code
stringlengths
2k
1.04M
repo_path
stringlengths
5
517
parsed_code
stringlengths
0
1.04M
quality_prob
float64
0.02
0.95
learning_prob
float64
0.02
0.93
import time import json from modules.DateGenerator import DateGenerator from modules.Config import APILoader, Network from modules.VaxFactory import VaxFactory from modules.Device import UserAgents from modules.Logger import Logger class AppointmentBooking: def __init__(self, data): self.center_id = data["center_id"] self.name = data["name"] self.address = data["address"] self.state_name = data["state_name"] self.district_name = data["district_name"] self.block_name = data["block_name"] self.pincode = data["pincode"] self.dose = data["dose"] self.appointment_id = data["appointment_id"] self.session_id = data["session_id"] self.date = data["date"] self.slot = data["slot"] class Appointment: BANGALORE_URBAN = "265" BBMP = "294" def __init__(self, seek=3, pin_codes=["560029"], freq_s=60, mode_cron=True, token='', district_codes=["265"] ) -> None: self.attempts = 0 self.days_seek = seek self.pin_codes = pin_codes self.freq_s = freq_s self.mode_cron = True if mode_cron else False self.token = token self.district_codes = district_codes self.operation_window_start_hr = 0 self.operation_window_start_min = 0 self.operation_window_end_hr = 23 self.operation_window_end_min = 58 self.last_status_code = 101 def __cycle(self): if self.mode_cron: self.attempts += 1 def operation_window(self, start_hr=0, start_min=0, end_hr=23, end_min=58): self.operation_window_start_hr = start_hr if start_hr >= 0 else 0 self.operation_window_end_hr = end_hr if end_hr >= 0 else 23 self.operation_window_start_min = start_min if start_min >= 0 else 0 self.operation_window_end_min = end_min if end_min >= 0 else 58 def can_continue(self): return (self.mode_cron and self.attempts < 1) or not self.mode_cron def reset(self): self.attempts = 0 def __perform(self, perform, and_then=None): self.reset() DateGenerator.seed() while self.can_continue(): perform() if and_then is not None: and_then() Logger.log("Sleeping for", self.freq_s) time.sleep(self.freq_s) self.__cycle() def __perform_seek(self): base_api_url, method = APILoader.appointment_by_pin() success = False for i in range(0, self.days_seek): date_to_check = DateGenerator.format_date_from_days(i) pincode = self.pin_codes[0] headers = Network.headers_json() headers['User-Agent'] = UserAgents.android() headers["Authorization"] = "Bearer " + self.token api_url = base_api_url + "?pincode=" + pincode + "&date=" + date_to_check resp = method( url=api_url, headers=headers ) self.last_status_code = int(resp.status_code) status = resp.status_code if resp: if int(status) < 300: success = True data = resp.json() Logger.log("(Pin API)", date_to_check, "[", status, "]", pincode, "::", data) else: Logger.log("(Pin API)", date_to_check, "[", status, "]", pincode, " X Failed", resp.content.decode()) time.sleep(self.freq_s) return success def __perform_seek_area(self): base_api_url, method = APILoader.appointment_by_district() success = False for districts in self.district_codes: api_url = base_api_url + "?district_id=" + \ str(districts) + "&date=" + \ DateGenerator.format_date_from_days(0) headers = Network.headers_json() headers['User-Agent'] = UserAgents.android() headers['Authorization'] = "Bearer " + self.token resp = method(url=api_url, headers=headers) self.last_status_code = int(resp.status_code) if self.last_status_code < 300: success = True self.aggregate_centers( centers=json.loads(resp.content.decode())) else: Logger.log("(District Cal API)", resp.status_code, resp.content.decode()) return success def seek(self): return self.__perform(self.__perform_seek) def seek_area(self, and_then=None): return self.__perform(self.__perform_seek_area, and_then) def aggregate_centers(self, centers): centers = centers if "centers" not in centers else centers["centers"] for each_center in centers: id = each_center["center_id"] name = each_center["name"] addr = each_center["address"] block = each_center["block_name"] pincode = each_center["pincode"] lati = each_center["lat"] longi = each_center["long"] sessions = each_center["sessions"] for each_session in sessions: session_id = each_session["session_id"] session_date = each_session["date"] min_age_limit = each_session["min_age_limit"] vax = each_session["vaccine"] cap_avail = each_session["available_capacity"] cap_avail_dose1 = each_session["available_capacity_dose1"] cap_avail_dose2 = each_session["available_capacity_dose2"] slots = each_session["slots"] VaxFactory.add_center( id, name, addr, block, pincode, lati, longi, session_id, session_date, min_age_limit, vax, cap_avail, cap_avail_dose1, cap_avail_dose2, slots )
modules/Appointment.py
import time import json from modules.DateGenerator import DateGenerator from modules.Config import APILoader, Network from modules.VaxFactory import VaxFactory from modules.Device import UserAgents from modules.Logger import Logger class AppointmentBooking: def __init__(self, data): self.center_id = data["center_id"] self.name = data["name"] self.address = data["address"] self.state_name = data["state_name"] self.district_name = data["district_name"] self.block_name = data["block_name"] self.pincode = data["pincode"] self.dose = data["dose"] self.appointment_id = data["appointment_id"] self.session_id = data["session_id"] self.date = data["date"] self.slot = data["slot"] class Appointment: BANGALORE_URBAN = "265" BBMP = "294" def __init__(self, seek=3, pin_codes=["560029"], freq_s=60, mode_cron=True, token='', district_codes=["265"] ) -> None: self.attempts = 0 self.days_seek = seek self.pin_codes = pin_codes self.freq_s = freq_s self.mode_cron = True if mode_cron else False self.token = token self.district_codes = district_codes self.operation_window_start_hr = 0 self.operation_window_start_min = 0 self.operation_window_end_hr = 23 self.operation_window_end_min = 58 self.last_status_code = 101 def __cycle(self): if self.mode_cron: self.attempts += 1 def operation_window(self, start_hr=0, start_min=0, end_hr=23, end_min=58): self.operation_window_start_hr = start_hr if start_hr >= 0 else 0 self.operation_window_end_hr = end_hr if end_hr >= 0 else 23 self.operation_window_start_min = start_min if start_min >= 0 else 0 self.operation_window_end_min = end_min if end_min >= 0 else 58 def can_continue(self): return (self.mode_cron and self.attempts < 1) or not self.mode_cron def reset(self): self.attempts = 0 def __perform(self, perform, and_then=None): self.reset() DateGenerator.seed() while self.can_continue(): perform() if and_then is not None: and_then() Logger.log("Sleeping for", self.freq_s) time.sleep(self.freq_s) self.__cycle() def __perform_seek(self): base_api_url, method = APILoader.appointment_by_pin() success = False for i in range(0, self.days_seek): date_to_check = DateGenerator.format_date_from_days(i) pincode = self.pin_codes[0] headers = Network.headers_json() headers['User-Agent'] = UserAgents.android() headers["Authorization"] = "Bearer " + self.token api_url = base_api_url + "?pincode=" + pincode + "&date=" + date_to_check resp = method( url=api_url, headers=headers ) self.last_status_code = int(resp.status_code) status = resp.status_code if resp: if int(status) < 300: success = True data = resp.json() Logger.log("(Pin API)", date_to_check, "[", status, "]", pincode, "::", data) else: Logger.log("(Pin API)", date_to_check, "[", status, "]", pincode, " X Failed", resp.content.decode()) time.sleep(self.freq_s) return success def __perform_seek_area(self): base_api_url, method = APILoader.appointment_by_district() success = False for districts in self.district_codes: api_url = base_api_url + "?district_id=" + \ str(districts) + "&date=" + \ DateGenerator.format_date_from_days(0) headers = Network.headers_json() headers['User-Agent'] = UserAgents.android() headers['Authorization'] = "Bearer " + self.token resp = method(url=api_url, headers=headers) self.last_status_code = int(resp.status_code) if self.last_status_code < 300: success = True self.aggregate_centers( centers=json.loads(resp.content.decode())) else: Logger.log("(District Cal API)", resp.status_code, resp.content.decode()) return success def seek(self): return self.__perform(self.__perform_seek) def seek_area(self, and_then=None): return self.__perform(self.__perform_seek_area, and_then) def aggregate_centers(self, centers): centers = centers if "centers" not in centers else centers["centers"] for each_center in centers: id = each_center["center_id"] name = each_center["name"] addr = each_center["address"] block = each_center["block_name"] pincode = each_center["pincode"] lati = each_center["lat"] longi = each_center["long"] sessions = each_center["sessions"] for each_session in sessions: session_id = each_session["session_id"] session_date = each_session["date"] min_age_limit = each_session["min_age_limit"] vax = each_session["vaccine"] cap_avail = each_session["available_capacity"] cap_avail_dose1 = each_session["available_capacity_dose1"] cap_avail_dose2 = each_session["available_capacity_dose2"] slots = each_session["slots"] VaxFactory.add_center( id, name, addr, block, pincode, lati, longi, session_id, session_date, min_age_limit, vax, cap_avail, cap_avail_dose1, cap_avail_dose2, slots )
0.251188
0.199444
import os from django.core.mail import send_mail from django.template.loader import render_to_string def feedback_mail(message, user): plain = message + "\n\nPosted by %s, %s" % (user.fname, user.email) subject = "FRCShirt Feedback" print(os.getenv("ADMIN_EMAIL")) send_mail(subject, plain, "FRCShirt<<EMAIL>>", [os.getenv("ADMIN_EMAIL")]) def pass_reset_mail(user, key): plain = "Hey %s!\n\nTo reset your password, click on the following link: " \ "https://frcshirt.trade/login/forgot/?key=%s" % ( user.fname, key ) subject = "FRCShirt: Reset Password" send_mail(subject, plain, "FRCShirt<<EMAIL>>", [user.email]) # TODO: Fix html message not displaying in gmail def trade_mail(trade): ctx = {'trade': trade} html = render_to_string('trade/email/trade_notification.html', ctx) plain = "Hey %s, you have a trade offer!\n\n%s offered you their %s for your %s. Go to https://frcshirt.trade/, " \ "log in, and select 'My Items' to view or accept the offer." % ( trade.take.owner.fname, trade.give.owner, trade.give, trade.take ) subject = "Trade offer for your %s" % trade.take send_mail(subject, plain, "FRCShirt<<EMAIL>>", [trade.take.owner.email]) def trade_accepted_mail(trade): ctx = {'trade': trade} # TODO: Find meetup and insert into ctx html = render_to_string('trade/email/trade_accepted.html', ctx) plain = "Hey %s!\n\n%s accepted your trade offer! They want to trade your %s for their %s. You can get in touch " \ "with them at %s to coordinate the trade. " % ( trade.give.owner.fname, trade.take.owner, trade.give, trade.take, trade.take.owner.email ) subject = "Trade offer accepted!" send_mail(subject, plain, "FRCShirt<<EMAIL>>", [trade.give.owner.email]) def trade_cancelled_by_giver(trade): ctx = {'trade': trade} html = None plain = "Hey %s,\n\n%s just marked the trade of your %s for their %s as cancelled. Reach out to them if you think " \ "this is an error. If you'd like to relist your %s, go to frcshirt.trade, click My Items and click " \ "relist on its item page" % ( trade.take.owner.fname, trade.give.owner, trade.take, trade.give, trade.take ) subject = "Trade offer cancelled" send_mail(subject, plain, "FRCShirt<<EMAIL>>", [trade.take.owner.email]) def trade_cancelled_by_taker(trade): ctx = {'trade': trade} html = None plain = "Hey %s,\n\n%s just marked the trade of your %s for their %s as cancelled. Reach out to them if you think " \ "this is an error. If you'd like to relist your %s, go to frcshirt.trade, click My Items and click " \ "relist on its item page" % ( trade.give.owner.fname, trade.take.owner, trade.give, trade.take, trade.give ) subject = "Trade offer cancelled" send_mail(subject, plain, "FRCShirt<<EMAIL>>", [trade.give.owner.email])
trade/email.py
import os from django.core.mail import send_mail from django.template.loader import render_to_string def feedback_mail(message, user): plain = message + "\n\nPosted by %s, %s" % (user.fname, user.email) subject = "FRCShirt Feedback" print(os.getenv("ADMIN_EMAIL")) send_mail(subject, plain, "FRCShirt<<EMAIL>>", [os.getenv("ADMIN_EMAIL")]) def pass_reset_mail(user, key): plain = "Hey %s!\n\nTo reset your password, click on the following link: " \ "https://frcshirt.trade/login/forgot/?key=%s" % ( user.fname, key ) subject = "FRCShirt: Reset Password" send_mail(subject, plain, "FRCShirt<<EMAIL>>", [user.email]) # TODO: Fix html message not displaying in gmail def trade_mail(trade): ctx = {'trade': trade} html = render_to_string('trade/email/trade_notification.html', ctx) plain = "Hey %s, you have a trade offer!\n\n%s offered you their %s for your %s. Go to https://frcshirt.trade/, " \ "log in, and select 'My Items' to view or accept the offer." % ( trade.take.owner.fname, trade.give.owner, trade.give, trade.take ) subject = "Trade offer for your %s" % trade.take send_mail(subject, plain, "FRCShirt<<EMAIL>>", [trade.take.owner.email]) def trade_accepted_mail(trade): ctx = {'trade': trade} # TODO: Find meetup and insert into ctx html = render_to_string('trade/email/trade_accepted.html', ctx) plain = "Hey %s!\n\n%s accepted your trade offer! They want to trade your %s for their %s. You can get in touch " \ "with them at %s to coordinate the trade. " % ( trade.give.owner.fname, trade.take.owner, trade.give, trade.take, trade.take.owner.email ) subject = "Trade offer accepted!" send_mail(subject, plain, "FRCShirt<<EMAIL>>", [trade.give.owner.email]) def trade_cancelled_by_giver(trade): ctx = {'trade': trade} html = None plain = "Hey %s,\n\n%s just marked the trade of your %s for their %s as cancelled. Reach out to them if you think " \ "this is an error. If you'd like to relist your %s, go to frcshirt.trade, click My Items and click " \ "relist on its item page" % ( trade.take.owner.fname, trade.give.owner, trade.take, trade.give, trade.take ) subject = "Trade offer cancelled" send_mail(subject, plain, "FRCShirt<<EMAIL>>", [trade.take.owner.email]) def trade_cancelled_by_taker(trade): ctx = {'trade': trade} html = None plain = "Hey %s,\n\n%s just marked the trade of your %s for their %s as cancelled. Reach out to them if you think " \ "this is an error. If you'd like to relist your %s, go to frcshirt.trade, click My Items and click " \ "relist on its item page" % ( trade.give.owner.fname, trade.take.owner, trade.give, trade.take, trade.give ) subject = "Trade offer cancelled" send_mail(subject, plain, "FRCShirt<<EMAIL>>", [trade.give.owner.email])
0.131703
0.125226
import collections import warnings import torch from reid_evaluation.metric import evaluate, compute_distances from utils import MetricTracker, SharedStorage class ActiveMetric: """Metric class that actively interacts with MetricTracker and SharedStorage to track metrics, during end-of-step and end-of-epoch callbacks. """ def on_step_end(self, items: collections.Mapping, tracker: MetricTracker, storage: SharedStorage): """ :param items: output from data loader and model during a single step :param tracker: metric tracker to write metrics to :param storage: storage to interact with. Note that writing data to storage should be handled by the trainer. A common use-case would be to write to the metadata dictionary. :return: """ pass def on_epoch_end(self, tracker: MetricTracker, storage: SharedStorage): pass def _accuracy(output, target): with torch.no_grad(): pred = torch.argmax(output, dim=1) assert pred.shape[0] == len(target) correct = 0 correct += torch.sum(pred == target).item() return correct / len(target) def _top_k_acc(output, target, k=3): warnings.warn("This metric isn't adapted to the current project. You'll probably get an error") with torch.no_grad(): pred = torch.topk(output, k, dim=1)[1] assert pred.shape[0] == len(target) correct = 0 for i in range(k): correct += torch.sum(pred[:, i] == target).item() return correct / len(target) class Accuracy(ActiveMetric): def __init__(self, output_key="preds", target_key="targets", name="accuracy"): if type(name) is not str: raise Exception("name must be a valid string") self.__name__ = str(name) self.output_key = output_key self.target_key = target_key def on_step_end(self, items: collections.Mapping, tracker: MetricTracker, storage: SharedStorage): output, target = items[self.output_key], items[self.target_key] value = _accuracy(output, target) tracker.update("accuracy", value, n=output.size(0)) class ReidMetric(ActiveMetric): def __init__(self): pass def on_epoch_end(self, tracker: MetricTracker, storage: SharedStorage): qpids = storage.get_data("qpids") gpids = storage.get_data("gpids") qcamids = storage.get_data("qcamids") gcamids = storage.get_data("gcamids") distmat = storage.get_data("distmat") if distmat is None: qf = storage.get_data("qf") gf = storage.get_data("gf") distmat = compute_distances(qf, gf) storage.set_data("distmat", distmat) all_cmc, all_AP, all_INP = evaluate(distmat, qpids, gpids, qcamids, gcamids) r1 = all_cmc[0].item() mAP = all_AP.mean().item() mINP = all_INP.mean().item() tracker.update("r1", r1) tracker.update("mAP", mAP) tracker.update("mINP", mINP) class ReidGlobalDistanceHistogram(ActiveMetric): def __init__(self, train=False): self.train = train def on_epoch_end(self, tracker: MetricTracker, storage: SharedStorage): if self.train: qf = gf = storage.get_data("features") qpids = gpids = storage.get_data("pids") qcamids = gcamids = storage.get_data("camids") prefix = "" else: qf = storage.get_data("qf") gf = storage.get_data("gf") qpids = storage.get_data("qpids") gpids = storage.get_data("gpids") qcamids = storage.get_data("qcamids") gcamids = storage.get_data("gcamids") prefix = "valid_" distmat = storage.get_data("distmat") if distmat is None: distmat = compute_distances(qf, gf) storage.set_data("distmat", distmat) same_pid = gpids.eq(qpids.reshape(-1, 1)) same_cam = gcamids.eq(qcamids.reshape(-1, 1)) negative: torch.Tensor = ~same_pid positive: torch.Tensor = same_pid positive_same_cam = torch.logical_and(same_pid, same_cam) positive_diff_cam = torch.logical_and(same_pid, ~same_cam) if self.train: # filter out identical instances from positive distances same_image = torch.diagflat(torch.ones(qf.size(0), dtype=torch.bool, device=qf.device)) positive.logical_and_(~same_image) positive_same_cam.logical_and_(~same_image) tracker.update(prefix + "global_dist_pos_same_cam_mean", distmat[positive_same_cam].mean().item()) tracker.update(prefix + "global_dist_pos_diff_cam_mean", distmat[positive_diff_cam].mean().item()) tracker.update(prefix + "global_dist_pos_mean", distmat[positive].mean().item()) tracker.update(prefix + "global_dist_neg_mean", distmat[negative].mean().item()) tracker.append_histogram(prefix + "global_dist_pos_same_cam", distmat[positive_same_cam]) tracker.append_histogram(prefix + "global_dist_pos_diff_cam", distmat[positive_diff_cam]) tracker.append_histogram(prefix + "global_dist_pos", distmat[positive]) tracker.append_histogram(prefix + "global_dist_neg", distmat[negative])
model/metric.py
import collections import warnings import torch from reid_evaluation.metric import evaluate, compute_distances from utils import MetricTracker, SharedStorage class ActiveMetric: """Metric class that actively interacts with MetricTracker and SharedStorage to track metrics, during end-of-step and end-of-epoch callbacks. """ def on_step_end(self, items: collections.Mapping, tracker: MetricTracker, storage: SharedStorage): """ :param items: output from data loader and model during a single step :param tracker: metric tracker to write metrics to :param storage: storage to interact with. Note that writing data to storage should be handled by the trainer. A common use-case would be to write to the metadata dictionary. :return: """ pass def on_epoch_end(self, tracker: MetricTracker, storage: SharedStorage): pass def _accuracy(output, target): with torch.no_grad(): pred = torch.argmax(output, dim=1) assert pred.shape[0] == len(target) correct = 0 correct += torch.sum(pred == target).item() return correct / len(target) def _top_k_acc(output, target, k=3): warnings.warn("This metric isn't adapted to the current project. You'll probably get an error") with torch.no_grad(): pred = torch.topk(output, k, dim=1)[1] assert pred.shape[0] == len(target) correct = 0 for i in range(k): correct += torch.sum(pred[:, i] == target).item() return correct / len(target) class Accuracy(ActiveMetric): def __init__(self, output_key="preds", target_key="targets", name="accuracy"): if type(name) is not str: raise Exception("name must be a valid string") self.__name__ = str(name) self.output_key = output_key self.target_key = target_key def on_step_end(self, items: collections.Mapping, tracker: MetricTracker, storage: SharedStorage): output, target = items[self.output_key], items[self.target_key] value = _accuracy(output, target) tracker.update("accuracy", value, n=output.size(0)) class ReidMetric(ActiveMetric): def __init__(self): pass def on_epoch_end(self, tracker: MetricTracker, storage: SharedStorage): qpids = storage.get_data("qpids") gpids = storage.get_data("gpids") qcamids = storage.get_data("qcamids") gcamids = storage.get_data("gcamids") distmat = storage.get_data("distmat") if distmat is None: qf = storage.get_data("qf") gf = storage.get_data("gf") distmat = compute_distances(qf, gf) storage.set_data("distmat", distmat) all_cmc, all_AP, all_INP = evaluate(distmat, qpids, gpids, qcamids, gcamids) r1 = all_cmc[0].item() mAP = all_AP.mean().item() mINP = all_INP.mean().item() tracker.update("r1", r1) tracker.update("mAP", mAP) tracker.update("mINP", mINP) class ReidGlobalDistanceHistogram(ActiveMetric): def __init__(self, train=False): self.train = train def on_epoch_end(self, tracker: MetricTracker, storage: SharedStorage): if self.train: qf = gf = storage.get_data("features") qpids = gpids = storage.get_data("pids") qcamids = gcamids = storage.get_data("camids") prefix = "" else: qf = storage.get_data("qf") gf = storage.get_data("gf") qpids = storage.get_data("qpids") gpids = storage.get_data("gpids") qcamids = storage.get_data("qcamids") gcamids = storage.get_data("gcamids") prefix = "valid_" distmat = storage.get_data("distmat") if distmat is None: distmat = compute_distances(qf, gf) storage.set_data("distmat", distmat) same_pid = gpids.eq(qpids.reshape(-1, 1)) same_cam = gcamids.eq(qcamids.reshape(-1, 1)) negative: torch.Tensor = ~same_pid positive: torch.Tensor = same_pid positive_same_cam = torch.logical_and(same_pid, same_cam) positive_diff_cam = torch.logical_and(same_pid, ~same_cam) if self.train: # filter out identical instances from positive distances same_image = torch.diagflat(torch.ones(qf.size(0), dtype=torch.bool, device=qf.device)) positive.logical_and_(~same_image) positive_same_cam.logical_and_(~same_image) tracker.update(prefix + "global_dist_pos_same_cam_mean", distmat[positive_same_cam].mean().item()) tracker.update(prefix + "global_dist_pos_diff_cam_mean", distmat[positive_diff_cam].mean().item()) tracker.update(prefix + "global_dist_pos_mean", distmat[positive].mean().item()) tracker.update(prefix + "global_dist_neg_mean", distmat[negative].mean().item()) tracker.append_histogram(prefix + "global_dist_pos_same_cam", distmat[positive_same_cam]) tracker.append_histogram(prefix + "global_dist_pos_diff_cam", distmat[positive_diff_cam]) tracker.append_histogram(prefix + "global_dist_pos", distmat[positive]) tracker.append_histogram(prefix + "global_dist_neg", distmat[negative])
0.816333
0.58166
from mvsnet import preprocess as pp import imageio import argparse import json import utils import os """ Converts DTU depth data from the format that is consumed by the original MVSNet to the mvs-training format that is created by export_densify_frames """ def convert_dtu(dtu_dir, output_dir): camera_base = os.path.join(dtu_dir, 'Cameras') camera_dir = os.path.join(dtu_dir, 'Cameras') depths_base = os.path.join(dtu_dir, 'Depths') images_base = os.path.join(dtu_dir, 'Rectified') pair_path = os.path.join(camera_base, 'pair.txt') num_scans = len((utils.list_no_hidden(images_base))) print("Number of scans = ", num_scans) for index, scan in enumerate(sorted(utils.list_no_hidden(images_base))): if index > 43: print("Processing scan", index) # For each dtu scan session there are 7 different lighting settings for l in range(7): session_dir = os.path.join( output_dir, 'dtu_scan_{}_lighting_{}'.format(index, l)) os.makedirs(session_dir) session_images = os.path.join(session_dir, 'images') session_depths = os.path.join(session_dir, 'depths') session_cams = os.path.join(session_dir, 'cameras') os.makedirs(session_images) os.makedirs(session_depths) os.makedirs(session_cams) covis_path = os.path.join(session_dir, 'covisibility.json') depths_dir = os.path.join(depths_base, scan) images_dir = os.path.join(images_base, scan) utils.pair_to_covisibility(pair_path, covis_path) for i in range(49): txt_path = os.path.join(camera_dir, utils.cam_name(i)) json_path = os.path.join(session_cams, '{}.json'.format(i)) # cams need to be rescaled due to image resizing rescale = 512.0 / 1200.0 utils.cam_to_json(txt_path, json_path, scale_factor=rescale) for j in range(49): png_path = os.path.join(session_depths, '{}.png'.format(j)) pfm_path = os.path.join(depths_dir, utils.depth_name(j)) utils.depth_pfm_to_png(pfm_path, png_path) image_path = os.path.join( images_dir, utils.image_name(j, l)) final_image_path = os.path.join( session_images, '{}.jpg'.format(j)) img = imageio.imread(image_path) imageio.imwrite(final_image_path, img) if __name__ == '__main__': parser = argparse.ArgumentParser() parser.add_argument('dtu_dir', type=str, help="Diretory where dtu data is") parser.add_argument('output_dir', type=str, help="Directory to output the converted data") args = parser.parse_args() convert_dtu(args.dtu_dir, args.output_dir)
datasets/convert/dtu_to_mvs_training.py
from mvsnet import preprocess as pp import imageio import argparse import json import utils import os """ Converts DTU depth data from the format that is consumed by the original MVSNet to the mvs-training format that is created by export_densify_frames """ def convert_dtu(dtu_dir, output_dir): camera_base = os.path.join(dtu_dir, 'Cameras') camera_dir = os.path.join(dtu_dir, 'Cameras') depths_base = os.path.join(dtu_dir, 'Depths') images_base = os.path.join(dtu_dir, 'Rectified') pair_path = os.path.join(camera_base, 'pair.txt') num_scans = len((utils.list_no_hidden(images_base))) print("Number of scans = ", num_scans) for index, scan in enumerate(sorted(utils.list_no_hidden(images_base))): if index > 43: print("Processing scan", index) # For each dtu scan session there are 7 different lighting settings for l in range(7): session_dir = os.path.join( output_dir, 'dtu_scan_{}_lighting_{}'.format(index, l)) os.makedirs(session_dir) session_images = os.path.join(session_dir, 'images') session_depths = os.path.join(session_dir, 'depths') session_cams = os.path.join(session_dir, 'cameras') os.makedirs(session_images) os.makedirs(session_depths) os.makedirs(session_cams) covis_path = os.path.join(session_dir, 'covisibility.json') depths_dir = os.path.join(depths_base, scan) images_dir = os.path.join(images_base, scan) utils.pair_to_covisibility(pair_path, covis_path) for i in range(49): txt_path = os.path.join(camera_dir, utils.cam_name(i)) json_path = os.path.join(session_cams, '{}.json'.format(i)) # cams need to be rescaled due to image resizing rescale = 512.0 / 1200.0 utils.cam_to_json(txt_path, json_path, scale_factor=rescale) for j in range(49): png_path = os.path.join(session_depths, '{}.png'.format(j)) pfm_path = os.path.join(depths_dir, utils.depth_name(j)) utils.depth_pfm_to_png(pfm_path, png_path) image_path = os.path.join( images_dir, utils.image_name(j, l)) final_image_path = os.path.join( session_images, '{}.jpg'.format(j)) img = imageio.imread(image_path) imageio.imwrite(final_image_path, img) if __name__ == '__main__': parser = argparse.ArgumentParser() parser.add_argument('dtu_dir', type=str, help="Diretory where dtu data is") parser.add_argument('output_dir', type=str, help="Directory to output the converted data") args = parser.parse_args() convert_dtu(args.dtu_dir, args.output_dir)
0.378
0.23865
import numpy as np import matplotlib.pyplot as plt from matplotlib import animation import matplotlib.patches as patches from LucasKanadeBasis import * from LucasKanade import * from TemplateCorrection import * import time def copyRect(rect): rect_new = [] for ele in rect: rect_new += [ele] return rect_new # write your script here, we recommend the above libraries for making your animation bases = np.load('../data/sylvbases.npy') frames = np.load('../data/sylvseq.npy') seq_len = frames.shape[2] frame0 = frames[:,:,0] rect = [101, 61, 155, 107] rect_baseline = [101, 61, 155, 107] width = rect[3] - rect[1] length = rect[2] - rect[0] rectList = [copyRect(frame0)] rectList_baseline = [copyRect(frame0)] time_total = 0 # since template driftingb uses only the first ever frame # lots of things can be pre-computed here rows_img, cols_img = frame0.shape x1, y1, x2, y2 = rect[0], rect[1], rect[2], rect[3] rows_rect, cols_rect = x2 - x1, y2 - y1 y = np.arange(0, rows_img, 1) x = np.arange(0, cols_img, 1) c = np.linspace(x1, x2, cols_rect) r = np.linspace(y1, y2, rows_rect) cc, rr = np.meshgrid(c, r) spline = RectBivariateSpline(y, x, frame0) T = spline.ev(rr, cc) #Apply LucasKanadeWithTemplateCorrection Algorithm for i in range(seq_len): if i == 0: continue It = frames[:,:,i-1] It1 = frames[:,:,i] p_baseline = LucasKanade(It, It1, rect_baseline) rect_baseline[0] += p_baseline[0] rect_baseline[1] += p_baseline[1] rect_baseline[2] += p_baseline[0] rect_baseline[3] += p_baseline[1] TemplateCorrection(T, It1, rect_baseline) rectList_baseline.append(copyRect(rect_baseline)) #Apply LucasKanadeBasis Algorithm for i in range(seq_len): if i == 0: continue print("Processing frame %d" % i) start = time.time() It = frames[:,:,i-1] It1 = frames[:,:,i] p = LucasKanadeBasis(It, It1, rect, bases) rect[0] += p[0] rect[1] += p[1] rect[2] += p[0] rect[3] += p[1] end = time.time() time_total += end - start rectList.append(copyRect(rect)) if i == 1 or i == 100 or i == 200 or i == 300 or i == 350 or i == 400: plt.figure() plt.imshow(frames[:,:,i],cmap='gray') bbox1 = patches.Rectangle((int(rectList[i][0]), int(rectList[i][1])), length, width, fill=False, edgecolor='blue', linewidth=2) plt.gca().add_patch(bbox1) bbox0 = patches.Rectangle((int(rectList_baseline[i][0]), int(rectList_baseline[i][1])), length, width, fill=False, edgecolor='red', linewidth=2) plt.gca().add_patch(bbox0) plt.title('frame %d' % i) plt.show() np.save('Sylvseqrects.npy',rectList) print('Finished, the tracking frequency is %.4f' % (seq_len / time_total))
src/testSylvSequence.py
import numpy as np import matplotlib.pyplot as plt from matplotlib import animation import matplotlib.patches as patches from LucasKanadeBasis import * from LucasKanade import * from TemplateCorrection import * import time def copyRect(rect): rect_new = [] for ele in rect: rect_new += [ele] return rect_new # write your script here, we recommend the above libraries for making your animation bases = np.load('../data/sylvbases.npy') frames = np.load('../data/sylvseq.npy') seq_len = frames.shape[2] frame0 = frames[:,:,0] rect = [101, 61, 155, 107] rect_baseline = [101, 61, 155, 107] width = rect[3] - rect[1] length = rect[2] - rect[0] rectList = [copyRect(frame0)] rectList_baseline = [copyRect(frame0)] time_total = 0 # since template driftingb uses only the first ever frame # lots of things can be pre-computed here rows_img, cols_img = frame0.shape x1, y1, x2, y2 = rect[0], rect[1], rect[2], rect[3] rows_rect, cols_rect = x2 - x1, y2 - y1 y = np.arange(0, rows_img, 1) x = np.arange(0, cols_img, 1) c = np.linspace(x1, x2, cols_rect) r = np.linspace(y1, y2, rows_rect) cc, rr = np.meshgrid(c, r) spline = RectBivariateSpline(y, x, frame0) T = spline.ev(rr, cc) #Apply LucasKanadeWithTemplateCorrection Algorithm for i in range(seq_len): if i == 0: continue It = frames[:,:,i-1] It1 = frames[:,:,i] p_baseline = LucasKanade(It, It1, rect_baseline) rect_baseline[0] += p_baseline[0] rect_baseline[1] += p_baseline[1] rect_baseline[2] += p_baseline[0] rect_baseline[3] += p_baseline[1] TemplateCorrection(T, It1, rect_baseline) rectList_baseline.append(copyRect(rect_baseline)) #Apply LucasKanadeBasis Algorithm for i in range(seq_len): if i == 0: continue print("Processing frame %d" % i) start = time.time() It = frames[:,:,i-1] It1 = frames[:,:,i] p = LucasKanadeBasis(It, It1, rect, bases) rect[0] += p[0] rect[1] += p[1] rect[2] += p[0] rect[3] += p[1] end = time.time() time_total += end - start rectList.append(copyRect(rect)) if i == 1 or i == 100 or i == 200 or i == 300 or i == 350 or i == 400: plt.figure() plt.imshow(frames[:,:,i],cmap='gray') bbox1 = patches.Rectangle((int(rectList[i][0]), int(rectList[i][1])), length, width, fill=False, edgecolor='blue', linewidth=2) plt.gca().add_patch(bbox1) bbox0 = patches.Rectangle((int(rectList_baseline[i][0]), int(rectList_baseline[i][1])), length, width, fill=False, edgecolor='red', linewidth=2) plt.gca().add_patch(bbox0) plt.title('frame %d' % i) plt.show() np.save('Sylvseqrects.npy',rectList) print('Finished, the tracking frequency is %.4f' % (seq_len / time_total))
0.307462
0.514278
from monitor_server import SERVER if SERVER.config['SQLALCHEMY_DATABASE_URI'].startswith('sqlite:'): from sqlalchemy.dialects.sqlite.json import JSON else: from sqlalchemy.dialects.postgresql.json import JSON class MetricModel(SERVER.DB.Model): __tablename__ = 'TEST_METRICS' test_id = SERVER.DB.Column('ITEM_PK', SERVER.DB.Integer, primary_key=True) session_h = SERVER.DB.Column('SESSION_H', SERVER.DB.ForeignKey('TEST_SESSIONS.SESSION_H')) ctx_h = SERVER.DB.Column('CONTEXT_H', SERVER.DB.ForeignKey('EXECUTION_CONTEXTS.ENV_H')) item_start_time = SERVER.DB.Column('ITEM_START_TIME', SERVER.DB.String(64), nullable=False) item_path = SERVER.DB.Column('ITEM_PATH', SERVER.DB.String(4096), nullable=False) item = SERVER.DB.Column('ITEM', SERVER.DB.String(2048), nullable=False) item_variant = SERVER.DB.Column('ITEM_VARIANT', SERVER.DB.String(2048), nullable=False) item_fs_loc = SERVER.DB.Column('ITEM_FS_LOC', SERVER.DB.String(2048), nullable=False) kind = SERVER.DB.Column('KIND', SERVER.DB.String(64), nullable=False) component = SERVER.DB.Column('COMPONENT', SERVER.DB.String(512), nullable=True) wall_time = SERVER.DB.Column('TOTAL_TIME', SERVER.DB.Float, nullable=False) user_time = SERVER.DB.Column('USER_TIME', SERVER.DB.Float, nullable=False) krnl_time = SERVER.DB.Column('KERNEL_TIME', SERVER.DB.Float, nullable=False) cpu_usage = SERVER.DB.Column('CPU_USAGE', SERVER.DB.Float, nullable=False) mem_usage = SERVER.DB.Column('MEM_USAGE', SERVER.DB.Float, nullable=False) class ExecutionContextModel(SERVER.DB.Model): __tablename__ = 'EXECUTION_CONTEXTS' h = SERVER.DB.Column('ENV_H', SERVER.DB.String(64), primary_key=True, nullable=False) cpu_count = SERVER.DB.Column('CPU_COUNT', SERVER.DB.Integer, nullable=False) cpu_freq = SERVER.DB.Column('CPU_FREQUENCY_MHZ', SERVER.DB.Integer, nullable=False) cpu_type = SERVER.DB.Column('CPU_TYPE', SERVER.DB.String(64), nullable=False) cpu_vendor = SERVER.DB.Column('CPU_VENDOR', SERVER.DB.String(256), nullable=True) ram_total = SERVER.DB.Column('RAM_TOTAL_MB', SERVER.DB.Integer, nullable=False) mac_node = SERVER.DB.Column('MACHINE_NODE', SERVER.DB.String(512), nullable=False) mac_type = SERVER.DB.Column('MACHINE_TYPE', SERVER.DB.String(32), nullable=False) mac_arch = SERVER.DB.Column('MACHINE_ARCH', SERVER.DB.String(16), nullable=False) sys_info = SERVER.DB.Column('SYSTEM_INFO', SERVER.DB.String(256), nullable=False) py_info = SERVER.DB.Column('PYTHON_INFO', SERVER.DB.String(512), nullable=False) ctx_h_rel = SERVER.DB.relationship('MetricModel', backref='exec_ctx', lazy=True) class SessionModel(SERVER.DB.Model): __tablename__ = 'TEST_SESSIONS' h = SERVER.DB.Column('SESSION_H', SERVER.DB.String(64), primary_key=True, nullable=False) run_date = SERVER.DB.Column('RUN_DATE', SERVER.DB.String(64), nullable=False) scm_ref = SERVER.DB.Column('SCM_REF', SERVER.DB.String(128), nullable=True) description = SERVER.DB.Column('DESCRIPTION', SERVER.DB.JSON(), nullable=True) session_h_rel = SERVER.DB.relationship('MetricModel', backref='sessions_ctx', lazy=True)
monitor_server/data/model.py
from monitor_server import SERVER if SERVER.config['SQLALCHEMY_DATABASE_URI'].startswith('sqlite:'): from sqlalchemy.dialects.sqlite.json import JSON else: from sqlalchemy.dialects.postgresql.json import JSON class MetricModel(SERVER.DB.Model): __tablename__ = 'TEST_METRICS' test_id = SERVER.DB.Column('ITEM_PK', SERVER.DB.Integer, primary_key=True) session_h = SERVER.DB.Column('SESSION_H', SERVER.DB.ForeignKey('TEST_SESSIONS.SESSION_H')) ctx_h = SERVER.DB.Column('CONTEXT_H', SERVER.DB.ForeignKey('EXECUTION_CONTEXTS.ENV_H')) item_start_time = SERVER.DB.Column('ITEM_START_TIME', SERVER.DB.String(64), nullable=False) item_path = SERVER.DB.Column('ITEM_PATH', SERVER.DB.String(4096), nullable=False) item = SERVER.DB.Column('ITEM', SERVER.DB.String(2048), nullable=False) item_variant = SERVER.DB.Column('ITEM_VARIANT', SERVER.DB.String(2048), nullable=False) item_fs_loc = SERVER.DB.Column('ITEM_FS_LOC', SERVER.DB.String(2048), nullable=False) kind = SERVER.DB.Column('KIND', SERVER.DB.String(64), nullable=False) component = SERVER.DB.Column('COMPONENT', SERVER.DB.String(512), nullable=True) wall_time = SERVER.DB.Column('TOTAL_TIME', SERVER.DB.Float, nullable=False) user_time = SERVER.DB.Column('USER_TIME', SERVER.DB.Float, nullable=False) krnl_time = SERVER.DB.Column('KERNEL_TIME', SERVER.DB.Float, nullable=False) cpu_usage = SERVER.DB.Column('CPU_USAGE', SERVER.DB.Float, nullable=False) mem_usage = SERVER.DB.Column('MEM_USAGE', SERVER.DB.Float, nullable=False) class ExecutionContextModel(SERVER.DB.Model): __tablename__ = 'EXECUTION_CONTEXTS' h = SERVER.DB.Column('ENV_H', SERVER.DB.String(64), primary_key=True, nullable=False) cpu_count = SERVER.DB.Column('CPU_COUNT', SERVER.DB.Integer, nullable=False) cpu_freq = SERVER.DB.Column('CPU_FREQUENCY_MHZ', SERVER.DB.Integer, nullable=False) cpu_type = SERVER.DB.Column('CPU_TYPE', SERVER.DB.String(64), nullable=False) cpu_vendor = SERVER.DB.Column('CPU_VENDOR', SERVER.DB.String(256), nullable=True) ram_total = SERVER.DB.Column('RAM_TOTAL_MB', SERVER.DB.Integer, nullable=False) mac_node = SERVER.DB.Column('MACHINE_NODE', SERVER.DB.String(512), nullable=False) mac_type = SERVER.DB.Column('MACHINE_TYPE', SERVER.DB.String(32), nullable=False) mac_arch = SERVER.DB.Column('MACHINE_ARCH', SERVER.DB.String(16), nullable=False) sys_info = SERVER.DB.Column('SYSTEM_INFO', SERVER.DB.String(256), nullable=False) py_info = SERVER.DB.Column('PYTHON_INFO', SERVER.DB.String(512), nullable=False) ctx_h_rel = SERVER.DB.relationship('MetricModel', backref='exec_ctx', lazy=True) class SessionModel(SERVER.DB.Model): __tablename__ = 'TEST_SESSIONS' h = SERVER.DB.Column('SESSION_H', SERVER.DB.String(64), primary_key=True, nullable=False) run_date = SERVER.DB.Column('RUN_DATE', SERVER.DB.String(64), nullable=False) scm_ref = SERVER.DB.Column('SCM_REF', SERVER.DB.String(128), nullable=True) description = SERVER.DB.Column('DESCRIPTION', SERVER.DB.JSON(), nullable=True) session_h_rel = SERVER.DB.relationship('MetricModel', backref='sessions_ctx', lazy=True)
0.304972
0.057388
import tempfile import os from sqlite3 import OperationalError import pytest import hypothesis.strategies as hst from hypothesis import given import unicodedata import qcodes as qc import qcodes.dataset.sqlite_base as mut # mut: module under test from qcodes.dataset.database import initialise_database from qcodes.dataset.param_spec import ParamSpec _unicode_categories = ('Lu', 'Ll', 'Lt', 'Lm', 'Lo', 'Nd', 'Pc', 'Pd', 'Zs') @pytest.fixture(scope="function") def empty_temp_db(): # create a temp database for testing with tempfile.TemporaryDirectory() as tmpdirname: qc.config["core"]["db_location"] = os.path.join(tmpdirname, 'temp.db') qc.config["core"]["db_debug"] = True initialise_database() yield @pytest.fixture(scope='function') def experiment(empty_temp_db): e = qc.new_experiment("test-experiment", sample_name="test-sample") yield e e.conn.close() def test_one_raises(experiment): conn = experiment.conn with pytest.raises(RuntimeError): mut.one(conn.cursor(), column='Something_you_dont_have') def test_atomic_transaction_raises(experiment): conn = experiment.conn bad_sql = '""' with pytest.raises(OperationalError): mut.atomic_transaction(conn, bad_sql) def test_atomic_raises(experiment): conn = experiment.conn bad_sql = '""' # it seems that the type of error raised differs between python versions # 3.6.0 (OperationalError) and 3.6.3 (RuntimeError) # -strange, huh? with pytest.raises((OperationalError, RuntimeError)): with mut.atomic(conn): mut.transaction(conn, bad_sql) def test_insert_many_values_raises(experiment): conn = experiment.conn with pytest.raises(ValueError): mut.insert_many_values(conn, 'some_string', ['column1'], values=[[1], [1, 3]]) @given(table_name=hst.text(max_size=50)) def test__validate_table_raises(table_name): should_raise = False for char in table_name: if unicodedata.category(char) not in _unicode_categories: should_raise = True break if should_raise: with pytest.raises(RuntimeError): mut._validate_table_name(table_name) else: assert mut._validate_table_name(table_name) def test_get_dependents(experiment): x = ParamSpec('x', 'numeric') t = ParamSpec('t', 'numeric') y = ParamSpec('y', 'numeric', depends_on=['x', 't']) # Make a dataset (_, run_id, _) = mut.create_run(experiment.conn, experiment.exp_id, name='testrun', parameters=[x, t, y]) deps = mut.get_dependents(experiment.conn, run_id) layout_id = mut.get_layout_id(experiment.conn, 'y', run_id) assert deps == [layout_id] # more parameters, more complicated dependencies x_raw = ParamSpec('x_raw', 'numeric') x_cooked = ParamSpec('x_cooked', 'numeric', inferred_from=['x_raw']) z = ParamSpec('z', 'numeric', depends_on=['x_cooked']) (_, run_id, _) = mut.create_run(experiment.conn, experiment.exp_id, name='testrun', parameters=[x, t, x_raw, x_cooked, y, z]) deps = mut.get_dependents(experiment.conn, run_id) expected_deps = [mut.get_layout_id(experiment.conn, 'y', run_id), mut.get_layout_id(experiment.conn, 'z', run_id)] assert deps == expected_deps
qcodes/tests/dataset/test_sqlite_base.py
import tempfile import os from sqlite3 import OperationalError import pytest import hypothesis.strategies as hst from hypothesis import given import unicodedata import qcodes as qc import qcodes.dataset.sqlite_base as mut # mut: module under test from qcodes.dataset.database import initialise_database from qcodes.dataset.param_spec import ParamSpec _unicode_categories = ('Lu', 'Ll', 'Lt', 'Lm', 'Lo', 'Nd', 'Pc', 'Pd', 'Zs') @pytest.fixture(scope="function") def empty_temp_db(): # create a temp database for testing with tempfile.TemporaryDirectory() as tmpdirname: qc.config["core"]["db_location"] = os.path.join(tmpdirname, 'temp.db') qc.config["core"]["db_debug"] = True initialise_database() yield @pytest.fixture(scope='function') def experiment(empty_temp_db): e = qc.new_experiment("test-experiment", sample_name="test-sample") yield e e.conn.close() def test_one_raises(experiment): conn = experiment.conn with pytest.raises(RuntimeError): mut.one(conn.cursor(), column='Something_you_dont_have') def test_atomic_transaction_raises(experiment): conn = experiment.conn bad_sql = '""' with pytest.raises(OperationalError): mut.atomic_transaction(conn, bad_sql) def test_atomic_raises(experiment): conn = experiment.conn bad_sql = '""' # it seems that the type of error raised differs between python versions # 3.6.0 (OperationalError) and 3.6.3 (RuntimeError) # -strange, huh? with pytest.raises((OperationalError, RuntimeError)): with mut.atomic(conn): mut.transaction(conn, bad_sql) def test_insert_many_values_raises(experiment): conn = experiment.conn with pytest.raises(ValueError): mut.insert_many_values(conn, 'some_string', ['column1'], values=[[1], [1, 3]]) @given(table_name=hst.text(max_size=50)) def test__validate_table_raises(table_name): should_raise = False for char in table_name: if unicodedata.category(char) not in _unicode_categories: should_raise = True break if should_raise: with pytest.raises(RuntimeError): mut._validate_table_name(table_name) else: assert mut._validate_table_name(table_name) def test_get_dependents(experiment): x = ParamSpec('x', 'numeric') t = ParamSpec('t', 'numeric') y = ParamSpec('y', 'numeric', depends_on=['x', 't']) # Make a dataset (_, run_id, _) = mut.create_run(experiment.conn, experiment.exp_id, name='testrun', parameters=[x, t, y]) deps = mut.get_dependents(experiment.conn, run_id) layout_id = mut.get_layout_id(experiment.conn, 'y', run_id) assert deps == [layout_id] # more parameters, more complicated dependencies x_raw = ParamSpec('x_raw', 'numeric') x_cooked = ParamSpec('x_cooked', 'numeric', inferred_from=['x_raw']) z = ParamSpec('z', 'numeric', depends_on=['x_cooked']) (_, run_id, _) = mut.create_run(experiment.conn, experiment.exp_id, name='testrun', parameters=[x, t, x_raw, x_cooked, y, z]) deps = mut.get_dependents(experiment.conn, run_id) expected_deps = [mut.get_layout_id(experiment.conn, 'y', run_id), mut.get_layout_id(experiment.conn, 'z', run_id)] assert deps == expected_deps
0.384334
0.46794
import sys _b=sys.version_info[0]<3 and (lambda x:x) or (lambda x:x.encode('latin1')) from google.protobuf import descriptor as _descriptor from google.protobuf import message as _message from google.protobuf import reflection as _reflection from google.protobuf import symbol_database as _symbol_database from google.protobuf import descriptor_pb2 # @@protoc_insertion_point(imports) _sym_db = _symbol_database.Default() DESCRIPTOR = _descriptor.FileDescriptor( name='pogoprotos/data/friends/friend.proto', package='pogoprotos.data.friends', syntax='proto3', serialized_pb=_b('\n$pogoprotos/data/friends/friend.proto\x12\x17pogoprotos.data.friends\"\x85\x01\n\x06\x46riend\x12\x11\n\tplayer_id\x18\x01 \x01(\t\x12\x10\n\x08\x63odename\x18\x02 \x01(\t\x12\x0c\n\x04team\x18\x03 \x01(\t\x12\r\n\x05score\x18\x04 \x01(\x05\x12\x14\n\x0c\x64\x61ta_with_me\x18\x05 \x01(\x0c\x12\x0f\n\x07version\x18\x06 \x01(\x03\x12\x12\n\ncreated_ms\x18\x07 \x01(\x03\x62\x06proto3') ) _FRIEND = _descriptor.Descriptor( name='Friend', full_name='pogoprotos.data.friends.Friend', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='player_id', full_name='pogoprotos.data.friends.Friend.player_id', index=0, number=1, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), _descriptor.FieldDescriptor( name='codename', full_name='pogoprotos.data.friends.Friend.codename', index=1, number=2, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), _descriptor.FieldDescriptor( name='team', full_name='pogoprotos.data.friends.Friend.team', index=2, number=3, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), _descriptor.FieldDescriptor( name='score', full_name='pogoprotos.data.friends.Friend.score', index=3, number=4, type=5, cpp_type=1, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), _descriptor.FieldDescriptor( name='data_with_me', full_name='pogoprotos.data.friends.Friend.data_with_me', index=4, number=5, type=12, cpp_type=9, label=1, has_default_value=False, default_value=_b(""), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), _descriptor.FieldDescriptor( name='version', full_name='pogoprotos.data.friends.Friend.version', index=5, number=6, type=3, cpp_type=2, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), _descriptor.FieldDescriptor( name='created_ms', full_name='pogoprotos.data.friends.Friend.created_ms', index=6, number=7, type=3, cpp_type=2, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), ], extensions=[ ], nested_types=[], enum_types=[ ], options=None, is_extendable=False, syntax='proto3', extension_ranges=[], oneofs=[ ], serialized_start=66, serialized_end=199, ) DESCRIPTOR.message_types_by_name['Friend'] = _FRIEND _sym_db.RegisterFileDescriptor(DESCRIPTOR) Friend = _reflection.GeneratedProtocolMessageType('Friend', (_message.Message,), dict( DESCRIPTOR = _FRIEND, __module__ = 'pogoprotos.data.friends.friend_pb2' # @@protoc_insertion_point(class_scope:pogoprotos.data.friends.Friend) )) _sym_db.RegisterMessage(Friend) # @@protoc_insertion_point(module_scope)
pgoapi/protos/pogoprotos/data/friends/friend_pb2.py
import sys _b=sys.version_info[0]<3 and (lambda x:x) or (lambda x:x.encode('latin1')) from google.protobuf import descriptor as _descriptor from google.protobuf import message as _message from google.protobuf import reflection as _reflection from google.protobuf import symbol_database as _symbol_database from google.protobuf import descriptor_pb2 # @@protoc_insertion_point(imports) _sym_db = _symbol_database.Default() DESCRIPTOR = _descriptor.FileDescriptor( name='pogoprotos/data/friends/friend.proto', package='pogoprotos.data.friends', syntax='proto3', serialized_pb=_b('\n$pogoprotos/data/friends/friend.proto\x12\x17pogoprotos.data.friends\"\x85\x01\n\x06\x46riend\x12\x11\n\tplayer_id\x18\x01 \x01(\t\x12\x10\n\x08\x63odename\x18\x02 \x01(\t\x12\x0c\n\x04team\x18\x03 \x01(\t\x12\r\n\x05score\x18\x04 \x01(\x05\x12\x14\n\x0c\x64\x61ta_with_me\x18\x05 \x01(\x0c\x12\x0f\n\x07version\x18\x06 \x01(\x03\x12\x12\n\ncreated_ms\x18\x07 \x01(\x03\x62\x06proto3') ) _FRIEND = _descriptor.Descriptor( name='Friend', full_name='pogoprotos.data.friends.Friend', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='player_id', full_name='pogoprotos.data.friends.Friend.player_id', index=0, number=1, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), _descriptor.FieldDescriptor( name='codename', full_name='pogoprotos.data.friends.Friend.codename', index=1, number=2, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), _descriptor.FieldDescriptor( name='team', full_name='pogoprotos.data.friends.Friend.team', index=2, number=3, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), _descriptor.FieldDescriptor( name='score', full_name='pogoprotos.data.friends.Friend.score', index=3, number=4, type=5, cpp_type=1, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), _descriptor.FieldDescriptor( name='data_with_me', full_name='pogoprotos.data.friends.Friend.data_with_me', index=4, number=5, type=12, cpp_type=9, label=1, has_default_value=False, default_value=_b(""), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), _descriptor.FieldDescriptor( name='version', full_name='pogoprotos.data.friends.Friend.version', index=5, number=6, type=3, cpp_type=2, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), _descriptor.FieldDescriptor( name='created_ms', full_name='pogoprotos.data.friends.Friend.created_ms', index=6, number=7, type=3, cpp_type=2, label=1, has_default_value=False, default_value=0, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None), ], extensions=[ ], nested_types=[], enum_types=[ ], options=None, is_extendable=False, syntax='proto3', extension_ranges=[], oneofs=[ ], serialized_start=66, serialized_end=199, ) DESCRIPTOR.message_types_by_name['Friend'] = _FRIEND _sym_db.RegisterFileDescriptor(DESCRIPTOR) Friend = _reflection.GeneratedProtocolMessageType('Friend', (_message.Message,), dict( DESCRIPTOR = _FRIEND, __module__ = 'pogoprotos.data.friends.friend_pb2' # @@protoc_insertion_point(class_scope:pogoprotos.data.friends.Friend) )) _sym_db.RegisterMessage(Friend) # @@protoc_insertion_point(module_scope)
0.16248
0.112162
import os import time import yaml from pathlib import Path import numpy as np import astropy.units as u from astropy.coordinates import SkyCoord from gammapy.modeling.models import ( SkyModel, ExpCutoffPowerLawSpectralModel, PointSpatialModel, ) from gammapy.spectrum import FluxPointsEstimator from gammapy.modeling import Fit from gammapy.data import DataStore from gammapy.maps import MapAxis, WcsGeom from gammapy.cube import MapDatasetMaker, MapDataset, SafeMaskMaker N_OBS = int(os.environ.get("GAMMAPY_BENCH_N_OBS", 10)) def data_prep(): data_store = DataStore.from_dir("$GAMMAPY_DATA/cta-1dc/index/gps/") OBS_ID = 110380 obs_ids = OBS_ID * np.ones(N_OBS) observations = data_store.get_observations(obs_ids) energy_axis = MapAxis.from_bounds( 0.1, 10, nbin=10, unit="TeV", name="energy", interp="log" ) geom = WcsGeom.create( skydir=(0, 0), binsz=0.02, width=(10, 8), coordsys="GAL", proj="CAR", axes=[energy_axis], ) src_pos = SkyCoord(0, 0, unit="deg", frame="galactic") offset_max = 4 * u.deg maker = MapDatasetMaker(offset_max=offset_max) safe_mask_maker = SafeMaskMaker(methods=["offset-max"], offset_max="4 deg") stacked = MapDataset.create(geom=geom) datasets = [] for obs in observations: dataset = maker.run(stacked, obs) dataset = safe_mask_maker.run(dataset, obs) dataset.edisp = dataset.edisp.get_energy_dispersion( position=src_pos, e_reco=energy_axis.edges ) dataset.psf = dataset.psf.get_psf_kernel( position=src_pos, geom=geom, max_radius="0.3 deg" ) datasets.append(dataset) return datasets def write(datasets): for ind, dataset in enumerate(datasets): dataset.write(f"dataset-{ind}.fits", overwrite=True) def read(): datasets = [] spatial_model = PointSpatialModel( lon_0="-0.05 deg", lat_0="-0.05 deg", frame="galactic" ) spectral_model = ExpCutoffPowerLawSpectralModel( index=2, amplitude=3e-12 * u.Unit("cm-2 s-1 TeV-1"), reference=1.0 * u.TeV, lambda_=0.1 / u.TeV, ) model = SkyModel( spatial_model=spatial_model, spectral_model=spectral_model, name="gc-source" ) for ind in range(N_OBS): dataset = MapDataset.read(f"dataset-{ind}.fits") dataset.model = model datasets.append(dataset) return datasets def data_fit(datasets): fit = Fit(datasets) result = fit.run() def flux_point(datasets): e_edges = [0.3, 1, 3, 10] * u.TeV fpe = FluxPointsEstimator(datasets=datasets, e_edges=e_edges, source="gc-source") fpe.run() def run_benchmark(): info = {"n_obs": N_OBS} t = time.time() datasets = data_prep() info["data_preparation"] = time.time() - t t = time.time() write(datasets) info["writing"] = time.time() - t t = time.time() datasets = read() info["reading"] = time.time() - t t = time.time() data_fit(datasets) info["data_fitting"] = time.time() - t t = time.time() flux_point(datasets) info["flux_point"] = time.time() - t Path("bench.yaml").write_text(yaml.dump(info, sort_keys=False, indent=4)) if __name__ == "__main__": run_benchmark()
benchmarks/analysis_3d_joint.py
import os import time import yaml from pathlib import Path import numpy as np import astropy.units as u from astropy.coordinates import SkyCoord from gammapy.modeling.models import ( SkyModel, ExpCutoffPowerLawSpectralModel, PointSpatialModel, ) from gammapy.spectrum import FluxPointsEstimator from gammapy.modeling import Fit from gammapy.data import DataStore from gammapy.maps import MapAxis, WcsGeom from gammapy.cube import MapDatasetMaker, MapDataset, SafeMaskMaker N_OBS = int(os.environ.get("GAMMAPY_BENCH_N_OBS", 10)) def data_prep(): data_store = DataStore.from_dir("$GAMMAPY_DATA/cta-1dc/index/gps/") OBS_ID = 110380 obs_ids = OBS_ID * np.ones(N_OBS) observations = data_store.get_observations(obs_ids) energy_axis = MapAxis.from_bounds( 0.1, 10, nbin=10, unit="TeV", name="energy", interp="log" ) geom = WcsGeom.create( skydir=(0, 0), binsz=0.02, width=(10, 8), coordsys="GAL", proj="CAR", axes=[energy_axis], ) src_pos = SkyCoord(0, 0, unit="deg", frame="galactic") offset_max = 4 * u.deg maker = MapDatasetMaker(offset_max=offset_max) safe_mask_maker = SafeMaskMaker(methods=["offset-max"], offset_max="4 deg") stacked = MapDataset.create(geom=geom) datasets = [] for obs in observations: dataset = maker.run(stacked, obs) dataset = safe_mask_maker.run(dataset, obs) dataset.edisp = dataset.edisp.get_energy_dispersion( position=src_pos, e_reco=energy_axis.edges ) dataset.psf = dataset.psf.get_psf_kernel( position=src_pos, geom=geom, max_radius="0.3 deg" ) datasets.append(dataset) return datasets def write(datasets): for ind, dataset in enumerate(datasets): dataset.write(f"dataset-{ind}.fits", overwrite=True) def read(): datasets = [] spatial_model = PointSpatialModel( lon_0="-0.05 deg", lat_0="-0.05 deg", frame="galactic" ) spectral_model = ExpCutoffPowerLawSpectralModel( index=2, amplitude=3e-12 * u.Unit("cm-2 s-1 TeV-1"), reference=1.0 * u.TeV, lambda_=0.1 / u.TeV, ) model = SkyModel( spatial_model=spatial_model, spectral_model=spectral_model, name="gc-source" ) for ind in range(N_OBS): dataset = MapDataset.read(f"dataset-{ind}.fits") dataset.model = model datasets.append(dataset) return datasets def data_fit(datasets): fit = Fit(datasets) result = fit.run() def flux_point(datasets): e_edges = [0.3, 1, 3, 10] * u.TeV fpe = FluxPointsEstimator(datasets=datasets, e_edges=e_edges, source="gc-source") fpe.run() def run_benchmark(): info = {"n_obs": N_OBS} t = time.time() datasets = data_prep() info["data_preparation"] = time.time() - t t = time.time() write(datasets) info["writing"] = time.time() - t t = time.time() datasets = read() info["reading"] = time.time() - t t = time.time() data_fit(datasets) info["data_fitting"] = time.time() - t t = time.time() flux_point(datasets) info["flux_point"] = time.time() - t Path("bench.yaml").write_text(yaml.dump(info, sort_keys=False, indent=4)) if __name__ == "__main__": run_benchmark()
0.662796
0.471467
from ast import Pass import sqlite3 from pyrsistent import v from utilities.exceptions import DBCursorError, DatabaseConnectionError, QueryError class BaseService(object): def __init__(self): """ :param cursor: """ super().__init__() self.query = "" def execute_query_fetchall(self, **character_check: dict) -> dict: """ Executes the built query and then fetches all the resulting rows from the db. Returns the whole result set. :param character_check: a dict that includes language as string include as list[str] exclude as list[str] :return: result_set_json as dict. """ try: if character_check["language"] == "tr": conn = sqlite3.connect('database/gtsTR.sqlite3.db') else: conn = sqlite3.connect('database/gtsEN.sqlite3.db') except: raise DatabaseConnectionError("Can not connect to sqlite db.") try: conn.row_factory = lambda cursor, row: row[0] cursor = conn.cursor() except: raise DBCursorError("Can not initialize cursor.") try: cursor.execute(self.query) result_set = cursor.fetchall() result_set_json = {"result": result_set} except: raise QueryError("Can not execute desired query.") finally: cursor.close() conn.close() if character_check["include"]: result_set_json = self.include_control(character_check["include"], result_set_json) if character_check["exclude"]: result_set_json = self.exclude_control(character_check["exclude"], result_set_json) result_set_json["result"] = [word.upper() for word in result_set_json["result"] if (" " not in word) and (len(word) > 1)] return result_set_json def build_query_params(self, length: str, word: str, language: str) -> None: """ Builds query parameters. Removes blank lines, Generates query. :param: length as str, word as str, language as str :return: """ generated_word = "" for letter in word: if letter == " ": generated_word += "_" else: generated_word += letter if language == "tr": return self.build_query_tr(length, generated_word) else: return self.build_query_en(length, generated_word) def build_query_tr(self, length: str, word: str) -> None: """ Builds query with given parameters. :param: length as str, word as str. """ try: if length == 0: self.query = "SELECT madde FROM madde WHERE madde LIKE '%{0}%' order by madde".format(word) else: self.query = "SELECT madde FROM madde WHERE LENGTH(madde)={0} and madde LIKE '%{1}%' order by madde".format(length, word) except: raise QueryError("Failed to fetch items. Check query parameters!") def build_query_en(self, length: str, word: str) -> None: """ Builds query with given parameters. :param: length as str, word as str. """ try: if length == 0: self.query = "SELECT word FROM entries WHERE word LIKE '%{0}%' order by word".format(word) else: self.query = "SELECT word FROM entries WHERE LENGTH(word)={0} and word LIKE '%{1}%' order by word".format(length, word) except: raise QueryError("Failed to fetch items. Check query parameters!") def include_control(self, char_list: list, result_set_json: dict) -> dict: """ Executes include letter control. :param: char_list as list, result_set_json as dict :return: result_set_json as dict """ include_list = [] char_list_set = set([char.lower() for char in char_list]) for word in result_set_json["result"]: set_word = set(word) if len(char_list_set.intersection(set_word)) == len(char_list): include_list.append(word) result_set_json["result"] = include_list return result_set_json def exclude_control(self, char_list: list, result_set_json: dict) -> dict: """ Executes exclude letter control. :param: char_list as list, result_set_json as dict :return: result_set_json as dict """ # TODO : Which faster algorithm can be used here? hash_map = {} exclude_list = [] for char in char_list: for word in result_set_json["result"]: if char not in word.lower() and word not in hash_map.keys(): hash_map[word] = 1 elif char not in word.lower() and word in hash_map.keys(): hash_map[word] += 1 for word, counter in hash_map.items(): if counter == len(char_list): exclude_list.append(word) result_set_json["result"] = exclude_list return result_set_json
services/base_service.py
from ast import Pass import sqlite3 from pyrsistent import v from utilities.exceptions import DBCursorError, DatabaseConnectionError, QueryError class BaseService(object): def __init__(self): """ :param cursor: """ super().__init__() self.query = "" def execute_query_fetchall(self, **character_check: dict) -> dict: """ Executes the built query and then fetches all the resulting rows from the db. Returns the whole result set. :param character_check: a dict that includes language as string include as list[str] exclude as list[str] :return: result_set_json as dict. """ try: if character_check["language"] == "tr": conn = sqlite3.connect('database/gtsTR.sqlite3.db') else: conn = sqlite3.connect('database/gtsEN.sqlite3.db') except: raise DatabaseConnectionError("Can not connect to sqlite db.") try: conn.row_factory = lambda cursor, row: row[0] cursor = conn.cursor() except: raise DBCursorError("Can not initialize cursor.") try: cursor.execute(self.query) result_set = cursor.fetchall() result_set_json = {"result": result_set} except: raise QueryError("Can not execute desired query.") finally: cursor.close() conn.close() if character_check["include"]: result_set_json = self.include_control(character_check["include"], result_set_json) if character_check["exclude"]: result_set_json = self.exclude_control(character_check["exclude"], result_set_json) result_set_json["result"] = [word.upper() for word in result_set_json["result"] if (" " not in word) and (len(word) > 1)] return result_set_json def build_query_params(self, length: str, word: str, language: str) -> None: """ Builds query parameters. Removes blank lines, Generates query. :param: length as str, word as str, language as str :return: """ generated_word = "" for letter in word: if letter == " ": generated_word += "_" else: generated_word += letter if language == "tr": return self.build_query_tr(length, generated_word) else: return self.build_query_en(length, generated_word) def build_query_tr(self, length: str, word: str) -> None: """ Builds query with given parameters. :param: length as str, word as str. """ try: if length == 0: self.query = "SELECT madde FROM madde WHERE madde LIKE '%{0}%' order by madde".format(word) else: self.query = "SELECT madde FROM madde WHERE LENGTH(madde)={0} and madde LIKE '%{1}%' order by madde".format(length, word) except: raise QueryError("Failed to fetch items. Check query parameters!") def build_query_en(self, length: str, word: str) -> None: """ Builds query with given parameters. :param: length as str, word as str. """ try: if length == 0: self.query = "SELECT word FROM entries WHERE word LIKE '%{0}%' order by word".format(word) else: self.query = "SELECT word FROM entries WHERE LENGTH(word)={0} and word LIKE '%{1}%' order by word".format(length, word) except: raise QueryError("Failed to fetch items. Check query parameters!") def include_control(self, char_list: list, result_set_json: dict) -> dict: """ Executes include letter control. :param: char_list as list, result_set_json as dict :return: result_set_json as dict """ include_list = [] char_list_set = set([char.lower() for char in char_list]) for word in result_set_json["result"]: set_word = set(word) if len(char_list_set.intersection(set_word)) == len(char_list): include_list.append(word) result_set_json["result"] = include_list return result_set_json def exclude_control(self, char_list: list, result_set_json: dict) -> dict: """ Executes exclude letter control. :param: char_list as list, result_set_json as dict :return: result_set_json as dict """ # TODO : Which faster algorithm can be used here? hash_map = {} exclude_list = [] for char in char_list: for word in result_set_json["result"]: if char not in word.lower() and word not in hash_map.keys(): hash_map[word] = 1 elif char not in word.lower() and word in hash_map.keys(): hash_map[word] += 1 for word, counter in hash_map.items(): if counter == len(char_list): exclude_list.append(word) result_set_json["result"] = exclude_list return result_set_json
0.367384
0.159119
import matplotlib.pyplot as plt import matplotlib.patches as patches plt.figure(figsize=(10,10)) plt.axis('off') cz = (0.3, 0.3, 0.3) cy = (0.7, 0.4, 0.12) ci = (0.1, 0.3, 0.5) ct = (0.7, 0.2, 0.1) def ln_func(text, x, y, color, mode=None): if mode is None: color_font = b_color = color alpha_bg = 0 elif mode == 'i': color_font = 'white' b_color = color alpha_bg = 1 elif mode == 'b': color_font = b_color = color color = 'white' alpha_bg = 1 plt.text(x, y, text, ha="left", va="top", color=color_font, bbox=dict(boxstyle="round", alpha=alpha_bg, ec=b_color, fc=color)) ty = 1 tx = 0.8 ln_func("Flowchart", tx-0.03, ty, ct, 'i') ty -= 0.03 ln_func('<if', tx+0.0, ty, cz) ln_func('$\\it{textspan\_a}$', tx+0.03, ty, cy) ln_func('>', tx+0.13, ty, cz) plt.gca().add_patch(patches.FancyArrowPatch((tx+0.13, ty-0.015), (tx+0.1, ty-0.075), connectionstyle="arc3,rad=-.7", color=cz, arrowstyle="Simple,head_width=3,head_length=6")) ln_func('else', tx+0.12, ty-0.0325, cz, 'b') plt.gca().add_patch(patches.FancyArrowPatch((tx, ty-0.015), (tx, ty-0.135), connectionstyle="arc3,rad=.7", color=cz, arrowstyle="Simple,head_width=3,head_length=6")) ln_func('then', tx-0.0625, ty-0.065, cz, 'b') ty-= 0.06 ln_func('$\\it{textspan\_b}$', tx+0.0, ty, ci) ty -= 0.06 ln_func('$\\it{textspan\_c}$', tx+0.0, ty, ct) ty = 1 tx = 0.0 ln_func("TRANSCRIPT", tx-0.03, ty, cz, 'i') ty -= 0.05 ln_func("sentence_a", tx+0.00, ty, ci) ty -= 0.05 ln_func("sentence_b", tx+0.00, ty, ct) ty -= 0.05 ln_func("sentence_c", tx+0.00, ty, ct) plt.text(0.16, 0.9, "Extract", color='w', ha="center", va="center", rotation=0, size=10, bbox={'boxstyle':"rarrow", 'fc':'dodgerblue', 'ec':'dodgerblue'}) plt.text(0.38, 0.9, "Classify", color='w', ha="center", va="center", rotation=0, size=10, bbox={'boxstyle':"rarrow", 'fc':'dodgerblue', 'ec':'dodgerblue'}) plt.text(0.665, 0.9, "Assemble", color='w', ha="center", va="center", rotation=0, size=10, bbox={'boxstyle':"rarrow", 'fc':'dodgerblue', 'ec':'dodgerblue'}) ty = 1.0 tx = 0.22 ln_func("Text Spans", tx-0.03, ty, ci, 'i') ty -= 0.05 ln_func("$\\it{textspan\_a}$", tx+0, ty, cy) ty -= 0.05 ln_func("$\\it{textspan\_b}$", tx+0, ty, ci) ty -= 0.05 ln_func("$\\it{textspan\_c}$", tx+0, ty, ct) ty = 1 tx = 0.45 ln_func("Relations", tx-0.03, ty, ci, 'i') ty -= 0.03 ln_func("$\\it{textspan\_a}$", tx+0.00, ty, cy) ln_func("$\\it{textspan\_b}$", tx+0.0, ty-0.02, ci) ln_func('<next>', tx+0.11, ty-0.01, cz, 'b') ty -= 0.06 ln_func("$\\it{textspan\_a}$", tx+0.00, ty, cy) ln_func("$\\it{textspan\_c}$", tx+0.0, ty-0.02, ct) ln_func('<if>', tx+0.11, ty-0.01, cz, 'b') ty -= 0.06 ln_func("$\\it{textspan\_b}$", tx+0.00, ty, ci) ln_func("$\\it{textspan\_c}$", tx+0.0, ty-0.02, ct) ln_func('<none>', tx+0.11, ty-0.01, cz, 'b') plt.savefig('figurepredict', dpi=1500) #plt.show()
