color="black", linewidth=0.9) ax.plot(X0, func_to_concave(X0), 'o', color="black", markersize=3) g_concave_val = func_g_concave(X) h_concave_val = func_h_concave(X) ax.plot(X, g_concave_val, label="$\hat{g}(x)$", color="tab:green", linewidth=0.9) ax.plot(X, h_concave_val, label="$\hat{h}(x)$", color="tab:orange", linewidth=0.9) g_minus_u_tangent_val = func_g_minus_u_tangent(X) ax.fill_between(X, g_concave_val, l_thresh, where=g_concave_val > l_thresh, color='green', alpha=0.5, interpolate=True) ax.fill_between(X, h_concave_val, g_minus_u_tangent_val, where=h_concave_val > g_minus_u_tangent_val, color='orange', alpha=0.3, interpolate=True) ax.axvline(x=left_range, ymin=-1, ymax=1, linestyle=":", color="grey", linewidth=0.8) ax.axvline(x=right_range, ymin=-1, ymax=1, linestyle=":", color="grey", linewidth=0.8) plt.xticks([left_range, right_range]) ax.hlines(y=u_thresh, xmin=xlim[0], xmax=xlim[1], colors='tab:blue', linestyles="--", linewidth=0.9) ax.hlines(y=l_thresh, xmin=xlim[0], xmax=xlim[1], colors='tab:red', linestyles="--", linewidth=0.9) ax.plot(X, g_minus_u_tangent_val, label=r"$f(x_0) +\nabla f(x_0)^T (x-x_0) - U$", color="grey", linestyle="-.", linewidth=0.9) ax.spines['right'].set_visible(False) ax.spines['top'].set_visible(False) ax.spines['bottom'].set_linewidth(0.5) ax.spines['left'].set_linewidth(0.5) ax.tick_params(width=0.5) handles, labels = ax.get_legend_handles_labels() plt.legend(handles, labels, loc='upper center', bbox_to_anchor=(0.5, 1.38), ncol=3, columnspacing=0.8, handlelength=1.7, frameon=False, handletextpad=0.8) plt.subplots_adjust(top=0.82, bottom=0.18, left=0.09, right=0.96, hspace=0.08, wspace=0.2) fig_file_name = "sine_concave_diff.pdf" plt.savefig(fig_file_name) plt.close(fig) rcParams.update(rcParamsDefault) # Minimize this function over x in a specific neighborhood around X0 def func_min_eigenvalue(x, args): hess = args eigenvalues, eigenvector = np.linalg.eig(hess(x)) min_eigenvalue = np.min(eigenvalues) return min_eigenvalue # Maximize this function over x in a specific neighborhood around X0 def func_max_eigenvalue(x, args): hess = args eigenvalues, eigenvector = np.linalg.eig(hess(x)) max_eigenvalue = np.max(eigenvalues) return -1.0 * max_eigenvalue def func_min_max_eigenvalues(func_to_convex, X0, domain): hess = hessian(func_to_convex) sol_min = minimize(func_min_eigenvalue, X0, args=hess, bounds=domain) sol_max = minimize(func_max_eigenvalue, X0, args=hess, bounds=domain) min_eigenvalue = sol_min.fun minimizing_point = sol_min.x max_eigenvalue = -1.0 * sol_max.fun maximizing_point = sol_max.x return min_eigenvalue, minimizing_point, max_eigenvalue, maximizing_point def find_min_and_max_eigenvalues(func_to_convex, domain): min_eigenvalue = np.inf max_eigenvalue = -np.inf # Start the optimization process from multiple points in the domain, then choose the max and min rand_start_points = np.random.uniform(domain[0][0], domain[0][1], (10, len(domain))) for start_point in rand_start_points: start_point = np.array(start_point, dtype=np.float32) min_eigenvalue_temp, minimizing_point, max_eigenvalue_temp, maximizing_point = func_min_max_eigenvalues(func_to_convex, start_point, domain) min_eigenvalue = np.minimum(min_eigenvalue, min_eigenvalue_temp) max_eigenvalue = np.maximum(max_eigenvalue, max_eigenvalue_temp) assert (min_eigenvalue <= max_eigenvalue) print("max_eigenvalue:", max_eigenvalue) print("min_eigenvalue:", min_eigenvalue) return min_eigenvalue, max_eigenvalue def admissible_region(X0, func_to_convex, xlim=None, ylim=None): l_thresh = func_to_convex(X0) - 0.2 u_thresh = func_to_convex(X0) + 0.2 func = lambda x: func_to_convex(x) - l_thresh lower_thresh_root_left, lower_thresh_root_right = brentq(func, X0 - 2, X0), brentq(func, X0, X0 + 2) plot_admissible_region(X0, xlim, ylim, func_to_convex, l_thresh, u_thresh, lower_thresh_root_left, lower_thresh_root_right) def convex_diff(X0, min_eigenvalue, func_to_convex, xlim=None, ylim=None): l_thresh = func_to_convex(X0) - 0.2 u_thresh = func_to_convex(X0) + 0.2 search_roots_distance = 10 eig = min_eigenvalue g_convex = lambda x: func_to_convex(x) + 0.5 * np.abs(eig) * (x - X0) * (x - X0) h_convex = lambda x: 0.5 * np.abs(eig) * (x - X0) * (x - X0) grad_func_to_convex = grad(func_to_convex) g_minus_l_tangent = lambda x: func_to_convex(X0) + grad_func_to_convex(X0) * (x - X0) - l_thresh # Condition 1: g(x) < U. # Check where g(x) = U and write in title func = lambda x: g_convex(x) - u_thresh upper_thresh_root_left, upper_thresh_root_right = brentq(func, X0 - search_roots_distance, X0), brentq(func, X0, X0 + search_roots_distance) assert upper_thresh_root_left <= upper_thresh_root_right, str(upper_thresh_root_left) + "," + str(upper_thresh_root_right) upper_safe_zone_size = upper_thresh_root_right - upper_thresh_root_left # Condition 2: Tangent g(x)-L bigger than h(x) # Check where Tangent g(x)-L = h(x) and write in figure title func = lambda x: g_minus_l_tangent(x) - h_convex(x) lower_thresh_root_left, lower_thresh_root_right = brentq(func, X0 - search_roots_distance, X0), brentq(func, X0, X0 + search_roots_distance) assert lower_thresh_root_left <= lower_thresh_root_right, str(lower_thresh_root_left) + "," + str(lower_thresh_root_right) lower_safe_zone_size = lower_thresh_root_right - lower_thresh_root_left if upper_safe_zone_size == 0 or lower_safe_zone_size == 0: safe_zone_size = 0 else: safe_zone_size = np.minimum(upper_thresh_root_right, lower_thresh_root_right) - np.maximum(upper_thresh_root_left, lower_thresh_root_left) assert safe_zone_size >= 0, str(safe_zone_size) plot_2d_convex_diff(X0, xlim, ylim, func_to_convex, l_thresh, u_thresh, g_convex, h_convex, g_minus_l_tangent, np.maximum(lower_thresh_root_left, upper_thresh_root_left), np.minimum(lower_thresh_root_right, upper_thresh_root_right)) return safe_zone_size, upper_safe_zone_size, lower_safe_zone_size def concave_diff(X0, max_eigenvalue, func_to_concave, xlim=None, ylim=None): l_thresh = func_to_concave(X0) - 0.2 u_thresh = func_to_concave(X0) + 0.2 search_roots_distance = 10 g_concave = lambda x: func_to_concave(x) - 0.5 * max_eigenvalue * (x - X0) * (x - X0) h_concave = lambda x: -0.5 * max_eigenvalue * (x - X0) * (x - X0) grad_func_to_convex = grad(func_to_concave) g_minus_u_tangent = lambda x: func_to_concave(X0) + grad_func_to_convex(X0) * (x - X0) - u_thresh # Condition 1: g(x) > L. # Check where g(x) = L and write in title func = lambda x: g_concave(x) - l_thresh lower_thresh_root_left, lower_thresh_root_right = brentq(func, X0 - search_roots_distance, X0), brentq(func, X0, X0 + search_roots_distance) assert lower_thresh_root_left <= lower_thresh_root_right, str(lower_thresh_root_left) + "," + str(lower_thresh_root_right) lower_safe_zone_size = lower_thresh_root_right - lower_thresh_root_left # Condition 2: Tangent g(x)-U smaller than h(x) # Check where Tangent g(x)-U = h(x) and write in figure title func = lambda x: g_minus_u_tangent(x) - h_concave(x) upper_thresh_root_left, upper_thresh_root_right = brentq(func, X0 - search_roots_distance, X0), brentq(func, X0, X0 + search_roots_distance) assert upper_thresh_root_left <= upper_thresh_root_right, str(upper_thresh_root_left) + "," + str(upper_thresh_root_right) upper_safe_zone_size = upper_thresh_root_right - upper_thresh_root_left if upper_safe_zone_size == 0 or lower_safe_zone_size == 0: safe_zone_size = 0 else: safe_zone_size = np.minimum(upper_thresh_root_right, lower_thresh_root_right) - np.maximum( upper_thresh_root_left, lower_thresh_root_left) assert safe_zone_size >= 0, str(safe_zone_size) plot_2d_concave_diff(X0, xlim, ylim, func_to_concave, l_thresh, u_thresh, g_concave, h_concave, g_minus_u_tangent, np.maximum(lower_thresh_root_left, upper_thresh_root_left), np.minimum(lower_thresh_root_right, upper_thresh_root_right)) return safe_zone_size, upper_safe_zone_size, lower_safe_zone_size if __name__ == "__main__": # Figure 1 X0 = 0.5 * np.pi domain = ((X0 - 3, X0 + 3),) xlim = [X0 - 2.1, X0 + 2.1] ylim = [-0.5, 1.5] X0 = np.array([X0]) min_eigenvalue, max_eigenvalue = find_min_and_max_eigenvalues(func_sine, domain) # Plot the concave and convex diffs convex_diff(X0, min_eigenvalue, func_sine, xlim=xlim, ylim=ylim) concave_diff(X0, max_eigenvalue, func_sine, xlim=xlim, ylim=ylim) admissible_region(X0, func_sine, xlim=xlim, ylim=ylim)
