code
stringlengths
2k
1.04M
repo_path
stringlengths
5
517
parsed_code
stringlengths
0
1.04M
quality_prob
float64
0.02
0.95
learning_prob
float64
0.02
0.93
import os.path from unittest import TestCase import numpy as np import pandas as pd from ipycli.notebookmanager import NotebookManager from IPython.utils.tempdir import TemporaryDirectory class TestCLI(TestCase): def __init__(self, *args, **kwargs): TestCase.__init__(self, *args, **kwargs) def runTest(self): pass def setUp(self): pass def test_new_notebook(self): with TemporaryDirectory() as td: km = NotebookManager(notebook_dir=td) filename = 'Untitled0.ipynb' filepath = os.path.join(td, filename) notebook_id = km.new_notebook(ndir=td) assert os.path.isfile(filepath) # Now make sure path mapping works assert km.path_mapping[notebook_id] == filepath assert km.find_path(notebook_id) == filepath def test_new_notebook_name(self): with TemporaryDirectory() as td: km = NotebookManager(notebook_dir=td) filename = 'new_test.ipynb' filepath = os.path.join(td, filename) notebook_id = km.new_notebook(ndir=td, name=filename) assert os.path.isfile(filepath) # Now make sure path mapping works assert km.path_mapping[notebook_id] == filepath assert km.find_path(notebook_id) == filepath assert filepath in km.pathed_notebooks.values() def test_notebook_list(self): with TemporaryDirectory() as td: km = NotebookManager(notebook_dir=td) filename = 'new_test.ipynb' filepath = os.path.join(td, filename) notebook_id = km.new_notebook(ndir=td, name=filename) n = {'name':filepath, 'notebook_id':notebook_id} correct = [] correct.append(n) nlist = km.list_notebooks() assert nlist[0]['name'] == correct[0]['name'] assert nlist[0]['notebook_id'] == correct[0]['notebook_id'] def test_delete_notebook(self): with TemporaryDirectory() as td: km = NotebookManager(notebook_dir=td) filename = 'new_test.ipynb' filepath = os.path.join(td, filename) notebook_id = km.new_notebook(ndir=td, name=filename) assert os.path.isfile(filepath) # Now make sure path mapping works assert km.path_mapping[notebook_id] == filepath assert km.find_path(notebook_id) == filepath assert notebook_id in km.mapping assert notebook_id in km.path_mapping assert notebook_id in km.rev_mapping.values() km.delete_notebook(notebook_id) assert notebook_id not in km.mapping assert notebook_id not in km.path_mapping assert notebook_id not in km.rev_mapping.values() assert not os.path.isfile(filepath) def test_existing_notebook(self): # Create a dir with notebooks td = TemporaryDirectory() ndir = td.__enter__() km = NotebookManager(notebook_dir=ndir) filename = 'new_test.ipynb' filepath = os.path.join(ndir, filename) notebook_id = km.new_notebook(ndir=ndir, name=filename) td2 = TemporaryDirectory() ndir2 = td2.__enter__() nbm = NotebookManager(notebook_dir=ndir2) assert nbm.notebook_dir != km.notebook_dir assert filepath not in nbm.path_mapping.values() assert filepath not in nbm.pathed_notebooks.values() nbm.get_pathed_notebook(filepath) assert nbm.path_mapping.values()[0] == filepath assert filepath in nbm.pathed_notebooks.values() if __name__ == '__main__': import nose nose.runmodule(argv=[__file__,'-vvs','-x','--pdb', '--pdb-failure'], exit=False)
ipycli/tests/test_cli.py
import os.path from unittest import TestCase import numpy as np import pandas as pd from ipycli.notebookmanager import NotebookManager from IPython.utils.tempdir import TemporaryDirectory class TestCLI(TestCase): def __init__(self, *args, **kwargs): TestCase.__init__(self, *args, **kwargs) def runTest(self): pass def setUp(self): pass def test_new_notebook(self): with TemporaryDirectory() as td: km = NotebookManager(notebook_dir=td) filename = 'Untitled0.ipynb' filepath = os.path.join(td, filename) notebook_id = km.new_notebook(ndir=td) assert os.path.isfile(filepath) # Now make sure path mapping works assert km.path_mapping[notebook_id] == filepath assert km.find_path(notebook_id) == filepath def test_new_notebook_name(self): with TemporaryDirectory() as td: km = NotebookManager(notebook_dir=td) filename = 'new_test.ipynb' filepath = os.path.join(td, filename) notebook_id = km.new_notebook(ndir=td, name=filename) assert os.path.isfile(filepath) # Now make sure path mapping works assert km.path_mapping[notebook_id] == filepath assert km.find_path(notebook_id) == filepath assert filepath in km.pathed_notebooks.values() def test_notebook_list(self): with TemporaryDirectory() as td: km = NotebookManager(notebook_dir=td) filename = 'new_test.ipynb' filepath = os.path.join(td, filename) notebook_id = km.new_notebook(ndir=td, name=filename) n = {'name':filepath, 'notebook_id':notebook_id} correct = [] correct.append(n) nlist = km.list_notebooks() assert nlist[0]['name'] == correct[0]['name'] assert nlist[0]['notebook_id'] == correct[0]['notebook_id'] def test_delete_notebook(self): with TemporaryDirectory() as td: km = NotebookManager(notebook_dir=td) filename = 'new_test.ipynb' filepath = os.path.join(td, filename) notebook_id = km.new_notebook(ndir=td, name=filename) assert os.path.isfile(filepath) # Now make sure path mapping works assert km.path_mapping[notebook_id] == filepath assert km.find_path(notebook_id) == filepath assert notebook_id in km.mapping assert notebook_id in km.path_mapping assert notebook_id in km.rev_mapping.values() km.delete_notebook(notebook_id) assert notebook_id not in km.mapping assert notebook_id not in km.path_mapping assert notebook_id not in km.rev_mapping.values() assert not os.path.isfile(filepath) def test_existing_notebook(self): # Create a dir with notebooks td = TemporaryDirectory() ndir = td.__enter__() km = NotebookManager(notebook_dir=ndir) filename = 'new_test.ipynb' filepath = os.path.join(ndir, filename) notebook_id = km.new_notebook(ndir=ndir, name=filename) td2 = TemporaryDirectory() ndir2 = td2.__enter__() nbm = NotebookManager(notebook_dir=ndir2) assert nbm.notebook_dir != km.notebook_dir assert filepath not in nbm.path_mapping.values() assert filepath not in nbm.pathed_notebooks.values() nbm.get_pathed_notebook(filepath) assert nbm.path_mapping.values()[0] == filepath assert filepath in nbm.pathed_notebooks.values() if __name__ == '__main__': import nose nose.runmodule(argv=[__file__,'-vvs','-x','--pdb', '--pdb-failure'], exit=False)
0.377426
0.371194
from enum import Enum from dsp_lab import * class Process(Enum): DSP_OPEN_FILE = 0 DSP_SAVE_FILE = 1 DSP_PLOT_TIME_DOMAIN = 2 DSP_PLOT_FREQUENCY_DOMAIN = 3 DSP_FILTER = 4 DSP_ROOT_MEAN_SQUARE_ERROR = 5 def banner(): """ Banner initial """ print("-----------------------------------------") print("Welcome Digital Signal Processing Lab") print("Universidade Luterana do Brasil 2019/2") print('') print("Professor: <NAME>") print("Alunos: <NAME> e <NAME>") print("-----------------------------------------") print("This Project remove interferente signal") print("-----------------------------------------") def show_process_menu() -> Process: """ Show main menu :return: """ print('\n\r') for op in Process: print(f'{op.value} - {op.name}.') print('Q - EXIT.') option = input('Option:') if option is 'Q' or option is 'q': print("Bye Bye! :)") exit(0) return Process(int(option)) def show_filter_type() -> filter_type: """ Menu filter type :return: """ print('\n\r') for op in filter_type: print(f'{op.value} - {op.name}.') print('Q - EXIT.') option = input('Option:') if option is 'Q' or option is 'q': return None return filter_type(int(option)) def file(message=None): """ Menu Open File :param message: :return: """ if message is None: print("Enter file name:") else: print(message) option = input() return option def main(): """ Main Signal Processing Lab. """ # Create instance for dsp lab dsp = dsp_lab() # Show main menu banner() while True: try: # Show menu opt = show_process_menu() # Open file if opt is Process.DSP_OPEN_FILE: print('Open file') filename = input('Filename:') audio_samples, sample_rate, duration = dsp.open(filename=filename) if audio_samples is not None: print(f'Audio Number Samples: {len(audio_samples)}') print(f'Sample Rate: {sample_rate}') print(f'Duration: {duration}s') else: print('Fail open file') # Save file elif opt is Process.DSP_SAVE_FILE: print('Save file') if len(dsp.audio_samples): filename = input('Filename:') dsp.save(filename=filename, audio_samples=dsp.audio_samples) else: print('Not samples for save') # Plot audio time domain elif opt is Process.DSP_PLOT_TIME_DOMAIN: print("Print Frequency Domain") dsp.time_domain(audio_samples) elif opt is Process.DSP_PLOT_FREQUENCY_DOMAIN: print('Print Fast Transform Fourier (FFT)') dsp.frequency_domain(audio_samples) # Process audio filters elif opt is Process.DSP_FILTER: print("Processing filter...") option = show_filter_type() filtred_audio = dsp.filter(option) print('Save file') if filtred_audio is not None and len(filtred_audio): filename = input('Filename:') dsp.save(filename=filename, audio_samples=filtred_audio) dsp.time_domain(filtred_audio) dsp.frequency_domain(filtred_audio) else: print("Error um process filter") #Calculate Root mean square elif opt is Process.DSP_ROOT_MEAN_SQUARE_ERROR: file_original = file("Filename original:") file_filtred = file("Filename filtred:") audio_samples_original, sample_rate, duration = dsp.open(filename=file_original) audio_samples_filtred, sample_rate, duration = dsp.open(filename=file_filtred) error = dsp.root_square_mean_error(audio_samples_original, audio_samples_filtred) print(f'Error: {error}') print(f'Percentage: {error * 100}%') except Exception as e: raise e if __name__ == '__main__': main()
signal_processing_lab.py
from enum import Enum from dsp_lab import * class Process(Enum): DSP_OPEN_FILE = 0 DSP_SAVE_FILE = 1 DSP_PLOT_TIME_DOMAIN = 2 DSP_PLOT_FREQUENCY_DOMAIN = 3 DSP_FILTER = 4 DSP_ROOT_MEAN_SQUARE_ERROR = 5 def banner(): """ Banner initial """ print("-----------------------------------------") print("Welcome Digital Signal Processing Lab") print("Universidade Luterana do Brasil 2019/2") print('') print("Professor: <NAME>") print("Alunos: <NAME> e <NAME>") print("-----------------------------------------") print("This Project remove interferente signal") print("-----------------------------------------") def show_process_menu() -> Process: """ Show main menu :return: """ print('\n\r') for op in Process: print(f'{op.value} - {op.name}.') print('Q - EXIT.') option = input('Option:') if option is 'Q' or option is 'q': print("Bye Bye! :)") exit(0) return Process(int(option)) def show_filter_type() -> filter_type: """ Menu filter type :return: """ print('\n\r') for op in filter_type: print(f'{op.value} - {op.name}.') print('Q - EXIT.') option = input('Option:') if option is 'Q' or option is 'q': return None return filter_type(int(option)) def file(message=None): """ Menu Open File :param message: :return: """ if message is None: print("Enter file name:") else: print(message) option = input() return option def main(): """ Main Signal Processing Lab. """ # Create instance for dsp lab dsp = dsp_lab() # Show main menu banner() while True: try: # Show menu opt = show_process_menu() # Open file if opt is Process.DSP_OPEN_FILE: print('Open file') filename = input('Filename:') audio_samples, sample_rate, duration = dsp.open(filename=filename) if audio_samples is not None: print(f'Audio Number Samples: {len(audio_samples)}') print(f'Sample Rate: {sample_rate}') print(f'Duration: {duration}s') else: print('Fail open file') # Save file elif opt is Process.DSP_SAVE_FILE: print('Save file') if len(dsp.audio_samples): filename = input('Filename:') dsp.save(filename=filename, audio_samples=dsp.audio_samples) else: print('Not samples for save') # Plot audio time domain elif opt is Process.DSP_PLOT_TIME_DOMAIN: print("Print Frequency Domain") dsp.time_domain(audio_samples) elif opt is Process.DSP_PLOT_FREQUENCY_DOMAIN: print('Print Fast Transform Fourier (FFT)') dsp.frequency_domain(audio_samples) # Process audio filters elif opt is Process.DSP_FILTER: print("Processing filter...") option = show_filter_type() filtred_audio = dsp.filter(option) print('Save file') if filtred_audio is not None and len(filtred_audio): filename = input('Filename:') dsp.save(filename=filename, audio_samples=filtred_audio) dsp.time_domain(filtred_audio) dsp.frequency_domain(filtred_audio) else: print("Error um process filter") #Calculate Root mean square elif opt is Process.DSP_ROOT_MEAN_SQUARE_ERROR: file_original = file("Filename original:") file_filtred = file("Filename filtred:") audio_samples_original, sample_rate, duration = dsp.open(filename=file_original) audio_samples_filtred, sample_rate, duration = dsp.open(filename=file_filtred) error = dsp.root_square_mean_error(audio_samples_original, audio_samples_filtred) print(f'Error: {error}') print(f'Percentage: {error * 100}%') except Exception as e: raise e if __name__ == '__main__': main()
0.619586
0.143968
__version__ = "0.7.0" from __future__ import print_function import config import yaml import html2text from os import path as p from itertools import imap, repeat from flask import Flask, g, render_template, url_for, Response, request from flask.ext.bootstrap import Bootstrap from flask.ext.markdown import Markdown from flask_weasyprint import HTML, render_pdf from weasyprint.css import find_stylesheets from app.tables import TableExtension from datetime import timedelta, date as d def _get_styles(app, style_urls): """Gets the content of the given list of style URLs.""" styles = [] for style_url in style_urls: with app.test_client() as c: response = c.get(style_url) styles.append(response.data) return styles def create_app(config_mode=None, config_file=None): """Create webapp instance""" # Flask application app = Flask(__name__) Bootstrap(app) md = Markdown(app, extensions=['toc']) md.register_extension(TableExtension) if config_mode: app.config.from_object(getattr(config, config_mode)) elif config_file: app.config.from_pyfile(config_file) else: app.config.from_envvar('APP_SETTINGS', silent=True) table = app.config['TABLE'] @app.before_request def before_request(): # set g variables stream = file(app.config['INFO_PATH'], 'r') [setattr(g, k, v) for k, v in yaml.safe_load(stream).items()] g.site = app.config['SITE'] g.valid_until = (d.today() + timedelta(days=g.days_valid)).strftime( "%B %d, %Y") # Views @app.route('/<style>/') @app.route('/<style>/<source>/') def index(style, source=None): source = source or request.args.get('source') if source: parent = p.dirname(p.dirname(__file__)) path = p.join(parent, source) stream = file(path, 'r') items = yaml.safe_load(stream).items() [setattr(g, k, v) for k, v in items] return render_template('%s.html' % style).replace('<table>', table) @app.route('/render/<style>/') @app.route('/render/<style>/<otype>/') def render(style, otype=None): otype = otype or request.args.get('type', 'html') source = request.args.get('source') if source: parent = p.dirname(p.dirname(__file__)) path = p.join(parent, source) stream = file(path, 'r') items = yaml.safe_load(stream).items() [setattr(g, k, v) for k, v in items] if otype.startswith('html'): html = render_template('%s.html' % style).replace('<table>', table) html_doc = HTML(string=html) stylesheets = find_stylesheets( html_doc.root_element, html_doc.media_type, html_doc.url_fetcher, ) urls = [sheet.base_url for sheet in stylesheets] style_urls = filter(lambda x: x.endswith('css'), urls) styles = _get_styles(app, style_urls) kwargs = {'styles': styles} if source: [setattr(g, k, v) for k, v in items] return render_template('%s.html' % style, **kwargs).replace( '<table>', table) elif otype.startswith('md'): h = html2text.HTML2Text() # h.ignore_links = True h.ignore_emphasis = True h.body_width = 65 return h.handle(render_template('%s.html' % style)) elif otype.startswith('pdf'): kwargs = {'to_print': True} return render_pdf(url_for('index', style=style)) elif otype.startswith('png'): kwargs = {'to_print': True} html = render_template('%s.html' % style, **kwargs).replace( '<table>', table) html_doc = HTML(string=html) return Response(html_doc.write_png(), mimetype='image/png') else: pass return app
app/__init__.py
__version__ = "0.7.0" from __future__ import print_function import config import yaml import html2text from os import path as p from itertools import imap, repeat from flask import Flask, g, render_template, url_for, Response, request from flask.ext.bootstrap import Bootstrap from flask.ext.markdown import Markdown from flask_weasyprint import HTML, render_pdf from weasyprint.css import find_stylesheets from app.tables import TableExtension from datetime import timedelta, date as d def _get_styles(app, style_urls): """Gets the content of the given list of style URLs.""" styles = [] for style_url in style_urls: with app.test_client() as c: response = c.get(style_url) styles.append(response.data) return styles def create_app(config_mode=None, config_file=None): """Create webapp instance""" # Flask application app = Flask(__name__) Bootstrap(app) md = Markdown(app, extensions=['toc']) md.register_extension(TableExtension) if config_mode: app.config.from_object(getattr(config, config_mode)) elif config_file: app.config.from_pyfile(config_file) else: app.config.from_envvar('APP_SETTINGS', silent=True) table = app.config['TABLE'] @app.before_request def before_request(): # set g variables stream = file(app.config['INFO_PATH'], 'r') [setattr(g, k, v) for k, v in yaml.safe_load(stream).items()] g.site = app.config['SITE'] g.valid_until = (d.today() + timedelta(days=g.days_valid)).strftime( "%B %d, %Y") # Views @app.route('/<style>/') @app.route('/<style>/<source>/') def index(style, source=None): source = source or request.args.get('source') if source: parent = p.dirname(p.dirname(__file__)) path = p.join(parent, source) stream = file(path, 'r') items = yaml.safe_load(stream).items() [setattr(g, k, v) for k, v in items] return render_template('%s.html' % style).replace('<table>', table) @app.route('/render/<style>/') @app.route('/render/<style>/<otype>/') def render(style, otype=None): otype = otype or request.args.get('type', 'html') source = request.args.get('source') if source: parent = p.dirname(p.dirname(__file__)) path = p.join(parent, source) stream = file(path, 'r') items = yaml.safe_load(stream).items() [setattr(g, k, v) for k, v in items] if otype.startswith('html'): html = render_template('%s.html' % style).replace('<table>', table) html_doc = HTML(string=html) stylesheets = find_stylesheets( html_doc.root_element, html_doc.media_type, html_doc.url_fetcher, ) urls = [sheet.base_url for sheet in stylesheets] style_urls = filter(lambda x: x.endswith('css'), urls) styles = _get_styles(app, style_urls) kwargs = {'styles': styles} if source: [setattr(g, k, v) for k, v in items] return render_template('%s.html' % style, **kwargs).replace( '<table>', table) elif otype.startswith('md'): h = html2text.HTML2Text() # h.ignore_links = True h.ignore_emphasis = True h.body_width = 65 return h.handle(render_template('%s.html' % style)) elif otype.startswith('pdf'): kwargs = {'to_print': True} return render_pdf(url_for('index', style=style)) elif otype.startswith('png'): kwargs = {'to_print': True} html = render_template('%s.html' % style, **kwargs).replace( '<table>', table) html_doc = HTML(string=html) return Response(html_doc.write_png(), mimetype='image/png') else: pass return app
0.357568
0.055183
import gtk import gobject import tempfile import os from plugins import get_plugin_by_type from file_chooser_dlg import File_Chooser, FILE_CHOOSER_TYPE_FILE from camera import Camera, Camera_Exception, DEFAULT_RESOLUTION from support import warning, debug from ossupport import xclose, xremove from proximateprotocol import PLUGIN_TYPE_NOTIFICATION, MAX_FACE_DIMENSION, \ TP_FACE_SIZE from guiutils import scale_image, compress_jpeg class Picture_Choose_Dialog: """ This class is used for previewing and selecting the profile picture. Uses File_Chooser to select the picture. """ def __init__(self, gui, got_picture_cb): self.notify = get_plugin_by_type(PLUGIN_TYPE_NOTIFICATION).notify self.filename = None self.gui = gui self.tempfile = None # file to be removed when dialog is closed self.got_picture_cb = got_picture_cb self.dialog = gtk.Dialog("Select Profile Picture", gui.get_main_window(), gtk.DIALOG_DESTROY_WITH_PARENT | gtk.DIALOG_MODAL, (gtk.STOCK_OK, gtk.RESPONSE_OK, gtk.STOCK_CANCEL, gtk.RESPONSE_CANCEL)) self.dialog.set_border_width(5) self.dialog.vbox.set_spacing(2) self.dialog.action_area.set_layout(gtk.BUTTONBOX_END) self.dialog.set_position(gtk.WIN_POS_CENTER) self.initialize_widgets() self.dialog.connect("response", self.response_handler) self.dialog.connect("delete-event", self.dialog_deleted) def initialize_widgets(self): self.profile_image = gtk.Image() self.profile_image.set_size_request(300, 300) self.profile_image.set_from_stock(gtk.STOCK_ORIENTATION_PORTRAIT, 4) self.browse_button = gtk.Button("Browse") self.take_photo = gtk.Button("Take photo") self.clear_image = gtk.Button('Clear image') self.vbox1 = gtk.VBox() self.vbox1.pack_start(self.profile_image) self.vbox1.pack_start(self.browse_button, False, True) self.vbox1.pack_start(self.take_photo, False, True) self.vbox1.pack_start(self.clear_image, False, True) self.dialog.vbox.pack_start(self.vbox1) self.browse_button.connect("clicked", self.browse_button_clicked) self.take_photo.connect("clicked", self.take_photo_clicked) self.clear_image.connect('clicked', self.clear_image_clicked) def response_handler(self, widget, response_id, *args): """ Handles dialog responses """ if response_id == gtk.RESPONSE_OK: self.got_picture_cb(self.filename) self.dialog.hide() return True def dialog_deleted(self, dialog, event): return True def show(self): self.dialog.show_all() def close(self): self.remove_temp() self.dialog.destroy() def browse_button_clicked(self, widget): file_dlg = File_Chooser(self.gui.main_window, FILE_CHOOSER_TYPE_FILE, False, self.browse_chooser_cb) file_dlg.add_supported_pixbuf_formats() #self.dialog.hide() def browse_chooser_cb(self, filename, ctx): #self.dialog.show() if filename == None: return # checking if we have to scale the picture down # also checking if it even is a picture try: pixbuf = gtk.gdk.pixbuf_new_from_file(filename) except gobject.GError: self.notify("Error: Invalid image file", True) return larger_dimension = max((pixbuf.get_width(), pixbuf.get_height())) if os.path.getsize(filename) <= TP_FACE_SIZE and \ larger_dimension <= MAX_FACE_DIMENSION: # use the picture directly without recompression self.remove_temp() self.set_picture(filename) else: # need to recompress the picture pixbuf = scale_image(pixbuf, MAX_FACE_DIMENSION) if not self.compress_jpeg(pixbuf): self.notify("Error: Unable to compress JPEG picture", True) def remove_temp(self): if self.tempfile != None: if not xremove(self.tempfile): warning("Unable to remove a scaled picture\n") self.tempfile = None def take_photo_clicked(self, widget): self.camera_dialog = Camera_Dialog(self.dialog, DEFAULT_RESOLUTION, self.got_photo) def got_photo(self, pixbuf): if pixbuf: pixbuf = scale_image(pixbuf, MAX_FACE_DIMENSION) if not self.compress_jpeg(pixbuf): self.notify("Error: Unable to compress JPEG picture", True) self.camera_dialog = None def clear_image_clicked(self, widget): self.remove_temp() self.set_picture(None) def set_picture(self, fname): self.filename = fname self.profile_image.set_from_file(fname) def compress_jpeg(self, pixbuf): (fd, filename) = tempfile.mkstemp(prefix = 'proximate-tmp-profile-pic-') xclose(fd) if not compress_jpeg(pixbuf, filename, TP_FACE_SIZE): return False self.remove_temp() self.tempfile = filename self.set_picture(filename) return True class Camera_Dialog: def __init__(self, profile_dialog, resolution, got_photo_cb): self.cb = got_photo_cb self.dialog = gtk.Dialog('Camera', profile_dialog, gtk.DIALOG_DESTROY_WITH_PARENT | gtk.DIALOG_MODAL) self.dialog.set_has_separator(False) self.image = gtk.DrawingArea() self.image.set_size_request(resolution[0], resolution[1]) self.help_text = gtk.Label('Click to take picture') try: self.camera = Camera(resolution, self.image) except Camera_Exception: debug('profile dialog: Unable to initialize camera\n') self.camera = None self.help_text.set_label('No camera found') self.image_hbox = gtk.HBox() self.image_hbox.pack_start(gtk.HBox()) self.image_hbox.pack_start(self.image, False, False) self.image_hbox.pack_start(gtk.HBox()) if self.camera != None: self.dialog.vbox.pack_start(self.image_hbox) self.dialog.vbox.pack_start(self.help_text, False, True) self.close_button = gtk.Button('Close') self.dialog.vbox.pack_start(self.close_button, False, True) self.close_button.connect('clicked', self.close_clicked) self.dialog.connect('response', self.dialog_response) self.image.add_events(gtk.gdk.BUTTON_PRESS_MASK) self.image.connect('button-press-event', self.image_clicked) self.dialog.show_all() def close_clicked(self, widget): self.close() def dialog_response(self, widget, response_id): self.close() def close(self): if self.camera: self.camera.stop() if self.camera.buffer: pixbuf = gtk.gdk.pixbuf_new_from_data(self.camera.buffer, gtk.gdk.COLORSPACE_RGB, False, 8, self.camera.width, self.camera.height, 3*self.camera.width) self.cb(pixbuf) else: self.cb(None) self.dialog.destroy() def image_clicked(self, widget, data=None): if self.camera: self.camera.take_photo()
pic_choose_dlg.py
import gtk import gobject import tempfile import os from plugins import get_plugin_by_type from file_chooser_dlg import File_Chooser, FILE_CHOOSER_TYPE_FILE from camera import Camera, Camera_Exception, DEFAULT_RESOLUTION from support import warning, debug from ossupport import xclose, xremove from proximateprotocol import PLUGIN_TYPE_NOTIFICATION, MAX_FACE_DIMENSION, \ TP_FACE_SIZE from guiutils import scale_image, compress_jpeg class Picture_Choose_Dialog: """ This class is used for previewing and selecting the profile picture. Uses File_Chooser to select the picture. """ def __init__(self, gui, got_picture_cb): self.notify = get_plugin_by_type(PLUGIN_TYPE_NOTIFICATION).notify self.filename = None self.gui = gui self.tempfile = None # file to be removed when dialog is closed self.got_picture_cb = got_picture_cb self.dialog = gtk.Dialog("Select Profile Picture", gui.get_main_window(), gtk.DIALOG_DESTROY_WITH_PARENT | gtk.DIALOG_MODAL, (gtk.STOCK_OK, gtk.RESPONSE_OK, gtk.STOCK_CANCEL, gtk.RESPONSE_CANCEL)) self.dialog.set_border_width(5) self.dialog.vbox.set_spacing(2) self.dialog.action_area.set_layout(gtk.BUTTONBOX_END) self.dialog.set_position(gtk.WIN_POS_CENTER) self.initialize_widgets() self.dialog.connect("response", self.response_handler) self.dialog.connect("delete-event", self.dialog_deleted) def initialize_widgets(self): self.profile_image = gtk.Image() self.profile_image.set_size_request(300, 300) self.profile_image.set_from_stock(gtk.STOCK_ORIENTATION_PORTRAIT, 4) self.browse_button = gtk.Button("Browse") self.take_photo = gtk.Button("Take photo") self.clear_image = gtk.Button('Clear image') self.vbox1 = gtk.VBox() self.vbox1.pack_start(self.profile_image) self.vbox1.pack_start(self.browse_button, False, True) self.vbox1.pack_start(self.take_photo, False, True) self.vbox1.pack_start(self.clear_image, False, True) self.dialog.vbox.pack_start(self.vbox1) self.browse_button.connect("clicked", self.browse_button_clicked) self.take_photo.connect("clicked", self.take_photo_clicked) self.clear_image.connect('clicked', self.clear_image_clicked) def response_handler(self, widget, response_id, *args): """ Handles dialog responses """ if response_id == gtk.RESPONSE_OK: self.got_picture_cb(self.filename) self.dialog.hide() return True def dialog_deleted(self, dialog, event): return True def show(self): self.dialog.show_all() def close(self): self.remove_temp() self.dialog.destroy() def browse_button_clicked(self, widget): file_dlg = File_Chooser(self.gui.main_window, FILE_CHOOSER_TYPE_FILE, False, self.browse_chooser_cb) file_dlg.add_supported_pixbuf_formats() #self.dialog.hide() def browse_chooser_cb(self, filename, ctx): #self.dialog.show() if filename == None: return # checking if we have to scale the picture down # also checking if it even is a picture try: pixbuf = gtk.gdk.pixbuf_new_from_file(filename) except gobject.GError: self.notify("Error: Invalid image file", True) return larger_dimension = max((pixbuf.get_width(), pixbuf.get_height())) if os.path.getsize(filename) <= TP_FACE_SIZE and \ larger_dimension <= MAX_FACE_DIMENSION: # use the picture directly without recompression self.remove_temp() self.set_picture(filename) else: # need to recompress the picture pixbuf = scale_image(pixbuf, MAX_FACE_DIMENSION) if not self.compress_jpeg(pixbuf): self.notify("Error: Unable to compress JPEG picture", True) def remove_temp(self): if self.tempfile != None: if not xremove(self.tempfile): warning("Unable to remove a scaled picture\n") self.tempfile = None def take_photo_clicked(self, widget): self.camera_dialog = Camera_Dialog(self.dialog, DEFAULT_RESOLUTION, self.got_photo) def got_photo(self, pixbuf): if pixbuf: pixbuf = scale_image(pixbuf, MAX_FACE_DIMENSION) if not self.compress_jpeg(pixbuf): self.notify("Error: Unable to compress JPEG picture", True) self.camera_dialog = None def clear_image_clicked(self, widget): self.remove_temp() self.set_picture(None) def set_picture(self, fname): self.filename = fname self.profile_image.set_from_file(fname) def compress_jpeg(self, pixbuf): (fd, filename) = tempfile.mkstemp(prefix = 'proximate-tmp-profile-pic-') xclose(fd) if not compress_jpeg(pixbuf, filename, TP_FACE_SIZE): return False self.remove_temp() self.tempfile = filename self.set_picture(filename) return True class Camera_Dialog: def __init__(self, profile_dialog, resolution, got_photo_cb): self.cb = got_photo_cb self.dialog = gtk.Dialog('Camera', profile_dialog, gtk.DIALOG_DESTROY_WITH_PARENT | gtk.DIALOG_MODAL) self.dialog.set_has_separator(False) self.image = gtk.DrawingArea() self.image.set_size_request(resolution[0], resolution[1]) self.help_text = gtk.Label('Click to take picture') try: self.camera = Camera(resolution, self.image) except Camera_Exception: debug('profile dialog: Unable to initialize camera\n') self.camera = None self.help_text.set_label('No camera found') self.image_hbox = gtk.HBox() self.image_hbox.pack_start(gtk.HBox()) self.image_hbox.pack_start(self.image, False, False) self.image_hbox.pack_start(gtk.HBox()) if self.camera != None: self.dialog.vbox.pack_start(self.image_hbox) self.dialog.vbox.pack_start(self.help_text, False, True) self.close_button = gtk.Button('Close') self.dialog.vbox.pack_start(self.close_button, False, True) self.close_button.connect('clicked', self.close_clicked) self.dialog.connect('response', self.dialog_response) self.image.add_events(gtk.gdk.BUTTON_PRESS_MASK) self.image.connect('button-press-event', self.image_clicked) self.dialog.show_all() def close_clicked(self, widget): self.close() def dialog_response(self, widget, response_id): self.close() def close(self): if self.camera: self.camera.stop() if self.camera.buffer: pixbuf = gtk.gdk.pixbuf_new_from_data(self.camera.buffer, gtk.gdk.COLORSPACE_RGB, False, 8, self.camera.width, self.camera.height, 3*self.camera.width) self.cb(pixbuf) else: self.cb(None) self.dialog.destroy() def image_clicked(self, widget, data=None): if self.camera: self.camera.take_photo()
0.381911
0.050635
import RPi.GPIO as GPIO import time import sys import subprocess, os import signal import pygame from pygame.locals import * pygame.mixer.pre_init(44100, -16, 2, 2048) # setup mixer to avoid sound lag os.environ["SDL_FBDEV"] = "/dev/fb1" os.environ["SDL_MOUSEDEV"] = "/dev/input/touchscreen" os.environ["SDL_MOUSEDRV"] = "TSLIB" pygame.init() #initialize pygame pygame.display.init() GPIO.setmode(GPIO.BCM) # set up buttons to monitor (compare to boswell.py though!) quit_button = 17 current_question = 0 change_question = False GPIO.setup(quit_button, GPIO.IN, pull_up_down=GPIO.PUD_UP) # Set up all questions img_names = [] sound_names = [] qcodes = [] img_names.append("images/john_quinn.png") sound_names.append("audio/alexa-please_tell_me_about.ogg") qcodes.append("jquinn1961") img_names.append("images/judy_wedding_photo.png") sound_names.append("audio/silence.ogg") qcodes.append("judywed1961") img_names.append("images/question01.png") sound_names.append("audio/willa_question01.ogg") qcodes.append("worldchange") img_names.append("images/question03.png") sound_names.append("audio/silence.ogg") qcodes.append("neighborhood") img_names.append("images/question04.png") sound_names.append("audio/alexa-earliestmemory.ogg") qcodes.append("earliestmemory") img_names.append("images/question05.png") sound_names.append("audio/alexa-bestfriend.ogg") qcodes.append("bestfriend") max_question = len(img_names) print "max_question = " , max_question # Display logo screen imgSurf = pygame.image.load ('images/boswell_startup_screen.png') pygame.mixer.music.load("audio/silence.ogg") pygame.mouse.set_visible(False) screen = pygame.display.set_mode ( imgSurf.get_size(), pygame.FULLSCREEN ) screen.blit ( imgSurf, ( 0, 0 ) ) pygame.display.flip() pygame.mixer.music.play() rpistr = "sudo python boswell.py" p=subprocess.Popen(rpistr,shell=True, preexec_fn=os.setsid) while pygame.mixer.music.get_busy() == True: continue while True: quit_state = GPIO.input(quit_button) if quit_state == False: os.killpg(p.pid, signal.SIGTERM) pygame.quit() sys.exit(0) if change_question == True: change_question = False current_question = current_question + 1 if current_question > max_question: current_question = 1 imgSurf = pygame.image.load (img_names[current_question-1]) # load the appropriate image pygame.mixer.music.load(sound_names[current_question-1]) # load the question audio screen = pygame.display.set_mode ( imgSurf.get_size(), pygame.FULLSCREEN ) screen.blit ( imgSurf, ( 0, 0 ) ) pygame.display.flip() pygame.display.update() pygame.mixer.music.play() while pygame.mixer.music.get_busy() == True: continue for event in pygame.event.get(): if event.type == pygame.MOUSEBUTTONDOWN: # pos = (pygame.mouse.get_pos() [0], pygame.mouse.get_pos() [1]) change_question = True
launcher.py
import RPi.GPIO as GPIO import time import sys import subprocess, os import signal import pygame from pygame.locals import * pygame.mixer.pre_init(44100, -16, 2, 2048) # setup mixer to avoid sound lag os.environ["SDL_FBDEV"] = "/dev/fb1" os.environ["SDL_MOUSEDEV"] = "/dev/input/touchscreen" os.environ["SDL_MOUSEDRV"] = "TSLIB" pygame.init() #initialize pygame pygame.display.init() GPIO.setmode(GPIO.BCM) # set up buttons to monitor (compare to boswell.py though!) quit_button = 17 current_question = 0 change_question = False GPIO.setup(quit_button, GPIO.IN, pull_up_down=GPIO.PUD_UP) # Set up all questions img_names = [] sound_names = [] qcodes = [] img_names.append("images/john_quinn.png") sound_names.append("audio/alexa-please_tell_me_about.ogg") qcodes.append("jquinn1961") img_names.append("images/judy_wedding_photo.png") sound_names.append("audio/silence.ogg") qcodes.append("judywed1961") img_names.append("images/question01.png") sound_names.append("audio/willa_question01.ogg") qcodes.append("worldchange") img_names.append("images/question03.png") sound_names.append("audio/silence.ogg") qcodes.append("neighborhood") img_names.append("images/question04.png") sound_names.append("audio/alexa-earliestmemory.ogg") qcodes.append("earliestmemory") img_names.append("images/question05.png") sound_names.append("audio/alexa-bestfriend.ogg") qcodes.append("bestfriend") max_question = len(img_names) print "max_question = " , max_question # Display logo screen imgSurf = pygame.image.load ('images/boswell_startup_screen.png') pygame.mixer.music.load("audio/silence.ogg") pygame.mouse.set_visible(False) screen = pygame.display.set_mode ( imgSurf.get_size(), pygame.FULLSCREEN ) screen.blit ( imgSurf, ( 0, 0 ) ) pygame.display.flip() pygame.mixer.music.play() rpistr = "sudo python boswell.py" p=subprocess.Popen(rpistr,shell=True, preexec_fn=os.setsid) while pygame.mixer.music.get_busy() == True: continue while True: quit_state = GPIO.input(quit_button) if quit_state == False: os.killpg(p.pid, signal.SIGTERM) pygame.quit() sys.exit(0) if change_question == True: change_question = False current_question = current_question + 1 if current_question > max_question: current_question = 1 imgSurf = pygame.image.load (img_names[current_question-1]) # load the appropriate image pygame.mixer.music.load(sound_names[current_question-1]) # load the question audio screen = pygame.display.set_mode ( imgSurf.get_size(), pygame.FULLSCREEN ) screen.blit ( imgSurf, ( 0, 0 ) ) pygame.display.flip() pygame.display.update() pygame.mixer.music.play() while pygame.mixer.music.get_busy() == True: continue for event in pygame.event.get(): if event.type == pygame.MOUSEBUTTONDOWN: # pos = (pygame.mouse.get_pos() [0], pygame.mouse.get_pos() [1]) change_question = True
0.061073
0.065995
"""Implements a class to be used for unit testing. """ import datetime from tlsmate.cert_chain import CertChain from tlsmate.server_profile import SPObject, ProfileSchema, ServerProfileSchema from tlsmate import utils from marshmallow import fields import pytest class SPUnitTest(SPObject): pass class SPUnitTestSchema(ProfileSchema): __profile_class__ = SPUnitTest unit_test_1 = fields.Integer() unit_test_2 = fields.String() @ServerProfileSchema.augment class SPUnitTestAugment(ProfileSchema): unit_test = fields.Nested(SPUnitTestSchema) def test_cert_paras(tlsmate, guballa_de_pem, quo_vadis_root_ca3): chain = CertChain() for cert in (quo_vadis_root_ca3, guballa_de_pem): chain.append_pem_cert(cert.as_bytes()) prof = tlsmate.server_profile prof.allocate_versions() prof.append_unique_cert_chain(chain) quo_vadis = prof.cert_chains[0].cert_chain[0] guballa = prof.cert_chains[0].cert_chain[1] cert_policies = quo_vadis.extensions[1].cert_policies explicit_text = cert_policies[0].policy_qualifiers[0].explicit_text assert type(explicit_text) is str assert len(explicit_text) text = cert_policies[0].policy_qualifiers[1].text assert type(text) is str assert len(text) signed_ct = guballa.extensions[8].signed_certificate_timestamps assert len(signed_ct) == 2 for ct in signed_ct: assert ct.entry_type == "PRE_CERTIFICATE" assert type(ct.log_id) is bytes assert len(ct.log_id) assert type(ct.timestamp) is datetime.datetime assert ct.version == "v1" def test_augment_profile(tlsmate): tlsmate.server_profile.unit_test = SPUnitTest(unit_test_1=1, unit_test_2="hello") data = tlsmate.server_profile.make_serializable() assert "unit_test" in data assert data["unit_test"]["unit_test_1"] == 1 assert data["unit_test"]["unit_test_2"] == "hello" def test_deserialize_profile_ok(tlsmate): data = {"unit_test": {"unit_test_1": 1, "unit_test_2": "hello"}} tlsmate.server_profile.load(data) assert tlsmate.server_profile.unit_test.unit_test_1 == 1 assert tlsmate.server_profile.unit_test.unit_test_2 == "hello" def test_deserialize_profile_nok(tlsmate): data = { "unit_test": {"unit_test_1": 1, "unit_test_2": "hello"}, "too_much": "outch", } with pytest.raises(ValueError, match="fields not defined in schema"): tlsmate.server_profile.load(data) def test_deserialize_full_profile(tlsmate, server_profile): tlsmate.server_profile.load(utils.deserialize_data(server_profile))
tests/modules/test_module_server_profile.py
"""Implements a class to be used for unit testing. """ import datetime from tlsmate.cert_chain import CertChain from tlsmate.server_profile import SPObject, ProfileSchema, ServerProfileSchema from tlsmate import utils from marshmallow import fields import pytest class SPUnitTest(SPObject): pass class SPUnitTestSchema(ProfileSchema): __profile_class__ = SPUnitTest unit_test_1 = fields.Integer() unit_test_2 = fields.String() @ServerProfileSchema.augment class SPUnitTestAugment(ProfileSchema): unit_test = fields.Nested(SPUnitTestSchema) def test_cert_paras(tlsmate, guballa_de_pem, quo_vadis_root_ca3): chain = CertChain() for cert in (quo_vadis_root_ca3, guballa_de_pem): chain.append_pem_cert(cert.as_bytes()) prof = tlsmate.server_profile prof.allocate_versions() prof.append_unique_cert_chain(chain) quo_vadis = prof.cert_chains[0].cert_chain[0] guballa = prof.cert_chains[0].cert_chain[1] cert_policies = quo_vadis.extensions[1].cert_policies explicit_text = cert_policies[0].policy_qualifiers[0].explicit_text assert type(explicit_text) is str assert len(explicit_text) text = cert_policies[0].policy_qualifiers[1].text assert type(text) is str assert len(text) signed_ct = guballa.extensions[8].signed_certificate_timestamps assert len(signed_ct) == 2 for ct in signed_ct: assert ct.entry_type == "PRE_CERTIFICATE" assert type(ct.log_id) is bytes assert len(ct.log_id) assert type(ct.timestamp) is datetime.datetime assert ct.version == "v1" def test_augment_profile(tlsmate): tlsmate.server_profile.unit_test = SPUnitTest(unit_test_1=1, unit_test_2="hello") data = tlsmate.server_profile.make_serializable() assert "unit_test" in data assert data["unit_test"]["unit_test_1"] == 1 assert data["unit_test"]["unit_test_2"] == "hello" def test_deserialize_profile_ok(tlsmate): data = {"unit_test": {"unit_test_1": 1, "unit_test_2": "hello"}} tlsmate.server_profile.load(data) assert tlsmate.server_profile.unit_test.unit_test_1 == 1 assert tlsmate.server_profile.unit_test.unit_test_2 == "hello" def test_deserialize_profile_nok(tlsmate): data = { "unit_test": {"unit_test_1": 1, "unit_test_2": "hello"}, "too_much": "outch", } with pytest.raises(ValueError, match="fields not defined in schema"): tlsmate.server_profile.load(data) def test_deserialize_full_profile(tlsmate, server_profile): tlsmate.server_profile.load(utils.deserialize_data(server_profile))
0.650023
0.486941
import json import os from shutil import rmtree from tempfile import mkdtemp from couchapp.localdoc import LocalDoc def test_load_ignores_non_exist(): doc = LocalDoc('/mock/app', create=False) assert doc.ignores == [] class testIgnores(object): def setUp(self): self.dir = mkdtemp() def tearDown(self): rmtree(self.dir) def test_load_ignore(self): func = self.check_ignore yield func, '[42]', [42] yield func, '["foo", "bar"]', ['foo', 'bar'] content = ''' [ "magic", // comments are allowed "answer" ] ''' yield func, content, ['magic', 'answer'] content = ''' [ "magic", /* comments are allowed */ "answer" ] ''' yield func, content, ['magic', 'answer'] content = ''' [ "magic", /* comments are allowed */ "answer" // remix ] ''' yield func, content, ['magic', 'answer'] content = ''' [ "magic" /* "answer" */ ] ''' yield func, content, ['magic'] content = ''' [ "^regex$", /* comment */ "answer" ] ''' yield func, content, ['^regex$', 'answer'] content = ''' [ "/*regex", /* comment */ "answer//" // comment ] ''' yield func, content, ['/*regex', 'answer//'] def check_ignore(self, content, ans): # prepare ignore file path = os.path.join(self.dir, '.couchappignore') with open(path, 'w') as f: f.write(content) doc = LocalDoc(self.dir, create=False) assert doc.ignores == ans class testGetId(object): ''' The test cases of ``LocalDoc.get_id`` ''' def setUp(self): self.dir = mkdtemp() def tearDown(self): rmtree(self.dir) def test_idfile(self): f = self.check_idfile yield f, 'magic_id', 'magic_id' yield f, 'magic_id', 'magic_id', 'wb' yield f, ' magic_id', 'magic_id' yield f, ' magic_id', 'magic_id', 'wb' yield f, 'magic_id ', 'magic_id' yield f, 'magic_id ', 'magic_id', 'wb' yield f, ' magic_id ', 'magic_id' yield f, ' magic_id ', 'magic_id', 'wb' yield f, 'magic_id\n', 'magic_id' yield f, 'magic_id\n', 'magic_id', 'wb' yield f, 'magic_id\n\r', 'magic_id' yield f, 'magic_id\n\r', 'magic_id', 'wb' yield f, 'magic_id\r', 'magic_id' yield f, 'magic_id\r', 'magic_id', 'wb' yield f, 'magic_id \n', 'magic_id' yield f, 'magic_id \n', 'magic_id', 'wb' yield f, 'magic_id \n\r', 'magic_id' yield f, 'magic_id \n\r', 'magic_id', 'wb' yield f, 'magic_id \r ', 'magic_id' yield f, 'magic_id \r ', 'magic_id', 'wb' f = self.check_not_idfile yield f, '\nmagic_id', 'magic_id' yield f, '\n\rmagic_id', 'magic_id' yield f, '\nmagic_id\n', 'magic_id' def check_idfile(self, content, ans, mode='w'): # create ``_id`` file p = os.path.join(self.dir, '_id') with open(p, mode) as idfile: idfile.write(content) doc = LocalDoc(self.dir, create=False) assert doc.get_id() == ans, doc.get_id() def check_not_idfile(self, content, ans, mode='w'): # create ``_id`` file p = os.path.join(self.dir, '_id') with open(p, mode) as idfile: idfile.write(content) doc = LocalDoc(self.dir, create=False) assert doc.get_id() != ans, doc.get_id() def test_dirname(self): ''' If the ``_id`` file does not eixsts ''' dirname = os.path.split(self.dir)[-1] doc = LocalDoc(self.dir, is_ddoc=False) assert doc.get_id() == dirname doc = LocalDoc(self.dir, is_ddoc=True) ans = '_design/{0}'.format(dirname) assert doc.get_id() == ans class testCreate(object): def setUp(self): self.dir = mkdtemp() def tearDown(self): rmtree(self.dir) def exists(self, filename): return os.path.exists(os.path.join(self.dir, filename)) def test_create(self): doc = LocalDoc(self.dir, create=True) assert self.exists('.couchapprc') assert self.exists('.couchappignore') def test_create_nothing(self): # .couchapprc already exists path = os.path.join(self.dir, '.couchapprc') with open(path, 'w') as f: f.write('{}') doc = LocalDoc(self.dir, create=True) assert self.exists('.couchapprc') assert not self.exists('.couchappignore') def test_check_ignore(): f = check_check_ignore ignores = ['.*\.bak'] yield f, ignores, 'magic.bak', True yield f, ignores, 'magicbak', False yield f, ignores, 'bar/magic.bak', True ignores = ['bar'] yield f, ignores, 'bar', True yield f, ignores, 'bar/', True yield f, ignores, 'bar.txt', False yield f, ignores, 'magic_bar', False yield f, ignores, 'foo/bar', True yield f, ignores, 'foo/qaz/bar', True yield f, ignores, 'foo/bar/app.js', True yield f, ignores, 'bar/app.js', True yield f, ignores, 'bar/foo.txt', True yield f, ignores, 'magic_bar/app.js', False yield f, ignores, 'bar_magic/app.js', False # the result should be same as ``['bar']``, # the ``$`` is include by default ignores = ['bar$'] yield f, ignores, 'bar', True yield f, ignores, 'bar/', True yield f, ignores, 'bar.txt', False yield f, ignores, 'magic_bar', False yield f, ignores, 'foo/bar', True yield f, ignores, 'foo/qaz/bar', True yield f, ignores, 'foo/bar/app.js', True yield f, ignores, 'bar/app.js', True yield f, ignores, 'bar/foo.txt', True yield f, ignores, 'magic_bar/app.js', False yield f, ignores, 'bar_magic/app.js', False ignores = ['foo/bar'] yield f, ignores, 'foo/bar', True yield f, ignores, 'qaz/foo/bar', True yield f, ignores, 'foo/bar/', True yield f, ignores, 'qaz/foo/bar/', True yield f, ignores, 'foo/bar/app.js', True yield f, ignores, 'qaz/foo/bar/app.js', True ignores = ['foo/.*bar'] yield f, ignores, 'foo/magic_bar', True yield f, ignores, 'foo/magic_bar/', True yield f, ignores, 'foo/magic_bar/app.js', True yield f, ignores, 'foo/magic/bar/', True yield f, ignores, 'foo/magic/bar/app.js', True yield f, ignores, 'foo/magic/long/long/bar', True yield f, ignores, 'foo/magic/long/long/bar/app.js', True yield f, ignores, 'foobar', False yield f, ignores, 'qaz/foo/magic_bar', True yield f, ignores, 'qaz/foo/magic_bar/', True yield f, ignores, 'qaz/foo/magic_bar/app.js', True yield f, ignores, 'qaz/foo/magic/bar/', True yield f, ignores, 'qaz/foo/magic/bar/app.js', True yield f, ignores, 'qaz/foo/magic/long/long/bar', True yield f, ignores, 'qaz/foo/magic/long/long/bar/app.js', True yield f, ignores, 'qaz_foo/magic_bar', False yield f, ignores, 'qaz_foo/magic_bar/', False yield f, ignores, 'qaz_foo/magic_bar/app.js', False yield f, ignores, 'qaz_foo/magic/bar/', False yield f, ignores, 'qaz_foo/magic/bar/app.js', False yield f, ignores, 'qaz_foo/magic/long/long/bar', False yield f, ignores, 'qaz_foo/magic/long/long/bar/app.js', False yield f, ignores, 'foo/magic_bar_', False yield f, ignores, 'foo/magic_bar_/', False yield f, ignores, 'foo/magic_bar_/app.js', False yield f, ignores, 'foo/magic/bar_/', False yield f, ignores, 'foo/magic/bar_/app.js', False yield f, ignores, 'foo/magic/long/long/bar_', False yield f, ignores, 'foo/magic/long/long/bar_/app.js', False ignores = ['foo/.*/bar'] yield f, ignores, 'foo/magic_bar', False yield f, ignores, 'foo/magic_bar/', False yield f, ignores, 'foo/magic_bar/app.js', False yield f, ignores, 'foo/magic/bar/', True yield f, ignores, 'foo/magic/bar/app.js', True yield f, ignores, 'foo/magic/long/long/bar', True yield f, ignores, 'foo/magic/long/long/bar/app.js', True yield f, ignores, 'foobar', False yield f, ignores, 'qaz/foo/magic_bar', False yield f, ignores, 'qaz/foo/magic_bar/', False yield f, ignores, 'qaz/foo/magic_bar/app.js', False yield f, ignores, 'qaz/foo/magic/bar/', True yield f, ignores, 'qaz/foo/magic/bar/app.js', True yield f, ignores, 'qaz/foo/magic/long/long/bar', True yield f, ignores, 'qaz/foo/magic/long/long/bar/app.js', True yield f, ignores, 'qaz_foo/magic_bar', False yield f, ignores, 'qaz_foo/magic_bar/', False yield f, ignores, 'qaz_foo/magic_bar/app.js', False yield f, ignores, 'qaz_foo/magic/bar/', False yield f, ignores, 'qaz_foo/magic/bar/app.js', False yield f, ignores, 'qaz_foo/magic/long/long/bar', False yield f, ignores, 'qaz_foo/magic/long/long/bar/app.js', False yield f, ignores, 'foo/magic/bar_', False yield f, ignores, 'foo/magic/bar_/', False yield f, ignores, 'foo/magic/bar_/app.js', False yield f, ignores, 'foo/magic/long/long/bar_', False yield f, ignores, 'foo/magic/long/long/bar_/app.js', False ignores = ['/foo/bar'] yield f, ignores, 'foo/bar', True yield f, ignores, 'foo/bar/app.js', True yield f, ignores, 'qaz/foo/bar', False yield f, ignores, 'qaz/foo/bar/app.js', False ignores = [u'測試'] # unicode testing yield f, ignores, u'測試', True yield f, ignores, u'測 試', False yield f, ignores, u'測試/app.js', True yield f, ignores, u'測試資料夾', False yield f, ignores, u'測試.txt', False yield f, ignores, u'foo/測試', True yield f, ignores, u'foo/測 試', False yield f, ignores, u'foo/測試/app.js', True yield f, ignores, u'foo/測試資料夾', False yield f, ignores, u'foo/測試.txt', False def check_check_ignore(ignores, path, ans): doc = LocalDoc('/mock/app', create=False) doc.ignores = ignores assert doc.check_ignore(path) is ans def test_meta_to_fields(): f = check_meta_to_fields yield f, ({}, {}), ({'couchapp': {}}, {}) yield f, ({}, []), ({'couchapp': {'meta': []}}, {'meta': []}) yield f, ({}, [42]), ({'couchapp': {'meta': [42]}}, {'meta': [42]}) yield f, ({}, 'magic'), ({'couchapp': {'meta': 'magic'}}, {'meta': 'magic'}) yield f, ({}, {'signatures': 42}), ({'couchapp': {}}, {}) yield f, ({}, {'manifest': 42}), ({'couchapp': {}}, {}) yield f, ({}, {'objects': 42}), ({'couchapp': {}}, {}) yield f, ({}, {'object': 42}), ({'couchapp': {'object': 42}}, {'object': 42}) yield f, ({}, {'length': 42}), ({'couchapp': {}}, {}) yield (f, ({'couchapp': {'magic': 42}}, {'foo': 'bar'}), ({'couchapp': {'magic': 42, 'foo': 'bar'}}, {'foo': 'bar'})) def check_meta_to_fields(input, ans): output = LocalDoc._meta_to_fields(*input) assert ans == output # check the is a copy of dict for i, o in zip(input, output): assert i is not o class TestEncodeContent(object): def setUp(self): self.dir = mkdtemp() def tearDown(self): rmtree(self.dir) def test_json_suffix(self): f = self.check_json_suffix yield f, '{"magic": 42}', {'magic': 42} yield f, '"magic"', "magic" yield f, '[1, 2, 3]', [1, 2, 3] yield f, '{}{}', '' def check_json_suffix(self, content, ans): name = 'magic.json' p = os.path.join(self.dir, name) with open(p, 'w') as f: f.write(content) content = LocalDoc._encode_content(name, p) assert content == ans def test_text_file(self): f = self.check_text_file yield f, b'readme' yield f, b'readme\ntopic\n' yield f, b'readme\ntopic\n ' yield f, b'測試' yield f, b'測試\n測試\n' yield f, b'測試\n測試\n ' def check_text_file(self, ans): name = 'README.rst' p = os.path.join(self.dir, name) with open(p, 'wb') as f: f.write(ans) content = LocalDoc._encode_content(name, p) assert content == ans.decode('utf8'), content def test_bin_file(self): f = self.check_bin_file yield f, b'\xb4\xfa\xb8\xd5', 'tPq41Q==' yield f, b'\xb4\xfa\xb8\xd5\xb4', 'tPq41bQ=' def check_bin_file(self, bits, ans): name = 'a.out' p = os.path.join(self.dir, name) with open(p, 'wb') as f: f.write(bits) content = LocalDoc._encode_content(name, p) assert content == 'base64-encoded;' + ans class TestDirToFieds(object): def setUp(self): self.dir = mkdtemp() def tearDown(self): rmtree(self.dir) def test_main(self): f = self.check # assume ``docdir`` is same as ``current_dir`` yield f, [], ['.foo'], {}, [] yield f, [], ['.foo', '.bar'], {}, [] yield f, ['test'], ['.foo', 'test/.bar'], {'test': {}}, ['test/'] f = self.check_ignore yield f, ['README'], [], ['README'], {}, [] yield f, ['README'], ['d'], ['d/README', 'README'], {'d': {}}, ['d/'] yield ( f, ['README'], ['d'], ['d/README', 'README', '.foo', 'd/.bar'], # files {'d': {}}, # fields ['d/']) # manifest f = self.check yield f, ['_foo'], [], {}, [] yield f, ['_foo', '_bar'], [], {}, [] yield f, ['_foo', '_bar'], ['_foo/foo'], {}, [] yield f, ['_foo', '_bar'], ['_foo/foo', '_bar/bar'], {}, [] yield ( f, ['d/_foo'], [], {'d': {'_foo': {}}}, ['d/', 'd/_foo/']) yield ( f, ['d/_foo'], ['d/_foo/README'], {'d': {'_foo': {'README': ''}}}, ['d/', 'd/_foo/', 'd/_foo/README']) yield ( f, ['d/_foo', '_bar'], ['d/_foo/README', '_bar/bar'], # files {'d': {'_foo': {'README': ''}}}, ['d/', 'd/_foo/', 'd/_foo/README']) yield ( f, ['d/_foo', '_bar', '.foo'], ['d/_foo/README', '_bar/bar', '.foo/foo'], # files {'d': {'_foo': {'README': ''}}}, ['d/', 'd/_foo/', 'd/_foo/README']) yield ( f, ['d/_foo', '_bar', '.foo'], ['d/_foo/README', '_bar/bar', '_bar/_bar', '.foo/foo'], # files {'d': {'_foo': {'README': ''}}}, ['d/', 'd/_foo/', 'd/_foo/README']) yield ( f, ['d/_foo', '_bar', '.foo'], ['d/_foo/README', 'd/_foo/.foo', '_bar/bar', '_bar/_bar', '.foo/foo'], # files {'d': {'_foo': {'README': ''}}}, ['d/', 'd/_foo/', 'd/_foo/README']) # test cases for ``_attachments`` yield ( f, ['_attachments'], ['_attachments/README'], # files {}, []) yield ( f, ['_attachments', 'd'], ['_attachments/README'], # files {'d': {}}, ['d/']) yield ( f, ['_attachments', 'd/_foo'], ['_attachments/README', 'd/_foo/foo'], # files {'d': {'_foo': {'foo': ''}}}, ['d/', 'd/_foo/', 'd/_foo/foo']) yield ( f, ['_attachments', 'd/_foo', 'd/_attachments'], ['_attachments/README', 'd/_foo/foo', 'd/_attachments/README'], # files {'d': {'_foo': {'foo': ''}}}, ['d/', 'd/_foo/', 'd/_foo/foo']) # test cases for ``couchapp/`` yield ( f, ['couchapp'], ['couchapp/README'], # files {'couchapp': {'README': ''}}, ['couchapp/', 'couchapp/README']) yield ( f, ['couchapp/_foo'], ['couchapp/README', 'couchapp/_foo/foo'], # files {'couchapp': {'README': '', '_foo': {'foo': ''}}}, ['couchapp/', 'couchapp/_foo/', 'couchapp/_foo/foo', 'couchapp/README']) # test cases for ``couchapp.json`` f = self.check_capp_json yield ( f, {}, [], ['couchapp.json'], {'couchapp': {}}, ['couchapp.json']) yield ( f, {'foo': 'bar', 'ans': 42}, [], ['couchapp.json'], {'couchapp': {'foo': 'bar', 'ans': 42}}, ['couchapp.json']) yield ( f, 'string', [], ['couchapp.json'], {'couchapp': {'meta': 'string'}}, ['couchapp.json']) yield ( f, ['list', 1, 2, 3], [], ['couchapp.json'], {'couchapp': {'meta': ['list', 1, 2, 3]}}, ['couchapp.json']) yield ( f, {'signatures': 42}, [], ['couchapp.json'], {'couchapp': {}}, ['couchapp.json']) yield ( f, {'signatures': 42, 'foo': 'bar'}, [], ['couchapp.json'], {'couchapp': {'foo': 'bar'}}, ['couchapp.json']) # test cases for name collision f = self.check yield( f, [], ['README', 'README.rst'], {'README': ''}, ['README']) def check(self, dirs, files, fields, manifest): [os.makedirs(os.path.join(self.dir, d)) for d in dirs] [open(os.path.join(self.dir, f), 'a').close() for f in files] out_m = [] out_f = LocalDoc(self.dir).dir_to_fields(self.dir, manifest=out_m) assert out_f == fields assert set(out_m) == set(manifest) def check_ignore(self, ignores, *args): with open(os.path.join(self.dir, '.couchappignore'), 'w') as f: f.write(json.dumps(ignores)) self.check(*args) def check_capp_json(self, content, *args): with open(os.path.join(self.dir, 'couchapp.json'), 'w') as f: f.write(json.dumps(content)) self.check(*args)
tests/test_localdoc.py
import json import os from shutil import rmtree from tempfile import mkdtemp from couchapp.localdoc import LocalDoc def test_load_ignores_non_exist(): doc = LocalDoc('/mock/app', create=False) assert doc.ignores == [] class testIgnores(object): def setUp(self): self.dir = mkdtemp() def tearDown(self): rmtree(self.dir) def test_load_ignore(self): func = self.check_ignore yield func, '[42]', [42] yield func, '["foo", "bar"]', ['foo', 'bar'] content = ''' [ "magic", // comments are allowed "answer" ] ''' yield func, content, ['magic', 'answer'] content = ''' [ "magic", /* comments are allowed */ "answer" ] ''' yield func, content, ['magic', 'answer'] content = ''' [ "magic", /* comments are allowed */ "answer" // remix ] ''' yield func, content, ['magic', 'answer'] content = ''' [ "magic" /* "answer" */ ] ''' yield func, content, ['magic'] content = ''' [ "^regex$", /* comment */ "answer" ] ''' yield func, content, ['^regex$', 'answer'] content = ''' [ "/*regex", /* comment */ "answer//" // comment ] ''' yield func, content, ['/*regex', 'answer//'] def check_ignore(self, content, ans): # prepare ignore file path = os.path.join(self.dir, '.couchappignore') with open(path, 'w') as f: f.write(content) doc = LocalDoc(self.dir, create=False) assert doc.ignores == ans class testGetId(object): ''' The test cases of ``LocalDoc.get_id`` ''' def setUp(self): self.dir = mkdtemp() def tearDown(self): rmtree(self.dir) def test_idfile(self): f = self.check_idfile yield f, 'magic_id', 'magic_id' yield f, 'magic_id', 'magic_id', 'wb' yield f, ' magic_id', 'magic_id' yield f, ' magic_id', 'magic_id', 'wb' yield f, 'magic_id ', 'magic_id' yield f, 'magic_id ', 'magic_id', 'wb' yield f, ' magic_id ', 'magic_id' yield f, ' magic_id ', 'magic_id', 'wb' yield f, 'magic_id\n', 'magic_id' yield f, 'magic_id\n', 'magic_id', 'wb' yield f, 'magic_id\n\r', 'magic_id' yield f, 'magic_id\n\r', 'magic_id', 'wb' yield f, 'magic_id\r', 'magic_id' yield f, 'magic_id\r', 'magic_id', 'wb' yield f, 'magic_id \n', 'magic_id' yield f, 'magic_id \n', 'magic_id', 'wb' yield f, 'magic_id \n\r', 'magic_id' yield f, 'magic_id \n\r', 'magic_id', 'wb' yield f, 'magic_id \r ', 'magic_id' yield f, 'magic_id \r ', 'magic_id', 'wb' f = self.check_not_idfile yield f, '\nmagic_id', 'magic_id' yield f, '\n\rmagic_id', 'magic_id' yield f, '\nmagic_id\n', 'magic_id' def check_idfile(self, content, ans, mode='w'): # create ``_id`` file p = os.path.join(self.dir, '_id') with open(p, mode) as idfile: idfile.write(content) doc = LocalDoc(self.dir, create=False) assert doc.get_id() == ans, doc.get_id() def check_not_idfile(self, content, ans, mode='w'): # create ``_id`` file p = os.path.join(self.dir, '_id') with open(p, mode) as idfile: idfile.write(content) doc = LocalDoc(self.dir, create=False) assert doc.get_id() != ans, doc.get_id() def test_dirname(self): ''' If the ``_id`` file does not eixsts ''' dirname = os.path.split(self.dir)[-1] doc = LocalDoc(self.dir, is_ddoc=False) assert doc.get_id() == dirname doc = LocalDoc(self.dir, is_ddoc=True) ans = '_design/{0}'.format(dirname) assert doc.get_id() == ans class testCreate(object): def setUp(self): self.dir = mkdtemp() def tearDown(self): rmtree(self.dir) def exists(self, filename): return os.path.exists(os.path.join(self.dir, filename)) def test_create(self): doc = LocalDoc(self.dir, create=True) assert self.exists('.couchapprc') assert self.exists('.couchappignore') def test_create_nothing(self): # .couchapprc already exists path = os.path.join(self.dir, '.couchapprc') with open(path, 'w') as f: f.write('{}') doc = LocalDoc(self.dir, create=True) assert self.exists('.couchapprc') assert not self.exists('.couchappignore') def test_check_ignore(): f = check_check_ignore ignores = ['.*\.bak'] yield f, ignores, 'magic.bak', True yield f, ignores, 'magicbak', False yield f, ignores, 'bar/magic.bak', True ignores = ['bar'] yield f, ignores, 'bar', True yield f, ignores, 'bar/', True yield f, ignores, 'bar.txt', False yield f, ignores, 'magic_bar', False yield f, ignores, 'foo/bar', True yield f, ignores, 'foo/qaz/bar', True yield f, ignores, 'foo/bar/app.js', True yield f, ignores, 'bar/app.js', True yield f, ignores, 'bar/foo.txt', True yield f, ignores, 'magic_bar/app.js', False yield f, ignores, 'bar_magic/app.js', False # the result should be same as ``['bar']``, # the ``$`` is include by default ignores = ['bar$'] yield f, ignores, 'bar', True yield f, ignores, 'bar/', True yield f, ignores, 'bar.txt', False yield f, ignores, 'magic_bar', False yield f, ignores, 'foo/bar', True yield f, ignores, 'foo/qaz/bar', True yield f, ignores, 'foo/bar/app.js', True yield f, ignores, 'bar/app.js', True yield f, ignores, 'bar/foo.txt', True yield f, ignores, 'magic_bar/app.js', False yield f, ignores, 'bar_magic/app.js', False ignores = ['foo/bar'] yield f, ignores, 'foo/bar', True yield f, ignores, 'qaz/foo/bar', True yield f, ignores, 'foo/bar/', True yield f, ignores, 'qaz/foo/bar/', True yield f, ignores, 'foo/bar/app.js', True yield f, ignores, 'qaz/foo/bar/app.js', True ignores = ['foo/.*bar'] yield f, ignores, 'foo/magic_bar', True yield f, ignores, 'foo/magic_bar/', True yield f, ignores, 'foo/magic_bar/app.js', True yield f, ignores, 'foo/magic/bar/', True yield f, ignores, 'foo/magic/bar/app.js', True yield f, ignores, 'foo/magic/long/long/bar', True yield f, ignores, 'foo/magic/long/long/bar/app.js', True yield f, ignores, 'foobar', False yield f, ignores, 'qaz/foo/magic_bar', True yield f, ignores, 'qaz/foo/magic_bar/', True yield f, ignores, 'qaz/foo/magic_bar/app.js', True yield f, ignores, 'qaz/foo/magic/bar/', True yield f, ignores, 'qaz/foo/magic/bar/app.js', True yield f, ignores, 'qaz/foo/magic/long/long/bar', True yield f, ignores, 'qaz/foo/magic/long/long/bar/app.js', True yield f, ignores, 'qaz_foo/magic_bar', False yield f, ignores, 'qaz_foo/magic_bar/', False yield f, ignores, 'qaz_foo/magic_bar/app.js', False yield f, ignores, 'qaz_foo/magic/bar/', False yield f, ignores, 'qaz_foo/magic/bar/app.js', False yield f, ignores, 'qaz_foo/magic/long/long/bar', False yield f, ignores, 'qaz_foo/magic/long/long/bar/app.js', False yield f, ignores, 'foo/magic_bar_', False yield f, ignores, 'foo/magic_bar_/', False yield f, ignores, 'foo/magic_bar_/app.js', False yield f, ignores, 'foo/magic/bar_/', False yield f, ignores, 'foo/magic/bar_/app.js', False yield f, ignores, 'foo/magic/long/long/bar_', False yield f, ignores, 'foo/magic/long/long/bar_/app.js', False ignores = ['foo/.*/bar'] yield f, ignores, 'foo/magic_bar', False yield f, ignores, 'foo/magic_bar/', False yield f, ignores, 'foo/magic_bar/app.js', False yield f, ignores, 'foo/magic/bar/', True yield f, ignores, 'foo/magic/bar/app.js', True yield f, ignores, 'foo/magic/long/long/bar', True yield f, ignores, 'foo/magic/long/long/bar/app.js', True yield f, ignores, 'foobar', False yield f, ignores, 'qaz/foo/magic_bar', False yield f, ignores, 'qaz/foo/magic_bar/', False yield f, ignores, 'qaz/foo/magic_bar/app.js', False yield f, ignores, 'qaz/foo/magic/bar/', True yield f, ignores, 'qaz/foo/magic/bar/app.js', True yield f, ignores, 'qaz/foo/magic/long/long/bar', True yield f, ignores, 'qaz/foo/magic/long/long/bar/app.js', True yield f, ignores, 'qaz_foo/magic_bar', False yield f, ignores, 'qaz_foo/magic_bar/', False yield f, ignores, 'qaz_foo/magic_bar/app.js', False yield f, ignores, 'qaz_foo/magic/bar/', False yield f, ignores, 'qaz_foo/magic/bar/app.js', False yield f, ignores, 'qaz_foo/magic/long/long/bar', False yield f, ignores, 'qaz_foo/magic/long/long/bar/app.js', False yield f, ignores, 'foo/magic/bar_', False yield f, ignores, 'foo/magic/bar_/', False yield f, ignores, 'foo/magic/bar_/app.js', False yield f, ignores, 'foo/magic/long/long/bar_', False yield f, ignores, 'foo/magic/long/long/bar_/app.js', False ignores = ['/foo/bar'] yield f, ignores, 'foo/bar', True yield f, ignores, 'foo/bar/app.js', True yield f, ignores, 'qaz/foo/bar', False yield f, ignores, 'qaz/foo/bar/app.js', False ignores = [u'測試'] # unicode testing yield f, ignores, u'測試', True yield f, ignores, u'測 試', False yield f, ignores, u'測試/app.js', True yield f, ignores, u'測試資料夾', False yield f, ignores, u'測試.txt', False yield f, ignores, u'foo/測試', True yield f, ignores, u'foo/測 試', False yield f, ignores, u'foo/測試/app.js', True yield f, ignores, u'foo/測試資料夾', False yield f, ignores, u'foo/測試.txt', False def check_check_ignore(ignores, path, ans): doc = LocalDoc('/mock/app', create=False) doc.ignores = ignores assert doc.check_ignore(path) is ans def test_meta_to_fields(): f = check_meta_to_fields yield f, ({}, {}), ({'couchapp': {}}, {}) yield f, ({}, []), ({'couchapp': {'meta': []}}, {'meta': []}) yield f, ({}, [42]), ({'couchapp': {'meta': [42]}}, {'meta': [42]}) yield f, ({}, 'magic'), ({'couchapp': {'meta': 'magic'}}, {'meta': 'magic'}) yield f, ({}, {'signatures': 42}), ({'couchapp': {}}, {}) yield f, ({}, {'manifest': 42}), ({'couchapp': {}}, {}) yield f, ({}, {'objects': 42}), ({'couchapp': {}}, {}) yield f, ({}, {'object': 42}), ({'couchapp': {'object': 42}}, {'object': 42}) yield f, ({}, {'length': 42}), ({'couchapp': {}}, {}) yield (f, ({'couchapp': {'magic': 42}}, {'foo': 'bar'}), ({'couchapp': {'magic': 42, 'foo': 'bar'}}, {'foo': 'bar'})) def check_meta_to_fields(input, ans): output = LocalDoc._meta_to_fields(*input) assert ans == output # check the is a copy of dict for i, o in zip(input, output): assert i is not o class TestEncodeContent(object): def setUp(self): self.dir = mkdtemp() def tearDown(self): rmtree(self.dir) def test_json_suffix(self): f = self.check_json_suffix yield f, '{"magic": 42}', {'magic': 42} yield f, '"magic"', "magic" yield f, '[1, 2, 3]', [1, 2, 3] yield f, '{}{}', '' def check_json_suffix(self, content, ans): name = 'magic.json' p = os.path.join(self.dir, name) with open(p, 'w') as f: f.write(content) content = LocalDoc._encode_content(name, p) assert content == ans def test_text_file(self): f = self.check_text_file yield f, b'readme' yield f, b'readme\ntopic\n' yield f, b'readme\ntopic\n ' yield f, b'測試' yield f, b'測試\n測試\n' yield f, b'測試\n測試\n ' def check_text_file(self, ans): name = 'README.rst' p = os.path.join(self.dir, name) with open(p, 'wb') as f: f.write(ans) content = LocalDoc._encode_content(name, p) assert content == ans.decode('utf8'), content def test_bin_file(self): f = self.check_bin_file yield f, b'\xb4\xfa\xb8\xd5', 'tPq41Q==' yield f, b'\xb4\xfa\xb8\xd5\xb4', 'tPq41bQ=' def check_bin_file(self, bits, ans): name = 'a.out' p = os.path.join(self.dir, name) with open(p, 'wb') as f: f.write(bits) content = LocalDoc._encode_content(name, p) assert content == 'base64-encoded;' + ans class TestDirToFieds(object): def setUp(self): self.dir = mkdtemp() def tearDown(self): rmtree(self.dir) def test_main(self): f = self.check # assume ``docdir`` is same as ``current_dir`` yield f, [], ['.foo'], {}, [] yield f, [], ['.foo', '.bar'], {}, [] yield f, ['test'], ['.foo', 'test/.bar'], {'test': {}}, ['test/'] f = self.check_ignore yield f, ['README'], [], ['README'], {}, [] yield f, ['README'], ['d'], ['d/README', 'README'], {'d': {}}, ['d/'] yield ( f, ['README'], ['d'], ['d/README', 'README', '.foo', 'd/.bar'], # files {'d': {}}, # fields ['d/']) # manifest f = self.check yield f, ['_foo'], [], {}, [] yield f, ['_foo', '_bar'], [], {}, [] yield f, ['_foo', '_bar'], ['_foo/foo'], {}, [] yield f, ['_foo', '_bar'], ['_foo/foo', '_bar/bar'], {}, [] yield ( f, ['d/_foo'], [], {'d': {'_foo': {}}}, ['d/', 'd/_foo/']) yield ( f, ['d/_foo'], ['d/_foo/README'], {'d': {'_foo': {'README': ''}}}, ['d/', 'd/_foo/', 'd/_foo/README']) yield ( f, ['d/_foo', '_bar'], ['d/_foo/README', '_bar/bar'], # files {'d': {'_foo': {'README': ''}}}, ['d/', 'd/_foo/', 'd/_foo/README']) yield ( f, ['d/_foo', '_bar', '.foo'], ['d/_foo/README', '_bar/bar', '.foo/foo'], # files {'d': {'_foo': {'README': ''}}}, ['d/', 'd/_foo/', 'd/_foo/README']) yield ( f, ['d/_foo', '_bar', '.foo'], ['d/_foo/README', '_bar/bar', '_bar/_bar', '.foo/foo'], # files {'d': {'_foo': {'README': ''}}}, ['d/', 'd/_foo/', 'd/_foo/README']) yield ( f, ['d/_foo', '_bar', '.foo'], ['d/_foo/README', 'd/_foo/.foo', '_bar/bar', '_bar/_bar', '.foo/foo'], # files {'d': {'_foo': {'README': ''}}}, ['d/', 'd/_foo/', 'd/_foo/README']) # test cases for ``_attachments`` yield ( f, ['_attachments'], ['_attachments/README'], # files {}, []) yield ( f, ['_attachments', 'd'], ['_attachments/README'], # files {'d': {}}, ['d/']) yield ( f, ['_attachments', 'd/_foo'], ['_attachments/README', 'd/_foo/foo'], # files {'d': {'_foo': {'foo': ''}}}, ['d/', 'd/_foo/', 'd/_foo/foo']) yield ( f, ['_attachments', 'd/_foo', 'd/_attachments'], ['_attachments/README', 'd/_foo/foo', 'd/_attachments/README'], # files {'d': {'_foo': {'foo': ''}}}, ['d/', 'd/_foo/', 'd/_foo/foo']) # test cases for ``couchapp/`` yield ( f, ['couchapp'], ['couchapp/README'], # files {'couchapp': {'README': ''}}, ['couchapp/', 'couchapp/README']) yield ( f, ['couchapp/_foo'], ['couchapp/README', 'couchapp/_foo/foo'], # files {'couchapp': {'README': '', '_foo': {'foo': ''}}}, ['couchapp/', 'couchapp/_foo/', 'couchapp/_foo/foo', 'couchapp/README']) # test cases for ``couchapp.json`` f = self.check_capp_json yield ( f, {}, [], ['couchapp.json'], {'couchapp': {}}, ['couchapp.json']) yield ( f, {'foo': 'bar', 'ans': 42}, [], ['couchapp.json'], {'couchapp': {'foo': 'bar', 'ans': 42}}, ['couchapp.json']) yield ( f, 'string', [], ['couchapp.json'], {'couchapp': {'meta': 'string'}}, ['couchapp.json']) yield ( f, ['list', 1, 2, 3], [], ['couchapp.json'], {'couchapp': {'meta': ['list', 1, 2, 3]}}, ['couchapp.json']) yield ( f, {'signatures': 42}, [], ['couchapp.json'], {'couchapp': {}}, ['couchapp.json']) yield ( f, {'signatures': 42, 'foo': 'bar'}, [], ['couchapp.json'], {'couchapp': {'foo': 'bar'}}, ['couchapp.json']) # test cases for name collision f = self.check yield( f, [], ['README', 'README.rst'], {'README': ''}, ['README']) def check(self, dirs, files, fields, manifest): [os.makedirs(os.path.join(self.dir, d)) for d in dirs] [open(os.path.join(self.dir, f), 'a').close() for f in files] out_m = [] out_f = LocalDoc(self.dir).dir_to_fields(self.dir, manifest=out_m) assert out_f == fields assert set(out_m) == set(manifest) def check_ignore(self, ignores, *args): with open(os.path.join(self.dir, '.couchappignore'), 'w') as f: f.write(json.dumps(ignores)) self.check(*args) def check_capp_json(self, content, *args): with open(os.path.join(self.dir, 'couchapp.json'), 'w') as f: f.write(json.dumps(content)) self.check(*args)
0.398875
0.222162
import re from studioqt import QtCore class SearchFilter(QtCore.QObject): searchChanged = QtCore.Signal() class Operator: OR = " or " AND = " and " def __init__(self, pattern, spaceOperator=Operator.AND): """ :type pattern: str :type spaceOperator: SearchFilter.Operator """ QtCore.QObject.__init__(self) self._matches = 0 self._pattern = None self._resolvedPattern = None self._spaceOperator = spaceOperator self.setPattern(pattern) def pattern(self): """ Return the pattern for the search filter. :rtype: str """ return self._pattern def setPattern(self, pattern): """ Set the pattern for the search filter. :type pattern: str """ self._pattern = pattern self._searchChanged() def _searchChanged(self): """ Triggered when the search filter changes. :rtype: None """ self.resolvePattern() self.searchChanged.emit() def resolvedPattern(self): """ Return the resolved pattern. :rtype: str """ return self._resolvedPattern def setResolvedPattern(self, resolvedPattern): """ Set the resolved pattern. :type resolvedPattern: str :rtype: None """ self._resolvedPattern = resolvedPattern def spaceOperator(self): """ Return the operator for all white spaces in the pattern. :rtype: SearchFilter.Operator """ return self._spaceOperator def setSpaceOperator(self, operator): """ Set the operator for all white spaces in the pattern. :type: SearchFilter.Operator """ self._spaceOperator = operator self._searchChanged() def settings(self): """ Return the state of the search filter as a dict object. :rtype: dict """ settings = {} settings["pattern"] = self.pattern() settings["spaceOperator"] = self.spaceOperator() return settings def setSettings(self, settings): """ Set the state of the search filter from a dict object. :type settings: dict :rtype: None """ pattern = settings.get("pattern", "") self.setPattern(pattern) spaceOperator = settings.get("spaceOperator", self.Operator.AND) self.setSpaceOperator(spaceOperator) def resolvePattern(self): """ Resolve the pattern to speed up the match method. :rtype: None """ pattern = self.pattern() spaceOperator = self.spaceOperator() pattern = pattern.strip() # Case-sensitive is not supported pattern = pattern.lower() # Remove all double spaces. pattern = re.sub(' +', ' ', pattern) # Replace all white spaces with the space operator pattern = pattern.replace(self.Operator.OR, "_OR_") pattern = pattern.replace(self.Operator.AND, "_AND_") pattern = pattern.replace(" ", spaceOperator) pattern = pattern.replace("_OR_", self.Operator.OR) pattern = pattern.replace("_AND_", self.Operator.AND) self.setResolvedPattern(pattern) def matches(self): """ Return the number of matches from the last match. :rtype: int """ return self._matches def match(self, text): """ Match the given text to the resolved pattern. :type text: str :rtype: bool """ match = False matches = 0 pattern = self.resolvedPattern() groups = pattern.split(self.Operator.OR) for group in groups: match = True labels = [label.lower() for label in group.split(self.Operator.AND)] for label in labels: if label not in text.lower(): matches += 1 match = False break matches += 1 if match: break matches += 1 if not match: matches = 0 self._matches = matches return match
zfused_maya/zfused_maya/tool/animation/studiolibrary/packages/studioqt/widgets/searchwidget/searchfilter.py
import re from studioqt import QtCore class SearchFilter(QtCore.QObject): searchChanged = QtCore.Signal() class Operator: OR = " or " AND = " and " def __init__(self, pattern, spaceOperator=Operator.AND): """ :type pattern: str :type spaceOperator: SearchFilter.Operator """ QtCore.QObject.__init__(self) self._matches = 0 self._pattern = None self._resolvedPattern = None self._spaceOperator = spaceOperator self.setPattern(pattern) def pattern(self): """ Return the pattern for the search filter. :rtype: str """ return self._pattern def setPattern(self, pattern): """ Set the pattern for the search filter. :type pattern: str """ self._pattern = pattern self._searchChanged() def _searchChanged(self): """ Triggered when the search filter changes. :rtype: None """ self.resolvePattern() self.searchChanged.emit() def resolvedPattern(self): """ Return the resolved pattern. :rtype: str """ return self._resolvedPattern def setResolvedPattern(self, resolvedPattern): """ Set the resolved pattern. :type resolvedPattern: str :rtype: None """ self._resolvedPattern = resolvedPattern def spaceOperator(self): """ Return the operator for all white spaces in the pattern. :rtype: SearchFilter.Operator """ return self._spaceOperator def setSpaceOperator(self, operator): """ Set the operator for all white spaces in the pattern. :type: SearchFilter.Operator """ self._spaceOperator = operator self._searchChanged() def settings(self): """ Return the state of the search filter as a dict object. :rtype: dict """ settings = {} settings["pattern"] = self.pattern() settings["spaceOperator"] = self.spaceOperator() return settings def setSettings(self, settings): """ Set the state of the search filter from a dict object. :type settings: dict :rtype: None """ pattern = settings.get("pattern", "") self.setPattern(pattern) spaceOperator = settings.get("spaceOperator", self.Operator.AND) self.setSpaceOperator(spaceOperator) def resolvePattern(self): """ Resolve the pattern to speed up the match method. :rtype: None """ pattern = self.pattern() spaceOperator = self.spaceOperator() pattern = pattern.strip() # Case-sensitive is not supported pattern = pattern.lower() # Remove all double spaces. pattern = re.sub(' +', ' ', pattern) # Replace all white spaces with the space operator pattern = pattern.replace(self.Operator.OR, "_OR_") pattern = pattern.replace(self.Operator.AND, "_AND_") pattern = pattern.replace(" ", spaceOperator) pattern = pattern.replace("_OR_", self.Operator.OR) pattern = pattern.replace("_AND_", self.Operator.AND) self.setResolvedPattern(pattern) def matches(self): """ Return the number of matches from the last match. :rtype: int """ return self._matches def match(self, text): """ Match the given text to the resolved pattern. :type text: str :rtype: bool """ match = False matches = 0 pattern = self.resolvedPattern() groups = pattern.split(self.Operator.OR) for group in groups: match = True labels = [label.lower() for label in group.split(self.Operator.AND)] for label in labels: if label not in text.lower(): matches += 1 match = False break matches += 1 if match: break matches += 1 if not match: matches = 0 self._matches = matches return match
0.742608
0.342984
import os import json from datetime import datetime from ckan.lib.redis import connect_to_redis def get_config(config_name): """ Retrieves a specific section of the config by its name. The config is retrieved from Redis, as it is cached there for up to 24 hours. :param str config_name: the name of the config key :rtype: dict[str, list of str|dict[str, list of str|dict[str, dict]] """ _load_config_file() return json.loads(redis_conn.get(config_key + config_name)) def in_list(name, list_type, value): """ Checks whether or not a given value is part of a given list. The lists to check against are stored in the Redis instance configured in the CKAN `production.ini` file. So in order to check against the list, the list will first be retrieved from Redis. :param str name: The name of the list :param str list_type: The type of the list :param str value: The value to search for :rtype: bool :return: Whether or not the value is contained in the list """ _load_config_file() return value in json.loads( redis_conn.get(redis_key + list_type + '.' + name) ) def _load_list(name, local_name, list_type='vocabulary'): """ Loads the requested list from the local filesystem. The identifiers of all the entries in the list are put into a list, this list is then returned. See also: https://waardelijsten.dcat-ap-donl.nl Support list_types: - vocabulary, found in `'ckanext/dataoverheid/resources/vocabularies/*'` - taxonomy, found in `'ckanext/dataoverheid/resources/taxonomies/*'` Will raise a Exception under the following conditions: - No list is found locally with the given name - The local list contains content that could not be parsed as valid JSON :param str name: The name of the list to load :param str local_name: The name of the list on the filesystem :param str list_type: The type of list to load :rtype: list of str :return: The entries of the loaded list """ types_map = { 'vocabulary': 'vocabularies', 'taxonomy': 'taxonomies' } special = [ 'CKAN:License', 'Overheid:License' ] try: list_type = types_map.get(list_type) filepath = os.path.join(os.path.dirname(__file__), '..', '..', 'resources', list_type, local_name) with open(filepath, 'r') as file_contents: parsed = json.loads(file_contents.read()) try: return [block['id'] for block in parsed] if name in special \ else parsed.keys() except KeyError: raise Exception(name + ' is malformed') except KeyError: raise Exception('the requested vocabulary ' + name + ' does not exist ' 'or is not supported') def _load_config_file(): """ Loads the contents from the ckanext-dataoverheid configuration file and stores it in Redis for later use. Additionally all the vocabularies and taxonomies used in DCAT-AP-DONL are stored in Redis so that they can be made available to CKAN during the package validation process. The Redis cache will be updated once every 24 hours on the first request of the day. :rtype: None """ current_date = str(datetime.strftime(datetime.now(), '%Y%m%d')) cache_key = redis_key + '_cache_date' if current_date == redis_conn.get(cache_key): return filepath = os.path.join(os.path.dirname(__file__), '..', '..', '..', '..', 'config.json') with open(filepath, 'r') as config_file: config_keys = [ 'validation', 'transformations', 'dcat', 'solr', 'properties_to_remove' ] contents = json.load(config_file) redis_conn.set(cache_key, current_date) for redis_config_key in config_keys: redis_conn.set(config_key + redis_config_key, json.dumps(contents.get(redis_config_key))) [redis_conn.set(redis_key + 'vocabulary.{0}'.format(key), json.dumps(_load_list(key, voc['local'], 'vocabulary'))) for key, voc in contents.get('validation')['vocabularies'].iteritems()] [redis_conn.set(redis_key + 'taxonomy.{0}'.format(key), json.dumps(_load_list(key, tax['local'], 'taxonomy'))) for key, tax in contents.get('validation')['taxonomies'].iteritems()] redis_key = 'ckanext.dataoverheid:' config_key = redis_key + 'config.' redis_conn = connect_to_redis() _load_config_file()
ckanext/dataoverheid/logic/helpers/config.py
import os import json from datetime import datetime from ckan.lib.redis import connect_to_redis def get_config(config_name): """ Retrieves a specific section of the config by its name. The config is retrieved from Redis, as it is cached there for up to 24 hours. :param str config_name: the name of the config key :rtype: dict[str, list of str|dict[str, list of str|dict[str, dict]] """ _load_config_file() return json.loads(redis_conn.get(config_key + config_name)) def in_list(name, list_type, value): """ Checks whether or not a given value is part of a given list. The lists to check against are stored in the Redis instance configured in the CKAN `production.ini` file. So in order to check against the list, the list will first be retrieved from Redis. :param str name: The name of the list :param str list_type: The type of the list :param str value: The value to search for :rtype: bool :return: Whether or not the value is contained in the list """ _load_config_file() return value in json.loads( redis_conn.get(redis_key + list_type + '.' + name) ) def _load_list(name, local_name, list_type='vocabulary'): """ Loads the requested list from the local filesystem. The identifiers of all the entries in the list are put into a list, this list is then returned. See also: https://waardelijsten.dcat-ap-donl.nl Support list_types: - vocabulary, found in `'ckanext/dataoverheid/resources/vocabularies/*'` - taxonomy, found in `'ckanext/dataoverheid/resources/taxonomies/*'` Will raise a Exception under the following conditions: - No list is found locally with the given name - The local list contains content that could not be parsed as valid JSON :param str name: The name of the list to load :param str local_name: The name of the list on the filesystem :param str list_type: The type of list to load :rtype: list of str :return: The entries of the loaded list """ types_map = { 'vocabulary': 'vocabularies', 'taxonomy': 'taxonomies' } special = [ 'CKAN:License', 'Overheid:License' ] try: list_type = types_map.get(list_type) filepath = os.path.join(os.path.dirname(__file__), '..', '..', 'resources', list_type, local_name) with open(filepath, 'r') as file_contents: parsed = json.loads(file_contents.read()) try: return [block['id'] for block in parsed] if name in special \ else parsed.keys() except KeyError: raise Exception(name + ' is malformed') except KeyError: raise Exception('the requested vocabulary ' + name + ' does not exist ' 'or is not supported') def _load_config_file(): """ Loads the contents from the ckanext-dataoverheid configuration file and stores it in Redis for later use. Additionally all the vocabularies and taxonomies used in DCAT-AP-DONL are stored in Redis so that they can be made available to CKAN during the package validation process. The Redis cache will be updated once every 24 hours on the first request of the day. :rtype: None """ current_date = str(datetime.strftime(datetime.now(), '%Y%m%d')) cache_key = redis_key + '_cache_date' if current_date == redis_conn.get(cache_key): return filepath = os.path.join(os.path.dirname(__file__), '..', '..', '..', '..', 'config.json') with open(filepath, 'r') as config_file: config_keys = [ 'validation', 'transformations', 'dcat', 'solr', 'properties_to_remove' ] contents = json.load(config_file) redis_conn.set(cache_key, current_date) for redis_config_key in config_keys: redis_conn.set(config_key + redis_config_key, json.dumps(contents.get(redis_config_key))) [redis_conn.set(redis_key + 'vocabulary.{0}'.format(key), json.dumps(_load_list(key, voc['local'], 'vocabulary'))) for key, voc in contents.get('validation')['vocabularies'].iteritems()] [redis_conn.set(redis_key + 'taxonomy.{0}'.format(key), json.dumps(_load_list(key, tax['local'], 'taxonomy'))) for key, tax in contents.get('validation')['taxonomies'].iteritems()] redis_key = 'ckanext.dataoverheid:' config_key = redis_key + 'config.' redis_conn = connect_to_redis() _load_config_file()
0.656438
0.305918
from django.shortcuts import render,redirect from post.models import Post, Comment # 向上取整 from math import ceil from post.helper import page_cach,read_count from post.helper import top_n from user.helper import login_required # Create your views here. # 帖子列表操作 @page_cach(60) def post_list(request): # 获取到当前的页码 page = int(request.GET.get('page',1)) # 获取所有的帖子总数 total = Post.objects.count() # 每页显示的帖子数 per_page = 10 # 显示的所有页数 pages = ceil(total/per_page) # 按照索引进行分页 start = (page - 1) * per_page end = start + per_page posts = Post.objects.all().order_by('-id')[start:end] # int 不能进行遍历,需要用range()转化下 return render(request, 'post_list.html' ,{'posts':posts, 'pages':range(pages)}) # 创建帖子的操作 @login_required def create_post(request): uid = request.session.get('uid') if request.method == 'POST': title = request.POST.get('title') content = request.POST.get('content') # 根据title和content创建帖子 post = Post.objects.create(uid=uid, title=title, content=content) # 创建完成之后跳转到阅读页面 return redirect('/post/read/?post_id=%s' %post.id) return render(request, 'create_post.html') # 修改帖子的操作 @login_required def edit_post(request): if request.method == 'POST': # 先获取要修改的数据(通过hidden里面要提交的post_id获取的) post_id = int(request.POST.get('post_id')) post = Post.objects.get(id=post_id) # 将要修改的内容存入数据库 post.title = request.POST.get('title') post.content = request.POST.get('content') post.save() return redirect('/post/read/?post_id=%s' %post.id) else: post_id = int(request.GET.get('post_id')) post = Post.objects.get(id=post_id) return render(request, 'edit_post.html', {'post':post}) # 阅读帖子的操作 # 给帖子添加缓存 @read_count @page_cach(5) def read_post(request): # 获取post_id post_id = int(request.GET.get('post_id')) # 根据请求参数所携带的post_id查找到对应的post post = Post.objects.get(id=post_id) return render(request, 'read_post.html', {'post':post}) # 搜索帖子的操作 def search_post(request): if request.method == 'POST': # 获取关键字 keyword = request.POST.get('keyword') # 根据关键字查询到所有符合条件的文章 posts = Post.objects.get(content__contains=keyword) return render(request, 'search.html', {'posts':posts}) return render(request, 'search.html', {}) def top10(request): rank_data = top_n(10) return render(request,'top10.html',{'rank_data':rank_data}) @login_required def comment(request): uid = request.session.get('uid') post_id = request.POST.get('post_id') content = request.POST.get('content') Comment.objects.create(uid=uid, post_id=post_id, content=content) return redirect('/post/read/post_id=%s'%post_id)
post/views.py
from django.shortcuts import render,redirect from post.models import Post, Comment # 向上取整 from math import ceil from post.helper import page_cach,read_count from post.helper import top_n from user.helper import login_required # Create your views here. # 帖子列表操作 @page_cach(60) def post_list(request): # 获取到当前的页码 page = int(request.GET.get('page',1)) # 获取所有的帖子总数 total = Post.objects.count() # 每页显示的帖子数 per_page = 10 # 显示的所有页数 pages = ceil(total/per_page) # 按照索引进行分页 start = (page - 1) * per_page end = start + per_page posts = Post.objects.all().order_by('-id')[start:end] # int 不能进行遍历,需要用range()转化下 return render(request, 'post_list.html' ,{'posts':posts, 'pages':range(pages)}) # 创建帖子的操作 @login_required def create_post(request): uid = request.session.get('uid') if request.method == 'POST': title = request.POST.get('title') content = request.POST.get('content') # 根据title和content创建帖子 post = Post.objects.create(uid=uid, title=title, content=content) # 创建完成之后跳转到阅读页面 return redirect('/post/read/?post_id=%s' %post.id) return render(request, 'create_post.html') # 修改帖子的操作 @login_required def edit_post(request): if request.method == 'POST': # 先获取要修改的数据(通过hidden里面要提交的post_id获取的) post_id = int(request.POST.get('post_id')) post = Post.objects.get(id=post_id) # 将要修改的内容存入数据库 post.title = request.POST.get('title') post.content = request.POST.get('content') post.save() return redirect('/post/read/?post_id=%s' %post.id) else: post_id = int(request.GET.get('post_id')) post = Post.objects.get(id=post_id) return render(request, 'edit_post.html', {'post':post}) # 阅读帖子的操作 # 给帖子添加缓存 @read_count @page_cach(5) def read_post(request): # 获取post_id post_id = int(request.GET.get('post_id')) # 根据请求参数所携带的post_id查找到对应的post post = Post.objects.get(id=post_id) return render(request, 'read_post.html', {'post':post}) # 搜索帖子的操作 def search_post(request): if request.method == 'POST': # 获取关键字 keyword = request.POST.get('keyword') # 根据关键字查询到所有符合条件的文章 posts = Post.objects.get(content__contains=keyword) return render(request, 'search.html', {'posts':posts}) return render(request, 'search.html', {}) def top10(request): rank_data = top_n(10) return render(request,'top10.html',{'rank_data':rank_data}) @login_required def comment(request): uid = request.session.get('uid') post_id = request.POST.get('post_id') content = request.POST.get('content') Comment.objects.create(uid=uid, post_id=post_id, content=content) return redirect('/post/read/post_id=%s'%post_id)
0.28279
0.066055
import os import re import logging import traceback from subprocess import call from time import time from pyramid.view import view_config from pyramid.response import Response from mist.monitor import config from mist.monitor import methods from mist.monitor import graphite from mist.monitor.model import get_all_machines from mist.monitor.exceptions import MistError from mist.monitor.exceptions import RequiredParameterMissingError from mist.monitor.exceptions import MachineNotFoundError from mist.monitor.exceptions import ForbiddenError from mist.monitor.exceptions import UnauthorizedError from mist.monitor.exceptions import BadRequestError log = logging.getLogger(__name__) OK = Response("OK", 200) @view_config(context=Exception) def exception_handler_mist(exc, request): """Here we catch exceptions and transform them to proper http responses This is a special pyramid view that gets triggered whenever an exception is raised from any other view. It catches all exceptions exc where isinstance(exc, context) is True. """ # non-mist exceptions. that shouldn't happen! never! if not isinstance(exc, MistError): trace = traceback.format_exc() log.critical("Uncaught non-mist exception? WTF!\n%s", trace) return Response("Internal Server Error", 500) # mist exceptions are ok. log.info("MistError: %r", exc) # translate it to HTTP response based on http_code attribute return Response(str(exc), exc.http_code) @view_config(route_name='machines', request_method='GET', renderer='json') def list_machines(request): """Lists machines with monitoring. Returns a dict with uuid's as keys and machine dicts as values. """ return {machine.uuid: {'rules': [rule_id]} for machine in get_all_machines() for rule_id in machine.rules} @view_config(route_name='machine', request_method='PUT') def add_machine(request): """Adds machine to monitored list.""" uuid = request.matchdict['machine'] passwd = request.params.get('passwd') log.info("Adding machine %s to monitor list" % (uuid)) if not passwd: raise RequiredParameterMissingError('passwd') methods.add_machine(uuid, passwd) return OK @view_config(route_name='machine', request_method='DELETE') def remove_machine(request): """Removes machine from monitored list.""" uuid = request.matchdict['machine'] log.info("Removing machine %s from monitor list" % (uuid)) methods.remove_machine(uuid) return OK @view_config(route_name='rule', request_method='PUT') def add_rule(request): """Add or update rule. This will create a new condition that will start being checked with clear history, even if the rule is not actually being changed. """ uuid = request.matchdict['machine'] rule_id = request.matchdict['rule'] params = request.json_body for key in ["metric", "operator"]: if not params.get(key): raise RequiredParameterMissingError(key) metric = params["metric"] operator = params["operator"] try: value = float(params["value"]) except (ValueError, TypeError): raise BadRequestError("Invalid value type %r" % value) reminder_list = params.get("reminder_list") reminder_offset = params.get("reminder_offset") aggregate = params.get("aggregate") methods.add_rule(uuid, rule_id, metric, operator, value, aggregate=aggregate, reminder_list=reminder_list, reminder_offset=reminder_offset) return OK @view_config(route_name='rule', request_method='DELETE') def remove_rule(request): """Removes rule and corresponding condition.""" uuid = request.matchdict['machine'] rule_id = request.matchdict['rule'] methods.remove_rule(uuid, rule_id) return OK def _parse_get_stats_params(request): try: params = request.json_body metrics = params.get('metrics', []) uuids = params.get('uuids', []) except: params = request.params metrics = params.getall('metric') uuids = params.getall('uuid') start = params.get('start') stop = params.get('stop') interval_str = str(params.get('step', '')) if re.match("^[0-9]+(\.[0-9]+)?$", interval_str): seconds = int(interval_str) log.info('seconds: %d', seconds) log.info('start: %s', start) for key in sorted(config.RETENTIONS.keys()): log.info('testing key, tstamp: %s %s', key, time()-key) log.info('period interval %s', config.RETENTIONS[key]) if int(start) >= time() - key: if seconds < config.RETENTIONS[key]: raise BadRequestError( "Requested resolution is too high for specified time " "range, try zooming out." ) log.info('step is ok') break interval_str = "%ssec" % seconds elif re.match("^[0-9]+m$", interval_str): interval_str += 'in' return uuids, metrics, start, stop, interval_str @view_config(route_name='stats', request_method='GET', renderer='json') def get_stats(request): """Returns all stats for a machine, the client will draw them.""" uuid = request.matchdict['machine'] _, metrics, start, stop, interval_str = _parse_get_stats_params(request) return methods.get_stats(uuid, metrics, start, stop, interval_str) @view_config(route_name='load', request_method='GET', renderer='json') def get_load(request): """Returns shortterm load for many machines""" uuids, _, start, stop, interval_str = _parse_get_stats_params(request) return methods.get_load(uuids, start, stop, interval_str) @view_config(route_name='cores', request_method='GET', renderer='json') def get_cores(request): """Returns number of cores for many machines""" uuids, _, start, stop, interval_str = _parse_get_stats_params(request) return methods.get_cores(uuids, start, stop, interval_str) @view_config(route_name='find_metrics', request_method='GET', renderer='json') def find_metrics(request): uuid = request.matchdict['machine'] return methods.find_metrics(uuid) @view_config(route_name='reset', request_method='POST') def reset_hard(request): """Reset mist.monitor with data provided from mist.core This is a special view that will cause monitor to drop all known data for machines, rules and conditions, will repopulate itself with the data provided in the request and will restart collectd and mist.alert. For security reasons, a special non empty key needs to be specified in settings.py and sent along with the reset request. """ params = request.json_body key, data = params.get('key'), params.get('data', {}) if not config.RESET_KEY: raise ForbiddenError("Reset functionality not enabled.") if key != config.RESET_KEY: raise UnauthorizedError("Wrong reset key provided.") methods.reset_hard(params['data']) return OK
src/mist/monitor/views.py
import os import re import logging import traceback from subprocess import call from time import time from pyramid.view import view_config from pyramid.response import Response from mist.monitor import config from mist.monitor import methods from mist.monitor import graphite from mist.monitor.model import get_all_machines from mist.monitor.exceptions import MistError from mist.monitor.exceptions import RequiredParameterMissingError from mist.monitor.exceptions import MachineNotFoundError from mist.monitor.exceptions import ForbiddenError from mist.monitor.exceptions import UnauthorizedError from mist.monitor.exceptions import BadRequestError log = logging.getLogger(__name__) OK = Response("OK", 200) @view_config(context=Exception) def exception_handler_mist(exc, request): """Here we catch exceptions and transform them to proper http responses This is a special pyramid view that gets triggered whenever an exception is raised from any other view. It catches all exceptions exc where isinstance(exc, context) is True. """ # non-mist exceptions. that shouldn't happen! never! if not isinstance(exc, MistError): trace = traceback.format_exc() log.critical("Uncaught non-mist exception? WTF!\n%s", trace) return Response("Internal Server Error", 500) # mist exceptions are ok. log.info("MistError: %r", exc) # translate it to HTTP response based on http_code attribute return Response(str(exc), exc.http_code) @view_config(route_name='machines', request_method='GET', renderer='json') def list_machines(request): """Lists machines with monitoring. Returns a dict with uuid's as keys and machine dicts as values. """ return {machine.uuid: {'rules': [rule_id]} for machine in get_all_machines() for rule_id in machine.rules} @view_config(route_name='machine', request_method='PUT') def add_machine(request): """Adds machine to monitored list.""" uuid = request.matchdict['machine'] passwd = request.params.get('passwd') log.info("Adding machine %s to monitor list" % (uuid)) if not passwd: raise RequiredParameterMissingError('passwd') methods.add_machine(uuid, passwd) return OK @view_config(route_name='machine', request_method='DELETE') def remove_machine(request): """Removes machine from monitored list.""" uuid = request.matchdict['machine'] log.info("Removing machine %s from monitor list" % (uuid)) methods.remove_machine(uuid) return OK @view_config(route_name='rule', request_method='PUT') def add_rule(request): """Add or update rule. This will create a new condition that will start being checked with clear history, even if the rule is not actually being changed. """ uuid = request.matchdict['machine'] rule_id = request.matchdict['rule'] params = request.json_body for key in ["metric", "operator"]: if not params.get(key): raise RequiredParameterMissingError(key) metric = params["metric"] operator = params["operator"] try: value = float(params["value"]) except (ValueError, TypeError): raise BadRequestError("Invalid value type %r" % value) reminder_list = params.get("reminder_list") reminder_offset = params.get("reminder_offset") aggregate = params.get("aggregate") methods.add_rule(uuid, rule_id, metric, operator, value, aggregate=aggregate, reminder_list=reminder_list, reminder_offset=reminder_offset) return OK @view_config(route_name='rule', request_method='DELETE') def remove_rule(request): """Removes rule and corresponding condition.""" uuid = request.matchdict['machine'] rule_id = request.matchdict['rule'] methods.remove_rule(uuid, rule_id) return OK def _parse_get_stats_params(request): try: params = request.json_body metrics = params.get('metrics', []) uuids = params.get('uuids', []) except: params = request.params metrics = params.getall('metric') uuids = params.getall('uuid') start = params.get('start') stop = params.get('stop') interval_str = str(params.get('step', '')) if re.match("^[0-9]+(\.[0-9]+)?$", interval_str): seconds = int(interval_str) log.info('seconds: %d', seconds) log.info('start: %s', start) for key in sorted(config.RETENTIONS.keys()): log.info('testing key, tstamp: %s %s', key, time()-key) log.info('period interval %s', config.RETENTIONS[key]) if int(start) >= time() - key: if seconds < config.RETENTIONS[key]: raise BadRequestError( "Requested resolution is too high for specified time " "range, try zooming out." ) log.info('step is ok') break interval_str = "%ssec" % seconds elif re.match("^[0-9]+m$", interval_str): interval_str += 'in' return uuids, metrics, start, stop, interval_str @view_config(route_name='stats', request_method='GET', renderer='json') def get_stats(request): """Returns all stats for a machine, the client will draw them.""" uuid = request.matchdict['machine'] _, metrics, start, stop, interval_str = _parse_get_stats_params(request) return methods.get_stats(uuid, metrics, start, stop, interval_str) @view_config(route_name='load', request_method='GET', renderer='json') def get_load(request): """Returns shortterm load for many machines""" uuids, _, start, stop, interval_str = _parse_get_stats_params(request) return methods.get_load(uuids, start, stop, interval_str) @view_config(route_name='cores', request_method='GET', renderer='json') def get_cores(request): """Returns number of cores for many machines""" uuids, _, start, stop, interval_str = _parse_get_stats_params(request) return methods.get_cores(uuids, start, stop, interval_str) @view_config(route_name='find_metrics', request_method='GET', renderer='json') def find_metrics(request): uuid = request.matchdict['machine'] return methods.find_metrics(uuid) @view_config(route_name='reset', request_method='POST') def reset_hard(request): """Reset mist.monitor with data provided from mist.core This is a special view that will cause monitor to drop all known data for machines, rules and conditions, will repopulate itself with the data provided in the request and will restart collectd and mist.alert. For security reasons, a special non empty key needs to be specified in settings.py and sent along with the reset request. """ params = request.json_body key, data = params.get('key'), params.get('data', {}) if not config.RESET_KEY: raise ForbiddenError("Reset functionality not enabled.") if key != config.RESET_KEY: raise UnauthorizedError("Wrong reset key provided.") methods.reset_hard(params['data']) return OK