paper/figure_predict.py
import matplotlib.pyplot as plt import matplotlib.patches as patches plt.figure(figsize=(10,10)) plt.axis('off') cz = (0.3, 0.3, 0.3) cy = (0.7, 0.4, 0.12) ci = (0.1, 0.3, 0.5) ct = (0.7, 0.2, 0.1) def ln_func(text, x, y, color, mode=None): if mode is None: color_font = b_color = color alpha_bg = 0 elif mode == 'i': color_font = 'white' b_color = color alpha_bg = 1 elif mode == 'b': color_font = b_color = color color = 'white' alpha_bg = 1 plt.text(x, y, text, ha="left", va="top", color=color_font, bbox=dict(boxstyle="round", alpha=alpha_bg, ec=b_color, fc=color)) ty = 1 tx = 0.8 ln_func("Flowchart", tx-0.03, ty, ct, 'i') ty -= 0.03 ln_func('<if', tx+0.0, ty, cz) ln_func('$\\it{textspan\_a}$', tx+0.03, ty, cy) ln_func('>', tx+0.13, ty, cz) plt.gca().add_patch(patches.FancyArrowPatch((tx+0.13, ty-0.015), (tx+0.1, ty-0.075), connectionstyle="arc3,rad=-.7", color=cz, arrowstyle="Simple,head_width=3,head_length=6")) ln_func('else', tx+0.12, ty-0.0325, cz, 'b') plt.gca().add_patch(patches.FancyArrowPatch((tx, ty-0.015), (tx, ty-0.135), connectionstyle="arc3,rad=.7", color=cz, arrowstyle="Simple,head_width=3,head_length=6")) ln_func('then', tx-0.0625, ty-0.065, cz, 'b') ty-= 0.06 ln_func('$\\it{textspan\_b}$', tx+0.0, ty, ci) ty -= 0.06 ln_func('$\\it{textspan\_c}$', tx+0.0, ty, ct) ty = 1 tx = 0.0 ln_func("TRANSCRIPT", tx-0.03, ty, cz, 'i') ty -= 0.05 ln_func("sentence_a", tx+0.00, ty, ci) ty -= 0.05 ln_func("sentence_b", tx+0.00, ty, ct) ty -= 0.05 ln_func("sentence_c", tx+0.00, ty, ct) plt.text(0.16, 0.9, "Extract", color='w', ha="center", va="center", rotation=0, size=10, bbox={'boxstyle':"rarrow", 'fc':'dodgerblue', 'ec':'dodgerblue'}) plt.text(0.38, 0.9, "Classify", color='w', ha="center", va="center", rotation=0, size=10, bbox={'boxstyle':"rarrow", 'fc':'dodgerblue', 'ec':'dodgerblue'}) plt.text(0.665, 0.9, "Assemble", color='w', ha="center", va="center", rotation=0, size=10, bbox={'boxstyle':"rarrow", 'fc':'dodgerblue', 'ec':'dodgerblue'}) ty = 1.0 tx = 0.22 ln_func("Text Spans", tx-0.03, ty, ci, 'i') ty -= 0.05 ln_func("$\\it{textspan\_a}$", tx+0, ty, cy) ty -= 0.05 ln_func("$\\it{textspan\_b}$", tx+0, ty, ci) ty -= 0.05 ln_func("$\\it{textspan\_c}$", tx+0, ty, ct) ty = 1 tx = 0.45 ln_func("Relations", tx-0.03, ty, ci, 'i') ty -= 0.03 ln_func("$\\it{textspan\_a}$", tx+0.00, ty, cy) ln_func("$\\it{textspan\_b}$", tx+0.0, ty-0.02, ci) ln_func('<next>', tx+0.11, ty-0.01, cz, 'b') ty -= 0.06 ln_func("$\\it{textspan\_a}$", tx+0.00, ty, cy) ln_func("$\\it{textspan\_c}$", tx+0.0, ty-0.02, ct) ln_func('<if>', tx+0.11, ty-0.01, cz, 'b') ty -= 0.06 ln_func("$\\it{textspan\_b}$", tx+0.00, ty, ci) ln_func("$\\it{textspan\_c}$", tx+0.0, ty-0.02, ct) ln_func('<none>', tx+0.11, ty-0.01, cz, 'b') plt.savefig('figurepredict', dpi=1500) #plt.show()
0.412412
0.474692
import argparse, os, readline, sys require date, taskfile, help __dir__ = os.path.join(*os.path.split(__file__)[:-1]) \ if os.path.basename(__file__)!=__file__ else "." # Command Line Argument Validation operations = "list add edit delete move do fail help report".split() ap = argparse.ArgumentParser(description="A Command Line ToDoList Manager", add_help=False) ap.add_argument("data", nargs="*", default=[]) ap.add_argument("-h","--help", action="store_true", default=False) ap.add_argument("-f","--file", default="./todolist.txt") ap.add_argument("-n","--nosave", action="store_true", default=False) ap.add_argument("--date", type=Date, default="today") ap.add_argument("--nodeadline", action="store_true", default=False) # User Interaction Functions def confirm(msg="Are you sure?"): while True: x = raw_input(msg+" (yes/no) ") if x=="yes": return True elif x=="no": return False print def prompt(prompt, prefill=""): readline.set_startup_hook(lambda: readline.insert_text(prefill)) try: data = raw_input(prompt) print return data finally: readline.set_startup_hook() # Convenience Functions def __relocate(taskfile,task,name): if task.group: task.group.task_remove(task) taskfile.update(task.group) taskgroup = taskfile.group(name) if not taskgroup: return False taskgroup.task_add(task) task.group = taskgroup taskfile.update(taskgroup) return True def __main(): print args, unknown = ap.parse_known_args() if len(unknown)>0: print help.basic sys.exit(0) if len(args.data) and args.data[0] in operations: operation = args.data[0] args.data.pop(0) else: operation = "list" if args.help or operation=="help": print help.full sys.exit(0) realdate = args.date.date==datetime.date.today() taskfile = TaskFile(args.file,args.date,args.nodeadline) if operation=="add": if len(args.data)>0: group = taskfile.group(args.data[0]) if group: args.data.pop(0) else: group = taskfile.group("today") else: group = taskfile.group("today") if len(args.data)>0: line = " ".join(args.data) else: while True: line = prompt("Add Task: ") if line.strip()!="": break task = Task(line,group,args.date,args.nodeadline) group.task_add(task) taskfile.update(group) print group.tabulate() today = taskfile.group("today") task = task.periodic(today) if task: today.task_add(task) taskfile.update(today) else: if len(args.data)==0: group = taskfile.group("today") else: group = taskfile.select(args.data[0], args.data[1:]) if not group: group = taskfile.select("today", args.data) if operation not in ("list","report"): tasks = group.task_list() if len(tasks)==0: raise Exception("No Matching Task") elif len(tasks)==1: task = tasks[0] else: print group.tabulate(True) while True: index = prompt("Select Task by Index: ") try: task = tasks[int(index)] except ValueError, IndexError: continue break del tasks if operation in ("edit","delete","move"): print TaskGroup([task]).tabulate() if operation=="list": print group.tabulate() elif operation=="report": print group.report() elif operation=="edit": while True: line = prompt("Edit Task: ",str(task)) if line!="": break task.update(line) taskfile.update(task.group) elif operation=="delete": task.group.task_remove(task) taskfile.update(task.group) elif operation=="move": while True: name = prompt("Enter Destination Date: ") try: group = taskfile.group(name) except: continue break __relocate(taskfile,task,group.name) elif operation=="do": task.tag_remove("failed") task.tag_remove("impossible") task.tag_add("done") taskfile.update(task.group) elif operation=="fail": task.tag_add("failed") task.tag_remove("impossible") task.tag_remove("done") taskfile.update(task.group) if operation not in ("list","delete","report"): print TaskGroup([task]).tabulate() if args.nosave or not realdate: pass elif operation in ("list","report"): taskfile.save() elif confirm(): taskfile.save() print "Saved updates to file." print def main(): try: __main() except KeyboardInterrupt: print "^SIGINT\n" sys.exit(1) except Exception as e: print "Error:", e.message, "\n" exports["main"] = main
src/cli.py
import argparse, os, readline, sys require date, taskfile, help __dir__ = os.path.join(*os.path.split(__file__)[:-1]) \ if os.path.basename(__file__)!=__file__ else "." # Command Line Argument Validation operations = "list add edit delete move do fail help report".split() ap = argparse.ArgumentParser(description="A Command Line ToDoList Manager", add_help=False) ap.add_argument("data", nargs="*", default=[]) ap.add_argument("-h","--help", action="store_true", default=False) ap.add_argument("-f","--file", default="./todolist.txt") ap.add_argument("-n","--nosave", action="store_true", default=False) ap.add_argument("--date", type=Date, default="today") ap.add_argument("--nodeadline", action="store_true", default=False) # User Interaction Functions def confirm(msg="Are you sure?"): while True: x = raw_input(msg+" (yes/no) ") if x=="yes": return True elif x=="no": return False print def prompt(prompt, prefill=""): readline.set_startup_hook(lambda: readline.insert_text(prefill)) try: data = raw_input(prompt) print return data finally: readline.set_startup_hook() # Convenience Functions def __relocate(taskfile,task,name): if task.group: task.group.task_remove(task) taskfile.update(task.group) taskgroup = taskfile.group(name) if not taskgroup: return False taskgroup.task_add(task) task.group = taskgroup taskfile.update(taskgroup) return True def __main(): print args, unknown = ap.parse_known_args() if len(unknown)>0: print help.basic sys.exit(0) if len(args.data) and args.data[0] in operations: operation = args.data[0] args.data.pop(0) else: operation = "list" if args.help or operation=="help": print help.full sys.exit(0) realdate = args.date.date==datetime.date.today() taskfile = TaskFile(args.file,args.date,args.nodeadline) if operation=="add": if len(args.data)>0: group = taskfile.group(args.data[0]) if group: args.data.pop(0) else: group = taskfile.group("today") else: group = taskfile.group("today") if len(args.data)>0: line = " ".join(args.data) else: while True: line = prompt("Add Task: ") if line.strip()!="": break task = Task(line,group,args.date,args.nodeadline) group.task_add(task) taskfile.update(group) print group.tabulate() today = taskfile.group("today") task = task.periodic(today) if task: today.task_add(task) taskfile.update(today) else: if len(args.data)==0: group = taskfile.group("today") else: group = taskfile.select(args.data[0], args.data[1:]) if not group: group = taskfile.select("today", args.data) if operation not in ("list","report"): tasks = group.task_list() if len(tasks)==0: raise Exception("No Matching Task") elif len(tasks)==1: task = tasks[0] else: print group.tabulate(True) while True: index = prompt("Select Task by Index: ") try: task = tasks[int(index)] except ValueError, IndexError: continue break del tasks if operation in ("edit","delete","move"): print TaskGroup([task]).tabulate() if operation=="list": print group.tabulate() elif operation=="report": print group.report() elif operation=="edit": while True: line = prompt("Edit Task: ",str(task)) if line!="": break task.update(line) taskfile.update(task.group) elif operation=="delete": task.group.task_remove(task) taskfile.update(task.group) elif operation=="move": while True: name = prompt("Enter Destination Date: ") try: group = taskfile.group(name) except: continue break __relocate(taskfile,task,group.name) elif operation=="do": task.tag_remove("failed") task.tag_remove("impossible") task.tag_add("done") taskfile.update(task.group) elif operation=="fail": task.tag_add("failed") task.tag_remove("impossible") task.tag_remove("done") taskfile.update(task.group) if operation not in ("list","delete","report"): print TaskGroup([task]).tabulate() if args.nosave or not realdate: pass elif operation in ("list","report"): taskfile.save() elif confirm(): taskfile.save() print "Saved updates to file." print def main(): try: __main() except KeyboardInterrupt: print "^SIGINT\n" sys.exit(1) except Exception as e: print "Error:", e.message, "\n" exports["main"] = main
0.069954
0.087994
from collections import OrderedDict import tensorflow as tf from tensorflow.keras.layers import ReLU, LayerNormalization from tensorflow.keras.layers import UpSampling2D from .adain import AdaptiveInstanceNormalization from .linear_blocks import linear_block from .conv_blocks import res_block from .conv_blocks import conv_block from .conv_blocks import res_block_adain from .conv_blocks import conv_block_adain from .norm import InstanceNorm, AdaptiveInstanceNorm, LayerNorm def _adain_params_iter(adain_config, adain_params): slices = [] curr_slice = 0 for _, dim in adain_config.items(): slices.append(adain_params[:, curr_slice: curr_slice + dim]) curr_slice += dim return slices.__iter__() def _get_adain_layer_params(adain_params, slices_iter): beta_left, beta_right = next(slices_iter) gamma_left, gamma_right = next(slices_iter) beta = adain_params[:, beta_left:beta_right] gamma = adain_params[:, gamma_left:gamma_right] return gamma, beta def _adain_net(inputs, dim=64, output_dim=3860): outputs = linear_block(inputs, dim, activation=ReLU) outputs = linear_block(outputs, dim, activation=ReLU) outputs = linear_block(outputs, output_dim, activation=None) return outputs def _body(inputs, adain_params_iter, num_res_blocks, dim): norm = AdaptiveInstanceNorm output = inputs for _ in range(num_res_blocks): gamma1, beta1 = next(adain_params_iter), next(adain_params_iter) gamma2, beta2 = next(adain_params_iter), next(adain_params_iter) res_block_inputs = (output, gamma1, beta1, gamma2, beta2) output = res_block_adain(res_block_inputs, dim, norm = norm) return output, adain_params_iter def _upsample_postprocess(inputs, skip_tensors, adain_params_iter, skip_dim=5, dim = 192): outputs = inputs norm = AdaptiveInstanceNorm for skip_tensor in skip_tensors: outputs = UpSampling2D(interpolation = 'bilinear')(outputs) gamma, beta = next(adain_params_iter), next(adain_params_iter) skip_outputs = conv_block_adain( skip_tensor, gamma, beta, filters = skip_dim, kernel_size = 7, padding = 3, stride = 1, \ norm = norm, activation = ReLU) print(outputs.shape, skip_outputs.shape) outputs = tf.concat([outputs, skip_outputs], -1) print(outputs.shape) outputs = conv_block( outputs, filters = dim // 2, kernel_size = 7, \ padding=3, stride=1, norm=LayerNorm, activation=ReLU, \ norm_kwargs={}, activation_kwargs={}) dim //= 2 outputs = conv_block( outputs, filters = 6, kernel_size = 9, \ padding=4, stride=1, norm=None, activation=None, \ norm_kwargs={}, activation_kwargs={}) return outputs def decoder( content_input, skip_tensors, style_input, adain_config, \ num_upsamples=2, num_res_blocks=5, dim=192): adain_params = _adain_net(style_input) adain_params_iter = _adain_params_iter(adain_config, adain_params) outputs, adain_params_iter = _body( content_input, adain_params_iter, num_res_blocks, dim) outputs = _upsample_postprocess(outputs, skip_tensors, adain_params_iter, dim = dim) return outputs def Decoder( input_shape=(64, 64, 192), skip2_shape=(128, 128, 5), skip1_shape=(256, 256, 5), style_shape=(3,), num_res_blocks=5, dim=192, num_upsamples=2, skip_dim=5): adain_config = OrderedDict() for i in range(num_res_blocks * 2): adain_config['res_block_{}_beta'.format(i)] = dim adain_config['res_block_{}_gamma'.format(i)] = dim for i in range(num_upsamples): adain_config['upsample_block_{}_beta'.format(i)] = skip_dim adain_config['upsample_block_{}_gamma'.format(i)] = skip_dim content_inputs = tf.keras.Input(input_shape) skip2_inputs = tf.keras.Input(skip2_shape) skip1_inputs = tf.keras.Input(skip1_shape) style_inputs = tf.keras.Input(style_shape) outputs = decoder( content_inputs, [skip2_inputs, skip1_inputs], style_inputs, adain_config, \ num_upsamples=num_upsamples, num_res_blocks=num_res_blocks, dim=dim) print(outputs.shape) model = tf.keras.models.Model(inputs=[content_inputs, skip2_inputs, skip1_inputs, style_inputs], outputs=outputs) return model
models/decoder.py
from collections import OrderedDict import tensorflow as tf from tensorflow.keras.layers import ReLU, LayerNormalization from tensorflow.keras.layers import UpSampling2D from .adain import AdaptiveInstanceNormalization from .linear_blocks import linear_block from .conv_blocks import res_block from .conv_blocks import conv_block from .conv_blocks import res_block_adain from .conv_blocks import conv_block_adain from .norm import InstanceNorm, AdaptiveInstanceNorm, LayerNorm def _adain_params_iter(adain_config, adain_params): slices = [] curr_slice = 0 for _, dim in adain_config.items(): slices.append(adain_params[:, curr_slice: curr_slice + dim]) curr_slice += dim return slices.__iter__() def _get_adain_layer_params(adain_params, slices_iter): beta_left, beta_right = next(slices_iter) gamma_left, gamma_right = next(slices_iter) beta = adain_params[:, beta_left:beta_right] gamma = adain_params[:, gamma_left:gamma_right] return gamma, beta def _adain_net(inputs, dim=64, output_dim=3860): outputs = linear_block(inputs, dim, activation=ReLU) outputs = linear_block(outputs, dim, activation=ReLU) outputs = linear_block(outputs, output_dim, activation=None) return outputs def _body(inputs, adain_params_iter, num_res_blocks, dim): norm = AdaptiveInstanceNorm output = inputs for _ in range(num_res_blocks): gamma1, beta1 = next(adain_params_iter), next(adain_params_iter) gamma2, beta2 = next(adain_params_iter), next(adain_params_iter) res_block_inputs = (output, gamma1, beta1, gamma2, beta2) output = res_block_adain(res_block_inputs, dim, norm = norm) return output, adain_params_iter def _upsample_postprocess(inputs, skip_tensors, adain_params_iter, skip_dim=5, dim = 192): outputs = inputs norm = AdaptiveInstanceNorm for skip_tensor in skip_tensors: outputs = UpSampling2D(interpolation = 'bilinear')(outputs) gamma, beta = next(adain_params_iter), next(adain_params_iter) skip_outputs = conv_block_adain( skip_tensor, gamma, beta, filters = skip_dim, kernel_size = 7, padding = 3, stride = 1, \ norm = norm, activation = ReLU) print(outputs.shape, skip_outputs.shape) outputs = tf.concat([outputs, skip_outputs], -1) print(outputs.shape) outputs = conv_block( outputs, filters = dim // 2, kernel_size = 7, \ padding=3, stride=1, norm=LayerNorm, activation=ReLU, \ norm_kwargs={}, activation_kwargs={}) dim //= 2 outputs = conv_block( outputs, filters = 6, kernel_size = 9, \ padding=4, stride=1, norm=None, activation=None, \ norm_kwargs={}, activation_kwargs={}) return outputs def decoder( content_input, skip_tensors, style_input, adain_config, \ num_upsamples=2, num_res_blocks=5, dim=192): adain_params = _adain_net(style_input) adain_params_iter = _adain_params_iter(adain_config, adain_params) outputs, adain_params_iter = _body( content_input, adain_params_iter, num_res_blocks, dim) outputs = _upsample_postprocess(outputs, skip_tensors, adain_params_iter, dim = dim) return outputs def Decoder( input_shape=(64, 64, 192), skip2_shape=(128, 128, 5), skip1_shape=(256, 256, 5), style_shape=(3,), num_res_blocks=5, dim=192, num_upsamples=2, skip_dim=5): adain_config = OrderedDict() for i in range(num_res_blocks * 2): adain_config['res_block_{}_beta'.format(i)] = dim adain_config['res_block_{}_gamma'.format(i)] = dim for i in range(num_upsamples): adain_config['upsample_block_{}_beta'.format(i)] = skip_dim adain_config['upsample_block_{}_gamma'.format(i)] = skip_dim content_inputs = tf.keras.Input(input_shape) skip2_inputs = tf.keras.Input(skip2_shape) skip1_inputs = tf.keras.Input(skip1_shape) style_inputs = tf.keras.Input(style_shape) outputs = decoder( content_inputs, [skip2_inputs, skip1_inputs], style_inputs, adain_config, \ num_upsamples=num_upsamples, num_res_blocks=num_res_blocks, dim=dim) print(outputs.shape) model = tf.keras.models.Model(inputs=[content_inputs, skip2_inputs, skip1_inputs, style_inputs], outputs=outputs) return model
0.804828
0.45944
import argparse from jinja2 import Environment, PackageLoader def main(properties): env = Environment(loader=PackageLoader('templates'), trim_blocks=True, lstrip_blocks=True) template = env.get_template('esp_template.jinja') out_path = properties['out'] del properties['out'] with open(out_path, 'w') as out_file: out_file.write(template.render(properties=properties)) if __name__ == '__main__': parser = argparse.ArgumentParser( description='Generate a Kubernetes config for your Endpoints API') # Required parser.add_argument( '--service-name', help='The hostname of your service. Usually \"my-project-id.appspot.com\".', required=True ) parser.add_argument( '--service-version', help='The generation id of your service. Run gcloud alpha service-management service describe <service-name> and look for the \"generation\" field', required=True ) parser.add_argument( '--api-image', required=True, help='The docker image that serves your API traffic' ) # Optional parser.add_argument( '--out', default='esp_config.yaml', help='Output path for your config' ) parser.add_argument( '--proxy-port', default=8080, type=int, help='The port on which traffic will be served by the endpoints server proxy' ) parser.add_argument( '--ssl', type=bool, default=False, help='Whether to use SSL termination. If true you must have a secret in your cluster named \"nginx-ssl\" which provides certs and secrets' ) parser.add_argument( '--ssl-port', type=int, default=443, help='If --ssl is False has no effect. Customizes the port the nginx proxy serves SSL traffic on' ) parser.add_argument( '--api-port', type=int, default=8081, help='The port that nginx proxies to, and your API image to serve traffic on' ) parser.add_argument( '--custom-nginx-config', type=bool, default=False, help='Whether or not you provide a custom configuration for the nginx proxy. If true you must havea configmap in your cluster named \"nginx-config\"' ) parser.add_argument( '--replicas', type=int, default=1, help='Number of replicas or your API container to maintain in the cluster.' ) parsed = parser.parse_args() main(vars(parsed))
k8s/render.py
import argparse from jinja2 import Environment, PackageLoader def main(properties): env = Environment(loader=PackageLoader('templates'), trim_blocks=True, lstrip_blocks=True) template = env.get_template('esp_template.jinja') out_path = properties['out'] del properties['out'] with open(out_path, 'w') as out_file: out_file.write(template.render(properties=properties)) if __name__ == '__main__': parser = argparse.ArgumentParser( description='Generate a Kubernetes config for your Endpoints API') # Required parser.add_argument( '--service-name', help='The hostname of your service. Usually \"my-project-id.appspot.com\".', required=True ) parser.add_argument( '--service-version', help='The generation id of your service. Run gcloud alpha service-management service describe <service-name> and look for the \"generation\" field', required=True ) parser.add_argument( '--api-image', required=True, help='The docker image that serves your API traffic' ) # Optional parser.add_argument( '--out', default='esp_config.yaml', help='Output path for your config' ) parser.add_argument( '--proxy-port', default=8080, type=int, help='The port on which traffic will be served by the endpoints server proxy' ) parser.add_argument( '--ssl', type=bool, default=False, help='Whether to use SSL termination. If true you must have a secret in your cluster named \"nginx-ssl\" which provides certs and secrets' ) parser.add_argument( '--ssl-port', type=int, default=443, help='If --ssl is False has no effect. Customizes the port the nginx proxy serves SSL traffic on' ) parser.add_argument( '--api-port', type=int, default=8081, help='The port that nginx proxies to, and your API image to serve traffic on' ) parser.add_argument( '--custom-nginx-config', type=bool, default=False, help='Whether or not you provide a custom configuration for the nginx proxy. If true you must havea configmap in your cluster named \"nginx-config\"' ) parser.add_argument( '--replicas', type=int, default=1, help='Number of replicas or your API container to maintain in the cluster.' ) parsed = parser.parse_args() main(vars(parsed))
0.699049
0.112747
import warnings import pulumi import pulumi.runtime from typing import Any, Mapping, Optional, Sequence, Union, overload from .. import _utilities from . import outputs from ._inputs import * __all__ = ['ListenerArgs', 'Listener'] @pulumi.input_type class ListenerArgs: def __init__(__self__, *, accelerator_id: pulumi.Input[str], port_ranges: pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]], certificates: Optional[pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]]] = None, client_affinity: Optional[pulumi.Input[str]] = None, description: Optional[pulumi.Input[str]] = None, name: Optional[pulumi.Input[str]] = None, protocol: Optional[pulumi.Input[str]] = None, proxy_protocol: Optional[pulumi.Input[bool]] = None): """ The set of arguments for constructing a Listener resource. :param pulumi.Input[str] accelerator_id: The accelerator id. :param pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]] port_ranges: The portRanges of the listener. :param pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]] certificates: The certificates of the listener. :param pulumi.Input[str] client_affinity: The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. :param pulumi.Input[str] description: The description of the listener. :param pulumi.Input[str] name: The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. :param pulumi.Input[str] protocol: Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. :param pulumi.Input[bool] proxy_protocol: The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. """ pulumi.set(__self__, "accelerator_id", accelerator_id) pulumi.set(__self__, "port_ranges", port_ranges) if certificates is not None: pulumi.set(__self__, "certificates", certificates) if client_affinity is not None: pulumi.set(__self__, "client_affinity", client_affinity) if description is not None: pulumi.set(__self__, "description", description) if name is not None: pulumi.set(__self__, "name", name) if protocol is not None: pulumi.set(__self__, "protocol", protocol) if proxy_protocol is not None: pulumi.set(__self__, "proxy_protocol", proxy_protocol) @property @pulumi.getter(name="acceleratorId") def accelerator_id(self) -> pulumi.Input[str]: """ The accelerator id. """ return pulumi.get(self, "accelerator_id") @accelerator_id.setter def accelerator_id(self, value: pulumi.Input[str]): pulumi.set(self, "accelerator_id", value) @property @pulumi.getter(name="portRanges") def port_ranges(self) -> pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]]: """ The portRanges of the listener. """ return pulumi.get(self, "port_ranges") @port_ranges.setter def port_ranges(self, value: pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]]): pulumi.set(self, "port_ranges", value) @property @pulumi.getter def certificates(self) -> Optional[pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]]]: """ The certificates of the listener. """ return pulumi.get(self, "certificates") @certificates.setter def certificates(self, value: Optional[pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]]]): pulumi.set(self, "certificates", value) @property @pulumi.getter(name="clientAffinity") def client_affinity(self) -> Optional[pulumi.Input[str]]: """ The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. """ return pulumi.get(self, "client_affinity") @client_affinity.setter def client_affinity(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "client_affinity", value) @property @pulumi.getter def description(self) -> Optional[pulumi.Input[str]]: """ The description of the listener. """ return pulumi.get(self, "description") @description.setter def description(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "description", value) @property @pulumi.getter def name(self) -> Optional[pulumi.Input[str]]: """ The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. """ return pulumi.get(self, "name") @name.setter def name(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "name", value) @property @pulumi.getter def protocol(self) -> Optional[pulumi.Input[str]]: """ Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. """ return pulumi.get(self, "protocol") @protocol.setter def protocol(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "protocol", value) @property @pulumi.getter(name="proxyProtocol") def proxy_protocol(self) -> Optional[pulumi.Input[bool]]: """ The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. """ return pulumi.get(self, "proxy_protocol") @proxy_protocol.setter def proxy_protocol(self, value: Optional[pulumi.Input[bool]]): pulumi.set(self, "proxy_protocol", value) @pulumi.input_type class _ListenerState: def __init__(__self__, *, accelerator_id: Optional[pulumi.Input[str]] = None, certificates: Optional[pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]]] = None, client_affinity: Optional[pulumi.Input[str]] = None, description: Optional[pulumi.Input[str]] = None, name: Optional[pulumi.Input[str]] = None, port_ranges: Optional[pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]]] = None, protocol: Optional[pulumi.Input[str]] = None, proxy_protocol: Optional[pulumi.Input[bool]] = None, status: Optional[pulumi.Input[str]] = None): """ Input properties used for looking up and filtering Listener resources. :param pulumi.Input[str] accelerator_id: The accelerator id. :param pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]] certificates: The certificates of the listener. :param pulumi.Input[str] client_affinity: The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. :param pulumi.Input[str] description: The description of the listener. :param pulumi.Input[str] name: The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. :param pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]] port_ranges: The portRanges of the listener. :param pulumi.Input[str] protocol: Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. :param pulumi.Input[bool] proxy_protocol: The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. :param pulumi.Input[str] status: The status of the listener. """ if accelerator_id is not None: pulumi.set(__self__, "accelerator_id", accelerator_id) if certificates is not None: pulumi.set(__self__, "certificates", certificates) if client_affinity is not None: pulumi.set(__self__, "client_affinity", client_affinity) if description is not None: pulumi.set(__self__, "description", description) if name is not None: pulumi.set(__self__, "name", name) if port_ranges is not None: pulumi.set(__self__, "port_ranges", port_ranges) if protocol is not None: pulumi.set(__self__, "protocol", protocol) if proxy_protocol is not None: pulumi.set(__self__, "proxy_protocol", proxy_protocol) if status is not None: pulumi.set(__self__, "status", status) @property @pulumi.getter(name="acceleratorId") def accelerator_id(self) -> Optional[pulumi.Input[str]]: """ The accelerator id. """ return pulumi.get(self, "accelerator_id") @accelerator_id.setter def accelerator_id(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "accelerator_id", value) @property @pulumi.getter def certificates(self) -> Optional[pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]]]: """ The certificates of the listener. """ return pulumi.get(self, "certificates") @certificates.setter def certificates(self, value: Optional[pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]]]): pulumi.set(self, "certificates", value) @property @pulumi.getter(name="clientAffinity") def client_affinity(self) -> Optional[pulumi.Input[str]]: """ The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. """ return pulumi.get(self, "client_affinity") @client_affinity.setter def client_affinity(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "client_affinity", value) @property @pulumi.getter def description(self) -> Optional[pulumi.Input[str]]: """ The description of the listener. """ return pulumi.get(self, "description") @description.setter def description(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "description", value) @property @pulumi.getter def name(self) -> Optional[pulumi.Input[str]]: """ The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. """ return pulumi.get(self, "name") @name.setter def name(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "name", value) @property @pulumi.getter(name="portRanges") def port_ranges(self) -> Optional[pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]]]: """ The portRanges of the listener. """ return pulumi.get(self, "port_ranges") @port_ranges.setter def port_ranges(self, value: Optional[pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]]]): pulumi.set(self, "port_ranges", value) @property @pulumi.getter def protocol(self) -> Optional[pulumi.Input[str]]: """ Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. """ return pulumi.get(self, "protocol") @protocol.setter def protocol(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "protocol", value) @property @pulumi.getter(name="proxyProtocol") def proxy_protocol(self) -> Optional[pulumi.Input[bool]]: """ The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. """ return pulumi.get(self, "proxy_protocol") @proxy_protocol.setter def proxy_protocol(self, value: Optional[pulumi.Input[bool]]): pulumi.set(self, "proxy_protocol", value) @property @pulumi.getter def status(self) -> Optional[pulumi.Input[str]]: """ The status of the listener. """ return pulumi.get(self, "status") @status.setter def status(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "status", value) class Listener(pulumi.CustomResource): @overload def __init__(__self__, resource_name: str, opts: Optional[pulumi.ResourceOptions] = None, accelerator_id: Optional[pulumi.Input[str]] = None, certificates: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerCertificateArgs']]]]] = None, client_affinity: Optional[pulumi.Input[str]] = None, description: Optional[pulumi.Input[str]] = None, name: Optional[pulumi.Input[str]] = None, port_ranges: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerPortRangeArgs']]]]] = None, protocol: Optional[pulumi.Input[str]] = None, proxy_protocol: Optional[pulumi.Input[bool]] = None, __props__=None): """ Provides a Global Accelerator (GA) Listener resource. For information about Global Accelerator (GA) Listener and how to use it, see [What is Listener](https://help.aliyun.com/document_detail/153253.html). > **NOTE:** Available in v1.111.0+. ## Example Usage Basic Usage ```python import pulumi import pulumi_alicloud as alicloud example_accelerator = alicloud.ga.Accelerator("exampleAccelerator", duration=1, auto_use_coupon=True, spec="1") de_bandwidth_package = alicloud.ga.BandwidthPackage("deBandwidthPackage", bandwidth=100, type="Basic", bandwidth_type="Basic", payment_type="PayAsYouGo", billing_type="PayBy95", ratio=30) de_bandwidth_package_attachment = alicloud.ga.BandwidthPackageAttachment("deBandwidthPackageAttachment", accelerator_id=example_accelerator.id, bandwidth_package_id=de_bandwidth_package.id) example_listener = alicloud.ga.Listener("exampleListener", accelerator_id=example_accelerator.id, port_ranges=[alicloud.ga.ListenerPortRangeArgs( from_port=60, to_port=70, )], opts=pulumi.ResourceOptions(depends_on=[de_bandwidth_package_attachment])) ``` ## Import Ga Listener can be imported using the id, e.g. ```sh $ pulumi import alicloud:ga/listener:Listener example <id> ``` :param str resource_name: The name of the resource. :param pulumi.ResourceOptions opts: Options for the resource. :param pulumi.Input[str] accelerator_id: The accelerator id. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerCertificateArgs']]]] certificates: The certificates of the listener. :param pulumi.Input[str] client_affinity: The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. :param pulumi.Input[str] description: The description of the listener. :param pulumi.Input[str] name: The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerPortRangeArgs']]]] port_ranges: The portRanges of the listener. :param pulumi.Input[str] protocol: Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. :param pulumi.Input[bool] proxy_protocol: The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. """ ... @overload def __init__(__self__, resource_name: str, args: ListenerArgs, opts: Optional[pulumi.ResourceOptions] = None): """ Provides a Global Accelerator (GA) Listener resource. For information about Global Accelerator (GA) Listener and how to use it, see [What is Listener](https://help.aliyun.com/document_detail/153253.html). > **NOTE:** Available in v1.111.0+. ## Example Usage Basic Usage ```python import pulumi import pulumi_alicloud as alicloud example_accelerator = alicloud.ga.Accelerator("exampleAccelerator", duration=1, auto_use_coupon=True, spec="1") de_bandwidth_package = alicloud.ga.BandwidthPackage("deBandwidthPackage", bandwidth=100, type="Basic", bandwidth_type="Basic", payment_type="PayAsYouGo", billing_type="PayBy95", ratio=30) de_bandwidth_package_attachment = alicloud.ga.BandwidthPackageAttachment("deBandwidthPackageAttachment", accelerator_id=example_accelerator.id, bandwidth_package_id=de_bandwidth_package.id) example_listener = alicloud.ga.Listener("exampleListener", accelerator_id=example_accelerator.id, port_ranges=[alicloud.ga.ListenerPortRangeArgs( from_port=60, to_port=70, )], opts=pulumi.ResourceOptions(depends_on=[de_bandwidth_package_attachment])) ``` ## Import Ga Listener can be imported using the id, e.g. ```sh $ pulumi import alicloud:ga/listener:Listener example <id> ``` :param str resource_name: The name of the resource. :param ListenerArgs args: The arguments to use to populate this resource's properties. :param pulumi.ResourceOptions opts: Options for the resource. """ ... def __init__(__self__, resource_name: str, *args, **kwargs): resource_args, opts = _utilities.get_resource_args_opts(ListenerArgs, pulumi.ResourceOptions, *args, **kwargs) if resource_args is not None: __self__._internal_init(resource_name, opts, **resource_args.__dict__) else: __self__._internal_init(resource_name, *args, **kwargs) def _internal_init(__self__, resource_name: str, opts: Optional[pulumi.ResourceOptions] = None, accelerator_id: Optional[pulumi.Input[str]] = None, certificates: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerCertificateArgs']]]]] = None, client_affinity: Optional[pulumi.Input[str]] = None, description: Optional[pulumi.Input[str]] = None, name: Optional[pulumi.Input[str]] = None, port_ranges: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerPortRangeArgs']]]]] = None, protocol: Optional[pulumi.Input[str]] = None, proxy_protocol: Optional[pulumi.Input[bool]] = None, __props__=None): if opts is None: opts = pulumi.ResourceOptions() if not isinstance(opts, pulumi.ResourceOptions): raise TypeError('Expected resource options to be a ResourceOptions instance') if opts.version is None: opts.version = _utilities.get_version() if opts.id is None: if __props__ is not None: raise TypeError('__props__ is only valid when passed in combination with a valid opts.id to get an existing resource') __props__ = ListenerArgs.__new__(ListenerArgs) if accelerator_id is None and not opts.urn: raise TypeError("Missing required property 'accelerator_id'") __props__.__dict__["accelerator_id"] = accelerator_id __props__.__dict__["certificates"] = certificates __props__.__dict__["client_affinity"] = client_affinity __props__.__dict__["description"] = description __props__.__dict__["name"] = name if port_ranges is None and not opts.urn: raise TypeError("Missing required property 'port_ranges'") __props__.__dict__["port_ranges"] = port_ranges __props__.__dict__["protocol"] = protocol __props__.__dict__["proxy_protocol"] = proxy_protocol __props__.__dict__["status"] = None super(Listener, __self__).__init__( 'alicloud:ga/listener:Listener', resource_name, __props__, opts) @staticmethod def get(resource_name: str, id: pulumi.Input[str], opts: Optional[pulumi.ResourceOptions] = None, accelerator_id: Optional[pulumi.Input[str]] = None, certificates: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerCertificateArgs']]]]] = None, client_affinity: Optional[pulumi.Input[str]] = None, description: Optional[pulumi.Input[str]] = None, name: Optional[pulumi.Input[str]] = None, port_ranges: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerPortRangeArgs']]]]] = None, protocol: Optional[pulumi.Input[str]] = None, proxy_protocol: Optional[pulumi.Input[bool]] = None, status: Optional[pulumi.Input[str]] = None) -> 'Listener': """ Get an existing Listener resource's state with the given name, id, and optional extra properties used to qualify the lookup. :param str resource_name: The unique name of the resulting resource. :param pulumi.Input[str] id: The unique provider ID of the resource to lookup. :param pulumi.ResourceOptions opts: Options for the resource. :param pulumi.Input[str] accelerator_id: The accelerator id. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerCertificateArgs']]]] certificates: The certificates of the listener. :param pulumi.Input[str] client_affinity: The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. :param pulumi.Input[str] description: The description of the listener. :param pulumi.Input[str] name: The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerPortRangeArgs']]]] port_ranges: The portRanges of the listener. :param pulumi.Input[str] protocol: Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. :param pulumi.Input[bool] proxy_protocol: The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. :param pulumi.Input[str] status: The status of the listener. """ opts = pulumi.ResourceOptions.merge(opts, pulumi.ResourceOptions(id=id)) __props__ = _ListenerState.__new__(_ListenerState) __props__.__dict__["accelerator_id"] = accelerator_id __props__.__dict__["certificates"] = certificates __props__.__dict__["client_affinity"] = client_affinity __props__.__dict__["description"] = description __props__.__dict__["name"] = name __props__.__dict__["port_ranges"] = port_ranges __props__.__dict__["protocol"] = protocol __props__.__dict__["proxy_protocol"] = proxy_protocol __props__.__dict__["status"] = status return Listener(resource_name, opts=opts, __props__=__props__) @property @pulumi.getter(name="acceleratorId") def accelerator_id(self) -> pulumi.Output[str]: """ The accelerator id. """ return pulumi.get(self, "accelerator_id") @property @pulumi.getter def certificates(self) -> pulumi.Output[Optional[Sequence['outputs.ListenerCertificate']]]: """ The certificates of the listener. """ return pulumi.get(self, "certificates") @property @pulumi.getter(name="clientAffinity") def client_affinity(self) -> pulumi.Output[Optional[str]]: """ The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. """ return pulumi.get(self, "client_affinity") @property @pulumi.getter def description(self) -> pulumi.Output[Optional[str]]: """ The description of the listener. """ return pulumi.get(self, "description") @property @pulumi.getter def name(self) -> pulumi.Output[str]: """ The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. """ return pulumi.get(self, "name") @property @pulumi.getter(name="portRanges") def port_ranges(self) -> pulumi.Output[Sequence['outputs.ListenerPortRange']]: """ The portRanges of the listener. """ return pulumi.get(self, "port_ranges") @property @pulumi.getter def protocol(self) -> pulumi.Output[Optional[str]]: """ Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. """ return pulumi.get(self, "protocol") @property @pulumi.getter(name="proxyProtocol") def proxy_protocol(self) -> pulumi.Output[Optional[bool]]: """ The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. """ return pulumi.get(self, "proxy_protocol") @property @pulumi.getter def status(self) -> pulumi.Output[str]: """ The status of the listener. """ return pulumi.get(self, "status")
sdk/python/pulumi_alicloud/ga/listener.py
import warnings import pulumi import pulumi.runtime from typing import Any, Mapping, Optional, Sequence, Union, overload from .. import _utilities from . import outputs from ._inputs import * __all__ = ['ListenerArgs', 'Listener'] @pulumi.input_type class ListenerArgs: def __init__(__self__, *, accelerator_id: pulumi.Input[str], port_ranges: pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]], certificates: Optional[pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]]] = None, client_affinity: Optional[pulumi.Input[str]] = None, description: Optional[pulumi.Input[str]] = None, name: Optional[pulumi.Input[str]] = None, protocol: Optional[pulumi.Input[str]] = None, proxy_protocol: Optional[pulumi.Input[bool]] = None): """ The set of arguments for constructing a Listener resource. :param pulumi.Input[str] accelerator_id: The accelerator id. :param pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]] port_ranges: The portRanges of the listener. :param pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]] certificates: The certificates of the listener. :param pulumi.Input[str] client_affinity: The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. :param pulumi.Input[str] description: The description of the listener. :param pulumi.Input[str] name: The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. :param pulumi.Input[str] protocol: Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. :param pulumi.Input[bool] proxy_protocol: The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. """ pulumi.set(__self__, "accelerator_id", accelerator_id) pulumi.set(__self__, "port_ranges", port_ranges) if certificates is not None: pulumi.set(__self__, "certificates", certificates) if client_affinity is not None: pulumi.set(__self__, "client_affinity", client_affinity) if description is not None: pulumi.set(__self__, "description", description) if name is not None: pulumi.set(__self__, "name", name) if protocol is not None: pulumi.set(__self__, "protocol", protocol) if proxy_protocol is not None: pulumi.set(__self__, "proxy_protocol", proxy_protocol) @property @pulumi.getter(name="acceleratorId") def accelerator_id(self) -> pulumi.Input[str]: """ The accelerator id. """ return pulumi.get(self, "accelerator_id") @accelerator_id.setter def accelerator_id(self, value: pulumi.Input[str]): pulumi.set(self, "accelerator_id", value) @property @pulumi.getter(name="portRanges") def port_ranges(self) -> pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]]: """ The portRanges of the listener. """ return pulumi.get(self, "port_ranges") @port_ranges.setter def port_ranges(self, value: pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]]): pulumi.set(self, "port_ranges", value) @property @pulumi.getter def certificates(self) -> Optional[pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]]]: """ The certificates of the listener. """ return pulumi.get(self, "certificates") @certificates.setter def certificates(self, value: Optional[pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]]]): pulumi.set(self, "certificates", value) @property @pulumi.getter(name="clientAffinity") def client_affinity(self) -> Optional[pulumi.Input[str]]: """ The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. """ return pulumi.get(self, "client_affinity") @client_affinity.setter def client_affinity(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "client_affinity", value) @property @pulumi.getter def description(self) -> Optional[pulumi.Input[str]]: """ The description of the listener. """ return pulumi.get(self, "description") @description.setter def description(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "description", value) @property @pulumi.getter def name(self) -> Optional[pulumi.Input[str]]: """ The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. """ return pulumi.get(self, "name") @name.setter def name(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "name", value) @property @pulumi.getter def protocol(self) -> Optional[pulumi.Input[str]]: """ Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. """ return pulumi.get(self, "protocol") @protocol.setter def protocol(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "protocol", value) @property @pulumi.getter(name="proxyProtocol") def proxy_protocol(self) -> Optional[pulumi.Input[bool]]: """ The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. """ return pulumi.get(self, "proxy_protocol") @proxy_protocol.setter def proxy_protocol(self, value: Optional[pulumi.Input[bool]]): pulumi.set(self, "proxy_protocol", value) @pulumi.input_type class _ListenerState: def __init__(__self__, *, accelerator_id: Optional[pulumi.Input[str]] = None, certificates: Optional[pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]]] = None, client_affinity: Optional[pulumi.Input[str]] = None, description: Optional[pulumi.Input[str]] = None, name: Optional[pulumi.Input[str]] = None, port_ranges: Optional[pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]]] = None, protocol: Optional[pulumi.Input[str]] = None, proxy_protocol: Optional[pulumi.Input[bool]] = None, status: Optional[pulumi.Input[str]] = None): """ Input properties used for looking up and filtering Listener resources. :param pulumi.Input[str] accelerator_id: The accelerator id. :param pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]] certificates: The certificates of the listener. :param pulumi.Input[str] client_affinity: The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. :param pulumi.Input[str] description: The description of the listener. :param pulumi.Input[str] name: The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. :param pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]] port_ranges: The portRanges of the listener. :param pulumi.Input[str] protocol: Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. :param pulumi.Input[bool] proxy_protocol: The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. :param pulumi.Input[str] status: The status of the listener. """ if accelerator_id is not None: pulumi.set(__self__, "accelerator_id", accelerator_id) if certificates is not None: pulumi.set(__self__, "certificates", certificates) if client_affinity is not None: pulumi.set(__self__, "client_affinity", client_affinity) if description is not None: pulumi.set(__self__, "description", description) if name is not None: pulumi.set(__self__, "name", name) if port_ranges is not None: pulumi.set(__self__, "port_ranges", port_ranges) if protocol is not None: pulumi.set(__self__, "protocol", protocol) if proxy_protocol is not None: pulumi.set(__self__, "proxy_protocol", proxy_protocol) if status is not None: pulumi.set(__self__, "status", status) @property @pulumi.getter(name="acceleratorId") def accelerator_id(self) -> Optional[pulumi.Input[str]]: """ The accelerator id. """ return pulumi.get(self, "accelerator_id") @accelerator_id.setter def accelerator_id(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "accelerator_id", value) @property @pulumi.getter def certificates(self) -> Optional[pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]]]: """ The certificates of the listener. """ return pulumi.get(self, "certificates") @certificates.setter def certificates(self, value: Optional[pulumi.Input[Sequence[pulumi.Input['ListenerCertificateArgs']]]]): pulumi.set(self, "certificates", value) @property @pulumi.getter(name="clientAffinity") def client_affinity(self) -> Optional[pulumi.Input[str]]: """ The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. """ return pulumi.get(self, "client_affinity") @client_affinity.setter def client_affinity(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "client_affinity", value) @property @pulumi.getter def description(self) -> Optional[pulumi.Input[str]]: """ The description of the listener. """ return pulumi.get(self, "description") @description.setter def description(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "description", value) @property @pulumi.getter def name(self) -> Optional[pulumi.Input[str]]: """ The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. """ return pulumi.get(self, "name") @name.setter def name(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "name", value) @property @pulumi.getter(name="portRanges") def port_ranges(self) -> Optional[pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]]]: """ The portRanges of the listener. """ return pulumi.get(self, "port_ranges") @port_ranges.setter def port_ranges(self, value: Optional[pulumi.Input[Sequence[pulumi.Input['ListenerPortRangeArgs']]]]): pulumi.set(self, "port_ranges", value) @property @pulumi.getter def protocol(self) -> Optional[pulumi.Input[str]]: """ Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. """ return pulumi.get(self, "protocol") @protocol.setter def protocol(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "protocol", value) @property @pulumi.getter(name="proxyProtocol") def proxy_protocol(self) -> Optional[pulumi.Input[bool]]: """ The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. """ return pulumi.get(self, "proxy_protocol") @proxy_protocol.setter def proxy_protocol(self, value: Optional[pulumi.Input[bool]]): pulumi.set(self, "proxy_protocol", value) @property @pulumi.getter def status(self) -> Optional[pulumi.Input[str]]: """ The status of the listener. """ return pulumi.get(self, "status") @status.setter def status(self, value: Optional[pulumi.Input[str]]): pulumi.set(self, "status", value) class Listener(pulumi.CustomResource): @overload def __init__(__self__, resource_name: str, opts: Optional[pulumi.ResourceOptions] = None, accelerator_id: Optional[pulumi.Input[str]] = None, certificates: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerCertificateArgs']]]]] = None, client_affinity: Optional[pulumi.Input[str]] = None, description: Optional[pulumi.Input[str]] = None, name: Optional[pulumi.Input[str]] = None, port_ranges: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerPortRangeArgs']]]]] = None, protocol: Optional[pulumi.Input[str]] = None, proxy_protocol: Optional[pulumi.Input[bool]] = None, __props__=None): """ Provides a Global Accelerator (GA) Listener resource. For information about Global Accelerator (GA) Listener and how to use it, see [What is Listener](https://help.aliyun.com/document_detail/153253.html). > **NOTE:** Available in v1.111.0+. ## Example Usage Basic Usage ```python import pulumi import pulumi_alicloud as alicloud example_accelerator = alicloud.ga.Accelerator("exampleAccelerator", duration=1, auto_use_coupon=True, spec="1") de_bandwidth_package = alicloud.ga.BandwidthPackage("deBandwidthPackage", bandwidth=100, type="Basic", bandwidth_type="Basic", payment_type="PayAsYouGo", billing_type="PayBy95", ratio=30) de_bandwidth_package_attachment = alicloud.ga.BandwidthPackageAttachment("deBandwidthPackageAttachment", accelerator_id=example_accelerator.id, bandwidth_package_id=de_bandwidth_package.id) example_listener = alicloud.ga.Listener("exampleListener", accelerator_id=example_accelerator.id, port_ranges=[alicloud.ga.ListenerPortRangeArgs( from_port=60, to_port=70, )], opts=pulumi.ResourceOptions(depends_on=[de_bandwidth_package_attachment])) ``` ## Import Ga Listener can be imported using the id, e.g. ```sh $ pulumi import alicloud:ga/listener:Listener example <id> ``` :param str resource_name: The name of the resource. :param pulumi.ResourceOptions opts: Options for the resource. :param pulumi.Input[str] accelerator_id: The accelerator id. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerCertificateArgs']]]] certificates: The certificates of the listener. :param pulumi.Input[str] client_affinity: The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. :param pulumi.Input[str] description: The description of the listener. :param pulumi.Input[str] name: The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerPortRangeArgs']]]] port_ranges: The portRanges of the listener. :param pulumi.Input[str] protocol: Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. :param pulumi.Input[bool] proxy_protocol: The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. """ ... @overload def __init__(__self__, resource_name: str, args: ListenerArgs, opts: Optional[pulumi.ResourceOptions] = None): """ Provides a Global Accelerator (GA) Listener resource. For information about Global Accelerator (GA) Listener and how to use it, see [What is Listener](https://help.aliyun.com/document_detail/153253.html). > **NOTE:** Available in v1.111.0+. ## Example Usage Basic Usage ```python import pulumi import pulumi_alicloud as alicloud example_accelerator = alicloud.ga.Accelerator("exampleAccelerator", duration=1, auto_use_coupon=True, spec="1") de_bandwidth_package = alicloud.ga.BandwidthPackage("deBandwidthPackage", bandwidth=100, type="Basic", bandwidth_type="Basic", payment_type="PayAsYouGo", billing_type="PayBy95", ratio=30) de_bandwidth_package_attachment = alicloud.ga.BandwidthPackageAttachment("deBandwidthPackageAttachment", accelerator_id=example_accelerator.id, bandwidth_package_id=de_bandwidth_package.id) example_listener = alicloud.ga.Listener("exampleListener", accelerator_id=example_accelerator.id, port_ranges=[alicloud.ga.ListenerPortRangeArgs( from_port=60, to_port=70, )], opts=pulumi.ResourceOptions(depends_on=[de_bandwidth_package_attachment])) ``` ## Import Ga Listener can be imported using the id, e.g. ```sh $ pulumi import alicloud:ga/listener:Listener example <id> ``` :param str resource_name: The name of the resource. :param ListenerArgs args: The arguments to use to populate this resource's properties. :param pulumi.ResourceOptions opts: Options for the resource. """ ... def __init__(__self__, resource_name: str, *args, **kwargs): resource_args, opts = _utilities.get_resource_args_opts(ListenerArgs, pulumi.ResourceOptions, *args, **kwargs) if resource_args is not None: __self__._internal_init(resource_name, opts, **resource_args.__dict__) else: __self__._internal_init(resource_name, *args, **kwargs) def _internal_init(__self__, resource_name: str, opts: Optional[pulumi.ResourceOptions] = None, accelerator_id: Optional[pulumi.Input[str]] = None, certificates: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerCertificateArgs']]]]] = None, client_affinity: Optional[pulumi.Input[str]] = None, description: Optional[pulumi.Input[str]] = None, name: Optional[pulumi.Input[str]] = None, port_ranges: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerPortRangeArgs']]]]] = None, protocol: Optional[pulumi.Input[str]] = None, proxy_protocol: Optional[pulumi.Input[bool]] = None, __props__=None): if opts is None: opts = pulumi.ResourceOptions() if not isinstance(opts, pulumi.ResourceOptions): raise TypeError('Expected resource options to be a ResourceOptions instance') if opts.version is None: opts.version = _utilities.get_version() if opts.id is None: if __props__ is not None: raise TypeError('__props__ is only valid when passed in combination with a valid opts.id to get an existing resource') __props__ = ListenerArgs.__new__(ListenerArgs) if accelerator_id is None and not opts.urn: raise TypeError("Missing required property 'accelerator_id'") __props__.__dict__["accelerator_id"] = accelerator_id __props__.__dict__["certificates"] = certificates __props__.__dict__["client_affinity"] = client_affinity __props__.__dict__["description"] = description __props__.__dict__["name"] = name if port_ranges is None and not opts.urn: raise TypeError("Missing required property 'port_ranges'") __props__.__dict__["port_ranges"] = port_ranges __props__.__dict__["protocol"] = protocol __props__.__dict__["proxy_protocol"] = proxy_protocol __props__.__dict__["status"] = None super(Listener, __self__).__init__( 'alicloud:ga/listener:Listener', resource_name, __props__, opts) @staticmethod def get(resource_name: str, id: pulumi.Input[str], opts: Optional[pulumi.ResourceOptions] = None, accelerator_id: Optional[pulumi.Input[str]] = None, certificates: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerCertificateArgs']]]]] = None, client_affinity: Optional[pulumi.Input[str]] = None, description: Optional[pulumi.Input[str]] = None, name: Optional[pulumi.Input[str]] = None, port_ranges: Optional[pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerPortRangeArgs']]]]] = None, protocol: Optional[pulumi.Input[str]] = None, proxy_protocol: Optional[pulumi.Input[bool]] = None, status: Optional[pulumi.Input[str]] = None) -> 'Listener': """ Get an existing Listener resource's state with the given name, id, and optional extra properties used to qualify the lookup. :param str resource_name: The unique name of the resulting resource. :param pulumi.Input[str] id: The unique provider ID of the resource to lookup. :param pulumi.ResourceOptions opts: Options for the resource. :param pulumi.Input[str] accelerator_id: The accelerator id. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerCertificateArgs']]]] certificates: The certificates of the listener. :param pulumi.Input[str] client_affinity: The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. :param pulumi.Input[str] description: The description of the listener. :param pulumi.Input[str] name: The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. :param pulumi.Input[Sequence[pulumi.Input[pulumi.InputType['ListenerPortRangeArgs']]]] port_ranges: The portRanges of the listener. :param pulumi.Input[str] protocol: Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. :param pulumi.Input[bool] proxy_protocol: The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. :param pulumi.Input[str] status: The status of the listener. """ opts = pulumi.ResourceOptions.merge(opts, pulumi.ResourceOptions(id=id)) __props__ = _ListenerState.__new__(_ListenerState) __props__.__dict__["accelerator_id"] = accelerator_id __props__.__dict__["certificates"] = certificates __props__.__dict__["client_affinity"] = client_affinity __props__.__dict__["description"] = description __props__.__dict__["name"] = name __props__.__dict__["port_ranges"] = port_ranges __props__.__dict__["protocol"] = protocol __props__.__dict__["proxy_protocol"] = proxy_protocol __props__.__dict__["status"] = status return Listener(resource_name, opts=opts, __props__=__props__) @property @pulumi.getter(name="acceleratorId") def accelerator_id(self) -> pulumi.Output[str]: """ The accelerator id. """ return pulumi.get(self, "accelerator_id") @property @pulumi.getter def certificates(self) -> pulumi.Output[Optional[Sequence['outputs.ListenerCertificate']]]: """ The certificates of the listener. """ return pulumi.get(self, "certificates") @property @pulumi.getter(name="clientAffinity") def client_affinity(self) -> pulumi.Output[Optional[str]]: """ The clientAffinity of the listener. Default value is `NONE`. Valid values: `NONE`: client affinity is not maintained, that is, connection requests from the same client cannot always be directed to the same terminal node. `SOURCE_IP`: maintain client affinity. When a client accesses a stateful application, all requests from the same client can be directed to the same terminal node, regardless of the source port and protocol. """ return pulumi.get(self, "client_affinity") @property @pulumi.getter def description(self) -> pulumi.Output[Optional[str]]: """ The description of the listener. """ return pulumi.get(self, "description") @property @pulumi.getter def name(self) -> pulumi.Output[str]: """ The name of the listener. The length of the name is 2-128 characters. It starts with uppercase and lowercase letters or Chinese characters. It can contain numbers and underscores and dashes. """ return pulumi.get(self, "name") @property @pulumi.getter(name="portRanges") def port_ranges(self) -> pulumi.Output[Sequence['outputs.ListenerPortRange']]: """ The portRanges of the listener. """ return pulumi.get(self, "port_ranges") @property @pulumi.getter def protocol(self) -> pulumi.Output[Optional[str]]: """ Type of network transport protocol monitored. Default value is `TCP`. Valid values: `TCP`, `UDP`, `HTTP`, `HTTPS`. """ return pulumi.get(self, "protocol") @property @pulumi.getter(name="proxyProtocol") def proxy_protocol(self) -> pulumi.Output[Optional[bool]]: """ The proxy protocol of the listener. Default value is `false`. Valid value: `true`: Turn on the keep client source IP function. After it is turned on, the back-end service is supported to view the original IP address of the client. `false`: keep client source IP function is not turned on. """ return pulumi.get(self, "proxy_protocol") @property @pulumi.getter def status(self) -> pulumi.Output[str]: """ The status of the listener. """ return pulumi.get(self, "status")
0.859162
0.119152
import re import time from ..base.account import BaseAccount from ..helpers import parse_html_form, set_cookie class TurbobitNet(BaseAccount): __name__ = "TurbobitNet" __type__ = "account" __version__ = "0.12" __status__ = "testing" __pyload_version__ = "0.5" __description__ = """TurbobitNet account plugin""" __license__ = "GPLv3" __authors__ = [ ("zoidberg", "<EMAIL>"), ("GammaC0de", "nitzo2001[AT]yahoo[DOT]com"), ] LOGIN_FAIL_PATTERN = r">(?:E-Mail address appears to be invalid\. Please try again|Incorrect login or password)</div>" def grab_info(self, user, password, data): html = self.load("https://turbobit.net/") m = re.search(r">Turbo access till ([\d.]+)<", html) if m is not None: premium = True validuntil = time.mktime(time.strptime(m.group(1), "%d.%m.%Y")) else: premium = False validuntil = -1 return {"premium": premium, "trafficleft": -1, "validuntil": validuntil} def signin(self, user, password, data): set_cookie(self.req.cj, "turbobit.net", "user_lang", "en") self.data = self.load("https://turbobit.net/login") if "<a href='/user/logout'" in self.data: self.skip_login() action, inputs = parse_html_form( 'class="form-horizontal login mail"', self.data ) if not inputs: self.fail_login(self._("Login form not found")) inputs["user[login]"] = user inputs["user[pass]"] = password inputs["user[submit]"] = "Sign in" if inputs.get("user[captcha_type]"): self.fail_login( self._( "Logging in with captcha is not supported, please disable catcha in turbobit's account settings" ) ) self.data = self.load("https://turbobit.net/user/login", post=inputs) if "<a href='/user/logout'" in self.data: self.log_debug("Login successful") elif re.search(self.LOGIN_FAIL_PATTERN, self.data): self.fail_login() elif ">Please enter the captcha code.</div>" in self.data: self.fail_login( self._( "Logging in with captcha is not supported, please disable catcha in turbobit's account settings" ) ) else: self.fail_login(self._("Unknown response"))
supports/pyload/src/pyload/plugins/accounts/TurbobitNet.py
import re import time from ..base.account import BaseAccount from ..helpers import parse_html_form, set_cookie class TurbobitNet(BaseAccount): __name__ = "TurbobitNet" __type__ = "account" __version__ = "0.12" __status__ = "testing" __pyload_version__ = "0.5" __description__ = """TurbobitNet account plugin""" __license__ = "GPLv3" __authors__ = [ ("zoidberg", "<EMAIL>"), ("GammaC0de", "nitzo2001[AT]yahoo[DOT]com"), ] LOGIN_FAIL_PATTERN = r">(?:E-Mail address appears to be invalid\. Please try again|Incorrect login or password)</div>" def grab_info(self, user, password, data): html = self.load("https://turbobit.net/") m = re.search(r">Turbo access till ([\d.]+)<", html) if m is not None: premium = True validuntil = time.mktime(time.strptime(m.group(1), "%d.%m.%Y")) else: premium = False validuntil = -1 return {"premium": premium, "trafficleft": -1, "validuntil": validuntil} def signin(self, user, password, data): set_cookie(self.req.cj, "turbobit.net", "user_lang", "en") self.data = self.load("https://turbobit.net/login") if "<a href='/user/logout'" in self.data: self.skip_login() action, inputs = parse_html_form( 'class="form-horizontal login mail"', self.data ) if not inputs: self.fail_login(self._("Login form not found")) inputs["user[login]"] = user inputs["user[pass]"] = password inputs["user[submit]"] = "Sign in" if inputs.get("user[captcha_type]"): self.fail_login( self._( "Logging in with captcha is not supported, please disable catcha in turbobit's account settings" ) ) self.data = self.load("https://turbobit.net/user/login", post=inputs) if "<a href='/user/logout'" in self.data: self.log_debug("Login successful") elif re.search(self.LOGIN_FAIL_PATTERN, self.data): self.fail_login() elif ">Please enter the captcha code.</div>" in self.data: self.fail_login( self._( "Logging in with captcha is not supported, please disable catcha in turbobit's account settings" ) ) else: self.fail_login(self._("Unknown response"))