0.768038
0.566858
from pydeep.core import Function import numpy as np class Loss(Function): def backward(self): gx = self.cache["local_gx"] return gx class CrossEntropyLoss(Loss): def forward(self, x, y): """ Descr.: calculate the mean loss of the batch :param x: final layer of the network (batch_size, n_dim), no need for softmax as we calculate it here :param y: truth values (batch_size, 1), each entry in the array is the an integer indicating the class of the data point :return: the mean cross entropy loss of the batch """ exp_x = np.exp(x) probs = exp_x / np.sum(exp_x, axis=1, keepdims=True) logprobs = -np.log([probs[i, y[i]] for i in range(len(probs))]) crossentropy_loss = np.mean(logprobs) self.cache["probs"] = probs self.cache['y'] = y return crossentropy_loss def local_grad(self, x, y): """ Descr.: cache the local gradient for backprop. :param x: final layer of the network (batch_size, n_dim), no need for softmax as we calculate it here :param y: truth values (batch_size, 1), each entry in the array is the an integer indicating the class of the data point """ probs = self.cache["probs"] truth = np.zeros_like(probs) for i, j in enumerate(y): truth[i, j] = 1.0 self.cache["local_gx"] = (probs - truth) / float(len(x)) class MSELoss(Loss): def forward(self, x, y): """ Descr.: calculate mean loss of the batch, the avg. loss of the current batch :param x: predicted values, (batch_size, 1) :param y: truth values, (batch_sze, 1) :return: scalar value, the mse of the batch """ loss = ((x - y)**2).mean() return loss def local_grad(self, x, y): """ Descr.: calulate dL/dx, and cache it for backprop. :param x: predicted values, (batch_size, 1) :param y: truth values, (batch_sze, 1) """ self.cache["local_gx"] = 2 * (x - y) / x.shape[0]
pydeep/loss.py
from pydeep.core import Function import numpy as np class Loss(Function): def backward(self): gx = self.cache["local_gx"] return gx class CrossEntropyLoss(Loss): def forward(self, x, y): """ Descr.: calculate the mean loss of the batch :param x: final layer of the network (batch_size, n_dim), no need for softmax as we calculate it here :param y: truth values (batch_size, 1), each entry in the array is the an integer indicating the class of the data point :return: the mean cross entropy loss of the batch """ exp_x = np.exp(x) probs = exp_x / np.sum(exp_x, axis=1, keepdims=True) logprobs = -np.log([probs[i, y[i]] for i in range(len(probs))]) crossentropy_loss = np.mean(logprobs) self.cache["probs"] = probs self.cache['y'] = y return crossentropy_loss def local_grad(self, x, y): """ Descr.: cache the local gradient for backprop. :param x: final layer of the network (batch_size, n_dim), no need for softmax as we calculate it here :param y: truth values (batch_size, 1), each entry in the array is the an integer indicating the class of the data point """ probs = self.cache["probs"] truth = np.zeros_like(probs) for i, j in enumerate(y): truth[i, j] = 1.0 self.cache["local_gx"] = (probs - truth) / float(len(x)) class MSELoss(Loss): def forward(self, x, y): """ Descr.: calculate mean loss of the batch, the avg. loss of the current batch :param x: predicted values, (batch_size, 1) :param y: truth values, (batch_sze, 1) :return: scalar value, the mse of the batch """ loss = ((x - y)**2).mean() return loss def local_grad(self, x, y): """ Descr.: calulate dL/dx, and cache it for backprop. :param x: predicted values, (batch_size, 1) :param y: truth values, (batch_sze, 1) """ self.cache["local_gx"] = 2 * (x - y) / x.shape[0]
0.905641
0.706558
import hashlib import os import pytest from pex import dist_metadata, resolver, targets from pex.fetcher import URLFetcher from pex.pip.tool import PackageIndexConfiguration from pex.resolve.configured_resolver import ConfiguredResolver from pex.resolve.locked_resolve import LockConfiguration, LockedResolve, LockStyle from pex.resolve.lockfile.operations import LockObserver from pex.resolve.resolved_requirement import Pin from pex.resolve.resolver_configuration import PipConfiguration from pex.resolve.testing import normalize_locked_resolve from pex.resolver import Downloaded, LocalDistribution, WheelBuilder from pex.typing import TYPE_CHECKING from pex.util import CacheHelper if TYPE_CHECKING: from typing import Any, Dict, Iterable, Tuple def normalize( locked_resolves, # type: Tuple[LockedResolve, ...] skip_additional_artifacts=False, # type: bool skip_urls=False, # type: bool skip_verified=False, # type: bool ): # type: (...) -> Tuple[LockedResolve, ...] return tuple( normalize_locked_resolve( lock, skip_additional_artifacts=skip_additional_artifacts, skip_urls=skip_urls, skip_verified=skip_verified, ) for lock in locked_resolves ) def create_lock_observer(lock_configuration): # type: (LockConfiguration) -> LockObserver pip_configuration = PipConfiguration() return LockObserver( lock_configuration=lock_configuration, resolver=ConfiguredResolver(pip_configuration=pip_configuration), wheel_builder=WheelBuilder( package_index_configuration=PackageIndexConfiguration.create( resolver_version=pip_configuration.resolver_version, indexes=pip_configuration.repos_configuration.indexes, find_links=pip_configuration.repos_configuration.find_links, network_configuration=pip_configuration.network_configuration, ), prefer_older_binary=pip_configuration.prefer_older_binary, use_pep517=pip_configuration.use_pep517, build_isolation=pip_configuration.build_isolation, ), url_fetcher=URLFetcher(network_configuration=pip_configuration.network_configuration), ) def create_lock( lock_configuration, # type: LockConfiguration **kwargs # type: Any ): # type: (...) -> Tuple[Downloaded, Tuple[LockedResolve, ...]] lock_observer = create_lock_observer(lock_configuration) downloaded = resolver.download(observer=lock_observer, **kwargs) return downloaded, lock_observer.lock(downloaded) @pytest.mark.parametrize( "requirements", ( pytest.param(["ansicolors==1.1.8"], id="pinned-no-transitive-deps"), pytest.param(["isort==4.3.21"], id="pinned-transitive-deps"), pytest.param(["ansicolors"], id="float-no-transitive-deps"), pytest.param(["isort"], id="float-transitive-deps"), ), ) @pytest.mark.parametrize( "lock_configuration", ( pytest.param(LockConfiguration(style=LockStyle.STRICT), id="strict"), pytest.param(LockConfiguration(style=LockStyle.SOURCES), id="sources"), ), ) def test_lock_single_target( tmpdir, # type: Any requirements, # type: Iterable[str] lock_configuration, # type: LockConfiguration ): # type: (...) -> None downloaded, locked_resolves = create_lock(lock_configuration, requirements=requirements) assert 1 == len(locked_resolves) lock = locked_resolves[0] assert targets.current().platform.tag == lock.platform_tag def pin(local_distribution): # type: (LocalDistribution) -> Pin project_name_and_version = dist_metadata.project_name_and_version(local_distribution.path) assert project_name_and_version is not None return Pin.canonicalize(project_name_and_version) local_distributions_by_pin = { pin(local_dist): local_dist for local_dist in downloaded.local_distributions } # type: Dict[Pin, LocalDistribution] assert sorted(local_distributions_by_pin) == sorted( locked_req.pin for locked_req in lock.locked_requirements ), ( "Expected the actual set of downloaded distributions to match the set of pinned " "requirements in the lock." ) for locked_req in lock.locked_requirements: fingerprint = locked_req.artifact.fingerprint assert fingerprint.hash == CacheHelper.hash( path=local_distributions_by_pin[locked_req.pin].path, hasher=lambda: hashlib.new(fingerprint.algorithm), ), ( "Expected the