0.649912
0.069985
import os import sys import unittest import PRESUBMIT sys.path.append( os.path.join(os.path.dirname(os.path.abspath(__file__)), '..', '..', '..', '..')) from PRESUBMIT_test_mocks import (MockInputApi, MockOutputApi, MockAffectedFile) class AccessibilityEventsTestIncludesAndroidTest(unittest.TestCase): # Test that no warning is raised when the Android file is also modified. def testAndroidChangeIncluded(self): mock_input_api = MockInputApi() mock_input_api.files = [ MockAffectedFile('content/test/data/accessibility/event/foo.html', [''], action='A'), MockAffectedFile( 'accessibility/WebContentsAccessibilityEventsTest.java', [''], action='M') ] msgs = PRESUBMIT.CheckAccessibilityEventsTestIncludesAndroid( mock_input_api, MockOutputApi()) self.assertEqual(0, len(msgs), 'Expected %d messages, found %d: %s' % (0, len(msgs), msgs)) # Test that a warning is raised when the Android file is not modified. def testAndroidChangeMissing(self): mock_input_api = MockInputApi() mock_input_api.files = [ MockAffectedFile('content/test/data/accessibility/event/foo.html', [''], action='A'), ] msgs = PRESUBMIT.CheckAccessibilityEventsTestIncludesAndroid( mock_input_api, MockOutputApi()) self.assertEqual(1, len(msgs), 'Expected %d messages, found %d: %s' % (1, len(msgs), msgs)) # Test that Android change is not required when no html file is added/removed. def testIgnoreNonHtmlFiles(self): mock_input_api = MockInputApi() mock_input_api.files = [ MockAffectedFile('content/test/data/accessibility/event/foo.txt', [''], action='A'), MockAffectedFile('content/test/data/accessibility/event/foo.cc', [''], action='A'), MockAffectedFile('content/test/data/accessibility/event/foo.h', [''], action='A'), MockAffectedFile('content/test/data/accessibility/event/foo.py', [''], action='A') ] msgs = PRESUBMIT.CheckAccessibilityEventsTestIncludesAndroid( mock_input_api, MockOutputApi()) self.assertEqual(0, len(msgs), 'Expected %d messages, found %d: %s' % (0, len(msgs), msgs)) # Test that Android change is not required for unrelated html files. def testIgnoreNonRelatedHtmlFiles(self): mock_input_api = MockInputApi() mock_input_api.files = [ MockAffectedFile('content/test/data/accessibility/aria/foo.html', [''], action='A'), MockAffectedFile('content/test/data/accessibility/html/foo.html', [''], action='A'), MockAffectedFile('chrome/tests/data/accessibility/foo.html', [''], action='A') ] msgs = PRESUBMIT.CheckAccessibilityEventsTestIncludesAndroid( mock_input_api, MockOutputApi()) self.assertEqual(0, len(msgs), 'Expected %d messages, found %d: %s' % (0, len(msgs), msgs)) # Test that only modifying an html file will not trigger the warning. def testIgnoreModifiedFiles(self): mock_input_api = MockInputApi() mock_input_api.files = [ MockAffectedFile('content/test/data/accessibility/event/foo.html', [''], action='M') ] msgs = PRESUBMIT.CheckAccessibilityEventsTestIncludesAndroid( mock_input_api, MockOutputApi()) self.assertEqual(0, len(msgs), 'Expected %d messages, found %d: %s' % (0, len(msgs), msgs)) # Test that deleting an html file will trigger the warning. def testAndroidChangeMissingOnDeletedFile(self): mock_input_api = MockInputApi() mock_input_api.files = [ MockAffectedFile('content/test/data/accessibility/event/foo.html', [], action='D') ] msgs = PRESUBMIT.CheckAccessibilityEventsTestIncludesAndroid( mock_input_api, MockOutputApi()) self.assertEqual(1, len(msgs), 'Expected %d messages, found %d: %s' % (1, len(msgs), msgs)) if __name__ == '__main__': unittest.main()
content/test/data/accessibility/PRESUBMIT_test.py
import os import sys import unittest import PRESUBMIT sys.path.append( os.path.join(os.path.dirname(os.path.abspath(__file__)), '..', '..', '..', '..')) from PRESUBMIT_test_mocks import (MockInputApi, MockOutputApi, MockAffectedFile) class AccessibilityEventsTestIncludesAndroidTest(unittest.TestCase): # Test that no warning is raised when the Android file is also modified. def testAndroidChangeIncluded(self): mock_input_api = MockInputApi() mock_input_api.files = [ MockAffectedFile('content/test/data/accessibility/event/foo.html', [''], action='A'), MockAffectedFile( 'accessibility/WebContentsAccessibilityEventsTest.java', [''], action='M') ] msgs = PRESUBMIT.CheckAccessibilityEventsTestIncludesAndroid( mock_input_api, MockOutputApi()) self.assertEqual(0, len(msgs), 'Expected %d messages, found %d: %s' % (0, len(msgs), msgs)) # Test that a warning is raised when the Android file is not modified. def testAndroidChangeMissing(self): mock_input_api = MockInputApi() mock_input_api.files = [ MockAffectedFile('content/test/data/accessibility/event/foo.html', [''], action='A'), ] msgs = PRESUBMIT.CheckAccessibilityEventsTestIncludesAndroid( mock_input_api, MockOutputApi()) self.assertEqual(1, len(msgs), 'Expected %d messages, found %d: %s' % (1, len(msgs), msgs)) # Test that Android change is not required when no html file is added/removed. def testIgnoreNonHtmlFiles(self): mock_input_api = MockInputApi() mock_input_api.files = [ MockAffectedFile('content/test/data/accessibility/event/foo.txt', [''], action='A'), MockAffectedFile('content/test/data/accessibility/event/foo.cc', [''], action='A'), MockAffectedFile('content/test/data/accessibility/event/foo.h', [''], action='A'), MockAffectedFile('content/test/data/accessibility/event/foo.py', [''], action='A') ] msgs = PRESUBMIT.CheckAccessibilityEventsTestIncludesAndroid( mock_input_api, MockOutputApi()) self.assertEqual(0, len(msgs), 'Expected %d messages, found %d: %s' % (0, len(msgs), msgs)) # Test that Android change is not required for unrelated html files. def testIgnoreNonRelatedHtmlFiles(self): mock_input_api = MockInputApi() mock_input_api.files = [ MockAffectedFile('content/test/data/accessibility/aria/foo.html', [''], action='A'), MockAffectedFile('content/test/data/accessibility/html/foo.html', [''], action='A'), MockAffectedFile('chrome/tests/data/accessibility/foo.html', [''], action='A') ] msgs = PRESUBMIT.CheckAccessibilityEventsTestIncludesAndroid( mock_input_api, MockOutputApi()) self.assertEqual(0, len(msgs), 'Expected %d messages, found %d: %s' % (0, len(msgs), msgs)) # Test that only modifying an html file will not trigger the warning. def testIgnoreModifiedFiles(self): mock_input_api = MockInputApi() mock_input_api.files = [ MockAffectedFile('content/test/data/accessibility/event/foo.html', [''], action='M') ] msgs = PRESUBMIT.CheckAccessibilityEventsTestIncludesAndroid( mock_input_api, MockOutputApi()) self.assertEqual(0, len(msgs), 'Expected %d messages, found %d: %s' % (0, len(msgs), msgs)) # Test that deleting an html file will trigger the warning. def testAndroidChangeMissingOnDeletedFile(self): mock_input_api = MockInputApi() mock_input_api.files = [ MockAffectedFile('content/test/data/accessibility/event/foo.html', [], action='D') ] msgs = PRESUBMIT.CheckAccessibilityEventsTestIncludesAndroid( mock_input_api, MockOutputApi()) self.assertEqual(1, len(msgs), 'Expected %d messages, found %d: %s' % (1, len(msgs), msgs)) if __name__ == '__main__': unittest.main()
0.405449
0.131507
import numpy as np import tensorflow as tf from tensorflow.contrib.framework.python.ops import arg_scope import net.nn as nn def vq_encoder_spec(x, ema=None, nr_channel=128, nr_res_block=2, nr_res_channel=64, embedding_dim=64, num_embeddings=512, commitment_cost=0.25, decay=0.99, is_training=False): """ Input: Tensor x of shape (N,H,W,3) (e.g. (128,256,256,3)) Output: Tensor enc_t of shape (N,H//8,W//8,C) (e.g. (128,32,32,64)) Tensor enc_b of shape (N,H//4,W//4,C) (e.g. (128,64,64,64)) Tensor quant_t of shape (N,H//8,W//8,C) (e.g. (128,32,32,64)) Tensor quant_b of shape (N,H//4,W//4,C) (e.g. (128,64,64,64)) Tensor loss of shape (1,) Tensor idx_t of shape (N,H//8,W//8) (e.g. (128,32,32)) Tensor idx_b of shape (N,H//4,W//4) (e.g. (128,64,64)) Tensor embed_t of shape (C,K) (e.g. (64,512)) Tensor embed_b of shape (C,K) (e.g. (64,512)) """ counters = {} with arg_scope([nn.conv2d, nn.deconv2d, nn.vector_quantize], counters=counters, ema=ema): # Bottom encoder enc_b = nn.conv2d(x, nr_channel//2, filter_size=[4,4], stride=[2,2]) enc_b = tf.nn.elu(enc_b) enc_b = nn.conv2d(enc_b, nr_channel, filter_size=[4,4], stride=[2,2]) enc_b = tf.nn.elu(enc_b) enc_b = nn.conv2d(enc_b, nr_channel) for rep in range(nr_res_block): enc_b = nn.resnet(enc_b, num_res_channel=nr_res_channel, nonlinearity=tf.nn.elu) enc_b = tf.nn.elu(enc_b) # Top encoder enc_t = nn.conv2d(enc_b, nr_channel//2, filter_size=[4,4], stride=[2,2]) enc_t = tf.nn.elu(enc_t) enc_t = nn.conv2d(enc_t, nr_channel) for rep in range(nr_res_block): enc_t = nn.resnet(enc_t, num_res_channel=nr_res_channel, nonlinearity=tf.nn.elu) enc_t = tf.nn.elu(enc_t) enc_t = nn.conv2d(enc_t, embedding_dim, filter_size=[1,1]) # Vector quantization with top codebook quant_t, diff_t, idx_t, embed_t = nn.vector_quantize(enc_t, embedding_dim=embedding_dim, num_embeddings=num_embeddings, commitment_cost=commitment_cost, decay=decay, is_training=is_training) # Top decoder dec_t = nn.conv2d(quant_t, nr_channel) for rep in range(nr_res_block): dec_t = nn.resnet(dec_t, num_res_channel=nr_res_channel, nonlinearity=tf.nn.elu) dec_t = tf.nn.elu(dec_t) dec_t = nn.deconv2d(dec_t, nr_channel, filter_size=[4,4], stride=[2,2]) enc_b = tf.concat([enc_b, dec_t], -1) enc_b = nn.conv2d(enc_b, embedding_dim, filter_size=[1,1]) # Vector quantization with bottom codebook quant_b, diff_b, idx_b, embed_b = nn.vector_quantize(enc_b, embedding_dim=embedding_dim, num_embeddings=num_embeddings, commitment_cost=commitment_cost, decay=decay, is_training=is_training) return {'enc_t': enc_t, 'enc_b': enc_b, 'quant_t': quant_t, 'quant_b': quant_b, 'loss': diff_t + diff_b, 'idx_t': idx_t, 'idx_b': idx_b, 'embed_t': embed_t, 'embed_b': embed_b} def vq_decoder_spec(quant_t, quant_b, ema=None, nr_channel=128, nr_res_block=2, nr_res_channel=64, embedding_dim=64): """ Input: Tensor quant_t of shape (N,H//8,W//8,C) (e.g. (128,32,32,64)) Tensor quant_b of shape (N,H//4,W//4,C) (e.g. (128,64,64,64)) Output: Tensor dec_b of shape (N,H,W,3) (e.g. (128,256,256,3)) """ counters = {} with arg_scope([nn.conv2d, nn.deconv2d], counters=counters, ema=ema): # Bottom decoder quant_t = nn.deconv2d(quant_t, embedding_dim, filter_size=[4,4], stride=[2,2]) dec_b = tf.concat([quant_b, quant_t], -1) dec_b = nn.conv2d(dec_b, nr_channel) for rep in range(nr_res_block): dec_b = nn.resnet(dec_b, num_res_channel=nr_res_channel, nonlinearity=tf.nn.elu) dec_b = tf.nn.elu(dec_b) dec_b = nn.deconv2d(dec_b, nr_channel//2, filter_size=[4,4], stride=[2,2]) dec_b = tf.nn.elu(dec_b) dec_b = nn.deconv2d(dec_b, 3, filter_size=[4,4], stride=[2,2]) return {'dec_b': dec_b}
net/vqvae.py
import numpy as np import tensorflow as tf from tensorflow.contrib.framework.python.ops import arg_scope import net.nn as nn def vq_encoder_spec(x, ema=None, nr_channel=128, nr_res_block=2, nr_res_channel=64, embedding_dim=64, num_embeddings=512, commitment_cost=0.25, decay=0.99, is_training=False): """ Input: Tensor x of shape (N,H,W,3) (e.g. (128,256,256,3)) Output: Tensor enc_t of shape (N,H//8,W//8,C) (e.g. (128,32,32,64)) Tensor enc_b of shape (N,H//4,W//4,C) (e.g. (128,64,64,64)) Tensor quant_t of shape (N,H//8,W//8,C) (e.g. (128,32,32,64)) Tensor quant_b of shape (N,H//4,W//4,C) (e.g. (128,64,64,64)) Tensor loss of shape (1,) Tensor idx_t of shape (N,H//8,W//8) (e.g. (128,32,32)) Tensor idx_b of shape (N,H//4,W//4) (e.g. (128,64,64)) Tensor embed_t of shape (C,K) (e.g. (64,512)) Tensor embed_b of shape (C,K) (e.g. (64,512)) """ counters = {} with arg_scope([nn.conv2d, nn.deconv2d, nn.vector_quantize], counters=counters, ema=ema): # Bottom encoder enc_b = nn.conv2d(x, nr_channel//2, filter_size=[4,4], stride=[2,2]) enc_b = tf.nn.elu(enc_b) enc_b = nn.conv2d(enc_b, nr_channel, filter_size=[4,4], stride=[2,2]) enc_b = tf.nn.elu(enc_b) enc_b = nn.conv2d(enc_b, nr_channel) for rep in range(nr_res_block): enc_b = nn.resnet(enc_b, num_res_channel=nr_res_channel, nonlinearity=tf.nn.elu) enc_b = tf.nn.elu(enc_b) # Top encoder enc_t = nn.conv2d(enc_b, nr_channel//2, filter_size=[4,4], stride=[2,2]) enc_t = tf.nn.elu(enc_t) enc_t = nn.conv2d(enc_t, nr_channel) for rep in range(nr_res_block): enc_t = nn.resnet(enc_t, num_res_channel=nr_res_channel, nonlinearity=tf.nn.elu) enc_t = tf.nn.elu(enc_t) enc_t = nn.conv2d(enc_t, embedding_dim, filter_size=[1,1]) # Vector quantization with top codebook quant_t, diff_t, idx_t, embed_t = nn.vector_quantize(enc_t, embedding_dim=embedding_dim, num_embeddings=num_embeddings, commitment_cost=commitment_cost, decay=decay, is_training=is_training) # Top decoder dec_t = nn.conv2d(quant_t, nr_channel) for rep in range(nr_res_block): dec_t = nn.resnet(dec_t, num_res_channel=nr_res_channel, nonlinearity=tf.nn.elu) dec_t = tf.nn.elu(dec_t) dec_t = nn.deconv2d(dec_t, nr_channel, filter_size=[4,4], stride=[2,2]) enc_b = tf.concat([enc_b, dec_t], -1) enc_b = nn.conv2d(enc_b, embedding_dim, filter_size=[1,1]) # Vector quantization with bottom codebook quant_b, diff_b, idx_b, embed_b = nn.vector_quantize(enc_b, embedding_dim=embedding_dim, num_embeddings=num_embeddings, commitment_cost=commitment_cost, decay=decay, is_training=is_training) return {'enc_t': enc_t, 'enc_b': enc_b, 'quant_t': quant_t, 'quant_b': quant_b, 'loss': diff_t + diff_b, 'idx_t': idx_t, 'idx_b': idx_b, 'embed_t': embed_t, 'embed_b': embed_b} def vq_decoder_spec(quant_t, quant_b, ema=None, nr_channel=128, nr_res_block=2, nr_res_channel=64, embedding_dim=64): """ Input: Tensor quant_t of shape (N,H//8,W//8,C) (e.g. (128,32,32,64)) Tensor quant_b of shape (N,H//4,W//4,C) (e.g. (128,64,64,64)) Output: Tensor dec_b of shape (N,H,W,3) (e.g. (128,256,256,3)) """ counters = {} with arg_scope([nn.conv2d, nn.deconv2d], counters=counters, ema=ema): # Bottom decoder quant_t = nn.deconv2d(quant_t, embedding_dim, filter_size=[4,4], stride=[2,2]) dec_b = tf.concat([quant_b, quant_t], -1) dec_b = nn.conv2d(dec_b, nr_channel) for rep in range(nr_res_block): dec_b = nn.resnet(dec_b, num_res_channel=nr_res_channel, nonlinearity=tf.nn.elu) dec_b = tf.nn.elu(dec_b) dec_b = nn.deconv2d(dec_b, nr_channel//2, filter_size=[4,4], stride=[2,2]) dec_b = tf.nn.elu(dec_b) dec_b = nn.deconv2d(dec_b, 3, filter_size=[4,4], stride=[2,2]) return {'dec_b': dec_b}
0.79999
0.403684
import numpy as np from settings import same_grid_dist_ratio class SudokuVideo: def __init__(self, grid): self.grid_raw = grid self.grid = np.zeros((9, 9), dtype=int) self.init_grid(grid) self.grid_solved = np.zeros((9, 9), dtype=int) self.isConfident = False self.isSolved = False self.nbr_apparition = 1 self.last_apparition = 0 self.TL = 0 self.TR = 0 self.BR = 0 self.BL = 0 self.w = 0 self.h = 0 def get_limits(self): return self.TL, self.TR, self.BR, self.BL def set_limits(self, points): self.TL = points[0] self.TR = points[1] self.BR = points[2] self.BL = points[3] self.w = ((self.TR[0] - self.TL[0]) + (self.BR[0] - self.BL[0])) / 2 self.h = ((self.TR[1] - self.TL[1]) + (self.BR[1] - self.BL[1])) / 2 def __str__(self): string = "-" * 18 for y in range(9): string += "\n|" for x in range(9): string += str(self.grid[y, x]) + "|" string += "\n" string += "-" * 18 return string def init_grid(self, grid): for y in range(9): for x in range(9): value = grid[y][x] self.grid[y, x] = value def is_filled(self): return self.isSolved def incr_last_apparition(self): self.last_apparition += 1 def incr_nbr_apparition(self): self.nbr_apparition += 1 def is_same_grid(self, points): thresh_dist = 0.03 * (self.w + self.h) points_grid = self.get_limits() for i in range(4): if np.linalg.norm(points_grid[i] - points[i]) > thresh_dist: return False self.last_apparition = 0 self.set_limits(points) return True def is_same_grid_v2(self, points): thresh_dist = same_grid_dist_ratio * (self.w + self.h) is_same = [] points_grid = self.get_limits() for i in range(4): is_same.append(np.linalg.norm(points_grid[i] - points[i]) < thresh_dist) if sum(is_same) < 3: return False if sum(is_same) == 3: false_value_ind = np.argmin(is_same) points[false_value_ind] = points_grid[false_value_ind] self.last_apparition = 0 self.set_limits(points) return True
src/solving_objects/SudokuVideo.py
import numpy as np from settings import same_grid_dist_ratio class SudokuVideo: def __init__(self, grid): self.grid_raw = grid self.grid = np.zeros((9, 9), dtype=int) self.init_grid(grid) self.grid_solved = np.zeros((9, 9), dtype=int) self.isConfident = False self.isSolved = False self.nbr_apparition = 1 self.last_apparition = 0 self.TL = 0 self.TR = 0 self.BR = 0 self.BL = 0 self.w = 0 self.h = 0 def get_limits(self): return self.TL, self.TR, self.BR, self.BL def set_limits(self, points): self.TL = points[0] self.TR = points[1] self.BR = points[2] self.BL = points[3] self.w = ((self.TR[0] - self.TL[0]) + (self.BR[0] - self.BL[0])) / 2 self.h = ((self.TR[1] - self.TL[1]) + (self.BR[1] - self.BL[1])) / 2 def __str__(self): string = "-" * 18 for y in range(9): string += "\n|" for x in range(9): string += str(self.grid[y, x]) + "|" string += "\n" string += "-" * 18 return string def init_grid(self, grid): for y in range(9): for x in range(9): value = grid[y][x] self.grid[y, x] = value def is_filled(self): return self.isSolved def incr_last_apparition(self): self.last_apparition += 1 def incr_nbr_apparition(self): self.nbr_apparition += 1 def is_same_grid(self, points): thresh_dist = 0.03 * (self.w + self.h) points_grid = self.get_limits() for i in range(4): if np.linalg.norm(points_grid[i] - points[i]) > thresh_dist: return False self.last_apparition = 0 self.set_limits(points) return True def is_same_grid_v2(self, points): thresh_dist = same_grid_dist_ratio * (self.w + self.h) is_same = [] points_grid = self.get_limits() for i in range(4): is_same.append(np.linalg.norm(points_grid[i] - points[i]) < thresh_dist) if sum(is_same) < 3: return False if sum(is_same) == 3: false_value_ind = np.argmin(is_same) points[false_value_ind] = points_grid[false_value_ind] self.last_apparition = 0 self.set_limits(points) return True
0.638723
0.258095
from logging import getLogger from pymcuprog.pymcuprog_errors import PymcuprogError from . import constants class UpdiDatalink: """ UPDI data link class handles the UPDI data protocol within the device """ LDCS_RESPONSE_BYTES = 1 def __init__(self): self.logger = getLogger(__name__) self.updi_phy = None def set_physical(self, physical): """ Inject a serial-port based physical layer for use by this DL """ self.updi_phy = physical def _init_session_parameters(self): """ Set the inter-byte delay bit and disable collision detection """ self.stcs(constants.UPDI_CS_CTRLB, 1 << constants.UPDI_CTRLB_CCDETDIS_BIT) self.stcs(constants.UPDI_CS_CTRLA, 1 << constants.UPDI_CTRLA_IBDLY_BIT) def init_datalink(self): """ Init DL layer """ self._init_session_parameters() # Check if not self._check_datalink(): # Send double break if all is not well, and re-check self.updi_phy.send_double_break() self._init_session_parameters() if not self._check_datalink(): raise PymcuprogError("UPDI initialisation failed") def _check_datalink(self): """ Check UPDI by loading CS STATUSA """ try: if self.ldcs(constants.UPDI_CS_STATUSA) != 0: self.logger.info("UPDI init OK") return True except PymcuprogError: self.logger.warning("Check failed") return False self.logger.info("UPDI not OK - reinitialisation required") return False def ldcs(self, address): """ Load data from Control/Status space :param address: address to load """ self.logger.debug("LDCS from 0x%02X", address) self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_LDCS | (address & 0x0F)]) response = self.updi_phy.receive(self.LDCS_RESPONSE_BYTES) numbytes_received = len(response) if numbytes_received != self.LDCS_RESPONSE_BYTES: raise PymcuprogError("Unexpected number of bytes in response: " "{} byte(s) expected {} byte(s)".format(numbytes_received, self.LDCS_RESPONSE_BYTES)) return response[0] def stcs(self, address, value): """ Store a value to Control/Status space :param address: address to store to :param value: value to write """ self.logger.debug("STCS to 0x%02X", address) self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_STCS | (address & 0x0F), value]) def ld_ptr_inc(self, size): """ Loads a number of bytes from the pointer location with pointer post-increment :param size: number of bytes to load :return: values read """ self.logger.debug("LD8 from ptr++") self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_LD | constants.UPDI_PTR_INC | constants.UPDI_DATA_8]) return self.updi_phy.receive(size) def ld_ptr_inc16(self, words): """ Load a 16-bit word value from the pointer location with pointer post-increment :param words: number of words to load :return: values read """ self.logger.debug("LD16 from ptr++") self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_LD | constants.UPDI_PTR_INC | constants.UPDI_DATA_16]) return self.updi_phy.receive(words << 1) def st_ptr_inc(self, data): """ Store data to the pointer location with pointer post-increment :param data: data to store """ self.logger.debug("ST8 to *ptr++") self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_ST | constants.UPDI_PTR_INC | constants.UPDI_DATA_8, data[0]]) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("ACK error with st_ptr_inc") num = 1 while num < len(data): self.updi_phy.send([data[num]]) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("Error with st_ptr_inc") num += 1 def st_ptr_inc16(self, data): """ Store a 16-bit word value to the pointer location with pointer post-increment :param data: data to store """ self.logger.debug("ST16 to *ptr++") self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_ST | constants.UPDI_PTR_INC | constants.UPDI_DATA_16, data[0], data[1]]) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("ACK error with st_ptr_inc16") num = 2 while num < len(data): self.updi_phy.send([data[num], data[num + 1]]) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("Error with st_ptr_inc16") num += 2 def repeat(self, repeats): """ Store a value to the repeat counter :param repeats: number of repeats requested """ self.logger.debug("Repeat %d", repeats) if (repeats - 1) > constants.UPDI_MAX_REPEAT_SIZE: self.logger.error("Invalid repeat count of %d", repeats) raise Exception("Invalid repeat count!") repeats -= 1 self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_REPEAT | constants.UPDI_REPEAT_BYTE, repeats & 0xFF]) def read_sib(self): """ Read the SIB """ return self.updi_phy.sib() def key(self, size, key): """ Write a key :param size: size of key (0=64B, 1=128B, 2=256B) :param key: key value """ self.logger.debug("Writing key") if len(key) != 8 << size: raise PymcuprogError("Invalid KEY length!") self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_KEY | constants.UPDI_KEY_KEY | size]) self.updi_phy.send(list(reversed(list(key)))) def _st_data_phase(self, values): """ Performs data phase of transaction: * receive ACK * send data :param values: bytearray of value(s) to send """ response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("Error with st") self.updi_phy.send(values) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("Error with st") class UpdiDatalink16bit(UpdiDatalink): """ UPDI data link layer in 16-bit version This means that all addresses and pointers contain 2 bytes """ def __init__(self): UpdiDatalink.__init__(self) self.logger = getLogger(__name__) # pylint: disable=invalid-name def ld(self, address): """ Load a single byte direct from a 16-bit address :param address: address to load from :return: value read """ self.logger.info("LD from 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_LDS | constants.UPDI_ADDRESS_16 | constants.UPDI_DATA_8, address & 0xFF, (address >> 8) & 0xFF]) return self.updi_phy.receive(1)[0] def ld16(self, address): """ Load a 16-bit word directly from a 16-bit address :param address: address to load from :return: values read """ self.logger.info("LD from 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_LDS | constants.UPDI_ADDRESS_16 | constants.UPDI_DATA_16, address & 0xFF, (address >> 8) & 0xFF]) return self.updi_phy.receive(2) # pylint: disable=invalid-name def st(self, address, value): """ Store a single byte value directly to a 16-bit address :param address: address to write to :param value: value to write """ self.logger.info("ST to 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_STS | constants.UPDI_ADDRESS_16 | constants.UPDI_DATA_8, address & 0xFF, (address >> 8) & 0xFF]) return self._st_data_phase([value & 0xFF]) def st16(self, address, value): """ Store a 16-bit word value directly to a 16-bit address :param address: address to write to :param value: value to write """ self.logger.info("ST to 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_STS | constants.UPDI_ADDRESS_16 | constants.UPDI_DATA_16, address & 0xFF, (address >> 8) & 0xFF]) return self._st_data_phase([value & 0xFF, (value >> 8) & 0xFF]) def st_ptr(self, address): """ Set the pointer location :param address: address to write """ self.logger.info("ST to ptr") self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_ST | constants.UPDI_PTR_ADDRESS | constants.UPDI_DATA_16, address & 0xFF, (address >> 8) & 0xFF]) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("Error with st_ptr") class UpdiDatalink24bit(UpdiDatalink): """ UPDI data link layer in 24-bit version This means that all addresses and pointers contain 3 bytes """ def __init__(self): UpdiDatalink.__init__(self) self.logger = getLogger(__name__) # pylint: disable=invalid-name def ld(self, address): """ Load a single byte direct from a 24-bit address :param address: address to load from :return: value read """ self.logger.info("LD from 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_LDS | constants.UPDI_ADDRESS_24 | constants.UPDI_DATA_8, address & 0xFF, (address >> 8) & 0xFF, (address >> 16) & 0xFF]) return self.updi_phy.receive(1)[0] def ld16(self, address): """ Load a 16-bit word directly from a 24-bit address :param address: address to load from :return: values read """ self.logger.info("LD from 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_LDS | constants.UPDI_ADDRESS_24 | constants.UPDI_DATA_16, address & 0xFF, (address >> 8) & 0xFF, (address >> 16) & 0xFF]) return self.updi_phy.receive(2) # pylint: disable=invalid-name def st(self, address, value): """ Store a single byte value directly to a 24-bit address :param address: address to write to :param value: value to write """ self.logger.info("ST to 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_STS | constants.UPDI_ADDRESS_24 | constants.UPDI_DATA_8, address & 0xFF, (address >> 8) & 0xFF, (address >> 16) & 0xFF]) return self._st_data_phase([value & 0xFF]) def st16(self, address, value): """ Store a 16-bit word value directly to a 24-bit address :param address: address to write to :param value: value to write """ self.logger.info("ST to 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_STS | constants.UPDI_ADDRESS_24 | constants.UPDI_DATA_16, address & 0xFF, (address >> 8) & 0xFF, (address >> 16) & 0xFF]) return self._st_data_phase([value & 0xFF, (value >> 8) & 0xFF]) def st_ptr(self, address): """ Set the pointer location :param address: address to write """ self.logger.info("ST to ptr") self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_ST | constants.UPDI_PTR_ADDRESS | constants.UPDI_DATA_24, address & 0xFF, (address >> 8) & 0xFF, (address >> 16) & 0xFF]) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("Error with st_ptr")
pymcuprog/serialupdi/link.py
from logging import getLogger from pymcuprog.pymcuprog_errors import PymcuprogError from . import constants class UpdiDatalink: """ UPDI data link class handles the UPDI data protocol within the device """ LDCS_RESPONSE_BYTES = 1 def __init__(self): self.logger = getLogger(__name__) self.updi_phy = None def set_physical(self, physical): """ Inject a serial-port based physical layer for use by this DL """ self.updi_phy = physical def _init_session_parameters(self): """ Set the inter-byte delay bit and disable collision detection """ self.stcs(constants.UPDI_CS_CTRLB, 1 << constants.UPDI_CTRLB_CCDETDIS_BIT) self.stcs(constants.UPDI_CS_CTRLA, 1 << constants.UPDI_CTRLA_IBDLY_BIT) def init_datalink(self): """ Init DL layer """ self._init_session_parameters() # Check if not self._check_datalink(): # Send double break if all is not well, and re-check self.updi_phy.send_double_break() self._init_session_parameters() if not self._check_datalink(): raise PymcuprogError("UPDI initialisation failed") def _check_datalink(self): """ Check UPDI by loading CS STATUSA """ try: if self.ldcs(constants.UPDI_CS_STATUSA) != 0: self.logger.info("UPDI init OK") return True except PymcuprogError: self.logger.warning("Check failed") return False self.logger.info("UPDI not OK - reinitialisation required") return False def ldcs(self, address): """ Load data from Control/Status space :param address: address to load """ self.logger.debug("LDCS from 0x%02X", address) self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_LDCS | (address & 0x0F)]) response = self.updi_phy.receive(self.LDCS_RESPONSE_BYTES) numbytes_received = len(response) if numbytes_received != self.LDCS_RESPONSE_BYTES: raise PymcuprogError("Unexpected number of bytes in response: " "{} byte(s) expected {} byte(s)".format(numbytes_received, self.LDCS_RESPONSE_BYTES)) return response[0] def stcs(self, address, value): """ Store a value to Control/Status space :param address: address to store to :param value: value to write """ self.logger.debug("STCS to 0x%02X", address) self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_STCS | (address & 0x0F), value]) def ld_ptr_inc(self, size): """ Loads a number of bytes from the pointer location with pointer post-increment :param size: number of bytes to load :return: values read """ self.logger.debug("LD8 from ptr++") self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_LD | constants.UPDI_PTR_INC | constants.UPDI_DATA_8]) return self.updi_phy.receive(size) def ld_ptr_inc16(self, words): """ Load a 16-bit word value from the pointer location with pointer post-increment :param words: number of words to load :return: values read """ self.logger.debug("LD16 from ptr++") self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_LD | constants.UPDI_PTR_INC | constants.UPDI_DATA_16]) return self.updi_phy.receive(words << 1) def st_ptr_inc(self, data): """ Store data to the pointer location with pointer post-increment :param data: data to store """ self.logger.debug("ST8 to *ptr++") self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_ST | constants.UPDI_PTR_INC | constants.UPDI_DATA_8, data[0]]) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("ACK error with st_ptr_inc") num = 1 while num < len(data): self.updi_phy.send([data[num]]) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("Error with st_ptr_inc") num += 1 def st_ptr_inc16(self, data): """ Store a 16-bit word value to the pointer location with pointer post-increment :param data: data to store """ self.logger.debug("ST16 to *ptr++") self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_ST | constants.UPDI_PTR_INC | constants.UPDI_DATA_16, data[0], data[1]]) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("ACK error with st_ptr_inc16") num = 2 while num < len(data): self.updi_phy.send([data[num], data[num + 1]]) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("Error with st_ptr_inc16") num += 2 def repeat(self, repeats): """ Store a value to the repeat counter :param repeats: number of repeats requested """ self.logger.debug("Repeat %d", repeats) if (repeats - 1) > constants.UPDI_MAX_REPEAT_SIZE: self.logger.error("Invalid repeat count of %d", repeats) raise Exception("Invalid repeat count!") repeats -= 1 self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_REPEAT | constants.UPDI_REPEAT_BYTE, repeats & 0xFF]) def read_sib(self): """ Read the SIB """ return self.updi_phy.sib() def key(self, size, key): """ Write a key :param size: size of key (0=64B, 1=128B, 2=256B) :param key: key value """ self.logger.debug("Writing key") if len(key) != 8 << size: raise PymcuprogError("Invalid KEY length!") self.updi_phy.send([constants.UPDI_PHY_SYNC, constants.UPDI_KEY | constants.UPDI_KEY_KEY | size]) self.updi_phy.send(list(reversed(list(key)))) def _st_data_phase(self, values): """ Performs data phase of transaction: * receive ACK * send data :param values: bytearray of value(s) to send """ response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("Error with st") self.updi_phy.send(values) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("Error with st") class UpdiDatalink16bit(UpdiDatalink): """ UPDI data link layer in 16-bit version This means that all addresses and pointers contain 2 bytes """ def __init__(self): UpdiDatalink.__init__(self) self.logger = getLogger(__name__) # pylint: disable=invalid-name def ld(self, address): """ Load a single byte direct from a 16-bit address :param address: address to load from :return: value read """ self.logger.info("LD from 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_LDS | constants.UPDI_ADDRESS_16 | constants.UPDI_DATA_8, address & 0xFF, (address >> 8) & 0xFF]) return self.updi_phy.receive(1)[0] def ld16(self, address): """ Load a 16-bit word directly from a 16-bit address :param address: address to load from :return: values read """ self.logger.info("LD from 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_LDS | constants.UPDI_ADDRESS_16 | constants.UPDI_DATA_16, address & 0xFF, (address >> 8) & 0xFF]) return self.updi_phy.receive(2) # pylint: disable=invalid-name def st(self, address, value): """ Store a single byte value directly to a 16-bit address :param address: address to write to :param value: value to write """ self.logger.info("ST to 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_STS | constants.UPDI_ADDRESS_16 | constants.UPDI_DATA_8, address & 0xFF, (address >> 8) & 0xFF]) return self._st_data_phase([value & 0xFF]) def st16(self, address, value): """ Store a 16-bit word value directly to a 16-bit address :param address: address to write to :param value: value to write """ self.logger.info("ST to 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_STS | constants.UPDI_ADDRESS_16 | constants.UPDI_DATA_16, address & 0xFF, (address >> 8) & 0xFF]) return self._st_data_phase([value & 0xFF, (value >> 8) & 0xFF]) def st_ptr(self, address): """ Set the pointer location :param address: address to write """ self.logger.info("ST to ptr") self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_ST | constants.UPDI_PTR_ADDRESS | constants.UPDI_DATA_16, address & 0xFF, (address >> 8) & 0xFF]) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("Error with st_ptr") class UpdiDatalink24bit(UpdiDatalink): """ UPDI data link layer in 24-bit version This means that all addresses and pointers contain 3 bytes """ def __init__(self): UpdiDatalink.__init__(self) self.logger = getLogger(__name__) # pylint: disable=invalid-name def ld(self, address): """ Load a single byte direct from a 24-bit address :param address: address to load from :return: value read """ self.logger.info("LD from 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_LDS | constants.UPDI_ADDRESS_24 | constants.UPDI_DATA_8, address & 0xFF, (address >> 8) & 0xFF, (address >> 16) & 0xFF]) return self.updi_phy.receive(1)[0] def ld16(self, address): """ Load a 16-bit word directly from a 24-bit address :param address: address to load from :return: values read """ self.logger.info("LD from 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_LDS | constants.UPDI_ADDRESS_24 | constants.UPDI_DATA_16, address & 0xFF, (address >> 8) & 0xFF, (address >> 16) & 0xFF]) return self.updi_phy.receive(2) # pylint: disable=invalid-name def st(self, address, value): """ Store a single byte value directly to a 24-bit address :param address: address to write to :param value: value to write """ self.logger.info("ST to 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_STS | constants.UPDI_ADDRESS_24 | constants.UPDI_DATA_8, address & 0xFF, (address >> 8) & 0xFF, (address >> 16) & 0xFF]) return self._st_data_phase([value & 0xFF]) def st16(self, address, value): """ Store a 16-bit word value directly to a 24-bit address :param address: address to write to :param value: value to write """ self.logger.info("ST to 0x{0:06X}".format(address)) self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_STS | constants.UPDI_ADDRESS_24 | constants.UPDI_DATA_16, address & 0xFF, (address >> 8) & 0xFF, (address >> 16) & 0xFF]) return self._st_data_phase([value & 0xFF, (value >> 8) & 0xFF]) def st_ptr(self, address): """ Set the pointer location :param address: address to write """ self.logger.info("ST to ptr") self.updi_phy.send( [constants.UPDI_PHY_SYNC, constants.UPDI_ST | constants.UPDI_PTR_ADDRESS | constants.UPDI_DATA_24, address & 0xFF, (address >> 8) & 0xFF, (address >> 16) & 0xFF]) response = self.updi_phy.receive(1) if len(response) != 1 or response[0] != constants.UPDI_PHY_ACK: raise PymcuprogError("Error with st_ptr")
0.765155
0.259718
import numpy as np from cloudvolume import CloudVolume from .cube import Cube from .error import CVDBError class CloudVolumeDB: """ Wrapper interface for cloudvolume read access to bossDB. """ def __init__(self, cv_config=None): self.cv_config = cv_config # Main READ interface method def cutout( self, resource, corner, extent, resolution, time_sample_range=None, filter_ids=None, iso=False, access_mode="cache", ): """Extract a cube of arbitrary size. Need not be aligned to cuboid boundaries. corner represents the location of the cutout and extent the size. As an example in 1D, if asking for a corner of 3 and extent of 2, this would be the values at 3 and 4. Args: resource (spdb.project.BossResource): Data model info based on the request or target resource corner ((int, int, int)): the xyz location of the corner of the cutout extent ((int, int, int)): the xyz extents resolution (int): the resolution level time_sample_range : ignored filter_ids (optional[list]): ignored iso (bool): ignored access_mode (str): ignored Returns: cube.Cube: The cutout data stored in a Cube instance Raises: (CVDBError) """ channel = resource.get_channel() out_cube = Cube.create_cube(resource, extent) # NOTE: Refer to Tim's changes for channel method to check storage type. if channel.storage_type != "cloudvol": raise CVDBError( f"Storage type {channel.storage_type} not configured for cloudvolume.", 701, ) # NOTE: Refer to Tim's changes for S3 bucket and path. try: # Accessing HTTPS version of dataset. This is READ-ONLY and PUBLIC-ONLY, but much faster to download. vol = CloudVolume( f"s3://{channel.bucket}/{channel.cv_path}", mip=resolution, use_https=True, fill_missing=True, ) # Data is downloaded by providing XYZ indicies. data = vol[ corner[0] : corner[0] + extent[0], corner[1] : corner[1] + extent[1], corner[2] : corner[2] + extent[2], ] # Data returned as cloudvolume VolumeCutout object in XYZT order. # Here we recast it to numpy array and transpose it to TZYX order. data = np.array(data.T) except Exception as e: raise CVDBError(f"Error downloading cloudvolume data: {e}") out_cube.set_data(data) return out_cube # Main WRITE interface method def write_cuboid( self, resource, corner, resolution, cuboid_data, time_sample_start=0, iso=False, to_black=False, ): """ Write a 3D/4D volume to the key-value store. Used by API/cache in consistent mode as it reconciles writes If cuboid_data.ndim == 4, data in time-series format - assume t,z,y,x If cuboid_data.ndim == 3, data not in time-series format - assume z,y,x Args: resource (project.BossResource): Data model info based on the request or target resource corner ((int, int, int)): the xyz locatiotn of the corner of the cuout resolution (int): the resolution level cuboid_data (numpy.ndarray): Matrix of data to write as cuboids time_sample_start (int): if cuboid_data.ndim == 3, the time sample for the data if cuboid_data.ndim == 4, the time sample for cuboid_data[0, :, :, :] iso (bool): Flag indicating if you want to write to the "isotropic" version of a channel, if available to_black (bool): Flag indicating is this cuboid is a cutout_to_black cuboid. Returns: None """ raise NotImplementedError
cvdb/cloudvolumedb.py
import numpy as np from cloudvolume import CloudVolume from .cube import Cube from .error import CVDBError class CloudVolumeDB: """ Wrapper interface for cloudvolume read access to bossDB. """ def __init__(self, cv_config=None): self.cv_config = cv_config # Main READ interface method def cutout( self, resource, corner, extent, resolution, time_sample_range=None, filter_ids=None, iso=False, access_mode="cache", ): """Extract a cube of arbitrary size. Need not be aligned to cuboid boundaries. corner represents the location of the cutout and extent the size. As an example in 1D, if asking for a corner of 3 and extent of 2, this would be the values at 3 and 4. Args: resource (spdb.project.BossResource): Data model info based on the request or target resource corner ((int, int, int)): the xyz location of the corner of the cutout extent ((int, int, int)): the xyz extents resolution (int): the resolution level time_sample_range : ignored filter_ids (optional[list]): ignored iso (bool): ignored access_mode (str): ignored Returns: cube.Cube: The cutout data stored in a Cube instance Raises: (CVDBError) """ channel = resource.get_channel() out_cube = Cube.create_cube(resource, extent) # NOTE: Refer to Tim's changes for channel method to check storage type. if channel.storage_type != "cloudvol": raise CVDBError( f"Storage type {channel.storage_type} not configured for cloudvolume.", 701, ) # NOTE: Refer to Tim's changes for S3 bucket and path. try: # Accessing HTTPS version of dataset. This is READ-ONLY and PUBLIC-ONLY, but much faster to download. vol = CloudVolume( f"s3://{channel.bucket}/{channel.cv_path}", mip=resolution, use_https=True, fill_missing=True, ) # Data is downloaded by providing XYZ indicies. data = vol[ corner[0] : corner[0] + extent[0], corner[1] : corner[1] + extent[1], corner[2] : corner[2] + extent[2], ] # Data returned as cloudvolume VolumeCutout object in XYZT order. # Here we recast it to numpy array and transpose it to TZYX order. data = np.array(data.T) except Exception as e: raise CVDBError(f"Error downloading cloudvolume data: {e}") out_cube.set_data(data) return out_cube # Main WRITE interface method def write_cuboid( self, resource, corner, resolution, cuboid_data, time_sample_start=0, iso=False, to_black=False, ): """ Write a 3D/4D volume to the key-value store. Used by API/cache in consistent mode as it reconciles writes If cuboid_data.ndim == 4, data in time-series format - assume t,z,y,x If cuboid_data.ndim == 3, data not in time-series format - assume z,y,x Args: resource (project.BossResource): Data model info based on the request or target resource corner ((int, int, int)): the xyz locatiotn of the corner of the cuout resolution (int): the resolution level cuboid_data (numpy.ndarray): Matrix of data to write as cuboids time_sample_start (int): if cuboid_data.ndim == 3, the time sample for the data if cuboid_data.ndim == 4, the time sample for cuboid_data[0, :, :, :] iso (bool): Flag indicating if you want to write to the "isotropic" version of a channel, if available to_black (bool): Flag indicating is this cuboid is a cutout_to_black cuboid. Returns: None """ raise NotImplementedError
0.863334
0.421373
import os import zipfile import pathlib from time import time from io import BytesIO import requests from psycopg2 import sql from flask import Blueprint, request, jsonify, send_file from app.config import config from app.auth_utils import auth_user from Database.postgres import Postgres_db from Drive.tools import allowed_file manage_storage_bp = Blueprint('manage_storage', __name__) @manage_storage_bp.route('/create_folder', methods=['POST']) @auth_user(name_func='create_folder') def create_folder(user): json = request.get_json(silent=True) if not json: return jsonify({"message": "JSON не найден"}), 204 file_path = json.get('file_path') path = os.path.join(f"{config['APP']['PATH_STORAGE']}{user.get_username()}{file_path}") os.makedirs(path, exist_ok=True) return jsonify(True) @manage_storage_bp.route('/get_file', methods=['POST']) @auth_user(name_func='get_file') def get_file(user): """Download a file.""" json = request.get_json(silent=True) if not json: return jsonify({"message": "JSON не найден"}), 204 file_path = json.get('file_path') path = os.path.join(f"{config['APP']['PATH_STORAGE']}{user.get_username()}{file_path}") with zipfile.ZipFile(path, 'r') as z: for filename in z.namelist( ): return send_file( BytesIO(z.read(filename)), attachment_filename=filename, as_attachment=True ) @manage_storage_bp.route('/get_files_in_directory', methods=['POST']) @auth_user(name_func='get_files_in_directory') def get_files_in_directory(user): json = request.get_json(silent=True) if not json: return jsonify({"message": "JSON не найден"}), 204 file_path = json.get('file_path') path = os.path.join(f"{config['APP']['PATH_STORAGE']}{user.get_username()}{file_path}") vozvrat = [] with os.scandir(path) as listOfEntries: for entry in listOfEntries: if entry.is_file(): vozvrat.append({ "title": entry.name, "path": entry.path[len(config['APP']['PATH_STORAGE']) + len(user.get_username()):], "size": entry.stat(follow_symlinks=False).st_size, "type": "file" }) elif entry.is_dir(): vozvrat.append({ "title": entry.name, "path": entry.path[len(config['APP']['PATH_STORAGE']) + len(user.get_username()):], "size": entry.stat(follow_symlinks=False).st_size, "type": "dir" }) return jsonify(vozvrat) @manage_storage_bp.route('/del_object', methods=['DELETE']) @auth_user(name_func='del_object') def del_object(user): json = request.get_json(silent=True) if not json: return jsonify({"message": "JSON не найден"}), 204 try: database = Postgres_db() except TypeError: return jsonify({"message": "Нет подключения к БД"}) file_path = json.get('file_path') path = os.path.join(f"{config['APP']['PATH_STORAGE']}{user.get_username()}{file_path}") file_size = os.stat(path).st_size if os.path.isdir(path): os.removedirs(path) elif os.path.isfile(path): os.remove(path) free_space_kbyte = database.select_data(sql.SQL(""" UPDATE users SET free_space_kbyte = ( SELECT free_space_kbyte FROM users WHERE id={user_id} ) + {file_size} WHERE id={user_id} RETURNING free_space_kbyte;""").format( user_id=sql.Literal(user.get_id()), file_size=sql.Literal(file_size) )) if type(free_space_kbyte) == list: return jsonify({ "free_space_kbyte": free_space_kbyte[0][0] }) else: return jsonify(free_space_kbyte) @manage_storage_bp.route('/share', methods=['POST']) @auth_user(name_func='share_object') def share_object(user): json = request.get_json(silent=True) if not json: return jsonify({"message": "JSON не найден"}), 204 file_path = json.get('file_path') path = os.path.join(f"{config['APP']['PATH_STORAGE']}{user.get_username()}{file_path}") payload = { "route": f"/{user.get_username()}{file_path}" } if os.path.isdir(path): payload["type"] = "dir" elif os.path.isfile(path): payload["type"] = "file" r = requests.Request(method='GET', url=f"http://{config['APP']['URL_SERVICE']}/share", params=payload).prepare() return jsonify(r.url) @manage_storage_bp.route('/share', methods=['GET']) @auth_user(name_func='get_share_object') def get_share_object(user): path = os.path.join(f"{config['APP']['PATH_STORAGE']}{request.args.get('route')}") type_obj = request.args.get('type') if type_obj == "dir" and os.path.isdir(path): vozvrat = [] with os.scandir(path) as listOfEntries: for entry in listOfEntries: if entry.is_file(): vozvrat.append({ "title": entry.name, "path": entry.path[len(config['APP']['PATH_STORAGE']) + len(user.get_username()):], "size": entry.stat(follow_symlinks=False).st_size // 1024, "type": "file" }) elif entry.is_dir(): vozvrat.append({ "title": entry.name, "path": entry.path[len(config['APP']['PATH_STORAGE']) + len(user.get_username()):], "size": entry.stat(follow_symlinks=False).st_size // 1024, "type": "dir" }) return vozvrat elif type_obj == "file" and os.path.isfile(path): with zipfile.ZipFile(path, 'r') as z: for filename in z.namelist( ): return send_file( BytesIO(z.read(filename)), attachment_filename=filename, as_attachment=True ) return jsonify(False), 404
backend/Drive/manage_storage.py
import os import zipfile import pathlib from time import time from io import BytesIO import requests from psycopg2 import sql from flask import Blueprint, request, jsonify, send_file from app.config import config from app.auth_utils import auth_user from Database.postgres import Postgres_db from Drive.tools import allowed_file manage_storage_bp = Blueprint('manage_storage', __name__) @manage_storage_bp.route('/create_folder', methods=['POST']) @auth_user(name_func='create_folder') def create_folder(user): json = request.get_json(silent=True) if not json: return jsonify({"message": "JSON не найден"}), 204 file_path = json.get('file_path') path = os.path.join(f"{config['APP']['PATH_STORAGE']}{user.get_username()}{file_path}") os.makedirs(path, exist_ok=True) return jsonify(True) @manage_storage_bp.route('/get_file', methods=['POST']) @auth_user(name_func='get_file') def get_file(user): """Download a file.""" json = request.get_json(silent=True) if not json: return jsonify({"message": "JSON не найден"}), 204 file_path = json.get('file_path') path = os.path.join(f"{config['APP']['PATH_STORAGE']}{user.get_username()}{file_path}") with zipfile.ZipFile(path, 'r') as z: for filename in z.namelist( ): return send_file( BytesIO(z.read(filename)), attachment_filename=filename, as_attachment=True ) @manage_storage_bp.route('/get_files_in_directory', methods=['POST']) @auth_user(name_func='get_files_in_directory') def get_files_in_directory(user): json = request.get_json(silent=True) if not json: return jsonify({"message": "JSON не найден"}), 204 file_path = json.get('file_path') path = os.path.join(f"{config['APP']['PATH_STORAGE']}{user.get_username()}{file_path}") vozvrat = [] with os.scandir(path) as listOfEntries: for entry in listOfEntries: if entry.is_file(): vozvrat.append({ "title": entry.name, "path": entry.path[len(config['APP']['PATH_STORAGE']) + len(user.get_username()):], "size": entry.stat(follow_symlinks=False).st_size, "type": "file" }) elif entry.is_dir(): vozvrat.append({ "title": entry.name, "path": entry.path[len(config['APP']['PATH_STORAGE']) + len(user.get_username()):], "size": entry.stat(follow_symlinks=False).st_size, "type": "dir" }) return jsonify(vozvrat) @manage_storage_bp.route('/del_object', methods=['DELETE']) @auth_user(name_func='del_object') def del_object(user): json = request.get_json(silent=True) if not json: return jsonify({"message": "JSON не найден"}), 204 try: database = Postgres_db() except TypeError: return jsonify({"message": "Нет подключения к БД"}) file_path = json.get('file_path') path = os.path.join(f"{config['APP']['PATH_STORAGE']}{user.get_username()}{file_path}") file_size = os.stat(path).st_size if os.path.isdir(path): os.removedirs(path) elif os.path.isfile(path): os.remove(path) free_space_kbyte = database.select_data(sql.SQL(""" UPDATE users SET free_space_kbyte = ( SELECT free_space_kbyte FROM users WHERE id={user_id} ) + {file_size} WHERE id={user_id} RETURNING free_space_kbyte;""").format( user_id=sql.Literal(user.get_id()), file_size=sql.Literal(file_size) )) if type(free_space_kbyte) == list: return jsonify({ "free_space_kbyte": free_space_kbyte[0][0] }) else: return jsonify(free_space_kbyte) @manage_storage_bp.route('/share', methods=['POST']) @auth_user(name_func='share_object') def share_object(user): json = request.get_json(silent=True) if not json: return jsonify({"message": "JSON не найден"}), 204 file_path = json.get('file_path') path = os.path.join(f"{config['APP']['PATH_STORAGE']}{user.get_username()}{file_path}") payload = { "route": f"/{user.get_username()}{file_path}" } if os.path.isdir(path): payload["type"] = "dir" elif os.path.isfile(path): payload["type"] = "file" r = requests.Request(method='GET', url=f"http://{config['APP']['URL_SERVICE']}/share", params=payload).prepare() return jsonify(r.url) @manage_storage_bp.route('/share', methods=['GET']) @auth_user(name_func='get_share_object') def get_share_object(user): path = os.path.join(f"{config['APP']['PATH_STORAGE']}{request.args.get('route')}") type_obj = request.args.get('type') if type_obj == "dir" and os.path.isdir(path): vozvrat = [] with os.scandir(path) as listOfEntries: for entry in listOfEntries: if entry.is_file(): vozvrat.append({ "title": entry.name, "path": entry.path[len(config['APP']['PATH_STORAGE']) + len(user.get_username()):], "size": entry.stat(follow_symlinks=False).st_size // 1024, "type": "file" }) elif entry.is_dir(): vozvrat.append({ "title": entry.name, "path": entry.path[len(config['APP']['PATH_STORAGE']) + len(user.get_username()):], "size": entry.stat(follow_symlinks=False).st_size // 1024, "type": "dir" }) return vozvrat elif type_obj == "file" and os.path.isfile(path): with zipfile.ZipFile(path, 'r') as z: for filename in z.namelist( ): return send_file( BytesIO(z.read(filename)), attachment_filename=filename, as_attachment=True ) return jsonify(False), 404
0.252016
0.093306
import sys from instrument_lookup import hex_to_instrument, instrument_to_hex class MIDIFile: MTrk = ["4d", "54", "72", "6b"] MThd = ["4d", "54", "68", "06"] END_TRACK = ["ff", "2f", "00"] def __init__(self): self.hex_array = [] self.meta_events = {} def read_file(self, input_file_name: str) -> None: """ Read a midi file and store it into the MIDIFile instance.""" with open(input_file_name, "rb") as input_file: binary_string = input_file.read() hex_string = binary_string.hex(" ") self.hex_array = hex_string.split(" ") self.read_header() def read_header(self) -> None: """Reads header information into format, ntracks, and tickdiv.""" position = 4 header_string = "" for hex_byte in self.read_bytes(4, 4): header_string = header_string + hex_byte position = 8 header_length = int(header_string, 16) header_data = self.read_bytes(8, header_length) self.format = self.htoi("".join(header_data[0:2])) self.num_tracks = self.htoi("".join(header_data[2:4])) timing = self.htoi("".join(header_data[4:6])) # The top bit of a 16-bit number determines the timing format. if (timing > 32768): self.timing = "timecode" timing = timing - 32768 else: self.timing = "metrical" self.tickdiv = timing def hexarray_to_binary(self) -> bytes: """Converts an array of HEX values into a binary sting.""" hex_string = ''.join(self.hex_array) binary_string = bytes.fromhex(hex_string) return binary_string def write_file(self, output_file_name: str) -> None: """Writes the MIDIFile instance to the output file.""" with open(output_file_name, "wb") as output_file: output_file.write(self.hexarray_to_binary()) def find_start_track(self, start: int) -> int: """Returns the index after the start track and length of the track.""" #print("searching") for index in range(start, len(self.hex_array) - 4): if self.read_bytes(index, 4) == self.MTrk: return index + 7 return -1 def find_end_track(self, start: int) -> int: """ Returns the index right after an end of track sequence.""" for index in range(start, len(self.hex_array) - 3): if (self.read_bytes(index, 3) == self.END_TRACK): return index + 3 return -1 def find_byte_sequence(self, start: int, byte_sequence: list) -> int: """Returns the index after the start track and length of the track.""" #print("searching") for index in range(start, len(self.hex_array) - len(byte_sequence)): if self.read_bytes(index, len(byte_sequence)) == byte_sequence: return index return -1 def list_instruments(self) -> dict: """ Returns the instrument titles being used in the midi file in a list. """ strings = {} search_index = self.find_end_track(0) search_index = self.find_start_track(search_index) while search_index < len(self.hex_array): if (search_index == -1): break if (self.hex_array[search_index][0] == "c"): channel = self.hex_array[search_index] instrument_type = self.hex_array[search_index+1] strings[channel] = hex_to_instrument[instrument_type] search_index = self.find_start_track(search_index) else: search_index = search_index + 1 return strings def change_instrument(self, channel: str, instrument_name: str) -> None: """Changes the instrument for a channel to the specified instrument.""" if (len(instrument_name) != 2): instrument_name = instrument_to_hex[instrument_name] search_index = self.find_end_track(0) search_index = self.find_start_track(search_index) while search_index < len(self.hex_array): if (self.hex_array[search_index] == "54"): search_index = search_index + 7 if (self.hex_array[search_index] == channel): self.hex_array[search_index+1] = instrument_name return search_index = search_index + 1 def read_bytes(self, start_position: int, number_of_bytes: int) -> list: """Read a certain number of bytes from the hex_array starting at start position.""" output = [] end_position = start_position + number_of_bytes for i in range(start_position, end_position): output.append(self.hex_array[i]) return output def htoi(self, hex_string: str) -> int: """Converts a hex_string to an integer.""" return int(hex_string, 16) def read_meta_events(self): """Reads all meta events into a dictionary.""" for type_byte in MetaEvent.TEXT_EVENTS: event = MetaEvent(type_byte) if (event.read_event(self)): self.meta_events[type_byte] = event.data for type_byte in MetaEvent.NUMERIC_EVENTS: event = MetaEvent(type_byte) if (event.read_event(self)): self.meta_events[type_byte] = event.data class Event: """This is a representation of a single event that can be found in a MIDI file.""" def __init__(self, start_byte: str) -> None: self.start_byte = start_byte def htoi(self, hex_string: str) -> int: """Converts a hex_string to an integer.""" return int(hex_string, 16) def hex_to_char(self, hex_string: str) -> str: """Converts a hex_string to an Unicode charater (string).""" return chr(self.htoi(hex_string)) class MIDIEvent(Event): """A single MIDI Event.""" def __init__(self, start_byte: str) -> None: super().__init__(start_byte) def parse_delta_time(self, start): """Reads the delta time of an event.""" class SysExEvent(Event): """A single system exclusive Event.""" def __init__(self, start_byte: str) -> None: super().__init__(start_byte) class MetaEvent(Event): """A single Meta Event.""" #Meta events are of the form ff type length data TEXT_EVENTS = ["01", "02", "03", "04", "05", "06", "07", "08", "09"] NUMERIC_EVENTS = ["00", "20", "21", "51", "54", "58", "59"] # Do not currently support Sequence Specific Event # Not including End of Track sequence def __init__(self, type_byte: str) -> None: super().__init__("ff") self.type = type_byte def read_event(self, midi: MIDIFile) -> bool: """Reads the meta-event from MIDIFile midi.""" search = [self.start_byte, self.type] start = midi.find_start_track(0) position = start index = midi.find_byte_sequence(start, search) if index == -1: return False length = self.htoi(midi.hex_array[index + 2]) data = midi.read_bytes(index + 3, length) if (self.type in self.TEXT_EVENTS): return self.read_event_text(data) else: return self.read_event_numeric(data) def read_event_text(self, data: list) -> bool: """Reads a text meta-event from MIDIFile midi.""" for i in range(len(data)): data[i] = self.hex_to_char(data[i]) self.data = "".join(data) return True def read_event_numeric(self, data: list) -> bool: """Reads a numeric meta-event from MIDIFile midi.""" if (len(data) == 1): self.data = self.htoi(data[0]) elif (self.type == "59"): self.data = [self.htoi(data[0]), self.htoi(data[1])] elif ((len(data) == 2) or (len(data) == 3)): hex_string = "" for i in data: hex_string = hex_string + i self.data = self.htoi(hex_string) elif ((len(data) == 4) or (len(data) == 5)): for i in range(len(data)): data[i] = self.htoi(data[i]) self.data = data else: return False return True if __name__ == "__main__": if (len(sys.argv) > 1): if (sys.argv[1] == "inst"): a = MIDIFile() a.read_file(sys.argv[2]) #print(a.list_instruments()) print(a.list_instruments()) print(a.format, a.num_tracks, a.timing, a.tickdiv) else: a = MIDIFile() a.read_file("mary.mid") print(a.read_bytes(0,6)) print(a.read_bytes(0,5)) #print(a.format, a.num_tracks, a.timing, a.tickdiv)
pymiditools.py
import sys from instrument_lookup import hex_to_instrument, instrument_to_hex class MIDIFile: MTrk = ["4d", "54", "72", "6b"] MThd = ["4d", "54", "68", "06"] END_TRACK = ["ff", "2f", "00"] def __init__(self): self.hex_array = [] self.meta_events = {} def read_file(self, input_file_name: str) -> None: """ Read a midi file and store it into the MIDIFile instance.""" with open(input_file_name, "rb") as input_file: binary_string = input_file.read() hex_string = binary_string.hex(" ") self.hex_array = hex_string.split(" ") self.read_header() def read_header(self) -> None: """Reads header information into format, ntracks, and tickdiv.""" position = 4 header_string = "" for hex_byte in self.read_bytes(4, 4): header_string = header_string + hex_byte position = 8 header_length = int(header_string, 16) header_data = self.read_bytes(8, header_length) self.format = self.htoi("".join(header_data[0:2])) self.num_tracks = self.htoi("".join(header_data[2:4])) timing = self.htoi("".join(header_data[4:6])) # The top bit of a 16-bit number determines the timing format. if (timing > 32768): self.timing = "timecode" timing = timing - 32768 else: self.timing = "metrical" self.tickdiv = timing def hexarray_to_binary(self) -> bytes: """Converts an array of HEX values into a binary sting.""" hex_string = ''.join(self.hex_array) binary_string = bytes.fromhex(hex_string) return binary_string def write_file(self, output_file_name: str) -> None: """Writes the MIDIFile instance to the output file.""" with open(output_file_name, "wb") as output_file: output_file.write(self.hexarray_to_binary()) def find_start_track(self, start: int) -> int: """Returns the index after the start track and length of the track.""" #print("searching") for index in range(start, len(self.hex_array) - 4): if self.read_bytes(index, 4) == self.MTrk: return index + 7 return -1 def find_end_track(self, start: int) -> int: """ Returns the index right after an end of track sequence.""" for index in range(start, len(self.hex_array) - 3): if (self.read_bytes(index, 3) == self.END_TRACK): return index + 3 return -1 def find_byte_sequence(self, start: int, byte_sequence: list) -> int: """Returns the index after the start track and length of the track.""" #print("searching") for index in range(start, len(self.hex_array) - len(byte_sequence)): if self.read_bytes(index, len(byte_sequence)) == byte_sequence: return index return -1 def list_instruments(self) -> dict: """ Returns the instrument titles being used in the midi file in a list. """ strings = {} search_index = self.find_end_track(0) search_index = self.find_start_track(search_index) while search_index < len(self.hex_array): if (search_index == -1): break if (self.hex_array[search_index][0] == "c"): channel = self.hex_array[search_index] instrument_type = self.hex_array[search_index+1] strings[channel] = hex_to_instrument[instrument_type] search_index = self.find_start_track(search_index) else: search_index = search_index + 1 return strings def change_instrument(self, channel: str, instrument_name: str) -> None: """Changes the instrument for a channel to the specified instrument.""" if (len(instrument_name) != 2): instrument_name = instrument_to_hex[instrument_name] search_index = self.find_end_track(0) search_index = self.find_start_track(search_index) while search_index < len(self.hex_array): if (self.hex_array[search_index] == "54"): search_index = search_index + 7 if (self.hex_array[search_index] == channel): self.hex_array[search_index+1] = instrument_name return search_index = search_index + 1 def read_bytes(self, start_position: int, number_of_bytes: int) -> list: """Read a certain number of bytes from the hex_array starting at start position.""" output = [] end_position = start_position + number_of_bytes for i in range(start_position, end_position): output.append(self.hex_array[i]) return output def htoi(self, hex_string: str) -> int: """Converts a hex_string to an integer.""" return int(hex_string, 16) def read_meta_events(self): """Reads all meta events into a dictionary.""" for type_byte in MetaEvent.TEXT_EVENTS: event = MetaEvent(type_byte) if (event.read_event(self)): self.meta_events[type_byte] = event.data for type_byte in MetaEvent.NUMERIC_EVENTS: event = MetaEvent(type_byte) if (event.read_event(self)): self.meta_events[type_byte] = event.data class Event: """This is a representation of a single event that can be found in a MIDI file.""" def __init__(self, start_byte: str) -> None: self.start_byte = start_byte def htoi(self, hex_string: str) -> int: """Converts a hex_string to an integer.""" return int(hex_string, 16) def hex_to_char(self, hex_string: str) -> str: """Converts a hex_string to an Unicode charater (string).""" return chr(self.htoi(hex_string)) class MIDIEvent(Event): """A single MIDI Event.""" def __init__(self, start_byte: str) -> None: super().__init__(start_byte) def parse_delta_time(self, start): """Reads the delta time of an event.""" class SysExEvent(Event): """A single system exclusive Event.""" def __init__(self, start_byte: str) -> None: super().__init__(start_byte) class MetaEvent(Event): """A single Meta Event.""" #Meta events are of the form ff type length data TEXT_EVENTS = ["01", "02", "03", "04", "05", "06", "07", "08", "09"] NUMERIC_EVENTS = ["00", "20", "21", "51", "54", "58", "59"] # Do not currently support Sequence Specific Event # Not including End of Track sequence def __init__(self, type_byte: str) -> None: super().__init__("ff") self.type = type_byte def read_event(self, midi: MIDIFile) -> bool: """Reads the meta-event from MIDIFile midi.""" search = [self.start_byte, self.type] start = midi.find_start_track(0) position = start index = midi.find_byte_sequence(start, search) if index == -1: return False length = self.htoi(midi.hex_array[index + 2]) data = midi.read_bytes(index + 3, length) if (self.type in self.TEXT_EVENTS): return self.read_event_text(data) else: return self.read_event_numeric(data) def read_event_text(self, data: list) -> bool: """Reads a text meta-event from MIDIFile midi.""" for i in range(len(data)): data[i] = self.hex_to_char(data[i]) self.data = "".join(data) return True def read_event_numeric(self, data: list) -> bool: """Reads a numeric meta-event from MIDIFile midi.""" if (len(data) == 1): self.data = self.htoi(data[0]) elif (self.type == "59"): self.data = [self.htoi(data[0]), self.htoi(data[1])] elif ((len(data) == 2) or (len(data) == 3)): hex_string = "" for i in data: hex_string = hex_string + i self.data = self.htoi(hex_string) elif ((len(data) == 4) or (len(data) == 5)): for i in range(len(data)): data[i] = self.htoi(data[i]) self.data = data else: return False return True if __name__ == "__main__": if (len(sys.argv) > 1): if (sys.argv[1] == "inst"): a = MIDIFile() a.read_file(sys.argv[2]) #print(a.list_instruments()) print(a.list_instruments()) print(a.format, a.num_tracks, a.timing, a.tickdiv) else: a = MIDIFile() a.read_file("mary.mid") print(a.read_bytes(0,6)) print(a.read_bytes(0,5)) #print(a.format, a.num_tracks, a.timing, a.tickdiv)
0.434221
0.452475
import datetime import json import os from flask import jsonify from flask import request from flask.views import MethodView from common.config import DOC_DIR, DOC_TEMPLATE_DIR from common.constant import EFFECT_TIME_NOW class ResignDirectorHandler(MethodView): methods = ['GET', 'POST'] def post(self): if request.data: data_json = json.loads(request.data) else: data_json = json.loads(request.form.to_dict().keys()[0]) from docxtpl import DocxTemplate tpl = DocxTemplate('%s/resign_tpl.docx' % DOC_TEMPLATE_DIR) # 一些公共的参数 effect_time = data_json['items'][0]['effect_time'] date = data_json['items'][0]['date'] time_format = datetime.datetime.strptime(date, '%Y-%m-%d') date = time_format.strftime('%d %B %Y') company = data_json['items'][0]['company'] notice_type_dic = { 1: u'董事辞任', 2: u'监事辞任', 3: u'委任董事', 4: u'委任监事', 5: u'委任职工董事', 6: u'委任职工监事', 7: u'变更董事', 8: u'变更监事', } job_dic = { 1: "Non-Executive Director", 2: "Supervisory Committee", 3: "Supervisory Committee", 4: "Supervisory Committee", 5: "Supervisory Committee", 6: "Supervisory Committee", } single_person_flag = True if len(data_json['items']) == 1 else False # 构造标题 title = job_dic[data_json['items'][0]['job']] if single_person_flag else "Directors" # 构造第一段 first_a = "" for item in data_json['items']: sex_he = 'he' if item['sex'] == 1 else 'she' sex_his = 'his' if item['sex'] == 1 else 'her' sex_Mr = 'Mr. %s' % item['lastname'] if item['sex'] == 1 else 'Ms. %s' % item['lastname'] sex_Mr_long = 'Mr. %s %s' % (item['lastname'], item['firstname']) if item['sex'] == 1 else 'Ms. %s%s' % ( item['lastname'], item['firstname']) first_a += u"a resignation letter from %s (“%s”), informing the Board of %s resignation from the position" \ u" as the %s of the Company due to %s " % \ (sex_Mr_long, sex_Mr, sex_his, item['position'], item['reason']) first_a += ', and ' first_a = first_a[0:-6] if effect_time == EFFECT_TIME_NOW: first_b = "The resignation takes effect immediately" else: _t = u'、'.join([job_dic[v["job"]] for v in data_json["items"]]) first_b = u"The resignation will take effect upon the election of the new %s of the Company." % _t # 构造第二段 if len(data_json['items']) == 1: item = data_json["items"][0] sex_he = 'he' if item['sex'] == 1 else 'she' sex_his = 'his' if item['sex'] == 1 else 'her' sex_Mr = 'Mr.' + item['lastname'] if item['sex'] == 1 else 'Ms.' + item['lastname'] second_a = "%s " % (sex_Mr) second_b = "%s has" % (sex_he) third_a = "%s for %s" % (sex_Mr, sex_his) third_b = "%s" % (sex_his) else: tmp_str = "" for item in data_json['items']: sex_Mr = 'Mr. ' + item['lastname'] if item['sex'] == 1 else 'Ms. ' + item['lastname'] tmp_str += "%s and " % sex_Mr tmp_str = tmp_str[0:-4] second_a = "Each of %s " % (tmp_str) second_b = "they have" third_a = "their" third_b = "their" context = data_json context['in_europe'] = True context['is_paid'] = False context['title'] = title context['date'] = date context['company'] = company context['first_a'] = first_a context['first_b'] = first_b context['second_a'] = second_a context['second_b'] = second_b context['third_a'] = third_a context['third_b'] = third_b tpl.render(context) if not os.path.exists(DOC_DIR): os.mkdir(DOC_DIR) # 保存文件 now = datetime.datetime.now().strftime("%Y%m%d:%H%M%S") new_filename = 'resign_director%s.docx' % now new_filepath = '%s/resign_director%s.docx' % (DOC_DIR, now) tpl.save(new_filepath) return jsonify({"msg": "ok", "code": 0, "url": "/download/%s" % new_filename})
handlers/resign_director_handler.py
import datetime import json import os from flask import jsonify from flask import request from flask.views import MethodView from common.config import DOC_DIR, DOC_TEMPLATE_DIR from common.constant import EFFECT_TIME_NOW class ResignDirectorHandler(MethodView): methods = ['GET', 'POST'] def post(self): if request.data: data_json = json.loads(request.data) else: data_json = json.loads(request.form.to_dict().keys()[0]) from docxtpl import DocxTemplate tpl = DocxTemplate('%s/resign_tpl.docx' % DOC_TEMPLATE_DIR) # 一些公共的参数 effect_time = data_json['items'][0]['effect_time'] date = data_json['items'][0]['date'] time_format = datetime.datetime.strptime(date, '%Y-%m-%d') date = time_format.strftime('%d %B %Y') company = data_json['items'][0]['company'] notice_type_dic = { 1: u'董事辞任', 2: u'监事辞任', 3: u'委任董事', 4: u'委任监事', 5: u'委任职工董事', 6: u'委任职工监事', 7: u'变更董事', 8: u'变更监事', } job_dic = { 1: "Non-Executive Director", 2: "Supervisory Committee", 3: "Supervisory Committee", 4: "Supervisory Committee", 5: "Supervisory Committee", 6: "Supervisory Committee", } single_person_flag = True if len(data_json['items']) == 1 else False # 构造标题 title = job_dic[data_json['items'][0]['job']] if single_person_flag else "Directors" # 构造第一段 first_a = "" for item in data_json['items']: sex_he = 'he' if item['sex'] == 1 else 'she' sex_his = 'his' if item['sex'] == 1 else 'her' sex_Mr = 'Mr. %s' % item['lastname'] if item['sex'] == 1 else 'Ms. %s' % item['lastname'] sex_Mr_long = 'Mr. %s %s' % (item['lastname'], item['firstname']) if item['sex'] == 1 else 'Ms. %s%s' % ( item['lastname'], item['firstname']) first_a += u"a resignation letter from %s (“%s”), informing the Board of %s resignation from the position" \ u" as the %s of the Company due to %s " % \ (sex_Mr_long, sex_Mr, sex_his, item['position'], item['reason']) first_a += ', and ' first_a = first_a[0:-6] if effect_time == EFFECT_TIME_NOW: first_b = "The resignation takes effect immediately" else: _t = u'、'.join([job_dic[v["job"]] for v in data_json["items"]]) first_b = u"The resignation will take effect upon the election of the new %s of the Company." % _t # 构造第二段 if len(data_json['items']) == 1: item = data_json["items"][0] sex_he = 'he' if item['sex'] == 1 else 'she' sex_his = 'his' if item['sex'] == 1 else 'her' sex_Mr = 'Mr.' + item['lastname'] if item['sex'] == 1 else 'Ms.' + item['lastname'] second_a = "%s " % (sex_Mr) second_b = "%s has" % (sex_he) third_a = "%s for %s" % (sex_Mr, sex_his) third_b = "%s" % (sex_his) else: tmp_str = "" for item in data_json['items']: sex_Mr = 'Mr. ' + item['lastname'] if item['sex'] == 1 else 'Ms. ' + item['lastname'] tmp_str += "%s and " % sex_Mr tmp_str = tmp_str[0:-4] second_a = "Each of %s " % (tmp_str) second_b = "they have" third_a = "their" third_b = "their" context = data_json context['in_europe'] = True context['is_paid'] = False context['title'] = title context['date'] = date context['company'] = company context['first_a'] = first_a context['first_b'] = first_b context['second_a'] = second_a context['second_b'] = second_b context['third_a'] = third_a context['third_b'] = third_b tpl.render(context) if not os.path.exists(DOC_DIR): os.mkdir(DOC_DIR) # 保存文件 now = datetime.datetime.now().strftime("%Y%m%d:%H%M%S") new_filename = 'resign_director%s.docx' % now new_filepath = '%s/resign_director%s.docx' % (DOC_DIR, now) tpl.save(new_filepath) return jsonify({"msg": "ok", "code": 0, "url": "/download/%s" % new_filename})
0.139543
0.160496
import json import argparse import string def get_parser(): # Get parser for command line arguments. parser = argparse.ArgumentParser(description="Twitter Downloader") parser.add_argument("-fn", "--fname", dest="fname") parser.add_argument("-d", "--data-dir", dest="data_dir", help="Output/Data Directory") return parser def full_version_json(source_file, data_dir): # Full version of pretty json with open('data/stream_movie.json', 'r') as f: content = f.readlines() # read only the first tweet/line for tweet in content: t = json.loads(tweet) outfile = "%s/%s_pretty.json" % (data_dir, source_file) with open(outfile, 'a') as ff: ff.write(json.dumps(t,indent=4)) # pretty-print ff.write('\n') def required_version_json(source_file, data_dir): # Required fields version of json with open('data/stream_movie.json', 'r') as f: content = f.readlines() # read only the first tweet/line for tweet in content: t = json.loads(tweet) new_t = {} for k, v in t.items(): if k == "user": new_t.update({k:v}) if k == "id": new_t.update({k:v}) if k == "lang": new_t.update({k:v}) if k == "text": new_t.update({k:v}) if k == "created_at": new_t.update({k:v}) if k == "favorite_count": new_t.update({k:v}) if k == "retweet_count": new_t.update({k:v}) if k == "favorited": new_t.update({k:v}) if k == "retweeted": new_t.update({k:v}) outfile = "%s/%s_pretty_required.json" % (data_dir, source_file) with open(outfile, 'a') as ff: ff.write(json.dumps(new_t,sort_keys=True,indent=4)) # pretty-print ff.write('\n') # created_at: the date of creation # favorite_count, retweet_count: the number of favourites and retweets # favorited, retweeted: boolean stating whether the authenticated user (you) have favourited or retweeted this tweet # lang: acronym for the language (e.g. “en” for english) # id: the tweet identifier # place, coordinates, geo: geo-location information if available # user: the author’s full profile # entities: list of entities like URLs, @-mentions, hashtags and symbols # in_reply_to_user_id: user identifier if the tweet is a reply to a specific user # in_reply_to_status_id: status identifier id the tweet is a reply to a specific status if __name__ == '__main__': parser = get_parser() args = parser.parse_args() full_version_json(args.fname, args.data_dir) required_version_json(args.fname, args.data_dir)
pretty_required_json.py
import json import argparse import string def get_parser(): # Get parser for command line arguments. parser = argparse.ArgumentParser(description="Twitter Downloader") parser.add_argument("-fn", "--fname", dest="fname") parser.add_argument("-d", "--data-dir", dest="data_dir", help="Output/Data Directory") return parser def full_version_json(source_file, data_dir): # Full version of pretty json with open('data/stream_movie.json', 'r') as f: content = f.readlines() # read only the first tweet/line for tweet in content: t = json.loads(tweet) outfile = "%s/%s_pretty.json" % (data_dir, source_file) with open(outfile, 'a') as ff: ff.write(json.dumps(t,indent=4)) # pretty-print ff.write('\n') def required_version_json(source_file, data_dir): # Required fields version of json with open('data/stream_movie.json', 'r') as f: content = f.readlines() # read only the first tweet/line for tweet in content: t = json.loads(tweet) new_t = {} for k, v in t.items(): if k == "user": new_t.update({k:v}) if k == "id": new_t.update({k:v}) if k == "lang": new_t.update({k:v}) if k == "text": new_t.update({k:v}) if k == "created_at": new_t.update({k:v}) if k == "favorite_count": new_t.update({k:v}) if k == "retweet_count": new_t.update({k:v}) if k == "favorited": new_t.update({k:v}) if k == "retweeted": new_t.update({k:v}) outfile = "%s/%s_pretty_required.json" % (data_dir, source_file) with open(outfile, 'a') as ff: ff.write(json.dumps(new_t,sort_keys=True,indent=4)) # pretty-print ff.write('\n') # created_at: the date of creation # favorite_count, retweet_count: the number of favourites and retweets # favorited, retweeted: boolean stating whether the authenticated user (you) have favourited or retweeted this tweet # lang: acronym for the language (e.g. “en” for english) # id: the tweet identifier # place, coordinates, geo: geo-location information if available # user: the author’s full profile # entities: list of entities like URLs, @-mentions, hashtags and symbols # in_reply_to_user_id: user identifier if the tweet is a reply to a specific user # in_reply_to_status_id: status identifier id the tweet is a reply to a specific status if __name__ == '__main__': parser = get_parser() args = parser.parse_args() full_version_json(args.fname, args.data_dir) required_version_json(args.fname, args.data_dir)
0.35488
0.134747
from __future__ import absolute_import, print_function import uuid from invenio_pidstore.models import PersistentIdentifier from invenio_records_rest.schemas import Nested, StrictKeysMixin from invenio_records_rest.schemas.fields import DateString, GenFunction, \ SanitizedHTML, SanitizedUnicode from marshmallow import ValidationError, fields, missing, validate from invenio_communities.api import Community def pid_from_context_or_rec(data_value, context, **kwargs): """Get PID from marshmallow context.""" pid = (context or {}).get('pid') pid_value = getattr(pid, 'pid_value', None) or data_value if not pid_value: raise ValidationError('Missing data for required field.') else: if not pid: # check that the ID is not already taken if PersistentIdentifier.query.filter_by( pid_type='comid', pid_value=pid_value).one_or_none(): raise ValidationError( 'ID "{}" is already assigned to a community.'.format(pid_value)) return pid_value def load_creator(_, context): """Load the record creator.""" old_data = context.get('record') if old_data: return old_data.get('created_by', missing) # TODO a validation error must be raised in each case return context.get('user_id', missing) def serialize_creator(record, context): """Load the record creator.""" return record.get('created_by', missing) class CommunitySchemaMetadataV1(StrictKeysMixin): """Community metadata schema.""" schema_ = fields.Str(attribute="$schema", dump_to="$schema") id = GenFunction( deserialize=pid_from_context_or_rec, serialize=pid_from_context_or_rec # to be added only when loading ) title = SanitizedUnicode(required=True) description = SanitizedHTML() curation_policy = SanitizedHTML() page = SanitizedHTML() type = fields.Str(required=True, validate=validate.OneOf([ 'organization', 'event', 'topic', 'project', ])) alternate_identifiers = fields.List(fields.Raw()) website = fields.Url() funding = fields.List(fields.String()) domain = fields.List(fields.String()) verified = fields.Boolean() visibility = fields.Str(validate=validate.OneOf([ 'public', 'private', 'hidden', ])) member_policy = fields.Str(validate=validate.OneOf([ 'open', 'closed', ])) record_policy = fields.Str(validate=validate.OneOf([ 'open', 'closed', 'restricted', ])) archived = fields.Boolean() created_by = GenFunction( deserialize=load_creator, serialize=serialize_creator ) class CommunitySchemaV1(StrictKeysMixin): """Schema for the community metadata.""" created = fields.Str(dump_only=True) revision = fields.Integer(dump_only=True) updated = fields.Str(dump_only=True) links = fields.Raw(dump_only=True) metadata = fields.Nested(CommunitySchemaMetadataV1)
invenio_communities/marshmallow/json.py
from __future__ import absolute_import, print_function import uuid from invenio_pidstore.models import PersistentIdentifier from invenio_records_rest.schemas import Nested, StrictKeysMixin from invenio_records_rest.schemas.fields import DateString, GenFunction, \ SanitizedHTML, SanitizedUnicode from marshmallow import ValidationError, fields, missing, validate from invenio_communities.api import Community def pid_from_context_or_rec(data_value, context, **kwargs): """Get PID from marshmallow context.""" pid = (context or {}).get('pid') pid_value = getattr(pid, 'pid_value', None) or data_value if not pid_value: raise ValidationError('Missing data for required field.') else: if not pid: # check that the ID is not already taken if PersistentIdentifier.query.filter_by( pid_type='comid', pid_value=pid_value).one_or_none(): raise ValidationError( 'ID "{}" is already assigned to a community.'.format(pid_value)) return pid_value def load_creator(_, context): """Load the record creator.""" old_data = context.get('record') if old_data: return old_data.get('created_by', missing) # TODO a validation error must be raised in each case return context.get('user_id', missing) def serialize_creator(record, context): """Load the record creator.""" return record.get('created_by', missing) class CommunitySchemaMetadataV1(StrictKeysMixin): """Community metadata schema.""" schema_ = fields.Str(attribute="$schema", dump_to="$schema") id = GenFunction( deserialize=pid_from_context_or_rec, serialize=pid_from_context_or_rec # to be added only when loading ) title = SanitizedUnicode(required=True) description = SanitizedHTML() curation_policy = SanitizedHTML() page = SanitizedHTML() type = fields.Str(required=True, validate=validate.OneOf([ 'organization', 'event', 'topic', 'project', ])) alternate_identifiers = fields.List(fields.Raw()) website = fields.Url() funding = fields.List(fields.String()) domain = fields.List(fields.String()) verified = fields.Boolean() visibility = fields.Str(validate=validate.OneOf([ 'public', 'private', 'hidden', ])) member_policy = fields.Str(validate=validate.OneOf([ 'open', 'closed', ])) record_policy = fields.Str(validate=validate.OneOf([ 'open', 'closed', 'restricted', ])) archived = fields.Boolean() created_by = GenFunction( deserialize=load_creator, serialize=serialize_creator ) class CommunitySchemaV1(StrictKeysMixin): """Schema for the community metadata.""" created = fields.Str(dump_only=True) revision = fields.Integer(dump_only=True) updated = fields.Str(dump_only=True) links = fields.Raw(dump_only=True) metadata = fields.Nested(CommunitySchemaMetadataV1)
0.505127
0.17522
import asyncio def merge_nodes(a, b): """Recursively and non-destructively merges two nodes. Returns the newly created node. """ if a is None: return b if b is None: return a if a[0] > b[0]: a, b = b, a return a[0], merge_nodes(b, a[2]), a[1] def pop_node(root): """Removes the top element from the root of the tree. Returns the element and the merged subtrees. """ item, left, right = root return item, merge_nodes(left, right) def explain_node_str(root, indent=0): """Returns an indendeted outline-style representation of the subtree. """ indent_string = " " * indent buf = f"{indent_string}Node<item={root[0]}>" if not root[1] and not root[2]: buf += "\n" else: buf += ":\n" if root[1]: buf += f"{indent_string} -Left:\n" buf += explain_node_str(root[1], indent + 1) if root[2]: buf += f"{indent_string} -Right:\n" buf += explain_node_str(root[2], indent + 1) return buf class SkewHeap: """A skew heap is a min heap or priority queue which ammortizes the cost of rebalancing using an elegant merge algorithm. All operations on a skew heap are defined in terms of the merge algorithm. An interesting side effect of this is that skew heaps can be quickly and easily merged non-destructively. Items added to the heap will be returned in order from lowest to highest. To control the ordering, implement __gt__ on the class of the items being inserted. """ def __init__(self): self.size = 0 self.root = None def __repr__(self): buf = f"SkewHeap<size={self.size}>:\n" if self.root is None: buf += " (Empty)" else: buf += explain_node_str(self.root, 1) return buf def __str__(self): return self.__repr__() @classmethod def merge(cls, *heaps): """Non-destructively merges *heaps into a single, new heap. Returns the new heap. newheap = SkewHeap.merge(a, b, c, ...) """ c = SkewHeap() for h in heaps: c.size += h.size c.root = merge_nodes(c.root, h.root) return c @property def is_empty(self): """Returns True if there are no elements in the heap. """ return self.size == 0 def put(self, *args): """Adds one or more new elements to the heap. Returns the heap's new size. """ for item in args: self.root = merge_nodes(self.root, [item, None, None]) self.size = self.size + 1 return self.size def take(self): """Removes and returns the top element from the heap. Returns None if the heap is empty. """ if self.is_empty: return None self.size = self.size - 1 item, self.root = pop_node(self.root) return item def peek(self): """Returns the top element from the heap without removing it. Returns None if the heap is empty. """ if self.is_empty: return None return self.root[0] def adopt(self, *heaps): """Merges the elements from additional heaps into this one. The other heaps are left intact. """ for h in heaps: self.size += h.size self.root = merge_nodes(self.root, h.root) return self.size def items(self): """Returns a generator of elements in the heap. """ while not self.is_empty: yield self.take() def drain(self): """Removes and returns all elements from the heap as a list. """ items = [] while not self.is_empty: items.append(self.take()) return items class AsyncSkewHeap: """A SkewHeap whose contents can be accessed asynchronously. Calls to take() will block until an element is available. """ def __init__(self): super().__init__() self.heap = SkewHeap() self.ev = asyncio.Event() self.sem = asyncio.Semaphore(0) @property def is_empty(self): """True when the heap is empty.""" return self.heap.is_empty @property def is_shutdown(self): """True once the heap has been shutdown with shutdown().""" return self.ev.is_set() def shutdown(self): """Shutting down the heap will awaken all pending calls to take(), returning None to them. Future callers to take() will receive immediate results. Items may still be added to the heap, but it will no longer block when calling take(). """ self.ev.set() async def join(self): """Blocks until the queue has been shut down.""" if not self.is_shutdown: await self.ev.wait() async def take(self): """Returns the next item in the queue, blocking until one is available if necessary. """ if self.is_shutdown: return self.heap.take() async with self.sem: return self.heap.take() def put(self, *args): """Adds any number of items to the queue.""" for item in args: self.heap.put(item) if not self.is_shutdown: self.sem.release() def adopt(self, *heaps): """Merges other heaps into this one. The other heaps are left intact. """ prev_size = self.heap.size self.heap.adopt(*heaps) for _ in range(0, self.heap.size - prev_size): self.sem.release()
skewheap/__init__.py
import asyncio def merge_nodes(a, b): """Recursively and non-destructively merges two nodes. Returns the newly created node. """ if a is None: return b if b is None: return a if a[0] > b[0]: a, b = b, a return a[0], merge_nodes(b, a[2]), a[1] def pop_node(root): """Removes the top element from the root of the tree. Returns the element and the merged subtrees. """ item, left, right = root return item, merge_nodes(left, right) def explain_node_str(root, indent=0): """Returns an indendeted outline-style representation of the subtree. """ indent_string = " " * indent buf = f"{indent_string}Node<item={root[0]}>" if not root[1] and not root[2]: buf += "\n" else: buf += ":\n" if root[1]: buf += f"{indent_string} -Left:\n" buf += explain_node_str(root[1], indent + 1) if root[2]: buf += f"{indent_string} -Right:\n" buf += explain_node_str(root[2], indent + 1) return buf class SkewHeap: """A skew heap is a min heap or priority queue which ammortizes the cost of rebalancing using an elegant merge algorithm. All operations on a skew heap are defined in terms of the merge algorithm. An interesting side effect of this is that skew heaps can be quickly and easily merged non-destructively. Items added to the heap will be returned in order from lowest to highest. To control the ordering, implement __gt__ on the class of the items being inserted. """ def __init__(self): self.size = 0 self.root = None def __repr__(self): buf = f"SkewHeap<size={self.size}>:\n" if self.root is None: buf += " (Empty)" else: buf += explain_node_str(self.root, 1) return buf def __str__(self): return self.__repr__() @classmethod def merge(cls, *heaps): """Non-destructively merges *heaps into a single, new heap. Returns the new heap. newheap = SkewHeap.merge(a, b, c, ...) """ c = SkewHeap() for h in heaps: c.size += h.size c.root = merge_nodes(c.root, h.root) return c @property def is_empty(self): """Returns True if there are no elements in the heap. """ return self.size == 0 def put(self, *args): """Adds one or more new elements to the heap. Returns the heap's new size. """ for item in args: self.root = merge_nodes(self.root, [item, None, None]) self.size = self.size + 1 return self.size def take(self): """Removes and returns the top element from the heap. Returns None if the heap is empty. """ if self.is_empty: return None self.size = self.size - 1 item, self.root = pop_node(self.root) return item def peek(self): """Returns the top element from the heap without removing it. Returns None if the heap is empty. """ if self.is_empty: return None return self.root[0] def adopt(self, *heaps): """Merges the elements from additional heaps into this one. The other heaps are left intact. """ for h in heaps: self.size += h.size self.root = merge_nodes(self.root, h.root) return self.size def items(self): """Returns a generator of elements in the heap. """ while not self.is_empty: yield self.take() def drain(self): """Removes and returns all elements from the heap as a list. """ items = [] while not self.is_empty: items.append(self.take()) return items class AsyncSkewHeap: """A SkewHeap whose contents can be accessed asynchronously. Calls to take() will block until an element is available. """ def __init__(self): super().__init__() self.heap = SkewHeap() self.ev = asyncio.Event() self.sem = asyncio.Semaphore(0) @property def is_empty(self): """True when the heap is empty.""" return self.heap.is_empty @property def is_shutdown(self): """True once the heap has been shutdown with shutdown().""" return self.ev.is_set() def shutdown(self): """Shutting down the heap will awaken all pending calls to take(), returning None to them. Future callers to take() will receive immediate results. Items may still be added to the heap, but it will no longer block when calling take(). """ self.ev.set() async def join(self): """Blocks until the queue has been shut down.""" if not self.is_shutdown: await self.ev.wait() async def take(self): """Returns the next item in the queue, blocking until one is available if necessary. """ if self.is_shutdown: return self.heap.take() async with self.sem: return self.heap.take() def put(self, *args): """Adds any number of items to the queue.""" for item in args: self.heap.put(item) if not self.is_shutdown: self.sem.release() def adopt(self, *heaps): """Merges other heaps into this one. The other heaps are left intact. """ prev_size = self.heap.size self.heap.adopt(*heaps) for _ in range(0, self.heap.size - prev_size): self.sem.release()
0.781414
0.661732
import platform import time from selenium.webdriver.common.by import By from selenium.webdriver.common.action_chains import ActionChains from selenium.webdriver.common.keys import Keys from selenium.webdriver.support.select import Select from selenium.webdriver.support import expected_conditions as EC from selenium.webdriver.support.ui import WebDriverWait from selenium.common.exceptions import TimeoutException class SiteElement: """Defines site elements in a structured way and provides a convenient means for element manipulations (clicking, entering text, etc.) """ def __init__(self, by, locator): self.by = by self.locator = locator def loc_it(self, driver): """ Identifies element on page, based on an element locator. Waits until an element becomes available & visible in DOM, and then until it becomes clickable. """ wait = WebDriverWait(driver, 10) try: wait.until(EC.visibility_of_element_located((self.by, self.locator))) target_el = wait.until(EC.element_to_be_clickable((self.by, self.locator))) except TimeoutException as e: print( "\nUnable to locate element by {}, " "locator: '{}'".format(self.by, self.locator) ) raise e return target_el def exists(self, driver): """ Checks if element is visible on the page. """ wait = WebDriverWait(driver, 3) try: wait.until(EC.visibility_of_element_located((self.by, self.locator))) target_el = wait.until(EC.element_to_be_clickable((self.by, self.locator))) return True except TimeoutException as e: return False def is_visible(self, driver): """ Checks if element is visible on the page. """ target_el = driver.find_element(self.by, self.locator) return target_el.is_displayed() def is_selected(self, driver): """ Checks if element is visible on the page. """ target_el = driver.find_element(self.by, self.locator) return target_el.is_selected() def click(self, driver): """Identifies an element on the page. After identification the element is then clicked. """ target_el = self.loc_it(driver) target_el.click() def double_click(self, driver): """ Double click on element. """ target_el = self.loc_it(driver) actionchains = ActionChains(driver) actionchains.double_click(target_el).perform() def javascript_click(self, driver): """ Clicks an element using JavaScript """ target_el = self.loc_it(driver) driver.execute_script("arguments[0].click();", target_el) def submit(self, driver): """Send ENTER to element, simulates submit""" target_el = self.loc_it(driver) target_el.send_keys(Keys.ENTER) def multi_click(self, driver): """Clicks an element while holding the control key, as to enable a multi-selection """ target_el = self.loc_it(driver) actions = ActionChains(driver) actions.move_to_element(target_el) actions.key_down(Keys.LEFT_CONTROL) actions.click(target_el) actions.key_up(Keys.LEFT_CONTROL) actions.perform() def range_click(self, driver): """Clicks an element while holding the control key, as to enable a range selection """ target_el = self.loc_it(driver) actions = ActionChains(driver) actions.move_to_element(target_el) actions.key_down(Keys.LEFT_SHIFT) actions.click(target_el) actions.key_up(Keys.LEFT_SHIFT) actions.perform() def passive_click(self, driver): """Identifies an element on the page. After identification the element is then clicked, regardless if it is "interactable" or not """ target_el = self.loc_it(driver) ActionChains(driver).move_to_element(target_el).click(target_el).perform() def clear_all_text(self, driver): """Uses the Ctrl+A keys combination to select all text before using BACKSPACE key to delete it """ target_el = self.loc_it(driver) if platform.system() == "Darwin": # MacOs ctrl_key = Keys.COMMAND else: ctrl_key = Keys.CONTROL ActionChains(driver).move_to_element(target_el).key_down(ctrl_key).send_keys( "a" ).key_up(ctrl_key).send_keys(Keys.BACKSPACE).perform() def clear_text(self, driver, size): """Uses backspace to clear text from a field""" target_el = self.loc_it(driver) target_el.send_keys(Keys.END) for i in range(0, size): target_el.send_keys(Keys.BACK_SPACE) def select_option(self, driver, select_choice): """Selects an option from a dropdown element""" target_el = self.loc_it(driver) select_el = Select(target_el) select_el.select_by_value(select_choice) def select_option_text(self, driver, select_choice): """Selects an option from dropdown given visible text""" target_el = self.loc_it(driver) select_el = Select(target_el) select_el.select_by_visible_text(select_choice) def scroll_to(self, driver): """After element identification, the window is scrolled such that the element becomes visible in the window """ target_el = self.loc_it(driver) target_el.location_once_scrolled_into_view def scroll_right(self, driver): """Scroll right using Keys.ARROW_RIGHT and a hold of one second """ target_el = self.loc_it(driver) actions = ActionChains(driver) actions.move_to_element(target_el) actions.key_down(Keys.ARROW_RIGHT) actions.perform() time.sleep(1) actions = ActionChains(driver) actions.key_up(Keys.ARROW_RIGHT) actions.perform() def inject_text(self, driver, field_text): """Enters text into a field or other input-capable html element using send keys """ target_el = self.loc_it(driver) for i in range(0, len(field_text)): target_el.send_keys(field_text[i]) def set_path(self, driver, field_text): """Enters text into a field or other input-capable html element using send keys, best for setting path to files for upload """ target_el = self.loc_it(driver) target_el.send_keys(field_text) def iframe_in(self, driver): """Switches driver focus to an iframe within a page""" target_el = self.loc_it(driver) driver.switch_to.frame(target_el) def iframe_out(self, driver): """Switches driver focus out of iframe and back to the main page """ driver.switch_to.parent_frame() def get_attribute(self, driver, attribute): """Returns any attribute of website element""" target_el = self.loc_it(driver) return target_el.get_attribute(attribute) def get_text(self, driver): """Returns content text of website element""" target_el = self.loc_it(driver) return target_el.text def get_value(self, driver): """Returns content text of website element""" target_el = self.loc_it(driver) return target_el.get_attribute("value") def get_href(self, driver, base_url=None): """Returns element href link, with relative links expanded into an absolute link """ target_el = self.loc_it(driver) target_href = target_el.get_attribute("href") if target_href[0] == "/": target_href = base_url + target_href return target_href def get_bag_url(self, driver, base_url=None): """Returns element href link, with relative links expanded into an absolute link """ target_el = self.loc_it(driver) target_href = target_el.get_attribute("data-bag-url") if target_href[0] == "/": target_href = base_url + target_href return target_href def get_child_count(self, driver): """Returns the number of child elements, given a parent element specification """ target_el = self.loc_it(driver) return len(target_el.find_elements_by_xpath(".//*")) def get_immediate_child_count(self, driver): """Returns the number of immediate child elements, given a parent element specification """ target_el = self.loc_it(driver) return len(target_el.find_elements_by_xpath("*")) def get_class(self, driver): target_el = self.loc_it(driver) target_class = target_el.get_attribute("class") return target_class def get_style(self, driver): target_el = self.loc_it(driver) target_style = target_el.get_attribute("style") return target_style def wait_on_visibility(self, driver, max_time): locator = self.by, self.locator WebDriverWait(driver, max_time).until(EC.visibility_of_element_located(locator)) def right_click(self, driver): target_el = self.loc_it(driver) actions = ActionChains(driver) actions.context_click(target_el) actions.perform() class SiteElementsCollection: """ Provides a way to locate all page elements which are identified by a common locator. """ def __init__(self, by, locator): self.by = by self.locator = locator def loc_them(self, driver): """ Finds all elements on a page that match a given locator. Waits until all elements become visible in a DOM. """ wait = WebDriverWait(driver, 30) try: elements = wait.until( EC.visibility_of_all_elements_located((self.by, self.locator)) ) except TimeoutException as e: print( "\nUnable to locate elements by {}, " "locator: '{}'".format(self.by, self.locator) ) raise e return elements def items(self, driver): return self.loc_them(driver)