0.23855
0.123736
from cnn_simple import * from utils import * import os import numpy as np import argparse import time os.system('echo $CUDA_VISIBLE_DEVICES') PATIENCE = 5 # The parameter is used for early stopping def main(): parser = argparse.ArgumentParser(prog='train.py') parser.add_argument('--epoch', type=int, default=1) parser.add_argument('--batch', type=int, default=64) parser.add_argument('--pretrain', type=bool, default=False) parser.add_argument('--save_every', type=int, default=1) parser.add_argument('--model_name', type=str, default='model/model-1') args = parser.parse_args() ''' To begin with, you should first read your csv training file and cut them into training set and validation set. Such as: with open(csvFile, 'r') as f: f.readline() for i, line in enumerate(f): data = line.split(',') label = data[0] pixel = data[1] ... ... In addition, we maintain it in array structure and save it in pickle ''' # training data train_pixels = load_pickle('../train_pixels.pkl') train_labels = load_pickle('../train_labels.pkl') print ('# of training instances: ' + str(len(train_labels))) # validation data valid_pixels = load_pickle('../valid_pixels.pkl') valid_labels = load_pickle('../valid_labels.pkl') print ('# of validation instances: ' + str(len(valid_labels))) ''' Modify the answer format so as to correspond with the output of keras model We can also do this to training data here, but we choose to do it in "train" function ''' for i in range(len(valid_labels)): valid_pixels[i] = np.fromstring(valid_pixels[i], dtype=float, sep=' ').reshape((48, 48, 1)) onehot = np.zeros((7, ), dtype=np.float) onehot[int(valid_labels[i])] = 1. valid_labels[i] = onehot # start training train(args.batch, args.epoch, args.pretrain, args.save_every, train_pixels, train_labels, np.asarray(valid_pixels), np.asarray(valid_labels), args.model_name) def train(batch_size, num_epoch, pretrain, save_every, train_pixels, train_labels, val_pixels, val_labels, model_name=None): if pretrain == False: model = build_model() else: model = load_model(model_name) ''' "1 Epoch" means you have been looked all of the training data once already. Batch size B means you look B instances at once when updating your parameter. Thus, given 320 instances, batch size 32, you need 10 iterations in 1 epoch. ''' num_instances = len(train_labels) iter_per_epoch = int(num_instances / batch_size) + 1 batch_cutoff = [0] for i in range(iter_per_epoch - 1): batch_cutoff.append(batch_size * (i+1)) batch_cutoff.append(num_instances) total_start_t = time.time() best_metrics = 0.0 early_stop_counter = 0 for e in range(num_epoch): #shuffle data in every epoch rand_idxs = np.random.permutation(num_instances) print ('#######') print ('Epoch ' + str(e+1)) print ('#######') start_t = time.time() for i in range(iter_per_epoch): if i % 50 == 0: print ('Iteration ' + str(i+1)) X_batch = [] Y_batch = [] ''' fill data into each batch ''' for n in range(batch_cutoff[i], batch_cutoff[i+1]): X_batch.append(train_pixels[rand_idxs[n]]) Y_batch.append(np.zeros((7, ), dtype=np.float)) X_batch[-1] = np.fromstring(X_batch[-1], dtype=float, sep=' ').reshape((48, 48, 1)) Y_batch[-1][int(train_labels[rand_idxs[n]])] = 1. ''' use these batch data to train your model ''' model.train_on_batch(np.asarray(X_batch),np.asarray(Y_batch)) ''' The above process is one epoch, and then we can check the performance now. ''' loss_and_metrics = model.evaluate(val_pixels, val_labels, batch_size) print ('\nloss & metrics:') print (loss_and_metrics) ''' early stop is a mechanism to prevent your model from overfitting ''' if loss_and_metrics[1] >= best_metrics: best_metrics = loss_and_metrics[1] print ("save best score!! "+str(loss_and_metrics[1])) early_stop_counter = 0 else: early_stop_counter += 1 ''' Sample code to write result : if e == e: val_proba = model.predict(val_pixels) val_classes = val_proba.argmax(axis=-1) with open('result/simple%s.csv' % str(e), 'w') as f: f.write('acc = %s\n' % str(lossandmetrics[1])) f.write('id,label') for i in range(len(valclasses)): f.write('\n' + str(i) + ',' + str(valclasses[i])) ''' print ('Elapsed time in epoch ' + str(e+1) + ': ' + str(time.time() - startt)) if (e+1) % saveevery == 0: model.save('model/model-%d.h5' %(e+1)) print ('Saved model %s!' %str(e+1)) if earlystopcounter >= PATIENCE: print ('Stop by early stopping') print ('Best score: '+str(best_metrics)) break print ('Elapsed time in total: ' + str(time.time() - total_start_t)) if __name=='__main': main()
ML-Course-NTU-Lee/hw3/demo/train.py
from cnn_simple import * from utils import * import os import numpy as np import argparse import time os.system('echo $CUDA_VISIBLE_DEVICES') PATIENCE = 5 # The parameter is used for early stopping def main(): parser = argparse.ArgumentParser(prog='train.py') parser.add_argument('--epoch', type=int, default=1) parser.add_argument('--batch', type=int, default=64) parser.add_argument('--pretrain', type=bool, default=False) parser.add_argument('--save_every', type=int, default=1) parser.add_argument('--model_name', type=str, default='model/model-1') args = parser.parse_args() ''' To begin with, you should first read your csv training file and cut them into training set and validation set. Such as: with open(csvFile, 'r') as f: f.readline() for i, line in enumerate(f): data = line.split(',') label = data[0] pixel = data[1] ... ... In addition, we maintain it in array structure and save it in pickle ''' # training data train_pixels = load_pickle('../train_pixels.pkl') train_labels = load_pickle('../train_labels.pkl') print ('# of training instances: ' + str(len(train_labels))) # validation data valid_pixels = load_pickle('../valid_pixels.pkl') valid_labels = load_pickle('../valid_labels.pkl') print ('# of validation instances: ' + str(len(valid_labels))) ''' Modify the answer format so as to correspond with the output of keras model We can also do this to training data here, but we choose to do it in "train" function ''' for i in range(len(valid_labels)): valid_pixels[i] = np.fromstring(valid_pixels[i], dtype=float, sep=' ').reshape((48, 48, 1)) onehot = np.zeros((7, ), dtype=np.float) onehot[int(valid_labels[i])] = 1. valid_labels[i] = onehot # start training train(args.batch, args.epoch, args.pretrain, args.save_every, train_pixels, train_labels, np.asarray(valid_pixels), np.asarray(valid_labels), args.model_name) def train(batch_size, num_epoch, pretrain, save_every, train_pixels, train_labels, val_pixels, val_labels, model_name=None): if pretrain == False: model = build_model() else: model = load_model(model_name) ''' "1 Epoch" means you have been looked all of the training data once already. Batch size B means you look B instances at once when updating your parameter. Thus, given 320 instances, batch size 32, you need 10 iterations in 1 epoch. ''' num_instances = len(train_labels) iter_per_epoch = int(num_instances / batch_size) + 1 batch_cutoff = [0] for i in range(iter_per_epoch - 1): batch_cutoff.append(batch_size * (i+1)) batch_cutoff.append(num_instances) total_start_t = time.time() best_metrics = 0.0 early_stop_counter = 0 for e in range(num_epoch): #shuffle data in every epoch rand_idxs = np.random.permutation(num_instances) print ('#######') print ('Epoch ' + str(e+1)) print ('#######') start_t = time.time() for i in range(iter_per_epoch): if i % 50 == 0: print ('Iteration ' + str(i+1)) X_batch = [] Y_batch = [] ''' fill data into each batch ''' for n in range(batch_cutoff[i], batch_cutoff[i+1]): X_batch.append(train_pixels[rand_idxs[n]]) Y_batch.append(np.zeros((7, ), dtype=np.float)) X_batch[-1] = np.fromstring(X_batch[-1], dtype=float, sep=' ').reshape((48, 48, 1)) Y_batch[-1][int(train_labels[rand_idxs[n]])] = 1. ''' use these batch data to train your model ''' model.train_on_batch(np.asarray(X_batch),np.asarray(Y_batch)) ''' The above process is one epoch, and then we can check the performance now. ''' loss_and_metrics = model.evaluate(val_pixels, val_labels, batch_size) print ('\nloss & metrics:') print (loss_and_metrics) ''' early stop is a mechanism to prevent your model from overfitting ''' if loss_and_metrics[1] >= best_metrics: best_metrics = loss_and_metrics[1] print ("save best score!! "+str(loss_and_metrics[1])) early_stop_counter = 0 else: early_stop_counter += 1 ''' Sample code to write result : if e == e: val_proba = model.predict(val_pixels) val_classes = val_proba.argmax(axis=-1) with open('result/simple%s.csv' % str(e), 'w') as f: f.write('acc = %s\n' % str(lossandmetrics[1])) f.write('id,label') for i in range(len(valclasses)): f.write('\n' + str(i) + ',' + str(valclasses[i])) ''' print ('Elapsed time in epoch ' + str(e+1) + ': ' + str(time.time() - startt)) if (e+1) % saveevery == 0: model.save('model/model-%d.h5' %(e+1)) print ('Saved model %s!' %str(e+1)) if earlystopcounter >= PATIENCE: print ('Stop by early stopping') print ('Best score: '+str(best_metrics)) break print ('Elapsed time in total: ' + str(time.time() - total_start_t)) if __name=='__main': main()
0.32178
0.222996
import json import logging import os import shutil import time from copy import deepcopy import certifi import requests import yaml from assemblyline.common import log as al_log from assemblyline.common.digests import get_sha256_for_file from assemblyline.common.isotime import iso_to_epoch al_log.init_logging('service_updater') LOGGER = logging.getLogger('assemblyline.updater.service') UPDATE_CONFIGURATION_PATH = os.environ.get('UPDATE_CONFIGURATION_PATH', None) UPDATE_OUTPUT_PATH = os.environ.get('UPDATE_OUTPUT_PATH', "/tmp/updater_output") def test_file(_): return True def url_update(test_func=test_file) -> None: """ Using an update configuration file as an input, which contains a list of sources, download all the file(s) which have been modified since the last update. """ update_config = {} # Load configuration if UPDATE_CONFIGURATION_PATH and os.path.exists(UPDATE_CONFIGURATION_PATH): with open(UPDATE_CONFIGURATION_PATH, 'r') as yml_fh: update_config = yaml.safe_load(yml_fh) else: LOGGER.warning("Could not find update configuration file.") exit(1) # Cleanup output path if os.path.exists(UPDATE_OUTPUT_PATH): if os.path.isdir(UPDATE_OUTPUT_PATH): shutil.rmtree(UPDATE_OUTPUT_PATH) else: os.unlink(UPDATE_OUTPUT_PATH) os.makedirs(UPDATE_OUTPUT_PATH) # Get sources sources = update_config.get('sources', None) # Exit if no update sources given if not sources: exit() # Parse updater configuration previous_update = update_config.get('previous_update', None) previous_hash = update_config.get('previous_hash', None) or {} if previous_hash: previous_hash = json.loads(previous_hash) if isinstance(previous_update, str): previous_update = iso_to_epoch(previous_update) # Create a requests session session = requests.Session() files_sha256 = {} # Go through each source and download file for source in sources: uri = source['uri'] name = source['name'] if not uri or not name: LOGGER.warning(f"Invalid source: {source}") continue LOGGER.info(f"Downloading file '{name}' from uri '{uri}' ...") username = source.get('username', None) password = source.get('password', None) auth = (username, password) if username and password else None ca_cert = source.get('ca_cert', None) ignore_ssl_errors = source.get('ssl_ignore_errors', False) headers = source.get('headers', None) if ca_cert: # Add certificate to requests cafile = certifi.where() with open(cafile, 'a') as ca_editor: ca_editor.write(f"\n{ca_cert}") session.verify = not ignore_ssl_errors try: # Check the response header for the last modified date response = session.head(uri, auth=auth, headers=headers) last_modified = response.headers.get('Last-Modified', None) if last_modified: # Convert the last modified time to epoch last_modified = time.mktime(time.strptime(last_modified, "%a, %d %b %Y %H:%M:%S %Z")) # Compare the last modified time with the last updated time if update_config.get('previous_update', None) and last_modified <= previous_update: # File has not been modified since last update, do nothing LOGGER.info("File has not changed since last time, Skipping...") continue if update_config.get('previous_update', None): previous_update = time.strftime("%a, %d %b %Y %H:%M:%S %Z", time.gmtime(previous_update)) if headers: headers['If-Modified-Since'] = previous_update else: headers = { 'If-Modified-Since': previous_update, } response = session.get(uri, auth=auth, headers=headers) # Check the response code if response.status_code == requests.codes['not_modified']: # File has not been modified since last update, do nothing LOGGER.info("File has not changed since last time, Skipping...") continue elif response.ok: file_path = os.path.join(UPDATE_OUTPUT_PATH, name) with open(file_path, 'wb') as f: f.write(response.content) if not test_func(file_path): os.unlink(file_path) LOGGER.warning(f"The downloaded file was invalid. It will not be part of this update...") continue # Append the SHA256 of the file to a list of downloaded files sha256 = get_sha256_for_file(file_path) if previous_hash.get(name, None) != sha256: files_sha256[name] = sha256 else: LOGGER.info("File as the same hash as last time. Skipping...") LOGGER.info("File successfully downloaded!") except requests.Timeout: LOGGER.warning(f"Cannot find the file for source {name} with url {uri} - (Timeout)") continue except Exception as e: # Catch all other types of exceptions such as ConnectionError, ProxyError, etc. LOGGER.warning(f"Source {name} failed with error: {str(e)}") if files_sha256: new_hash = deepcopy(previous_hash) new_hash.update(files_sha256) # Check if the new update hash matches the previous update hash if new_hash == previous_hash: # Update file(s) not changed, delete the downloaded files and exit shutil.rmtree(UPDATE_OUTPUT_PATH, ignore_errors=True) exit() # Create the response yaml with open(os.path.join(UPDATE_OUTPUT_PATH, 'response.yaml'), 'w') as yml_fh: yaml.safe_dump(dict( hash=json.dumps(new_hash), ), yml_fh) LOGGER.info("Service update file(s) successfully downloaded") # Close the requests session session.close() if __name__ == '__main__': url_update()
assemblyline_core/updater/url_update.py
import json import logging import os import shutil import time from copy import deepcopy import certifi import requests import yaml from assemblyline.common import log as al_log from assemblyline.common.digests import get_sha256_for_file from assemblyline.common.isotime import iso_to_epoch al_log.init_logging('service_updater') LOGGER = logging.getLogger('assemblyline.updater.service') UPDATE_CONFIGURATION_PATH = os.environ.get('UPDATE_CONFIGURATION_PATH', None) UPDATE_OUTPUT_PATH = os.environ.get('UPDATE_OUTPUT_PATH', "/tmp/updater_output") def test_file(_): return True def url_update(test_func=test_file) -> None: """ Using an update configuration file as an input, which contains a list of sources, download all the file(s) which have been modified since the last update. """ update_config = {} # Load configuration if UPDATE_CONFIGURATION_PATH and os.path.exists(UPDATE_CONFIGURATION_PATH): with open(UPDATE_CONFIGURATION_PATH, 'r') as yml_fh: update_config = yaml.safe_load(yml_fh) else: LOGGER.warning("Could not find update configuration file.") exit(1) # Cleanup output path if os.path.exists(UPDATE_OUTPUT_PATH): if os.path.isdir(UPDATE_OUTPUT_PATH): shutil.rmtree(UPDATE_OUTPUT_PATH) else: os.unlink(UPDATE_OUTPUT_PATH) os.makedirs(UPDATE_OUTPUT_PATH) # Get sources sources = update_config.get('sources', None) # Exit if no update sources given if not sources: exit() # Parse updater configuration previous_update = update_config.get('previous_update', None) previous_hash = update_config.get('previous_hash', None) or {} if previous_hash: previous_hash = json.loads(previous_hash) if isinstance(previous_update, str): previous_update = iso_to_epoch(previous_update) # Create a requests session session = requests.Session() files_sha256 = {} # Go through each source and download file for source in sources: uri = source['uri'] name = source['name'] if not uri or not name: LOGGER.warning(f"Invalid source: {source}") continue LOGGER.info(f"Downloading file '{name}' from uri '{uri}' ...") username = source.get('username', None) password = source.get('password', None) auth = (username, password) if username and password else None ca_cert = source.get('ca_cert', None) ignore_ssl_errors = source.get('ssl_ignore_errors', False) headers = source.get('headers', None) if ca_cert: # Add certificate to requests cafile = certifi.where() with open(cafile, 'a') as ca_editor: ca_editor.write(f"\n{ca_cert}") session.verify = not ignore_ssl_errors try: # Check the response header for the last modified date response = session.head(uri, auth=auth, headers=headers) last_modified = response.headers.get('Last-Modified', None) if last_modified: # Convert the last modified time to epoch last_modified = time.mktime(time.strptime(last_modified, "%a, %d %b %Y %H:%M:%S %Z")) # Compare the last modified time with the last updated time if update_config.get('previous_update', None) and last_modified <= previous_update: # File has not been modified since last update, do nothing LOGGER.info("File has not changed since last time, Skipping...") continue if update_config.get('previous_update', None): previous_update = time.strftime("%a, %d %b %Y %H:%M:%S %Z", time.gmtime(previous_update)) if headers: headers['If-Modified-Since'] = previous_update else: headers = { 'If-Modified-Since': previous_update, } response = session.get(uri, auth=auth, headers=headers) # Check the response code if response.status_code == requests.codes['not_modified']: # File has not been modified since last update, do nothing LOGGER.info("File has not changed since last time, Skipping...") continue elif response.ok: file_path = os.path.join(UPDATE_OUTPUT_PATH, name) with open(file_path, 'wb') as f: f.write(response.content) if not test_func(file_path): os.unlink(file_path) LOGGER.warning(f"The downloaded file was invalid. It will not be part of this update...") continue # Append the SHA256 of the file to a list of downloaded files sha256 = get_sha256_for_file(file_path) if previous_hash.get(name, None) != sha256: files_sha256[name] = sha256 else: LOGGER.info("File as the same hash as last time. Skipping...") LOGGER.info("File successfully downloaded!") except requests.Timeout: LOGGER.warning(f"Cannot find the file for source {name} with url {uri} - (Timeout)") continue except Exception as e: # Catch all other types of exceptions such as ConnectionError, ProxyError, etc. LOGGER.warning(f"Source {name} failed with error: {str(e)}") if files_sha256: new_hash = deepcopy(previous_hash) new_hash.update(files_sha256) # Check if the new update hash matches the previous update hash if new_hash == previous_hash: # Update file(s) not changed, delete the downloaded files and exit shutil.rmtree(UPDATE_OUTPUT_PATH, ignore_errors=True) exit() # Create the response yaml with open(os.path.join(UPDATE_OUTPUT_PATH, 'response.yaml'), 'w') as yml_fh: yaml.safe_dump(dict( hash=json.dumps(new_hash), ), yml_fh) LOGGER.info("Service update file(s) successfully downloaded") # Close the requests session session.close() if __name__ == '__main__': url_update()
0.421433
0.075109
# In[1]: # %pip install tensorflow==2.4.1 # %pip install transformers # %pip install pyarrow # %pip install tensorflow-addons # In[1]: import tensorflow as tf import pandas as pd import pickle import os import tensorflow_addons as tfa from transformers import RobertaTokenizer, RobertaTokenizerFast, TFRobertaModel, TFAlbertModel AUTO = tf.data.experimental.AUTOTUNE # In[2]: model_iteration = 'iteration_1' # In[3]: tf.config.list_physical_devices() # In[4]: with open(f"./{model_iteration}/vocab/topics_vocab.pkl", "rb") as f: target_vocab = pickle.load(f) with open(f"./{model_iteration}/vocab/doc_type_vocab.pkl", "rb") as f: doc_vocab = pickle.load(f) with open(f"./{model_iteration}/vocab/journal_name_vocab.pkl", "rb") as f: journal_vocab = pickle.load(f) # In[5]: encoding_layer = tf.keras.layers.experimental.preprocessing.CategoryEncoding( max_tokens=len(target_vocab)+1, output_mode="binary", sparse=False) # loss_fn = tf.keras.losses.CategoricalCrossentropy(reduction=tf.keras.losses.Reduction.NONE) loss_fn = tfa.losses.SigmoidFocalCrossEntropy(alpha=0.25, gamma=2.0, reduction=tf.keras.losses.Reduction.NONE) metric_1 = tf.keras.metrics.CategoricalAccuracy() metric_2 = tf.keras.metrics.Recall() metric_3 = tf.keras.metrics.Precision() metric_4 = tf.keras.metrics.TopKCategoricalAccuracy(k=10) # Eventually will use with focal loss # In[6]: class CustomModel(tf.keras.Model): def train_step(self, inputs): old_features, labels = inputs labels = tf.RaggedTensor.from_tensor(labels, padding=0) paper_titles = old_features[0][:,:512].to_tensor(shape=[None, 512]) paper_masks = old_features[1][:,:512].to_tensor(shape=[None, 512]) features = (paper_titles, paper_masks, old_features[2], old_features[3]) labels = encoding_layer(labels) with tf.GradientTape() as tape: predictions = self(features, training=True) loss = loss_fn(labels, predictions) trainable_vars = self.trainable_variables gradients = tape.gradient(loss, trainable_vars) self.optimizer.apply_gradients(zip(gradients, trainable_vars)) metric_1.update_state(labels, predictions) metric_2.update_state(labels, predictions) metric_3.update_state(labels, predictions) metric_4.update_state(labels, predictions) return {"loss": loss, "accuracy": metric_1.result(), "recall": metric_2.result(), "precision": metric_3.result(), "topK15": metric_4.result()} def test_step(self, inputs): old_features, labels = inputs labels = tf.RaggedTensor.from_tensor(labels, padding=0) paper_titles = old_features[0][:,:512].to_tensor(shape=[None, 512]) paper_masks = old_features[1][:,:512].to_tensor(shape=[None, 512]) features = (paper_titles, paper_masks, old_features[2], old_features[3]) labels = encoding_layer(labels) with tf.GradientTape() as tape: predictions = self(features, training=False) loss = loss_fn(labels, predictions) metric_1.update_state(labels, predictions) metric_2.update_state(labels, predictions) metric_3.update_state(labels, predictions) metric_4.update_state(labels, predictions) return {"loss": loss, "accuracy": metric_1.result(), "recall": metric_2.result(), "precision": metric_3.result(), "topK15": metric_4.result()} @property def metrics(self): return [metric_1, metric_2, metric_3] # In[7]: def _parse_function(example_proto): feature_description = { 'paper_title': tf.io.RaggedFeature(tf.int64), 'paper_mask': tf.io.RaggedFeature(tf.int64), 'journal': tf.io.FixedLenFeature((1,), tf.int64), 'doc_type': tf.io.FixedLenFeature((1,), tf.int64), 'targets': tf.io.FixedLenFeature((20,), tf.int64) } example = tf.io.parse_single_example(example_proto, feature_description) paper_title = example['paper_title'] paper_mask = example['paper_mask'] doc_type = example['doc_type'] journal = example['journal'] targets = example['targets'] return (paper_title, paper_mask, doc_type, journal), targets # In[8]: def get_dataset(path, data_type='train'): tfrecords = [f"{path}{data_type}/{x}" for x in os.listdir(f"{path}{data_type}/") if x.endswith('tfrecord')] tfrecords.sort() raw_dataset = tf.data.TFRecordDataset(tfrecords[:25], num_parallel_reads=AUTO) parsed_dataset = raw_dataset.map(_parse_function, num_parallel_calls=AUTO) parsed_dataset = parsed_dataset .apply(tf.data.experimental.dense_to_ragged_batch(256, drop_remainder=True)).shuffle(1024) return parsed_dataset.prefetch(AUTO) # In[9]: file_path = f'./{model_iteration}/tfrecords/' # In[10]: train_ds = get_dataset(file_path, 'train') val_ds = get_dataset(file_path, 'val') # In[11]: mirrored_strategy = tf.distribute.MirroredStrategy() # In[12]: with mirrored_strategy.scope(): # model = TFAlbertModel.from_pretrained('albert-base-v2') # model.layers[0].trainable = False # Model Inputs paper_title_input_ids = tf.keras.layers.Input((512,), dtype=tf.int64, name='paper_title_ids') paper_title_att_mask = tf.keras.layers.Input((512,), dtype=tf.int64, name='paper_title_mask') doc_type_id = tf.keras.layers.Input((1,), dtype=tf.int64, name='doc_type_id') journal_id = tf.keras.layers.Input((1,), dtype=tf.int64, name='journal_id') # Using HF Model for Title Representation # paper_title_embs = model(input_ids = paper_title_input_ids, # attention_mask=paper_title_att_mask, # output_hidden_states=True, # training=False).last_hidden_state # Embedding Layers paper_title_embs = tf.keras.layers.Embedding(input_dim=30001, output_dim=512, mask_zero=False, trainable=True, name="title_embedding")(paper_title_input_ids) doc_embs = tf.keras.layers.Embedding(input_dim=len(doc_vocab)+1, output_dim=32, mask_zero=False, name="doc_type_embedding")(doc_type_id) journal_embs = tf.keras.layers.Embedding(input_dim=len(journal_vocab)+1, output_dim=128, mask_zero=False, name="journal_embedding")(journal_id) # First layer dense_output = tf.keras.layers.Dense(1024, activation='relu', kernel_regularizer='L2', name="dense_1")(paper_title_embs) dense_output = tf.keras.layers.Dropout(0.20, name="dropout_1")(dense_output) dense_output = tf.keras.layers.LayerNormalization(epsilon=1e-6, name="layer_norm_1")(dense_output) dense_output_flat = tf.keras.layers.GlobalAveragePooling1D(name="title_pooling_layer")(dense_output) doc_flat = tf.keras.layers.GlobalAveragePooling1D(name="doc_pooling_layer")(doc_embs) journal_flat = tf.keras.layers.GlobalAveragePooling1D(name="journal_pooling_layer")(journal_embs) concat_output = tf.concat(values=[dense_output_flat, journal_flat, doc_flat], axis=1) # Second layer dense_output = tf.keras.layers.Dense(1024, activation='relu', kernel_regularizer='L2', name="dense_2")(concat_output) dense_output = tf.keras.layers.Dropout(0.20, name="dropout_2")(dense_output) dense_output = tf.keras.layers.LayerNormalization(epsilon=1e-6, name="layer_norm_2")(dense_output) # Third Layer dense_output = tf.keras.layers.Dense(256, activation='relu', kernel_regularizer='L2', name="dense_3")(dense_output) dense_output = tf.keras.layers.Dropout(0.20, name="dropout_3")(dense_output) dense_output = tf.keras.layers.LayerNormalization(epsilon=1e-6, name="layer_norm_3")(dense_output) # dense_output_flat = tf.keras.layers.GlobalAveragePooling1D(name="title_pooling_layer")(dense_output) # Output Layer final_output = tf.keras.layers.Dense(len(target_vocab)+1, activation="sigmoid", name="cls")(dense_output) test_model = CustomModel(inputs=[paper_title_input_ids, paper_title_att_mask, doc_type_id, journal_id], outputs=final_output, name='test_model') optimizer = tf.keras.optimizers.Adam(learning_rate=0.001) # In[13]: test_model.compile(optimizer=optimizer) # In[14]: test_model.summary() # In[15]: callbacks = [tf.keras.callbacks.ModelCheckpoint(f'./models/{model_iteration}/{model_iteration}_first_try', save_best_only=False, save_weights_only=False)] # ## First try (with all variables and Albert model output) # In[ ]: history = test_model.fit(train_ds, epochs=1, validation_data=val_ds, verbose=1, callbacks=callbacks) # In[ ]: # In[ ]: # In[ ]: # In[ ]: # ## ARCHIVE: Baseline Second Try (trainable embeddings) # In[23]: history = test_model.fit(train_ds, epochs=5, validation_data=val_ds, verbose=1, callbacks=callbacks) # In[ ]: # In[ ]: # In[ ]:
POC/mag_model_iteration_1.py
# In[1]: # %pip install tensorflow==2.4.1 # %pip install transformers # %pip install pyarrow # %pip install tensorflow-addons # In[1]: import tensorflow as tf import pandas as pd import pickle import os import tensorflow_addons as tfa from transformers import RobertaTokenizer, RobertaTokenizerFast, TFRobertaModel, TFAlbertModel AUTO = tf.data.experimental.AUTOTUNE # In[2]: model_iteration = 'iteration_1' # In[3]: tf.config.list_physical_devices() # In[4]: with open(f"./{model_iteration}/vocab/topics_vocab.pkl", "rb") as f: target_vocab = pickle.load(f) with open(f"./{model_iteration}/vocab/doc_type_vocab.pkl", "rb") as f: doc_vocab = pickle.load(f) with open(f"./{model_iteration}/vocab/journal_name_vocab.pkl", "rb") as f: journal_vocab = pickle.load(f) # In[5]: encoding_layer = tf.keras.layers.experimental.preprocessing.CategoryEncoding( max_tokens=len(target_vocab)+1, output_mode="binary", sparse=False) # loss_fn = tf.keras.losses.CategoricalCrossentropy(reduction=tf.keras.losses.Reduction.NONE) loss_fn = tfa.losses.SigmoidFocalCrossEntropy(alpha=0.25, gamma=2.0, reduction=tf.keras.losses.Reduction.NONE) metric_1 = tf.keras.metrics.CategoricalAccuracy() metric_2 = tf.keras.metrics.Recall() metric_3 = tf.keras.metrics.Precision() metric_4 = tf.keras.metrics.TopKCategoricalAccuracy(k=10) # Eventually will use with focal loss # In[6]: class CustomModel(tf.keras.Model): def train_step(self, inputs): old_features, labels = inputs labels = tf.RaggedTensor.from_tensor(labels, padding=0) paper_titles = old_features[0][:,:512].to_tensor(shape=[None, 512]) paper_masks = old_features[1][:,:512].to_tensor(shape=[None, 512]) features = (paper_titles, paper_masks, old_features[2], old_features[3]) labels = encoding_layer(labels) with tf.GradientTape() as tape: predictions = self(features, training=True) loss = loss_fn(labels, predictions) trainable_vars = self.trainable_variables gradients = tape.gradient(loss, trainable_vars) self.optimizer.apply_gradients(zip(gradients, trainable_vars)) metric_1.update_state(labels, predictions) metric_2.update_state(labels, predictions) metric_3.update_state(labels, predictions) metric_4.update_state(labels, predictions) return {"loss": loss, "accuracy": metric_1.result(), "recall": metric_2.result(), "precision": metric_3.result(), "topK15": metric_4.result()} def test_step(self, inputs): old_features, labels = inputs labels = tf.RaggedTensor.from_tensor(labels, padding=0) paper_titles = old_features[0][:,:512].to_tensor(shape=[None, 512]) paper_masks = old_features[1][:,:512].to_tensor(shape=[None, 512]) features = (paper_titles, paper_masks, old_features[2], old_features[3]) labels = encoding_layer(labels) with tf.GradientTape() as tape: predictions = self(features, training=False) loss = loss_fn(labels, predictions) metric_1.update_state(labels, predictions) metric_2.update_state(labels, predictions) metric_3.update_state(labels, predictions) metric_4.update_state(labels, predictions) return {"loss": loss, "accuracy": metric_1.result(), "recall": metric_2.result(), "precision": metric_3.result(), "topK15": metric_4.result()} @property def metrics(self): return [metric_1, metric_2, metric_3] # In[7]: def _parse_function(example_proto): feature_description = { 'paper_title': tf.io.RaggedFeature(tf.int64), 'paper_mask': tf.io.RaggedFeature(tf.int64), 'journal': tf.io.FixedLenFeature((1,), tf.int64), 'doc_type': tf.io.FixedLenFeature((1,), tf.int64), 'targets': tf.io.FixedLenFeature((20,), tf.int64) } example = tf.io.parse_single_example(example_proto, feature_description) paper_title = example['paper_title'] paper_mask = example['paper_mask'] doc_type = example['doc_type'] journal = example['journal'] targets = example['targets'] return (paper_title, paper_mask, doc_type, journal), targets # In[8]: def get_dataset(path, data_type='train'): tfrecords = [f"{path}{data_type}/{x}" for x in os.listdir(f"{path}{data_type}/") if x.endswith('tfrecord')] tfrecords.sort() raw_dataset = tf.data.TFRecordDataset(tfrecords[:25], num_parallel_reads=AUTO) parsed_dataset = raw_dataset.map(_parse_function, num_parallel_calls=AUTO) parsed_dataset = parsed_dataset .apply(tf.data.experimental.dense_to_ragged_batch(256, drop_remainder=True)).shuffle(1024) return parsed_dataset.prefetch(AUTO) # In[9]: file_path = f'./{model_iteration}/tfrecords/' # In[10]: train_ds = get_dataset(file_path, 'train') val_ds = get_dataset(file_path, 'val') # In[11]: mirrored_strategy = tf.distribute.MirroredStrategy() # In[12]: with mirrored_strategy.scope(): # model = TFAlbertModel.from_pretrained('albert-base-v2') # model.layers[0].trainable = False # Model Inputs paper_title_input_ids = tf.keras.layers.Input((512,), dtype=tf.int64, name='paper_title_ids') paper_title_att_mask = tf.keras.layers.Input((512,), dtype=tf.int64, name='paper_title_mask') doc_type_id = tf.keras.layers.Input((1,), dtype=tf.int64, name='doc_type_id') journal_id = tf.keras.layers.Input((1,), dtype=tf.int64, name='journal_id') # Using HF Model for Title Representation # paper_title_embs = model(input_ids = paper_title_input_ids, # attention_mask=paper_title_att_mask, # output_hidden_states=True, # training=False).last_hidden_state # Embedding Layers paper_title_embs = tf.keras.layers.Embedding(input_dim=30001, output_dim=512, mask_zero=False, trainable=True, name="title_embedding")(paper_title_input_ids) doc_embs = tf.keras.layers.Embedding(input_dim=len(doc_vocab)+1, output_dim=32, mask_zero=False, name="doc_type_embedding")(doc_type_id) journal_embs = tf.keras.layers.Embedding(input_dim=len(journal_vocab)+1, output_dim=128, mask_zero=False, name="journal_embedding")(journal_id) # First layer dense_output = tf.keras.layers.Dense(1024, activation='relu', kernel_regularizer='L2', name="dense_1")(paper_title_embs) dense_output = tf.keras.layers.Dropout(0.20, name="dropout_1")(dense_output) dense_output = tf.keras.layers.LayerNormalization(epsilon=1e-6, name="layer_norm_1")(dense_output) dense_output_flat = tf.keras.layers.GlobalAveragePooling1D(name="title_pooling_layer")(dense_output) doc_flat = tf.keras.layers.GlobalAveragePooling1D(name="doc_pooling_layer")(doc_embs) journal_flat = tf.keras.layers.GlobalAveragePooling1D(name="journal_pooling_layer")(journal_embs) concat_output = tf.concat(values=[dense_output_flat, journal_flat, doc_flat], axis=1) # Second layer dense_output = tf.keras.layers.Dense(1024, activation='relu', kernel_regularizer='L2', name="dense_2")(concat_output) dense_output = tf.keras.layers.Dropout(0.20, name="dropout_2")(dense_output) dense_output = tf.keras.layers.LayerNormalization(epsilon=1e-6, name="layer_norm_2")(dense_output) # Third Layer dense_output = tf.keras.layers.Dense(256, activation='relu', kernel_regularizer='L2', name="dense_3")(dense_output) dense_output = tf.keras.layers.Dropout(0.20, name="dropout_3")(dense_output) dense_output = tf.keras.layers.LayerNormalization(epsilon=1e-6, name="layer_norm_3")(dense_output) # dense_output_flat = tf.keras.layers.GlobalAveragePooling1D(name="title_pooling_layer")(dense_output) # Output Layer final_output = tf.keras.layers.Dense(len(target_vocab)+1, activation="sigmoid", name="cls")(dense_output) test_model = CustomModel(inputs=[paper_title_input_ids, paper_title_att_mask, doc_type_id, journal_id], outputs=final_output, name='test_model') optimizer = tf.keras.optimizers.Adam(learning_rate=0.001) # In[13]: test_model.compile(optimizer=optimizer) # In[14]: test_model.summary() # In[15]: callbacks = [tf.keras.callbacks.ModelCheckpoint(f'./models/{model_iteration}/{model_iteration}_first_try', save_best_only=False, save_weights_only=False)] # ## First try (with all variables and Albert model output) # In[ ]: history = test_model.fit(train_ds, epochs=1, validation_data=val_ds, verbose=1, callbacks=callbacks) # In[ ]: # In[ ]: # In[ ]: # In[ ]: # ## ARCHIVE: Baseline Second Try (trainable embeddings) # In[23]: history = test_model.fit(train_ds, epochs=5, validation_data=val_ds, verbose=1, callbacks=callbacks) # In[ ]: # In[ ]: # In[ ]:
0.741955
0.31457
from collections import deque from time import time import numpy as np class LoopTracker(object): """timekeeping, contains 1) with `enter`-> `exit`; 2) loop between current and next `exit`. """ def __init__(self, length): self.with_time_list = deque(maxlen=length) self.loop_time_list = deque(maxlen=length) self.loop_point = None def __enter__(self): self.start = time() return self def __exit__(self, exc_type, exc_val, exc_tb): self.end = time() self.with_time_list.append(self.end - self.start) if not self.loop_point: self.loop_point = self.end else: self.loop_time_list.append(self.end - self.loop_point) self.loop_point = self.end def average(self, time_name): """mean time of `with` interaction, and loop time as well.""" if time_name == "enter": return np.nanmean(self.with_time_list) * 1000 elif time_name == "loop": return np.nanmean(self.loop_time_list) * 1000 else: return np.nan class SingleTracker(object): """single time tracker, only profiling the enter time used.""" def __init__(self, length): self.with_time_list = deque(maxlen=length) self.start = time() def __enter__(self): self.start = time() return self def __exit__(self, exc_type, exc_val, exc_tb): self.with_time_list.append(time() - self.start) def average(self): """mean time of `with` interaction""" if not self.with_time_list: return np.nan return np.nanmean(self.with_time_list) * 1000 class PredictStats(object): """predictor status records handle the wait and inference time of predictor""" def __init__(self): """init with default value""" self.obs_wait_time = 0.0 self.inference_time = 0.0 self.iters = 0.0 def get(self): ret = { "mean_predictor_wait_ms": self.obs_wait_time * 1000 / self.iters, "mean_predictor_infer_ms": self.inference_time * 1000 / self.iters, } self.reset() return ret def reset(self): self.obs_wait_time = 0.0 self.inference_time = 0.0 self.iters = 0.0 class AgentStats(object): """ Agent status records handle the env.step and inference time of Agent""" def __init__(self): """init with default value""" self.env_step_time = 0.0 self.inference_time = 0.0 self.iters = 0.0 def get(self): """get agent status and clear the buffer""" ret = { "mean_env_step_time_ms": self.env_step_time * 1000 / self.iters, "mean_inference_time_ms": self.inference_time * 1000 / self.iters, "iters": self.iters, } self.reset() return ret def reset(self): """reset buffer""" self.env_step_time = 0.0 self.inference_time = 0.0 self.iters = 0 class AgentGroupStats(object): """ AgentGroup status records handle the env.step and inference time of AgentGroup the status could been make sence within once explore There should been gather by logger or others""" def __init__(self, n_agents, env_type): """init with default value""" self.env_step_time = 0.0 self.inference_time = 0.0 self.iters = 0 self.explore_time_in_epi = 0.0 self.wait_model_time = 0.0 self.restore_model_time = 0.0 self.n_agents = n_agents self.env_api_type = env_type self._stats = dict() def update_with_agent_stats(self, agent_stats: list): """update agent status to agent group""" _steps = [sta["mean_env_step_time_ms"] for sta in agent_stats] _infers = [sta["mean_inference_time_ms"] for sta in agent_stats] _iters = [sta["iters"] for sta in agent_stats] self._stats.update( { "mean_env_step_ms": np.nanmean(_steps), "mean_inference_ms": np.nanmean(_infers), "iters": np.max(_iters), } ) def get(self): """get the newest one-explore-status of agent group""" self._stats.update( { "explore_ms": self.explore_time_in_epi * 1000, "wait_model_ms": self.wait_model_time * 1000, "restore_model_ms": self.restore_model_time * 1000, } ) # use unified api, agent group will record the iteraction times. if self.iters > 1e-1: self._stats.update( { "mean_env_step_time_ms": self.env_step_time * 1000 / self.iters, "mean_inference_time_ms": self.inference_time * 1000 / self.iters, "iters": self.iters, } ) self.reset() return self._stats def reset(self): """reset buffer.""" self.env_step_time = 0.0 self.inference_time = 0.0 self.iters = 0 self.explore_time_in_epi = 0.0 self.wait_model_time = 0.0 self.restore_model_time = 0.0
built-in/TensorFlow/Research/reinforcement-learning/ModelZoo_QMIX_TensorFlow/xt/util/profile_stats.py
from collections import deque from time import time import numpy as np class LoopTracker(object): """timekeeping, contains 1) with `enter`-> `exit`; 2) loop between current and next `exit`. """ def __init__(self, length): self.with_time_list = deque(maxlen=length) self.loop_time_list = deque(maxlen=length) self.loop_point = None def __enter__(self): self.start = time() return self def __exit__(self, exc_type, exc_val, exc_tb): self.end = time() self.with_time_list.append(self.end - self.start) if not self.loop_point: self.loop_point = self.end else: self.loop_time_list.append(self.end - self.loop_point) self.loop_point = self.end def average(self, time_name): """mean time of `with` interaction, and loop time as well.""" if time_name == "enter": return np.nanmean(self.with_time_list) * 1000 elif time_name == "loop": return np.nanmean(self.loop_time_list) * 1000 else: return np.nan class SingleTracker(object): """single time tracker, only profiling the enter time used.""" def __init__(self, length): self.with_time_list = deque(maxlen=length) self.start = time() def __enter__(self): self.start = time() return self def __exit__(self, exc_type, exc_val, exc_tb): self.with_time_list.append(time() - self.start) def average(self): """mean time of `with` interaction""" if not self.with_time_list: return np.nan return np.nanmean(self.with_time_list) * 1000 class PredictStats(object): """predictor status records handle the wait and inference time of predictor""" def __init__(self): """init with default value""" self.obs_wait_time = 0.0 self.inference_time = 0.0 self.iters = 0.0 def get(self): ret = { "mean_predictor_wait_ms": self.obs_wait_time * 1000 / self.iters, "mean_predictor_infer_ms": self.inference_time * 1000 / self.iters, } self.reset() return ret def reset(self): self.obs_wait_time = 0.0 self.inference_time = 0.0 self.iters = 0.0 class AgentStats(object): """ Agent status records handle the env.step and inference time of Agent""" def __init__(self): """init with default value""" self.env_step_time = 0.0 self.inference_time = 0.0 self.iters = 0.0 def get(self): """get agent status and clear the buffer""" ret = { "mean_env_step_time_ms": self.env_step_time * 1000 / self.iters, "mean_inference_time_ms": self.inference_time * 1000 / self.iters, "iters": self.iters, } self.reset() return ret def reset(self): """reset buffer""" self.env_step_time = 0.0 self.inference_time = 0.0 self.iters = 0 class AgentGroupStats(object): """ AgentGroup status records handle the env.step and inference time of AgentGroup the status could been make sence within once explore There should been gather by logger or others""" def __init__(self, n_agents, env_type): """init with default value""" self.env_step_time = 0.0 self.inference_time = 0.0 self.iters = 0 self.explore_time_in_epi = 0.0 self.wait_model_time = 0.0 self.restore_model_time = 0.0 self.n_agents = n_agents self.env_api_type = env_type self._stats = dict() def update_with_agent_stats(self, agent_stats: list): """update agent status to agent group""" _steps = [sta["mean_env_step_time_ms"] for sta in agent_stats] _infers = [sta["mean_inference_time_ms"] for sta in agent_stats] _iters = [sta["iters"] for sta in agent_stats] self._stats.update( { "mean_env_step_ms": np.nanmean(_steps), "mean_inference_ms": np.nanmean(_infers), "iters": np.max(_iters), } ) def get(self): """get the newest one-explore-status of agent group""" self._stats.update( { "explore_ms": self.explore_time_in_epi * 1000, "wait_model_ms": self.wait_model_time * 1000, "restore_model_ms": self.restore_model_time * 1000, } ) # use unified api, agent group will record the iteraction times. if self.iters > 1e-1: self._stats.update( { "mean_env_step_time_ms": self.env_step_time * 1000 / self.iters, "mean_inference_time_ms": self.inference_time * 1000 / self.iters, "iters": self.iters, } ) self.reset() return self._stats def reset(self): """reset buffer.""" self.env_step_time = 0.0 self.inference_time = 0.0 self.iters = 0 self.explore_time_in_epi = 0.0 self.wait_model_time = 0.0 self.restore_model_time = 0.0
0.777046
0.32126
from . import db,login_manager from werkzeug.security import generate_password_hash,check_password_hash from flask_login import UserMixin from datetime import datetime #Added this code to solve the Exception: Missing user_loader or request_loader. @login_manager.user_loader def load_user(user_id): return User.query.get(int(user_id)) class User(UserMixin,db.Model): __tablename__ = 'users' id = db.Column(db.Integer,primary_key = True) username = db.Column(db.String(255)) email = db.Column(db.String(255),unique = True,index = True) bio = db.Column(db.String(255)) profile_pic_path = db.Column(db.String()) pass_secure = db.Column(db.String(255)) blog = db.relationship('Blog',backref = 'user',lazy = "dynamic") comment = db.relationship('Comment',backref = 'user',lazy = "dynamic") # upvote = db.relationship('Like',backref='user',lazy='dynamic') # downvote = db.relationship('Dislike',backref='user',lazy='dynamic') @property def password(self): raise AttributeError('You cannot read the password attribute') @password.setter def password(self, password): self.pass_secure = generate_password_hash(password) def verify_password(self,password): return check_password_hash(self.pass_secure,password) def __repr__(self): return f'User {self.username}' class Blog(db.Model): _tablename_ = 'blogs' id = db.Column(db.Integer, primary_key=True) title = db.Column(db.String(255)) category = db.Column(db.String) description = db.Column(db.Text) date_posted = db.Column(db.DateTime, default=datetime.utcnow) user_id = db.Column(db.Integer, db.ForeignKey('users.id')) comment = db.relationship('Comment', backref='blog', lazy='dynamic') # save blog def save_blog(self): db.session.add(self) db.session.commit() #Delete blog def delete_blog(self): db.session.delete(self) db.session.commit() # get blog by id @classmethod def get_blog(cls, id): blog = Blog.query.filter_by(id=id).first() return blog @classmethod def get_blogs(cls,id): blogs =Blog.query.filter_by(blog_id=id).all() return blogs def _repr_(self): return f'Blog {self.title}' class Comment(db.Model): __tablename__ = 'comments' id = db.Column(db.Integer, primary_key=True) comment = db.Column(db.String(255)) date_posted = db.Column(db.DateTime, default=datetime.utcnow) user_id = db.Column(db.Integer,db.ForeignKey("users.id")) blog_id = db.Column(db.Integer,db.ForeignKey("blog.id")) def save_comment(self): db.session.add(self) db.session.commit() def delete_comment(self): db.session.delete(self) db.session.commit() @classmethod def get_comments(cls,id): comments = Comment.query.filter_by(blog_id=id).all() return comments def _repr_(self): return f'Comment {self.comment}' class Quote: """ Qoute blueprint """ def __init__(self,quote, author): self.quote = quote self.author = author class Subscriber(db.Model): __tablename__ = "subscribers" id=db.Column(db.Integer,primary_key=True) email = db.Column(db.String(255),index=True) def save_subscriber(self): db.session.add(self) db.session.commit() def __repr__(self): return f'Subscriber:{self.email}'
app/models.py
from . import db,login_manager from werkzeug.security import generate_password_hash,check_password_hash from flask_login import UserMixin from datetime import datetime #Added this code to solve the Exception: Missing user_loader or request_loader. @login_manager.user_loader def load_user(user_id): return User.query.get(int(user_id)) class User(UserMixin,db.Model): __tablename__ = 'users' id = db.Column(db.Integer,primary_key = True) username = db.Column(db.String(255)) email = db.Column(db.String(255),unique = True,index = True) bio = db.Column(db.String(255)) profile_pic_path = db.Column(db.String()) pass_secure = db.Column(db.String(255)) blog = db.relationship('Blog',backref = 'user',lazy = "dynamic") comment = db.relationship('Comment',backref = 'user',lazy = "dynamic") # upvote = db.relationship('Like',backref='user',lazy='dynamic') # downvote = db.relationship('Dislike',backref='user',lazy='dynamic') @property def password(self): raise AttributeError('You cannot read the password attribute') @password.setter def password(self, password): self.pass_secure = generate_password_hash(password) def verify_password(self,password): return check_password_hash(self.pass_secure,password) def __repr__(self): return f'User {self.username}' class Blog(db.Model): _tablename_ = 'blogs' id = db.Column(db.Integer, primary_key=True) title = db.Column(db.String(255)) category = db.Column(db.String) description = db.Column(db.Text) date_posted = db.Column(db.DateTime, default=datetime.utcnow) user_id = db.Column(db.Integer, db.ForeignKey('users.id')) comment = db.relationship('Comment', backref='blog', lazy='dynamic') # save blog def save_blog(self): db.session.add(self) db.session.commit() #Delete blog def delete_blog(self): db.session.delete(self) db.session.commit() # get blog by id @classmethod def get_blog(cls, id): blog = Blog.query.filter_by(id=id).first() return blog @classmethod def get_blogs(cls,id): blogs =Blog.query.filter_by(blog_id=id).all() return blogs def _repr_(self): return f'Blog {self.title}' class Comment(db.Model): __tablename__ = 'comments' id = db.Column(db.Integer, primary_key=True) comment = db.Column(db.String(255)) date_posted = db.Column(db.DateTime, default=datetime.utcnow) user_id = db.Column(db.Integer,db.ForeignKey("users.id")) blog_id = db.Column(db.Integer,db.ForeignKey("blog.id")) def save_comment(self): db.session.add(self) db.session.commit() def delete_comment(self): db.session.delete(self) db.session.commit() @classmethod def get_comments(cls,id): comments = Comment.query.filter_by(blog_id=id).all() return comments def _repr_(self): return f'Comment {self.comment}' class Quote: """ Qoute blueprint """ def __init__(self,quote, author): self.quote = quote self.author = author class Subscriber(db.Model): __tablename__ = "subscribers" id=db.Column(db.Integer,primary_key=True) email = db.Column(db.String(255),index=True) def save_subscriber(self): db.session.add(self) db.session.commit() def __repr__(self): return f'Subscriber:{self.email}'
0.372277
0.058051
from fractions import Fraction from random import randint NUMBER_OF_ITERATIONS = 10_000 FLOUR = True SUGAR = False def main(iterations: int = NUMBER_OF_ITERATIONS) -> None: """ print the percentage of the iterations where the selected person had the required item """ times_person_A_has_extra_flour = 0 times_person_A_does_not_have_extra_flour = 0 times_person_B_has_extra_flour = 0 times_person_B_does_not_have_extra_flour = 0 # local redefinition to make things slightly faster FLOUR = True SUGAR = False for _ in range(iterations): first_item = FLOUR if randint(0, 1) else SUGAR second_item = FLOUR if randint(0, 1) else SUGAR # only choose pairs that person A could have, based on their statement # that one of the two items they have is flour if first_item or second_item: # person A has extra flour if both items are flour if first_item == second_item == FLOUR: times_person_A_has_extra_flour += 1 else: times_person_A_does_not_have_extra_flour += 1 # only choose pairs that person B could have, based on their statement # that the first item they bought is flour if first_item: # person B has extra flour if both items are flour if first_item == second_item == FLOUR: times_person_B_has_extra_flour += 1 else: times_person_B_does_not_have_extra_flour += 1 print(__doc__) print( f"""If they visit the store {iterations:,} times, and you pick someone at random each time they respond as in the scenario: """ ) total_valid_person_A_scenarios = ( times_person_A_has_extra_flour + times_person_A_does_not_have_extra_flour ) percent_of_times_person_A_has_flour = ( times_person_A_has_extra_flour / total_valid_person_A_scenarios ) print(f"person A had flour {percent_of_times_person_A_has_flour:.1%} of the time") total_valid_person_B_scenarios = ( times_person_B_has_extra_flour + times_person_B_does_not_have_extra_flour ) percent_of_times_person_B_has_flour = ( times_person_B_has_extra_flour / total_valid_person_B_scenarios ) print(f"person B had flour {percent_of_times_person_B_has_flour:.1%} of the time") person_A_fraction = Fraction( times_person_A_has_extra_flour, iterations ).limit_denominator(iterations) person_B_fraction = Fraction( times_person_B_has_extra_flour, iterations ).limit_denominator(iterations) print( f""" If you don't wait for a time when their answers are correct, {person_A_fraction.numerator:,} times out of every {person_A_fraction.denominator:,} visits to the store ({float(person_A_fraction):.1%}) person A will have flour, and person B will have it {person_B_fraction.numerator:,} times out of {person_B_fraction.denominator:,} visits ({float(person_B_fraction):.1%}) This is because out of {iterations:,} scenarios, person A's statement was true in {total_valid_person_A_scenarios / iterations:.1%} of the scenarios, while person B's statement was true in only {total_valid_person_B_scenarios / iterations:.1%} of the scenarios. """ ) if __name__ == "__main__": main()
other/two_children_problem.py
from fractions import Fraction from random import randint NUMBER_OF_ITERATIONS = 10_000 FLOUR = True SUGAR = False def main(iterations: int = NUMBER_OF_ITERATIONS) -> None: """ print the percentage of the iterations where the selected person had the required item """ times_person_A_has_extra_flour = 0 times_person_A_does_not_have_extra_flour = 0 times_person_B_has_extra_flour = 0 times_person_B_does_not_have_extra_flour = 0 # local redefinition to make things slightly faster FLOUR = True SUGAR = False for _ in range(iterations): first_item = FLOUR if randint(0, 1) else SUGAR second_item = FLOUR if randint(0, 1) else SUGAR # only choose pairs that person A could have, based on their statement # that one of the two items they have is flour if first_item or second_item: # person A has extra flour if both items are flour if first_item == second_item == FLOUR: times_person_A_has_extra_flour += 1 else: times_person_A_does_not_have_extra_flour += 1 # only choose pairs that person B could have, based on their statement # that the first item they bought is flour if first_item: # person B has extra flour if both items are flour if first_item == second_item == FLOUR: times_person_B_has_extra_flour += 1 else: times_person_B_does_not_have_extra_flour += 1 print(__doc__) print( f"""If they visit the store {iterations:,} times, and you pick someone at random each time they respond as in the scenario: """ ) total_valid_person_A_scenarios = ( times_person_A_has_extra_flour + times_person_A_does_not_have_extra_flour ) percent_of_times_person_A_has_flour = ( times_person_A_has_extra_flour / total_valid_person_A_scenarios ) print(f"person A had flour {percent_of_times_person_A_has_flour:.1%} of the time") total_valid_person_B_scenarios = ( times_person_B_has_extra_flour + times_person_B_does_not_have_extra_flour ) percent_of_times_person_B_has_flour = ( times_person_B_has_extra_flour / total_valid_person_B_scenarios ) print(f"person B had flour {percent_of_times_person_B_has_flour:.1%} of the time") person_A_fraction = Fraction( times_person_A_has_extra_flour, iterations ).limit_denominator(iterations) person_B_fraction = Fraction( times_person_B_has_extra_flour, iterations ).limit_denominator(iterations) print( f""" If you don't wait for a time when their answers are correct, {person_A_fraction.numerator:,} times out of every {person_A_fraction.denominator:,} visits to the store ({float(person_A_fraction):.1%}) person A will have flour, and person B will have it {person_B_fraction.numerator:,} times out of {person_B_fraction.denominator:,} visits ({float(person_B_fraction):.1%}) This is because out of {iterations:,} scenarios, person A's statement was true in {total_valid_person_A_scenarios / iterations:.1%} of the scenarios, while person B's statement was true in only {total_valid_person_B_scenarios / iterations:.1%} of the scenarios. """ ) if __name__ == "__main__": main()
0.523177
0.362236
import os import time from glob import glob from multiprocessing import Pool, cpu_count import numpy as np import tensorflow as tf from absl import app, logging from absl.flags import argparse_flags from tqdm import auto as tqdm import lm.config import lm.encoders import lm.examples args = None def readlines_txt(src): with open(src) as fd: if not args.by_line: return [fd.read()] else: return fd.readlines() LINE_READER = { ".txt": readlines_txt, ".tsv": readlines_txt, } def readlines(src): _, ext = os.path.splitext(src) f = LINE_READER.get(ext, None) if f is None: logging.warning("no readlines for file %s", src) return return f(src) # Helper functions and classes def sizechunks(l, n): out = [] chunk = [] sz = 0 pbar = tqdm.tqdm(l) pbar.set_description("Measuring size...") for fpath in pbar: chunk.append(fpath) sz += tf.io.gfile.stat(fpath).length if sz >= n: out.append(chunk) sz = 0 chunk = [] if chunk: out.append(chunk) return out def parallel(src_dst_list, total): count = args.nproc or cpu_count() pool = Pool(processes=count) if count > 1 else None mapper = pool.imap if count > 1 else map if args.format == "tfrecord": transformer = lm.examples.transform_many_and_write_one_tfrecord elif args.format in ["tok16", "tok32"]: transformer = lm.examples.transform_many_and_write_one_tok16_or_tok32 else: raise ValueError("Unknown --format {}".format(args.format)) token_total = 0 example_total = 0 for token_count, example_count in tqdm.tqdm( mapper(transformer, src_dst_list), total=total, ): token_total += token_count example_total += example_count return token_total, example_total def parse_args(args, parser): parser.add_argument( "input", type=str, help="A file containing a list of filenames. Each file will become a single training example (unless --by_line is set).", ) parser.add_argument( "output", type=str, default="output", help="Where to write tfrecords" ) parser.add_argument( "--size", type=float, default=165.0, help="the size in MB of uncompressed text to add to each tfrecord file, default 165MB", ) parser.add_argument( "--name", type=str, default="dataset", help="prefix name for the output files." ) parser.add_argument( "--encoder", type=str, default="gpt2", help="Name or path of an encoder spec" ) parser.add_argument( "--by_line", action="store_true", help="encodes each line as a separate record" ) parser.add_argument( "--no-ftfy", action="store_true", help="Don't pass source text through ftfy.fix_text() (and don't replace unicode ellipses with '...')" ) parser.add_argument( "--nproc", type=int, default=0, help="the number of processes to use for multiprocess encoding (0=all CPUs, 1=disable multiprocessing)" ) parser.add_argument( "--format", type=str, default="tfrecord", help="""--format=tfrecord (the default) writes tokens as .tfrecord files; each document becomes a single tf.train.Example. --format=tok16 simply dumps uint16 tokens to disk; good for OpenAI GPT-2/GPT-3 tokenization (which is the default --encoder setting). --format=tok32 dumps int32 tokens to disk; suitable for advanced tokenization schemes that need to store negative-valued tokens or whose vocabulary is larger than 65535 elements.""" ) def is_integer(x): return np.can_cast(x, np.int32) def is_float(x): return np.can_cast(x, np.float32) def is_exact(x): return is_integer(x) or is_float(x) and x == int(x) def num(x, digits_after_decimal=2): if is_integer(x): spec = '{:,d}' else: spec = '{:,.%df}' % digits_after_decimal return spec.format(x) def local_parse_args(args): parser = argparse_flags.ArgumentParser() parse_args(args, parser) return parser.parse_args(args[1:]) def main(argv): global args args = argv txt_files = open(args.input).read().splitlines() if not txt_files: logging.error("no data files found") return os.makedirs(args.output, exist_ok=True) if tf.io.gfile.exists(args.encoder): enccfg = lm.config.load(args.encoder) encoder = lm.encoders.from_config(enccfg) else: encoder = lm.encoders.from_config(dict(kind="hf", location=args.encoder)) megabytes_per_tfrecord = int(args.size * 1e6) file_chunks = sizechunks( txt_files, megabytes_per_tfrecord ) # Assign files_per file to a tfrecord file each logging.info( "Got %d files, divided into %d chunks.", len(txt_files), len(file_chunks) ) def getdst(name, idx, total): filename_format = '%s-%05d-of-%05d' # standard tensorflow shard naming convention: https://www.tensorflow.org/api_docs/cc/class/tensorflow/ops/sharded-filename if args.format == "tfrecord": return os.path.join(args.output, (filename_format + ".tfrecord") % (name, idx, total)) elif args.format == "tok16": return os.path.join(args.output, (filename_format + ".tok16") % (name, idx, total)) elif args.format == "tok32": return os.path.join(args.output, (filename_format + ".tok32") % (name, idx, total)) else: raise ValueError("Unknown --format {}".format(args.format)) jobs = list( (encoder, chunks, getdst(args.name, idx, len(file_chunks)), args) for idx, chunks in enumerate(file_chunks) ) start = time.time() token_total, example_total = parallel(jobs, total=len(file_chunks)) end = time.time() elapsed = (end - start) tokens_per_second = token_total / elapsed tokens_per_file = token_total / len(jobs) logging.info( "finished in %ss: tokenized %d of %d files (%s tokens @ %s tokens/sec) into %d files (~%s tokens per file)", num(elapsed), example_total, len(txt_files), num(token_total), num(tokens_per_second), len(jobs), num(tokens_per_file), ) if __name__ == "__main__": app.run(main, flags_parser=parse_args)
src/lm/cli/encode.py
import os import time from glob import glob from multiprocessing import Pool, cpu_count import numpy as np import tensorflow as tf from absl import app, logging from absl.flags import argparse_flags from tqdm import auto as tqdm import lm.config import lm.encoders import lm.examples args = None def readlines_txt(src): with open(src) as fd: if not args.by_line: return [fd.read()] else: return fd.readlines() LINE_READER = { ".txt": readlines_txt, ".tsv": readlines_txt, } def readlines(src): _, ext = os.path.splitext(src) f = LINE_READER.get(ext, None) if f is None: logging.warning("no readlines for file %s", src) return return f(src) # Helper functions and classes def sizechunks(l, n): out = [] chunk = [] sz = 0 pbar = tqdm.tqdm(l) pbar.set_description("Measuring size...") for fpath in pbar: chunk.append(fpath) sz += tf.io.gfile.stat(fpath).length if sz >= n: out.append(chunk) sz = 0 chunk = [] if chunk: out.append(chunk) return out def parallel(src_dst_list, total): count = args.nproc or cpu_count() pool = Pool(processes=count) if count > 1 else None mapper = pool.imap if count > 1 else map if args.format == "tfrecord": transformer = lm.examples.transform_many_and_write_one_tfrecord elif args.format in ["tok16", "tok32"]: transformer = lm.examples.transform_many_and_write_one_tok16_or_tok32 else: raise ValueError("Unknown --format {}".format(args.format)) token_total = 0 example_total = 0 for token_count, example_count in tqdm.tqdm( mapper(transformer, src_dst_list), total=total, ): token_total += token_count example_total += example_count return token_total, example_total def parse_args(args, parser): parser.add_argument( "input", type=str, help="A file containing a list of filenames. Each file will become a single training example (unless --by_line is set).", ) parser.add_argument( "output", type=str, default="output", help="Where to write tfrecords" ) parser.add_argument( "--size", type=float, default=165.0, help="the size in MB of uncompressed text to add to each tfrecord file, default 165MB", ) parser.add_argument( "--name", type=str, default="dataset", help="prefix name for the output files." ) parser.add_argument( "--encoder", type=str, default="gpt2", help="Name or path of an encoder spec" ) parser.add_argument( "--by_line", action="store_true", help="encodes each line as a separate record" ) parser.add_argument( "--no-ftfy", action="store_true", help="Don't pass source text through ftfy.fix_text() (and don't replace unicode ellipses with '...')" ) parser.add_argument( "--nproc", type=int, default=0, help="the number of processes to use for multiprocess encoding (0=all CPUs, 1=disable multiprocessing)" ) parser.add_argument( "--format", type=str, default="tfrecord", help="""--format=tfrecord (the default) writes tokens as .tfrecord files; each document becomes a single tf.train.Example. --format=tok16 simply dumps uint16 tokens to disk; good for OpenAI GPT-2/GPT-3 tokenization (which is the default --encoder setting). --format=tok32 dumps int32 tokens to disk; suitable for advanced tokenization schemes that need to store negative-valued tokens or whose vocabulary is larger than 65535 elements.""" ) def is_integer(x): return np.can_cast(x, np.int32) def is_float(x): return np.can_cast(x, np.float32) def is_exact(x): return is_integer(x) or is_float(x) and x == int(x) def num(x, digits_after_decimal=2): if is_integer(x): spec = '{:,d}' else: spec = '{:,.%df}' % digits_after_decimal return spec.format(x) def local_parse_args(args): parser = argparse_flags.ArgumentParser() parse_args(args, parser) return parser.parse_args(args[1:]) def main(argv): global args args = argv txt_files = open(args.input).read().splitlines() if not txt_files: logging.error("no data files found") return os.makedirs(args.output, exist_ok=True) if tf.io.gfile.exists(args.encoder): enccfg = lm.config.load(args.encoder) encoder = lm.encoders.from_config(enccfg) else: encoder = lm.encoders.from_config(dict(kind="hf", location=args.encoder)) megabytes_per_tfrecord = int(args.size * 1e6) file_chunks = sizechunks( txt_files, megabytes_per_tfrecord ) # Assign files_per file to a tfrecord file each logging.info( "Got %d files, divided into %d chunks.", len(txt_files), len(file_chunks) ) def getdst(name, idx, total): filename_format = '%s-%05d-of-%05d' # standard tensorflow shard naming convention: https://www.tensorflow.org/api_docs/cc/class/tensorflow/ops/sharded-filename if args.format == "tfrecord": return os.path.join(args.output, (filename_format + ".tfrecord") % (name, idx, total)) elif args.format == "tok16": return os.path.join(args.output, (filename_format + ".tok16") % (name, idx, total)) elif args.format == "tok32": return os.path.join(args.output, (filename_format + ".tok32") % (name, idx, total)) else: raise ValueError("Unknown --format {}".format(args.format)) jobs = list( (encoder, chunks, getdst(args.name, idx, len(file_chunks)), args) for idx, chunks in enumerate(file_chunks) ) start = time.time() token_total, example_total = parallel(jobs, total=len(file_chunks)) end = time.time() elapsed = (end - start) tokens_per_second = token_total / elapsed tokens_per_file = token_total / len(jobs) logging.info( "finished in %ss: tokenized %d of %d files (%s tokens @ %s tokens/sec) into %d files (~%s tokens per file)", num(elapsed), example_total, len(txt_files), num(token_total), num(tokens_per_second), len(jobs), num(tokens_per_file), ) if __name__ == "__main__": app.run(main, flags_parser=parse_args)
0.522689
0.180215