fingerprint of the downloaded distribution to match the fingerprint " "recorded in the lock." ) find_links_repo = os.path.join(str(tmpdir), "find-links") os.mkdir(find_links_repo) for local_dist in downloaded.local_distributions: os.symlink( local_dist.path, os.path.join(find_links_repo, os.path.basename(local_dist.path)) ) _, find_links_locked_resolves = create_lock( lock_configuration, requirements=requirements, indexes=[], find_links=[find_links_repo], ) assert normalize( locked_resolves, skip_additional_artifacts=True, skip_urls=True, skip_verified=True ) == normalize( find_links_locked_resolves, skip_additional_artifacts=True, skip_urls=True, skip_verified=True, ), ( "Expected a find-links lock to match an equivalent PyPI lock except for the primary " "artifact urls and their verification status and lack of additional artifacts (since these " "are never downloaded; but instead, just recorded)." ) lock_file = os.path.join(str(tmpdir), "requirements.txt") with open(lock_file, "w") as fp: lock.emit_requirements(fp) _, export_locked_resolves = create_lock(lock_configuration, requirement_files=[lock_file]) assert normalize(locked_resolves) == normalize(export_locked_resolves), ( "Expected the download used to create a lock to be reproduced by a download using the " "requirements generated from the lock." )
tests/integration/test_locked_resolve.py
import hashlib import os import pytest from pex import dist_metadata, resolver, targets from pex.fetcher import URLFetcher from pex.pip.tool import PackageIndexConfiguration from pex.resolve.configured_resolver import ConfiguredResolver from pex.resolve.locked_resolve import LockConfiguration, LockedResolve, LockStyle from pex.resolve.lockfile.operations import LockObserver from pex.resolve.resolved_requirement import Pin from pex.resolve.resolver_configuration import PipConfiguration from pex.resolve.testing import normalize_locked_resolve from pex.resolver import Downloaded, LocalDistribution, WheelBuilder from pex.typing import TYPE_CHECKING from pex.util import CacheHelper if TYPE_CHECKING: from typing import Any, Dict, Iterable, Tuple def normalize( locked_resolves, # type: Tuple[LockedResolve, ...] skip_additional_artifacts=False, # type: bool skip_urls=False, # type: bool skip_verified=False, # type: bool ): # type: (...) -> Tuple[LockedResolve, ...] return tuple( normalize_locked_resolve( lock, skip_additional_artifacts=skip_additional_artifacts, skip_urls=skip_urls, skip_verified=skip_verified, ) for lock in locked_resolves ) def create_lock_observer(lock_configuration): # type: (LockConfiguration) -> LockObserver pip_configuration = PipConfiguration() return LockObserver( lock_configuration=lock_configuration, resolver=ConfiguredResolver(pip_configuration=pip_configuration), wheel_builder=WheelBuilder( package_index_configuration=PackageIndexConfiguration.create( resolver_version=pip_configuration.resolver_version, indexes=pip_configuration.repos_configuration.indexes, find_links=pip_configuration.repos_configuration.find_links, network_configuration=pip_configuration.network_configuration, ), prefer_older_binary=pip_configuration.prefer_older_binary, use_pep517=pip_configuration.use_pep517, build_isolation=pip_configuration.build_isolation, ), url_fetcher=URLFetcher(network_configuration=pip_configuration.network_configuration), ) def create_lock( lock_configuration, # type: LockConfiguration **kwargs # type: Any ): # type: (...) -> Tuple[Downloaded, Tuple[LockedResolve, ...]] lock_observer = create_lock_observer(lock_configuration) downloaded = resolver.download(observer=lock_observer, **kwargs) return downloaded, lock_observer.lock(downloaded) @pytest.mark.parametrize( "requirements", ( pytest.param(["ansicolors==1.1.8"], id="pinned-no-transitive-deps"), pytest.param(["isort==4.3.21"], id="pinned-transitive-deps"), pytest.param(["ansicolors"], id="float-no-transitive-deps"), pytest.param(["isort"], id="float-transitive-deps"), ), ) @pytest.mark.parametrize( "lock_configuration", ( pytest.param(LockConfiguration(style=LockStyle.STRICT), id="strict"), pytest.param(LockConfiguration(style=LockStyle.SOURCES), id="sources"), ), ) def test_lock_single_target( tmpdir, # type: Any requirements, # type: Iterable[str] lock_configuration, # type: LockConfiguration ): # type: (...) -> None downloaded, locked_resolves = create_lock(lock_configuration, requirements=requirements) assert 1 == len(locked_resolves) lock = locked_resolves[0] assert targets.current().platform.tag == lock.platform_tag def pin(local_distribution): # type: (LocalDistribution) -> Pin project_name_and_version = dist_metadata.project_name_and_version(local_distribution.path) assert project_name_and_version is not None return Pin.canonicalize(project_name_and_version) local_distributions_by_pin = { pin(local_dist): local_dist for local_dist in downloaded.local_distributions } # type: Dict[Pin, LocalDistribution] assert sorted(local_distributions_by_pin) == sorted( locked_req.pin for locked_req in lock.locked_requirements ), ( "Expected the actual set of downloaded distributions to match the set of pinned " "requirements in the lock." ) for locked_req in lock.locked_requirements: fingerprint = locked_req.artifact.fingerprint assert fingerprint.hash == CacheHelper.hash( path=local_distributions_by_pin[locked_req.pin].path, hasher=lambda: hashlib.new(fingerprint.algorithm), ), ( "Expected the fingerprint of the downloaded distribution to match the fingerprint " "recorded in the lock." ) find_links_repo = os.path.join(str(tmpdir), "find-links") os.mkdir(find_links_repo) for local_dist in downloaded.local_distributions: os.symlink( local_dist.path, os.path.join(find_links_repo, os.path.basename(local_dist.path)) ) _, find_links_locked_resolves = create_lock( lock_configuration, requirements=requirements, indexes=[], find_links=[find_links_repo], ) assert normalize( locked_resolves, skip_additional_artifacts=True, skip_urls=True, skip_verified=True ) == normalize( find_links_locked_resolves, skip_additional_artifacts=True, skip_urls=True, skip_verified=True, ), ( "Expected a find-links lock to match an equivalent PyPI lock except for the primary " "artifact urls and their verification status and lack of additional artifacts (since these " "are never downloaded; but instead, just recorded)." ) lock_file = os.path.join(str(tmpdir), "requirements.txt") with open(lock_file, "w") as fp: lock.emit_requirements(fp) _, export_locked_resolves = create_lock(lock_configuration, requirement_files=[lock_file]) assert normalize(locked_resolves) == normalize(export_locked_resolves), ( "Expected the download used to create a lock to be reproduced by a download using the " "requirements generated from the lock." )
0.767516
0.164382