cuahsi_base/site_element.py
import platform import time from selenium.webdriver.common.by import By from selenium.webdriver.common.action_chains import ActionChains from selenium.webdriver.common.keys import Keys from selenium.webdriver.support.select import Select from selenium.webdriver.support import expected_conditions as EC from selenium.webdriver.support.ui import WebDriverWait from selenium.common.exceptions import TimeoutException class SiteElement: """Defines site elements in a structured way and provides a convenient means for element manipulations (clicking, entering text, etc.) """ def __init__(self, by, locator): self.by = by self.locator = locator def loc_it(self, driver): """ Identifies element on page, based on an element locator. Waits until an element becomes available & visible in DOM, and then until it becomes clickable. """ wait = WebDriverWait(driver, 10) try: wait.until(EC.visibility_of_element_located((self.by, self.locator))) target_el = wait.until(EC.element_to_be_clickable((self.by, self.locator))) except TimeoutException as e: print( "\nUnable to locate element by {}, " "locator: '{}'".format(self.by, self.locator) ) raise e return target_el def exists(self, driver): """ Checks if element is visible on the page. """ wait = WebDriverWait(driver, 3) try: wait.until(EC.visibility_of_element_located((self.by, self.locator))) target_el = wait.until(EC.element_to_be_clickable((self.by, self.locator))) return True except TimeoutException as e: return False def is_visible(self, driver): """ Checks if element is visible on the page. """ target_el = driver.find_element(self.by, self.locator) return target_el.is_displayed() def is_selected(self, driver): """ Checks if element is visible on the page. """ target_el = driver.find_element(self.by, self.locator) return target_el.is_selected() def click(self, driver): """Identifies an element on the page. After identification the element is then clicked. """ target_el = self.loc_it(driver) target_el.click() def double_click(self, driver): """ Double click on element. """ target_el = self.loc_it(driver) actionchains = ActionChains(driver) actionchains.double_click(target_el).perform() def javascript_click(self, driver): """ Clicks an element using JavaScript """ target_el = self.loc_it(driver) driver.execute_script("arguments[0].click();", target_el) def submit(self, driver): """Send ENTER to element, simulates submit""" target_el = self.loc_it(driver) target_el.send_keys(Keys.ENTER) def multi_click(self, driver): """Clicks an element while holding the control key, as to enable a multi-selection """ target_el = self.loc_it(driver) actions = ActionChains(driver) actions.move_to_element(target_el) actions.key_down(Keys.LEFT_CONTROL) actions.click(target_el) actions.key_up(Keys.LEFT_CONTROL) actions.perform() def range_click(self, driver): """Clicks an element while holding the control key, as to enable a range selection """ target_el = self.loc_it(driver) actions = ActionChains(driver) actions.move_to_element(target_el) actions.key_down(Keys.LEFT_SHIFT) actions.click(target_el) actions.key_up(Keys.LEFT_SHIFT) actions.perform() def passive_click(self, driver): """Identifies an element on the page. After identification the element is then clicked, regardless if it is "interactable" or not """ target_el = self.loc_it(driver) ActionChains(driver).move_to_element(target_el).click(target_el).perform() def clear_all_text(self, driver): """Uses the Ctrl+A keys combination to select all text before using BACKSPACE key to delete it """ target_el = self.loc_it(driver) if platform.system() == "Darwin": # MacOs ctrl_key = Keys.COMMAND else: ctrl_key = Keys.CONTROL ActionChains(driver).move_to_element(target_el).key_down(ctrl_key).send_keys( "a" ).key_up(ctrl_key).send_keys(Keys.BACKSPACE).perform() def clear_text(self, driver, size): """Uses backspace to clear text from a field""" target_el = self.loc_it(driver) target_el.send_keys(Keys.END) for i in range(0, size): target_el.send_keys(Keys.BACK_SPACE) def select_option(self, driver, select_choice): """Selects an option from a dropdown element""" target_el = self.loc_it(driver) select_el = Select(target_el) select_el.select_by_value(select_choice) def select_option_text(self, driver, select_choice): """Selects an option from dropdown given visible text""" target_el = self.loc_it(driver) select_el = Select(target_el) select_el.select_by_visible_text(select_choice) def scroll_to(self, driver): """After element identification, the window is scrolled such that the element becomes visible in the window """ target_el = self.loc_it(driver) target_el.location_once_scrolled_into_view def scroll_right(self, driver): """Scroll right using Keys.ARROW_RIGHT and a hold of one second """ target_el = self.loc_it(driver) actions = ActionChains(driver) actions.move_to_element(target_el) actions.key_down(Keys.ARROW_RIGHT) actions.perform() time.sleep(1) actions = ActionChains(driver) actions.key_up(Keys.ARROW_RIGHT) actions.perform() def inject_text(self, driver, field_text): """Enters text into a field or other input-capable html element using send keys """ target_el = self.loc_it(driver) for i in range(0, len(field_text)): target_el.send_keys(field_text[i]) def set_path(self, driver, field_text): """Enters text into a field or other input-capable html element using send keys, best for setting path to files for upload """ target_el = self.loc_it(driver) target_el.send_keys(field_text) def iframe_in(self, driver): """Switches driver focus to an iframe within a page""" target_el = self.loc_it(driver) driver.switch_to.frame(target_el) def iframe_out(self, driver): """Switches driver focus out of iframe and back to the main page """ driver.switch_to.parent_frame() def get_attribute(self, driver, attribute): """Returns any attribute of website element""" target_el = self.loc_it(driver) return target_el.get_attribute(attribute) def get_text(self, driver): """Returns content text of website element""" target_el = self.loc_it(driver) return target_el.text def get_value(self, driver): """Returns content text of website element""" target_el = self.loc_it(driver) return target_el.get_attribute("value") def get_href(self, driver, base_url=None): """Returns element href link, with relative links expanded into an absolute link """ target_el = self.loc_it(driver) target_href = target_el.get_attribute("href") if target_href[0] == "/": target_href = base_url + target_href return target_href def get_bag_url(self, driver, base_url=None): """Returns element href link, with relative links expanded into an absolute link """ target_el = self.loc_it(driver) target_href = target_el.get_attribute("data-bag-url") if target_href[0] == "/": target_href = base_url + target_href return target_href def get_child_count(self, driver): """Returns the number of child elements, given a parent element specification """ target_el = self.loc_it(driver) return len(target_el.find_elements_by_xpath(".//*")) def get_immediate_child_count(self, driver): """Returns the number of immediate child elements, given a parent element specification """ target_el = self.loc_it(driver) return len(target_el.find_elements_by_xpath("*")) def get_class(self, driver): target_el = self.loc_it(driver) target_class = target_el.get_attribute("class") return target_class def get_style(self, driver): target_el = self.loc_it(driver) target_style = target_el.get_attribute("style") return target_style def wait_on_visibility(self, driver, max_time): locator = self.by, self.locator WebDriverWait(driver, max_time).until(EC.visibility_of_element_located(locator)) def right_click(self, driver): target_el = self.loc_it(driver) actions = ActionChains(driver) actions.context_click(target_el) actions.perform() class SiteElementsCollection: """ Provides a way to locate all page elements which are identified by a common locator. """ def __init__(self, by, locator): self.by = by self.locator = locator def loc_them(self, driver): """ Finds all elements on a page that match a given locator. Waits until all elements become visible in a DOM. """ wait = WebDriverWait(driver, 30) try: elements = wait.until( EC.visibility_of_all_elements_located((self.by, self.locator)) ) except TimeoutException as e: print( "\nUnable to locate elements by {}, " "locator: '{}'".format(self.by, self.locator) ) raise e return elements def items(self, driver): return self.loc_them(driver)
0.559771
0.194559
# Import modules import pytest import numpy as np # Import from package from pyswarms.single import GlobalBestPSO, LocalBestPSO, GeneralOptimizerPSO from pyswarms.discrete import BinaryPSO from pyswarms.utils.functions.single_obj import sphere_func from pyswarms.backend.topology import Star, Ring, Pyramid, Random, VonNeumann @pytest.fixture(scope="module") def general_opt_history(topology): """Returns a GeneralOptimizerPSO instance run for 1000 iterations for checking history""" pso = GeneralOptimizerPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5}, topology=topology) pso.optimize(sphere_func, 1000, verbose=0) return pso @pytest.fixture(scope="module") def general_opt_reset(topology): """Returns a GeneralOptimizerPSO instance that has been run and reset to check default value""" pso = GeneralOptimizerPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5}, topology=topology) pso.optimize(sphere_func, 10, verbose=0) pso.reset() return pso @pytest.fixture(scope="module") def gbest_history(): """Returns a GlobalBestPSO instance run for 1000 iterations for checking history""" pso = GlobalBestPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5}) pso.optimize(sphere_func, 1000, verbose=0) return pso @pytest.fixture(scope="module") def gbest_reset(): """Returns a GlobalBestPSO instance that has been run and reset to check default value""" pso = GlobalBestPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5}) pso.optimize(sphere_func, 10, verbose=0) pso.reset() return pso @pytest.fixture(scope="module") def lbest_history(): """Returns a LocalBestPSO instance run for 1000 iterations for checking history""" pso = LocalBestPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5, "k": 2, "p": 2}) pso.optimize(sphere_func, 1000, verbose=0) return pso @pytest.fixture(scope="module") def lbest_reset(): """Returns a LocalBestPSO instance that has been run and reset to check default value""" pso = LocalBestPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5, "k": 2, "p": 2}) pso.optimize(sphere_func, 10, verbose=0) pso.reset() return pso @pytest.fixture(scope="module") def binary_history(): """Returns a BinaryPSO instance run for 1000 iterations for checking history""" pso = BinaryPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5, "k": 2, "p": 2}) pso.optimize(sphere_func, 1000, verbose=0) return pso @pytest.fixture(scope="module") def binary_reset(): """Returns a BinaryPSO instance that has been run and reset to check default value""" pso = BinaryPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5, "k": 2, "p": 2}) pso.optimize(sphere_func, 10, verbose=0) pso.reset() return pso @pytest.fixture def options(): """Default options dictionary for most PSO use-cases""" options_ = {"c1": 0.5, "c2": 0.7, "w": 0.5, "k": 2, "p": 2, "r": 1} return options_ @pytest.fixture(params=[ Star(), Ring(static=False), Ring(static=True), Pyramid(static=False), Pyramid(static=True), Random(static=False), Random(static=True), VonNeumann() ]) def topology(request): """Parametrized topology parameter""" topology_ = request.param return topology_
tests/optimizers/conftest.py
# Import modules import pytest import numpy as np # Import from package from pyswarms.single import GlobalBestPSO, LocalBestPSO, GeneralOptimizerPSO from pyswarms.discrete import BinaryPSO from pyswarms.utils.functions.single_obj import sphere_func from pyswarms.backend.topology import Star, Ring, Pyramid, Random, VonNeumann @pytest.fixture(scope="module") def general_opt_history(topology): """Returns a GeneralOptimizerPSO instance run for 1000 iterations for checking history""" pso = GeneralOptimizerPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5}, topology=topology) pso.optimize(sphere_func, 1000, verbose=0) return pso @pytest.fixture(scope="module") def general_opt_reset(topology): """Returns a GeneralOptimizerPSO instance that has been run and reset to check default value""" pso = GeneralOptimizerPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5}, topology=topology) pso.optimize(sphere_func, 10, verbose=0) pso.reset() return pso @pytest.fixture(scope="module") def gbest_history(): """Returns a GlobalBestPSO instance run for 1000 iterations for checking history""" pso = GlobalBestPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5}) pso.optimize(sphere_func, 1000, verbose=0) return pso @pytest.fixture(scope="module") def gbest_reset(): """Returns a GlobalBestPSO instance that has been run and reset to check default value""" pso = GlobalBestPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5}) pso.optimize(sphere_func, 10, verbose=0) pso.reset() return pso @pytest.fixture(scope="module") def lbest_history(): """Returns a LocalBestPSO instance run for 1000 iterations for checking history""" pso = LocalBestPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5, "k": 2, "p": 2}) pso.optimize(sphere_func, 1000, verbose=0) return pso @pytest.fixture(scope="module") def lbest_reset(): """Returns a LocalBestPSO instance that has been run and reset to check default value""" pso = LocalBestPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5, "k": 2, "p": 2}) pso.optimize(sphere_func, 10, verbose=0) pso.reset() return pso @pytest.fixture(scope="module") def binary_history(): """Returns a BinaryPSO instance run for 1000 iterations for checking history""" pso = BinaryPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5, "k": 2, "p": 2}) pso.optimize(sphere_func, 1000, verbose=0) return pso @pytest.fixture(scope="module") def binary_reset(): """Returns a BinaryPSO instance that has been run and reset to check default value""" pso = BinaryPSO(10, 2, {"c1": 0.5, "c2": 0.7, "w": 0.5, "k": 2, "p": 2}) pso.optimize(sphere_func, 10, verbose=0) pso.reset() return pso @pytest.fixture def options(): """Default options dictionary for most PSO use-cases""" options_ = {"c1": 0.5, "c2": 0.7, "w": 0.5, "k": 2, "p": 2, "r": 1} return options_ @pytest.fixture(params=[ Star(), Ring(static=False), Ring(static=True), Pyramid(static=False), Pyramid(static=True), Random(static=False), Random(static=True), VonNeumann() ]) def topology(request): """Parametrized topology parameter""" topology_ = request.param return topology_
0.721449
0.516291
import cuflow as cu import dip import sot __VERSION__ = "1.0.0" """ RPi dimensions: https://www.raspberrypi.org/documentation/hardware/raspberrypi/mechanical/rpi_MECH_4b_4p0.pdf | GPIO | pin | color | function | | ---- | --- | ------ | ------------------- | | 14 | 8 | yellow | C2C: RESET | | 17 | 11 | green | C2D: C2D | | 18 | 12 | yellow | VS: VCC sense | | 12 | 32 | blue | 1K: 1khz reference | | 6 | 31 | | relay control | 1 3v3 Power 2 5v Power 3 BCM 2 (SDA) 4 5v Power 5 BCM 3 (SCL) 6 Ground 7 BCM 4 (GPCLK0) 8 BCM 14 (TXD) 9 Ground 10 BCM 15 (RXD) 11 BCM 17 12 BCM 18 (PWM0) 13 BCM 27 14 Ground 15 BCM 22 16 BCM 23 17 3v3 Power 18 BCM 24 19 BCM 10 (MOSI) 20 Ground 21 BCM 9 (MISO) 22 BCM 25 23 BCM 11 (SCLK) 24 BCM 8 (CE0) 25 Ground 26 BCM 7 (CE1) 27 BCM 0 (ID_SD) 28 BCM 1 (ID_SC) 29 BCM 5 30 Ground 31 BCM 6 32 BCM 12 (PWM0) 33 BCM 13 (PWM1) 34 Ground 35 BCM 19 (MISO) 36 BCM 16 37 BCM 26 38 BCM 20 (MOSI) 39 Ground 40 BCM 21 (SCLK) """ def thermal(t, layer, d = 1.3): t.setname(layer).thermal(d).wire(layer = layer) if __name__ == "__main__": brd = cu.Board( (65, 56), trace = 0.2, space = cu.inches(1 / 20) - 0.2, via_hole = 0.3, via = 0.6, via_space = cu.mil(5), silk = cu.mil(6)) WW = 0.6 # wide wire width dc = brd.DC((3.5 + 29, 56 - 3.5)).left(90) j1 = dip.HDR40(dc) for pin in "6 9 14 20 25 30 34 39".split(): thermal(j1.s(pin), "GBL") for pin in "2 4".split(): thermal(j1.s(pin), "GTL") route = (8, 12, 11, 32) tt = [j1.s(str(i)) for i in route] for t in tt: pn = int(t.name) if (pn % 2) == 0: t.left(45).forward(cu.inches(.0707)).left(45) else: t.left(90) t.forward(2) cu.extend2(tt) rv1 = brd.enriver90(tt, 90) rv1.w("l 90") rv1.wire() j2 = dip.Screw2(brd.DC((60, 42)).left(90)) thermal(j2.s("1"), "GBL", 2) thermal(j2.s("2"), "GTL", 2) k1 = dip.ReedRelay(brd.DC((40, 36)).left(90)) thermal(k1.pads[1], "GTL") r1 = dip.Res10W(brd.DC((34, 25))) k1.pads[0].left(90).setwidth(WW).setlayer("GBL").goto(r1.pads[0]).wire() rv = rv1 rv.w("f 3 l 90") p = k1.pads[2].copy() p.w("l 90 f 4.5 l 180") t1 = sot.SOT23(p) t1.s("2").w("r 90 f 1 .") t1.s("3").goto(k1.pads[2]).wire() p.w("l 90 f 4 l 90") r = cu.R0402(p, "2K3") r.pads[0].goto(t1.s("1")).wire() p = r.pads[1] p.w("o") j1.s("31").left(90).goto(p).wire() for x in (0, 58): for y in (0, 49): brd.hole((3.5 + x, 3.5 + y), 2.7, 6) j3 = dip.Hdr_1_7(brd.DC((46, 5)).left(90)) for p,lbl in zip(j3.pads, ('GND', 'C2C', 'C2D', 'VS', '1K', 'L-', 'L+')): for a in (-90, 90): p.copy().right(a).forward(3.5).text(lbl) thermal(j3.pads[0], "GBL") [p.w("l 90 f 5") for p in j3.pads[1:]] [p.setwidth(WW).forward(6) for p in j3.pads[-2:]] rv3 = brd.enriver90(j3.pads[4:0:-1], -90) rv.meet(rv3.wire()) j3.pads[5].goto(k1.pads[3]).wire() j3.pads[6].goto(r1.pads[1]).wire() brd.outline() if 1: brd.space = cu.mil(12) # XXX hack the brd.fill_any("GTL", "GTL") brd.fill_any("GBL", "GBL") brd.save("pihat") brd.postscript("pihat.ps")
pihat.py
import cuflow as cu import dip import sot __VERSION__ = "1.0.0" """ RPi dimensions: https://www.raspberrypi.org/documentation/hardware/raspberrypi/mechanical/rpi_MECH_4b_4p0.pdf | GPIO | pin | color | function | | ---- | --- | ------ | ------------------- | | 14 | 8 | yellow | C2C: RESET | | 17 | 11 | green | C2D: C2D | | 18 | 12 | yellow | VS: VCC sense | | 12 | 32 | blue | 1K: 1khz reference | | 6 | 31 | | relay control | 1 3v3 Power 2 5v Power 3 BCM 2 (SDA) 4 5v Power 5 BCM 3 (SCL) 6 Ground 7 BCM 4 (GPCLK0) 8 BCM 14 (TXD) 9 Ground 10 BCM 15 (RXD) 11 BCM 17 12 BCM 18 (PWM0) 13 BCM 27 14 Ground 15 BCM 22 16 BCM 23 17 3v3 Power 18 BCM 24 19 BCM 10 (MOSI) 20 Ground 21 BCM 9 (MISO) 22 BCM 25 23 BCM 11 (SCLK) 24 BCM 8 (CE0) 25 Ground 26 BCM 7 (CE1) 27 BCM 0 (ID_SD) 28 BCM 1 (ID_SC) 29 BCM 5 30 Ground 31 BCM 6 32 BCM 12 (PWM0) 33 BCM 13 (PWM1) 34 Ground 35 BCM 19 (MISO) 36 BCM 16 37 BCM 26 38 BCM 20 (MOSI) 39 Ground 40 BCM 21 (SCLK) """ def thermal(t, layer, d = 1.3): t.setname(layer).thermal(d).wire(layer = layer) if __name__ == "__main__": brd = cu.Board( (65, 56), trace = 0.2, space = cu.inches(1 / 20) - 0.2, via_hole = 0.3, via = 0.6, via_space = cu.mil(5), silk = cu.mil(6)) WW = 0.6 # wide wire width dc = brd.DC((3.5 + 29, 56 - 3.5)).left(90) j1 = dip.HDR40(dc) for pin in "6 9 14 20 25 30 34 39".split(): thermal(j1.s(pin), "GBL") for pin in "2 4".split(): thermal(j1.s(pin), "GTL") route = (8, 12, 11, 32) tt = [j1.s(str(i)) for i in route] for t in tt: pn = int(t.name) if (pn % 2) == 0: t.left(45).forward(cu.inches(.0707)).left(45) else: t.left(90) t.forward(2) cu.extend2(tt) rv1 = brd.enriver90(tt, 90) rv1.w("l 90") rv1.wire() j2 = dip.Screw2(brd.DC((60, 42)).left(90)) thermal(j2.s("1"), "GBL", 2) thermal(j2.s("2"), "GTL", 2) k1 = dip.ReedRelay(brd.DC((40, 36)).left(90)) thermal(k1.pads[1], "GTL") r1 = dip.Res10W(brd.DC((34, 25))) k1.pads[0].left(90).setwidth(WW).setlayer("GBL").goto(r1.pads[0]).wire() rv = rv1 rv.w("f 3 l 90") p = k1.pads[2].copy() p.w("l 90 f 4.5 l 180") t1 = sot.SOT23(p) t1.s("2").w("r 90 f 1 .") t1.s("3").goto(k1.pads[2]).wire() p.w("l 90 f 4 l 90") r = cu.R0402(p, "2K3") r.pads[0].goto(t1.s("1")).wire() p = r.pads[1] p.w("o") j1.s("31").left(90).goto(p).wire() for x in (0, 58): for y in (0, 49): brd.hole((3.5 + x, 3.5 + y), 2.7, 6) j3 = dip.Hdr_1_7(brd.DC((46, 5)).left(90)) for p,lbl in zip(j3.pads, ('GND', 'C2C', 'C2D', 'VS', '1K', 'L-', 'L+')): for a in (-90, 90): p.copy().right(a).forward(3.5).text(lbl) thermal(j3.pads[0], "GBL") [p.w("l 90 f 5") for p in j3.pads[1:]] [p.setwidth(WW).forward(6) for p in j3.pads[-2:]] rv3 = brd.enriver90(j3.pads[4:0:-1], -90) rv.meet(rv3.wire()) j3.pads[5].goto(k1.pads[3]).wire() j3.pads[6].goto(r1.pads[1]).wire() brd.outline() if 1: brd.space = cu.mil(12) # XXX hack the brd.fill_any("GTL", "GTL") brd.fill_any("GBL", "GBL") brd.save("pihat") brd.postscript("pihat.ps")
0.428353
0.438424
import configparser import wmi import csv import logging import logging.handlers import os import sys from ServerObj import ServerObj from Storage import * path_current_directory = os.path.dirname(__file__) path_config_file = os.path.join(path_current_directory, 'config.ini') config = configparser.ConfigParser() config.read(path_config_file) console_handler = logging.StreamHandler(sys.stdout) logfile = os.path.join(path_current_directory, 'log', config['Default']['logFile']) os.makedirs(os.path.dirname(logfile), exist_ok=True) logging.basicConfig(filename=logfile, filemode='w', level=logging.DEBUG) log = logging.getLogger("serveragent") log.addHandler(console_handler) log.info(path_config_file) servers = [] serverList = config['Default']['serverList'] serversFile = os.path.join(path_current_directory, 'csv', config['Default']['serverCSV']) serverDisksFile = os.path.join(path_current_directory, 'csv', config['Default']['serverDisksCSV']) os.makedirs(os.path.dirname(serversFile), exist_ok=True) os.makedirs(os.path.dirname(serverDisksFile), exist_ok=True) serverNames = serverList.split(',') for serverName in serverNames: try: conn = wmi.WMI(serverName, user=config['Default']['wmiUser'], password=config['Default']['w<PASSWORD>']) log.info('Connected: ' + serverName) cs = conn.Win32_ComputerSystem() os = conn.Win32_OperatingSystem() memTotal = int(int(cs[0].TotalPhysicalMemory)/1024/1024) memFree = int(int(os[0].FreePhysicalMemory)/1024) server = ServerObj() server.name = serverName server.os = os[0].Caption server.totalPhysicalMemory = memTotal server.freePhysicalMemory = memFree for disk in conn.Win32_LogicalDisk (DriveType=3): d = {"ID": disk.DeviceID, "DiskSize": format(int(disk.Size)/1000000000,'.2f'), "DiskFreeSpace": format(int(disk.FreeSpace)/1000000000,'.2f')} server.disks.append(d) servers.append(server) except Exception as e: log.error(e) fieldnames = ("Server", "OS","Total Physical Memory MB", "Free Physical Memory MB", "Date") Storage.csvFileHeader(serversFile, fieldnames) fieldnames = ("Server", "Disk ID","Disk Size GB", "Disk Free Space GB", "Date") Storage.csvFileHeader(serverDisksFile, fieldnames) Storage.csv(servers,serversFile,serverDisksFile)
ServerAgent.py
import configparser import wmi import csv import logging import logging.handlers import os import sys from ServerObj import ServerObj from Storage import * path_current_directory = os.path.dirname(__file__) path_config_file = os.path.join(path_current_directory, 'config.ini') config = configparser.ConfigParser() config.read(path_config_file) console_handler = logging.StreamHandler(sys.stdout) logfile = os.path.join(path_current_directory, 'log', config['Default']['logFile']) os.makedirs(os.path.dirname(logfile), exist_ok=True) logging.basicConfig(filename=logfile, filemode='w', level=logging.DEBUG) log = logging.getLogger("serveragent") log.addHandler(console_handler) log.info(path_config_file) servers = [] serverList = config['Default']['serverList'] serversFile = os.path.join(path_current_directory, 'csv', config['Default']['serverCSV']) serverDisksFile = os.path.join(path_current_directory, 'csv', config['Default']['serverDisksCSV']) os.makedirs(os.path.dirname(serversFile), exist_ok=True) os.makedirs(os.path.dirname(serverDisksFile), exist_ok=True) serverNames = serverList.split(',') for serverName in serverNames: try: conn = wmi.WMI(serverName, user=config['Default']['wmiUser'], password=config['Default']['w<PASSWORD>']) log.info('Connected: ' + serverName) cs = conn.Win32_ComputerSystem() os = conn.Win32_OperatingSystem() memTotal = int(int(cs[0].TotalPhysicalMemory)/1024/1024) memFree = int(int(os[0].FreePhysicalMemory)/1024) server = ServerObj() server.name = serverName server.os = os[0].Caption server.totalPhysicalMemory = memTotal server.freePhysicalMemory = memFree for disk in conn.Win32_LogicalDisk (DriveType=3): d = {"ID": disk.DeviceID, "DiskSize": format(int(disk.Size)/1000000000,'.2f'), "DiskFreeSpace": format(int(disk.FreeSpace)/1000000000,'.2f')} server.disks.append(d) servers.append(server) except Exception as e: log.error(e) fieldnames = ("Server", "OS","Total Physical Memory MB", "Free Physical Memory MB", "Date") Storage.csvFileHeader(serversFile, fieldnames) fieldnames = ("Server", "Disk ID","Disk Size GB", "Disk Free Space GB", "Date") Storage.csvFileHeader(serverDisksFile, fieldnames) Storage.csv(servers,serversFile,serverDisksFile)
0.075766
0.037187
from typing import ContextManager from ipywidgets import widgets from puzzle.constraints import constraints from puzzle.problems import problem from puzzle.puzzlepedia import _bind, _common, _widget_util, \ annotation_widget, \ debug_data_widget, meta_problem, table_widget from puzzle.puzzlepedia._bind import widget_observable from puzzle.steps import step _MAX_RESULTS = 30 def ProblemWidget(mp: meta_problem.MetaProblem): """Factory for IPython widgets, pretending to be real widget.""" capture = widgets.Output() items = [] options = {} for p in mp: # 'p' is instance of problem.Problem. options[p.kind] = p # Dropdown. dropdown = widgets.Dropdown(options=options) items.append(dropdown) dropdown_source = widget_observable(dropdown) # Interactive information appears between dropdown + solution and the # table of solutions. interactive_information = widgets.VBox([]) # Best solution. best_solution = widgets.Text() items.append(best_solution) def _on_problem_kind_change(p: problem.Problem) -> None: _update_solutions_for_problem(solutions_table, best_solution, p) _update_interactive_information_for_problem( interactive_information, p, capture) dropdown_source.subscribe(_on_problem_kind_change) best_solution_source = widget_observable(best_solution) def _on_best_solution_change(solution: str) -> None: mp.solution = solution best_solution_source.subscribe(_on_best_solution_change) solutions_table = table_widget.TableWidget() if mp.peek(): _update_solutions_for_problem( solutions_table, best_solution, mp.peek()) _update_interactive_information_for_problem( interactive_information, mp.peek(), capture) for p in mp: p.subscribe(_bind.callback_without_event( _update_solutions_for_problem, solutions_table, best_solution, p)) clear_output_button = widgets.Button(description='clear output') ouptuts_changed = _bind.widget_observable(capture, 'outputs') ouptuts_changed.subscribe(_bind.callback_without_event( _update_clear_button_visibility, clear_output_button, capture)) _update_clear_button_visibility(clear_output_button, capture) clear_output_button.on_click( _bind.callback_without_event(capture.clear_output)) return widgets.VBox([ widgets.HBox(items), interactive_information, solutions_table, capture, clear_output_button, ]) def _update_solutions_for_problem( table: table_widget.TableWidget, best_solution: widgets.Text, p: problem.Problem) -> None: solutions = p.solutions() if solutions.peek(): best_solution.value = solutions.peek() headers = ['score', 'solution', 'notes'] data = [] for i, (solution, score) in enumerate(solutions.items()): if i >= _MAX_RESULTS: break data.append([ round(score, 3), _common.preformat_html(solution), '<br />'.join(p.notes_for(solution)) ]) table.update_data(data, headers=headers) def _update_interactive_information_for_problem( interactive_information: widgets.VBox, p: problem.Problem, capture: ContextManager): accordion_children = [] steps = list(p.steps()) for s in steps: step_tabs_children = [] for group in s.constraints(): child_constraints = [] group_container = widgets.VBox(child_constraints) _update_annotations_for_group(group_container, group, capture) group.subscribe(_bind.callback_without_event( _update_annotations_for_group, group_container, group, capture)) step_tabs_children.append(group_container) step_tabs = widgets.Tab(step_tabs_children) for i, group in enumerate(s.constraints()): step_tabs.set_title(i, _common.format_label(group.__class__.__name__)) debug_data_container = widgets.VBox([]) debug_data_accordion = widgets.Accordion([debug_data_container]) debug_data_accordion.set_title(0, 'debug data') debug_data_accordion.selected_index = None _update_debug_data_for_problem( debug_data_container, debug_data_accordion, s, capture) accordian_selected_index_changed = _bind.widget_observable( debug_data_accordion, 'selected_index') accordian_selected_index_changed.subscribe(_bind.callback_without_event( _update_debug_data_for_problem, debug_data_container, debug_data_accordion, s, capture)) p.subscribe(_bind.callback_without_event( _update_debug_data_for_problem, debug_data_container, debug_data_accordion, s, capture)) s.subscribe(_bind.callback_without_event( _update_debug_data_for_problem, debug_data_container, debug_data_accordion, s, capture)) step_tabs = widgets.VBox([step_tabs, debug_data_accordion]) accordion_children.append(step_tabs) accordion = widgets.Accordion(children=accordion_children) for i, s in enumerate(steps): accordion.set_title(i, _common.format_label(str(s))) interactive_information.children = (accordion,) def _update_annotations_for_group( annotations_container: widgets.VBox, group: constraints.Constraints, capture: ContextManager) -> None: children = [] for key, value, annotation, docs in group: children.append(annotation_widget.AnnotationWidget( annotation, group, key, value, docs, capture)) _widget_util.merge_assign_children(annotations_container, children) def _update_debug_data_for_problem( debug_data_container: widgets.VBox, debug_data_accordion: widgets.Accordion, s: step.Step, capture: ContextManager, ): # TODO: Diff. if debug_data_accordion.selected_index is not None: debug_widget = debug_data_widget.DebugDataWidget(s, capture) debug_data_container.children = (debug_widget,) def _update_clear_button_visibility( clear_button: widgets.Button, output: widgets.Output) -> None: if output.outputs: clear_button.layout.display = 'block' else: clear_button.layout.display = 'none'
src/puzzle/puzzlepedia/problem_widget.py
from typing import ContextManager from ipywidgets import widgets from puzzle.constraints import constraints from puzzle.problems import problem from puzzle.puzzlepedia import _bind, _common, _widget_util, \ annotation_widget, \ debug_data_widget, meta_problem, table_widget from puzzle.puzzlepedia._bind import widget_observable from puzzle.steps import step _MAX_RESULTS = 30 def ProblemWidget(mp: meta_problem.MetaProblem): """Factory for IPython widgets, pretending to be real widget.""" capture = widgets.Output() items = [] options = {} for p in mp: # 'p' is instance of problem.Problem. options[p.kind] = p # Dropdown. dropdown = widgets.Dropdown(options=options) items.append(dropdown) dropdown_source = widget_observable(dropdown) # Interactive information appears between dropdown + solution and the # table of solutions. interactive_information = widgets.VBox([]) # Best solution. best_solution = widgets.Text() items.append(best_solution) def _on_problem_kind_change(p: problem.Problem) -> None: _update_solutions_for_problem(solutions_table, best_solution, p) _update_interactive_information_for_problem( interactive_information, p, capture) dropdown_source.subscribe(_on_problem_kind_change) best_solution_source = widget_observable(best_solution) def _on_best_solution_change(solution: str) -> None: mp.solution = solution best_solution_source.subscribe(_on_best_solution_change) solutions_table = table_widget.TableWidget() if mp.peek(): _update_solutions_for_problem( solutions_table, best_solution, mp.peek()) _update_interactive_information_for_problem( interactive_information, mp.peek(), capture) for p in mp: p.subscribe(_bind.callback_without_event( _update_solutions_for_problem, solutions_table, best_solution, p)) clear_output_button = widgets.Button(description='clear output') ouptuts_changed = _bind.widget_observable(capture, 'outputs') ouptuts_changed.subscribe(_bind.callback_without_event( _update_clear_button_visibility, clear_output_button, capture)) _update_clear_button_visibility(clear_output_button, capture) clear_output_button.on_click( _bind.callback_without_event(capture.clear_output)) return widgets.VBox([ widgets.HBox(items), interactive_information, solutions_table, capture, clear_output_button, ]) def _update_solutions_for_problem( table: table_widget.TableWidget, best_solution: widgets.Text, p: problem.Problem) -> None: solutions = p.solutions() if solutions.peek(): best_solution.value = solutions.peek() headers = ['score', 'solution', 'notes'] data = [] for i, (solution, score) in enumerate(solutions.items()): if i >= _MAX_RESULTS: break data.append([ round(score, 3), _common.preformat_html(solution), '<br />'.join(p.notes_for(solution)) ]) table.update_data(data, headers=headers) def _update_interactive_information_for_problem( interactive_information: widgets.VBox, p: problem.Problem, capture: ContextManager): accordion_children = [] steps = list(p.steps()) for s in steps: step_tabs_children = [] for group in s.constraints(): child_constraints = [] group_container = widgets.VBox(child_constraints) _update_annotations_for_group(group_container, group, capture) group.subscribe(_bind.callback_without_event( _update_annotations_for_group, group_container, group, capture)) step_tabs_children.append(group_container) step_tabs = widgets.Tab(step_tabs_children) for i, group in enumerate(s.constraints()): step_tabs.set_title(i, _common.format_label(group.__class__.__name__)) debug_data_container = widgets.VBox([]) debug_data_accordion = widgets.Accordion([debug_data_container]) debug_data_accordion.set_title(0, 'debug data') debug_data_accordion.selected_index = None _update_debug_data_for_problem( debug_data_container, debug_data_accordion, s, capture) accordian_selected_index_changed = _bind.widget_observable( debug_data_accordion, 'selected_index') accordian_selected_index_changed.subscribe(_bind.callback_without_event( _update_debug_data_for_problem, debug_data_container, debug_data_accordion, s, capture)) p.subscribe(_bind.callback_without_event( _update_debug_data_for_problem, debug_data_container, debug_data_accordion, s, capture)) s.subscribe(_bind.callback_without_event( _update_debug_data_for_problem, debug_data_container, debug_data_accordion, s, capture)) step_tabs = widgets.VBox([step_tabs, debug_data_accordion]) accordion_children.append(step_tabs) accordion = widgets.Accordion(children=accordion_children) for i, s in enumerate(steps): accordion.set_title(i, _common.format_label(str(s))) interactive_information.children = (accordion,) def _update_annotations_for_group( annotations_container: widgets.VBox, group: constraints.Constraints, capture: ContextManager) -> None: children = [] for key, value, annotation, docs in group: children.append(annotation_widget.AnnotationWidget( annotation, group, key, value, docs, capture)) _widget_util.merge_assign_children(annotations_container, children) def _update_debug_data_for_problem( debug_data_container: widgets.VBox, debug_data_accordion: widgets.Accordion, s: step.Step, capture: ContextManager, ): # TODO: Diff. if debug_data_accordion.selected_index is not None: debug_widget = debug_data_widget.DebugDataWidget(s, capture) debug_data_container.children = (debug_widget,) def _update_clear_button_visibility( clear_button: widgets.Button, output: widgets.Output) -> None: if output.outputs: clear_button.layout.display = 'block' else: clear_button.layout.display = 'none'
0.632957
0.140661
import json from django.urls import reverse from rest_framework.test import APITestCase, APIClient from core.models import Author from core.tests.factories import AuthorFactory from users.tests.factories import UserFactory, TokenFactory class AuthorUpdateTestCase(APITestCase): def setUp(self): self.client = APIClient() author = AuthorFactory(name='<NAME>') self.url = reverse('v1:author-detail', kwargs={'pk': author.pk}) def test_author_update_returns_401_given_anonymous_request(self): body = { 'name': '<NAME>', } response = self.client.patch(self.url, json.dumps(body), content_type='application/json') self.assertEqual(401, response.status_code) def test_author_update_returns_403_given_non_admin_user(self): user = UserFactory(is_staff=False) token = TokenFactory(user=user) self.client.credentials(HTTP_AUTHORIZATION='Token ' + token.key) body = { 'name': '<NAME>', } response = self.client.patch(self.url, json.dumps(body), content_type='application/json') self.assertEqual(403, response.status_code) def test_author_update_returns_200_given_valid_input(self): user = UserFactory(is_staff=True) token = TokenFactory(user=user) self.client.credentials(HTTP_AUTHORIZATION='Token ' + token.key) body = { 'name': '<NAME>', } response = self.client.patch(self.url, json.dumps(body), content_type='application/json') self.assertEqual(200, response.status_code) def test_author_update_updates_a_author_given_valid_input(self): user = UserFactory(is_staff=True) token = TokenFactory(user=user) self.client.credentials(HTTP_AUTHORIZATION='Token ' + token.key) body = { 'name': '<NAME>', } self.client.patch(self.url, json.dumps(body), content_type='application/json') self.assertTrue(Author.objects.filter(name='<NAME>').exists())
core/tests/test_author_update.py
import json from django.urls import reverse from rest_framework.test import APITestCase, APIClient from core.models import Author from core.tests.factories import AuthorFactory from users.tests.factories import UserFactory, TokenFactory class AuthorUpdateTestCase(APITestCase): def setUp(self): self.client = APIClient() author = AuthorFactory(name='<NAME>') self.url = reverse('v1:author-detail', kwargs={'pk': author.pk}) def test_author_update_returns_401_given_anonymous_request(self): body = { 'name': '<NAME>', } response = self.client.patch(self.url, json.dumps(body), content_type='application/json') self.assertEqual(401, response.status_code) def test_author_update_returns_403_given_non_admin_user(self): user = UserFactory(is_staff=False) token = TokenFactory(user=user) self.client.credentials(HTTP_AUTHORIZATION='Token ' + token.key) body = { 'name': '<NAME>', } response = self.client.patch(self.url, json.dumps(body), content_type='application/json') self.assertEqual(403, response.status_code) def test_author_update_returns_200_given_valid_input(self): user = UserFactory(is_staff=True) token = TokenFactory(user=user) self.client.credentials(HTTP_AUTHORIZATION='Token ' + token.key) body = { 'name': '<NAME>', } response = self.client.patch(self.url, json.dumps(body), content_type='application/json') self.assertEqual(200, response.status_code) def test_author_update_updates_a_author_given_valid_input(self): user = UserFactory(is_staff=True) token = TokenFactory(user=user) self.client.credentials(HTTP_AUTHORIZATION='Token ' + token.key) body = { 'name': '<NAME>', } self.client.patch(self.url, json.dumps(body), content_type='application/json') self.assertTrue(Author.objects.filter(name='<NAME>').exists())
0.431345
0.123471
# Copyright 2020 <NAME> # License: Apache 2.0 (http://www.apache.org/licenses/LICENSE-2.0) """ Python version of tokenizer.pl """ import sys import codecs import argparse def io_wrapper(io_str, mode): """ Wrapper for IO stream """ if io_str != "-": std = False stream = codecs.open(io_str, mode, encoding="utf-8") else: std = True if mode not in ["r", "w"]: raise RuntimeError(f"Unknown IO mode: {mode}") if mode == "w": stream = codecs.getwriter("utf-8")(sys.stdout.buffer) else: stream = codecs.getreader("utf-8")(sys.stdin.buffer) return std, stream def run(args): src_std, src = io_wrapper(args.src_txt, "r") dst_std, dst = io_wrapper(args.dst_tok, "w") def add_to_vocab(vocab, units): if vocab is None: return for unit in units: if unit not in vocab: vocab[unit] = len(vocab) sp_mdl = None vocab = None add_units = None if args.unit == "subword": if not args.spm: raise RuntimeError("Missing --spm when choose subword unit") import sentencepiece as sp sp_mdl = sp.SentencePieceProcessor(model_file=args.spm) else: if args.add_units: add_units = args.add_units.split(",") if args.dump_vocab: vocab = {} if add_units: print(f"Add units: {add_units} to vocabulary") add_to_vocab(vocab, add_units) if args.space: add_to_vocab(vocab, [args.space]) filter_units = args.filter_units.split(",") print(f"Filter units: {filter_units}") for raw_line in src: line = raw_line.strip() raw_tokens = line.split() if args.text_format == "kaldi": sets = raw_tokens[1:] dst.write(f"{raw_tokens[0]}\t") else: sets = raw_tokens kept_tokens = [] for n, tok in enumerate(sets): # remove tokens is_filter_tok = tok in filter_units if is_filter_tok and args.unit != "char": continue # word => char if args.unit == "char" and not is_filter_tok: toks = [t for t in tok] else: toks = [tok] kept_tokens += toks add_to_vocab(vocab, toks) if args.space and n != len(sets) - 1: kept_tokens += [args.space] if args.unit == "subword": kept_tokens = sp_mdl.encode(" ".join(kept_tokens), out_type=str) dst.write(" ".join(kept_tokens) + "\n") if vocab: _, dump_vocab = io_wrapper(args.dump_vocab, "w") for unit, idx in vocab.items(): dump_vocab.write(f"{unit} {idx}\n") print(f"Dump vocabulary to {args.dump_vocab} with {len(vocab)} units") dump_vocab.close() if not src_std: src.close() if not dst_std: dst.close() if __name__ == "__main__": parser = argparse.ArgumentParser( description="Tokenize the text to modeling units, e.g., " "character, phoneme, word, subword, ...") parser.add_argument("src_txt", type=str, help="Source text file (Kaldi format or not)") parser.add_argument("dst_tok", type=str, help="Output text file (Kaldi format or not)") parser.add_argument("--text-format", type=str, default="kaldi", choices=["kaldi", "raw"], help="Format of the text file. " "The kaldi format begins with the utterance ID") parser.add_argument("--spm", type=str, default="", help="Path of the sentencepiece's model " "if we choose subword unit") parser.add_argument("--filter-units", type=str, default="", help="Filter the units if needed, " "each unit is separated via \',\'") parser.add_argument("--unit", type=str, default="char", choices=["char", "word", "subword"], help="Type of the modeling unit") parser.add_argument("--space", type=str, default="", help="If not none, insert space " "symbol between each units") parser.add_argument("--add-units", type=str, default="", help="Add units to vocabulary set, " "e.g., <sos>, <eos>, <unk>") parser.add_argument("--dump-vocab", type=str, default="", help="If not none, dump out the vocabulary set") args = parser.parse_args() run(args)
utils/tokenizer.py
# Copyright 2020 <NAME> # License: Apache 2.0 (http://www.apache.org/licenses/LICENSE-2.0) """ Python version of tokenizer.pl """ import sys import codecs import argparse def io_wrapper(io_str, mode): """ Wrapper for IO stream """ if io_str != "-": std = False stream = codecs.open(io_str, mode, encoding="utf-8") else: std = True if mode not in ["r", "w"]: raise RuntimeError(f"Unknown IO mode: {mode}") if mode == "w": stream = codecs.getwriter("utf-8")(sys.stdout.buffer) else: stream = codecs.getreader("utf-8")(sys.stdin.buffer) return std, stream def run(args): src_std, src = io_wrapper(args.src_txt, "r") dst_std, dst = io_wrapper(args.dst_tok, "w") def add_to_vocab(vocab, units): if vocab is None: return for unit in units: if unit not in vocab: vocab[unit] = len(vocab) sp_mdl = None vocab = None add_units = None if args.unit == "subword": if not args.spm: raise RuntimeError("Missing --spm when choose subword unit") import sentencepiece as sp sp_mdl = sp.SentencePieceProcessor(model_file=args.spm) else: if args.add_units: add_units = args.add_units.split(",") if args.dump_vocab: vocab = {} if add_units: print(f"Add units: {add_units} to vocabulary") add_to_vocab(vocab, add_units) if args.space: add_to_vocab(vocab, [args.space]) filter_units = args.filter_units.split(",") print(f"Filter units: {filter_units}") for raw_line in src: line = raw_line.strip() raw_tokens = line.split() if args.text_format == "kaldi": sets = raw_tokens[1:] dst.write(f"{raw_tokens[0]}\t") else: sets = raw_tokens kept_tokens = [] for n, tok in enumerate(sets): # remove tokens is_filter_tok = tok in filter_units if is_filter_tok and args.unit != "char": continue # word => char if args.unit == "char" and not is_filter_tok: toks = [t for t in tok] else: toks = [tok] kept_tokens += toks add_to_vocab(vocab, toks) if args.space and n != len(sets) - 1: kept_tokens += [args.space] if args.unit == "subword": kept_tokens = sp_mdl.encode(" ".join(kept_tokens), out_type=str) dst.write(" ".join(kept_tokens) + "\n") if vocab: _, dump_vocab = io_wrapper(args.dump_vocab, "w") for unit, idx in vocab.items(): dump_vocab.write(f"{unit} {idx}\n") print(f"Dump vocabulary to {args.dump_vocab} with {len(vocab)} units") dump_vocab.close() if not src_std: src.close() if not dst_std: dst.close() if __name__ == "__main__": parser = argparse.ArgumentParser( description="Tokenize the text to modeling units, e.g., " "character, phoneme, word, subword, ...") parser.add_argument("src_txt", type=str, help="Source text file (Kaldi format or not)") parser.add_argument("dst_tok", type=str, help="Output text file (Kaldi format or not)") parser.add_argument("--text-format", type=str, default="kaldi", choices=["kaldi", "raw"], help="Format of the text file. " "The kaldi format begins with the utterance ID") parser.add_argument("--spm", type=str, default="", help="Path of the sentencepiece's model " "if we choose subword unit") parser.add_argument("--filter-units", type=str, default="", help="Filter the units if needed, " "each unit is separated via \',\'") parser.add_argument("--unit", type=str, default="char", choices=["char", "word", "subword"], help="Type of the modeling unit") parser.add_argument("--space", type=str, default="", help="If not none, insert space " "symbol between each units") parser.add_argument("--add-units", type=str, default="", help="Add units to vocabulary set, " "e.g., <sos>, <eos>, <unk>") parser.add_argument("--dump-vocab", type=str, default="", help="If not none, dump out the vocabulary set") args = parser.parse_args() run(args)
0.45641
0.196537
import sqlite3 class UserRepository: def __init__(self, config): connection = config["Database"]["connection"] assert connection self.connection_string = connection def _connection(self): return sqlite3.connect(self.connection_string) def list_user(self): """ Query for a list of user :return: a list tuple (user_name, user_pass, note) """ query = "SELECT user_name, user_pass, note FROM users" result = [] with self._connection() as connection: cursor = connection.cursor() cursor.execute(query) for row in cursor.fetchall(): result.append( (row[0], row[1], row[2]) ) return result def get_user(self, user_name): """ Find a user base on user name :param user_name: target user name :return: tuple of (username, password, note) or None """ query = "SELECT user_name, user_pass, note FROM users WHERE user_name = :user_name" params = {"user_name": user_name} with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) found_user = cursor.fetchone() if found_user is not None: return found_user[0], found_user[1], found_user[2] else: return None def create_user(self, user_name, password, note): """ Create an entry of user :param user_name: user's user name :param password: <PASSWORD> :param note: note of the user :return: if the operation success or not """ query = "INSERT INTO users (user_name, user_pass, note) VALUES (:user_name, :password, :note);" params = { "user_name": user_name, "password": password, "note": note } with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) row_effected = cursor.rowcount return row_effected == 1 def edit_user(self, user_name, password, note): """ Update a user :param user_name: user name of the user :param password: <PASSWORD> :param note: note of the user :return: if the operation success of not """ query = "UPDATE users SET user_pass = :password, note = :note WHERE user_name = :user_name" params = { "user_name": user_name, "password": password, "note": note } with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) row_effected = cursor.rowcount return row_effected == 1 def delete_user(self, user_name): """ Delete a user :param user_name: user name of the user :return: if the operation success or not """ query = "DELETE FROM users WHERE user_name = :user_name" params = {"user_name": user_name} with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) row_effected = cursor.rowcount return row_effected == 1 def get_role(self, user_name, role_name): """ Return a single mapping of user role :param user_name: user name of the target mapping :param role_name: role name of the target mapping :return: a tuple (user_name, role_name) of found mapping or None """ query = "SELECT user_name, role_name FROM user_roles WHERE user_name = :user_name AND role_name = :role_name" params = { "user_name": user_name, "role_name": role_name } with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) found_mapping = cursor.fetchone() if found_mapping is not None: return found_mapping[0], found_mapping(1) else: return None def get_roles(self, user_name): """ Return a list of role name for a user :param user_name: user name of the target user :return: a list of tuple (username, role name) for a user or an empty list """ query = "SELECT user_name, role_name FROM user_roles WHERE user_name = :user_name" params = {"user_name": user_name} result = [] with self._connection() as connection: cursor = connection.cursor() for row in cursor.execute(query, params): result.append( (row[0], row[1]) ) return result def create_role(self, user_name, role_name): """ Create a role for target user :param user_name: user name of the user :param role_name: role name of the user :return: if the operation success of not """ query = "INSERT INTO user_roles (user_name, role_name) VALUES (:user_name, :role_name)" params = { "user_name": user_name, "role_name": role_name } with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) row_count = cursor.rowcount return row_count == 1 def delete_role(self, user_name, role_name): """ Delete a role from target user :param user_name: :param role_name: :return: """ query = "DELETE FROM user_roles WHERE user_name = :user_name AND role_name = :role_name" params = { "user_name": user_name, "role_name": role_name } with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) row_count = cursor.rowcount return row_count == 1
back/facades/UserRepository.py
import sqlite3 class UserRepository: def __init__(self, config): connection = config["Database"]["connection"] assert connection self.connection_string = connection def _connection(self): return sqlite3.connect(self.connection_string) def list_user(self): """ Query for a list of user :return: a list tuple (user_name, user_pass, note) """ query = "SELECT user_name, user_pass, note FROM users" result = [] with self._connection() as connection: cursor = connection.cursor() cursor.execute(query) for row in cursor.fetchall(): result.append( (row[0], row[1], row[2]) ) return result def get_user(self, user_name): """ Find a user base on user name :param user_name: target user name :return: tuple of (username, password, note) or None """ query = "SELECT user_name, user_pass, note FROM users WHERE user_name = :user_name" params = {"user_name": user_name} with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) found_user = cursor.fetchone() if found_user is not None: return found_user[0], found_user[1], found_user[2] else: return None def create_user(self, user_name, password, note): """ Create an entry of user :param user_name: user's user name :param password: <PASSWORD> :param note: note of the user :return: if the operation success or not """ query = "INSERT INTO users (user_name, user_pass, note) VALUES (:user_name, :password, :note);" params = { "user_name": user_name, "password": password, "note": note } with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) row_effected = cursor.rowcount return row_effected == 1 def edit_user(self, user_name, password, note): """ Update a user :param user_name: user name of the user :param password: <PASSWORD> :param note: note of the user :return: if the operation success of not """ query = "UPDATE users SET user_pass = :password, note = :note WHERE user_name = :user_name" params = { "user_name": user_name, "password": password, "note": note } with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) row_effected = cursor.rowcount return row_effected == 1 def delete_user(self, user_name): """ Delete a user :param user_name: user name of the user :return: if the operation success or not """ query = "DELETE FROM users WHERE user_name = :user_name" params = {"user_name": user_name} with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) row_effected = cursor.rowcount return row_effected == 1 def get_role(self, user_name, role_name): """ Return a single mapping of user role :param user_name: user name of the target mapping :param role_name: role name of the target mapping :return: a tuple (user_name, role_name) of found mapping or None """ query = "SELECT user_name, role_name FROM user_roles WHERE user_name = :user_name AND role_name = :role_name" params = { "user_name": user_name, "role_name": role_name } with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) found_mapping = cursor.fetchone() if found_mapping is not None: return found_mapping[0], found_mapping(1) else: return None def get_roles(self, user_name): """ Return a list of role name for a user :param user_name: user name of the target user :return: a list of tuple (username, role name) for a user or an empty list """ query = "SELECT user_name, role_name FROM user_roles WHERE user_name = :user_name" params = {"user_name": user_name} result = [] with self._connection() as connection: cursor = connection.cursor() for row in cursor.execute(query, params): result.append( (row[0], row[1]) ) return result def create_role(self, user_name, role_name): """ Create a role for target user :param user_name: user name of the user :param role_name: role name of the user :return: if the operation success of not """ query = "INSERT INTO user_roles (user_name, role_name) VALUES (:user_name, :role_name)" params = { "user_name": user_name, "role_name": role_name } with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) row_count = cursor.rowcount return row_count == 1 def delete_role(self, user_name, role_name): """ Delete a role from target user :param user_name: :param role_name: :return: """ query = "DELETE FROM user_roles WHERE user_name = :user_name AND role_name = :role_name" params = { "user_name": user_name, "role_name": role_name } with self._connection() as connection: cursor = connection.cursor() cursor.execute(query, params) row_count = cursor.rowcount return row_count == 1
0.520496
0.228146
import struct import unittest from datasketch.partition_minhash import PartitionMinHash, BetterWeightedPartitionMinHash class FakeHash(object): def __init__(self, h): ''' Initialize with an integer ''' self.h = h def digest(self): ''' Return the bytes representation of the integer ''' return struct.pack('<Q', self.h) class TestPartitionMinhash(unittest.TestCase): def test_init(self): m1 = PartitionMinHash(4) m2 = PartitionMinHash(4) self.assertEqual(m1, m2) self.assertEqual(m1.k_val, m2.k_val) self.assertEqual(m1.partitions, m1.partitions) def test_is_empty(self): m = PartitionMinHash(4, hashobj=FakeHash) self.assertTrue(m.is_empty()) m.update(1) self.assertFalse(m.is_empty()) def test_update(self): m1 = PartitionMinHash(4, hashobj=FakeHash) m2 = PartitionMinHash(4, hashobj=FakeHash) m1.update(12) self.assertTrue(m1 != m2) def test_jaccard(self): m1 = PartitionMinHash(4, hashobj=FakeHash) m2 = PartitionMinHash(4, hashobj=FakeHash) self.assertEqual(m1.jaccard(m2), 1.0) m2.update(12) self.assertEqual(m1.jaccard(m2), 0.0) m1.update(13) self.assertEqual(m1.jaccard(m2), 0.0) m1.update(12) self.assertEqual(m1.jaccard(m2), 0.75) m2.update(13) self.assertEqual(m1.jaccard(m2), 1.0) m1.update(14) self.assertEqual(m1.jaccard(m2), 2./3) m2.update(14) self.assertEqual(m1.jaccard(m2), 1.0) def test_better_weighting_jaccard(self): m1 = BetterWeightedPartitionMinHash(4, hashobj=FakeHash) m2 = BetterWeightedPartitionMinHash(4, hashobj=FakeHash) self.assertEqual(m1.jaccard(m2), 1.0) m2.update(12) self.assertEqual(m1.jaccard(m2), 0.0) m1.update(13) self.assertEqual(m1.jaccard(m2), 0.0) m1.update(12) self.assertEqual(m1.jaccard(m2), 0.50) m2.update(13) self.assertEqual(m1.jaccard(m2), 1.0) m1.update(14) self.assertEqual(m1.jaccard(m2), 2./3) m2.update(14) self.assertEqual(m1.jaccard(m2), 1.0) def test_eq(self): m1 = PartitionMinHash(4, hashobj=FakeHash) m2 = PartitionMinHash(4, hashobj=FakeHash) m3 = PartitionMinHash(4, hashobj=FakeHash) m4 = PartitionMinHash(4, hashobj=FakeHash) m5 = PartitionMinHash(4, hashobj=FakeHash) m1.update(11) m2.update(12) m3.update(11) m4.update(11) m5.update(11) self.assertNotEqual(m1, m2) self.assertEqual(m1, m3) self.assertEqual(m1, m4) self.assertEqual(m1, m5) m1.update(12) m2.update(11) self.assertEqual(m1, m2) if __name__ == "__main__": unittest.main()
test/partition_minhash_test.py
import struct import unittest from datasketch.partition_minhash import PartitionMinHash, BetterWeightedPartitionMinHash class FakeHash(object): def __init__(self, h): ''' Initialize with an integer ''' self.h = h def digest(self): ''' Return the bytes representation of the integer ''' return struct.pack('<Q', self.h) class TestPartitionMinhash(unittest.TestCase): def test_init(self): m1 = PartitionMinHash(4) m2 = PartitionMinHash(4) self.assertEqual(m1, m2) self.assertEqual(m1.k_val, m2.k_val) self.assertEqual(m1.partitions, m1.partitions) def test_is_empty(self): m = PartitionMinHash(4, hashobj=FakeHash) self.assertTrue(m.is_empty()) m.update(1) self.assertFalse(m.is_empty()) def test_update(self): m1 = PartitionMinHash(4, hashobj=FakeHash) m2 = PartitionMinHash(4, hashobj=FakeHash) m1.update(12) self.assertTrue(m1 != m2) def test_jaccard(self): m1 = PartitionMinHash(4, hashobj=FakeHash) m2 = PartitionMinHash(4, hashobj=FakeHash) self.assertEqual(m1.jaccard(m2), 1.0) m2.update(12) self.assertEqual(m1.jaccard(m2), 0.0) m1.update(13) self.assertEqual(m1.jaccard(m2), 0.0) m1.update(12) self.assertEqual(m1.jaccard(m2), 0.75) m2.update(13) self.assertEqual(m1.jaccard(m2), 1.0) m1.update(14) self.assertEqual(m1.jaccard(m2), 2./3) m2.update(14) self.assertEqual(m1.jaccard(m2), 1.0) def test_better_weighting_jaccard(self): m1 = BetterWeightedPartitionMinHash(4, hashobj=FakeHash) m2 = BetterWeightedPartitionMinHash(4, hashobj=FakeHash) self.assertEqual(m1.jaccard(m2), 1.0) m2.update(12) self.assertEqual(m1.jaccard(m2), 0.0) m1.update(13) self.assertEqual(m1.jaccard(m2), 0.0) m1.update(12) self.assertEqual(m1.jaccard(m2), 0.50) m2.update(13) self.assertEqual(m1.jaccard(m2), 1.0) m1.update(14) self.assertEqual(m1.jaccard(m2), 2./3) m2.update(14) self.assertEqual(m1.jaccard(m2), 1.0) def test_eq(self): m1 = PartitionMinHash(4, hashobj=FakeHash) m2 = PartitionMinHash(4, hashobj=FakeHash) m3 = PartitionMinHash(4, hashobj=FakeHash) m4 = PartitionMinHash(4, hashobj=FakeHash) m5 = PartitionMinHash(4, hashobj=FakeHash) m1.update(11) m2.update(12) m3.update(11) m4.update(11) m5.update(11) self.assertNotEqual(m1, m2) self.assertEqual(m1, m3) self.assertEqual(m1, m4) self.assertEqual(m1, m5) m1.update(12) m2.update(11) self.assertEqual(m1, m2) if __name__ == "__main__": unittest.main()
0.709623
0.572185
import six import logging import numpy as np import re if not six.PY2: basestring = str def is_string(s): """判断是否是字符串 """ return isinstance(s, basestring) def strQ2B(ustring): """全角符号转对应的半角符号 """ rstring = '' for uchar in ustring: inside_code = ord(uchar) # 全角空格直接转换 if inside_code == 12288: inside_code = 32 # 全角字符(除空格)根据关系转化 elif (inside_code >= 65281 and inside_code <= 65374): inside_code -= 65248 rstring += unichr(inside_code) return rstring def string_matching(s, keywords): """判断s是否至少包含keywords中的至少一个字符串 """ for k in keywords: if re.search(k, s): return True return False class Progress: """显示进度,自己简单封装,比tqdm更可控一些 iterable: 可迭代的对象; period: 显示进度的周期; steps: iterable可迭代的总步数,相当于len(iterable) """ def __init__(self, iterable, period=1, steps=None, desc=None): self.iterable = iterable self.period = period if hasattr(iterable, '__len__'): self.steps = len(iterable) else: self.steps = steps self.desc = desc if self.steps: self._format_ = u'%s/%s passed' % ('%s', self.steps) else: self._format_ = u'%s passed' if self.desc: self._format_ = self.desc + ' - ' + self._format_ self.logger = logging.getLogger() def __iter__(self): for i, j in enumerate(self.iterable): if (i + 1) % self.period == 0: self.logger.info(self._format_ % (i + 1)) yield j def parallel_apply(func, iterable, workers, max_queue_size, callback=None, dummy=False): """多进程或多线程地将func应用到iterable的每个元素中。 注意这个apply是异步且无序的,也就是说依次输入a,b,c,但是 输出可能是func(c), func(a), func(b)。 参数: dummy: False是多进程/线性,True则是多线程/线性; callback: 处理单个输出的回调函数; """ if dummy: from multiprocessing.dummy import Pool, Queue else: from multiprocessing import Pool, Queue in_queue, out_queue = Queue(max_queue_size), Queue() def worker_step(in_queue, out_queue): # 单步函数包装成循环执行 while True: d = in_queue.get() r = func(d) out_queue.put(r) # 启动多进程/线程 pool = Pool(workers, worker_step, (in_queue, out_queue)) if callback is None: results = [] # 后处理函数 def process_out_queue(): out_count = 0 for _ in range(out_queue.qsize()): d = out_queue.get() out_count += 1 if callback is None: results.append(d) else: callback(d) return out_count # 存入数据,取出结果 in_count, out_count = 0, 0 for d in iterable: in_count += 1 while True: try: in_queue.put(d, block=False) break except six.moves.queue.Full: out_count += process_out_queue() if in_count % max_queue_size == 0: out_count += process_out_queue() while out_count != in_count: out_count += process_out_queue() pool.terminate() if callback is None: return results def get_all_attributes(something): """获取类下的所有属性和方法 """ return { name: getattr(something, name) for name in dir(something) if name[0] != '_' } def sequence_padding(inputs, length=None, padding=0): """Numpy函数,将序列padding到同一长度 """ if length is None: length = max([len(x) for x in inputs]) outputs = np.array([ np.concatenate([x, [padding] * (length - len(x))]) if len(x) < length else x[:length] for x in inputs ]) return outputs def is_one_of(x, ys): """判断x是否在ys之中 等价于x in ys,但有些情况下x in ys会报错 """ for y in ys: if x is y: return True return False
bert4keras/snippets.py
import six import logging import numpy as np import re if not six.PY2: basestring = str def is_string(s): """判断是否是字符串 """ return isinstance(s, basestring) def strQ2B(ustring): """全角符号转对应的半角符号 """ rstring = '' for uchar in ustring: inside_code = ord(uchar) # 全角空格直接转换 if inside_code == 12288: inside_code = 32 # 全角字符(除空格)根据关系转化 elif (inside_code >= 65281 and inside_code <= 65374): inside_code -= 65248 rstring += unichr(inside_code) return rstring def string_matching(s, keywords): """判断s是否至少包含keywords中的至少一个字符串 """ for k in keywords: if re.search(k, s): return True return False class Progress: """显示进度,自己简单封装,比tqdm更可控一些 iterable: 可迭代的对象; period: 显示进度的周期; steps: iterable可迭代的总步数,相当于len(iterable) """ def __init__(self, iterable, period=1, steps=None, desc=None): self.iterable = iterable self.period = period if hasattr(iterable, '__len__'): self.steps = len(iterable) else: self.steps = steps self.desc = desc if self.steps: self._format_ = u'%s/%s passed' % ('%s', self.steps) else: self._format_ = u'%s passed' if self.desc: self._format_ = self.desc + ' - ' + self._format_ self.logger = logging.getLogger() def __iter__(self): for i, j in enumerate(self.iterable): if (i + 1) % self.period == 0: self.logger.info(self._format_ % (i + 1)) yield j def parallel_apply(func, iterable, workers, max_queue_size, callback=None, dummy=False): """多进程或多线程地将func应用到iterable的每个元素中。 注意这个apply是异步且无序的,也就是说依次输入a,b,c,但是 输出可能是func(c), func(a), func(b)。 参数: dummy: False是多进程/线性,True则是多线程/线性; callback: 处理单个输出的回调函数; """ if dummy: from multiprocessing.dummy import Pool, Queue else: from multiprocessing import Pool, Queue in_queue, out_queue = Queue(max_queue_size), Queue() def worker_step(in_queue, out_queue): # 单步函数包装成循环执行 while True: d = in_queue.get() r = func(d) out_queue.put(r) # 启动多进程/线程 pool = Pool(workers, worker_step, (in_queue, out_queue)) if callback is None: results = [] # 后处理函数 def process_out_queue(): out_count = 0 for _ in range(out_queue.qsize()): d = out_queue.get() out_count += 1 if callback is None: results.append(d) else: callback(d) return out_count # 存入数据,取出结果 in_count, out_count = 0, 0 for d in iterable: in_count += 1 while True: try: in_queue.put(d, block=False) break except six.moves.queue.Full: out_count += process_out_queue() if in_count % max_queue_size == 0: out_count += process_out_queue() while out_count != in_count: out_count += process_out_queue() pool.terminate() if callback is None: return results def get_all_attributes(something): """获取类下的所有属性和方法 """ return { name: getattr(something, name) for name in dir(something) if name[0] != '_' } def sequence_padding(inputs, length=None, padding=0): """Numpy函数,将序列padding到同一长度 """ if length is None: length = max([len(x) for x in inputs]) outputs = np.array([ np.concatenate([x, [padding] * (length - len(x))]) if len(x) < length else x[:length] for x in inputs ]) return outputs def is_one_of(x, ys): """判断x是否在ys之中 等价于x in ys,但有些情况下x in ys会报错 """ for y in ys: if x is y: return True return False
0.334916
0.361306
import pandas as pd import re import os from pptx import Presentation from pptx.util import Inches, Pt from pptx.enum.shapes import MSO_SHAPE from pptx.enum.text import PP_ALIGN from pptx.dml.color import RGBColor from pptx.oxml.xmlchemy import OxmlElement d = '' # Glasswall palette dark_blue = RGBColor(14, 61, 90) green_blue = RGBColor(26, 145, 154) white = RGBColor(255, 255, 255) blue1 = RGBColor(22, 94, 122) # table colors: gray = RGBColor(191, 191, 191) blue2 = RGBColor(45, 92, 117) # rag colors: green = RGBColor(0, 204, 153) # (0, 255, 0) amber = RGBColor(255, 204, 0) # (255, 153, 51) red = RGBColor(255, 102, 102) # (255, 0, 0) # Letter font gw_font = 'Arial' def examine_template(): """ Print default Master's slides information, title, subtitle, placeholders, etc. """ prs = Presentation() for n in range(0, 11): slide = prs.slides.add_slide(prs.slide_layouts[n]) print('Master Slide ' + str(n)) for shape in slide.placeholders: print('%d, %s' % (shape.placeholder_format.idx, shape.name)) def logo(slide, img_path=d + 'gw.png', place='top right'): """ Insert logo in slide. :param slide: slide from presentation :param img_path: path to image file, Glasswall logo for default :param place: place to locate image, top right, center or top left """ if place == 'top right': # Logo size width = Inches(1.2) height = Inches(0.6) # width half top = Inches(0.1) left = Inches(10.0) - width - Inches(0.2) elif place == 'center': width = Inches(6.0) height = Inches(3.0) # width halfs left = (Inches(10.0) - width) / 2 top = (Inches(7.5) - height) / 2 elif place == 'top left': width = Inches(1.25) height = Inches(0.625) # width half top = Inches(0.25) left = Inches(0.3) pic = slide.shapes.add_picture(img_path, left, top, width, height) def set_background_color(slide, bg_color=dark_blue): """ Set slide background color. :param slide: slide from presentation :param bg_color: background color """ background = slide.background fill(background, bg_color) def fill(shape, fill_color=dark_blue): """ Fill shape with color. :param shape: MSO_SHAPE shape (MSO_SHAPE.RECTANGLE, MSO_SHAPE.ELLIPSE, etc) :param fill_color: fill color """ fill = shape.fill fill.solid() fill.fore_color.rgb = fill_color def wrap_by_word(s, n): """ Returns a string where \n is inserted between every n words :param s: string :param n: integer, number of words :return: """ a = s.split() ret = '' for i in range(0, len(a), n): ret += ' '.join(a[i:i+n]) + '\n' return ret def wrap_by_char(s, n): return '\n'.join(l for line in s.splitlines() for l in textwrap.wrap(line, width=n)) def get_data(): # Create URL to JSON file (alternatively this can be a filepath) url = 'https://wmwaredata.s3.us-east-2.amazonaws.com/gw_releases.json' # Load the first sheet of the JSON file into a data frame df = pd.read_json(url, orient='columns') df = df.rename(columns={'sub_repo_commit_url': 'sub_repo_url'}) repos = [] dates = [] tags = [] hashes = [] descriptions = [] for i in range(len(df)): # Repo repo = df['repo_name'].iloc[i] + '\n\n' + df['repo_url'].iloc[i] repos.append(repo) # Date d = df['release_date'].iloc[i] if d is not None: d = d.split('T') date = d[0] + '\n\n' + d[1][:-1] else: date = '' dates.append(date) # Version / Tag t = df['version'].iloc[i] tags.append(t) # Hash h = df['hash'].iloc[i] hashes.append(h) # Notes / Description content = re.sub('<.*?>', '', df['release_notes'].iloc[i]) des = wrap_by_word(content, n=20) descriptions.append(des) # Sub Repo s_name = df['sub_repo_name'].iloc[i] if s_name is not None: s_repo = s_name + '\n\n' + df['sub_repo_url'].iloc[i] repos.append(s_repo) # date dates.append(date) # tag tags.append(t) # Sub Hash s_h = df['sub_hash'].iloc[i] if s_h is not None: hashes.append(s_h) # notes descriptions.append(des) df = pd.DataFrame() df['Repo'] = repos df['Date'] = dates df['Version'] = tags df['Hash'] = hashes df['Notes'] = descriptions # Sort columns df = df[['Repo', 'Date', 'Version', 'Hash', 'Notes']] # drop repeated rows df1 = df.drop_duplicates().reset_index(drop=True) return df1 def make_presentation(output_to, single=False, dm=False): """ Autocreate power point presentation for 'Project Team Structure' sheet. :param sheet_name: sheet name, in this case 'Projects Team Structure' :param output_to: path to save output pptx file :param single: bool, create a single presentations and save it to single folder if true :param dm: bool, create a presentation per delivery manager and save it to dm folder if true """ prs = Presentation() df1 = get_data() # PROJECT SLIDES for row_index in range(len(df1)): add_project_slide(prs, df1, row_index) prs.save(output_to) def add_project_slide(prs, df, row_index): """ Add slide to presentation. :param prs: presentation :param df: pandas dataframe with presentation information :param row_index: index of the row with the information corresponding to the slide """ repo = df.iloc[row_index]['Repo'] date = df.iloc[row_index]['Date'] version = df.iloc[row_index]['Version'] hash = df.iloc[row_index]['Hash'] notes = df.iloc[row_index]['Notes'] title_only_slide_layout = prs.slide_layouts[5] slide = prs.slides.add_slide(title_only_slide_layout) title = slide.shapes.title.text = "GW Releases" #set_background_color(slide) logo(slide) shapes = slide.shapes # TITLE #title = shapes.title #title = '\n GW Releases' + repo.upper() + '\n' #text_settings(title, i=0) #text_settings(title, i=1) #text_settings(title, i=2, font_size=Pt(26)) #text_settings(title, i=4, font_size=Pt(24), font_color=green_blue) rnr = df[(df['Hash'] == hash)].reset_index() if len(rnr) > 0: add_table(shapes, rnr, blue1) def text_settings( shape, i=0, alignment=PP_ALIGN.LEFT, font_color=white, font_size=Pt(9), font= gw_font, bold=False): """ Format shape's text with alignment, font, font color and size, etc. :param shape: MSO_SHAPE shape (MSO_SHAPE.RECTANGLE, MSO_SHAPE.ELLIPSE, etc) :param i: line position :param alignment: alignment (PP_ALIGN.LEFT, PP_ALIGN.CENTER, etc.) :param font_color: font color :param font_size: font size :param font: letter font :param bold: bool, use bold letters if true """ text = shape.text_frame.paragraphs[i] text.alignment = alignment text.font.name = font text.font.size = font_size text.font.color.rgb = font_color text.font.bold = bold for paragraph in shape.text_frame.paragraphs: paragraph.font.size = Pt(9) paragraph.font.color.rgb = RGBColor(255, 255, 255) def add_table( shapes, df, table_color, top=Inches(1.5), col_width=Inches(3.0), left=Inches(0.3), width=Inches(3.5), height=Inches(0.5)): """ Add table to slide. :param shapes: shapes attribute from slide (which in turn is an attribute of the presentation) :param df: pandas dataframe with 'Resource' and 'Responsability' information in columns :param table_color: table color :param top: distance (in inches) to top edge of slide (each slide is 10 per 7.5 inches) :param col_width: column width :param left: distance (in inches) to left edge of slide :param width: table width :param height: table height """ cols = 5 rows = len(df) + 1 shape = shapes.add_table(rows, cols, left, top, width, height) table = shape.table # set column widths table.columns[0].width = Inches(1.5) table.columns[1].width = Inches(1.0) table.columns[2].width = Inches(1.0) table.columns[3].width = col_width table.columns[4].width = col_width # write column headings table.cell(0, 0).text = 'Repo'.capitalize() table.cell(0, 1).text = 'Date'.capitalize() table.cell(0, 2).text = 'Version'.capitalize() table.cell(0, 3).text = 'Hash'.capitalize() table.cell(0, 4).text = 'Notes'.capitalize() # write body cells for i in range(1, rows): table.cell(i, 0).text = df['Repo'][i - 1] cell = table.cell(i, 0) fill(cell, blue2) text_settings(cell, alignment = PP_ALIGN.CENTER, font_size=Pt(5)) set_cell_border(cell, blue2, white) table.cell(i, 1).text = df['Date'][i - 1] cell = table.cell(i, 1) fill(cell, blue2) text_settings(cell, alignment = PP_ALIGN.CENTER) set_cell_border(cell, blue2, white) table.cell(i, 2).text = df['Version'][i - 1] cell = table.cell(i, 2) fill(cell, blue2) text_settings(cell, alignment = PP_ALIGN.CENTER) set_cell_border(cell, blue2, white) table.cell(i, 3).text = df['Hash'][i - 1] cell = table.cell(i, 3) fill(cell, blue2) text_settings(cell, alignment = PP_ALIGN.CENTER) set_cell_border(cell, blue2, white) table.cell(i, 4).text = df['Notes'][i - 1] cell = table.cell(i, 4) fill(cell, blue2) text_settings(cell, alignment = PP_ALIGN.CENTER) set_cell_border(cell, blue2, white) def set_cell_border( cell, border_color_LR, border_color_TB, border_width='12700'): """ Format cell borders. :param cell: cell from table :param border_color_LR: left and right border colors :param border_color_TB: top and bottom border colors :param border_width: border width """ # convert RGB to hex border_color_LR = '%02x%02x%02x' % border_color_LR border_color_TB = '%02x%02x%02x' % border_color_TB colors = [ border_color_LR, border_color_LR, border_color_TB, border_color_TB] tc = cell._tc tcPr = tc.get_or_add_tcPr() lines = ['a:lnL', 'a:lnR', 'a:lnT', 'a:lnB'] for line, color in zip(lines, colors): ln = SubElement( tcPr, line, w=border_width, cap='flat', cmpd='sng', algn='ctr') solidFill = SubElement(ln, 'a:solidFill') srgbClr = SubElement(solidFill, 'a:srgbClr', val=color) prstDash = SubElement(ln, 'a:prstDash', val='solid') round_ = SubElement(ln, 'a:round') headEnd = SubElement(ln, 'a:headEnd', type='none', w='med', len='med') tailEnd = SubElement(ln, 'a:tailEnd', type='none', w='med', len='med') def SubElement(parent, tagname, **kwargs): element = OxmlElement(tagname) element.attrib.update(kwargs) parent.append(element) return element
upwork-devs/Lwasampijja-Baker/make_ppt.py
import pandas as pd import re import os from pptx import Presentation from pptx.util import Inches, Pt from pptx.enum.shapes import MSO_SHAPE from pptx.enum.text import PP_ALIGN from pptx.dml.color import RGBColor from pptx.oxml.xmlchemy import OxmlElement d = '' # Glasswall palette dark_blue = RGBColor(14, 61, 90) green_blue = RGBColor(26, 145, 154) white = RGBColor(255, 255, 255) blue1 = RGBColor(22, 94, 122) # table colors: gray = RGBColor(191, 191, 191) blue2 = RGBColor(45, 92, 117) # rag colors: green = RGBColor(0, 204, 153) # (0, 255, 0) amber = RGBColor(255, 204, 0) # (255, 153, 51) red = RGBColor(255, 102, 102) # (255, 0, 0) # Letter font gw_font = 'Arial' def examine_template(): """ Print default Master's slides information, title, subtitle, placeholders, etc. """ prs = Presentation() for n in range(0, 11): slide = prs.slides.add_slide(prs.slide_layouts[n]) print('Master Slide ' + str(n)) for shape in slide.placeholders: print('%d, %s' % (shape.placeholder_format.idx, shape.name)) def logo(slide, img_path=d + 'gw.png', place='top right'): """ Insert logo in slide. :param slide: slide from presentation :param img_path: path to image file, Glasswall logo for default :param place: place to locate image, top right, center or top left """ if place == 'top right': # Logo size width = Inches(1.2) height = Inches(0.6) # width half top = Inches(0.1) left = Inches(10.0) - width - Inches(0.2) elif place == 'center': width = Inches(6.0) height = Inches(3.0) # width halfs left = (Inches(10.0) - width) / 2 top = (Inches(7.5) - height) / 2 elif place == 'top left': width = Inches(1.25) height = Inches(0.625) # width half top = Inches(0.25) left = Inches(0.3) pic = slide.shapes.add_picture(img_path, left, top, width, height) def set_background_color(slide, bg_color=dark_blue): """ Set slide background color. :param slide: slide from presentation :param bg_color: background color """ background = slide.background fill(background, bg_color) def fill(shape, fill_color=dark_blue): """ Fill shape with color. :param shape: MSO_SHAPE shape (MSO_SHAPE.RECTANGLE, MSO_SHAPE.ELLIPSE, etc) :param fill_color: fill color """ fill = shape.fill fill.solid() fill.fore_color.rgb = fill_color def wrap_by_word(s, n): """ Returns a string where \n is inserted between every n words :param s: string :param n: integer, number of words :return: """ a = s.split() ret = '' for i in range(0, len(a), n): ret += ' '.join(a[i:i+n]) + '\n' return ret def wrap_by_char(s, n): return '\n'.join(l for line in s.splitlines() for l in textwrap.wrap(line, width=n)) def get_data(): # Create URL to JSON file (alternatively this can be a filepath) url = 'https://wmwaredata.s3.us-east-2.amazonaws.com/gw_releases.json' # Load the first sheet of the JSON file into a data frame df = pd.read_json(url, orient='columns') df = df.rename(columns={'sub_repo_commit_url': 'sub_repo_url'}) repos = [] dates = [] tags = [] hashes = [] descriptions = [] for i in range(len(df)): # Repo repo = df['repo_name'].iloc[i] + '\n\n' + df['repo_url'].iloc[i] repos.append(repo) # Date d = df['release_date'].iloc[i] if d is not None: d = d.split('T') date = d[0] + '\n\n' + d[1][:-1] else: date = '' dates.append(date) # Version / Tag t = df['version'].iloc[i] tags.append(t) # Hash h = df['hash'].iloc[i] hashes.append(h) # Notes / Description content = re.sub('<.*?>', '', df['release_notes'].iloc[i]) des = wrap_by_word(content, n=20) descriptions.append(des) # Sub Repo s_name = df['sub_repo_name'].iloc[i] if s_name is not None: s_repo = s_name + '\n\n' + df['sub_repo_url'].iloc[i] repos.append(s_repo) # date dates.append(date) # tag tags.append(t) # Sub Hash s_h = df['sub_hash'].iloc[i] if s_h is not None: hashes.append(s_h) # notes descriptions.append(des) df = pd.DataFrame() df['Repo'] = repos df['Date'] = dates df['Version'] = tags df['Hash'] = hashes df['Notes'] = descriptions # Sort columns df = df[['Repo', 'Date', 'Version', 'Hash', 'Notes']] # drop repeated rows df1 = df.drop_duplicates().reset_index(drop=True) return df1 def make_presentation(output_to, single=False, dm=False): """ Autocreate power point presentation for 'Project Team Structure' sheet. :param sheet_name: sheet name, in this case 'Projects Team Structure' :param output_to: path to save output pptx file :param single: bool, create a single presentations and save it to single folder if true :param dm: bool, create a presentation per delivery manager and save it to dm folder if true """ prs = Presentation() df1 = get_data() # PROJECT SLIDES for row_index in range(len(df1)): add_project_slide(prs, df1, row_index) prs.save(output_to) def add_project_slide(prs, df, row_index): """ Add slide to presentation. :param prs: presentation :param df: pandas dataframe with presentation information :param row_index: index of the row with the information corresponding to the slide """ repo = df.iloc[row_index]['Repo'] date = df.iloc[row_index]['Date'] version = df.iloc[row_index]['Version'] hash = df.iloc[row_index]['Hash'] notes = df.iloc[row_index]['Notes'] title_only_slide_layout = prs.slide_layouts[5] slide = prs.slides.add_slide(title_only_slide_layout) title = slide.shapes.title.text = "GW Releases" #set_background_color(slide) logo(slide) shapes = slide.shapes # TITLE #title = shapes.title #title = '\n GW Releases' + repo.upper() + '\n' #text_settings(title, i=0) #text_settings(title, i=1) #text_settings(title, i=2, font_size=Pt(26)) #text_settings(title, i=4, font_size=Pt(24), font_color=green_blue) rnr = df[(df['Hash'] == hash)].reset_index() if len(rnr) > 0: add_table(shapes, rnr, blue1) def text_settings( shape, i=0, alignment=PP_ALIGN.LEFT, font_color=white, font_size=Pt(9), font= gw_font, bold=False): """ Format shape's text with alignment, font, font color and size, etc. :param shape: MSO_SHAPE shape (MSO_SHAPE.RECTANGLE, MSO_SHAPE.ELLIPSE, etc) :param i: line position :param alignment: alignment (PP_ALIGN.LEFT, PP_ALIGN.CENTER, etc.) :param font_color: font color :param font_size: font size :param font: letter font :param bold: bool, use bold letters if true """ text = shape.text_frame.paragraphs[i] text.alignment = alignment text.font.name = font text.font.size = font_size text.font.color.rgb = font_color text.font.bold = bold for paragraph in shape.text_frame.paragraphs: paragraph.font.size = Pt(9) paragraph.font.color.rgb = RGBColor(255, 255, 255) def add_table( shapes, df, table_color, top=Inches(1.5), col_width=Inches(3.0), left=Inches(0.3), width=Inches(3.5), height=Inches(0.5)): """ Add table to slide. :param shapes: shapes attribute from slide (which in turn is an attribute of the presentation) :param df: pandas dataframe with 'Resource' and 'Responsability' information in columns :param table_color: table color :param top: distance (in inches) to top edge of slide (each slide is 10 per 7.5 inches) :param col_width: column width :param left: distance (in inches) to left edge of slide :param width: table width :param height: table height """ cols = 5 rows = len(df) + 1 shape = shapes.add_table(rows, cols, left, top, width, height) table = shape.table # set column widths table.columns[0].width = Inches(1.5) table.columns[1].width = Inches(1.0) table.columns[2].width = Inches(1.0) table.columns[3].width = col_width table.columns[4].width = col_width # write column headings table.cell(0, 0).text = 'Repo'.capitalize() table.cell(0, 1).text = 'Date'.capitalize() table.cell(0, 2).text = 'Version'.capitalize() table.cell(0, 3).text = 'Hash'.capitalize() table.cell(0, 4).text = 'Notes'.capitalize() # write body cells for i in range(1, rows): table.cell(i, 0).text = df['Repo'][i - 1] cell = table.cell(i, 0) fill(cell, blue2) text_settings(cell, alignment = PP_ALIGN.CENTER, font_size=Pt(5)) set_cell_border(cell, blue2, white) table.cell(i, 1).text = df['Date'][i - 1] cell = table.cell(i, 1) fill(cell, blue2) text_settings(cell, alignment = PP_ALIGN.CENTER) set_cell_border(cell, blue2, white) table.cell(i, 2).text = df['Version'][i - 1] cell = table.cell(i, 2) fill(cell, blue2) text_settings(cell, alignment = PP_ALIGN.CENTER) set_cell_border(cell, blue2, white) table.cell(i, 3).text = df['Hash'][i - 1] cell = table.cell(i, 3) fill(cell, blue2) text_settings(cell, alignment = PP_ALIGN.CENTER) set_cell_border(cell, blue2, white) table.cell(i, 4).text = df['Notes'][i - 1] cell = table.cell(i, 4) fill(cell, blue2) text_settings(cell, alignment = PP_ALIGN.CENTER) set_cell_border(cell, blue2, white) def set_cell_border( cell, border_color_LR, border_color_TB, border_width='12700'): """ Format cell borders. :param cell: cell from table :param border_color_LR: left and right border colors :param border_color_TB: top and bottom border colors :param border_width: border width """ # convert RGB to hex border_color_LR = '%02x%02x%02x' % border_color_LR border_color_TB = '%02x%02x%02x' % border_color_TB colors = [ border_color_LR, border_color_LR, border_color_TB, border_color_TB] tc = cell._tc tcPr = tc.get_or_add_tcPr() lines = ['a:lnL', 'a:lnR', 'a:lnT', 'a:lnB'] for line, color in zip(lines, colors): ln = SubElement( tcPr, line, w=border_width, cap='flat', cmpd='sng', algn='ctr') solidFill = SubElement(ln, 'a:solidFill') srgbClr = SubElement(solidFill, 'a:srgbClr', val=color) prstDash = SubElement(ln, 'a:prstDash', val='solid') round_ = SubElement(ln, 'a:round') headEnd = SubElement(ln, 'a:headEnd', type='none', w='med', len='med') tailEnd = SubElement(ln, 'a:tailEnd', type='none', w='med', len='med') def SubElement(parent, tagname, **kwargs): element = OxmlElement(tagname) element.attrib.update(kwargs) parent.append(element) return element
0.519034
0.125762
from django.conf import settings from django.shortcuts import render, get_object_or_404, redirect from django.http import HttpResponse from django.contrib import messages from django.core.cache import caches from django.views.decorators.cache import cache_page from django.contrib.postgres.search import SearchVector from datetime import date import time import logging from .models import Poster, Conference from .forms import PDFForm from .utils import email_log logger = logging.getLogger(__name__) USR_FAILED = "Your poster was uploaded successfully, but we had trouble converting it. We will look into it and activate your poster within the next few hours." USR_FAILED_MULTIPAGE = "It looks like you might have uploaded a multi-page document. We can only handle single page posters, at the moment." USR_SUCCESS = "Your poster was uploaded successfully! It will appear on the front page within a minute or two." USR_INVALID_FILE = "Please upload a valid file." USR_EXISTING_FILE = "Your poster has been uploaded already. You may update it by uploading a new file." #TODO: change to generic views @cache_page(settings.CACHE_TTL, cache='index') def index(request, conference_id=None): if conference_id is None: poster_list = Poster.objects.filter(active=True).order_by('-pub_date')[:256].prefetch_related('authors') return render(request, 'pages/index.html', {'poster_list': poster_list}) else: conference = get_object_or_404(Conference, slug=conference_id) poster_list = Poster.objects.filter(active=True, conference=conference).prefetch_related('authors') return render(request, 'pages/index.html', {'poster_list': poster_list, 'conference': conference}) def search(request): search_vector = SearchVector('title', 'conference__name', 'authors__name') poster_list = Poster.objects.annotate(search=search_vector).distinct('pk').filter(active=True, search=request.GET['q']) return render(request, 'pages/index.html', {'poster_list': poster_list, 'search': True}) def detail(request, slug): poster = get_object_or_404(Poster, slug=slug) return render(request, 'pages/detail.html', {'poster': poster}) def upload(request, access_key): poster = get_object_or_404(Poster, access_key=access_key) log_email = email_log.LogEmail(poster) form = PDFForm(instance=poster) if poster.pdf: messages.info(request, USR_EXISTING_FILE) if request.method == 'POST': try: log_email.add_message('INFO: uploaded') form = PDFForm(request.POST, request.FILES, instance=poster) if form.is_valid(): log_email.add_message('INFO: valid file') form.save() try: poster.generate_preview() poster.active = True poster.pub_date = date.today() poster.save() messages.success(request, USR_SUCCESS) log_email.add_message('INFO: conversion successful') return redirect('detail', slug=poster.slug) except TypeError: poster.active = False poster.save() logger.exception('ERR: failed to convert PDF (id %s) -- likely multi-page document' % poster.pk) messages.error(request, USR_FAILED_MULTIPAGE) log_email.add_message('ERR: conversion failed -- likely multi-page document') except: poster.active = False poster.save() logger.exception('ERR: failed to convert PDF (id %s)' % poster.pk) messages.warning(request, USR_FAILED) log_email.add_message('ERR: conversion failed') return redirect('detail', slug=poster.slug) else: log_email.add_message('ERR: invalid file') messages.error(request, USR_INVALID_FILE) finally: caches['index'].clear() log_email.send() form.active = False return render(request, 'pages/upload.html', {'form': form, 'poster': poster}) @cache_page(3600, cache='default') def sitemap(request): poster_list = Poster.objects.filter(active=True).order_by('-pub_date') return render(request, 'sitemap.xml', {'poster_list': poster_list}, content_type='text/xml') def rss(request): pass
posters/views.py
from django.conf import settings from django.shortcuts import render, get_object_or_404, redirect from django.http import HttpResponse from django.contrib import messages from django.core.cache import caches from django.views.decorators.cache import cache_page from django.contrib.postgres.search import SearchVector from datetime import date import time import logging from .models import Poster, Conference from .forms import PDFForm from .utils import email_log logger = logging.getLogger(__name__) USR_FAILED = "Your poster was uploaded successfully, but we had trouble converting it. We will look into it and activate your poster within the next few hours." USR_FAILED_MULTIPAGE = "It looks like you might have uploaded a multi-page document. We can only handle single page posters, at the moment." USR_SUCCESS = "Your poster was uploaded successfully! It will appear on the front page within a minute or two." USR_INVALID_FILE = "Please upload a valid file." USR_EXISTING_FILE = "Your poster has been uploaded already. You may update it by uploading a new file." #TODO: change to generic views @cache_page(settings.CACHE_TTL, cache='index') def index(request, conference_id=None): if conference_id is None: poster_list = Poster.objects.filter(active=True).order_by('-pub_date')[:256].prefetch_related('authors') return render(request, 'pages/index.html', {'poster_list': poster_list}) else: conference = get_object_or_404(Conference, slug=conference_id) poster_list = Poster.objects.filter(active=True, conference=conference).prefetch_related('authors') return render(request, 'pages/index.html', {'poster_list': poster_list, 'conference': conference}) def search(request): search_vector = SearchVector('title', 'conference__name', 'authors__name') poster_list = Poster.objects.annotate(search=search_vector).distinct('pk').filter(active=True, search=request.GET['q']) return render(request, 'pages/index.html', {'poster_list': poster_list, 'search': True}) def detail(request, slug): poster = get_object_or_404(Poster, slug=slug) return render(request, 'pages/detail.html', {'poster': poster}) def upload(request, access_key): poster = get_object_or_404(Poster, access_key=access_key) log_email = email_log.LogEmail(poster) form = PDFForm(instance=poster) if poster.pdf: messages.info(request, USR_EXISTING_FILE) if request.method == 'POST': try: log_email.add_message('INFO: uploaded') form = PDFForm(request.POST, request.FILES, instance=poster) if form.is_valid(): log_email.add_message('INFO: valid file') form.save() try: poster.generate_preview() poster.active = True poster.pub_date = date.today() poster.save() messages.success(request, USR_SUCCESS) log_email.add_message('INFO: conversion successful') return redirect('detail', slug=poster.slug) except TypeError: poster.active = False poster.save() logger.exception('ERR: failed to convert PDF (id %s) -- likely multi-page document' % poster.pk) messages.error(request, USR_FAILED_MULTIPAGE) log_email.add_message('ERR: conversion failed -- likely multi-page document') except: poster.active = False poster.save() logger.exception('ERR: failed to convert PDF (id %s)' % poster.pk) messages.warning(request, USR_FAILED) log_email.add_message('ERR: conversion failed') return redirect('detail', slug=poster.slug) else: log_email.add_message('ERR: invalid file') messages.error(request, USR_INVALID_FILE) finally: caches['index'].clear() log_email.send() form.active = False return render(request, 'pages/upload.html', {'form': form, 'poster': poster}) @cache_page(3600, cache='default') def sitemap(request): poster_list = Poster.objects.filter(active=True).order_by('-pub_date') return render(request, 'sitemap.xml', {'poster_list': poster_list}, content_type='text/xml') def rss(request): pass
0.216674
0.061819
import os import warnings import dj_database_url import raven import yaml from django.urls import reverse_lazy from promgen.plugins import apps_from_setuptools from promgen.version import __version__ # Build paths inside the project like this: os.path.join(BASE_DIR, ...) BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) CONFIG_DIR = os.environ['CONFIG_DIR'] # Quick-start development settings - unsuitable for production # See https://docs.djangoproject.com/en/1.10/howto/deployment/checklist/ # SECURITY WARNING: keep the secret key used in production secret! SECRET_KEY = os.environ.get('SECRET_KEY') if not SECRET_KEY: warnings.warn('Unset SECRET_KEY setting to random for now') # Taken from Django's generation function from django.utils.crypto import get_random_string SECRET_KEY = get_random_string(50, '<KEY>@#$%^&*(-_=+)') # SECURITY WARNING: don't run with debug turned on in production! DEBUG = os.path.exists(os.path.join(CONFIG_DIR, 'DEBUG')) # Settings for Prometheus paths and such PROMGEN_CONFIG = os.path.join(CONFIG_DIR, 'promgen.yml') if os.path.exists(PROMGEN_CONFIG): with open(PROMGEN_CONFIG) as fp: PROMGEN = yaml.load(fp) else: PROMGEN = {} ALLOWED_HOSTS = ['*'] # Application definition INSTALLED_APPS = apps_from_setuptools + [ 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.sites', 'django.contrib.staticfiles', 'social_django', 'promgen', ] MIDDLEWARE = [ 'django.middleware.security.SecurityMiddleware', 'django.middleware.locale.LocaleMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', 'promgen.middleware.PromgenMiddleware', ] SOCIAL_AUTH_RAISE_EXCEPTIONS = DEBUG LOGIN_URL = reverse_lazy('login') LOGIN_REDIRECT_URL = reverse_lazy('home') LOGOUT_REDIRECT_URL = reverse_lazy('home') ROOT_URLCONF = 'promgen.urls' TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': [], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.contrib.messages.context_processors.messages', 'promgen.context_processors.settings_in_view', 'social_django.context_processors.backends', 'social_django.context_processors.login_redirect', ], }, }, ] WSGI_APPLICATION = 'promgen.wsgi.application' # Database # https://docs.djangoproject.com/en/1.10/ref/settings/#databases DATABASES = {'default': dj_database_url.config( env='DATABASE_URL', default='sqlite:///' + os.path.join(BASE_DIR, 'db.sqlite3') )} # Password validation # https://docs.djangoproject.com/en/1.10/ref/settings/#auth-password-validators AUTH_PASSWORD_VALIDATORS = [ { 'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator', }, { 'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator', }, { 'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator', }, { 'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator', }, ] # Internationalization # https://docs.djangoproject.com/en/1.10/topics/i18n/ LANGUAGE_CODE = 'en-us' TIME_ZONE = 'UTC' USE_I18N = True USE_L10N = True USE_TZ = True # Static files (CSS, JavaScript, Images) # https://docs.djangoproject.com/en/1.10/howto/static-files/ STATIC_URL = '/static/' STATIC_ROOT = os.path.expanduser('~/.cache/promgen') SITE_ID = 1 TEST_RUNNER = 'django_nose.NoseTestSuiteRunner' if 'SENTRY_DSN' in os.environ: INSTALLED_APPS += ['raven.contrib.django.raven_compat'] try: _RELEASE = raven.fetch_git_sha(BASE_DIR) except: _RELEASE = __version__ RAVEN_CONFIG = { 'dsn': os.environ['SENTRY_DSN'], 'release': _RELEASE, } LOGGING = { 'version': 1, 'disable_existing_loggers': False, 'handlers': { 'sentry': { 'level': 'ERROR', 'class': 'raven.contrib.django.raven_compat.handlers.SentryHandler', 'dsn': os.environ['SENTRY_DSN'], }, }, 'loggers': { '': { 'handlers': ['sentry'], 'level': 'ERROR', 'propagate': True, }, }, } # If CELERY_BROKER_URL is set in our environment, then we configure celery as # expected. If it is not configured, then we set CELERY_TASK_ALWAYS_EAGER to # force celery to run all tasks in the same process (effectively runs each task # as a normal function) if 'CELERY_BROKER_URL' in os.environ: CELERY_BROKER_URL = os.environ.get('CELERY_BROKER_URL') else: CELERY_TASK_ALWAYS_EAGER = True if DEBUG: try: import debug_toolbar # NOQA INSTALLED_APPS += ['debug_toolbar'] MIDDLEWARE = ['debug_toolbar.middleware.DebugToolbarMiddleware'] + MIDDLEWARE INTERNAL_IPS = ['127.0.0.1'] except: pass # Load overrides from PROMGEN to replace Django settings for k, v in PROMGEN.pop('django', {}).items(): globals()[k] = v