import ddt from deuceclient.tests import * import httpretty from deucevalere import vault_validate from deucevalere.tests import * from deucevalere.tests.client_base import TestValereClientBase @ddt.ddt @httpretty.activate class TestConvenienceFunctionValidation(TestValereClientBase): def setUp(self): super().setUp() self.project_id = create_project_name() self.vault_id = create_vault_name() self.generate_blocks(count=20) self.generate_orphaned_blocks(count=10) self.secondary_setup(manager_start=None, manager_end=None) def tearDown(self): super().tearDown() @ddt.data(True, False) def test_vault_validate(self, value): def metadata_listing_callback(request, uri, headers): return self.metadata_block_listing_success(request, uri, headers) def metadata_head_callback(request, uri, headers): return self.metadata_block_head_success(request, uri, headers) def storage_listing_callback(request, uri, headers): return self.storage_block_listing_success(request, uri, headers) def storage_head_callback(request, uri, headers): return self.storage_block_head_success(request, uri, headers) url = get_blocks_url(self.apihost, self.vault.vault_id) httpretty.register_uri(httpretty.GET, url, body=metadata_listing_callback) httpretty.register_uri(httpretty.HEAD, self.get_metadata_block_pattern_matcher(), body=metadata_head_callback) surl = get_storage_blocks_url(self.apihost, self.vault.vault_id) httpretty.register_uri(httpretty.GET, surl, body=storage_listing_callback) httpretty.register_uri(httpretty.HEAD, self.get_storage_block_pattern_matcher(), body=storage_head_callback) self.assertEqual(vault_validate(self.deuce_client, self.vault, self.manager, head_storage_blocks=value), 0) def test_vault_validate_fail_metadata_block_list(self): def metadata_listing_callback(request, uri, headers): return (404, headers, 'mock failure') url = get_blocks_url(self.apihost, self.vault.vault_id) httpretty.register_uri(httpretty.GET, url, body=metadata_listing_callback) with self.assertRaises(RuntimeError): vault_validate(self.deuce_client, self.vault, self.manager) def test_vault_validate_fail_storage_block_list(self): def metadata_listing_callback(request, uri, headers): return self.metadata_block_listing_success(request, uri, headers) def metadata_head_callback(request, uri, headers): return self.metadata_block_head_success(request, uri, headers) def storage_listing_callback(request, uri, headers): return (404, headers, 'mock failure') url = get_blocks_url(self.apihost, self.vault.vault_id) httpretty.register_uri(httpretty.GET, url, body=metadata_listing_callback) httpretty.register_uri(httpretty.HEAD, self.get_metadata_block_pattern_matcher(), body=metadata_head_callback) surl = get_storage_blocks_url(self.apihost, self.vault.vault_id) httpretty.register_uri(httpretty.GET, surl, body=storage_listing_callback) with self.assertRaises(RuntimeError): vault_validate(self.deuce_client, self.vault, self.manager)
deucevalere/tests/test_convenience_functions_validation.py
import ddt from deuceclient.tests import * import httpretty from deucevalere import vault_validate from deucevalere.tests import * from deucevalere.tests.client_base import TestValereClientBase @ddt.ddt @httpretty.activate class TestConvenienceFunctionValidation(TestValereClientBase): def setUp(self): super().setUp() self.project_id = create_project_name() self.vault_id = create_vault_name() self.generate_blocks(count=20) self.generate_orphaned_blocks(count=10) self.secondary_setup(manager_start=None, manager_end=None) def tearDown(self): super().tearDown() @ddt.data(True, False) def test_vault_validate(self, value): def metadata_listing_callback(request, uri, headers): return self.metadata_block_listing_success(request, uri, headers) def metadata_head_callback(request, uri, headers): return self.metadata_block_head_success(request, uri, headers) def storage_listing_callback(request, uri, headers): return self.storage_block_listing_success(request, uri, headers) def storage_head_callback(request, uri, headers): return self.storage_block_head_success(request, uri, headers) url = get_blocks_url(self.apihost, self.vault.vault_id) httpretty.register_uri(httpretty.GET, url, body=metadata_listing_callback) httpretty.register_uri(httpretty.HEAD, self.get_metadata_block_pattern_matcher(), body=metadata_head_callback) surl = get_storage_blocks_url(self.apihost, self.vault.vault_id) httpretty.register_uri(httpretty.GET, surl, body=storage_listing_callback) httpretty.register_uri(httpretty.HEAD, self.get_storage_block_pattern_matcher(), body=storage_head_callback) self.assertEqual(vault_validate(self.deuce_client, self.vault, self.manager, head_storage_blocks=value), 0) def test_vault_validate_fail_metadata_block_list(self): def metadata_listing_callback(request, uri, headers): return (404, headers, 'mock failure') url = get_blocks_url(self.apihost, self.vault.vault_id) httpretty.register_uri(httpretty.GET, url, body=metadata_listing_callback) with self.assertRaises(RuntimeError): vault_validate(self.deuce_client, self.vault, self.manager) def test_vault_validate_fail_storage_block_list(self): def metadata_listing_callback(request, uri, headers): return self.metadata_block_listing_success(request, uri, headers) def metadata_head_callback(request, uri, headers): return self.metadata_block_head_success(request, uri, headers) def storage_listing_callback(request, uri, headers): return (404, headers, 'mock failure') url = get_blocks_url(self.apihost, self.vault.vault_id) httpretty.register_uri(httpretty.GET, url, body=metadata_listing_callback) httpretty.register_uri(httpretty.HEAD, self.get_metadata_block_pattern_matcher(), body=metadata_head_callback) surl = get_storage_blocks_url(self.apihost, self.vault.vault_id) httpretty.register_uri(httpretty.GET, surl, body=storage_listing_callback) with self.assertRaises(RuntimeError): vault_validate(self.deuce_client, self.vault, self.manager)
0.511961
0.117876
"""Process road data from OSM extracts and create road network topology """ import os from glob import glob import fiona import geopandas as gpd import pandas as pd from tqdm import tqdm tqdm.pandas() from utils import * def get_road_condition_surface(x): if not x.surface: if x.highway in ('motorway','motorway_link','trunk','trunk_link','primary','primary_link'): return 'paved','asphalt' else: return 'unpaved','gravel' elif x.surface == 'paved': return x.surface, 'asphalt' elif x.surface == 'unpaved': return x.surface, 'gravel' elif x.surface in ('asphalt','concrete'): return 'paved',x.surface else: return 'unpaved',x.surface def get_road_width(x,width,shoulder): if not x.lanes: if x.highway in ('motorway','motorway_link','trunk','trunk_link','primary','primary_link'): return 2.0*width + 2.0*shoulder else: return 1.0*width + 2.0*shoulder else: return float(x.lanes)*width + 2.0*shoulder def get_road_lanes(x): if not x.lanes: if x.highway in ('motorway','motorway_link','trunk','trunk_link','primary','primary_link'): return 2 else: return 1 else: return x.lanes def main(config): incoming_data_path = config['paths']['incoming_data'] data_path = config['paths']['data'] output_path = config['paths']['output'] scratch_path = config['paths']['scratch'] networks = os.path.join(scratch_path,'road') # Extract date string date="211101" width = 6.5 # Default carriageway width in meters shoulder = 1.5 # Extract rail features from .osm.pbf to .gpkg countries=[ "kenya", "tanzania", "uganda", "zambia" ] summary_path = os.path.join(output_path,'summary_stats') if os.path.exists(summary_path) == False: os.mkdir(summary_path) output_excel = os.path.join(summary_path, 'road_conditions_summary.xlsx', ) output_wrtr = pd.ExcelWriter(output_excel) for country in countries: # Read the geopackage file that was converted from osm.pdf edges = gpd.read_file(os.path.join(networks,f"{country}-road.gpkg"), layer = "lines") # From the geopackage file extract relevant roads highway_list = ['motorway','motorway_link', 'trunk','trunk_link', 'primary','primary_link', 'secondary','secondary_link', 'tertiary','tertiary_link'] edges = edges[edges.highway.isin(highway_list)] # Add attributes edges['surface_material'] = edges.progress_apply(lambda x:get_road_condition_surface(x),axis=1) edges[['road_cond','material']] = edges['surface_material'].apply(pd.Series) edges.drop('surface_material',axis=1,inplace=True) edges['width_m'] = edges.progress_apply(lambda x:get_road_width(x,width,shoulder),axis=1) edges['lanes'] = edges.progress_apply(lambda x:get_road_lanes(x),axis=1) edges['highway'] = edges.progress_apply(lambda x: x.highway.replace('_link',''),axis=1) processed_path = os.path.join(data_path,country,'networks') if os.path.exists(processed_path) == False: os.mkdir(processed_path) out_fname = os.path.join(data_path,country,"networks","road.gpkg") # Create network topology network = create_network_from_nodes_and_edges( None, edges, "road", out_fname, ) # Set projection systems find the actual road lengths in meters # Length may be invalid for a geographic CRS using degrees as units; must project geometries to a planar CRS # EPSG 32736 works for Burundi, Eswatini, Kenya, Malawi, Mozambique, Rwanda, South Africa, Tanzania, Uganda, Zambia, Zimbabwe # Use https://epsg.io/ to find for other areas network.edges = network.edges.set_crs(epsg=4326) network.nodes = network.nodes.set_crs(epsg=4326) network.edges = network.edges.to_crs(epsg=32736) network.nodes = network.nodes.to_crs(epsg=32736) network.edges['road_length_m'] = network.edges.progress_apply(lambda x:x.geometry.length,axis=1) # Store the final road network in geopackage in the processed_path network.edges.to_file(out_fname, layer='edges', driver='GPKG') network.nodes.to_file(out_fname, layer='nodes', driver='GPKG') # Generate summary statistics sum_network = network.edges.groupby(['highway','road_cond'])[['road_length_m']].sum().reset_index() print (sum_network) # length in m sum_network2 = (sum_network.set_index(['highway']).pivot( columns='road_cond' )['road_length_m'].div(1000).reset_index().rename_axis(None, axis=1)).fillna(0) print(sum_network2) # length converted to km sum_network2.to_excel(output_wrtr,country, index=False) output_wrtr.save() if __name__ == '__main__': CONFIG = load_config() main(CONFIG)
scripts/preprocess/road/process_road.py
"""Process road data from OSM extracts and create road network topology """ import os from glob import glob import fiona import geopandas as gpd import pandas as pd from tqdm import tqdm tqdm.pandas() from utils import * def get_road_condition_surface(x): if not x.surface: if x.highway in ('motorway','motorway_link','trunk','trunk_link','primary','primary_link'): return 'paved','asphalt' else: return 'unpaved','gravel' elif x.surface == 'paved': return x.surface, 'asphalt' elif x.surface == 'unpaved': return x.surface, 'gravel' elif x.surface in ('asphalt','concrete'): return 'paved',x.surface else: return 'unpaved',x.surface def get_road_width(x,width,shoulder): if not x.lanes: if x.highway in ('motorway','motorway_link','trunk','trunk_link','primary','primary_link'): return 2.0*width + 2.0*shoulder else: return 1.0*width + 2.0*shoulder else: return float(x.lanes)*width + 2.0*shoulder def get_road_lanes(x): if not x.lanes: if x.highway in ('motorway','motorway_link','trunk','trunk_link','primary','primary_link'): return 2 else: return 1 else: return x.lanes def main(config): incoming_data_path = config['paths']['incoming_data'] data_path = config['paths']['data'] output_path = config['paths']['output'] scratch_path = config['paths']['scratch'] networks = os.path.join(scratch_path,'road') # Extract date string date="211101" width = 6.5 # Default carriageway width in meters shoulder = 1.5 # Extract rail features from .osm.pbf to .gpkg countries=[ "kenya", "tanzania", "uganda", "zambia" ] summary_path = os.path.join(output_path,'summary_stats') if os.path.exists(summary_path) == False: os.mkdir(summary_path) output_excel = os.path.join(summary_path, 'road_conditions_summary.xlsx', ) output_wrtr = pd.ExcelWriter(output_excel) for country in countries: # Read the geopackage file that was converted from osm.pdf edges = gpd.read_file(os.path.join(networks,f"{country}-road.gpkg"), layer = "lines") # From the geopackage file extract relevant roads highway_list = ['motorway','motorway_link', 'trunk','trunk_link', 'primary','primary_link', 'secondary','secondary_link', 'tertiary','tertiary_link'] edges = edges[edges.highway.isin(highway_list)] # Add attributes edges['surface_material'] = edges.progress_apply(lambda x:get_road_condition_surface(x),axis=1) edges[['road_cond','material']] = edges['surface_material'].apply(pd.Series) edges.drop('surface_material',axis=1,inplace=True) edges['width_m'] = edges.progress_apply(lambda x:get_road_width(x,width,shoulder),axis=1) edges['lanes'] = edges.progress_apply(lambda x:get_road_lanes(x),axis=1) edges['highway'] = edges.progress_apply(lambda x: x.highway.replace('_link',''),axis=1) processed_path = os.path.join(data_path,country,'networks') if os.path.exists(processed_path) == False: os.mkdir(processed_path) out_fname = os.path.join(data_path,country,"networks","road.gpkg") # Create network topology network = create_network_from_nodes_and_edges( None, edges, "road", out_fname, ) # Set projection systems find the actual road lengths in meters # Length may be invalid for a geographic CRS using degrees as units; must project geometries to a planar CRS # EPSG 32736 works for Burundi, Eswatini, Kenya, Malawi, Mozambique, Rwanda, South Africa, Tanzania, Uganda, Zambia, Zimbabwe # Use https://epsg.io/ to find for other areas network.edges = network.edges.set_crs(epsg=4326) network.nodes = network.nodes.set_crs(epsg=4326) network.edges = network.edges.to_crs(epsg=32736) network.nodes = network.nodes.to_crs(epsg=32736) network.edges['road_length_m'] = network.edges.progress_apply(lambda x:x.geometry.length,axis=1) # Store the final road network in geopackage in the processed_path network.edges.to_file(out_fname, layer='edges', driver='GPKG') network.nodes.to_file(out_fname, layer='nodes', driver='GPKG') # Generate summary statistics sum_network = network.edges.groupby(['highway','road_cond'])[['road_length_m']].sum().reset_index() print (sum_network) # length in m sum_network2 = (sum_network.set_index(['highway']).pivot( columns='road_cond' )['road_length_m'].div(1000).reset_index().rename_axis(None, axis=1)).fillna(0) print(sum_network2) # length converted to km sum_network2.to_excel(output_wrtr,country, index=False) output_wrtr.save() if __name__ == '__main__': CONFIG = load_config() main(CONFIG)
0.422266
0.382286
import config import telebot import sqlite3 bot = telebot.TeleBot(config.token) user_markup = telebot.types.InlineKeyboardMarkup(row_width=2) first_button = telebot.types.InlineKeyboardButton(text="Магазин", callback_data="shop") second_button = telebot.types.InlineKeyboardButton(text="О нас", callback_data="about") third_button = telebot.types.InlineKeyboardButton(text="Профиль", callback_data="prof_users") fourth_button=telebot.types.InlineKeyboardButton(text="Корзина", callback_data="sale") user_markup.add( first_button, second_button,third_button,fourth_button ) backboard = telebot.types.InlineKeyboardMarkup( row_width=2 ) backbutton = telebot.types.InlineKeyboardButton( text="В меню", callback_data="mainmenu" ) menubutton = telebot.types.InlineKeyboardButton( text="Вернутся к категориям", callback_data="shop" ) backboard.add( backbutton, menubutton ) user_markup = telebot.types.InlineKeyboardMarkup( row_width=2 ) user_markup.add( first_button, second_button, third_button, fourth_button ) shopboard = telebot.types.InlineKeyboardMarkup( row_width=3 ) cat1 = telebot.types.InlineKeyboardButton( text="Формы", callback_data="category_form" ) cat2 = telebot.types.InlineKeyboardButton( text="Жидкий силикон", callback_data="category_silic" ) cat3 = telebot.types.InlineKeyboardButton( text="Краски", callback_data="category_kras" ) cat4 = telebot.types.InlineKeyboardButton( text="Блёстки", callback_data="category_bles" ) cat5 = telebot.types.InlineKeyboardButton( text="Шприцы", callback_data="category_shpritc" ) cat6 = telebot.types.InlineKeyboardButton( text="Аттрактанты", callback_data="category_att" ) cat7 = telebot.types.InlineKeyboardButton( text="Приманки", callback_data="category_sp" ) cat8 = telebot.types.InlineKeyboardButton( text="Лодки", callback_data="category_ship" ) cat9 = telebot.types.InlineKeyboardButton( text="Одежда", callback_data="category_odej" ) shopboard.add( cat1, cat2, cat3, cat4, cat5, cat6, cat7, cat8, cat9, backbutton ) adoutboard = telebot.types.InlineKeyboardMarkup( row_width=2 ) adoutboard.add( backbutton ) profboard = telebot.types.InlineKeyboardMarkup( row_width=2 ) profboard.add( backbutton ) saleboard = telebot.types.InlineKeyboardMarkup( row_width=2 ) saleboard.add( backbutton ) def regist(call): reg = [] def inputsurname(message): text = message.text reg.append( text ) msg = bot.send_message( message.chat.id, 'Введите Фамилию:' ) bot.register_next_step_handler( msg, inputphone ) def inputphone(message): text = message.text reg.append( text ) msg = bot.send_message( message.chat.id, 'Введите телефон:' ) bot.register_next_step_handler( msg, inputadress ) def inputadress(message): text = message.text reg.append( text ) msg = bot.send_message( message.chat.id, 'Введите адрес:' ) bot.register_next_step_handler( msg, allreg ) def allreg(message): text = message.text reg.append( text ) bot.send_message( message.chat.id, 'Регистрация завершена!' ) with sqlite3.connect( "picbd.db") as pic: cur = pic.cursor() cur.execute("INSERT INTO users (id, name, surname, phone, adress) VALUES (?, ?, ?, ?, ?)",(message.chat.id,reg[0],reg[1],reg[2],reg[3])) pic.commit() cur.close() bot.send_message( chat_id=call.message.chat.id, text="Выберите действие", reply_markup=backboard ) msg = bot.send_message(call.message.chat.id, 'Введите имя' ) bot.register_next_step_handler( msg, inputsurname) def sendphoto(bdname,call): media=[] with sqlite3.connect( "picbd.db" ) as pic: cur = pic.cursor() result = cur.execute( "SELECT price,path,name FROM "+bdname ).fetchall() pic.close() for i in result: media.append(telebot.types.InputMediaPhoto(open( i[1], "rb" ),"Цена: " + str( i[0] ) + " грн." + "\n" + "Название: " + i[2])) else: bot.send_media_group( call.message.chat.id, media ) def profile(bdname,call): with sqlite3.connect( "picbd.db" ) as pic: cur = pic.cursor() info = cur.execute("SELECT * FROM "+bdname+" WHERE id=?", (call.message.chat.id,)) if info.fetchone() is None: cur.close() regist(call) else: info = cur.execute( "SELECT * FROM users WHERE id=?", (call.message.chat.id,)) data=info.fetchone() cur.close() bot.send_message( call.message.chat.id,"Имя: "+data[1]+"\nФамилия: "+data[2]+"\nТелефон: "+data[3]+"\nАдрес доставки: "+data[4]) bot.send_message( chat_id=call.message.chat.id, text="Выберите действие", reply_markup=backboard ) @bot.message_handler(commands=["start"]) def start(commands): bot.send_message( commands.chat.id, "Выберите категорию ",reply_markup=user_markup ) @bot.callback_query_handler(func=lambda call:True) def callback_inline(call): if call.data == "mainmenu": bot.edit_message_text( chat_id=call.message.chat.id, message_id=call.message.message_id, text="Меню",reply_markup=user_markup ) if call.data == "shop": bot.edit_message_text( chat_id=call.message.chat.id, message_id=call.message.message_id, text="Выберите категорию",reply_markup=shopboard ) elif call.data=="about": bot.edit_message_text( chat_id=call.message.chat.id, message_id=call.message.message_id,text="Раздел 'О нас' в работе", reply_markup=adoutboard ) elif call.data == "sale": bot.edit_message_text( chat_id=call.message.chat.id, message_id=call.message.message_id,text="Раздел 'Корзина' в работе", reply_markup=saleboard ) if call.data.split("_")[0]=="category": sendphoto(call.data.split("_")[1],call) bot.send_message( chat_id=call.message.chat.id, text="Выберите действие", reply_markup=backboard ) if call.data.split("_")[0]=="prof": profile(call.data.split("_")[1],call) bot.infinity_polling()
main.py
import config import telebot import sqlite3 bot = telebot.TeleBot(config.token) user_markup = telebot.types.InlineKeyboardMarkup(row_width=2) first_button = telebot.types.InlineKeyboardButton(text="Магазин", callback_data="shop") second_button = telebot.types.InlineKeyboardButton(text="О нас", callback_data="about") third_button = telebot.types.InlineKeyboardButton(text="Профиль", callback_data="prof_users") fourth_button=telebot.types.InlineKeyboardButton(text="Корзина", callback_data="sale") user_markup.add( first_button, second_button,third_button,fourth_button ) backboard = telebot.types.InlineKeyboardMarkup( row_width=2 ) backbutton = telebot.types.InlineKeyboardButton( text="В меню", callback_data="mainmenu" ) menubutton = telebot.types.InlineKeyboardButton( text="Вернутся к категориям", callback_data="shop" ) backboard.add( backbutton, menubutton ) user_markup = telebot.types.InlineKeyboardMarkup( row_width=2 ) user_markup.add( first_button, second_button, third_button, fourth_button ) shopboard = telebot.types.InlineKeyboardMarkup( row_width=3 ) cat1 = telebot.types.InlineKeyboardButton( text="Формы", callback_data="category_form" ) cat2 = telebot.types.InlineKeyboardButton( text="Жидкий силикон", callback_data="category_silic" ) cat3 = telebot.types.InlineKeyboardButton( text="Краски", callback_data="category_kras" ) cat4 = telebot.types.InlineKeyboardButton( text="Блёстки", callback_data="category_bles" ) cat5 = telebot.types.InlineKeyboardButton( text="Шприцы", callback_data="category_shpritc" ) cat6 = telebot.types.InlineKeyboardButton( text="Аттрактанты", callback_data="category_att" ) cat7 = telebot.types.InlineKeyboardButton( text="Приманки", callback_data="category_sp" ) cat8 = telebot.types.InlineKeyboardButton( text="Лодки", callback_data="category_ship" ) cat9 = telebot.types.InlineKeyboardButton( text="Одежда", callback_data="category_odej" ) shopboard.add( cat1, cat2, cat3, cat4, cat5, cat6, cat7, cat8, cat9, backbutton ) adoutboard = telebot.types.InlineKeyboardMarkup( row_width=2 ) adoutboard.add( backbutton ) profboard = telebot.types.InlineKeyboardMarkup( row_width=2 ) profboard.add( backbutton ) saleboard = telebot.types.InlineKeyboardMarkup( row_width=2 ) saleboard.add( backbutton ) def regist(call): reg = [] def inputsurname(message): text = message.text reg.append( text ) msg = bot.send_message( message.chat.id, 'Введите Фамилию:' ) bot.register_next_step_handler( msg, inputphone ) def inputphone(message): text = message.text reg.append( text ) msg = bot.send_message( message.chat.id, 'Введите телефон:' ) bot.register_next_step_handler( msg, inputadress ) def inputadress(message): text = message.text reg.append( text ) msg = bot.send_message( message.chat.id, 'Введите адрес:' ) bot.register_next_step_handler( msg, allreg ) def allreg(message): text = message.text reg.append( text ) bot.send_message( message.chat.id, 'Регистрация завершена!' ) with sqlite3.connect( "picbd.db") as pic: cur = pic.cursor() cur.execute("INSERT INTO users (id, name, surname, phone, adress) VALUES (?, ?, ?, ?, ?)",(message.chat.id,reg[0],reg[1],reg[2],reg[3])) pic.commit() cur.close() bot.send_message( chat_id=call.message.chat.id, text="Выберите действие", reply_markup=backboard ) msg = bot.send_message(call.message.chat.id, 'Введите имя' ) bot.register_next_step_handler( msg, inputsurname) def sendphoto(bdname,call): media=[] with sqlite3.connect( "picbd.db" ) as pic: cur = pic.cursor() result = cur.execute( "SELECT price,path,name FROM "+bdname ).fetchall() pic.close() for i in result: media.append(telebot.types.InputMediaPhoto(open( i[1], "rb" ),"Цена: " + str( i[0] ) + " грн." + "\n" + "Название: " + i[2])) else: bot.send_media_group( call.message.chat.id, media ) def profile(bdname,call): with sqlite3.connect( "picbd.db" ) as pic: cur = pic.cursor() info = cur.execute("SELECT * FROM "+bdname+" WHERE id=?", (call.message.chat.id,)) if info.fetchone() is None: cur.close() regist(call) else: info = cur.execute( "SELECT * FROM users WHERE id=?", (call.message.chat.id,)) data=info.fetchone() cur.close() bot.send_message( call.message.chat.id,"Имя: "+data[1]+"\nФамилия: "+data[2]+"\nТелефон: "+data[3]+"\nАдрес доставки: "+data[4]) bot.send_message( chat_id=call.message.chat.id, text="Выберите действие", reply_markup=backboard ) @bot.message_handler(commands=["start"]) def start(commands): bot.send_message( commands.chat.id, "Выберите категорию ",reply_markup=user_markup ) @bot.callback_query_handler(func=lambda call:True) def callback_inline(call): if call.data == "mainmenu": bot.edit_message_text( chat_id=call.message.chat.id, message_id=call.message.message_id, text="Меню",reply_markup=user_markup ) if call.data == "shop": bot.edit_message_text( chat_id=call.message.chat.id, message_id=call.message.message_id, text="Выберите категорию",reply_markup=shopboard ) elif call.data=="about": bot.edit_message_text( chat_id=call.message.chat.id, message_id=call.message.message_id,text="Раздел 'О нас' в работе", reply_markup=adoutboard ) elif call.data == "sale": bot.edit_message_text( chat_id=call.message.chat.id, message_id=call.message.message_id,text="Раздел 'Корзина' в работе", reply_markup=saleboard ) if call.data.split("_")[0]=="category": sendphoto(call.data.split("_")[1],call) bot.send_message( chat_id=call.message.chat.id, text="Выберите действие", reply_markup=backboard ) if call.data.split("_")[0]=="prof": profile(call.data.split("_")[1],call) bot.infinity_polling()
0.063956
0.093719
import logging from numbers import Real import pandas as pd from pandas.testing import assert_series_equal import pytest import toml from incognita.data import ons_pd from incognita.logger import logger from incognita.utility import config from incognita.utility import deciles from incognita.utility import root from incognita.utility.timing import time_function ons_postcode_directory_stub = ons_pd.ONSPostcodeDirectory( fields=set(), index_column="", data_types={}, PUBLICATION_DATE="", IMD_MAX={"England": 32844, "Wales": 1909, "Scotland": 6976, "Northern Ireland": 890}, COUNTRY_CODES={"E92000001": "England", "W92000004": "Wales", "S92000003": "Scotland", "N92000002": "Northern Ireland"}, ) def add(number1: Real, number2: Real) -> Real: return number1 + number2 def test_calc_imd_decile(): data = {"row_1": [1, "E92000001", 32844], "row_2": [2, "W92000004", 1]} frame = pd.DataFrame.from_dict(data, orient="index", columns=["id", "ctry", "imd"]) imd_decile_data: pd.Series = deciles.calc_imd_decile(frame["imd"], frame["ctry"], ons_postcode_directory_stub) predicted_result = pd.Series(data=[10, 1], index=["row_1", "row_2"]) assert isinstance(imd_decile_data, pd.Series) assert_series_equal(imd_decile_data, predicted_result, check_dtype=False) def test_settings_are_accurate(): with open(root.PROJECT_ROOT.joinpath("incognita-config.toml"), "r") as read_file: settings = toml.load(read_file) assert config._SETTINGS_TOML == settings def test_settings_model_is_accurate(): with open(root.PROJECT_ROOT.joinpath("incognita-config.toml"), "r") as read_file: settings = toml.load(read_file) assert config.SETTINGS == config._create_settings(settings) class ExampleClassLogger: @time_function def add(self, number1: Real, number2: Real) -> Real: logger.info("Example Function") return number1 + number2 def test_time_function_wraps_function(): assert time_function(add)(2, 2) == add(2, 2) def test_time_function_raises_exception_on_non_method_arguments(): with pytest.raises(ValueError): time_function("not a function or method") # NoQA def test_time_function_logger_output(caplog: pytest.LogCaptureFixture): caplog.set_level(logging.INFO) ExampleClassLogger().add(2, 2) assert "Calling function add" in caplog.text assert "add took 0.0" in caplog.text
tests/test_utility.py
import logging from numbers import Real import pandas as pd from pandas.testing import assert_series_equal import pytest import toml from incognita.data import ons_pd from incognita.logger import logger from incognita.utility import config from incognita.utility import deciles from incognita.utility import root from incognita.utility.timing import time_function ons_postcode_directory_stub = ons_pd.ONSPostcodeDirectory( fields=set(), index_column="", data_types={}, PUBLICATION_DATE="", IMD_MAX={"England": 32844, "Wales": 1909, "Scotland": 6976, "Northern Ireland": 890}, COUNTRY_CODES={"E92000001": "England", "W92000004": "Wales", "S92000003": "Scotland", "N92000002": "Northern Ireland"}, ) def add(number1: Real, number2: Real) -> Real: return number1 + number2 def test_calc_imd_decile(): data = {"row_1": [1, "E92000001", 32844], "row_2": [2, "W92000004", 1]} frame = pd.DataFrame.from_dict(data, orient="index", columns=["id", "ctry", "imd"]) imd_decile_data: pd.Series = deciles.calc_imd_decile(frame["imd"], frame["ctry"], ons_postcode_directory_stub) predicted_result = pd.Series(data=[10, 1], index=["row_1", "row_2"]) assert isinstance(imd_decile_data, pd.Series) assert_series_equal(imd_decile_data, predicted_result, check_dtype=False) def test_settings_are_accurate(): with open(root.PROJECT_ROOT.joinpath("incognita-config.toml"), "r") as read_file: settings = toml.load(read_file) assert config._SETTINGS_TOML == settings def test_settings_model_is_accurate(): with open(root.PROJECT_ROOT.joinpath("incognita-config.toml"), "r") as read_file: settings = toml.load(read_file) assert config.SETTINGS == config._create_settings(settings) class ExampleClassLogger: @time_function def add(self, number1: Real, number2: Real) -> Real: logger.info("Example Function") return number1 + number2 def test_time_function_wraps_function(): assert time_function(add)(2, 2) == add(2, 2) def test_time_function_raises_exception_on_non_method_arguments(): with pytest.raises(ValueError): time_function("not a function or method") # NoQA def test_time_function_logger_output(caplog: pytest.LogCaptureFixture): caplog.set_level(logging.INFO) ExampleClassLogger().add(2, 2) assert "Calling function add" in caplog.text assert "add took 0.0" in caplog.text
0.65368
0.445288
import os import time import torch import random import argparse from tqdm import tqdm from scorer import Scorer from data_utils import load_data from sagan_trainer import SAGAN_Trainer from torchvision.utils import save_image from torch.utils.tensorboard import SummaryWriter class Instructor: def __init__(self, args): self.args = args self._print_args() def _print_args(self): print('TRAINING ARGUMENTS:') for arg in vars(self.args): print(f">>> {arg}: {getattr(self.args, arg)}") def train_sagan(self): print('=> creating model...') trainer = SAGAN_Trainer(args) writer = SummaryWriter() print('=> creating scorer...') scorer = Scorer(device=args.device, resize=True) print('=> loading data...') dataloader = load_data(im_size=self.args.im_size, batch_size=self.args.batch_size, workers=self.args.num_workers, dataset=self.args.dataset, data_path=os.path.join(self.args.data_dir, self.args.dataset)) data_iter = iter(dataloader) model_save_step = int(self.args.model_save_step * len(dataloader)) fixed_z = torch.randn(self.args.batch_size, self.args.z_dim).to(self.args.device) real_images, _ = next(data_iter) real_images = (real_images * 0.5 + 0.5).clamp(0, 1) writer.add_images('real', real_images, 0) save_image(real_images, os.path.join(self.args.sample_dir, self.args.timestamp, 'real.png')) all_preds = list() for inputs, _ in tqdm(dataloader): inputs = inputs.to(self.args.device) * 0.5 + 0.5 all_preds.append(scorer.get_preds(inputs)) score, _ = scorer.compute_score(torch.cat(all_preds, dim=0), splits=10) print(f"real inception score: {score:.4f}") best_score = 0 for step in range(self.args.total_step): ''' train sagan model ''' trainer.D.train() trainer.G.train() try: real_images, _ = next(data_iter) except: data_iter = iter(dataloader) real_images, _ = next(data_iter) real_images = real_images.to(self.args.device) d_loss_real, d_loss_fake, g_loss_fake = trainer.train(real_images) ''' print info ''' if (step + 1) % self.args.log_step == 0: print(f"step: {step + 1}/{self.args.total_step}, g_loss_fake: {g_loss_fake:.4f}") writer.add_scalar('Loss/D_real', d_loss_real, step + 1) writer.add_scalar('Loss/D_fake', d_loss_fake, step + 1) writer.add_scalar('Loss/G_fake', g_loss_fake, step + 1) writer.add_scalar('Score/G_attn1', trainer.G.attn1.gamma.mean().item(), step + 1) writer.add_scalar('Score/D_attn1', trainer.D.attn1.gamma.mean().item(), step + 1) ''' compute inception score ''' if (step + 1) % self.args.eval_step == 0: trainer.G.eval() all_preds = list() for i in tqdm(range(self.args.sample_num)): z = torch.randn(self.args.batch_size, self.args.z_dim).to(self.args.device) inputs = trainer.G(z) * 0.5 + 0.5 all_preds.append(scorer.get_preds(inputs)) score, _ = scorer.compute_score(torch.cat(all_preds, dim=0), splits=10) best_score = score if score > best_score else best_score print(f"fake inception score: {score:.4f}") writer.add_scalar('Score/IS_fake', score, step + 1) ''' sample image ''' if (step + 1) % self.args.sample_step == 0: trainer.G.eval() fake_images = trainer.G(fixed_z) fake_images = (fake_images * 0.5 + 0.5).clamp(0, 1) writer.add_images('fake', fake_images, step + 1) save_image(fake_images, os.path.join(self.args.sample_dir, self.args.timestamp, f"fake_{step + 1}.png")) ''' save model ''' if (step + 1) % model_save_step == 0: torch.save(trainer.G.state_dict(), os.path.join(self.args.save_dir, self.args.timestamp, f"{step + 1}_G.pt")) torch.save(trainer.D.state_dict(), os.path.join(self.args.save_dir, self.args.timestamp, f"{step + 1}_D.pt")) writer.close() print(f"best inception score: {best_score:.4f}") if __name__ == '__main__': parser = argparse.ArgumentParser() ''' dataset ''' parser.add_argument('--dataset', type=str, default='cifar10', choices=['cifar10']) parser.add_argument('--data_dir', type=str, default='data') parser.add_argument('--sample_dir', type=str, default='sample') parser.add_argument('--save_dir', type=str, default='saves') parser.add_argument('--num_workers', type=int, default=16) ''' model ''' parser.add_argument('--im_size', type=int, default=32) parser.add_argument('--z_dim', type=int, default=128) parser.add_argument('--g_conv_dim', type=int, default=64) parser.add_argument('--d_conv_dim', type=int, default=64) ''' optimization ''' parser.add_argument('--total_step', type=int, default=200000) parser.add_argument('--batch_size', type=int, default=64) parser.add_argument('--g_lr', type=float, default=0.0001) parser.add_argument('--d_lr', type=float, default=0.0004) parser.add_argument('--beta1', type=float, default=0.0) parser.add_argument('--beta2', type=float, default=0.9) parser.add_argument('--lambda_gp', type=float, default=10) parser.add_argument('--adv_loss', type=str, default='wgan-gp', choices=['hinge', 'wgan-gp']) ''' environment''' parser.add_argument('--device', type=str, default=None, choices=['cpu', 'cuda']) parser.add_argument('--parallel', default=False, action='store_true') parser.add_argument('--log_step', type=int, default=20) parser.add_argument('--sample_step', type=int, default=200) parser.add_argument('--eval_step', type=int, default=500) parser.add_argument('--model_save_step', type=int, default=10) parser.add_argument('--sample_num', type=int, default=100) parser.add_argument('--timestamp', type=str, default=None) args = parser.parse_args() args.timestamp = args.timestamp if args.timestamp else str(int(time.time())) + format(random.randint(0, 999), '03') args.device = torch.device(args.device) if args.device else torch.device('cuda' if torch.cuda.is_available() else 'cpu') torch.backends.cudnn.benchmark = True for dir_name in [args.data_dir, args.sample_dir, args.save_dir]: if not os.path.exists(dir_name): os.mkdir(dir_name) os.mkdir(os.path.join(args.sample_dir, args.timestamp)) os.mkdir(os.path.join(args.save_dir, args.timestamp)) os.environ['TF_CPP_MIN_LOG_LEVEL'] = '3' ins = Instructor(args) ins.train_sagan()
main.py
import os import time import torch import random import argparse from tqdm import tqdm from scorer import Scorer from data_utils import load_data from sagan_trainer import SAGAN_Trainer from torchvision.utils import save_image from torch.utils.tensorboard import SummaryWriter class Instructor: def __init__(self, args): self.args = args self._print_args() def _print_args(self): print('TRAINING ARGUMENTS:') for arg in vars(self.args): print(f">>> {arg}: {getattr(self.args, arg)}") def train_sagan(self): print('=> creating model...') trainer = SAGAN_Trainer(args) writer = SummaryWriter() print('=> creating scorer...') scorer = Scorer(device=args.device, resize=True) print('=> loading data...') dataloader = load_data(im_size=self.args.im_size, batch_size=self.args.batch_size, workers=self.args.num_workers, dataset=self.args.dataset, data_path=os.path.join(self.args.data_dir, self.args.dataset)) data_iter = iter(dataloader) model_save_step = int(self.args.model_save_step * len(dataloader)) fixed_z = torch.randn(self.args.batch_size, self.args.z_dim).to(self.args.device) real_images, _ = next(data_iter) real_images = (real_images * 0.5 + 0.5).clamp(0, 1) writer.add_images('real', real_images, 0) save_image(real_images, os.path.join(self.args.sample_dir, self.args.timestamp, 'real.png')) all_preds = list() for inputs, _ in tqdm(dataloader): inputs = inputs.to(self.args.device) * 0.5 + 0.5 all_preds.append(scorer.get_preds(inputs)) score, _ = scorer.compute_score(torch.cat(all_preds, dim=0), splits=10) print(f"real inception score: {score:.4f}") best_score = 0 for step in range(self.args.total_step): ''' train sagan model ''' trainer.D.train() trainer.G.train() try: real_images, _ = next(data_iter) except: data_iter = iter(dataloader) real_images, _ = next(data_iter) real_images = real_images.to(self.args.device) d_loss_real, d_loss_fake, g_loss_fake = trainer.train(real_images) ''' print info ''' if (step + 1) % self.args.log_step == 0: print(f"step: {step + 1}/{self.args.total_step}, g_loss_fake: {g_loss_fake:.4f}") writer.add_scalar('Loss/D_real', d_loss_real, step + 1) writer.add_scalar('Loss/D_fake', d_loss_fake, step + 1) writer.add_scalar('Loss/G_fake', g_loss_fake, step + 1) writer.add_scalar('Score/G_attn1', trainer.G.attn1.gamma.mean().item(), step + 1) writer.add_scalar('Score/D_attn1', trainer.D.attn1.gamma.mean().item(), step + 1) ''' compute inception score ''' if (step + 1) % self.args.eval_step == 0: trainer.G.eval() all_preds = list() for i in tqdm(range(self.args.sample_num)): z = torch.randn(self.args.batch_size, self.args.z_dim).to(self.args.device) inputs = trainer.G(z) * 0.5 + 0.5 all_preds.append(scorer.get_preds(inputs)) score, _ = scorer.compute_score(torch.cat(all_preds, dim=0), splits=10) best_score = score if score > best_score else best_score print(f"fake inception score: {score:.4f}") writer.add_scalar('Score/IS_fake', score, step + 1) ''' sample image ''' if (step + 1) % self.args.sample_step == 0: trainer.G.eval() fake_images = trainer.G(fixed_z) fake_images = (fake_images * 0.5 + 0.5).clamp(0, 1) writer.add_images('fake', fake_images, step + 1) save_image(fake_images, os.path.join(self.args.sample_dir, self.args.timestamp, f"fake_{step + 1}.png")) ''' save model ''' if (step + 1) % model_save_step == 0: torch.save(trainer.G.state_dict(), os.path.join(self.args.save_dir, self.args.timestamp, f"{step + 1}_G.pt")) torch.save(trainer.D.state_dict(), os.path.join(self.args.save_dir, self.args.timestamp, f"{step + 1}_D.pt")) writer.close() print(f"best inception score: {best_score:.4f}") if __name__ == '__main__': parser = argparse.ArgumentParser() ''' dataset ''' parser.add_argument('--dataset', type=str, default='cifar10', choices=['cifar10']) parser.add_argument('--data_dir', type=str, default='data') parser.add_argument('--sample_dir', type=str, default='sample') parser.add_argument('--save_dir', type=str, default='saves') parser.add_argument('--num_workers', type=int, default=16) ''' model ''' parser.add_argument('--im_size', type=int, default=32) parser.add_argument('--z_dim', type=int, default=128) parser.add_argument('--g_conv_dim', type=int, default=64) parser.add_argument('--d_conv_dim', type=int, default=64) ''' optimization ''' parser.add_argument('--total_step', type=int, default=200000) parser.add_argument('--batch_size', type=int, default=64) parser.add_argument('--g_lr', type=float, default=0.0001) parser.add_argument('--d_lr', type=float, default=0.0004) parser.add_argument('--beta1', type=float, default=0.0) parser.add_argument('--beta2', type=float, default=0.9) parser.add_argument('--lambda_gp', type=float, default=10) parser.add_argument('--adv_loss', type=str, default='wgan-gp', choices=['hinge', 'wgan-gp']) ''' environment''' parser.add_argument('--device', type=str, default=None, choices=['cpu', 'cuda']) parser.add_argument('--parallel', default=False, action='store_true') parser.add_argument('--log_step', type=int, default=20) parser.add_argument('--sample_step', type=int, default=200) parser.add_argument('--eval_step', type=int, default=500) parser.add_argument('--model_save_step', type=int, default=10) parser.add_argument('--sample_num', type=int, default=100) parser.add_argument('--timestamp', type=str, default=None) args = parser.parse_args() args.timestamp = args.timestamp if args.timestamp else str(int(time.time())) + format(random.randint(0, 999), '03') args.device = torch.device(args.device) if args.device else torch.device('cuda' if torch.cuda.is_available() else 'cpu') torch.backends.cudnn.benchmark = True for dir_name in [args.data_dir, args.sample_dir, args.save_dir]: if not os.path.exists(dir_name): os.mkdir(dir_name) os.mkdir(os.path.join(args.sample_dir, args.timestamp)) os.mkdir(os.path.join(args.save_dir, args.timestamp)) os.environ['TF_CPP_MIN_LOG_LEVEL'] = '3' ins = Instructor(args) ins.train_sagan()
0.586523
0.138928
from rest_framework import serializers from .models import * from rest_framework_simplejwt.tokens import RefreshToken from django.contrib.auth import authenticate from django.contrib.auth.models import update_last_login class UserProfileSerializer(serializers.HyperlinkedModelSerializer): class Meta: model = UserProfile fields = ('id','email','first_name','last_name','age','gender','state','city','mobile') extra_kwargs = { 'password': { 'write_only': True, 'style': {'input_type': 'password'} } } class RailwayPassengerSerializer(serializers.ModelSerializer): class Meta: model = RailwayPassenger fields = ('pnr','user','user_id','route_id','train_id','seat_amount') class AuthUserRegistrationSerializer(serializers.ModelSerializer): class Meta: model = UserProfile fields = ('id','email','password','first_name','last_name','age','gender','state','city','mobile') def create(self, validated_data): auth_user = UserProfile.objects.create_user(**validated_data) return auth_user class AuthUserLoginSerializer(serializers.Serializer): email = serializers.EmailField() password = serializers.CharField(max_length=128, write_only=True) access = serializers.CharField(read_only=True) refresh = serializers.CharField(read_only=True) role = serializers.CharField(read_only=True) def create(self, validated_date): pass def update(self, instance, validated_data): pass def validate(self, data): email = data['email'] password = data['password'] user = authenticate(username=email, password=password) if user is None: raise serializers.ValidationError("No user exist with this email") if not user.is_active: raise serializers.ValidationError( 'This user has been deactivated.' ) refresh = RefreshToken.for_user(user) refresh_token = str(refresh) access_token = str(refresh.access_token) update_last_login(None, user) validation = { 'access': access_token, 'refresh': refresh_token, 'email': user.email, 'full_name': user.get_name(), 'role': user.role, } return validation
railway_api/serializers.py
from rest_framework import serializers from .models import * from rest_framework_simplejwt.tokens import RefreshToken from django.contrib.auth import authenticate from django.contrib.auth.models import update_last_login class UserProfileSerializer(serializers.HyperlinkedModelSerializer): class Meta: model = UserProfile fields = ('id','email','first_name','last_name','age','gender','state','city','mobile') extra_kwargs = { 'password': { 'write_only': True, 'style': {'input_type': 'password'} } } class RailwayPassengerSerializer(serializers.ModelSerializer): class Meta: model = RailwayPassenger fields = ('pnr','user','user_id','route_id','train_id','seat_amount') class AuthUserRegistrationSerializer(serializers.ModelSerializer): class Meta: model = UserProfile fields = ('id','email','password','first_name','last_name','age','gender','state','city','mobile') def create(self, validated_data): auth_user = UserProfile.objects.create_user(**validated_data) return auth_user class AuthUserLoginSerializer(serializers.Serializer): email = serializers.EmailField() password = serializers.CharField(max_length=128, write_only=True) access = serializers.CharField(read_only=True) refresh = serializers.CharField(read_only=True) role = serializers.CharField(read_only=True) def create(self, validated_date): pass def update(self, instance, validated_data): pass def validate(self, data): email = data['email'] password = data['password'] user = authenticate(username=email, password=password) if user is None: raise serializers.ValidationError("No user exist with this email") if not user.is_active: raise serializers.ValidationError( 'This user has been deactivated.' ) refresh = RefreshToken.for_user(user) refresh_token = str(refresh) access_token = str(refresh.access_token) update_last_login(None, user) validation = { 'access': access_token, 'refresh': refresh_token, 'email': user.email, 'full_name': user.get_name(), 'role': user.role, } return validation
0.529507
0.079603
' Argument parser ' import argparse import pathlib from . import( constants, custom_types ) def valid_percent(value): ' Validate percentage values ' percent = float(value) if 0 < percent <= 100: return percent raise argparse.ArgumentTypeError(f'{value} must be within 1 and 100') def quoted_choices(choices): ' Return a string of quoted choices ' return ', '.join([f"'{choice}'" for choice in choices]) def str_to_bool(value): ' Validate boolean arguments ' token = value.lower() true_values = ['t', 'true', '1'] if token in true_values: return True false_values = ['f', 'false', '0'] if token in false_values: return False choices = quoted_choices(true_values + false_values) raise argparse.ArgumentTypeError(f"invalid choice '{value}' (choose from {choices})") def get_arguments(): ' Parse command line arguments ' parser = argparse.ArgumentParser( prog=__package__, formatter_class=argparse.ArgumentDefaultsHelpFormatter ) parser.add_argument( 'ffprobe_file_path', type=pathlib.Path, help='Path to the ffprobe binary', ) parser.add_argument( 'ffmpeg_file_path', type=pathlib.Path, help='Path to the ffmpeg binary', ) parser.add_argument( 'input_folder_path', type=pathlib.Path, help='Path to the video folder containing timestamped folders', ) parser.add_argument( 'output_folder_path', type=pathlib.Path, help='Path to the output folder containing both merged files and the temporary work folder', ) parser.add_argument( '--codec', default='hevc_nvenc', help='Codec to use for encoding', choices=constants.CODEC_OPTIONS.keys(), ) preset_token = '--preset' parser.add_argument( preset_token, default='slow', help='Codec\'s preset to use for encoding. See ffmpeg -h long for each codec\'s available presets', ) parser.add_argument( '--reduce', default=constants.DONT_REDUCE, help='Percent to reduce video to', type=valid_percent, ) parser.add_argument( '--layout', default='pyramid', help='Camera layout', choices=constants.LAYOUT_OFFSETS.keys(), ) parser.add_argument( '--keep_temp_folder', default=False, help='Keep temporary working folder after extraction', type=str_to_bool, ) parser.add_argument( '--log_level', default='info', help=( 'Display log messages that matches or exceeds the severity ' f'of the specified level. Use "{constants.DISABLE_LOGGING}" ' 'to disable messages' ), choices=constants.LOG_LEVELS.keys() ) args = parser.parse_args() presets = constants.CODEC_OPTIONS[args.codec][0] if args.preset not in presets: choices = quoted_choices(presets) parser.error( f"argument {preset_token}: invalid choice: '{args.preset}' (choose from {choices})" ) return ( constants.LOG_LEVELS[args.log_level], ( custom_types.FFMpegPaths( args.ffprobe_file_path, args.ffmpeg_file_path, ), custom_types.LayoutOptions( args.codec, args.preset, args.layout, args.reduce, ), custom_types.BaseFolderPaths( args.input_folder_path, args.output_folder_path, ), args.keep_temp_folder, ) )
teslacam/arg_parser.py
' Argument parser ' import argparse import pathlib from . import( constants, custom_types ) def valid_percent(value): ' Validate percentage values ' percent = float(value) if 0 < percent <= 100: return percent raise argparse.ArgumentTypeError(f'{value} must be within 1 and 100') def quoted_choices(choices): ' Return a string of quoted choices ' return ', '.join([f"'{choice}'" for choice in choices]) def str_to_bool(value): ' Validate boolean arguments ' token = value.lower() true_values = ['t', 'true', '1'] if token in true_values: return True false_values = ['f', 'false', '0'] if token in false_values: return False choices = quoted_choices(true_values + false_values) raise argparse.ArgumentTypeError(f"invalid choice '{value}' (choose from {choices})") def get_arguments(): ' Parse command line arguments ' parser = argparse.ArgumentParser( prog=__package__, formatter_class=argparse.ArgumentDefaultsHelpFormatter ) parser.add_argument( 'ffprobe_file_path', type=pathlib.Path, help='Path to the ffprobe binary', ) parser.add_argument( 'ffmpeg_file_path', type=pathlib.Path, help='Path to the ffmpeg binary', ) parser.add_argument( 'input_folder_path', type=pathlib.Path, help='Path to the video folder containing timestamped folders', ) parser.add_argument( 'output_folder_path', type=pathlib.Path, help='Path to the output folder containing both merged files and the temporary work folder', ) parser.add_argument( '--codec', default='hevc_nvenc', help='Codec to use for encoding', choices=constants.CODEC_OPTIONS.keys(), ) preset_token = '--preset' parser.add_argument( preset_token, default='slow', help='Codec\'s preset to use for encoding. See ffmpeg -h long for each codec\'s available presets', ) parser.add_argument( '--reduce', default=constants.DONT_REDUCE, help='Percent to reduce video to', type=valid_percent, ) parser.add_argument( '--layout', default='pyramid', help='Camera layout', choices=constants.LAYOUT_OFFSETS.keys(), ) parser.add_argument( '--keep_temp_folder', default=False, help='Keep temporary working folder after extraction', type=str_to_bool, ) parser.add_argument( '--log_level', default='info', help=( 'Display log messages that matches or exceeds the severity ' f'of the specified level. Use "{constants.DISABLE_LOGGING}" ' 'to disable messages' ), choices=constants.LOG_LEVELS.keys() ) args = parser.parse_args() presets = constants.CODEC_OPTIONS[args.codec][0] if args.preset not in presets: choices = quoted_choices(presets) parser.error( f"argument {preset_token}: invalid choice: '{args.preset}' (choose from {choices})" ) return ( constants.LOG_LEVELS[args.log_level], ( custom_types.FFMpegPaths( args.ffprobe_file_path, args.ffmpeg_file_path, ), custom_types.LayoutOptions( args.codec, args.preset, args.layout, args.reduce, ), custom_types.BaseFolderPaths( args.input_folder_path, args.output_folder_path, ), args.keep_temp_folder, ) )
0.685423
0.285154
import torch from torch.utils.data import Dataset, DataLoader from torchvision import transforms, utils import scipy.misc import torch import torch.nn as nn from torch.autograd import Variable import torch import torch.optim as optim import torchvision import numpy as np import torch.utils.data as data_utils import torch.nn.functional as F from data_utils import * # lr_scheduler() manages the learning rate according to given condition def lr_scheduler(optimizer, init_lr, epoch): for param_group in optimizer.param_groups: if epoch == 150 or epoch == 225: param_group['lr']=param_group['lr']/10 if epoch == 0: param_group['lr']=init_lr print('Current learning rate is {}'.format(param_group['lr'])) return optimizer def train_model(cnn,optimizer_s,lrate,num_epochs,train_loader,test_loader,dataset_train_len,dataset_test_len, plotsFileName, csvFileName): epochs= [] train_acc=[] test_acc=[] train_loss=[] test_loss = [] train_error=[] test_error =[] for epoch in range(num_epochs): cnn.train() epochs.append(epoch) optimizer = lr_scheduler(optimizer_s, lrate, epoch) print('Epoch {}/{}'.format(epoch+1, num_epochs)) print('*' * 70) running_loss = 0.0 running_corrects = 0.0 train_batch_ctr = 0.0 for i, (image, label) in enumerate(train_loader): image,label = Variable(image.cuda(),requires_grad=True),Variable(label.cuda(),requires_grad=False) optimizer.zero_grad() outputs = cnn(image) _, preds = torch.max(outputs.data, 1) loss = F.nll_loss(outputs, label) loss.backward() optimizer.step() train_batch_ctr = train_batch_ctr + 1 running_loss += loss.data[0] running_corrects += torch.sum(preds == label.data) epoch_acc = running_corrects / (dataset_train_len) print ('Train corrects: {} Train samples: {} Train accuracy: {}' .format( running_corrects, (dataset_train_len),epoch_acc)) train_acc.append(epoch_acc) train_loss.append(running_loss / train_batch_ctr) train_error.append(((dataset_train_len)-running_corrects) / (dataset_train_len)) cnn.eval() test_running_corrects = 0.0 test_batch_ctr = 0.0 test_running_loss = 0.0 test_total = 0.0 for image, label in test_loader: image, label = Variable(image.cuda(),volatile=True), Variable(label.cuda()) test_outputs = cnn(image) _, predicted_test = torch.max(test_outputs.data, 1) loss = F.nll_loss(test_outputs, label) test_running_loss += loss.data[0] test_batch_ctr = test_batch_ctr+1 test_running_corrects += torch.sum(predicted_test == label.data) test_epoch_acc = test_running_corrects / (dataset_test_len) test_acc.append(test_epoch_acc) test_loss.append(test_running_loss / test_batch_ctr) test_error.append(((dataset_test_len)-test_running_corrects) / (dataset_test_len)) print('Test corrects: {} Test samples: {} Test accuracy {}' .format(test_running_corrects,(dataset_test_len),test_epoch_acc)) print('Train loss: {} Test loss: {}' .format(train_loss[epoch],test_loss[epoch])) print('Train error: {} Test error {}' .format(train_error[epoch],test_error[epoch])) print('*' * 70) plots(epochs, train_acc, test_acc, train_loss, test_loss,train_error,test_error,plotsFileName) write_csv(csvFileName, train_acc,test_acc,train_loss,test_loss,train_error,test_error,epoch) ''' plots() and write_csv() are defined in data_utils.py. plots() updates the training plots with each epoch and write_csv() updates training log with each epoch. '''
train_utils.py
import torch from torch.utils.data import Dataset, DataLoader from torchvision import transforms, utils import scipy.misc import torch import torch.nn as nn from torch.autograd import Variable import torch import torch.optim as optim import torchvision import numpy as np import torch.utils.data as data_utils import torch.nn.functional as F from data_utils import * # lr_scheduler() manages the learning rate according to given condition def lr_scheduler(optimizer, init_lr, epoch): for param_group in optimizer.param_groups: if epoch == 150 or epoch == 225: param_group['lr']=param_group['lr']/10 if epoch == 0: param_group['lr']=init_lr print('Current learning rate is {}'.format(param_group['lr'])) return optimizer def train_model(cnn,optimizer_s,lrate,num_epochs,train_loader,test_loader,dataset_train_len,dataset_test_len, plotsFileName, csvFileName): epochs= [] train_acc=[] test_acc=[] train_loss=[] test_loss = [] train_error=[] test_error =[] for epoch in range(num_epochs): cnn.train() epochs.append(epoch) optimizer = lr_scheduler(optimizer_s, lrate, epoch) print('Epoch {}/{}'.format(epoch+1, num_epochs)) print('*' * 70) running_loss = 0.0 running_corrects = 0.0 train_batch_ctr = 0.0 for i, (image, label) in enumerate(train_loader): image,label = Variable(image.cuda(),requires_grad=True),Variable(label.cuda(),requires_grad=False) optimizer.zero_grad() outputs = cnn(image) _, preds = torch.max(outputs.data, 1) loss = F.nll_loss(outputs, label) loss.backward() optimizer.step() train_batch_ctr = train_batch_ctr + 1 running_loss += loss.data[0] running_corrects += torch.sum(preds == label.data) epoch_acc = running_corrects / (dataset_train_len) print ('Train corrects: {} Train samples: {} Train accuracy: {}' .format( running_corrects, (dataset_train_len),epoch_acc)) train_acc.append(epoch_acc) train_loss.append(running_loss / train_batch_ctr) train_error.append(((dataset_train_len)-running_corrects) / (dataset_train_len)) cnn.eval() test_running_corrects = 0.0 test_batch_ctr = 0.0 test_running_loss = 0.0 test_total = 0.0 for image, label in test_loader: image, label = Variable(image.cuda(),volatile=True), Variable(label.cuda()) test_outputs = cnn(image) _, predicted_test = torch.max(test_outputs.data, 1) loss = F.nll_loss(test_outputs, label) test_running_loss += loss.data[0] test_batch_ctr = test_batch_ctr+1 test_running_corrects += torch.sum(predicted_test == label.data) test_epoch_acc = test_running_corrects / (dataset_test_len) test_acc.append(test_epoch_acc) test_loss.append(test_running_loss / test_batch_ctr) test_error.append(((dataset_test_len)-test_running_corrects) / (dataset_test_len)) print('Test corrects: {} Test samples: {} Test accuracy {}' .format(test_running_corrects,(dataset_test_len),test_epoch_acc)) print('Train loss: {} Test loss: {}' .format(train_loss[epoch],test_loss[epoch])) print('Train error: {} Test error {}' .format(train_error[epoch],test_error[epoch])) print('*' * 70) plots(epochs, train_acc, test_acc, train_loss, test_loss,train_error,test_error,plotsFileName) write_csv(csvFileName, train_acc,test_acc,train_loss,test_loss,train_error,test_error,epoch) ''' plots() and write_csv() are defined in data_utils.py. plots() updates the training plots with each epoch and write_csv() updates training log with each epoch. '''
0.723016
0.550849
# Este script toma un archivo CSV y lo geolocaliza, es decir crea un nuevo archivo _geo.csv con columnas lat y long. # Utiliza el API de Google Maps # Instrucciones en como obtener la API Key para Google Maps: https://github.com/slawek87/geolocation-python from geolocation.main import GoogleMaps from geolocation.distance_matrix.client import DistanceMatrixApiClient import os import argparse import csv import sys import logging import time ## SAVE THE FILE TO A GEOJSON # the template. where data from the csv will be formatted to geojson template = \ ''' \ { "type" : "Feature", "geometry" : { "type" : "Point", "coordinates" : [%s, %s]}, "properties" : %s }, ''' ## GEOLOCALIZATION # get address to geolocalize # geolocalize # save it in file_geo.csv # environment variables: # GOOGLE_MAPS_API_KEY # COUNTRY # arguments: # COLUMN NAMES def convert_row(row): properties = {} for i in row: if i != 'lng' or i != 'lat': properties[i] = row[i] return template % (row['lng'], row['lat'], properties) def get_environment_variables(): if not os.environ.has_key('COUNTRY') or not os.environ.has_key('GOOGLE_MAPS_API_KEY'): sys.exit('Variables de ambiente COUNTRY o GOOGLE_MAPS_API_KEY no estan definidas.') # look for environment variables return {'country': os.environ['COUNTRY'], 'api_key': os.environ['GOOGLE_MAPS_API_KEY']} def get_address(row, fields, country): address = ', '.join(map(lambda x: row[x], fields.split(','))) + ', ' + country return address def main(): logging_file = 'geolocation_%s.log' % time.strftime("%H_%M_%S") logging.basicConfig(filename=logging_file,level=logging.DEBUG) parser = argparse.ArgumentParser(description='Geolocalizer un archivo CSV.') parser.add_argument('--csv', help='nombre del archivo CSV a geolocalizar') parser.add_argument('--columnas', help='las columnas (en orden) de la dirección') args = parser.parse_args() # get file name and column names from arguments csv_file = args.csv new_csv_file = '_'.join([csv_file.split('.')[0], 'geo.csv']) new_geojson_file = '_'.join([csv_file.split('.')[0], '.geojson']) # get the columns names where the address is fields = args.columnas # get api key and country from environment variables env_variables = get_environment_variables() # get an instance of google maps google_maps = GoogleMaps(api_key=env_variables['api_key']) # the head of the geojson file output = \ ''' \ { "type" : "Feature Collection", "features" : [ ''' with open(csv_file, 'rb') as csvfile: reader = csv.DictReader(csvfile) fieldnames = reader.fieldnames fieldnames.append('lat') fieldnames.append('lng') with open(new_csv_file, 'wb') as newcsvfile: writer = csv.DictWriter(newcsvfile, fieldnames=fieldnames) for row in reader: address = get_address(row, fields, env_variables['country']) try: location = google_maps.search(location=address) # sends search to Google Maps. my_location = location.first() # returns only first location. if my_location != None: row['lat'] = my_location.lat row['lng'] = my_location.lng writer.writerow(row) except: e = sys.exc_info()[0] logging.warning("<p>LOG: no pudo encontrar la dirección: '%s' . Error: %s</p>", address, e) output += convert_row(row) # convert new file into a geojson file # the tail of the geojson file output += \ ''' \ ] } ''' # opens an geoJSON file to write the output to outFileHandle = open(new_geojson_file, "w") outFileHandle.write(output) outFileHandle.close() if __name__ == '__main__': main()
code/geolocalize.py
# Este script toma un archivo CSV y lo geolocaliza, es decir crea un nuevo archivo _geo.csv con columnas lat y long. # Utiliza el API de Google Maps # Instrucciones en como obtener la API Key para Google Maps: https://github.com/slawek87/geolocation-python from geolocation.main import GoogleMaps from geolocation.distance_matrix.client import DistanceMatrixApiClient import os import argparse import csv import sys import logging import time ## SAVE THE FILE TO A GEOJSON # the template. where data from the csv will be formatted to geojson template = \ ''' \ { "type" : "Feature", "geometry" : { "type" : "Point", "coordinates" : [%s, %s]}, "properties" : %s }, ''' ## GEOLOCALIZATION # get address to geolocalize # geolocalize # save it in file_geo.csv # environment variables: # GOOGLE_MAPS_API_KEY # COUNTRY # arguments: # COLUMN NAMES def convert_row(row): properties = {} for i in row: if i != 'lng' or i != 'lat': properties[i] = row[i] return template % (row['lng'], row['lat'], properties) def get_environment_variables(): if not os.environ.has_key('COUNTRY') or not os.environ.has_key('GOOGLE_MAPS_API_KEY'): sys.exit('Variables de ambiente COUNTRY o GOOGLE_MAPS_API_KEY no estan definidas.') # look for environment variables return {'country': os.environ['COUNTRY'], 'api_key': os.environ['GOOGLE_MAPS_API_KEY']} def get_address(row, fields, country): address = ', '.join(map(lambda x: row[x], fields.split(','))) + ', ' + country return address def main(): logging_file = 'geolocation_%s.log' % time.strftime("%H_%M_%S") logging.basicConfig(filename=logging_file,level=logging.DEBUG) parser = argparse.ArgumentParser(description='Geolocalizer un archivo CSV.') parser.add_argument('--csv', help='nombre del archivo CSV a geolocalizar') parser.add_argument('--columnas', help='las columnas (en orden) de la dirección') args = parser.parse_args() # get file name and column names from arguments csv_file = args.csv new_csv_file = '_'.join([csv_file.split('.')[0], 'geo.csv']) new_geojson_file = '_'.join([csv_file.split('.')[0], '.geojson']) # get the columns names where the address is fields = args.columnas # get api key and country from environment variables env_variables = get_environment_variables() # get an instance of google maps google_maps = GoogleMaps(api_key=env_variables['api_key']) # the head of the geojson file output = \ ''' \ { "type" : "Feature Collection", "features" : [ ''' with open(csv_file, 'rb') as csvfile: reader = csv.DictReader(csvfile) fieldnames = reader.fieldnames fieldnames.append('lat') fieldnames.append('lng') with open(new_csv_file, 'wb') as newcsvfile: writer = csv.DictWriter(newcsvfile, fieldnames=fieldnames) for row in reader: address = get_address(row, fields, env_variables['country']) try: location = google_maps.search(location=address) # sends search to Google Maps. my_location = location.first() # returns only first location. if my_location != None: row['lat'] = my_location.lat row['lng'] = my_location.lng writer.writerow(row) except: e = sys.exc_info()[0] logging.warning("<p>LOG: no pudo encontrar la dirección: '%s' . Error: %s</p>", address, e) output += convert_row(row) # convert new file into a geojson file # the tail of the geojson file output += \ ''' \ ] } ''' # opens an geoJSON file to write the output to outFileHandle = open(new_geojson_file, "w") outFileHandle.write(output) outFileHandle.close() if __name__ == '__main__': main()
0.338296
0.477067