from lxml import etree import os.path import os def rename(filepath, srcext, destext): if os.name == 'nt': # Can't rename to existing files, so we have to move the old one, then # rename, then delete the old one. if os.path.exists(filepath + destext): if os.path.exists(filepath + '.bak'): os.unlink(filepath + '.bak') os.rename(filepath + destext, filepath + ".bak") os.rename(filepath + srcext, filepath + destext) os.unlink(filepath + ".bak") else: os.rename(filepath + srcext, filepath + destext) else: os.rename(filepath + srcext, filepath + destext) class XmlStore(object): class CachedTree(object): """A cached XML tree, with some properties. """ __slots__ = ("tree", "modified") def __init__(self, tree, modified=False): self.tree = tree self.modified = modified def __len__(self): return len(self.tree.getroot()) def write(self, filepath): """Write the cached tree to a given filepath. The ".xml" extension is added to the end of the filepath. """ if not os.path.exists(os.path.dirname(filepath)): os.makedirs(os.path.dirname(filepath)) fd = open(filepath + ".tmp", "wb") try: self.tree.write(fd, encoding="UTF-8", xml_declaration=True) finally: fd.close() # Atomic replace of the old file with the new one. rename(filepath, ".tmp", ".xml") self.modified = False def set(self, record): """Set a record. The record must be an Element, with the "id" property set to the id for the record. """ self.modified = True record_id = record.get(u'id') assert record_id is not None old = self.tree.xpath('/*/*[@id=$id]', id=record_id) if len(old) != 0: old[0].getparent().remove(old[0]) self.tree.getroot().append(record) def remove(self, id): """Remove the record with the given id. Raises KeyError if the record isn't found. """ self.modified = True old = self.tree.xpath('/*/*[@id=$id]', id=id) if len(old) == 0: raise KeyError("Key with id %r not found" % id) assert len(old) == 1 old[0].getparent().remove(old[0]) def get(self, id): """Get the record with the given id. Raises KeyError if the record isn't found. """ old = self.tree.xpath('/*/*[@id=$id]', id=id) if len(old) == 0: raise KeyError("Key with id %r not found" % id) assert len(old) == 1 return old[0] class Cache(object): """A cache of parsed XML files. """ def __init__(self): self.cache = {} def __del__(self): """Flush any modified trees on delete. Don't write code relying on this method; it's here to try and prevent dataloss, but you should always call flush() (or clear()) explicitly before exiting. """ self.flush() def flush(self): """Write any modified trees in the cache to disk. """ for filepath, tree in self.cache.iteritems(): if tree.modified: tree.write(filepath) def clear(self): """Clear the cache, flushing any modified trees. """ self.flush() self.cache = {} def get(self, filepath): """Get a tree from the cache. Returns a CachedTree, creating an empty one if the file didn't exist. """ tree = self.cache.get(filepath, None) if tree is not None: return tree # Clear the cache - for now, we only keep one parsed file in it, # but this could easily be modified in future. self.clear() if os.path.exists(filepath + '.xml'): fd = open(filepath + '.xml', "rb") try: tree = XmlStore.CachedTree(etree.parse(fd)) finally: fd.close() elif os.path.exists(filepath + '.bak'): # This can happen on windows if we crashed after renaming the # old file away, but before writing the new one. fd = open(filepath + '.bak', "rb") try: tree = XmlStore.CachedTree(etree.parse(fd)) finally: fd.close() else: # Make an empty container tree. # Don't mark it as modified, because if no entries get put into # it, we don't want to write it back. xmltree = etree.ElementTree(etree.Element("container")) tree = XmlStore.CachedTree(xmltree) self.cache[filepath] = tree return tree def __init__(self, topdir, items_per_file=100): """Make a new XML store, in the directory given by topdir. The XML store stores the records it is given in a set of XML files. It puts at most `items_per_file` items in each file. """ self.topdir = topdir # Dictionary mapping from id to file number. self.idmap = {} self.idmap_modified = False # Meta info dictionary. self.meta = {} # Next file number to allocate. self.next_num = 0 # Number of files to put in each directory. self.files_per_dir = 10 # Number of items to put in each file. self.items_per_file = items_per_file # Cache of parsed files. self.tree_cache = XmlStore.Cache() # Read the idmap from idmap.xml self.idmap_path = os.path.join(self.topdir, 'idmap') fd = None if os.path.exists(self.idmap_path + ".xml"): fd = open(self.idmap_path + ".xml", "rb") elif os.path.exists(self.idmap_path + ".bak"): fd = open(self.idmap_path + ".bak", "rb") if fd is not None: try: idmap_xml = etree.parse(fd) finally: fd.close() for elt in idmap_xml.xpath(u'/*/id'): num = int(elt.text) self.idmap[elt.get(u'id')] = num if num > self.next_num: self.next_num = num for elt in idmap_xml.xpath(u'/*/meta'): self.meta[elt.get(u'name')] = elt.text def __del__(self): """Flush any modified trees on delete. Don't write code relying on this method; it's here to try and prevent dataloss, but you should always call flush() or close() explicitly before exiting. """ self.flush() def __len__(self): return len(self.idmap) def __iter__(self): keys = self.idmap.keys() keys.sort() for key in keys: yield key def close(self): """Cleanup, flushing all changes to disk, and dropping any cache items. """ self.flush() self.tree_cache.clear() self.idmap = None def flush(self): """Flush all changes to disk. """ if self.idmap_modified: map = etree.Element("idmap") for id in sorted(self.idmap.keys()): elt = etree.SubElement(map, "id") elt.set('id', id) elt.text = unicode(self.idmap[id]) for name in sorted(self.meta.keys()): elt = etree.SubElement(map, "meta") elt.set('name', name) elt.text = unicode(self.meta[name]) map = etree.ElementTree(map) if not os.path.exists(os.path.dirname(self.idmap_path)): os.makedirs(os.path.dirname(self.idmap_path)) fd = open(self.idmap_path + ".tmp", "wb") try: map.write(fd, encoding="UTF-8", xml_declaration=True) finally: fd.close() # Atomic replace of the old file with the new one. rename(self.idmap_path, ".tmp", ".xml") self.idmap_modified = False self.tree_cache.flush() def _num_to_path(self, filenum): """Convert a file number to the path for that file. Returns the path without the extension. """ components = [] while filenum >= self.files_per_dir: components.append(filenum % self.files_per_dir) filenum = filenum // self.files_per_dir components.append(filenum) components.reverse() result = [] for c in components[:-1]: result.append("D%d" % c) result.append("F%d" % components[-1]) return os.path.join(self.topdir, *result) def _get_tree(self, filenum): """Get the tree for a given filenum. """ return self.tree_cache.get(self._num_to_path(filenum)) def set(self, record): """Set a record. `record` should be an lxml Element object, or a unicode string containing raw XML. The record must have an "id" attribute containing the ID to use. If a record with the same id already exists, it is replaced. """ assert not isinstance(record, str) if isinstance(record, unicode): record = etree.fromstring(record) id = record.get(u'id') assert id is not None filenum = self.idmap.get(id, None) if filenum is None: filenum = self.next_num tree = self._get_tree(filenum) if len(tree) >= self.items_per_file: self.next_num += 1 filenum = self.next_num tree = self._get_tree(filenum) self.idmap[id] = filenum self.idmap_modified = True else: tree = self._get_tree(filenum) tree.set(record) def remove(self, id): """Remove the record with a given id. Raises KeyError if the record isn't found. """ filenum = self.idmap[id] tree = self._get_tree(filenum) tree.remove(id) del self.idmap[id] self.idmap_modified = True def get(self, id): """Get the record with a given id. Raises KeyError if the record isn't found. """ filenum = self.idmap[id] tree = self._get_tree(filenum) return tree.get(id) def get_meta(self, name): """Get a metadata value. Raises KeyError if the value isn't found. """ assert isinstance(name, unicode) return self.meta[name] def set_meta(self, name, value): """Set a metadata value. """ assert isinstance(name, unicode) assert isinstance(value, unicode) self.meta[name] = value self.idmap_modified = True def del_meta(self, name): """Delete a metadata value. """ assert isinstance(name, unicode) del self.meta[name] self.idmap_modified = True
web/xmlstore.py