promgen/settings.py
import os import warnings import dj_database_url import raven import yaml from django.urls import reverse_lazy from promgen.plugins import apps_from_setuptools from promgen.version import __version__ # Build paths inside the project like this: os.path.join(BASE_DIR, ...) BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) CONFIG_DIR = os.environ['CONFIG_DIR'] # Quick-start development settings - unsuitable for production # See https://docs.djangoproject.com/en/1.10/howto/deployment/checklist/ # SECURITY WARNING: keep the secret key used in production secret! SECRET_KEY = os.environ.get('SECRET_KEY') if not SECRET_KEY: warnings.warn('Unset SECRET_KEY setting to random for now') # Taken from Django's generation function from django.utils.crypto import get_random_string SECRET_KEY = get_random_string(50, '<KEY>@#$%^&*(-_=+)') # SECURITY WARNING: don't run with debug turned on in production! DEBUG = os.path.exists(os.path.join(CONFIG_DIR, 'DEBUG')) # Settings for Prometheus paths and such PROMGEN_CONFIG = os.path.join(CONFIG_DIR, 'promgen.yml') if os.path.exists(PROMGEN_CONFIG): with open(PROMGEN_CONFIG) as fp: PROMGEN = yaml.load(fp) else: PROMGEN = {} ALLOWED_HOSTS = ['*'] # Application definition INSTALLED_APPS = apps_from_setuptools + [ 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.sites', 'django.contrib.staticfiles', 'social_django', 'promgen', ] MIDDLEWARE = [ 'django.middleware.security.SecurityMiddleware', 'django.middleware.locale.LocaleMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', 'promgen.middleware.PromgenMiddleware', ] SOCIAL_AUTH_RAISE_EXCEPTIONS = DEBUG LOGIN_URL = reverse_lazy('login') LOGIN_REDIRECT_URL = reverse_lazy('home') LOGOUT_REDIRECT_URL = reverse_lazy('home') ROOT_URLCONF = 'promgen.urls' TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': [], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.contrib.messages.context_processors.messages', 'promgen.context_processors.settings_in_view', 'social_django.context_processors.backends', 'social_django.context_processors.login_redirect', ], }, }, ] WSGI_APPLICATION = 'promgen.wsgi.application' # Database # https://docs.djangoproject.com/en/1.10/ref/settings/#databases DATABASES = {'default': dj_database_url.config( env='DATABASE_URL', default='sqlite:///' + os.path.join(BASE_DIR, 'db.sqlite3') )} # Password validation # https://docs.djangoproject.com/en/1.10/ref/settings/#auth-password-validators AUTH_PASSWORD_VALIDATORS = [ { 'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator', }, { 'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator', }, { 'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator', }, { 'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator', }, ] # Internationalization # https://docs.djangoproject.com/en/1.10/topics/i18n/ LANGUAGE_CODE = 'en-us' TIME_ZONE = 'UTC' USE_I18N = True USE_L10N = True USE_TZ = True # Static files (CSS, JavaScript, Images) # https://docs.djangoproject.com/en/1.10/howto/static-files/ STATIC_URL = '/static/' STATIC_ROOT = os.path.expanduser('~/.cache/promgen') SITE_ID = 1 TEST_RUNNER = 'django_nose.NoseTestSuiteRunner' if 'SENTRY_DSN' in os.environ: INSTALLED_APPS += ['raven.contrib.django.raven_compat'] try: _RELEASE = raven.fetch_git_sha(BASE_DIR) except: _RELEASE = __version__ RAVEN_CONFIG = { 'dsn': os.environ['SENTRY_DSN'], 'release': _RELEASE, } LOGGING = { 'version': 1, 'disable_existing_loggers': False, 'handlers': { 'sentry': { 'level': 'ERROR', 'class': 'raven.contrib.django.raven_compat.handlers.SentryHandler', 'dsn': os.environ['SENTRY_DSN'], }, }, 'loggers': { '': { 'handlers': ['sentry'], 'level': 'ERROR', 'propagate': True, }, }, } # If CELERY_BROKER_URL is set in our environment, then we configure celery as # expected. If it is not configured, then we set CELERY_TASK_ALWAYS_EAGER to # force celery to run all tasks in the same process (effectively runs each task # as a normal function) if 'CELERY_BROKER_URL' in os.environ: CELERY_BROKER_URL = os.environ.get('CELERY_BROKER_URL') else: CELERY_TASK_ALWAYS_EAGER = True if DEBUG: try: import debug_toolbar # NOQA INSTALLED_APPS += ['debug_toolbar'] MIDDLEWARE = ['debug_toolbar.middleware.DebugToolbarMiddleware'] + MIDDLEWARE INTERNAL_IPS = ['127.0.0.1'] except: pass # Load overrides from PROMGEN to replace Django settings for k, v in PROMGEN.pop('django', {}).items(): globals()[k] = v
0.331444
0.059401
import re import csv import hashlib import numpy as np from .errors import AnnotationsError GENESETS_TIDYCSV_HEADER = [ "gene_set_description", "gene_set_name", "differential_expression" ] def read_gene_sets_tidycsv(gs_locator, context=None): """ Read & parse the Tidy CSV format, applying validation checks for mandatory values, and de-duping rules. Format is a four-column CSV, with a mandatory header row, and optional "#" prefixed comments. Format: gene_set_name, gene_set_description, gene_symbol, gene_description gene_set_name must be non-null; others are optional. Returns: a dictionary of the shape (values in angle-brackets vary): { <string, a gene set name>: { "geneset_name": <string, a gene set name>, "geneset_description": <a string or None>, "genes": [ { "gene_symbol": <string, a gene symbol or name>, "gene_description": <a string or None> }, ... ] }, ... } """ class myDialect(csv.excel): skipinitialspace = False gene_sets = {} with gs_locator.local_handle() as fname: header_read = False with open(fname, newline="") as f: reader = csv.reader(f, dialect=myDialect()) for row in reader: if len(row) <= 3 or not header_read: header_read = True continue geneset_description, geneset_name, diffExp = row[:3] x = "//;;//" if (diffExp=="TRUE" or diffExp == "True" or diffExp == "true") else "" geneset_description+=x gene_symbols = row[3:] try: gene_symbols = gene_symbols[:gene_symbols.index("")] except: pass if geneset_description in gene_sets: gs = gene_sets[geneset_description] else: gs = gene_sets[geneset_description] = {} if geneset_name in gs: gene_symbols = list(set(gene_symbols).union(gs[geneset_name])) gs[geneset_name] = gene_symbols return gene_sets def write_gene_sets_tidycsv(f, genesets): """ Convert the internal gene sets format (returned by read_gene_set_tidycsv) into the simple Tidy CSV. """ writer = csv.writer(f, dialect="excel") writer.writerow(GENESETS_TIDYCSV_HEADER) for k1 in genesets.keys(): for k2 in genesets[k1].keys(): genes = genesets[k1].get(k2,None) k3 ='__DEG__' in k1 knew = k1.split('__DEG__')[0] if not genes: writer.writerow([knew, k2, k3]) else: writer.writerow([knew, k2, k3]+genes) def summarizeQueryHash(raw_query): """ generate a cache key (hash) from the raw query string """ return hashlib.sha1(raw_query).hexdigest() def validate_gene_sets(genesets, var_names, context=None): """ Check validity of gene sets, return if correct, else raise error. May also modify the gene set for conditions that should be resolved, but which do not warrant a hard error. Argument gene sets may be either the REST OTA format (list of dicts) or the internal format (dict of dicts, keyed by the gene set name). Will return a modified gene sets (eg, remove warnings) of the same type as the provided argument. Ie, dict->dict, list->list Rules: 0. All gene set names must be unique. [error] 1. Gene set names must conform to the following: [error] * Names must be comprised of 1 or more ASCII characters 32-126 * No leading or trailing spaces (ASCII 32) * No multi-space (ASCII 32) runs 2. Gene symbols must be part of the current var_index. [warning] If gene symbol is not in the var_index, generate a warning and remove the symbol from the gene sets. 3. Gene symbols must not be duplicated in a gene set. [warning] Duplications will be silently de-duped. Items marked [error] will generate a hard error, causing the validation to fail. Items marked [warning] will generate a warning, and will be resolved without failing the validation (typically by removing the offending item from the gene sets). """ messagefn = context["messagefn"] if context else (lambda x: None) # accept genesets args as either the internal (dict) or REST (list) format, # as they are identical except for the dict being keyed by geneset_name. if not isinstance(genesets, dict): raise ValueError("Gene sets must be a dict.") for k1 in genesets.keys(): for name in genesets[k1].keys(): if type(name) != str or len(name) == 0: raise KeyError("Gene set names must be non-null string.") for k1 in genesets.keys(): for k2 in genesets[k1].keys(): genes = genesets[k1][k2] if not isinstance(genes, list): raise ValueError("Gene set genes field must be a list") gene_symbol_already_seen = set() new_genes = [] for gene_symbol in genes: if not isinstance(gene_symbol, str) or len(gene_symbol) == 0: raise ValueError("Gene symbol must be non-null string.") if gene_symbol in gene_symbol_already_seen: # duplicate check messagefn( f"Warning: a duplicate of gene {gene_symbol} was found in gene set {k1}:{k2}, " "and will be ignored." ) continue if gene_symbol not in var_names: messagefn( f"Warning: {gene_symbol}, used in gene set {k1}:{k2}, " "was not found in the dataset and will be ignored." ) continue gene_symbol_already_seen.add(gene_symbol) new_genes.append(gene_symbol) genesets[k1][k2] = new_genes return genesets
backend/common/genesets.py
import re import csv import hashlib import numpy as np from .errors import AnnotationsError GENESETS_TIDYCSV_HEADER = [ "gene_set_description", "gene_set_name", "differential_expression" ] def read_gene_sets_tidycsv(gs_locator, context=None): """ Read & parse the Tidy CSV format, applying validation checks for mandatory values, and de-duping rules. Format is a four-column CSV, with a mandatory header row, and optional "#" prefixed comments. Format: gene_set_name, gene_set_description, gene_symbol, gene_description gene_set_name must be non-null; others are optional. Returns: a dictionary of the shape (values in angle-brackets vary): { <string, a gene set name>: { "geneset_name": <string, a gene set name>, "geneset_description": <a string or None>, "genes": [ { "gene_symbol": <string, a gene symbol or name>, "gene_description": <a string or None> }, ... ] }, ... } """ class myDialect(csv.excel): skipinitialspace = False gene_sets = {} with gs_locator.local_handle() as fname: header_read = False with open(fname, newline="") as f: reader = csv.reader(f, dialect=myDialect()) for row in reader: if len(row) <= 3 or not header_read: header_read = True continue geneset_description, geneset_name, diffExp = row[:3] x = "//;;//" if (diffExp=="TRUE" or diffExp == "True" or diffExp == "true") else "" geneset_description+=x gene_symbols = row[3:] try: gene_symbols = gene_symbols[:gene_symbols.index("")] except: pass if geneset_description in gene_sets: gs = gene_sets[geneset_description] else: gs = gene_sets[geneset_description] = {} if geneset_name in gs: gene_symbols = list(set(gene_symbols).union(gs[geneset_name])) gs[geneset_name] = gene_symbols return gene_sets def write_gene_sets_tidycsv(f, genesets): """ Convert the internal gene sets format (returned by read_gene_set_tidycsv) into the simple Tidy CSV. """ writer = csv.writer(f, dialect="excel") writer.writerow(GENESETS_TIDYCSV_HEADER) for k1 in genesets.keys(): for k2 in genesets[k1].keys(): genes = genesets[k1].get(k2,None) k3 ='__DEG__' in k1 knew = k1.split('__DEG__')[0] if not genes: writer.writerow([knew, k2, k3]) else: writer.writerow([knew, k2, k3]+genes) def summarizeQueryHash(raw_query): """ generate a cache key (hash) from the raw query string """ return hashlib.sha1(raw_query).hexdigest() def validate_gene_sets(genesets, var_names, context=None): """ Check validity of gene sets, return if correct, else raise error. May also modify the gene set for conditions that should be resolved, but which do not warrant a hard error. Argument gene sets may be either the REST OTA format (list of dicts) or the internal format (dict of dicts, keyed by the gene set name). Will return a modified gene sets (eg, remove warnings) of the same type as the provided argument. Ie, dict->dict, list->list Rules: 0. All gene set names must be unique. [error] 1. Gene set names must conform to the following: [error] * Names must be comprised of 1 or more ASCII characters 32-126 * No leading or trailing spaces (ASCII 32) * No multi-space (ASCII 32) runs 2. Gene symbols must be part of the current var_index. [warning] If gene symbol is not in the var_index, generate a warning and remove the symbol from the gene sets. 3. Gene symbols must not be duplicated in a gene set. [warning] Duplications will be silently de-duped. Items marked [error] will generate a hard error, causing the validation to fail. Items marked [warning] will generate a warning, and will be resolved without failing the validation (typically by removing the offending item from the gene sets). """ messagefn = context["messagefn"] if context else (lambda x: None) # accept genesets args as either the internal (dict) or REST (list) format, # as they are identical except for the dict being keyed by geneset_name. if not isinstance(genesets, dict): raise ValueError("Gene sets must be a dict.") for k1 in genesets.keys(): for name in genesets[k1].keys(): if type(name) != str or len(name) == 0: raise KeyError("Gene set names must be non-null string.") for k1 in genesets.keys(): for k2 in genesets[k1].keys(): genes = genesets[k1][k2] if not isinstance(genes, list): raise ValueError("Gene set genes field must be a list") gene_symbol_already_seen = set() new_genes = [] for gene_symbol in genes: if not isinstance(gene_symbol, str) or len(gene_symbol) == 0: raise ValueError("Gene symbol must be non-null string.") if gene_symbol in gene_symbol_already_seen: # duplicate check messagefn( f"Warning: a duplicate of gene {gene_symbol} was found in gene set {k1}:{k2}, " "and will be ignored." ) continue if gene_symbol not in var_names: messagefn( f"Warning: {gene_symbol}, used in gene set {k1}:{k2}, " "was not found in the dataset and will be ignored." ) continue gene_symbol_already_seen.add(gene_symbol) new_genes.append(gene_symbol) genesets[k1][k2] = new_genes return genesets
0.580709
0.475118
from typing import List, Dict, Any from pydantic import ValidationError from starlette.exceptions import HTTPException from robot_server.service.json_api.errors import ErrorResponse, Error, \ ErrorSource class V1HandlerError(Exception): """An exception raised in order to produce a V1BasicResponse response""" def __init__(self, status_code, message): self.status_code = status_code self.message = message class RobotServerError(Exception): def __init__(self, status_code: int, error: Error): self.status_code = status_code self.error = error def transform_http_exception_to_json_api_errors(exception: HTTPException) \ -> ErrorResponse: """ Object marshalling for http exceptions (these errors come back differently than validation errors). e.g. invalid json in request body. """ request_error = Error( status=str(exception.status_code), detail=exception.detail, title='Bad Request' ) return ErrorResponse(errors=[request_error]) def transform_validation_error_to_json_api_errors( status_code: int, exception: ValidationError ) -> ErrorResponse: """ Object marshalling for validation errors. format pydantic validation errors to expected json:api response shape. """ def transform_error(error): return Error( status=str(status_code), detail=error.get('msg'), source=ErrorSource(pointer='/' + '/'.join( str(node) for node in error['loc'])), title=error.get('type') ) return ErrorResponse( errors=[transform_error(error) for error in exception.errors()] ) def consolidate_fastapi_response(all_exceptions: List[Dict[str, Any]]) -> str: """ Consolidate the default fastAPI response so it can be returned as a string. Default schema of fastAPI exception response is: { 'loc': ('body', '<outer_scope1>', '<outer_scope2>', '<inner_param>'), 'msg': '<the_error_message>', 'type': '<expected_type>' } In order to create a meaningful V1-style response, we consolidate the above response into a string of shape: '<outer_scope1>.<outer_scope2>.<inner_param>: <the_error_message>' """ # Pick just the error message while discarding v2 response items def error_to_str(error: dict) -> str: err_node = ".".join(str(loc) for loc in error['loc'] if loc != 'body') res = ": ".join([err_node, error["msg"]]) return res all_errs = ". ".join(error_to_str(exc) for exc in all_exceptions) return all_errs
robot-server/robot_server/service/errors.py
from typing import List, Dict, Any from pydantic import ValidationError from starlette.exceptions import HTTPException from robot_server.service.json_api.errors import ErrorResponse, Error, \ ErrorSource class V1HandlerError(Exception): """An exception raised in order to produce a V1BasicResponse response""" def __init__(self, status_code, message): self.status_code = status_code self.message = message class RobotServerError(Exception): def __init__(self, status_code: int, error: Error): self.status_code = status_code self.error = error def transform_http_exception_to_json_api_errors(exception: HTTPException) \ -> ErrorResponse: """ Object marshalling for http exceptions (these errors come back differently than validation errors). e.g. invalid json in request body. """ request_error = Error( status=str(exception.status_code), detail=exception.detail, title='Bad Request' ) return ErrorResponse(errors=[request_error]) def transform_validation_error_to_json_api_errors( status_code: int, exception: ValidationError ) -> ErrorResponse: """ Object marshalling for validation errors. format pydantic validation errors to expected json:api response shape. """ def transform_error(error): return Error( status=str(status_code), detail=error.get('msg'), source=ErrorSource(pointer='/' + '/'.join( str(node) for node in error['loc'])), title=error.get('type') ) return ErrorResponse( errors=[transform_error(error) for error in exception.errors()] ) def consolidate_fastapi_response(all_exceptions: List[Dict[str, Any]]) -> str: """ Consolidate the default fastAPI response so it can be returned as a string. Default schema of fastAPI exception response is: { 'loc': ('body', '<outer_scope1>', '<outer_scope2>', '<inner_param>'), 'msg': '<the_error_message>', 'type': '<expected_type>' } In order to create a meaningful V1-style response, we consolidate the above response into a string of shape: '<outer_scope1>.<outer_scope2>.<inner_param>: <the_error_message>' """ # Pick just the error message while discarding v2 response items def error_to_str(error: dict) -> str: err_node = ".".join(str(loc) for loc in error['loc'] if loc != 'body') res = ": ".join([err_node, error["msg"]]) return res all_errs = ". ".join(error_to_str(exc) for exc in all_exceptions) return all_errs
0.857186
0.196209
import time import grovepi class Grove4DigitDisplay: def __init__(self, pin = 5): """ initialize 4 digit display at pin = 5 by default connect to grovePi port D5 """ self.display = pin grovepi.pinMode(self.display, "OUTPUT") grovepi.fourDigit_init(self.display) def setBrightness(self, value = 0): """ set brightness of the 4 digit display 0 - 8 brightness set to 0 by default """ grovepi.fourDigit_brightness(self.display, value) def setNumber(self, value = 0, leading_zero = 1): """ display a number on 4 digit display by default display number 0 without leading zeroes """ grovepi.fourDigit_number(self.display, value, leading_zero) def setDigit(self, position = 0, digit = 0): """ set a particular digit at a particular position position 0 - 3 (0 = leftmost position) digit 0 - 15 (0-9A-F) by default set digit 0 at position 0 """ grovepi.fourDigit_digit(self.display, position, digit) def setScore(self, left_score = 0, right_score = 0): """ display score , i.e two 2 digit values separated by : by default display 00:00 """ grovepi.fourDigit_score(self.display, left_score, right_score) def monitorAnalog(self, pin = 0 , seconds = 0): """ monitor and display the value of an analog pin for some nuber of seconds by default monitor analog pin 0 for 0 seconds """ grovepi.fourDigit_monitor(self.display, pin, seconds) def allOn(self): """ switch all lights on """ grovepi.fourDigit_on(self.display) def allOff(self): """ switch all lights off """ grovepi.fourDigit_off(self.display) if __name__ == "__main__": print "initialize" four_digit_display = Grove4DigitDisplay() print "set brightness" four_digit_display.setBrightness() while True: print "set number 5 without leading zeros" four_digit_display.setNumber(5, 1) time.sleep(0.5) print "set number 5 with leading zeros" four_digit_display.setNumber(5, 0) time.sleep(0.5) print "set digits ABCD" four_digit_display.setDigit(0, 10) #A four_digit_display.setDigit(1, 11) #B four_digit_display.setDigit(2, 12) #C four_digit_display.setDigit(3, 13) #D time.sleep(0.5) print "set score 07:03" four_digit_display.setScore(7, 3) time.sleep(0.5) print "turn all lights on" four_digit_display.allOn() time.sleep(0.5) print "turn all lights off" four_digit_display.allOff() time.sleep(0.5) print "done"
cloudmesh/pi/grove_4_digit_display.py
import time import grovepi class Grove4DigitDisplay: def __init__(self, pin = 5): """ initialize 4 digit display at pin = 5 by default connect to grovePi port D5 """ self.display = pin grovepi.pinMode(self.display, "OUTPUT") grovepi.fourDigit_init(self.display) def setBrightness(self, value = 0): """ set brightness of the 4 digit display 0 - 8 brightness set to 0 by default """ grovepi.fourDigit_brightness(self.display, value) def setNumber(self, value = 0, leading_zero = 1): """ display a number on 4 digit display by default display number 0 without leading zeroes """ grovepi.fourDigit_number(self.display, value, leading_zero) def setDigit(self, position = 0, digit = 0): """ set a particular digit at a particular position position 0 - 3 (0 = leftmost position) digit 0 - 15 (0-9A-F) by default set digit 0 at position 0 """ grovepi.fourDigit_digit(self.display, position, digit) def setScore(self, left_score = 0, right_score = 0): """ display score , i.e two 2 digit values separated by : by default display 00:00 """ grovepi.fourDigit_score(self.display, left_score, right_score) def monitorAnalog(self, pin = 0 , seconds = 0): """ monitor and display the value of an analog pin for some nuber of seconds by default monitor analog pin 0 for 0 seconds """ grovepi.fourDigit_monitor(self.display, pin, seconds) def allOn(self): """ switch all lights on """ grovepi.fourDigit_on(self.display) def allOff(self): """ switch all lights off """ grovepi.fourDigit_off(self.display) if __name__ == "__main__": print "initialize" four_digit_display = Grove4DigitDisplay() print "set brightness" four_digit_display.setBrightness() while True: print "set number 5 without leading zeros" four_digit_display.setNumber(5, 1) time.sleep(0.5) print "set number 5 with leading zeros" four_digit_display.setNumber(5, 0) time.sleep(0.5) print "set digits ABCD" four_digit_display.setDigit(0, 10) #A four_digit_display.setDigit(1, 11) #B four_digit_display.setDigit(2, 12) #C four_digit_display.setDigit(3, 13) #D time.sleep(0.5) print "set score 07:03" four_digit_display.setScore(7, 3) time.sleep(0.5) print "turn all lights on" four_digit_display.allOn() time.sleep(0.5) print "turn all lights off" four_digit_display.allOff() time.sleep(0.5) print "done"
0.39036
0.548915
from typing import ( Optional, Tuple, ) import numpy as np from packaging import version from pandas.core.exchange.dataframe_protocol import ( Buffer, DlpackDeviceType, ) _NUMPY_HAS_DLPACK = version.parse(np.__version__) >= version.parse("1.22.0") class PandasBuffer(Buffer): """ Data in the buffer is guaranteed to be contiguous in memory. """ def __init__(self, x: np.ndarray, allow_copy: bool = True) -> None: """ Handle only regular columns (= numpy arrays) for now. """ if not x.strides == (x.dtype.itemsize,): # The protocol does not support strided buffers, so a copy is # necessary. If that's not allowed, we need to raise an exception. if allow_copy: x = x.copy() else: raise RuntimeError( "Exports cannot be zero-copy in the case " "of a non-contiguous buffer" ) # Store the numpy array in which the data resides as a private # attribute, so we can use it to retrieve the public attributes self._x = x @property def bufsize(self) -> int: """ Buffer size in bytes. """ return self._x.size * self._x.dtype.itemsize @property def ptr(self) -> int: """ Pointer to start of the buffer as an integer. """ return self._x.__array_interface__["data"][0] def __dlpack__(self): """ Represent this structure as DLPack interface. """ if _NUMPY_HAS_DLPACK: return self._x.__dlpack__() raise NotImplementedError("__dlpack__") def __dlpack_device__(self) -> Tuple[DlpackDeviceType, Optional[int]]: """ Device type and device ID for where the data in the buffer resides. """ return (DlpackDeviceType.CPU, None) def __repr__(self) -> str: return ( "PandasBuffer(" + str( { "bufsize": self.bufsize, "ptr": self.ptr, "device": self.__dlpack_device__()[0].name, } ) + ")" )
pandas/core/exchange/buffer.py
from typing import ( Optional, Tuple, ) import numpy as np from packaging import version from pandas.core.exchange.dataframe_protocol import ( Buffer, DlpackDeviceType, ) _NUMPY_HAS_DLPACK = version.parse(np.__version__) >= version.parse("1.22.0") class PandasBuffer(Buffer): """ Data in the buffer is guaranteed to be contiguous in memory. """ def __init__(self, x: np.ndarray, allow_copy: bool = True) -> None: """ Handle only regular columns (= numpy arrays) for now. """ if not x.strides == (x.dtype.itemsize,): # The protocol does not support strided buffers, so a copy is # necessary. If that's not allowed, we need to raise an exception. if allow_copy: x = x.copy() else: raise RuntimeError( "Exports cannot be zero-copy in the case " "of a non-contiguous buffer" ) # Store the numpy array in which the data resides as a private # attribute, so we can use it to retrieve the public attributes self._x = x @property def bufsize(self) -> int: """ Buffer size in bytes. """ return self._x.size * self._x.dtype.itemsize @property def ptr(self) -> int: """ Pointer to start of the buffer as an integer. """ return self._x.__array_interface__["data"][0] def __dlpack__(self): """ Represent this structure as DLPack interface. """ if _NUMPY_HAS_DLPACK: return self._x.__dlpack__() raise NotImplementedError("__dlpack__") def __dlpack_device__(self) -> Tuple[DlpackDeviceType, Optional[int]]: """ Device type and device ID for where the data in the buffer resides. """ return (DlpackDeviceType.CPU, None) def __repr__(self) -> str: return ( "PandasBuffer(" + str( { "bufsize": self.bufsize, "ptr": self.ptr, "device": self.__dlpack_device__()[0].name, } ) + ")" )
0.871064
0.285339
from __future__ import absolute_import, print_function from django.utils.translation import gettext_lazy as _ from django.conf import settings from django.db import models from django.db.models.signals import post_delete from django.dispatch import receiver from model_utils.models import TimeStampedModel from rest_framework.reverse import reverse from ..files.models import RelatedFile class Portfolio(TimeStampedModel): name = models.CharField(max_length=255, help_text=_('The name of the portfolio')) creator = models.ForeignKey(settings.AUTH_USER_MODEL, on_delete=models.CASCADE, related_name='portfolios') accounts_file = models.ForeignKey(RelatedFile, on_delete=models.CASCADE, blank=True, null=True, default=None, related_name='accounts_file_portfolios') location_file = models.ForeignKey(RelatedFile, on_delete=models.CASCADE, blank=True, null=True, default=None, related_name='location_file_portfolios') reinsurance_info_file = models.ForeignKey(RelatedFile, on_delete=models.CASCADE, blank=True, null=True, default=None, related_name='reinsurance_info_file_portfolios') reinsurance_scope_file = models.ForeignKey(RelatedFile, on_delete=models.CASCADE, blank=True, null=True, default=None, related_name='reinsurance_scope_file_portfolios') def __str__(self): return self.name def get_absolute_url(self, request=None): return reverse('portfolio-detail', kwargs={'version': 'v1', 'pk': self.pk}, request=request) def get_absolute_create_analysis_url(self, request=None): return reverse('portfolio-create-analysis', kwargs={'version': 'v1', 'pk': self.pk}, request=request) def get_absolute_accounts_file_url(self, request=None): return reverse('portfolio-accounts-file', kwargs={'version': 'v1', 'pk': self.pk}, request=request) def get_absolute_location_file_url(self, request=None): return reverse('portfolio-location-file', kwargs={'version': 'v1', 'pk': self.pk}, request=request) def get_absolute_reinsurance_info_file_url(self, request=None): return reverse('portfolio-reinsurance-info-file', kwargs={'version': 'v1', 'pk': self.pk}, request=request) def get_absolute_reinsurance_scope_file_url(self, request=None): return reverse('portfolio-reinsurance-scope-file', kwargs={'version': 'v1', 'pk': self.pk}, request=request) def get_absolute_storage_url(self, request=None): return reverse('portfolio-storage-links', kwargs={'version': 'v1', 'pk': self.pk}, request=request) class PortfolioStatus(TimeStampedModel): def __str__(self): pass @receiver(post_delete, sender=Portfolio) def delete_connected_files(sender, instance, **kwargs): """ Post delete handler to clear out any dangaling analyses files """ files_for_removal = [ 'accounts_file', 'location_file', 'reinsurance_info_file', 'reinsurance_scope_file', ] for ref in files_for_removal: file_ref = getattr(instance, ref) if file_ref: file_ref.delete()
src/server/oasisapi/portfolios/models.py
from __future__ import absolute_import, print_function from django.utils.translation import gettext_lazy as _ from django.conf import settings from django.db import models from django.db.models.signals import post_delete from django.dispatch import receiver from model_utils.models import TimeStampedModel from rest_framework.reverse import reverse from ..files.models import RelatedFile class Portfolio(TimeStampedModel): name = models.CharField(max_length=255, help_text=_('The name of the portfolio')) creator = models.ForeignKey(settings.AUTH_USER_MODEL, on_delete=models.CASCADE, related_name='portfolios') accounts_file = models.ForeignKey(RelatedFile, on_delete=models.CASCADE, blank=True, null=True, default=None, related_name='accounts_file_portfolios') location_file = models.ForeignKey(RelatedFile, on_delete=models.CASCADE, blank=True, null=True, default=None, related_name='location_file_portfolios') reinsurance_info_file = models.ForeignKey(RelatedFile, on_delete=models.CASCADE, blank=True, null=True, default=None, related_name='reinsurance_info_file_portfolios') reinsurance_scope_file = models.ForeignKey(RelatedFile, on_delete=models.CASCADE, blank=True, null=True, default=None, related_name='reinsurance_scope_file_portfolios') def __str__(self): return self.name def get_absolute_url(self, request=None): return reverse('portfolio-detail', kwargs={'version': 'v1', 'pk': self.pk}, request=request) def get_absolute_create_analysis_url(self, request=None): return reverse('portfolio-create-analysis', kwargs={'version': 'v1', 'pk': self.pk}, request=request) def get_absolute_accounts_file_url(self, request=None): return reverse('portfolio-accounts-file', kwargs={'version': 'v1', 'pk': self.pk}, request=request) def get_absolute_location_file_url(self, request=None): return reverse('portfolio-location-file', kwargs={'version': 'v1', 'pk': self.pk}, request=request) def get_absolute_reinsurance_info_file_url(self, request=None): return reverse('portfolio-reinsurance-info-file', kwargs={'version': 'v1', 'pk': self.pk}, request=request) def get_absolute_reinsurance_scope_file_url(self, request=None): return reverse('portfolio-reinsurance-scope-file', kwargs={'version': 'v1', 'pk': self.pk}, request=request) def get_absolute_storage_url(self, request=None): return reverse('portfolio-storage-links', kwargs={'version': 'v1', 'pk': self.pk}, request=request) class PortfolioStatus(TimeStampedModel): def __str__(self): pass @receiver(post_delete, sender=Portfolio) def delete_connected_files(sender, instance, **kwargs): """ Post delete handler to clear out any dangaling analyses files """ files_for_removal = [ 'accounts_file', 'location_file', 'reinsurance_info_file', 'reinsurance_scope_file', ] for ref in files_for_removal: file_ref = getattr(instance, ref) if file_ref: file_ref.delete()
0.579757
0.069038
import sys import os import argparse import importlib import getpass from datetime import datetime import logging import subprocess import socket import boto3 from click import echo from drift.management.gittools import get_branch, get_commit, get_repo_url, get_git_version from drift.utils import pretty, set_pretty_settings, PRETTY_FORMATTER, PRETTY_STYLE from driftconfig.util import get_default_drift_config_and_source, ConfigNotFound from drift.flaskfactory import AppRootNotFound def get_commands(): commands = [ f[:-3] for f in os.listdir(os.path.join(os.path.dirname(__file__), "commands")) if not f.startswith("_") and f.endswith(".py") ] return commands def execute_cmd(): try: return do_execute_cmd(sys.argv[1:]) except AppRootNotFound as e: # A very common case that needs pretty printing echo(str(e)) except KeyboardInterrupt: echo(" Aborting because you said so.") def do_execute_cmd(argv): valid_commands = get_commands() parser = argparse.ArgumentParser(description="") parser.add_argument( '--tier', help="Specify which tenant to use. Will override any other settings." ) parser.add_argument( '--tenant', '-t', help="Specify which tenant to use. Will override any other settings." ) parser.add_argument( '--config', help="Specify which config source to use. Will override 'DRIFT_CONFIG_URL' environment variable." ) parser.add_argument( "--loglevel", '-l', help="Logging level name. Default is WARNING.", default='WARNING' ) parser.add_argument( '--formatter', help="Specify which formatter to use for text output. Default is {}.".format( PRETTY_FORMATTER) ) parser.add_argument( '--style', help="Specify which style to use for text output. Default is {}.".format( PRETTY_STYLE) ) parser.add_argument("-v", "--verbose", help="I am verbose!", action="store_true") subparsers = parser.add_subparsers(help="sub-command help", dest="cmd") subparsers.required = True for cmd in valid_commands: module = importlib.import_module("drift.management.commands." + cmd) subparser = subparsers.add_parser(cmd, help="Subcommands for {}".format(cmd)) if hasattr(module, "get_options"): module.get_options(subparser) subparser.set_defaults(func=module.run_command) args = parser.parse_args(argv) if args.loglevel: logging.basicConfig(level=args.loglevel) if args.config: os.environ['DRIFT_CONFIG_URL'] = args.config try: conf, source = get_default_drift_config_and_source() echo("Drift configuration source: {!r}".format(source)) except ConfigNotFound: pass set_pretty_settings(formatter=args.formatter, style=args.style) if args.tier: os.environ['DRIFT_TIER'] = args.tier echo("Tier set to {!r}.".format(args.tier)) if args.tenant: os.environ['DRIFT_DEFAULT_TENANT'] = args.tenant echo("Default tenant set to {!r}.".format(args.tenant)) if 'DRIFT_APP_ROOT' in os.environ: echo("App root set: DRIFT_APP_ROOT={!r}".format(os.environ['DRIFT_APP_ROOT'])) args.func(args) def get_app_version(): """ Return the version of the current app. It's gotten by running: python setup.py --version """ # HACK: Get app root: from drift.utils import get_app_root app_root = get_app_root() p = subprocess.Popen( [sys.executable, 'setup.py', '--version'], stdout=subprocess.PIPE, stderr=subprocess.PIPE, cwd=app_root ) out, err = p.communicate() out, err = (str(s.decode("utf-8")) for s in (out, err)) if p.returncode != 0: raise RuntimeError( "Can't get version of this deployable. Error: {} - {}".format(p.returncode, err) ) version = out.strip() return version def check_connectivity(instances): SSH_PORT = 22 for inst in instances: ip_address = inst.private_ip_address sock = socket.socket(socket.AF_INET, socket.SOCK_STREAM) sock.settimeout(2) result = sock.connect_ex((ip_address, SSH_PORT)) if result != 0: raise RuntimeError("Unable to connect to '%s'. Is your VPN connection active?" % ip_address) def get_ec2_instances(region, tier, service_name): """ Returns all EC2 instances on the specified region, tier and service. Raises an error if any of the instances are not reachable in SSH """ filters = { 'tag:service-name': service_name, "instance-state-name": "running", "tag:tier": tier, } echo("Finding ec2 instances in region {!r} from filters: {!r}".format(region, filters)) conn = boto3.client('ec2', region_name=region) reservations = conn.get_all_reservations(filters=filters) instances = [i for r in reservations for i in r.instances] if not instances: raise RuntimeError("Found no running ec2 instances in region '%s', tier '%s' and service '%s'" % (region, tier, service_name)) check_connectivity(instances) return instances def create_deployment_manifest(method, comment=None, deployable_name=None): """Returns a dict describing the current deployable.""" git_version = get_git_version() git_commit = get_commit() info = { 'method': method, 'deployable': deployable_name, 'version': get_app_version(), 'username': getpass.getuser(), 'comment': comment, 'datetime': datetime.utcnow().isoformat(), 'git_branch': get_branch(), 'git_commit': git_commit, 'git_commit_url': get_repo_url() + "/commit/" + git_commit, 'git_release': git_version['tag'] if git_version else 'untagged-branch', } return info
drift/management/__init__.py
import sys import os import argparse import importlib import getpass from datetime import datetime import logging import subprocess import socket import boto3 from click import echo from drift.management.gittools import get_branch, get_commit, get_repo_url, get_git_version from drift.utils import pretty, set_pretty_settings, PRETTY_FORMATTER, PRETTY_STYLE from driftconfig.util import get_default_drift_config_and_source, ConfigNotFound from drift.flaskfactory import AppRootNotFound def get_commands(): commands = [ f[:-3] for f in os.listdir(os.path.join(os.path.dirname(__file__), "commands")) if not f.startswith("_") and f.endswith(".py") ] return commands def execute_cmd(): try: return do_execute_cmd(sys.argv[1:]) except AppRootNotFound as e: # A very common case that needs pretty printing echo(str(e)) except KeyboardInterrupt: echo(" Aborting because you said so.") def do_execute_cmd(argv): valid_commands = get_commands() parser = argparse.ArgumentParser(description="") parser.add_argument( '--tier', help="Specify which tenant to use. Will override any other settings." ) parser.add_argument( '--tenant', '-t', help="Specify which tenant to use. Will override any other settings." ) parser.add_argument( '--config', help="Specify which config source to use. Will override 'DRIFT_CONFIG_URL' environment variable." ) parser.add_argument( "--loglevel", '-l', help="Logging level name. Default is WARNING.", default='WARNING' ) parser.add_argument( '--formatter', help="Specify which formatter to use for text output. Default is {}.".format( PRETTY_FORMATTER) ) parser.add_argument( '--style', help="Specify which style to use for text output. Default is {}.".format( PRETTY_STYLE) ) parser.add_argument("-v", "--verbose", help="I am verbose!", action="store_true") subparsers = parser.add_subparsers(help="sub-command help", dest="cmd") subparsers.required = True for cmd in valid_commands: module = importlib.import_module("drift.management.commands." + cmd) subparser = subparsers.add_parser(cmd, help="Subcommands for {}".format(cmd)) if hasattr(module, "get_options"): module.get_options(subparser) subparser.set_defaults(func=module.run_command) args = parser.parse_args(argv) if args.loglevel: logging.basicConfig(level=args.loglevel) if args.config: os.environ['DRIFT_CONFIG_URL'] = args.config try: conf, source = get_default_drift_config_and_source() echo("Drift configuration source: {!r}".format(source)) except ConfigNotFound: pass set_pretty_settings(formatter=args.formatter, style=args.style) if args.tier: os.environ['DRIFT_TIER'] = args.tier echo("Tier set to {!r}.".format(args.tier)) if args.tenant: os.environ['DRIFT_DEFAULT_TENANT'] = args.tenant echo("Default tenant set to {!r}.".format(args.tenant)) if 'DRIFT_APP_ROOT' in os.environ: echo("App root set: DRIFT_APP_ROOT={!r}".format(os.environ['DRIFT_APP_ROOT'])) args.func(args) def get_app_version(): """ Return the version of the current app. It's gotten by running: python setup.py --version """ # HACK: Get app root: from drift.utils import get_app_root app_root = get_app_root() p = subprocess.Popen( [sys.executable, 'setup.py', '--version'], stdout=subprocess.PIPE, stderr=subprocess.PIPE, cwd=app_root ) out, err = p.communicate() out, err = (str(s.decode("utf-8")) for s in (out, err)) if p.returncode != 0: raise RuntimeError( "Can't get version of this deployable. Error: {} - {}".format(p.returncode, err) ) version = out.strip() return version def check_connectivity(instances): SSH_PORT = 22 for inst in instances: ip_address = inst.private_ip_address sock = socket.socket(socket.AF_INET, socket.SOCK_STREAM) sock.settimeout(2) result = sock.connect_ex((ip_address, SSH_PORT)) if result != 0: raise RuntimeError("Unable to connect to '%s'. Is your VPN connection active?" % ip_address) def get_ec2_instances(region, tier, service_name): """ Returns all EC2 instances on the specified region, tier and service. Raises an error if any of the instances are not reachable in SSH """ filters = { 'tag:service-name': service_name, "instance-state-name": "running", "tag:tier": tier, } echo("Finding ec2 instances in region {!r} from filters: {!r}".format(region, filters)) conn = boto3.client('ec2', region_name=region) reservations = conn.get_all_reservations(filters=filters) instances = [i for r in reservations for i in r.instances] if not instances: raise RuntimeError("Found no running ec2 instances in region '%s', tier '%s' and service '%s'" % (region, tier, service_name)) check_connectivity(instances) return instances def create_deployment_manifest(method, comment=None, deployable_name=None): """Returns a dict describing the current deployable.""" git_version = get_git_version() git_commit = get_commit() info = { 'method': method, 'deployable': deployable_name, 'version': get_app_version(), 'username': getpass.getuser(), 'comment': comment, 'datetime': datetime.utcnow().isoformat(), 'git_branch': get_branch(), 'git_commit': git_commit, 'git_commit_url': get_repo_url() + "/commit/" + git_commit, 'git_release': git_version['tag'] if git_version else 'untagged-branch', } return info
0.388618
0.06216
import sys from PyQt5 import QtCore, QtGui, QtWidgets, uic import database_receita from datetime import date, datetime qt_tela_inicial = "telas/tela_gerenciar_fabricacao.ui" Ui_MainWindow, QtBaseClass = uic.loadUiType(qt_tela_inicial) class MainWindow(QtWidgets.QMainWindow, Ui_MainWindow): def __init__(self): QtWidgets.QMainWindow.__init__(self) Ui_MainWindow.__init__(self) self.setupUi(self) #CONFIG BOTOES self.btn_cancelar.pressed.connect(self.cancelar_edicao) self.btn_voltar.pressed.connect(self.fechar_tela) self.btn_editar.pressed.connect(self.editar) self.btn_excluir.pressed.connect(self.excluir_item) self.combo_status.currentIndexChanged.connect(self.carrega_fabricacoes) self.list_fabricacoes.itemDoubleClicked.connect(self.iniciar_edicao) def iniciar_edicao(self, item): item = item.text() id_fabricacao, data, _ = item.split(' - ') self.list_fabricacoes.setEnabled(False) data_fabricacao = datetime.strptime(data, '%Y/%m/%d') self.date_data.setDate(data_fabricacao) rendimento, unidade, tempo = database_receita.select_fabricacao_por_id(id_fabricacao) self.txt_rendimento.setPlaceholderText(rendimento) self.txt_rendimento.setText(rendimento) self.txt_rendimento.setEnabled(True) self.txt_unidade.setPlaceholderText(unidade) self.txt_unidade.setText(unidade) self.txt_unidade.setEnabled(True) self.spin_tempo.setValue(int(tempo)) self.spin_tempo.setEnabled(True) self.btn_editar.setEnabled(True) self.btn_excluir.setEnabled(True) self.btn_cancelar.setEnabled(True) def cancelar_edicao(self): self.list_fabricacoes.setEnabled(True) data_hoje = str(date.today()) data_hoje = QtCore.QDate.fromString(data_hoje, 'yyyy-MM-dd') self.date_data.setDate(data_hoje) self.txt_rendimento.clear() self.txt_rendimento.setPlaceholderText('') self.txt_rendimento.setEnabled(False) self.txt_unidade.clear() self.spin_tempo.setValue(0) self.spin_tempo.setEnabled(False) self.btn_editar.setEnabled(False) self.btn_excluir.setEnabled(False) self.btn_cancelar.setEnabled(False) def editar(self): id_ingrediente = str(self.combo_ingrediente.currentText()).split(' - ')[0] id_embalagem = str(self.list_embalagens.selectedItems()[0].text()).split(' - ')[0] tamanho = self.txt_tamanho.text() nome_marca = self.txt_marca.text() id_marca = database_receita.select_marca_por_nome(nome_marca) if(not database_receita.verifica_embalagem_duplicada(tamanho, id_ingrediente, id_marca)): database_receita.update_embalagem(id_embalagem, id_marca, tamanho) self.limpar() def combo_ingrediente_selecionado(self, item): try: codigo, _, unidade = str(self.combo_ingrediente.currentText()).split(' - ') self.txt_unidade.setText(unidade) self.carrega_embalagens(codigo) except: self.txt_unidade.clear() def carrega_embalagens(self, id_ingrediente): #COD - MARCA - TAMANHO - UNIDADE self.list_embalagens.clear() lista_embalagens = database_receita.select_embalagens_nomes_por_ingrediente(id_ingrediente) self.list_embalagens.addItems(lista_embalagens) def carrega_fabricacoes(self, indice): self.list_fabricacoes.clear() status = self.combo_status.itemText(indice).split(' - ')[0] if(status == 0): lista_fabricacoes = database_receita.select_fabricacoes_vendidas() lista_fabricacoes = database_receita.select_fabricacoes_por_lista_ids(lista_fabricacoes) elif(status == 1): lista_fabricacoes = database_receita.select_fabricacoes_ids() lista_fabricacoes = database_receita.select_fabricacoes_por_lista_ids(lista_fabricacoes) else: lista_fabricacoes_vendidas = database_receita.select_fabricacoes_vendidas() lista_fabricacoes_todas = database_receita.select_fabricacoes_ids() lista_fabricacoes_nao = [] for fabri in lista_fabricacoes_vendidas: if(not fabri in lista_fabricacoes_todas): lista_fabricacoes_nao.append(fabri) lista_fabricacoes = database_receita.select_fabricacoes_por_lista_ids(lista_fabricacoes_nao) print(lista_fabricacoes) self.list_fabricacoes.addItems(lista_fabricacoes) def fechar_tela(self): self.close() def limpar(self): self.list_embalagens.clear() self.cancelar_edicao() def excluir_item(self): try: item_selec = self.list_embalagens.selectedItems()[0].text() cod = item_selec.split(' - ')[0] database_receita.delete_embalagem(cod) self.carrega_tb_dados() self.cancelar_edicao() self.limpar() except: self.cancelar_edicao() self.limpar()
tela_gerenciar_fabricacao.py
import sys from PyQt5 import QtCore, QtGui, QtWidgets, uic import database_receita from datetime import date, datetime qt_tela_inicial = "telas/tela_gerenciar_fabricacao.ui" Ui_MainWindow, QtBaseClass = uic.loadUiType(qt_tela_inicial) class MainWindow(QtWidgets.QMainWindow, Ui_MainWindow): def __init__(self): QtWidgets.QMainWindow.__init__(self) Ui_MainWindow.__init__(self) self.setupUi(self) #CONFIG BOTOES self.btn_cancelar.pressed.connect(self.cancelar_edicao) self.btn_voltar.pressed.connect(self.fechar_tela) self.btn_editar.pressed.connect(self.editar) self.btn_excluir.pressed.connect(self.excluir_item) self.combo_status.currentIndexChanged.connect(self.carrega_fabricacoes) self.list_fabricacoes.itemDoubleClicked.connect(self.iniciar_edicao) def iniciar_edicao(self, item): item = item.text() id_fabricacao, data, _ = item.split(' - ') self.list_fabricacoes.setEnabled(False) data_fabricacao = datetime.strptime(data, '%Y/%m/%d') self.date_data.setDate(data_fabricacao) rendimento, unidade, tempo = database_receita.select_fabricacao_por_id(id_fabricacao) self.txt_rendimento.setPlaceholderText(rendimento) self.txt_rendimento.setText(rendimento) self.txt_rendimento.setEnabled(True) self.txt_unidade.setPlaceholderText(unidade) self.txt_unidade.setText(unidade) self.txt_unidade.setEnabled(True) self.spin_tempo.setValue(int(tempo)) self.spin_tempo.setEnabled(True) self.btn_editar.setEnabled(True) self.btn_excluir.setEnabled(True) self.btn_cancelar.setEnabled(True) def cancelar_edicao(self): self.list_fabricacoes.setEnabled(True) data_hoje = str(date.today()) data_hoje = QtCore.QDate.fromString(data_hoje, 'yyyy-MM-dd') self.date_data.setDate(data_hoje) self.txt_rendimento.clear() self.txt_rendimento.setPlaceholderText('') self.txt_rendimento.setEnabled(False) self.txt_unidade.clear() self.spin_tempo.setValue(0) self.spin_tempo.setEnabled(False) self.btn_editar.setEnabled(False) self.btn_excluir.setEnabled(False) self.btn_cancelar.setEnabled(False) def editar(self): id_ingrediente = str(self.combo_ingrediente.currentText()).split(' - ')[0] id_embalagem = str(self.list_embalagens.selectedItems()[0].text()).split(' - ')[0] tamanho = self.txt_tamanho.text() nome_marca = self.txt_marca.text() id_marca = database_receita.select_marca_por_nome(nome_marca) if(not database_receita.verifica_embalagem_duplicada(tamanho, id_ingrediente, id_marca)): database_receita.update_embalagem(id_embalagem, id_marca, tamanho) self.limpar() def combo_ingrediente_selecionado(self, item): try: codigo, _, unidade = str(self.combo_ingrediente.currentText()).split(' - ') self.txt_unidade.setText(unidade) self.carrega_embalagens(codigo) except: self.txt_unidade.clear() def carrega_embalagens(self, id_ingrediente): #COD - MARCA - TAMANHO - UNIDADE self.list_embalagens.clear() lista_embalagens = database_receita.select_embalagens_nomes_por_ingrediente(id_ingrediente) self.list_embalagens.addItems(lista_embalagens) def carrega_fabricacoes(self, indice): self.list_fabricacoes.clear() status = self.combo_status.itemText(indice).split(' - ')[0] if(status == 0): lista_fabricacoes = database_receita.select_fabricacoes_vendidas() lista_fabricacoes = database_receita.select_fabricacoes_por_lista_ids(lista_fabricacoes) elif(status == 1): lista_fabricacoes = database_receita.select_fabricacoes_ids() lista_fabricacoes = database_receita.select_fabricacoes_por_lista_ids(lista_fabricacoes) else: lista_fabricacoes_vendidas = database_receita.select_fabricacoes_vendidas() lista_fabricacoes_todas = database_receita.select_fabricacoes_ids() lista_fabricacoes_nao = [] for fabri in lista_fabricacoes_vendidas: if(not fabri in lista_fabricacoes_todas): lista_fabricacoes_nao.append(fabri) lista_fabricacoes = database_receita.select_fabricacoes_por_lista_ids(lista_fabricacoes_nao) print(lista_fabricacoes) self.list_fabricacoes.addItems(lista_fabricacoes) def fechar_tela(self): self.close() def limpar(self): self.list_embalagens.clear() self.cancelar_edicao() def excluir_item(self): try: item_selec = self.list_embalagens.selectedItems()[0].text() cod = item_selec.split(' - ')[0] database_receita.delete_embalagem(cod) self.carrega_tb_dados() self.cancelar_edicao() self.limpar() except: self.cancelar_edicao() self.limpar()
0.089338
0.112186
import json import sys import argparse import requests import datetime from markdown import markdown from weasyprint import HTML from thehive4py.api import TheHiveApi HTML_TEMPLATE = u""" <!DOCTYPE html> <html lang="en"> <head> <meta charset="utf-8"> <link rel="stylesheet" type="text/css" href="./codehilite.css"> </head> <body> {} </body> </html> """ class TheHiveExtendedApi(TheHiveApi): def get_case_tasks(self, caseId): """ :param caseId: Case identifier :return: request.response object with case tasks list """ req = self.url + "/api/case/task/_search?range=all" params = { "range": "all", "sort": "startDate" } data = { 'query': { '_parent': { '_type': 'case', '_query': { '_id': caseId } } } } try: return requests.post(req, json=data, proxies=self.proxies, auth=self.auth) except requests.exceptions.RequestException as e: sys.exit("Error: {}".format(e)) def get_task_logs(self, taskId): """ :param taskId: Task identifier :return: request.response with task log records list """ req = self.url + "/api/case/task/log/_search" params = { "range": "all", "sort": "startDate" } data = { "query": { "_and": [{ "_parent": { "_type": "case_task", "_query": { "_id": taskId } } }] } } try: return requests.post(req, json=data, params=params, proxies=self.proxies, auth=self.auth) except requests.exceptions.RequestException as e: sys.exit("Error: {}".format(e)) class TheHiveRetriever: def __init__(self, host, user, password, proxies=None): self.api = TheHiveExtendedApi(host, user, password, proxies=proxies) def fetch_case(self, case_id): case = self.api.get_case(case_id).json() title = case['title'] description = case['description'] # created_date = case['createdAt'] # severity = case['severity'] # tags = case['tags'] observables = self.fetch_observables(case_id) tasks = self.fetch_tasks(case_id) case_markdown = unicode() case_markdown += u'{}\n{}\n\n'.format(title, '---') case_markdown += u'{}\n\n'.format(description) if observables: case_markdown += observables if tasks: case_markdown += tasks return case_markdown def fetch_observables(self, case_id): obs = self.api.get_case_observables(case_id).json() if not obs: return None observables_markdown = u'## Observables\n\nData | Type | Message | Analysis\n---|---|---|---\n' for artifact in obs: observables_markdown += u'{} | {} | {} | {}'.format(artifact['data'], artifact['dataType'], artifact['message'], artifact['reports'] if artifact['reports'] else 'Not available') return observables_markdown + '\n\n' def fetch_tasks(self, case_id): tasks = self.api.get_case_tasks(case_id).json() if not tasks: return None tasks_markdown = unicode('## Tasks\n\n') for task in tasks: tasks_markdown += u'### {}\n\n'.format(task['title']) tasks_markdown += self.fetch_task_logs(task['id']) return tasks_markdown def fetch_task_logs(self, task_id): logs = self.api.get_task_logs(task_id).json() task_log_markdown = u'' for log in logs: date = datetime.datetime.utcfromtimestamp(log['startDate']/1000).strftime('%Y-%m-%dT%H:%M:%SZ') task_log_markdown += u'{} ({})\n---\n\n{}\n\n'.format( log['createdBy'], date, log['message'] ) return task_log_markdown def case_to_pdf(self, case_id, output_filename): case_md = self.fetch_case(case_id) case_html = HTML_TEMPLATE.format(markdown(case_md, output_format='html5')) with open(output_filename, "w+b") as out: HTML(string=case_html).write_pdf(out) return True if __name__ == "__main__": parser = argparse.ArgumentParser() parser.add_argument('-s', '--url', required=True, type=str, help='TheHive server URL') parser.add_argument('-u', '--user', required=True, type=str, help='Username') parser.add_argument('-p', '--password', required=True, type=str, help='User password') parser.add_argument('-c', '--case', required=True, type=str, help='Case ID, could be retrieved from case URL') parser.add_argument('-o', '--output', required=True, type=str, help='PDF output filename') args = parser.parse_args() the_hive = TheHiveRetriever(args.url, args.user, args.password) if the_hive.case_to_pdf(args.case, args.output): print("Successfully written report to {}".format(args.output))
case-to-pdf/case2pdf.py
import json import sys import argparse import requests import datetime from markdown import markdown from weasyprint import HTML from thehive4py.api import TheHiveApi HTML_TEMPLATE = u""" <!DOCTYPE html> <html lang="en"> <head> <meta charset="utf-8"> <link rel="stylesheet" type="text/css" href="./codehilite.css"> </head> <body> {} </body> </html> """ class TheHiveExtendedApi(TheHiveApi): def get_case_tasks(self, caseId): """ :param caseId: Case identifier :return: request.response object with case tasks list """ req = self.url + "/api/case/task/_search?range=all" params = { "range": "all", "sort": "startDate" } data = { 'query': { '_parent': { '_type': 'case', '_query': { '_id': caseId } } } } try: return requests.post(req, json=data, proxies=self.proxies, auth=self.auth) except requests.exceptions.RequestException as e: sys.exit("Error: {}".format(e)) def get_task_logs(self, taskId): """ :param taskId: Task identifier :return: request.response with task log records list """ req = self.url + "/api/case/task/log/_search" params = { "range": "all", "sort": "startDate" } data = { "query": { "_and": [{ "_parent": { "_type": "case_task", "_query": { "_id": taskId } } }] } } try: return requests.post(req, json=data, params=params, proxies=self.proxies, auth=self.auth) except requests.exceptions.RequestException as e: sys.exit("Error: {}".format(e)) class TheHiveRetriever: def __init__(self, host, user, password, proxies=None): self.api = TheHiveExtendedApi(host, user, password, proxies=proxies) def fetch_case(self, case_id): case = self.api.get_case(case_id).json() title = case['title'] description = case['description'] # created_date = case['createdAt'] # severity = case['severity'] # tags = case['tags'] observables = self.fetch_observables(case_id) tasks = self.fetch_tasks(case_id) case_markdown = unicode() case_markdown += u'{}\n{}\n\n'.format(title, '---') case_markdown += u'{}\n\n'.format(description) if observables: case_markdown += observables if tasks: case_markdown += tasks return case_markdown def fetch_observables(self, case_id): obs = self.api.get_case_observables(case_id).json() if not obs: return None observables_markdown = u'## Observables\n\nData | Type | Message | Analysis\n---|---|---|---\n' for artifact in obs: observables_markdown += u'{} | {} | {} | {}'.format(artifact['data'], artifact['dataType'], artifact['message'], artifact['reports'] if artifact['reports'] else 'Not available') return observables_markdown + '\n\n' def fetch_tasks(self, case_id): tasks = self.api.get_case_tasks(case_id).json() if not tasks: return None tasks_markdown = unicode('## Tasks\n\n') for task in tasks: tasks_markdown += u'### {}\n\n'.format(task['title']) tasks_markdown += self.fetch_task_logs(task['id']) return tasks_markdown def fetch_task_logs(self, task_id): logs = self.api.get_task_logs(task_id).json() task_log_markdown = u'' for log in logs: date = datetime.datetime.utcfromtimestamp(log['startDate']/1000).strftime('%Y-%m-%dT%H:%M:%SZ') task_log_markdown += u'{} ({})\n---\n\n{}\n\n'.format( log['createdBy'], date, log['message'] ) return task_log_markdown def case_to_pdf(self, case_id, output_filename): case_md = self.fetch_case(case_id) case_html = HTML_TEMPLATE.format(markdown(case_md, output_format='html5')) with open(output_filename, "w+b") as out: HTML(string=case_html).write_pdf(out) return True if __name__ == "__main__": parser = argparse.ArgumentParser() parser.add_argument('-s', '--url', required=True, type=str, help='TheHive server URL') parser.add_argument('-u', '--user', required=True, type=str, help='Username') parser.add_argument('-p', '--password', required=True, type=str, help='User password') parser.add_argument('-c', '--case', required=True, type=str, help='Case ID, could be retrieved from case URL') parser.add_argument('-o', '--output', required=True, type=str, help='PDF output filename') args = parser.parse_args() the_hive = TheHiveRetriever(args.url, args.user, args.password) if the_hive.case_to_pdf(args.case, args.output): print("Successfully written report to {}".format(args.output))
0.341143
0.08043
import os import re import redis class RedisClient(object): """ Redis Client """ WIKI_AUGMENTED_DB = 3 WIKI_PAGE_DB = 4 WIKI_SEARCH_DB = 5 def __init__(self, db: int = 0, decode_responses: bool = True): """ Created: 29-May-2019 <EMAIL> Updated: 04-Dec-2019 <EMAIL> * Use CredentialsFromJson Updated: 23-Jan-2020 <EMAIL> * Honor de DB parameter even when using an url. from_url ignores its param if already specified in the url """ from ..dto import CredentialsFromJson url = None ca_file = None if 'REDIS_JSON_CREDENTIALS' in os.environ: credentials = CredentialsFromJson(os.environ['REDIS_JSON_CREDENTIALS'], 'rediss') url = credentials.url ca_file = credentials.ca_file if not url: url = 'redis://localhost:6379/0' url = re.sub(r'/\d*$', f'/{db}', url) options = { 'decode_responses': decode_responses } if url.startswith('rediss:') and ca_file: options['ssl_ca_certs'] = ca_file self.redis = redis.from_url(url, **options) self.url = CredentialsFromJson.sanitize_url(url, 'rediss') def size(self) -> int: return self.redis.dbsize() def clear(self): for key in self.redis.keys(): self.redis.delete(key) def set(self, a_key: str, value: str) -> None: self.redis.set(a_key, value) def get(self, key) -> str: return self.redis.get(key) def has(self, key) -> bool: return self.redis.exists(key) def set_list(self, a_key: str, a_list: list) -> None: if not self.has(a_key): self.redis.rpush(a_key, *a_list) def get_list(self, a_key: str) -> list: return self.redis.lrange(a_key, 0, 9999999) # I don't like this either ... def set_dict(self, a_key: str, a_dict: dict) -> None: if not self.has(a_key): self.redis.hmset(a_key, a_dict) def get_dict(self, a_key: str) -> dict: return self.redis.hgetall(a_key)
python/base/core/dmo/redis_client.py
import os import re import redis class RedisClient(object): """ Redis Client """ WIKI_AUGMENTED_DB = 3 WIKI_PAGE_DB = 4 WIKI_SEARCH_DB = 5 def __init__(self, db: int = 0, decode_responses: bool = True): """ Created: 29-May-2019 <EMAIL> Updated: 04-Dec-2019 <EMAIL> * Use CredentialsFromJson Updated: 23-Jan-2020 <EMAIL> * Honor de DB parameter even when using an url. from_url ignores its param if already specified in the url """ from ..dto import CredentialsFromJson url = None ca_file = None if 'REDIS_JSON_CREDENTIALS' in os.environ: credentials = CredentialsFromJson(os.environ['REDIS_JSON_CREDENTIALS'], 'rediss') url = credentials.url ca_file = credentials.ca_file if not url: url = 'redis://localhost:6379/0' url = re.sub(r'/\d*$', f'/{db}', url) options = { 'decode_responses': decode_responses } if url.startswith('rediss:') and ca_file: options['ssl_ca_certs'] = ca_file self.redis = redis.from_url(url, **options) self.url = CredentialsFromJson.sanitize_url(url, 'rediss') def size(self) -> int: return self.redis.dbsize() def clear(self): for key in self.redis.keys(): self.redis.delete(key) def set(self, a_key: str, value: str) -> None: self.redis.set(a_key, value) def get(self, key) -> str: return self.redis.get(key) def has(self, key) -> bool: return self.redis.exists(key) def set_list(self, a_key: str, a_list: list) -> None: if not self.has(a_key): self.redis.rpush(a_key, *a_list) def get_list(self, a_key: str) -> list: return self.redis.lrange(a_key, 0, 9999999) # I don't like this either ... def set_dict(self, a_key: str, a_dict: dict) -> None: if not self.has(a_key): self.redis.hmset(a_key, a_dict) def get_dict(self, a_key: str) -> dict: return self.redis.hgetall(a_key)
0.509276
0.1178
from fabric.api import env from fabric.api import settings from cloudferrylib.utils import cmd_cfg from cloudferrylib.utils import driver_transporter from cloudferrylib.utils import rbd_util from cloudferrylib.utils import utils LOG = utils.get_log(__name__) class SSHCephToCeph(driver_transporter.DriverTransporter): def transfer(self, data, snapshot=None, snapshot_type=1): host_src = (data.get('host_src') if data.get('host_src') else self.src_cloud.getIpSsh()) host_dst = (data.get('host_dst') if data.get('host_dst') else self.dst_cloud.getIpSsh()) with (settings(host_string=host_src, connection_attempts=env.connection_attempts), utils.forward_agent(env.key_filename)): rbd_import_diff = rbd_util.RbdUtil.rbd_import_diff_cmd ssh_cmd = cmd_cfg.ssh_cmd ssh_rbd_import_diff = ssh_cmd(host_dst, rbd_import_diff) if snapshot: process_params = [snapshot['name'], data['path_src'], '-', '-', data['path_dst']] if snapshot_type == 1: rbd_export_diff = rbd_util.RbdUtil.rbd_export_diff_snap_cmd elif snapshot_type == 2: rbd_export_diff = \ rbd_util.RbdUtil.rbd_export_diff_from_snap_cmd process_params.insert(0, snapshot['prev_snapname']) elif snapshot_type == 3: rbd_export_diff = rbd_util.RbdUtil.rbd_export_diff_from_cmd else: raise ValueError("Unsupported snapshot type %s", snapshot_type) else: rbd_export_diff = rbd_util.RbdUtil.rbd_export_diff_cmd process_params = [data['path_src'], '-', '-', data['path_dst']] process = rbd_export_diff >> ssh_rbd_import_diff process = process(*process_params) self.src_cloud.ssh_util.execute(process)
cloudferrylib/utils/drivers/ssh_ceph_to_ceph.py
from fabric.api import env from fabric.api import settings from cloudferrylib.utils import cmd_cfg from cloudferrylib.utils import driver_transporter from cloudferrylib.utils import rbd_util from cloudferrylib.utils import utils LOG = utils.get_log(__name__) class SSHCephToCeph(driver_transporter.DriverTransporter): def transfer(self, data, snapshot=None, snapshot_type=1): host_src = (data.get('host_src') if data.get('host_src') else self.src_cloud.getIpSsh()) host_dst = (data.get('host_dst') if data.get('host_dst') else self.dst_cloud.getIpSsh()) with (settings(host_string=host_src, connection_attempts=env.connection_attempts), utils.forward_agent(env.key_filename)): rbd_import_diff = rbd_util.RbdUtil.rbd_import_diff_cmd ssh_cmd = cmd_cfg.ssh_cmd ssh_rbd_import_diff = ssh_cmd(host_dst, rbd_import_diff) if snapshot: process_params = [snapshot['name'], data['path_src'], '-', '-', data['path_dst']] if snapshot_type == 1: rbd_export_diff = rbd_util.RbdUtil.rbd_export_diff_snap_cmd elif snapshot_type == 2: rbd_export_diff = \ rbd_util.RbdUtil.rbd_export_diff_from_snap_cmd process_params.insert(0, snapshot['prev_snapname']) elif snapshot_type == 3: rbd_export_diff = rbd_util.RbdUtil.rbd_export_diff_from_cmd else: raise ValueError("Unsupported snapshot type %s", snapshot_type) else: rbd_export_diff = rbd_util.RbdUtil.rbd_export_diff_cmd process_params = [data['path_src'], '-', '-', data['path_dst']] process = rbd_export_diff >> ssh_rbd_import_diff process = process(*process_params) self.src_cloud.ssh_util.execute(process)
0.258794
0.128662
import logging from argparse import ArgumentParser from datetime import datetime from lib.base_test import StatelessTest from lib.gtpu import GTPU from lib.utils import list_port_status from lib.xnt import analysis_report_pcap from scapy.layers.all import IP, TCP, UDP, Ether from trex_stl_lib.api import STLPktBuilder, STLStream, STLTXCont SOURCE_MAC = "00:00:00:00:00:01" DEST_MAC = "00:00:00:00:00:03" SOURCE_IP = "192.168.10.1" DEST_IP = "192.168.30.1" INNER_SRC_IP = "10.240.0.1" INNER_DEST_IP = "8.8.8.8" SENDER_PORTS = [0] INT_COLLECTPR_PORTS = [3] class IntSingleFlow(StatelessTest): @classmethod def setup_subparser(cls, parser: ArgumentParser) -> None: parser.add_argument("--duration", type=int, help="Test duration", default=5) parser.add_argument( "--mult", type=str, help="Traffic multiplier", default="1pps" ) parser.add_argument("--pkt-type", type=str, help="Packet type", default="tcp") def get_sample_packet(self, pkt_type): if pkt_type == "tcp": return Ether() / IP(src=SOURCE_IP, dst=DEST_IP) / TCP() / ("*" * 1500) elif pkt_type == "gtpu-udp": return ( Ether() / IP(src=SOURCE_IP, dst=DEST_IP) / UDP() / GTPU() / IP() / UDP() / ("*" * 1500) ) else: return Ether() / IP(src=SOURCE_IP, dst=DEST_IP) / UDP() / ("*" * 1500) def start(self, args) -> None: pkt = self.get_sample_packet(args.pkt_type) if not pkt: return 1 stream = STLStream(packet=STLPktBuilder(pkt=pkt, vm=[]), mode=STLTXCont()) logging.info("Setting up ports") self.client.add_streams(stream, ports=SENDER_PORTS) pkt_capture_limit = args.duration * 3 logging.info( "Start capturing first %s RX packet from INT collector", pkt_capture_limit ) self.client.set_service_mode(ports=INT_COLLECTPR_PORTS, enabled=True) capture = self.client.start_capture( rx_ports=INT_COLLECTPR_PORTS, limit=pkt_capture_limit, bpf_filter="udp and dst port 32766", ) logging.info( "Starting traffic, duration: %ds, throughput: %s", args.duration, args.mult ) self.client.start(ports=SENDER_PORTS, mult=args.mult, duration=args.duration) logging.info("Waiting until all traffic stop") self.client.wait_on_traffic(ports=SENDER_PORTS) logging.info("Stop capturing packet from INT collector port") output = "/tmp/int-single-flow-{}-{}.pcap".format( args.pkt_type, datetime.now().strftime("%Y%m%d-%H%M%S") ) self.client.stop_capture(capture["id"], output) analysis_report_pcap(output) list_port_status(self.client.get_stats())
trex-scripts/tests/int_single_flow.py
import logging from argparse import ArgumentParser from datetime import datetime from lib.base_test import StatelessTest from lib.gtpu import GTPU from lib.utils import list_port_status from lib.xnt import analysis_report_pcap from scapy.layers.all import IP, TCP, UDP, Ether from trex_stl_lib.api import STLPktBuilder, STLStream, STLTXCont SOURCE_MAC = "00:00:00:00:00:01" DEST_MAC = "00:00:00:00:00:03" SOURCE_IP = "192.168.10.1" DEST_IP = "192.168.30.1" INNER_SRC_IP = "10.240.0.1" INNER_DEST_IP = "8.8.8.8" SENDER_PORTS = [0] INT_COLLECTPR_PORTS = [3] class IntSingleFlow(StatelessTest): @classmethod def setup_subparser(cls, parser: ArgumentParser) -> None: parser.add_argument("--duration", type=int, help="Test duration", default=5) parser.add_argument( "--mult", type=str, help="Traffic multiplier", default="1pps" ) parser.add_argument("--pkt-type", type=str, help="Packet type", default="tcp") def get_sample_packet(self, pkt_type): if pkt_type == "tcp": return Ether() / IP(src=SOURCE_IP, dst=DEST_IP) / TCP() / ("*" * 1500) elif pkt_type == "gtpu-udp": return ( Ether() / IP(src=SOURCE_IP, dst=DEST_IP) / UDP() / GTPU() / IP() / UDP() / ("*" * 1500) ) else: return Ether() / IP(src=SOURCE_IP, dst=DEST_IP) / UDP() / ("*" * 1500) def start(self, args) -> None: pkt = self.get_sample_packet(args.pkt_type) if not pkt: return 1 stream = STLStream(packet=STLPktBuilder(pkt=pkt, vm=[]), mode=STLTXCont()) logging.info("Setting up ports") self.client.add_streams(stream, ports=SENDER_PORTS) pkt_capture_limit = args.duration * 3 logging.info( "Start capturing first %s RX packet from INT collector", pkt_capture_limit ) self.client.set_service_mode(ports=INT_COLLECTPR_PORTS, enabled=True) capture = self.client.start_capture( rx_ports=INT_COLLECTPR_PORTS, limit=pkt_capture_limit, bpf_filter="udp and dst port 32766", ) logging.info( "Starting traffic, duration: %ds, throughput: %s", args.duration, args.mult ) self.client.start(ports=SENDER_PORTS, mult=args.mult, duration=args.duration) logging.info("Waiting until all traffic stop") self.client.wait_on_traffic(ports=SENDER_PORTS) logging.info("Stop capturing packet from INT collector port") output = "/tmp/int-single-flow-{}-{}.pcap".format( args.pkt_type, datetime.now().strftime("%Y%m%d-%H%M%S") ) self.client.stop_capture(capture["id"], output) analysis_report_pcap(output) list_port_status(self.client.get_stats())
0.561696
0.110136
import backend.container_service.cluster_tools.constants from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='Tool', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('chart_name', models.CharField(max_length=128, unique=True)), ('name', models.CharField(max_length=64, verbose_name='组件名')), ('default_version', models.CharField(max_length=64, verbose_name='单个组件的默认版本')), ('default_values', models.TextField(blank=True, help_text='组件启用时需要额外设置的变量值,文本内容格式为 yaml', null=True)), ('extra_options', models.TextField(default='')), ('namespace', models.CharField(default='bcs-system', max_length=64)), ('description', models.TextField(blank=True, help_text='组件功能介绍', null=True)), ('help_link', models.CharField(blank=True, max_length=255, null=True)), ('logo', models.TextField(blank=True, null=True, verbose_name='图片 logo')), ('version', models.CharField(max_length=64, verbose_name='组件库的版本')), ], ), migrations.CreateModel( name='InstalledTool', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('creator', models.CharField(max_length=64, verbose_name='创建者')), ('updator', models.CharField(max_length=64, verbose_name='修改者')), ('created', models.DateTimeField(auto_now_add=True)), ('updated', models.DateTimeField(auto_now=True)), ('is_deleted', models.BooleanField(default=False)), ('deleted_time', models.DateTimeField(blank=True, null=True)), ('release_name', models.CharField(max_length=53)), ('project_id', models.CharField(max_length=32)), ('cluster_id', models.CharField(max_length=32)), ('chart_url', models.CharField(max_length=255)), ('values', models.TextField(blank=True, help_text='组件启用或更新时设置的变量值,文本内容格式为 yaml', null=True)), ('extra_options', models.TextField(default='')), ('namespace', models.CharField(max_length=64)), ('status', models.CharField(choices=[('pending', 'pending'), ('deployed', 'deployed'), ('failed', 'failed'), ('unknown', 'unknown')], default=backend.container_service.cluster_tools.constants.ToolStatus['PENDING'], max_length=32)), ('message', models.TextField(default='', verbose_name='记录错误信息')), ('tool', models.ForeignKey(db_constraint=False, on_delete=django.db.models.deletion.CASCADE, to='cluster_tools.tool')), ], options={ 'unique_together': {('tool', 'project_id', 'cluster_id')}, }, ), ]
bcs-ui/backend/container_service/cluster_tools/migrations/0001_initial.py
import backend.container_service.cluster_tools.constants from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='Tool', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('chart_name', models.CharField(max_length=128, unique=True)), ('name', models.CharField(max_length=64, verbose_name='组件名')), ('default_version', models.CharField(max_length=64, verbose_name='单个组件的默认版本')), ('default_values', models.TextField(blank=True, help_text='组件启用时需要额外设置的变量值,文本内容格式为 yaml', null=True)), ('extra_options', models.TextField(default='')), ('namespace', models.CharField(default='bcs-system', max_length=64)), ('description', models.TextField(blank=True, help_text='组件功能介绍', null=True)), ('help_link', models.CharField(blank=True, max_length=255, null=True)), ('logo', models.TextField(blank=True, null=True, verbose_name='图片 logo')), ('version', models.CharField(max_length=64, verbose_name='组件库的版本')), ], ), migrations.CreateModel( name='InstalledTool', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('creator', models.CharField(max_length=64, verbose_name='创建者')), ('updator', models.CharField(max_length=64, verbose_name='修改者')), ('created', models.DateTimeField(auto_now_add=True)), ('updated', models.DateTimeField(auto_now=True)), ('is_deleted', models.BooleanField(default=False)), ('deleted_time', models.DateTimeField(blank=True, null=True)), ('release_name', models.CharField(max_length=53)), ('project_id', models.CharField(max_length=32)), ('cluster_id', models.CharField(max_length=32)), ('chart_url', models.CharField(max_length=255)), ('values', models.TextField(blank=True, help_text='组件启用或更新时设置的变量值,文本内容格式为 yaml', null=True)), ('extra_options', models.TextField(default='')), ('namespace', models.CharField(max_length=64)), ('status', models.CharField(choices=[('pending', 'pending'), ('deployed', 'deployed'), ('failed', 'failed'), ('unknown', 'unknown')], default=backend.container_service.cluster_tools.constants.ToolStatus['PENDING'], max_length=32)), ('message', models.TextField(default='', verbose_name='记录错误信息')), ('tool', models.ForeignKey(db_constraint=False, on_delete=django.db.models.deletion.CASCADE, to='cluster_tools.tool')), ], options={ 'unique_together': {('tool', 'project_id', 'cluster_id')}, }, ), ]
0.416559
0.197987
import talos as ta import pandas as pd from talos.model.normalizers import lr_normalizer from keras.models import Sequential from keras.layers import Dropout, Dense from keras.optimizers import Adam, Nadam from keras.activations import softmax from keras.losses import categorical_crossentropy, logcosh x, y = ta.datasets.iris() def iris_model(x_train, y_train, x_val, y_val, params): model = Sequential() model.add(Dense(params['first_neuron'], input_dim=x_train.shape[1], activation='relu')) model.add(Dropout(params['dropout'])) model.add(Dense(y_train.shape[1], activation=params['last_activation'])) model.compile(optimizer=params['optimizer'](lr=lr_normalizer(params['lr'], params['optimizer'])), loss=params['loss'], metrics=['acc']) out = model.fit(x_train, y_train, batch_size=params['batch_size'], epochs=params['epochs'], verbose=0, validation_data=[x_val, y_val]) return out, model p = {'lr': (0.1, 10, 10), 'first_neuron':[4, 8, 16, 32, 64, 128], 'batch_size': [2, 3, 4], 'epochs': [200], 'dropout': (0, 0.40, 10), 'optimizer': [Adam, Nadam], 'loss': ['categorical_crossentropy'], 'last_activation': ['softmax'], 'weight_regulizer': [None]} h = ta.Scan(x, y, params=p, model=iris_model, dataset_name='iris', experiment_no='1', grid_downsample=.01) # accessing the results data frame print(h.data.head()) # accessing epoch entropy values for each round print(h.peak_epochs_df) # access the summary details print(h.details) # use Scan object as input r = ta.Reporting(h) # use filename as input r = ta.Reporting('iris_1.csv') # access the dataframe with the results r.data.head(-3) # get the number of rounds in the Scan r.rounds() # get the highest result ('val_acc' by default) r.high() # get the highest result for any metric r.high('acc') # get the round with the best result r.rounds2high() # get the best paramaters r.best_params() # get correlation for hyperparameters against a metric r.correlate('val_loss') # a regression plot for two dimensions r.plot_regs() # line plot r.plot_line() # up to two dimensional kernel density estimator r.plot_kde('val_acc') # a simple histogram r.plot_hist(bins=50) # heatmap correlation r.plot_corr() # a four dimensional bar grid r.plot_bars('batch_size', 'val_acc', 'first_neuron', 'lr') e = ta.Evaluate(h) e.evaluate(x, y, folds=10, average='macro') ta.Deploy(h, 'iris') iris = ta.Restore('iris.zip') # make predictions with the model iris.model.predict(x) # get the meta-data for the experiment print(iris.details) # get the hyperparameter space boundary print(iris.params) # sample of x and y data print(iris.x) print(iris.y) # the results dataframe print(iris.results)
playground/talos_reporting_sample.py
import talos as ta import pandas as pd from talos.model.normalizers import lr_normalizer from keras.models import Sequential from keras.layers import Dropout, Dense from keras.optimizers import Adam, Nadam from keras.activations import softmax from keras.losses import categorical_crossentropy, logcosh x, y = ta.datasets.iris() def iris_model(x_train, y_train, x_val, y_val, params): model = Sequential() model.add(Dense(params['first_neuron'], input_dim=x_train.shape[1], activation='relu')) model.add(Dropout(params['dropout'])) model.add(Dense(y_train.shape[1], activation=params['last_activation'])) model.compile(optimizer=params['optimizer'](lr=lr_normalizer(params['lr'], params['optimizer'])), loss=params['loss'], metrics=['acc']) out = model.fit(x_train, y_train, batch_size=params['batch_size'], epochs=params['epochs'], verbose=0, validation_data=[x_val, y_val]) return out, model p = {'lr': (0.1, 10, 10), 'first_neuron':[4, 8, 16, 32, 64, 128], 'batch_size': [2, 3, 4], 'epochs': [200], 'dropout': (0, 0.40, 10), 'optimizer': [Adam, Nadam], 'loss': ['categorical_crossentropy'], 'last_activation': ['softmax'], 'weight_regulizer': [None]} h = ta.Scan(x, y, params=p, model=iris_model, dataset_name='iris', experiment_no='1', grid_downsample=.01) # accessing the results data frame print(h.data.head()) # accessing epoch entropy values for each round print(h.peak_epochs_df) # access the summary details print(h.details) # use Scan object as input r = ta.Reporting(h) # use filename as input r = ta.Reporting('iris_1.csv') # access the dataframe with the results r.data.head(-3) # get the number of rounds in the Scan r.rounds() # get the highest result ('val_acc' by default) r.high() # get the highest result for any metric r.high('acc') # get the round with the best result r.rounds2high() # get the best paramaters r.best_params() # get correlation for hyperparameters against a metric r.correlate('val_loss') # a regression plot for two dimensions r.plot_regs() # line plot r.plot_line() # up to two dimensional kernel density estimator r.plot_kde('val_acc') # a simple histogram r.plot_hist(bins=50) # heatmap correlation r.plot_corr() # a four dimensional bar grid r.plot_bars('batch_size', 'val_acc', 'first_neuron', 'lr') e = ta.Evaluate(h) e.evaluate(x, y, folds=10, average='macro') ta.Deploy(h, 'iris') iris = ta.Restore('iris.zip') # make predictions with the model iris.model.predict(x) # get the meta-data for the experiment print(iris.details) # get the hyperparameter space boundary print(iris.params) # sample of x and y data print(iris.x) print(iris.y) # the results dataframe print(iris.results)
0.879082
0.392599
import os import numpy as np import tensorflow as tf from tensorflow.keras import Model from tensorflow.estimator import ( Estimator, ModeKeys, TrainSpec, EvalSpec, EstimatorSpec, ) from galileo.platform.default_values import DefaultValues from galileo.platform.log import log from galileo.platform.export import export from galileo.framework.python.utils.save_embedding import save_embedding from galileo.framework.tf.python.tf_trainer import TFTrainer from galileo.framework.tf.python.hooks.hooks import ( get_train_hooks, get_evaluate_hooks, get_predict_hooks, ) @export('galileo.tf') class EstimatorTrainer(TFTrainer): r''' \brief Trainer for tf estimator attention API: galileo.tf.EstimatorTrainer ''' def init_model(self, **kwargs): super().init_model(**kwargs) if 1 == self.config['num_workers'] and 0 == self.config['num_ps']: # remove TF_CONFIG when num_workers==1 and num_ps==0 # otherwise assert error not _is_device_list_single_worker(devices) os.environ['TF_CONFIG'] = '{}' self.model_args['is_add_metrics'] = False batch_num = self.run_config.get('batch_num') log_steps = self.run_config.get('log_steps', DefaultValues.LOG_STEPS) log_max_times_per_epoch = self.run_config.get( 'log_max_times_per_epoch', DefaultValues.LOG_MAX_TIMES_PER_EPOCH) save_checkpoint_epochs = self.run_config.get('save_checkpoint_epochs') keep_checkpoint_max = self.run_config.get('keep_checkpoint_max', 5) if batch_num and batch_num > 0: # avoid too much batch log log_steps = min(log_steps, batch_num) if batch_num // log_steps > log_max_times_per_epoch: log_steps = batch_num // log_max_times_per_epoch if save_checkpoint_epochs and save_checkpoint_epochs > 0: save_checkpoints_steps = save_checkpoint_epochs * batch_num else: save_checkpoints_steps = None self.run_config['log_steps'] = log_steps tensorboard_steps = self.run_config.get('tensorboard_steps', 'epoch') if 'epoch' == tensorboard_steps: tensorboard_steps = batch_num if batch_num and batch_num > 0 else 100 elif 'batch' == tensorboard_steps: tensorboard_steps = 1 else: tensorboard_steps = int(tensorboard_steps) rel_model_dir = os.path.relpath(self.model_dir) # RunConfig will parse TF_CONFIG self.estimator_config = tf.estimator.RunConfig( model_dir=rel_model_dir, train_distribute=self.strategy, eval_distribute=self.strategy, save_checkpoints_steps=save_checkpoints_steps, keep_checkpoint_max=keep_checkpoint_max, log_step_count_steps=None, save_summary_steps=tensorboard_steps) if self.inputs is not None: self.inputs_dict = { ModeKeys.TRAIN: self.inputs.train_data, ModeKeys.EVAL: self.inputs.evaluate_data, ModeKeys.PREDICT: self.inputs.predict_data, } def create_estimator(self): self.estimator = Estimator(self.model_fn, config=self.estimator_config, model_dir=None, params=None, warm_start_from=None) custom_metric_fn = self.run_config.get('custom_metric_fn') if callable(custom_metric_fn): self.estimator = tf.estimator.add_metrics(self.estimator, custom_metric_fn) def model_fn(self, features, labels, mode): self.model = self.model_class(**self.model_args) r''' the metric_objs of model must be a function, not a `Metric` class for tf/estimator version 2.3.0 ''' if hasattr(self.model, 'metric_objs'): for name, mo in self.model.metric_objs.items(): if isinstance(mo, tf.keras.metrics.Metric): raise ValueError(f'metric {name} for estimator must be a ' f'function, not a Metric class {mo}') outputs = self.model(features, training=mode == ModeKeys.TRAIN) if mode == ModeKeys.PREDICT: return EstimatorSpec( mode, predictions=outputs, prediction_hooks=get_predict_hooks(**self.run_config)) loss = outputs.pop('loss') logits = outputs.pop('logits', None) if mode == ModeKeys.EVAL: r''' eval_metric_ops is dict of metric results keyed by name. The values of the dict can be one of the following: (1) instance of `Metric` class. (2) Results of calling a metric function, namely a `(metric_tensor, update_op)` tuple. when metric results is returned by model, value must be tensor returned by a function, not a `Metric` class for tf version 2.3.0 ''' eval_metric_ops = {} for name, o in outputs.items(): if tf.is_tensor(o): eval_metric_ops[name] = tf.compat.v1.metrics.mean(o) if len(eval_metric_ops) == 0: eval_metric_ops = None return EstimatorSpec( mode, loss=loss, predictions={'logits': logits}, eval_metric_ops=eval_metric_ops, evaluation_hooks=get_evaluate_hooks(**self.run_config)) optimizer = self.get_optimizer() global_step = tf.compat.v1.train.get_or_create_global_step() optimizer.iterations = global_step trainable_variables = self.model.trainable_variables update_ops = self.model.updates train_op = optimizer.get_updates(loss, trainable_variables)[0] if update_ops is not None and len(update_ops) > 0: train_op = tf.group(train_op, *update_ops) log_tensor_dict = dict(loss=loss, step=global_step) log_tensor_dict.update(outputs) train_hooks = get_train_hooks(log_tensor_dict, **self.run_config) return EstimatorSpec( mode, loss=loss, predictions={'logits': logits}, train_op=train_op, training_hooks=train_hooks, ) def get_dataset(self, mode, input_context=None): # args from self.config and self.run_config batch_size = self.run_config['batch_size'] if self.should_dist_dataset and self.strategy is not None: batch_size *= self.strategy.num_replicas_in_sync inputs_args = dict( distribution_strategy=self.config['distribution_strategy'], num_workers=self.config['num_workers'], task_id=self.config['task_id'], batch_size=batch_size, max_id=self.run_config.get('max_id'), input_context=input_context, ) if self.inputs is not None: self.inputs.config.update(inputs_args) dataset = self.inputs_dict[mode]() else: if not callable(self.run_config.get('inputs_fn')): raise ValueError('inputs_fn must be specified and callable' 'when self.inputs is None') kwargs = self.run_config.copy() kwargs.update(inputs_args) kwargs['mode'] = mode dataset = self.run_config['inputs_fn'](**kwargs) if self.should_dist_dataset and self.strategy is not None: dataset = self.strategy.experimental_distribute_dataset(dataset) return dataset def do_train(self): self.create_estimator() max_steps = None num_epochs = self.run_config.get('num_epochs') if self.config['task_type'] != 'ps': batch_num = self.run_config.get('batch_num') assert batch_num and batch_num > 0 max_steps = batch_num * num_epochs log.info(f'start train model {self.model_name}, ' f'epochs: {num_epochs}, steps per epoch: {batch_num}, ' f'all steps: {max_steps}') eval_hooks = self.run_config.get('eval_hooks') exporters = self.run_config.get('eval_exporters') throttle_secs = self.run_config.get('eval_throttle_secs') or 600 estimator_hooks_fn = self.run_config.get('estimator_hooks_fn') or ( lambda **kwargs: []) train_spec = TrainSpec( self.get_dataset, max_steps=max_steps, hooks=estimator_hooks_fn(estimator=self.estimator, **self.run_config)) eval_spec = EvalSpec(self.get_dataset, steps=None, hooks=eval_hooks, exporters=exporters, throttle_secs=throttle_secs) tf.estimator.train_and_evaluate(self.estimator, train_spec, eval_spec) def do_evaluate(self): if self.config['task_type'] == 'ps': log.info(f'parameter server exits when evaluate') return log.info(f'starting evaluate model {self.model_name}') self.estimator_config = self.estimator_config.replace( eval_distribute=None) self.create_estimator() outputs = self.estimator.evaluate(self.get_dataset, steps=None) log.info(f'evaluate output: {outputs}') return outputs def do_predict(self): if self.config['task_type'] == 'ps': log.info(f'parameter server exits when predict') return self.create_estimator() save_predict_dir = os.path.join(self.model_dir, 'predict_results') os.makedirs(save_predict_dir, exist_ok=True) log.info(f'starting save predict outputs to {save_predict_dir}') save_predict_fn = self.run_config.get('save_predict_fn') task_id = self.config['task_id'] outputs = self.estimator.predict(self.get_dataset) ids = [] embeddings = [] ret_outputs = [] for output in outputs: if 'ids' in output and 'embeddings' in output: ids.append(output['ids']) embeddings.append(output['embeddings']) ret_outputs.append(output) if ids and embeddings: embeddings = np.stack(embeddings, axis=0) if not callable(save_predict_fn): save_predict_fn = save_embedding save_predict_fn(ids, embeddings, save_predict_dir, task_id) return ret_outputs, task_id export('galileo.tf').var('Trainer', EstimatorTrainer)
galileo/framework/tf/python/estimator_trainer.py
import os import numpy as np import tensorflow as tf from tensorflow.keras import Model from tensorflow.estimator import ( Estimator, ModeKeys, TrainSpec, EvalSpec, EstimatorSpec, ) from galileo.platform.default_values import DefaultValues from galileo.platform.log import log from galileo.platform.export import export from galileo.framework.python.utils.save_embedding import save_embedding from galileo.framework.tf.python.tf_trainer import TFTrainer from galileo.framework.tf.python.hooks.hooks import ( get_train_hooks, get_evaluate_hooks, get_predict_hooks, ) @export('galileo.tf') class EstimatorTrainer(TFTrainer): r''' \brief Trainer for tf estimator attention API: galileo.tf.EstimatorTrainer ''' def init_model(self, **kwargs): super().init_model(**kwargs) if 1 == self.config['num_workers'] and 0 == self.config['num_ps']: # remove TF_CONFIG when num_workers==1 and num_ps==0 # otherwise assert error not _is_device_list_single_worker(devices) os.environ['TF_CONFIG'] = '{}' self.model_args['is_add_metrics'] = False batch_num = self.run_config.get('batch_num') log_steps = self.run_config.get('log_steps', DefaultValues.LOG_STEPS) log_max_times_per_epoch = self.run_config.get( 'log_max_times_per_epoch', DefaultValues.LOG_MAX_TIMES_PER_EPOCH) save_checkpoint_epochs = self.run_config.get('save_checkpoint_epochs') keep_checkpoint_max = self.run_config.get('keep_checkpoint_max', 5) if batch_num and batch_num > 0: # avoid too much batch log log_steps = min(log_steps, batch_num) if batch_num // log_steps > log_max_times_per_epoch: log_steps = batch_num // log_max_times_per_epoch if save_checkpoint_epochs and save_checkpoint_epochs > 0: save_checkpoints_steps = save_checkpoint_epochs * batch_num else: save_checkpoints_steps = None self.run_config['log_steps'] = log_steps tensorboard_steps = self.run_config.get('tensorboard_steps', 'epoch') if 'epoch' == tensorboard_steps: tensorboard_steps = batch_num if batch_num and batch_num > 0 else 100 elif 'batch' == tensorboard_steps: tensorboard_steps = 1 else: tensorboard_steps = int(tensorboard_steps) rel_model_dir = os.path.relpath(self.model_dir) # RunConfig will parse TF_CONFIG self.estimator_config = tf.estimator.RunConfig( model_dir=rel_model_dir, train_distribute=self.strategy, eval_distribute=self.strategy, save_checkpoints_steps=save_checkpoints_steps, keep_checkpoint_max=keep_checkpoint_max, log_step_count_steps=None, save_summary_steps=tensorboard_steps) if self.inputs is not None: self.inputs_dict = { ModeKeys.TRAIN: self.inputs.train_data, ModeKeys.EVAL: self.inputs.evaluate_data, ModeKeys.PREDICT: self.inputs.predict_data, } def create_estimator(self): self.estimator = Estimator(self.model_fn, config=self.estimator_config, model_dir=None, params=None, warm_start_from=None) custom_metric_fn = self.run_config.get('custom_metric_fn') if callable(custom_metric_fn): self.estimator = tf.estimator.add_metrics(self.estimator, custom_metric_fn) def model_fn(self, features, labels, mode): self.model = self.model_class(**self.model_args) r''' the metric_objs of model must be a function, not a `Metric` class for tf/estimator version 2.3.0 ''' if hasattr(self.model, 'metric_objs'): for name, mo in self.model.metric_objs.items(): if isinstance(mo, tf.keras.metrics.Metric): raise ValueError(f'metric {name} for estimator must be a ' f'function, not a Metric class {mo}') outputs = self.model(features, training=mode == ModeKeys.TRAIN) if mode == ModeKeys.PREDICT: return EstimatorSpec( mode, predictions=outputs, prediction_hooks=get_predict_hooks(**self.run_config)) loss = outputs.pop('loss') logits = outputs.pop('logits', None) if mode == ModeKeys.EVAL: r''' eval_metric_ops is dict of metric results keyed by name. The values of the dict can be one of the following: (1) instance of `Metric` class. (2) Results of calling a metric function, namely a `(metric_tensor, update_op)` tuple. when metric results is returned by model, value must be tensor returned by a function, not a `Metric` class for tf version 2.3.0 ''' eval_metric_ops = {} for name, o in outputs.items(): if tf.is_tensor(o): eval_metric_ops[name] = tf.compat.v1.metrics.mean(o) if len(eval_metric_ops) == 0: eval_metric_ops = None return EstimatorSpec( mode, loss=loss, predictions={'logits': logits}, eval_metric_ops=eval_metric_ops, evaluation_hooks=get_evaluate_hooks(**self.run_config)) optimizer = self.get_optimizer() global_step = tf.compat.v1.train.get_or_create_global_step() optimizer.iterations = global_step trainable_variables = self.model.trainable_variables update_ops = self.model.updates train_op = optimizer.get_updates(loss, trainable_variables)[0] if update_ops is not None and len(update_ops) > 0: train_op = tf.group(train_op, *update_ops) log_tensor_dict = dict(loss=loss, step=global_step) log_tensor_dict.update(outputs) train_hooks = get_train_hooks(log_tensor_dict, **self.run_config) return EstimatorSpec( mode, loss=loss, predictions={'logits': logits}, train_op=train_op, training_hooks=train_hooks, ) def get_dataset(self, mode, input_context=None): # args from self.config and self.run_config batch_size = self.run_config['batch_size'] if self.should_dist_dataset and self.strategy is not None: batch_size *= self.strategy.num_replicas_in_sync inputs_args = dict( distribution_strategy=self.config['distribution_strategy'], num_workers=self.config['num_workers'], task_id=self.config['task_id'], batch_size=batch_size, max_id=self.run_config.get('max_id'), input_context=input_context, ) if self.inputs is not None: self.inputs.config.update(inputs_args) dataset = self.inputs_dict[mode]() else: if not callable(self.run_config.get('inputs_fn')): raise ValueError('inputs_fn must be specified and callable' 'when self.inputs is None') kwargs = self.run_config.copy() kwargs.update(inputs_args) kwargs['mode'] = mode dataset = self.run_config['inputs_fn'](**kwargs) if self.should_dist_dataset and self.strategy is not None: dataset = self.strategy.experimental_distribute_dataset(dataset) return dataset def do_train(self): self.create_estimator() max_steps = None num_epochs = self.run_config.get('num_epochs') if self.config['task_type'] != 'ps': batch_num = self.run_config.get('batch_num') assert batch_num and batch_num > 0 max_steps = batch_num * num_epochs log.info(f'start train model {self.model_name}, ' f'epochs: {num_epochs}, steps per epoch: {batch_num}, ' f'all steps: {max_steps}') eval_hooks = self.run_config.get('eval_hooks') exporters = self.run_config.get('eval_exporters') throttle_secs = self.run_config.get('eval_throttle_secs') or 600 estimator_hooks_fn = self.run_config.get('estimator_hooks_fn') or ( lambda **kwargs: []) train_spec = TrainSpec( self.get_dataset, max_steps=max_steps, hooks=estimator_hooks_fn(estimator=self.estimator, **self.run_config)) eval_spec = EvalSpec(self.get_dataset, steps=None, hooks=eval_hooks, exporters=exporters, throttle_secs=throttle_secs) tf.estimator.train_and_evaluate(self.estimator, train_spec, eval_spec) def do_evaluate(self): if self.config['task_type'] == 'ps': log.info(f'parameter server exits when evaluate') return log.info(f'starting evaluate model {self.model_name}') self.estimator_config = self.estimator_config.replace( eval_distribute=None) self.create_estimator() outputs = self.estimator.evaluate(self.get_dataset, steps=None) log.info(f'evaluate output: {outputs}') return outputs def do_predict(self): if self.config['task_type'] == 'ps': log.info(f'parameter server exits when predict') return self.create_estimator() save_predict_dir = os.path.join(self.model_dir, 'predict_results') os.makedirs(save_predict_dir, exist_ok=True) log.info(f'starting save predict outputs to {save_predict_dir}') save_predict_fn = self.run_config.get('save_predict_fn') task_id = self.config['task_id'] outputs = self.estimator.predict(self.get_dataset) ids = [] embeddings = [] ret_outputs = [] for output in outputs: if 'ids' in output and 'embeddings' in output: ids.append(output['ids']) embeddings.append(output['embeddings']) ret_outputs.append(output) if ids and embeddings: embeddings = np.stack(embeddings, axis=0) if not callable(save_predict_fn): save_predict_fn = save_embedding save_predict_fn(ids, embeddings, save_predict_dir, task_id) return ret_outputs, task_id export('galileo.tf').var('Trainer', EstimatorTrainer)
0.74512
0.210868