# FIXME IMPORT! import random import math import copy import time import socket import pickle from RULEngine.Util.Pose import Pose from RULEngine.Util.Position import Position from RULEngine.Util.constant import POSITION_DEADZONE from ai.Algorithm.IntelligentModule import Pathfinder from ai.Debug.debug_interface import COLOR_ID_MAP, DEFAULT_PATH_TIMEOUT OBSTACLE_DEAD_ZONE = 700 TIME_TO_UPDATE = 1 class PathfinderRRT(Pathfinder): """ La classe hérite de IntelligentModule pour définir sa propriété state. L'interface expose une méthode qui force le calcul de toutes les trajectoires. Celles-ci sont enregistrés par effet de bords dans le GameState. Une méthode permet de récupérer la trajectoire d'un robot spécifique. """ def __init__(self, p_worldstate): """ Constructeur, appel le constructeur de la classe mère pour assigner la référence sur l'InfoManager. :param info_manager: référence sur l'InfoManager """ super().__init__(p_worldstate) self.paths = {} for i in range(6): self.paths[i] = [] self.last_timestamp = self.ws.game_state.get_timestamp() # Pour être conforme à la nouvelle interface à être changé # éventuellement mgl 2016/12/23 # TODO(mgl): change this please! def get_next_point(self, robot_id=None): pass def update(self): pass def draw_path(self, path, pid=0): points = [] for path_element in path: x = path_element.position.x y = path_element.position.y points.append((x,y)) self.debug_interface.add_multiple_points(points, COLOR_ID_MAP[pid], width=5, link="path - " + str(pid), timeout=DEFAULT_PATH_TIMEOUT) def get_path(self, pid=None, target=None): """ Retourne la trajectoire du robot. :param pid: Identifiant du robot, 0 à 5. :return: Une liste de Pose, [Pose] """ assert(isinstance(pid, int)), "Un pid doit être passé" assert(isinstance(target, Pose)), "La cible doit être une Pose" return self._compute_path(pid, target) def _compute_path(self, pid, target): """ Cette méthode calcul la trajectoire pour un robot. :param pid: L'identifiant du robot, 0 à 5. :return: None """ # TODO mettre les buts dans les obstacles list_of_pid = list(range(6)) list_of_other_team_pid = list(range(6)) list_of_pid.remove(pid) obstacleList = [] for other_pid in list_of_pid: # TODO info manager changer get_player_position position = self.ws.game_state.get_player_pose(other_pid).position obstacleList.append([position.x, position.y, OBSTACLE_DEAD_ZONE]) initial_position_of_main_player = self.ws.game_state.get_player_pose(pid).position for pid in list_of_other_team_pid: position = self.ws.game_state.get_player_pose(pid,False).position obstacleList.append([position.x, position.y, OBSTACLE_DEAD_ZONE]) target_position_of_player = target.position target_orientation_of_player = target.orientation assert(isinstance(target_position_of_player, Position)), "La cible du joueur doit être une Position" try : target_position_of_player.x target_position_of_player.y except AttributeError: target_position_of_player = self.ws.game_state.get_player_pose(pid).position rrt = RRT(start=[initial_position_of_main_player.x, initial_position_of_main_player.y], goal=[target_position_of_player.x, target_position_of_player.y], obstacleList=obstacleList, # TODO Vérifier si le robot peut sortir du terrain rand_area=[-4500, 4500], expand_dis=get_expand_dis([initial_position_of_main_player.x, initial_position_of_main_player.y], [target_position_of_player.x, target_position_of_player.y]), goal_sample_rate=get_goal_sample_rate([initial_position_of_main_player.x, initial_position_of_main_player.y], [target_position_of_player.x, target_position_of_player.y])) not_smoothed_path = rrt.planning(obstacleList) # Path smoothing maxIter = 100 # Il faut inverser la liste du chemin lissé tout en retirant le point de départ smoothed_path = path_smoothing(not_smoothed_path, maxIter, obstacleList) smoothed_path = list(reversed(smoothed_path[:-1])) return self._smoothed_path_to_pose_list(smoothed_path, target_orientation_of_player) def _smoothed_path_to_pose_list(self, smoothed_path, target_orientation): smoothed_poses = [] for point in smoothed_path: smoothed_poses.append(Pose(Position(point[0], point[1]), target_orientation)) return smoothed_poses class RRT(): """ Classe principale du pathfinder, contient les fonctions principales permettant de générer le path. """ def __init__(self, start, goal, obstacleList, rand_area, expand_dis, goal_sample_rate, max_iteration=50): """ Setting Parameter start: Position de départ [x,y] goal: Destination [x,y] obstacleList: Position et taille des obstacles [[x,y,size],...] randArea: Ramdom Samping Area [min,max] expand_dis : Longueur des arêtes goal_sample_rate : Probabilité d'obtenir directement le goal comme position. Améliore la vitesse du RRT max_iteration : Nombre d'itération du path smoother """ self.start = Node(start[0], start[1]) self.end = Node(goal[0], goal[1]) self.minrand = rand_area[0] self.maxrand = rand_area[1] self.expand_dis = expand_dis self.goal_sample_rate = goal_sample_rate self.max_iteration = max_iteration def planning(self, obstacleList): """Fonction qui s'occupe de faire le path""" initial_time = time.time() self.node_list = [self.start] #TODO changer le gros hack degueux pour la gestion de la loop infinie while True and time.time()-initial_time < TIME_TO_UPDATE: # Random Sampling if random.randint(0, 100) > self.goal_sample_rate: random_coordinates = [random.uniform(self.minrand, self.maxrand), random.uniform(self.minrand, self.maxrand)] else: random_coordinates = [self.end.x, self.end.y] # Find nearest node nind = self.get_nearest_list_index(self.node_list, random_coordinates) # print(nind) # expand tree nearest_node = self.node_list[nind] theta = math.atan2(random_coordinates[1] - nearest_node.y, random_coordinates[0] - nearest_node.x) new_node = copy.deepcopy(nearest_node) new_node.x += self.expand_dis * math.cos(theta) new_node.y += self.expand_dis * math.sin(theta) new_node.parent = nind if not self.__collision_check(new_node, obstacleList): continue self.node_list.append(new_node) # check goal dx = new_node.x - self.end.x dy = new_node.y - self.end.y d = math.sqrt(dx * dx + dy * dy) if d <= self.expand_dis: break path = [[self.end.x, self.end.y]] last_index = len(self.node_list) - 1 while self.node_list[last_index].parent is not None: node = self.node_list[last_index] path.append([node.x, node.y]) last_index = node.parent path.append([self.start.x, self.start.y]) # TODO fix gros hack sale if time.time()-initial_time >=1 : path = [[self.start.x, self.start.y],[self.start.x, self.start.y]] return path def get_nearest_list_index(self, node_list, rnd): dlist = [(node.x - rnd[0]) ** 2 + (node.y - rnd[1]) ** 2 for node in node_list] minind = dlist.index(min(dlist)) return minind def __collision_check(self, node, obstacleList): """ Permet de vérifier si le chemin passe à travers un obstacle""" for (ox, oy, size) in obstacleList: dx = ox - node.x dy = oy - node.y d = math.sqrt(dx * dx + dy * dy) if d <= size: return False # collision return True # safe class Node(): """ RRT Node """ def __init__(self, x, y): self.x = x self.y = y self.parent = None def get_expand_dis(start, goal): """Modifie la distance entre 2 noeuds selon la distance entre le départ et le but. Utile pour la précision et les performances.""" try : dx = goal[0]-start[0] dy = goal[1]-start[1] d = math.sqrt(dx * dx + dy * dy) # TODO voir comment on regle ça except TypeError: d = 0 if d < 600 : expand_dis = d/2 else : expand_dis = 300 return expand_dis def get_goal_sample_rate(start, goal): """Modifie la probabilité d'obtenir directement le but comme point selon la distance entre le départ et le but. Utile pour la précision et les performances.""" try : dx = goal[0]-start[0] dy = goal[1]-start[1] d = math.sqrt(dx * dx + dy * dy) except TypeError: goal_sample_rate = 5 return goal_sample_rate if d < 600 : goal_sample_rate = (10-d/140)**2 else : goal_sample_rate = 30 return goal_sample_rate def get_path_length(path): """Donne la longueur du trajet""" path_length = 0 try : for i in range(len(path) - 1): dx = path[i + 1][0] - path[i][0] dy = path[i + 1][1] - path[i][1] d = math.sqrt(dx * dx + dy * dy) path_length += d except TypeError: pass return path_length def get_target_point(path, targetL): l = 0 ti = 0 last_pair_len = 0 for i in range(len(path) - 1): dx = path[i + 1][0] - path[i][0] dy = path[i + 1][1] - path[i][1] d = math.sqrt(dx * dx + dy * dy) l += d if l >= targetL: ti = i-1 last_pair_len = d break try : partRatio = (l - targetL) / last_pair_len except ZeroDivisionError: partRatio = 0 # print(partRatio) # print((ti,len(path),path[ti],path[ti+1])) x = path[ti][0] + (path[ti + 1][0] - path[ti][0]) * partRatio y = path[ti][1] + (path[ti + 1][1] - path[ti][1]) * partRatio # print((x,y)) return [x, y, ti] def line_collision_check(first, second, obstacleList): """ Vérifie si la ligne entre 2 noeuds entre en collision avec un obstacle. """ # Line Equation x1 = first[0] y1 = first[1] x2 = second[0] y2 = second[1] try: a = y2-y1 b = -(x2-x1) c = y2 * (x2-x1) - x2 * (y2-y1) except ZeroDivisionError: return False # print(first) # print(second) for (ox, oy, size) in obstacleList: d = abs(a*ox+b*oy+c)/(math.sqrt(a*a+b*b)) # print((ox,oy,size,d)) if d <= (size): # print("NG") return False # print("OK") return True # OK def path_smoothing(path, maxIter, obstacleList): # Elle ralentit légèrement le tout, voir si améliorable """Permet de rendre le trajet obtenu avec le RRT plus lisse""" # print("PathSmoothing") path_length = get_path_length(path) for i in range(maxIter): # Sample two points pick_points = [random.uniform(0, path_length), random.uniform(0, path_length)] pick_points.sort() # print(pick_points) first = get_target_point(path, pick_points[0]) # print(first) second = get_target_point(path, pick_points[1]) # print(second) if first[2] <= 0 or second[2] <= 0: continue if (second[2]+1) > len(path): continue if second[2] == first[2]: continue # collision check if not line_collision_check(first, second, obstacleList): continue #Create New path new_path = [] new_path.extend(path[:first[2]+1]) new_path.append([first[0], first[1]]) new_path.append([second[0], second[1]]) new_path.extend(path[second[2]+1:]) path = new_path path_length = get_path_length(path) return path # taille terrain = 9000 x 6000
ai/Algorithm/PathfinderRRT.py
# FIXME IMPORT! import random import math import copy import time import socket import pickle from RULEngine.Util.Pose import Pose from RULEngine.Util.Position import Position from RULEngine.Util.constant import POSITION_DEADZONE from ai.Algorithm.IntelligentModule import Pathfinder from ai.Debug.debug_interface import COLOR_ID_MAP, DEFAULT_PATH_TIMEOUT OBSTACLE_DEAD_ZONE = 700 TIME_TO_UPDATE = 1 class PathfinderRRT(Pathfinder): """ La classe hérite de IntelligentModule pour définir sa propriété state. L'interface expose une méthode qui force le calcul de toutes les trajectoires. Celles-ci sont enregistrés par effet de bords dans le GameState. Une méthode permet de récupérer la trajectoire d'un robot spécifique. """ def __init__(self, p_worldstate): """ Constructeur, appel le constructeur de la classe mère pour assigner la référence sur l'InfoManager. :param info_manager: référence sur l'InfoManager """ super().__init__(p_worldstate) self.paths = {} for i in range(6): self.paths[i] = [] self.last_timestamp = self.ws.game_state.get_timestamp() # Pour être conforme à la nouvelle interface à être changé # éventuellement mgl 2016/12/23 # TODO(mgl): change this please! def get_next_point(self, robot_id=None): pass def update(self): pass def draw_path(self, path, pid=0): points = [] for path_element in path: x = path_element.position.x y = path_element.position.y points.append((x,y)) self.debug_interface.add_multiple_points(points, COLOR_ID_MAP[pid], width=5, link="path - " + str(pid), timeout=DEFAULT_PATH_TIMEOUT) def get_path(self, pid=None, target=None): """ Retourne la trajectoire du robot. :param pid: Identifiant du robot, 0 à 5. :return: Une liste de Pose, [Pose] """ assert(isinstance(pid, int)), "Un pid doit être passé" assert(isinstance(target, Pose)), "La cible doit être une Pose" return self._compute_path(pid, target) def _compute_path(self, pid, target): """ Cette méthode calcul la trajectoire pour un robot. :param pid: L'identifiant du robot, 0 à 5. :return: None """ # TODO mettre les buts dans les obstacles list_of_pid = list(range(6)) list_of_other_team_pid = list(range(6)) list_of_pid.remove(pid) obstacleList = [] for other_pid in list_of_pid: # TODO info manager changer get_player_position position = self.ws.game_state.get_player_pose(other_pid).position obstacleList.append([position.x, position.y, OBSTACLE_DEAD_ZONE]) initial_position_of_main_player = self.ws.game_state.get_player_pose(pid).position for pid in list_of_other_team_pid: position = self.ws.game_state.get_player_pose(pid,False).position obstacleList.append([position.x, position.y, OBSTACLE_DEAD_ZONE]) target_position_of_player = target.position target_orientation_of_player = target.orientation assert(isinstance(target_position_of_player, Position)), "La cible du joueur doit être une Position" try : target_position_of_player.x target_position_of_player.y except AttributeError: target_position_of_player = self.ws.game_state.get_player_pose(pid).position rrt = RRT(start=[initial_position_of_main_player.x, initial_position_of_main_player.y], goal=[target_position_of_player.x, target_position_of_player.y], obstacleList=obstacleList, # TODO Vérifier si le robot peut sortir du terrain rand_area=[-4500, 4500], expand_dis=get_expand_dis([initial_position_of_main_player.x, initial_position_of_main_player.y], [target_position_of_player.x, target_position_of_player.y]), goal_sample_rate=get_goal_sample_rate([initial_position_of_main_player.x, initial_position_of_main_player.y], [target_position_of_player.x, target_position_of_player.y])) not_smoothed_path = rrt.planning(obstacleList) # Path smoothing maxIter = 100 # Il faut inverser la liste du chemin lissé tout en retirant le point de départ smoothed_path = path_smoothing(not_smoothed_path, maxIter, obstacleList) smoothed_path = list(reversed(smoothed_path[:-1])) return self._smoothed_path_to_pose_list(smoothed_path, target_orientation_of_player) def _smoothed_path_to_pose_list(self, smoothed_path, target_orientation): smoothed_poses = [] for point in smoothed_path: smoothed_poses.append(Pose(Position(point[0], point[1]), target_orientation)) return smoothed_poses class RRT(): """ Classe principale du pathfinder, contient les fonctions principales permettant de générer le path. """ def __init__(self, start, goal, obstacleList, rand_area, expand_dis, goal_sample_rate, max_iteration=50): """ Setting Parameter start: Position de départ [x,y] goal: Destination [x,y] obstacleList: Position et taille des obstacles [[x,y,size],...] randArea: Ramdom Samping Area [min,max] expand_dis : Longueur des arêtes goal_sample_rate : Probabilité d'obtenir directement le goal comme position. Améliore la vitesse du RRT max_iteration : Nombre d'itération du path smoother """ self.start = Node(start[0], start[1]) self.end = Node(goal[0], goal[1]) self.minrand = rand_area[0] self.maxrand = rand_area[1] self.expand_dis = expand_dis self.goal_sample_rate = goal_sample_rate self.max_iteration = max_iteration def planning(self, obstacleList): """Fonction qui s'occupe de faire le path""" initial_time = time.time() self.node_list = [self.start] #TODO changer le gros hack degueux pour la gestion de la loop infinie while True and time.time()-initial_time < TIME_TO_UPDATE: # Random Sampling if random.randint(0, 100) > self.goal_sample_rate: random_coordinates = [random.uniform(self.minrand, self.maxrand), random.uniform(self.minrand, self.maxrand)] else: random_coordinates = [self.end.x, self.end.y] # Find nearest node nind = self.get_nearest_list_index(self.node_list, random_coordinates) # print(nind) # expand tree nearest_node = self.node_list[nind] theta = math.atan2(random_coordinates[1] - nearest_node.y, random_coordinates[0] - nearest_node.x) new_node = copy.deepcopy(nearest_node) new_node.x += self.expand_dis * math.cos(theta) new_node.y += self.expand_dis * math.sin(theta) new_node.parent = nind if not self.__collision_check(new_node, obstacleList): continue self.node_list.append(new_node) # check goal dx = new_node.x - self.end.x dy = new_node.y - self.end.y d = math.sqrt(dx * dx + dy * dy) if d <= self.expand_dis: break path = [[self.end.x, self.end.y]] last_index = len(self.node_list) - 1 while self.node_list[last_index].parent is not None: node = self.node_list[last_index] path.append([node.x, node.y]) last_index = node.parent path.append([self.start.x, self.start.y]) # TODO fix gros hack sale if time.time()-initial_time >=1 : path = [[self.start.x, self.start.y],[self.start.x, self.start.y]] return path def get_nearest_list_index(self, node_list, rnd): dlist = [(node.x - rnd[0]) ** 2 + (node.y - rnd[1]) ** 2 for node in node_list] minind = dlist.index(min(dlist)) return minind def __collision_check(self, node, obstacleList): """ Permet de vérifier si le chemin passe à travers un obstacle""" for (ox, oy, size) in obstacleList: dx = ox - node.x dy = oy - node.y d = math.sqrt(dx * dx + dy * dy) if d <= size: return False # collision return True # safe class Node(): """ RRT Node """ def __init__(self, x, y): self.x = x self.y = y self.parent = None def get_expand_dis(start, goal): """Modifie la distance entre 2 noeuds selon la distance entre le départ et le but. Utile pour la précision et les performances.""" try : dx = goal[0]-start[0] dy = goal[1]-start[1] d = math.sqrt(dx * dx + dy * dy) # TODO voir comment on regle ça except TypeError: d = 0 if d < 600 : expand_dis = d/2 else : expand_dis = 300 return expand_dis def get_goal_sample_rate(start, goal): """Modifie la probabilité d'obtenir directement le but comme point selon la distance entre le départ et le but. Utile pour la précision et les performances.""" try : dx = goal[0]-start[0] dy = goal[1]-start[1] d = math.sqrt(dx * dx + dy * dy) except TypeError: goal_sample_rate = 5 return goal_sample_rate if d < 600 : goal_sample_rate = (10-d/140)**2 else : goal_sample_rate = 30 return goal_sample_rate def get_path_length(path): """Donne la longueur du trajet""" path_length = 0 try : for i in range(len(path) - 1): dx = path[i + 1][0] - path[i][0] dy = path[i + 1][1] - path[i][1] d = math.sqrt(dx * dx + dy * dy) path_length += d except TypeError: pass return path_length def get_target_point(path, targetL): l = 0 ti = 0 last_pair_len = 0 for i in range(len(path) - 1): dx = path[i + 1][0] - path[i][0] dy = path[i + 1][1] - path[i][1] d = math.sqrt(dx * dx + dy * dy) l += d if l >= targetL: ti = i-1 last_pair_len = d break try : partRatio = (l - targetL) / last_pair_len except ZeroDivisionError: partRatio = 0 # print(partRatio) # print((ti,len(path),path[ti],path[ti+1])) x = path[ti][0] + (path[ti + 1][0] - path[ti][0]) * partRatio y = path[ti][1] + (path[ti + 1][1] - path[ti][1]) * partRatio # print((x,y)) return [x, y, ti] def line_collision_check(first, second, obstacleList): """ Vérifie si la ligne entre 2 noeuds entre en collision avec un obstacle. """ # Line Equation x1 = first[0] y1 = first[1] x2 = second[0] y2 = second[1] try: a = y2-y1 b = -(x2-x1) c = y2 * (x2-x1) - x2 * (y2-y1) except ZeroDivisionError: return False # print(first) # print(second) for (ox, oy, size) in obstacleList: d = abs(a*ox+b*oy+c)/(math.sqrt(a*a+b*b)) # print((ox,oy,size,d)) if d <= (size): # print("NG") return False # print("OK") return True # OK def path_smoothing(path, maxIter, obstacleList): # Elle ralentit légèrement le tout, voir si améliorable """Permet de rendre le trajet obtenu avec le RRT plus lisse""" # print("PathSmoothing") path_length = get_path_length(path) for i in range(maxIter): # Sample two points pick_points = [random.uniform(0, path_length), random.uniform(0, path_length)] pick_points.sort() # print(pick_points) first = get_target_point(path, pick_points[0]) # print(first) second = get_target_point(path, pick_points[1]) # print(second) if first[2] <= 0 or second[2] <= 0: continue if (second[2]+1) > len(path): continue if second[2] == first[2]: continue # collision check if not line_collision_check(first, second, obstacleList): continue #Create New path new_path = [] new_path.extend(path[:first[2]+1]) new_path.append([first[0], first[1]]) new_path.append([second[0], second[1]]) new_path.extend(path[second[2]+1:]) path = new_path path_length = get_path_length(path) return path # taille terrain = 9000 x 6000
0.158891
0.348008
from django.db import models from django.contrib.auth.models import User from django.utils import timezone from api.utils import humanize_time import datetime import urllib class ChatMessage(models.Model): author = models.ForeignKey(User, related_name='author', null=False, blank=False) message = models.CharField(max_length=2000, blank=False, null=False) date = models.DateTimeField(auto_now_add=True) url = models.URLField(max_length=300, blank=False, null=False) def __unicode__(self): return "Chat message item on %s by %s" % (self.date, self.author) class FilterListItem(models.Model): user = models.ForeignKey(User, null=False, blank=False) url = models.URLField(max_length=200, null=False, blank=False) date_created = models.DateTimeField(default=datetime.datetime.utcnow()) class Meta: abstract = True class WhiteListItem(FilterListItem): class Meta: unique_together = ('user','url') def __unicode__(self): return "Whitelist item %s for %s" % (self.url, self.user.username) class BlackListItem(FilterListItem): class Meta: unique_together = ('user','url') def __unicode__(self): return "Blacklist item %s for %s" % (self.url, self.user.username) class EyeHistoryRaw(models.Model): user = models.ForeignKey(User) src = models.CharField(max_length=40, default='') url = models.URLField(max_length=2000, default='') domain = models.URLField(max_length=2000, default='') favIconUrl = models.URLField(max_length=2000, default='') title = models.CharField(max_length=2000, default='') start_event = models.CharField(max_length=40, default='') start_time = models.DateTimeField() end_event = models.CharField(max_length=40, default='') end_time = models.DateTimeField() total_time = models.IntegerField() # store in ms # store as human readable according to moment.js library: http://momentjs.com/docs/#/displaying/humanize-duration/ humanize_time = models.CharField(max_length=200, default='') def __unicode__(self): return "EyeHistory item %s for %s on %s" % (self.url, self.user.username, self.start_time) class EyeHistory(models.Model): user = models.ForeignKey(User) src = models.CharField(max_length=40, default='') url = models.URLField(max_length=2000, default='') domain = models.URLField(max_length=2000, default='') favIconUrl = models.URLField(max_length=2000, default='') title = models.CharField(max_length=2000, default='') start_event = models.CharField(max_length=40, default='') start_time = models.DateTimeField() end_event = models.CharField(max_length=40, default='') end_time = models.DateTimeField() total_time = models.IntegerField() # store in ms # store as human readable according to moment.js library: http://momentjs.com/docs/#/displaying/humanize-duration/ humanize_time = models.CharField(max_length=200, default='') def __unicode__(self): return "EyeHistory item %s for %s on %s" % (self.url, self.user.username, self.start_time) def save(self, save_raw=True, *args, **kwargs): if self.favIconUrl.strip() == '': self.favIconUrl = "http://www.google.com/s2/favicons?domain_url=" + urllib.quote(self.url) super(EyeHistory, self).save(*args, **kwargs) class EyeHistoryMessage(models.Model): message = models.CharField(max_length=300, default='') post_time = models.DateTimeField(auto_now_add=True) eyehistory = models.ForeignKey(EyeHistory, blank=True, null=True, on_delete=models.SET_NULL) class Meta: ordering = ['-post_time'] def __unicode__(self): return "Message %s on %s" % (self.message, self.post_time) def save_raw_eyehistory(user, url, title, start_event, end_event, start_time, end_time, src, domain, favIconUrl): elapsed_time = end_time - start_time total_time = int(round((elapsed_time.microseconds / 1.0E3) + (elapsed_time.seconds * 1000) + (elapsed_time.days * 8.64E7))) hum_time = humanize_time(elapsed_time) if favIconUrl == None: favIconUrl = "http://www.google.com/s2/favicons?domain_url=" + urllib.quote(url) raw, created = EyeHistoryRaw.objects.get_or_create(user=user, url=url, title=title, start_event=start_event, end_event=end_event, start_time=start_time, end_time=end_time, src=src, domain=domain, favIconUrl=favIconUrl, total_time=total_time, humanize_time=hum_time) def merge_histories(dup_histories, end_time, end_event): earliest_start = timezone.now() earliest_eyehist = None dup_histories = list(dup_histories) for hist in dup_histories: if hist.start_time < earliest_start: earliest_start = hist.start_time earliest_eyehist = hist if earliest_eyehist == None: earliest_eyehist = dup_histories[0] earliest_eyehist.end_time = end_time earliest_eyehist.end_event = end_event elapsed_time = earliest_eyehist.end_time - earliest_eyehist.start_time earliest_eyehist.total_time = int(round((elapsed_time.microseconds / 1.0E3) + (elapsed_time.seconds * 1000) + (elapsed_time.days * 8.64E7))) earliest_eyehist.humanize_time = humanize_time(elapsed_time) if earliest_eyehist.favIconUrl.strip() == '': earliest_eyehist.favIconUrl = "http://www.google.com/s2/favicons?domain_url=" + urllib.quote(earliest_eyehist.url) earliest_eyehist.save() if len(dup_histories) > 1: for item in dup_histories: if item != earliest_eyehist: messages = EyeHistoryMessage.objects.filter(eyehistory=item) for message in messages: message.eyehistory = earliest_eyehist message.save() item.delete() return earliest_eyehist
api/models.py
from django.db import models from django.contrib.auth.models import User from django.utils import timezone from api.utils import humanize_time import datetime import urllib class ChatMessage(models.Model): author = models.ForeignKey(User, related_name='author', null=False, blank=False) message = models.CharField(max_length=2000, blank=False, null=False) date = models.DateTimeField(auto_now_add=True) url = models.URLField(max_length=300, blank=False, null=False) def __unicode__(self): return "Chat message item on %s by %s" % (self.date, self.author) class FilterListItem(models.Model): user = models.ForeignKey(User, null=False, blank=False) url = models.URLField(max_length=200, null=False, blank=False) date_created = models.DateTimeField(default=datetime.datetime.utcnow()) class Meta: abstract = True class WhiteListItem(FilterListItem): class Meta: unique_together = ('user','url') def __unicode__(self): return "Whitelist item %s for %s" % (self.url, self.user.username) class BlackListItem(FilterListItem): class Meta: unique_together = ('user','url') def __unicode__(self): return "Blacklist item %s for %s" % (self.url, self.user.username) class EyeHistoryRaw(models.Model): user = models.ForeignKey(User) src = models.CharField(max_length=40, default='') url = models.URLField(max_length=2000, default='') domain = models.URLField(max_length=2000, default='') favIconUrl = models.URLField(max_length=2000, default='') title = models.CharField(max_length=2000, default='') start_event = models.CharField(max_length=40, default='') start_time = models.DateTimeField() end_event = models.CharField(max_length=40, default='') end_time = models.DateTimeField() total_time = models.IntegerField() # store in ms # store as human readable according to moment.js library: http://momentjs.com/docs/#/displaying/humanize-duration/ humanize_time = models.CharField(max_length=200, default='') def __unicode__(self): return "EyeHistory item %s for %s on %s" % (self.url, self.user.username, self.start_time) class EyeHistory(models.Model): user = models.ForeignKey(User) src = models.CharField(max_length=40, default='') url = models.URLField(max_length=2000, default='') domain = models.URLField(max_length=2000, default='') favIconUrl = models.URLField(max_length=2000, default='') title = models.CharField(max_length=2000, default='') start_event = models.CharField(max_length=40, default='') start_time = models.DateTimeField() end_event = models.CharField(max_length=40, default='') end_time = models.DateTimeField() total_time = models.IntegerField() # store in ms # store as human readable according to moment.js library: http://momentjs.com/docs/#/displaying/humanize-duration/ humanize_time = models.CharField(max_length=200, default='') def __unicode__(self): return "EyeHistory item %s for %s on %s" % (self.url, self.user.username, self.start_time) def save(self, save_raw=True, *args, **kwargs): if self.favIconUrl.strip() == '': self.favIconUrl = "http://www.google.com/s2/favicons?domain_url=" + urllib.quote(self.url) super(EyeHistory, self).save(*args, **kwargs) class EyeHistoryMessage(models.Model): message = models.CharField(max_length=300, default='') post_time = models.DateTimeField(auto_now_add=True) eyehistory = models.ForeignKey(EyeHistory, blank=True, null=True, on_delete=models.SET_NULL) class Meta: ordering = ['-post_time'] def __unicode__(self): return "Message %s on %s" % (self.message, self.post_time) def save_raw_eyehistory(user, url, title, start_event, end_event, start_time, end_time, src, domain, favIconUrl): elapsed_time = end_time - start_time total_time = int(round((elapsed_time.microseconds / 1.0E3) + (elapsed_time.seconds * 1000) + (elapsed_time.days * 8.64E7))) hum_time = humanize_time(elapsed_time) if favIconUrl == None: favIconUrl = "http://www.google.com/s2/favicons?domain_url=" + urllib.quote(url) raw, created = EyeHistoryRaw.objects.get_or_create(user=user, url=url, title=title, start_event=start_event, end_event=end_event, start_time=start_time, end_time=end_time, src=src, domain=domain, favIconUrl=favIconUrl, total_time=total_time, humanize_time=hum_time) def merge_histories(dup_histories, end_time, end_event): earliest_start = timezone.now() earliest_eyehist = None dup_histories = list(dup_histories) for hist in dup_histories: if hist.start_time < earliest_start: earliest_start = hist.start_time earliest_eyehist = hist if earliest_eyehist == None: earliest_eyehist = dup_histories[0] earliest_eyehist.end_time = end_time earliest_eyehist.end_event = end_event elapsed_time = earliest_eyehist.end_time - earliest_eyehist.start_time earliest_eyehist.total_time = int(round((elapsed_time.microseconds / 1.0E3) + (elapsed_time.seconds * 1000) + (elapsed_time.days * 8.64E7))) earliest_eyehist.humanize_time = humanize_time(elapsed_time) if earliest_eyehist.favIconUrl.strip() == '': earliest_eyehist.favIconUrl = "http://www.google.com/s2/favicons?domain_url=" + urllib.quote(earliest_eyehist.url) earliest_eyehist.save() if len(dup_histories) > 1: for item in dup_histories: if item != earliest_eyehist: messages = EyeHistoryMessage.objects.filter(eyehistory=item) for message in messages: message.eyehistory = earliest_eyehist message.save() item.delete() return earliest_eyehist
0.5144
0.071559
import numpy as np import math from matplotlib import pyplot import time import sys import numba @numba.jit def bilinear_interpolation(X, Y, f, x, y): """Returns the approximate value of f(x,y) using bilinear interpolation. Arguments --------- X, Y -- mesh grid. f -- the function f that should be an NxN matrix. x, y -- coordinates where to compute f(x,y) """ N = np.shape(X[:, 0])[0] dx, dy = X[0, 1] - X[0, 0], Y[1, 0] - Y[0, 0] x_start, y_start = X[0, 0], Y[0, 0] i1, i2 = int((x - x_start) / dx), int((x - x_start) / dx) + 1 j1, j2 = int((y - y_start) / dy), int((y - y_start) / dy) + 1 # Take care of boundaries # 1. Right boundary if i1 >= N - 1 and j1 <= N - 1 and j1 >= 0: return f[j1, N - 1] if i1 >= N - 1 and j1 <= 0: return f[0, N - 1] if i1 >= N - 1 and j1 >= N - 1: return f[N - 1, N - 1] # 2. Left boundary if i1 <= 0 and j1 <= N - 1 and j1 >= 0: return f[j1, 0] if i1 <= 0 and j1 <= 0: return f[0, 0] if i1 <= 0 and j1 >= N - 1: return f[N - 1, 0] # 3. Top boundary if j1 >= N - 1 and i1 <= N - 1 and i1 >= 0: return f[N - 1, i1] if j1 >= N - 1 and i1 <= 0: return f[N - 1, 0] # 3. Bottom boundary if j1 <= 0 and i1 <= N - 1 and i1 >= 0: return f[0, i1] if j1 <= 0 and i1 >= N - 1: return f[N - 1, 0] x1, x2 = X[j1, i1], X[j2, i2] y1, y2 = Y[j1, i1], Y[j2, i2] f_interpolated = ( 1 / (x2 - x1) * 1 / (y2 - y1) * ( f[j1, i1] * (x2 - x) * (y2 - y) + f[j1, i2] * (x - x1) * (y2 - y) + f[j2, i1] * (x2 - x) * (y - y1) + f[j2, i2] * (x - x1) * (y - y1) ) ) return f_interpolated @numba.jit def rk4(X, Y, x, y, f, h, dim): """Returns the approximate value of f(x,y) using bilinear interpolation. Arguments --------- X, Y -- mesh grid. x, y -- coordinates where to begin the evolution. f -- the function f that will be evolved. h -- the time step (usually referred to this as dt.) dim -- 0 for x and 1 for y. """ k1 = h * bilinear_interpolation(X, Y, f, x, y) k2 = h * bilinear_interpolation(X, Y, f, x + 0.5 * h, y + 0.5 * k1) k3 = h * bilinear_interpolation(X, Y, f, x + 0.5 * h, y + 0.5 * k2) k4 = h * bilinear_interpolation(X, Y, f, x + h, y + k3) if dim == 0: return x + 1.0 / 6 * k1 + 1.0 / 3 * k2 + 1.0 / 3 * k3 + 1.0 / 6 * k4 elif dim == 1: return y + 1.0 / 6 * k1 + 1.0 / 3 * k2 + 1.0 / 3 * k3 + 1.0 / 6 * k4 else: print("invalid dimension parameter passed to rk4, exiting") # sys.exit() @numba.jit def integrate(x_y, integration_time, dt, X, Y, u, v): xs = x_y[0] ys = x_y[1] tr_x = xs tr_y = ys for k in range(0, int(integration_time / dt)): xs, ys = rk4(X, Y, xs, ys, u, dt, 0), rk4(X, Y, xs, ys, v, dt, 1) tr_x += xs tr_y += ys return [tr_x, tr_y] def eigs(xt, yt, xo, yo): ftlemat = np.zeros((2, 2)) ftlemat[0][0] = (xt[1] - xt[0]) / (xo[1] - xo[0]) ftlemat[1][0] = (yt[1] - yt[0]) / (xo[1] - xo[0]) ftlemat[0][1] = (xt[3] - xt[2]) / (yo[1] - yo[0]) ftlemat[1][1] = (yt[3] - yt[2]) / (yo[1] - yo[0]) if True in np.isnan(ftlemat): return "nan" ftlemat = np.dot(ftlemat.transpose(), ftlemat) w, v = np.linalg.eig(ftlemat) return w
dyntrack/utils/FTLE.py
import numpy as np import math from matplotlib import pyplot import time import sys import numba @numba.jit def bilinear_interpolation(X, Y, f, x, y): """Returns the approximate value of f(x,y) using bilinear interpolation. Arguments --------- X, Y -- mesh grid. f -- the function f that should be an NxN matrix. x, y -- coordinates where to compute f(x,y) """ N = np.shape(X[:, 0])[0] dx, dy = X[0, 1] - X[0, 0], Y[1, 0] - Y[0, 0] x_start, y_start = X[0, 0], Y[0, 0] i1, i2 = int((x - x_start) / dx), int((x - x_start) / dx) + 1 j1, j2 = int((y - y_start) / dy), int((y - y_start) / dy) + 1 # Take care of boundaries # 1. Right boundary if i1 >= N - 1 and j1 <= N - 1 and j1 >= 0: return f[j1, N - 1] if i1 >= N - 1 and j1 <= 0: return f[0, N - 1] if i1 >= N - 1 and j1 >= N - 1: return f[N - 1, N - 1] # 2. Left boundary if i1 <= 0 and j1 <= N - 1 and j1 >= 0: return f[j1, 0] if i1 <= 0 and j1 <= 0: return f[0, 0] if i1 <= 0 and j1 >= N - 1: return f[N - 1, 0] # 3. Top boundary if j1 >= N - 1 and i1 <= N - 1 and i1 >= 0: return f[N - 1, i1] if j1 >= N - 1 and i1 <= 0: return f[N - 1, 0] # 3. Bottom boundary if j1 <= 0 and i1 <= N - 1 and i1 >= 0: return f[0, i1] if j1 <= 0 and i1 >= N - 1: return f[N - 1, 0] x1, x2 = X[j1, i1], X[j2, i2] y1, y2 = Y[j1, i1], Y[j2, i2] f_interpolated = ( 1 / (x2 - x1) * 1 / (y2 - y1) * ( f[j1, i1] * (x2 - x) * (y2 - y) + f[j1, i2] * (x - x1) * (y2 - y) + f[j2, i1] * (x2 - x) * (y - y1) + f[j2, i2] * (x - x1) * (y - y1) ) ) return f_interpolated @numba.jit def rk4(X, Y, x, y, f, h, dim): """Returns the approximate value of f(x,y) using bilinear interpolation. Arguments --------- X, Y -- mesh grid. x, y -- coordinates where to begin the evolution. f -- the function f that will be evolved. h -- the time step (usually referred to this as dt.) dim -- 0 for x and 1 for y. """ k1 = h * bilinear_interpolation(X, Y, f, x, y) k2 = h * bilinear_interpolation(X, Y, f, x + 0.5 * h, y + 0.5 * k1) k3 = h * bilinear_interpolation(X, Y, f, x + 0.5 * h, y + 0.5 * k2) k4 = h * bilinear_interpolation(X, Y, f, x + h, y + k3) if dim == 0: return x + 1.0 / 6 * k1 + 1.0 / 3 * k2 + 1.0 / 3 * k3 + 1.0 / 6 * k4 elif dim == 1: return y + 1.0 / 6 * k1 + 1.0 / 3 * k2 + 1.0 / 3 * k3 + 1.0 / 6 * k4 else: print("invalid dimension parameter passed to rk4, exiting") # sys.exit() @numba.jit def integrate(x_y, integration_time, dt, X, Y, u, v): xs = x_y[0] ys = x_y[1] tr_x = xs tr_y = ys for k in range(0, int(integration_time / dt)): xs, ys = rk4(X, Y, xs, ys, u, dt, 0), rk4(X, Y, xs, ys, v, dt, 1) tr_x += xs tr_y += ys return [tr_x, tr_y] def eigs(xt, yt, xo, yo): ftlemat = np.zeros((2, 2)) ftlemat[0][0] = (xt[1] - xt[0]) / (xo[1] - xo[0]) ftlemat[1][0] = (yt[1] - yt[0]) / (xo[1] - xo[0]) ftlemat[0][1] = (xt[3] - xt[2]) / (yo[1] - yo[0]) ftlemat[1][1] = (yt[3] - yt[2]) / (yo[1] - yo[0]) if True in np.isnan(ftlemat): return "nan" ftlemat = np.dot(ftlemat.transpose(), ftlemat) w, v = np.linalg.eig(ftlemat) return w
0.471467
0.663471
from fastapi import FastAPI, Depends, HTTPException from fastapi.middleware.cors import CORSMiddleware from sqlalchemy.orm import Session from app.database import crud, models, schemas, SessionLocal, engine from app.validate_wasm import validate_wasm from typing import List models.Base.metadata.create_all(bind=engine) # Dont know what this does # Initialize the FastAPI instance app = FastAPI( title="WASM Bots", description="A simple server for our LangSec project where we can upload base64 encoded wasm bots", version="1.0" ) app.add_middleware( CORSMiddleware, allow_credentials=True, allow_origins=["*"], allow_methods=["*"], allow_headers=["*"], ) # Used to create a connection to the db upon requests to the server def get_db(): try: db = SessionLocal() yield db finally: db.close() @app.get("/bots", response_model=List[schemas.Bot]) def get_bots(skip: int = 0, limit: int = 100, db: Session = Depends(get_db)): """Returns all the wasm bots""" bots = crud.get_bots(db, skip=skip, limit=limit) return bots @app.get("/bots/{bot_id}", response_model=schemas.Bot) def get_bot(bot_id: int, db: Session = Depends(get_db)): """Fetched that particular bot""" return crud.get_bot(db, bot_id) @app.delete("/bots/{bot_id}") def remove_bot(bot_id: int, db: Session = Depends(get_db)): """Removes that particular bot""" if crud.remove_bot(db, bot_id): return else: raise HTTPException(status_code=400, detail=f"Bot with id #{bot_id} does not exist") @app.post("/bots/get-by-name", response_model=schemas.Bot) def get_bot_by_name(name: str, db: Session = Depends(get_db)): """Fetched that particular bot""" return crud.get_bot_by_name(db, name) @app.post("/bots", response_model=schemas.Bot) def create_bot(bot: schemas.BotBase, db: Session = Depends(get_db)): """Creates a new bot""" if not validate_wasm(bot.base64_encoded_bot): raise HTTPException(status_code=400, detail="Provided wasm file is invalid") db_bot = crud.get_bot_by_name(db, name=bot.name) if db_bot: # A bot with that name already exists raise HTTPException(status_code=400, detail=f"Bot with that name already exists: {bot.name}") return crud.create_bot(db, bot)
backend/app/main.py
from fastapi import FastAPI, Depends, HTTPException from fastapi.middleware.cors import CORSMiddleware from sqlalchemy.orm import Session from app.database import crud, models, schemas, SessionLocal, engine from app.validate_wasm import validate_wasm from typing import List models.Base.metadata.create_all(bind=engine) # Dont know what this does # Initialize the FastAPI instance app = FastAPI( title="WASM Bots", description="A simple server for our LangSec project where we can upload base64 encoded wasm bots", version="1.0" ) app.add_middleware( CORSMiddleware, allow_credentials=True, allow_origins=["*"], allow_methods=["*"], allow_headers=["*"], ) # Used to create a connection to the db upon requests to the server def get_db(): try: db = SessionLocal() yield db finally: db.close() @app.get("/bots", response_model=List[schemas.Bot]) def get_bots(skip: int = 0, limit: int = 100, db: Session = Depends(get_db)): """Returns all the wasm bots""" bots = crud.get_bots(db, skip=skip, limit=limit) return bots @app.get("/bots/{bot_id}", response_model=schemas.Bot) def get_bot(bot_id: int, db: Session = Depends(get_db)): """Fetched that particular bot""" return crud.get_bot(db, bot_id) @app.delete("/bots/{bot_id}") def remove_bot(bot_id: int, db: Session = Depends(get_db)): """Removes that particular bot""" if crud.remove_bot(db, bot_id): return else: raise HTTPException(status_code=400, detail=f"Bot with id #{bot_id} does not exist") @app.post("/bots/get-by-name", response_model=schemas.Bot) def get_bot_by_name(name: str, db: Session = Depends(get_db)): """Fetched that particular bot""" return crud.get_bot_by_name(db, name) @app.post("/bots", response_model=schemas.Bot) def create_bot(bot: schemas.BotBase, db: Session = Depends(get_db)): """Creates a new bot""" if not validate_wasm(bot.base64_encoded_bot): raise HTTPException(status_code=400, detail="Provided wasm file is invalid") db_bot = crud.get_bot_by_name(db, name=bot.name) if db_bot: # A bot with that name already exists raise HTTPException(status_code=400, detail=f"Bot with that name already exists: {bot.name}") return crud.create_bot(db, bot)
0.61231
0.065515
from pyrsistent import pmap, thaw from .event import EventBase from .util import is_pmap, ms_from_dt class TimeRangeEvent(EventBase): """ The creation of an TimeRangeEvent is done by combining two parts - the timerange and the data. To construct you specify a TimeRange, along with the data. The first arg can be: - a TimeRangeEvent instance (copy ctor) - a pyrsistent.PMap, or - a python tuple, list or pyrsistent.PVector object containing two python datetime objects or ms timestamps - the args for the TimeRange object. To specify the data you can supply either: - a python dict - a pyrsistent.PMap, or - a simple type such as an integer. In the case of the simple type this is a shorthand for supplying {"value": v}. Parameters ---------- instance_or_args : TimeRange, iterable, pyrsistent.pmap See above arg2 : dict, pmap, int, float, str, optional See above. """ __slots__ = () # inheriting relevant slots, stil need this def __init__(self, instance_or_args, arg2=None): """ Create a time range event. """ # pylint doesn't like self._d but be consistent w/original code. # pylint: disable=invalid-name if isinstance(instance_or_args, TimeRangeEvent): super(TimeRangeEvent, self).__init__(instance_or_args._d) # pylint: disable=protected-access return elif is_pmap(instance_or_args): super(TimeRangeEvent, self).__init__(instance_or_args) return rng = self.timerange_from_arg(instance_or_args) data = self.data_from_arg(arg2) super(TimeRangeEvent, self).__init__(pmap(dict(range=rng, data=data))) # Query/accessor methods def to_json(self): """ Returns the TimeRangeEvent as a JSON object, essentially :: {timerange: tr, data: {key: value, ...}} This is actually like json.loads(s) - produces the actual data structure from the object internal data. Returns ------- dict Dict representation of internals (timerange, data). """ return dict( timerange=self.timerange().to_json(), data=thaw(self.data()), ) def key(self): """Returns a range string in the format 'begin,end' as expressed as ms since the epoch. Returns ------- str The begin and end of the timerange in ms since the epoch. """ return '{0},{1}'.format(ms_from_dt(self.begin()), ms_from_dt(self.end())) def type(self): # pylint: disable=no-self-use """Return the type of this event type Returns ------- class The class of this event type. """ return TimeRangeEvent def to_point(self, cols=None): """ Returns a flat array starting with the timestamp, followed by the values. Can be given an optional list of columns so the returned list will have the values in order. Primarily for the TimeSeries wire format. Parameters ---------- cols : list, optional List of data columns to order the data points in so the TimeSeries wire format lines up correctly. If not specified, the points will be whatever order that dict.values() decides to return it in. Returns ------- list Epoch ms followed by points. """ points = [self.timerange().to_json()] data = thaw(self.data()) if isinstance(cols, list): points += [data.get(x, None) for x in cols] else: points += [x for x in list(data.values())] return points def timerange_as_utc_string(self): """The timerange of this data, in UTC time, as a string. Returns ------- str Formatted time string """ return self.timerange().to_utc_string() def timerange_as_local_string(self): """The timerange of this data, in Local time, as a string. Returns ------- str Formatted time string. """ return self.timerange().to_local_string() def timestamp(self): """The timestamp of this Event data. It's just the beginning of the range in this case. Returns ------- datetime.datetime Beginning of range. """ return self.begin() def timerange(self): """The TimeRange of this data. Returns ------- TimeRange The underlying time range object. """ return self._d.get('range') def begin(self): """The begin time of this Event, which will be just the timestamp. Returns ------- datetime.datetime Beginning of range. """ return self.timerange().begin() def end(self): """The end time of this Event, which will be just the timestamp. Returns ------- datetime.datetime End of range. """ return self.timerange().end() # data setters, returns new object def set_data(self, data): """Sets the data portion of the event and returns a new TimeRangeEvent. :param data: The new data portion for this event object. :type data: dict :returns: TimeRangeEvent - a new TimeRangeEvent object. Parameters ---------- data : dict New payload to set as the data for this event. Returns ------- TimeRangeEvent A new time range event object with new data payload. """ _dnew = self._d.set('data', self.data_from_arg(data)) return TimeRangeEvent(_dnew) # Humanize def humanize_duration(self): """Humanize the timerange. Returns ------- str Humanized string of the time range. """ return self.timerange().humanize_duration()
pypond/timerange_event.py
from pyrsistent import pmap, thaw from .event import EventBase from .util import is_pmap, ms_from_dt class TimeRangeEvent(EventBase): """ The creation of an TimeRangeEvent is done by combining two parts - the timerange and the data. To construct you specify a TimeRange, along with the data. The first arg can be: - a TimeRangeEvent instance (copy ctor) - a pyrsistent.PMap, or - a python tuple, list or pyrsistent.PVector object containing two python datetime objects or ms timestamps - the args for the TimeRange object. To specify the data you can supply either: - a python dict - a pyrsistent.PMap, or - a simple type such as an integer. In the case of the simple type this is a shorthand for supplying {"value": v}. Parameters ---------- instance_or_args : TimeRange, iterable, pyrsistent.pmap See above arg2 : dict, pmap, int, float, str, optional See above. """ __slots__ = () # inheriting relevant slots, stil need this def __init__(self, instance_or_args, arg2=None): """ Create a time range event. """ # pylint doesn't like self._d but be consistent w/original code. # pylint: disable=invalid-name if isinstance(instance_or_args, TimeRangeEvent): super(TimeRangeEvent, self).__init__(instance_or_args._d) # pylint: disable=protected-access return elif is_pmap(instance_or_args): super(TimeRangeEvent, self).__init__(instance_or_args) return rng = self.timerange_from_arg(instance_or_args) data = self.data_from_arg(arg2) super(TimeRangeEvent, self).__init__(pmap(dict(range=rng, data=data))) # Query/accessor methods def to_json(self): """ Returns the TimeRangeEvent as a JSON object, essentially :: {timerange: tr, data: {key: value, ...}} This is actually like json.loads(s) - produces the actual data structure from the object internal data. Returns ------- dict Dict representation of internals (timerange, data). """ return dict( timerange=self.timerange().to_json(), data=thaw(self.data()), ) def key(self): """Returns a range string in the format 'begin,end' as expressed as ms since the epoch. Returns ------- str The begin and end of the timerange in ms since the epoch. """ return '{0},{1}'.format(ms_from_dt(self.begin()), ms_from_dt(self.end())) def type(self): # pylint: disable=no-self-use """Return the type of this event type Returns ------- class The class of this event type. """ return TimeRangeEvent def to_point(self, cols=None): """ Returns a flat array starting with the timestamp, followed by the values. Can be given an optional list of columns so the returned list will have the values in order. Primarily for the TimeSeries wire format. Parameters ---------- cols : list, optional List of data columns to order the data points in so the TimeSeries wire format lines up correctly. If not specified, the points will be whatever order that dict.values() decides to return it in. Returns ------- list Epoch ms followed by points. """ points = [self.timerange().to_json()] data = thaw(self.data()) if isinstance(cols, list): points += [data.get(x, None) for x in cols] else: points += [x for x in list(data.values())] return points def timerange_as_utc_string(self): """The timerange of this data, in UTC time, as a string. Returns ------- str Formatted time string """ return self.timerange().to_utc_string() def timerange_as_local_string(self): """The timerange of this data, in Local time, as a string. Returns ------- str Formatted time string. """ return self.timerange().to_local_string() def timestamp(self): """The timestamp of this Event data. It's just the beginning of the range in this case. Returns ------- datetime.datetime Beginning of range. """ return self.begin() def timerange(self): """The TimeRange of this data. Returns ------- TimeRange The underlying time range object. """ return self._d.get('range') def begin(self): """The begin time of this Event, which will be just the timestamp. Returns ------- datetime.datetime Beginning of range. """ return self.timerange().begin() def end(self): """The end time of this Event, which will be just the timestamp. Returns ------- datetime.datetime End of range. """ return self.timerange().end() # data setters, returns new object def set_data(self, data): """Sets the data portion of the event and returns a new TimeRangeEvent. :param data: The new data portion for this event object. :type data: dict :returns: TimeRangeEvent - a new TimeRangeEvent object. Parameters ---------- data : dict New payload to set as the data for this event. Returns ------- TimeRangeEvent A new time range event object with new data payload. """ _dnew = self._d.set('data', self.data_from_arg(data)) return TimeRangeEvent(_dnew) # Humanize def humanize_duration(self): """Humanize the timerange. Returns ------- str Humanized string of the time range. """ return self.timerange().humanize_duration()
0.91204
0.72594
import datetime import scrapelib import pytz import cachetools class GovInfo(scrapelib.Scraper): BASE_URL = 'https://api.govinfo.gov' def __init__(self, *args, api_key='DEMO_KEY', **kwargs): super().__init__(*args, **kwargs) self.headers['X-Api-Key'] = api_key def collections(self): endpoint = '/collections' response = self.get(self.BASE_URL + endpoint) return response.json() def _format_time(self, dt): utc_time = dt.astimezone(pytz.utc) time_str = dt.strftime('%Y-%m-%dT%H:%M:%SZ') return time_str def congressional_hearings(self, start_time=None, end_time=None): if start_time is None: # the earliest date for this collection start_time = datetime.datetime(2018, 6, 5, 0, 0, tzinfo=pytz.utc) start_time_str = self._format_time(start_time) if end_time is None: end_time = datetime.datetime.now(pytz.utc) end_time_str = self._format_time(end_time) partial = '/collections/CHRG/{start_time}'.format(start_time=start_time_str) url_template = self.BASE_URL + partial + '/{end_time}' seen = cachetools.LRUCache(30) for page in self._pages(url_template, end_time_str): for package in page['packages']: package_id = package['packageId'] if package_id in seen: continue else: # the LRUCache is like a dict, but all we care # about is whether we've seen this package # recently, so we just store None as the value # associated with the package_id key seen[package_id] = None response = self.get(package['packageLink']) yield response.json() def _pages(self, url_template, end_time_str): page_size = 100 params = {'offset': 0, 'pageSize': page_size} url = url_template.format(end_time=end_time_str) response = self.get(url, params=params) data = response.json() yield data while len(data['packages']) == page_size: # the API results are sorted in descending order by timestamp # so we can paginate through results by making the end_time # filter earlier and earlier earliest_timestamp = data['packages'][-1]['lastModified'] url = url_template.format(end_time=earliest_timestamp) response = self.get(url, params=params) data = response.json() yield data
govinfo/__init__.py
import datetime import scrapelib import pytz import cachetools class GovInfo(scrapelib.Scraper): BASE_URL = 'https://api.govinfo.gov' def __init__(self, *args, api_key='DEMO_KEY', **kwargs): super().__init__(*args, **kwargs) self.headers['X-Api-Key'] = api_key def collections(self): endpoint = '/collections' response = self.get(self.BASE_URL + endpoint) return response.json() def _format_time(self, dt): utc_time = dt.astimezone(pytz.utc) time_str = dt.strftime('%Y-%m-%dT%H:%M:%SZ') return time_str def congressional_hearings(self, start_time=None, end_time=None): if start_time is None: # the earliest date for this collection start_time = datetime.datetime(2018, 6, 5, 0, 0, tzinfo=pytz.utc) start_time_str = self._format_time(start_time) if end_time is None: end_time = datetime.datetime.now(pytz.utc) end_time_str = self._format_time(end_time) partial = '/collections/CHRG/{start_time}'.format(start_time=start_time_str) url_template = self.BASE_URL + partial + '/{end_time}' seen = cachetools.LRUCache(30) for page in self._pages(url_template, end_time_str): for package in page['packages']: package_id = package['packageId'] if package_id in seen: continue else: # the LRUCache is like a dict, but all we care # about is whether we've seen this package # recently, so we just store None as the value # associated with the package_id key seen[package_id] = None response = self.get(package['packageLink']) yield response.json() def _pages(self, url_template, end_time_str): page_size = 100 params = {'offset': 0, 'pageSize': page_size} url = url_template.format(end_time=end_time_str) response = self.get(url, params=params) data = response.json() yield data while len(data['packages']) == page_size: # the API results are sorted in descending order by timestamp # so we can paginate through results by making the end_time # filter earlier and earlier earliest_timestamp = data['packages'][-1]['lastModified'] url = url_template.format(end_time=earliest_timestamp) response = self.get(url, params=params) data = response.json() yield data
0.371479
0.182389
# Python modules from PyQt5 import QtWidgets, QtCore, QtGui from PyQt5.QtCore import pyqtSignal import colorsys # Wizard gui modules from wizard.gui import gui_utils class color_picker(QtWidgets.QWidget): validate_signal = pyqtSignal(str) color_signal = pyqtSignal(str) def __init__(self, color='#798fe8', parent=None): super(color_picker, self).__init__(parent) self.setWindowFlags(QtCore.Qt.FramelessWindowHint | QtCore.Qt.WindowStaysOnTopHint | QtCore.Qt.ToolTip) self.setAttribute(QtCore.Qt.WA_TranslucentBackground) self.build_ui() self.connect_functions() self.set_color(color) def showEvent(self, event): gui_utils.move_ui(self) event.accept() def set_color(self, hex): h, s, v = self.hex_to_hsv(hex) self.set_HSV(h, s, v) def set_HSV(self, h, s, v): self.hue_selector.move(0, (100 - h) * 1.85) self.color_view.setStyleSheet(f"border-radius: 5px;background-color: qlineargradient(x1:1, x2:0, stop:0 hsl({h}%,100%,50%), stop:1 #fff);") self.selector.move(s * 2 - 6, (200 - v * 2) - 6) def hex_to_hsv(self, hex): hex = hex.replace('#', '') if len(hex) < 6: hex += "0"*(6-len(hex)) elif len(hex) > 6: hex = hex[0:6] r,g,b = tuple(int(hex[i:i+2], 16) for i in (0,2,4)) h,s,v = colorsys.rgb_to_hsv(r / 255.0, g / 255.0, b / 255.0) return (h * 100, s * 100, v * 100) def leaveEvent(self, event): h, s, v = self.get_color() self.validate_signal.emit(self.hsv_to_hex(h, s, v)) self.close() def connect_functions(self): self.hue.mouseMoveEvent = self.moveHueSelector self.black_overlay.mouseMoveEvent = self.moveSVSelector self.black_overlay.mousePressEvent = self.moveSVSelector def moveSVSelector(self, event): if event.buttons() == QtCore.Qt.LeftButton: pos = event.pos() if pos.x() < 0: pos.setX(0) if pos.y() < 0: pos.setY(0) if pos.x() > 200: pos.setX(200) if pos.y() > 200: pos.setY(200) self.selector.move(pos - QtCore.QPoint(6,6)) self.hsvChanged() def moveHueSelector(self, event): if event.buttons() == QtCore.Qt.LeftButton: pos = event.pos().y() if pos < 0: pos = 0 if pos > 185: pos = 185 self.hue_selector.move(QtCore.QPoint(0,pos)) self.hsvChanged() def hsv_to_hex(self, h, s, v): r,g,b = colorsys.hsv_to_rgb(h / 100.0, s / 100.0, v / 100.0) hex = '#%02x%02x%02x' % (int(r*255),int(g*255),int(b*255)) return hex def hsvChanged(self): h, s, v = self.get_color() self.color_signal.emit(self.hsv_to_hex(h,s,v)) self.color_view.setStyleSheet(f"border-radius: 5px;background-color: qlineargradient(x1:1, x2:0, stop:0 hsl({h}%,100%,50%), stop:1 #fff);") def get_color(self): h,s,v = (100 - self.hue_selector.y() / 1.85, (self.selector.x() + 6) / 2.0, (194 - self.selector.y()) / 2.0) return h, s, v def build_ui(self): self.main_widget_layout = QtWidgets.QHBoxLayout() self.main_widget_layout.setContentsMargins(12, 12, 12, 12) self.setLayout(self.main_widget_layout) self.main_widget = QtWidgets.QFrame() self.main_widget.setMaximumWidth(300) self.main_widget.setObjectName('black_round_frame') self.main_layout = QtWidgets.QHBoxLayout() self.main_layout.setSpacing(6) self.main_widget.setLayout(self.main_layout) self.main_widget_layout.addWidget(self.main_widget) self.color_view = QtWidgets.QFrame(self) self.color_view.setMinimumSize(QtCore.QSize(200, 200)) self.color_view.setMaximumSize(QtCore.QSize(200, 200)) self.color_view.setStyleSheet("/* ALL CHANGES HERE WILL BE OVERWRITTEN */;\n" "background-color: qlineargradient(x1:1, x2:0, stop:0 hsl(0%,100%,50%), stop:1 rgba(255, 255, 255, 255));border-radius:6px;\n" "\n" "") self.color_view.setFrameShape(QtWidgets.QFrame.StyledPanel) self.color_view.setFrameShadow(QtWidgets.QFrame.Raised) self.color_view.setObjectName("color_view") self.verticalLayout_2 = QtWidgets.QVBoxLayout(self.color_view) self.verticalLayout_2.setContentsMargins(0, 0, 0, 0) self.verticalLayout_2.setSpacing(0) self.verticalLayout_2.setObjectName("verticalLayout_2") self.black_overlay = QtWidgets.QFrame(self.color_view) self.black_overlay.setStyleSheet("background-color: qlineargradient(spread:pad, x1:0, y1:0, x2:0, y2:1, stop:0 rgba(0, 0, 0, 0), stop:1 rgba(0, 0, 0, 255));;border-radius:4px;\n" "\n" "\n" "") self.black_overlay.setFrameShape(QtWidgets.QFrame.StyledPanel) self.black_overlay.setFrameShadow(QtWidgets.QFrame.Raised) self.black_overlay.setObjectName("black_overlay") self.selector = QtWidgets.QFrame(self.black_overlay) self.selector.setGeometry(QtCore.QRect(194, 20, 12, 12)) self.selector.setMinimumSize(QtCore.QSize(12, 12)) self.selector.setMaximumSize(QtCore.QSize(12, 12)) self.selector.setStyleSheet("background-color:none;\n" "border: 2px solid white;\n" "border-radius: 6px;") self.selector.setFrameShape(QtWidgets.QFrame.StyledPanel) self.selector.setFrameShadow(QtWidgets.QFrame.Raised) self.selector.setObjectName("selector") self.verticalLayout_2.addWidget(self.black_overlay) self.main_layout.addWidget(self.color_view) self.frame_2 = QtWidgets.QFrame(self) self.frame_2.setObjectName('transparent_widget') self.frame_2.setMinimumSize(QtCore.QSize(12, 0)) self.frame_2.setFrameShape(QtWidgets.QFrame.StyledPanel) self.frame_2.setFrameShadow(QtWidgets.QFrame.Raised) self.hue_bg = QtWidgets.QFrame(self.frame_2) self.hue_bg.setGeometry(QtCore.QRect(0, 0, 12, 200)) self.hue_bg.setMinimumSize(QtCore.QSize(12, 200)) self.hue_bg.setStyleSheet("background-color: qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0, stop:0 rgba(255, 0, 0, 255), stop:0.166 rgba(255, 255, 0, 255), stop:0.333 rgba(0, 255, 0, 255), stop:0.5 rgba(0, 255, 255, 255), stop:0.666 rgba(0, 0, 255, 255), stop:0.833 rgba(255, 0, 255, 255), stop:1 rgba(255, 0, 0, 255));\n" "border-radius: 6px;") self.hue_bg.setFrameShape(QtWidgets.QFrame.StyledPanel) self.hue_bg.setFrameShadow(QtWidgets.QFrame.Raised) #self.hue_bg.setObjectName("hue_bg") self.hue_selector = QtWidgets.QLabel(self.frame_2) self.hue_selector.setGeometry(QtCore.QRect(0, 185, 0, 12)) self.hue_selector.setMinimumSize(QtCore.QSize(12, 0)) self.hue_selector.setStyleSheet("background-color: none;\n" "border: 2px solid white;\n" "border-radius: 6px;") self.hue_selector.setText("") self.hue_selector.setObjectName("hue_selector") self.hue = QtWidgets.QFrame(self.frame_2) self.hue.setGeometry(QtCore.QRect(0, 0, 12, 200)) self.hue.setMinimumSize(QtCore.QSize(12, 200)) self.hue.setStyleSheet("background-color: none;") self.hue.setFrameShape(QtWidgets.QFrame.StyledPanel) self.hue.setFrameShadow(QtWidgets.QFrame.Raised) self.hue.setObjectName("hue") self.main_layout.addWidget(self.frame_2)
wizard/gui/color_picker.py
# Python modules from PyQt5 import QtWidgets, QtCore, QtGui from PyQt5.QtCore import pyqtSignal import colorsys # Wizard gui modules from wizard.gui import gui_utils class color_picker(QtWidgets.QWidget): validate_signal = pyqtSignal(str) color_signal = pyqtSignal(str) def __init__(self, color='#798fe8', parent=None): super(color_picker, self).__init__(parent) self.setWindowFlags(QtCore.Qt.FramelessWindowHint | QtCore.Qt.WindowStaysOnTopHint | QtCore.Qt.ToolTip) self.setAttribute(QtCore.Qt.WA_TranslucentBackground) self.build_ui() self.connect_functions() self.set_color(color) def showEvent(self, event): gui_utils.move_ui(self) event.accept() def set_color(self, hex): h, s, v = self.hex_to_hsv(hex) self.set_HSV(h, s, v) def set_HSV(self, h, s, v): self.hue_selector.move(0, (100 - h) * 1.85) self.color_view.setStyleSheet(f"border-radius: 5px;background-color: qlineargradient(x1:1, x2:0, stop:0 hsl({h}%,100%,50%), stop:1 #fff);") self.selector.move(s * 2 - 6, (200 - v * 2) - 6) def hex_to_hsv(self, hex): hex = hex.replace('#', '') if len(hex) < 6: hex += "0"*(6-len(hex)) elif len(hex) > 6: hex = hex[0:6] r,g,b = tuple(int(hex[i:i+2], 16) for i in (0,2,4)) h,s,v = colorsys.rgb_to_hsv(r / 255.0, g / 255.0, b / 255.0) return (h * 100, s * 100, v * 100) def leaveEvent(self, event): h, s, v = self.get_color() self.validate_signal.emit(self.hsv_to_hex(h, s, v)) self.close() def connect_functions(self): self.hue.mouseMoveEvent = self.moveHueSelector self.black_overlay.mouseMoveEvent = self.moveSVSelector self.black_overlay.mousePressEvent = self.moveSVSelector def moveSVSelector(self, event): if event.buttons() == QtCore.Qt.LeftButton: pos = event.pos() if pos.x() < 0: pos.setX(0) if pos.y() < 0: pos.setY(0) if pos.x() > 200: pos.setX(200) if pos.y() > 200: pos.setY(200) self.selector.move(pos - QtCore.QPoint(6,6)) self.hsvChanged() def moveHueSelector(self, event): if event.buttons() == QtCore.Qt.LeftButton: pos = event.pos().y() if pos < 0: pos = 0 if pos > 185: pos = 185 self.hue_selector.move(QtCore.QPoint(0,pos)) self.hsvChanged() def hsv_to_hex(self, h, s, v): r,g,b = colorsys.hsv_to_rgb(h / 100.0, s / 100.0, v / 100.0) hex = '#%02x%02x%02x' % (int(r*255),int(g*255),int(b*255)) return hex def hsvChanged(self): h, s, v = self.get_color() self.color_signal.emit(self.hsv_to_hex(h,s,v)) self.color_view.setStyleSheet(f"border-radius: 5px;background-color: qlineargradient(x1:1, x2:0, stop:0 hsl({h}%,100%,50%), stop:1 #fff);") def get_color(self): h,s,v = (100 - self.hue_selector.y() / 1.85, (self.selector.x() + 6) / 2.0, (194 - self.selector.y()) / 2.0) return h, s, v def build_ui(self): self.main_widget_layout = QtWidgets.QHBoxLayout() self.main_widget_layout.setContentsMargins(12, 12, 12, 12) self.setLayout(self.main_widget_layout) self.main_widget = QtWidgets.QFrame() self.main_widget.setMaximumWidth(300) self.main_widget.setObjectName('black_round_frame') self.main_layout = QtWidgets.QHBoxLayout() self.main_layout.setSpacing(6) self.main_widget.setLayout(self.main_layout) self.main_widget_layout.addWidget(self.main_widget) self.color_view = QtWidgets.QFrame(self) self.color_view.setMinimumSize(QtCore.QSize(200, 200)) self.color_view.setMaximumSize(QtCore.QSize(200, 200)) self.color_view.setStyleSheet("/* ALL CHANGES HERE WILL BE OVERWRITTEN */;\n" "background-color: qlineargradient(x1:1, x2:0, stop:0 hsl(0%,100%,50%), stop:1 rgba(255, 255, 255, 255));border-radius:6px;\n" "\n" "") self.color_view.setFrameShape(QtWidgets.QFrame.StyledPanel) self.color_view.setFrameShadow(QtWidgets.QFrame.Raised) self.color_view.setObjectName("color_view") self.verticalLayout_2 = QtWidgets.QVBoxLayout(self.color_view) self.verticalLayout_2.setContentsMargins(0, 0, 0, 0) self.verticalLayout_2.setSpacing(0) self.verticalLayout_2.setObjectName("verticalLayout_2") self.black_overlay = QtWidgets.QFrame(self.color_view) self.black_overlay.setStyleSheet("background-color: qlineargradient(spread:pad, x1:0, y1:0, x2:0, y2:1, stop:0 rgba(0, 0, 0, 0), stop:1 rgba(0, 0, 0, 255));;border-radius:4px;\n" "\n" "\n" "") self.black_overlay.setFrameShape(QtWidgets.QFrame.StyledPanel) self.black_overlay.setFrameShadow(QtWidgets.QFrame.Raised) self.black_overlay.setObjectName("black_overlay") self.selector = QtWidgets.QFrame(self.black_overlay) self.selector.setGeometry(QtCore.QRect(194, 20, 12, 12)) self.selector.setMinimumSize(QtCore.QSize(12, 12)) self.selector.setMaximumSize(QtCore.QSize(12, 12)) self.selector.setStyleSheet("background-color:none;\n" "border: 2px solid white;\n" "border-radius: 6px;") self.selector.setFrameShape(QtWidgets.QFrame.StyledPanel) self.selector.setFrameShadow(QtWidgets.QFrame.Raised) self.selector.setObjectName("selector") self.verticalLayout_2.addWidget(self.black_overlay) self.main_layout.addWidget(self.color_view) self.frame_2 = QtWidgets.QFrame(self) self.frame_2.setObjectName('transparent_widget') self.frame_2.setMinimumSize(QtCore.QSize(12, 0)) self.frame_2.setFrameShape(QtWidgets.QFrame.StyledPanel) self.frame_2.setFrameShadow(QtWidgets.QFrame.Raised) self.hue_bg = QtWidgets.QFrame(self.frame_2) self.hue_bg.setGeometry(QtCore.QRect(0, 0, 12, 200)) self.hue_bg.setMinimumSize(QtCore.QSize(12, 200)) self.hue_bg.setStyleSheet("background-color: qlineargradient(spread:pad, x1:0, y1:1, x2:0, y2:0, stop:0 rgba(255, 0, 0, 255), stop:0.166 rgba(255, 255, 0, 255), stop:0.333 rgba(0, 255, 0, 255), stop:0.5 rgba(0, 255, 255, 255), stop:0.666 rgba(0, 0, 255, 255), stop:0.833 rgba(255, 0, 255, 255), stop:1 rgba(255, 0, 0, 255));\n" "border-radius: 6px;") self.hue_bg.setFrameShape(QtWidgets.QFrame.StyledPanel) self.hue_bg.setFrameShadow(QtWidgets.QFrame.Raised) #self.hue_bg.setObjectName("hue_bg") self.hue_selector = QtWidgets.QLabel(self.frame_2) self.hue_selector.setGeometry(QtCore.QRect(0, 185, 0, 12)) self.hue_selector.setMinimumSize(QtCore.QSize(12, 0)) self.hue_selector.setStyleSheet("background-color: none;\n" "border: 2px solid white;\n" "border-radius: 6px;") self.hue_selector.setText("") self.hue_selector.setObjectName("hue_selector") self.hue = QtWidgets.QFrame(self.frame_2) self.hue.setGeometry(QtCore.QRect(0, 0, 12, 200)) self.hue.setMinimumSize(QtCore.QSize(12, 200)) self.hue.setStyleSheet("background-color: none;") self.hue.setFrameShape(QtWidgets.QFrame.StyledPanel) self.hue.setFrameShadow(QtWidgets.QFrame.Raised) self.hue.setObjectName("hue") self.main_layout.addWidget(self.frame_2)
0.669096
0.13788