from lxml import etree import os.path import os def rename(filepath, srcext, destext): if os.name == 'nt': # Can't rename to existing files, so we have to move the old one, then # rename, then delete the old one. if os.path.exists(filepath + destext): if os.path.exists(filepath + '.bak'): os.unlink(filepath + '.bak') os.rename(filepath + destext, filepath + ".bak") os.rename(filepath + srcext, filepath + destext) os.unlink(filepath + ".bak") else: os.rename(filepath + srcext, filepath + destext) else: os.rename(filepath + srcext, filepath + destext) class XmlStore(object): class CachedTree(object): """A cached XML tree, with some properties. """ __slots__ = ("tree", "modified") def __init__(self, tree, modified=False): self.tree = tree self.modified = modified def __len__(self): return len(self.tree.getroot()) def write(self, filepath): """Write the cached tree to a given filepath. The ".xml" extension is added to the end of the filepath. """ if not os.path.exists(os.path.dirname(filepath)): os.makedirs(os.path.dirname(filepath)) fd = open(filepath + ".tmp", "wb") try: self.tree.write(fd, encoding="UTF-8", xml_declaration=True) finally: fd.close() # Atomic replace of the old file with the new one. rename(filepath, ".tmp", ".xml") self.modified = False def set(self, record): """Set a record. The record must be an Element, with the "id" property set to the id for the record. """ self.modified = True record_id = record.get(u'id') assert record_id is not None old = self.tree.xpath('/*/*[@id=$id]', id=record_id) if len(old) != 0: old[0].getparent().remove(old[0]) self.tree.getroot().append(record) def remove(self, id): """Remove the record with the given id. Raises KeyError if the record isn't found. """ self.modified = True old = self.tree.xpath('/*/*[@id=$id]', id=id) if len(old) == 0: raise KeyError("Key with id %r not found" % id) assert len(old) == 1 old[0].getparent().remove(old[0]) def get(self, id): """Get the record with the given id. Raises KeyError if the record isn't found. """ old = self.tree.xpath('/*/*[@id=$id]', id=id) if len(old) == 0: raise KeyError("Key with id %r not found" % id) assert len(old) == 1 return old[0] class Cache(object): """A cache of parsed XML files. """ def __init__(self): self.cache = {} def __del__(self): """Flush any modified trees on delete. Don't write code relying on this method; it's here to try and prevent dataloss, but you should always call flush() (or clear()) explicitly before exiting. """ self.flush() def flush(self): """Write any modified trees in the cache to disk. """ for filepath, tree in self.cache.iteritems(): if tree.modified: tree.write(filepath) def clear(self): """Clear the cache, flushing any modified trees. """ self.flush() self.cache = {} def get(self, filepath): """Get a tree from the cache. Returns a CachedTree, creating an empty one if the file didn't exist. """ tree = self.cache.get(filepath, None) if tree is not None: return tree # Clear the cache - for now, we only keep one parsed file in it, # but this could easily be modified in future. self.clear() if os.path.exists(filepath + '.xml'): fd = open(filepath + '.xml', "rb") try: tree = XmlStore.CachedTree(etree.parse(fd)) finally: fd.close() elif os.path.exists(filepath + '.bak'): # This can happen on windows if we crashed after renaming the # old file away, but before writing the new one. fd = open(filepath + '.bak', "rb") try: tree = XmlStore.CachedTree(etree.parse(fd)) finally: fd.close() else: # Make an empty container tree. # Don't mark it as modified, because if no entries get put into # it, we don't want to write it back. xmltree = etree.ElementTree(etree.Element("container")) tree = XmlStore.CachedTree(xmltree) self.cache[filepath] = tree return tree def __init__(self, topdir, items_per_file=100): """Make a new XML store, in the directory given by topdir. The XML store stores the records it is given in a set of XML files. It puts at most `items_per_file` items in each file. """ self.topdir = topdir # Dictionary mapping from id to file number. self.idmap = {} self.idmap_modified = False # Meta info dictionary. self.meta = {} # Next file number to allocate. self.next_num = 0 # Number of files to put in each directory. self.files_per_dir = 10 # Number of items to put in each file. self.items_per_file = items_per_file # Cache of parsed files. self.tree_cache = XmlStore.Cache() # Read the idmap from idmap.xml self.idmap_path = os.path.join(self.topdir, 'idmap') fd = None if os.path.exists(self.idmap_path + ".xml"): fd = open(self.idmap_path + ".xml", "rb") elif os.path.exists(self.idmap_path + ".bak"): fd = open(self.idmap_path + ".bak", "rb") if fd is not None: try: idmap_xml = etree.parse(fd) finally: fd.close() for elt in idmap_xml.xpath(u'/*/id'): num = int(elt.text) self.idmap[elt.get(u'id')] = num if num > self.next_num: self.next_num = num for elt in idmap_xml.xpath(u'/*/meta'): self.meta[elt.get(u'name')] = elt.text def __del__(self): """Flush any modified trees on delete. Don't write code relying on this method; it's here to try and prevent dataloss, but you should always call flush() or close() explicitly before exiting. """ self.flush() def __len__(self): return len(self.idmap) def __iter__(self): keys = self.idmap.keys() keys.sort() for key in keys: yield key def close(self): """Cleanup, flushing all changes to disk, and dropping any cache items. """ self.flush() self.tree_cache.clear() self.idmap = None def flush(self): """Flush all changes to disk. """ if self.idmap_modified: map = etree.Element("idmap") for id in sorted(self.idmap.keys()): elt = etree.SubElement(map, "id") elt.set('id', id) elt.text = unicode(self.idmap[id]) for name in sorted(self.meta.keys()): elt = etree.SubElement(map, "meta") elt.set('name', name) elt.text = unicode(self.meta[name]) map = etree.ElementTree(map) if not os.path.exists(os.path.dirname(self.idmap_path)): os.makedirs(os.path.dirname(self.idmap_path)) fd = open(self.idmap_path + ".tmp", "wb") try: map.write(fd, encoding="UTF-8", xml_declaration=True) finally: fd.close() # Atomic replace of the old file with the new one. rename(self.idmap_path, ".tmp", ".xml") self.idmap_modified = False self.tree_cache.flush() def _num_to_path(self, filenum): """Convert a file number to the path for that file. Returns the path without the extension. """ components = [] while filenum >= self.files_per_dir: components.append(filenum % self.files_per_dir) filenum = filenum // self.files_per_dir components.append(filenum) components.reverse() result = [] for c in components[:-1]: result.append("D%d" % c) result.append("F%d" % components[-1]) return os.path.join(self.topdir, *result) def _get_tree(self, filenum): """Get the tree for a given filenum. """ return self.tree_cache.get(self._num_to_path(filenum)) def set(self, record): """Set a record. `record` should be an lxml Element object, or a unicode string containing raw XML. The record must have an "id" attribute containing the ID to use. If a record with the same id already exists, it is replaced. """ assert not isinstance(record, str) if isinstance(record, unicode): record = etree.fromstring(record) id = record.get(u'id') assert id is not None filenum = self.idmap.get(id, None) if filenum is None: filenum = self.next_num tree = self._get_tree(filenum) if len(tree) >= self.items_per_file: self.next_num += 1 filenum = self.next_num tree = self._get_tree(filenum) self.idmap[id] = filenum self.idmap_modified = True else: tree = self._get_tree(filenum) tree.set(record) def remove(self, id): """Remove the record with a given id. Raises KeyError if the record isn't found. """ filenum = self.idmap[id] tree = self._get_tree(filenum) tree.remove(id) del self.idmap[id] self.idmap_modified = True def get(self, id): """Get the record with a given id. Raises KeyError if the record isn't found. """ filenum = self.idmap[id] tree = self._get_tree(filenum) return tree.get(id) def get_meta(self, name): """Get a metadata value. Raises KeyError if the value isn't found. """ assert isinstance(name, unicode) return self.meta[name] def set_meta(self, name, value): """Set a metadata value. """ assert isinstance(name, unicode) assert isinstance(value, unicode) self.meta[name] = value self.idmap_modified = True def del_meta(self, name): """Delete a metadata value. """ assert isinstance(name, unicode) del self.meta[name] self.idmap_modified = True
0.519765
0.181463