import builtins import inspect import sys from collections import deque from typing import Any, Callable, Dict, List, Optional, Union, cast from pydoc_fork import settings from pydoc_fork.inspector.custom_types import TypeLike from pydoc_fork.inspector.utils import ( _split_list, classify_class_attrs, classname, getdoc, sort_attributes, visiblename, ) from pydoc_fork.reporter import inline_styles from pydoc_fork.reporter.format_data import document_data from pydoc_fork.reporter.format_other import docother from pydoc_fork.reporter.formatter_html import markup, section def classlink(the_object: Union[TypeLike, type], modname: str) -> str: """Make a link for a class.""" name, module = the_object.__name__, sys.modules.get(the_object.__module__) if hasattr(module, name) and getattr(module, name) is the_object: return f'<a href="{module.__name__}.html#{name}">{classname(cast(TypeLike, the_object), modname)}</a>' return classname(the_object, modname) # noinspection PyBroadException def docclass( the_object: TypeLike, name: str = "", mod: str = "", funcs: Optional[Dict[str, str]] = None, classes: Optional[Dict[str, str]] = None, ) -> str: """Produce HTML documentation for a class object.""" funcs = funcs or {} classes = classes or {} real_name = the_object.__name__ name = name or real_name bases = the_object.__bases__ contents: List[str] = [] push = contents.append class HorizontalRule: """Cute little class to pump out a horizontal rule between sections.""" def __init__(self) -> None: self.need_one = 0 def maybe(self) -> None: """Skip""" if self.need_one: push("<hr>\n") self.need_one = 1 # pylint:disable=invalid-name hr = HorizontalRule() # List the mro, if non-trivial. mro = deque(inspect.getmro(cast(type, the_object))) if len(mro) > 2: hr.maybe() push("<dl><dt>Method resolution order:</dt>\n") for base in mro: push(f"<dd>{classlink(base, the_object.__module__)}</dd>\n") push("</dl>\n") def spill( msg: str, attrs_in: List[Any], predicate: Callable[[Any], Any] ) -> List[Any]: """Not sure""" ok, attrs = _split_list(attrs_in, predicate) if ok: hr.maybe() push(msg) for name, _, _, value in ok: # noinspection PyBroadException try: value = getattr(the_object, name) except Exception: # nosec # Some descriptors may meet a failure in their __get__. # (bug #1785) push( document_data( value, name, # mod, unused ) ) else: # circular ref # pylint: disable=import-outside-toplevel from pydoc_fork.reporter.format_page import document push( document( value, name, mod, funcs, classes, module_dict, the_object ) ) push("\n") return attrs def spilldescriptors( msg: str, attrs_in: List[Any], # Tuple[str, str, type, "object"] predicate: Callable[[Any], bool], ) -> List[Any]: """Not sure""" ok, attrs = _split_list(attrs_in, predicate) if ok: hr.maybe() push(msg) for name, _, _, value in ok: push( document_data( value, name, # mod, ignored ) ) return attrs def spilldata( msg: str, attrs_in: List[Any], predicate: Callable[[Any], bool] ) -> List[Any]: """Not sure""" ok, attrs = _split_list(attrs_in, predicate) if ok: hr.maybe() push(msg) for name, _, __, value in ok: base = docother( getattr(the_object, name), name, # mod ignored ) found_doc = getdoc(value) if not found_doc: push(f"<dl><dt>{base}</dl>\n") else: found_doc = markup(getdoc(value), funcs, classes, module_dict) found_doc = f"<dd><tt>{found_doc}</tt>" push(f"<dl><dt>{base}{found_doc}</dl>\n") push("\n") return attrs attrs = [ (name, kind, cls, value) for name, kind, cls, value in classify_class_attrs(the_object) if visiblename(name, obj=the_object) ] module_dict = {} for key, _, _, value in attrs: module_dict[key] = anchor = "#" + name + "-" + key try: value = getattr(the_object, name) except Exception: # nosec # Some descriptors may meet a failure in their __get__. # (bug #1785) pass # nosec try: # The value may not be hashable (e.g., a data attr with # a dict or list value). module_dict[value] = anchor except TypeError: pass # nosec while attrs: if mro: this_class = mro.popleft() else: this_class = attrs[0][2] is_this_class: Callable[[Any], Any] = lambda t: t[2] is this_class attrs, inherited = _split_list(attrs, is_this_class) if the_object is not builtins.object and this_class is builtins.object: attrs = inherited continue if this_class is the_object: tag = "defined here" else: tag = f"inherited from {classlink(this_class, the_object.__module__)}" tag += ":<br>\n" sort_attributes(attrs, the_object) # feature to remove typing annotations cruft. for kind in attrs.copy(): module_name = inspect.getmodule(kind) if module_name and module_name.__name__ in settings.SKIP_MODULES: attrs.remove(kind) # Pump out the attrs, segregated by kind. is_method: Callable[[Any], Any] = lambda t: t[1] == "method" attrs = spill(f"Methods {tag}", attrs, is_method) is_class: Callable[[Any], Any] = lambda t: t[1] == "class method" attrs = spill(f"Class methods {tag}", attrs, is_class) is_static: Callable[[Any], Any] = lambda t: t[1] == "static method" attrs = spill(f"Static methods {tag}", attrs, is_static) is_read_only: Callable[[Any], Any] = lambda t: t[1] == "readonly property" attrs = spilldescriptors( f"Readonly properties {tag}", attrs, is_read_only, ) is_data_descriptor: Callable[[Any], Any] = lambda t: t[1] == "data descriptor" attrs = spilldescriptors(f"Data descriptors {tag}", attrs, is_data_descriptor) is_data: Callable[[Any], Any] = lambda t: t[1] == "data" attrs = spilldata(f"Data and other attributes {tag}", attrs, is_data) assert not attrs # nosec attrs = inherited contents_as_string = "".join(contents) # type got redefined if name == real_name: title = f'<a name="{name}">class <strong>{real_name}</strong></a>' else: title = f'<strong>{name}</strong> = <a name="{name}">class {real_name}</a>' if bases: parents = [] for base in bases: parents.append(classlink(base, the_object.__module__)) title = title + f"({', '.join(parents)})" decl = "" try: signature = inspect.signature(the_object) except (ValueError, TypeError): signature = None if signature: argument_specification = str(signature) if argument_specification and argument_specification != "()": # this will cause double escape on -> # escape(argument_specification) decl = name + argument_specification + "\n\n" doc = getdoc(the_object) if decl: doc = decl + (doc or "") doc = markup(doc, funcs, classes, module_dict) doc = doc and f"<tt>{doc}<br>&nbsp;</tt>" return section(title, "#000000", "#ffc8d8", contents_as_string, 3, doc) def format_tree(tree: List[Any], modname: str, parent: Optional[Any] = None) -> str: """ Creates a representation of class inheritance. """ # """Produce HTML for a class tree as given by inspect.getclasstree().""" result = "" for entry in tree: class_object = entry # pylint: disable=unidiomatic-typecheck if type(entry) is type(()): # noqa - not sure of switching to isinstance class_object, bases = entry result = ( result + f'<dt><span style="font-family:{inline_styles.SAN_SERIF}">' ) result = result + classlink(class_object, modname) if bases and bases != (parent,): parents = [] for base in bases: parents.append(classlink(base, modname)) result = result + "(" + ", ".join(parents) + ")" result = result + "\n</span></dt>" elif type(entry) is type([]): # noqa - not sure of switching to isinstance tree = format_tree(entry, modname, class_object) result = result + f"<dd>\n{tree}</dd>\n" return f"<dl>\n{result}</dl>\n"
pydoc_fork/reporter/format_class.py
import builtins import inspect import sys from collections import deque from typing import Any, Callable, Dict, List, Optional, Union, cast from pydoc_fork import settings from pydoc_fork.inspector.custom_types import TypeLike from pydoc_fork.inspector.utils import ( _split_list, classify_class_attrs, classname, getdoc, sort_attributes, visiblename, ) from pydoc_fork.reporter import inline_styles from pydoc_fork.reporter.format_data import document_data from pydoc_fork.reporter.format_other import docother from pydoc_fork.reporter.formatter_html import markup, section def classlink(the_object: Union[TypeLike, type], modname: str) -> str: """Make a link for a class.""" name, module = the_object.__name__, sys.modules.get(the_object.__module__) if hasattr(module, name) and getattr(module, name) is the_object: return f'<a href="{module.__name__}.html#{name}">{classname(cast(TypeLike, the_object), modname)}</a>' return classname(the_object, modname) # noinspection PyBroadException def docclass( the_object: TypeLike, name: str = "", mod: str = "", funcs: Optional[Dict[str, str]] = None, classes: Optional[Dict[str, str]] = None, ) -> str: """Produce HTML documentation for a class object.""" funcs = funcs or {} classes = classes or {} real_name = the_object.__name__ name = name or real_name bases = the_object.__bases__ contents: List[str] = [] push = contents.append class HorizontalRule: """Cute little class to pump out a horizontal rule between sections.""" def __init__(self) -> None: self.need_one = 0 def maybe(self) -> None: """Skip""" if self.need_one: push("<hr>\n") self.need_one = 1 # pylint:disable=invalid-name hr = HorizontalRule() # List the mro, if non-trivial. mro = deque(inspect.getmro(cast(type, the_object))) if len(mro) > 2: hr.maybe() push("<dl><dt>Method resolution order:</dt>\n") for base in mro: push(f"<dd>{classlink(base, the_object.__module__)}</dd>\n") push("</dl>\n") def spill( msg: str, attrs_in: List[Any], predicate: Callable[[Any], Any] ) -> List[Any]: """Not sure""" ok, attrs = _split_list(attrs_in, predicate) if ok: hr.maybe() push(msg) for name, _, _, value in ok: # noinspection PyBroadException try: value = getattr(the_object, name) except Exception: # nosec # Some descriptors may meet a failure in their __get__. # (bug #1785) push( document_data( value, name, # mod, unused ) ) else: # circular ref # pylint: disable=import-outside-toplevel from pydoc_fork.reporter.format_page import document push( document( value, name, mod, funcs, classes, module_dict, the_object ) ) push("\n") return attrs def spilldescriptors( msg: str, attrs_in: List[Any], # Tuple[str, str, type, "object"] predicate: Callable[[Any], bool], ) -> List[Any]: """Not sure""" ok, attrs = _split_list(attrs_in, predicate) if ok: hr.maybe() push(msg) for name, _, _, value in ok: push( document_data( value, name, # mod, ignored ) ) return attrs def spilldata( msg: str, attrs_in: List[Any], predicate: Callable[[Any], bool] ) -> List[Any]: """Not sure""" ok, attrs = _split_list(attrs_in, predicate) if ok: hr.maybe() push(msg) for name, _, __, value in ok: base = docother( getattr(the_object, name), name, # mod ignored ) found_doc = getdoc(value) if not found_doc: push(f"<dl><dt>{base}</dl>\n") else: found_doc = markup(getdoc(value), funcs, classes, module_dict) found_doc = f"<dd><tt>{found_doc}</tt>" push(f"<dl><dt>{base}{found_doc}</dl>\n") push("\n") return attrs attrs = [ (name, kind, cls, value) for name, kind, cls, value in classify_class_attrs(the_object) if visiblename(name, obj=the_object) ] module_dict = {} for key, _, _, value in attrs: module_dict[key] = anchor = "#" + name + "-" + key try: value = getattr(the_object, name) except Exception: # nosec # Some descriptors may meet a failure in their __get__. # (bug #1785) pass # nosec try: # The value may not be hashable (e.g., a data attr with # a dict or list value). module_dict[value] = anchor except TypeError: pass # nosec while attrs: if mro: this_class = mro.popleft() else: this_class = attrs[0][2] is_this_class: Callable[[Any], Any] = lambda t: t[2] is this_class attrs, inherited = _split_list(attrs, is_this_class) if the_object is not builtins.object and this_class is builtins.object: attrs = inherited continue if this_class is the_object: tag = "defined here" else: tag = f"inherited from {classlink(this_class, the_object.__module__)}" tag += ":<br>\n" sort_attributes(attrs, the_object) # feature to remove typing annotations cruft. for kind in attrs.copy(): module_name = inspect.getmodule(kind) if module_name and module_name.__name__ in settings.SKIP_MODULES: attrs.remove(kind) # Pump out the attrs, segregated by kind. is_method: Callable[[Any], Any] = lambda t: t[1] == "method" attrs = spill(f"Methods {tag}", attrs, is_method) is_class: Callable[[Any], Any] = lambda t: t[1] == "class method" attrs = spill(f"Class methods {tag}", attrs, is_class) is_static: Callable[[Any], Any] = lambda t: t[1] == "static method" attrs = spill(f"Static methods {tag}", attrs, is_static) is_read_only: Callable[[Any], Any] = lambda t: t[1] == "readonly property" attrs = spilldescriptors( f"Readonly properties {tag}", attrs, is_read_only, ) is_data_descriptor: Callable[[Any], Any] = lambda t: t[1] == "data descriptor" attrs = spilldescriptors(f"Data descriptors {tag}", attrs, is_data_descriptor) is_data: Callable[[Any], Any] = lambda t: t[1] == "data" attrs = spilldata(f"Data and other attributes {tag}", attrs, is_data) assert not attrs # nosec attrs = inherited contents_as_string = "".join(contents) # type got redefined if name == real_name: title = f'<a name="{name}">class <strong>{real_name}</strong></a>' else: title = f'<strong>{name}</strong> = <a name="{name}">class {real_name}</a>' if bases: parents = [] for base in bases: parents.append(classlink(base, the_object.__module__)) title = title + f"({', '.join(parents)})" decl = "" try: signature = inspect.signature(the_object) except (ValueError, TypeError): signature = None if signature: argument_specification = str(signature) if argument_specification and argument_specification != "()": # this will cause double escape on -> # escape(argument_specification) decl = name + argument_specification + "\n\n" doc = getdoc(the_object) if decl: doc = decl + (doc or "") doc = markup(doc, funcs, classes, module_dict) doc = doc and f"<tt>{doc}<br>&nbsp;</tt>" return section(title, "#000000", "#ffc8d8", contents_as_string, 3, doc) def format_tree(tree: List[Any], modname: str, parent: Optional[Any] = None) -> str: """ Creates a representation of class inheritance. """ # """Produce HTML for a class tree as given by inspect.getclasstree().""" result = "" for entry in tree: class_object = entry # pylint: disable=unidiomatic-typecheck if type(entry) is type(()): # noqa - not sure of switching to isinstance class_object, bases = entry result = ( result + f'<dt><span style="font-family:{inline_styles.SAN_SERIF}">' ) result = result + classlink(class_object, modname) if bases and bases != (parent,): parents = [] for base in bases: parents.append(classlink(base, modname)) result = result + "(" + ", ".join(parents) + ")" result = result + "\n</span></dt>" elif type(entry) is type([]): # noqa - not sure of switching to isinstance tree = format_tree(entry, modname, class_object) result = result + f"<dd>\n{tree}</dd>\n" return f"<dl>\n{result}</dl>\n"
0.593374
0.136206
from flask import Flask from flask import render_template from flask import Response import sqlite3 import random import io from matplotlib.backends.backend_agg import FigureCanvasAgg as FigureCanvas from matplotlib.figure import Figure app = Flask(__name__) @app.route("/") def cv_index(): cvs = get_cv() res = "" res += f"<h2>Кол-во резюме по годам</h2>" for i, cv in enumerate(cvs): res += f"<p>{cv['substr(dateModify,1,4)']} - {cv['count(dateModify)']}</p>" return res @app.route("/dashboard") def dashboard(): con = sqlite3.connect('works.sqlite') res = con.execute('select substr(dateModify,1,4), count(dateModify) ' 'from works where dateModify is not null group by substr(dateModify,1,4);').fetchall() con.close() return render_template('d1.html', cvs=get_cv(), labels=[row[0] for row in res], data=[row[1] for row in res] ) def dict_factory(cursor, row): # обертка для преобразования # полученной строки. (взята из документации) d = {} for idx, col in enumerate(cursor.description): d[col[0]] = row[idx] return d def get_cv(): con = sqlite3.connect('works.sqlite') con.row_factory = dict_factory res = list(con.execute('select substr(dateModify,1,4), count(dateModify) ' 'from works where dateModify is not null group by substr(dateModify,1,4);')) con.close() return res @app.route('/plot.png') def plot_png(): fig = create_figure() output = io.BytesIO() FigureCanvas(fig).print_png(output) return Response(output.getvalue(), mimetype='image/png') def create_figure(): fig = Figure() axis = fig.add_subplot(1, 1, 1) xs = range(100) ys = [random.randint(1, 50) for x in xs] axis.plot(xs, ys) return fig @app.route("/statistic") def statistic(): job_titles = get_field('jobTitle') qualifications = get_field('qualification') res = "" people_count = count_people_with_non_matched_fields(job_titles, qualifications) res += f"<p>Из {people_count[1]} людей не совпадают профессия и должность у {people_count[0]}</p>" res += f"\n<p>Список зарплат у людей со скиллами в python:</p>" python_salaries = get_python_salary() for i in python_salaries: res += f"<p>{i[0]} руб.</p>" return res def get_field(field): con = sqlite3.connect('works.sqlite') res = list(con.execute(f'select {field} from works')) con.close() return res def get_python_salary(): con = sqlite3.connect('works.sqlite') res = list(con.execute("select salary from works where skills is" " not null and instr(lower(skills),'python')")) con.close() return res def count_people_with_non_matched_fields(field1, field2): res_count, total = 0, 0 for (f1, f2) in zip(field1, field2): total += 1 if not find_match(f1[0], f2[0]) and not find_match(f2[0], f1[0]): res_count += 1 return res_count, total def find_match(f1, f2): arr1 = str(f1).lower().replace('-', ' ').split() for word in arr1: if word in str(f2).lower(): return True return False app.run(debug=True)
main.py
from flask import Flask from flask import render_template from flask import Response import sqlite3 import random import io from matplotlib.backends.backend_agg import FigureCanvasAgg as FigureCanvas from matplotlib.figure import Figure app = Flask(__name__) @app.route("/") def cv_index(): cvs = get_cv() res = "" res += f"<h2>Кол-во резюме по годам</h2>" for i, cv in enumerate(cvs): res += f"<p>{cv['substr(dateModify,1,4)']} - {cv['count(dateModify)']}</p>" return res @app.route("/dashboard") def dashboard(): con = sqlite3.connect('works.sqlite') res = con.execute('select substr(dateModify,1,4), count(dateModify) ' 'from works where dateModify is not null group by substr(dateModify,1,4);').fetchall() con.close() return render_template('d1.html', cvs=get_cv(), labels=[row[0] for row in res], data=[row[1] for row in res] ) def dict_factory(cursor, row): # обертка для преобразования # полученной строки. (взята из документации) d = {} for idx, col in enumerate(cursor.description): d[col[0]] = row[idx] return d def get_cv(): con = sqlite3.connect('works.sqlite') con.row_factory = dict_factory res = list(con.execute('select substr(dateModify,1,4), count(dateModify) ' 'from works where dateModify is not null group by substr(dateModify,1,4);')) con.close() return res @app.route('/plot.png') def plot_png(): fig = create_figure() output = io.BytesIO() FigureCanvas(fig).print_png(output) return Response(output.getvalue(), mimetype='image/png') def create_figure(): fig = Figure() axis = fig.add_subplot(1, 1, 1) xs = range(100) ys = [random.randint(1, 50) for x in xs] axis.plot(xs, ys) return fig @app.route("/statistic") def statistic(): job_titles = get_field('jobTitle') qualifications = get_field('qualification') res = "" people_count = count_people_with_non_matched_fields(job_titles, qualifications) res += f"<p>Из {people_count[1]} людей не совпадают профессия и должность у {people_count[0]}</p>" res += f"\n<p>Список зарплат у людей со скиллами в python:</p>" python_salaries = get_python_salary() for i in python_salaries: res += f"<p>{i[0]} руб.</p>" return res def get_field(field): con = sqlite3.connect('works.sqlite') res = list(con.execute(f'select {field} from works')) con.close() return res def get_python_salary(): con = sqlite3.connect('works.sqlite') res = list(con.execute("select salary from works where skills is" " not null and instr(lower(skills),'python')")) con.close() return res def count_people_with_non_matched_fields(field1, field2): res_count, total = 0, 0 for (f1, f2) in zip(field1, field2): total += 1 if not find_match(f1[0], f2[0]) and not find_match(f2[0], f1[0]): res_count += 1 return res_count, total def find_match(f1, f2): arr1 = str(f1).lower().replace('-', ' ').split() for word in arr1: if word in str(f2).lower(): return True return False app.run(debug=True)
0.404155
0.155431
from typing import Tuple import matplotlib.pyplot as plt import pandas as pd from polar_bearings.opt_pah_finder_robotics.potential_field_planning import ( potential_field_planning, ) def main( filepath: str = "ice_thickness_01-01-2020.csv", rescaling_factor: int = 2, grid_size: float = 0.1, robot_radius: float = 0.01, ): """Loads the ice thickness data and plans a route over safe ice.""" df = pd.read_csv(filepath) df_rescaled = df.iloc[::rescaling_factor, :] gx, gy, sx, sy, ox, oy = process_data(df_rescaled) plt.grid(True) plt.axis("equal") # path generation _, _ = potential_field_planning(sx, sy, gx, gy, ox, oy, grid_size, robot_radius) plt.show() def process_data( single_day_df: pd.DataFrame, safety_threshold: float = 1.0, ): """Rescales data, then provides the coordinates needed for the pathfinder.""" sx, sy, gx, gy = find_start_end(single_day_df) single_day_df = single_day_df.fillna(safety_threshold) # NaN values are land unsafe = single_day_df[single_day_df.sithick < safety_threshold] ox = unsafe.longitude.values.tolist() oy = unsafe.latitude.values.tolist() print(f"{len(ox)}/{len(single_day_df)} co-ordinates considered as dangerous ice.") return gx, gy, sx, sy, ox, oy def find_closest(df, lat, lon): dist = (df["latitude"] - lat).abs() + (df["longitude"] - lon).abs() return df.loc[dist.idxmin()] def find_start_end(df_rescaled: pd.DataFrame) -> Tuple[int, int, int, int]: """Finds start and end points of ulukhaktok and sachs harbour, then scales their coordinate values to the origin.""" df_rescaled["longitude"] = df_rescaled.longitude df_rescaled["latitude"] = df_rescaled.latitude ulukhaktok_y, ulukhaktok_x = ( 70.74025296172513, -117.77122885607929, ) sachs_y, sachs_x = 71.98715823380064, -125.24848194895534 closest = find_closest(df_rescaled, ulukhaktok_y, ulukhaktok_x) sy, sx = closest["latitude"], closest["longitude"] closest = find_closest(df_rescaled, sachs_y, sachs_x) gy, gx = closest["latitude"], closest["longitude"] return sx, sy, gx, gy
polar_bearings/opt_pah_finder_robotics/navigate_ice.py
from typing import Tuple import matplotlib.pyplot as plt import pandas as pd from polar_bearings.opt_pah_finder_robotics.potential_field_planning import ( potential_field_planning, ) def main( filepath: str = "ice_thickness_01-01-2020.csv", rescaling_factor: int = 2, grid_size: float = 0.1, robot_radius: float = 0.01, ): """Loads the ice thickness data and plans a route over safe ice.""" df = pd.read_csv(filepath) df_rescaled = df.iloc[::rescaling_factor, :] gx, gy, sx, sy, ox, oy = process_data(df_rescaled) plt.grid(True) plt.axis("equal") # path generation _, _ = potential_field_planning(sx, sy, gx, gy, ox, oy, grid_size, robot_radius) plt.show() def process_data( single_day_df: pd.DataFrame, safety_threshold: float = 1.0, ): """Rescales data, then provides the coordinates needed for the pathfinder.""" sx, sy, gx, gy = find_start_end(single_day_df) single_day_df = single_day_df.fillna(safety_threshold) # NaN values are land unsafe = single_day_df[single_day_df.sithick < safety_threshold] ox = unsafe.longitude.values.tolist() oy = unsafe.latitude.values.tolist() print(f"{len(ox)}/{len(single_day_df)} co-ordinates considered as dangerous ice.") return gx, gy, sx, sy, ox, oy def find_closest(df, lat, lon): dist = (df["latitude"] - lat).abs() + (df["longitude"] - lon).abs() return df.loc[dist.idxmin()] def find_start_end(df_rescaled: pd.DataFrame) -> Tuple[int, int, int, int]: """Finds start and end points of ulukhaktok and sachs harbour, then scales their coordinate values to the origin.""" df_rescaled["longitude"] = df_rescaled.longitude df_rescaled["latitude"] = df_rescaled.latitude ulukhaktok_y, ulukhaktok_x = ( 70.74025296172513, -117.77122885607929, ) sachs_y, sachs_x = 71.98715823380064, -125.24848194895534 closest = find_closest(df_rescaled, ulukhaktok_y, ulukhaktok_x) sy, sx = closest["latitude"], closest["longitude"] closest = find_closest(df_rescaled, sachs_y, sachs_x) gy, gx = closest["latitude"], closest["longitude"] return sx, sy, gx, gy
0.937139
0.640776
from QuantTorch.functions.terner_connect import TernaryConnectDeterministic, TernaryConnectStochastic import torch import pytest def equals(a, b, epsilon=1e-12): return torch.all(torch.lt( torch.abs(a-b), epsilon )) def test_terner_connect_det_forward(): x_1 = torch.Tensor([0.75,0.5,0.25,0.0,-1,-0.2]) x_2 = torch.Tensor([1,0,0.51,0.1,0,-1,-0.2,.7]).view(2,4) y_1_expected = torch.Tensor([1,1,0,0,-1,0]) y_2_expected = torch.Tensor([1,0,1,0.,0,-1,0,1]).view(2,4) y_1 = TernaryConnectDeterministic.apply(x_1) y_2 = TernaryConnectDeterministic.apply(x_2) assert equals( y_1, y_1_expected ) assert equals( y_2, y_2_expected ) def test_terner_connect_sto_forward(): x = torch.Tensor([1,0,0.45,-1,-0.9]).view(1,-1) results = list() for i in range(1000): temp_result = TernaryConnectStochastic.apply(x) # Tensor must have only -1 , 0 , 1 values assert not torch.any(torch.lt(torch.abs(temp_result-1),1e-8)*torch.lt(torch.abs(temp_result),1e-8)) results.append(temp_result) result = torch.cat(results,0 ) result = torch.sum(result, 0)/1000 assert equals( result, torch.Tensor([1,0,0.45,-1,-0.9]).view(1,-1), 5e-2) @pytest.mark.parametrize("inputs, weight", [ [torch.FloatTensor(6).uniform_(-10, 10).view(3,2),torch.FloatTensor(6).uniform_(-1, 1).view(2,3)], [torch.FloatTensor(5).uniform_(-7, 8).view(1,5),torch.FloatTensor(5).uniform_(-1,1).view(5,1)], [torch.FloatTensor(10).uniform_(50, -10).view(2,5),torch.FloatTensor(5).uniform_(-1,1).view(5,1)] ]) def test_terner_connect_det_backward(inputs, weight): #setup all vars inputs_var_1 = torch.autograd.Variable(inputs, requires_grad=True) weight_var_1 = torch.autograd.Variable(weight, requires_grad=True) inputs_var_2 = torch.autograd.Variable(inputs, requires_grad=True) weight_var_2 = torch.autograd.Variable(weight, requires_grad=True) loss_1 = torch.sum(torch.mm(inputs,TernaryConnectDeterministic.apply(weight_var_1) )) loss_1.backward() assert equals( weight_var_1.grad, torch.transpose(torch.sum(inputs_var_1,0, keepdim=True),1,0).repeat(1, weight.shape[-1]) ) loss_2_temp = torch.mm(inputs_var_2,TernaryConnectDeterministic.apply(weight_var_2) ) loss_2 = torch.sum(torch.pow(loss_2_temp, 2)) loss_2.backward() assert equals( weight_var_2.grad, torch.mm(inputs_var_2.transpose(1,0),2*loss_2_temp ) ) def test_terner_connect_det_backward_bis(): x = torch.autograd.Variable(torch.Tensor([2,1.0,0.0,-1,-3]), requires_grad=True) loss = torch.sum(TernaryConnectDeterministic.apply(x)) loss.backward() assert equals( x.grad[0], 0) assert equals( x.grad[4], 0) @pytest.mark.parametrize("inputs, weight", [ [torch.FloatTensor(6).uniform_(-10, 10).view(3,2),torch.FloatTensor(6).uniform_(-1, 1).view(2,3)], [torch.FloatTensor(5).uniform_(-7, 8).view(1,5),torch.FloatTensor(5).uniform_(-1,1).view(5,1)], [torch.FloatTensor(10).uniform_(50, -10).view(2,5),torch.FloatTensor(5).uniform_(-1,1).view(5,1)] ]) def test_terner_connect_sto_backward(inputs, weight): #setup all vars inputs_var_1 = torch.autograd.Variable(inputs, requires_grad=True) weight_var_1 = torch.autograd.Variable(weight, requires_grad=True) inputs_var_2 = torch.autograd.Variable(inputs, requires_grad=True) weight_var_2 = torch.autograd.Variable(weight, requires_grad=True) loss_1 = torch.sum(torch.mm(inputs,TernaryConnectStochastic.apply(weight_var_1) )) loss_1.backward() assert equals( weight_var_1.grad, torch.transpose(torch.sum(inputs_var_1,0, keepdim=True),1,0).repeat(1, weight.shape[-1]) ) loss_2_temp = torch.mm(inputs_var_2,TernaryConnectStochastic.apply(weight_var_2) ) loss_2 = torch.sum(torch.pow(loss_2_temp, 2)) loss_2.backward() assert equals( weight_var_2.grad, torch.mm(inputs_var_2.transpose(1,0),2*loss_2_temp ) )
tests/implementations/Terner/function_test.py
from QuantTorch.functions.terner_connect import TernaryConnectDeterministic, TernaryConnectStochastic import torch import pytest def equals(a, b, epsilon=1e-12): return torch.all(torch.lt( torch.abs(a-b), epsilon )) def test_terner_connect_det_forward(): x_1 = torch.Tensor([0.75,0.5,0.25,0.0,-1,-0.2]) x_2 = torch.Tensor([1,0,0.51,0.1,0,-1,-0.2,.7]).view(2,4) y_1_expected = torch.Tensor([1,1,0,0,-1,0]) y_2_expected = torch.Tensor([1,0,1,0.,0,-1,0,1]).view(2,4) y_1 = TernaryConnectDeterministic.apply(x_1) y_2 = TernaryConnectDeterministic.apply(x_2) assert equals( y_1, y_1_expected ) assert equals( y_2, y_2_expected ) def test_terner_connect_sto_forward(): x = torch.Tensor([1,0,0.45,-1,-0.9]).view(1,-1) results = list() for i in range(1000): temp_result = TernaryConnectStochastic.apply(x) # Tensor must have only -1 , 0 , 1 values assert not torch.any(torch.lt(torch.abs(temp_result-1),1e-8)*torch.lt(torch.abs(temp_result),1e-8)) results.append(temp_result) result = torch.cat(results,0 ) result = torch.sum(result, 0)/1000 assert equals( result, torch.Tensor([1,0,0.45,-1,-0.9]).view(1,-1), 5e-2) @pytest.mark.parametrize("inputs, weight", [ [torch.FloatTensor(6).uniform_(-10, 10).view(3,2),torch.FloatTensor(6).uniform_(-1, 1).view(2,3)], [torch.FloatTensor(5).uniform_(-7, 8).view(1,5),torch.FloatTensor(5).uniform_(-1,1).view(5,1)], [torch.FloatTensor(10).uniform_(50, -10).view(2,5),torch.FloatTensor(5).uniform_(-1,1).view(5,1)] ]) def test_terner_connect_det_backward(inputs, weight): #setup all vars inputs_var_1 = torch.autograd.Variable(inputs, requires_grad=True) weight_var_1 = torch.autograd.Variable(weight, requires_grad=True) inputs_var_2 = torch.autograd.Variable(inputs, requires_grad=True) weight_var_2 = torch.autograd.Variable(weight, requires_grad=True) loss_1 = torch.sum(torch.mm(inputs,TernaryConnectDeterministic.apply(weight_var_1) )) loss_1.backward() assert equals( weight_var_1.grad, torch.transpose(torch.sum(inputs_var_1,0, keepdim=True),1,0).repeat(1, weight.shape[-1]) ) loss_2_temp = torch.mm(inputs_var_2,TernaryConnectDeterministic.apply(weight_var_2) ) loss_2 = torch.sum(torch.pow(loss_2_temp, 2)) loss_2.backward() assert equals( weight_var_2.grad, torch.mm(inputs_var_2.transpose(1,0),2*loss_2_temp ) ) def test_terner_connect_det_backward_bis(): x = torch.autograd.Variable(torch.Tensor([2,1.0,0.0,-1,-3]), requires_grad=True) loss = torch.sum(TernaryConnectDeterministic.apply(x)) loss.backward() assert equals( x.grad[0], 0) assert equals( x.grad[4], 0) @pytest.mark.parametrize("inputs, weight", [ [torch.FloatTensor(6).uniform_(-10, 10).view(3,2),torch.FloatTensor(6).uniform_(-1, 1).view(2,3)], [torch.FloatTensor(5).uniform_(-7, 8).view(1,5),torch.FloatTensor(5).uniform_(-1,1).view(5,1)], [torch.FloatTensor(10).uniform_(50, -10).view(2,5),torch.FloatTensor(5).uniform_(-1,1).view(5,1)] ]) def test_terner_connect_sto_backward(inputs, weight): #setup all vars inputs_var_1 = torch.autograd.Variable(inputs, requires_grad=True) weight_var_1 = torch.autograd.Variable(weight, requires_grad=True) inputs_var_2 = torch.autograd.Variable(inputs, requires_grad=True) weight_var_2 = torch.autograd.Variable(weight, requires_grad=True) loss_1 = torch.sum(torch.mm(inputs,TernaryConnectStochastic.apply(weight_var_1) )) loss_1.backward() assert equals( weight_var_1.grad, torch.transpose(torch.sum(inputs_var_1,0, keepdim=True),1,0).repeat(1, weight.shape[-1]) ) loss_2_temp = torch.mm(inputs_var_2,TernaryConnectStochastic.apply(weight_var_2) ) loss_2 = torch.sum(torch.pow(loss_2_temp, 2)) loss_2.backward() assert equals( weight_var_2.grad, torch.mm(inputs_var_2.transpose(1,0),2*loss_2_temp ) )
0.735547
0.644589
import os import pytest from intervaltree import Interval from viridian_workflow import self_qc, primers this_dir = os.path.dirname(os.path.abspath(__file__)) data_dir = os.path.join(this_dir, "data", "primers") class StatsTest: def __init__(self, fail): self.fail = fail self.log = [] self.config = self_qc.default_config def check_for_failure(self, **kwargs): return self.fail def test_cigar_tuple_construction(): ref = "AAA" query = "AAA" cigar = [ (3, 0), ] assert self_qc.cigar_to_alts(ref, query, cigar) == [(0, "A"), (1, "A"), (2, "A")] ref = "AAA" query = "ATTAA" cigar = [(1, 0), (2, 1), (2, 0)] assert self_qc.cigar_to_alts(ref, query, cigar) == [ (0, "A"), # (1, "TT"), (1, "A"), (2, "A"), ] ref = "ATTAA" query = "AAA" cigar = [(1, 0), (2, 2), (2, 0)] assert self_qc.cigar_to_alts(ref, query, cigar) == [ (0, "A"), (1, "-"), (2, "-"), (3, "A"), (4, "A"), ] ref = "ATTAA" query = "AAA" cigar = [(0, 1), (2, 2), (0, 2)] assert self_qc.cigar_to_alts(ref, query, cigar, pysam=True) == [ (0, "A"), (1, "-"), (2, "-"), (3, "A"), (4, "A"), ] ref = "AAAA" query = "GGGAAAA" cigar = [(3, 4), (4, 0)] assert self_qc.cigar_to_alts(ref, query, cigar, q_pos=3) == [ (0, "A"), (1, "A"), (2, "A"), (3, "A"), ] def test_mappy_cigar_liftover(): amplicon = primers.Amplicon("test_amplicon") seq = "CTTCAGGTGATGGCACAACAAGTCCTATTTGAACATAGACTCACGAGATTGCGGTTATACTTTCGAAAATGGGAATCTGGAGTAAAAGACTAAAGTTAGATACACAGTTGCTTCACTTCAGACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTGCCATCTTCTTCATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGGTCCAATTCACACAACGACGGTTCATCCGGAGTTGTTAATCCAGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTGTTACTCAAGCTGATGAGTACGAACTTATGTACTCATTCGTTTCGGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGT" cigar = [ (4, 32), (0, 29), (2, 2), (0, 7), (1, 1), (0, 4), (1, 1), (0, 8), (2, 1), (0, 11), (1, 3), (0, 1), (2, 1), (0, 26), (1, 1), (0, 8), (2, 1), (0, 76), (1, 2), (0, 46), (1, 1), (0, 4), (2, 1), (0, 11), (2, 1), (0, 77), (1, 2), (0, 5), (2, 1), (0, 40), (1, 1), (0, 54), (4, 70), ] self_qc.cigar_to_alts(seq, seq, cigar, pysam=True) def test_bias_test(): return True # TODO resolve assert not self_qc.test_bias(10, 100, threshold=0.3) assert not self_qc.test_bias(90, 100, threshold=0.3) assert self_qc.test_bias(40, 100, threshold=0.3) assert self_qc.test_bias(60, 100, threshold=0.3) def test_stat_evaluation(): return True # resolve fwd = self_qc.BaseProfile(False, True, "test_amplicon1") rev = self_qc.BaseProfile(False, False, "test_amplicon2") # 20% alt alleles pileup20 = ["A", "A", "C", "T", "A", "A", "A", "A", "A", "A"] # 0% alt alleles pileup0 = ["A", "A", "A", "A", "A", "A", "A", "A", "A", "A"] # 100% alt alleles pileup100 = ["T", "T", "T", "G", "G", "G", "T", "G", "C", "C"] stats = self_qc.Stats() for base in pileup20: if base != "A": stats.add_alt(fwd) stats.add_alt(rev) else: stats.add_ref(fwd) stats.add_ref(rev) assert stats.check_for_failure(bias_threshold=0.3) def test_masking(): fail = StatsTest(True) succeed = StatsTest(False) sequence = "ATCATC" stats = {0: succeed, 4: fail} masked, _ = self_qc.mask_sequence(sequence, stats) assert masked == "ATCANC" sequence = "ATCATC" stats = {0: fail, 4: fail} masked, _ = self_qc.mask_sequence(sequence, stats) assert masked == "NTCANC"
tests/self_qc_test.py
import os import pytest from intervaltree import Interval from viridian_workflow import self_qc, primers this_dir = os.path.dirname(os.path.abspath(__file__)) data_dir = os.path.join(this_dir, "data", "primers") class StatsTest: def __init__(self, fail): self.fail = fail self.log = [] self.config = self_qc.default_config def check_for_failure(self, **kwargs): return self.fail def test_cigar_tuple_construction(): ref = "AAA" query = "AAA" cigar = [ (3, 0), ] assert self_qc.cigar_to_alts(ref, query, cigar) == [(0, "A"), (1, "A"), (2, "A")] ref = "AAA" query = "ATTAA" cigar = [(1, 0), (2, 1), (2, 0)] assert self_qc.cigar_to_alts(ref, query, cigar) == [ (0, "A"), # (1, "TT"), (1, "A"), (2, "A"), ] ref = "ATTAA" query = "AAA" cigar = [(1, 0), (2, 2), (2, 0)] assert self_qc.cigar_to_alts(ref, query, cigar) == [ (0, "A"), (1, "-"), (2, "-"), (3, "A"), (4, "A"), ] ref = "ATTAA" query = "AAA" cigar = [(0, 1), (2, 2), (0, 2)] assert self_qc.cigar_to_alts(ref, query, cigar, pysam=True) == [ (0, "A"), (1, "-"), (2, "-"), (3, "A"), (4, "A"), ] ref = "AAAA" query = "GGGAAAA" cigar = [(3, 4), (4, 0)] assert self_qc.cigar_to_alts(ref, query, cigar, q_pos=3) == [ (0, "A"), (1, "A"), (2, "A"), (3, "A"), ] def test_mappy_cigar_liftover(): amplicon = primers.Amplicon("test_amplicon") seq = "CTTCAGGTGATGGCACAACAAGTCCTATTTGAACATAGACTCACGAGATTGCGGTTATACTTTCGAAAATGGGAATCTGGAGTAAAAGACTAAAGTTAGATACACAGTTGCTTCACTTCAGACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTGCCATCTTCTTCATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGGTCCAATTCACACAACGACGGTTCATCCGGAGTTGTTAATCCAGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTGTTACTCAAGCTGATGAGTACGAACTTATGTACTCATTCGTTTCGGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGT" cigar = [ (4, 32), (0, 29), (2, 2), (0, 7), (1, 1), (0, 4), (1, 1), (0, 8), (2, 1), (0, 11), (1, 3), (0, 1), (2, 1), (0, 26), (1, 1), (0, 8), (2, 1), (0, 76), (1, 2), (0, 46), (1, 1), (0, 4), (2, 1), (0, 11), (2, 1), (0, 77), (1, 2), (0, 5), (2, 1), (0, 40), (1, 1), (0, 54), (4, 70), ] self_qc.cigar_to_alts(seq, seq, cigar, pysam=True) def test_bias_test(): return True # TODO resolve assert not self_qc.test_bias(10, 100, threshold=0.3) assert not self_qc.test_bias(90, 100, threshold=0.3) assert self_qc.test_bias(40, 100, threshold=0.3) assert self_qc.test_bias(60, 100, threshold=0.3) def test_stat_evaluation(): return True # resolve fwd = self_qc.BaseProfile(False, True, "test_amplicon1") rev = self_qc.BaseProfile(False, False, "test_amplicon2") # 20% alt alleles pileup20 = ["A", "A", "C", "T", "A", "A", "A", "A", "A", "A"] # 0% alt alleles pileup0 = ["A", "A", "A", "A", "A", "A", "A", "A", "A", "A"] # 100% alt alleles pileup100 = ["T", "T", "T", "G", "G", "G", "T", "G", "C", "C"] stats = self_qc.Stats() for base in pileup20: if base != "A": stats.add_alt(fwd) stats.add_alt(rev) else: stats.add_ref(fwd) stats.add_ref(rev) assert stats.check_for_failure(bias_threshold=0.3) def test_masking(): fail = StatsTest(True) succeed = StatsTest(False) sequence = "ATCATC" stats = {0: succeed, 4: fail} masked, _ = self_qc.mask_sequence(sequence, stats) assert masked == "ATCANC" sequence = "ATCATC" stats = {0: fail, 4: fail} masked, _ = self_qc.mask_sequence(sequence, stats) assert masked == "NTCANC"
0.449876
0.703282
import os import sys import logging from argparse import ArgumentParser ROOT = os.path.dirname(os.path.realpath(__file__)) # Try to load modules from our current env first sys.path.insert(0, os.path.join(ROOT, "..")) from burpui_monitor.tools.logging import logger logger.init_logger(config=dict(level=logging.CRITICAL)) def parse_args(name=None): mname = name if not name: mname = "bui-monitor" parser = ArgumentParser(prog=mname) parser.add_argument( "-v", "--verbose", dest="log", help="increase output verbosity (e.g., -vv is more verbose than -v)", action="count", ) parser.add_argument( "-V", "--version", dest="version", help="print version and exit", action="store_true", ) parser.add_argument( "-c", "--config", dest="config", help="burp-ui configuration file", metavar="<CONFIG>", ) parser.add_argument( "-l", "--logfile", dest="logfile", help="output logs in defined file", metavar="<FILE>", ) options = parser.parse_args() if options.version: from burpui_monitor import __title__ from burpui_monitor.desc import __version__, __release__ ver = "{}: v{}".format(mname or __title__, __version__) if options.log: ver = "{} ({})".format(ver, __release__) print(ver) sys.exit(0) return options def main(): """ Main function """ options = parse_args() monitor(options) def monitor(options=None): import trio from burpui_monitor.engines.monitor import MonitorPool from burpui_monitor.utils import lookup_file if not options: options = parse_args(name="bui-monitor") conf = ["buimonitor.cfg", "buimonitor.sample.cfg"] if options.config: conf = lookup_file(options.config, guess=False) else: conf = lookup_file(conf) check_config(conf) monitor = MonitorPool(conf, options.log, options.logfile) trio.run(monitor.run) def check_config(conf): if not conf: raise IOError("No configuration file found") if not os.path.isfile(conf): raise IOError("File does not exist: '{0}'".format(conf)) if __name__ == "__main__": main()
pkgs/burp-ui-monitor/burpui_monitor-decoy/__main__.py
import os import sys import logging from argparse import ArgumentParser ROOT = os.path.dirname(os.path.realpath(__file__)) # Try to load modules from our current env first sys.path.insert(0, os.path.join(ROOT, "..")) from burpui_monitor.tools.logging import logger logger.init_logger(config=dict(level=logging.CRITICAL)) def parse_args(name=None): mname = name if not name: mname = "bui-monitor" parser = ArgumentParser(prog=mname) parser.add_argument( "-v", "--verbose", dest="log", help="increase output verbosity (e.g., -vv is more verbose than -v)", action="count", ) parser.add_argument( "-V", "--version", dest="version", help="print version and exit", action="store_true", ) parser.add_argument( "-c", "--config", dest="config", help="burp-ui configuration file", metavar="<CONFIG>", ) parser.add_argument( "-l", "--logfile", dest="logfile", help="output logs in defined file", metavar="<FILE>", ) options = parser.parse_args() if options.version: from burpui_monitor import __title__ from burpui_monitor.desc import __version__, __release__ ver = "{}: v{}".format(mname or __title__, __version__) if options.log: ver = "{} ({})".format(ver, __release__) print(ver) sys.exit(0) return options def main(): """ Main function """ options = parse_args() monitor(options) def monitor(options=None): import trio from burpui_monitor.engines.monitor import MonitorPool from burpui_monitor.utils import lookup_file if not options: options = parse_args(name="bui-monitor") conf = ["buimonitor.cfg", "buimonitor.sample.cfg"] if options.config: conf = lookup_file(options.config, guess=False) else: conf = lookup_file(conf) check_config(conf) monitor = MonitorPool(conf, options.log, options.logfile) trio.run(monitor.run) def check_config(conf): if not conf: raise IOError("No configuration file found") if not os.path.isfile(conf): raise IOError("File does not exist: '{0}'".format(conf)) if __name__ == "__main__": main()
0.294114
0.064418
import argparse import csv import math import pathlib import sys from typing import List from pynapl.APL import APL from pynapl.APLPyConnect import Connection LANGUAGES = ["en", "fr", "es", "pt"] DATA_FOLDER = pathlib.Path(__file__).parent / "data" FILE_NAME_TEMPLATE = "{lang}_trigram_count_filtered.tsv" def init_data(apl: Connection.APL) -> List[int]: """Initialise the data arrays on the APL side. As a side effect, this function defines some arrays on the APL instance. For each language, {lang}_trigrams and {lang}_counts arrays are created. The trigrams array is a nested character vector, and the counts array is a simple integer vector. The counts vector is one item longer than the trigrams array, having an extra 1 at the end. Returns an integer list, with the total trigram count for each language. """ totals = [] for lang in LANGUAGES: total = 0 trigrams, counts = [], [] with open(DATA_FOLDER / FILE_NAME_TEMPLATE.format(lang=lang), "r") as f: reader = csv.reader(f, delimiter="\t") for trigram, count in reader: trigrams.append(trigram) total += int(count) counts.append(int(count) + 1) totals.append(total) _ = apl.eval(f"{lang}_trigrams ← ⊃∆", trigrams) _ = apl.eval(f"{lang}_counts ← 1,⍨⊃∆", counts) return totals def get_counts(apl: Connection.APL, sentence: str, language: str) -> List[int]: """Return the trigram counts for each trigram of a sentence.""" code = "{lang}_counts[{lang}_trigrams ⍳ 3,/⊃∆]".format(lang=language) return apl.eval(code, sentence.lower()) def recognise_sentence(apl: Connection.APL, totals: List[int], sentence: str) -> str: """Performs automatic language recognition on the given sentence.""" log_probabilities = [ sum(math.log(c/total) for c in get_counts(apl, sentence.lower(), lang)) for lang, total in zip(LANGUAGES, totals) ] # Find the index where log_probabilities is maximal and return respective language. return LANGUAGES[max(range(len(LANGUAGES)), key=log_probabilities.__getitem__)] if __name__ == "__main__": parser = argparse.ArgumentParser() parser.add_argument("-s", "--sentence", help="Sentence to recognise.") parser.add_argument( "-i", "--interactive", help="Enter interactive mode.", action="store_true" ) args = parser.parse_args() if not args.sentence and not args.interactive: sys.exit() apl = APL() totals = init_data(apl) if args.sentence: print(recognise_sentence(apl, totals, args.sentence)) if args.interactive: print("Type sentences to be recognised:") sentence = input(" >> ") while sentence: print(recognise_sentence(apl, totals, sentence)) sentence = input(" >> ")
demos/language_recogniser/recogniser.py
import argparse import csv import math import pathlib import sys from typing import List from pynapl.APL import APL from pynapl.APLPyConnect import Connection LANGUAGES = ["en", "fr", "es", "pt"] DATA_FOLDER = pathlib.Path(__file__).parent / "data" FILE_NAME_TEMPLATE = "{lang}_trigram_count_filtered.tsv" def init_data(apl: Connection.APL) -> List[int]: """Initialise the data arrays on the APL side. As a side effect, this function defines some arrays on the APL instance. For each language, {lang}_trigrams and {lang}_counts arrays are created. The trigrams array is a nested character vector, and the counts array is a simple integer vector. The counts vector is one item longer than the trigrams array, having an extra 1 at the end. Returns an integer list, with the total trigram count for each language. """ totals = [] for lang in LANGUAGES: total = 0 trigrams, counts = [], [] with open(DATA_FOLDER / FILE_NAME_TEMPLATE.format(lang=lang), "r") as f: reader = csv.reader(f, delimiter="\t") for trigram, count in reader: trigrams.append(trigram) total += int(count) counts.append(int(count) + 1) totals.append(total) _ = apl.eval(f"{lang}_trigrams ← ⊃∆", trigrams) _ = apl.eval(f"{lang}_counts ← 1,⍨⊃∆", counts) return totals def get_counts(apl: Connection.APL, sentence: str, language: str) -> List[int]: """Return the trigram counts for each trigram of a sentence.""" code = "{lang}_counts[{lang}_trigrams ⍳ 3,/⊃∆]".format(lang=language) return apl.eval(code, sentence.lower()) def recognise_sentence(apl: Connection.APL, totals: List[int], sentence: str) -> str: """Performs automatic language recognition on the given sentence.""" log_probabilities = [ sum(math.log(c/total) for c in get_counts(apl, sentence.lower(), lang)) for lang, total in zip(LANGUAGES, totals) ] # Find the index where log_probabilities is maximal and return respective language. return LANGUAGES[max(range(len(LANGUAGES)), key=log_probabilities.__getitem__)] if __name__ == "__main__": parser = argparse.ArgumentParser() parser.add_argument("-s", "--sentence", help="Sentence to recognise.") parser.add_argument( "-i", "--interactive", help="Enter interactive mode.", action="store_true" ) args = parser.parse_args() if not args.sentence and not args.interactive: sys.exit() apl = APL() totals = init_data(apl) if args.sentence: print(recognise_sentence(apl, totals, args.sentence)) if args.interactive: print("Type sentences to be recognised:") sentence = input(" >> ") while sentence: print(recognise_sentence(apl, totals, sentence)) sentence = input(" >> ")
0.627837
0.373762
import filecmp import os import shutil import tempfile import unittest import json_summary_combiner class TestJsonSummaryCombiner(unittest.TestCase): def setUp(self): self._test_data_dir = os.path.join( os.path.dirname(os.path.realpath(__file__)), 'test_data', 'combiner') self._actual_html_dir = tempfile.mkdtemp() self._absolute_url = 'http://dummy-link.foobar/' self._render_pictures_args = '--test1=test --test2=test --test3' self._nopatch_gpu = 'False' self._withpatch_gpu = 'True' def tearDown(self): shutil.rmtree(self._actual_html_dir) def test_CombineJsonSummaries_WithDifferences(self): worker_name_to_info = json_summary_combiner.CombineJsonSummaries( os.path.join(self._test_data_dir, 'differences')) for worker_name, worker_info in worker_name_to_info.items(): worker_num = worker_name[-1] file_count = 0 for file_info in worker_info.failed_files: file_count += 1 self.assertEquals(file_info.file_name, 'file%s_%s.png' % (worker_name, file_count)) self.assertEquals(file_info.skp_location, 'http://storage.cloud.google.com/dummy-bucket/skps' '/%s/file%s_.skp' % (worker_name, worker_name)) self.assertEquals(file_info.num_pixels_differing, int('%s%s1' % (worker_num, file_count))) self.assertEquals(file_info.percent_pixels_differing, int('%s%s2' % (worker_num, file_count))) self.assertEquals(file_info.max_diff_per_channel, int('%s%s4' % (worker_num, file_count))) self.assertEquals( worker_info.skps_location, 'gs://dummy-bucket/skps/%s' % worker_name) self.assertEquals( worker_info.files_location_nopatch, 'gs://dummy-bucket/output-dir/%s/nopatch-images' % worker_name) self.assertEquals( worker_info.files_location_diffs, 'gs://dummy-bucket/output-dir/%s/diffs' % worker_name) self.assertEquals( worker_info.files_location_whitediffs, 'gs://dummy-bucket/output-dir/%s/whitediffs' % worker_name) def test_CombineJsonSummaries_NoDifferences(self): worker_name_to_info = json_summary_combiner.CombineJsonSummaries( os.path.join(self._test_data_dir, 'no_output')) self.assertEquals(worker_name_to_info, {}) def _get_test_worker_name_to_info(self): worker_name_to_info = { 'worker1': json_summary_combiner.WorkerInfo( worker_name='worker1', failed_files=[ json_summary_combiner.FileInfo( 'fileworker1_1.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker1/' 'fileworker1_.skp', 111, 112, 114, 115), json_summary_combiner.FileInfo( 'fileworker1_2.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker1/' 'fileworker1_.skp', 121, 122, 124, 125)], skps_location='gs://dummy-bucket/skps/worker1', files_location_diffs='gs://dummy-bucket/worker1/diffs', files_location_whitediffs='gs://dummy-bucket/worker1/whitediffs', files_location_nopatch='gs://dummy-bucket/worker1/nopatch', files_location_withpatch='gs://dummy-bucket/worker1/withpatch'), 'worker2': json_summary_combiner.WorkerInfo( worker_name='worker2', failed_files=[ json_summary_combiner.FileInfo( 'fileworker2_1.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker2/' 'fileworker2_.skp', 211, 212, 214, 215)], skps_location='gs://dummy-bucket/skps/worker2', files_location_diffs='gs://dummy-bucket/worker2/diffs', files_location_whitediffs='gs://dummy-bucket/worker2/whitediffs', files_location_nopatch='gs://dummy-bucket/worker2/nopatch', files_location_withpatch='gs://dummy-bucket/worker2/withpatch'), 'worker3': json_summary_combiner.WorkerInfo( worker_name='worker3', failed_files=[ json_summary_combiner.FileInfo( 'fileworker3_1.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker3/' 'fileworker3_.skp', 311, 312, 314, 315), json_summary_combiner.FileInfo( 'fileworker3_2.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker3/' 'fileworker3_.skp', 321, 322, 324, 325), json_summary_combiner.FileInfo( 'fileworker3_3.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker3/' 'fileworker3_.skp', 331, 332, 334, 335), json_summary_combiner.FileInfo( 'fileworker3_4.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker3/' 'fileworker3_.skp', 341, 342, 344, 345)], skps_location='gs://dummy-bucket/skps/worker3', files_location_diffs='gs://dummy-bucket/worker3/diffs', files_location_whitediffs='gs://dummy-bucket/worker3/whitediffs', files_location_nopatch='gs://dummy-bucket/worker3/nopatch', files_location_withpatch='gs://dummy-bucket/worker3/withpatch') } return worker_name_to_info def test_OutputToHTML_WithDifferences_WithAbsoluteUrl(self): worker_name_to_info = self._get_test_worker_name_to_info() json_summary_combiner.OutputToHTML( worker_name_to_info=worker_name_to_info, output_html_dir=self._actual_html_dir, absolute_url=self._absolute_url, render_pictures_args=self._render_pictures_args, nopatch_gpu=self._nopatch_gpu, withpatch_gpu=self._withpatch_gpu) html_expected_dir = os.path.join(self._test_data_dir, 'html_outputs', 'differences_with_url') for html_file in ('index.html', 'list_of_all_files.html', 'fileworker1_1.png.html', 'fileworker1_2.png.html', 'fileworker2_1.png.html', 'fileworker3_1.png.html', 'fileworker3_2.png.html', 'fileworker3_3.png.html', 'fileworker3_4.png.html'): self.assertTrue( filecmp.cmp(os.path.join(html_expected_dir, html_file), os.path.join(self._actual_html_dir, html_file))) def test_OutputToHTML_WithDifferences_WithNoUrl(self): worker_name_to_info = self._get_test_worker_name_to_info() json_summary_combiner.OutputToHTML( worker_name_to_info=worker_name_to_info, output_html_dir=self._actual_html_dir, absolute_url='', render_pictures_args=self._render_pictures_args, nopatch_gpu=self._nopatch_gpu, withpatch_gpu=self._withpatch_gpu) html_expected_dir = os.path.join(self._test_data_dir, 'html_outputs', 'differences_no_url') for html_file in ('index.html', 'list_of_all_files.html', 'fileworker1_1.png.html', 'fileworker1_2.png.html', 'fileworker2_1.png.html', 'fileworker3_1.png.html', 'fileworker3_2.png.html', 'fileworker3_3.png.html', 'fileworker3_4.png.html'): self.assertTrue( filecmp.cmp(os.path.join(html_expected_dir, html_file), os.path.join(self._actual_html_dir, html_file))) def test_OutputToHTML_NoDifferences(self): json_summary_combiner.OutputToHTML( worker_name_to_info={}, output_html_dir=self._actual_html_dir, absolute_url='', render_pictures_args=self._render_pictures_args, nopatch_gpu=self._nopatch_gpu, withpatch_gpu=self._withpatch_gpu) html_expected_dir = os.path.join(self._test_data_dir, 'html_outputs', 'nodifferences') self.assertTrue( filecmp.cmp(os.path.join(html_expected_dir, 'index.html'), os.path.join(self._actual_html_dir, 'index.html'))) if __name__ == '__main__': unittest.main()
ct/py/json_summary_combiner_test.py
import filecmp import os import shutil import tempfile import unittest import json_summary_combiner class TestJsonSummaryCombiner(unittest.TestCase): def setUp(self): self._test_data_dir = os.path.join( os.path.dirname(os.path.realpath(__file__)), 'test_data', 'combiner') self._actual_html_dir = tempfile.mkdtemp() self._absolute_url = 'http://dummy-link.foobar/' self._render_pictures_args = '--test1=test --test2=test --test3' self._nopatch_gpu = 'False' self._withpatch_gpu = 'True' def tearDown(self): shutil.rmtree(self._actual_html_dir) def test_CombineJsonSummaries_WithDifferences(self): worker_name_to_info = json_summary_combiner.CombineJsonSummaries( os.path.join(self._test_data_dir, 'differences')) for worker_name, worker_info in worker_name_to_info.items(): worker_num = worker_name[-1] file_count = 0 for file_info in worker_info.failed_files: file_count += 1 self.assertEquals(file_info.file_name, 'file%s_%s.png' % (worker_name, file_count)) self.assertEquals(file_info.skp_location, 'http://storage.cloud.google.com/dummy-bucket/skps' '/%s/file%s_.skp' % (worker_name, worker_name)) self.assertEquals(file_info.num_pixels_differing, int('%s%s1' % (worker_num, file_count))) self.assertEquals(file_info.percent_pixels_differing, int('%s%s2' % (worker_num, file_count))) self.assertEquals(file_info.max_diff_per_channel, int('%s%s4' % (worker_num, file_count))) self.assertEquals( worker_info.skps_location, 'gs://dummy-bucket/skps/%s' % worker_name) self.assertEquals( worker_info.files_location_nopatch, 'gs://dummy-bucket/output-dir/%s/nopatch-images' % worker_name) self.assertEquals( worker_info.files_location_diffs, 'gs://dummy-bucket/output-dir/%s/diffs' % worker_name) self.assertEquals( worker_info.files_location_whitediffs, 'gs://dummy-bucket/output-dir/%s/whitediffs' % worker_name) def test_CombineJsonSummaries_NoDifferences(self): worker_name_to_info = json_summary_combiner.CombineJsonSummaries( os.path.join(self._test_data_dir, 'no_output')) self.assertEquals(worker_name_to_info, {}) def _get_test_worker_name_to_info(self): worker_name_to_info = { 'worker1': json_summary_combiner.WorkerInfo( worker_name='worker1', failed_files=[ json_summary_combiner.FileInfo( 'fileworker1_1.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker1/' 'fileworker1_.skp', 111, 112, 114, 115), json_summary_combiner.FileInfo( 'fileworker1_2.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker1/' 'fileworker1_.skp', 121, 122, 124, 125)], skps_location='gs://dummy-bucket/skps/worker1', files_location_diffs='gs://dummy-bucket/worker1/diffs', files_location_whitediffs='gs://dummy-bucket/worker1/whitediffs', files_location_nopatch='gs://dummy-bucket/worker1/nopatch', files_location_withpatch='gs://dummy-bucket/worker1/withpatch'), 'worker2': json_summary_combiner.WorkerInfo( worker_name='worker2', failed_files=[ json_summary_combiner.FileInfo( 'fileworker2_1.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker2/' 'fileworker2_.skp', 211, 212, 214, 215)], skps_location='gs://dummy-bucket/skps/worker2', files_location_diffs='gs://dummy-bucket/worker2/diffs', files_location_whitediffs='gs://dummy-bucket/worker2/whitediffs', files_location_nopatch='gs://dummy-bucket/worker2/nopatch', files_location_withpatch='gs://dummy-bucket/worker2/withpatch'), 'worker3': json_summary_combiner.WorkerInfo( worker_name='worker3', failed_files=[ json_summary_combiner.FileInfo( 'fileworker3_1.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker3/' 'fileworker3_.skp', 311, 312, 314, 315), json_summary_combiner.FileInfo( 'fileworker3_2.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker3/' 'fileworker3_.skp', 321, 322, 324, 325), json_summary_combiner.FileInfo( 'fileworker3_3.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker3/' 'fileworker3_.skp', 331, 332, 334, 335), json_summary_combiner.FileInfo( 'fileworker3_4.png', 'http://storage.cloud.google.com/dummy-bucket/skps/worker3/' 'fileworker3_.skp', 341, 342, 344, 345)], skps_location='gs://dummy-bucket/skps/worker3', files_location_diffs='gs://dummy-bucket/worker3/diffs', files_location_whitediffs='gs://dummy-bucket/worker3/whitediffs', files_location_nopatch='gs://dummy-bucket/worker3/nopatch', files_location_withpatch='gs://dummy-bucket/worker3/withpatch') } return worker_name_to_info def test_OutputToHTML_WithDifferences_WithAbsoluteUrl(self): worker_name_to_info = self._get_test_worker_name_to_info() json_summary_combiner.OutputToHTML( worker_name_to_info=worker_name_to_info, output_html_dir=self._actual_html_dir, absolute_url=self._absolute_url, render_pictures_args=self._render_pictures_args, nopatch_gpu=self._nopatch_gpu, withpatch_gpu=self._withpatch_gpu) html_expected_dir = os.path.join(self._test_data_dir, 'html_outputs', 'differences_with_url') for html_file in ('index.html', 'list_of_all_files.html', 'fileworker1_1.png.html', 'fileworker1_2.png.html', 'fileworker2_1.png.html', 'fileworker3_1.png.html', 'fileworker3_2.png.html', 'fileworker3_3.png.html', 'fileworker3_4.png.html'): self.assertTrue( filecmp.cmp(os.path.join(html_expected_dir, html_file), os.path.join(self._actual_html_dir, html_file))) def test_OutputToHTML_WithDifferences_WithNoUrl(self): worker_name_to_info = self._get_test_worker_name_to_info() json_summary_combiner.OutputToHTML( worker_name_to_info=worker_name_to_info, output_html_dir=self._actual_html_dir, absolute_url='', render_pictures_args=self._render_pictures_args, nopatch_gpu=self._nopatch_gpu, withpatch_gpu=self._withpatch_gpu) html_expected_dir = os.path.join(self._test_data_dir, 'html_outputs', 'differences_no_url') for html_file in ('index.html', 'list_of_all_files.html', 'fileworker1_1.png.html', 'fileworker1_2.png.html', 'fileworker2_1.png.html', 'fileworker3_1.png.html', 'fileworker3_2.png.html', 'fileworker3_3.png.html', 'fileworker3_4.png.html'): self.assertTrue( filecmp.cmp(os.path.join(html_expected_dir, html_file), os.path.join(self._actual_html_dir, html_file))) def test_OutputToHTML_NoDifferences(self): json_summary_combiner.OutputToHTML( worker_name_to_info={}, output_html_dir=self._actual_html_dir, absolute_url='', render_pictures_args=self._render_pictures_args, nopatch_gpu=self._nopatch_gpu, withpatch_gpu=self._withpatch_gpu) html_expected_dir = os.path.join(self._test_data_dir, 'html_outputs', 'nodifferences') self.assertTrue( filecmp.cmp(os.path.join(html_expected_dir, 'index.html'), os.path.join(self._actual_html_dir, 'index.html'))) if __name__ == '__main__': unittest.main()
0.363082
0.152694
from heapq import heappush, heappop # The Maze # DFS is faster to get to destination class Solution(object): def hasPath(self, maze, start, destination): """ :type maze: List[List[int]] :type start: List[int] :type destination: List[int] :rtype: bool """ visited = set() return self.dfs(maze, tuple(start), tuple(destination), visited) def dfs(self, maze, curr, dest, visited): # early stop condition if curr in visited: return False # valid result condition if curr == dest: return True visited.add(curr) # recursion definition for coor in self.next_coors(curr[0], curr[1], maze): if self.dfs(maze, coor, dest, visited): return True return False def next_coors(self, i, j, maze): m, n = len(maze), len(maze[0]) coors = [] for dx, dy in [(-1, 0), (0, -1), (1, 0), (0, 1)]: x, y = i, j while 0 <= x + dx < m and 0 <= y + dy < n and maze[x + dx][y + dy] == 0: x += dx y += dy if not (i == x and j == y): coors.append((x, y)) return coors # The Maze II # BFS with priority queue is faster in this case class Solution(object): def shortestDistance(self, maze, start, destination): """ :type maze: List[List[int]] :type start: List[int] :type destination: List[int] :rtype: int """ visited = set() pq = [(0, start[0], start[1])] while pq: # means every coordinate starts the search with shortest distance # and the same coordinate with longer distance will be deduplicated # thus overall forming a shortest path dist, i, j = heappop(pq) if (i, j) in visited: continue if [i, j] == destination: return dist visited.add((i, j)) for coor in self.next_coors(i, j, maze): new_dist = dist + abs(coor[0] - i) + abs(coor[1] - j) heappush(pq, (new_dist, coor[0], coor[1])) return -1 # same as Q1 def next_coors(self, i, j, maze): m, n = len(maze), len(maze[0]) coors = [] for dx, dy in [(-1, 0), (0, -1), (1, 0), (0, 1)]: x, y = i, j while 0 <= x + dx < m and 0 <= y + dy < n and maze[x + dx][y + dy] == 0: x += dx y += dy if not (i == x and j == y): coors.append((x, y)) return coors # The Maze III # BFS with prioritiy queue, ball will fall into hole if rolled to that position # similar approach as Q2 class Solution(object): def findShortestWay(self, maze, ball, hole): """ :type maze: List[List[int]] :type ball: List[int] :type hole: List[int] :rtype: str """ m, n = len(maze), len(maze[0]) visited = set() pq = [(0, '', ball[0], ball[1])] while pq: dist, path, i, j = heappop(pq) if (i, j) in visited: continue if [i, j] == hole: return path visited.add((i, j)) for x, y, direction in self.next_coors(maze, i, j, hole): new_dist = dist + abs(x - i) + abs(y - j) new_path = path + direction heappush(pq, (new_dist, new_path, x, y)) return 'impossible' def next_coors(self, maze, i, j, hole): m, n = len(maze), len(maze[0]) directions = { 'r': (0, 1), 'l': (0, -1), 'd': (1, 0), 'u': (-1, 0) } coors = [] for d in directions: dx, dy = directions[d] x, y = i, j while 0 <= x + dx < m and 0 <= y + dy < n and maze[x + dx][y + dy] == 0: x += dx y += dy # stop when reaching the hole if [x, y] == hole: break if not (x == i and y == j) coors.append((x, y, d)) return coors
algorithms/bfs/the_maze.py
from heapq import heappush, heappop # The Maze # DFS is faster to get to destination class Solution(object): def hasPath(self, maze, start, destination): """ :type maze: List[List[int]] :type start: List[int] :type destination: List[int] :rtype: bool """ visited = set() return self.dfs(maze, tuple(start), tuple(destination), visited) def dfs(self, maze, curr, dest, visited): # early stop condition if curr in visited: return False # valid result condition if curr == dest: return True visited.add(curr) # recursion definition for coor in self.next_coors(curr[0], curr[1], maze): if self.dfs(maze, coor, dest, visited): return True return False def next_coors(self, i, j, maze): m, n = len(maze), len(maze[0]) coors = [] for dx, dy in [(-1, 0), (0, -1), (1, 0), (0, 1)]: x, y = i, j while 0 <= x + dx < m and 0 <= y + dy < n and maze[x + dx][y + dy] == 0: x += dx y += dy if not (i == x and j == y): coors.append((x, y)) return coors # The Maze II # BFS with priority queue is faster in this case class Solution(object): def shortestDistance(self, maze, start, destination): """ :type maze: List[List[int]] :type start: List[int] :type destination: List[int] :rtype: int """ visited = set() pq = [(0, start[0], start[1])] while pq: # means every coordinate starts the search with shortest distance # and the same coordinate with longer distance will be deduplicated # thus overall forming a shortest path dist, i, j = heappop(pq) if (i, j) in visited: continue if [i, j] == destination: return dist visited.add((i, j)) for coor in self.next_coors(i, j, maze): new_dist = dist + abs(coor[0] - i) + abs(coor[1] - j) heappush(pq, (new_dist, coor[0], coor[1])) return -1 # same as Q1 def next_coors(self, i, j, maze): m, n = len(maze), len(maze[0]) coors = [] for dx, dy in [(-1, 0), (0, -1), (1, 0), (0, 1)]: x, y = i, j while 0 <= x + dx < m and 0 <= y + dy < n and maze[x + dx][y + dy] == 0: x += dx y += dy if not (i == x and j == y): coors.append((x, y)) return coors # The Maze III # BFS with prioritiy queue, ball will fall into hole if rolled to that position # similar approach as Q2 class Solution(object): def findShortestWay(self, maze, ball, hole): """ :type maze: List[List[int]] :type ball: List[int] :type hole: List[int] :rtype: str """ m, n = len(maze), len(maze[0]) visited = set() pq = [(0, '', ball[0], ball[1])] while pq: dist, path, i, j = heappop(pq) if (i, j) in visited: continue if [i, j] == hole: return path visited.add((i, j)) for x, y, direction in self.next_coors(maze, i, j, hole): new_dist = dist + abs(x - i) + abs(y - j) new_path = path + direction heappush(pq, (new_dist, new_path, x, y)) return 'impossible' def next_coors(self, maze, i, j, hole): m, n = len(maze), len(maze[0]) directions = { 'r': (0, 1), 'l': (0, -1), 'd': (1, 0), 'u': (-1, 0) } coors = [] for d in directions: dx, dy = directions[d] x, y = i, j while 0 <= x + dx < m and 0 <= y + dy < n and maze[x + dx][y + dy] == 0: x += dx y += dy # stop when reaching the hole if [x, y] == hole: break if not (x == i and y == j) coors.append((x, y, d)) return coors
0.736021
0.624379
import random humanMales = ['Kharmat', 'Dalba', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] humanFemales = ['Vurnan', 'Ulbuh', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', 'Share Bhalme', '<NAME>', '<NAME>'] halflingMales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', 'N<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] halflingFemales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] halforcMales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] halforcFemales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] halfelfMales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] halfelfFemales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] gnomeMales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] gnomeFemales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] elfMales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', 'Corio<NAME>igohhih', 'Neironthalmas Komrol'] elfFemales = ['<NAME>', '<NAME>', '<NAME>', 'Inthe Shaniol', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] dwarfMales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] dwarfFemales = ['<NAME>', '<NAME>', 'So Deeppunch', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] genders = [ #Weighted to allow for a 1/40 chance of a non-binary NPC, a 20/40 chance #of a female NPC, and a 19/40 chance of a male NPC. 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'non-binary'] #Proof of concept using a list for now, need to find a way to generate #names en-masse and either create them on the fly or put a bunch in a DB #Also, an androgynous set of names would be nice, but for now just choose #randomly between male and female names if gender is not male/female class Name(): def __init__(self, inName, inGender, finalRace): self.finalName = inName self.finalGender = inGender self.finalRace = finalRace def get_gender(self): if self.finalGender == 'rand': self.finalGender = random.choice(genders) def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(humanMales + halfingMales + halforcMales + halfelfMales + gnomeMales + elfMales + dwarfMales) elif self.finalGender == 'female': self.finalName = random.choice(humanFemales + halflingFemales + halforcFemales + halfelfFemales + gnomeFemales + elfFemales + dwarfFemales) else: self.finalName = random.choice(humanMales + humanFemales + halfingMales + halflingFemales + halforcMales + halforcFemales + halfelfMales + halfelfFemales + gnomeMales + gnomeFemales + elfMales + elfFemales + dwarfMales + dwarfFemales) def generate(self): self.get_gender() self.get_name() return (self.finalName, self.finalGender) class HumanName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(humanMales) elif self.finalGender == 'female': self.finalName = random.choice(humanFemales) else: self.finalName = random.choice((humanMales + humanFemales)) class HalflingName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(halflingMales) elif self.finalGender == 'female': self.finalName = random.choice(halflingFemales) else: self.finalName = random.choice(halflingMales + halflingFemales) class HalfOrcName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(halforcMales) elif self.finalGender == 'female': self.finalName = random.choice(halforcFemales) else: self.finalName = random.choice(halforcMales + halforcFemales) class HalfElfName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(halfelfMales) elif self.finalGender == 'female': self.finalName = random.choice(halfelfFemales) else: self.finalName = random.choice(halfelfMales + halfelfFemales) class GnomeName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(gnomeMales) elif self.finalGender == 'female': self.finalName = random.choice(gnomeFemales) else: self.finalName = random.choice(gnomeMales + gnomeFemales) class ElfName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(elfMales) elif self.finalGender == 'female': self.finalName = random.choice(elfFemales) else: self.finalName = random.choice(elfMales + elfFemales) class DwarfName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(dwarfMales) elif self.finalGender == 'female': self.finalName = random.choice(dwarfFemales) else: self.finalName = random.choice(dwarfMales + dwarfFemales)
namegen.py
import random humanMales = ['Kharmat', 'Dalba', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] humanFemales = ['Vurnan', 'Ulbuh', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', 'Share Bhalme', '<NAME>', '<NAME>'] halflingMales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', 'N<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] halflingFemales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] halforcMales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] halforcFemales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] halfelfMales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] halfelfFemales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] gnomeMales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] gnomeFemales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] elfMales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', 'Corio<NAME>igohhih', 'Neironthalmas Komrol'] elfFemales = ['<NAME>', '<NAME>', '<NAME>', 'Inthe Shaniol', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] dwarfMales = ['<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] dwarfFemales = ['<NAME>', '<NAME>', 'So Deeppunch', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>', '<NAME>'] genders = [ #Weighted to allow for a 1/40 chance of a non-binary NPC, a 20/40 chance #of a female NPC, and a 19/40 chance of a male NPC. 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'male', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'female', 'non-binary'] #Proof of concept using a list for now, need to find a way to generate #names en-masse and either create them on the fly or put a bunch in a DB #Also, an androgynous set of names would be nice, but for now just choose #randomly between male and female names if gender is not male/female class Name(): def __init__(self, inName, inGender, finalRace): self.finalName = inName self.finalGender = inGender self.finalRace = finalRace def get_gender(self): if self.finalGender == 'rand': self.finalGender = random.choice(genders) def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(humanMales + halfingMales + halforcMales + halfelfMales + gnomeMales + elfMales + dwarfMales) elif self.finalGender == 'female': self.finalName = random.choice(humanFemales + halflingFemales + halforcFemales + halfelfFemales + gnomeFemales + elfFemales + dwarfFemales) else: self.finalName = random.choice(humanMales + humanFemales + halfingMales + halflingFemales + halforcMales + halforcFemales + halfelfMales + halfelfFemales + gnomeMales + gnomeFemales + elfMales + elfFemales + dwarfMales + dwarfFemales) def generate(self): self.get_gender() self.get_name() return (self.finalName, self.finalGender) class HumanName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(humanMales) elif self.finalGender == 'female': self.finalName = random.choice(humanFemales) else: self.finalName = random.choice((humanMales + humanFemales)) class HalflingName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(halflingMales) elif self.finalGender == 'female': self.finalName = random.choice(halflingFemales) else: self.finalName = random.choice(halflingMales + halflingFemales) class HalfOrcName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(halforcMales) elif self.finalGender == 'female': self.finalName = random.choice(halforcFemales) else: self.finalName = random.choice(halforcMales + halforcFemales) class HalfElfName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(halfelfMales) elif self.finalGender == 'female': self.finalName = random.choice(halfelfFemales) else: self.finalName = random.choice(halfelfMales + halfelfFemales) class GnomeName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(gnomeMales) elif self.finalGender == 'female': self.finalName = random.choice(gnomeFemales) else: self.finalName = random.choice(gnomeMales + gnomeFemales) class ElfName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(elfMales) elif self.finalGender == 'female': self.finalName = random.choice(elfFemales) else: self.finalName = random.choice(elfMales + elfFemales) class DwarfName(Name): def get_name(self): if self.finalName != 'rand': pass elif self.finalGender == 'male': self.finalName = random.choice(dwarfMales) elif self.finalGender == 'female': self.finalName = random.choice(dwarfFemales) else: self.finalName = random.choice(dwarfMales + dwarfFemales)
0.084259
0.095687
# Import necessary libraries import subprocess # Runs commands and gets output import socket # Used to test internet connection import os # Used to run system commands and checks if run as root user import getpass # Used to hide user input in password field # Check if the user that executed this program is root user = os.getenv("SUDO_USER") if user is None: # If not root print("\n Execute as \033[1;31;48msudo\033[1;37;48m\n") # Prints request to run as root exit() # Closes program def internet(host="8.8.8.8", port=53, timeout=3): # Function to check if internet connection is successful try: socket.setdefaulttimeout(timeout) socket.socket(socket.AF_INET, socket.SOCK_STREAM).connect((host, port)) return True except Exception as ex: print(ex) return False # Enter wifi name here. search = "tamulink-wpa" # SSID to seach for tamulink-wpa. ssid = search # Also accepts parts of SSID like, "tam" or "link" scan = subprocess.Popen(["connmanctl", "services"], stdout=subprocess.PIPE) # Run connmanctl services and get output ssids = scan.stdout.readlines() # Break output into list named "ssids" print("\n\033[1;32;40mSearching For SSID:\033[1;37;40m", ssid) # Print SSID that is being searched for os.system("echo \"nameserver 8.8.8.8\" >> /etc/resolv.conf") # Writes "nameserver 8.8.8.8" to /etc/resolv.conf while len(ssids) <= 1: # Checks how many SSIDs where found during scan print("Scanning for more SSIDS") # Scans again if no SSIDs were found subprocess.call("connmanctl", " scan", " wifi") # Runs system command to scan for more ssids print("Have ", len(ssids), " ssids.") # Prints number of SSIDs found after scan for x in range(len(ssids)): # Looks at each SSID in list and converts each list entry to string ssids[x] = str(ssids[x]) # Convert to string for idx, val in enumerate(ssids): # Search through list for specified SSID or specified part of SSID if ssid in val: # If found SSID ssid = val # Replace specified SSID with found SSID ssid = ssid[0:len(ssid)-3].split() # Split SSID string along space chars and store in list del ssid[0] # Delete first entry in list because it's an artifact from # bytes to sting in lines 44 and 45 print("\033[1;32;40m\nFound: \n\033[1;37;40m" + ssid[0] + "\t\t" + ssid[1]) # Output SSID found matching search string username = input("\n\033[1;37;40mPlease enter your username: \033[0;37;40m") # Ask for tamulink-wpa username password = getpass.getpass(prompt='\033[1;37;40mPlease enter your password: \033[0;37;40m', stream=None) # Ask for tamulink-wpa password config_path = "/var/lib/connman/" + ssid[1] + ".config" # Generate connmanctl wifi configuration file path and name file = open(config_path, "w") # Open file using generated name and path, will create if file is non-existant print("\033[1;32;40m\nGenerated Configuration File Path: \n\033[1;37;40m" + config_path + "\n") # Tell user configuration file name and path connmanctl_ssid = ssid[1].splits("_") # Split connmanctl wifi scan wireless details file.write("[service_" + ssid[1] + "]\n") # Use tamulink detailed ssid for file title file.write("Type = wifi\n") # this is a WiFi file file.write("SSID = " + connmanctl_ssid[2] + "\n") # Set SSID to detailed SSID file.write("EAP = peap\n") # Set type of encapsulation file.write("Phase2 = MSCHAPV2\n") # Set type of authentication for network file.write("Identity= " + username + "\n") # Set network username file.write("Passphrase= " + password + "\n") # Set network password file.close() # Close file os.system("sudo systemctl restart connman") # Restart connman service so it finds new configuration file
software/python/basics/setup_wpa_enterprise.py
# Import necessary libraries import subprocess # Runs commands and gets output import socket # Used to test internet connection import os # Used to run system commands and checks if run as root user import getpass # Used to hide user input in password field # Check if the user that executed this program is root user = os.getenv("SUDO_USER") if user is None: # If not root print("\n Execute as \033[1;31;48msudo\033[1;37;48m\n") # Prints request to run as root exit() # Closes program def internet(host="8.8.8.8", port=53, timeout=3): # Function to check if internet connection is successful try: socket.setdefaulttimeout(timeout) socket.socket(socket.AF_INET, socket.SOCK_STREAM).connect((host, port)) return True except Exception as ex: print(ex) return False # Enter wifi name here. search = "tamulink-wpa" # SSID to seach for tamulink-wpa. ssid = search # Also accepts parts of SSID like, "tam" or "link" scan = subprocess.Popen(["connmanctl", "services"], stdout=subprocess.PIPE) # Run connmanctl services and get output ssids = scan.stdout.readlines() # Break output into list named "ssids" print("\n\033[1;32;40mSearching For SSID:\033[1;37;40m", ssid) # Print SSID that is being searched for os.system("echo \"nameserver 8.8.8.8\" >> /etc/resolv.conf") # Writes "nameserver 8.8.8.8" to /etc/resolv.conf while len(ssids) <= 1: # Checks how many SSIDs where found during scan print("Scanning for more SSIDS") # Scans again if no SSIDs were found subprocess.call("connmanctl", " scan", " wifi") # Runs system command to scan for more ssids print("Have ", len(ssids), " ssids.") # Prints number of SSIDs found after scan for x in range(len(ssids)): # Looks at each SSID in list and converts each list entry to string ssids[x] = str(ssids[x]) # Convert to string for idx, val in enumerate(ssids): # Search through list for specified SSID or specified part of SSID if ssid in val: # If found SSID ssid = val # Replace specified SSID with found SSID ssid = ssid[0:len(ssid)-3].split() # Split SSID string along space chars and store in list del ssid[0] # Delete first entry in list because it's an artifact from # bytes to sting in lines 44 and 45 print("\033[1;32;40m\nFound: \n\033[1;37;40m" + ssid[0] + "\t\t" + ssid[1]) # Output SSID found matching search string username = input("\n\033[1;37;40mPlease enter your username: \033[0;37;40m") # Ask for tamulink-wpa username password = getpass.getpass(prompt='\033[1;37;40mPlease enter your password: \033[0;37;40m', stream=None) # Ask for tamulink-wpa password config_path = "/var/lib/connman/" + ssid[1] + ".config" # Generate connmanctl wifi configuration file path and name file = open(config_path, "w") # Open file using generated name and path, will create if file is non-existant print("\033[1;32;40m\nGenerated Configuration File Path: \n\033[1;37;40m" + config_path + "\n") # Tell user configuration file name and path connmanctl_ssid = ssid[1].splits("_") # Split connmanctl wifi scan wireless details file.write("[service_" + ssid[1] + "]\n") # Use tamulink detailed ssid for file title file.write("Type = wifi\n") # this is a WiFi file file.write("SSID = " + connmanctl_ssid[2] + "\n") # Set SSID to detailed SSID file.write("EAP = peap\n") # Set type of encapsulation file.write("Phase2 = MSCHAPV2\n") # Set type of authentication for network file.write("Identity= " + username + "\n") # Set network username file.write("Passphrase= " + password + "\n") # Set network password file.close() # Close file os.system("sudo systemctl restart connman") # Restart connman service so it finds new configuration file
0.263315
0.077832
from django.conf import settings from django.db import models from django.utils.translation import ugettext_lazy as _ from wishlist import exceptions class WishListItem(models.Model): user = models.ForeignKey( settings.AUTH_USER_MODEL, related_name='wishlist_items', verbose_name=_('Owner'), on_delete=models.CASCADE) product = models.ForeignKey( 'products.Product', verbose_name=_('Product'), on_delete=models.CASCADE) date_created = models.DateTimeField( _('Date created'), auto_now_add=True, editable=False) def __str__(self): return str(self.product) class Meta: unique_together = ['user', 'product'] verbose_name = _('Wish list item') verbose_name_plural = _('Wish list items') class WishList(object): def __init__(self, user): self._user = user @property def _items(self): if not self._user.is_authenticated: raise exceptions.UserIsNotAuthenticated() if not hasattr(self, '_items_cache'): self._items_cache = { i.product_id: i for i in self._user.wishlist_items.all().select_related('product') } return self._items_cache def add(self, product): if product.id in self._items: raise exceptions.ProductAlreadyAdded() item = self._user.wishlist_items.create(product=product) self._items_cache[product.id] = item def remove(self, product_id): if product_id not in self._items: raise exceptions.ItemDoesNotExists() self._items[product_id].delete() del self._items[product_id] def has_product(self, product_id): if not self._user.is_authenticated: return False return product_id in self._items def __iter__(self): return iter(self._items.values()) def __len__(self): if self._user.is_authenticated: return len(self._items) return 0
wishlist/models.py
from django.conf import settings from django.db import models from django.utils.translation import ugettext_lazy as _ from wishlist import exceptions class WishListItem(models.Model): user = models.ForeignKey( settings.AUTH_USER_MODEL, related_name='wishlist_items', verbose_name=_('Owner'), on_delete=models.CASCADE) product = models.ForeignKey( 'products.Product', verbose_name=_('Product'), on_delete=models.CASCADE) date_created = models.DateTimeField( _('Date created'), auto_now_add=True, editable=False) def __str__(self): return str(self.product) class Meta: unique_together = ['user', 'product'] verbose_name = _('Wish list item') verbose_name_plural = _('Wish list items') class WishList(object): def __init__(self, user): self._user = user @property def _items(self): if not self._user.is_authenticated: raise exceptions.UserIsNotAuthenticated() if not hasattr(self, '_items_cache'): self._items_cache = { i.product_id: i for i in self._user.wishlist_items.all().select_related('product') } return self._items_cache def add(self, product): if product.id in self._items: raise exceptions.ProductAlreadyAdded() item = self._user.wishlist_items.create(product=product) self._items_cache[product.id] = item def remove(self, product_id): if product_id not in self._items: raise exceptions.ItemDoesNotExists() self._items[product_id].delete() del self._items[product_id] def has_product(self, product_id): if not self._user.is_authenticated: return False return product_id in self._items def __iter__(self): return iter(self._items.values()) def __len__(self): if self._user.is_authenticated: return len(self._items) return 0
0.565299
0.07333
from rnd_game import RNDGame from player import Player from rpsls_game import RockPaperScissorsLizardSpockGame def enter_username(): while True: try: username_input = str(input().strip()) return username_input break except: print("please insert a useful username") def enter_game_selection(): while True: game_input = str(input()).strip() if game_input == '1': return game_input break elif game_input == '2': return game_input break print("Sorry, {0} is not a option, please try again".format(str(game_input))) print("Please choose a game") print("Press 1 and Enter for 'Random Number Game'") print("Press 2 and Enter for 'Rock, Paper, Scissors, Lizard, Spock'") class MenuStarter: def __init__(self) -> object: print( "Welcome to the first exercise - it consists of 'Random Number Game' und 'Rock, paper, scissors (" "extended with Spock and Lizard) '") print("Please enter your nickname") player1 = Player(enter_username()) print("Welcome " + player1.name + " to the first exercise :)") print("Select the game you want to play") print("Select 1 and Enter for 'Random Number Game'") print("Select 2 und Enter für 'Rock, Paper, Scissors, Lizard, Spock'") check = enter_game_selection() if check == '1': print("'Random Number Game' is your selection") g = RNDGame(player1.name) g.start_game() elif check == '2': print("'Rock, Paper, Scissors, Lizard, Spock' is your selection") print("Please enter name of the second player") player2 = Player(enter_username()) g = RockPaperScissorsLizardSpockGame(player1, player2) print("OK let's start the game " + player1.name + " vs. " + player2.name + " have fun") g.start_game(player1, player2)
menu_starter.py
from rnd_game import RNDGame from player import Player from rpsls_game import RockPaperScissorsLizardSpockGame def enter_username(): while True: try: username_input = str(input().strip()) return username_input break except: print("please insert a useful username") def enter_game_selection(): while True: game_input = str(input()).strip() if game_input == '1': return game_input break elif game_input == '2': return game_input break print("Sorry, {0} is not a option, please try again".format(str(game_input))) print("Please choose a game") print("Press 1 and Enter for 'Random Number Game'") print("Press 2 and Enter for 'Rock, Paper, Scissors, Lizard, Spock'") class MenuStarter: def __init__(self) -> object: print( "Welcome to the first exercise - it consists of 'Random Number Game' und 'Rock, paper, scissors (" "extended with Spock and Lizard) '") print("Please enter your nickname") player1 = Player(enter_username()) print("Welcome " + player1.name + " to the first exercise :)") print("Select the game you want to play") print("Select 1 and Enter for 'Random Number Game'") print("Select 2 und Enter für 'Rock, Paper, Scissors, Lizard, Spock'") check = enter_game_selection() if check == '1': print("'Random Number Game' is your selection") g = RNDGame(player1.name) g.start_game() elif check == '2': print("'Rock, Paper, Scissors, Lizard, Spock' is your selection") print("Please enter name of the second player") player2 = Player(enter_username()) g = RockPaperScissorsLizardSpockGame(player1, player2) print("OK let's start the game " + player1.name + " vs. " + player2.name + " have fun") g.start_game(player1, player2)
0.293607
0.220531
import itertools import random import subprocess import os from absl import logging, flags, app from multiprocessing import Queue, Manager from pathos import multiprocessing import traceback import time import sys log_dir = sys.argv[1] num_gpus = 2 max_worker_num = num_gpus * 1 + 1 nb_train_steps = 400 meta_update_freq = 1 actor_update_freq = 1 batch_size = 1024 num_envs = 10 COMMAND1 = f"python3 experiments/run_hiro.py {log_dir}" COMMAND2 = f"--alg TD3 --evaluate --n_training 1 --verbose 1 --relative_goals --off_policy_corrections --eval_deterministic --num_envs {num_envs} --actor_lr 1e-4 --critic_lr 1e-4 --use_huber --target_noise_clip 0.5 --batch_size {batch_size} --tau 0.05 --gamma 0.99 --nb_train_steps {nb_train_steps} --meta_update_freq {meta_update_freq} --actor_update_freq {actor_update_freq} --intrinsic_reward_scale 1.0 --meta_period 3 --buffer_size 500000 --noise 0.1" envs = ["GoalTask", "KickBallTask"] total_steps = [4950000, 4950000] horizons = [100, 200] nb_rollout_steps = [10 * 100, 10 * 200] def _init_device_queue(max_worker_num): m = Manager() device_queue = m.Queue() for i in range(max_worker_num): idx = i % num_gpus device_queue.put(idx) return device_queue def run(): """Run trainings with all possible parameter combinations in the configured space. """ process_pool = multiprocessing.Pool( processes=max_worker_num, maxtasksperchild=1) device_queue = _init_device_queue(max_worker_num) for i in range(3): for i, env in enumerate(envs): command = "%s %s --total_steps %d --horizon %d --nb_rollout_steps %d %s" % (COMMAND1, env, total_steps[i], horizons[i], nb_rollout_steps[i], COMMAND2) process_pool.apply_async( func=_worker, args=[command, device_queue], error_callback=lambda e: logging.error(e)) process_pool.close() process_pool.join() def _worker(command, device_queue): # sleep for random seconds to avoid crowded launching try: time.sleep(random.uniform(0, 15)) device = device_queue.get() logging.set_verbosity(logging.INFO) logging.info("command %s" % command) os.system("CUDA_VISIBLE_DEVICES=%d " % device + command) device_queue.put(device) except Exception as e: logging.info(traceback.format_exc()) raise e run()
run_socialbot_evals.py
import itertools import random import subprocess import os from absl import logging, flags, app from multiprocessing import Queue, Manager from pathos import multiprocessing import traceback import time import sys log_dir = sys.argv[1] num_gpus = 2 max_worker_num = num_gpus * 1 + 1 nb_train_steps = 400 meta_update_freq = 1 actor_update_freq = 1 batch_size = 1024 num_envs = 10 COMMAND1 = f"python3 experiments/run_hiro.py {log_dir}" COMMAND2 = f"--alg TD3 --evaluate --n_training 1 --verbose 1 --relative_goals --off_policy_corrections --eval_deterministic --num_envs {num_envs} --actor_lr 1e-4 --critic_lr 1e-4 --use_huber --target_noise_clip 0.5 --batch_size {batch_size} --tau 0.05 --gamma 0.99 --nb_train_steps {nb_train_steps} --meta_update_freq {meta_update_freq} --actor_update_freq {actor_update_freq} --intrinsic_reward_scale 1.0 --meta_period 3 --buffer_size 500000 --noise 0.1" envs = ["GoalTask", "KickBallTask"] total_steps = [4950000, 4950000] horizons = [100, 200] nb_rollout_steps = [10 * 100, 10 * 200] def _init_device_queue(max_worker_num): m = Manager() device_queue = m.Queue() for i in range(max_worker_num): idx = i % num_gpus device_queue.put(idx) return device_queue def run(): """Run trainings with all possible parameter combinations in the configured space. """ process_pool = multiprocessing.Pool( processes=max_worker_num, maxtasksperchild=1) device_queue = _init_device_queue(max_worker_num) for i in range(3): for i, env in enumerate(envs): command = "%s %s --total_steps %d --horizon %d --nb_rollout_steps %d %s" % (COMMAND1, env, total_steps[i], horizons[i], nb_rollout_steps[i], COMMAND2) process_pool.apply_async( func=_worker, args=[command, device_queue], error_callback=lambda e: logging.error(e)) process_pool.close() process_pool.join() def _worker(command, device_queue): # sleep for random seconds to avoid crowded launching try: time.sleep(random.uniform(0, 15)) device = device_queue.get() logging.set_verbosity(logging.INFO) logging.info("command %s" % command) os.system("CUDA_VISIBLE_DEVICES=%d " % device + command) device_queue.put(device) except Exception as e: logging.info(traceback.format_exc()) raise e run()
0.239883
0.105995
import matplotlib.pyplot as plt import matplotlib import numpy as np import pandautils as pup from sklearn.metrics import roc_curve import cPickle def plotROC(test_ntuple_path):#, picklename): ''' Definition: ----------- Plot a ROC curve comparison between the old mv2c10 contained in the branch and the newly evaluated one, which is loaded in from a pickle file. Both the .root file and the pickled mv2 array are assumed to be event-flat, not jet-flat. Args: ----- test_ntuple_path: string, the path to the root files used for evaluation picklename: string, the path to the pickle containing the new output of your retrained mv2 ''' # -- import the root file into a df print 'Opening files' df = pup.root2panda(test_ntuple_path, 'bTag_AntiKt2PV0TrackJets', branches=['jet_mv2c10', 'jet_LabDr_HadF']) # -- extract the old mv2c10 branch for comparison oldMV2 = pup.flatten(df['jet_mv2c10']) # -- extract the truth labels truthflav = pup.flatten(df['jet_LabDr_HadF']) # -- open the pickle produced by evaluate_and_store print 'Importing pickle' c00 = pup.flatten(cPickle.load(open('val_Alessandro_c00.pkl', 'rb'))) c07 = pup.flatten(cPickle.load(open('val_Alessandro_c07.pkl', 'rb'))) c15 = pup.flatten(cPickle.load(open('val_Alessandro_c15.pkl', 'rb'))) # -- this allows you to check performance on b VS light # -- change it, if you want to look at a different performance print 'Slicing' bl_selection = (truthflav == 0) | (truthflav == 5) print 'Plotting' plot(bl_selection, 'bl', truthflav, oldMV2, c00, c07, c15) print 'Slicing' bc_selection = (truthflav == 4) | (truthflav == 5) print 'Plotting' plot(bc_selection, 'bc', truthflav, oldMV2, c00, c07, c15) def plot(selection, ID, truthflav, oldMV2, c00, c07, c15): # -- calculate the points that make up a roc curve old_fpr, old_eff, _ = roc_curve(truthflav[selection], oldMV2[selection], pos_label=5) c00_fpr, c00_eff, _ = roc_curve(truthflav[selection], c00[selection], pos_label=5) c07_fpr, c07_eff, _ = roc_curve(truthflav[selection], c07[selection], pos_label=5) c15_fpr, c15_eff, _ = roc_curve(truthflav[selection], c15[selection], pos_label=5) # -- PLOTTING! # -- settings matplotlib.rcParams.update({'font.size': 18}) fig = plt.figure(figsize=(11.69, 8.27), dpi=100) # -- add as many curves as you want here # -- note: to plot rejection, take 1/false_positive_rate plt.plot(old_eff, 1/old_fpr, label='mv2c10 branch', color='black') plt.plot(c00_eff, 1/c00_fpr, label='new c00') plt.plot(c07_eff, 1/c07_fpr, label='new c07') plt.plot(c15_eff, 1/c15_fpr, label='new c15') # -- more settings plt.xlim(xmin=0.6) plt.yscale('log') plt.xlabel(r'$\varepsilon_b$') if ID == 'bl': plt.ylabel((r'$1/\varepsilon_u$')) plt.ylim(ymax=1000) elif ID == 'bc': plt.ylabel((r'$1/\varepsilon_c$')) plt.ylim(ymax=20) plt.grid(which='both') plt.legend() # display legend on plot plt.show() # open window to show plot fig.savefig('ROC'+ID+'.pdf') # save plot as a pdf # ----------------------------------------------------------------- if __name__ == '__main__': import sys import argparse # -- read in arguments parser = argparse.ArgumentParser() parser.add_argument("filename", help="input .root file name") #parser.add_argument("picklename", help="path to the .pkl file with the evaluation results") args = parser.parse_args() # -- pass arguments to main sys.exit(plotROC(args.filename))#, args.picklename))
trackjets/plotROC.py
import matplotlib.pyplot as plt import matplotlib import numpy as np import pandautils as pup from sklearn.metrics import roc_curve import cPickle def plotROC(test_ntuple_path):#, picklename): ''' Definition: ----------- Plot a ROC curve comparison between the old mv2c10 contained in the branch and the newly evaluated one, which is loaded in from a pickle file. Both the .root file and the pickled mv2 array are assumed to be event-flat, not jet-flat. Args: ----- test_ntuple_path: string, the path to the root files used for evaluation picklename: string, the path to the pickle containing the new output of your retrained mv2 ''' # -- import the root file into a df print 'Opening files' df = pup.root2panda(test_ntuple_path, 'bTag_AntiKt2PV0TrackJets', branches=['jet_mv2c10', 'jet_LabDr_HadF']) # -- extract the old mv2c10 branch for comparison oldMV2 = pup.flatten(df['jet_mv2c10']) # -- extract the truth labels truthflav = pup.flatten(df['jet_LabDr_HadF']) # -- open the pickle produced by evaluate_and_store print 'Importing pickle' c00 = pup.flatten(cPickle.load(open('val_Alessandro_c00.pkl', 'rb'))) c07 = pup.flatten(cPickle.load(open('val_Alessandro_c07.pkl', 'rb'))) c15 = pup.flatten(cPickle.load(open('val_Alessandro_c15.pkl', 'rb'))) # -- this allows you to check performance on b VS light # -- change it, if you want to look at a different performance print 'Slicing' bl_selection = (truthflav == 0) | (truthflav == 5) print 'Plotting' plot(bl_selection, 'bl', truthflav, oldMV2, c00, c07, c15) print 'Slicing' bc_selection = (truthflav == 4) | (truthflav == 5) print 'Plotting' plot(bc_selection, 'bc', truthflav, oldMV2, c00, c07, c15) def plot(selection, ID, truthflav, oldMV2, c00, c07, c15): # -- calculate the points that make up a roc curve old_fpr, old_eff, _ = roc_curve(truthflav[selection], oldMV2[selection], pos_label=5) c00_fpr, c00_eff, _ = roc_curve(truthflav[selection], c00[selection], pos_label=5) c07_fpr, c07_eff, _ = roc_curve(truthflav[selection], c07[selection], pos_label=5) c15_fpr, c15_eff, _ = roc_curve(truthflav[selection], c15[selection], pos_label=5) # -- PLOTTING! # -- settings matplotlib.rcParams.update({'font.size': 18}) fig = plt.figure(figsize=(11.69, 8.27), dpi=100) # -- add as many curves as you want here # -- note: to plot rejection, take 1/false_positive_rate plt.plot(old_eff, 1/old_fpr, label='mv2c10 branch', color='black') plt.plot(c00_eff, 1/c00_fpr, label='new c00') plt.plot(c07_eff, 1/c07_fpr, label='new c07') plt.plot(c15_eff, 1/c15_fpr, label='new c15') # -- more settings plt.xlim(xmin=0.6) plt.yscale('log') plt.xlabel(r'$\varepsilon_b$') if ID == 'bl': plt.ylabel((r'$1/\varepsilon_u$')) plt.ylim(ymax=1000) elif ID == 'bc': plt.ylabel((r'$1/\varepsilon_c$')) plt.ylim(ymax=20) plt.grid(which='both') plt.legend() # display legend on plot plt.show() # open window to show plot fig.savefig('ROC'+ID+'.pdf') # save plot as a pdf # ----------------------------------------------------------------- if __name__ == '__main__': import sys import argparse # -- read in arguments parser = argparse.ArgumentParser() parser.add_argument("filename", help="input .root file name") #parser.add_argument("picklename", help="path to the .pkl file with the evaluation results") args = parser.parse_args() # -- pass arguments to main sys.exit(plotROC(args.filename))#, args.picklename))
0.439627
0.457621
import csv import numpy as np import matplotlib.pyplot as plt import matplotlib.animation as animation from matplotlib.patches import Rectangle FRAME_DELTA = 500 # milliseconds animationYear = 1999 fig, ax, = plt.subplots() animationTitle = ax.text(0.5, 0.85, "", transform=ax.transAxes, ha="center", fontsize=20) index = 0 N = 15 ind = np.arange(N) width = 0.75 animate01 = Rectangle((-.35, 0), width, 0) animate02 = Rectangle((.65, 0), width, 0) animate03 = Rectangle((1.65, 0), width, 0) animate04 = Rectangle((2.65, 0), width, 0) animate05 = Rectangle((3.65, 0), width, 0) animate06 = Rectangle((4.65, 0), width, 0) animate07 = Rectangle((5.65, 0), width, 0) animate08 = Rectangle((6.65, 0), width, 0) animate09 = Rectangle((7.65, 0), width, 0) animate10 = Rectangle((8.65, 0), width, 0) animate11 = Rectangle((9.65, 0), width, 0) animate12 = Rectangle((10.65, 0), width, 0) animate13 = Rectangle((11.65, 0), width, 0) animate14 = Rectangle((12.65, 0), width, 0) animate15 = Rectangle((13.65, 0), width, 0) years = np.zeros(19) foodName = [] data99 = np.zeros(15) data00 = np.zeros(15) data01 = np.zeros(15) data02 = np.zeros(15) data03 = np.zeros(15) data04 = np.zeros(15) data05 = np.zeros(15) data06 = np.zeros(15) data07 = np.zeros(15) data08 = np.zeros(15) data09 = np.zeros(15) data10 = np.zeros(15) data11 = np.zeros(15) data12 = np.zeros(15) data13 = np.zeros(15) data14 = np.zeros(15) data15 = np.zeros(15) data16 = np.zeros(15) data17 = np.zeros(15) with open("food_imports.csv", 'r') as fil: data = csv.DictReader(fil, delimiter=',') for row in data: foodName.append(row['Food Type']) del(row['Food Type']) for year, dollarAmount in row.items(): temp = dollarAmount.replace(',', '') if len(temp) != 0: if year == '1999': data99[index] = temp years[0] = year elif year == '2000': data00[index] = temp years[1] = year elif year == '2001': data01[index] = temp years[2] = year elif year == '2002': data02[index] = temp years[3] = year elif year == '2003': data03[index] = temp years[4] = year elif year == '2004': data04[index] = temp years[5] = year elif year == '2005': data05[index] = temp years[6] = year elif year == '2006': data06[index] = temp years[7] = year elif year == '2007': data07[index] = temp years[8] = year elif year == '2008': data08[index] = temp years[9] = year elif year == '2009': data09[index] = temp years[10] = year elif year == '2010': data10[index] = temp years[11] = year elif year == '2011': data11[index] = temp years[12] = year elif year == '2012': data12[index] = temp years[13] = year elif year == '2013': data13[index] = temp years[14] = year elif year == '2014': data14[index] = temp years[15] = year elif year == '2015': data15[index] = temp years[16] = year elif year == '2016': data16[index] = temp years[17] = year elif year == '2017': data17[index] = temp years[18] = year index = index + 1 dataSet = [data99, data00, data01, data02, data03, data04, data05, data06, data07, data08, data09, data10, data11, data12, data13, data14, data15, data16, data17] def init(): # init function for the animation ax.set_xlim(-1, 15) ax.set_ylim(0.0, 25000) animate01.set_height(0) animate02.set_height(0) animate03.set_height(0) animate04.set_height(0) animate05.set_height(0) animate06.set_height(0) animate07.set_height(0) animate08.set_height(0) animate09.set_height(0) animate10.set_height(0) animate11.set_height(0) animate12.set_height(0) animate13.set_height(0) animate14.set_height(0) animate15.set_height(0) ax.add_patch(animate01) ax.add_patch(animate02) ax.add_patch(animate03) ax.add_patch(animate04) ax.add_patch(animate05) ax.add_patch(animate06) ax.add_patch(animate07) ax.add_patch(animate08) ax.add_patch(animate09) ax.add_patch(animate10) ax.add_patch(animate11) ax.add_patch(animate12) ax.add_patch(animate13) ax.add_patch(animate14) ax.add_patch(animate15) return animationTitle, animate01, animate02, animate03, animate04, animate05, animate06, animate07, animate08, \ animate09, animate10, animate11, animate12, animate13, animate14, animate15 def update(price): global animationYear animationTitle.set_text('Food Imports for {}'.format(animationYear)) animate01.set_height(price[0]) animate02.set_height(price[1]) animate03.set_height(price[2]) animate04.set_height(price[3]) animate05.set_height(price[4]) animate06.set_height(price[5]) animate07.set_height(price[6]) animate08.set_height(price[7]) animate09.set_height(price[8]) animate10.set_height(price[9]) animate11.set_height(price[10]) animate12.set_height(price[11]) animate13.set_height(price[12]) animate14.set_height(price[13]) animate15.set_height(price[14]) animationYear += 1 if animationYear > 2017: animationYear = 1999 return animationTitle, animate01, animate02, animate03, animate04, animate05, animate06, animate07, animate08, \ animate09, animate10, animate11, animate12, animate13, animate14, animate15 ax.set_ylabel('Price ($) in Millions') ax.set_xticks(ind) ax.set_xticklabels(('Live\nmeat\nanimals', 'Meats', 'Fish\nand\nshellfish', 'Dairy', 'Vegies', 'Fruits', 'Nuts', 'Coffee,\ntea, and\nspices', 'Grains', 'Veg.\noils', 'Sugar\nand\ncandy', 'Cocoa\nand\nchoc.', 'Other\nedible\nprod.', 'Bev.', ' Liquors')) ani = animation.FuncAnimation(fig, update, frames=dataSet, init_func=init, interval=FRAME_DELTA, blit=True) plt.show()