import datetime import jwt from api.models import (AccountDetails, AgentCoins, AgentTransactionHistory, ContactUs, User, UserCoins, UserTrasactionHistory, otp) from CustomCode import (autentication, fixed_var, password_functions, sms, string_generator, validator) from django.db.models import Sum from rest_framework.decorators import api_view from rest_framework.response import Response from wasteCoin import settings # Create your views here. @api_view(['GET']) def index_page(request): return_data = { "error" : "0", "message" : "Successful" } return Response(return_data) @api_view(["POST"]) def user_registration(request): try: firstName = request.data.get('firstname',None) lastName = request.data.get('lastname',None) phoneNumber = request.data.get('phonenumber',None) email = request.data.get('email',None) gender = request.data.get('gender',None) password = request.data.get('password',None) address = request.data.get('address',None) lga = request.data.get('lga',None) state = request.data.get('state',None) country = request.data.get('country',None) reg_field = [firstName,lastName,phoneNumber,email,password,address,lga,state,country] if not None in reg_field and not "" in reg_field: if User.objects.filter(user_phone =phoneNumber).exists() or User.objects.filter(email =email).exists(): return_data = { "error": "1", "message": "User Exists" } elif validator.checkmail(email) == False or validator.checkphone(phoneNumber)== False: return_data = { "error": "1", "message": "Email or Phone number is Invalid" } else: #generate user_id userRandomId = string_generator.alphanumeric(20) miner_id = string_generator.numeric(7) transactionid = string_generator.alphanumeric(15) #encrypt password encryped_password = password_functions.generate_password_hash(password) #Save user_data new_userData = User(user_id=userRandomId,firstname=firstName,lastname=lastName, email=email,user_phone=phoneNumber,user_gender=gender, user_password=<PASSWORD>,user_address=address, user_state=state,user_LGA=lga,user_country=country) new_userData.save() #Generate OTP code = string_generator.numeric(6) #Save OTP user_OTP =otp(user=new_userData,otp_code=code) user_OTP.save() #Generate default coins user_Coins = UserCoins(user=new_userData,minerID=miner_id,redeemedWasteCoin=0,minedCoins=0) user_Coins.save() #Save Transaction Details user_transaction = UserTrasactionHistory(user=new_userData,transaction_id=transactionid, amount=0,coin_redeemed_amount=0,transaction="Credit") user_transaction.save() role = User.objects.get(user_id=userRandomId).role validated = otp.objects.get(user__user_id=userRandomId).validated #Generate token timeLimit= datetime.datetime.utcnow() + datetime.timedelta(minutes=1440) #set duration for token payload = {"user_id": f"{userRandomId}", "role": role, "validated": validated, "exp":timeLimit} token = jwt.encode(payload,settings.SECRET_KEY) message = f"Welcome to WasteCoin, your verification code is {code}" sms.sendsms(phoneNumber[1:],message) return_data = { "error": "0", "message": "The registration was successful, A verrification SMS has been sent", "token": f"{token.decode('UTF-8')}", "elapsed_time": f"{timeLimit}", } else: return_data = { "error":"2", "message": "Invalid Parameter" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) #User verfication @api_view(["POST"]) @autentication.token_required def user_verification(request,decrypedToken): try: otp_entered = request.data.get("otp",None) if otp_entered != None and otp_entered != "": user_data = otp.objects.get(user__user_id=decrypedToken['user_id']) otpCode,date_added = user_data.otp_code,user_data.date_added date_now = datetime.datetime.now(datetime.timezone.utc) duration = float((date_now - date_added).total_seconds()) timeLimit = 1800.0 #30 mins interval if otp_entered == otpCode and duration < timeLimit: #validate user user_data.validated = True user_data.save() return_data = { "error": "0", "message":"User Verified" } elif otp_entered != otpCode and duration < timeLimit: return_data = { "error": "1", "message": "Incorrect OTP" } elif otp_entered == otpCode and duration > timeLimit: return_data = { "error": "1", "message": "OTP has expired" } else: return_data = { "error": "2", "message": "Invalid Parameters" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) #resend OTP @api_view(["POST"]) def resend_otp(request): try: phone_number = request.data.get('phone_number',None) if phone_number != None and phone_number != "": if User.objects.filter(user_phone =phone_number).exists() == False: return_data = { "error": "1", "message": "User does not exist" } else: user_data = otp.objects.get(user__user_phone=phone_number) user = User.objects.get(user_phone=phone_number) #generate new otp code = string_generator.numeric(6) user_data.otp_code = code user_data.save() message = f"Welcome to WasteCoin, your verification code is {code}" sms.sendsms(phone_number[1:],message) timeLimit= datetime.datetime.utcnow() + datetime.timedelta(minutes=1440) #set limit for user payload = {"user_id": f'{user.user_id}', "role": user.role, "validated": user_data.validated, "exp":timeLimit} token = jwt.encode(payload,settings.SECRET_KEY) return_data = { "error": "0", "message": "OTP sent to phone number", "token": token.decode('UTF-8') } else: return_data = { "error": "2", "message": "Invalid Parameters" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) #User login @api_view(["POST"]) def user_login(request): try: email_phone = request.data.get("email_phone",None) password = request.data.get("password",None) field = [email_phone,password] if not None in field and not '' in field: validate_mail = validator.checkmail(email_phone) validate_phone = validator.checkphone(email_phone) if validate_mail == True: if User.objects.filter(email =email_phone).exists() == False: return_data = { "error": "1", "message": "User does not exist" } else: user_data = User.objects.get(email=email_phone) is_valid_password = password_functions.check_password_match(password,user_data.user_password) is_verified = otp.objects.get(user__user_phone=user_data.user_phone).validated #Generate token timeLimit= datetime.datetime.utcnow() + datetime.timedelta(minutes=1440) #set limit for user payload = {"user_id": f'{user_data.user_id}', "role": user_data.role, "validated": is_verified, "exp":timeLimit} token = jwt.encode(payload,settings.SECRET_KEY) if is_valid_password and is_verified: return_data = { "error": "0", "message": "Successfull", "token": token.decode('UTF-8'), "token-expiration": f"{timeLimit}", "user_details": [ { "firstname": f"{user_data.firstname}", "lastname": f"{user_data.lastname}", "email": f"{user_data.email}", "phone_number": f"{user_data.user_phone}", "gender": f"{user_data.user_gender}", "address": f"{user_data.user_address}", "state": f"{user_data.user_state}", "LGA": f"{user_data.user_LGA}", "country": f"{user_data.user_country}" } ] } elif is_verified == False: return_data = { "error" : "1", "message": "User is not verified", "token": token.decode('UTF-8') } else: return_data = { "error" : "1", "message" : "Wrong Password" } elif validate_phone == True: if User.objects.filter(user_phone =email_phone).exists() == False: return_data = { "error": "1", "message": "User does not exist" } else: user_data = User.objects.get(user_phone=email_phone) is_verified = otp.objects.get(user__user_phone=user_data.user_phone).validated is_valid_password = password_functions.check_password_match(password,user_data.user_password) #Generate token timeLimit= datetime.datetime.utcnow() + datetime.timedelta(minutes=1440) #set limit for user payload = {"user_id": f'{user_data.user_id}', "validated": is_verified, "role": user_data.role, "exp":timeLimit} token = jwt.encode(payload,settings.SECRET_KEY) if is_valid_password and is_verified: return_data = { "error": "0", "message": "Successfull", "token": token.decode('UTF-8'), "token-expiration": f"{timeLimit}", "user_details": [ { "firstname": f"{user_data.firstname}", "lastname": f"{user_data.lastname}", "email": f"{user_data.email}", "phone_number": f"{user_data.user_phone}", "gender": f"{user_data.user_gender}", "address": f"{user_data.user_address}", "state": f"{user_data.user_state}", "LGA": f"{user_data.user_LGA}", "country": f"{user_data.user_country}" } ] } elif is_verified == False: return_data = { "error" : "1", "message": "User is not verified", "token": token.decode('UTF-8') } else: return_data = { "error" : "1", "message" : "Wrong Password" } else: return_data = { "error": "2", "message": "Email or Phone Number is Invalid" } else: return_data = { "error" : "2", "message" : "Invalid Parameters" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["POST"]) def password_reset(request): try: phone_number = request.data.get('phone_number',None) if phone_number != None and phone_number != "": if User.objects.filter(user_phone =phone_number).exists() == False: return_data = { "error": "1", "message": "User does not exist" } else: user_data = otp.objects.get(user__user_phone=phone_number) user = User.objects.get(user_phone=phone_number) generate_pin = string_generator.alphanumeric(15) user_data.password_reset_code = generate_pin user_data.save() message = f"Welcome to WasteCoin, your password reset code is {generate_pin}" sms.sendsms(phone_number[1:],message) timeLimit= datetime.datetime.utcnow() + datetime.timedelta(minutes=1440) #set limit for user payload = {"user_id": f'{user.user_id}', "role": user.role, "validated": user_data.validated, "exp":timeLimit} token = jwt.encode(payload,settings.SECRET_KEY) return_data = { "error": "0", "message": "Successful, reset code sent to Phone Number", "token": token.decode('UTF-8') } else: return_data = { "error": "2", "message": "Invalid Parameter" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) #Change password @api_view(["POST"]) @autentication.token_required def password_change(request,decrypedToken): try: reset_code = request.data.get("reset_code",None) new_password = request.data.get("new_password",None) fields = [reset_code,new_password] if not None in fields and not "" in fields: #get user info user_data = User.objects.get(user_id=decrypedToken["user_id"]) otp_reset_code = otp.objects.get(user__user_id=decrypedToken["user_id"]).password_reset_code print(otp_reset_code) if reset_code == otp_reset_code: #encrypt password encryptpassword = password_functions.generate_password_hash(new_password) user_data.user_password = <PASSWORD> user_data.save() return_data = { "error": "0", "message": "Successfull, Password Changed" } elif reset_code != otp_reset_code: return_data = { "error": "1", "message": "Code does not Match" } else: return_data = { "error": "2", "message": "Invalid Parameters" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["GET"]) @autentication.token_required def Dashboard(request,decrypedToken): try: user_id = decrypedToken['user_id'] if user_id != None and user_id != '': total_wastecoin = fixed_var.backallocation rate_exchange = fixed_var.exchange_rate rate_changed = fixed_var.changed_rate month = datetime.datetime.now().strftime('%B') total_minedCoins = UserTrasactionHistory.objects.filter(transaction="Credit").aggregate(Sum('amount'))['amount__sum'] total_unminedCoins = total_wastecoin - total_minedCoins #Get Percentage percent_of_Usermined_coins = round((total_minedCoins/(total_wastecoin))*100) percent_of_Userunmined_coins = round((total_unminedCoins/(total_wastecoin))*100) WasteCoinBoard = UserTrasactionHistory.objects.filter(transaction='Credit').distinct('amount').order_by('-amount') i = 0 numberOfUsers = 5 topCoinsMined = [] while i < len(WasteCoinBoard): topUsers = { "miner_id": UserCoins.objects.get(user__user_id=WasteCoinBoard[i].user.user_id).minerID, "CoinMined": WasteCoinBoard[i].amount } topCoinsMined.append(topUsers) i += 1 return_data = { "error": "0", "message": "Sucessfull", "data": { "allocatedWasteCoin": total_wastecoin, "month": month, "exchangeRate": rate_exchange, "changedRate": rate_changed, "totalWasteCoinMined": total_minedCoins, "totalWasteCoinUnmined": total_unminedCoins, "summary": { "totalWasteCoinMinedPercentage": percent_of_Usermined_coins, "totalWasteCoinUnMinedPercentage": percent_of_Userunmined_coins }, "leaderBoard": topCoinsMined } } else: return_data = { "error": "2", "message": "Invalid Parameter" } except Exception as e: return_data = { "error": "3", "message": str(e) } return Response(return_data) #Check leaderboard @api_view(["GET"]) def LeadBoard(request): try: WasteCoinBoard = UserCoins.objects.all().order_by('-minedCoins') i = 0 topCoinsMined = [] numberOfUsers = 2 while i < len(WasteCoinBoard): topUsers = { "miner_id": WasteCoinBoard[i].minerID, "CoinMined": UserCoins.objects.get(user__user_id=WasteCoinBoard[i].user.user_id).minedCoins } topCoinsMined.append(topUsers) i += 1 return_data = { "error": "0", "message": "Successfull", "LeaderBoard": topCoinsMined } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["GET"]) @autentication.token_required def user_profile(request,decrypedToken): try: userID = decrypedToken['user_id'] UserInfo = User.objects.get(user_id=userID) UserCoin = UserCoins.objects.get(user__user_id=userID) #verify if user have account account_info = AccountDetails.objects.filter(user__user_id=decrypedToken['user_id']).exists() if account_info == True: account = AccountDetails.objects.get(user__user_id=decrypedToken['user_id']) account_details = { "account_name": account.account_name, "account_number": account.account_number, "bank_name": account.bank_name } else: account_details = { "account_name": None, "account_number": None, "bank_name": None } if decrypedToken['role'] == 'user': UserInfo = User.objects.get(user_id=userID) UserCoin = UserCoins.objects.get(user__user_id=userID) return_data = { "error": "0", "message": "Successfull", "data": { "user_details": { "first_name": f"{UserInfo.firstname}", "last_name": f"{UserInfo.lastname}", "email": f"{UserInfo.email}", "phone_number": f"{UserInfo.user_phone}", "gender": f"{UserInfo.user_gender}", "address": f"{UserInfo.user_address}", "state": f"{UserInfo.user_state}", "LGA": f"{UserInfo.user_LGA}", "country": f"{UserInfo.user_country}", "role": f"{UserInfo.role}" } , "user_coins": { "miner_id": f"{UserCoin.minerID}", "mined_coins": f"{UserCoin.minedCoins}", "redeemed_coins": f"{UserCoin.redeemedWasteCoin}", }, "account_information": account_details } } else: UserInfo = User.objects.get(user_id=userID) AgentCoin = AgentCoins.objects.get(agent__user_id=userID) return_data = { "error": "0", "message": "Successfull", "data": { "user_details": { "first_name": f"{UserInfo.firstname}", "last_name": f"{UserInfo.lastname}", "email": f"{UserInfo.email}", "phone_number": f"{UserInfo.user_phone}", "gender": f"{UserInfo.user_gender}", "address": f"{UserInfo.user_address}", "state": f"{UserInfo.user_state}", "LGA": f"{UserInfo.user_LGA}", "country": f"{UserInfo.user_country}", "role": f"{UserInfo.role}" }, "agent_coins": f"{AgentCoin.agentCoins}", "account_information": account_details } } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["GET"]) @autentication.token_required def wallet_details(request,decrypedToken): try: userID = decrypedToken['user_id'] trasactions = [] if decrypedToken["role"] == "user": i = 0 transaction_history = UserTrasactionHistory.objects.filter(user__user_id=userID) numOfTransactions = len(transaction_history) user_coins = UserCoins.objects.get(user__user_id=userID) while i < numOfTransactions: perTransaction = { "date": transaction_history[i].date_added.strftime("%Y-%m-%d"), "amount": transaction_history[i].amount, "transaction": transaction_history[i].transaction } trasactions.append(perTransaction) i += 1 return_data = { "error": "0", "message": "Successfull", "data": { "current_balance": f"{user_coins.minedCoins}", "transaction_history": trasactions[1:][::-1] } } else: i = 0 transaction_history = AgentTransactionHistory.objects.filter(agent__user_id=userID) numOfTransactions = len(transaction_history) agent_coins = AgentCoins.objects.get(agent__user_id=userID) while i < numOfTransactions: perTransaction = { "date": transaction_history[i].date_added.strftime("%Y-%m-%d"), "amount": transaction_history[i].amount, "transaction" : transaction_history[i].transaction, "miner_id": transaction_history[i].coin_allocated_to } trasactions.append(perTransaction) i +=1 return_data = { "error": "0", "message": "Successfull", "data": { "current_balance": f"{agent_coins.agentCoins}", "transaction_history": trasactions[::-1] } } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["POST"]) @autentication.token_required def redeemcoins(request,decrypedToken): try: coins_amount = request.data.get("amount",None) if coins_amount != None and coins_amount != "": coins_amount = float(coins_amount) if coins_amount == float(0) or coins_amount < float(0): return_data = { "error": 2, "message": "Number is negative or zero" } else: user_coins = UserCoins.objects.get(user__user_id=decrypedToken["user_id"]) exchange_rate = fixed_var.exchange_rate numofCoins = user_coins.minedCoins user_data = User.objects.get(user_id=decrypedToken["user_id"]) if coins_amount > numofCoins: return_data = { "error": "1", "message": "Not enough coins" } else: transactionid = string_generator.alphanumeric(15) toNaira = exchange_rate * coins_amount user_coins.minedCoins = numofCoins - coins_amount user_coins.redeemedWasteCoin = coins_amount user_coins.save() #Save Transaction transaction = UserTrasactionHistory(user=user_data,transaction_id=transactionid, amount=coins_amount,coin_redeemed_amount=toNaira,transaction="Debit") transaction.save() #Add coin to the coin repository return_data = { "error": "0", "message": "Successful, Coin Mined", "transaction_id": f"{transactionid}", "amount": f"{toNaira}" } else: return_data = { "error": 2, "message": "Invalid Parameter" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["POST"]) @autentication.token_required def allocate_coins(request,decrypedToken): try: coins_allocated = float(request.data.get("coins_allocated",None)) user_MinerID = request.data.get("miner_id",None) field = [coins_allocated,user_MinerID] if not None in field and not "" in field: if UserCoins.objects.filter(minerID=user_MinerID).exists() == False: return_data = { "error": "1", "message": "User does not exist" } elif User.objects.get(user_id= decrypedToken['user_id']).role != "agent": return_data = { "error": "2", "message": "Unauthorized User" } else: agent_coins = AgentCoins.objects.get(agent__user_id=decrypedToken["user_id"]).agentCoins if coins_allocated > agent_coins: return_data = { "error": "2", "message": "Not enough coins" } else: wastecoin_user = UserCoins.objects.get(minerID=user_MinerID) user = wastecoin_user.user agent_user = User.objects.get(user_id= decrypedToken['user_id']) agent_coins = AgentCoins.objects.get(agent__user_id=decrypedToken["user_id"]) user_coins = UserCoins.objects.get(user__user_id=user.user_id) string_generator.alphanumeric(15) #allocate Coin to user remaining_coins =agent_coins.agentCoins - coins_allocated agent_coins.agentCoins = remaining_coins #Debit_agent withdrawl= AgentTransactionHistory(agent=agent_user,transaction_id=string_generator.alphanumeric(15),amount=coins_allocated, coin_allocated_to=user_MinerID,transaction="Debit") agent_coins.save() withdrawl.save() #credit User add_coins = user_coins.minedCoins + coins_allocated user_coins.minedCoins = add_coins allocate = UserTrasactionHistory(user=user,transaction_id=string_generator.alphanumeric(15), amount=coins_allocated,transaction="Credit") user_coins.save() allocate.save() return_data = { "error": "0", "message": f"Successful,coins allocated to {user.firstname} {user.lastname}", "current_balance": f"{remaining_coins}" } else: return_data = { "error": "2", "message": "Invalid Parameters" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["POST"]) @autentication.token_required def changepassword(request,decryptedToken): try: old_password = request.data.get("old_password",None) new_password = request.data.get("new_password",None) field = [old_password,new_password] if not None in field and not "" in field: user_data = User.objects.get(user_id=decryptedToken["user_id"]) is_valid_password = password_functions.check_password_match(old_password,user_data.user_password) if is_valid_password == False: return_data = { "error": "2", "message": "Password is Incorrect" } else: #decrypt password encryptpassword = password_functions.generate_password_hash(new_password) user_data.user_password = <PASSWORD> user_data.save() return_data = { "error": "0", "message": "Successfull, Password Changed" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["PUT"]) @autentication.token_required def update_info(request,decryptedToken): try: address = request.data.get("address",None) state = request.data.get("state",None) user_lga = request.data.get("lga",None) field = [address,state,user_lga] if not None in field and not "" in field: print(decryptedToken["user_id"]) user_data = User.objects.get(user_id=decryptedToken["user_id"]) user_data.user_address = address user_data.user_state = state user_data.user_LGA = user_lga user_data.save() return_data = { "error": "0", "message": "Successfully Updated", "data": { "address": address, "state": state, "lga": user_lga } } else: return_data = { "error": "2", "message": "Invalid Parameter" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["POST","PUT"]) @autentication.token_required def account_details(request,decryptedToken): try: accountName = request.data.get("account_name",None) accountNumber = request.data.get("account_number",None) bankName = request.data.get("bank_name",None) field = [accountName,accountNumber,bankName] if not None in field and not "" in field: user_data = User.objects.get(user_id=decryptedToken['user_id']) if AccountDetails.objects.filter(user__user_id=decryptedToken['user_id']).exists(): user_account = AccountDetails.objects.get(user__user_id=decryptedToken['user_id']) user_account.account_number = accountNumber user_account.account_name = accountName user_account.bank_name = bankName user_account.save() return_data = { "error": "0", "message": "Account saved successfully", "data": { "account_name": accountName, "account_number": accountNumber, "bank_name": bankName } } else: user_account = AccountDetails(user=user_data,account_name=accountName, account_number=accountNumber,bank_name=bankName) user_account.save() return_data = { "error": "0", "message": "Account saved successfully", "data": { "account_name": accountName, "account_number": accountNumber, "bank_name": bankName } } else: return_data = { "error": "2", "message": "Invalid Parameter" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["POST"]) def contact_us(request): try: fullName = request.data.get('full_name',None) Email = request.data.get('email',None) phoneNumber = request.data.get('phone_number',None) Message = request.data.get('message',None) field = [fullName,Email,Message] if not None in field and not "" in field: if phoneNumber == None or phoneNumber == "": contact_response = ContactUs(full_name=fullName,email=Email,message=Message) contact_response.save() return_data = { "error": "0", "message": "Your response have been saved successfully" } else: contact_response = ContactUs(full_name=fullName,email=Email,phone_number=phoneNumber,message=Message) contact_response.save() return_data = { "error": "0", "message": "Your response have been saved successfully" } else: return_data = { "error": "2", "message": "Invalid Parameters" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) #
api/views.py
import datetime import jwt from api.models import (AccountDetails, AgentCoins, AgentTransactionHistory, ContactUs, User, UserCoins, UserTrasactionHistory, otp) from CustomCode import (autentication, fixed_var, password_functions, sms, string_generator, validator) from django.db.models import Sum from rest_framework.decorators import api_view from rest_framework.response import Response from wasteCoin import settings # Create your views here. @api_view(['GET']) def index_page(request): return_data = { "error" : "0", "message" : "Successful" } return Response(return_data) @api_view(["POST"]) def user_registration(request): try: firstName = request.data.get('firstname',None) lastName = request.data.get('lastname',None) phoneNumber = request.data.get('phonenumber',None) email = request.data.get('email',None) gender = request.data.get('gender',None) password = request.data.get('password',None) address = request.data.get('address',None) lga = request.data.get('lga',None) state = request.data.get('state',None) country = request.data.get('country',None) reg_field = [firstName,lastName,phoneNumber,email,password,address,lga,state,country] if not None in reg_field and not "" in reg_field: if User.objects.filter(user_phone =phoneNumber).exists() or User.objects.filter(email =email).exists(): return_data = { "error": "1", "message": "User Exists" } elif validator.checkmail(email) == False or validator.checkphone(phoneNumber)== False: return_data = { "error": "1", "message": "Email or Phone number is Invalid" } else: #generate user_id userRandomId = string_generator.alphanumeric(20) miner_id = string_generator.numeric(7) transactionid = string_generator.alphanumeric(15) #encrypt password encryped_password = password_functions.generate_password_hash(password) #Save user_data new_userData = User(user_id=userRandomId,firstname=firstName,lastname=lastName, email=email,user_phone=phoneNumber,user_gender=gender, user_password=<PASSWORD>,user_address=address, user_state=state,user_LGA=lga,user_country=country) new_userData.save() #Generate OTP code = string_generator.numeric(6) #Save OTP user_OTP =otp(user=new_userData,otp_code=code) user_OTP.save() #Generate default coins user_Coins = UserCoins(user=new_userData,minerID=miner_id,redeemedWasteCoin=0,minedCoins=0) user_Coins.save() #Save Transaction Details user_transaction = UserTrasactionHistory(user=new_userData,transaction_id=transactionid, amount=0,coin_redeemed_amount=0,transaction="Credit") user_transaction.save() role = User.objects.get(user_id=userRandomId).role validated = otp.objects.get(user__user_id=userRandomId).validated #Generate token timeLimit= datetime.datetime.utcnow() + datetime.timedelta(minutes=1440) #set duration for token payload = {"user_id": f"{userRandomId}", "role": role, "validated": validated, "exp":timeLimit} token = jwt.encode(payload,settings.SECRET_KEY) message = f"Welcome to WasteCoin, your verification code is {code}" sms.sendsms(phoneNumber[1:],message) return_data = { "error": "0", "message": "The registration was successful, A verrification SMS has been sent", "token": f"{token.decode('UTF-8')}", "elapsed_time": f"{timeLimit}", } else: return_data = { "error":"2", "message": "Invalid Parameter" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) #User verfication @api_view(["POST"]) @autentication.token_required def user_verification(request,decrypedToken): try: otp_entered = request.data.get("otp",None) if otp_entered != None and otp_entered != "": user_data = otp.objects.get(user__user_id=decrypedToken['user_id']) otpCode,date_added = user_data.otp_code,user_data.date_added date_now = datetime.datetime.now(datetime.timezone.utc) duration = float((date_now - date_added).total_seconds()) timeLimit = 1800.0 #30 mins interval if otp_entered == otpCode and duration < timeLimit: #validate user user_data.validated = True user_data.save() return_data = { "error": "0", "message":"User Verified" } elif otp_entered != otpCode and duration < timeLimit: return_data = { "error": "1", "message": "Incorrect OTP" } elif otp_entered == otpCode and duration > timeLimit: return_data = { "error": "1", "message": "OTP has expired" } else: return_data = { "error": "2", "message": "Invalid Parameters" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) #resend OTP @api_view(["POST"]) def resend_otp(request): try: phone_number = request.data.get('phone_number',None) if phone_number != None and phone_number != "": if User.objects.filter(user_phone =phone_number).exists() == False: return_data = { "error": "1", "message": "User does not exist" } else: user_data = otp.objects.get(user__user_phone=phone_number) user = User.objects.get(user_phone=phone_number) #generate new otp code = string_generator.numeric(6) user_data.otp_code = code user_data.save() message = f"Welcome to WasteCoin, your verification code is {code}" sms.sendsms(phone_number[1:],message) timeLimit= datetime.datetime.utcnow() + datetime.timedelta(minutes=1440) #set limit for user payload = {"user_id": f'{user.user_id}', "role": user.role, "validated": user_data.validated, "exp":timeLimit} token = jwt.encode(payload,settings.SECRET_KEY) return_data = { "error": "0", "message": "OTP sent to phone number", "token": token.decode('UTF-8') } else: return_data = { "error": "2", "message": "Invalid Parameters" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) #User login @api_view(["POST"]) def user_login(request): try: email_phone = request.data.get("email_phone",None) password = request.data.get("password",None) field = [email_phone,password] if not None in field and not '' in field: validate_mail = validator.checkmail(email_phone) validate_phone = validator.checkphone(email_phone) if validate_mail == True: if User.objects.filter(email =email_phone).exists() == False: return_data = { "error": "1", "message": "User does not exist" } else: user_data = User.objects.get(email=email_phone) is_valid_password = password_functions.check_password_match(password,user_data.user_password) is_verified = otp.objects.get(user__user_phone=user_data.user_phone).validated #Generate token timeLimit= datetime.datetime.utcnow() + datetime.timedelta(minutes=1440) #set limit for user payload = {"user_id": f'{user_data.user_id}', "role": user_data.role, "validated": is_verified, "exp":timeLimit} token = jwt.encode(payload,settings.SECRET_KEY) if is_valid_password and is_verified: return_data = { "error": "0", "message": "Successfull", "token": token.decode('UTF-8'), "token-expiration": f"{timeLimit}", "user_details": [ { "firstname": f"{user_data.firstname}", "lastname": f"{user_data.lastname}", "email": f"{user_data.email}", "phone_number": f"{user_data.user_phone}", "gender": f"{user_data.user_gender}", "address": f"{user_data.user_address}", "state": f"{user_data.user_state}", "LGA": f"{user_data.user_LGA}", "country": f"{user_data.user_country}" } ] } elif is_verified == False: return_data = { "error" : "1", "message": "User is not verified", "token": token.decode('UTF-8') } else: return_data = { "error" : "1", "message" : "Wrong Password" } elif validate_phone == True: if User.objects.filter(user_phone =email_phone).exists() == False: return_data = { "error": "1", "message": "User does not exist" } else: user_data = User.objects.get(user_phone=email_phone) is_verified = otp.objects.get(user__user_phone=user_data.user_phone).validated is_valid_password = password_functions.check_password_match(password,user_data.user_password) #Generate token timeLimit= datetime.datetime.utcnow() + datetime.timedelta(minutes=1440) #set limit for user payload = {"user_id": f'{user_data.user_id}', "validated": is_verified, "role": user_data.role, "exp":timeLimit} token = jwt.encode(payload,settings.SECRET_KEY) if is_valid_password and is_verified: return_data = { "error": "0", "message": "Successfull", "token": token.decode('UTF-8'), "token-expiration": f"{timeLimit}", "user_details": [ { "firstname": f"{user_data.firstname}", "lastname": f"{user_data.lastname}", "email": f"{user_data.email}", "phone_number": f"{user_data.user_phone}", "gender": f"{user_data.user_gender}", "address": f"{user_data.user_address}", "state": f"{user_data.user_state}", "LGA": f"{user_data.user_LGA}", "country": f"{user_data.user_country}" } ] } elif is_verified == False: return_data = { "error" : "1", "message": "User is not verified", "token": token.decode('UTF-8') } else: return_data = { "error" : "1", "message" : "Wrong Password" } else: return_data = { "error": "2", "message": "Email or Phone Number is Invalid" } else: return_data = { "error" : "2", "message" : "Invalid Parameters" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["POST"]) def password_reset(request): try: phone_number = request.data.get('phone_number',None) if phone_number != None and phone_number != "": if User.objects.filter(user_phone =phone_number).exists() == False: return_data = { "error": "1", "message": "User does not exist" } else: user_data = otp.objects.get(user__user_phone=phone_number) user = User.objects.get(user_phone=phone_number) generate_pin = string_generator.alphanumeric(15) user_data.password_reset_code = generate_pin user_data.save() message = f"Welcome to WasteCoin, your password reset code is {generate_pin}" sms.sendsms(phone_number[1:],message) timeLimit= datetime.datetime.utcnow() + datetime.timedelta(minutes=1440) #set limit for user payload = {"user_id": f'{user.user_id}', "role": user.role, "validated": user_data.validated, "exp":timeLimit} token = jwt.encode(payload,settings.SECRET_KEY) return_data = { "error": "0", "message": "Successful, reset code sent to Phone Number", "token": token.decode('UTF-8') } else: return_data = { "error": "2", "message": "Invalid Parameter" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) #Change password @api_view(["POST"]) @autentication.token_required def password_change(request,decrypedToken): try: reset_code = request.data.get("reset_code",None) new_password = request.data.get("new_password",None) fields = [reset_code,new_password] if not None in fields and not "" in fields: #get user info user_data = User.objects.get(user_id=decrypedToken["user_id"]) otp_reset_code = otp.objects.get(user__user_id=decrypedToken["user_id"]).password_reset_code print(otp_reset_code) if reset_code == otp_reset_code: #encrypt password encryptpassword = password_functions.generate_password_hash(new_password) user_data.user_password = <PASSWORD> user_data.save() return_data = { "error": "0", "message": "Successfull, Password Changed" } elif reset_code != otp_reset_code: return_data = { "error": "1", "message": "Code does not Match" } else: return_data = { "error": "2", "message": "Invalid Parameters" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["GET"]) @autentication.token_required def Dashboard(request,decrypedToken): try: user_id = decrypedToken['user_id'] if user_id != None and user_id != '': total_wastecoin = fixed_var.backallocation rate_exchange = fixed_var.exchange_rate rate_changed = fixed_var.changed_rate month = datetime.datetime.now().strftime('%B') total_minedCoins = UserTrasactionHistory.objects.filter(transaction="Credit").aggregate(Sum('amount'))['amount__sum'] total_unminedCoins = total_wastecoin - total_minedCoins #Get Percentage percent_of_Usermined_coins = round((total_minedCoins/(total_wastecoin))*100) percent_of_Userunmined_coins = round((total_unminedCoins/(total_wastecoin))*100) WasteCoinBoard = UserTrasactionHistory.objects.filter(transaction='Credit').distinct('amount').order_by('-amount') i = 0 numberOfUsers = 5 topCoinsMined = [] while i < len(WasteCoinBoard): topUsers = { "miner_id": UserCoins.objects.get(user__user_id=WasteCoinBoard[i].user.user_id).minerID, "CoinMined": WasteCoinBoard[i].amount } topCoinsMined.append(topUsers) i += 1 return_data = { "error": "0", "message": "Sucessfull", "data": { "allocatedWasteCoin": total_wastecoin, "month": month, "exchangeRate": rate_exchange, "changedRate": rate_changed, "totalWasteCoinMined": total_minedCoins, "totalWasteCoinUnmined": total_unminedCoins, "summary": { "totalWasteCoinMinedPercentage": percent_of_Usermined_coins, "totalWasteCoinUnMinedPercentage": percent_of_Userunmined_coins }, "leaderBoard": topCoinsMined } } else: return_data = { "error": "2", "message": "Invalid Parameter" } except Exception as e: return_data = { "error": "3", "message": str(e) } return Response(return_data) #Check leaderboard @api_view(["GET"]) def LeadBoard(request): try: WasteCoinBoard = UserCoins.objects.all().order_by('-minedCoins') i = 0 topCoinsMined = [] numberOfUsers = 2 while i < len(WasteCoinBoard): topUsers = { "miner_id": WasteCoinBoard[i].minerID, "CoinMined": UserCoins.objects.get(user__user_id=WasteCoinBoard[i].user.user_id).minedCoins } topCoinsMined.append(topUsers) i += 1 return_data = { "error": "0", "message": "Successfull", "LeaderBoard": topCoinsMined } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["GET"]) @autentication.token_required def user_profile(request,decrypedToken): try: userID = decrypedToken['user_id'] UserInfo = User.objects.get(user_id=userID) UserCoin = UserCoins.objects.get(user__user_id=userID) #verify if user have account account_info = AccountDetails.objects.filter(user__user_id=decrypedToken['user_id']).exists() if account_info == True: account = AccountDetails.objects.get(user__user_id=decrypedToken['user_id']) account_details = { "account_name": account.account_name, "account_number": account.account_number, "bank_name": account.bank_name } else: account_details = { "account_name": None, "account_number": None, "bank_name": None } if decrypedToken['role'] == 'user': UserInfo = User.objects.get(user_id=userID) UserCoin = UserCoins.objects.get(user__user_id=userID) return_data = { "error": "0", "message": "Successfull", "data": { "user_details": { "first_name": f"{UserInfo.firstname}", "last_name": f"{UserInfo.lastname}", "email": f"{UserInfo.email}", "phone_number": f"{UserInfo.user_phone}", "gender": f"{UserInfo.user_gender}", "address": f"{UserInfo.user_address}", "state": f"{UserInfo.user_state}", "LGA": f"{UserInfo.user_LGA}", "country": f"{UserInfo.user_country}", "role": f"{UserInfo.role}" } , "user_coins": { "miner_id": f"{UserCoin.minerID}", "mined_coins": f"{UserCoin.minedCoins}", "redeemed_coins": f"{UserCoin.redeemedWasteCoin}", }, "account_information": account_details } } else: UserInfo = User.objects.get(user_id=userID) AgentCoin = AgentCoins.objects.get(agent__user_id=userID) return_data = { "error": "0", "message": "Successfull", "data": { "user_details": { "first_name": f"{UserInfo.firstname}", "last_name": f"{UserInfo.lastname}", "email": f"{UserInfo.email}", "phone_number": f"{UserInfo.user_phone}", "gender": f"{UserInfo.user_gender}", "address": f"{UserInfo.user_address}", "state": f"{UserInfo.user_state}", "LGA": f"{UserInfo.user_LGA}", "country": f"{UserInfo.user_country}", "role": f"{UserInfo.role}" }, "agent_coins": f"{AgentCoin.agentCoins}", "account_information": account_details } } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["GET"]) @autentication.token_required def wallet_details(request,decrypedToken): try: userID = decrypedToken['user_id'] trasactions = [] if decrypedToken["role"] == "user": i = 0 transaction_history = UserTrasactionHistory.objects.filter(user__user_id=userID) numOfTransactions = len(transaction_history) user_coins = UserCoins.objects.get(user__user_id=userID) while i < numOfTransactions: perTransaction = { "date": transaction_history[i].date_added.strftime("%Y-%m-%d"), "amount": transaction_history[i].amount, "transaction": transaction_history[i].transaction } trasactions.append(perTransaction) i += 1 return_data = { "error": "0", "message": "Successfull", "data": { "current_balance": f"{user_coins.minedCoins}", "transaction_history": trasactions[1:][::-1] } } else: i = 0 transaction_history = AgentTransactionHistory.objects.filter(agent__user_id=userID) numOfTransactions = len(transaction_history) agent_coins = AgentCoins.objects.get(agent__user_id=userID) while i < numOfTransactions: perTransaction = { "date": transaction_history[i].date_added.strftime("%Y-%m-%d"), "amount": transaction_history[i].amount, "transaction" : transaction_history[i].transaction, "miner_id": transaction_history[i].coin_allocated_to } trasactions.append(perTransaction) i +=1 return_data = { "error": "0", "message": "Successfull", "data": { "current_balance": f"{agent_coins.agentCoins}", "transaction_history": trasactions[::-1] } } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["POST"]) @autentication.token_required def redeemcoins(request,decrypedToken): try: coins_amount = request.data.get("amount",None) if coins_amount != None and coins_amount != "": coins_amount = float(coins_amount) if coins_amount == float(0) or coins_amount < float(0): return_data = { "error": 2, "message": "Number is negative or zero" } else: user_coins = UserCoins.objects.get(user__user_id=decrypedToken["user_id"]) exchange_rate = fixed_var.exchange_rate numofCoins = user_coins.minedCoins user_data = User.objects.get(user_id=decrypedToken["user_id"]) if coins_amount > numofCoins: return_data = { "error": "1", "message": "Not enough coins" } else: transactionid = string_generator.alphanumeric(15) toNaira = exchange_rate * coins_amount user_coins.minedCoins = numofCoins - coins_amount user_coins.redeemedWasteCoin = coins_amount user_coins.save() #Save Transaction transaction = UserTrasactionHistory(user=user_data,transaction_id=transactionid, amount=coins_amount,coin_redeemed_amount=toNaira,transaction="Debit") transaction.save() #Add coin to the coin repository return_data = { "error": "0", "message": "Successful, Coin Mined", "transaction_id": f"{transactionid}", "amount": f"{toNaira}" } else: return_data = { "error": 2, "message": "Invalid Parameter" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["POST"]) @autentication.token_required def allocate_coins(request,decrypedToken): try: coins_allocated = float(request.data.get("coins_allocated",None)) user_MinerID = request.data.get("miner_id",None) field = [coins_allocated,user_MinerID] if not None in field and not "" in field: if UserCoins.objects.filter(minerID=user_MinerID).exists() == False: return_data = { "error": "1", "message": "User does not exist" } elif User.objects.get(user_id= decrypedToken['user_id']).role != "agent": return_data = { "error": "2", "message": "Unauthorized User" } else: agent_coins = AgentCoins.objects.get(agent__user_id=decrypedToken["user_id"]).agentCoins if coins_allocated > agent_coins: return_data = { "error": "2", "message": "Not enough coins" } else: wastecoin_user = UserCoins.objects.get(minerID=user_MinerID) user = wastecoin_user.user agent_user = User.objects.get(user_id= decrypedToken['user_id']) agent_coins = AgentCoins.objects.get(agent__user_id=decrypedToken["user_id"]) user_coins = UserCoins.objects.get(user__user_id=user.user_id) string_generator.alphanumeric(15) #allocate Coin to user remaining_coins =agent_coins.agentCoins - coins_allocated agent_coins.agentCoins = remaining_coins #Debit_agent withdrawl= AgentTransactionHistory(agent=agent_user,transaction_id=string_generator.alphanumeric(15),amount=coins_allocated, coin_allocated_to=user_MinerID,transaction="Debit") agent_coins.save() withdrawl.save() #credit User add_coins = user_coins.minedCoins + coins_allocated user_coins.minedCoins = add_coins allocate = UserTrasactionHistory(user=user,transaction_id=string_generator.alphanumeric(15), amount=coins_allocated,transaction="Credit") user_coins.save() allocate.save() return_data = { "error": "0", "message": f"Successful,coins allocated to {user.firstname} {user.lastname}", "current_balance": f"{remaining_coins}" } else: return_data = { "error": "2", "message": "Invalid Parameters" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["POST"]) @autentication.token_required def changepassword(request,decryptedToken): try: old_password = request.data.get("old_password",None) new_password = request.data.get("new_password",None) field = [old_password,new_password] if not None in field and not "" in field: user_data = User.objects.get(user_id=decryptedToken["user_id"]) is_valid_password = password_functions.check_password_match(old_password,user_data.user_password) if is_valid_password == False: return_data = { "error": "2", "message": "Password is Incorrect" } else: #decrypt password encryptpassword = password_functions.generate_password_hash(new_password) user_data.user_password = <PASSWORD> user_data.save() return_data = { "error": "0", "message": "Successfull, Password Changed" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["PUT"]) @autentication.token_required def update_info(request,decryptedToken): try: address = request.data.get("address",None) state = request.data.get("state",None) user_lga = request.data.get("lga",None) field = [address,state,user_lga] if not None in field and not "" in field: print(decryptedToken["user_id"]) user_data = User.objects.get(user_id=decryptedToken["user_id"]) user_data.user_address = address user_data.user_state = state user_data.user_LGA = user_lga user_data.save() return_data = { "error": "0", "message": "Successfully Updated", "data": { "address": address, "state": state, "lga": user_lga } } else: return_data = { "error": "2", "message": "Invalid Parameter" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["POST","PUT"]) @autentication.token_required def account_details(request,decryptedToken): try: accountName = request.data.get("account_name",None) accountNumber = request.data.get("account_number",None) bankName = request.data.get("bank_name",None) field = [accountName,accountNumber,bankName] if not None in field and not "" in field: user_data = User.objects.get(user_id=decryptedToken['user_id']) if AccountDetails.objects.filter(user__user_id=decryptedToken['user_id']).exists(): user_account = AccountDetails.objects.get(user__user_id=decryptedToken['user_id']) user_account.account_number = accountNumber user_account.account_name = accountName user_account.bank_name = bankName user_account.save() return_data = { "error": "0", "message": "Account saved successfully", "data": { "account_name": accountName, "account_number": accountNumber, "bank_name": bankName } } else: user_account = AccountDetails(user=user_data,account_name=accountName, account_number=accountNumber,bank_name=bankName) user_account.save() return_data = { "error": "0", "message": "Account saved successfully", "data": { "account_name": accountName, "account_number": accountNumber, "bank_name": bankName } } else: return_data = { "error": "2", "message": "Invalid Parameter" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) @api_view(["POST"]) def contact_us(request): try: fullName = request.data.get('full_name',None) Email = request.data.get('email',None) phoneNumber = request.data.get('phone_number',None) Message = request.data.get('message',None) field = [fullName,Email,Message] if not None in field and not "" in field: if phoneNumber == None or phoneNumber == "": contact_response = ContactUs(full_name=fullName,email=Email,message=Message) contact_response.save() return_data = { "error": "0", "message": "Your response have been saved successfully" } else: contact_response = ContactUs(full_name=fullName,email=Email,phone_number=phoneNumber,message=Message) contact_response.save() return_data = { "error": "0", "message": "Your response have been saved successfully" } else: return_data = { "error": "2", "message": "Invalid Parameters" } except Exception: return_data = { "error": "3", "message": "An error occured" } return Response(return_data) #
0.283583
0.118921
from data_science_layer.reporting.abstract_report import AbstractReport from data_science_layer.pipeline.abstract_pipline import AbstractPipeline import pkg_resources import numpy as np import pandas as pd import matplotlib.pyplot as plt import seaborn as sns class RegressorCurves(AbstractReport): sub_folder = 'reports' log_y = False exp_y = False def report(self, pipeline: AbstractPipeline): # Set Directory path folder = '' path = pkg_resources.resource_filename('crcdal', 'cache/' + folder + '/' + self.sub_folder + '/') pkg_resources.ensure_directory(path) # Hist Train fig, ax = plt.subplots(figsize=(40, 40)) pipeline.train.hist(bins=100, ax=ax) fig.savefig(path + 'Hist_Train.png') # Hist Test fig, ax = plt.subplots(figsize=(40, 40)) pipeline.test.hist(bins=100, ax=ax) fig.savefig(path + 'Hist_Test.png') # Feature Results nrows = len(pipeline._ml_models) nrows = 2 if nrows == 1 else nrows ncols = 2 ncols = 2 ** pipeline.test_y.shape[1] if pipeline.test_y.shape[1] > 1 else ncols fig, axes = plt.subplots(nrows=nrows, ncols=ncols, sharex=False, sharey=False, figsize=(40, 10 * nrows)) fig2, axes2 = plt.subplots(nrows=nrows, ncols=ncols, sharex=False, sharey=False, figsize=(40, 10 * nrows)) for i, model in enumerate(pipeline.get_models()): name = model.short_name preds_y_train, _ = model.predict(pipeline.train) preds_y_test, _ = model.predict(pipeline.test) preds_y_train = pd.DataFrame(preds_y_train) preds_y_test = pd.DataFrame(preds_y_test) train_y = pd.DataFrame(pipeline.train_y) test_y = pd.DataFrame(pipeline.test_y) k = 0 for j in range(pipeline.test_y.shape[1]): try: sns.distplot(preds_y_test.iloc[:, j], label='predict', ax=axes[i, k]) sns.distplot(test_y.iloc[:, j], label='test', ax=axes[i, k]) axes[i, k].set_title('Distribution ' + str(name)) axes[i, k].legend() sns.regplot(test_y.iloc[:, j], preds_y_test.iloc[:, j], ax=axes[i, k + 1]) axes[i, k + 1].set_title('Scatter ' + str(name)) axes[i, k + 1].set_xlabel('Test') axes[i, k + 1].set_ylabel('Predict') sns.distplot(np.exp(preds_y_test.iloc[:, j]), label='predict', ax=axes2[i, k]) sns.distplot(np.exp(test_y.iloc[:, j]), label='test', ax=axes2[i, k]) axes2[i, k].set_title('Distribution ' + str(name)) axes2[i, k].legend() sns.regplot(np.exp(test_y.iloc[:, j]), np.exp(preds_y_test.iloc[:, j]), ax=axes2[i, k + 1]) axes2[i, k + 1].set_title('Scatter ' + str(name)) axes2[i, k + 1].set_xlabel('Test') axes2[i, k + 1].set_ylabel('Predict') except: # ExceptionTracking().log_exception('Result distributions plot failed', 'DCE_pipeline', 'NA') print('report error') k += 2 fig.savefig(path + 'result_distributions_log.png') fig2.savefig(path + 'result_distributions.png')
data_science_layer/reporting/regressor_curves.py
from data_science_layer.reporting.abstract_report import AbstractReport from data_science_layer.pipeline.abstract_pipline import AbstractPipeline import pkg_resources import numpy as np import pandas as pd import matplotlib.pyplot as plt import seaborn as sns class RegressorCurves(AbstractReport): sub_folder = 'reports' log_y = False exp_y = False def report(self, pipeline: AbstractPipeline): # Set Directory path folder = '' path = pkg_resources.resource_filename('crcdal', 'cache/' + folder + '/' + self.sub_folder + '/') pkg_resources.ensure_directory(path) # Hist Train fig, ax = plt.subplots(figsize=(40, 40)) pipeline.train.hist(bins=100, ax=ax) fig.savefig(path + 'Hist_Train.png') # Hist Test fig, ax = plt.subplots(figsize=(40, 40)) pipeline.test.hist(bins=100, ax=ax) fig.savefig(path + 'Hist_Test.png') # Feature Results nrows = len(pipeline._ml_models) nrows = 2 if nrows == 1 else nrows ncols = 2 ncols = 2 ** pipeline.test_y.shape[1] if pipeline.test_y.shape[1] > 1 else ncols fig, axes = plt.subplots(nrows=nrows, ncols=ncols, sharex=False, sharey=False, figsize=(40, 10 * nrows)) fig2, axes2 = plt.subplots(nrows=nrows, ncols=ncols, sharex=False, sharey=False, figsize=(40, 10 * nrows)) for i, model in enumerate(pipeline.get_models()): name = model.short_name preds_y_train, _ = model.predict(pipeline.train) preds_y_test, _ = model.predict(pipeline.test) preds_y_train = pd.DataFrame(preds_y_train) preds_y_test = pd.DataFrame(preds_y_test) train_y = pd.DataFrame(pipeline.train_y) test_y = pd.DataFrame(pipeline.test_y) k = 0 for j in range(pipeline.test_y.shape[1]): try: sns.distplot(preds_y_test.iloc[:, j], label='predict', ax=axes[i, k]) sns.distplot(test_y.iloc[:, j], label='test', ax=axes[i, k]) axes[i, k].set_title('Distribution ' + str(name)) axes[i, k].legend() sns.regplot(test_y.iloc[:, j], preds_y_test.iloc[:, j], ax=axes[i, k + 1]) axes[i, k + 1].set_title('Scatter ' + str(name)) axes[i, k + 1].set_xlabel('Test') axes[i, k + 1].set_ylabel('Predict') sns.distplot(np.exp(preds_y_test.iloc[:, j]), label='predict', ax=axes2[i, k]) sns.distplot(np.exp(test_y.iloc[:, j]), label='test', ax=axes2[i, k]) axes2[i, k].set_title('Distribution ' + str(name)) axes2[i, k].legend() sns.regplot(np.exp(test_y.iloc[:, j]), np.exp(preds_y_test.iloc[:, j]), ax=axes2[i, k + 1]) axes2[i, k + 1].set_title('Scatter ' + str(name)) axes2[i, k + 1].set_xlabel('Test') axes2[i, k + 1].set_ylabel('Predict') except: # ExceptionTracking().log_exception('Result distributions plot failed', 'DCE_pipeline', 'NA') print('report error') k += 2 fig.savefig(path + 'result_distributions_log.png') fig2.savefig(path + 'result_distributions.png')
0.42919
0.468243
import unittest import enum from test.asserting.policy import PolicyAssertion, get_fixture_path from vint.linting.level import Level from vint.linting.policy.prohibit_unused_variable import ProhibitUnusedVariable class Fixtures(enum.Enum): VALID_VIM_SCRIPT = get_fixture_path('prohibit_unused_variable_valid.vim') INVALID_VIM_SCRIPT = get_fixture_path('prohibit_unused_variable_invalid.vim') ISSUE_274 = get_fixture_path('prohibit_unused_variable_issue_274.vim') IGNORED_PATTERNS = get_fixture_path('prohibit_unused_variable_ignored_patterns.vim') README = get_fixture_path('prohibit_unused_variable_readme.vim') class TestProhibitUnusedVariable(PolicyAssertion, unittest.TestCase): def test_get_violation_if_found_when_file_is_valid(self): self.assertFoundNoViolations(Fixtures.VALID_VIM_SCRIPT.value, ProhibitUnusedVariable) def create_violation(self, line, column, path): return { 'name': 'ProhibitUnusedVariable', 'level': Level.WARNING, 'position': { 'line': line, 'column': column, 'path': path } } def test_get_violation_if_found_when_file_is_invalid(self): expected_violations = [ self.create_violation(2, 5, Fixtures.INVALID_VIM_SCRIPT.value), self.create_violation(4, 11, Fixtures.INVALID_VIM_SCRIPT.value), self.create_violation(7, 25, Fixtures.INVALID_VIM_SCRIPT.value), self.create_violation(7, 36, Fixtures.INVALID_VIM_SCRIPT.value), self.create_violation(11, 9, Fixtures.INVALID_VIM_SCRIPT.value), self.create_violation(12, 9, Fixtures.INVALID_VIM_SCRIPT.value), self.create_violation(15, 8, Fixtures.INVALID_VIM_SCRIPT.value), ] self.assertFoundViolationsEqual(Fixtures.INVALID_VIM_SCRIPT.value, ProhibitUnusedVariable, expected_violations) def test_issue_274(self): self.assertFoundNoViolations(Fixtures.ISSUE_274.value, ProhibitUnusedVariable) def test_ignored_patterns(self): expected_violations = [ self.create_violation(1, 5, Fixtures.IGNORED_PATTERNS.value), ] self.assertFoundViolationsEqual(Fixtures.IGNORED_PATTERNS.value, ProhibitUnusedVariable, expected_violations, policy_options={'ignored_patterns': ['_ignored$']}) def test_readme(self): self.assertFoundNoViolations(Fixtures.README.value, ProhibitUnusedVariable) if __name__ == '__main__': unittest.main()
test/integration/vint/linting/policy/test_prohibit_unused_variable.py
import unittest import enum from test.asserting.policy import PolicyAssertion, get_fixture_path from vint.linting.level import Level from vint.linting.policy.prohibit_unused_variable import ProhibitUnusedVariable class Fixtures(enum.Enum): VALID_VIM_SCRIPT = get_fixture_path('prohibit_unused_variable_valid.vim') INVALID_VIM_SCRIPT = get_fixture_path('prohibit_unused_variable_invalid.vim') ISSUE_274 = get_fixture_path('prohibit_unused_variable_issue_274.vim') IGNORED_PATTERNS = get_fixture_path('prohibit_unused_variable_ignored_patterns.vim') README = get_fixture_path('prohibit_unused_variable_readme.vim') class TestProhibitUnusedVariable(PolicyAssertion, unittest.TestCase): def test_get_violation_if_found_when_file_is_valid(self): self.assertFoundNoViolations(Fixtures.VALID_VIM_SCRIPT.value, ProhibitUnusedVariable) def create_violation(self, line, column, path): return { 'name': 'ProhibitUnusedVariable', 'level': Level.WARNING, 'position': { 'line': line, 'column': column, 'path': path } } def test_get_violation_if_found_when_file_is_invalid(self): expected_violations = [ self.create_violation(2, 5, Fixtures.INVALID_VIM_SCRIPT.value), self.create_violation(4, 11, Fixtures.INVALID_VIM_SCRIPT.value), self.create_violation(7, 25, Fixtures.INVALID_VIM_SCRIPT.value), self.create_violation(7, 36, Fixtures.INVALID_VIM_SCRIPT.value), self.create_violation(11, 9, Fixtures.INVALID_VIM_SCRIPT.value), self.create_violation(12, 9, Fixtures.INVALID_VIM_SCRIPT.value), self.create_violation(15, 8, Fixtures.INVALID_VIM_SCRIPT.value), ] self.assertFoundViolationsEqual(Fixtures.INVALID_VIM_SCRIPT.value, ProhibitUnusedVariable, expected_violations) def test_issue_274(self): self.assertFoundNoViolations(Fixtures.ISSUE_274.value, ProhibitUnusedVariable) def test_ignored_patterns(self): expected_violations = [ self.create_violation(1, 5, Fixtures.IGNORED_PATTERNS.value), ] self.assertFoundViolationsEqual(Fixtures.IGNORED_PATTERNS.value, ProhibitUnusedVariable, expected_violations, policy_options={'ignored_patterns': ['_ignored$']}) def test_readme(self): self.assertFoundNoViolations(Fixtures.README.value, ProhibitUnusedVariable) if __name__ == '__main__': unittest.main()
0.364438
0.331174
import designes as dsgn import characters as chr import random as rdm market_1 = False market_2 = False market_3 = False lvl = 0 print(dsgn.main_screen()) cvp = int(input()) if cvp != 1: print("ÇIKIŞ YAPILIYOR") while 1: print("""************************************************************************************************************ """) print(f"HP: {chr.hero.hp} AP: {chr.hero.ap} GOLD: {chr.hero.gold}") dsgn.choice_screen() #seçim ekranı: 1-taverna 2-market 3-büyücü 4-arena cvp = int(input()) if cvp == 1: dsgn.tavern_screen() #taverna sayfasına giriş print("""************************************************************************************************************ """) print(f"HP: {chr.hero.hp} AP: {chr.hero.ap} GOLD: {chr.hero.gold}") cvp = int(input()) if cvp == 1: if chr.hero.gold > 80: chr.hero.hp = chr.hero.hp + rdm.randint(10, 40) chr.hero.gold = chr.hero.gold-80 else: print("yeterli altının yok!") else: continue elif cvp == 2: dsgn.market_screen() #market sayfasına giriş print("""************************************************************************************************************ """) print(f"HP: {chr.hero.hp} AP: {chr.hero.ap} GOLD: {chr.hero.gold}") cvp = int(input()) if cvp == 1: if chr.hero.gold > 50 and market_1 == False: chr.hero.ap = chr.hero.ap + 15 chr.hero.gold = chr.hero.gold-50 market_1 =True else: print("yeterli altının yok!") elif cvp == 2: if chr.hero.gold > 150 and market_2 == False: chr.hero.ap = chr.hero.ap + 35 chr.hero.gold = chr.hero.gold - 150 market_2 = True else: print("yeterli altının yok!") elif cvp == 3: if chr.hero.gold > 300 and market_3 == False: chr.hero.hp = chr.hero.hp + 200 chr.hero.gold = chr.hero.gold - 300 market_3 = True else: print("yeterli altının yok!") else: pass continue elif cvp == 3: dsgn.magic_screen() #büyücü sayfasına giriş dsgn.durum() cvp = int(input()) if cvp == 1: if chr.hero.gold > 150: chr.hero.hp = chr.hero.hp + rdm.randint(50,100) chr.hero.gold = chr.hero.gold - 150 else: print("yeterli altının yok!") else: pass continue elif cvp == 4: dsgn.durum() dsgn.attack_wait_screen() #saldırı bekleme seçim ekranı while chr.monster.hp > 0 and chr.hero.hp > 0: cvp = int(input()) monster_cvp = rdm.randint(1, 4) if cvp == 1: if monster_cvp == 1: dsgn.durum() dsgn.attack_hero_miss_screen() print("ıskaladın") else: chr.monster.hp = chr.monster.hp - rdm.randint(0, chr.hero.ap) dsgn.durum() dsgn.attack_hero_action_screen() if chr.monster.hp < 0: chr.hero.gold = chr.hero.gold + chr.monster.gold elif cvp == 2: if monster_cvp == 2: dsgn.durum() dsgn.attack_hero_miss_screen() print("ıskaladın") else: chr.monster.hp = chr.monster.hp - rdm.randint(0, chr.hero.ap) dsgn.durum() dsgn.attack_hero_action_screen() if chr.monster.hp < 0: chr.hero.gold = chr.hero.gold + chr.monster.gold elif cvp == 3: if monster_cvp == 3: dsgn.durum() dsgn.attack_hero_miss_screen() print("ıskaladın") else: chr.monster.hp = chr.monster.hp - rdm.randint(0, chr.hero.ap) dsgn.durum() dsgn.attack_hero_action_screen() if chr.monster.hp < 0: chr.hero.gold = chr.hero.gold + chr.monster.gold else: chr.hero.hp += 20 monster_atack_chance = rdm.randint(1,4) if monster_atack_chance == 1: dsgn.durum() dsgn.attack_hero_miss_screen() print("Saldırıdan kurtuldun") else: dsgn.durum() dsgn.attack_hero_action_screen() chr.hero.hp -= rdm.randint(0,chr.monster.ap) print("Hasar aldın") if chr.hero.hp < 0: print("ÖLDÜN") break elif chr.monster.hp < 0: print("CANAVARI ÖLDÜRDÜN") lvl += 1 chr.monster.hp += 100 * (lvl * 0.5) chr.monster.gold += 40 * (lvl) chr.monster.ap += 40 * (lvl * 0.1) continue else: pass else: print("lütfen geçerli bir değer giriniz")
Python-Game_Spark-man/main.py
import designes as dsgn import characters as chr import random as rdm market_1 = False market_2 = False market_3 = False lvl = 0 print(dsgn.main_screen()) cvp = int(input()) if cvp != 1: print("ÇIKIŞ YAPILIYOR") while 1: print("""************************************************************************************************************ """) print(f"HP: {chr.hero.hp} AP: {chr.hero.ap} GOLD: {chr.hero.gold}") dsgn.choice_screen() #seçim ekranı: 1-taverna 2-market 3-büyücü 4-arena cvp = int(input()) if cvp == 1: dsgn.tavern_screen() #taverna sayfasına giriş print("""************************************************************************************************************ """) print(f"HP: {chr.hero.hp} AP: {chr.hero.ap} GOLD: {chr.hero.gold}") cvp = int(input()) if cvp == 1: if chr.hero.gold > 80: chr.hero.hp = chr.hero.hp + rdm.randint(10, 40) chr.hero.gold = chr.hero.gold-80 else: print("yeterli altının yok!") else: continue elif cvp == 2: dsgn.market_screen() #market sayfasına giriş print("""************************************************************************************************************ """) print(f"HP: {chr.hero.hp} AP: {chr.hero.ap} GOLD: {chr.hero.gold}") cvp = int(input()) if cvp == 1: if chr.hero.gold > 50 and market_1 == False: chr.hero.ap = chr.hero.ap + 15 chr.hero.gold = chr.hero.gold-50 market_1 =True else: print("yeterli altının yok!") elif cvp == 2: if chr.hero.gold > 150 and market_2 == False: chr.hero.ap = chr.hero.ap + 35 chr.hero.gold = chr.hero.gold - 150 market_2 = True else: print("yeterli altının yok!") elif cvp == 3: if chr.hero.gold > 300 and market_3 == False: chr.hero.hp = chr.hero.hp + 200 chr.hero.gold = chr.hero.gold - 300 market_3 = True else: print("yeterli altının yok!") else: pass continue elif cvp == 3: dsgn.magic_screen() #büyücü sayfasına giriş dsgn.durum() cvp = int(input()) if cvp == 1: if chr.hero.gold > 150: chr.hero.hp = chr.hero.hp + rdm.randint(50,100) chr.hero.gold = chr.hero.gold - 150 else: print("yeterli altının yok!") else: pass continue elif cvp == 4: dsgn.durum() dsgn.attack_wait_screen() #saldırı bekleme seçim ekranı while chr.monster.hp > 0 and chr.hero.hp > 0: cvp = int(input()) monster_cvp = rdm.randint(1, 4) if cvp == 1: if monster_cvp == 1: dsgn.durum() dsgn.attack_hero_miss_screen() print("ıskaladın") else: chr.monster.hp = chr.monster.hp - rdm.randint(0, chr.hero.ap) dsgn.durum() dsgn.attack_hero_action_screen() if chr.monster.hp < 0: chr.hero.gold = chr.hero.gold + chr.monster.gold elif cvp == 2: if monster_cvp == 2: dsgn.durum() dsgn.attack_hero_miss_screen() print("ıskaladın") else: chr.monster.hp = chr.monster.hp - rdm.randint(0, chr.hero.ap) dsgn.durum() dsgn.attack_hero_action_screen() if chr.monster.hp < 0: chr.hero.gold = chr.hero.gold + chr.monster.gold elif cvp == 3: if monster_cvp == 3: dsgn.durum() dsgn.attack_hero_miss_screen() print("ıskaladın") else: chr.monster.hp = chr.monster.hp - rdm.randint(0, chr.hero.ap) dsgn.durum() dsgn.attack_hero_action_screen() if chr.monster.hp < 0: chr.hero.gold = chr.hero.gold + chr.monster.gold else: chr.hero.hp += 20 monster_atack_chance = rdm.randint(1,4) if monster_atack_chance == 1: dsgn.durum() dsgn.attack_hero_miss_screen() print("Saldırıdan kurtuldun") else: dsgn.durum() dsgn.attack_hero_action_screen() chr.hero.hp -= rdm.randint(0,chr.monster.ap) print("Hasar aldın") if chr.hero.hp < 0: print("ÖLDÜN") break elif chr.monster.hp < 0: print("CANAVARI ÖLDÜRDÜN") lvl += 1 chr.monster.hp += 100 * (lvl * 0.5) chr.monster.gold += 40 * (lvl) chr.monster.ap += 40 * (lvl * 0.1) continue else: pass else: print("lütfen geçerli bir değer giriniz")
0.046206
0.121477
from django.core.management.base import BaseCommand, CommandError import os import re import json def fp_dict(path): json_file=open(path) json_str = json_file.read() json_data = json.loads(json_str) return json_data def get_cont_type(self,jsonfile,n1,n2): if(len(n1.split("x")) != 2): self.stdout.write(self.style.ERROR("GPCR num %s not understood in %s." % (n1 , jsonfile))) return False chain1=n1.split("x")[0] chain2=n2.split("x")[0] if (chain1==chain2): group="1" info="Intra" else: group="2" info="Inter" return (info) def addContTypetoEdges(self,jsonfile,myfp): cont_li=myfp["edges"]; for cont_info in cont_li: n1=cont_info["name1"] n2=cont_info["name2"] (info)=get_cont_type(self,jsonfile,n1,n2) if (info): cont_info["helixpos"]=info else: break class Command(BaseCommand): help = "Add information at the JSON files of the Flare Plots" def add_arguments(self, parser): parser.add_argument( "-type", dest="info_type", nargs="*", choices=["helixpos"], #Add more options if I want to add other types of info tot he FP action="store", default="helixpos", help="Type of information to be added to the flare plot." ) parser.add_argument( '-dyn', dest='dyn_id', nargs='*', action='store', default=False, help='Specify id(s) of dynamics for which a json file will be modified' ) def handle(self, *args, **options): hb_json_path="/protwis/sites/files/Precomputed/flare_plot/hbonds" if not os.path.isdir(hb_json_path): self.stdout.write(self.style.ERROR("No json files found.")) return for myfile in os.listdir(hb_json_path): isjsonfile=re.match("^\d*_trj_(\d*)_\w*.json$",myfile); if isjsonfile: jsonfile=isjsonfile.group(0) dynrestrict=options['dyn_id'] if dynrestrict: dyn_id=isjsonfile.group(1) if dyn_id not in dynrestrict: continue fp_path=os.path.join(hb_json_path, jsonfile) myfp=fp_dict(fp_path) addContTypetoEdges(self,jsonfile,myfp) with open(fp_path,"w") as of: json.dump(myfp, of) self.stdout.write(self.style.NOTICE("%s modified") % (jsonfile))
dynadb/management/commands/addinfo_fplot.py
from django.core.management.base import BaseCommand, CommandError import os import re import json def fp_dict(path): json_file=open(path) json_str = json_file.read() json_data = json.loads(json_str) return json_data def get_cont_type(self,jsonfile,n1,n2): if(len(n1.split("x")) != 2): self.stdout.write(self.style.ERROR("GPCR num %s not understood in %s." % (n1 , jsonfile))) return False chain1=n1.split("x")[0] chain2=n2.split("x")[0] if (chain1==chain2): group="1" info="Intra" else: group="2" info="Inter" return (info) def addContTypetoEdges(self,jsonfile,myfp): cont_li=myfp["edges"]; for cont_info in cont_li: n1=cont_info["name1"] n2=cont_info["name2"] (info)=get_cont_type(self,jsonfile,n1,n2) if (info): cont_info["helixpos"]=info else: break class Command(BaseCommand): help = "Add information at the JSON files of the Flare Plots" def add_arguments(self, parser): parser.add_argument( "-type", dest="info_type", nargs="*", choices=["helixpos"], #Add more options if I want to add other types of info tot he FP action="store", default="helixpos", help="Type of information to be added to the flare plot." ) parser.add_argument( '-dyn', dest='dyn_id', nargs='*', action='store', default=False, help='Specify id(s) of dynamics for which a json file will be modified' ) def handle(self, *args, **options): hb_json_path="/protwis/sites/files/Precomputed/flare_plot/hbonds" if not os.path.isdir(hb_json_path): self.stdout.write(self.style.ERROR("No json files found.")) return for myfile in os.listdir(hb_json_path): isjsonfile=re.match("^\d*_trj_(\d*)_\w*.json$",myfile); if isjsonfile: jsonfile=isjsonfile.group(0) dynrestrict=options['dyn_id'] if dynrestrict: dyn_id=isjsonfile.group(1) if dyn_id not in dynrestrict: continue fp_path=os.path.join(hb_json_path, jsonfile) myfp=fp_dict(fp_path) addContTypetoEdges(self,jsonfile,myfp) with open(fp_path,"w") as of: json.dump(myfp, of) self.stdout.write(self.style.NOTICE("%s modified") % (jsonfile))
0.289071
0.057971
import os import mock import utils from common import cli_helpers # Need this for plugin imports utils.add_sys_plugin_path("kubernetes") from plugins.kubernetes.parts import ( # noqa E402 general, network, ) class TestKubernetesPluginPartGeneral(utils.BaseTestCase): def setUp(self): self.snaps_list = cli_helpers.get_snap_list_all() super().setUp() def tearDown(self): super().tearDown() @mock.patch.object(general, "KUBERNETES_INFO", {}) def test_get_service_info(self): expected = ['calico-node (3)', 'containerd (17)', 'containerd-shim (16)', 'flanneld (1)', 'kube-proxy (1)', 'kubelet (2)'] general.get_kubernetes_service_checker()() self.assertEqual(general.KUBERNETES_INFO['services'], expected) @mock.patch.object(general, "KUBERNETES_INFO", {}) def test_get_snap_info_from_line(self): result = {'conjure-up': '2.6.14-20200716.2107', 'core': '16-2.48.2', 'core18': '20201210', 'docker': '19.03.11', 'go': '1.15.6', 'helm': '3.5.0', 'kubectl': '1.20.2', 'vault': '1.5.4'} general.get_kubernetes_package_checker()() self.assertEqual(general.KUBERNETES_INFO["snaps"], result) @mock.patch.object(general.cli_helpers, "get_snap_list_all") @mock.patch.object(general, "KUBERNETES_INFO", {}) def test_get_snap_info_from_line_no_k8s(self, mock_get_snap_list_all): filterered_snaps = [] for line in self.snaps_list: found = False for snap in general.SNAPS_K8S: cls = general.KubernetesPackageChecks if cls.get_snap_info_from_line(line, snap): found = True break if not found: filterered_snaps.append(line) mock_get_snap_list_all.return_value = filterered_snaps general.get_kubernetes_package_checker()() self.assertIsNone(general.KUBERNETES_INFO.get("snaps")) class TestKubernetesPluginPartNetwork(utils.BaseTestCase): def setUp(self): super().setUp() def tearDown(self): super().tearDown() @mock.patch.object(network.cli_helpers, "get_ip_addr") @mock.patch.object(network, "NETWORK_INFO", {}) def test_get_network_info(self, mock_get_ip_addr): def fake_get_ip_addr(): path = os.path.join(os.environ["DATA_ROOT"], "sos_commands/networking/ip_-d_address.k8s") with open(path) as fd: return fd.readlines() mock_get_ip_addr.side_effect = fake_get_ip_addr expected = {'flannel': {'flannel.1': {'addr': '172.16.31.10/32', 'vxlan': '10.78.2.176@enp6s0f0'}}} network.get_kubernetes_network_checks()() self.assertEqual(network.NETWORK_INFO, expected)
tests/unit/test_kubernetes.py
import os import mock import utils from common import cli_helpers # Need this for plugin imports utils.add_sys_plugin_path("kubernetes") from plugins.kubernetes.parts import ( # noqa E402 general, network, ) class TestKubernetesPluginPartGeneral(utils.BaseTestCase): def setUp(self): self.snaps_list = cli_helpers.get_snap_list_all() super().setUp() def tearDown(self): super().tearDown() @mock.patch.object(general, "KUBERNETES_INFO", {}) def test_get_service_info(self): expected = ['calico-node (3)', 'containerd (17)', 'containerd-shim (16)', 'flanneld (1)', 'kube-proxy (1)', 'kubelet (2)'] general.get_kubernetes_service_checker()() self.assertEqual(general.KUBERNETES_INFO['services'], expected) @mock.patch.object(general, "KUBERNETES_INFO", {}) def test_get_snap_info_from_line(self): result = {'conjure-up': '2.6.14-20200716.2107', 'core': '16-2.48.2', 'core18': '20201210', 'docker': '19.03.11', 'go': '1.15.6', 'helm': '3.5.0', 'kubectl': '1.20.2', 'vault': '1.5.4'} general.get_kubernetes_package_checker()() self.assertEqual(general.KUBERNETES_INFO["snaps"], result) @mock.patch.object(general.cli_helpers, "get_snap_list_all") @mock.patch.object(general, "KUBERNETES_INFO", {}) def test_get_snap_info_from_line_no_k8s(self, mock_get_snap_list_all): filterered_snaps = [] for line in self.snaps_list: found = False for snap in general.SNAPS_K8S: cls = general.KubernetesPackageChecks if cls.get_snap_info_from_line(line, snap): found = True break if not found: filterered_snaps.append(line) mock_get_snap_list_all.return_value = filterered_snaps general.get_kubernetes_package_checker()() self.assertIsNone(general.KUBERNETES_INFO.get("snaps")) class TestKubernetesPluginPartNetwork(utils.BaseTestCase): def setUp(self): super().setUp() def tearDown(self): super().tearDown() @mock.patch.object(network.cli_helpers, "get_ip_addr") @mock.patch.object(network, "NETWORK_INFO", {}) def test_get_network_info(self, mock_get_ip_addr): def fake_get_ip_addr(): path = os.path.join(os.environ["DATA_ROOT"], "sos_commands/networking/ip_-d_address.k8s") with open(path) as fd: return fd.readlines() mock_get_ip_addr.side_effect = fake_get_ip_addr expected = {'flannel': {'flannel.1': {'addr': '172.16.31.10/32', 'vxlan': '10.78.2.176@enp6s0f0'}}} network.get_kubernetes_network_checks()() self.assertEqual(network.NETWORK_INFO, expected)