from rdkit import Chem from rdkit.Chem import Lipinski as LPK import pandas as pd def CalculateMolWeight(mol): """ Calculation of molecular weight. Note that not including H Parameters: mol: rdkit molecule Returns: MolWeight: Molecular weight """ MolWeight = 0 for atom in mol.GetAtoms(): MolWeight = MolWeight + atom.GetMass() return MolWeight def CalculateAverageMolWeight(mol): """ Calculation of average molecular weight. Note that not including H Parameters: mol: rdkit molecule Returns: AvgMolWeight: Average Molecular weight """ MolWeight = 0 for atom in mol.GetAtoms(): MolWeight = MolWeight + atom.GetMass() return MolWeight / mol.GetNumAtoms() def CalculateHydrogenNumber(mol): """ Calculation of Number of Hydrogen in a molecule Parameters: mol: rdkit molecule Returns: HydrogenNumber """ i = 0 Hmol = Chem.AddHs(mol) for atom in Hmol.GetAtoms(): if atom.GetAtomicNum() == 1: i = i + 1 return i def CalculateHalogenNumber(mol): """ Calculation of Halogen counts in a molecule Parameters: mol: rdkit molecule Returns: HalogenNumber """ i = 0 for atom in mol.GetAtoms(): if atom.GetAtomicNum() == 9 or atom.GetAtomicNum() == 17 or atom.GetAtomicNum() == 35 or atom.GetAtomicNum() == 53: i = i + 1 return i def CalculateHeteroNumber(mol): """ Calculation of Hetero counts in a molecule Parameters: mol: rdkit molecule Returns: HeteroNumber """ i = 0 for atom in mol.GetAtoms(): if atom.GetAtomicNum() == 6 or atom.GetAtomicNum() == 1: i = i + 1 return mol.GetNumAtoms() - i def CalculateHeavyAtomNumber(mol): """ Calculation of Heavy atom counts in a molecule Parameters: mol: rdkit molecule Returns: Heavy Atom Number """ return mol.GetNumHeavyAtoms() def _CalculateElementNumber(mol, AtomicNumber=6): """ **Internal used only** Calculation of element counts with atomic number equal to n in a molecule """ i = 0 for atom in mol.GetAtoms(): if atom.GetAtomicNum() == AtomicNumber: i = i + 1 return i def CalculateFlorineNumber(mol): """ Calculation of Florine count in a molecule Parameters: mol: rdkit molecule Returns: Florine Number """ return _CalculateElementNumber(mol, AtomicNumber=9) def CalculateChlorineNumber(mol): """ Calculation of Chlorine count in a molecule Parameters: mol: rdkit molecule Returns: Chlorine Number """ return _CalculateElementNumber(mol, AtomicNumber=17) def CalculateBromineNumber(mol): """ Calculation of Bromine counts in a molecule Parameters: mol: rdkit molecule Returns: Bromine Number """ return _CalculateElementNumber(mol, AtomicNumber=35) def CalculateIodineNumber(mol): """ Calculation of Iodine counts in a molecule Parameters: mol: rdkit molecule Returns: Iodine Number """ return _CalculateElementNumber(mol, AtomicNumber=53) def CalculateCarbonNumber(mol): """ Calculation of Carbon number in a molecule Parameters: mol: rdkit molecule Returns: Carbon Number """ return _CalculateElementNumber(mol, AtomicNumber=6) def CalculatePhosphorNumber(mol): """ Calculation of Phosphorus number in a molecule Parameters: mol: rdkit molecule Returns: Heavy Atom Number """ return _CalculateElementNumber(mol, AtomicNumber=15) def CalculateSulfurNumber(mol): """ Calculation of Sulfur count in a molecule Parameters: mol: rdkit molecule Returns: Sulfur Number """ return _CalculateElementNumber(mol, AtomicNumber=16) def CalculateOxygenNumber(mol): """ Calculation of Oxygen count in a molecule Parameters: mol: rdkit molecule Returns: Oxygen Number """ return _CalculateElementNumber(mol, AtomicNumber=8) def CalculateNitrogenNumber(mol): """ Calculation of Nitrogen count in a molecule Parameters: mol: rdkit molecule Returns: Nitrogen Number """ return _CalculateElementNumber(mol, AtomicNumber=7) def CalculateRingNumber(mol): """ Calculation of ring counts in a molecule Parameters: mol: rdkit molecule Returns: Ring Number """ return Chem.GetSSSR(mol) def CalculateRotationBondNumber(mol): """ Calculation of rotation bonds count in a molecule Parameters: mol: rdkit molecule Returns: Rotation Bond Number """ return LPK.NumRotatableBonds(mol) def CalculateHdonorNumber(mol): """ Calculation of Hydrongen bond donor count in a molecule Parameters: mol: rdkit molecule Returns: Hdonor Number """ return LPK.NumHDonors(mol) def CalculateHacceptorNumber(mol): """ Calculation of Hydrogen bond acceptor count in a molecule Parameters: mol: rdkit molecule Returns: Hacceptor Number """ return LPK.NumHAcceptors(mol) def CalculateSingleBondNumber(mol): """ Calculation of single bond counts in a molecule Parameters: mol: rdkit molecule Returns: Single Bond Number """ i = 0; for bond in mol.GetBonds(): if bond.GetBondType().name == 'SINGLE': i = i + 1 return i def CalculateDoubleBondNumber(mol): """ Calculation of double bond counts in a molecule Parameters: mol: rdkit molecule Returns: Double Bond Number """ i = 0; for bond in mol.GetBonds(): if bond.GetBondType().name == 'DOUBLE': i = i + 1 return i def CalculateTripleBondNumber(mol): """ Calculation of triple bond counts in a molecule Parameters: mol: rdkit molecule Returns: Triple Bond Number """ i = 0; for bond in mol.GetBonds(): if bond.GetBondType().name == 'TRIPLE': i = i + 1 return i def CalculateAromaticBondNumber(mol): """ Calculation of aromatic bond counts in a molecule Parameters: mol: rdkit molecule Returns: Aromatic Bond Number """ i = 0; for bond in mol.GetBonds(): if bond.GetBondType().name == 'AROMATIC': i = i + 1 return i def CalculateAllAtomNumber(mol): """ Calculation of all atom counts in a molecule Parameters: mol: rdkit molecule Returns: All Atom Count """ return Chem.AddHs(mol).GetNumAtoms() def _CalculatePathN(mol, PathLength=2): """ *Internal Use Only* Calculation of the counts of path length N for a molecule """ return len(Chem.FindAllPathsOfLengthN(mol, PathLength, useBonds=1)) def CalculatePath1(mol): """ Calculation of the counts of path length 1 for a molecule """ return _CalculatePathN(mol, 1) def CalculatePath2(mol): """ Calculation of the counts of path length 2 for a molecule """ return _CalculatePathN(mol, 2) def CalculatePath3(mol): """ Calculation of the counts of path length 3 for a molecule """ return _CalculatePathN(mol, 3) def CalculatePath4(mol): """ Calculation of the counts of path length 4 for a molecule """ return _CalculatePathN(mol, 4) def CalculatePath5(mol): """ Calculation of the counts of path length 5 for a molecule """ return _CalculatePathN(mol, 5) def CalculatePath6(mol): """ Calculation of the counts of path length 6 for a molecule """ return _CalculatePathN(mol, 6) _constitutional = {'Weight': CalculateMolWeight, 'AWeight': CalculateAverageMolWeight, 'nhyd': CalculateHydrogenNumber, 'nhal': CalculateHalogenNumber, 'nhet': CalculateHeteroNumber, 'nhev': CalculateHeavyAtomNumber, 'ncof': CalculateFlorineNumber, 'ncocl': CalculateChlorineNumber, 'ncobr': CalculateBromineNumber, 'ncoi': CalculateIodineNumber, 'ncarb': CalculateCarbonNumber, 'nphos': CalculatePhosphorNumber, 'nsulph': CalculateOxygenNumber, 'noxy': CalculateOxygenNumber, 'nnitro': CalculateNitrogenNumber, 'nring': CalculateRingNumber, 'nrot': CalculateRotationBondNumber, 'ndonr': CalculateHdonorNumber, 'naccr': CalculateHacceptorNumber, 'nsb': CalculateSingleBondNumber, 'ndb': CalculateDoubleBondNumber, 'naro': CalculateAromaticBondNumber, 'ntb': CalculateTripleBondNumber, 'nta': CalculateAllAtomNumber, 'PC1': CalculatePath1, 'PC2': CalculatePath2, 'PC3': CalculatePath3, 'PC4': CalculatePath4, 'PC5': CalculatePath5, 'PC6': CalculatePath6 } def GetConstitutionalofMol(mol): """ Get the dictionary of constitutional descriptors for given molecule mol Parameters: mol: rdkit molecule Returns: constitution descriptors: dict """ result = {} for DesLabel in _constitutional.keys(): result[DesLabel] = round(_constitutional[DesLabel](mol), 3) return result def getConstitutional(df_x): """ Calculates all constitutional descriptors for the dataset Parameters: df_x: pandas.DataFrame SMILES DataFrame Returns: constitutional_descriptors: pandas.DataFrame Constitutional Descriptors DataFrame """ r = {} for key in _constitutional.keys(): r[key] = [] for m in df_x['SMILES']: mol = Chem.MolFromSmiles(m) res = GetConstitutionalofMol(mol) for key in _constitutional.keys(): r[key].append(res[key]) constitutional_descriptors = pd.DataFrame(r).round(3) return pd.DataFrame(constitutional_descriptors)