Food Imports/foodImportsAnimation.py
import csv import numpy as np import matplotlib.pyplot as plt import matplotlib.animation as animation from matplotlib.patches import Rectangle FRAME_DELTA = 500 # milliseconds animationYear = 1999 fig, ax, = plt.subplots() animationTitle = ax.text(0.5, 0.85, "", transform=ax.transAxes, ha="center", fontsize=20) index = 0 N = 15 ind = np.arange(N) width = 0.75 animate01 = Rectangle((-.35, 0), width, 0) animate02 = Rectangle((.65, 0), width, 0) animate03 = Rectangle((1.65, 0), width, 0) animate04 = Rectangle((2.65, 0), width, 0) animate05 = Rectangle((3.65, 0), width, 0) animate06 = Rectangle((4.65, 0), width, 0) animate07 = Rectangle((5.65, 0), width, 0) animate08 = Rectangle((6.65, 0), width, 0) animate09 = Rectangle((7.65, 0), width, 0) animate10 = Rectangle((8.65, 0), width, 0) animate11 = Rectangle((9.65, 0), width, 0) animate12 = Rectangle((10.65, 0), width, 0) animate13 = Rectangle((11.65, 0), width, 0) animate14 = Rectangle((12.65, 0), width, 0) animate15 = Rectangle((13.65, 0), width, 0) years = np.zeros(19) foodName = [] data99 = np.zeros(15) data00 = np.zeros(15) data01 = np.zeros(15) data02 = np.zeros(15) data03 = np.zeros(15) data04 = np.zeros(15) data05 = np.zeros(15) data06 = np.zeros(15) data07 = np.zeros(15) data08 = np.zeros(15) data09 = np.zeros(15) data10 = np.zeros(15) data11 = np.zeros(15) data12 = np.zeros(15) data13 = np.zeros(15) data14 = np.zeros(15) data15 = np.zeros(15) data16 = np.zeros(15) data17 = np.zeros(15) with open("food_imports.csv", 'r') as fil: data = csv.DictReader(fil, delimiter=',') for row in data: foodName.append(row['Food Type']) del(row['Food Type']) for year, dollarAmount in row.items(): temp = dollarAmount.replace(',', '') if len(temp) != 0: if year == '1999': data99[index] = temp years[0] = year elif year == '2000': data00[index] = temp years[1] = year elif year == '2001': data01[index] = temp years[2] = year elif year == '2002': data02[index] = temp years[3] = year elif year == '2003': data03[index] = temp years[4] = year elif year == '2004': data04[index] = temp years[5] = year elif year == '2005': data05[index] = temp years[6] = year elif year == '2006': data06[index] = temp years[7] = year elif year == '2007': data07[index] = temp years[8] = year elif year == '2008': data08[index] = temp years[9] = year elif year == '2009': data09[index] = temp years[10] = year elif year == '2010': data10[index] = temp years[11] = year elif year == '2011': data11[index] = temp years[12] = year elif year == '2012': data12[index] = temp years[13] = year elif year == '2013': data13[index] = temp years[14] = year elif year == '2014': data14[index] = temp years[15] = year elif year == '2015': data15[index] = temp years[16] = year elif year == '2016': data16[index] = temp years[17] = year elif year == '2017': data17[index] = temp years[18] = year index = index + 1 dataSet = [data99, data00, data01, data02, data03, data04, data05, data06, data07, data08, data09, data10, data11, data12, data13, data14, data15, data16, data17] def init(): # init function for the animation ax.set_xlim(-1, 15) ax.set_ylim(0.0, 25000) animate01.set_height(0) animate02.set_height(0) animate03.set_height(0) animate04.set_height(0) animate05.set_height(0) animate06.set_height(0) animate07.set_height(0) animate08.set_height(0) animate09.set_height(0) animate10.set_height(0) animate11.set_height(0) animate12.set_height(0) animate13.set_height(0) animate14.set_height(0) animate15.set_height(0) ax.add_patch(animate01) ax.add_patch(animate02) ax.add_patch(animate03) ax.add_patch(animate04) ax.add_patch(animate05) ax.add_patch(animate06) ax.add_patch(animate07) ax.add_patch(animate08) ax.add_patch(animate09) ax.add_patch(animate10) ax.add_patch(animate11) ax.add_patch(animate12) ax.add_patch(animate13) ax.add_patch(animate14) ax.add_patch(animate15) return animationTitle, animate01, animate02, animate03, animate04, animate05, animate06, animate07, animate08, \ animate09, animate10, animate11, animate12, animate13, animate14, animate15 def update(price): global animationYear animationTitle.set_text('Food Imports for {}'.format(animationYear)) animate01.set_height(price[0]) animate02.set_height(price[1]) animate03.set_height(price[2]) animate04.set_height(price[3]) animate05.set_height(price[4]) animate06.set_height(price[5]) animate07.set_height(price[6]) animate08.set_height(price[7]) animate09.set_height(price[8]) animate10.set_height(price[9]) animate11.set_height(price[10]) animate12.set_height(price[11]) animate13.set_height(price[12]) animate14.set_height(price[13]) animate15.set_height(price[14]) animationYear += 1 if animationYear > 2017: animationYear = 1999 return animationTitle, animate01, animate02, animate03, animate04, animate05, animate06, animate07, animate08, \ animate09, animate10, animate11, animate12, animate13, animate14, animate15 ax.set_ylabel('Price ($) in Millions') ax.set_xticks(ind) ax.set_xticklabels(('Live\nmeat\nanimals', 'Meats', 'Fish\nand\nshellfish', 'Dairy', 'Vegies', 'Fruits', 'Nuts', 'Coffee,\ntea, and\nspices', 'Grains', 'Veg.\noils', 'Sugar\nand\ncandy', 'Cocoa\nand\nchoc.', 'Other\nedible\nprod.', 'Bev.', ' Liquors')) ani = animation.FuncAnimation(fig, update, frames=dataSet, init_func=init, interval=FRAME_DELTA, blit=True) plt.show()
0.347759
0.530723
from .Dark_Neuron_CNN import Dark_Neuron import tensorflow as tf # Powerful Framework for Deep Learning import os # For Searching Folder within the system from .models import Create_Model, Train_Model # Script containing Different Models from .Preprocessing_Image import Preprocess_Image #Preprocessing Image Script from .Prediction import Prediction import matplotlib.pyplot as plt class Classify_Images(Dark_Neuron): """ This Class will have Following Properties: Attributes: --Working Directory -- Output Directory -- train --> Whether to train to predict Methods: --Preprocess_the_Images --Create_the_Model --Train_the_Model --Predict_from_the_Model --Visualize_the_Metric """ def __init__(self,working_directory,output_directory): """ In this function we will call Parent Function containing other Function and Define other variables. Arguments: --------- working_directory --> Directory Containing Raw Data output_directory --> Output Sirectory to which Results will be posted Output: ------ None """ Dark_Neuron.__init__(self,working_directory,output_directory) self.working_directory = working_directory self.output_directory = output_directory def load_model(self,user_model_name): user_model_path = os.path.join(self.working_directory,user_model_name) return tf.keras.models.load_model(user_model_path) """ Defining Preprocess Function to Preprocess the Images with Different Flow Method """ def Preprocess_the_Image(self,method,train,num_classes=2,batch_size=32,target_image_size=(224,224,3),model_name = None,user_model = None,image_path=None,grayscale=None,training_image_directory=None,validation_image_directory=None,dataframe=None, test_image_directory=None,x_train=None,x_test=None,y_train=None,y_test=None,x_col=None,y_col = None,split=0.1,image_directory=None,input_tensor=None): """ This function Will do image processing and return training Data Generator, Validation Data Generator and Test Data Generator on the Basis of Training Argument whether it is True Or False. Arguments: model_name --> Name for The Predefined Architecture num_classes --> Number of Classes batch_size --> Batch Size method --> Method by which Images will flow in the Function --> directory,dataframe,point training_image_directory --> Directory for method Directory validation_image_directory --> (Optional) For method Directory Outputs: It will Return the Data Generator for Train and Test """ self.train = train self.target_image_size = target_image_size self.model_name = model_name self.num_classes = num_classes self.batch_size = batch_size self.method = method self.training_directory = training_image_directory self.validation_directory = validation_image_directory self.test_directory = test_image_directory self.dataframe = dataframe self.x_train = x_train self.x_test = x_test self.y_train = y_train self.y_test = y_test self.x_col_name = x_col self.y_col_name = y_col self.split = split self.image_directory = image_directory self.input_tensor = input_tensor self.image_path = image_path if user_model is not None: self.user_model = user_model else: self.user_model = None #Defining Variables for Preprocessing preprocessing = Preprocess_Image(model_name=self.model_name,user_model=self.user_model,target_image_size = self.target_image_size,num_classes = self.num_classes,batch_size=self.batch_size,training=self.train,method=self.method,working_directory = self.working_directory) #Getting results based on Different flow methods if self.method == 'directory': print('\n\t\t-----Getting Images From Directory------\n') if self.train:# From Preprocessing_Image.py File train_data,validation_data = preprocessing.Get_Images_from_Directory(self.training_directory,self.validation_directory,self.test_directory) print('\n\t\t-------Training Data Generated--------\n') return train_data,validation_data,(train_data.class_indices) else: test_data = preprocessing.Get_Images_from_Directory(self.training_directory,self.validation_directory, self.test_directory) print('\n\t\t-------Test Data Generated--------\n') return test_data elif self.method=='dataframe': print('\n\t\t-----Getting Images From DataFrame------\n') if self.train: train_data,validation_data = preprocessing.Get_Images_from_DataFrame(self.dataframe,self.x_col_name,self.split,self.y_col_name,self.image_directory) print('\n\t\t-----Training Data Generated------\n') return train_data,validation_data,(train_data.class_indices) else: test_data = preprocessing.Get_Images_from_DataFrame(self.dataframe,self.x_col_name,self.split,self.y_col_name,self.image_directory) print('\n\t\t-----Test Data Generated------\n') return test_data elif self.method=='point': print('\n\t\t-----Getting Images From Points------\n') if self.train: train_data,validation_data = preprocessing.Get_Data(self.x_train,self.y_train,self.x_test,self.y_test) print('\n\t\t------Training Data Generated-------\n') return train_data,validation_data else: test_data = preprocessing.Get_Data(self.x_train,self.y_train,self.x_test,self.y_test) print('\n\t\t---------Test Data Generated--------\n') return test_data elif self.method == 'image': if image_path is None: raise ValueError('Provide Image Path for Image Prediction or If it is containing in a directory having multiple ', 'images, then set method = "directory"') print('\n\t\t----------Getting Image -------------\n') image = preprocessing.Get_Image(image_path = image_path,model_name = self.model_name,user_model=user_model, grayscale=grayscale) return image else: raise ValueError('Invalid Method Input --Must be from "directory","dataframe","point","image"') def Create_the_Model(self): """ This Function will be used for Initialisation of Model according to Model name Given Arguments: None Returns: It will return the model for Training the model """ print('\n\t\t--------------Model Creation Phase-----------\n') model_init = Create_Model(working_directory=self.working_directory,image_shape = self.target_image_size,train = self.train,input_tensor=self.input_tensor) # Defining Model based on Model name: if self.model_name in ['mobilenetv2','MobileNetV2','mobilenet_v2','MobileNet_V2']: # Checking whether Target Image size is within bounds for Predefined Architecture if self.target_image_size[0] <32 or self.target_image_size[1]<32: Model_Target_Value_Checker() #Check the Function Below which Raise the Value Error print('\n\t\t-------MobileNetV2 Model Initiated Successfully----------\n') return model_init.MobileNetV2() if self.model_name in ['inceptionv3','InceptionV3','inception_v3','Inception_V3']: # Checking whether Target Image size is within bounds for Predefined Architecture if self.target_image_size[0] <75 or self.target_image_size[1]<75: Model_Target_Value_Checker() #Check the Function Below which Raise the Value Error print('\n\t\t-------InceptiontV3 Model Initiated Successfully----------\n') return model_init.InceptionV3() if self.model_name in ['resnet50','ResNet50','Resnet50']: # Checking whether Target Image size is within bounds for Predefined Architecture if self.target_image_size[0] <32 or self.target_image_size[1]<32: Model_Target_Value_Checker() #Check the Function Below which Raise the Value Error print('\n\t\t-------Resnet50 Model Initiated Successfully----------\n') return model_init.ResNet50() if self.model_name in ['Xception','xception']: # Checking whether Target Image size is within bounds for Predefined Architecture if self.target_image_size[0] <71 or self.target_image_size[1]<71: Model_Target_Value_Checker() #Check the Function Below which Raise the Value Error print('\n\t\t-------Xception Model Initiated Successfully----------\n') return model_init.Xception() if self.model_name in ['VGG16','Vgg16','vgg16']: # Checking whether Target Image size is within bounds for Predefined Architecture if self.target_image_size[0] <32 or self.target_image_size[1]<32: Model_Target_Value_Checker() #Check the Function Below which Raise the Value Error print('\n\t\t-------VGG16 Model Initiated Successfully----------\n') return model_init.VGG16() if self.model_name in ['VGG19','Vgg19','vgg19']: # Checking whether Target Image size is within bounds for Predefined Architecture if self.target_image_size[0] <32 or self.target_image_size[1]<32: Model_Target_Value_Checker() #Check the Function Below which Raise the Value Error print('\n\t\t-------VGG19 Model Initiated Successfully----------\n') return model_init.VGG19() def Train_the_Model(self,model,rebuild=False,train_data_object=None,validation_data_object=None,test_data_object=None,epochs = 10,optimizer='adam',loss = 'binary_crossentropy',fine_tuning = False,layers = 20,metrics='accuracy',validation_steps=80,save_model = True,steps_per_epoch = 50,callbacks=None): """ This function will call up the Initialised Model """ print('\n\t\t------------Model Training To be Start---------------') history,model = Train_Model(model=model,rebuild=rebuild,num_classes = self.num_classes,train_data_object=train_data_object, working_directory = self.working_directory,output_directory = self.output_directory,loss = loss,epochs=epochs, optimizer = optimizer,metrics = metrics,validation_data_object = validation_data_object,fine_tuning = fine_tuning, layers = layers,validation_steps=validation_steps,save_model=save_model,steps_per_epoch = steps_per_epoch,callbacks=callbacks) self.model_history = history return model def Visualize_the_Metrics(self): import matplotlib.pyplot as plt # Plot for Training Loss and Training Accuracy plt.plot(self.model_history.history['loss'],label='Training Loss') plt.plot(self.model_history.history['acc'],label = 'Training Accuracy') plt.title('Training Loss vs Training Accuracy') plt.legend() plt.show() #excetuted when validation set will be there try: # Training Loss vs Vaidation Loss plt.plot(self.model_history.history['val_loss'],label='Test Loss') plt.plot(self.model_history.history['loss'],label = 'Training Loss') plt.title('Training Loss vs Validation Loss') plt.legend() plt.show() plt.plot(self.model_history.history['acc'],label='Training Accuracy') plt.plot(self.model_history.history['val_acc'],label = 'Validation Accuracy') plt.title('Training Accuracy vs Validation Accuracy') plt.legend() plt.show() plt.plot(self.model_history.history['val_loss'],label='Validation_Loss') plt.plot(self.model_history.history['val_acc'],label = 'Validation_Accuracy') plt.title('Validation Loss vs Validation Accuracy') plt.legend() plt.show() except: pass def Predict_from_the_Model(self,labels=None,generator=None,img = None,top = 5,model=None): """ This Function will be used to predict the classes from Model Arguments: preprocessed_image --> preprocessed_image suitable for model model --> model get from trained part top --> Number of High Probabilities Return: Classes """ self.generator = generator self.img = img prediction = Prediction(working_directory = self.working_directory,labels = labels,method = self.method, model_name = self.model_name,user_model=self.user_model, img = img,top=top,image_directory=self.image_path) if self.user_model is not None: model = self.user_model else: if model is None: raise ValueError('Provide Model, model argument should not be empty') model = model predicted_indices,predictions = prediction.prediction(method=self.method,model=model,img=img,data_generator=generator) label_score = prediction.label_class_provider(label=labels,predictions=predictions,predicted_indices=predicted_indices, generator=generator,img=img) print('\n\t\t--------------Generating Predictions with Score----------------') self.label_score = label_score if len(label_score) == 0: print('\n\t\t----------No Predictions-----------') return label_score else: print(f'\n\t\t------------Found {len(label_score)} Predicitons-------' ) return label_score def Visualize_the_Predictions(self,number=6): if number > len(self.label_score): number = len(self.label_score) if number ==0: print('No predictions to Show') else: if self.generator is not None: for label_score in self.label_score[:number]: filepath = os.path.join(self.test_directory,label_score[0]) img = plt.imread(filepath) plt.imshow(img) plt.title(f'Predicted:{label_score[1].title()} ---- Score: {label_score[2]*100}') plt.show() elif self.img is not None: for label_score in self.label_score[:number]: filepath = label_score[0] img = plt.imread(filepath) plt.imshow(img) plt.title(f'Predicted:{label_score[1].title()} ---- Score: {label_score[2]*100}') plt.show() def Model_Target_Value_Checker(): raise ValueError('Try with Different Model.Get ' 'information on Keras Documentation\n' 'The Lowest Dimensions allowed for Different Model are : \n' 'Try to change in Preprocess Images Process \n' 'MobileNetV2 --> (32,32) \n' 'InceptionV3 --> (75,75)\n' 'Resnet50 --> (32,32) \n' 'Xception --> (71,71) \n' 'VGG16 --> (32,32) \n' 'VGG19 --> (32,32) \n' )
build/lib/DarkNeurons/Classification.py
from .Dark_Neuron_CNN import Dark_Neuron import tensorflow as tf # Powerful Framework for Deep Learning import os # For Searching Folder within the system from .models import Create_Model, Train_Model # Script containing Different Models from .Preprocessing_Image import Preprocess_Image #Preprocessing Image Script from .Prediction import Prediction import matplotlib.pyplot as plt class Classify_Images(Dark_Neuron): """ This Class will have Following Properties: Attributes: --Working Directory -- Output Directory -- train --> Whether to train to predict Methods: --Preprocess_the_Images --Create_the_Model --Train_the_Model --Predict_from_the_Model --Visualize_the_Metric """ def __init__(self,working_directory,output_directory): """ In this function we will call Parent Function containing other Function and Define other variables. Arguments: --------- working_directory --> Directory Containing Raw Data output_directory --> Output Sirectory to which Results will be posted Output: ------ None """ Dark_Neuron.__init__(self,working_directory,output_directory) self.working_directory = working_directory self.output_directory = output_directory def load_model(self,user_model_name): user_model_path = os.path.join(self.working_directory,user_model_name) return tf.keras.models.load_model(user_model_path) """ Defining Preprocess Function to Preprocess the Images with Different Flow Method """ def Preprocess_the_Image(self,method,train,num_classes=2,batch_size=32,target_image_size=(224,224,3),model_name = None,user_model = None,image_path=None,grayscale=None,training_image_directory=None,validation_image_directory=None,dataframe=None, test_image_directory=None,x_train=None,x_test=None,y_train=None,y_test=None,x_col=None,y_col = None,split=0.1,image_directory=None,input_tensor=None): """ This function Will do image processing and return training Data Generator, Validation Data Generator and Test Data Generator on the Basis of Training Argument whether it is True Or False. Arguments: model_name --> Name for The Predefined Architecture num_classes --> Number of Classes batch_size --> Batch Size method --> Method by which Images will flow in the Function --> directory,dataframe,point training_image_directory --> Directory for method Directory validation_image_directory --> (Optional) For method Directory Outputs: It will Return the Data Generator for Train and Test """ self.train = train self.target_image_size = target_image_size self.model_name = model_name self.num_classes = num_classes self.batch_size = batch_size self.method = method self.training_directory = training_image_directory self.validation_directory = validation_image_directory self.test_directory = test_image_directory self.dataframe = dataframe self.x_train = x_train self.x_test = x_test self.y_train = y_train self.y_test = y_test self.x_col_name = x_col self.y_col_name = y_col self.split = split self.image_directory = image_directory self.input_tensor = input_tensor self.image_path = image_path if user_model is not None: self.user_model = user_model else: self.user_model = None #Defining Variables for Preprocessing preprocessing = Preprocess_Image(model_name=self.model_name,user_model=self.user_model,target_image_size = self.target_image_size,num_classes = self.num_classes,batch_size=self.batch_size,training=self.train,method=self.method,working_directory = self.working_directory) #Getting results based on Different flow methods if self.method == 'directory': print('\n\t\t-----Getting Images From Directory------\n') if self.train:# From Preprocessing_Image.py File train_data,validation_data = preprocessing.Get_Images_from_Directory(self.training_directory,self.validation_directory,self.test_directory) print('\n\t\t-------Training Data Generated--------\n') return train_data,validation_data,(train_data.class_indices) else: test_data = preprocessing.Get_Images_from_Directory(self.training_directory,self.validation_directory, self.test_directory) print('\n\t\t-------Test Data Generated--------\n') return test_data elif self.method=='dataframe': print('\n\t\t-----Getting Images From DataFrame------\n') if self.train: train_data,validation_data = preprocessing.Get_Images_from_DataFrame(self.dataframe,self.x_col_name,self.split,self.y_col_name,self.image_directory) print('\n\t\t-----Training Data Generated------\n') return train_data,validation_data,(train_data.class_indices) else: test_data = preprocessing.Get_Images_from_DataFrame(self.dataframe,self.x_col_name,self.split,self.y_col_name,self.image_directory) print('\n\t\t-----Test Data Generated------\n') return test_data elif self.method=='point': print('\n\t\t-----Getting Images From Points------\n') if self.train: train_data,validation_data = preprocessing.Get_Data(self.x_train,self.y_train,self.x_test,self.y_test) print('\n\t\t------Training Data Generated-------\n') return train_data,validation_data else: test_data = preprocessing.Get_Data(self.x_train,self.y_train,self.x_test,self.y_test) print('\n\t\t---------Test Data Generated--------\n') return test_data elif self.method == 'image': if image_path is None: raise ValueError('Provide Image Path for Image Prediction or If it is containing in a directory having multiple ', 'images, then set method = "directory"') print('\n\t\t----------Getting Image -------------\n') image = preprocessing.Get_Image(image_path = image_path,model_name = self.model_name,user_model=user_model, grayscale=grayscale) return image else: raise ValueError('Invalid Method Input --Must be from "directory","dataframe","point","image"') def Create_the_Model(self): """ This Function will be used for Initialisation of Model according to Model name Given Arguments: None Returns: It will return the model for Training the model """ print('\n\t\t--------------Model Creation Phase-----------\n') model_init = Create_Model(working_directory=self.working_directory,image_shape = self.target_image_size,train = self.train,input_tensor=self.input_tensor) # Defining Model based on Model name: if self.model_name in ['mobilenetv2','MobileNetV2','mobilenet_v2','MobileNet_V2']: # Checking whether Target Image size is within bounds for Predefined Architecture if self.target_image_size[0] <32 or self.target_image_size[1]<32: Model_Target_Value_Checker() #Check the Function Below which Raise the Value Error print('\n\t\t-------MobileNetV2 Model Initiated Successfully----------\n') return model_init.MobileNetV2() if self.model_name in ['inceptionv3','InceptionV3','inception_v3','Inception_V3']: # Checking whether Target Image size is within bounds for Predefined Architecture if self.target_image_size[0] <75 or self.target_image_size[1]<75: Model_Target_Value_Checker() #Check the Function Below which Raise the Value Error print('\n\t\t-------InceptiontV3 Model Initiated Successfully----------\n') return model_init.InceptionV3() if self.model_name in ['resnet50','ResNet50','Resnet50']: # Checking whether Target Image size is within bounds for Predefined Architecture if self.target_image_size[0] <32 or self.target_image_size[1]<32: Model_Target_Value_Checker() #Check the Function Below which Raise the Value Error print('\n\t\t-------Resnet50 Model Initiated Successfully----------\n') return model_init.ResNet50() if self.model_name in ['Xception','xception']: # Checking whether Target Image size is within bounds for Predefined Architecture if self.target_image_size[0] <71 or self.target_image_size[1]<71: Model_Target_Value_Checker() #Check the Function Below which Raise the Value Error print('\n\t\t-------Xception Model Initiated Successfully----------\n') return model_init.Xception() if self.model_name in ['VGG16','Vgg16','vgg16']: # Checking whether Target Image size is within bounds for Predefined Architecture if self.target_image_size[0] <32 or self.target_image_size[1]<32: Model_Target_Value_Checker() #Check the Function Below which Raise the Value Error print('\n\t\t-------VGG16 Model Initiated Successfully----------\n') return model_init.VGG16() if self.model_name in ['VGG19','Vgg19','vgg19']: # Checking whether Target Image size is within bounds for Predefined Architecture if self.target_image_size[0] <32 or self.target_image_size[1]<32: Model_Target_Value_Checker() #Check the Function Below which Raise the Value Error print('\n\t\t-------VGG19 Model Initiated Successfully----------\n') return model_init.VGG19() def Train_the_Model(self,model,rebuild=False,train_data_object=None,validation_data_object=None,test_data_object=None,epochs = 10,optimizer='adam',loss = 'binary_crossentropy',fine_tuning = False,layers = 20,metrics='accuracy',validation_steps=80,save_model = True,steps_per_epoch = 50,callbacks=None): """ This function will call up the Initialised Model """ print('\n\t\t------------Model Training To be Start---------------') history,model = Train_Model(model=model,rebuild=rebuild,num_classes = self.num_classes,train_data_object=train_data_object, working_directory = self.working_directory,output_directory = self.output_directory,loss = loss,epochs=epochs, optimizer = optimizer,metrics = metrics,validation_data_object = validation_data_object,fine_tuning = fine_tuning, layers = layers,validation_steps=validation_steps,save_model=save_model,steps_per_epoch = steps_per_epoch,callbacks=callbacks) self.model_history = history return model def Visualize_the_Metrics(self): import matplotlib.pyplot as plt # Plot for Training Loss and Training Accuracy plt.plot(self.model_history.history['loss'],label='Training Loss') plt.plot(self.model_history.history['acc'],label = 'Training Accuracy') plt.title('Training Loss vs Training Accuracy') plt.legend() plt.show() #excetuted when validation set will be there try: # Training Loss vs Vaidation Loss plt.plot(self.model_history.history['val_loss'],label='Test Loss') plt.plot(self.model_history.history['loss'],label = 'Training Loss') plt.title('Training Loss vs Validation Loss') plt.legend() plt.show() plt.plot(self.model_history.history['acc'],label='Training Accuracy') plt.plot(self.model_history.history['val_acc'],label = 'Validation Accuracy') plt.title('Training Accuracy vs Validation Accuracy') plt.legend() plt.show() plt.plot(self.model_history.history['val_loss'],label='Validation_Loss') plt.plot(self.model_history.history['val_acc'],label = 'Validation_Accuracy') plt.title('Validation Loss vs Validation Accuracy') plt.legend() plt.show() except: pass def Predict_from_the_Model(self,labels=None,generator=None,img = None,top = 5,model=None): """ This Function will be used to predict the classes from Model Arguments: preprocessed_image --> preprocessed_image suitable for model model --> model get from trained part top --> Number of High Probabilities Return: Classes """ self.generator = generator self.img = img prediction = Prediction(working_directory = self.working_directory,labels = labels,method = self.method, model_name = self.model_name,user_model=self.user_model, img = img,top=top,image_directory=self.image_path) if self.user_model is not None: model = self.user_model else: if model is None: raise ValueError('Provide Model, model argument should not be empty') model = model predicted_indices,predictions = prediction.prediction(method=self.method,model=model,img=img,data_generator=generator) label_score = prediction.label_class_provider(label=labels,predictions=predictions,predicted_indices=predicted_indices, generator=generator,img=img) print('\n\t\t--------------Generating Predictions with Score----------------') self.label_score = label_score if len(label_score) == 0: print('\n\t\t----------No Predictions-----------') return label_score else: print(f'\n\t\t------------Found {len(label_score)} Predicitons-------' ) return label_score def Visualize_the_Predictions(self,number=6): if number > len(self.label_score): number = len(self.label_score) if number ==0: print('No predictions to Show') else: if self.generator is not None: for label_score in self.label_score[:number]: filepath = os.path.join(self.test_directory,label_score[0]) img = plt.imread(filepath) plt.imshow(img) plt.title(f'Predicted:{label_score[1].title()} ---- Score: {label_score[2]*100}') plt.show() elif self.img is not None: for label_score in self.label_score[:number]: filepath = label_score[0] img = plt.imread(filepath) plt.imshow(img) plt.title(f'Predicted:{label_score[1].title()} ---- Score: {label_score[2]*100}') plt.show() def Model_Target_Value_Checker(): raise ValueError('Try with Different Model.Get ' 'information on Keras Documentation\n' 'The Lowest Dimensions allowed for Different Model are : \n' 'Try to change in Preprocess Images Process \n' 'MobileNetV2 --> (32,32) \n' 'InceptionV3 --> (75,75)\n' 'Resnet50 --> (32,32) \n' 'Xception --> (71,71) \n' 'VGG16 --> (32,32) \n' 'VGG19 --> (32,32) \n' )
0.636127
0.389605
from django.shortcuts import render from django.views import View import requests ACCUWEATHER_API_KEY = "<KEY>" ACCUWEATHER_CITY_URL = "http://dataservice.accuweather.com/locations/v1/cities/search?apikey={}&q={}&language=en-us" ACCUWEATHER_WEATHER_URL = "http://dataservice.accuweather.com/currentconditions/v1/{}?apikey={}&language=en-us" OPENWEATHERMAP_API_KEY = "<KEY>" OPENWEATHERMAP_WEATHER_URL = "http://api.openweathermap.org/data/2.5/weather?q={}&appid={}" class ApiException(Exception): def __init__(self, status_code): self.status_code = status_code def __str__(self): return "Error {}".format(self.status_code) class HomeView(View): @staticmethod def get(request): template = "index.html" context = {} return render(request, template, context) @staticmethod def post(request): city = request.POST.get("city", None) try: accuweather_data = get_accuweather(city) openweathermap_data = get_openweathermap(city) except ApiException as e: template = "error.html" context = { "status_code": e.status_code, "error_msg": "We probably couldn't find the city you requested. Sorry about that!" } return render(request, template, context) weather_datapoints = [ accuweather_data, openweathermap_data, ] template = "weather.html" context = { "city": city, "datapoints": weather_datapoints, } return render(request, template, context) def get_accuweather(city): city_url = ACCUWEATHER_CITY_URL.format(ACCUWEATHER_API_KEY, city) city_rsp = requests.get(city_url) city_data = city_rsp.json()[0] city_key = city_data["Key"] weather_url = ACCUWEATHER_WEATHER_URL.format(city_key, ACCUWEATHER_API_KEY) weather_rsp = requests.get(weather_url) if weather_rsp.status_code != 200: raise ApiException(weather_rsp.status_code) weather_data = weather_rsp.json()[0] conditions = weather_data["WeatherText"] temperature = weather_data["Temperature"]["Metric"]["Value"] return { "source": "AccuWeather", "conditions": conditions, "temperature": int(temperature), } def get_openweathermap(city): kelvin_to_celsius = lambda k: k - 273.15 weather_url = OPENWEATHERMAP_WEATHER_URL.format(city, OPENWEATHERMAP_API_KEY) weather_rsp = requests.get(weather_url) if weather_rsp.status_code != 200: raise ApiException(weather_rsp.status_code) weather_data = weather_rsp.json() conditions = weather_data["weather"][0]["main"] temperature_k = weather_data["main"]["temp"] temperature_c = kelvin_to_celsius(temperature_k) return { "source": "OpenWeatherMap", "conditions": conditions, "temperature": int(temperature_c), }
weather/weather/views.py
from django.shortcuts import render from django.views import View import requests ACCUWEATHER_API_KEY = "<KEY>" ACCUWEATHER_CITY_URL = "http://dataservice.accuweather.com/locations/v1/cities/search?apikey={}&q={}&language=en-us" ACCUWEATHER_WEATHER_URL = "http://dataservice.accuweather.com/currentconditions/v1/{}?apikey={}&language=en-us" OPENWEATHERMAP_API_KEY = "<KEY>" OPENWEATHERMAP_WEATHER_URL = "http://api.openweathermap.org/data/2.5/weather?q={}&appid={}" class ApiException(Exception): def __init__(self, status_code): self.status_code = status_code def __str__(self): return "Error {}".format(self.status_code) class HomeView(View): @staticmethod def get(request): template = "index.html" context = {} return render(request, template, context) @staticmethod def post(request): city = request.POST.get("city", None) try: accuweather_data = get_accuweather(city) openweathermap_data = get_openweathermap(city) except ApiException as e: template = "error.html" context = { "status_code": e.status_code, "error_msg": "We probably couldn't find the city you requested. Sorry about that!" } return render(request, template, context) weather_datapoints = [ accuweather_data, openweathermap_data, ] template = "weather.html" context = { "city": city, "datapoints": weather_datapoints, } return render(request, template, context) def get_accuweather(city): city_url = ACCUWEATHER_CITY_URL.format(ACCUWEATHER_API_KEY, city) city_rsp = requests.get(city_url) city_data = city_rsp.json()[0] city_key = city_data["Key"] weather_url = ACCUWEATHER_WEATHER_URL.format(city_key, ACCUWEATHER_API_KEY) weather_rsp = requests.get(weather_url) if weather_rsp.status_code != 200: raise ApiException(weather_rsp.status_code) weather_data = weather_rsp.json()[0] conditions = weather_data["WeatherText"] temperature = weather_data["Temperature"]["Metric"]["Value"] return { "source": "AccuWeather", "conditions": conditions, "temperature": int(temperature), } def get_openweathermap(city): kelvin_to_celsius = lambda k: k - 273.15 weather_url = OPENWEATHERMAP_WEATHER_URL.format(city, OPENWEATHERMAP_API_KEY) weather_rsp = requests.get(weather_url) if weather_rsp.status_code != 200: raise ApiException(weather_rsp.status_code) weather_data = weather_rsp.json() conditions = weather_data["weather"][0]["main"] temperature_k = weather_data["main"]["temp"] temperature_c = kelvin_to_celsius(temperature_k) return { "source": "OpenWeatherMap", "conditions": conditions, "temperature": int(temperature_c), }
0.586523
0.087759
class Queue: """ Queue is a collection of entities that are maintained in a sequence and can be modified by the addition of entities at one end of the sequence and removal from the other end of the sequence. The order in which elements come off of a queue are First In, First Out (FIFO). https://en.wikipedia.org/wiki/Queue_(abstract_data_type) """ def __init__(self): """ Initializing empty queue.""" self.items = [] def enqueue(self, item): """ Takes in an item and inserts that item into the 0th index of the list that is representing the Queue. The runtime is O(n), or linear time, because inserting into the 0th index of a list forces all the other items in the list to move one index to the right. :param item: item to be inserted in queue """ self.items.insert(0, item) def dequeue(self): """ Returns and removes the front-most item of the Queue, which is represented by the last items in the list. The runtime is O(1), or constant time, because indexing to the end of a list happens in constant time. :return: front-most item of the queue or None, if the queue is empty """ if not self.items: raise IndexError('queue is empty') return self.items.pop() def peek(self): """ Returns the last item in the list, which represents the front-most item in the Queue. The runtime is O(1), or constant time, because we are just indexing to the last item of the list and returning the value found there. :return: front-most item of the queue or None, if the queue is empty """ if not self.items: raise IndexError('queue is empty') return self.items[-1] def size(self): """ Returns the size of the Queue, which is represent bu the length of the list The runtime is O(1), or constant time, because we're only returning the length. :return: length of list :rtype: int """ return len(self.items) def is_empty(self): """ Returns a boolean value expressing whether or not the list representing the Queue is empty. Runs in constant time, because it's only checking for equality. :return: returns true if stack is empty, else false """ return self.items == []
queue/library/queue.py
class Queue: """ Queue is a collection of entities that are maintained in a sequence and can be modified by the addition of entities at one end of the sequence and removal from the other end of the sequence. The order in which elements come off of a queue are First In, First Out (FIFO). https://en.wikipedia.org/wiki/Queue_(abstract_data_type) """ def __init__(self): """ Initializing empty queue.""" self.items = [] def enqueue(self, item): """ Takes in an item and inserts that item into the 0th index of the list that is representing the Queue. The runtime is O(n), or linear time, because inserting into the 0th index of a list forces all the other items in the list to move one index to the right. :param item: item to be inserted in queue """ self.items.insert(0, item) def dequeue(self): """ Returns and removes the front-most item of the Queue, which is represented by the last items in the list. The runtime is O(1), or constant time, because indexing to the end of a list happens in constant time. :return: front-most item of the queue or None, if the queue is empty """ if not self.items: raise IndexError('queue is empty') return self.items.pop() def peek(self): """ Returns the last item in the list, which represents the front-most item in the Queue. The runtime is O(1), or constant time, because we are just indexing to the last item of the list and returning the value found there. :return: front-most item of the queue or None, if the queue is empty """ if not self.items: raise IndexError('queue is empty') return self.items[-1] def size(self): """ Returns the size of the Queue, which is represent bu the length of the list The runtime is O(1), or constant time, because we're only returning the length. :return: length of list :rtype: int """ return len(self.items) def is_empty(self): """ Returns a boolean value expressing whether or not the list representing the Queue is empty. Runs in constant time, because it's only checking for equality. :return: returns true if stack is empty, else false """ return self.items == []
0.898944
0.912942
import re from datetime import datetime from sqlalchemy import Column,Integer, String, DateTime, Sequence, Index, \ UniqueConstraint from sqlalchemy.ext.declarative import declarative_base Base = declarative_base() class Lexicon(Base): __tablename__ = 'lexicon_2_1' id = Column(Integer, Sequence('user_id_seq'), primary_key=True) surface = Column(String(64), nullable=False, index=True) pos = Column(String(64), nullable=False, index=True) semantic_class = Column(String(16), default="*", nullable=False) read = Column(String(64), nullable=False) type_name = Column(String(16), name='type', default="*", nullable=False) start_pos = Column(String(16), default="*", nullable=False) end_pos = Column(String(16), default="*", nullable=False) expression = Column(String(128), default="*", nullable=False) class_name = Column(String(64), name='class', index=True) is_available = Column(Integer, nullable=False, index=True) is_inspected = Column(Integer, nullable=False, index=True) last_modified = Column(DateTime, default=datetime.now(), nullable=False, index=True) comment = Column(String(256)) __table_args__ = (UniqueConstraint('surface', 'pos', 'semantic_class', name='idx_surface_pos_semantic_class'),) def __init__(self, surface, pos, read, semantic_class='*', type_name='*', start_pos='*', end_pos='*', expression='*', class_name=None, is_available=1, is_inspected=0, last_modified=datetime.now()): self.surface = surface self.pos = pos self.semantic_class = semantic_class self.read = read self.type_name = type_name self.start_pos = start_pos self.end_pos = end_pos self.expression = expression self.class_name = class_name if class_name else '*' self.is_available = is_available if is_available else 1 self.is_inspected = is_inspected if is_inspected else 0 def __repr__(self): return '<' + ','.join((self.surface, self.pos, self.semantic_class, self.read, self.type_name, self.start_pos, self.end_pos, self.expression, self.class_name, str(self.is_available), str(self.is_inspected))) + '>'
utils/dictionary/lexicon.py
import re from datetime import datetime from sqlalchemy import Column,Integer, String, DateTime, Sequence, Index, \ UniqueConstraint from sqlalchemy.ext.declarative import declarative_base Base = declarative_base() class Lexicon(Base): __tablename__ = 'lexicon_2_1' id = Column(Integer, Sequence('user_id_seq'), primary_key=True) surface = Column(String(64), nullable=False, index=True) pos = Column(String(64), nullable=False, index=True) semantic_class = Column(String(16), default="*", nullable=False) read = Column(String(64), nullable=False) type_name = Column(String(16), name='type', default="*", nullable=False) start_pos = Column(String(16), default="*", nullable=False) end_pos = Column(String(16), default="*", nullable=False) expression = Column(String(128), default="*", nullable=False) class_name = Column(String(64), name='class', index=True) is_available = Column(Integer, nullable=False, index=True) is_inspected = Column(Integer, nullable=False, index=True) last_modified = Column(DateTime, default=datetime.now(), nullable=False, index=True) comment = Column(String(256)) __table_args__ = (UniqueConstraint('surface', 'pos', 'semantic_class', name='idx_surface_pos_semantic_class'),) def __init__(self, surface, pos, read, semantic_class='*', type_name='*', start_pos='*', end_pos='*', expression='*', class_name=None, is_available=1, is_inspected=0, last_modified=datetime.now()): self.surface = surface self.pos = pos self.semantic_class = semantic_class self.read = read self.type_name = type_name self.start_pos = start_pos self.end_pos = end_pos self.expression = expression self.class_name = class_name if class_name else '*' self.is_available = is_available if is_available else 1 self.is_inspected = is_inspected if is_inspected else 0 def __repr__(self): return '<' + ','.join((self.surface, self.pos, self.semantic_class, self.read, self.type_name, self.start_pos, self.end_pos, self.expression, self.class_name, str(self.is_available), str(self.is_inspected))) + '>'
0.452778
0.24159
import cv2 import numpy as np from src.DroneVision.DroneVision_src.imgProcessing.frameTools.frameTools import GetShape from src.DroneVision.DroneVision_src.hardware.imageTools import GetImage, RealTimePlot from src.DroneVision.DroneVision_src.hardware.PyQtImage import PyQtImage from CameraCalibration import CameraCalibration from src.bin.SaveParameters import SaveParameters ''' @brief Class for calibrating the stereo vision system. @param me_master (True if this instance is master, False for slave) @param settings_inst (CALIB settings) @param reset (True/False) @param plot_figure (optional plot figure (default=None)) @param use_PyQt (default=True) ''' class StereoCalibration(): def __init__(self, me_master, settings_inst, reset, plot_figure=None, use_PyQt=True): '''CONSTRUCTOR''' self.__saveParameters = SaveParameters(settings_inst.GetSettings('calib_save_folder'), settings_inst.GetSettings('calib_save_fname_stereo'), settings_inst.GetSettings('save_calib_param_to_json')) self.__leftCameraCalibration = CameraCalibration(settings_inst, settings_inst.GetSettings('calib_img_folder_left_cam'), settings_inst.GetSettings('calib_save_fname_left_cam'), reset, plot_figure=plot_figure) self.__rightCameraCalibration = CameraCalibration(settings_inst, settings_inst.GetSettings('calib_img_folder_right_cam'), settings_inst.GetSettings('calib_save_fname_right_cam'), reset, plot_figure=plot_figure) self.__show_chessboard_img = settings_inst.GetSettings('calib_show_imgs') self.__baseline = settings_inst.GetSettings('baseline') self.__stereo_calib_reset = reset self.__me_master = me_master self.__stereo_calibrated = False self.__plot_figure = plot_figure self.__use_PyQt = use_PyQt self.__calib_params = {} def CalibrateStereoVisionSystem(self, force_calibration=False, default_frame_shape=(-1,-1)): ''' @brief Calibrate stereo vision system, with full calibration of cameras as well. @param force_calibration (True/False for forcing new full calibration) @param default_frame_shape (Default desired frame shape of processed frames. Given as a tuple of (height, width). The rectification vectors will automatically be adjusted to incoming frame shapes (only ones for a new shape), but it is time consuming to compute. Set (-1,-1) to not change the precomputed intrinsic parameters (default)) ''' self.__leftCameraCalibration.CalibrateCameraDistortion(force_calibration=force_calibration) self.__rightCameraCalibration.CalibrateCameraDistortion(force_calibration=force_calibration) self.__stereo_calibrated = True new_calibration = False if not(self.LoadStereoParameters()) or self.__stereo_calib_reset or force_calibration: new_calibration = True self.StereoCalibrate() self.StereoRectify() self.SaveStereoParameters() self.InitUndistortRectifyMapStereo() if new_calibration: self.ShowTestCalibImage() if default_frame_shape[0] > 0: self.SetIntrinsicStereoScale(default_frame_shape) def GetNewRealTimePlot(self): ''' @brief Get new realtime plot figure @return realtime plot figure ''' if self.__plot_figure != None: realTimePlot = self.__plot_figure realTimePlot(reset=True) else: if self.__use_PyQt: realTimePlot = PyQtImage(True) else: realTimePlot = RealTimePlot() return realTimePlot def ShowTestCalibImage(self): ''' @brief Show test image in plot ''' if self.__show_chessboard_img: touple_frames = [] if self.__me_master: side_txt = 'left' test_img_fname = self.__leftCameraCalibration.GetDistorionCalibImages()[0] else: side_txt = 'right' test_img_fname = self.__rightCameraCalibration.GetDistorionCalibImages()[0] test_img = GetImage(test_img_fname) headline = '[{0}] before shape {1}'.format(side_txt, test_img.shape) touple_frames.append((headline, test_img)) test_und_img = self.Undistort(test_img) headline = '[{0}] After undistort shape {1}'.format(side_txt, test_und_img.shape) touple_frames.append((headline, test_und_img)) realTimePlot = self.GetNewRealTimePlot() realTimePlot(touple_frames, 'calibration_result') def AssertStereoCalibrated(self): ''' @brief Assert that the stereo vision system is calibrated. Raises Exception if it is not calibrated. ''' if not(self.GetStereoCalibrated()): raise Exception('Stereo is not calibrated. Run CalibrateStereoVisionSystem().') def CheckIntrinsicStereoScale(self, frame_size): ''' @brief Check intrinsic stereo scale @return True/False ''' return self.__leftCameraCalibration.CheckIntrinsicScale(frame_size) def GetLeftCameraCalibrationInstance(self): ''' @brief Get left camera calibration instance @return leftCameraCalibration ''' return self.__leftCameraCalibration def GetRightCameraCalibrationInstance(self): ''' @brief Get right camera calibration instance @return rightCameraCalibration ''' return self.__rightCameraCalibration def GetBaseline(self): ''' @brief Get baseline between cameras in mm @return baseline ''' return float(self.__baseline) def GetPixelBaseline(self): ''' @brief Get baseline between camers in pixel units ''' self.AssertStereoCalibrated() return self.__calib_params['P2'][0,3]*-1 # Projection matrix give negated baseline seen from the right camera. def GetFocalLength(self): ''' @brief Get original focal length in mm @return focal_length ''' return self.__leftCameraCalibration.GetFocalLength() def GetPixelFocalLength(self): ''' @brief Get focal length in camera pixel units @return f_x, f_y, f_z ''' self.AssertStereoCalibrated() f_x = self.__calib_params['P1'][0,0] f_y = self.__calib_params['P1'][1,1] f_z = (f_x + f_y)/2.0 return f_x, f_y, f_z def GetProjectionMatrices(self): ''' @brief Get projection matrices (P1 and P2) @return P1, P2 ''' return self.__calib_params['P1'], self.__calib_params['P2'] def GetDisparityToDepthMatrix(self): ''' @brief Get disparity to depth transformation matrix (Q) @return Q ''' return self.__calib_params['Q'] def GetStereoCalibrated(self): ''' @brief Check if stereo vision system is calibrated @return True/False ''' return self.__stereo_calibrated def AssertSameStereoSize(self): ''' @brief Assert that both cameras have same image dimensions ''' left_imageSize = self.__leftCameraCalibration.GetImageSize() right_imageSize = self.__rightCameraCalibration.GetImageSize() if not(left_imageSize[0] == right_imageSize[0]) or not(left_imageSize[1] == right_imageSize[1]): raise ValueError('Left and right image dimensions do not match!' ) def StereoCalibrate(self): ''' @brief Calibrates the stereo camera first, and then computes rectification transforms for each head of a calibrated stereo camera. Computes rotation matrix (R), translation vector (T), essential matrix (E) and fundamental matrix (F) ''' self.AssertSameStereoSize() cameraMatrix1, distCoeffs1 = self.__leftCameraCalibration.GetIntrinsicParameters() cameraMatrix2, distCoeffs2 = self.__rightCameraCalibration.GetIntrinsicParameters() objectPoints = self.__leftCameraCalibration.GetObjectPoints() imagePoints1 = self.__leftCameraCalibration.GetImagePoints() imagePoints2 = self.__rightCameraCalibration.GetImagePoints() imageSize = self.__leftCameraCalibration.GetImageSize() stereocalib_criteria = (cv2.TERM_CRITERIA_MAX_ITER + cv2.TERM_CRITERIA_EPS, 100, 1e-5) #stereocalib_flags = cv2.CALIB_FIX_ASPECT_RATIO | cv2.CALIB_ZERO_TANGENT_DIST | cv2.CALIB_SAME_FOCAL_LENGTH | cv2.CALIB_RATIONAL_MODEL | cv2.CALIB_FIX_K3 | cv2.CALIB_FIX_K4 | cv2.CALIB_FIX_K5 #stereocalib_flags = cv2.CALIB_FIX_INTRINSIC | cv2.CALIB_SAME_FOCAL_LENGTH stereocalib_flags = cv2.CALIB_FIX_INTRINSIC | cv2.CALIB_ZERO_DISPARITY | cv2.CALIB_RATIONAL_MODEL | cv2.CALIB_FIX_K3 | cv2.CALIB_FIX_K4 | cv2.CALIB_FIX_K5 retval, cameraMatrix1, distCoeffs1, cameraMatrix2, distCoeffs2, R, T, E, F = cv2.stereoCalibrate(objectPoints, \ imagePoints1, \ imagePoints2, \ cameraMatrix1, \ distCoeffs1, \ cameraMatrix2, \ distCoeffs2, \ (imageSize[1], imageSize[0]), \ criteria=stereocalib_criteria, \ flags=stereocalib_flags) if not(retval): raise Exception('Stereo calibration failed!') # Store params in dictionary self.__calib_params['cameraMatrix1'] = cameraMatrix1 self.__calib_params['distCoeffs1'] = distCoeffs1 self.__calib_params['cameraMatrix2'] = cameraMatrix2 self.__calib_params['distCoeffs2'] = distCoeffs2 self.__calib_params['R'] = R self.__calib_params['T'] = T self.__calib_params['E'] = E self.__calib_params['F'] = F def StereoRectify(self, frame_size=None, rectify_scale=0.0): ''' @brief Rectify the stereopsis system. Computes rectification transform (rotation matrices - 3x3) (R), projection matrices 3x4 (P) and disparity to depth mapping matrix 4x4 (Q) rectify_scale: 0 = full crop, 1 = no crop If rectify_scale = 1, all pixels are retained with some extra black images. If rectify_scale = 0, it returns undistorted image with minimum unwanted pixels. @param frame_size ((height, width) If None, then stored left frame size is used (default=None)) @param rectify_scale (default=0.0) ''' if not(isinstance(frame_size, tuple)) and not(isinstance(frame_size, list)): frame_size = self.__leftCameraCalibration.GetImageSize() if not(self.CheckIntrinsicStereoScale(frame_size)): self.__leftCameraCalibration.RectifyCamera(frame_size) self.__rightCameraCalibration.RectifyCamera(frame_size) self.StereoCalibrate() self.__calib_params['R'], self.__calib_params['T'] = self.ComputeTranslationAndRotationMatrices() self.__calib_params['R1'], self.__calib_params['R2'], self.__calib_params['P1'], self.__calib_params['P2'], self.__calib_params['Q'], self.__calib_params['roi1'], self.__calib_params['roi2'] = cv2.stereoRectify(self.__calib_params['cameraMatrix1'], self.__calib_params['distCoeffs1'], self.__calib_params['cameraMatrix2'], self.__calib_params['distCoeffs2'], (frame_size[1], frame_size[0]), self.__calib_params['R'], self.__calib_params['T'], alpha=rectify_scale) def InitUndistortRectifyMapStereo(self): ''' @brief Compute rectification maps ''' frame_size = self.__leftCameraCalibration.GetImageSize() self.__left_rectify_maps = cv2.initUndistortRectifyMap(self.__calib_params['cameraMatrix1'], self.__calib_params['distCoeffs1'], self.__calib_params['R1'], self.__calib_params['P1'], (frame_size[1], frame_size[0]), cv2.CV_16SC2) self.__right_rectify_maps = cv2.initUndistortRectifyMap(self.__calib_params['cameraMatrix2'], self.__calib_params['distCoeffs2'], self.__calib_params['R2'], self.__calib_params['P2'], (frame_size[1], frame_size[0]), cv2.CV_16SC2) def ComputeTranslationAndRotationMatrices(self): ''' @brief Compute the translation vector (T) and rotation vector (R) on perfectly horizontally aligned cameras. @return R, T ''' R = np.eye(3) # Perfectly aligned cameras T = np.zeros((3,1)) T_x = self.GetBaseline() # horizontal baseline in mm T[0,0] = -T_x return R, T def SetIntrinsicStereoScale(self, frame_size): ''' @brief Set new intrinsic scale parameters for a new frame shape (if it is different from the current parameters). Calibration is invariant to scale, but intrinsic parameters are not. @param frame_size (Tuple as (height, width)) ''' if not(self.CheckIntrinsicStereoScale(frame_size)): self.StereoRectify(frame_size) self.InitUndistortRectifyMapStereo() def Undistort(self, frame): ''' @brief Stereo undistorting @return undistorted frame ''' self.AssertStereoCalibrated() if not(self.CheckIntrinsicStereoScale(GetShape(frame))): self.SetIntrinsicStereoScale(GetShape(frame)) if self.__me_master: und_frame = cv2.remap(frame, self.__left_rectify_maps[0], self.__left_rectify_maps[1], cv2.INTER_LANCZOS4) else: und_frame = cv2.remap(frame, self.__right_rectify_maps[0], self.__right_rectify_maps[1], cv2.INTER_LANCZOS4) return self.CropUndistortedFrame(und_frame) def CropUndistortedFrame(self, und_frame): ''' @brief Crop undistorted frame @param und_frame @return und_frame Cropped undistorted frame ''' if self.__me_master: x, y, w, h = self.__calib_params['roi1'] else: x, y, w, h = self.__calib_params['roi2'] und_frame = und_frame[y:y+h, x:x+w] return und_frame def SaveStereoParameters(self): ''' @brief Save stereo parameters for later use. ''' self.__saveParameters.Save(self.__calib_params) def LoadStereoParameters(self): ''' @brief Load stereo parameters @return True/False - stereo parameters loaded successfully. ''' ok, self.__calib_params = self.__saveParameters.Load() return ok
src/DroneVision/DroneVision_src/imgProcessing/CameraCalibration/StereoCalibration.py
import cv2 import numpy as np from src.DroneVision.DroneVision_src.imgProcessing.frameTools.frameTools import GetShape from src.DroneVision.DroneVision_src.hardware.imageTools import GetImage, RealTimePlot from src.DroneVision.DroneVision_src.hardware.PyQtImage import PyQtImage from CameraCalibration import CameraCalibration from src.bin.SaveParameters import SaveParameters ''' @brief Class for calibrating the stereo vision system. @param me_master (True if this instance is master, False for slave) @param settings_inst (CALIB settings) @param reset (True/False) @param plot_figure (optional plot figure (default=None)) @param use_PyQt (default=True) ''' class StereoCalibration(): def __init__(self, me_master, settings_inst, reset, plot_figure=None, use_PyQt=True): '''CONSTRUCTOR''' self.__saveParameters = SaveParameters(settings_inst.GetSettings('calib_save_folder'), settings_inst.GetSettings('calib_save_fname_stereo'), settings_inst.GetSettings('save_calib_param_to_json')) self.__leftCameraCalibration = CameraCalibration(settings_inst, settings_inst.GetSettings('calib_img_folder_left_cam'), settings_inst.GetSettings('calib_save_fname_left_cam'), reset, plot_figure=plot_figure) self.__rightCameraCalibration = CameraCalibration(settings_inst, settings_inst.GetSettings('calib_img_folder_right_cam'), settings_inst.GetSettings('calib_save_fname_right_cam'), reset, plot_figure=plot_figure) self.__show_chessboard_img = settings_inst.GetSettings('calib_show_imgs') self.__baseline = settings_inst.GetSettings('baseline') self.__stereo_calib_reset = reset self.__me_master = me_master self.__stereo_calibrated = False self.__plot_figure = plot_figure self.__use_PyQt = use_PyQt self.__calib_params = {} def CalibrateStereoVisionSystem(self, force_calibration=False, default_frame_shape=(-1,-1)): ''' @brief Calibrate stereo vision system, with full calibration of cameras as well. @param force_calibration (True/False for forcing new full calibration) @param default_frame_shape (Default desired frame shape of processed frames. Given as a tuple of (height, width). The rectification vectors will automatically be adjusted to incoming frame shapes (only ones for a new shape), but it is time consuming to compute. Set (-1,-1) to not change the precomputed intrinsic parameters (default)) ''' self.__leftCameraCalibration.CalibrateCameraDistortion(force_calibration=force_calibration) self.__rightCameraCalibration.CalibrateCameraDistortion(force_calibration=force_calibration) self.__stereo_calibrated = True new_calibration = False if not(self.LoadStereoParameters()) or self.__stereo_calib_reset or force_calibration: new_calibration = True self.StereoCalibrate() self.StereoRectify() self.SaveStereoParameters() self.InitUndistortRectifyMapStereo() if new_calibration: self.ShowTestCalibImage() if default_frame_shape[0] > 0: self.SetIntrinsicStereoScale(default_frame_shape) def GetNewRealTimePlot(self): ''' @brief Get new realtime plot figure @return realtime plot figure ''' if self.__plot_figure != None: realTimePlot = self.__plot_figure realTimePlot(reset=True) else: if self.__use_PyQt: realTimePlot = PyQtImage(True) else: realTimePlot = RealTimePlot() return realTimePlot def ShowTestCalibImage(self): ''' @brief Show test image in plot ''' if self.__show_chessboard_img: touple_frames = [] if self.__me_master: side_txt = 'left' test_img_fname = self.__leftCameraCalibration.GetDistorionCalibImages()[0] else: side_txt = 'right' test_img_fname = self.__rightCameraCalibration.GetDistorionCalibImages()[0] test_img = GetImage(test_img_fname) headline = '[{0}] before shape {1}'.format(side_txt, test_img.shape) touple_frames.append((headline, test_img)) test_und_img = self.Undistort(test_img) headline = '[{0}] After undistort shape {1}'.format(side_txt, test_und_img.shape) touple_frames.append((headline, test_und_img)) realTimePlot = self.GetNewRealTimePlot() realTimePlot(touple_frames, 'calibration_result') def AssertStereoCalibrated(self): ''' @brief Assert that the stereo vision system is calibrated. Raises Exception if it is not calibrated. ''' if not(self.GetStereoCalibrated()): raise Exception('Stereo is not calibrated. Run CalibrateStereoVisionSystem().') def CheckIntrinsicStereoScale(self, frame_size): ''' @brief Check intrinsic stereo scale @return True/False ''' return self.__leftCameraCalibration.CheckIntrinsicScale(frame_size) def GetLeftCameraCalibrationInstance(self): ''' @brief Get left camera calibration instance @return leftCameraCalibration ''' return self.__leftCameraCalibration def GetRightCameraCalibrationInstance(self): ''' @brief Get right camera calibration instance @return rightCameraCalibration ''' return self.__rightCameraCalibration def GetBaseline(self): ''' @brief Get baseline between cameras in mm @return baseline ''' return float(self.__baseline) def GetPixelBaseline(self): ''' @brief Get baseline between camers in pixel units ''' self.AssertStereoCalibrated() return self.__calib_params['P2'][0,3]*-1 # Projection matrix give negated baseline seen from the right camera. def GetFocalLength(self): ''' @brief Get original focal length in mm @return focal_length ''' return self.__leftCameraCalibration.GetFocalLength() def GetPixelFocalLength(self): ''' @brief Get focal length in camera pixel units @return f_x, f_y, f_z ''' self.AssertStereoCalibrated() f_x = self.__calib_params['P1'][0,0] f_y = self.__calib_params['P1'][1,1] f_z = (f_x + f_y)/2.0 return f_x, f_y, f_z def GetProjectionMatrices(self): ''' @brief Get projection matrices (P1 and P2) @return P1, P2 ''' return self.__calib_params['P1'], self.__calib_params['P2'] def GetDisparityToDepthMatrix(self): ''' @brief Get disparity to depth transformation matrix (Q) @return Q ''' return self.__calib_params['Q'] def GetStereoCalibrated(self): ''' @brief Check if stereo vision system is calibrated @return True/False ''' return self.__stereo_calibrated def AssertSameStereoSize(self): ''' @brief Assert that both cameras have same image dimensions ''' left_imageSize = self.__leftCameraCalibration.GetImageSize() right_imageSize = self.__rightCameraCalibration.GetImageSize() if not(left_imageSize[0] == right_imageSize[0]) or not(left_imageSize[1] == right_imageSize[1]): raise ValueError('Left and right image dimensions do not match!' ) def StereoCalibrate(self): ''' @brief Calibrates the stereo camera first, and then computes rectification transforms for each head of a calibrated stereo camera. Computes rotation matrix (R), translation vector (T), essential matrix (E) and fundamental matrix (F) ''' self.AssertSameStereoSize() cameraMatrix1, distCoeffs1 = self.__leftCameraCalibration.GetIntrinsicParameters() cameraMatrix2, distCoeffs2 = self.__rightCameraCalibration.GetIntrinsicParameters() objectPoints = self.__leftCameraCalibration.GetObjectPoints() imagePoints1 = self.__leftCameraCalibration.GetImagePoints() imagePoints2 = self.__rightCameraCalibration.GetImagePoints() imageSize = self.__leftCameraCalibration.GetImageSize() stereocalib_criteria = (cv2.TERM_CRITERIA_MAX_ITER + cv2.TERM_CRITERIA_EPS, 100, 1e-5) #stereocalib_flags = cv2.CALIB_FIX_ASPECT_RATIO | cv2.CALIB_ZERO_TANGENT_DIST | cv2.CALIB_SAME_FOCAL_LENGTH | cv2.CALIB_RATIONAL_MODEL | cv2.CALIB_FIX_K3 | cv2.CALIB_FIX_K4 | cv2.CALIB_FIX_K5 #stereocalib_flags = cv2.CALIB_FIX_INTRINSIC | cv2.CALIB_SAME_FOCAL_LENGTH stereocalib_flags = cv2.CALIB_FIX_INTRINSIC | cv2.CALIB_ZERO_DISPARITY | cv2.CALIB_RATIONAL_MODEL | cv2.CALIB_FIX_K3 | cv2.CALIB_FIX_K4 | cv2.CALIB_FIX_K5 retval, cameraMatrix1, distCoeffs1, cameraMatrix2, distCoeffs2, R, T, E, F = cv2.stereoCalibrate(objectPoints, \ imagePoints1, \ imagePoints2, \ cameraMatrix1, \ distCoeffs1, \ cameraMatrix2, \ distCoeffs2, \ (imageSize[1], imageSize[0]), \ criteria=stereocalib_criteria, \ flags=stereocalib_flags) if not(retval): raise Exception('Stereo calibration failed!') # Store params in dictionary self.__calib_params['cameraMatrix1'] = cameraMatrix1 self.__calib_params['distCoeffs1'] = distCoeffs1 self.__calib_params['cameraMatrix2'] = cameraMatrix2 self.__calib_params['distCoeffs2'] = distCoeffs2 self.__calib_params['R'] = R self.__calib_params['T'] = T self.__calib_params['E'] = E self.__calib_params['F'] = F def StereoRectify(self, frame_size=None, rectify_scale=0.0): ''' @brief Rectify the stereopsis system. Computes rectification transform (rotation matrices - 3x3) (R), projection matrices 3x4 (P) and disparity to depth mapping matrix 4x4 (Q) rectify_scale: 0 = full crop, 1 = no crop If rectify_scale = 1, all pixels are retained with some extra black images. If rectify_scale = 0, it returns undistorted image with minimum unwanted pixels. @param frame_size ((height, width) If None, then stored left frame size is used (default=None)) @param rectify_scale (default=0.0) ''' if not(isinstance(frame_size, tuple)) and not(isinstance(frame_size, list)): frame_size = self.__leftCameraCalibration.GetImageSize() if not(self.CheckIntrinsicStereoScale(frame_size)): self.__leftCameraCalibration.RectifyCamera(frame_size) self.__rightCameraCalibration.RectifyCamera(frame_size) self.StereoCalibrate() self.__calib_params['R'], self.__calib_params['T'] = self.ComputeTranslationAndRotationMatrices() self.__calib_params['R1'], self.__calib_params['R2'], self.__calib_params['P1'], self.__calib_params['P2'], self.__calib_params['Q'], self.__calib_params['roi1'], self.__calib_params['roi2'] = cv2.stereoRectify(self.__calib_params['cameraMatrix1'], self.__calib_params['distCoeffs1'], self.__calib_params['cameraMatrix2'], self.__calib_params['distCoeffs2'], (frame_size[1], frame_size[0]), self.__calib_params['R'], self.__calib_params['T'], alpha=rectify_scale) def InitUndistortRectifyMapStereo(self): ''' @brief Compute rectification maps ''' frame_size = self.__leftCameraCalibration.GetImageSize() self.__left_rectify_maps = cv2.initUndistortRectifyMap(self.__calib_params['cameraMatrix1'], self.__calib_params['distCoeffs1'], self.__calib_params['R1'], self.__calib_params['P1'], (frame_size[1], frame_size[0]), cv2.CV_16SC2) self.__right_rectify_maps = cv2.initUndistortRectifyMap(self.__calib_params['cameraMatrix2'], self.__calib_params['distCoeffs2'], self.__calib_params['R2'], self.__calib_params['P2'], (frame_size[1], frame_size[0]), cv2.CV_16SC2) def ComputeTranslationAndRotationMatrices(self): ''' @brief Compute the translation vector (T) and rotation vector (R) on perfectly horizontally aligned cameras. @return R, T ''' R = np.eye(3) # Perfectly aligned cameras T = np.zeros((3,1)) T_x = self.GetBaseline() # horizontal baseline in mm T[0,0] = -T_x return R, T def SetIntrinsicStereoScale(self, frame_size): ''' @brief Set new intrinsic scale parameters for a new frame shape (if it is different from the current parameters). Calibration is invariant to scale, but intrinsic parameters are not. @param frame_size (Tuple as (height, width)) ''' if not(self.CheckIntrinsicStereoScale(frame_size)): self.StereoRectify(frame_size) self.InitUndistortRectifyMapStereo() def Undistort(self, frame): ''' @brief Stereo undistorting @return undistorted frame ''' self.AssertStereoCalibrated() if not(self.CheckIntrinsicStereoScale(GetShape(frame))): self.SetIntrinsicStereoScale(GetShape(frame)) if self.__me_master: und_frame = cv2.remap(frame, self.__left_rectify_maps[0], self.__left_rectify_maps[1], cv2.INTER_LANCZOS4) else: und_frame = cv2.remap(frame, self.__right_rectify_maps[0], self.__right_rectify_maps[1], cv2.INTER_LANCZOS4) return self.CropUndistortedFrame(und_frame) def CropUndistortedFrame(self, und_frame): ''' @brief Crop undistorted frame @param und_frame @return und_frame Cropped undistorted frame ''' if self.__me_master: x, y, w, h = self.__calib_params['roi1'] else: x, y, w, h = self.__calib_params['roi2'] und_frame = und_frame[y:y+h, x:x+w] return und_frame def SaveStereoParameters(self): ''' @brief Save stereo parameters for later use. ''' self.__saveParameters.Save(self.__calib_params) def LoadStereoParameters(self): ''' @brief Load stereo parameters @return True/False - stereo parameters loaded successfully. ''' ok, self.__calib_params = self.__saveParameters.Load() return ok
0.570092
0.273975
from sys import stdout, stderr import csv from argparse import ArgumentParser from io import TextIOWrapper from copy import deepcopy from datetime import timedelta from dateutil import parser def command_line_options()->dict: parser = ArgumentParser(prog="obd_log_to_csv", description="""Telemetry CSV To Delta CSV generates values indicating the rate of change for identified columns. All original columns pass through unmolested. The delta columns are added columns. """) parser.add_argument( "--input_csv_file", help=""" CSV file generated by obd_log_to_csv.obd_log_to_csv that includes the header. That is, each column in the file has a valid text column name in the first row. """, ) parser.add_argument( "--delta", help=""" Comma separated list of commands where successive pairs of non-null return values would be used to calculate the rate of change between the two return values. e.g. "SPEED,FUEL_LEVEL,THROTTLE_POSITION". Calculated from "(second-return-value - first-return-value) / (second-iso_ts_post - first-iso_ts_post)". Applied in this way, delta SPEED would represent acceleration. The results will be in a column headed by delta-COMMAND_NAME. e.g. delta SPEED column name would be "delta-SPEED". """, ) parser.add_argument( "--output_csv_file", help="""CSV output file. File can be either a full or relative path name. If the file already exists, it will be overwritten. Do not make the input and output file the same. Bad things will happen. Defaults to stdout (terminal output). """, default="stdout" ) parser.add_argument( "--verbose", help="Turn verbose output on. Default is off.", default=False, action='store_true' ) return vars(parser.parse_args()) def delta_column_names(delta_columns:list) -> list: return [f"delta-{name}" for name in delta_columns] def delta(input_csv_file, output_csv_file, delta_columns, verbose=False): delta_column_name_list = delta_column_names(delta_columns) reader = csv.DictReader(input_csv_file) field_names = reader.fieldnames # check to make sure delta columns map into the input CSV file columns for name in (delta_columns + ['iso_ts_pre', 'iso_ts_post', ]): if name not in field_names: raise ValueError(f"delta column '{name}' missing from CSV input file") all_field_names = field_names + delta_column_name_list writer = csv.DictWriter(output_csv_file, fieldnames=all_field_names) writer.writeheader() delta_first = {} for in_row in reader: if verbose: print(f"in_row: {in_row}", file=stderr) # the original row passes through unmolested out_row = deepcopy(in_row) # delta columns are added and set to None for name in delta_columns: if ( name in delta_first and delta_first[name]['value'] and in_row[name] ): v1 = float(delta_first[name]['value']) v2 = float(in_row[name]) t1 = parser.isoparse(delta_first[name]['iso_ts_pre']) t2 = parser.isoparse(in_row['iso_ts_post']) out_row[f"delta-{name}"] = (v2 - v1) / (float((t2 - t1) / timedelta(microseconds=1)) * 1000000.0) else: out_row[f"delta-{name}"] = None if in_row[name]: delta_first[name] = { 'value': in_row[name], 'iso_ts_pre': in_row['iso_ts_pre'], 'iso_ts_post': in_row['iso_ts_post'], } if verbose: print(f"out_row: {out_row}", file=stderr) writer.writerow(out_row) def main(): args = command_line_options() input_csv_file_name = args['input_csv_file'] output_csv_file_name = args['output_csv_file'] verbose = args['verbose'] delta_columns = (args['delta']).split(sep=',') if args['delta'] else [] if verbose: print(f"verbose: {args['verbose']}", file=stderr) print(f"input csv file: {input_csv_file_name}", file=stderr) print(f"output csv file: {output_csv_file_name}", file=stderr) print(f"delta: {delta_columns}", file=stderr) if output_csv_file_name != "stdout": with open(output_csv_file_name, "w") as output_csv_file: with open(input_csv_file_name, "r") as input_csv_file: delta(input_csv_file, output_csv_file, delta_columns, verbose=verbose) else: with open(input_csv_file_name, "r") as input_csv_file: delta(input_csv_file, stdout, delta_columns, verbose=verbose) if __name__ == "__main__": main()
obd_log_to_csv/csv_to_delta_csv.py
from sys import stdout, stderr import csv from argparse import ArgumentParser from io import TextIOWrapper from copy import deepcopy from datetime import timedelta from dateutil import parser def command_line_options()->dict: parser = ArgumentParser(prog="obd_log_to_csv", description="""Telemetry CSV To Delta CSV generates values indicating the rate of change for identified columns. All original columns pass through unmolested. The delta columns are added columns. """) parser.add_argument( "--input_csv_file", help=""" CSV file generated by obd_log_to_csv.obd_log_to_csv that includes the header. That is, each column in the file has a valid text column name in the first row. """, ) parser.add_argument( "--delta", help=""" Comma separated list of commands where successive pairs of non-null return values would be used to calculate the rate of change between the two return values. e.g. "SPEED,FUEL_LEVEL,THROTTLE_POSITION". Calculated from "(second-return-value - first-return-value) / (second-iso_ts_post - first-iso_ts_post)". Applied in this way, delta SPEED would represent acceleration. The results will be in a column headed by delta-COMMAND_NAME. e.g. delta SPEED column name would be "delta-SPEED". """, ) parser.add_argument( "--output_csv_file", help="""CSV output file. File can be either a full or relative path name. If the file already exists, it will be overwritten. Do not make the input and output file the same. Bad things will happen. Defaults to stdout (terminal output). """, default="stdout" ) parser.add_argument( "--verbose", help="Turn verbose output on. Default is off.", default=False, action='store_true' ) return vars(parser.parse_args()) def delta_column_names(delta_columns:list) -> list: return [f"delta-{name}" for name in delta_columns] def delta(input_csv_file, output_csv_file, delta_columns, verbose=False): delta_column_name_list = delta_column_names(delta_columns) reader = csv.DictReader(input_csv_file) field_names = reader.fieldnames # check to make sure delta columns map into the input CSV file columns for name in (delta_columns + ['iso_ts_pre', 'iso_ts_post', ]): if name not in field_names: raise ValueError(f"delta column '{name}' missing from CSV input file") all_field_names = field_names + delta_column_name_list writer = csv.DictWriter(output_csv_file, fieldnames=all_field_names) writer.writeheader() delta_first = {} for in_row in reader: if verbose: print(f"in_row: {in_row}", file=stderr) # the original row passes through unmolested out_row = deepcopy(in_row) # delta columns are added and set to None for name in delta_columns: if ( name in delta_first and delta_first[name]['value'] and in_row[name] ): v1 = float(delta_first[name]['value']) v2 = float(in_row[name]) t1 = parser.isoparse(delta_first[name]['iso_ts_pre']) t2 = parser.isoparse(in_row['iso_ts_post']) out_row[f"delta-{name}"] = (v2 - v1) / (float((t2 - t1) / timedelta(microseconds=1)) * 1000000.0) else: out_row[f"delta-{name}"] = None if in_row[name]: delta_first[name] = { 'value': in_row[name], 'iso_ts_pre': in_row['iso_ts_pre'], 'iso_ts_post': in_row['iso_ts_post'], } if verbose: print(f"out_row: {out_row}", file=stderr) writer.writerow(out_row) def main(): args = command_line_options() input_csv_file_name = args['input_csv_file'] output_csv_file_name = args['output_csv_file'] verbose = args['verbose'] delta_columns = (args['delta']).split(sep=',') if args['delta'] else [] if verbose: print(f"verbose: {args['verbose']}", file=stderr) print(f"input csv file: {input_csv_file_name}", file=stderr) print(f"output csv file: {output_csv_file_name}", file=stderr) print(f"delta: {delta_columns}", file=stderr) if output_csv_file_name != "stdout": with open(output_csv_file_name, "w") as output_csv_file: with open(input_csv_file_name, "r") as input_csv_file: delta(input_csv_file, output_csv_file, delta_columns, verbose=verbose) else: with open(input_csv_file_name, "r") as input_csv_file: delta(input_csv_file, stdout, delta_columns, verbose=verbose) if __name__ == "__main__": main()
0.504394
0.374648
DOCUMENTATION = ''' --- module: foreman_image short_description: - Manage Foreman images using Foreman API v2. description: - Create, update and and delete Foreman images using Foreman API v2 options: name: description: Image name as used in Foreman required: true state: description: image state required: false default: 'present' choices: ['present', 'absent'] uuid: operatingsystem: description: Operatingsystem used on the image required: True architecture: description: Architecture the image is for required: True uuid: description: UUID of the image required: True user: description: User used to log into the image required: False default: root foreman_host: description: Hostname or IP address of Foreman system required: false default: 127.0.0.1 foreman_port: description: Port of Foreman API required: false default: 443 foreman_user: description: Username to be used to authenticate on Foreman required: true foreman_pass: description: Password to be used to authenticate user on Foreman required: true foreman_ssl: description: Enable SSL when connecting to Foreman API required: false default: true notes: - Requires the python-foreman package to be installed. See https://github.com/Nosmoht/python-foreman. version_added: "2.0" author: "<NAME> <<EMAIL>>" ''' EXAMPLES = ''' - name: Ensure Debian Jessie Image foreman_image: name: Debian Jessie Minimal architecture: x86_64 operatingsystem: DebianJessie uuid: /path/to/image state: present foreman_host: 127.0.0.1 foreman_port: 443 foreman_user: admin foreman_pass: secret ''' try: from foreman.foreman import * foremanclient_found = True except ImportError: foremanclient_found = False def get_resources(resource_type, resource_func, resource_name, search_field='name'): if not resource_name: return None search_data = dict() search_data[search_field] = resource_name try: resource = resource_func(data=search_data) if not resource: module.fail_json( msg='Could not find resource type {resource_type} specified as {name}'.format( resource_type=resource_type, name=resource_name)) except ForemanError as e: module.fail_json(msg='Could not search resource type {resource_type} specified as {name}: {error}'.format( resource_type=resource_type, name=resource_name, error=e.message)) return resource def ensure(): name = module.params['name'] compute_resource_name = module.params['compute_resource'] state = module.params['state'] data = dict(name=name) try: compute_resource = theforeman.search_compute_resource(data=dict(name=compute_resource_name)) except ForemanError as e: module.fail_json(msg='Could not find compute resource {0}: {1}'.format(compute_resource_name, e.message)) if not compute_resource: module.fail_json(msg='Could not find compute resource {0}'.format(compute_resource_name)) cid = compute_resource['id'] try: images = theforeman.get_compute_resource_images(compute_resource['id']) for i in images: if i['name'] == name: image = i break else: image = None except ForemanError as e: module.fail_json(msg='Could not get images: {0}'.format(e.message)) if state == 'absent': if image: try: image = theforeman.delete_compute_resource_image(cid, image.get('id')) return True, image except ForemanError as e: module.fail_json(msg='Could not delete image: {0}'.format(e.message)) return False, image data['compute_resource_id'] = cid data['uuid'] = module.params['uuid'] data['username'] = module.params['user'] if module.params['password']: data['password'] = module.params['password'] data['architecture_id'] = get_resources(resource_type='architecture', resource_func=theforeman.search_architecture, resource_name=module.params['architecture'])['id'] data['operatingsystem_id'] = get_resources(resource_type='operatingsystem', resource_func=theforeman.search_operatingsystem, resource_name=module.params['operatingsystem'], search_field='title')['id'] if not image: try: image = theforeman.create_compute_resource_image(compute_resource_id=cid, data=data) return True, image except ForemanError as e: module.fail_json(msg='Could not create image: {0}'.format(e.message)) else: data['id'] = image['id'] if not all(data[key] == image.get(key, data[key]) for key in data.keys()): try: new_data = dict(compute_resource_id=cid, id=image['id'], image=data) image = theforeman.update_compute_resource_image(compute_resource_id=cid, data=new_data) return True, image except ForemanError as e: module.fail_json(msg='Could not update image: {0}'.format(e.message)) return False, image def main(): global module global theforeman module = AnsibleModule( argument_spec=dict( name=dict(type='str', required=True), compute_resource=dict(type='str', required=True), architecture=dict(type='str', required=True), operatingsystem=dict(operatingsystem='str', required=True), uuid=dict(type='str', required=True), user=dict(type='str', default='root'), password=dict(type='str', default=None, no_log=True), state=dict(type='str', default='present', choices=['present', 'absent']), foreman_host=dict(type='str', default='127.0.0.1'), foreman_port=dict(type='str', default='443'), foreman_user=dict(type='str', required=True), foreman_pass=dict(type='str', required=True, no_log=True), foreman_ssl=dict(type='bool', default=True) ), ) if not foremanclient_found: module.fail_json(msg='python-foreman module is required. See https://github.com/Nosmoht/python-foreman.') foreman_host = module.params['foreman_host'] foreman_port = module.params['foreman_port'] foreman_user = module.params['foreman_user'] foreman_pass = module.params['foreman_pass'] foreman_ssl = module.params['foreman_ssl'] theforeman = Foreman(hostname=foreman_host, port=foreman_port, username=foreman_user, password=<PASSWORD>, ssl=foreman_ssl) changed, image = ensure() module.exit_json(changed=changed, image=image) from ansible.module_utils.basic import * if __name__ == '__main__': main()
foreman_image.py
DOCUMENTATION = ''' --- module: foreman_image short_description: - Manage Foreman images using Foreman API v2. description: - Create, update and and delete Foreman images using Foreman API v2 options: name: description: Image name as used in Foreman required: true state: description: image state required: false default: 'present' choices: ['present', 'absent'] uuid: operatingsystem: description: Operatingsystem used on the image required: True architecture: description: Architecture the image is for required: True uuid: description: UUID of the image required: True user: description: User used to log into the image required: False default: root foreman_host: description: Hostname or IP address of Foreman system required: false default: 127.0.0.1 foreman_port: description: Port of Foreman API required: false default: 443 foreman_user: description: Username to be used to authenticate on Foreman required: true foreman_pass: description: Password to be used to authenticate user on Foreman required: true foreman_ssl: description: Enable SSL when connecting to Foreman API required: false default: true notes: - Requires the python-foreman package to be installed. See https://github.com/Nosmoht/python-foreman. version_added: "2.0" author: "<NAME> <<EMAIL>>" ''' EXAMPLES = ''' - name: Ensure Debian Jessie Image foreman_image: name: Debian Jessie Minimal architecture: x86_64 operatingsystem: DebianJessie uuid: /path/to/image state: present foreman_host: 127.0.0.1 foreman_port: 443 foreman_user: admin foreman_pass: secret ''' try: from foreman.foreman import * foremanclient_found = True except ImportError: foremanclient_found = False def get_resources(resource_type, resource_func, resource_name, search_field='name'): if not resource_name: return None search_data = dict() search_data[search_field] = resource_name try: resource = resource_func(data=search_data) if not resource: module.fail_json( msg='Could not find resource type {resource_type} specified as {name}'.format( resource_type=resource_type, name=resource_name)) except ForemanError as e: module.fail_json(msg='Could not search resource type {resource_type} specified as {name}: {error}'.format( resource_type=resource_type, name=resource_name, error=e.message)) return resource def ensure(): name = module.params['name'] compute_resource_name = module.params['compute_resource'] state = module.params['state'] data = dict(name=name) try: compute_resource = theforeman.search_compute_resource(data=dict(name=compute_resource_name)) except ForemanError as e: module.fail_json(msg='Could not find compute resource {0}: {1}'.format(compute_resource_name, e.message)) if not compute_resource: module.fail_json(msg='Could not find compute resource {0}'.format(compute_resource_name)) cid = compute_resource['id'] try: images = theforeman.get_compute_resource_images(compute_resource['id']) for i in images: if i['name'] == name: image = i break else: image = None except ForemanError as e: module.fail_json(msg='Could not get images: {0}'.format(e.message)) if state == 'absent': if image: try: image = theforeman.delete_compute_resource_image(cid, image.get('id')) return True, image except ForemanError as e: module.fail_json(msg='Could not delete image: {0}'.format(e.message)) return False, image data['compute_resource_id'] = cid data['uuid'] = module.params['uuid'] data['username'] = module.params['user'] if module.params['password']: data['password'] = module.params['password'] data['architecture_id'] = get_resources(resource_type='architecture', resource_func=theforeman.search_architecture, resource_name=module.params['architecture'])['id'] data['operatingsystem_id'] = get_resources(resource_type='operatingsystem', resource_func=theforeman.search_operatingsystem, resource_name=module.params['operatingsystem'], search_field='title')['id'] if not image: try: image = theforeman.create_compute_resource_image(compute_resource_id=cid, data=data) return True, image except ForemanError as e: module.fail_json(msg='Could not create image: {0}'.format(e.message)) else: data['id'] = image['id'] if not all(data[key] == image.get(key, data[key]) for key in data.keys()): try: new_data = dict(compute_resource_id=cid, id=image['id'], image=data) image = theforeman.update_compute_resource_image(compute_resource_id=cid, data=new_data) return True, image except ForemanError as e: module.fail_json(msg='Could not update image: {0}'.format(e.message)) return False, image def main(): global module global theforeman module = AnsibleModule( argument_spec=dict( name=dict(type='str', required=True), compute_resource=dict(type='str', required=True), architecture=dict(type='str', required=True), operatingsystem=dict(operatingsystem='str', required=True), uuid=dict(type='str', required=True), user=dict(type='str', default='root'), password=dict(type='str', default=None, no_log=True), state=dict(type='str', default='present', choices=['present', 'absent']), foreman_host=dict(type='str', default='127.0.0.1'), foreman_port=dict(type='str', default='443'), foreman_user=dict(type='str', required=True), foreman_pass=dict(type='str', required=True, no_log=True), foreman_ssl=dict(type='bool', default=True) ), ) if not foremanclient_found: module.fail_json(msg='python-foreman module is required. See https://github.com/Nosmoht/python-foreman.') foreman_host = module.params['foreman_host'] foreman_port = module.params['foreman_port'] foreman_user = module.params['foreman_user'] foreman_pass = module.params['foreman_pass'] foreman_ssl = module.params['foreman_ssl'] theforeman = Foreman(hostname=foreman_host, port=foreman_port, username=foreman_user, password=<PASSWORD>, ssl=foreman_ssl) changed, image = ensure() module.exit_json(changed=changed, image=image) from ansible.module_utils.basic import * if __name__ == '__main__': main()
0.564339
0.452657
from django.contrib.auth import get_user_model, authenticate from rest_framework import serializers from core.models import CommunityMember, Community class RegisterSerializer(serializers.ModelSerializer): """ serializer for register class """ class Meta: model = get_user_model() fields = ('name', 'email', 'password',) extra_kwargs = { 'password': { 'write_only': True, 'style': {'input_type': 'password'} } } def create(self, validated_data): return get_user_model().objects.create_user(**validated_data) class LoginSerializer(serializers.Serializer): """ serializer for user login """ email = serializers.EmailField() password = serializers.CharField( style={'input_type': 'password'}, trim_whitespace=False ) def validate(self, attrs): """ validate and authenticate the user """ email = attrs.get('email') password = attrs.get('password') user = authenticate( request=self.context.get('request'), username=email, password=password ) if not user: msg = 'User not Found, Please Try Different User' raise serializers.ValidationError( {'message': msg}, code='authentication' ) attrs['user'] = user return attrs class CommunityProfileSerializer(serializers.ModelSerializer): """ community profile serializer """ class Meta: model = Community fields = ('id', 'name', 'image',) read_only_field = ('id', 'name', 'image',) class CommunityMemberSerializer(serializers.ModelSerializer): """ community profile serializer """ community = CommunityProfileSerializer(read_only=True) class Meta: model = CommunityMember fields = ('community',) read_only_field = ('community',) class ProfileSerializer(serializers.ModelSerializer): """ User Profile Serializer """ community = serializers.SerializerMethodField() class Meta: model = get_user_model() fields = ('name', 'email', 'exp', 'about', 'age', 'password', 'image', 'community',) extra_kwargs = {'password': {'write_only': True, 'min_length': 5}} def get_community(self, profile): community_member = CommunityMember.objects.filter(user=profile) communities = Community.objects.filter(communitymember__in=community_member) serializer = CommunityProfileSerializer(instance=communities, many=True) return serializer.data def update(self, instance, validated_data): """ update user """ password = validated_data.pop('password', None) user = super().update(instance, validated_data) if password: user.set_password(password) user.save() return user
app/userauth/serializers.py
from django.contrib.auth import get_user_model, authenticate from rest_framework import serializers from core.models import CommunityMember, Community class RegisterSerializer(serializers.ModelSerializer): """ serializer for register class """ class Meta: model = get_user_model() fields = ('name', 'email', 'password',) extra_kwargs = { 'password': { 'write_only': True, 'style': {'input_type': 'password'} } } def create(self, validated_data): return get_user_model().objects.create_user(**validated_data) class LoginSerializer(serializers.Serializer): """ serializer for user login """ email = serializers.EmailField() password = serializers.CharField( style={'input_type': 'password'}, trim_whitespace=False ) def validate(self, attrs): """ validate and authenticate the user """ email = attrs.get('email') password = attrs.get('password') user = authenticate( request=self.context.get('request'), username=email, password=password ) if not user: msg = 'User not Found, Please Try Different User' raise serializers.ValidationError( {'message': msg}, code='authentication' ) attrs['user'] = user return attrs class CommunityProfileSerializer(serializers.ModelSerializer): """ community profile serializer """ class Meta: model = Community fields = ('id', 'name', 'image',) read_only_field = ('id', 'name', 'image',) class CommunityMemberSerializer(serializers.ModelSerializer): """ community profile serializer """ community = CommunityProfileSerializer(read_only=True) class Meta: model = CommunityMember fields = ('community',) read_only_field = ('community',) class ProfileSerializer(serializers.ModelSerializer): """ User Profile Serializer """ community = serializers.SerializerMethodField() class Meta: model = get_user_model() fields = ('name', 'email', 'exp', 'about', 'age', 'password', 'image', 'community',) extra_kwargs = {'password': {'write_only': True, 'min_length': 5}} def get_community(self, profile): community_member = CommunityMember.objects.filter(user=profile) communities = Community.objects.filter(communitymember__in=community_member) serializer = CommunityProfileSerializer(instance=communities, many=True) return serializer.data def update(self, instance, validated_data): """ update user """ password = validated_data.pop('password', None) user = super().update(instance, validated_data) if password: user.set_password(password) user.save() return user
0.695028
0.071656
# imports __version__ = "0.0.0-auto.0" __repo__ = "https://github.com/tinkeringtech/rda5807m.git" import time # Registers definitions FREQ_STEPS = 10 RADIO_REG_CHIPID = 0x00 RADIO_REG_CTRL = 0x02 RADIO_REG_CTRL_OUTPUT = 0x8000 RADIO_REG_CTRL_UNMUTE = 0x4000 RADIO_REG_CTRL_MONO = 0x2000 RADIO_REG_CTRL_BASS = 0x1000 RADIO_REG_CTRL_SEEKUP = 0x0200 RADIO_REG_CTRL_SEEK = 0x0100 RADIO_REG_CTRL_RDS = 0x0008 RADIO_REG_CTRL_NEW = 0x0004 RADIO_REG_CTRL_RESET = 0x0002 RADIO_REG_CTRL_ENABLE = 0x0001 RADIO_REG_CHAN = 0x03 RADIO_REG_CHAN_SPACE = 0x0003 RADIO_REG_CHAN_SPACE_100 = 0x0000 RADIO_REG_CHAN_BAND = 0x000C RADIO_REG_CHAN_BAND_FM = 0x0000 RADIO_REG_CHAN_BAND_FMWORLD = 0x0008 RADIO_REG_CHAN_TUNE = 0x0010 RADIO_REG_CHAN_NR = 0x7FC0 RADIO_REG_R4 = 0x04 RADIO_REG_R4_EM50 = 0x0800 RADIO_REG_R4_SOFTMUTE = 0x0200 RADIO_REG_R4_AFC = 0x0100 RADIO_REG_VOL = 0x05 RADIO_REG_VOL_VOL = 0x000F RADIO_REG_RA = 0x0A RADIO_REG_RA_RDS = 0x8000 RADIO_REG_RA_RDSBLOCK = 0x0800 RADIO_REG_RA_STEREO = 0x0400 RADIO_REG_RA_NR = 0x03FF RADIO_REG_RA_STC = 0x4000 RADIO_REG_RA_SF = 0x2000 RADIO_REG_RB = 0x0B RADIO_REG_RB_FMTRUE = 0x0100 RADIO_REG_RB_FMREADY = 0x0080 # Radio class definition class Radio: """ A class for communicating with the rda5807m chip ... Attributes ---------- registers : list virtual registers address : int chip's address maxvolume : int maximum volume freqLow, freqHigh, freqSteps : int min and max frequency for FM band, and frequency steps board : busio.i2c object used for i2c communication frequency : int current chip frequency volume : int current chip volume bassBoost : boolean toggle bass boost on the chip mute : boolean toggle mute/unmute softMute : boolean toggle soft mute (mute if signal strength too low) mono : boolean toggle stereo mode rds : boolean toggle rds tuned : boolean is chip tuned band : string selected band (FM or FMWORLD) """ # Initialize virtual registers registers = [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0] # Chip constants I2C_SEQ = 0x10 I2C_REG = 0x11 maxvolume = 15 # FMWORLD Band freqLow = 8700 freqHigh = 10800 freqSteps = 10 # Set default frequency and volume def __init__(self, i2c, frequency=10000, volume=1): self.i2c = i2c self.frequency = frequency # Basic audio info self.volume = volume self.bassBoost = False self.mute = False self.softMute = False # Radio features from the chip self.mono = False self.rds = False self.tuned = False # Band - Default FMWORLD # 1. FM # 2. FMWORLD self.band = "FMWORLD" # Functions saves register values to virtual registers, sets the basic frequency and volume self.setup() print("Got to point 1!") self.tune() # Apply volume and frequency def setup(self): # Initialize registers self.registers[RADIO_REG_CHIPID] = 0x58 self.registers[RADIO_REG_CTRL] = (RADIO_REG_CTRL_RESET | RADIO_REG_CTRL_ENABLE) | ( RADIO_REG_CTRL_UNMUTE | RADIO_REG_CTRL_OUTPUT) # self.registers[RADIO_REG_R4] = RADIO_REG_R4_EM50 # Initialized to volume - 6 by default self.registers[RADIO_REG_VOL] = 0x84D1 # Other registers are already set to zero # Update registers self._saveRegister(RADIO_REG_CTRL) self._saveRegister(RADIO_REG_VOL) self.registers[ RADIO_REG_CTRL] = RADIO_REG_CTRL_ENABLE | RADIO_REG_CTRL_NEW | RADIO_REG_CTRL_RDS | RADIO_REG_CTRL_UNMUTE | RADIO_REG_CTRL_OUTPUT self._saveRegister(RADIO_REG_CTRL) # Turn on bass boost and rds self.setBassBoost(True) self.rds = True self.mute = False def tune(self): # Tunes radio to current frequency and volume self.setFreq(self.frequency) self.setVolume(self.volume) self.tuned = True def setFreq(self, freq): # Sets frequency to freq if freq < self.freqLow: freq = self.freqLow elif freq > self.freqHigh: freq = self.freqHigh self.frequency = freq newChannel = (freq - self.freqLow) // 10 regChannel = RADIO_REG_CHAN_TUNE # Enable tuning regChannel = regChannel | (newChannel << 6) # Enable output, unmute self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | ( RADIO_REG_CTRL_OUTPUT | RADIO_REG_CTRL_UNMUTE | RADIO_REG_CTRL_RDS | RADIO_REG_CTRL_ENABLE) self._saveRegister(RADIO_REG_CTRL) # Save frequency to register self.registers[RADIO_REG_CHAN] = regChannel self._saveRegister(RADIO_REG_CHAN) time.sleep(0.2) # Adjust volume self._saveRegister(RADIO_REG_VOL) time.sleep(0.3) # Get frequnecy self.getFreq() def getFreq(self): # Read register RA #self.writeBytes(bytes([RADIO_REG_RA])) self.registers[RADIO_REG_RA] = self._read16() ch = self.registers[RADIO_REG_RA] & RADIO_REG_RA_NR self.frequency = self.freqLow + ch * 10 return self.frequency def formatFreq(self): # Formats the current frequency for better readabilitiy freq = self.frequency s = str(freq) s = list(s) last_two = s[-2:] s[-2] = "." s[-1] = last_two[0] s.append(last_two[1]) return ("".join(s)) + " Mhz" def setBand(self, band): # Changes bands to FM or FMWORLD self.band = band if band == "FM": r = RADIO_REG_CHAN_BAND_FM else: r = RADIO_REG_CHAN_BAND_FMWORLD self.registers[RADIO_REG_CHAN] = (r | RADIO_REG_CHAN_SPACE_100) self._saveRegister(RADIO_REG_CHAN) def term(self): # Terminates all receiver functions self.setVolume(0) self.registers[RADIO_REG_CTRL] = 0x0000 self._saveRegisters def setBassBoost(self, switchOn): # Switches bass boost to true or false self.bassBoost = switchOn regCtrl = self.registers[RADIO_REG_CTRL] if switchOn: regCtrl = regCtrl | RADIO_REG_CTRL_BASS else: regCtrl = regCtrl & (~RADIO_REG_CTRL_BASS) self.registers[RADIO_REG_CTRL] = regCtrl self._saveRegister(RADIO_REG_CTRL) def setMono(self, switchOn): # Switches mono to 0 or 1 self.mono = switchOn self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_SEEK) if switchOn: self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | RADIO_REG_CTRL_MONO else: self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_MONO) self._saveRegister(RADIO_REG_CTRL) def setMute(self, switchOn): # Switches mute off or on self.mute = switchOn if (switchOn): self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_UNMUTE) else: self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | RADIO_REG_CTRL_UNMUTE self._saveRegister(RADIO_REG_CTRL) def setSoftMute(self, switchOn): # Switches soft mute off or on self.softMute = switchOn if switchOn: self.registers[RADIO_REG_R4] = self.registers[RADIO_REG_R4] | RADIO_REG_R4_SOFTMUTE else: self.registers[RADIO_REG_R4] = self.registers[RADIO_REG_R4] & (~RADIO_REG_R4_SOFTMUTE) self._saveRegister(RADIO_REG_R4) def softReset(self): # Soft reset chip self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | RADIO_REG_CTRL_RESET self._saveRegister(RADIO_REG_CTRL) time.sleep(2) self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_RESET) self._saveRegister(RADIO_REG_CTRL) def seekUp(self): # Start seek mode upwards self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | RADIO_REG_CTRL_SEEKUP self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | RADIO_REG_CTRL_SEEK self._saveRegister(RADIO_REG_CTRL) # Wait until scan is over time.sleep(1) self.getFreq() self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_SEEK) self._saveRegister(RADIO_REG_CTRL) def seekDown(self): # Start seek mode downwards self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_SEEKUP) self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | RADIO_REG_CTRL_SEEK self._saveRegister(RADIO_REG_CTRL) # Wait until scan is over time.sleep(1) self.getFreq() self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_SEEK) self._saveRegister(RADIO_REG_CTRL) def setVolume(self, volume): # Sets the volume if (volume > self.maxvolume): volume = self.maxvolume self.volume = volume self.registers[RADIO_REG_VOL] = self.registers[RADIO_REG_VOL] & (~RADIO_REG_VOL_VOL) self.registers[RADIO_REG_VOL] = self.registers[RADIO_REG_VOL] | volume self._saveRegister(RADIO_REG_VOL) def getRssi(self): # Get the current signal strength #self.writeBytes(bytes([RADIO_REG_RB])) self.registers[RADIO_REG_RB]=self._readRegisters(0xb) self.rssi = self.registers[RADIO_REG_RB] >> 10 return self.rssi def getRadioInfo(self): # Reads info from chip and saves it into virtual memory self._readRegisters() if self.registers[RADIO_REG_RA] & RADIO_REG_RA_RDS: self.rds = True self.rssi = self.registers[RADIO_REG_RB] >> 10 if self.registers[RADIO_REG_RB] & RADIO_REG_RB_FMTRUE: self.tuned = True if self.registers[RADIO_REG_CTRL] & RADIO_REG_CTRL_MONO: self.mono = True def _saveRegister(self, regN): # Write register from memory to receiver regVal=bytearray(2) regVal1 = self.registers[regN] # 16 bit value in list regVal[0] = regVal1 >> 8 regVal[1] = regVal1 & 255 #write to i2c address with particular register and value self.i2c.writeto_mem(self.I2C_REG, regN,regVal) def _saveRegisters(self): #save data into register 2 to 7 for i in range(2, 7): self._saveRegister(i) def _read16(self): # Reads two bytes, returns as one 16 bit integer result = bytearray(4) self.i2c.readfrom_into(self.I2C_SEQ, result) return result[0] * 256 + result[1] def _readRegisters(self,reg): #redfrom_mem_into reg,memadd,buffer result = bytearray(2) self.i2c.readfrom_mem_into(self.I2C_REG , reg,result) return result[0] * 256 + result[1]
rda5807m.py