0.42656
0.128416
import math import glob import threading from PIL import Image import tqdm from TiledImage import others def resizeImage(image: Image.Image, w, h, keepRatio=True): if keepRatio: ratio = image.width / image.height if w > h: return image.resize((int(ratio * h), h)) else: return image.resize((w, int(ratio / w))) return image.resize((w, h)) def loadImagesFromFolder(path: str) -> list[Image.Image]: """ :param path: path of folder. make sure to add "/*" :return: lsit of pillow images """ others.printLoadingTiles() return [Image.open(f) for f in tqdm.tqdm(glob.iglob(path))] class ImageTiles: def __init__(self, imageTiles: list[Image.Image]): self.imTiles = imageTiles self.tiles: dict[(int, int, int), Image] = {} def averageColor(self, tile: Image.Image): return tile.convert("RGB").resize((1, 1)).getpixel((0, 0))[:3] def prepTiles(self): self.tiles = {self.averageColor(im): im for im in tqdm.tqdm(self.imTiles, desc="Averaging image colors...")} def getNearest(self, r, g, b): distances = {math.sqrt((r - r2) ** 2 + (g - g2) ** 2 + (b - b2) ** 2): (r2, g2, b2) for r2, g2, b2 in self.tiles.keys()} rgb = distances[min(*distances.keys())] return self.tiles[rgb] class CanvasQuad: def __init__(self, x, y, canvasQuadSize, canvas: Image.Image): self.x = x self.y = y self.canvasQuadSize = canvasQuadSize self.worldX = self.canvasQuadSize[0] * x self.worldY = self.canvasQuadSize[1] * y self.canvas = canvas def fill(self, color="#000000"): self.canvas.paste(Image.new("RGB", self.canvasQuadSize, color), (self.worldX, self.worldY)) def setTile(self, im: Image.Image, x, y): self.canvas.paste(im, (self.worldX + x, self.worldY + y)) class ImageQuadrant: def __init__(self, x: int, y: int, imageTiles: ImageTiles, refQuad: Image.Image, quadCanvas: CanvasQuad, tileSize): self.x = x self.y = y self.refQuad = refQuad self.imageTiles = imageTiles self.quadCanvas = quadCanvas self.tileSize = tileSize def run(self, pbar: tqdm.tqdm): for x in range(self.refQuad.width): for y in range(self.refQuad.height): pix = self.refQuad.getpixel((x, y)) tile = self.imageTiles.getNearest(pix[0], pix[1], pix[2]) self.quadCanvas.setTile(tile, self.tileSize[0] * x, self.tileSize[1] * y) pbar.update(1) class TiledImageMaker: def __init__(self, imageTiles: list[Image.Image], referenceImage: Image.Image): """ :param imageTiles: Tiles to use for the tiled image. They have to be of the same width and height :param referenceImage: The image reference. """ self.quads: list[ImageQuadrant] = [] self.tiles = ImageTiles(imageTiles) self.refImage = referenceImage.copy() self.tile_w = imageTiles[0].width self.tile_h = imageTiles[0].height # Resize the referenceImage to be smaller, resulting in smaller image output. Improves performance self.downsample = True self.keepRatio = True def getCanvas(self): print((self.refImage.width * self.tile_w, self.refImage.height * self.tile_h)) return Image.new("RGB", (self.refImage.width * self.tile_w, self.refImage.height * self.tile_h)) def _prep_reference_image(self): if self.downsample: self.refImage = resizeImage( self.refImage, int(self.refImage.width / self.tile_w), int(self.refImage.height / self.tile_h), self.keepRatio) def generate(self, quadNo=2, save_dir="./out.png", save=True): self._prep_reference_image() canvas = self.getCanvas() self.tiles.prepTiles() quadRefSize = (math.ceil(self.refImage.width / quadNo), math.ceil(self.refImage.height / quadNo)) quadCanvasSize = (quadRefSize[0] * self.tile_w, quadRefSize[1] * self.tile_h) others.printImageOutputDetails(save_dir,*canvas.size) for y in range(quadNo): for x in range(quadNo): xPos = x * quadRefSize[0] yPos = y * quadRefSize[1] quadIm = self.refImage.crop((xPos, yPos, quadRefSize[0] + xPos, quadRefSize[1] + yPos)) quad = ImageQuadrant(x, y, self.tiles, quadIm, CanvasQuad(x, y, quadCanvasSize, canvas), (self.tile_w, self.tile_h)) self.quads.append(quad) total_iterations = quadRefSize[0] * quadRefSize[1] * quadNo * quadNo with tqdm.tqdm(total=total_iterations, desc=f"Progress [size:{self.refImage.size}]") as pbar: threads = [threading.Thread(target=i.run, args=(pbar,)) for i in self.quads] [i.start() for i in threads] [i.join() for i in threads] print("Saving...") canvas.save(save_dir)
TiledImage/__init__.py
import math import glob import threading from PIL import Image import tqdm from TiledImage import others def resizeImage(image: Image.Image, w, h, keepRatio=True): if keepRatio: ratio = image.width / image.height if w > h: return image.resize((int(ratio * h), h)) else: return image.resize((w, int(ratio / w))) return image.resize((w, h)) def loadImagesFromFolder(path: str) -> list[Image.Image]: """ :param path: path of folder. make sure to add "/*" :return: lsit of pillow images """ others.printLoadingTiles() return [Image.open(f) for f in tqdm.tqdm(glob.iglob(path))] class ImageTiles: def __init__(self, imageTiles: list[Image.Image]): self.imTiles = imageTiles self.tiles: dict[(int, int, int), Image] = {} def averageColor(self, tile: Image.Image): return tile.convert("RGB").resize((1, 1)).getpixel((0, 0))[:3] def prepTiles(self): self.tiles = {self.averageColor(im): im for im in tqdm.tqdm(self.imTiles, desc="Averaging image colors...")} def getNearest(self, r, g, b): distances = {math.sqrt((r - r2) ** 2 + (g - g2) ** 2 + (b - b2) ** 2): (r2, g2, b2) for r2, g2, b2 in self.tiles.keys()} rgb = distances[min(*distances.keys())] return self.tiles[rgb] class CanvasQuad: def __init__(self, x, y, canvasQuadSize, canvas: Image.Image): self.x = x self.y = y self.canvasQuadSize = canvasQuadSize self.worldX = self.canvasQuadSize[0] * x self.worldY = self.canvasQuadSize[1] * y self.canvas = canvas def fill(self, color="#000000"): self.canvas.paste(Image.new("RGB", self.canvasQuadSize, color), (self.worldX, self.worldY)) def setTile(self, im: Image.Image, x, y): self.canvas.paste(im, (self.worldX + x, self.worldY + y)) class ImageQuadrant: def __init__(self, x: int, y: int, imageTiles: ImageTiles, refQuad: Image.Image, quadCanvas: CanvasQuad, tileSize): self.x = x self.y = y self.refQuad = refQuad self.imageTiles = imageTiles self.quadCanvas = quadCanvas self.tileSize = tileSize def run(self, pbar: tqdm.tqdm): for x in range(self.refQuad.width): for y in range(self.refQuad.height): pix = self.refQuad.getpixel((x, y)) tile = self.imageTiles.getNearest(pix[0], pix[1], pix[2]) self.quadCanvas.setTile(tile, self.tileSize[0] * x, self.tileSize[1] * y) pbar.update(1) class TiledImageMaker: def __init__(self, imageTiles: list[Image.Image], referenceImage: Image.Image): """ :param imageTiles: Tiles to use for the tiled image. They have to be of the same width and height :param referenceImage: The image reference. """ self.quads: list[ImageQuadrant] = [] self.tiles = ImageTiles(imageTiles) self.refImage = referenceImage.copy() self.tile_w = imageTiles[0].width self.tile_h = imageTiles[0].height # Resize the referenceImage to be smaller, resulting in smaller image output. Improves performance self.downsample = True self.keepRatio = True def getCanvas(self): print((self.refImage.width * self.tile_w, self.refImage.height * self.tile_h)) return Image.new("RGB", (self.refImage.width * self.tile_w, self.refImage.height * self.tile_h)) def _prep_reference_image(self): if self.downsample: self.refImage = resizeImage( self.refImage, int(self.refImage.width / self.tile_w), int(self.refImage.height / self.tile_h), self.keepRatio) def generate(self, quadNo=2, save_dir="./out.png", save=True): self._prep_reference_image() canvas = self.getCanvas() self.tiles.prepTiles() quadRefSize = (math.ceil(self.refImage.width / quadNo), math.ceil(self.refImage.height / quadNo)) quadCanvasSize = (quadRefSize[0] * self.tile_w, quadRefSize[1] * self.tile_h) others.printImageOutputDetails(save_dir,*canvas.size) for y in range(quadNo): for x in range(quadNo): xPos = x * quadRefSize[0] yPos = y * quadRefSize[1] quadIm = self.refImage.crop((xPos, yPos, quadRefSize[0] + xPos, quadRefSize[1] + yPos)) quad = ImageQuadrant(x, y, self.tiles, quadIm, CanvasQuad(x, y, quadCanvasSize, canvas), (self.tile_w, self.tile_h)) self.quads.append(quad) total_iterations = quadRefSize[0] * quadRefSize[1] * quadNo * quadNo with tqdm.tqdm(total=total_iterations, desc=f"Progress [size:{self.refImage.size}]") as pbar: threads = [threading.Thread(target=i.run, args=(pbar,)) for i in self.quads] [i.start() for i in threads] [i.join() for i in threads] print("Saving...") canvas.save(save_dir)
0.660282
0.39257
from django.urls import path from django.contrib.auth import views as auth_views from . import views #crud urls app_name='products' urlpatterns=[ path('category/',views.get_all_categories,name='categories'), path('category_view_ajax/',views.category_view_ajax,name="category_view_ajax"), path('add_category/',views.add_category,name="add_category"), path('add_multiple_categories',views.add_multiple_categories,name="add_multiple_categories"), path('delete_category_ajax/',views.delete_category_ajax,name="delete_category_ajax"), path('edit_category/',views.edit_category,name="edit_category"), path('edit_category_ajax/',views.edit_category_ajax,name="edit_category_ajax"), path('delete_multiple_categories/',views.delete_multiple_categories,name="delete_multiple_categories"), path('category_view_ajax/',views.category_view_ajax,name = 'category_view_ajax'), #sub category urls path('sub_categories/', views.get_all_sub_categories, name = 'sub_categories'), path('get_categories/',views.get_categories,name = 'get_categories'), path('add_sub_category/',views.add_sub_category, name = 'add_sub_category'), path('delete_sub_category/',views.delete_sub_category_ajax, name = 'delete_sub_category_ajax'), path('edit_sub_category/', views.edit_sub_category, name = 'edit_sub_category'), path('edit_sub_category_ajax/', views.edit_sub_category_ajax, name = 'edit_sub_category_ajax'), path('delete_multiple_sub_categories/',views.delete_multiple_sub_categories, name ='delete_multiple_sub_categories'), path('add_multiple_sub_categories/',views.add_multiple_sub_categories, name = 'add_multiple_sub_categories'), #brands path('brands/', views.get_all_brands, name = 'brands'), path('add_brand/', views.add_brand, name = 'add_brand'), path('delete_brand/', views.delete_brand, name = 'delete_brand_ajax'), path('edit_brand/',views.update_brand, name='edit_brand'), path('edit_brand_ajax/',views.edit_brand_ajax,name = 'edit_brand_ajax'), path('delete_multiple_brands/',views.delete_multiple_brands, name = 'delete_multiple_brands'), path('brand_view_ajax/',views.brand_view_ajax, name ='brand_view_ajax'), path('add_multiple_brands/',views.add_multiple_brands,name = 'add_multiple_brands'), #items path('items/',views.get_all_items,name = 'items'), path('add_item/',views.add_item, name = 'add_item'), path('delete_item/',views.delete_item, name = 'delete_item_ajax'), path('edit_item/',views.edit_item,name = 'edit_item'), path('edit_item_ajax/', views.edit_item_ajax,name = 'edit_item_ajax'), path('delete_multiple_items/',views.delete_multiple_items,name = 'delete_multiple_items'), path('item_view_ajax/',views.item_view_ajax,name = 'item_view_ajax'), path('add_multiple_items', views.add_multiple_items, name = 'add_multiple_items'), path('get_brands_subcategories', views.get_brands_subcategories ,name = 'get_brands_subcategories') ]
products/urls.py
from django.urls import path from django.contrib.auth import views as auth_views from . import views #crud urls app_name='products' urlpatterns=[ path('category/',views.get_all_categories,name='categories'), path('category_view_ajax/',views.category_view_ajax,name="category_view_ajax"), path('add_category/',views.add_category,name="add_category"), path('add_multiple_categories',views.add_multiple_categories,name="add_multiple_categories"), path('delete_category_ajax/',views.delete_category_ajax,name="delete_category_ajax"), path('edit_category/',views.edit_category,name="edit_category"), path('edit_category_ajax/',views.edit_category_ajax,name="edit_category_ajax"), path('delete_multiple_categories/',views.delete_multiple_categories,name="delete_multiple_categories"), path('category_view_ajax/',views.category_view_ajax,name = 'category_view_ajax'), #sub category urls path('sub_categories/', views.get_all_sub_categories, name = 'sub_categories'), path('get_categories/',views.get_categories,name = 'get_categories'), path('add_sub_category/',views.add_sub_category, name = 'add_sub_category'), path('delete_sub_category/',views.delete_sub_category_ajax, name = 'delete_sub_category_ajax'), path('edit_sub_category/', views.edit_sub_category, name = 'edit_sub_category'), path('edit_sub_category_ajax/', views.edit_sub_category_ajax, name = 'edit_sub_category_ajax'), path('delete_multiple_sub_categories/',views.delete_multiple_sub_categories, name ='delete_multiple_sub_categories'), path('add_multiple_sub_categories/',views.add_multiple_sub_categories, name = 'add_multiple_sub_categories'), #brands path('brands/', views.get_all_brands, name = 'brands'), path('add_brand/', views.add_brand, name = 'add_brand'), path('delete_brand/', views.delete_brand, name = 'delete_brand_ajax'), path('edit_brand/',views.update_brand, name='edit_brand'), path('edit_brand_ajax/',views.edit_brand_ajax,name = 'edit_brand_ajax'), path('delete_multiple_brands/',views.delete_multiple_brands, name = 'delete_multiple_brands'), path('brand_view_ajax/',views.brand_view_ajax, name ='brand_view_ajax'), path('add_multiple_brands/',views.add_multiple_brands,name = 'add_multiple_brands'), #items path('items/',views.get_all_items,name = 'items'), path('add_item/',views.add_item, name = 'add_item'), path('delete_item/',views.delete_item, name = 'delete_item_ajax'), path('edit_item/',views.edit_item,name = 'edit_item'), path('edit_item_ajax/', views.edit_item_ajax,name = 'edit_item_ajax'), path('delete_multiple_items/',views.delete_multiple_items,name = 'delete_multiple_items'), path('item_view_ajax/',views.item_view_ajax,name = 'item_view_ajax'), path('add_multiple_items', views.add_multiple_items, name = 'add_multiple_items'), path('get_brands_subcategories', views.get_brands_subcategories ,name = 'get_brands_subcategories') ]
0.250821
0.044681
from __future__ import unicode_literals import csv import json import os from . import CONFIG, common, osm, plfunctions from .cities import montreal as mrl from .cities import quebec as qbc from .cities import newyork as nyc from .cities import seattle as sea from .cities import boston as bos from .database import PostgresWrapper from .filters import group_rules from .logger import Logger from .utils import pretty_time, tstr_to_float # distance from road to slot LINE_OFFSET = 6 CITIES = ["montreal", "quebec", "newyork", "seattle", "boston"] db = PostgresWrapper( "host='{PG_HOST}' port={PG_PORT} dbname={PG_DATABASE} " "user={PG_USERNAME} password={<PASSWORD>} ".format(**CONFIG)) def process_quebec(debug=False): """ Process Quebec data """ def info(msg): return Logger.info("Québec: {}".format(msg)) def debug(msg): return Logger.debug("Québec: {}".format(msg)) def warning(msg): return Logger.warning("Québec: {}".format(msg)) info('Loading and translating rules') insert_rules('quebec_rules_translation') db.vacuum_analyze('public', 'rules') info("Creating sign table") db.query(qbc.create_sign) info("Loading signs") db.query(qbc.insert_sign) db.create_index('quebec_sign', 'direction') db.create_index('quebec_sign', 'code') db.create_index('quebec_sign', 'geom', index_type='gist') db.vacuum_analyze('public', 'quebec_sign') info("Creating signposts") db.query(qbc.create_signpost) db.create_index('quebec_signpost', 'id') db.create_index('quebec_signpost', 'rid') db.create_index('quebec_signpost', 'signs', index_type='gin') db.create_index('quebec_signpost', 'geom', index_type='gist') db.vacuum_analyze('public', 'quebec_signpost') info("Add signpost id to signs") db.query(qbc.add_signposts_to_sign) db.vacuum_analyze('public', 'quebec_sign') info("Projection signposts on road") duplicates = db.query(qbc.project_signposts) if duplicates: warning("Duplicates found for projected signposts : {}" .format(str(duplicates))) percent, total = db.query(qbc.count_signpost_projected)[0] if percent < 100: warning("Only {:.0f}% of signposts have been bound to a road. Total is {}" .format(percent, total)) db.query(qbc.generate_signposts_orphans) info("Table 'signpost_orphans' has been generated to check for orphans") info("Creating slots between signposts") db.query(qbc.create_slots_likely) db.query(qbc.insert_slots_likely.format(isleft=1)) db.query(qbc.insert_slots_likely.format(isleft=-1)) db.create_index('quebec_slots_likely', 'id') db.create_index('quebec_slots_likely', 'signposts', index_type='gin') db.create_index('quebec_slots_likely', 'geom', index_type='gist') db.vacuum_analyze('public', 'quebec_slots_likely') db.query(qbc.create_nextpoints_for_signposts) db.create_index('quebec_nextpoints', 'id') db.create_index('quebec_nextpoints', 'slot_id') db.create_index('quebec_nextpoints', 'direction') db.vacuum_analyze('public', 'quebec_nextpoints') db.query(qbc.insert_slots_temp.format(offset=LINE_OFFSET)) db.create_index('quebec_slots_temp', 'id') db.create_index('quebec_slots_temp', 'geom', index_type='gist') db.create_index('quebec_slots_temp', 'rules', index_type='gin') db.vacuum_analyze('public', 'quebec_slots_temp') info("Creating and overlaying paid slots") db.query(qbc.create_bornes_raw) db.query(qbc.create_paid_signpost) db.query(qbc.aggregate_paid_signposts.format(offset=LINE_OFFSET)) db.query(qbc.overlay_paid_rules) db.query(qbc.create_paid_slots_standalone) if debug: info("Creating debug slots") db.query(qbc.create_slots_for_debug.format(offset=LINE_OFFSET)) db.create_index('quebec_slots_debug', 'pkid') db.create_index('quebec_slots_debug', 'geom', index_type='gist') db.vacuum_analyze('public', 'quebec_slots_debug') def process_montreal(debug=False): """ process montreal data and generate parking slots """ def info(msg): return Logger.info("Montréal: {}".format(msg)) def debug(msg): return Logger.debug("Montréal: {}".format(msg)) def warning(msg): return Logger.warning("Montréal: {}".format(msg)) debug('Loading and translating rules') insert_rules('montreal_rules_translation') db.vacuum_analyze('public', 'rules') info("Matching osm roads with geobase") db.query(mrl.match_roads_geobase) db.create_index('montreal_roads_geobase', 'id') db.create_index('montreal_roads_geobase', 'id_trc') db.create_index('montreal_roads_geobase', 'osm_id') db.create_index('montreal_roads_geobase', 'name') db.create_index('montreal_roads_geobase', 'geom', index_type='gist') db.vacuum_analyze('public', 'montreal_roads_geobase') info("Creating sign table") db.query(mrl.create_sign) info("Loading signs") db.query(mrl.insert_sign) db.query(mrl.insert_signpost_verdun) db.query(mrl.insert_sign_verdun) db.create_index('montreal_sign', 'geom', index_type='gist') db.create_index('montreal_sign', 'direction') db.create_index('montreal_sign', 'elevation') db.create_index('montreal_sign', 'signpost') db.vacuum_analyze('public', 'montreal_sign') info("Creating sign posts") db.query(mrl.create_signpost) db.query(mrl.insert_signpost) db.create_index('montreal_signpost', 'geom', index_type='gist') db.create_index('montreal_signpost', 'geobase_id') db.vacuum_analyze('public', 'montreal_signpost') info("Projecting signposts on road") duplicates = db.query(mrl.project_signposts) if duplicates: warning("Duplicates found for projected signposts : {}" .format(str(duplicates))) db.create_index('montreal_signpost_onroad', 'id') db.create_index('montreal_signpost_onroad', 'road_id') db.create_index('montreal_signpost_onroad', 'isleft') db.create_index('montreal_signpost_onroad', 'geom', index_type='gist') db.vacuum_analyze('public', 'montreal_signpost_onroad') percent, total = db.query(mrl.count_signpost_projected)[0] if percent < 100: warning("Only {:.0f}% of signposts have been bound to a road. Total is {}" .format(percent, total)) db.query(mrl.generate_signposts_orphans) info("Table 'montreal_signpost_orphans' has been generated to check for orphans") info("Creating slots between signposts") db.query(mrl.create_slots_likely) db.query(mrl.insert_slots_likely.format(isleft=1)) db.query(mrl.insert_slots_likely.format(isleft=-1)) db.create_index('montreal_slots_likely', 'id') db.create_index('montreal_slots_likely', 'signposts', index_type='gin') db.create_index('montreal_slots_likely', 'geom', index_type='gist') db.vacuum_analyze('public', 'montreal_slots_likely') db.query(mrl.create_nextpoints_for_signposts) db.create_index('montreal_nextpoints', 'id') db.create_index('montreal_nextpoints', 'slot_id') db.create_index('montreal_nextpoints', 'direction') db.vacuum_analyze('public', 'montreal_nextpoints') db.create_index('montreal_slots_temp', 'id') db.create_index('montreal_slots_temp', 'geom', index_type='gist') db.create_index('montreal_slots_temp', 'rules', index_type='gin') db.query(mrl.insert_slots_temp.format(offset=LINE_OFFSET)) info("Creating and overlaying paid slots") db.query(mrl.overlay_paid_rules) db.vacuum_analyze('public', 'montreal_slots_temp') if debug: info("Creating debug slots") db.query(mrl.create_slots_for_debug.format(offset=LINE_OFFSET)) db.create_index('montreal_slots_debug', 'pkid') db.create_index('montreal_slots_debug', 'geom', index_type='gist') db.vacuum_analyze('public', 'montreal_slots_debug') def process_newyork(debug=False): """ Process New York data """ def info(msg): return Logger.info("New York: {}".format(msg)) def debug(msg): return Logger.debug("New York: {}".format(msg)) def warning(msg): return Logger.warning("New York: {}".format(msg)) info('Loading and translating rules') insert_rules('newyork_rules_translation') db.vacuum_analyze('public', 'rules') info("Loading signs") db.query(nyc.create_sign) db.query(nyc.insert_sign) db.create_index('newyork_sign', 'direction') db.create_index('newyork_sign', 'code') db.create_index('newyork_sign', 'geom', index_type='gist') db.vacuum_analyze('public', 'newyork_sign') info("Creating signposts") db.query(nyc.create_signpost) db.query(nyc.insert_signpost) db.create_index('newyork_signpost', 'id') db.create_index('newyork_signpost', 'geobase_id') db.create_index('newyork_signpost', 'signs', index_type='gin') db.create_index('newyork_signpost', 'geom', index_type='gist') db.vacuum_analyze('public', 'newyork_signpost') info("Matching osm roads with geobase") db.query(nyc.match_roads_geobase) db.create_index('newyork_roads_geobase', 'id') db.create_index('newyork_roads_geobase', 'osm_id') db.create_index('newyork_roads_geobase', 'name') db.create_index('newyork_roads_geobase', 'boro') db.create_index('newyork_roads_geobase', 'geom', index_type='gist') db.vacuum_analyze('public', 'newyork_roads_geobase') info("Match signposts to geobase") db.query(nyc.match_signposts) db.vacuum_analyze('public', 'newyork_signpost') info("Add signpost id to signs") db.query(nyc.add_signposts_to_sign) db.vacuum_analyze('public', 'newyork_sign') info("Projecting signposts on road") duplicates = db.query(nyc.project_signposts) if duplicates: warning("Duplicates found for projected signposts : {}" .format(str(duplicates))) percent, total = db.query(nyc.count_signpost_projected)[0] if percent < 100: warning("Only {:.0f}% of signposts have been bound to a road. Total is {}" .format(percent, total)) db.query(nyc.generate_signposts_orphans) info("Table 'newyork_signpost_orphans' has been generated to check for orphans") info("Creating likely slots") db.query(nyc.create_slots_likely) db.query(nyc.insert_slots_likely.format(isleft=1)) db.query(nyc.insert_slots_likely.format(isleft=-1)) # Get rid of problem segments FIXME db.query(""" with tmp as ( select * from ( select g.id, count(distinct s.order_no) from newyork_roads_geobase g join newyork_signpost s on s.geobase_id = g.id group by g.id ) foo where count > 2 ) delete from newyork_slots_likely s using tmp t where t.id = s.rid; """) db.create_index('newyork_slots_likely', 'id') db.create_index('newyork_slots_likely', 'signposts', index_type='gin') db.create_index('newyork_slots_likely', 'geom', index_type='gist') db.vacuum_analyze('public', 'newyork_slots_likely') info("Creating nextpoints") db.query(nyc.create_nextpoints_for_signposts) db.create_index('newyork_nextpoints', 'id') db.create_index('newyork_nextpoints', 'slot_id') db.create_index('newyork_nextpoints', 'direction') db.vacuum_analyze('public', 'newyork_nextpoints') for x in ['K', 'M', 'Q', 'B', 'S']: info("Creating slots between signposts (borough {})".format(x)) db.query(nyc.insert_slots_temp.format(boro=x, offset=LINE_OFFSET)) db.create_index('newyork_slots_temp', 'id') db.create_index('newyork_slots_temp', 'geom', index_type='gist') db.create_index('newyork_slots_temp', 'rules', index_type='gin') db.vacuum_analyze('public', 'newyork_slots_temp') if debug: info("Creating debug slots") for x in ['K', 'M', 'Q', 'B', 'S']: db.query(nyc.create_slots_for_debug.format(boro=x, offset=LINE_OFFSET)) db.create_index('newyork_slots_debug', 'pkid') db.create_index('newyork_slots_debug', 'geom', index_type='gist') db.vacuum_analyze('public', 'newyork_slots_debug') def process_seattle(debug=False): """ Process Seattle data """ def info(msg): return Logger.info("Seattle: {}".format(msg)) def debug(msg): return Logger.debug("Seattle: {}".format(msg)) def warning(msg): return Logger.warning("Seattle: {}".format(msg)) info('Loading and translating rules') insert_rules('seattle_rules_translation') insert_dynamic_rules_seattle() db.vacuum_analyze('public', 'rules') info("Matching OSM roads with geobase") db.query(sea.match_roads_geobase) db.create_index('seattle_roads_geobase', 'id') db.create_index('seattle_roads_geobase', 'osm_id') db.create_index('seattle_roads_geobase', 'name') db.create_index('seattle_roads_geobase', 'geom', index_type='gist') db.vacuum_analyze('public', 'seattle_roads_geobase') info("Loading signs") db.query(sea.create_sign) db.query(sea.insert_sign) db.query(sea.insert_sign_paid) db.query(sea.insert_sign_directional) db.query(sea.insert_sign_parklines) db.create_index('seattle_sign', 'direction') db.create_index('seattle_sign', 'code') db.create_index('seattle_sign', 'geom', index_type='gist') db.vacuum_analyze('public', 'seattle_sign') info("Creating signposts") db.query(sea.create_signpost) db.query(sea.insert_signpost) db.create_index('seattle_signpost', 'id') db.create_index('seattle_signpost', 'geobase_id') db.create_index('seattle_signpost', 'signs', index_type='gin') db.create_index('seattle_signpost', 'geom', index_type='gist') db.query(sea.add_signposts_to_sign) db.vacuum_analyze('public', 'seattle_signpost') info("Projecting signposts on road") duplicates = db.query(sea.project_signposts) if duplicates: warning("Duplicates found for projected signposts : {}" .format(str(duplicates))) percent, total = db.query(sea.count_signpost_projected)[0] if percent < 100: warning("Only {:.0f}% of signposts have been bound to a road. Total is {}" .format(percent, total)) db.query(sea.generate_signposts_orphans) info("Table 'seattle_signpost_orphans' has been generated to check for orphans") db.query(sea.assign_directions) db.vacuum_analyze('public', 'seattle_sign') info("Creating likely slots") db.query(sea.create_slots_likely) db.query(sea.insert_slots_likely.format(isleft=1)) db.query(sea.insert_slots_likely.format(isleft=-1)) db.create_index('seattle_slots_likely', 'id') db.create_index('seattle_slots_likely', 'signposts', index_type='gin') db.create_index('seattle_slots_likely', 'geom', index_type='gist') db.vacuum_analyze('public', 'seattle_slots_likely') info("Creating nextpoints") db.query(sea.create_nextpoints_for_signposts) db.create_index('seattle_nextpoints', 'id') db.create_index('seattle_nextpoints', 'slot_id') db.create_index('seattle_nextpoints', 'direction') db.vacuum_analyze('public', 'seattle_nextpoints') info("Creating slots between signposts") db.query(sea.insert_slots_temp.format(offset=LINE_OFFSET)) db.create_index('seattle_slots_temp', 'id') db.create_index('seattle_slots_temp', 'geom', index_type='gist') db.create_index('seattle_slots_temp', 'rules', index_type='gin') db.vacuum_analyze('public', 'seattle_slots_temp') if debug: info("Creating debug slots") db.query(sea.create_slots_for_debug.format(offset=LINE_OFFSET)) db.create_index('seattle_slots_debug', 'pkid') db.create_index('seattle_slots_debug', 'geom', index_type='gist') db.vacuum_analyze('public', 'seattle_slots_debug') def process_boston(debug=False): """ process boston data and generate parking slots """ def info(msg): return Logger.info("Boston: {}".format(msg)) def debug(msg): return Logger.debug("Boston: {}".format(msg)) def warning(msg): return Logger.warning("Boston: {}".format(msg)) debug('Loading and translating rules') insert_rules('boston_rules_translation') db.vacuum_analyze('public', 'rules') info("Matching OSM roads with geobase") db.query(bos.create_roads_geobase) db.query(bos.match_roads_geobase.format(tbl="boston_geobase")) db.query(bos.match_roads_geobase.format(tbl="boston_metro_geobase")) db.create_index('boston_roads_geobase', 'id') db.create_index('boston_roads_geobase', 'roadsegment') db.create_index('boston_roads_geobase', 'osm_id') db.create_index('boston_roads_geobase', 'name') db.create_index('boston_roads_geobase', 'geom', index_type='gist') db.vacuum_analyze('public', 'boston_roads_geobase') info("Creating sign table") db.query(bos.create_sign) info("Loading signs") db.query(bos.insert_sign) db.query(bos.insert_sign_cambridge) db.create_index('boston_sign', 'geom', index_type='gist') db.create_index('boston_sign', 'direction') db.create_index('boston_sign', 'signpost') db.vacuum_analyze('public', 'boston_sign') info("Creating sign posts") db.query(bos.create_signpost) db.query(bos.insert_signpost) db.create_index('boston_signpost', 'geom', index_type='gist') db.create_index('boston_signpost', 'geobase_id') db.query(bos.add_signposts_to_sign) db.vacuum_analyze('public', 'boston_signpost') info("Projecting signposts on road") duplicates = db.query(bos.project_signposts) if duplicates: warning("Duplicates found for projected signposts : {}" .format(str(duplicates))) db.create_index('boston_signpost_onroad', 'id') db.create_index('boston_signpost_onroad', 'road_id') db.create_index('boston_signpost_onroad', 'isleft') db.create_index('boston_signpost_onroad', 'geom', index_type='gist') db.vacuum_analyze('public', 'boston_signpost_onroad') percent, total = db.query(bos.count_signpost_projected)[0] if percent < 100: warning("Only {:.0f}% of signposts have been bound to a road. Total is {}" .format(percent, total)) db.query(bos.generate_signposts_orphans) info("Table 'boston_signpost_orphans' has been generated to check for orphans") info("Creating slots between signposts") db.query(bos.create_slots_likely) db.query(bos.insert_slots_likely.format(isleft=1)) db.query(bos.insert_slots_likely.format(isleft=-1)) db.create_index('boston_slots_likely', 'id') db.create_index('boston_slots_likely', 'signposts', index_type='gin') db.create_index('boston_slots_likely', 'geom', index_type='gist') db.vacuum_analyze('public', 'boston_slots_likely') db.query(bos.create_nextpoints_for_signposts) db.create_index('boston_nextpoints', 'id') db.create_index('boston_nextpoints', 'slot_id') db.create_index('boston_nextpoints', 'direction') db.vacuum_analyze('public', 'boston_nextpoints') db.create_index('boston_slots_temp', 'id') db.create_index('boston_slots_temp', 'geom', index_type='gist') db.create_index('boston_slots_temp', 'rules', index_type='gin') db.query(bos.insert_slots_temp.format(offset=LINE_OFFSET)) info("Creating and overlaying paid slots") db.query(bos.overlay_paid_rules) db.vacuum_analyze('public', 'boston_slots_temp') if debug: info("Creating debug slots") db.query(bos.create_slots_for_debug.format(offset=LINE_OFFSET)) db.create_index('boston_slots_debug', 'pkid') db.create_index('boston_slots_debug', 'geom', index_type='gist') db.vacuum_analyze('public', 'boston_slots_debug') def cleanup_table(): """ Remove temporary tables """ Logger.info("Cleanup schema") # drop universal temp tables for x in ["bad_intersection", "way_intersection", "roads", "signpost_onroad", "parking_lots_raw"]: db.query("DROP TABLE IF EXISTS {}".format(x)) # drop per-city temp tables for x in ["slots_likely", "slots_temp", "nextpoints", "paid_temp", "signpost_temp", "paid_slots_raw", "bornes_raw", "bornes_clustered"]: for y in CITIES: db.query("DROP TABLE IF EXISTS {}_{}".format(y, x)) def process_osm(): """ Process OSM data """ def info(msg): return Logger.info("OpenStreetMap: {}".format(msg)) def debug(msg): return Logger.debug("OpenStreetMap: {}".format(msg)) def warning(msg): return Logger.warning("OpenStreetMap: {}".format(msg)) info("Filtering ways") db.query(osm.create_osm_ways) db.create_index('osm_ways', 'geom', index_type='gist') db.create_index('osm_ways', 'osm_id') db.create_index('osm_ways', 'name') info("Creating way intersections from planet lines") db.query(osm.create_way_intersection) db.create_index('way_intersection', 'way_id') db.create_index('way_intersection', 'geom', index_type='gist') db.vacuum_analyze('public', 'way_intersection') res = db.query(osm.remove_bad_intersection) if res: debug("Removed {} bad intersections".format(len(res))) info("Splitting ways on intersections") db.query(osm.split_osm_roads) db.create_index('roads', 'id') db.create_index('roads', 'osm_id') db.create_index('roads', 'name') db.create_index('roads', 'geom', index_type='gist') db.vacuum_analyze('public', 'roads') def run(cities=CITIES, osm=False, debug=False): """ Run the entire pipeline """ Logger.debug("Loading extensions and custom functions") db.query("create extension if not exists fuzzystrmatch") db.query("create extension if not exists intarray") db.query(plfunctions.st_isleft_func) db.query(plfunctions.array_sort) db.query(plfunctions.get_max_range) if osm: process_osm() # create common tables db.query(common.create_rules) db.create_index('rules', 'code') db.query(common.create_slots) for x in cities: db.query(common.create_slots_temp.format(city=x)) db.query(common.create_slots_partition.format(city=x)) Logger.info("Processing parking lot / garage data") db.query(common.create_parking_lots) db.query(common.create_parking_lots_raw.format(city="montreal")) insert_raw_lots("montreal", "lots_montreal.csv") insert_parking_lots("montreal") db.query(common.create_parking_lots_raw.format(city="quebec")) insert_raw_lots("quebec", "lots_quebec.csv") insert_parking_lots("quebec") db.query(common.create_parking_lots_raw.format(city="seattle")) insert_raw_lots("seattle", "lots_seattle.csv") insert_parking_lots("seattle") db.query(common.create_parking_lots_raw.format(city="boston")) insert_raw_lots("boston", "lots_boston.csv") insert_parking_lots("boston") db.create_index('parking_lots', 'id') db.create_index('parking_lots', 'city') db.create_index('parking_lots', 'geom', index_type='gist') db.create_index('parking_lots', 'agenda', index_type='gin') db.query("DROP TABLE IF EXISTS parking_lots_streetview;") insert_lots_streetview("lots_newyork_streetview.csv") if 'montreal' in cities: process_montreal(debug) if 'quebec' in cities: process_quebec(debug) if 'newyork' in cities: process_newyork(debug) if 'seattle' in cities: process_seattle(debug) if 'boston' in cities: process_boston(debug) Logger.info("Shorten slots that intersect with roads or other slots") for x in cities: db.query(common.cut_slots_crossing_roads.format(city=x, offset=LINE_OFFSET)) db.query(common.cut_slots_crossing_slots.format(city=x)) Logger.info("Aggregating like slots") for x in cities: db.create_index(x+'_slots', 'id') db.create_index(x+'_slots', 'geom', index_type='gist') db.create_index(x+'_slots', 'rules', index_type='gin') db.query(common.aggregate_like_slots.format(city=x, within=3 if x == "seattle" else 0.1)) db.query(common.create_client_data.format(city=x)) db.vacuum_analyze('public', x+'_slots') Logger.info("Creating permit lists") db.query(common.create_permit_lists) for x in cities: db.query(common.insert_permit_lists.format(city=x)) if not debug: cleanup_table() def insert_rules(from_table): """ Get rules from specific location (montreal, quebec), group them, make a simpler model and load them into database """ Logger.debug("Get rules from {} and simplify them".format(from_table)) rules = db.query( common.get_rules_from_source.format(source=from_table), namedtuple=True ) rules_grouped = group_rules(rules) Logger.debug("Load rules into rules table") db.copy_from('public', 'rules', common.rules_columns, [ [ json.dumps(val).replace('\\', '\\\\') if isinstance(val, dict) else val for val in rule._asdict().values()] for rule in rules_grouped ]) def insert_raw_lots(city, filename): db.query(""" COPY {}_parking_lots (name, operator, address, description, lun_normal, mar_normal, mer_normal, jeu_normal, ven_normal, sam_normal, dim_normal, hourly_normal, daily_normal, max_normal, lun_special, mar_special, mer_special, jeu_special, ven_special, sam_special, dim_special, hourly_special, daily_special, max_special, lun_free, mar_free, mer_free, jeu_free, ven_free, sam_free, dim_free, daily_free, indoor, handicap, card, valet, lat, long, capacity, street_view_lat, street_view_long, street_view_head, street_view_id, active, partner_name, partner_id) FROM '{}' WITH CSV HEADER """.format(city, os.path.join(os.path.dirname(__file__), 'data', filename))) def insert_lots_streetview(filename): with open(os.path.join(os.path.dirname(__file__), 'data', 'load_lots_streetview.sql'), 'rb') as infile: db.query(infile.read().format(os.path.join(os.path.dirname(__file__), 'data', filename))) db.vacuum_analyze("public", "parking_lots_streetview") def insert_parking_lots(city): columns = ["city", "name", "operator", "address", "description", "agenda", "capacity", "attrs", "geom", "active", "street_view", "partner_name", "partner_id", "geojson"] days = ["lun", "mar", "mer", "jeu", "ven", "sam", "dim"] lots, queries = [], [] for row in db.query(""" SELECT *, ST_Transform(ST_SetSRID(ST_MakePoint(long, lat), 4326), 3857) AS geom FROM {}_parking_lots """.format(city), namedtuple=True): lot = [(x.decode('utf-8').replace("'", "''") if x else '') for x in [row.name, row.operator, row.address, row.description]] # Create pricing rules per time period the lot is open agenda = {str(y): [] for y in range(1,8)} for x in range(1,8): if getattr(row, days[x - 1] + "_normal"): y = getattr(row, days[x - 1] + "_normal") hours = [float(z) for z in y.split(",")] if hours != [0.0, 24.0] and hours[0] > hours[1]: nextday = str(x+1) if (x < 7) else "1" agenda[nextday].append({"hours": [0.0, hours[1]], "max": row.max_normal or None, "hourly": row.hourly_normal or None, "daily": row.daily_normal or None}) hours = [hours[0], 24.0] agenda[str(x)].append({"hours": hours, "hourly": row.hourly_normal or None, "max": row.max_normal or None, "daily": row.daily_normal or None}) if getattr(row, days[x - 1] + "_special"): y = getattr(row, days[x - 1] + "_special") hours = [float(z) for z in y.split(",")] if hours != [0.0, 24.0] and hours[0] > hours[1]: nextday = str(x+1) if (x < 7) else "1" agenda[nextday].append({"hours": [0.0, hours[1]], "max": row.max_special or None, "hourly": row.hourly_special or None, "daily": row.daily_special or None}) hours = [hours[0], 24.0] agenda[str(x)].append({"hours": hours, "hourly": row.hourly_special or None, "max": row.max_special or None, "daily": row.daily_special or None}) if getattr(row, days[x - 1] + "_free"): y = getattr(row, days[x - 1] + "_free") hours = [float(z) for z in y.split(",")] if hours != [0.0, 24.0] and hours[0] > hours[1]: nextday = str(x+1) if (x < 7) else "1" agenda[nextday].append({"hours": [0.0, hours[1]], "max": None, "hourly": 0, "daily": row.daily_free or None}) hours = [hours[0], 24.0] agenda[str(x)].append({"hours": hours, "hourly": 0, "max": None, "daily": row.daily_free or None}) # Create "closed" rules for periods not covered by an open rule for x in agenda: hours = sorted([y["hours"] for y in agenda[x]], key=lambda z: z[0]) for i, y in enumerate(hours): starts = [z[0] for z in hours] if y[0] == 0.0: continue last_end = hours[i-1][1] if not i == 0 else 0.0 next_start = hours[i+1][0] if not i == (len(hours) - 1) else 24.0 if not last_end in starts: agenda[x].append({"hours": [last_end, y[0]], "hourly": None, "max": None, "daily": None}) if not next_start in starts and y[1] != 24.0: agenda[x].append({"hours": [y[1], next_start], "hourly": None, "max": None, "daily": None}) if agenda[x] == []: agenda[x].append({"hours": [0.0,24.0], "hourly": None, "max": None, "daily": None}) lot += [json.dumps(agenda), row.capacity or 0, json.dumps({"indoor": row.indoor, "handicap": row.handicap, "card": row.card, "valet": row.valet}), row.geom, row.active, row.street_view_head, row.street_view_id, "'{}'".format(row.partner_name) if row.partner_name else "NULL", "'{}'".format(row.partner_id) if row.partner_id else "NULL"] lots.append(lot) for x in lots: queries.append(""" INSERT INTO parking_lots ({}) VALUES ('{city}', '{}', '{}', '{}', '{}', '{}'::jsonb, {}, '{}'::jsonb, '{}'::geometry, '{}', json_build_object('head', {}, 'id', '{}')::jsonb, {}, {}, ST_AsGeoJSON(ST_Transform('{geom}'::geometry, 4326))::jsonb) """.format(",".join(columns), *[y for y in x], city=city, geom=x[-6])) db.queries(queries) def insert_dynamic_rules_seattle(): # load dynamic paid parking rules for Seattle paid_rules = [] data = db.query(""" SELECT ROW_NUMBER() OVER (ORDER BY wkd_start1), array_agg(elmntkey), wkd_start1, wkd_end1, wkd_start2, wkd_end2, wkd_start3, wkd_end3, sat_start1, sat_end1, sat_start2, sat_end2, sat_start3, sat_end3, sun_start1, sun_end1, sun_start2, sun_end2, sun_start3, sun_end3, wkd_rate1, wkd_rate2, wkd_rate3, sat_rate1, sat_rate2, sat_rate3, sun_rate1, sun_rate2, sun_rate3, parking_time_limit, rpz_spaces != 0, rpz_zone, peak_hour FROM seattle_parklines WHERE parking_category = 'Paid Parking' GROUP BY wkd_start1, wkd_end1, wkd_start2, wkd_end2, wkd_start3, wkd_end3, sat_start1, sat_end1, sat_start2, sat_end2, sat_start3, sat_end3, sun_start1, sun_end1, sun_start2, sun_end2, sun_start3, sun_end3, wkd_rate1, wkd_rate2, wkd_rate3, sat_rate1, sat_rate2, sat_rate3, sun_rate1, sun_rate2, sun_rate3, parking_time_limit, rpz_spaces != 0, rpz_zone, peak_hour """) for x in data: wkd2 = wkd3 = sat2 = sat3 = sun2 = sun3 = False if x[2] and x[3]: # weekday start/end times no1 start, end = x[2], x[3] if x[4] and x[5] and x[4] == (end + 1) and x[20] == x[21]: end = x[5] wkd2 = True if x[6] and x[7] and x[6] == (end + 1) and x[21] == x[22]: end = x[7] wkd3 = True paid_rules.append(_dynrule(x, "MON-FRI", start, end, 1)) if x[4] and x[5] and not wkd2: # weekday start/end times no2 start, end = x[4], x[5] if x[6] and x[7] and x[6] == (end + 1) and x[21] == x[22]: end = x[7] wkd3 = True paid_rules.append(_dynrule(x, "MON-FRI", start, end, 2)) if x[6] and x[7] and not wkd3: # weekday start/end times no3 paid_rules.append(_dynrule(x, "MON-FRI", x[6], x[7], 3)) if x[8] and x[9]: # saturday start/end times no1 start, end = x[8], x[9] if x[10] and x[11] and x[10] == (end + 1) and x[23] == x[24]: end = x[11] sat2 = True if x[12] and x[13] and x[12] == (end + 1) and x[24] == x[25]: end = x[13] sat3 = True paid_rules.append(_dynrule(x, "SAT", start, end, 4)) if x[10] and x[11] and not sat2: # saturday start/end times no2 start, end = x[10], x[11] if x[12] and x[13] and x[12] == (end + 1) and x[24] == x[25]: end = x[13] sat3 = True paid_rules.append(_dynrule(x, "SAT", start, end, 5)) if x[12] and x[13] and not sat3: # saturday start/end times no3 paid_rules.append(_dynrule(x, "SAT", start, end, 6)) if x[14] and x[15]: # sunday start/end times no1 start, end = x[14], x[15] if x[16] and x[17] and x[16] == (end + 1) and x[26] == x[27]: end = x[17] sun2 = True if x[18] and x[19] and x[18] == (end + 1) and x[27] == x[28]: end = x[19] sun3 = True paid_rules.append(_dynrule(x, "SUN", start, end, 7)) if x[16] and x[17] and not sun2: # sunday start/end times no2 start, end = x[16], x[17] if x[18] and x[19] and x[18] == (end + 1) and x[27] == x[28]: end = x[19] sun3 = True paid_rules.append(_dynrule(x, "SUN", start, end, 8)) if x[18] and x[19] and not sun3: # sunday start/end times no3 paid_rules.append(_dynrule(x, "SUN", start, end, 9)) if x[32]: # peak hour restriction insert_qry = "('{}', '{}', '{}'::jsonb, {}, ARRAY[{}]::varchar[], '{}', ARRAY{}::varchar[])" code, agenda = "SEA-PAID-{}-10".format(x[0]), {str(y): [] for y in range(1,8)} for z in x[32].split(" "): for y in range(1,6): agenda[str(y)].append([tstr_to_float(z.split("-")[0] + z[-2:]), tstr_to_float(z.split("-")[1])]) desc = "PEAK HOUR NO PARKING WEEKDAYS {}".format(x[32]) paid_rules.append(insert_qry.format(code, desc, json.dumps(agenda), "NULL", "'peak_hour'", "", x[1])) db.query(""" INSERT INTO rules (code, description, agenda, time_max_parking, restrict_types, permit_no) SELECT code, description, agenda, time_max_parking, restrict_types, permit_no FROM (VALUES {}) AS d(code, description, agenda, time_max_parking, restrict_types, permit_no, ids) """.format(",".join([x for x in paid_rules]))) db.query(""" INSERT INTO seattle_sign_codes (code, signs) SELECT code, ids FROM (VALUES {}) AS d(code, description, agenda, time_max_parking, restrict_types, permit_no, ids) """.format(",".join([x for x in paid_rules]))) def _dynrule(x, per, start, end, count): insert_qry = "('{}', '{}', '{}'::jsonb, {}, ARRAY[{}]::varchar[], '{}', ARRAY{}::varchar[])" code, agenda = "SEA-PAID-{}-{}".format(x[0], count), {str(y): [] for y in range(1,8)} if per == "MON-FRI": for y in range(1,6): agenda[str(y)].append([float(start) / 60.0, round(float(end) / 60.0)]) else: agenda["6" if per == "SAT" else "7"].append([float(start) / 60.0, round(float(end) / 60.0)]) desc = "PAID PARKING {}-{} {} ${}/hr".format(pretty_time(start), pretty_time(end), per, "{0:.2f}".format(float(x[19 + count]))) return insert_qry.format(code, desc, json.dumps(agenda), int(x[29]) if x[29] else "NULL", "'paid'" + (",'permit'" if x[30] else ""), x[31] if x[31] else "", x[1])
prkng_process/pipeline.py
from __future__ import unicode_literals import csv import json import os from . import CONFIG, common, osm, plfunctions from .cities import montreal as mrl from .cities import quebec as qbc from .cities import newyork as nyc from .cities import seattle as sea from .cities import boston as bos from .database import PostgresWrapper from .filters import group_rules from .logger import Logger from .utils import pretty_time, tstr_to_float # distance from road to slot LINE_OFFSET = 6 CITIES = ["montreal", "quebec", "newyork", "seattle", "boston"] db = PostgresWrapper( "host='{PG_HOST}' port={PG_PORT} dbname={PG_DATABASE} " "user={PG_USERNAME} password={<PASSWORD>} ".format(**CONFIG)) def process_quebec(debug=False): """ Process Quebec data """ def info(msg): return Logger.info("Québec: {}".format(msg)) def debug(msg): return Logger.debug("Québec: {}".format(msg)) def warning(msg): return Logger.warning("Québec: {}".format(msg)) info('Loading and translating rules') insert_rules('quebec_rules_translation') db.vacuum_analyze('public', 'rules') info("Creating sign table") db.query(qbc.create_sign) info("Loading signs") db.query(qbc.insert_sign) db.create_index('quebec_sign', 'direction') db.create_index('quebec_sign', 'code') db.create_index('quebec_sign', 'geom', index_type='gist') db.vacuum_analyze('public', 'quebec_sign') info("Creating signposts") db.query(qbc.create_signpost) db.create_index('quebec_signpost', 'id') db.create_index('quebec_signpost', 'rid') db.create_index('quebec_signpost', 'signs', index_type='gin') db.create_index('quebec_signpost', 'geom', index_type='gist') db.vacuum_analyze('public', 'quebec_signpost') info("Add signpost id to signs") db.query(qbc.add_signposts_to_sign) db.vacuum_analyze('public', 'quebec_sign') info("Projection signposts on road") duplicates = db.query(qbc.project_signposts) if duplicates: warning("Duplicates found for projected signposts : {}" .format(str(duplicates))) percent, total = db.query(qbc.count_signpost_projected)[0] if percent < 100: warning("Only {:.0f}% of signposts have been bound to a road. Total is {}" .format(percent, total)) db.query(qbc.generate_signposts_orphans) info("Table 'signpost_orphans' has been generated to check for orphans") info("Creating slots between signposts") db.query(qbc.create_slots_likely) db.query(qbc.insert_slots_likely.format(isleft=1)) db.query(qbc.insert_slots_likely.format(isleft=-1)) db.create_index('quebec_slots_likely', 'id') db.create_index('quebec_slots_likely', 'signposts', index_type='gin') db.create_index('quebec_slots_likely', 'geom', index_type='gist') db.vacuum_analyze('public', 'quebec_slots_likely') db.query(qbc.create_nextpoints_for_signposts) db.create_index('quebec_nextpoints', 'id') db.create_index('quebec_nextpoints', 'slot_id') db.create_index('quebec_nextpoints', 'direction') db.vacuum_analyze('public', 'quebec_nextpoints') db.query(qbc.insert_slots_temp.format(offset=LINE_OFFSET)) db.create_index('quebec_slots_temp', 'id') db.create_index('quebec_slots_temp', 'geom', index_type='gist') db.create_index('quebec_slots_temp', 'rules', index_type='gin') db.vacuum_analyze('public', 'quebec_slots_temp') info("Creating and overlaying paid slots") db.query(qbc.create_bornes_raw) db.query(qbc.create_paid_signpost) db.query(qbc.aggregate_paid_signposts.format(offset=LINE_OFFSET)) db.query(qbc.overlay_paid_rules) db.query(qbc.create_paid_slots_standalone) if debug: info("Creating debug slots") db.query(qbc.create_slots_for_debug.format(offset=LINE_OFFSET)) db.create_index('quebec_slots_debug', 'pkid') db.create_index('quebec_slots_debug', 'geom', index_type='gist') db.vacuum_analyze('public', 'quebec_slots_debug') def process_montreal(debug=False): """ process montreal data and generate parking slots """ def info(msg): return Logger.info("Montréal: {}".format(msg)) def debug(msg): return Logger.debug("Montréal: {}".format(msg)) def warning(msg): return Logger.warning("Montréal: {}".format(msg)) debug('Loading and translating rules') insert_rules('montreal_rules_translation') db.vacuum_analyze('public', 'rules') info("Matching osm roads with geobase") db.query(mrl.match_roads_geobase) db.create_index('montreal_roads_geobase', 'id') db.create_index('montreal_roads_geobase', 'id_trc') db.create_index('montreal_roads_geobase', 'osm_id') db.create_index('montreal_roads_geobase', 'name') db.create_index('montreal_roads_geobase', 'geom', index_type='gist') db.vacuum_analyze('public', 'montreal_roads_geobase') info("Creating sign table") db.query(mrl.create_sign) info("Loading signs") db.query(mrl.insert_sign) db.query(mrl.insert_signpost_verdun) db.query(mrl.insert_sign_verdun) db.create_index('montreal_sign', 'geom', index_type='gist') db.create_index('montreal_sign', 'direction') db.create_index('montreal_sign', 'elevation') db.create_index('montreal_sign', 'signpost') db.vacuum_analyze('public', 'montreal_sign') info("Creating sign posts") db.query(mrl.create_signpost) db.query(mrl.insert_signpost) db.create_index('montreal_signpost', 'geom', index_type='gist') db.create_index('montreal_signpost', 'geobase_id') db.vacuum_analyze('public', 'montreal_signpost') info("Projecting signposts on road") duplicates = db.query(mrl.project_signposts) if duplicates: warning("Duplicates found for projected signposts : {}" .format(str(duplicates))) db.create_index('montreal_signpost_onroad', 'id') db.create_index('montreal_signpost_onroad', 'road_id') db.create_index('montreal_signpost_onroad', 'isleft') db.create_index('montreal_signpost_onroad', 'geom', index_type='gist') db.vacuum_analyze('public', 'montreal_signpost_onroad') percent, total = db.query(mrl.count_signpost_projected)[0] if percent < 100: warning("Only {:.0f}% of signposts have been bound to a road. Total is {}" .format(percent, total)) db.query(mrl.generate_signposts_orphans) info("Table 'montreal_signpost_orphans' has been generated to check for orphans") info("Creating slots between signposts") db.query(mrl.create_slots_likely) db.query(mrl.insert_slots_likely.format(isleft=1)) db.query(mrl.insert_slots_likely.format(isleft=-1)) db.create_index('montreal_slots_likely', 'id') db.create_index('montreal_slots_likely', 'signposts', index_type='gin') db.create_index('montreal_slots_likely', 'geom', index_type='gist') db.vacuum_analyze('public', 'montreal_slots_likely') db.query(mrl.create_nextpoints_for_signposts) db.create_index('montreal_nextpoints', 'id') db.create_index('montreal_nextpoints', 'slot_id') db.create_index('montreal_nextpoints', 'direction') db.vacuum_analyze('public', 'montreal_nextpoints') db.create_index('montreal_slots_temp', 'id') db.create_index('montreal_slots_temp', 'geom', index_type='gist') db.create_index('montreal_slots_temp', 'rules', index_type='gin') db.query(mrl.insert_slots_temp.format(offset=LINE_OFFSET)) info("Creating and overlaying paid slots") db.query(mrl.overlay_paid_rules) db.vacuum_analyze('public', 'montreal_slots_temp') if debug: info("Creating debug slots") db.query(mrl.create_slots_for_debug.format(offset=LINE_OFFSET)) db.create_index('montreal_slots_debug', 'pkid') db.create_index('montreal_slots_debug', 'geom', index_type='gist') db.vacuum_analyze('public', 'montreal_slots_debug') def process_newyork(debug=False): """ Process New York data """ def info(msg): return Logger.info("New York: {}".format(msg)) def debug(msg): return Logger.debug("New York: {}".format(msg)) def warning(msg): return Logger.warning("New York: {}".format(msg)) info('Loading and translating rules') insert_rules('newyork_rules_translation') db.vacuum_analyze('public', 'rules') info("Loading signs") db.query(nyc.create_sign) db.query(nyc.insert_sign) db.create_index('newyork_sign', 'direction') db.create_index('newyork_sign', 'code') db.create_index('newyork_sign', 'geom', index_type='gist') db.vacuum_analyze('public', 'newyork_sign') info("Creating signposts") db.query(nyc.create_signpost) db.query(nyc.insert_signpost) db.create_index('newyork_signpost', 'id') db.create_index('newyork_signpost', 'geobase_id') db.create_index('newyork_signpost', 'signs', index_type='gin') db.create_index('newyork_signpost', 'geom', index_type='gist') db.vacuum_analyze('public', 'newyork_signpost') info("Matching osm roads with geobase") db.query(nyc.match_roads_geobase) db.create_index('newyork_roads_geobase', 'id') db.create_index('newyork_roads_geobase', 'osm_id') db.create_index('newyork_roads_geobase', 'name') db.create_index('newyork_roads_geobase', 'boro') db.create_index('newyork_roads_geobase', 'geom', index_type='gist') db.vacuum_analyze('public', 'newyork_roads_geobase') info("Match signposts to geobase") db.query(nyc.match_signposts) db.vacuum_analyze('public', 'newyork_signpost') info("Add signpost id to signs") db.query(nyc.add_signposts_to_sign) db.vacuum_analyze('public', 'newyork_sign') info("Projecting signposts on road") duplicates = db.query(nyc.project_signposts) if duplicates: warning("Duplicates found for projected signposts : {}" .format(str(duplicates))) percent, total = db.query(nyc.count_signpost_projected)[0] if percent < 100: warning("Only {:.0f}% of signposts have been bound to a road. Total is {}" .format(percent, total)) db.query(nyc.generate_signposts_orphans) info("Table 'newyork_signpost_orphans' has been generated to check for orphans") info("Creating likely slots") db.query(nyc.create_slots_likely) db.query(nyc.insert_slots_likely.format(isleft=1)) db.query(nyc.insert_slots_likely.format(isleft=-1)) # Get rid of problem segments FIXME db.query(""" with tmp as ( select * from ( select g.id, count(distinct s.order_no) from newyork_roads_geobase g join newyork_signpost s on s.geobase_id = g.id group by g.id ) foo where count > 2 ) delete from newyork_slots_likely s using tmp t where t.id = s.rid; """) db.create_index('newyork_slots_likely', 'id') db.create_index('newyork_slots_likely', 'signposts', index_type='gin') db.create_index('newyork_slots_likely', 'geom', index_type='gist') db.vacuum_analyze('public', 'newyork_slots_likely') info("Creating nextpoints") db.query(nyc.create_nextpoints_for_signposts) db.create_index('newyork_nextpoints', 'id') db.create_index('newyork_nextpoints', 'slot_id') db.create_index('newyork_nextpoints', 'direction') db.vacuum_analyze('public', 'newyork_nextpoints') for x in ['K', 'M', 'Q', 'B', 'S']: info("Creating slots between signposts (borough {})".format(x)) db.query(nyc.insert_slots_temp.format(boro=x, offset=LINE_OFFSET)) db.create_index('newyork_slots_temp', 'id') db.create_index('newyork_slots_temp', 'geom', index_type='gist') db.create_index('newyork_slots_temp', 'rules', index_type='gin') db.vacuum_analyze('public', 'newyork_slots_temp') if debug: info("Creating debug slots") for x in ['K', 'M', 'Q', 'B', 'S']: db.query(nyc.create_slots_for_debug.format(boro=x, offset=LINE_OFFSET)) db.create_index('newyork_slots_debug', 'pkid') db.create_index('newyork_slots_debug', 'geom', index_type='gist') db.vacuum_analyze('public', 'newyork_slots_debug') def process_seattle(debug=False): """ Process Seattle data """ def info(msg): return Logger.info("Seattle: {}".format(msg)) def debug(msg): return Logger.debug("Seattle: {}".format(msg)) def warning(msg): return Logger.warning("Seattle: {}".format(msg)) info('Loading and translating rules') insert_rules('seattle_rules_translation') insert_dynamic_rules_seattle() db.vacuum_analyze('public', 'rules') info("Matching OSM roads with geobase") db.query(sea.match_roads_geobase) db.create_index('seattle_roads_geobase', 'id') db.create_index('seattle_roads_geobase', 'osm_id') db.create_index('seattle_roads_geobase', 'name') db.create_index('seattle_roads_geobase', 'geom', index_type='gist') db.vacuum_analyze('public', 'seattle_roads_geobase') info("Loading signs") db.query(sea.create_sign) db.query(sea.insert_sign) db.query(sea.insert_sign_paid) db.query(sea.insert_sign_directional) db.query(sea.insert_sign_parklines) db.create_index('seattle_sign', 'direction') db.create_index('seattle_sign', 'code') db.create_index('seattle_sign', 'geom', index_type='gist') db.vacuum_analyze('public', 'seattle_sign') info("Creating signposts") db.query(sea.create_signpost) db.query(sea.insert_signpost) db.create_index('seattle_signpost', 'id') db.create_index('seattle_signpost', 'geobase_id') db.create_index('seattle_signpost', 'signs', index_type='gin') db.create_index('seattle_signpost', 'geom', index_type='gist') db.query(sea.add_signposts_to_sign) db.vacuum_analyze('public', 'seattle_signpost') info("Projecting signposts on road") duplicates = db.query(sea.project_signposts) if duplicates: warning("Duplicates found for projected signposts : {}" .format(str(duplicates))) percent, total = db.query(sea.count_signpost_projected)[0] if percent < 100: warning("Only {:.0f}% of signposts have been bound to a road. Total is {}" .format(percent, total)) db.query(sea.generate_signposts_orphans) info("Table 'seattle_signpost_orphans' has been generated to check for orphans") db.query(sea.assign_directions) db.vacuum_analyze('public', 'seattle_sign') info("Creating likely slots") db.query(sea.create_slots_likely) db.query(sea.insert_slots_likely.format(isleft=1)) db.query(sea.insert_slots_likely.format(isleft=-1)) db.create_index('seattle_slots_likely', 'id') db.create_index('seattle_slots_likely', 'signposts', index_type='gin') db.create_index('seattle_slots_likely', 'geom', index_type='gist') db.vacuum_analyze('public', 'seattle_slots_likely') info("Creating nextpoints") db.query(sea.create_nextpoints_for_signposts) db.create_index('seattle_nextpoints', 'id') db.create_index('seattle_nextpoints', 'slot_id') db.create_index('seattle_nextpoints', 'direction') db.vacuum_analyze('public', 'seattle_nextpoints') info("Creating slots between signposts") db.query(sea.insert_slots_temp.format(offset=LINE_OFFSET)) db.create_index('seattle_slots_temp', 'id') db.create_index('seattle_slots_temp', 'geom', index_type='gist') db.create_index('seattle_slots_temp', 'rules', index_type='gin') db.vacuum_analyze('public', 'seattle_slots_temp') if debug: info("Creating debug slots") db.query(sea.create_slots_for_debug.format(offset=LINE_OFFSET)) db.create_index('seattle_slots_debug', 'pkid') db.create_index('seattle_slots_debug', 'geom', index_type='gist') db.vacuum_analyze('public', 'seattle_slots_debug') def process_boston(debug=False): """ process boston data and generate parking slots """ def info(msg): return Logger.info("Boston: {}".format(msg)) def debug(msg): return Logger.debug("Boston: {}".format(msg)) def warning(msg): return Logger.warning("Boston: {}".format(msg)) debug('Loading and translating rules') insert_rules('boston_rules_translation') db.vacuum_analyze('public', 'rules') info("Matching OSM roads with geobase") db.query(bos.create_roads_geobase) db.query(bos.match_roads_geobase.format(tbl="boston_geobase")) db.query(bos.match_roads_geobase.format(tbl="boston_metro_geobase")) db.create_index('boston_roads_geobase', 'id') db.create_index('boston_roads_geobase', 'roadsegment') db.create_index('boston_roads_geobase', 'osm_id') db.create_index('boston_roads_geobase', 'name') db.create_index('boston_roads_geobase', 'geom', index_type='gist') db.vacuum_analyze('public', 'boston_roads_geobase') info("Creating sign table") db.query(bos.create_sign) info("Loading signs") db.query(bos.insert_sign) db.query(bos.insert_sign_cambridge) db.create_index('boston_sign', 'geom', index_type='gist') db.create_index('boston_sign', 'direction') db.create_index('boston_sign', 'signpost') db.vacuum_analyze('public', 'boston_sign') info("Creating sign posts") db.query(bos.create_signpost) db.query(bos.insert_signpost) db.create_index('boston_signpost', 'geom', index_type='gist') db.create_index('boston_signpost', 'geobase_id') db.query(bos.add_signposts_to_sign) db.vacuum_analyze('public', 'boston_signpost') info("Projecting signposts on road") duplicates = db.query(bos.project_signposts) if duplicates: warning("Duplicates found for projected signposts : {}" .format(str(duplicates))) db.create_index('boston_signpost_onroad', 'id') db.create_index('boston_signpost_onroad', 'road_id') db.create_index('boston_signpost_onroad', 'isleft') db.create_index('boston_signpost_onroad', 'geom', index_type='gist') db.vacuum_analyze('public', 'boston_signpost_onroad') percent, total = db.query(bos.count_signpost_projected)[0] if percent < 100: warning("Only {:.0f}% of signposts have been bound to a road. Total is {}" .format(percent, total)) db.query(bos.generate_signposts_orphans) info("Table 'boston_signpost_orphans' has been generated to check for orphans") info("Creating slots between signposts") db.query(bos.create_slots_likely) db.query(bos.insert_slots_likely.format(isleft=1)) db.query(bos.insert_slots_likely.format(isleft=-1)) db.create_index('boston_slots_likely', 'id') db.create_index('boston_slots_likely', 'signposts', index_type='gin') db.create_index('boston_slots_likely', 'geom', index_type='gist') db.vacuum_analyze('public', 'boston_slots_likely') db.query(bos.create_nextpoints_for_signposts) db.create_index('boston_nextpoints', 'id') db.create_index('boston_nextpoints', 'slot_id') db.create_index('boston_nextpoints', 'direction') db.vacuum_analyze('public', 'boston_nextpoints') db.create_index('boston_slots_temp', 'id') db.create_index('boston_slots_temp', 'geom', index_type='gist') db.create_index('boston_slots_temp', 'rules', index_type='gin') db.query(bos.insert_slots_temp.format(offset=LINE_OFFSET)) info("Creating and overlaying paid slots") db.query(bos.overlay_paid_rules) db.vacuum_analyze('public', 'boston_slots_temp') if debug: info("Creating debug slots") db.query(bos.create_slots_for_debug.format(offset=LINE_OFFSET)) db.create_index('boston_slots_debug', 'pkid') db.create_index('boston_slots_debug', 'geom', index_type='gist') db.vacuum_analyze('public', 'boston_slots_debug') def cleanup_table(): """ Remove temporary tables """ Logger.info("Cleanup schema") # drop universal temp tables for x in ["bad_intersection", "way_intersection", "roads", "signpost_onroad", "parking_lots_raw"]: db.query("DROP TABLE IF EXISTS {}".format(x)) # drop per-city temp tables for x in ["slots_likely", "slots_temp", "nextpoints", "paid_temp", "signpost_temp", "paid_slots_raw", "bornes_raw", "bornes_clustered"]: for y in CITIES: db.query("DROP TABLE IF EXISTS {}_{}".format(y, x)) def process_osm(): """ Process OSM data """ def info(msg): return Logger.info("OpenStreetMap: {}".format(msg)) def debug(msg): return Logger.debug("OpenStreetMap: {}".format(msg)) def warning(msg): return Logger.warning("OpenStreetMap: {}".format(msg)) info("Filtering ways") db.query(osm.create_osm_ways) db.create_index('osm_ways', 'geom', index_type='gist') db.create_index('osm_ways', 'osm_id') db.create_index('osm_ways', 'name') info("Creating way intersections from planet lines") db.query(osm.create_way_intersection) db.create_index('way_intersection', 'way_id') db.create_index('way_intersection', 'geom', index_type='gist') db.vacuum_analyze('public', 'way_intersection') res = db.query(osm.remove_bad_intersection) if res: debug("Removed {} bad intersections".format(len(res))) info("Splitting ways on intersections") db.query(osm.split_osm_roads) db.create_index('roads', 'id') db.create_index('roads', 'osm_id') db.create_index('roads', 'name') db.create_index('roads', 'geom', index_type='gist') db.vacuum_analyze('public', 'roads') def run(cities=CITIES, osm=False, debug=False): """ Run the entire pipeline """ Logger.debug("Loading extensions and custom functions") db.query("create extension if not exists fuzzystrmatch") db.query("create extension if not exists intarray") db.query(plfunctions.st_isleft_func) db.query(plfunctions.array_sort) db.query(plfunctions.get_max_range) if osm: process_osm() # create common tables db.query(common.create_rules) db.create_index('rules', 'code') db.query(common.create_slots) for x in cities: db.query(common.create_slots_temp.format(city=x)) db.query(common.create_slots_partition.format(city=x)) Logger.info("Processing parking lot / garage data") db.query(common.create_parking_lots) db.query(common.create_parking_lots_raw.format(city="montreal")) insert_raw_lots("montreal", "lots_montreal.csv") insert_parking_lots("montreal") db.query(common.create_parking_lots_raw.format(city="quebec")) insert_raw_lots("quebec", "lots_quebec.csv") insert_parking_lots("quebec") db.query(common.create_parking_lots_raw.format(city="seattle")) insert_raw_lots("seattle", "lots_seattle.csv") insert_parking_lots("seattle") db.query(common.create_parking_lots_raw.format(city="boston")) insert_raw_lots("boston", "lots_boston.csv") insert_parking_lots("boston") db.create_index('parking_lots', 