smdt/descriptors/constitution.py
from rdkit import Chem from rdkit.Chem import Lipinski as LPK import pandas as pd def CalculateMolWeight(mol): """ Calculation of molecular weight. Note that not including H Parameters: mol: rdkit molecule Returns: MolWeight: Molecular weight """ MolWeight = 0 for atom in mol.GetAtoms(): MolWeight = MolWeight + atom.GetMass() return MolWeight def CalculateAverageMolWeight(mol): """ Calculation of average molecular weight. Note that not including H Parameters: mol: rdkit molecule Returns: AvgMolWeight: Average Molecular weight """ MolWeight = 0 for atom in mol.GetAtoms(): MolWeight = MolWeight + atom.GetMass() return MolWeight / mol.GetNumAtoms() def CalculateHydrogenNumber(mol): """ Calculation of Number of Hydrogen in a molecule Parameters: mol: rdkit molecule Returns: HydrogenNumber """ i = 0 Hmol = Chem.AddHs(mol) for atom in Hmol.GetAtoms(): if atom.GetAtomicNum() == 1: i = i + 1 return i def CalculateHalogenNumber(mol): """ Calculation of Halogen counts in a molecule Parameters: mol: rdkit molecule Returns: HalogenNumber """ i = 0 for atom in mol.GetAtoms(): if atom.GetAtomicNum() == 9 or atom.GetAtomicNum() == 17 or atom.GetAtomicNum() == 35 or atom.GetAtomicNum() == 53: i = i + 1 return i def CalculateHeteroNumber(mol): """ Calculation of Hetero counts in a molecule Parameters: mol: rdkit molecule Returns: HeteroNumber """ i = 0 for atom in mol.GetAtoms(): if atom.GetAtomicNum() == 6 or atom.GetAtomicNum() == 1: i = i + 1 return mol.GetNumAtoms() - i def CalculateHeavyAtomNumber(mol): """ Calculation of Heavy atom counts in a molecule Parameters: mol: rdkit molecule Returns: Heavy Atom Number """ return mol.GetNumHeavyAtoms() def _CalculateElementNumber(mol, AtomicNumber=6): """ **Internal used only** Calculation of element counts with atomic number equal to n in a molecule """ i = 0 for atom in mol.GetAtoms(): if atom.GetAtomicNum() == AtomicNumber: i = i + 1 return i def CalculateFlorineNumber(mol): """ Calculation of Florine count in a molecule Parameters: mol: rdkit molecule Returns: Florine Number """ return _CalculateElementNumber(mol, AtomicNumber=9) def CalculateChlorineNumber(mol): """ Calculation of Chlorine count in a molecule Parameters: mol: rdkit molecule Returns: Chlorine Number """ return _CalculateElementNumber(mol, AtomicNumber=17) def CalculateBromineNumber(mol): """ Calculation of Bromine counts in a molecule Parameters: mol: rdkit molecule Returns: Bromine Number """ return _CalculateElementNumber(mol, AtomicNumber=35) def CalculateIodineNumber(mol): """ Calculation of Iodine counts in a molecule Parameters: mol: rdkit molecule Returns: Iodine Number """ return _CalculateElementNumber(mol, AtomicNumber=53) def CalculateCarbonNumber(mol): """ Calculation of Carbon number in a molecule Parameters: mol: rdkit molecule Returns: Carbon Number """ return _CalculateElementNumber(mol, AtomicNumber=6) def CalculatePhosphorNumber(mol): """ Calculation of Phosphorus number in a molecule Parameters: mol: rdkit molecule Returns: Heavy Atom Number """ return _CalculateElementNumber(mol, AtomicNumber=15) def CalculateSulfurNumber(mol): """ Calculation of Sulfur count in a molecule Parameters: mol: rdkit molecule Returns: Sulfur Number """ return _CalculateElementNumber(mol, AtomicNumber=16) def CalculateOxygenNumber(mol): """ Calculation of Oxygen count in a molecule Parameters: mol: rdkit molecule Returns: Oxygen Number """ return _CalculateElementNumber(mol, AtomicNumber=8) def CalculateNitrogenNumber(mol): """ Calculation of Nitrogen count in a molecule Parameters: mol: rdkit molecule Returns: Nitrogen Number """ return _CalculateElementNumber(mol, AtomicNumber=7) def CalculateRingNumber(mol): """ Calculation of ring counts in a molecule Parameters: mol: rdkit molecule Returns: Ring Number """ return Chem.GetSSSR(mol) def CalculateRotationBondNumber(mol): """ Calculation of rotation bonds count in a molecule Parameters: mol: rdkit molecule Returns: Rotation Bond Number """ return LPK.NumRotatableBonds(mol) def CalculateHdonorNumber(mol): """ Calculation of Hydrongen bond donor count in a molecule Parameters: mol: rdkit molecule Returns: Hdonor Number """ return LPK.NumHDonors(mol) def CalculateHacceptorNumber(mol): """ Calculation of Hydrogen bond acceptor count in a molecule Parameters: mol: rdkit molecule Returns: Hacceptor Number """ return LPK.NumHAcceptors(mol) def CalculateSingleBondNumber(mol): """ Calculation of single bond counts in a molecule Parameters: mol: rdkit molecule Returns: Single Bond Number """ i = 0; for bond in mol.GetBonds(): if bond.GetBondType().name == 'SINGLE': i = i + 1 return i def CalculateDoubleBondNumber(mol): """ Calculation of double bond counts in a molecule Parameters: mol: rdkit molecule Returns: Double Bond Number """ i = 0; for bond in mol.GetBonds(): if bond.GetBondType().name == 'DOUBLE': i = i + 1 return i def CalculateTripleBondNumber(mol): """ Calculation of triple bond counts in a molecule Parameters: mol: rdkit molecule Returns: Triple Bond Number """ i = 0; for bond in mol.GetBonds(): if bond.GetBondType().name == 'TRIPLE': i = i + 1 return i def CalculateAromaticBondNumber(mol): """ Calculation of aromatic bond counts in a molecule Parameters: mol: rdkit molecule Returns: Aromatic Bond Number """ i = 0; for bond in mol.GetBonds(): if bond.GetBondType().name == 'AROMATIC': i = i + 1 return i def CalculateAllAtomNumber(mol): """ Calculation of all atom counts in a molecule Parameters: mol: rdkit molecule Returns: All Atom Count """ return Chem.AddHs(mol).GetNumAtoms() def _CalculatePathN(mol, PathLength=2): """ *Internal Use Only* Calculation of the counts of path length N for a molecule """ return len(Chem.FindAllPathsOfLengthN(mol, PathLength, useBonds=1)) def CalculatePath1(mol): """ Calculation of the counts of path length 1 for a molecule """ return _CalculatePathN(mol, 1) def CalculatePath2(mol): """ Calculation of the counts of path length 2 for a molecule """ return _CalculatePathN(mol, 2) def CalculatePath3(mol): """ Calculation of the counts of path length 3 for a molecule """ return _CalculatePathN(mol, 3) def CalculatePath4(mol): """ Calculation of the counts of path length 4 for a molecule """ return _CalculatePathN(mol, 4) def CalculatePath5(mol): """ Calculation of the counts of path length 5 for a molecule """ return _CalculatePathN(mol, 5) def CalculatePath6(mol): """ Calculation of the counts of path length 6 for a molecule """ return _CalculatePathN(mol, 6) _constitutional = {'Weight': CalculateMolWeight, 'AWeight': CalculateAverageMolWeight, 'nhyd': CalculateHydrogenNumber, 'nhal': CalculateHalogenNumber, 'nhet': CalculateHeteroNumber, 'nhev': CalculateHeavyAtomNumber, 'ncof': CalculateFlorineNumber, 'ncocl': CalculateChlorineNumber, 'ncobr': CalculateBromineNumber, 'ncoi': CalculateIodineNumber, 'ncarb': CalculateCarbonNumber, 'nphos': CalculatePhosphorNumber, 'nsulph': CalculateOxygenNumber, 'noxy': CalculateOxygenNumber, 'nnitro': CalculateNitrogenNumber, 'nring': CalculateRingNumber, 'nrot': CalculateRotationBondNumber, 'ndonr': CalculateHdonorNumber, 'naccr': CalculateHacceptorNumber, 'nsb': CalculateSingleBondNumber, 'ndb': CalculateDoubleBondNumber, 'naro': CalculateAromaticBondNumber, 'ntb': CalculateTripleBondNumber, 'nta': CalculateAllAtomNumber, 'PC1': CalculatePath1, 'PC2': CalculatePath2, 'PC3': CalculatePath3, 'PC4': CalculatePath4, 'PC5': CalculatePath5, 'PC6': CalculatePath6 } def GetConstitutionalofMol(mol): """ Get the dictionary of constitutional descriptors for given molecule mol Parameters: mol: rdkit molecule Returns: constitution descriptors: dict """ result = {} for DesLabel in _constitutional.keys(): result[DesLabel] = round(_constitutional[DesLabel](mol), 3) return result def getConstitutional(df_x): """ Calculates all constitutional descriptors for the dataset Parameters: df_x: pandas.DataFrame SMILES DataFrame Returns: constitutional_descriptors: pandas.DataFrame Constitutional Descriptors DataFrame """ r = {} for key in _constitutional.keys(): r[key] = [] for m in df_x['SMILES']: mol = Chem.MolFromSmiles(m) res = GetConstitutionalofMol(mol) for key in _constitutional.keys(): r[key].append(res[key]) constitutional_descriptors = pd.DataFrame(r).round(3) return pd.DataFrame(constitutional_descriptors)