# imports __version__ = "0.0.0-auto.0" __repo__ = "https://github.com/tinkeringtech/rda5807m.git" import time # Registers definitions FREQ_STEPS = 10 RADIO_REG_CHIPID = 0x00 RADIO_REG_CTRL = 0x02 RADIO_REG_CTRL_OUTPUT = 0x8000 RADIO_REG_CTRL_UNMUTE = 0x4000 RADIO_REG_CTRL_MONO = 0x2000 RADIO_REG_CTRL_BASS = 0x1000 RADIO_REG_CTRL_SEEKUP = 0x0200 RADIO_REG_CTRL_SEEK = 0x0100 RADIO_REG_CTRL_RDS = 0x0008 RADIO_REG_CTRL_NEW = 0x0004 RADIO_REG_CTRL_RESET = 0x0002 RADIO_REG_CTRL_ENABLE = 0x0001 RADIO_REG_CHAN = 0x03 RADIO_REG_CHAN_SPACE = 0x0003 RADIO_REG_CHAN_SPACE_100 = 0x0000 RADIO_REG_CHAN_BAND = 0x000C RADIO_REG_CHAN_BAND_FM = 0x0000 RADIO_REG_CHAN_BAND_FMWORLD = 0x0008 RADIO_REG_CHAN_TUNE = 0x0010 RADIO_REG_CHAN_NR = 0x7FC0 RADIO_REG_R4 = 0x04 RADIO_REG_R4_EM50 = 0x0800 RADIO_REG_R4_SOFTMUTE = 0x0200 RADIO_REG_R4_AFC = 0x0100 RADIO_REG_VOL = 0x05 RADIO_REG_VOL_VOL = 0x000F RADIO_REG_RA = 0x0A RADIO_REG_RA_RDS = 0x8000 RADIO_REG_RA_RDSBLOCK = 0x0800 RADIO_REG_RA_STEREO = 0x0400 RADIO_REG_RA_NR = 0x03FF RADIO_REG_RA_STC = 0x4000 RADIO_REG_RA_SF = 0x2000 RADIO_REG_RB = 0x0B RADIO_REG_RB_FMTRUE = 0x0100 RADIO_REG_RB_FMREADY = 0x0080 # Radio class definition class Radio: """ A class for communicating with the rda5807m chip ... Attributes ---------- registers : list virtual registers address : int chip's address maxvolume : int maximum volume freqLow, freqHigh, freqSteps : int min and max frequency for FM band, and frequency steps board : busio.i2c object used for i2c communication frequency : int current chip frequency volume : int current chip volume bassBoost : boolean toggle bass boost on the chip mute : boolean toggle mute/unmute softMute : boolean toggle soft mute (mute if signal strength too low) mono : boolean toggle stereo mode rds : boolean toggle rds tuned : boolean is chip tuned band : string selected band (FM or FMWORLD) """ # Initialize virtual registers registers = [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0] # Chip constants I2C_SEQ = 0x10 I2C_REG = 0x11 maxvolume = 15 # FMWORLD Band freqLow = 8700 freqHigh = 10800 freqSteps = 10 # Set default frequency and volume def __init__(self, i2c, frequency=10000, volume=1): self.i2c = i2c self.frequency = frequency # Basic audio info self.volume = volume self.bassBoost = False self.mute = False self.softMute = False # Radio features from the chip self.mono = False self.rds = False self.tuned = False # Band - Default FMWORLD # 1. FM # 2. FMWORLD self.band = "FMWORLD" # Functions saves register values to virtual registers, sets the basic frequency and volume self.setup() print("Got to point 1!") self.tune() # Apply volume and frequency def setup(self): # Initialize registers self.registers[RADIO_REG_CHIPID] = 0x58 self.registers[RADIO_REG_CTRL] = (RADIO_REG_CTRL_RESET | RADIO_REG_CTRL_ENABLE) | ( RADIO_REG_CTRL_UNMUTE | RADIO_REG_CTRL_OUTPUT) # self.registers[RADIO_REG_R4] = RADIO_REG_R4_EM50 # Initialized to volume - 6 by default self.registers[RADIO_REG_VOL] = 0x84D1 # Other registers are already set to zero # Update registers self._saveRegister(RADIO_REG_CTRL) self._saveRegister(RADIO_REG_VOL) self.registers[ RADIO_REG_CTRL] = RADIO_REG_CTRL_ENABLE | RADIO_REG_CTRL_NEW | RADIO_REG_CTRL_RDS | RADIO_REG_CTRL_UNMUTE | RADIO_REG_CTRL_OUTPUT self._saveRegister(RADIO_REG_CTRL) # Turn on bass boost and rds self.setBassBoost(True) self.rds = True self.mute = False def tune(self): # Tunes radio to current frequency and volume self.setFreq(self.frequency) self.setVolume(self.volume) self.tuned = True def setFreq(self, freq): # Sets frequency to freq if freq < self.freqLow: freq = self.freqLow elif freq > self.freqHigh: freq = self.freqHigh self.frequency = freq newChannel = (freq - self.freqLow) // 10 regChannel = RADIO_REG_CHAN_TUNE # Enable tuning regChannel = regChannel | (newChannel << 6) # Enable output, unmute self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | ( RADIO_REG_CTRL_OUTPUT | RADIO_REG_CTRL_UNMUTE | RADIO_REG_CTRL_RDS | RADIO_REG_CTRL_ENABLE) self._saveRegister(RADIO_REG_CTRL) # Save frequency to register self.registers[RADIO_REG_CHAN] = regChannel self._saveRegister(RADIO_REG_CHAN) time.sleep(0.2) # Adjust volume self._saveRegister(RADIO_REG_VOL) time.sleep(0.3) # Get frequnecy self.getFreq() def getFreq(self): # Read register RA #self.writeBytes(bytes([RADIO_REG_RA])) self.registers[RADIO_REG_RA] = self._read16() ch = self.registers[RADIO_REG_RA] & RADIO_REG_RA_NR self.frequency = self.freqLow + ch * 10 return self.frequency def formatFreq(self): # Formats the current frequency for better readabilitiy freq = self.frequency s = str(freq) s = list(s) last_two = s[-2:] s[-2] = "." s[-1] = last_two[0] s.append(last_two[1]) return ("".join(s)) + " Mhz" def setBand(self, band): # Changes bands to FM or FMWORLD self.band = band if band == "FM": r = RADIO_REG_CHAN_BAND_FM else: r = RADIO_REG_CHAN_BAND_FMWORLD self.registers[RADIO_REG_CHAN] = (r | RADIO_REG_CHAN_SPACE_100) self._saveRegister(RADIO_REG_CHAN) def term(self): # Terminates all receiver functions self.setVolume(0) self.registers[RADIO_REG_CTRL] = 0x0000 self._saveRegisters def setBassBoost(self, switchOn): # Switches bass boost to true or false self.bassBoost = switchOn regCtrl = self.registers[RADIO_REG_CTRL] if switchOn: regCtrl = regCtrl | RADIO_REG_CTRL_BASS else: regCtrl = regCtrl & (~RADIO_REG_CTRL_BASS) self.registers[RADIO_REG_CTRL] = regCtrl self._saveRegister(RADIO_REG_CTRL) def setMono(self, switchOn): # Switches mono to 0 or 1 self.mono = switchOn self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_SEEK) if switchOn: self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | RADIO_REG_CTRL_MONO else: self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_MONO) self._saveRegister(RADIO_REG_CTRL) def setMute(self, switchOn): # Switches mute off or on self.mute = switchOn if (switchOn): self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_UNMUTE) else: self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | RADIO_REG_CTRL_UNMUTE self._saveRegister(RADIO_REG_CTRL) def setSoftMute(self, switchOn): # Switches soft mute off or on self.softMute = switchOn if switchOn: self.registers[RADIO_REG_R4] = self.registers[RADIO_REG_R4] | RADIO_REG_R4_SOFTMUTE else: self.registers[RADIO_REG_R4] = self.registers[RADIO_REG_R4] & (~RADIO_REG_R4_SOFTMUTE) self._saveRegister(RADIO_REG_R4) def softReset(self): # Soft reset chip self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | RADIO_REG_CTRL_RESET self._saveRegister(RADIO_REG_CTRL) time.sleep(2) self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_RESET) self._saveRegister(RADIO_REG_CTRL) def seekUp(self): # Start seek mode upwards self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | RADIO_REG_CTRL_SEEKUP self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | RADIO_REG_CTRL_SEEK self._saveRegister(RADIO_REG_CTRL) # Wait until scan is over time.sleep(1) self.getFreq() self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_SEEK) self._saveRegister(RADIO_REG_CTRL) def seekDown(self): # Start seek mode downwards self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_SEEKUP) self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] | RADIO_REG_CTRL_SEEK self._saveRegister(RADIO_REG_CTRL) # Wait until scan is over time.sleep(1) self.getFreq() self.registers[RADIO_REG_CTRL] = self.registers[RADIO_REG_CTRL] & (~RADIO_REG_CTRL_SEEK) self._saveRegister(RADIO_REG_CTRL) def setVolume(self, volume): # Sets the volume if (volume > self.maxvolume): volume = self.maxvolume self.volume = volume self.registers[RADIO_REG_VOL] = self.registers[RADIO_REG_VOL] & (~RADIO_REG_VOL_VOL) self.registers[RADIO_REG_VOL] = self.registers[RADIO_REG_VOL] | volume self._saveRegister(RADIO_REG_VOL) def getRssi(self): # Get the current signal strength #self.writeBytes(bytes([RADIO_REG_RB])) self.registers[RADIO_REG_RB]=self._readRegisters(0xb) self.rssi = self.registers[RADIO_REG_RB] >> 10 return self.rssi def getRadioInfo(self): # Reads info from chip and saves it into virtual memory self._readRegisters() if self.registers[RADIO_REG_RA] & RADIO_REG_RA_RDS: self.rds = True self.rssi = self.registers[RADIO_REG_RB] >> 10 if self.registers[RADIO_REG_RB] & RADIO_REG_RB_FMTRUE: self.tuned = True if self.registers[RADIO_REG_CTRL] & RADIO_REG_CTRL_MONO: self.mono = True def _saveRegister(self, regN): # Write register from memory to receiver regVal=bytearray(2) regVal1 = self.registers[regN] # 16 bit value in list regVal[0] = regVal1 >> 8 regVal[1] = regVal1 & 255 #write to i2c address with particular register and value self.i2c.writeto_mem(self.I2C_REG, regN,regVal) def _saveRegisters(self): #save data into register 2 to 7 for i in range(2, 7): self._saveRegister(i) def _read16(self): # Reads two bytes, returns as one 16 bit integer result = bytearray(4) self.i2c.readfrom_into(self.I2C_SEQ, result) return result[0] * 256 + result[1] def _readRegisters(self,reg): #redfrom_mem_into reg,memadd,buffer result = bytearray(2) self.i2c.readfrom_mem_into(self.I2C_REG , reg,result) return result[0] * 256 + result[1]
0.551815
0.38798
import numpy as np import tensorflow as tf from keras import layers, models from keras.utils.generic_utils import register_keras_serializable from keras.utils.tf_utils import shape_type_conversion from scipy import ndimage from vit_keras import vit from ...backbone.utils import patch_config from ...common import ConvBnRelu @register_keras_serializable(package='SegMe>TriTrans') class VisionTransformer(layers.Layer): def __init__(self, **kwargs): super().__init__(**kwargs) self.input_spec = layers.InputSpec(ndim=4) @shape_type_conversion def build(self, input_shape): width, height, channels = input_shape[1:] if width is None or height is None or channels is None: raise ValueError('Width, height and channel dimensions of the inputs should be defined. Found `None`.') if width != height: raise ValueError('Only square images supported. Provided: {}.'.format(input_shape)) self.input_spec = layers.InputSpec(ndim=4, axes={1: width, 2: height, 3: channels}) base_model = vit.vit_b16( image_size=(224, 224), pretrained=True, include_top=False, pretrained_top=False, weights='imagenet21k') outputs = base_model.get_layer(name='Transformer/encoder_norm').output outputs = layers.Lambda(lambda v: v[:, 1:, ...], name='ExtractFeatures')(outputs) base_model = models.Model(inputs=base_model.inputs, outputs=outputs) base_config = base_model.get_config() vit_config = patch_config(base_config, [0], 'batch_input_shape', (None, width, height, channels)) vit_config = patch_config(vit_config, ['embedding'], 'kernel_size', (1, 1)) vit_config = patch_config(vit_config, ['embedding'], 'strides', (1, 1)) vit_config = patch_config(vit_config, [2], 'target_shape', lambda old: (width * height,) + old[-1:]) vit_model = models.Model.from_config(vit_config) def _ext_weight(wb, wv): if wb.shape == wv.shape: return wb if (16, 16, 3) == wb.shape[:3] and (1, 1) == wv.shape[:2]: # embedding # will be trained from scratch return wv if 3 == len(wb.shape) and wb.shape[0] == wv.shape[0] == 1 and wb.shape[2] == wv.shape[2]: # posembed_input token, grid = wb[0, :1], wb[0, 1:] sin = int(np.sqrt(grid.shape[0])) zoom = (width / sin, height / sin, 1) grid = grid.reshape(sin, sin, -1) grid = ndimage.zoom(grid, zoom, order=1).reshape(width * height, -1) combo = np.concatenate([token, grid], axis=0)[None] assert combo.shape == wv.shape return combo return wb # will raise error if something changes base_weights = base_model.get_weights() vit_weights = [_ext_weight(wb, wv) for wb, wv in zip(base_weights, vit_model.get_weights())] vit_model.set_weights(vit_weights) self.vit = vit_model self.decoder = DecoderCup(channels) super().build(input_shape) def call(self, inputs, **kwargs): outputs = self.vit(inputs) outputs = self.decoder(outputs) return outputs @shape_type_conversion def compute_output_shape(self, input_shape): output_shape = self.vit.compute_output_shape(input_shape) output_shape = self.decoder.compute_output_shape(output_shape) return output_shape @register_keras_serializable(package='SegMe>TriTrans') class DecoderCup(layers.Layer): def __init__(self, filters, **kwargs): super().__init__(**kwargs) self.input_spec = layers.InputSpec(ndim=3) self.filters = filters @shape_type_conversion def build(self, input_shape): width_height, channels = input_shape[1:] if width_height is None or channels is None: raise ValueError('Width/height and channel dimensions of the inputs should be defined. Found `None`.') if width_height != int(width_height ** 0.5) ** 2: raise ValueError('Provided input can\'t be reshaped to square image.') self.input_spec = layers.InputSpec(ndim=3, axes={1: width_height, 2: channels}) self.width_height = int(width_height ** 0.5) self.channels = channels self.conv = ConvBnRelu(self.filters, kernel_size=3) super().build(input_shape) def call(self, inputs, **kwargs): outputs = tf.reshape(inputs, [-1, self.width_height, self.width_height, self.channels]) outputs = self.conv(outputs) return outputs @shape_type_conversion def compute_output_shape(self, input_shape): width_height = int(input_shape[1] ** 0.5) return input_shape[:1] + (width_height, width_height, self.filters) def get_config(self): config = super().get_config() config.update({'filters': self.filters}) return config
segme/model/tri_trans/transformer.py
import numpy as np import tensorflow as tf from keras import layers, models from keras.utils.generic_utils import register_keras_serializable from keras.utils.tf_utils import shape_type_conversion from scipy import ndimage from vit_keras import vit from ...backbone.utils import patch_config from ...common import ConvBnRelu @register_keras_serializable(package='SegMe>TriTrans') class VisionTransformer(layers.Layer): def __init__(self, **kwargs): super().__init__(**kwargs) self.input_spec = layers.InputSpec(ndim=4) @shape_type_conversion def build(self, input_shape): width, height, channels = input_shape[1:] if width is None or height is None or channels is None: raise ValueError('Width, height and channel dimensions of the inputs should be defined. Found `None`.') if width != height: raise ValueError('Only square images supported. Provided: {}.'.format(input_shape)) self.input_spec = layers.InputSpec(ndim=4, axes={1: width, 2: height, 3: channels}) base_model = vit.vit_b16( image_size=(224, 224), pretrained=True, include_top=False, pretrained_top=False, weights='imagenet21k') outputs = base_model.get_layer(name='Transformer/encoder_norm').output outputs = layers.Lambda(lambda v: v[:, 1:, ...], name='ExtractFeatures')(outputs) base_model = models.Model(inputs=base_model.inputs, outputs=outputs) base_config = base_model.get_config() vit_config = patch_config(base_config, [0], 'batch_input_shape', (None, width, height, channels)) vit_config = patch_config(vit_config, ['embedding'], 'kernel_size', (1, 1)) vit_config = patch_config(vit_config, ['embedding'], 'strides', (1, 1)) vit_config = patch_config(vit_config, [2], 'target_shape', lambda old: (width * height,) + old[-1:]) vit_model = models.Model.from_config(vit_config) def _ext_weight(wb, wv): if wb.shape == wv.shape: return wb if (16, 16, 3) == wb.shape[:3] and (1, 1) == wv.shape[:2]: # embedding # will be trained from scratch return wv if 3 == len(wb.shape) and wb.shape[0] == wv.shape[0] == 1 and wb.shape[2] == wv.shape[2]: # posembed_input token, grid = wb[0, :1], wb[0, 1:] sin = int(np.sqrt(grid.shape[0])) zoom = (width / sin, height / sin, 1) grid = grid.reshape(sin, sin, -1) grid = ndimage.zoom(grid, zoom, order=1).reshape(width * height, -1) combo = np.concatenate([token, grid], axis=0)[None] assert combo.shape == wv.shape return combo return wb # will raise error if something changes base_weights = base_model.get_weights() vit_weights = [_ext_weight(wb, wv) for wb, wv in zip(base_weights, vit_model.get_weights())] vit_model.set_weights(vit_weights) self.vit = vit_model self.decoder = DecoderCup(channels) super().build(input_shape) def call(self, inputs, **kwargs): outputs = self.vit(inputs) outputs = self.decoder(outputs) return outputs @shape_type_conversion def compute_output_shape(self, input_shape): output_shape = self.vit.compute_output_shape(input_shape) output_shape = self.decoder.compute_output_shape(output_shape) return output_shape @register_keras_serializable(package='SegMe>TriTrans') class DecoderCup(layers.Layer): def __init__(self, filters, **kwargs): super().__init__(**kwargs) self.input_spec = layers.InputSpec(ndim=3) self.filters = filters @shape_type_conversion def build(self, input_shape): width_height, channels = input_shape[1:] if width_height is None or channels is None: raise ValueError('Width/height and channel dimensions of the inputs should be defined. Found `None`.') if width_height != int(width_height ** 0.5) ** 2: raise ValueError('Provided input can\'t be reshaped to square image.') self.input_spec = layers.InputSpec(ndim=3, axes={1: width_height, 2: channels}) self.width_height = int(width_height ** 0.5) self.channels = channels self.conv = ConvBnRelu(self.filters, kernel_size=3) super().build(input_shape) def call(self, inputs, **kwargs): outputs = tf.reshape(inputs, [-1, self.width_height, self.width_height, self.channels]) outputs = self.conv(outputs) return outputs @shape_type_conversion def compute_output_shape(self, input_shape): width_height = int(input_shape[1] ** 0.5) return input_shape[:1] + (width_height, width_height, self.filters) def get_config(self): config = super().get_config() config.update({'filters': self.filters}) return config
0.926204
0.363816
from cores import cor, limpa from espacos import tio, tracos def calculoImposto(taxas): #informações das ações acao = input('Digite o código da ação: ') valorAcao = float(input('Digite o valor da operação: ')) tipo = input('C/V? ').upper() print() #Cálculo do imposto porcentagemL = taxas[0] / total porcentagemE = taxas[1] / total porcentagemC = taxas[2] / total porcentagemIS = taxas[3] / total porcentagemB = taxas[4] / total porcentagemIR = taxas[5] / total taxaL = valorAcao * porcentagemL taxaE = valorAcao * porcentagemE taxaC = valorAcao * porcentagemC taxaIS = valorAcao * porcentagemIS taxaB = valorAcao * porcentagemB taxaIR = valorAcao * porcentagemIR subTotal = taxaL + taxaE + taxaC + taxaIS + taxaB + taxaIR if tipo == 'C': subTotal -= taxaIR #Impressão dos impostos print(f'{cor(1)}Subtotal das taxas = {subTotal:.2f}{cor(1,37)}') return subTotal, acao def recebeTaxas(): print('-'*50) taxas = [] taxas.append(float(input(f'{cor(1,37)}Taxa de liquidação: '))) taxas.append(float(input('Emolumentos: '))) taxas.append(float(input('Taxa de corretagem: '))) taxas.append(float(input('Taxa de ISS: '))) taxas.append(float(input('Taxa Bovespa: '))) taxas.append(float(input('Taxa de IRRF: '))) print('-'*50) return taxas print(cor(1)) tracos('IMPOSTO DE MOVIMENTO DE RENDA VARIÁVEL', 50) total = float(input('Digite o valor total da operação do dia: ')) taxas = recebeTaxas() subtotais, acoes = [], [] while True: valorTaxa, acao = calculoImposto(taxas) subtotais.append(valorTaxa) acoes.append(acao) print('-'*40) resposta = input('Deseja calcular mais alguma ação? [S/N]: ').upper() if resposta == 'N': limpa() print() break if resposta not in 'SN': resposta = input('Digite uma resposta válida[S/N]: ') print(f'{cor(1)}{"-"*15}RESULTADO{"-"*15}') print() print(f'Os valores dos impostos são:') for x in range(len(subtotais)): print(f'{x + 1}° - {acoes[x]}: {subtotais[x]:.2f}')
Pacote download/ImpostoAcoes.py
from cores import cor, limpa from espacos import tio, tracos def calculoImposto(taxas): #informações das ações acao = input('Digite o código da ação: ') valorAcao = float(input('Digite o valor da operação: ')) tipo = input('C/V? ').upper() print() #Cálculo do imposto porcentagemL = taxas[0] / total porcentagemE = taxas[1] / total porcentagemC = taxas[2] / total porcentagemIS = taxas[3] / total porcentagemB = taxas[4] / total porcentagemIR = taxas[5] / total taxaL = valorAcao * porcentagemL taxaE = valorAcao * porcentagemE taxaC = valorAcao * porcentagemC taxaIS = valorAcao * porcentagemIS taxaB = valorAcao * porcentagemB taxaIR = valorAcao * porcentagemIR subTotal = taxaL + taxaE + taxaC + taxaIS + taxaB + taxaIR if tipo == 'C': subTotal -= taxaIR #Impressão dos impostos print(f'{cor(1)}Subtotal das taxas = {subTotal:.2f}{cor(1,37)}') return subTotal, acao def recebeTaxas(): print('-'*50) taxas = [] taxas.append(float(input(f'{cor(1,37)}Taxa de liquidação: '))) taxas.append(float(input('Emolumentos: '))) taxas.append(float(input('Taxa de corretagem: '))) taxas.append(float(input('Taxa de ISS: '))) taxas.append(float(input('Taxa Bovespa: '))) taxas.append(float(input('Taxa de IRRF: '))) print('-'*50) return taxas print(cor(1)) tracos('IMPOSTO DE MOVIMENTO DE RENDA VARIÁVEL', 50) total = float(input('Digite o valor total da operação do dia: ')) taxas = recebeTaxas() subtotais, acoes = [], [] while True: valorTaxa, acao = calculoImposto(taxas) subtotais.append(valorTaxa) acoes.append(acao) print('-'*40) resposta = input('Deseja calcular mais alguma ação? [S/N]: ').upper() if resposta == 'N': limpa() print() break if resposta not in 'SN': resposta = input('Digite uma resposta válida[S/N]: ') print(f'{cor(1)}{"-"*15}RESULTADO{"-"*15}') print() print(f'Os valores dos impostos são:') for x in range(len(subtotais)): print(f'{x + 1}° - {acoes[x]}: {subtotais[x]:.2f}')
0.262369
0.436862
import pytest from selenium import webdriver from selenium.webdriver.chrome.options import Options from persine.bridges.youtube import YoutubeBridge @pytest.fixture def driver(): options = Options() options.add_argument("--headless") options.add_argument("--mute-audio") # options.add_extension("ublock-origin.crx") options.add_argument("--autoplay-policy=no-user-gesture-required") return webdriver.Chrome(options=options) def test_player_data(driver): bridge = YoutubeBridge(driver) driver.get("https://www.youtube.com/watch?v=1kIQT7uUiME") res = bridge._YoutubeBridge__get_player_data() comps = { "title": "Land of Talk - Some Are Lakes [Official Music Video]", "video_id": "1kIQT7uUiME", "author": "Saddle Creek", } for key, value in comps.items(): assert comps[key] == res[key] def test_video_data(driver): bridge = YoutubeBridge(driver) bridge.run("https://www.youtube.com/watch?v=1kIQT7uUiME") res = bridge._YoutubeBridge__get_video_data() comps = { "page_type": "video", "title": "Land of Talk - Some Are Lakes [Official Music Video]", "id": "1kIQT7uUiME", "channel_name": "Saddle Creek", "channel_url": "https://www.youtube.com/channel/UCW7MRMCxD5dbOU7TQaCAMLQ", # noqa: E501 } for key, value in comps.items(): assert comps[key] == res[key] assert len(res["recommendations"]) > 0 def test_recommendation_scraper(driver): bridge = YoutubeBridge(driver) bridge.run("https://www.youtube.com/watch?v=1kIQT7uUiME") recs = bridge._YoutubeBridge__scrape_sidebar() assert len(recs) > 5 for rec in recs: assert rec["item_type"] is not None assert rec["title"] is not None assert rec["url"] is not None def test_likes_v_dislikes(driver): bridge = YoutubeBridge(driver) bridge.run("https://www.youtube.com/watch?v=1kIQT7uUiME") data = bridge._YoutubeBridge__get_player_page_data() assert data['dislike_count'] != data['like_count'] def test_homepage_scraper(driver): bridge = YoutubeBridge(driver) bridge.run("https://www.youtube.com/") recs = bridge._YoutubeBridge__scrape_homepage() assert len(recs) > 5 for rec in recs: assert rec["item_type"] is not None assert rec["title"] is not None assert rec["url"] is not None def test_search_results(driver): bridge = YoutubeBridge(driver) bridge.run("youtube:search?lofi") recs = bridge._YoutubeBridge__scrape_search_results() assert len(recs) > 5 for rec in recs: assert rec["item_type"] is not None assert rec["title"] is not None assert rec["url"] is not None
tests/bridges/test_yt_bridge.py
import pytest from selenium import webdriver from selenium.webdriver.chrome.options import Options from persine.bridges.youtube import YoutubeBridge @pytest.fixture def driver(): options = Options() options.add_argument("--headless") options.add_argument("--mute-audio") # options.add_extension("ublock-origin.crx") options.add_argument("--autoplay-policy=no-user-gesture-required") return webdriver.Chrome(options=options) def test_player_data(driver): bridge = YoutubeBridge(driver) driver.get("https://www.youtube.com/watch?v=1kIQT7uUiME") res = bridge._YoutubeBridge__get_player_data() comps = { "title": "Land of Talk - Some Are Lakes [Official Music Video]", "video_id": "1kIQT7uUiME", "author": "Saddle Creek", } for key, value in comps.items(): assert comps[key] == res[key] def test_video_data(driver): bridge = YoutubeBridge(driver) bridge.run("https://www.youtube.com/watch?v=1kIQT7uUiME") res = bridge._YoutubeBridge__get_video_data() comps = { "page_type": "video", "title": "Land of Talk - Some Are Lakes [Official Music Video]", "id": "1kIQT7uUiME", "channel_name": "Saddle Creek", "channel_url": "https://www.youtube.com/channel/UCW7MRMCxD5dbOU7TQaCAMLQ", # noqa: E501 } for key, value in comps.items(): assert comps[key] == res[key] assert len(res["recommendations"]) > 0 def test_recommendation_scraper(driver): bridge = YoutubeBridge(driver) bridge.run("https://www.youtube.com/watch?v=1kIQT7uUiME") recs = bridge._YoutubeBridge__scrape_sidebar() assert len(recs) > 5 for rec in recs: assert rec["item_type"] is not None assert rec["title"] is not None assert rec["url"] is not None def test_likes_v_dislikes(driver): bridge = YoutubeBridge(driver) bridge.run("https://www.youtube.com/watch?v=1kIQT7uUiME") data = bridge._YoutubeBridge__get_player_page_data() assert data['dislike_count'] != data['like_count'] def test_homepage_scraper(driver): bridge = YoutubeBridge(driver) bridge.run("https://www.youtube.com/") recs = bridge._YoutubeBridge__scrape_homepage() assert len(recs) > 5 for rec in recs: assert rec["item_type"] is not None assert rec["title"] is not None assert rec["url"] is not None def test_search_results(driver): bridge = YoutubeBridge(driver) bridge.run("youtube:search?lofi") recs = bridge._YoutubeBridge__scrape_search_results() assert len(recs) > 5 for rec in recs: assert rec["item_type"] is not None assert rec["title"] is not None assert rec["url"] is not None
0.519521
0.325815
__author__ = "Alex 'CubOfJudahsLion' Feterman" __url__ = ("blender", "http://www.blender.org", "Author's homepage, http://geocities.com/cubofjudahslion") __version__ = "0.1.2" __bpydoc__ = """\ xmesh_import.py | Python Script for Blender3D | imports a VegaStrike .xmesh Copyright (C)2005 Alex 'CubOfJudahsLion' Feterman <p>This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. <p>This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. <p>You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. <p>Usage:<br> Execute this script from the "File->Import" menu and choose a Xmesh file to open. <p>Notes:<br> Generates UV mappings, but for the texture to be activated, go to the texture buttons and """ import Blender from Blender import Image, Texture, Material, Object, NMesh, Types, sys import xml.sax import meshtools import os.path from string import lower locationDir = [] # registers the search of the results for images def SetLocationDir(fileName, aDir, fileList): """ adds finding of fileName in aDir to a global variable in a list """ global locationDir fullPath = os.path.join(aDir, fileName) if os.path.isfile(fullPath): locationDir.append(fullPath) def FindTexture(path, fileName): """ finds the texture from path and its sub-paths """ sourcePath = os.path.join(path, fileName) if os.path.isfile(sourcePath): # check if the file is actually there and report if so return sourcePath else: # otherwise check the directory hierarchy for the VS textures folder global locationDir searchBaseDir = os.path.normpath(os.path.join(path, '..', '..', 'textures')) os.path.walk(searchBaseDir, SetLocationDir, fileName) if len(locationDir) > 0: return locationDir[0] else: return None class XMeshHandler(xml.sax.handler.ContentHandler): """ Created to handle XML contexts in XMESH objects """ locationDir = None def __init__(self, filename): # find where the directory path ends # (both un*x and win accounted for) self.path, simpleFile = os.path.split(sys.expandpath(filename)) self.objName = os.path.splitext(simpleFile)[0] # material values (to be checked later) self.faces = [] self.verts = [] self.uvs = [] self.faceuvs = [] self.alpha =\ self.rgbCol =\ self.amb =\ self.emit =\ self.colorTexture =\ self.specTexture =\ self.spec =\ self.specCol = None # finally, start chronometer sys.time() def startDocument(self): """ Callback. Invoked when the parsing starts. Used to display notification of process initiation. """ print "Loading file..." Blender.Window.DrawProgressBar(0.0, "Loading file...") def endDocument(self): """ Invoked when mesh processing is done. Used for realizing the mesh from collected vertex/faces and texturizing info. """ # report print "Finished loading file, constructing mesh..." Blender.Window.DrawProgressBar(0.9, "Building mesh...") # build object meshtools.create_mesh(self.verts, self.faces, self.objName, self.faceuvs, self.uvs) print "Done, object built" # load corresponding images and set texture Blender.Window.DrawProgressBar(0.95, "Loading/Applying Texture...") colorTex, specTex = None, None # convert images into textures if self.colorTexture: colTexFName = FindTexture(self.path, self.colorTexture) if colTexFName != None: colorImg = Image.Load(colTexFName) colorTex = Texture.New(self.objName + ".col.tx") colorTex.type = Texture.Types.IMAGE colorTex.image = colorImg if self.specTexture: specTexFName = FindTexture(self.path, self.specTexture) if specTexFName != None: specImg = Image.Load(specTexFName) specTex = Texture.New(self.objName + ".spe.tx") specTex.type = Texture.Types.IMAGE specTex.image = specImg # make material with them and all other previously collected data mat = Material.New(self.objName + ".mat") mat.mode |= Material.Modes.TEXFACE | Material.Modes.SHADOW | Material.Modes.TRACEABLE | Material.Modes.ZTRANSP mat.specTransp = 1.0 if self.alpha : mat.alpha = self.alpha if self.rgbCol : mat.rgbCol = self.rgbCol if self.amb : mat.amb = self.amb if self.emit : mat.emit = self.emit if self.spec : mat.spec = self.spec if self.specCol : mat.specCol = self.specCol if colorTex: mat.setTexture(0, colorTex, Texture.TexCo.UV, Texture.MapTo.COL) if specTex: mat.setTexture(1, specTex, Texture.TexCo.UV, Texture.MapTo.SPEC) # apply to mesh obj = Object.Get(self.objName) mesh = obj.data # mesh.mode = NMesh.Modes.NOVNORMALSFLIP # uncomment the following if you want models automatically sub-surfaced """for currFace in mesh.faces: currFace.smooth = 1 mesh.setSubDivLevels([1,2]) mesh.setMode("SubSurf", "TwoSided")""" mesh.setMode("TwoSided") mesh.addMaterial(mat) mesh.update(1) # Done, notify user Blender.Window.DrawProgressBar(1.0, "Done.") def startElement(self, pname, attrMixed): """ Receives pre-parsed data for every geometry/texture datum in the mesh. Like blender, wings3d and vegastrike are also opengl apps. the internal format described by the xml tags is similar to that of blender. see the xmesh format description and the opengl red/blue books for structure and mapping details. """ # we transalte everything to lowercase name = lower(pname) attr = {} for ik, iv in attrMixed.items(): attr[lower(ik)] = iv # pre-parse attributes if available if name == "mesh": if "texture" in attr: self.colorTexture = attr["texture"] print "* color tex:", self.colorTexture if "texture1" in attr: self.specTexture = attr["texture1"] print "* spec tex:", self.specTexture elif name == "points": print "Reading vertex coordinates..." Blender.Window.DrawProgressBar(0.1, "Reading vertexes...") elif name == "location": self.verts.append( (float(attr["x"]), float(attr["y"]), float(attr["z"])) ) elif name == "polygons": print "Reading faces..." Blender.Window.DrawProgressBar(0.25, "Reading faces...") elif name == "tri" or name == "quad" or name == "trifan": self.faceVerts = [] self.facevUVs = [] elif name == "vertex": self.faceVerts.append(int(attr["point"])) self.facevUVs.append( (float(attr["s"]), 1-float(attr["t"])) ) elif name == "diffuse": self.rgbCol = [float(attr['red']), float(attr['green']), float(attr['blue'])] self.alpha = float(attr['alpha']) elif name == "ambient": self.amb = (float(attr['red']) + float(attr['green']) + float(attr['blue'])) / 3.0 * float(attr['alpha']) elif name == "specular": specIn = float(attr['alpha']) self.specCol = [specIn*float(attr['red']), specIn*float(attr['green']), specIn*float(attr['blue'])] self.spec = 0.01 # float(attr['alpha']) elif name == "emissive": # sorry, no emissive color, only emission index self.emit = (float(attr['red']) + float(attr['green']) + float(attr['blue'])) / 3.0 * float(attr['alpha']) def endElement(self, pname): """ Serves to assemble gathered data from inner subelements """ name = lower(pname) # these are handled directly if name == "tri" or name == "quad": # the faces are an array, each element an array of # vertex indexes as collected in self.verts # to get (x,y,z) tuples for the jth vertex of the ith face: # self.verts[self.faces[i][j]] self.faces.append(self.faceVerts) # similarly, the UV mapping coordinats for the same vertex # are expected to be retrievable as # self.uvs[self.faceuvs[i][j]] insertPos = len(self.uvs) self.faceuvs.append(range(insertPos, insertPos+len(self.facevUVs))) self.uvs.extend(self.facevUVs) elif name == "trifan": # yes, opengl handles triangle fans naturally, but not blender fanIdx = 2 while fanIdx < len(self.faceVerts): # so we make triangles out of them instead self.faces.append( [self.faceVerts[0], self.faceVerts[fanIdx-1], self.faceVerts[fanIdx]] ) insertPos = len(self.uvs) self.faceuvs.append(range(insertPos, insertPos+3)) self.uvs.extend( [self.facevUVs[0], self.facevUVs[fanIdx-1], self.facevUVs[fanIdx]] ) fanIdx += 1 def read(filename): """ Invokes the xml parser on the file upon being called by the file selector with a file name """ xml.sax.parse(filename, XMeshHandler(filename)) Blender.Window.FileSelector(read, "VegaStrike .XMesh")
vegastrike/objconv/blender_xmesh_import.py
__author__ = "Alex 'CubOfJudahsLion' Feterman" __url__ = ("blender", "http://www.blender.org", "Author's homepage, http://geocities.com/cubofjudahslion") __version__ = "0.1.2" __bpydoc__ = """\ xmesh_import.py | Python Script for Blender3D | imports a VegaStrike .xmesh Copyright (C)2005 Alex 'CubOfJudahsLion' Feterman <p>This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. <p>This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. <p>You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. <p>Usage:<br> Execute this script from the "File->Import" menu and choose a Xmesh file to open. <p>Notes:<br> Generates UV mappings, but for the texture to be activated, go to the texture buttons and """ import Blender from Blender import Image, Texture, Material, Object, NMesh, Types, sys import xml.sax import meshtools import os.path from string import lower locationDir = [] # registers the search of the results for images def SetLocationDir(fileName, aDir, fileList): """ adds finding of fileName in aDir to a global variable in a list """ global locationDir fullPath = os.path.join(aDir, fileName) if os.path.isfile(fullPath): locationDir.append(fullPath) def FindTexture(path, fileName): """ finds the texture from path and its sub-paths """ sourcePath = os.path.join(path, fileName) if os.path.isfile(sourcePath): # check if the file is actually there and report if so return sourcePath else: # otherwise check the directory hierarchy for the VS textures folder global locationDir searchBaseDir = os.path.normpath(os.path.join(path, '..', '..', 'textures')) os.path.walk(searchBaseDir, SetLocationDir, fileName) if len(locationDir) > 0: return locationDir[0] else: return None class XMeshHandler(xml.sax.handler.ContentHandler): """ Created to handle XML contexts in XMESH objects """ locationDir = None def __init__(self, filename): # find where the directory path ends # (both un*x and win accounted for) self.path, simpleFile = os.path.split(sys.expandpath(filename)) self.objName = os.path.splitext(simpleFile)[0] # material values (to be checked later) self.faces = [] self.verts = [] self.uvs = [] self.faceuvs = [] self.alpha =\ self.rgbCol =\ self.amb =\ self.emit =\ self.colorTexture =\ self.specTexture =\ self.spec =\ self.specCol = None # finally, start chronometer sys.time() def startDocument(self): """ Callback. Invoked when the parsing starts. Used to display notification of process initiation. """ print "Loading file..." Blender.Window.DrawProgressBar(0.0, "Loading file...") def endDocument(self): """ Invoked when mesh processing is done. Used for realizing the mesh from collected vertex/faces and texturizing info. """ # report print "Finished loading file, constructing mesh..." Blender.Window.DrawProgressBar(0.9, "Building mesh...") # build object meshtools.create_mesh(self.verts, self.faces, self.objName, self.faceuvs, self.uvs) print "Done, object built" # load corresponding images and set texture Blender.Window.DrawProgressBar(0.95, "Loading/Applying Texture...") colorTex, specTex = None, None # convert images into textures if self.colorTexture: colTexFName = FindTexture(self.path, self.colorTexture) if colTexFName != None: colorImg = Image.Load(colTexFName) colorTex = Texture.New(self.objName + ".col.tx") colorTex.type = Texture.Types.IMAGE colorTex.image = colorImg if self.specTexture: specTexFName = FindTexture(self.path, self.specTexture) if specTexFName != None: specImg = Image.Load(specTexFName) specTex = Texture.New(self.objName + ".spe.tx") specTex.type = Texture.Types.IMAGE specTex.image = specImg # make material with them and all other previously collected data mat = Material.New(self.objName + ".mat") mat.mode |= Material.Modes.TEXFACE | Material.Modes.SHADOW | Material.Modes.TRACEABLE | Material.Modes.ZTRANSP mat.specTransp = 1.0 if self.alpha : mat.alpha = self.alpha if self.rgbCol : mat.rgbCol = self.rgbCol if self.amb : mat.amb = self.amb if self.emit : mat.emit = self.emit if self.spec : mat.spec = self.spec if self.specCol : mat.specCol = self.specCol if colorTex: mat.setTexture(0, colorTex, Texture.TexCo.UV, Texture.MapTo.COL) if specTex: mat.setTexture(1, specTex, Texture.TexCo.UV, Texture.MapTo.SPEC) # apply to mesh obj = Object.Get(self.objName) mesh = obj.data # mesh.mode = NMesh.Modes.NOVNORMALSFLIP # uncomment the following if you want models automatically sub-surfaced """for currFace in mesh.faces: currFace.smooth = 1 mesh.setSubDivLevels([1,2]) mesh.setMode("SubSurf", "TwoSided")""" mesh.setMode("TwoSided") mesh.addMaterial(mat) mesh.update(1) # Done, notify user Blender.Window.DrawProgressBar(1.0, "Done.") def startElement(self, pname, attrMixed): """ Receives pre-parsed data for every geometry/texture datum in the mesh. Like blender, wings3d and vegastrike are also opengl apps. the internal format described by the xml tags is similar to that of blender. see the xmesh format description and the opengl red/blue books for structure and mapping details. """ # we transalte everything to lowercase name = lower(pname) attr = {} for ik, iv in attrMixed.items(): attr[lower(ik)] = iv # pre-parse attributes if available if name == "mesh": if "texture" in attr: self.colorTexture = attr["texture"] print "* color tex:", self.colorTexture if "texture1" in attr: self.specTexture = attr["texture1"] print "* spec tex:", self.specTexture elif name == "points": print "Reading vertex coordinates..." Blender.Window.DrawProgressBar(0.1, "Reading vertexes...") elif name == "location": self.verts.append( (float(attr["x"]), float(attr["y"]), float(attr["z"])) ) elif name == "polygons": print "Reading faces..." Blender.Window.DrawProgressBar(0.25, "Reading faces...") elif name == "tri" or name == "quad" or name == "trifan": self.faceVerts = [] self.facevUVs = [] elif name == "vertex": self.faceVerts.append(int(attr["point"])) self.facevUVs.append( (float(attr["s"]), 1-float(attr["t"])) ) elif name == "diffuse": self.rgbCol = [float(attr['red']), float(attr['green']), float(attr['blue'])] self.alpha = float(attr['alpha']) elif name == "ambient": self.amb = (float(attr['red']) + float(attr['green']) + float(attr['blue'])) / 3.0 * float(attr['alpha']) elif name == "specular": specIn = float(attr['alpha']) self.specCol = [specIn*float(attr['red']), specIn*float(attr['green']), specIn*float(attr['blue'])] self.spec = 0.01 # float(attr['alpha']) elif name == "emissive": # sorry, no emissive color, only emission index self.emit = (float(attr['red']) + float(attr['green']) + float(attr['blue'])) / 3.0 * float(attr['alpha']) def endElement(self, pname): """ Serves to assemble gathered data from inner subelements """ name = lower(pname) # these are handled directly if name == "tri" or name == "quad": # the faces are an array, each element an array of # vertex indexes as collected in self.verts # to get (x,y,z) tuples for the jth vertex of the ith face: # self.verts[self.faces[i][j]] self.faces.append(self.faceVerts) # similarly, the UV mapping coordinats for the same vertex # are expected to be retrievable as # self.uvs[self.faceuvs[i][j]] insertPos = len(self.uvs) self.faceuvs.append(range(insertPos, insertPos+len(self.facevUVs))) self.uvs.extend(self.facevUVs) elif name == "trifan": # yes, opengl handles triangle fans naturally, but not blender fanIdx = 2 while fanIdx < len(self.faceVerts): # so we make triangles out of them instead self.faces.append( [self.faceVerts[0], self.faceVerts[fanIdx-1], self.faceVerts[fanIdx]] ) insertPos = len(self.uvs) self.faceuvs.append(range(insertPos, insertPos+3)) self.uvs.extend( [self.facevUVs[0], self.facevUVs[fanIdx-1], self.facevUVs[fanIdx]] ) fanIdx += 1 def read(filename): """ Invokes the xml parser on the file upon being called by the file selector with a file name """ xml.sax.parse(filename, XMeshHandler(filename)) Blender.Window.FileSelector(read, "VegaStrike .XMesh")
0.343892
0.112113
# Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import math import numpy as np from numba import njit @njit(fastmath=True, cache=True) def conditional_probability(k, i, r, a, p, d): """ Calculates the conditional probability to be used for the calculation of the a priori probabilities. :param k: The discretized variable. :param i: The value of the bin. :param r: The correlation parameter. :param a: The discretization cut-off parameter. :param p: The number of bins exponent. :param d: The constant-size interval divider. :return: The conditional probability P(K|X). """ if i == 0: ak = -np.inf bk = -a + d elif i == 2 ** p - 1: ak = -a + (2 ** p - 1) * d bk = np.inf else: ak = -a + i * d bk = -a + (i + 1) * d A = (ak - k * r) / np.sqrt(2 * (1 - r ** 2)) B = (bk - k * r) / np.sqrt(2 * (1 - r ** 2)) prob = 0.5 * (math.erf(B) - math.erf(A)) return prob def q_ary_to_binary(m, q): """ Converts a q-ary sequence into a binary sequence of length q. :param m: The q-ary sequence. :param q: The Galois field exponent. :return: The binary representations of the q-ary sequences. """ mA_bin = np.empty(len(m) * q, dtype=np.int8) # Binary representation of Alice's q-ary message for i in range(len(m)): bitsA = np.binary_repr(m[i], width=q) for j in range(q): mA_bin[i * q + j] = bitsA[j] return mA_bin
utilities.py
# Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import math import numpy as np from numba import njit @njit(fastmath=True, cache=True) def conditional_probability(k, i, r, a, p, d): """ Calculates the conditional probability to be used for the calculation of the a priori probabilities. :param k: The discretized variable. :param i: The value of the bin. :param r: The correlation parameter. :param a: The discretization cut-off parameter. :param p: The number of bins exponent. :param d: The constant-size interval divider. :return: The conditional probability P(K|X). """ if i == 0: ak = -np.inf bk = -a + d elif i == 2 ** p - 1: ak = -a + (2 ** p - 1) * d bk = np.inf else: ak = -a + i * d bk = -a + (i + 1) * d A = (ak - k * r) / np.sqrt(2 * (1 - r ** 2)) B = (bk - k * r) / np.sqrt(2 * (1 - r ** 2)) prob = 0.5 * (math.erf(B) - math.erf(A)) return prob def q_ary_to_binary(m, q): """ Converts a q-ary sequence into a binary sequence of length q. :param m: The q-ary sequence. :param q: The Galois field exponent. :return: The binary representations of the q-ary sequences. """ mA_bin = np.empty(len(m) * q, dtype=np.int8) # Binary representation of Alice's q-ary message for i in range(len(m)): bitsA = np.binary_repr(m[i], width=q) for j in range(q): mA_bin[i * q + j] = bitsA[j] return mA_bin
0.870817
0.507812
import utils from utils.unit_conversions import lin_to_db, db_to_lin, kft_to_km import matplotlib.pyplot as plt import numpy as np from scipy import stats import seaborn as sns import atm import prop import detector def make_all_figures(close_figs=False): """ Call all the figure generators for this chapter :close_figs: Boolean flag. If true, will close all figures after generating them; for batch scripting. Default=False :return: List of figure handles """ # Initializes colorSet - Mx3 RGB vector for successive plot lines colors = plt.get_cmap("tab10") # Reset the random number generator, to ensure reproducability rng = np.random.default_rng(0) # Find the output directory prefix = utils.init_output_dir('chapter3') # Activate seaborn for prettier plots sns.set() # Generate all figures fig1 = make_figure_1(prefix) fig2 = make_figure_2(prefix) fig3 = make_figure_3(prefix) fig4 = make_figure_4(prefix) fig7 = make_figure_7(prefix) fig8 = make_figure_8(prefix) fig9 = make_figure_9(prefix, rng, colors) fig10 = make_figure_10(prefix, rng, colors) figs = [fig1, fig2, fig3, fig4, fig7, fig8, fig9, fig10] if close_figs: for fig in figs: plt.close(fig) return None else: plt.show() return figs def make_figure_1(prefix=None): """ Figure 1, Spectral Content Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :return: figure handle """ # Frequency of Signal freq0 = 1 bandwidth = .4 # Amplitudes noise_pwr = 1 signal_amplitude = 5 # Generate Frequency Content num_freq_bins = 201 freq_vec = 2*freq0*np.linspace(start=-1, stop=1, num=num_freq_bins) noise_vec = noise_pwr*np.ones(shape=(num_freq_bins, )) signal_vec = np.fmax(0, signal_amplitude*(1-2*np.absolute(np.absolute(freq_vec)-freq0)/bandwidth)) # Plot fig1 = plt.figure() plt.plot(freq_vec, noise_vec, label='Noise') plt.plot(freq_vec, signal_vec, label='Signal') plt.xlabel('$f$') plt.ylabel('$P(f)$') plt.legend(loc='upper right') # Annotate the bandwidth plt.annotate(s='', xy=(-1.2, 5.1), xytext=(-0.8, 5.1), arrowprops=dict(arrowstyle='<->', color='k')) plt.annotate(s='', xy=(1.2, 5.1), xytext=(0.8, 5.1), arrowprops=dict(arrowstyle='<->', color='k')) plt.text(-1.1, 5.2, r'$B_F$') plt.text(.9, 5.2, r'$B_F$') # Change the x/y ticks plt.xticks([-1, 0, 1], [r'$-f_0$', 0, r'$f_0$']) plt.yticks([noise_pwr, signal_amplitude], [r'$N_0/2$', r'$S/2$']) plt.xlim([freq_vec[0], freq_vec[-1]]) # Save figure if prefix is not None: plt.savefig(prefix + 'fig1.svg') plt.savefig(prefix + 'fig1.png') return fig1 def make_figure_2(prefix=None): """ Figure 2 - Plot with Spectrum Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :return: figure handle """ # Frequency of Signal freq0 = 1 bandwidth = .4 # Amplitudes noise_pwr = 1 signal_amplitude = 5 # Generate Frequency Content num_freq_bins = 201 freq_vec = 2 * freq0 * np.linspace(start=-1, stop=1, num=num_freq_bins) noise_vec = noise_pwr * np.ones(shape=(num_freq_bins, )) signal_vec = np.fmax(0, signal_amplitude * (1 - 2 * np.absolute(np.absolute(freq_vec) - freq0) / bandwidth)) # Filtered bandwidth_filtered = 2*bandwidth filter_mask = np.absolute(np.absolute(freq_vec) - freq0) <= bandwidth_filtered/2 filter_vec = np.zeros_like(freq_vec) filter_vec[filter_mask] = 1.2*signal_amplitude # Mark the pass-band slightly higher than the signal amplitude noise_filtered = np.copy(noise_vec) # Copy and filter the noise noise_filtered[np.logical_not(filter_mask)] = 0 # Plot fig2 = plt.figure() plt.plot(freq_vec, noise_vec, label='Noise') plt.plot(freq_vec, noise_filtered, label='Noise (filtered)') plt.plot(freq_vec, signal_vec, label='Signal') plt.plot(freq_vec, filter_vec, '--', label='Filter') plt.xlabel('$f$') plt.ylabel('$P(f)$') plt.legend(loc='lower right') # Annotate the bandwidth plt.annotate(s='', xy=(-1.2, 5.1), xytext=(-0.8, 5.1), arrowprops=dict(arrowstyle='<->', color='k')) plt.annotate(s='', xy=(1.2, 5.1), xytext=(0.8, 5.1), arrowprops=dict(arrowstyle='<->', color='k')) plt.text(-1.1, 5.2, r'$B_F$') plt.text(.9, 5.2, r'$B_F$') # Change the x/y ticks plt.xticks([-1, 0, 1], [r'$-f_0$', 0, r'$f_0$']) plt.yticks([noise_pwr, signal_amplitude], [r'$N_0/2$', r'$S/2$']) plt.xlim([freq_vec[0], freq_vec[-1]]) # Save figure if prefix is not None: plt.savefig(prefix + 'fig2.svg') plt.savefig(prefix + 'fig2.png') return fig2 def make_figure_3(prefix=None): """ Figure 3 - CW Detection PFA vs. Threshold Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :return: figure handle """ num_samples = np.array([1, 10, 100]) eta_db = np.arange(start=-10, step=.1, stop=30.1) eta_lin = db_to_lin(eta_db) # The complementary cdf (1 - CDF) is called the 'survival function' prob_fa = stats.chi2.sf(x=np.expand_dims(eta_lin, axis=1), df=2*np.expand_dims(num_samples, axis=0)) # Plot fig3 = plt.figure() for idx, this_m in enumerate(num_samples): plt.semilogy(eta_db, prob_fa[:, idx], label='M = {}'.format(this_m)) plt.legend(loc='lower left') plt.xlabel(r'$\eta [dB]$') plt.ylabel('$P_{FA}$') plt.ylim([1e-6, 1.1]) plt.xlim([eta_db[0], eta_db[-1]]) # Save figure if prefix is not None: plt.savefig(prefix + 'fig3.svg') plt.savefig(prefix + 'fig3.png') return fig3 def make_figure_4(prefix=None): """ Figure 4, PD vs. SNR for CW Detection Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :return: figure handle """ prob_fa = 1e-6 num_samples = np.expand_dims(np.array([1, 10, 100, 1000]), axis=0) xi_db = np.expand_dims(np.arange(start=-20, step=.1, stop=20.1), axis=1) xi_lin = db_to_lin(xi_db) # Compute threshold eta = stats.chi2.ppf(q=1-prob_fa, df=2*num_samples) # Compute Probability of Detection chi_lambda = 2*xi_lin # Non-centrality parameter, lambda, or chi-squared RV prob_det = 1 - stats.ncx2.cdf(x=eta, df=2*num_samples, nc=num_samples*chi_lambda) # Plot fig4 = plt.figure() for idx, this_m in enumerate(num_samples[0, :]): plt.plot(xi_db, prob_det[:, idx], label='M = {}'.format(this_m)) plt.legend(loc='upper left') plt.xlabel(r'$\xi$ [dB]') plt.ylabel('$P_D$') # Save figure if prefix is not None: plt.savefig(prefix + 'fig4.svg') plt.savefig(prefix + 'fig4.png') return fig4 def make_figure_7(prefix=None): """ Figure 7, Atmospheric Loss Table Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :return: figure handle """ range_m = 1.0e3 # set ref distance to 1 km freq_vec = np.arange(start=1.e9, step=50.e6, stop=100.e9+50.e6) # Reference Atmosphere # -- Sea Level, 10 kft, 20 kft, 30 kft, 40 kft alt_kft = np.array([0., 10., 20., 30., 40.]) # T = [15, -4.8, -24.6, -44.4, -56.6]; # P = [101325, 69680, 46560, 30090,18750]; # g = [7.5,2.01,0.34,.05,.01]; loss_atm = np.zeros(shape=(np.size(freq_vec), np.size(alt_kft))) for idx_alt, this_alt in enumerate(alt_kft): # Create atmosphere for this altitude band this_alt_m = kft_to_km(this_alt) * 1.0e3 atmosphere = atm.reference.get_standard_atmosphere(this_alt_m) loss_atm[:, idx_alt] = atm.model.calc_atm_loss(freq_vec, gas_path_len_m=range_m, atmosphere=atmosphere) # Generate plot fig7 = plt.figure() for idx_alt, this_alt in enumerate(alt_kft): plt.semilogy(freq_vec/1e9, loss_atm[:, idx_alt], label='Alt = {} kft'.format(this_alt)) plt.legend(loc='upper left') plt.xlabel('Frequency [GHz]') plt.ylabel('Specific Attenuation [dB/km]') # Save figure if prefix is not None: plt.savefig(prefix + 'fig7.svg') plt.savefig(prefix + 'fig7.png') return fig7 def make_figure_8(prefix=None): """ Figures 8, FM Reception Power vs. Range Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :return: figure handle """ # Figure 8 : SNR vs. range # Set up RF environment ht = 100 hr = 2 range_vec = np.arange(start=10.0e3, step=10.0e3, stop=510.0e3) f0 = 100e6 # Compute Losses and Fresnel Zone # Lfspl = prop.model.get_free_space_path_loss(R=range_vec, f0=f0, include_atm_loss=False) # Ltworay = prop.model.get_tworay_path_loss(R=range_vec, f0=f0, ht=ht, hr=hr, includeAtmLoss=False) loss_prop = prop.model.get_path_loss(range_m=range_vec, freq_hz=f0, tx_ht_m=ht, rx_ht_m=hr, include_atm_loss=False) # Noise Power bandwidth = 2e6 # channel bandwidth [Hz] noise_figure = 5 # noise figure [dB] noise_pwr = lin_to_db(utils.constants.kT*bandwidth)+noise_figure # Signal Power eirp = 47 # dBW rx_gain = 0 # Receive antenna gain rx_loss = 0 # Received Power and SNR signal_pwr = eirp-loss_prop+rx_gain-rx_loss snr_min = 3.65 signal_pwr_min = noise_pwr+snr_min snr0 = eirp+rx_gain-rx_loss-noise_pwr # snr with no propagation loss range_max = detector.squareLaw.max_range(prob_fa=1e-6, prob_d=.5, num_samples=10, f0=f0, ht=ht, hr=hr, snr0=snr0, include_atm_loss=False) print('Max Range: {} m'.format(range_max)) fig8 = plt.figure() plt.plot(range_vec/1e3, signal_pwr, label='$P_R$') plt.plot(range_vec/1e3, signal_pwr_min*np.ones_like(range_vec), linestyle=':', label='MDS') plt.legend(loc='upper right') plt.xlabel('Range [km]') plt.ylabel('Received Power [dBW]') # Save figure if prefix is not None: plt.savefig(prefix + 'fig8.svg') plt.savefig(prefix + 'fig8.png') return fig8 def make_figure_9(prefix=None, rng=None, colors=None): """ Figures 9, Example 3.1 Monte Carlo Results Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :param rng: random number generator :param colors: colormap for plotting :return: figure handle """ from examples import chapter3 fig9 = chapter3.example1(rng, colors) # Save figure if prefix is not None: plt.savefig(prefix + 'fig9.svg') plt.savefig(prefix + 'fig9.png') return fig9 def make_figure_10(prefix=None, rng=None, colors=None): """ Figures 10, Example 3.2 Monte Carlo results Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :param rng: random number generator :param colors: colormap for plotting :return: figure handle """ # Figure 10, Monte Carlo Results from examples import chapter3 fig10 = chapter3.example2(rng, colors) # Save figure if prefix is not None: plt.savefig(prefix + 'fig10.svg') plt.savefig(prefix + 'fig10.png') return fig10
make_figures/chapter3.py
import utils from utils.unit_conversions import lin_to_db, db_to_lin, kft_to_km import matplotlib.pyplot as plt import numpy as np from scipy import stats import seaborn as sns import atm import prop import detector def make_all_figures(close_figs=False): """ Call all the figure generators for this chapter :close_figs: Boolean flag. If true, will close all figures after generating them; for batch scripting. Default=False :return: List of figure handles """ # Initializes colorSet - Mx3 RGB vector for successive plot lines colors = plt.get_cmap("tab10") # Reset the random number generator, to ensure reproducability rng = np.random.default_rng(0) # Find the output directory prefix = utils.init_output_dir('chapter3') # Activate seaborn for prettier plots sns.set() # Generate all figures fig1 = make_figure_1(prefix) fig2 = make_figure_2(prefix) fig3 = make_figure_3(prefix) fig4 = make_figure_4(prefix) fig7 = make_figure_7(prefix) fig8 = make_figure_8(prefix) fig9 = make_figure_9(prefix, rng, colors) fig10 = make_figure_10(prefix, rng, colors) figs = [fig1, fig2, fig3, fig4, fig7, fig8, fig9, fig10] if close_figs: for fig in figs: plt.close(fig) return None else: plt.show() return figs def make_figure_1(prefix=None): """ Figure 1, Spectral Content Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :return: figure handle """ # Frequency of Signal freq0 = 1 bandwidth = .4 # Amplitudes noise_pwr = 1 signal_amplitude = 5 # Generate Frequency Content num_freq_bins = 201 freq_vec = 2*freq0*np.linspace(start=-1, stop=1, num=num_freq_bins) noise_vec = noise_pwr*np.ones(shape=(num_freq_bins, )) signal_vec = np.fmax(0, signal_amplitude*(1-2*np.absolute(np.absolute(freq_vec)-freq0)/bandwidth)) # Plot fig1 = plt.figure() plt.plot(freq_vec, noise_vec, label='Noise') plt.plot(freq_vec, signal_vec, label='Signal') plt.xlabel('$f$') plt.ylabel('$P(f)$') plt.legend(loc='upper right') # Annotate the bandwidth plt.annotate(s='', xy=(-1.2, 5.1), xytext=(-0.8, 5.1), arrowprops=dict(arrowstyle='<->', color='k')) plt.annotate(s='', xy=(1.2, 5.1), xytext=(0.8, 5.1), arrowprops=dict(arrowstyle='<->', color='k')) plt.text(-1.1, 5.2, r'$B_F$') plt.text(.9, 5.2, r'$B_F$') # Change the x/y ticks plt.xticks([-1, 0, 1], [r'$-f_0$', 0, r'$f_0$']) plt.yticks([noise_pwr, signal_amplitude], [r'$N_0/2$', r'$S/2$']) plt.xlim([freq_vec[0], freq_vec[-1]]) # Save figure if prefix is not None: plt.savefig(prefix + 'fig1.svg') plt.savefig(prefix + 'fig1.png') return fig1 def make_figure_2(prefix=None): """ Figure 2 - Plot with Spectrum Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :return: figure handle """ # Frequency of Signal freq0 = 1 bandwidth = .4 # Amplitudes noise_pwr = 1 signal_amplitude = 5 # Generate Frequency Content num_freq_bins = 201 freq_vec = 2 * freq0 * np.linspace(start=-1, stop=1, num=num_freq_bins) noise_vec = noise_pwr * np.ones(shape=(num_freq_bins, )) signal_vec = np.fmax(0, signal_amplitude * (1 - 2 * np.absolute(np.absolute(freq_vec) - freq0) / bandwidth)) # Filtered bandwidth_filtered = 2*bandwidth filter_mask = np.absolute(np.absolute(freq_vec) - freq0) <= bandwidth_filtered/2 filter_vec = np.zeros_like(freq_vec) filter_vec[filter_mask] = 1.2*signal_amplitude # Mark the pass-band slightly higher than the signal amplitude noise_filtered = np.copy(noise_vec) # Copy and filter the noise noise_filtered[np.logical_not(filter_mask)] = 0 # Plot fig2 = plt.figure() plt.plot(freq_vec, noise_vec, label='Noise') plt.plot(freq_vec, noise_filtered, label='Noise (filtered)') plt.plot(freq_vec, signal_vec, label='Signal') plt.plot(freq_vec, filter_vec, '--', label='Filter') plt.xlabel('$f$') plt.ylabel('$P(f)$') plt.legend(loc='lower right') # Annotate the bandwidth plt.annotate(s='', xy=(-1.2, 5.1), xytext=(-0.8, 5.1), arrowprops=dict(arrowstyle='<->', color='k')) plt.annotate(s='', xy=(1.2, 5.1), xytext=(0.8, 5.1), arrowprops=dict(arrowstyle='<->', color='k')) plt.text(-1.1, 5.2, r'$B_F$') plt.text(.9, 5.2, r'$B_F$') # Change the x/y ticks plt.xticks([-1, 0, 1], [r'$-f_0$', 0, r'$f_0$']) plt.yticks([noise_pwr, signal_amplitude], [r'$N_0/2$', r'$S/2$']) plt.xlim([freq_vec[0], freq_vec[-1]]) # Save figure if prefix is not None: plt.savefig(prefix + 'fig2.svg') plt.savefig(prefix + 'fig2.png') return fig2 def make_figure_3(prefix=None): """ Figure 3 - CW Detection PFA vs. Threshold Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :return: figure handle """ num_samples = np.array([1, 10, 100]) eta_db = np.arange(start=-10, step=.1, stop=30.1) eta_lin = db_to_lin(eta_db) # The complementary cdf (1 - CDF) is called the 'survival function' prob_fa = stats.chi2.sf(x=np.expand_dims(eta_lin, axis=1), df=2*np.expand_dims(num_samples, axis=0)) # Plot fig3 = plt.figure() for idx, this_m in enumerate(num_samples): plt.semilogy(eta_db, prob_fa[:, idx], label='M = {}'.format(this_m)) plt.legend(loc='lower left') plt.xlabel(r'$\eta [dB]$') plt.ylabel('$P_{FA}$') plt.ylim([1e-6, 1.1]) plt.xlim([eta_db[0], eta_db[-1]]) # Save figure if prefix is not None: plt.savefig(prefix + 'fig3.svg') plt.savefig(prefix + 'fig3.png') return fig3 def make_figure_4(prefix=None): """ Figure 4, PD vs. SNR for CW Detection Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :return: figure handle """ prob_fa = 1e-6 num_samples = np.expand_dims(np.array([1, 10, 100, 1000]), axis=0) xi_db = np.expand_dims(np.arange(start=-20, step=.1, stop=20.1), axis=1) xi_lin = db_to_lin(xi_db) # Compute threshold eta = stats.chi2.ppf(q=1-prob_fa, df=2*num_samples) # Compute Probability of Detection chi_lambda = 2*xi_lin # Non-centrality parameter, lambda, or chi-squared RV prob_det = 1 - stats.ncx2.cdf(x=eta, df=2*num_samples, nc=num_samples*chi_lambda) # Plot fig4 = plt.figure() for idx, this_m in enumerate(num_samples[0, :]): plt.plot(xi_db, prob_det[:, idx], label='M = {}'.format(this_m)) plt.legend(loc='upper left') plt.xlabel(r'$\xi$ [dB]') plt.ylabel('$P_D$') # Save figure if prefix is not None: plt.savefig(prefix + 'fig4.svg') plt.savefig(prefix + 'fig4.png') return fig4 def make_figure_7(prefix=None): """ Figure 7, Atmospheric Loss Table Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :return: figure handle """ range_m = 1.0e3 # set ref distance to 1 km freq_vec = np.arange(start=1.e9, step=50.e6, stop=100.e9+50.e6) # Reference Atmosphere # -- Sea Level, 10 kft, 20 kft, 30 kft, 40 kft alt_kft = np.array([0., 10., 20., 30., 40.]) # T = [15, -4.8, -24.6, -44.4, -56.6]; # P = [101325, 69680, 46560, 30090,18750]; # g = [7.5,2.01,0.34,.05,.01]; loss_atm = np.zeros(shape=(np.size(freq_vec), np.size(alt_kft))) for idx_alt, this_alt in enumerate(alt_kft): # Create atmosphere for this altitude band this_alt_m = kft_to_km(this_alt) * 1.0e3 atmosphere = atm.reference.get_standard_atmosphere(this_alt_m) loss_atm[:, idx_alt] = atm.model.calc_atm_loss(freq_vec, gas_path_len_m=range_m, atmosphere=atmosphere) # Generate plot fig7 = plt.figure() for idx_alt, this_alt in enumerate(alt_kft): plt.semilogy(freq_vec/1e9, loss_atm[:, idx_alt], label='Alt = {} kft'.format(this_alt)) plt.legend(loc='upper left') plt.xlabel('Frequency [GHz]') plt.ylabel('Specific Attenuation [dB/km]') # Save figure if prefix is not None: plt.savefig(prefix + 'fig7.svg') plt.savefig(prefix + 'fig7.png') return fig7 def make_figure_8(prefix=None): """ Figures 8, FM Reception Power vs. Range Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :return: figure handle """ # Figure 8 : SNR vs. range # Set up RF environment ht = 100 hr = 2 range_vec = np.arange(start=10.0e3, step=10.0e3, stop=510.0e3) f0 = 100e6 # Compute Losses and Fresnel Zone # Lfspl = prop.model.get_free_space_path_loss(R=range_vec, f0=f0, include_atm_loss=False) # Ltworay = prop.model.get_tworay_path_loss(R=range_vec, f0=f0, ht=ht, hr=hr, includeAtmLoss=False) loss_prop = prop.model.get_path_loss(range_m=range_vec, freq_hz=f0, tx_ht_m=ht, rx_ht_m=hr, include_atm_loss=False) # Noise Power bandwidth = 2e6 # channel bandwidth [Hz] noise_figure = 5 # noise figure [dB] noise_pwr = lin_to_db(utils.constants.kT*bandwidth)+noise_figure # Signal Power eirp = 47 # dBW rx_gain = 0 # Receive antenna gain rx_loss = 0 # Received Power and SNR signal_pwr = eirp-loss_prop+rx_gain-rx_loss snr_min = 3.65 signal_pwr_min = noise_pwr+snr_min snr0 = eirp+rx_gain-rx_loss-noise_pwr # snr with no propagation loss range_max = detector.squareLaw.max_range(prob_fa=1e-6, prob_d=.5, num_samples=10, f0=f0, ht=ht, hr=hr, snr0=snr0, include_atm_loss=False) print('Max Range: {} m'.format(range_max)) fig8 = plt.figure() plt.plot(range_vec/1e3, signal_pwr, label='$P_R$') plt.plot(range_vec/1e3, signal_pwr_min*np.ones_like(range_vec), linestyle=':', label='MDS') plt.legend(loc='upper right') plt.xlabel('Range [km]') plt.ylabel('Received Power [dBW]') # Save figure if prefix is not None: plt.savefig(prefix + 'fig8.svg') plt.savefig(prefix + 'fig8.png') return fig8 def make_figure_9(prefix=None, rng=None, colors=None): """ Figures 9, Example 3.1 Monte Carlo Results Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :param rng: random number generator :param colors: colormap for plotting :return: figure handle """ from examples import chapter3 fig9 = chapter3.example1(rng, colors) # Save figure if prefix is not None: plt.savefig(prefix + 'fig9.svg') plt.savefig(prefix + 'fig9.png') return fig9 def make_figure_10(prefix=None, rng=None, colors=None): """ Figures 10, Example 3.2 Monte Carlo results Ported from MATLAB Code <NAME> 23 March 2021 :param prefix: output directory to place generated figure :param rng: random number generator :param colors: colormap for plotting :return: figure handle """ # Figure 10, Monte Carlo Results from examples import chapter3 fig10 = chapter3.example2(rng, colors) # Save figure if prefix is not None: plt.savefig(prefix + 'fig10.svg') plt.savefig(prefix + 'fig10.png') return fig10
0.840848
0.564339
import sys from sys import stderr import argparse import yaml import fontforge parser = argparse.ArgumentParser(description='Merges glyphs from ' 'several fonts, as specified in config.') parser.add_argument('-c', '--config', type=str, required=False, help='Config file in json or yml format. If missed, then ' 'loaded from stdin. ' 'example: ../config.json') parser.add_argument('-o', '--dst_font', type=str, required=True, help='Output font') args = parser.parse_args() if args.config is not None: try: unparsed_config = open(args.config, 'r') except IOError as (errno, strerror): stderr.write("Cannot open %s: %s\n" % (args.config, strerror)) sys.exit(1) else: unparsed_config = sys.stdin try: # yaml parser undestend both formats config = yaml.load(unparsed_config) except yaml.YAMLError, e: config_file_name = '' if args.config is None else args.config if hasattr(e, 'problem_mark'): mark = e.problem_mark stderr.write("YAML parser error in config %s at line %d, col %d\n" % (config_file_name, mark.line + 1, mark.column + 1)) else: stderr.write("YAML parser error in config %s: %s\n" % (config_file_name, e)) sys.exit(1) # init new font new_font = fontforge.font() new_font.encoding = 'UnicodeFull' # load font properties from config for key, value in config['font'].iteritems(): setattr(new_font, key, value) try: # read source fonts src_fonts = {} for name, path in config['src_fonts'].iteritems(): src_fonts[name] = fontforge.open(path) except: stderr.write("Error: fontforge can't open source font from %s" % path) sys.exit(1) # prepare config to view: # [(from_code1, to_code1, src), (from_code2, to_code2, src), ...] remap_config = [(glyph.get('from', glyph['code']), glyph['code'], glyph['src']) for glyph in config['glyphs']] for from_code, to_code, src in remap_config: try: src_fonts[src][from_code] except TypeError: stderr.write("Warning: no such glyph in the source font (code=0x%04x)\n" % from_code) continue src_fonts[src].selection.select(("unicode",), from_code) src_fonts[src].copy() new_font.selection.select(("unicode",), to_code) new_font.paste() try: new_font.generate(args.dst_font) except: stderr.write("Cannot write to file %s\n" % args.dst_font) sys.exit(1)
bin/font_merge.py
import sys from sys import stderr import argparse import yaml import fontforge parser = argparse.ArgumentParser(description='Merges glyphs from ' 'several fonts, as specified in config.') parser.add_argument('-c', '--config', type=str, required=False, help='Config file in json or yml format. If missed, then ' 'loaded from stdin. ' 'example: ../config.json') parser.add_argument('-o', '--dst_font', type=str, required=True, help='Output font') args = parser.parse_args() if args.config is not None: try: unparsed_config = open(args.config, 'r') except IOError as (errno, strerror): stderr.write("Cannot open %s: %s\n" % (args.config, strerror)) sys.exit(1) else: unparsed_config = sys.stdin try: # yaml parser undestend both formats config = yaml.load(unparsed_config) except yaml.YAMLError, e: config_file_name = '' if args.config is None else args.config if hasattr(e, 'problem_mark'): mark = e.problem_mark stderr.write("YAML parser error in config %s at line %d, col %d\n" % (config_file_name, mark.line + 1, mark.column + 1)) else: stderr.write("YAML parser error in config %s: %s\n" % (config_file_name, e)) sys.exit(1) # init new font new_font = fontforge.font() new_font.encoding = 'UnicodeFull' # load font properties from config for key, value in config['font'].iteritems(): setattr(new_font, key, value) try: # read source fonts src_fonts = {} for name, path in config['src_fonts'].iteritems(): src_fonts[name] = fontforge.open(path) except: stderr.write("Error: fontforge can't open source font from %s" % path) sys.exit(1) # prepare config to view: # [(from_code1, to_code1, src), (from_code2, to_code2, src), ...] remap_config = [(glyph.get('from', glyph['code']), glyph['code'], glyph['src']) for glyph in config['glyphs']] for from_code, to_code, src in remap_config: try: src_fonts[src][from_code] except TypeError: stderr.write("Warning: no such glyph in the source font (code=0x%04x)\n" % from_code) continue src_fonts[src].selection.select(("unicode",), from_code) src_fonts[src].copy() new_font.selection.select(("unicode",), to_code) new_font.paste() try: new_font.generate(args.dst_font) except: stderr.write("Cannot write to file %s\n" % args.dst_font) sys.exit(1)
0.193757
0.070592
import json import logging import voluptuous as vol from homeassistant.components.media_player import ( DEVICE_CLASS_SPEAKER, SUPPORT_PLAY_MEDIA, MediaPlayerDevice, ) from homeassistant.const import ATTR_ENTITY_ID from homeassistant.helpers import config_validation as cv from homeassistant.helpers.dispatcher import async_dispatcher_connect from .const import CONTROLLER, COORDINATOR, DOMAIN _LOGGER = logging.getLogger(__name__) CONF_FULLY_SETTING = "setting" CONF_FULLY_SETTING_VALUE = "value" SERVICE_SET_CONFIGURATION_STRING = "set_configuration_string" SET_CONFIGURATION_STRING_SCHEMA = vol.Schema( { vol.Required(ATTR_ENTITY_ID): cv.entity_ids, vol.Required(CONF_FULLY_SETTING): cv.string, vol.Required(CONF_FULLY_SETTING_VALUE): cv.string, } ) async def async_setup_entry(hass, config_entry, async_add_entities): """Set up the Fully Kiosk Browser media player.""" coordinator = hass.data[DOMAIN][config_entry.entry_id][COORDINATOR] controller = hass.data[DOMAIN][config_entry.entry_id][CONTROLLER] async_add_entities([FullyMediaPlayer(coordinator, controller)], False) async def set_configuration_string(call) -> None: """Call set string config handler.""" await async_handle_set_configuration_string_service(call) hass.services.async_register( DOMAIN, SERVICE_SET_CONFIGURATION_STRING, set_configuration_string, schema=SET_CONFIGURATION_STRING_SCHEMA, ) class FullyMediaPlayer(MediaPlayerDevice): def __init__(self, coordinator, controller): self._name = f"{coordinator.data['deviceName']} Media Player" self.coordinator = coordinator self.controller = controller self._unique_id = f"{coordinator.data['deviceID']}-mediaplayer" @property def name(self): return self._name @property def supported_features(self): return SUPPORT_PLAY_MEDIA @property def device_info(self): return { "identifiers": {(DOMAIN, self.coordinator.data["deviceID"])}, "name": self.coordinator.data["deviceName"], "manufacturer": self.coordinator.data["deviceManufacturer"], "model": self.coordinator.data["deviceModel"], "sw_version": self.coordinator.data["appVersionName"], } @property def unique_id(self): return self._unique_id def play_media(self, media_type, media_id, **kwargs): self.controller.playSound(media_id) async def async_added_to_hass(self): """Connect to dispatcher listening for entity data notifications.""" self.async_on_remove( self.coordinator.async_add_listener(self.async_write_ha_state) ) async def async_update(self): """Update Fully Kiosk Browser entity.""" await self.coordinator.async_request_refresh() async def async_handle_set_configuration_string_service(self, call): """Handle configuration string call.""" self.controller.setConfigurationString( call.data[CONF_FULLY_SETTING], call.data[CONF_FULLY_SETTING_VALUE] )
custom_components/fullykiosk/media_player.py
import json import logging import voluptuous as vol from homeassistant.components.media_player import ( DEVICE_CLASS_SPEAKER, SUPPORT_PLAY_MEDIA, MediaPlayerDevice, ) from homeassistant.const import ATTR_ENTITY_ID from homeassistant.helpers import config_validation as cv from homeassistant.helpers.dispatcher import async_dispatcher_connect from .const import CONTROLLER, COORDINATOR, DOMAIN _LOGGER = logging.getLogger(__name__) CONF_FULLY_SETTING = "setting" CONF_FULLY_SETTING_VALUE = "value" SERVICE_SET_CONFIGURATION_STRING = "set_configuration_string" SET_CONFIGURATION_STRING_SCHEMA = vol.Schema( { vol.Required(ATTR_ENTITY_ID): cv.entity_ids, vol.Required(CONF_FULLY_SETTING): cv.string, vol.Required(CONF_FULLY_SETTING_VALUE): cv.string, } ) async def async_setup_entry(hass, config_entry, async_add_entities): """Set up the Fully Kiosk Browser media player.""" coordinator = hass.data[DOMAIN][config_entry.entry_id][COORDINATOR] controller = hass.data[DOMAIN][config_entry.entry_id][CONTROLLER] async_add_entities([FullyMediaPlayer(coordinator, controller)], False) async def set_configuration_string(call) -> None: """Call set string config handler.""" await async_handle_set_configuration_string_service(call) hass.services.async_register( DOMAIN, SERVICE_SET_CONFIGURATION_STRING, set_configuration_string, schema=SET_CONFIGURATION_STRING_SCHEMA, ) class FullyMediaPlayer(MediaPlayerDevice): def __init__(self, coordinator, controller): self._name = f"{coordinator.data['deviceName']} Media Player" self.coordinator = coordinator self.controller = controller self._unique_id = f"{coordinator.data['deviceID']}-mediaplayer" @property def name(self): return self._name @property def supported_features(self): return SUPPORT_PLAY_MEDIA @property def device_info(self): return { "identifiers": {(DOMAIN, self.coordinator.data["deviceID"])}, "name": self.coordinator.data["deviceName"], "manufacturer": self.coordinator.data["deviceManufacturer"], "model": self.coordinator.data["deviceModel"], "sw_version": self.coordinator.data["appVersionName"], } @property def unique_id(self): return self._unique_id def play_media(self, media_type, media_id, **kwargs): self.controller.playSound(media_id) async def async_added_to_hass(self): """Connect to dispatcher listening for entity data notifications.""" self.async_on_remove( self.coordinator.async_add_listener(self.async_write_ha_state) ) async def async_update(self): """Update Fully Kiosk Browser entity.""" await self.coordinator.async_request_refresh() async def async_handle_set_configuration_string_service(self, call): """Handle configuration string call.""" self.controller.setConfigurationString( call.data[CONF_FULLY_SETTING], call.data[CONF_FULLY_SETTING_VALUE] )
0.661923
0.084003
import cv2 from __init__ import Square, predictor, detector, vfps, size from facefrontal import facefrontal, warp_mapping import numpy as np padw = 95 detw = 130 def getGaussianPyr(img, layers): g = img.astype(np.float64) pyramid = [g] for i in range(layers): g = cv2.pyrDown(g) pyramid.append(g) return pyramid def getLaplacianPyr(Gaupyr): pyramid = [] for i in range(len(Gaupyr)-2, -1, -1): # len(Gaupyr)-2, ..., 1, 0 gi = Gaupyr[i] gi_aprx = cv2.pyrUp(Gaupyr[i+1]) gi_aprx = cv2.resize(gi_aprx, gi.shape[:2][::-1]) pyramid.append((gi - gi_aprx)) return pyramid[::-1] def reconstruct(G, Lappyr): for i in range(len(Lappyr)-1, -1, -1): # len(Gaupyr)-1, ..., 1, 0 G = cv2.pyrUp(G) G = cv2.resize(G, Lappyr[i].shape[:2][::-1]) G += Lappyr[i] return G.astype(np.uint8) def pyramid_blend(img1, img2, mask_, layers=4): assert(img1.shape == img2.shape and img1.shape[:2] == mask_.shape) mask = mask_ / np.max(mask_) # 0 ~ 1 # construct Gaussian pyramids of input images Gaupyr1 = getGaussianPyr(img1, layers+1) Gaupyr2 = getGaussianPyr(img2, layers+1) Gaupyrm = getGaussianPyr(mask, layers+1) # construct Laplacian pyramids of input images Lappyr1 = getLaplacianPyr(Gaupyr1) Lappyr2 = getLaplacianPyr(Gaupyr2) # blend pyramids in every layer Gaupyrm1 = Gaupyrm[:-1] Gaupyrm2 = [1-msk for msk in Gaupyrm1] BLappyr1 = [lap * msk[:, :, np.newaxis] for lap, msk in zip(Lappyr1, Gaupyrm1)] BLappyr2 = [lap * msk[:, :, np.newaxis] for lap, msk in zip(Lappyr2, Gaupyrm2)] BLappyr = [lap1 + lap2 for lap1, lap2 in zip(BLappyr1, BLappyr2)] initG = Gaupyr1[-1] * Gaupyrm[-1][:, :, np.newaxis] + Gaupyr2[-1] * (1-Gaupyrm[-1])[:, :, np.newaxis] # collapse pyramids and form the blended image img = reconstruct(initG, BLappyr) return img def getindices(ftl_face, sq, padw=padw, detw=detw): # get mask region using boundary, chin landmarks and nose landmarks # boundary region: left -> right, upper -> lower WH = ftl_face.shape[0] boundary = sq.align(detw) left, right, upper, lower = np.array(boundary) + padw indices = np.array([(x, y) for x in range(left, right) for y in range(upper, lower)]) # get landmarks of frontalized face det = detector(ftl_face, 1)[0] shape = predictor(ftl_face, det) ldmk = np.asarray([(shape.part(n).x, shape.part(n).y,) for n in range(shape.num_parts)], np.float32) chin_xp, chin_fp = ldmk[ 3:14, 0], ldmk[ 3:14, 1] chin_line = np.interp(np.arange(WH), chin_xp, chin_fp) nose_xp, nose_fp = ldmk[31:36, 0], ldmk[31:36, 1] nose_line = np.interp(np.arange(WH), nose_xp, nose_fp) # filter the position which is out of chin line and nose line check = np.logical_and(indices[:, 1] < chin_line[indices[:, 0]], indices[:, 1] > nose_line[indices[:, 0]]) return indices[check.nonzero()] def align2target(syntxtr, tar_shape, sq, padw=padw, detw=detw): # align lower-face to target frame # |padw| detw |padw| # |----|-------|--------- # | |padw # | --------- ----- # | | | | # | | | |detw # | | | | # | --------- ----- # | ftl_face |padw # ----------------------- rsize = sq.getrsize(syntxtr.shape) syn_face_ = np.zeros((rsize, rsize, syntxtr.shape[2]), dtype=np.uint8) left, right, upper, lower = sq.align(rsize) syn_face_[upper:lower, left:right, :] = syntxtr syn_face_ = cv2.resize(syn_face_, (detw, detw)) syn_face = np.zeros(tar_shape, dtype=np.uint8) syn_face[padw:padw+detw, padw:padw+detw, :] = syn_face_ return syn_face def recalc_pixel(pt, coords, pixels, thr=5, sigma=0.2): L2 = np.linalg.norm(coords-pt, ord=2, axis=1) indx = np.where(L2 <= thr) weights = np.exp(-L2[indx]**2 / (2* sigma**2)) weights /= np.sum(weights) # np.sum(weights) == 1 return np.matmul(weights, pixels[indx, :]) def warpback(face, tarfr, tarldmk, indices, projM, transM): # get the pixels of given indices pixels = face[indices[:, 1], indices[:, 0], :] # (N, 3) # get the to-be-recalculated region in the original frame warp_mask, region, coords, pixels = warp_mapping(indices, pixels, tarfr, tarldmk, projM, transM) # do recalculation for every pixel in the region tmpfr = np.zeros(tarfr.shape, dtype=np.uint8) for pt in region: tmpfr[pt[1], pt[0], :] = recalc_pixel(pt, coords, pixels) tmpfr = cv2.inpaint(tmpfr, ~warp_mask, 10, cv2.INPAINT_TELEA) return pyramid_blend(tmpfr, tarfr, warp_mask) def synthesize_frame(tarfr, syntxtr, sq): # frontalize the target frame ftl_face, ldmk, projM, transM = facefrontal(tarfr, detector, predictor, detail=True) # align lower-face to target frame syn_face = align2target(syntxtr, ftl_face.shape, sq) # get indices of pixels in ftl_face which needs to be blended into target frame indices = getindices(ftl_face, sq) # warp the synthesized face to the original pose and blending return warpback(syn_face, tarfr, ldmk, indices, projM, transM) def composite(inp_path, tar_path, save_path, sq): syndata = np.load(inp_path) cap = cv2.VideoCapture(tar_path) writer = cv2.VideoWriter(save_path, cv2.VideoWriter_fourcc(*'DIVX'), vfps, size) nfr = int(cap.get(cv2.CAP_PROP_FRAME_COUNT)) assert(syndata.shape[0] == nfr) for i in range(nfr): print('%s: %04d/%04d' % (save_path, i+1, nfr)) ret, tarfr = cap.read() assert(ret) frame = synthesize_frame(tarfr, syndata[i], sq) writer.write(frame) print('%s: synthesis done.' % save_path) return save_path def test1(): left = cv2.imread('tmp/left.png') right = cv2.imread('tmp/right.png') mask = np.zeros(left.shape) mask[:, :mask.shape[1]//2, :] = 1 n = 6 spec = np.zeros((mask.shape[0]*n, mask.shape[1], mask.shape[2])) for layers in range(n): blend = pyramid_blend(left, right, mask, layers) spec[mask.shape[0]*layers:mask.shape[0]*(layers+1), :, :] = blend cv2.imwrite('reference/blend.png', spec) def test2(): tarfr = cv2.imread('tmp/0660.png') region = np.load('tmp/region.npy') tarfr[region[:, 1], region[:, 0], :] = (255, 255, 0) cv2.imwrite('tmp/regiontest.png', tarfr) def test3(): tarfr = cv2.imread('tmp/0660.png') syntxtr = cv2.imread('tmp/syn100.png') sq = Square(0.25, 0.75, 0.6, 1.0) outpfr = synthesize_frame(tarfr, syntxtr, sq) cv2.imwrite('tmp/i100t660.png', outpfr) if __name__ == '__main__': test3()
composite.py
import cv2 from __init__ import Square, predictor, detector, vfps, size from facefrontal import facefrontal, warp_mapping import numpy as np padw = 95 detw = 130 def getGaussianPyr(img, layers): g = img.astype(np.float64) pyramid = [g] for i in range(layers): g = cv2.pyrDown(g) pyramid.append(g) return pyramid def getLaplacianPyr(Gaupyr): pyramid = [] for i in range(len(Gaupyr)-2, -1, -1): # len(Gaupyr)-2, ..., 1, 0 gi = Gaupyr[i] gi_aprx = cv2.pyrUp(Gaupyr[i+1]) gi_aprx = cv2.resize(gi_aprx, gi.shape[:2][::-1]) pyramid.append((gi - gi_aprx)) return pyramid[::-1] def reconstruct(G, Lappyr): for i in range(len(Lappyr)-1, -1, -1): # len(Gaupyr)-1, ..., 1, 0 G = cv2.pyrUp(G) G = cv2.resize(G, Lappyr[i].shape[:2][::-1]) G += Lappyr[i] return G.astype(np.uint8) def pyramid_blend(img1, img2, mask_, layers=4): assert(img1.shape == img2.shape and img1.shape[:2] == mask_.shape) mask = mask_ / np.max(mask_) # 0 ~ 1 # construct Gaussian pyramids of input images Gaupyr1 = getGaussianPyr(img1, layers+1) Gaupyr2 = getGaussianPyr(img2, layers+1) Gaupyrm = getGaussianPyr(mask, layers+1) # construct Laplacian pyramids of input images Lappyr1 = getLaplacianPyr(Gaupyr1) Lappyr2 = getLaplacianPyr(Gaupyr2) # blend pyramids in every layer Gaupyrm1 = Gaupyrm[:-1] Gaupyrm2 = [1-msk for msk in Gaupyrm1] BLappyr1 = [lap * msk[:, :, np.newaxis] for lap, msk in zip(Lappyr1, Gaupyrm1)] BLappyr2 = [lap * msk[:, :, np.newaxis] for lap, msk in zip(Lappyr2, Gaupyrm2)] BLappyr = [lap1 + lap2 for lap1, lap2 in zip(BLappyr1, BLappyr2)] initG = Gaupyr1[-1] * Gaupyrm[-1][:, :, np.newaxis] + Gaupyr2[-1] * (1-Gaupyrm[-1])[:, :, np.newaxis] # collapse pyramids and form the blended image img = reconstruct(initG, BLappyr) return img def getindices(ftl_face, sq, padw=padw, detw=detw): # get mask region using boundary, chin landmarks and nose landmarks # boundary region: left -> right, upper -> lower WH = ftl_face.shape[0] boundary = sq.align(detw) left, right, upper, lower = np.array(boundary) + padw indices = np.array([(x, y) for x in range(left, right) for y in range(upper, lower)]) # get landmarks of frontalized face det = detector(ftl_face, 1)[0] shape = predictor(ftl_face, det) ldmk = np.asarray([(shape.part(n).x, shape.part(n).y,) for n in range(shape.num_parts)], np.float32) chin_xp, chin_fp = ldmk[ 3:14, 0], ldmk[ 3:14, 1] chin_line = np.interp(np.arange(WH), chin_xp, chin_fp) nose_xp, nose_fp = ldmk[31:36, 0], ldmk[31:36, 1] nose_line = np.interp(np.arange(WH), nose_xp, nose_fp) # filter the position which is out of chin line and nose line check = np.logical_and(indices[:, 1] < chin_line[indices[:, 0]], indices[:, 1] > nose_line[indices[:, 0]]) return indices[check.nonzero()] def align2target(syntxtr, tar_shape, sq, padw=padw, detw=detw): # align lower-face to target frame # |padw| detw |padw| # |----|-------|--------- # | |padw # | --------- ----- # | | | | # | | | |detw # | | | | # | --------- ----- # | ftl_face |padw # ----------------------- rsize = sq.getrsize(syntxtr.shape) syn_face_ = np.zeros((rsize, rsize, syntxtr.shape[2]), dtype=np.uint8) left, right, upper, lower = sq.align(rsize) syn_face_[upper:lower, left:right, :] = syntxtr syn_face_ = cv2.resize(syn_face_, (detw, detw)) syn_face = np.zeros(tar_shape, dtype=np.uint8) syn_face[padw:padw+detw, padw:padw+detw, :] = syn_face_ return syn_face def recalc_pixel(pt, coords, pixels, thr=5, sigma=0.2): L2 = np.linalg.norm(coords-pt, ord=2, axis=1) indx = np.where(L2 <= thr) weights = np.exp(-L2[indx]**2 / (2* sigma**2)) weights /= np.sum(weights) # np.sum(weights) == 1 return np.matmul(weights, pixels[indx, :]) def warpback(face, tarfr, tarldmk, indices, projM, transM): # get the pixels of given indices pixels = face[indices[:, 1], indices[:, 0], :] # (N, 3) # get the to-be-recalculated region in the original frame warp_mask, region, coords, pixels = warp_mapping(indices, pixels, tarfr, tarldmk, projM, transM) # do recalculation for every pixel in the region tmpfr = np.zeros(tarfr.shape, dtype=np.uint8) for pt in region: tmpfr[pt[1], pt[0], :] = recalc_pixel(pt, coords, pixels) tmpfr = cv2.inpaint(tmpfr, ~warp_mask, 10, cv2.INPAINT_TELEA) return pyramid_blend(tmpfr, tarfr, warp_mask) def synthesize_frame(tarfr, syntxtr, sq): # frontalize the target frame ftl_face, ldmk, projM, transM = facefrontal(tarfr, detector, predictor, detail=True) # align lower-face to target frame syn_face = align2target(syntxtr, ftl_face.shape, sq) # get indices of pixels in ftl_face which needs to be blended into target frame indices = getindices(ftl_face, sq) # warp the synthesized face to the original pose and blending return warpback(syn_face, tarfr, ldmk, indices, projM, transM) def composite(inp_path, tar_path, save_path, sq): syndata = np.load(inp_path) cap = cv2.VideoCapture(tar_path) writer = cv2.VideoWriter(save_path, cv2.VideoWriter_fourcc(*'DIVX'), vfps, size) nfr = int(cap.get(cv2.CAP_PROP_FRAME_COUNT)) assert(syndata.shape[0] == nfr) for i in range(nfr): print('%s: %04d/%04d' % (save_path, i+1, nfr)) ret, tarfr = cap.read() assert(ret) frame = synthesize_frame(tarfr, syndata[i], sq) writer.write(frame) print('%s: synthesis done.' % save_path) return save_path def test1(): left = cv2.imread('tmp/left.png') right = cv2.imread('tmp/right.png') mask = np.zeros(left.shape) mask[:, :mask.shape[1]//2, :] = 1 n = 6 spec = np.zeros((mask.shape[0]*n, mask.shape[1], mask.shape[2])) for layers in range(n): blend = pyramid_blend(left, right, mask, layers) spec[mask.shape[0]*layers:mask.shape[0]*(layers+1), :, :] = blend cv2.imwrite('reference/blend.png', spec) def test2(): tarfr = cv2.imread('tmp/0660.png') region = np.load('tmp/region.npy') tarfr[region[:, 1], region[:, 0], :] = (255, 255, 0) cv2.imwrite('tmp/regiontest.png', tarfr) def test3(): tarfr = cv2.imread('tmp/0660.png') syntxtr = cv2.imread('tmp/syn100.png') sq = Square(0.25, 0.75, 0.6, 1.0) outpfr = synthesize_frame(tarfr, syntxtr, sq) cv2.imwrite('tmp/i100t660.png', outpfr) if __name__ == '__main__': test3()
0.533154
0.356195
import numpy as np import torch class ReplayBuffer(object): """Buffer to store environment transitions.""" def __init__(self, obs_shape, t_obs_shape, action_shape, capacity, device): self.capacity = capacity self.device = device # the proprioceptive obs is stored as float32, pixels obs as uint8 obs_dtype = np.float32 if len(obs_shape) == 1 else np.uint8 self.obses = np.empty((capacity, *obs_shape), dtype=obs_dtype) self.t_obses = np.empty((capacity, *t_obs_shape), dtype=obs_dtype) self.next_obses = np.empty((capacity, *obs_shape), dtype=obs_dtype) self.next_t_obses = np.empty((capacity, *t_obs_shape), dtype=obs_dtype) self.actions = np.empty((capacity, *action_shape), dtype=np.float32) self.rewards = np.empty((capacity, 1), dtype=np.float32) self.not_dones = np.empty((capacity, 1), dtype=np.float32) self.not_dones_no_max = np.empty((capacity, 1), dtype=np.float32) self.idx = 0 self.last_save = 0 self.full = False def __len__(self): return self.capacity if self.full else self.idx def add( self, obs, t_obs, action, reward, next_obs, next_t_obs, done, done_no_max, ): np.copyto(self.obses[self.idx], obs) np.copyto(self.t_obses[self.idx], t_obs) np.copyto(self.actions[self.idx], action) np.copyto(self.rewards[self.idx], reward) np.copyto(self.next_obses[self.idx], next_obs) np.copyto(self.next_t_obses[self.idx], next_t_obs) np.copyto(self.not_dones[self.idx], not done) np.copyto(self.not_dones_no_max[self.idx], not done_no_max) self.idx = (self.idx + 1) % self.capacity self.full = self.full or self.idx == 0 def purge_frac(self, frac=0.5): to_keep = int((1.0 - frac) * self.__len__()) idxs = np.random.randint(0, self.__len__(), size=to_keep) self.obses[:to_keep] = self.obses[idxs] self.t_obses[:to_keep] = self.t_obses[idxs] self.actions[:to_keep] = self.actions[idxs] self.rewards[:to_keep] = self.rewards[idxs] self.next_obses[:to_keep] = self.next_obses[idxs] self.next_t_obses[:to_keep] = self.next_t_obses[idxs] self.not_dones[:to_keep] = self.not_dones[idxs] self.not_dones_no_max[:to_keep] = self.not_dones_no_max[idxs] self.idx = to_keep self.full = False def sample(self, batch_size): idxs = np.random.randint(0, self.__len__(), size=batch_size) obses = torch.from_numpy(self.obses[idxs]).to(self.device) t_obses = torch.from_numpy(self.t_obses[idxs]).to(self.device) actions = torch.from_numpy(self.actions[idxs]).to(self.device) rewards = torch.from_numpy(self.rewards[idxs]).to(self.device) next_obses = torch.from_numpy(self.next_obses[idxs]).to(self.device) next_t_obses = torch.from_numpy(self.next_t_obses[idxs]).to(self.device) not_dones = torch.from_numpy(self.not_dones[idxs]).to(self.device) not_dones_no_max = torch.from_numpy(self.not_dones_no_max[idxs]).to(self.device) return ( obses, t_obses, actions, rewards, next_obses, next_t_obses, not_dones, not_dones_no_max, )
buffers/replay_buffer.py
import numpy as np import torch class ReplayBuffer(object): """Buffer to store environment transitions.""" def __init__(self, obs_shape, t_obs_shape, action_shape, capacity, device): self.capacity = capacity self.device = device # the proprioceptive obs is stored as float32, pixels obs as uint8 obs_dtype = np.float32 if len(obs_shape) == 1 else np.uint8 self.obses = np.empty((capacity, *obs_shape), dtype=obs_dtype) self.t_obses = np.empty((capacity, *t_obs_shape), dtype=obs_dtype) self.next_obses = np.empty((capacity, *obs_shape), dtype=obs_dtype) self.next_t_obses = np.empty((capacity, *t_obs_shape), dtype=obs_dtype) self.actions = np.empty((capacity, *action_shape), dtype=np.float32) self.rewards = np.empty((capacity, 1), dtype=np.float32) self.not_dones = np.empty((capacity, 1), dtype=np.float32) self.not_dones_no_max = np.empty((capacity, 1), dtype=np.float32) self.idx = 0 self.last_save = 0 self.full = False def __len__(self): return self.capacity if self.full else self.idx def add( self, obs, t_obs, action, reward, next_obs, next_t_obs, done, done_no_max, ): np.copyto(self.obses[self.idx], obs) np.copyto(self.t_obses[self.idx], t_obs) np.copyto(self.actions[self.idx], action) np.copyto(self.rewards[self.idx], reward) np.copyto(self.next_obses[self.idx], next_obs) np.copyto(self.next_t_obses[self.idx], next_t_obs) np.copyto(self.not_dones[self.idx], not done) np.copyto(self.not_dones_no_max[self.idx], not done_no_max) self.idx = (self.idx + 1) % self.capacity self.full = self.full or self.idx == 0 def purge_frac(self, frac=0.5): to_keep = int((1.0 - frac) * self.__len__()) idxs = np.random.randint(0, self.__len__(), size=to_keep) self.obses[:to_keep] = self.obses[idxs] self.t_obses[:to_keep] = self.t_obses[idxs] self.actions[:to_keep] = self.actions[idxs] self.rewards[:to_keep] = self.rewards[idxs] self.next_obses[:to_keep] = self.next_obses[idxs] self.next_t_obses[:to_keep] = self.next_t_obses[idxs] self.not_dones[:to_keep] = self.not_dones[idxs] self.not_dones_no_max[:to_keep] = self.not_dones_no_max[idxs] self.idx = to_keep self.full = False def sample(self, batch_size): idxs = np.random.randint(0, self.__len__(), size=batch_size) obses = torch.from_numpy(self.obses[idxs]).to(self.device) t_obses = torch.from_numpy(self.t_obses[idxs]).to(self.device) actions = torch.from_numpy(self.actions[idxs]).to(self.device) rewards = torch.from_numpy(self.rewards[idxs]).to(self.device) next_obses = torch.from_numpy(self.next_obses[idxs]).to(self.device) next_t_obses = torch.from_numpy(self.next_t_obses[idxs]).to(self.device) not_dones = torch.from_numpy(self.not_dones[idxs]).to(self.device) not_dones_no_max = torch.from_numpy(self.not_dones_no_max[idxs]).to(self.device) return ( obses, t_obses, actions, rewards, next_obses, next_t_obses, not_dones, not_dones_no_max, )
0.826046
0.407923
from ..api import Extension, helpers from ..log import logger from ..templates import isort_cfg, pre_commit_config class PreCommit(Extension): """Generate pre-commit configuration file""" def activate(self, actions): """Activate extension Args: actions (list): list of actions to perform Returns: list: updated list of actions """ return ( self.register(actions, self.add_files, after='define_structure') + [self.instruct_user]) @staticmethod def add_files(struct, opts): """Add .pre-commit-config.yaml file to structure Since the default template uses isort, this function also provides an initial version of .isort.cfg that can be extended by the user (it contains some useful skips, e.g. tox and venv) Args: struct (dict): project representation as (possibly) nested :obj:`dict`. opts (dict): given options, see :obj:`create_project` for an extensive list. Returns: struct, opts: updated project representation and options """ files = { '.pre-commit-config.yaml': ( pre_commit_config(opts), helpers.NO_OVERWRITE ), '.isort.cfg': ( isort_cfg(opts), helpers.NO_OVERWRITE ), } return helpers.merge(struct, {opts['project']: files}), opts @staticmethod def instruct_user(struct, opts): logger.warning( '\nA `.pre-commit-config.yaml` file was generated inside your ' 'project but in order to make sure the hooks will run, please ' 'don\'t forget to install the `pre-commit` package:\n\n' ' cd %s\n' ' # it is a good idea to create and activate a virtualenv here\n' ' pip install pre-commit\n' ' pre-commit install\n' ' # another good idea is update the hooks to the latest version\n' ' # pre-commit autoupdate\n\n' 'You might also consider including similar instructions in your ' 'docs, to remind the contributors to do the same.\n', opts['project']) return struct, opts
.eggs/PyScaffold-3.1-py3.9.egg/pyscaffold/extensions/pre_commit.py
from ..api import Extension, helpers from ..log import logger from ..templates import isort_cfg, pre_commit_config class PreCommit(Extension): """Generate pre-commit configuration file""" def activate(self, actions): """Activate extension Args: actions (list): list of actions to perform Returns: list: updated list of actions """ return ( self.register(actions, self.add_files, after='define_structure') + [self.instruct_user]) @staticmethod def add_files(struct, opts): """Add .pre-commit-config.yaml file to structure Since the default template uses isort, this function also provides an initial version of .isort.cfg that can be extended by the user (it contains some useful skips, e.g. tox and venv) Args: struct (dict): project representation as (possibly) nested :obj:`dict`. opts (dict): given options, see :obj:`create_project` for an extensive list. Returns: struct, opts: updated project representation and options """ files = { '.pre-commit-config.yaml': ( pre_commit_config(opts), helpers.NO_OVERWRITE ), '.isort.cfg': ( isort_cfg(opts), helpers.NO_OVERWRITE ), } return helpers.merge(struct, {opts['project']: files}), opts @staticmethod def instruct_user(struct, opts): logger.warning( '\nA `.pre-commit-config.yaml` file was generated inside your ' 'project but in order to make sure the hooks will run, please ' 'don\'t forget to install the `pre-commit` package:\n\n' ' cd %s\n' ' # it is a good idea to create and activate a virtualenv here\n' ' pip install pre-commit\n' ' pre-commit install\n' ' # another good idea is update the hooks to the latest version\n' ' # pre-commit autoupdate\n\n' 'You might also consider including similar instructions in your ' 'docs, to remind the contributors to do the same.\n', opts['project']) return struct, opts
0.765769
0.13134
from autosense.autodiff.autotensor import autoTensor, Node import torch from autosense.neural.param import Weight, Initializer import autosense.autodiff.functional as F import torch.nn.init as torchInit class Layer(object): """Abstract class that is inherited by all types of layers""" def __call__(self): raise NotImplementedError class Linear(Layer): def __init__(self, input_dim, output_dim,initializer=None,bias=True): self.weight = Weight(shape=(input_dim,output_dim),initializer=initializer) if bias: self.bias = Weight(shape=(1,output_dim),initializer=initializer) self.bias_present = bias def __call__(self,inputs): if self.bias_present: return F.MatMul(inputs,self.weight) + self.bias else: return F.MatMul(inputs,self.weight) class Linear2(Layer): def __init__(self, input1_dim,input2_dim, output_dim,initializer=None,bias=True): self.weight = Weight(shape=(input1_dim,output_dim),initializer=initializer) self.weight2 = Weight(shape=(input2_dim,output_dim),initializer=initializer) if bias: self.bias = Weight(shape=(1,output_dim),initializer=initializer) self.bias_present = bias def __call__(self,inputs1,inputs2): if self.bias_present: return F.MatMul(inputs1,self.weight) + F.MatMul(inputs2,self.weight2) + self.bias else: return F.MatMul(inputs1,self.weight) + F.MatMul(inputs2,self.weight2) class Conv2D(Layer): def __init__(self,filter_shape,padding=0,stride=1,initializer=None): """ input – input tensor of shape (minibatch,in_channels,iH,iW) \n weight – filters of shape (out_channels,in_channels,kH,kW) \n bias – bias tensor of shape (out_channels). """ self.padding = padding self.stride = stride self.filter = Weight(filter_shape,initializer=initializer) self.bias = Weight(shape = filter_shape[0]) def __call__(self,inputs): return F.Conv2d(image_block=inputs, filters=self.filter, bias=self.bias, padding=self.padding, stride=self.stride ) class Dropout(Layer): def __init__(self,input_shape,keep_prob=0.8): self.input_shape = input_shape self.keep_prob = keep_prob def __call__(self,inputs): mask = torchInit.uniform_(torch.rand(self.input_shape)).type(inputs.value.type()) mask[mask < self.keep_prob] = 1 mask[mask != 1 ] = 0 return F.Dpout(inputs,mask)
autosense/neural/layers.py
from autosense.autodiff.autotensor import autoTensor, Node import torch from autosense.neural.param import Weight, Initializer import autosense.autodiff.functional as F import torch.nn.init as torchInit class Layer(object): """Abstract class that is inherited by all types of layers""" def __call__(self): raise NotImplementedError class Linear(Layer): def __init__(self, input_dim, output_dim,initializer=None,bias=True): self.weight = Weight(shape=(input_dim,output_dim),initializer=initializer) if bias: self.bias = Weight(shape=(1,output_dim),initializer=initializer) self.bias_present = bias def __call__(self,inputs): if self.bias_present: return F.MatMul(inputs,self.weight) + self.bias else: return F.MatMul(inputs,self.weight) class Linear2(Layer): def __init__(self, input1_dim,input2_dim, output_dim,initializer=None,bias=True): self.weight = Weight(shape=(input1_dim,output_dim),initializer=initializer) self.weight2 = Weight(shape=(input2_dim,output_dim),initializer=initializer) if bias: self.bias = Weight(shape=(1,output_dim),initializer=initializer) self.bias_present = bias def __call__(self,inputs1,inputs2): if self.bias_present: return F.MatMul(inputs1,self.weight) + F.MatMul(inputs2,self.weight2) + self.bias else: return F.MatMul(inputs1,self.weight) + F.MatMul(inputs2,self.weight2) class Conv2D(Layer): def __init__(self,filter_shape,padding=0,stride=1,initializer=None): """ input – input tensor of shape (minibatch,in_channels,iH,iW) \n weight – filters of shape (out_channels,in_channels,kH,kW) \n bias – bias tensor of shape (out_channels). """ self.padding = padding self.stride = stride self.filter = Weight(filter_shape,initializer=initializer) self.bias = Weight(shape = filter_shape[0]) def __call__(self,inputs): return F.Conv2d(image_block=inputs, filters=self.filter, bias=self.bias, padding=self.padding, stride=self.stride ) class Dropout(Layer): def __init__(self,input_shape,keep_prob=0.8): self.input_shape = input_shape self.keep_prob = keep_prob def __call__(self,inputs): mask = torchInit.uniform_(torch.rand(self.input_shape)).type(inputs.value.type()) mask[mask < self.keep_prob] = 1 mask[mask != 1 ] = 0 return F.Dpout(inputs,mask)
0.890604
0.33292
import numpy as np from scipy.special import lpmv, gamma, hyp1f1, legendre from scipy.special.orthogonal import genlaguerre from scipy.misc import factorial import sh, spf # default parameters values _default_radial_order = spf._default_radial_order _default_angular_rank = sh._default_rank _default_zeta = spf._default_zeta class ModifiedSphericalPolarFourier: """This class implements the modified SPF basis, for the reconstruction of a continuous function. Parameters ---------- radial_order : int The radial truncation order of the mSPF basis. angular_rank : int The truncation rank of the angular part of the mSPF basis. zeta : float The scale parameter of the mSPF basis. """ def __init__(self, radial_order=_default_radial_order, angular_rank=_default_angular_rank, zeta=_default_zeta): self.radial_order = radial_order self.angular_rank = angular_rank self.zeta = zeta self.coefficients = np.zeros((self.radial_order, sh.dimension(self.angular_rank))) def get_angular_rank(self): return self._angular_rank def set_angular_rank(self, value): if value % 2 != 0: raise ValueError("'angular_rank' only accepts even values.") self._angular_rank = value angular_rank = property(get_angular_rank, set_angular_rank) def spherical_function(self, r, theta, phi): """The 3d function represented by the mSPF object. Parameters ---------- r : array-like, shape (K, ) The radii of the points in q-space where to compute the spherical function. theta : array-like, shape (K, ) The polar angles of the points in q-space where to compute the spherical function. phi : array-like, shape (K, ) The azimuthal angles of the points in q-space where to compute the spherical function. Returns ------- f : array-like, shape (K, ) The function computed at the points provided as input. """ result = 0.0 for n in range(self.radial_order - 1): if np.abs(self.coefficients[n]).max() > 0.0: sh_coefs = self.coefficients[n] spherical_harm = sh.SphericalHarmonics(sh_coefs) result += spherical_harm.angular_function(theta, phi) * \ radial_function(r, n, self.zeta) return result def matrix(r, theta, phi, radial_order=_default_radial_order, angular_rank=_default_angular_rank, zeta=_default_zeta): """Returns the spherical polar Fourier observation matrix for a given set of points represented by their spherical coordinates. Parameters ---------- r : array-like, shape (K, ) The radii of the points in q-space where to compute the spherical function. theta : array-like, shape (K, ) The polar angles of the points in q-space where to compute the spherical function. phi : array-like, shape (K, ) The azimuthal angles of the points in q-space where to compute the spherical function. radial_order : int The radial truncation order of the SPF basis. angular_rank : int The truncation rank of the angular part of the SPF basis. zeta : float The scale parameter of the mSPF basis. Returns ------- H : array-like, shape (K, R) The observation matrix corresponding to the point set passed as input. """ K = r.shape[0] H = np.zeros((K, radial_order - 1, sh.dimension(angular_rank))) b_n_j = ModifiedSphericalPolarFourier(radial_order, angular_rank, zeta) for n in range(H.shape[1]): for j in range(H.shape[2]): b_n_j.coefficients[:] = 0 b_n_j.coefficients[n, j] = 1.0 H[:, n, j] = b_n_j.spherical_function(r, theta, phi) return H.reshape(K, dimension(radial_order, angular_rank)) def to_spf_matrix(radial_order=_default_radial_order, angular_rank=_default_angular_rank, zeta=_default_zeta): "Computes the transition matrix from modified SPF basis to SPF basis." M = np.zeros((spf.dimension(radial_order, angular_rank), dimension(radial_order, angular_rank))) for i in range(M.shape[0]): n_i = spf.index_n(i, radial_order, angular_rank) l_i = spf.index_l(i, radial_order, angular_rank) m_i = spf.index_m(i, radial_order, angular_rank) kappa_ni = spf.kappa(zeta, n_i) for j in range(M.shape[1]): n_j = index_n(j, radial_order, angular_rank) l_j = index_l(j, radial_order, angular_rank) m_j = index_m(j, radial_order, angular_rank) chi_nj = chi(zeta, n_j) if (l_i == l_j and m_i == m_j): if n_i <= n_j: M[i, j] = 3 * chi_nj / (2 * kappa_ni) else: if n_i == n_j + 1: M[i, j] = - (n_j + 1) * chi_nj / kappa_ni return M def dimension(radial_order, angular_rank): "Returns the dimension of the truncated mSPF basis." return (radial_order - 1) * sh.dimension(angular_rank) index_i = spf.index_i index_n = spf.index_n index_l = spf.index_l index_m = spf.index_m def chi(zeta, n): "Returns the normalization constant of the mSPF basis." return np.sqrt(2 / zeta**1.5 * factorial(n) / gamma(n + 3.5)) def radial_function(r, n, zeta): "Computes the radial part of the mSPF basis." return genlaguerre(n, 2.5)(r**2 / zeta) * \ r**2 / zeta * np.exp(- r**2 / (2 * zeta)) * chi(zeta, n) def Lambda(radial_order, angular_rank, zeta=_default_zeta): """The Laplace regularization is computed by matrix multiplication (x-x0)^T Lambda (x-x0). """ max_degree = 2 * (radial_order + 1) gammas = gamma(np.arange(max_degree) + 0.5) dim = dimension(radial_order, angular_rank) L = np.zeros((dim, dim)) dim_sh = sh.dimension(angular_rank) for n1 in range(radial_order - 1): chi1 = chi(zeta, n1) for n2 in range(radial_order - 1): chi2 = chi(zeta, n2) for j1 in range(dim_sh): l1 = sh.index_l(j1) coeffs = __Tcoeffs(n1, n2, l1) degree = coeffs.shape[0] matrix_entry = chi1 * chi2 / (2 * np.sqrt(zeta)) * \ np.dot(coeffs, gammas[range(degree-1, -1, -1)]) for j2 in range(dim_sh): l2 = sh.index_l(j2) if j1 == j2: L[n1 * dim_sh + j1, n2 * dim_sh + j2] = matrix_entry return L def v(radial_order, angular_rank, zeta=_default_zeta): "The vector x0 for Laplace regularization is -Lambda^-1 v." max_degree = 2 * (radial_order + 1) gammas = gamma(np.arange(max_degree) + 0.5) dim = dimension(radial_order, angular_rank) v = np.zeros(dim) dim_sh = sh.dimension(angular_rank) for n in range(radial_order - 1): chi1 = chi(zeta, n) coeffs = __Tcoeffs(n, -1, 0) degree = coeffs.shape[0] v[n * dim_sh] = chi1 / (2 * np.sqrt(zeta)) \ * np.dot(coeffs, gammas[range(degree-1, -1, -1)]) return v def __F_n(n): """F_n(q) = \chi_n \exp(-q^2 / 2\zeta) P_n(q) and P_n(q) = q^2 / zeta * L_n^{5/2}(q^2 / zeta)""" if n == -1: return np.poly1d([1.0]) else: a = np.poly1d([1, 0.0, 0.0]) return a * genlaguerre(n, 2.5)(a) def __diffFn(p): """F_n'(q) = \chi_n \exp(-q^2 / 2\zeta) * (-q / \zeta * P_n(q) + P_n'(q))""" a = np.poly1d([-1, 0.0]) return a * p + p.deriv() def __h_i_poly(n, l): """h_i(q) = \chi_n \exp(-q^2 / 2\zeta) * h_i_poly(q)""" F0n = __F_n(n) F1n = __diffFn(F0n) F2n = __diffFn(F1n) a = np.poly1d([1.0, 0.0]) b = (F0n / a)[0] # Polynomial euclidian division return a * F2n + 2 * F1n - l * (l + 1) * b def __Tcoeffs(ni, nj, l): """The entry (i, j) of laplace matrix is $\chi_{n(i)}\chi_{n(j)} \int_0^\infty \exp(-q^2/\zeta) T_{i,j}(q^2/\zeta)\,\mathrm{d}q$. This function returns the coefficients of T.""" Tij = __h_i_poly(ni, l) * __h_i_poly(nj, l) degree = Tij.coeffs.shape[0] coeffs = Tij.coeffs[range(0, degree, 2)] return coeffs
qspace/bases/mspf.py
import numpy as np from scipy.special import lpmv, gamma, hyp1f1, legendre from scipy.special.orthogonal import genlaguerre from scipy.misc import factorial import sh, spf # default parameters values _default_radial_order = spf._default_radial_order _default_angular_rank = sh._default_rank _default_zeta = spf._default_zeta class ModifiedSphericalPolarFourier: """This class implements the modified SPF basis, for the reconstruction of a continuous function. Parameters ---------- radial_order : int The radial truncation order of the mSPF basis. angular_rank : int The truncation rank of the angular part of the mSPF basis. zeta : float The scale parameter of the mSPF basis. """ def __init__(self, radial_order=_default_radial_order, angular_rank=_default_angular_rank, zeta=_default_zeta): self.radial_order = radial_order self.angular_rank = angular_rank self.zeta = zeta self.coefficients = np.zeros((self.radial_order, sh.dimension(self.angular_rank))) def get_angular_rank(self): return self._angular_rank def set_angular_rank(self, value): if value % 2 != 0: raise ValueError("'angular_rank' only accepts even values.") self._angular_rank = value angular_rank = property(get_angular_rank, set_angular_rank) def spherical_function(self, r, theta, phi): """The 3d function represented by the mSPF object. Parameters ---------- r : array-like, shape (K, ) The radii of the points in q-space where to compute the spherical function. theta : array-like, shape (K, ) The polar angles of the points in q-space where to compute the spherical function. phi : array-like, shape (K, ) The azimuthal angles of the points in q-space where to compute the spherical function. Returns ------- f : array-like, shape (K, ) The function computed at the points provided as input. """ result = 0.0 for n in range(self.radial_order - 1): if np.abs(self.coefficients[n]).max() > 0.0: sh_coefs = self.coefficients[n] spherical_harm = sh.SphericalHarmonics(sh_coefs) result += spherical_harm.angular_function(theta, phi) * \ radial_function(r, n, self.zeta) return result def matrix(r, theta, phi, radial_order=_default_radial_order, angular_rank=_default_angular_rank, zeta=_default_zeta): """Returns the spherical polar Fourier observation matrix for a given set of points represented by their spherical coordinates. Parameters ---------- r : array-like, shape (K, ) The radii of the points in q-space where to compute the spherical function. theta : array-like, shape (K, ) The polar angles of the points in q-space where to compute the spherical function. phi : array-like, shape (K, ) The azimuthal angles of the points in q-space where to compute the spherical function. radial_order : int The radial truncation order of the SPF basis. angular_rank : int The truncation rank of the angular part of the SPF basis. zeta : float The scale parameter of the mSPF basis. Returns ------- H : array-like, shape (K, R) The observation matrix corresponding to the point set passed as input. """ K = r.shape[0] H = np.zeros((K, radial_order - 1, sh.dimension(angular_rank))) b_n_j = ModifiedSphericalPolarFourier(radial_order, angular_rank, zeta) for n in range(H.shape[1]): for j in range(H.shape[2]): b_n_j.coefficients[:] = 0 b_n_j.coefficients[n, j] = 1.0 H[:, n, j] = b_n_j.spherical_function(r, theta, phi) return H.reshape(K, dimension(radial_order, angular_rank)) def to_spf_matrix(radial_order=_default_radial_order, angular_rank=_default_angular_rank, zeta=_default_zeta): "Computes the transition matrix from modified SPF basis to SPF basis." M = np.zeros((spf.dimension(radial_order, angular_rank), dimension(radial_order, angular_rank))) for i in range(M.shape[0]): n_i = spf.index_n(i, radial_order, angular_rank) l_i = spf.index_l(i, radial_order, angular_rank) m_i = spf.index_m(i, radial_order, angular_rank) kappa_ni = spf.kappa(zeta, n_i) for j in range(M.shape[1]): n_j = index_n(j, radial_order, angular_rank) l_j = index_l(j, radial_order, angular_rank) m_j = index_m(j, radial_order, angular_rank) chi_nj = chi(zeta, n_j) if (l_i == l_j and m_i == m_j): if n_i <= n_j: M[i, j] = 3 * chi_nj / (2 * kappa_ni) else: if n_i == n_j + 1: M[i, j] = - (n_j + 1) * chi_nj / kappa_ni return M def dimension(radial_order, angular_rank): "Returns the dimension of the truncated mSPF basis." return (radial_order - 1) * sh.dimension(angular_rank) index_i = spf.index_i index_n = spf.index_n index_l = spf.index_l index_m = spf.index_m def chi(zeta, n): "Returns the normalization constant of the mSPF basis." return np.sqrt(2 / zeta**1.5 * factorial(n) / gamma(n + 3.5)) def radial_function(r, n, zeta): "Computes the radial part of the mSPF basis." return genlaguerre(n, 2.5)(r**2 / zeta) * \ r**2 / zeta * np.exp(- r**2 / (2 * zeta)) * chi(zeta, n) def Lambda(radial_order, angular_rank, zeta=_default_zeta): """The Laplace regularization is computed by matrix multiplication (x-x0)^T Lambda (x-x0). """ max_degree = 2 * (radial_order + 1) gammas = gamma(np.arange(max_degree) + 0.5) dim = dimension(radial_order, angular_rank) L = np.zeros((dim, dim)) dim_sh = sh.dimension(angular_rank) for n1 in range(radial_order - 1): chi1 = chi(zeta, n1) for n2 in range(radial_order - 1): chi2 = chi(zeta, n2) for j1 in range(dim_sh): l1 = sh.index_l(j1) coeffs = __Tcoeffs(n1, n2, l1) degree = coeffs.shape[0] matrix_entry = chi1 * chi2 / (2 * np.sqrt(zeta)) * \ np.dot(coeffs, gammas[range(degree-1, -1, -1)]) for j2 in range(dim_sh): l2 = sh.index_l(j2) if j1 == j2: L[n1 * dim_sh + j1, n2 * dim_sh + j2] = matrix_entry return L def v(radial_order, angular_rank, zeta=_default_zeta): "The vector x0 for Laplace regularization is -Lambda^-1 v." max_degree = 2 * (radial_order + 1) gammas = gamma(np.arange(max_degree) + 0.5) dim = dimension(radial_order, angular_rank) v = np.zeros(dim) dim_sh = sh.dimension(angular_rank) for n in range(radial_order - 1): chi1 = chi(zeta, n) coeffs = __Tcoeffs(n, -1, 0) degree = coeffs.shape[0] v[n * dim_sh] = chi1 / (2 * np.sqrt(zeta)) \ * np.dot(coeffs, gammas[range(degree-1, -1, -1)]) return v def __F_n(n): """F_n(q) = \chi_n \exp(-q^2 / 2\zeta) P_n(q) and P_n(q) = q^2 / zeta * L_n^{5/2}(q^2 / zeta)""" if n == -1: return np.poly1d([1.0]) else: a = np.poly1d([1, 0.0, 0.0]) return a * genlaguerre(n, 2.5)(a) def __diffFn(p): """F_n'(q) = \chi_n \exp(-q^2 / 2\zeta) * (-q / \zeta * P_n(q) + P_n'(q))""" a = np.poly1d([-1, 0.0]) return a * p + p.deriv() def __h_i_poly(n, l): """h_i(q) = \chi_n \exp(-q^2 / 2\zeta) * h_i_poly(q)""" F0n = __F_n(n) F1n = __diffFn(F0n) F2n = __diffFn(F1n) a = np.poly1d([1.0, 0.0]) b = (F0n / a)[0] # Polynomial euclidian division return a * F2n + 2 * F1n - l * (l + 1) * b def __Tcoeffs(ni, nj, l): """The entry (i, j) of laplace matrix is $\chi_{n(i)}\chi_{n(j)} \int_0^\infty \exp(-q^2/\zeta) T_{i,j}(q^2/\zeta)\,\mathrm{d}q$. This function returns the coefficients of T.""" Tij = __h_i_poly(ni, l) * __h_i_poly(nj, l) degree = Tij.coeffs.shape[0] coeffs = Tij.coeffs[range(0, degree, 2)] return coeffs
0.90198
0.571527
from selenium import webdriver from time import sleep class Filler(object): def __init__(self, key_pairs, submit_element, url_list, testing_mode): self.testing_mode = testing_mode self.key_pairs = key_pairs self.submit_element = submit_element self.url_list = url_list self.first_click = False self.first_click_el = "" self.popups = False self.popup_el = "" def fill(self): if self.testing_mode: options = webdriver.FirefoxOptions() options.accept_insecure_certs = True driver = webdriver.Firefox(firefox_options=options, ) else: options = webdriver.ChromeOptions() options.accept_insecure_certs = True options.headless = True options.add_argument('--no-sandbox') options.add_argument('--window-size=1920,1080') options.add_argument('--disable-gpu') driver = webdriver.Chrome(executable_path=r'/app/automator/chromedriver', chrome_options=options) driver.set_window_size(1920, 1080) driver.set_script_timeout(60) driver.set_page_load_timeout(90) print(self.key_pairs) for url in self.url_list: driver.get(url) driver.get_cookies() sleep(5) if self.popups: if isinstance(self.popup_el, list): for popup in self.popup_el: select = driver.find_element_by_xpath(popup) select.click() sleep(1) driver.switch_to.default_content() if self.first_click: if isinstance(self.first_click_el, list): for click in self.first_click_el: driver.get_cookies() sleep(5) clicking_first = driver.find_element_by_xpath(click) clicking_first.click() else: print(type(self.first_click_el)) driver.get_cookies() sleep(5) clicking_first = driver.find_element_by_xpath(self.first_click_el) clicking_first.click() for key in list(self.key_pairs.keys()): element = driver.find_element_by_xpath(key) element.send_keys(self.key_pairs[key]) sleep(0.3) if isinstance(self.submit_element, list): for el in self.submit_element: submit = driver.find_element_by_xpath(el) submit.click() sleep(0.3) sleep(5) else: submit = driver.find_element_by_xpath(self.submit_element) submit.click() sleep(5) print("Submitted {} out of {} contests".format(str(self.url_list.index(url)+1), str(len(self.url_list))))
automator/filler.py
from selenium import webdriver from time import sleep class Filler(object): def __init__(self, key_pairs, submit_element, url_list, testing_mode): self.testing_mode = testing_mode self.key_pairs = key_pairs self.submit_element = submit_element self.url_list = url_list self.first_click = False self.first_click_el = "" self.popups = False self.popup_el = "" def fill(self): if self.testing_mode: options = webdriver.FirefoxOptions() options.accept_insecure_certs = True driver = webdriver.Firefox(firefox_options=options, ) else: options = webdriver.ChromeOptions() options.accept_insecure_certs = True options.headless = True options.add_argument('--no-sandbox') options.add_argument('--window-size=1920,1080') options.add_argument('--disable-gpu') driver = webdriver.Chrome(executable_path=r'/app/automator/chromedriver', chrome_options=options) driver.set_window_size(1920, 1080) driver.set_script_timeout(60) driver.set_page_load_timeout(90) print(self.key_pairs) for url in self.url_list: driver.get(url) driver.get_cookies() sleep(5) if self.popups: if isinstance(self.popup_el, list): for popup in self.popup_el: select = driver.find_element_by_xpath(popup) select.click() sleep(1) driver.switch_to.default_content() if self.first_click: if isinstance(self.first_click_el, list): for click in self.first_click_el: driver.get_cookies() sleep(5) clicking_first = driver.find_element_by_xpath(click) clicking_first.click() else: print(type(self.first_click_el)) driver.get_cookies() sleep(5) clicking_first = driver.find_element_by_xpath(self.first_click_el) clicking_first.click() for key in list(self.key_pairs.keys()): element = driver.find_element_by_xpath(key) element.send_keys(self.key_pairs[key]) sleep(0.3) if isinstance(self.submit_element, list): for el in self.submit_element: submit = driver.find_element_by_xpath(el) submit.click() sleep(0.3) sleep(5) else: submit = driver.find_element_by_xpath(self.submit_element) submit.click() sleep(5) print("Submitted {} out of {} contests".format(str(self.url_list.index(url)+1), str(len(self.url_list))))
0.212722
0.059921
import os import sys import fcntl import errno import subprocess import typing import threading from . import utils, const, _pidlock from .exceptions import UpdaterInvalidHookCommandError def __run_command(command): def _fthread(file): while True: line = file.readline() if not line: break utils.report(line.decode(sys.getdefaultencoding())) utils.report('Running command: ' + command) process = subprocess.Popen(command, stderr=subprocess.PIPE, stdout=subprocess.PIPE, shell=True) tout = threading.Thread(target=_fthread, args=(process.stdout,)) terr = threading.Thread(target=_fthread, args=(process.stderr,)) tout.daemon = True terr.daemon = True tout.start() terr.start() exit_code = process.wait() if exit_code != 0: utils.report('Command failed with exit code: ' + str(exit_code)) def register(command: str): """Add given command (format is expected to be same as if you call subprocess.run) to be executed when updater exits. Note that this hook is executed no matter if updater passed or failed or even if it just requested user's approval. In all of those cases when updater exits this hook is executed. "commands" has to be single line shell script. """ if '\n' in command: raise UpdaterInvalidHookCommandError( "Argument register can be only single line string.") # Open file for writing and take exclusive lock file = os.open(const.POSTRUN_HOOK_FILE, os.O_WRONLY | os.O_CREAT | os.O_APPEND) fcntl.lockf(file, fcntl.LOCK_EX) # Check if we are working with existing file invalid = False try: if os.fstat(file).st_ino != os.stat(const.POSTRUN_HOOK_FILE).st_ino: invalid = True except OSError as excp: if excp.errno == errno.ENOENT: invalid = True raise if invalid: # File was removed before we locked it os.close(file) register(command) return if not _pidlock.pid_locked(): # Check if updater is running os.close(file) # If there is no running instance then just run given command __run_command(command) return # Append given arguments to file # Note: This takes ownership of file and automatically closes it. (at least # it seems that way) with os.fdopen(file, 'w') as fhook: fhook.write(command + '\n') utils.report('Postrun hook registered: ' + command) def register_list(commands: typing.Iterable[str]): """Same as register but it allows multiple commands to be registered at once. """ if commands is not None: for cmd in commands: register(cmd) def _run(): """Run all registered commands. """ # Open file for reading and take exclusive lock try: file = os.open(const.POSTRUN_HOOK_FILE, os.O_RDWR) except OSError as excp: if excp.errno == errno.ENOENT: return # No file means nothing to do raise fcntl.lockf(file, fcntl.LOCK_EX) # Note: nobody except us should be able to remove this file (because we # should hold pidlock) so we don't have to check if file we opened is still # on FS. with os.fdopen(file, 'r') as fhook: for line in fhook.readlines(): __run_command(line) os.remove(const.POSTRUN_HOOK_FILE)
svupdater/hook.py
import os import sys import fcntl import errno import subprocess import typing import threading from . import utils, const, _pidlock from .exceptions import UpdaterInvalidHookCommandError def __run_command(command): def _fthread(file): while True: line = file.readline() if not line: break utils.report(line.decode(sys.getdefaultencoding())) utils.report('Running command: ' + command) process = subprocess.Popen(command, stderr=subprocess.PIPE, stdout=subprocess.PIPE, shell=True) tout = threading.Thread(target=_fthread, args=(process.stdout,)) terr = threading.Thread(target=_fthread, args=(process.stderr,)) tout.daemon = True terr.daemon = True tout.start() terr.start() exit_code = process.wait() if exit_code != 0: utils.report('Command failed with exit code: ' + str(exit_code)) def register(command: str): """Add given command (format is expected to be same as if you call subprocess.run) to be executed when updater exits. Note that this hook is executed no matter if updater passed or failed or even if it just requested user's approval. In all of those cases when updater exits this hook is executed. "commands" has to be single line shell script. """ if '\n' in command: raise UpdaterInvalidHookCommandError( "Argument register can be only single line string.") # Open file for writing and take exclusive lock file = os.open(const.POSTRUN_HOOK_FILE, os.O_WRONLY | os.O_CREAT | os.O_APPEND) fcntl.lockf(file, fcntl.LOCK_EX) # Check if we are working with existing file invalid = False try: if os.fstat(file).st_ino != os.stat(const.POSTRUN_HOOK_FILE).st_ino: invalid = True except OSError as excp: if excp.errno == errno.ENOENT: invalid = True raise if invalid: # File was removed before we locked it os.close(file) register(command) return if not _pidlock.pid_locked(): # Check if updater is running os.close(file) # If there is no running instance then just run given command __run_command(command) return # Append given arguments to file # Note: This takes ownership of file and automatically closes it. (at least # it seems that way) with os.fdopen(file, 'w') as fhook: fhook.write(command + '\n') utils.report('Postrun hook registered: ' + command) def register_list(commands: typing.Iterable[str]): """Same as register but it allows multiple commands to be registered at once. """ if commands is not None: for cmd in commands: register(cmd) def _run(): """Run all registered commands. """ # Open file for reading and take exclusive lock try: file = os.open(const.POSTRUN_HOOK_FILE, os.O_RDWR) except OSError as excp: if excp.errno == errno.ENOENT: return # No file means nothing to do raise fcntl.lockf(file, fcntl.LOCK_EX) # Note: nobody except us should be able to remove this file (because we # should hold pidlock) so we don't have to check if file we opened is still # on FS. with os.fdopen(file, 'r') as fhook: for line in fhook.readlines(): __run_command(line) os.remove(const.POSTRUN_HOOK_FILE)
0.23926
0.101411
from django.conf import settings from django.conf.urls import include, url from django.views.decorators.cache import cache_page from .feeds import ArticleFeed from .views import SourceSearchView, HomepageView, SlackMessageView from haystack.forms import SearchForm from haystack.query import SearchQuerySet from haystack.views import search_view_factory from source.articles.views import ArticleList, ArticleDetail from source.utils.caching import ClearCache STANDARD_CACHE_TIME = getattr(settings, 'CACHE_MIDDLEWARE_SECONDS', 60*15) FEED_CACHE_TIME = getattr(settings, 'FEED_CACHE_SECONDS', 60*15) BASE_URLS = [ url( regex = '^$', view = cache_page(STANDARD_CACHE_TIME)(HomepageView.as_view(template_name='homepage.html')), kwargs = {}, name = 'homepage', ), url(r'^articles/', include('source.articles.urls')), url(r'^code/', include('source.code.urls')), url(r'^guides/', include('source.guides.urls')), url(r'^jobs/', include('source.jobs.urls')), url(r'^organizations/', include('source.people.urls.organizations')), url(r'^people/', include('source.people.urls.people')), url( regex = '^search/$', view = search_view_factory(view_class=SourceSearchView, form_class=SearchForm, searchqueryset=SearchQuerySet().order_by('django_ct')), kwargs = {}, name = 'haystack_search', ), url( regex = '^clear-cache/$', view = ClearCache.as_view(), kwargs = {}, name = 'clear_cache', ), url( regex = '^send-to-slack/$', view = SlackMessageView.as_view(), kwargs = {}, name = 'send_to_slack', ), url( regex = '^rss/$', view = cache_page(FEED_CACHE_TIME)(ArticleFeed()), kwargs = {}, name = 'homepage_feed', ), url( regex = '^category/(?P<category>[-\w]+)/$', view = cache_page(STANDARD_CACHE_TIME)(ArticleList.as_view()), kwargs = {}, name = 'article_list_by_category', ), url( regex = '^category/(?P<category>[-\w]+)/rss/$', view = cache_page(FEED_CACHE_TIME)(ArticleFeed()), kwargs = {}, name = 'article_list_by_category_feed', ), url( regex = '^(?P<section>[-\w]+)/$', view = cache_page(STANDARD_CACHE_TIME)(ArticleList.as_view()), kwargs = {}, name = 'article_list_by_section', ), url( regex = '^(?P<section>[-\w]+)/rss/$', view = cache_page(FEED_CACHE_TIME)(ArticleFeed()), kwargs = {}, name = 'article_list_by_section_feed', ), url( regex = '^(?P<section>[-\w]+)/(?P<slug>[-\w]+)/$', view = cache_page(STANDARD_CACHE_TIME)(ArticleDetail.as_view()), kwargs = {}, name = 'article_detail', ), ]
source/base/urls.py
from django.conf import settings from django.conf.urls import include, url from django.views.decorators.cache import cache_page from .feeds import ArticleFeed from .views import SourceSearchView, HomepageView, SlackMessageView from haystack.forms import SearchForm from haystack.query import SearchQuerySet from haystack.views import search_view_factory from source.articles.views import ArticleList, ArticleDetail from source.utils.caching import ClearCache STANDARD_CACHE_TIME = getattr(settings, 'CACHE_MIDDLEWARE_SECONDS', 60*15) FEED_CACHE_TIME = getattr(settings, 'FEED_CACHE_SECONDS', 60*15) BASE_URLS = [ url( regex = '^$', view = cache_page(STANDARD_CACHE_TIME)(HomepageView.as_view(template_name='homepage.html')), kwargs = {}, name = 'homepage', ), url(r'^articles/', include('source.articles.urls')), url(r'^code/', include('source.code.urls')), url(r'^guides/', include('source.guides.urls')), url(r'^jobs/', include('source.jobs.urls')), url(r'^organizations/', include('source.people.urls.organizations')), url(r'^people/', include('source.people.urls.people')), url( regex = '^search/$', view = search_view_factory(view_class=SourceSearchView, form_class=SearchForm, searchqueryset=SearchQuerySet().order_by('django_ct')), kwargs = {}, name = 'haystack_search', ), url( regex = '^clear-cache/$', view = ClearCache.as_view(), kwargs = {}, name = 'clear_cache', ), url( regex = '^send-to-slack/$', view = SlackMessageView.as_view(), kwargs = {}, name = 'send_to_slack', ), url( regex = '^rss/$', view = cache_page(FEED_CACHE_TIME)(ArticleFeed()), kwargs = {}, name = 'homepage_feed', ), url( regex = '^category/(?P<category>[-\w]+)/$', view = cache_page(STANDARD_CACHE_TIME)(ArticleList.as_view()), kwargs = {}, name = 'article_list_by_category', ), url( regex = '^category/(?P<category>[-\w]+)/rss/$', view = cache_page(FEED_CACHE_TIME)(ArticleFeed()), kwargs = {}, name = 'article_list_by_category_feed', ), url( regex = '^(?P<section>[-\w]+)/$', view = cache_page(STANDARD_CACHE_TIME)(ArticleList.as_view()), kwargs = {}, name = 'article_list_by_section', ), url( regex = '^(?P<section>[-\w]+)/rss/$', view = cache_page(FEED_CACHE_TIME)(ArticleFeed()), kwargs = {}, name = 'article_list_by_section_feed', ), url( regex = '^(?P<section>[-\w]+)/(?P<slug>[-\w]+)/$', view = cache_page(STANDARD_CACHE_TIME)(ArticleDetail.as_view()), kwargs = {}, name = 'article_detail', ), ]
0.358241
0.11353
# See TRANSFORMATIONS.md file for details import json from pierky.p2es.errors import P2ESError # Parse list of conditions c against data d. # Returns: True | False (conditions matched / did not match). # Raises exceptions: yes. def parse_conditions_list(c, d): if not c: raise P2ESError('Empty list') if isinstance(c[0], basestring): if c[0] == 'AND': if len(c) > 2: for sub_c in c[1:]: if not parse_conditions(sub_c, d): return False return True else: return False elif c[0] == 'OR': if len(c) > 2: for sub_c in c[1:]: if parse_conditions(sub_c, d): return True return False else: return True else: raise P2ESError( 'Logical groups must begin with "AND" or "OR" ' '("{}" found)'.format(c[0]) ) else: # default to "AND" if not specified for sub_c in c: if not parse_conditions(sub_c, d): return False return True # Parse condition c against data d, using operator opfield. # Returns: True | False (condition matched / did not match). # Raises exceptions: yes. def parse_conditions_dict(c, d, opfield): op = '=' n = None v = None for k in c: if k == opfield: op = c[k] if not op in ('=', '>', '>=', '<', '<=', '!=', 'in', 'notin'): raise P2ESError('Unexpected operator: "{}"'.format(op)) else: if n is None: n = k v = c[k] else: raise P2ESError('Only one name/value pair allowed') if op in ('in', 'notin') and not isinstance(v, list): raise P2ESError('The "{}" operator requires a list'.format(op)) if n is None: raise P2ESError('Name/value pair expected') if n not in d: return False if op == '=': return d[n] == v elif op == '>': return d[n] > v elif op == '>=': return d[n] >= v elif op == '<': return d[n] < v elif op == '<=': return d[n] <= v elif op == '!=': return d[n] != v elif op == 'in': return d[n] in v elif op == 'notin': return not d[n] in v else: raise P2ESError('Operator not implemented: "{}"'.format(op)) # Parse conditions c against data d. # Return: True | False (conditions matched / did not match). # Raises exception: yes. def parse_conditions(c, d, opfield='__op__'): if isinstance(c, list): return parse_conditions_list(c, d) elif isinstance(c, dict): return parse_conditions_dict(c, d, opfield) else: raise P2ESError('Unexpected object type {} from {}'.format( type(c), str(c) )) # Tests if a transformation syntax is valid. # Returns: True | False. # Raises exceptions: yes. def test_transformation(tr): ret = True try: tr_det = 'Transformations matrix ({})'.format(transformation) except: tr_det = 'Transformations matrix' if 'Conditions' not in tr: raise P2ESError('{}, "Conditions" is missing'.format(tr_det)) if 'Actions' not in tr: raise P2ESError('{}, "Actions" is missing'.format(tr_det)) try: parse_conditions(tr['Conditions'], {}) except P2ESError as e: raise P2ESError('{}, invalid "Conditions": {}'.format(tr_det, str(e))) for action in tr['Actions']: if 'Type' not in action: raise P2ESError('{}, "Type" is missing'.format(tr_det)) tr_det += ', action type = {}'.format(action['Type']) if action['Type'] not in ('AddField', 'AddFieldLookup', 'DelField'): raise P2ESError('{}, "Type" unknown'.format(tr_det)) if 'Name' not in action: raise P2ESError('{}, "Name" is missing'.format(tr_det)) if action['Type'] == 'AddField': if 'Value' not in action: raise P2ESError( '{}, "Value" is missing for new field "{}"'.format( tr_det, action['Name'] ) ) if action['Type'] == 'AddFieldLookup': if 'LookupFieldName' not in action: raise P2ESError( '{}, "LookupFieldName" is missing for ' 'new field "{}"'.format(tr_det, action['Name']) ) if 'LookupTable' in action and 'LookupTableFile' in action: raise P2ESError( '{}, only one from "LookupTable" and ' '"LookupTableFile" allowed'.format(tr_det) ) if 'LookupTable' not in action and 'LookupTableFile' not in action: raise P2ESError( '{}, "LookupTable" and "LookupTableFile" missing ' 'for new field "{}"'.format(tr_det, action['Name']) ) if 'LookupTableFile' in action: try: with open(action['LookupTableFile'], "r") as f: action['LookupTable'] = json.load(f) except Exception as e: raise P2ESError( '{}, error loading lookup table from {}: {}'.format( tr_det, action['LookupTableFile'], str(e) ) ) if __name__ == '__main__': #Test conditions #------------------- #C = [ { "Name": "Bob" }, { "Age": 16, "__op__": ">=" } ] #C = [ "OR", { "Name": "Bob" }, { "Name": "Tom" } ] C = [ "OR", [ { "Name": "Bob" }, { "Age": 16, "__op__": ">=" } ], { "Name": "Tom" }, [ { "Name": "Lisa" }, { "Age": 20, "__op__": ">=" } ] ] #C = [ "Invalid" ] Data = [ { "Name": "Bob", "Age": 15 }, { "Name": "Bob", "Age": 16 }, { "Name": "Ken", "Age": 14 }, { "Name": "Tom", "Age": 14 }, { "Name": "Tom", "Age": 20 }, { "Name": "Lisa", "Age": 15 }, { "Name": "Lisa", "Age": 22 } ] print(C) for Person in Data: try: if parse_conditions(C, Person): print( "YES - %s" % Person ) else: print( "--- - %s" % Person ) except P2ESError as e: print( "ParseConditions error: %s" % str(e) ) raise
pierky/p2es/transformations.py
# See TRANSFORMATIONS.md file for details import json from pierky.p2es.errors import P2ESError # Parse list of conditions c against data d. # Returns: True | False (conditions matched / did not match). # Raises exceptions: yes. def parse_conditions_list(c, d): if not c: raise P2ESError('Empty list') if isinstance(c[0], basestring): if c[0] == 'AND': if len(c) > 2: for sub_c in c[1:]: if not parse_conditions(sub_c, d): return False return True else: return False elif c[0] == 'OR': if len(c) > 2: for sub_c in c[1:]: if parse_conditions(sub_c, d): return True return False else: return True else: raise P2ESError( 'Logical groups must begin with "AND" or "OR" ' '("{}" found)'.format(c[0]) ) else: # default to "AND" if not specified for sub_c in c: if not parse_conditions(sub_c, d): return False return True # Parse condition c against data d, using operator opfield. # Returns: True | False (condition matched / did not match). # Raises exceptions: yes. def parse_conditions_dict(c, d, opfield): op = '=' n = None v = None for k in c: if k == opfield: op = c[k] if not op in ('=', '>', '>=', '<', '<=', '!=', 'in', 'notin'): raise P2ESError('Unexpected operator: "{}"'.format(op)) else: if n is None: n = k v = c[k] else: raise P2ESError('Only one name/value pair allowed') if op in ('in', 'notin') and not isinstance(v, list): raise P2ESError('The "{}" operator requires a list'.format(op)) if n is None: raise P2ESError('Name/value pair expected') if n not in d: return False if op == '=': return d[n] == v elif op == '>': return d[n] > v elif op == '>=': return d[n] >= v elif op == '<': return d[n] < v elif op == '<=': return d[n] <= v elif op == '!=': return d[n] != v elif op == 'in': return d[n] in v elif op == 'notin': return not d[n] in v else: raise P2ESError('Operator not implemented: "{}"'.format(op)) # Parse conditions c against data d. # Return: True | False (conditions matched / did not match). # Raises exception: yes. def parse_conditions(c, d, opfield='__op__'): if isinstance(c, list): return parse_conditions_list(c, d) elif isinstance(c, dict): return parse_conditions_dict(c, d, opfield) else: raise P2ESError('Unexpected object type {} from {}'.format( type(c), str(c) )) # Tests if a transformation syntax is valid. # Returns: True | False. # Raises exceptions: yes. def test_transformation(tr): ret = True try: tr_det = 'Transformations matrix ({})'.format(transformation) except: tr_det = 'Transformations matrix' if 'Conditions' not in tr: raise P2ESError('{}, "Conditions" is missing'.format(tr_det)) if 'Actions' not in tr: raise P2ESError('{}, "Actions" is missing'.format(tr_det)) try: parse_conditions(tr['Conditions'], {}) except P2ESError as e: raise P2ESError('{}, invalid "Conditions": {}'.format(tr_det, str(e))) for action in tr['Actions']: if 'Type' not in action: raise P2ESError('{}, "Type" is missing'.format(tr_det)) tr_det += ', action type = {}'.format(action['Type']) if action['Type'] not in ('AddField', 'AddFieldLookup', 'DelField'): raise P2ESError('{}, "Type" unknown'.format(tr_det)) if 'Name' not in action: raise P2ESError('{}, "Name" is missing'.format(tr_det)) if action['Type'] == 'AddField': if 'Value' not in action: raise P2ESError( '{}, "Value" is missing for new field "{}"'.format( tr_det, action['Name'] ) ) if action['Type'] == 'AddFieldLookup': if 'LookupFieldName' not in action: raise P2ESError( '{}, "LookupFieldName" is missing for ' 'new field "{}"'.format(tr_det, action['Name']) ) if 'LookupTable' in action and 'LookupTableFile' in action: raise P2ESError( '{}, only one from "LookupTable" and ' '"LookupTableFile" allowed'.format(tr_det) ) if 'LookupTable' not in action and 'LookupTableFile' not in action: raise P2ESError( '{}, "LookupTable" and "LookupTableFile" missing ' 'for new field "{}"'.format(tr_det, action['Name']) ) if 'LookupTableFile' in action: try: with open(action['LookupTableFile'], "r") as f: action['LookupTable'] = json.load(f) except Exception as e: raise P2ESError( '{}, error loading lookup table from {}: {}'.format( tr_det, action['LookupTableFile'], str(e) ) ) if __name__ == '__main__': #Test conditions #------------------- #C = [ { "Name": "Bob" }, { "Age": 16, "__op__": ">=" } ] #C = [ "OR", { "Name": "Bob" }, { "Name": "Tom" } ] C = [ "OR", [ { "Name": "Bob" }, { "Age": 16, "__op__": ">=" } ], { "Name": "Tom" }, [ { "Name": "Lisa" }, { "Age": 20, "__op__": ">=" } ] ] #C = [ "Invalid" ] Data = [ { "Name": "Bob", "Age": 15 }, { "Name": "Bob", "Age": 16 }, { "Name": "Ken", "Age": 14 }, { "Name": "Tom", "Age": 14 }, { "Name": "Tom", "Age": 20 }, { "Name": "Lisa", "Age": 15 }, { "Name": "Lisa", "Age": 22 } ] print(C) for Person in Data: try: if parse_conditions(C, Person): print( "YES - %s" % Person ) else: print( "--- - %s" % Person ) except P2ESError as e: print( "ParseConditions error: %s" % str(e) ) raise
0.569613
0.320476
class WarthogError(Exception): """Base for all errors raised by the Warthog library.""" def __init__(self, msg): super(WarthogError, self).__init__() self.msg = msg def __str__(self): return self.msg class WarthogConfigError(WarthogError): """Base for errors raised while parsing or loading configuration.""" class WarthogNoConfigFileError(WarthogConfigError): """No configuration file could be found.""" def __init__(self, msg, locations_checked=None): super(WarthogNoConfigFileError, self).__init__(msg) self.locations_checked = list(locations_checked) if locations_checked is not None else [] def __str__(self): out = [self.msg] if self.locations_checked is not None: out.append('Locations checked: ' + ', '.join(self.locations_checked)) return '. '.join(out) class WarthogMalformedConfigFileError(WarthogConfigError): """The configuration file is missing required sections or fields.""" def __init__(self, msg, missing_section=None, missing_option=None): super(WarthogMalformedConfigFileError, self).__init__(msg) self.missing_section = missing_section self.missing_option = missing_option def __str__(self): out = [self.msg] if self.missing_section is not None: out.append('Missing-section: {0}'.format(self.missing_section)) if self.missing_option is not None: out.append('Missing-option: {0}'.format(self.missing_option)) return '. '.join(out) class WarthogApiError(WarthogError): """Base for errors raised in the course of interacting with the load balancer.""" def __init__(self, msg, api_msg=None, api_code=None): super(WarthogApiError, self).__init__(msg) self.api_msg = api_msg self.api_code = api_code def __str__(self): out = [self.msg] if self.api_msg is not None: # Some error messages from the A10 end with a period, others don't out.append('API-message: {0}'.format(self.api_msg.rstrip('.'))) if self.api_code is not None: out.append('API-code: {0}'.format(self.api_code)) return '. '.join(out) class WarthogAuthFailureError(WarthogApiError): """The credentials for authentication are invalid.""" class WarthogInvalidSessionError(WarthogApiError): """The session ID or auth token used while performing some action is unrecognized.""" class WarthogNodeError(WarthogApiError): """Base for errors specific to operating on some individual node.""" def __init__(self, msg, api_msg=None, api_code=None, server=None): super(WarthogNodeError, self).__init__(msg, api_msg=api_msg, api_code=api_code) self.server = server class WarthogNoSuchNodeError(WarthogNodeError): """The host being operated on is unrecognized.""" class WarthogPermissionError(WarthogNodeError): """The credentials lack required permissions to perform an operation. .. versionadded:: 1.999.0 """ class WarthogNodeStatusError(WarthogNodeError): """There was some error while getting the status of a node."""
warthog/exceptions.py
class WarthogError(Exception): """Base for all errors raised by the Warthog library.""" def __init__(self, msg): super(WarthogError, self).__init__() self.msg = msg def __str__(self): return self.msg class WarthogConfigError(WarthogError): """Base for errors raised while parsing or loading configuration.""" class WarthogNoConfigFileError(WarthogConfigError): """No configuration file could be found.""" def __init__(self, msg, locations_checked=None): super(WarthogNoConfigFileError, self).__init__(msg) self.locations_checked = list(locations_checked) if locations_checked is not None else [] def __str__(self): out = [self.msg] if self.locations_checked is not None: out.append('Locations checked: ' + ', '.join(self.locations_checked)) return '. '.join(out) class WarthogMalformedConfigFileError(WarthogConfigError): """The configuration file is missing required sections or fields.""" def __init__(self, msg, missing_section=None, missing_option=None): super(WarthogMalformedConfigFileError, self).__init__(msg) self.missing_section = missing_section self.missing_option = missing_option def __str__(self): out = [self.msg] if self.missing_section is not None: out.append('Missing-section: {0}'.format(self.missing_section)) if self.missing_option is not None: out.append('Missing-option: {0}'.format(self.missing_option)) return '. '.join(out) class WarthogApiError(WarthogError): """Base for errors raised in the course of interacting with the load balancer.""" def __init__(self, msg, api_msg=None, api_code=None): super(WarthogApiError, self).__init__(msg) self.api_msg = api_msg self.api_code = api_code def __str__(self): out = [self.msg] if self.api_msg is not None: # Some error messages from the A10 end with a period, others don't out.append('API-message: {0}'.format(self.api_msg.rstrip('.'))) if self.api_code is not None: out.append('API-code: {0}'.format(self.api_code)) return '. '.join(out) class WarthogAuthFailureError(WarthogApiError): """The credentials for authentication are invalid.""" class WarthogInvalidSessionError(WarthogApiError): """The session ID or auth token used while performing some action is unrecognized.""" class WarthogNodeError(WarthogApiError): """Base for errors specific to operating on some individual node.""" def __init__(self, msg, api_msg=None, api_code=None, server=None): super(WarthogNodeError, self).__init__(msg, api_msg=api_msg, api_code=api_code) self.server = server class WarthogNoSuchNodeError(WarthogNodeError): """The host being operated on is unrecognized.""" class WarthogPermissionError(WarthogNodeError): """The credentials lack required permissions to perform an operation. .. versionadded:: 1.999.0 """ class WarthogNodeStatusError(WarthogNodeError): """There was some error while getting the status of a node."""
0.930553
0.064477
import logging from util.bleu import Bleu # validating metrics: bleu (referenced open codes on Github) class MetricWrapper: " Validate Metrics wrapper. " def __init__(self, index2words, start_symbol, end_symbol, pad_symbol, metric=Bleu()): ''' Args: index2words: (dict) e.g. start_symbol: (str of int / int) should be the id of start symbol. end_symbol: (str of int / int) should be the id of end symbol. pad_symbol: (str of int / int) should be the id of pad symbol. metric: (class) only support Bleu() now ''' self.index2words = index2words self.metric = metric self.Ngram = metric.n if isinstance(start_symbol, str) and start_symbol.isnumeric(): self.start_symbol = int(start_symbol) elif isinstance(start_symbol, int): self.start_symbol = start_symbol else: raise ValueError(f"Invalid start_symbol:{start_symbol}") if isinstance(end_symbol, str) and end_symbol.isnumeric(): self.end_symbol = int(end_symbol) elif isinstance(end_symbol, int): self.end_symbol = end_symbol else: raise ValueError(f"Invalid end_symbol:{end_symbol}") if isinstance(pad_symbol, str) and pad_symbol.isnumeric(): self.pad_symbol = int(pad_symbol) elif isinstance(pad_symbol, int): self.pad_symbol = pad_symbol else: raise ValueError(f"Invalid pad_symbol:{pad_symbol}") def intarr2str(self, intarr): ''' Add logics of processing the int array of sequences. Cut off the <START>, <END>, <PAD>. Args: intarr: (ndarray) with int elements Returns: strlist: (nested lists of words) [["a","b","c"], ["g","h","j"], ] ''' strlist = [] for item in intarr: strlist_ = [] for wordid in item: if wordid == self.start_symbol: #TODO strlist_ = [self.index2words[str(self.start_symbol)]] continue if wordid == self.end_symbol or wordid == self.pad_symbol: break strlist_.append(self.index2words[str(wordid)]) if len(strlist_)<1: strlist.append(None) logging.error(f"MetricWrapper: strlist_ is None.") else: strlist.append(strlist_) return strlist def __call__(self, out, trg): assert out.shape[0] == trg.shape[0], f"out:{out.shape[0]} trg:{trg.shape[0]}, dim-1 of out and trg must be the same." candidate_list = self.intarr2str(out.cpu().numpy()) # [["a","b","c"], ["g","h","j"], ] reference_list = self.intarr2str(trg.cpu().numpy()) # [["a","b","c"], ["g","h","j"], ] scores, _ = self.metric(candidates=candidate_list, references=reference_list) # scores: [[0.7, 0.6, 0.5, 0.2], [0.5, 0.5, 0.4, 0.1]] return scores
util/metricwrapper.py
import logging from util.bleu import Bleu # validating metrics: bleu (referenced open codes on Github) class MetricWrapper: " Validate Metrics wrapper. " def __init__(self, index2words, start_symbol, end_symbol, pad_symbol, metric=Bleu()): ''' Args: index2words: (dict) e.g. start_symbol: (str of int / int) should be the id of start symbol. end_symbol: (str of int / int) should be the id of end symbol. pad_symbol: (str of int / int) should be the id of pad symbol. metric: (class) only support Bleu() now ''' self.index2words = index2words self.metric = metric self.Ngram = metric.n if isinstance(start_symbol, str) and start_symbol.isnumeric(): self.start_symbol = int(start_symbol) elif isinstance(start_symbol, int): self.start_symbol = start_symbol else: raise ValueError(f"Invalid start_symbol:{start_symbol}") if isinstance(end_symbol, str) and end_symbol.isnumeric(): self.end_symbol = int(end_symbol) elif isinstance(end_symbol, int): self.end_symbol = end_symbol else: raise ValueError(f"Invalid end_symbol:{end_symbol}") if isinstance(pad_symbol, str) and pad_symbol.isnumeric(): self.pad_symbol = int(pad_symbol) elif isinstance(pad_symbol, int): self.pad_symbol = pad_symbol else: raise ValueError(f"Invalid pad_symbol:{pad_symbol}") def intarr2str(self, intarr): ''' Add logics of processing the int array of sequences. Cut off the <START>, <END>, <PAD>. Args: intarr: (ndarray) with int elements Returns: strlist: (nested lists of words) [["a","b","c"], ["g","h","j"], ] ''' strlist = [] for item in intarr: strlist_ = [] for wordid in item: if wordid == self.start_symbol: #TODO strlist_ = [self.index2words[str(self.start_symbol)]] continue if wordid == self.end_symbol or wordid == self.pad_symbol: break strlist_.append(self.index2words[str(wordid)]) if len(strlist_)<1: strlist.append(None) logging.error(f"MetricWrapper: strlist_ is None.") else: strlist.append(strlist_) return strlist def __call__(self, out, trg): assert out.shape[0] == trg.shape[0], f"out:{out.shape[0]} trg:{trg.shape[0]}, dim-1 of out and trg must be the same." candidate_list = self.intarr2str(out.cpu().numpy()) # [["a","b","c"], ["g","h","j"], ] reference_list = self.intarr2str(trg.cpu().numpy()) # [["a","b","c"], ["g","h","j"], ] scores, _ = self.metric(candidates=candidate_list, references=reference_list) # scores: [[0.7, 0.6, 0.5, 0.2], [0.5, 0.5, 0.4, 0.1]] return scores
0.489503
0.237852
from django.template.base import VariableDoesNotExist EXCLUDE_EXCEPTIONS = [ VariableDoesNotExist, ] # Lowercase only EXCLUDE_PHRASES = [ 'invalid http_host header', ] def filter_exc_by_type(record): """Exclude blacklisted exception types.""" if record.exc_info: exc = record.exc_info[1] for excluded in EXCLUDE_EXCEPTIONS: if isinstance(exc, excluded): return False return True def filter_exc_by_phrase(record): """Exclude exceptions based on string content.""" for phrase in EXCLUDE_PHRASES: if phrase in record.msg.lower(): return False return True def configure_logging(LOG_ROOT): """Return logging configuration.""" return { 'version': 1, 'disable_existing_loggers': True, 'formatters': { 'verbose': { 'format': '{levelname} | {asctime} | {module}: {message}', 'style': '{', }, }, 'filters': { 'filter_exc_by_type': { '()': 'django.utils.log.CallbackFilter', 'callback': filter_exc_by_type, }, 'filter_exc_by_phrase': { '()': 'django.utils.log.CallbackFilter', 'callback': filter_exc_by_phrase, }, }, 'handlers': { 'debug_file': { 'delay': True, 'level': 'DEBUG', 'class': 'logging.handlers.RotatingFileHandler', 'maxBytes': 1000000, # 1MB ~ 20k rows 'backupCount': 5, 'filename': LOG_ROOT / 'debug.log', 'formatter': 'verbose', 'filters': ['filter_exc_by_type'], }, 'main_file': { 'delay': True, 'level': 'INFO', 'class': 'logging.handlers.RotatingFileHandler', 'maxBytes': 1000000, # 1MB ~ 20k rows 'backupCount': 5, 'filename': LOG_ROOT / 'main.log', 'formatter': 'verbose', }, 'error_file': { 'delay': True, 'level': 'ERROR', 'class': 'logging.handlers.RotatingFileHandler', 'maxBytes': 1000000, # 1MB ~ 20k rows 'backupCount': 5, 'filename': LOG_ROOT / 'error.log', 'formatter': 'verbose', }, 'error_mail': { 'level': 'ERROR', 'class': 'django.utils.log.AdminEmailHandler', 'formatter': 'verbose', 'filters': ['filter_exc_by_phrase'], }, 'error_slack': { # Credentials are read directly from .env 'level': 'ERROR', 'class': 'webapp.settings.log.handlers.SlackHandler', 'filters': ['filter_exc_by_phrase'], }, 'console': { 'class': 'logging.StreamHandler', 'level': 'INFO', 'formatter': 'verbose', }, }, 'loggers': { 'django': { 'handlers': [ 'debug_file', 'main_file', 'error_file', 'error_mail', 'error_slack', 'console' ], 'level': 'DEBUG', 'propagate': True, }, 'django.utils.autoreload': { 'level': 'WARNING', # This logger is way too noisy on DEBUG } }, }
webapp/webapp/settings/log/config.py
from django.template.base import VariableDoesNotExist EXCLUDE_EXCEPTIONS = [ VariableDoesNotExist, ] # Lowercase only EXCLUDE_PHRASES = [ 'invalid http_host header', ] def filter_exc_by_type(record): """Exclude blacklisted exception types.""" if record.exc_info: exc = record.exc_info[1] for excluded in EXCLUDE_EXCEPTIONS: if isinstance(exc, excluded): return False return True def filter_exc_by_phrase(record): """Exclude exceptions based on string content.""" for phrase in EXCLUDE_PHRASES: if phrase in record.msg.lower(): return False return True def configure_logging(LOG_ROOT): """Return logging configuration.""" return { 'version': 1, 'disable_existing_loggers': True, 'formatters': { 'verbose': { 'format': '{levelname} | {asctime} | {module}: {message}', 'style': '{', }, }, 'filters': { 'filter_exc_by_type': { '()': 'django.utils.log.CallbackFilter', 'callback': filter_exc_by_type, }, 'filter_exc_by_phrase': { '()': 'django.utils.log.CallbackFilter', 'callback': filter_exc_by_phrase, }, }, 'handlers': { 'debug_file': { 'delay': True, 'level': 'DEBUG', 'class': 'logging.handlers.RotatingFileHandler', 'maxBytes': 1000000, # 1MB ~ 20k rows 'backupCount': 5, 'filename': LOG_ROOT / 'debug.log', 'formatter': 'verbose', 'filters': ['filter_exc_by_type'], }, 'main_file': { 'delay': True, 'level': 'INFO', 'class': 'logging.handlers.RotatingFileHandler', 'maxBytes': 1000000, # 1MB ~ 20k rows 'backupCount': 5, 'filename': LOG_ROOT / 'main.log', 'formatter': 'verbose', }, 'error_file': { 'delay': True, 'level': 'ERROR', 'class': 'logging.handlers.RotatingFileHandler', 'maxBytes': 1000000, # 1MB ~ 20k rows 'backupCount': 5, 'filename': LOG_ROOT / 'error.log', 'formatter': 'verbose', }, 'error_mail': { 'level': 'ERROR', 'class': 'django.utils.log.AdminEmailHandler', 'formatter': 'verbose', 'filters': ['filter_exc_by_phrase'], }, 'error_slack': { # Credentials are read directly from .env 'level': 'ERROR', 'class': 'webapp.settings.log.handlers.SlackHandler', 'filters': ['filter_exc_by_phrase'], }, 'console': { 'class': 'logging.StreamHandler', 'level': 'INFO', 'formatter': 'verbose', }, }, 'loggers': { 'django': { 'handlers': [ 'debug_file', 'main_file', 'error_file', 'error_mail', 'error_slack', 'console' ], 'level': 'DEBUG', 'propagate': True, }, 'django.utils.autoreload': { 'level': 'WARNING', # This logger is way too noisy on DEBUG } }, }
0.558086
0.099602
""" collect network device data via napalm and write it to influxdb """ import logging from influxdb import InfluxDBClient from napalm import get_network_driver from .get_interfaces_counters import get_interfaces_counters from .get_optics import get_optics class NapalmInflux(object): """ the NapalmInflux class implements the influx as well as device connection, it polls the device and writes the resulting data to the db """ def __init__(self, host, port, user, passwd, db): """ set up logger and influx connection :param host: influx hostname :param port: influx port :param user: influx user :param passwd: influx passwd :param db: influx db """ self.log = logging.getLogger('NapalmInflux') # connect to influx self.influx = InfluxDBClient(host, port, user, passwd, db) def run(self, device_host, user, passwd, device_os, tags): """ connect to provided device, fetch data and write to influx :param device_host: (str) device hostname :param user: (str) device user :param passwd: (str) device passwd :param os: (str) a supported napalm os :param tags: (dict) dict of tags as specified in config file """ if tags is None: tags = {} try: print("polling device: " + device_host) # open device connection with napalm driver = get_network_driver(device_os) device = driver(device_host, user, passwd) device.open() # get interface counter data iface_counters = get_interfaces_counters(device_host, device, tags) print(' done polling device interfaces') # get optics data optics_counters = get_optics(device_host, device, tags) print(' done polling device optical levels') # write data to influx print('writing data to influx') self.influx.write_points(iface_counters) self.influx.write_points(optics_counters) # self.log.info('done polling device: %s', device_host) print(' done writing data to influx') except Exception as err: print(err) raise
napalm_influx/napalm_influx.py
""" collect network device data via napalm and write it to influxdb """ import logging from influxdb import InfluxDBClient from napalm import get_network_driver from .get_interfaces_counters import get_interfaces_counters from .get_optics import get_optics class NapalmInflux(object): """ the NapalmInflux class implements the influx as well as device connection, it polls the device and writes the resulting data to the db """ def __init__(self, host, port, user, passwd, db): """ set up logger and influx connection :param host: influx hostname :param port: influx port :param user: influx user :param passwd: influx passwd :param db: influx db """ self.log = logging.getLogger('NapalmInflux') # connect to influx self.influx = InfluxDBClient(host, port, user, passwd, db) def run(self, device_host, user, passwd, device_os, tags): """ connect to provided device, fetch data and write to influx :param device_host: (str) device hostname :param user: (str) device user :param passwd: (str) device passwd :param os: (str) a supported napalm os :param tags: (dict) dict of tags as specified in config file """ if tags is None: tags = {} try: print("polling device: " + device_host) # open device connection with napalm driver = get_network_driver(device_os) device = driver(device_host, user, passwd) device.open() # get interface counter data iface_counters = get_interfaces_counters(device_host, device, tags) print(' done polling device interfaces') # get optics data optics_counters = get_optics(device_host, device, tags) print(' done polling device optical levels') # write data to influx print('writing data to influx') self.influx.write_points(iface_counters) self.influx.write_points(optics_counters) # self.log.info('done polling device: %s', device_host) print(' done writing data to influx') except Exception as err: print(err) raise
0.538255
0.294373
from itertools import combinations from fcapsy.decorators import metadata from fcapsy import Concept, Context @metadata(name='RiceSiffConcepts', short_name='RSConcepts') def concept_subset(context: Context, similarity_measure) -> list: """ Experimental implementation of Rice, <NAME>., and <NAME>. "Clusters, concepts, and pseudometrics." Electronic Notes in Theoretical Computer Science 40 (2001): 323-346. """ init_intent = context.Attributes.supremum init_extent = context.down(init_intent) init_concept = Concept(init_extent, init_intent) atoms = context.Objects.supremum.atoms() # init worklist with all atoms worklist = {Concept.from_intent( context.up(extent), context) for extent in atoms} # init resulting concepts with init_concept and worklist concepts = set(worklist) concepts.add(init_concept) while len(worklist) > 1: # create all possible pairs of different concepts from worklist concept_combinations = tuple(combinations(worklist, 2)) # calculate all distances distances = [1 - similarity_measure( concepts[0].intent, concepts[1].intent) for concepts in concept_combinations] # select minimal distance from all distances min_distance = min(distances) # get all possible pairs of concepts with minimal distance concept_pairs_min_distance = {concept_tuple for concept_tuple, distance in zip( concept_combinations, distances) if distance == min_distance} # flatten pairs and transform them to set concepts_from_pairs = { concept for concept_pair in concept_pairs_min_distance for concept in concept_pair} # calculate new concepts and add them to worklist and result concepts for concept_tuple in concept_pairs_min_distance: extent = concept_tuple[0].extent | concept_tuple[1].extent new_intent = context.up(extent) new_extent = context.down(new_intent) new_concept = Concept(new_extent, new_intent) worklist.add(new_concept) concepts.add(new_concept) # remove already processed concepts worklist = worklist.difference(concepts_from_pairs) return concepts
fcapsy/algorithms/rice_siff.py
from itertools import combinations from fcapsy.decorators import metadata from fcapsy import Concept, Context @metadata(name='RiceSiffConcepts', short_name='RSConcepts') def concept_subset(context: Context, similarity_measure) -> list: """ Experimental implementation of Rice, <NAME>., and <NAME>. "Clusters, concepts, and pseudometrics." Electronic Notes in Theoretical Computer Science 40 (2001): 323-346. """ init_intent = context.Attributes.supremum init_extent = context.down(init_intent) init_concept = Concept(init_extent, init_intent) atoms = context.Objects.supremum.atoms() # init worklist with all atoms worklist = {Concept.from_intent( context.up(extent), context) for extent in atoms} # init resulting concepts with init_concept and worklist concepts = set(worklist) concepts.add(init_concept) while len(worklist) > 1: # create all possible pairs of different concepts from worklist concept_combinations = tuple(combinations(worklist, 2)) # calculate all distances distances = [1 - similarity_measure( concepts[0].intent, concepts[1].intent) for concepts in concept_combinations] # select minimal distance from all distances min_distance = min(distances) # get all possible pairs of concepts with minimal distance concept_pairs_min_distance = {concept_tuple for concept_tuple, distance in zip( concept_combinations, distances) if distance == min_distance} # flatten pairs and transform them to set concepts_from_pairs = { concept for concept_pair in concept_pairs_min_distance for concept in concept_pair} # calculate new concepts and add them to worklist and result concepts for concept_tuple in concept_pairs_min_distance: extent = concept_tuple[0].extent | concept_tuple[1].extent new_intent = context.up(extent) new_extent = context.down(new_intent) new_concept = Concept(new_extent, new_intent) worklist.add(new_concept) concepts.add(new_concept) # remove already processed concepts worklist = worklist.difference(concepts_from_pairs) return concepts
0.770465
0.284999
import uuid import django.contrib.postgres.indexes import django.contrib.postgres.search import django.db.models.deletion from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ("backend", "0001"), ] operations = [ migrations.CreateModel( name="Item", fields=[ ( "id", models.UUIDField( default=uuid.uuid4, editable=False, primary_key=True, serialize=False, ), ), ("created", models.DateTimeField(auto_now_add=True, db_index=True)), ("updated", models.DateTimeField(auto_now=True, db_index=True)), ("name", models.TextField()), ("description", models.TextField()), ( "search_vector", django.contrib.postgres.search.SearchVectorField(null=True), ), ], ), migrations.CreateModel( name="User", fields=[ ( "id", models.UUIDField( default=uuid.uuid4, editable=False, primary_key=True, serialize=False, ), ), ("created", models.DateTimeField(auto_now_add=True, db_index=True)), ("updated", models.DateTimeField(auto_now=True, db_index=True)), ("full_name", models.TextField()), ("email", models.TextField()), ("hashed_password", models.TextField()), ( "search_vector", django.contrib.postgres.search.SearchVectorField(null=True), ), ], ), migrations.AddIndex( model_name="user", index=models.Index(fields=["email"], name="backend_use_email_db66b5_idx"), ), migrations.AddIndex( model_name="user", index=django.contrib.postgres.indexes.GinIndex( fields=["search_vector"], name="backend_use_search__6cf6bf_gin" ), ), migrations.AddConstraint( model_name="user", constraint=models.UniqueConstraint(fields=("email",), name="unique_email"), ), migrations.AddField( model_name="item", name="owner", field=models.ForeignKey( null=True, on_delete=django.db.models.deletion.SET_NULL, to="backend.user", ), ), migrations.AddIndex( model_name="item", index=models.Index( fields=["name", "owner"], name="backend_ite_name_c0732e_idx" ), ), migrations.AddIndex( model_name="item", index=django.contrib.postgres.indexes.GinIndex( fields=["search_vector"], name="backend_ite_search__4170f7_gin" ), ), migrations.AddConstraint( model_name="item", constraint=models.UniqueConstraint( fields=("name", "owner"), name="unique_owner_and_name" ), ), ]
{{ cookiecutter.project_slug }}/backend/migrations/0002.py
import uuid import django.contrib.postgres.indexes import django.contrib.postgres.search import django.db.models.deletion from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ("backend", "0001"), ] operations = [ migrations.CreateModel( name="Item", fields=[ ( "id", models.UUIDField( default=uuid.uuid4, editable=False, primary_key=True, serialize=False, ), ), ("created", models.DateTimeField(auto_now_add=True, db_index=True)), ("updated", models.DateTimeField(auto_now=True, db_index=True)), ("name", models.TextField()), ("description", models.TextField()), ( "search_vector", django.contrib.postgres.search.SearchVectorField(null=True), ), ], ), migrations.CreateModel( name="User", fields=[ ( "id", models.UUIDField( default=uuid.uuid4, editable=False, primary_key=True, serialize=False, ), ), ("created", models.DateTimeField(auto_now_add=True, db_index=True)), ("updated", models.DateTimeField(auto_now=True, db_index=True)), ("full_name", models.TextField()), ("email", models.TextField()), ("hashed_password", models.TextField()), ( "search_vector", django.contrib.postgres.search.SearchVectorField(null=True), ), ], ), migrations.AddIndex( model_name="user", index=models.Index(fields=["email"], name="backend_use_email_db66b5_idx"), ), migrations.AddIndex( model_name="user", index=django.contrib.postgres.indexes.GinIndex( fields=["search_vector"], name="backend_use_search__6cf6bf_gin" ), ), migrations.AddConstraint( model_name="user", constraint=models.UniqueConstraint(fields=("email",), name="unique_email"), ), migrations.AddField( model_name="item", name="owner", field=models.ForeignKey( null=True, on_delete=django.db.models.deletion.SET_NULL, to="backend.user", ), ), migrations.AddIndex( model_name="item", index=models.Index( fields=["name", "owner"], name="backend_ite_name_c0732e_idx" ), ), migrations.AddIndex( model_name="item", index=django.contrib.postgres.indexes.GinIndex( fields=["search_vector"], name="backend_ite_search__4170f7_gin" ), ), migrations.AddConstraint( model_name="item", constraint=models.UniqueConstraint( fields=("name", "owner"), name="unique_owner_and_name" ), ), ]
0.446012
0.170819
import os from oscar.defaults import * from oscar import OSCAR_MAIN_TEMPLATE_DIR from oscar import get_core_apps from decouple import config, Csv import dj_database_url # Build paths inside the project like this: os.path.join(BASE_DIR, ...) BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) SITE_ID = 1 # Quick-start development settings - unsuitable for production # See https://docs.djangoproject.com/en/1.11/howto/deployment/checklist/ # SECURITY WARNING: keep the secret key used in production secret! SECRET_KEY = config('SECRET_KEY') # SECURITY WARNING: don't run with debug turned on in production! DEBUG = config('DEBUG', default=False, cast=bool) ALLOWED_HOSTS = config('ALLOWED_HOSTS', cast=Csv()) # Application definition INSTALLED_APPS = [ 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.sites', 'django.contrib.staticfiles', 'frobshop.apps.FrobshopConfig', 'django.contrib.flatpages', 'paypal', 'storages', 'compressor', 'widget_tweaks', ] + get_core_apps() MIDDLEWARE_CLASSES = [ 'django.middleware.security.SecurityMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', 'oscar.apps.basket.middleware.BasketMiddleware', 'django.contrib.flatpages.middleware.FlatpageFallbackMiddleware', ] ROOT_URLCONF = 'oscar_project.urls' TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': [ os.path.join(BASE_DIR, 'templates'), OSCAR_MAIN_TEMPLATE_DIR ], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.template.context_processors.i18n', 'django.contrib.messages.context_processors.messages', 'oscar.apps.search.context_processors.search_form', 'oscar.apps.promotions.context_processors.promotions', 'oscar.apps.checkout.context_processors.checkout', 'oscar.apps.customer.notifications.context_processors.notifications', 'oscar.core.context_processors.metadata', ], }, }, ] WSGI_APPLICATION = 'oscar_project.wsgi.application' # Database # https://docs.djangoproject.com/en/1.11/ref/settings/#databases DATABASES = { 'default': { 'ENGINE': 'django.db.backends.postgresql_psycopg2', 'NAME': config('DB_NAME'), 'USER': config('DB_USER'), 'PASSWORD': config('DB_PASSWORD'), 'HOST': config('DB_HOST'), 'PORT': config('DB_PORT'), } } # Password validation # https://docs.djangoproject.com/en/1.11/ref/settings/#auth-password-validators AUTHENTICATION_BACKENDS = ( 'oscar.apps.customer.auth_backends.EmailBackend', 'django.contrib.auth.backends.ModelBackend', ) AUTH_PASSWORD_VALIDATORS = [ { 'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator', }, { 'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator', }, { 'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator', }, { 'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator', }, ] HAYSTACK_CONNECTIONS = { 'default': { 'ENGINE': 'haystack.backends.simple_backend.SimpleEngine', }, } # Internationalization # https://docs.djangoproject.com/en/1.11/topics/i18n/ LANGUAGE_CODE = 'en' TIME_ZONE = 'US/Pacific' USE_I18N = True USE_L10N = True USE_TZ = True # Static files (CSS, JavaScript, Images) # https://docs.djangoproject.com/en/1.11/howto/static-files/ # URL that handles the media served from MEDIA_ROOT. Make sure to use a # trailing slash if there is a path component (optional in other cases). # Examples: "http://media.lawrence.com", "http://example.com/media/" EMAIL_BACKEND = 'django.core.mail.backends.console.EmailBackend' STATIC_URL = '/static/' STATIC_ROOT = ('static') AWS_STORAGE_BUCKET_NAME = config('BUCKET_NAME') AWS_ACCESS_KEY_ID = config('AWS_ACCESS_KEY_ID') AWS_SECRET_ACCESS_KEY = config('AWS_SECRET_ACCESS_KEY') AWS_S3_CUSTOM_DOMAIN = '%s.s3.amazonaws.com' % AWS_STORAGE_BUCKET_NAME MEDIAFILES_LOCATION = 'media' MEDIA_URL = "https://%s/%s/" % (AWS_S3_CUSTOM_DOMAIN, MEDIAFILES_LOCATION) DEFAULT_FILE_STORAGE = 'custom_storages.MediaStorage' STATIC_ROOT = 'lostkawzlifestyle1/staticfiles/' STATICFILES_LOCATION = 'static' STATICFILES_STORAGE = 'custom_storages.StaticStorage' STATIC_URL = "https://%s/%s/" % (AWS_S3_CUSTOM_DOMAIN, STATICFILES_LOCATION) db_from_env = dj_database_url.config(conn_max_age=500) DATABASES['default'].update(db_from_env)
oscar_project/settings.py
import os from oscar.defaults import * from oscar import OSCAR_MAIN_TEMPLATE_DIR from oscar import get_core_apps from decouple import config, Csv import dj_database_url # Build paths inside the project like this: os.path.join(BASE_DIR, ...) BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) SITE_ID = 1 # Quick-start development settings - unsuitable for production # See https://docs.djangoproject.com/en/1.11/howto/deployment/checklist/ # SECURITY WARNING: keep the secret key used in production secret! SECRET_KEY = config('SECRET_KEY') # SECURITY WARNING: don't run with debug turned on in production! DEBUG = config('DEBUG', default=False, cast=bool) ALLOWED_HOSTS = config('ALLOWED_HOSTS', cast=Csv()) # Application definition INSTALLED_APPS = [ 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.sites', 'django.contrib.staticfiles', 'frobshop.apps.FrobshopConfig', 'django.contrib.flatpages', 'paypal', 'storages', 'compressor', 'widget_tweaks', ] + get_core_apps() MIDDLEWARE_CLASSES = [ 'django.middleware.security.SecurityMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'django.middleware.clickjacking.XFrameOptionsMiddleware', 'oscar.apps.basket.middleware.BasketMiddleware', 'django.contrib.flatpages.middleware.FlatpageFallbackMiddleware', ] ROOT_URLCONF = 'oscar_project.urls' TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', 'DIRS': [ os.path.join(BASE_DIR, 'templates'), OSCAR_MAIN_TEMPLATE_DIR ], 'APP_DIRS': True, 'OPTIONS': { 'context_processors': [ 'django.template.context_processors.debug', 'django.template.context_processors.request', 'django.contrib.auth.context_processors.auth', 'django.template.context_processors.i18n', 'django.contrib.messages.context_processors.messages', 'oscar.apps.search.context_processors.search_form', 'oscar.apps.promotions.context_processors.promotions', 'oscar.apps.checkout.context_processors.checkout', 'oscar.apps.customer.notifications.context_processors.notifications', 'oscar.core.context_processors.metadata', ], }, }, ] WSGI_APPLICATION = 'oscar_project.wsgi.application' # Database # https://docs.djangoproject.com/en/1.11/ref/settings/#databases DATABASES = { 'default': { 'ENGINE': 'django.db.backends.postgresql_psycopg2', 'NAME': config('DB_NAME'), 'USER': config('DB_USER'), 'PASSWORD': config('DB_PASSWORD'), 'HOST': config('DB_HOST'), 'PORT': config('DB_PORT'), } } # Password validation # https://docs.djangoproject.com/en/1.11/ref/settings/#auth-password-validators AUTHENTICATION_BACKENDS = ( 'oscar.apps.customer.auth_backends.EmailBackend', 'django.contrib.auth.backends.ModelBackend', ) AUTH_PASSWORD_VALIDATORS = [ { 'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator', }, { 'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator', }, { 'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator', }, { 'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator', }, ] HAYSTACK_CONNECTIONS = { 'default': { 'ENGINE': 'haystack.backends.simple_backend.SimpleEngine', }, } # Internationalization # https://docs.djangoproject.com/en/1.11/topics/i18n/ LANGUAGE_CODE = 'en' TIME_ZONE = 'US/Pacific' USE_I18N = True USE_L10N = True USE_TZ = True # Static files (CSS, JavaScript, Images) # https://docs.djangoproject.com/en/1.11/howto/static-files/ # URL that handles the media served from MEDIA_ROOT. Make sure to use a # trailing slash if there is a path component (optional in other cases). # Examples: "http://media.lawrence.com", "http://example.com/media/" EMAIL_BACKEND = 'django.core.mail.backends.console.EmailBackend' STATIC_URL = '/static/' STATIC_ROOT = ('static') AWS_STORAGE_BUCKET_NAME = config('BUCKET_NAME') AWS_ACCESS_KEY_ID = config('AWS_ACCESS_KEY_ID') AWS_SECRET_ACCESS_KEY = config('AWS_SECRET_ACCESS_KEY') AWS_S3_CUSTOM_DOMAIN = '%s.s3.amazonaws.com' % AWS_STORAGE_BUCKET_NAME MEDIAFILES_LOCATION = 'media' MEDIA_URL = "https://%s/%s/" % (AWS_S3_CUSTOM_DOMAIN, MEDIAFILES_LOCATION) DEFAULT_FILE_STORAGE = 'custom_storages.MediaStorage' STATIC_ROOT = 'lostkawzlifestyle1/staticfiles/' STATICFILES_LOCATION = 'static' STATICFILES_STORAGE = 'custom_storages.StaticStorage' STATIC_URL = "https://%s/%s/" % (AWS_S3_CUSTOM_DOMAIN, STATICFILES_LOCATION) db_from_env = dj_database_url.config(conn_max_age=500) DATABASES['default'].update(db_from_env)
0.368974
0.063832
import argparse import json import os import sys import time import requests MAX_FAIL = 5 PAGESIZE = 2000 VERSION = 0.1 # Interval in seconds between successive requests WAIT_PERIOD = 5 class OutputManager: def __init__(self, verbose=False): self.verbose = verbose def print(self, string): if self.verbose: print(string) def store_data(filename, data, count): with open(filename, "w") as file_handle: cvedata = { "CVE_data_type": "CVE", "CVE_data_format": "MITRE", "CVE_data_version": "4.0", "CVE_data_numberOfCVEs": count, "CVE_Items": data, } json.dump(cvedata, file_handle) def process_data(elements): for cve_item in elements: # print(cve_item) cve = { "ID": cve_item["cve"]["CVE_data_meta"]["ID"], "description": cve_item["cve"]["description"]["description_data"][0][ "value" ], "severity": "unknown", "score": "unknown", "CVSS_version": "unknown", "vector": "TBD", "problem": "unknown", } if "baseMetricV3" in cve_item["impact"]: cve["severity"] = cve_item["impact"]["baseMetricV3"]["cvssV3"][ "baseSeverity" ] cve["score"] = cve_item["impact"]["baseMetricV3"]["cvssV3"]["baseScore"] cve["vector"] = cve_item["impact"]["baseMetricV3"]["cvssV3"]["vectorString"] cve["CVSS_version"] = 3 elif "baseMetricV2" in cve_item["impact"]: cve["severity"] = cve_item["impact"]["baseMetricV2"]["severity"] cve["score"] = cve_item["impact"]["baseMetricV2"]["cvssV2"]["baseScore"] cve["vector"] = cve_item["impact"]["baseMetricV2"]["cvssV2"]["vectorString"] cve["CVSS_version"] = 2 if cve["vector"] != "TBD": try: # cve["problem"] = cve_item["cve"]["problemtype"]["problemtype_data"][0]["description"][0]["value"] check = cve_item["cve"]["problemtype"]["problemtype_data"][0][ "description" ] if len(check) > 0: problem = "" for data_item in cve_item["cve"]["problemtype"]["problemtype_data"][0][ "description" ]: # print (d["value"]) problem = data_item["value"] + ";" cve["problem"] = problem[:-1] except: # print("Error with",cve_item["cve"]["CVE_data_meta"]["ID"] ) pass print(cve["ID"], cve["score"], cve["severity"], cve["vector"], cve["problem"]) def get_data(startdate, enddate, outdir, config): nvd_feed = "https://services.nvd.nist.gov/rest/json/cves/1.0" default_filename = "NVD_Data_1.json" index = 0 # Extract configuration parameters verbose = config[0] pagesize = config[1] interval = config[2] show_data = config[3] # pagesize = 2000 items = 0 finished = False query_count = 0 fail_count = 0 file_data = [] om = OutputManager(verbose) om.print(f"Retrieve CVEs from {startdate}") if enddate != "": om.print(f"Retrieve CVEs to {enddate}") while not finished: if enddate != "": query = { "resultsPerPage": pagesize, "startIndex": index, "pubStartDate": startdate, "pubEndDate": enddate, } filename = f"{outdir}NVD_data_{startdate[:4]}.json" else: query = { "resultsPerPage": pagesize, "startIndex": index, "modStartDate": startdate, } filename = f"{outdir}{default_filename}" try: response = requests.get(nvd_feed, params=query) om.print(f"Response :{response.status_code}") query_count += 1 if response.status_code == 200: j = response.json() total_results = j["totalResults"] om.print(f"Query {query_count}") om.print(f"\tTotal results {total_results}") om.print(f"\tStart index {j['startIndex']}") no_of_results = j["resultsPerPage"] om.print(f"\tNumber of results returned: {no_of_results}") # Now process data if show_data: process_data(j['result']["CVE_Items"]) # filename = f"{outdir}NVD_data_{query_count}.json" # store_data(filename, j['result']["CVE_Items"], no_of_results) items = items + no_of_results for item in j["result"]["CVE_Items"]: file_data.append(item.copy()) # Have we finished? if items < total_results: index = index + pagesize # Calculate number of requests remaining count = int((total_results - items) / pagesize) + 1 om.print(f"Estimated remaining time {count * interval} seconds") # And wait # om.print(f"Pause for {interval} seconds") time.sleep(interval) else: finished = True store_data(filename, file_data, total_results) om.print(f"Data saved in {filename}") else: fail_count += 1 finished = fail_count == MAX_FAIL if not finished: om.print(f"Pause for {interval} seconds") time.sleep(interval) except: print(f"Failed to connect to NVD webservice {nvd_feed}") fail_count += 1 finished = fail_count == MAX_FAIL if not finished: om.print(f"Pause for {interval} seconds") time.sleep(interval) return items # Main if __name__ == "__main__": desc = "Download NVD data and store data in JSON file" # Set all parser arguments here. parser = argparse.ArgumentParser( formatter_class=argparse.RawDescriptionHelpFormatter, description=desc ) parser.add_argument( "-o", "--output", help="Output directory", dest="output_directory", default="./" ) parser.add_argument( "-f", "--file", help="Name of file with time of last update", dest="update_file", default="", ) parser.add_argument( "-d", "--date", help="Download all items modified from specified date (YYYY-MM-DD)", dest="start_date", default="", ) parser.add_argument( "-a", "--all", help="Download all items", dest="all_items", action="store_true" ) parser.add_argument( "-y", "--year", help="Download all items published for specified year (YYYY)", dest="year", default="", ) parser.add_argument( "-t", "--time", help="Time (secs) between successive requests. Default " + str(WAIT_PERIOD) + " secs.", dest="interval", default=WAIT_PERIOD, ) parser.add_argument( "-p", "--pagesize", help="Maximum number of items per request. Default " + str(PAGESIZE) + " items.", dest="page_size", default=PAGESIZE, ) parser.add_argument( "-V", "--verbose", help="Verbose reporting", dest="verbose", action="store_true" ) parser.add_argument( "-v", "--version", help="Show version information and exit", dest="version", action="store_true", ) parser.add_argument( "-s", "--show", help="Output retrieved records to console", dest="show_data", action="store_true" ) # Parse arguments in case they are provided. params = parser.parse_args() version = params.version update_file = params.update_file all_items = params.all_items year = params.year # start_date = params.start_date output_directory = params.output_directory request_interval = int(params.interval) page_size = int(params.page_size) end_date = "" # Validate parameters if version: print("Version", VERSION) sys.exit(0) if page_size not in range(20, 5000): print(f"[ERROR] Specified request size ({page_size}) is out of range") sys.exit(-1) # Determine dates for record retrieval if update_file != "": # Time from last time file was updated try: update_time = os.path.getmtime(update_file) start_date = time.strftime( "%Y-%m-%dT%H:%M:%S:000 UTC-00:00", time.gmtime(update_time) ) except OSError: print("[ERROR] File '%s' does not exist or is inaccessible" % update_file) sys.exit(-1) elif all_items: # All files since start of 1999 start_date = "1999-01-01T00:00:00:000 UTC-00:00" elif year != "": start_date = f"{year}-01-01T00:00:00:000 UTC-00:00" end_date = f"{year}-12-31T23:59:59:000 UTC-00:00" elif params.start_date != "": start_date = f"{params.start_date}T00:00:00:000 UTC-00:00" # print ("Date",start_date) else: print("[ERROR] Start date not specified") sys.exit(-1) print( "Number of records retrieved", get_data(start_date, end_date, output_directory, [params.verbose, page_size, request_interval, params.show_data]), ) # End
nvdget.py
import argparse import json import os import sys import time import requests MAX_FAIL = 5 PAGESIZE = 2000 VERSION = 0.1 # Interval in seconds between successive requests WAIT_PERIOD = 5 class OutputManager: def __init__(self, verbose=False): self.verbose = verbose def print(self, string): if self.verbose: print(string) def store_data(filename, data, count): with open(filename, "w") as file_handle: cvedata = { "CVE_data_type": "CVE", "CVE_data_format": "MITRE", "CVE_data_version": "4.0", "CVE_data_numberOfCVEs": count, "CVE_Items": data, } json.dump(cvedata, file_handle) def process_data(elements): for cve_item in elements: # print(cve_item) cve = { "ID": cve_item["cve"]["CVE_data_meta"]["ID"], "description": cve_item["cve"]["description"]["description_data"][0][ "value" ], "severity": "unknown", "score": "unknown", "CVSS_version": "unknown", "vector": "TBD", "problem": "unknown", } if "baseMetricV3" in cve_item["impact"]: cve["severity"] = cve_item["impact"]["baseMetricV3"]["cvssV3"][ "baseSeverity" ] cve["score"] = cve_item["impact"]["baseMetricV3"]["cvssV3"]["baseScore"] cve["vector"] = cve_item["impact"]["baseMetricV3"]["cvssV3"]["vectorString"] cve["CVSS_version"] = 3 elif "baseMetricV2" in cve_item["impact"]: cve["severity"] = cve_item["impact"]["baseMetricV2"]["severity"] cve["score"] = cve_item["impact"]["baseMetricV2"]["cvssV2"]["baseScore"] cve["vector"] = cve_item["impact"]["baseMetricV2"]["cvssV2"]["vectorString"] cve["CVSS_version"] = 2 if cve["vector"] != "TBD": try: # cve["problem"] = cve_item["cve"]["problemtype"]["problemtype_data"][0]["description"][0]["value"] check = cve_item["cve"]["problemtype"]["problemtype_data"][0][ "description" ] if len(check) > 0: problem = "" for data_item in cve_item["cve"]["problemtype"]["problemtype_data"][0][ "description" ]: # print (d["value"]) problem = data_item["value"] + ";" cve["problem"] = problem[:-1] except: # print("Error with",cve_item["cve"]["CVE_data_meta"]["ID"] ) pass print(cve["ID"], cve["score"], cve["severity"], cve["vector"], cve["problem"]) def get_data(startdate, enddate, outdir, config): nvd_feed = "https://services.nvd.nist.gov/rest/json/cves/1.0" default_filename = "NVD_Data_1.json" index = 0 # Extract configuration parameters verbose = config[0] pagesize = config[1] interval = config[2] show_data = config[3] # pagesize = 2000 items = 0 finished = False query_count = 0 fail_count = 0 file_data = [] om = OutputManager(verbose) om.print(f"Retrieve CVEs from {startdate}") if enddate != "": om.print(f"Retrieve CVEs to {enddate}") while not finished: if enddate != "": query = { "resultsPerPage": pagesize, "startIndex": index, "pubStartDate": startdate, "pubEndDate": enddate, } filename = f"{outdir}NVD_data_{startdate[:4]}.json" else: query = { "resultsPerPage": pagesize, "startIndex": index, "modStartDate": startdate, } filename = f"{outdir}{default_filename}" try: response = requests.get(nvd_feed, params=query) om.print(f"Response :{response.status_code}") query_count += 1 if response.status_code == 200: j = response.json() total_results = j["totalResults"] om.print(f"Query {query_count}") om.print(f"\tTotal results {total_results}") om.print(f"\tStart index {j['startIndex']}") no_of_results = j["resultsPerPage"] om.print(f"\tNumber of results returned: {no_of_results}") # Now process data if show_data: process_data(j['result']["CVE_Items"]) # filename = f"{outdir}NVD_data_{query_count}.json" # store_data(filename, j['result']["CVE_Items"], no_of_results) items = items + no_of_results for item in j["result"]["CVE_Items"]: file_data.append(item.copy()) # Have we finished? if items < total_results: index = index + pagesize # Calculate number of requests remaining count = int((total_results - items) / pagesize) + 1 om.print(f"Estimated remaining time {count * interval} seconds") # And wait # om.print(f"Pause for {interval} seconds") time.sleep(interval) else: finished = True store_data(filename, file_data, total_results) om.print(f"Data saved in {filename}") else: fail_count += 1 finished = fail_count == MAX_FAIL if not finished: om.print(f"Pause for {interval} seconds") time.sleep(interval) except: print(f"Failed to connect to NVD webservice {nvd_feed}") fail_count += 1 finished = fail_count == MAX_FAIL if not finished: om.print(f"Pause for {interval} seconds") time.sleep(interval) return items # Main if __name__ == "__main__": desc = "Download NVD data and store data in JSON file" # Set all parser arguments here. parser = argparse.ArgumentParser( formatter_class=argparse.RawDescriptionHelpFormatter, description=desc ) parser.add_argument( "-o", "--output", help="Output directory", dest="output_directory", default="./" ) parser.add_argument( "-f", "--file", help="Name of file with time of last update", dest="update_file", default="", ) parser.add_argument( "-d", "--date", help="Download all items modified from specified date (YYYY-MM-DD)", dest="start_date", default="", ) parser.add_argument( "-a", "--all", help="Download all items", dest="all_items", action="store_true" ) parser.add_argument( "-y", "--year", help="Download all items published for specified year (YYYY)", dest="year", default="", ) parser.add_argument( "-t", "--time", help="Time (secs) between successive requests. Default " + str(WAIT_PERIOD) + " secs.", dest="interval", default=WAIT_PERIOD, ) parser.add_argument( "-p", "--pagesize", help="Maximum number of items per request. Default " + str(PAGESIZE) + " items.", dest="page_size", default=PAGESIZE, ) parser.add_argument( "-V", "--verbose", help="Verbose reporting", dest="verbose", action="store_true" ) parser.add_argument( "-v", "--version", help="Show version information and exit", dest="version", action="store_true", ) parser.add_argument( "-s", "--show", help="Output retrieved records to console", dest="show_data", action="store_true" ) # Parse arguments in case they are provided. params = parser.parse_args() version = params.version update_file = params.update_file all_items = params.all_items year = params.year # start_date = params.start_date output_directory = params.output_directory request_interval = int(params.interval) page_size = int(params.page_size) end_date = "" # Validate parameters if version: print("Version", VERSION) sys.exit(0) if page_size not in range(20, 5000): print(f"[ERROR] Specified request size ({page_size}) is out of range") sys.exit(-1) # Determine dates for record retrieval if update_file != "": # Time from last time file was updated try: update_time = os.path.getmtime(update_file) start_date = time.strftime( "%Y-%m-%dT%H:%M:%S:000 UTC-00:00", time.gmtime(update_time) ) except OSError: print("[ERROR] File '%s' does not exist or is inaccessible" % update_file) sys.exit(-1) elif all_items: # All files since start of 1999 start_date = "1999-01-01T00:00:00:000 UTC-00:00" elif year != "": start_date = f"{year}-01-01T00:00:00:000 UTC-00:00" end_date = f"{year}-12-31T23:59:59:000 UTC-00:00" elif params.start_date != "": start_date = f"{params.start_date}T00:00:00:000 UTC-00:00" # print ("Date",start_date) else: print("[ERROR] Start date not specified") sys.exit(-1) print( "Number of records retrieved", get_data(start_date, end_date, output_directory, [params.verbose, page_size, request_interval, params.show_data]), ) # End
0.209227
0.100392
from Crypto.Cipher import AES from Crypto import Random from ironic_neutron_plugin import config from neutron.db import model_base from neutron.db import models_v2 from neutron.openstack.common import log as logging import sqlalchemy as sa from sqlalchemy import orm as sa_orm import base64 LOG = logging.getLogger(__name__) def aes_encrypt(key, msg): iv = Random.new().read(AES.block_size) cipher = AES.new(key, AES.MODE_CFB, iv) ciphertext = iv + cipher.encrypt(msg) return base64.b64encode(ciphertext) def aes_decrypt(key, msg): msg = base64.b64decode(msg) iv = msg[:AES.block_size] cipher = AES.new(key, AES.MODE_CFB, iv) msg = cipher.decrypt(msg[AES.block_size:]) return msg class EncryptedValue(sa.TypeDecorator): impl = sa.String def process_bind_param(self, value, dialect): if value: key = config.cfg.CONF.ironic.credential_secret value = aes_encrypt(key, value) return value def process_result_value(self, value, dialect): if value: key = config.cfg.CONF.ironic.credential_secret value = aes_decrypt(key, value) return value class SwitchPort(model_base.BASEV2, models_v2.HasId): """Maps a device to a physical switch port.""" __tablename__ = "switch_ports" switch_id = sa.Column(sa.String(255), sa.ForeignKey("switches.id"), nullable=False) # Interface name (eth0, some other meaningful identifier) name = sa.Column(sa.String(255), nullable=False) # Switchport identifier (Ethernet1/1, something your mech understands) port = sa.Column(sa.String(255), nullable=False) # Some kind of externally-identifiable id suitable for mapping multiple # ports to a single entity (ironic node_id) hardware_id = sa.Column(sa.String(255), nullable=True) # Extra mac_address = sa.Column(sa.String(255), nullable=True) def as_dict(self): return { u"id": self.id, u"switch_id": self.switch_id, u"name": self.name, u"port": self.port, u"hardware_id": self.hardware_id, # extra u"mac_address": self.mac_address } @classmethod def make_dict(cls, d): return { u"id": d.get("id"), u"switch_id": d.get("switch_id"), u"name": d.get("name"), u"port": d.get("port"), u"hardware_id": d.get("hardware_id"), u"mac_address": d.get("mac_address") } class Switch(model_base.BASEV2): """An external attachment point.""" __tablename__ = "switches" id = sa.Column(sa.String(255), primary_key=True) description = sa.Column(sa.String(255)) type = sa.Column(sa.String(255)) # TODO(morgabra) move this out into a separate model host = sa.Column(sa.String(255)) username = sa.Column(sa.String(255), nullable=True) password = sa.Column(EncryptedValue(255), nullable=True) ports = sa_orm.relationship( SwitchPort, lazy="joined", cascade="delete", backref="switch") def as_dict(self): return { u"id": self.id, u"description": self.description, u"host": self.host, u"username": self.username, u"password": "*****", u"type": self.type } class PortExt(model_base.BASEV2): """Keep track of extra information about neutron ports. TODO(morgabra) This is not correct, but we need to stick this data somewhere. """ __tablename__ = "port_ext" # TODO(morgabra) FK to the actual model and cascade port_id = sa.Column(sa.String(255), primary_key=True) hardware_id = sa.Column(sa.String(255), nullable=True) commit = sa.Column(sa.Boolean, nullable=False) trunked = sa.Column(sa.Boolean, nullable=True) def as_dict(self): return { u"port_id": self.port_id, u"commit": self.commit, u"trunked": self.trunked, u"hardware_id": self.hardware_id } class SwitchPortBindingState(object): INACTIVE = u"INACTIVE" WANT_ACTIVE = u"WANT_ACTIVE" ACTIVE = u"ACTIVE" WANT_INACTIVE = u"WANT_INACTIVE" ERROR = u"ERROR" @classmethod def as_dict(cls): return { u"INACTIVE": cls.INACTIVE, u"WANT_ACTIVE": cls.WANT_ACTIVE, u"ACTIVE": cls.ACTIVE, u"WANT_INACTIVE": cls.WANT_INACTIVE, u"ERROR": cls.ERROR } class SwitchPortBinding(model_base.BASEV2): """Keep track of which neutron ports are bound to which physical switchports. """ __tablename__ = "switch_port_bindings" # TODO(morgabra) FK to the actual model and cascade port_id = sa.Column(sa.String(255), primary_key=True) network_id = sa.Column(sa.String(255), primary_key=True) switch_port_id = sa.Column( sa.String(36), sa.ForeignKey("switch_ports.id"), primary_key=True) state = sa.Column(sa.String(255), default=SwitchPortBindingState.INACTIVE) def as_dict(self): return { u"port_id": self.port_id, u"network_id": self.network_id, u"switch_port_id": self.switch_port_id, u"state": self.state }
ironic_neutron_plugin/db/models.py
from Crypto.Cipher import AES from Crypto import Random from ironic_neutron_plugin import config from neutron.db import model_base from neutron.db import models_v2 from neutron.openstack.common import log as logging import sqlalchemy as sa from sqlalchemy import orm as sa_orm import base64 LOG = logging.getLogger(__name__) def aes_encrypt(key, msg): iv = Random.new().read(AES.block_size) cipher = AES.new(key, AES.MODE_CFB, iv) ciphertext = iv + cipher.encrypt(msg) return base64.b64encode(ciphertext) def aes_decrypt(key, msg): msg = base64.b64decode(msg) iv = msg[:AES.block_size] cipher = AES.new(key, AES.MODE_CFB, iv) msg = cipher.decrypt(msg[AES.block_size:]) return msg class EncryptedValue(sa.TypeDecorator): impl = sa.String def process_bind_param(self, value, dialect): if value: key = config.cfg.CONF.ironic.credential_secret value = aes_encrypt(key, value) return value def process_result_value(self, value, dialect): if value: key = config.cfg.CONF.ironic.credential_secret value = aes_decrypt(key, value) return value class SwitchPort(model_base.BASEV2, models_v2.HasId): """Maps a device to a physical switch port.""" __tablename__ = "switch_ports" switch_id = sa.Column(sa.String(255), sa.ForeignKey("switches.id"), nullable=False) # Interface name (eth0, some other meaningful identifier) name = sa.Column(sa.String(255), nullable=False) # Switchport identifier (Ethernet1/1, something your mech understands) port = sa.Column(sa.String(255), nullable=False) # Some kind of externally-identifiable id suitable for mapping multiple # ports to a single entity (ironic node_id) hardware_id = sa.Column(sa.String(255), nullable=True) # Extra mac_address = sa.Column(sa.String(255), nullable=True) def as_dict(self): return { u"id": self.id, u"switch_id": self.switch_id, u"name": self.name, u"port": self.port, u"hardware_id": self.hardware_id, # extra u"mac_address": self.mac_address } @classmethod def make_dict(cls, d): return { u"id": d.get("id"), u"switch_id": d.get("switch_id"), u"name": d.get("name"), u"port": d.get("port"), u"hardware_id": d.get("hardware_id"), u"mac_address": d.get("mac_address") } class Switch(model_base.BASEV2): """An external attachment point.""" __tablename__ = "switches" id = sa.Column(sa.String(255), primary_key=True) description = sa.Column(sa.String(255)) type = sa.Column(sa.String(255)) # TODO(morgabra) move this out into a separate model host = sa.Column(sa.String(255)) username = sa.Column(sa.String(255), nullable=True) password = sa.Column(EncryptedValue(255), nullable=True) ports = sa_orm.relationship( SwitchPort, lazy="joined", cascade="delete", backref="switch") def as_dict(self): return { u"id": self.id, u"description": self.description, u"host": self.host, u"username": self.username, u"password": "*****", u"type": self.type } class PortExt(model_base.BASEV2): """Keep track of extra information about neutron ports. TODO(morgabra) This is not correct, but we need to stick this data somewhere. """ __tablename__ = "port_ext" # TODO(morgabra) FK to the actual model and cascade port_id = sa.Column(sa.String(255), primary_key=True) hardware_id = sa.Column(sa.String(255), nullable=True) commit = sa.Column(sa.Boolean, nullable=False) trunked = sa.Column(sa.Boolean, nullable=True) def as_dict(self): return { u"port_id": self.port_id, u"commit": self.commit, u"trunked": self.trunked, u"hardware_id": self.hardware_id } class SwitchPortBindingState(object): INACTIVE = u"INACTIVE" WANT_ACTIVE = u"WANT_ACTIVE" ACTIVE = u"ACTIVE" WANT_INACTIVE = u"WANT_INACTIVE" ERROR = u"ERROR" @classmethod def as_dict(cls): return { u"INACTIVE": cls.INACTIVE, u"WANT_ACTIVE": cls.WANT_ACTIVE, u"ACTIVE": cls.ACTIVE, u"WANT_INACTIVE": cls.WANT_INACTIVE, u"ERROR": cls.ERROR } class SwitchPortBinding(model_base.BASEV2): """Keep track of which neutron ports are bound to which physical switchports. """ __tablename__ = "switch_port_bindings" # TODO(morgabra) FK to the actual model and cascade port_id = sa.Column(sa.String(255), primary_key=True) network_id = sa.Column(sa.String(255), primary_key=True) switch_port_id = sa.Column( sa.String(36), sa.ForeignKey("switch_ports.id"), primary_key=True) state = sa.Column(sa.String(255), default=SwitchPortBindingState.INACTIVE) def as_dict(self): return { u"port_id": self.port_id, u"network_id": self.network_id, u"switch_port_id": self.switch_port_id, u"state": self.state }
0.609408
0.191252