0.841305
0.640383
from __future__ import print_function import argparse import os.path import models.examples as ex from config import cfg from generic_op import * from midap_simulator import * from midap_software import Compiler, MidapModel def parse(): parser = argparse.ArgumentParser() parser.add_argument('-i', '--input_shape', nargs='+', type=int, required=True) parser.add_argument('-oc', '--out_chan', type=int, required=True) parser.add_argument('-k', '--kern_info', nargs='+', type=int, required=True) parser.add_argument('-l', '--layer_compiler', type=str, choices=['MIN_DRAM_ACCESS', 'HIDE_DRAM_LATENCY'], default='HIDE_DRAM_LATENCY') parser.add_argument('-ib', '--init_banks', type=int, default=0) parser.add_argument('-b', '--bus_policy', type=str, choices=['WMEM_FIRST', 'FIFO'], default='WMEM_FIRST') parser.add_argument('-o', '--output_dir', type=str, default=None) parser.add_argument('-da', '--disable_abstract_layer', action="store_true", default=False) parser.add_argument('-f', '--fmem_entries', type=int, default=256) parser.add_argument('-nb', '--num_banks', type=int, default=4) parser.add_argument('--latency', type=int, default=100) parser.add_argument('--bandwidth', type=int, default=32) return parser.parse_args() class TestWrapper(object): def __init__(self): self.cv = GenericConvertor() self.midap_model = MidapModel() self.cm = Compiler() self.midap_simulator = MidapManager() self.step_checker = [0, 0, 0] def setup_from_builder(self, builder): odict = builder.get_operator_dict() self.cv.operator_dict = odict self.cv.post_process() self.midap_model.from_generic_op_dict(odict) self.step_checker[0] = 1 if self.step_checker[1] > 0: del self.cm self.cm = Compiler() self.step_checker[1] = 0 def compile(self, num_init_banks): if self.step_checker[0] == 0: print("Please setup the model first") return self.cm.force_setup(num_init_banks) static_info = self.cm.compile(self.midap_model) self.step_checker[1] = 1 if self.step_checker[2] > 0: del self.midap_simulator self.midap_simulator = MidapManager() self.step_checker[2] = 0 return static_info def simulate(self): if self.step_checker[0] == 0: print("Please setup the model first") return elif self.step_checker[1] == 0: print("Please run compile") return input_tensor_list, path_info = self.cm.control_info init_layer_list = self.midap_model.init_layer _ = self.midap_simulator.process_network_with_multiple_input(input_tensor_list, init_layer_list, path_info) self.step_checker[2] = 1 return path_info def run_all(self, model, output_dir=None, output_option=(True, False, False, False)): self.__init__() self.setup_from_builder(model) model = model.name self.logger.info("[ {} ]".format(model)) _ = self.compile() sim_instruction, stat = self.simulate() diff, latency, feature_dram, weight_dram = stat # print("check stat(Checking info) of network {}: {}".format(model ,stat), file=sys.stderr) if diff > 0: self.logger.error( "Network Result Diff > 0: Functional Problem may occur, network {}".format(model)) self.midap_simulator.stats.print_result(sim_instruction.processing_order, model) args = parse() cfg.MIDAP.CONTROL_STRATEGY.LAYER_COMPILER = args.layer_compiler cfg.MIDAP.BUS_POLICY = args.bus_policy cfg.MODEL.ALLOW_ABSTRACT_DATA = not args.disable_abstract_layer cfg.MODEL.REDUCTION_LOGIC = True # Configuration cfg.MIDAP.SYSTEM_WIDTH = 64 # cfg.MIDAP.FMEM.SIZE = 256 * 1024 cfg.MIDAP.FMEM.NUM_ENTRIES = args.fmem_entries * 1024 cfg.MIDAP.FMEM.NUM = args.num_banks cfg.SYSTEM.BANDWIDTH = args.bandwidth # GB ( * 10^9 byte) / s cfg.LATENCY.DRAM_READ = args.latency output_dir = args.output_dir tr = TestWrapper() mb = ex.one_layer_example(args.input_shape, args.out_chan, args.kern_info) tr.run_all("custom", mb, args.init_banks, output_dir=output_dir)
one_layer_test.py
from __future__ import print_function import argparse import os.path import models.examples as ex from config import cfg from generic_op import * from midap_simulator import * from midap_software import Compiler, MidapModel def parse(): parser = argparse.ArgumentParser() parser.add_argument('-i', '--input_shape', nargs='+', type=int, required=True) parser.add_argument('-oc', '--out_chan', type=int, required=True) parser.add_argument('-k', '--kern_info', nargs='+', type=int, required=True) parser.add_argument('-l', '--layer_compiler', type=str, choices=['MIN_DRAM_ACCESS', 'HIDE_DRAM_LATENCY'], default='HIDE_DRAM_LATENCY') parser.add_argument('-ib', '--init_banks', type=int, default=0) parser.add_argument('-b', '--bus_policy', type=str, choices=['WMEM_FIRST', 'FIFO'], default='WMEM_FIRST') parser.add_argument('-o', '--output_dir', type=str, default=None) parser.add_argument('-da', '--disable_abstract_layer', action="store_true", default=False) parser.add_argument('-f', '--fmem_entries', type=int, default=256) parser.add_argument('-nb', '--num_banks', type=int, default=4) parser.add_argument('--latency', type=int, default=100) parser.add_argument('--bandwidth', type=int, default=32) return parser.parse_args() class TestWrapper(object): def __init__(self): self.cv = GenericConvertor() self.midap_model = MidapModel() self.cm = Compiler() self.midap_simulator = MidapManager() self.step_checker = [0, 0, 0] def setup_from_builder(self, builder): odict = builder.get_operator_dict() self.cv.operator_dict = odict self.cv.post_process() self.midap_model.from_generic_op_dict(odict) self.step_checker[0] = 1 if self.step_checker[1] > 0: del self.cm self.cm = Compiler() self.step_checker[1] = 0 def compile(self, num_init_banks): if self.step_checker[0] == 0: print("Please setup the model first") return self.cm.force_setup(num_init_banks) static_info = self.cm.compile(self.midap_model) self.step_checker[1] = 1 if self.step_checker[2] > 0: del self.midap_simulator self.midap_simulator = MidapManager() self.step_checker[2] = 0 return static_info def simulate(self): if self.step_checker[0] == 0: print("Please setup the model first") return elif self.step_checker[1] == 0: print("Please run compile") return input_tensor_list, path_info = self.cm.control_info init_layer_list = self.midap_model.init_layer _ = self.midap_simulator.process_network_with_multiple_input(input_tensor_list, init_layer_list, path_info) self.step_checker[2] = 1 return path_info def run_all(self, model, output_dir=None, output_option=(True, False, False, False)): self.__init__() self.setup_from_builder(model) model = model.name self.logger.info("[ {} ]".format(model)) _ = self.compile() sim_instruction, stat = self.simulate() diff, latency, feature_dram, weight_dram = stat # print("check stat(Checking info) of network {}: {}".format(model ,stat), file=sys.stderr) if diff > 0: self.logger.error( "Network Result Diff > 0: Functional Problem may occur, network {}".format(model)) self.midap_simulator.stats.print_result(sim_instruction.processing_order, model) args = parse() cfg.MIDAP.CONTROL_STRATEGY.LAYER_COMPILER = args.layer_compiler cfg.MIDAP.BUS_POLICY = args.bus_policy cfg.MODEL.ALLOW_ABSTRACT_DATA = not args.disable_abstract_layer cfg.MODEL.REDUCTION_LOGIC = True # Configuration cfg.MIDAP.SYSTEM_WIDTH = 64 # cfg.MIDAP.FMEM.SIZE = 256 * 1024 cfg.MIDAP.FMEM.NUM_ENTRIES = args.fmem_entries * 1024 cfg.MIDAP.FMEM.NUM = args.num_banks cfg.SYSTEM.BANDWIDTH = args.bandwidth # GB ( * 10^9 byte) / s cfg.LATENCY.DRAM_READ = args.latency output_dir = args.output_dir tr = TestWrapper() mb = ex.one_layer_example(args.input_shape, args.out_chan, args.kern_info) tr.run_all("custom", mb, args.init_banks, output_dir=output_dir)
0.387343
0.105211