'id') db.create_index('parking_lots', 'city') db.create_index('parking_lots', 'geom', index_type='gist') db.create_index('parking_lots', 'agenda', index_type='gin') db.query("DROP TABLE IF EXISTS parking_lots_streetview;") insert_lots_streetview("lots_newyork_streetview.csv") if 'montreal' in cities: process_montreal(debug) if 'quebec' in cities: process_quebec(debug) if 'newyork' in cities: process_newyork(debug) if 'seattle' in cities: process_seattle(debug) if 'boston' in cities: process_boston(debug) Logger.info("Shorten slots that intersect with roads or other slots") for x in cities: db.query(common.cut_slots_crossing_roads.format(city=x, offset=LINE_OFFSET)) db.query(common.cut_slots_crossing_slots.format(city=x)) Logger.info("Aggregating like slots") for x in cities: db.create_index(x+'_slots', 'id') db.create_index(x+'_slots', 'geom', index_type='gist') db.create_index(x+'_slots', 'rules', index_type='gin') db.query(common.aggregate_like_slots.format(city=x, within=3 if x == "seattle" else 0.1)) db.query(common.create_client_data.format(city=x)) db.vacuum_analyze('public', x+'_slots') Logger.info("Creating permit lists") db.query(common.create_permit_lists) for x in cities: db.query(common.insert_permit_lists.format(city=x)) if not debug: cleanup_table() def insert_rules(from_table): """ Get rules from specific location (montreal, quebec), group them, make a simpler model and load them into database """ Logger.debug("Get rules from {} and simplify them".format(from_table)) rules = db.query( common.get_rules_from_source.format(source=from_table), namedtuple=True ) rules_grouped = group_rules(rules) Logger.debug("Load rules into rules table") db.copy_from('public', 'rules', common.rules_columns, [ [ json.dumps(val).replace('\\', '\\\\') if isinstance(val, dict) else val for val in rule._asdict().values()] for rule in rules_grouped ]) def insert_raw_lots(city, filename): db.query(""" COPY {}_parking_lots (name, operator, address, description, lun_normal, mar_normal, mer_normal, jeu_normal, ven_normal, sam_normal, dim_normal, hourly_normal, daily_normal, max_normal, lun_special, mar_special, mer_special, jeu_special, ven_special, sam_special, dim_special, hourly_special, daily_special, max_special, lun_free, mar_free, mer_free, jeu_free, ven_free, sam_free, dim_free, daily_free, indoor, handicap, card, valet, lat, long, capacity, street_view_lat, street_view_long, street_view_head, street_view_id, active, partner_name, partner_id) FROM '{}' WITH CSV HEADER """.format(city, os.path.join(os.path.dirname(__file__), 'data', filename))) def insert_lots_streetview(filename): with open(os.path.join(os.path.dirname(__file__), 'data', 'load_lots_streetview.sql'), 'rb') as infile: db.query(infile.read().format(os.path.join(os.path.dirname(__file__), 'data', filename))) db.vacuum_analyze("public", "parking_lots_streetview") def insert_parking_lots(city): columns = ["city", "name", "operator", "address", "description", "agenda", "capacity", "attrs", "geom", "active", "street_view", "partner_name", "partner_id", "geojson"] days = ["lun", "mar", "mer", "jeu", "ven", "sam", "dim"] lots, queries = [], [] for row in db.query(""" SELECT *, ST_Transform(ST_SetSRID(ST_MakePoint(long, lat), 4326), 3857) AS geom FROM {}_parking_lots """.format(city), namedtuple=True): lot = [(x.decode('utf-8').replace("'", "''") if x else '') for x in [row.name, row.operator, row.address, row.description]] # Create pricing rules per time period the lot is open agenda = {str(y): [] for y in range(1,8)} for x in range(1,8): if getattr(row, days[x - 1] + "_normal"): y = getattr(row, days[x - 1] + "_normal") hours = [float(z) for z in y.split(",")] if hours != [0.0, 24.0] and hours[0] > hours[1]: nextday = str(x+1) if (x < 7) else "1" agenda[nextday].append({"hours": [0.0, hours[1]], "max": row.max_normal or None, "hourly": row.hourly_normal or None, "daily": row.daily_normal or None}) hours = [hours[0], 24.0] agenda[str(x)].append({"hours": hours, "hourly": row.hourly_normal or None, "max": row.max_normal or None, "daily": row.daily_normal or None}) if getattr(row, days[x - 1] + "_special"): y = getattr(row, days[x - 1] + "_special") hours = [float(z) for z in y.split(",")] if hours != [0.0, 24.0] and hours[0] > hours[1]: nextday = str(x+1) if (x < 7) else "1" agenda[nextday].append({"hours": [0.0, hours[1]], "max": row.max_special or None, "hourly": row.hourly_special or None, "daily": row.daily_special or None}) hours = [hours[0], 24.0] agenda[str(x)].append({"hours": hours, "hourly": row.hourly_special or None, "max": row.max_special or None, "daily": row.daily_special or None}) if getattr(row, days[x - 1] + "_free"): y = getattr(row, days[x - 1] + "_free") hours = [float(z) for z in y.split(",")] if hours != [0.0, 24.0] and hours[0] > hours[1]: nextday = str(x+1) if (x < 7) else "1" agenda[nextday].append({"hours": [0.0, hours[1]], "max": None, "hourly": 0, "daily": row.daily_free or None}) hours = [hours[0], 24.0] agenda[str(x)].append({"hours": hours, "hourly": 0, "max": None, "daily": row.daily_free or None}) # Create "closed" rules for periods not covered by an open rule for x in agenda: hours = sorted([y["hours"] for y in agenda[x]], key=lambda z: z[0]) for i, y in enumerate(hours): starts = [z[0] for z in hours] if y[0] == 0.0: continue last_end = hours[i-1][1] if not i == 0 else 0.0 next_start = hours[i+1][0] if not i == (len(hours) - 1) else 24.0 if not last_end in starts: agenda[x].append({"hours": [last_end, y[0]], "hourly": None, "max": None, "daily": None}) if not next_start in starts and y[1] != 24.0: agenda[x].append({"hours": [y[1], next_start], "hourly": None, "max": None, "daily": None}) if agenda[x] == []: agenda[x].append({"hours": [0.0,24.0], "hourly": None, "max": None, "daily": None}) lot += [json.dumps(agenda), row.capacity or 0, json.dumps({"indoor": row.indoor, "handicap": row.handicap, "card": row.card, "valet": row.valet}), row.geom, row.active, row.street_view_head, row.street_view_id, "'{}'".format(row.partner_name) if row.partner_name else "NULL", "'{}'".format(row.partner_id) if row.partner_id else "NULL"] lots.append(lot) for x in lots: queries.append(""" INSERT INTO parking_lots ({}) VALUES ('{city}', '{}', '{}', '{}', '{}', '{}'::jsonb, {}, '{}'::jsonb, '{}'::geometry, '{}', json_build_object('head', {}, 'id', '{}')::jsonb, {}, {}, ST_AsGeoJSON(ST_Transform('{geom}'::geometry, 4326))::jsonb) """.format(",".join(columns), *[y for y in x], city=city, geom=x[-6])) db.queries(queries) def insert_dynamic_rules_seattle(): # load dynamic paid parking rules for Seattle paid_rules = [] data = db.query(""" SELECT ROW_NUMBER() OVER (ORDER BY wkd_start1), array_agg(elmntkey), wkd_start1, wkd_end1, wkd_start2, wkd_end2, wkd_start3, wkd_end3, sat_start1, sat_end1, sat_start2, sat_end2, sat_start3, sat_end3, sun_start1, sun_end1, sun_start2, sun_end2, sun_start3, sun_end3, wkd_rate1, wkd_rate2, wkd_rate3, sat_rate1, sat_rate2, sat_rate3, sun_rate1, sun_rate2, sun_rate3, parking_time_limit, rpz_spaces != 0, rpz_zone, peak_hour FROM seattle_parklines WHERE parking_category = 'Paid Parking' GROUP BY wkd_start1, wkd_end1, wkd_start2, wkd_end2, wkd_start3, wkd_end3, sat_start1, sat_end1, sat_start2, sat_end2, sat_start3, sat_end3, sun_start1, sun_end1, sun_start2, sun_end2, sun_start3, sun_end3, wkd_rate1, wkd_rate2, wkd_rate3, sat_rate1, sat_rate2, sat_rate3, sun_rate1, sun_rate2, sun_rate3, parking_time_limit, rpz_spaces != 0, rpz_zone, peak_hour """) for x in data: wkd2 = wkd3 = sat2 = sat3 = sun2 = sun3 = False if x[2] and x[3]: # weekday start/end times no1 start, end = x[2], x[3] if x[4] and x[5] and x[4] == (end + 1) and x[20] == x[21]: end = x[5] wkd2 = True if x[6] and x[7] and x[6] == (end + 1) and x[21] == x[22]: end = x[7] wkd3 = True paid_rules.append(_dynrule(x, "MON-FRI", start, end, 1)) if x[4] and x[5] and not wkd2: # weekday start/end times no2 start, end = x[4], x[5] if x[6] and x[7] and x[6] == (end + 1) and x[21] == x[22]: end = x[7] wkd3 = True paid_rules.append(_dynrule(x, "MON-FRI", start, end, 2)) if x[6] and x[7] and not wkd3: # weekday start/end times no3 paid_rules.append(_dynrule(x, "MON-FRI", x[6], x[7], 3)) if x[8] and x[9]: # saturday start/end times no1 start, end = x[8], x[9] if x[10] and x[11] and x[10] == (end + 1) and x[23] == x[24]: end = x[11] sat2 = True if x[12] and x[13] and x[12] == (end + 1) and x[24] == x[25]: end = x[13] sat3 = True paid_rules.append(_dynrule(x, "SAT", start, end, 4)) if x[10] and x[11] and not sat2: # saturday start/end times no2 start, end = x[10], x[11] if x[12] and x[13] and x[12] == (end + 1) and x[24] == x[25]: end = x[13] sat3 = True paid_rules.append(_dynrule(x, "SAT", start, end, 5)) if x[12] and x[13] and not sat3: # saturday start/end times no3 paid_rules.append(_dynrule(x, "SAT", start, end, 6)) if x[14] and x[15]: # sunday start/end times no1 start, end = x[14], x[15] if x[16] and x[17] and x[16] == (end + 1) and x[26] == x[27]: end = x[17] sun2 = True if x[18] and x[19] and x[18] == (end + 1) and x[27] == x[28]: end = x[19] sun3 = True paid_rules.append(_dynrule(x, "SUN", start, end, 7)) if x[16] and x[17] and not sun2: # sunday start/end times no2 start, end = x[16], x[17] if x[18] and x[19] and x[18] == (end + 1) and x[27] == x[28]: end = x[19] sun3 = True paid_rules.append(_dynrule(x, "SUN", start, end, 8)) if x[18] and x[19] and not sun3: # sunday start/end times no3 paid_rules.append(_dynrule(x, "SUN", start, end, 9)) if x[32]: # peak hour restriction insert_qry = "('{}', '{}', '{}'::jsonb, {}, ARRAY[{}]::varchar[], '{}', ARRAY{}::varchar[])" code, agenda = "SEA-PAID-{}-10".format(x[0]), {str(y): [] for y in range(1,8)} for z in x[32].split(" "): for y in range(1,6): agenda[str(y)].append([tstr_to_float(z.split("-")[0] + z[-2:]), tstr_to_float(z.split("-")[1])]) desc = "PEAK HOUR NO PARKING WEEKDAYS {}".format(x[32]) paid_rules.append(insert_qry.format(code, desc, json.dumps(agenda), "NULL", "'peak_hour'", "", x[1])) db.query(""" INSERT INTO rules (code, description, agenda, time_max_parking, restrict_types, permit_no) SELECT code, description, agenda, time_max_parking, restrict_types, permit_no FROM (VALUES {}) AS d(code, description, agenda, time_max_parking, restrict_types, permit_no, ids) """.format(",".join([x for x in paid_rules]))) db.query(""" INSERT INTO seattle_sign_codes (code, signs) SELECT code, ids FROM (VALUES {}) AS d(code, description, agenda, time_max_parking, restrict_types, permit_no, ids) """.format(",".join([x for x in paid_rules]))) def _dynrule(x, per, start, end, count): insert_qry = "('{}', '{}', '{}'::jsonb, {}, ARRAY[{}]::varchar[], '{}', ARRAY{}::varchar[])" code, agenda = "SEA-PAID-{}-{}".format(x[0], count), {str(y): [] for y in range(1,8)} if per == "MON-FRI": for y in range(1,6): agenda[str(y)].append([float(start) / 60.0, round(float(end) / 60.0)]) else: agenda["6" if per == "SAT" else "7"].append([float(start) / 60.0, round(float(end) / 60.0)]) desc = "PAID PARKING {}-{} {} ${}/hr".format(pretty_time(start), pretty_time(end), per, "{0:.2f}".format(float(x[19 + count]))) return insert_qry.format(code, desc, json.dumps(agenda), int(x[29]) if x[29] else "NULL", "'paid'" + (",'permit'" if x[30] else ""), x[31] if x[31] else "", x[1])
0.493409
0.113481
from flask import Flask, request, jsonify, render_template, abort, Response from . import shallow_backend from . import suggest app = Flask(__name__) app.debug = True # todo: 1. suggestions do not work # todo: 2. adding corrections is still not implemeneted # todo: 3. joining tokens across the lines has to be implemented # todo: 4. commitable decorator @app.route('/scriptorium') def scriptorium(): '''scriptorium page: returns titles of works being transcribed''' titles = shallow_backend.get_just_titles() return render_template("scriptorium.html", titles=titles) # FIXME - for nice frienldy urls: /tiro/<author>/<title>/page @app.route('/tiro/<title>/<int:pagenumber>') def tiro(title, pagenumber): """shows single page""" page = shallow_backend.get_page(title, pagenumber) if not page: abort(404) return render_template("tiro.html", page=page) # AJAX SECTION @app.route("/suggest") def suggest(): """ Ajax - receive incorrect form, suggest correction""" incorrect = request.args.get('word') suggestions = suggest.smart_suggest(incorrect) return jsonify(suggestions) @app.route("/update", methods=['POST']) def update(): ''' Corrected version of the token provided manually by user Rename the function. ''' correct_form = request.form.get('correct_form') word_id = request.form.get('word_id') return shallow_backend.save_corrected(word_id, correct_form) @app.route("/divide", methods=['POST']) def divide(): """ Fixme: use PUT method :return: """ word_id = request.form.get('word_id'), word = request.form.get('word') return shallow_backend.divide_word(word_id, word) @app.route("/join", methods=['POST']) def join(): """ Fixme: use PUT method :return: """ word_id = request.form.get('word_id') word = request.form.get('word') return shallow_backend.join_word_with_next(word_id, word) @app.route("/setcorrect", methods=['POST']) def set_correct(): ''' User clicks: 'this word is correct' - we set corr to 1 ''' word_id = request.form.get('word_id') return shallow_backend.set_correct(word_id) @app.route("/setincorrect", methods=['POST']) def setincorrect(): ''' User clicks: 'this word is not correct' - we set corr to 0 ''' word_id = request.form.get('word_id') return shallow_backend.set_incorrect(word_id) @app.route("/setpagination", methods=['POST']) def setpagination(): ''' ''' word_id = request.form.get('word_id') return shallow_backend.set_pagination(word_id) @app.route("/remove", methods=['POST']) def remove(): ''' Remove token ''' word_id = request.form.get('word_id') return shallow_backend.remove(word_id) # ADMIN SECTION @app.route("/corrections", methods=['GET']) def get_corrections(): ''' Show all corrections - only to logged in user ''' time_from = request.args.get('time_from') time_to = request.args.get('time_to') source = request.args.get('source') corrections = shallow_backend.get_corrections(time_from=time_from, time_to=time_to, source=source) return render_template("corrections.html", corrections=corrections) @app.route("/rollback", methods=['POST']) def rollback(): ''' Rollback correction ''' word_id = request.form.get('word_id') return shallow_backend.roll_back(word_id) @app.errorhandler(404) def page_not_found(error): ''' 404 ''' return render_template("404.html"), 404
app.py
from flask import Flask, request, jsonify, render_template, abort, Response from . import shallow_backend from . import suggest app = Flask(__name__) app.debug = True # todo: 1. suggestions do not work # todo: 2. adding corrections is still not implemeneted # todo: 3. joining tokens across the lines has to be implemented # todo: 4. commitable decorator @app.route('/scriptorium') def scriptorium(): '''scriptorium page: returns titles of works being transcribed''' titles = shallow_backend.get_just_titles() return render_template("scriptorium.html", titles=titles) # FIXME - for nice frienldy urls: /tiro/<author>/<title>/page @app.route('/tiro/<title>/<int:pagenumber>') def tiro(title, pagenumber): """shows single page""" page = shallow_backend.get_page(title, pagenumber) if not page: abort(404) return render_template("tiro.html", page=page) # AJAX SECTION @app.route("/suggest") def suggest(): """ Ajax - receive incorrect form, suggest correction""" incorrect = request.args.get('word') suggestions = suggest.smart_suggest(incorrect) return jsonify(suggestions) @app.route("/update", methods=['POST']) def update(): ''' Corrected version of the token provided manually by user Rename the function. ''' correct_form = request.form.get('correct_form') word_id = request.form.get('word_id') return shallow_backend.save_corrected(word_id, correct_form) @app.route("/divide", methods=['POST']) def divide(): """ Fixme: use PUT method :return: """ word_id = request.form.get('word_id'), word = request.form.get('word') return shallow_backend.divide_word(word_id, word) @app.route("/join", methods=['POST']) def join(): """ Fixme: use PUT method :return: """ word_id = request.form.get('word_id') word = request.form.get('word') return shallow_backend.join_word_with_next(word_id, word) @app.route("/setcorrect", methods=['POST']) def set_correct(): ''' User clicks: 'this word is correct' - we set corr to 1 ''' word_id = request.form.get('word_id') return shallow_backend.set_correct(word_id) @app.route("/setincorrect", methods=['POST']) def setincorrect(): ''' User clicks: 'this word is not correct' - we set corr to 0 ''' word_id = request.form.get('word_id') return shallow_backend.set_incorrect(word_id) @app.route("/setpagination", methods=['POST']) def setpagination(): ''' ''' word_id = request.form.get('word_id') return shallow_backend.set_pagination(word_id) @app.route("/remove", methods=['POST']) def remove(): ''' Remove token ''' word_id = request.form.get('word_id') return shallow_backend.remove(word_id) # ADMIN SECTION @app.route("/corrections", methods=['GET']) def get_corrections(): ''' Show all corrections - only to logged in user ''' time_from = request.args.get('time_from') time_to = request.args.get('time_to') source = request.args.get('source') corrections = shallow_backend.get_corrections(time_from=time_from, time_to=time_to, source=source) return render_template("corrections.html", corrections=corrections) @app.route("/rollback", methods=['POST']) def rollback(): ''' Rollback correction ''' word_id = request.form.get('word_id') return shallow_backend.roll_back(word_id) @app.errorhandler(404) def page_not_found(error): ''' 404 ''' return render_template("404.html"), 404
0.297164
0.084568
import csv import datetime import os import roslib import rospy import rostopic _node_name = 'logger_node' """Name of this node in the ROS system.""" class DataIn(object): """Receiver and buffer of a topic.""" def __init__(self, topic, name=None): """Constructor. topic -- topic including field to receive. name -- abbreviation for the topic used as column header in the CSV. """ self.__topic = topic """Topic including field (full path, i.e., all namespaces included).""" if name is None: self.__name = topic else: self.__name = name """Abbreviation for the topic used as column header.""" self.__value = None # no message received yet """Value of the input data.""" # get the topic type and function to evaluate the field # wait until topic gets available rospy.loginfo("DataIn '%s': await availability...", topic) topic_type, real_topic, field_eval = rostopic.get_topic_type(topic, blocking=True) if topic_type is None: raise Exception("Can not resolve topic type of {}.".format(topic)) if field_eval is None: raise Exception("Can not resolve field of {}.".format(topic)) # subscribe and save function for message evaluation data_class = roslib.message.get_message_class(topic_type) self.__subscriber = rospy.Subscriber(real_topic, data_class, self.__msg_callback) """Subscriber to a topic - to receive messages.""" self.__field_eval = field_eval """Function returning the value of the specificed field in a message.""" rospy.loginfo("DataIn '%s': created.", topic) def __exit__(self): self.__subscriber.unregister() def __msg_callback(self, msg): """Called when a message of the topic is received.""" self.__value = self.__field_eval(msg) rospy.logdebug("DataIn '%s' received: %f", self.__topic, self.__value) def __get_name(self): """Returns the name of the input.""" return self.__name name = property(__get_name) def __get_value(self): """Returns the latest value received.""" return self.__value value = property(__get_value) class Logger(object): """Logs inputs to a CSV.""" def __init__(self, path, data, log_time=True): """Constructor. path -- path to CSV. data -- list of DataIn objects. log_time -- enables logging of timestamps. """ self.__data = data # DataIn objects self.__path = path # path to csv to write logs to self.__writer = None # csv writer self.__enabled = False # enable write to csv self.__log_time = log_time # open csv file csvfile = open(path, 'w') self.__writer = csv.writer(csvfile) # write header fieldnames = [d.name for d in self.__data] if self.__log_time: fieldnames.insert(0, "time") rospy.logdebug("CSV fields: %s.", fieldnames) fieldnames[0] = '%' + fieldnames[0] # header is a comment self.__writer.writerow(fieldnames) rospy.loginfo("Logger will write to %s.", os.path.abspath(csvfile.name)) def __exit__(self): print "close csv file" csvfile.close() def log(self, event): values = [d.value for d in self.__data] if self.__enabled: if self.__log_time: curtime = rospy.Time.now() values.insert(0, "{:d}.{:09d}".format(curtime.secs, curtime.nsecs)) self.__writer.writerow(values) rospy.logdebug("New row: %s.", values) else: # enable logger as soon as all inputs received at least once received = [1 for v in values if v is not None] if sum(received) == len(values): rospy.loginfo("Start logging (next cycle).") self.__enabled = True # main entry point of this node if __name__ == '__main__': try: # setup ROS node rospy.init_node(_node_name) # params topics = rospy.get_param('~topics', None) rate = rospy.get_param('~rate', 10) # path ... create default string from-ROS-time now = datetime.datetime.now().strftime("%Y-%m-%dT%H:%M:%S") path = rospy.get_param('~path', now + ".csv") # create a port for each topic inputs = [] try: for name, topic in topics.items(): inputs.append(DataIn(topic, name=name)) except Exception as e: raise RuntimeError("""Failed to subscribe to topics {}. {}""".format(topics, e)) # initialize logger if len(inputs) == 0: raise RuntimeError("""No topics/inputs.""") logger = Logger(path, inputs) # create and start timer for logging pub_timer = rospy.Timer(rospy.Duration(1.0/rate), logger.log) """Timer for logging the received data periodically.""" rospy.loginfo("Logger node initialized.") # loop over receive-log-sleep rospy.spin() # cleanup pub_timer.shutdown() rospy.sleep(0.5) except Exception as e: rospy.logerr('Logger node failed. %s', e) raise except rospy.ROSInterruptException: pass
src/logger_node.py
import csv import datetime import os import roslib import rospy import rostopic _node_name = 'logger_node' """Name of this node in the ROS system.""" class DataIn(object): """Receiver and buffer of a topic.""" def __init__(self, topic, name=None): """Constructor. topic -- topic including field to receive. name -- abbreviation for the topic used as column header in the CSV. """ self.__topic = topic """Topic including field (full path, i.e., all namespaces included).""" if name is None: self.__name = topic else: self.__name = name """Abbreviation for the topic used as column header.""" self.__value = None # no message received yet """Value of the input data.""" # get the topic type and function to evaluate the field # wait until topic gets available rospy.loginfo("DataIn '%s': await availability...", topic) topic_type, real_topic, field_eval = rostopic.get_topic_type(topic, blocking=True) if topic_type is None: raise Exception("Can not resolve topic type of {}.".format(topic)) if field_eval is None: raise Exception("Can not resolve field of {}.".format(topic)) # subscribe and save function for message evaluation data_class = roslib.message.get_message_class(topic_type) self.__subscriber = rospy.Subscriber(real_topic, data_class, self.__msg_callback) """Subscriber to a topic - to receive messages.""" self.__field_eval = field_eval """Function returning the value of the specificed field in a message.""" rospy.loginfo("DataIn '%s': created.", topic) def __exit__(self): self.__subscriber.unregister() def __msg_callback(self, msg): """Called when a message of the topic is received.""" self.__value = self.__field_eval(msg) rospy.logdebug("DataIn '%s' received: %f", self.__topic, self.__value) def __get_name(self): """Returns the name of the input.""" return self.__name name = property(__get_name) def __get_value(self): """Returns the latest value received.""" return self.__value value = property(__get_value) class Logger(object): """Logs inputs to a CSV.""" def __init__(self, path, data, log_time=True): """Constructor. path -- path to CSV. data -- list of DataIn objects. log_time -- enables logging of timestamps. """ self.__data = data # DataIn objects self.__path = path # path to csv to write logs to self.__writer = None # csv writer self.__enabled = False # enable write to csv self.__log_time = log_time # open csv file csvfile = open(path, 'w') self.__writer = csv.writer(csvfile) # write header fieldnames = [d.name for d in self.__data] if self.__log_time: fieldnames.insert(0, "time") rospy.logdebug("CSV fields: %s.", fieldnames) fieldnames[0] = '%' + fieldnames[0] # header is a comment self.__writer.writerow(fieldnames) rospy.loginfo("Logger will write to %s.", os.path.abspath(csvfile.name)) def __exit__(self): print "close csv file" csvfile.close() def log(self, event): values = [d.value for d in self.__data] if self.__enabled: if self.__log_time: curtime = rospy.Time.now() values.insert(0, "{:d}.{:09d}".format(curtime.secs, curtime.nsecs)) self.__writer.writerow(values) rospy.logdebug("New row: %s.", values) else: # enable logger as soon as all inputs received at least once received = [1 for v in values if v is not None] if sum(received) == len(values): rospy.loginfo("Start logging (next cycle).") self.__enabled = True # main entry point of this node if __name__ == '__main__': try: # setup ROS node rospy.init_node(_node_name) # params topics = rospy.get_param('~topics', None) rate = rospy.get_param('~rate', 10) # path ... create default string from-ROS-time now = datetime.datetime.now().strftime("%Y-%m-%dT%H:%M:%S") path = rospy.get_param('~path', now + ".csv") # create a port for each topic inputs = [] try: for name, topic in topics.items(): inputs.append(DataIn(topic, name=name)) except Exception as e: raise RuntimeError("""Failed to subscribe to topics {}. {}""".format(topics, e)) # initialize logger if len(inputs) == 0: raise RuntimeError("""No topics/inputs.""") logger = Logger(path, inputs) # create and start timer for logging pub_timer = rospy.Timer(rospy.Duration(1.0/rate), logger.log) """Timer for logging the received data periodically.""" rospy.loginfo("Logger node initialized.") # loop over receive-log-sleep rospy.spin() # cleanup pub_timer.shutdown() rospy.sleep(0.5) except Exception as e: rospy.logerr('Logger node failed. %s', e) raise except rospy.ROSInterruptException: pass
0.596551
0.20201
import torch import torch.nn as nn import torch.nn.functional as F from myutils.nn import LSTM, Linear class TextRCNN(nn.Module): """Text RCNN model.""" def __init__(self, config, pretrained_emb): super(TextRCNN, self).__init__() self.config = config["arch"]["args"] # word embedding layer self.word_emb = nn.Embedding.from_pretrained(pretrained_emb, freeze=True) # rnn layer self.bi_rnn = LSTM( input_size=self.config["word_dim"], hidden_size=self.config["hidden_size"], batch_first=True, num_layers=1, bidirectional=True, dropout=self.config["dropout"] ) # conv layer self.conv_layer = nn.Sequential( nn.Conv1d( in_channels=self.config["hidden_size"] * 2 + self.config["word_dim"], out_channels=self.config["hidden_size"], kernel_size=self.config["filter_size"] ), # nn.BatchNorm1d(self.config["hidden_size"]), nn.ReLU(inplace=True) ) # full-connected layer self.fc = Linear(self.config["hidden_size"] * self.config["kmax_pooling"], self.config["n_classes"]) def kmax_pooling(self, x, dim=2, k=2): """k-max pooling""" index = x.topk(k, dim=dim)[1].sort(dim=dim)[0] return x.gather(dim, index) def forward(self, data): text, length = data # (b, seq_len), (b) x0 = self.word_emb(text) # (b, seq_len, d) x, h = self.bi_rnn((x0, length)) # (b, seq_len, 2*d), (b, 2*d) x = torch.cat((x0, x), dim=-1).permute(0, 2, 1) # (b, seq_len, 3*d) --> (b, 3*d, seq_len) # x = torch.tanh(self.conv(x)) # (b, d, seq_len - filter_size + 1) x = self.conv_layer(x) # (b, d, seq_len - filter_size + 1) x = self.kmax_pooling(x, dim=2, k=self.config["kmax_pooling"]) x = x.reshape(x.size()[0], -1) # (b, k*d) x = self.fc(x) _, pred = torch.max(x, dim=-1) return x, pred
src/model/text_rcnn.py
import torch import torch.nn as nn import torch.nn.functional as F from myutils.nn import LSTM, Linear class TextRCNN(nn.Module): """Text RCNN model.""" def __init__(self, config, pretrained_emb): super(TextRCNN, self).__init__() self.config = config["arch"]["args"] # word embedding layer self.word_emb = nn.Embedding.from_pretrained(pretrained_emb, freeze=True) # rnn layer self.bi_rnn = LSTM( input_size=self.config["word_dim"], hidden_size=self.config["hidden_size"], batch_first=True, num_layers=1, bidirectional=True, dropout=self.config["dropout"] ) # conv layer self.conv_layer = nn.Sequential( nn.Conv1d( in_channels=self.config["hidden_size"] * 2 + self.config["word_dim"], out_channels=self.config["hidden_size"], kernel_size=self.config["filter_size"] ), # nn.BatchNorm1d(self.config["hidden_size"]), nn.ReLU(inplace=True) ) # full-connected layer self.fc = Linear(self.config["hidden_size"] * self.config["kmax_pooling"], self.config["n_classes"]) def kmax_pooling(self, x, dim=2, k=2): """k-max pooling""" index = x.topk(k, dim=dim)[1].sort(dim=dim)[0] return x.gather(dim, index) def forward(self, data): text, length = data # (b, seq_len), (b) x0 = self.word_emb(text) # (b, seq_len, d) x, h = self.bi_rnn((x0, length)) # (b, seq_len, 2*d), (b, 2*d) x = torch.cat((x0, x), dim=-1).permute(0, 2, 1) # (b, seq_len, 3*d) --> (b, 3*d, seq_len) # x = torch.tanh(self.conv(x)) # (b, d, seq_len - filter_size + 1) x = self.conv_layer(x) # (b, d, seq_len - filter_size + 1) x = self.kmax_pooling(x, dim=2, k=self.config["kmax_pooling"]) x = x.reshape(x.size()[0], -1) # (b, k*d) x = self.fc(x) _, pred = torch.max(x, dim=-1) return x, pred
0.944158
0.307397
from textx import metamodel_from_str, get_children_of_type import numpy as np import random grammar = """ Model: commands*=GameCommand; GameCommand: MoveCommand | ActionCommand; MoveCommand: Left|Right|Up|Down; ActionCommand: Reset | Exit; Left: 'left' count=INT?; Right: 'right' count=INT?; Up: 'up' count=INT?; Down: 'down' count=INT?; Reset: 'reset'; Exit: 'exit'; """ # Only final data structures, a purely functional data structure is immutable # COMO TAL EN PYTHON NO SE PUEDEN CREAR CONSTANTES DE FORMA NATIVA(SIN LIBRERIA) PERO ESTA VARIABLE ES UNA CONSTANTE EN FORMA LOGICA, ES INMUTABLE def cname(o): return o.__class__.__name__ class Coordinate(object): """Prueba de Federico""" def __init__(self, x, y): self.x = x self.y = y def __str__(self): return "{},{}".format(self.x, self.y) def command_validator(model, finish, player, stop, game, size): """This gets the foobar This really should have a full function definition, but I am too lazy. >>> print get_foobar(10, 20) 30 >>> print get_foobar('a', 'b') ab Isn't that what you want? """ for command in model.commands: _cname = cname(command) delta = 1 if command.count == 0 else command.count # ESTO ES OTRO CONCEPTO YA QUE DELEGA EL FLUJO O CONDICIONES A UNA FUNCION... ESTA LINEA ES UNA FUNCION if _cname == 'Left' and player.x - delta >= 0: player.x = player.x - delta elif _cname == 'Right' and player.x + delta <= size - 1: player.x = player.x + delta elif _cname == 'Up' and player.y - delta >= 0: player.y = player.y - delta elif _cname == 'Down' and player.y + delta <= size - 1: player.y = player.y + delta else: if command == 'reset': game, finish, player = create_game(board_size) elif command == 'exit': print("Exiting...") stop = True game = np.zeros((board_size, board_size)) game[player.y][player.x] = '1' game[finish.y][finish.x] = '2' if player.x == finish.x and player.y == finish.y: stop = True print("Victory!") return finish, player, stop, game def create_game(board_size): """This gets the foobar This really should have a full function definition, but I am too lazy. >>> print get_foobar(10, 20) 30 >>> print get_foobar('a', 'b') ab Isn't that what you want? """ game = np.zeros((board_size, board_size)) finish = Coordinate(random.randint(0, board_size - 1), random.randint(0, board_size - 1)) player = Coordinate(random.randint(0, board_size - 1), random.randint(0, board_size - 1)) game[player.y][player.x] = '1' game[finish.y][finish.x] = '2' return game, finish, player mm = metamodel_from_str(grammar) board_size = 10 # Side effects free functions: this is a pure function, the variables games, finis, player are mutable but not # outside their context??? game, finish, player = create_game(board_size) stop = False while not stop: print(game) print("\nMove single cell: '<left, right, up, down>'") print("Move multiple cells: '<left, right, up, down> XCELLS'") print("Reset game: 'reset'") print("Exit game: 'exit'") command = input('Enter command: ') # Functions as parameters and return values (F(G(x))) ??? finish, player, stop, game = command_validator(mm.model_from_str(command), finish, player, stop, game, board_size)
src/main/python/dsl.py
from textx import metamodel_from_str, get_children_of_type import numpy as np import random grammar = """ Model: commands*=GameCommand; GameCommand: MoveCommand | ActionCommand; MoveCommand: Left|Right|Up|Down; ActionCommand: Reset | Exit; Left: 'left' count=INT?; Right: 'right' count=INT?; Up: 'up' count=INT?; Down: 'down' count=INT?; Reset: 'reset'; Exit: 'exit'; """ # Only final data structures, a purely functional data structure is immutable # COMO TAL EN PYTHON NO SE PUEDEN CREAR CONSTANTES DE FORMA NATIVA(SIN LIBRERIA) PERO ESTA VARIABLE ES UNA CONSTANTE EN FORMA LOGICA, ES INMUTABLE def cname(o): return o.__class__.__name__ class Coordinate(object): """Prueba de Federico""" def __init__(self, x, y): self.x = x self.y = y def __str__(self): return "{},{}".format(self.x, self.y) def command_validator(model, finish, player, stop, game, size): """This gets the foobar This really should have a full function definition, but I am too lazy. >>> print get_foobar(10, 20) 30 >>> print get_foobar('a', 'b') ab Isn't that what you want? """ for command in model.commands: _cname = cname(command) delta = 1 if command.count == 0 else command.count # ESTO ES OTRO CONCEPTO YA QUE DELEGA EL FLUJO O CONDICIONES A UNA FUNCION... ESTA LINEA ES UNA FUNCION if _cname == 'Left' and player.x - delta >= 0: player.x = player.x - delta elif _cname == 'Right' and player.x + delta <= size - 1: player.x = player.x + delta elif _cname == 'Up' and player.y - delta >= 0: player.y = player.y - delta elif _cname == 'Down' and player.y + delta <= size - 1: player.y = player.y + delta else: if command == 'reset': game, finish, player = create_game(board_size) elif command == 'exit': print("Exiting...") stop = True game = np.zeros((board_size, board_size)) game[player.y][player.x] = '1' game[finish.y][finish.x] = '2' if player.x == finish.x and player.y == finish.y: stop = True print("Victory!") return finish, player, stop, game def create_game(board_size): """This gets the foobar This really should have a full function definition, but I am too lazy. >>> print get_foobar(10, 20) 30 >>> print get_foobar('a', 'b') ab Isn't that what you want? """ game = np.zeros((board_size, board_size)) finish = Coordinate(random.randint(0, board_size - 1), random.randint(0, board_size - 1)) player = Coordinate(random.randint(0, board_size - 1), random.randint(0, board_size - 1)) game[player.y][player.x] = '1' game[finish.y][finish.x] = '2' return game, finish, player mm = metamodel_from_str(grammar) board_size = 10 # Side effects free functions: this is a pure function, the variables games, finis, player are mutable but not # outside their context??? game, finish, player = create_game(board_size) stop = False while not stop: print(game) print("\nMove single cell: '<left, right, up, down>'") print("Move multiple cells: '<left, right, up, down> XCELLS'") print("Reset game: 'reset'") print("Exit game: 'exit'") command = input('Enter command: ') # Functions as parameters and return values (F(G(x))) ??? finish, player, stop, game = command_validator(mm.model_from_str(command), finish, player, stop, game, board_size)
0.52683
0.227148
from __future__ import annotations from typing import Dict, Set, List, Tuple, Optional, Any import enum import gc import math import sys import pytest import msgspec class FruitInt(enum.IntEnum): APPLE = 1 BANANA = 2 class FruitStr(enum.Enum): APPLE = "apple" BANANA = "banana" class Person(msgspec.Struct): first: str last: str age: int prefect: bool = False class Node(msgspec.Struct): left: Optional[Node] = None right: Optional[Node] = None INTS = [ -(2 ** 63), -(2 ** 31 + 1), -(2 ** 31), -(2 ** 15 + 1), -(2 ** 15), -(2 ** 7 + 1), -(2 ** 7), -(2 ** 5 + 1), -(2 ** 5), -1, 0, 1, 2 ** 7 - 1, 2 ** 7, 2 ** 8 - 1, 2 ** 8, 2 ** 16 - 1, 2 ** 16, 2 ** 32 - 1, 2 ** 32, 2 ** 64 - 1, ] FLOATS = [ -1.5, 0.0, 1.5, -float("inf"), float("inf"), float("nan"), sys.float_info.max, sys.float_info.min, -sys.float_info.max, -sys.float_info.min, ] SIZES = [0, 1, 31, 32, 2 ** 8 - 1, 2 ** 8, 2 ** 16 - 1, 2 ** 16] def assert_eq(x, y): if isinstance(x, float) and math.isnan(x): assert math.isnan(y) else: assert x == y class TestEncodeFunction: def test_encode(self): dec = msgspec.Decoder() assert dec.decode(msgspec.encode(1)) == 1 def test_encode_error(self): with pytest.raises(TypeError): msgspec.encode(object()) def test_encode_large_object(self): """Check that buffer resize works""" data = b"x" * 4097 dec = msgspec.Decoder() assert dec.decode(msgspec.encode(data)) == data def test_encode_no_default(self): class Foo: pass with pytest.raises( TypeError, match="Encoding objects of type Foo is unsupported" ): msgspec.encode(Foo()) def test_encode_default(self): unsupported = object() def default(x): assert x is unsupported return "hello" orig_refcount = sys.getrefcount(default) res = msgspec.encode(unsupported, default=default) assert msgspec.encode("hello") == res assert sys.getrefcount(default) == orig_refcount def test_encode_default_errors(self): def default(x): raise TypeError("bad") orig_refcount = sys.getrefcount(default) with pytest.raises(TypeError, match="bad"): msgspec.encode(object(), default=default) assert sys.getrefcount(default) == orig_refcount def test_encode_parse_arguments_errors(self): with pytest.raises(TypeError, match="Missing 1 required argument"): msgspec.encode() with pytest.raises(TypeError, match="Extra positional arguments"): msgspec.encode(1, lambda x: None) with pytest.raises(TypeError, match="Extra positional arguments"): msgspec.encode(1, 2, 3) with pytest.raises(TypeError, match="Invalid keyword argument 'bad'"): msgspec.encode(1, bad=1) with pytest.raises(TypeError, match="Extra keyword arguments"): msgspec.encode(1, default=lambda x: None, extra="extra") class TestDecodeFunction: def setup(self): self.buf = msgspec.encode([1, 2, 3]) def test_decode(self): assert msgspec.decode(self.buf) == [1, 2, 3] def test_decode_type_keyword(self): assert msgspec.decode(self.buf, type=List[int]) == [1, 2, 3] with pytest.raises(msgspec.DecodingError): assert msgspec.decode(self.buf, type=List[str]) def test_decode_type_any(self): assert msgspec.decode(self.buf, type=Any) == [1, 2, 3] def test_decode_invalid_type(self): with pytest.raises(TypeError, match="Type '1' is not supported"): msgspec.decode(self.buf, type=1) def test_decode_invalid_buf(self): with pytest.raises(TypeError): msgspec.decode(1) def test_decode_parse_arguments_errors(self): with pytest.raises(TypeError, match="Missing 1 required argument"): msgspec.decode() with pytest.raises(TypeError, match="Extra positional arguments"): msgspec.decode(self.buf, List[int]) with pytest.raises(TypeError, match="Extra positional arguments"): msgspec.decode(self.buf, 2, 3) with pytest.raises(TypeError, match="Invalid keyword argument 'bad'"): msgspec.decode(self.buf, bad=1) with pytest.raises(TypeError, match="Extra keyword arguments"): msgspec.decode(self.buf, type=List[int], extra=1) class TestEncoderMisc: @pytest.mark.parametrize("x", [-(2 ** 63) - 1, 2 ** 64]) def test_encode_integer_limits(self, x): enc = msgspec.Encoder() with pytest.raises(OverflowError): enc.encode(x) def rec_obj1(self): o = [] o.append(o) return o def rec_obj2(self): o = ([],) o[0].append(o) return o def rec_obj3(self): o = {} o["a"] = o return o def rec_obj4(self): class Box(msgspec.Struct): a: "Box" o = Box(None) o.a = o return o @pytest.mark.parametrize("case", [1, 2, 3, 4]) def test_encode_infinite_recursive_object_errors(self, case): enc = msgspec.Encoder() o = getattr(self, "rec_obj%d" % case)() with pytest.raises(RecursionError): enc.encode(o) def test_getsizeof(self): a = sys.getsizeof(msgspec.Encoder(write_buffer_size=64)) b = sys.getsizeof(msgspec.Encoder(write_buffer_size=128)) assert b > a def test_encode_no_default(self): class Foo: pass enc = msgspec.Encoder() assert enc.default is None with pytest.raises( TypeError, match="Encoding objects of type Foo is unsupported" ): enc.encode(Foo()) def test_encode_default(self): unsupported = object() def default(x): assert x is unsupported return "hello" orig_refcount = sys.getrefcount(default) enc = msgspec.Encoder(default=default) assert enc.default is default assert sys.getrefcount(enc.default) == orig_refcount + 2 assert sys.getrefcount(default) == orig_refcount + 1 res = enc.encode(unsupported) assert enc.encode("hello") == res del enc assert sys.getrefcount(default) == orig_refcount def test_encode_default_errors(self): def default(x): raise TypeError("bad") enc = msgspec.Encoder(default=default) with pytest.raises(TypeError, match="bad"): enc.encode(object()) def test_encode_default_recurses(self): class Node: def __init__(self, a): self.a = a def default(x): return {"type": "Node", "a": x.a} enc = msgspec.Encoder(default=default) msg = enc.encode(Node(Node(1))) res = msgspec.decode(msg) assert res == {"type": "Node", "a": {"type": "Node", "a": 1}} def test_encode_default_recursion_error(self): enc = msgspec.Encoder(default=lambda x: x) with pytest.raises(RecursionError): enc.encode(object()) class TestDecoderMisc: def test_decoder_type_attribute(self): dec = msgspec.Decoder() assert dec.type is Any dec = msgspec.Decoder(int) assert dec.type is int @pytest.mark.parametrize("typ, typstr", [(None, "None"), (Any, "Any")]) def test_decoder_none_any_repr(self, typ, typstr): dec = msgspec.Decoder(typ) assert repr(dec) == f"Decoder({typstr})" # Optionality of None/Any doesn't change things dec = msgspec.Decoder(Optional[typ]) assert repr(dec) == f"Decoder({typstr})" @pytest.mark.parametrize( "typ, typstr", [ (bool, "bool"), (int, "int"), (float, "float"), (str, "str"), (bytes, "bytes"), (bytearray, "bytearray"), (Dict, "Dict[Any, Any]"), (Dict[int, str], "Dict[int, str]"), (List, "List[Any]"), (List[Optional[int]], "List[Optional[int]]"), (Set, "Set[Any]"), (Set[Optional[int]], "Set[Optional[int]]"), (Tuple, "Tuple[Any, ...]"), (Tuple[Optional[int], ...], "Tuple[Optional[int], ...]"), (Tuple[int, str], "Tuple[int, str]"), (Person, "Person"), (FruitInt, "FruitInt"), (FruitStr, "FruitStr"), (List[Optional[Dict[str, Person]]], "List[Optional[Dict[str, Person]]]"), ], ) def test_decoder_repr(self, typ, typstr): dec = msgspec.Decoder(typ) assert repr(dec) == f"Decoder({typstr})" dec = msgspec.Decoder(Optional[typ]) assert repr(dec) == f"Decoder(Optional[{typstr}])" def test_decoder_unsupported_type(self): with pytest.raises(TypeError): msgspec.Decoder(1) with pytest.raises(TypeError): msgspec.Decoder(slice) def test_decoder_validates_struct_definition_unsupported_types(self): """Struct definitions aren't validated until first use""" class Test(msgspec.Struct): a: slice with pytest.raises(TypeError): msgspec.Decoder(Test) class TestTypedDecoder: def check_unexpected_type(self, dec_type, val, msg): dec = msgspec.Decoder(dec_type) s = msgspec.Encoder().encode(val) with pytest.raises(msgspec.DecodingError, match=msg): dec.decode(s) def test_none(self): enc = msgspec.Encoder() dec = msgspec.Decoder(None) assert dec.decode(enc.encode(None)) is None with pytest.raises(msgspec.DecodingError, match="expected `None`"): assert dec.decode(enc.encode(1)) @pytest.mark.parametrize("x", [False, True]) def test_bool(self, x): enc = msgspec.Encoder() dec = msgspec.Decoder(bool) assert dec.decode(enc.encode(x)) is x def test_bool_unexpected_type(self): self.check_unexpected_type(bool, "a", "expected `bool`") @pytest.mark.parametrize("x", INTS) def test_int(self, x): enc = msgspec.Encoder() dec = msgspec.Decoder(int) assert dec.decode(enc.encode(x)) == x def test_int_unexpected_type(self): self.check_unexpected_type(int, "a", "expected `int`") @pytest.mark.parametrize("x", FLOATS + INTS) def test_float(self, x): enc = msgspec.Encoder() dec = msgspec.Decoder(float) res = dec.decode(enc.encode(x)) sol = float(x) if math.isnan(sol): assert math.isnan(res) else: assert res == sol def test_float_unexpected_type(self): self.check_unexpected_type(float, "a", "expected `float`") @pytest.mark.parametrize("size", SIZES) def test_str(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(str) x = "a" * size res = dec.decode(enc.encode(x)) assert res == x def test_str_unexpected_type(self): self.check_unexpected_type(str, 1, "expected `str`") @pytest.mark.parametrize("size", SIZES) def test_bytes(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(bytes) x = b"a" * size res = dec.decode(enc.encode(x)) assert isinstance(res, bytes) assert res == x def test_bytes_unexpected_type(self): self.check_unexpected_type(bytes, 1, "expected `bytes`") @pytest.mark.parametrize("size", SIZES) def test_bytearray(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(bytearray) x = bytearray(size) res = dec.decode(enc.encode(x)) assert isinstance(res, bytearray) assert res == x def test_bytearray_unexpected_type(self): self.check_unexpected_type(bytearray, 1, "expected `bytearray`") @pytest.mark.parametrize("size", SIZES) def test_list_lengths(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(list) x = list(range(size)) res = dec.decode(enc.encode(x)) assert res == x @pytest.mark.parametrize("typ", [list, List, List[Any]]) def test_list_any(self, typ): enc = msgspec.Encoder() dec = msgspec.Decoder(typ) x = [1, "two", b"three"] res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `list`"): dec.decode(enc.encode(1)) def test_list_typed(self): enc = msgspec.Encoder() dec = msgspec.Decoder(List[int]) x = [1, 2, 3] res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `int`"): dec.decode(enc.encode([1, 2, "three"])) @pytest.mark.parametrize("size", SIZES) def test_set_lengths(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(set) x = set(range(size)) res = dec.decode(enc.encode(x)) assert res == x @pytest.mark.parametrize("typ", [set, Set, Set[Any]]) def test_set_any(self, typ): enc = msgspec.Encoder() dec = msgspec.Decoder(typ) x = {1, "two", b"three"} res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `set`"): dec.decode(enc.encode(1)) def test_set_typed(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Set[int]) x = {1, 2, 3} res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `int`"): dec.decode(enc.encode({1, 2, "three"})) @pytest.mark.parametrize("size", SIZES) def test_vartuple_lengths(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(tuple) x = tuple(range(size)) res = dec.decode(enc.encode(x)) assert res == x @pytest.mark.parametrize("typ", [tuple, Tuple, Tuple[Any, ...]]) def test_vartuple_any(self, typ): enc = msgspec.Encoder() dec = msgspec.Decoder(typ) x = (1, "two", b"three") res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `tuple`"): dec.decode(enc.encode(1)) def test_vartuple_typed(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Tuple[int, ...]) x = (1, 2, 3) res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `int`"): dec.decode(enc.encode((1, 2, "three"))) def test_fixtuple_any(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Tuple[Any, Any, Any]) x = (1, "two", b"three") res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `tuple`"): dec.decode(enc.encode(1)) with pytest.raises( msgspec.DecodingError, match=r"Error decoding `Tuple\[Any, Any, Any\]`: expected tuple of length 3, got 2", ): dec.decode(enc.encode((1, 2))) def test_fixtuple_typed(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Tuple[int, str, bytes]) x = (1, "two", b"three") res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `bytes`"): dec.decode(enc.encode((1, "two", "three"))) with pytest.raises( msgspec.DecodingError, match=r"Error decoding `Tuple\[int, str, bytes\]`: expected tuple of length 3, got 2", ): dec.decode(enc.encode((1, 2))) @pytest.mark.parametrize("size", SIZES) def test_dict_lengths(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(dict) x = {i: i for i in range(size)} res = dec.decode(enc.encode(x)) assert res == x @pytest.mark.parametrize("typ", [dict, Dict, Dict[Any, Any]]) def test_dict_any_any(self, typ): enc = msgspec.Encoder() dec = msgspec.Decoder(typ) x = {1: "one", "two": 2, b"three": 3.0} res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `dict`"): dec.decode(enc.encode(1)) def test_dict_any_val(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Dict[str, Any]) x = {"a": 1, "b": "two", "c": b"three"} res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `str`"): dec.decode(enc.encode({1: 2})) def test_dict_any_key(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Dict[Any, str]) x = {1: "a", "two": "b", b"three": "c"} res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `str`"): dec.decode(enc.encode({1: 2})) def test_dict_typed(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Dict[str, int]) x = {"a": 1, "b": 2} res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `str`"): dec.decode(enc.encode({1: 2})) with pytest.raises(msgspec.DecodingError, match="expected `int`"): dec.decode(enc.encode({"a": "two"})) def test_enum(self): enc = msgspec.Encoder() dec = msgspec.Decoder(FruitStr) a = enc.encode(FruitStr.APPLE) assert enc.encode("APPLE") == a assert dec.decode(a) == FruitStr.APPLE with pytest.raises(msgspec.DecodingError, match="truncated"): dec.decode(a[:-2]) with pytest.raises( msgspec.DecodingError, match="Error decoding enum `FruitStr`" ): dec.decode(enc.encode("MISSING")) with pytest.raises(msgspec.DecodingError): dec.decode(enc.encode(1)) def test_int_enum(self): enc = msgspec.Encoder() dec = msgspec.Decoder(FruitInt) a = enc.encode(FruitInt.APPLE) assert enc.encode(1) == a assert dec.decode(a) == FruitInt.APPLE with pytest.raises(msgspec.DecodingError, match="truncated"): dec.decode(a[:-2]) with pytest.raises( msgspec.DecodingError, match="Error decoding enum `FruitInt`" ): dec.decode(enc.encode(1000)) with pytest.raises(msgspec.DecodingError): dec.decode(enc.encode("INVALID")) def test_struct(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Person) x = Person(first="harry", last="potter", age=13) a = enc.encode(x) assert ( enc.encode( {"first": "harry", "last": "potter", "age": 13, "prefect": False} ) == a ) assert dec.decode(a) == x with pytest.raises(msgspec.DecodingError, match="truncated"): dec.decode(a[:-2]) with pytest.raises(msgspec.DecodingError, match="expected `struct`"): dec.decode(enc.encode(1)) with pytest.raises( msgspec.DecodingError, match=r"Error decoding `Person` field `first` \(`str`\): expected `str`, got `int`", ): dec.decode(enc.encode({1: "harry"})) def test_struct_field_wrong_type(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Person) bad = enc.encode({"first": "harry", "last": "potter", "age": "thirteen"}) with pytest.raises(msgspec.DecodingError, match="expected `int`"): dec.decode(bad) def test_struct_missing_fields(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Person) bad = enc.encode({"first": "harry", "last": "potter"}) with pytest.raises(msgspec.DecodingError, match="missing required field `age`"): dec.decode(bad) bad = enc.encode({}) with pytest.raises( msgspec.DecodingError, match="missing required field `first`" ): dec.decode(bad) @pytest.mark.parametrize( "extra", [None, False, True, 1, 2.0, "three", b"four", [1, 2], {3: 4}] ) def test_struct_ignore_extra_fields(self, extra): enc = msgspec.Encoder() dec = msgspec.Decoder(Person) a = enc.encode( { "extra1": extra, "first": "harry", "extra2": extra, "last": "potter", "age": 13, "extra3": extra, } ) res = dec.decode(a) assert res == Person("harry", "potter", 13) def test_struct_defaults_missing_fields(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Person) a = enc.encode({"first": "harry", "last": "potter", "age": 13}) res = dec.decode(a) assert res == Person("harry", "potter", 13) assert res.prefect is False def test_struct_gc_maybe_untracked_on_decode(self): class Test(msgspec.Struct): x: Any y: Any z: Tuple = () enc = msgspec.Encoder() dec = msgspec.Decoder(List[Test]) ts = [ Test(1, 2), Test(3, "hello"), Test([], []), Test({}, {}), Test(None, None, ()), ] a, b, c, d, e = dec.decode(enc.encode(ts)) assert not gc.is_tracked(a) assert not gc.is_tracked(b) assert gc.is_tracked(c) assert gc.is_tracked(d) assert not gc.is_tracked(e) def test_struct_recursive_definition(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Node) x = Node(Node(Node(), Node(Node()))) s = enc.encode(x) res = dec.decode(s) assert res == x @pytest.mark.parametrize( "typ, value", [ (bool, False), (bool, True), (int, 1), (float, 2.5), (str, "a"), (bytes, b"a"), (bytearray, bytearray(b"a")), (FruitInt, FruitInt.APPLE), (FruitStr, FruitStr.APPLE), (Person, Person("harry", "potter", 13)), (list, [1]), (set, {1}), (tuple, (1, 2)), (Tuple[int, int], (1, 2)), (dict, {1: 2}), ], ) def test_optional(self, typ, value): enc = msgspec.Encoder() dec = msgspec.Decoder(Optional[typ]) s = enc.encode(value) s2 = enc.encode(None) assert dec.decode(s) == value assert dec.decode(s2) is None dec = msgspec.Decoder(typ) with pytest.raises(msgspec.DecodingError): dec.decode(s2) @pytest.mark.parametrize( "typ, value", [ (List[Optional[int]], [1, None]), (Tuple[Optional[int], int], (None, 1)), (Set[Optional[int]], {1, None}), (Dict[str, Optional[int]], {"a": 1, "b": None}), (Dict[Optional[str], int], {"a": 1, None: 2}), ], ) def test_optional_nested(self, typ, value): enc = msgspec.Encoder() dec = msgspec.Decoder(typ) s = enc.encode(value) assert dec.decode(s) == value def test_decoding_error_no_struct_toplevel(self): b = msgspec.Encoder().encode([{"a": 1}]) dec = msgspec.Decoder(List[Dict[str, str]]) with pytest.raises( msgspec.DecodingError, match=r"Error decoding `List\[Dict\[str, str\]\]`: expected `str`, got `int`", ): dec.decode(b) class CommonTypeTestBase: """Test msgspec untyped encode/decode""" def test_none(self): self.check(None) @pytest.mark.parametrize("x", [False, True]) def test_bool(self, x): self.check(x) @pytest.mark.parametrize("x", INTS) def test_int(self, x): self.check(x) @pytest.mark.parametrize("x", FLOATS) def test_float(self, x): self.check(x) @pytest.mark.parametrize("size", SIZES) def test_str(self, size): self.check(" " * size) @pytest.mark.parametrize("size", SIZES) def test_bytes(self, size): self.check(b" " * size) @pytest.mark.parametrize("size", SIZES) def test_dict(self, size): self.check({str(i): i for i in range(size)}) @pytest.mark.parametrize("size", SIZES) def test_list(self, size): self.check(list(range(size))) class TestDecodeArrayTypeUsesTupleIfHashableRequired: def test_decode_tuple_dict_keys_as_tuples(self): orig = {(1, 2): [1, 2, [3, 4]], (1, (2, 3)): [4, 5, 6]} data = msgspec.encode(orig) out = msgspec.decode(data) assert orig == out @pytest.mark.parametrize( "typ", [ Dict[Tuple[int, Tuple[int, int]], List[int]], Dict[Tuple[int, Tuple[int, ...]], Any], Dict[Tuple, List[int]], Dict[Tuple[Any, ...], Any], Dict[Tuple[Any, Any], Any], ], ) def test_decode_dict_key_status_forwarded_through_typed_tuples(self, typ): orig = {(1, (2, 3)): [1, 2, 3]} data = msgspec.encode(orig) out = msgspec.Decoder(typ).decode(data) assert orig == out def test_decode_tuple_set_keys_as_tuples(self): orig = {(1, 2), (3, (4, 5)), 6} data = msgspec.encode(orig) out = msgspec.decode(data, type=set) assert orig == out def test_decode_hashable_struct_in_key(self): class Test(msgspec.Struct): data: List[int] def __hash__(self): return hash(tuple(self.data)) orig = {(1, Test([1, 2])): [1, 2]} data = msgspec.encode(orig) out = msgspec.Decoder(Dict[Tuple[int, Test], List[int]]).decode(data) assert orig == out class TestUntypedDecoder(CommonTypeTestBase): """Check the untyped deserializer works for common types""" def check(self, x): enc = msgspec.Encoder() dec = msgspec.Decoder() assert_eq(dec.decode(enc.encode(x)), x) class TestCompatibility(CommonTypeTestBase): """Test compatibility with the existing python msgpack library""" def check(self, x): msgpack = pytest.importorskip("msgpack") enc = msgspec.Encoder() dec = msgspec.Decoder() assert_eq(dec.decode(msgpack.dumps(x)), x) assert_eq(msgpack.loads(enc.encode(x)), x)
tests/test_msgspec.py
from __future__ import annotations from typing import Dict, Set, List, Tuple, Optional, Any import enum import gc import math import sys import pytest import msgspec class FruitInt(enum.IntEnum): APPLE = 1 BANANA = 2 class FruitStr(enum.Enum): APPLE = "apple" BANANA = "banana" class Person(msgspec.Struct): first: str last: str age: int prefect: bool = False class Node(msgspec.Struct): left: Optional[Node] = None right: Optional[Node] = None INTS = [ -(2 ** 63), -(2 ** 31 + 1), -(2 ** 31), -(2 ** 15 + 1), -(2 ** 15), -(2 ** 7 + 1), -(2 ** 7), -(2 ** 5 + 1), -(2 ** 5), -1, 0, 1, 2 ** 7 - 1, 2 ** 7, 2 ** 8 - 1, 2 ** 8, 2 ** 16 - 1, 2 ** 16, 2 ** 32 - 1, 2 ** 32, 2 ** 64 - 1, ] FLOATS = [ -1.5, 0.0, 1.5, -float("inf"), float("inf"), float("nan"), sys.float_info.max, sys.float_info.min, -sys.float_info.max, -sys.float_info.min, ] SIZES = [0, 1, 31, 32, 2 ** 8 - 1, 2 ** 8, 2 ** 16 - 1, 2 ** 16] def assert_eq(x, y): if isinstance(x, float) and math.isnan(x): assert math.isnan(y) else: assert x == y class TestEncodeFunction: def test_encode(self): dec = msgspec.Decoder() assert dec.decode(msgspec.encode(1)) == 1 def test_encode_error(self): with pytest.raises(TypeError): msgspec.encode(object()) def test_encode_large_object(self): """Check that buffer resize works""" data = b"x" * 4097 dec = msgspec.Decoder() assert dec.decode(msgspec.encode(data)) == data def test_encode_no_default(self): class Foo: pass with pytest.raises( TypeError, match="Encoding objects of type Foo is unsupported" ): msgspec.encode(Foo()) def test_encode_default(self): unsupported = object() def default(x): assert x is unsupported return "hello" orig_refcount = sys.getrefcount(default) res = msgspec.encode(unsupported, default=default) assert msgspec.encode("hello") == res assert sys.getrefcount(default) == orig_refcount def test_encode_default_errors(self): def default(x): raise TypeError("bad") orig_refcount = sys.getrefcount(default) with pytest.raises(TypeError, match="bad"): msgspec.encode(object(), default=default) assert sys.getrefcount(default) == orig_refcount def test_encode_parse_arguments_errors(self): with pytest.raises(TypeError, match="Missing 1 required argument"): msgspec.encode() with pytest.raises(TypeError, match="Extra positional arguments"): msgspec.encode(1, lambda x: None) with pytest.raises(TypeError, match="Extra positional arguments"): msgspec.encode(1, 2, 3) with pytest.raises(TypeError, match="Invalid keyword argument 'bad'"): msgspec.encode(1, bad=1) with pytest.raises(TypeError, match="Extra keyword arguments"): msgspec.encode(1, default=lambda x: None, extra="extra") class TestDecodeFunction: def setup(self): self.buf = msgspec.encode([1, 2, 3]) def test_decode(self): assert msgspec.decode(self.buf) == [1, 2, 3] def test_decode_type_keyword(self): assert msgspec.decode(self.buf, type=List[int]) == [1, 2, 3] with pytest.raises(msgspec.DecodingError): assert msgspec.decode(self.buf, type=List[str]) def test_decode_type_any(self): assert msgspec.decode(self.buf, type=Any) == [1, 2, 3] def test_decode_invalid_type(self): with pytest.raises(TypeError, match="Type '1' is not supported"): msgspec.decode(self.buf, type=1) def test_decode_invalid_buf(self): with pytest.raises(TypeError): msgspec.decode(1) def test_decode_parse_arguments_errors(self): with pytest.raises(TypeError, match="Missing 1 required argument"): msgspec.decode() with pytest.raises(TypeError, match="Extra positional arguments"): msgspec.decode(self.buf, List[int]) with pytest.raises(TypeError, match="Extra positional arguments"): msgspec.decode(self.buf, 2, 3) with pytest.raises(TypeError, match="Invalid keyword argument 'bad'"): msgspec.decode(self.buf, bad=1) with pytest.raises(TypeError, match="Extra keyword arguments"): msgspec.decode(self.buf, type=List[int], extra=1) class TestEncoderMisc: @pytest.mark.parametrize("x", [-(2 ** 63) - 1, 2 ** 64]) def test_encode_integer_limits(self, x): enc = msgspec.Encoder() with pytest.raises(OverflowError): enc.encode(x) def rec_obj1(self): o = [] o.append(o) return o def rec_obj2(self): o = ([],) o[0].append(o) return o def rec_obj3(self): o = {} o["a"] = o return o def rec_obj4(self): class Box(msgspec.Struct): a: "Box" o = Box(None) o.a = o return o @pytest.mark.parametrize("case", [1, 2, 3, 4]) def test_encode_infinite_recursive_object_errors(self, case): enc = msgspec.Encoder() o = getattr(self, "rec_obj%d" % case)() with pytest.raises(RecursionError): enc.encode(o) def test_getsizeof(self): a = sys.getsizeof(msgspec.Encoder(write_buffer_size=64)) b = sys.getsizeof(msgspec.Encoder(write_buffer_size=128)) assert b > a def test_encode_no_default(self): class Foo: pass enc = msgspec.Encoder() assert enc.default is None with pytest.raises( TypeError, match="Encoding objects of type Foo is unsupported" ): enc.encode(Foo()) def test_encode_default(self): unsupported = object() def default(x): assert x is unsupported return "hello" orig_refcount = sys.getrefcount(default) enc = msgspec.Encoder(default=default) assert enc.default is default assert sys.getrefcount(enc.default) == orig_refcount + 2 assert sys.getrefcount(default) == orig_refcount + 1 res = enc.encode(unsupported) assert enc.encode("hello") == res del enc assert sys.getrefcount(default) == orig_refcount def test_encode_default_errors(self): def default(x): raise TypeError("bad") enc = msgspec.Encoder(default=default) with pytest.raises(TypeError, match="bad"): enc.encode(object()) def test_encode_default_recurses(self): class Node: def __init__(self, a): self.a = a def default(x): return {"type": "Node", "a": x.a} enc = msgspec.Encoder(default=default) msg = enc.encode(Node(Node(1))) res = msgspec.decode(msg) assert res == {"type": "Node", "a": {"type": "Node", "a": 1}} def test_encode_default_recursion_error(self): enc = msgspec.Encoder(default=lambda x: x) with pytest.raises(RecursionError): enc.encode(object()) class TestDecoderMisc: def test_decoder_type_attribute(self): dec = msgspec.Decoder() assert dec.type is Any dec = msgspec.Decoder(int) assert dec.type is int @pytest.mark.parametrize("typ, typstr", [(None, "None"), (Any, "Any")]) def test_decoder_none_any_repr(self, typ, typstr): dec = msgspec.Decoder(typ) assert repr(dec) == f"Decoder({typstr})" # Optionality of None/Any doesn't change things dec = msgspec.Decoder(Optional[typ]) assert repr(dec) == f"Decoder({typstr})" @pytest.mark.parametrize( "typ, typstr", [ (bool, "bool"), (int, "int"), (float, "float"), (str, "str"), (bytes, "bytes"), (bytearray, "bytearray"), (Dict, "Dict[Any, Any]"), (Dict[int, str], "Dict[int, str]"), (List, "List[Any]"), (List[Optional[int]], "List[Optional[int]]"), (Set, "Set[Any]"), (Set[Optional[int]], "Set[Optional[int]]"), (Tuple, "Tuple[Any, ...]"), (Tuple[Optional[int], ...], "Tuple[Optional[int], ...]"), (Tuple[int, str], "Tuple[int, str]"), (Person, "Person"), (FruitInt, "FruitInt"), (FruitStr, "FruitStr"), (List[Optional[Dict[str, Person]]], "List[Optional[Dict[str, Person]]]"), ], ) def test_decoder_repr(self, typ, typstr): dec = msgspec.Decoder(typ) assert repr(dec) == f"Decoder({typstr})" dec = msgspec.Decoder(Optional[typ]) assert repr(dec) == f"Decoder(Optional[{typstr}])" def test_decoder_unsupported_type(self): with pytest.raises(TypeError): msgspec.Decoder(1) with pytest.raises(TypeError): msgspec.Decoder(slice) def test_decoder_validates_struct_definition_unsupported_types(self): """Struct definitions aren't validated until first use""" class Test(msgspec.Struct): a: slice with pytest.raises(TypeError): msgspec.Decoder(Test) class TestTypedDecoder: def check_unexpected_type(self, dec_type, val, msg): dec = msgspec.Decoder(dec_type) s = msgspec.Encoder().encode(val) with pytest.raises(msgspec.DecodingError, match=msg): dec.decode(s) def test_none(self): enc = msgspec.Encoder() dec = msgspec.Decoder(None) assert dec.decode(enc.encode(None)) is None with pytest.raises(msgspec.DecodingError, match="expected `None`"): assert dec.decode(enc.encode(1)) @pytest.mark.parametrize("x", [False, True]) def test_bool(self, x): enc = msgspec.Encoder() dec = msgspec.Decoder(bool) assert dec.decode(enc.encode(x)) is x def test_bool_unexpected_type(self): self.check_unexpected_type(bool, "a", "expected `bool`") @pytest.mark.parametrize("x", INTS) def test_int(self, x): enc = msgspec.Encoder() dec = msgspec.Decoder(int) assert dec.decode(enc.encode(x)) == x def test_int_unexpected_type(self): self.check_unexpected_type(int, "a", "expected `int`") @pytest.mark.parametrize("x", FLOATS + INTS) def test_float(self, x): enc = msgspec.Encoder() dec = msgspec.Decoder(float) res = dec.decode(enc.encode(x)) sol = float(x) if math.isnan(sol): assert math.isnan(res) else: assert res == sol def test_float_unexpected_type(self): self.check_unexpected_type(float, "a", "expected `float`") @pytest.mark.parametrize("size", SIZES) def test_str(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(str) x = "a" * size res = dec.decode(enc.encode(x)) assert res == x def test_str_unexpected_type(self): self.check_unexpected_type(str, 1, "expected `str`") @pytest.mark.parametrize("size", SIZES) def test_bytes(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(bytes) x = b"a" * size res = dec.decode(enc.encode(x)) assert isinstance(res, bytes) assert res == x def test_bytes_unexpected_type(self): self.check_unexpected_type(bytes, 1, "expected `bytes`") @pytest.mark.parametrize("size", SIZES) def test_bytearray(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(bytearray) x = bytearray(size) res = dec.decode(enc.encode(x)) assert isinstance(res, bytearray) assert res == x def test_bytearray_unexpected_type(self): self.check_unexpected_type(bytearray, 1, "expected `bytearray`") @pytest.mark.parametrize("size", SIZES) def test_list_lengths(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(list) x = list(range(size)) res = dec.decode(enc.encode(x)) assert res == x @pytest.mark.parametrize("typ", [list, List, List[Any]]) def test_list_any(self, typ): enc = msgspec.Encoder() dec = msgspec.Decoder(typ) x = [1, "two", b"three"] res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `list`"): dec.decode(enc.encode(1)) def test_list_typed(self): enc = msgspec.Encoder() dec = msgspec.Decoder(List[int]) x = [1, 2, 3] res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `int`"): dec.decode(enc.encode([1, 2, "three"])) @pytest.mark.parametrize("size", SIZES) def test_set_lengths(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(set) x = set(range(size)) res = dec.decode(enc.encode(x)) assert res == x @pytest.mark.parametrize("typ", [set, Set, Set[Any]]) def test_set_any(self, typ): enc = msgspec.Encoder() dec = msgspec.Decoder(typ) x = {1, "two", b"three"} res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `set`"): dec.decode(enc.encode(1)) def test_set_typed(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Set[int]) x = {1, 2, 3} res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `int`"): dec.decode(enc.encode({1, 2, "three"})) @pytest.mark.parametrize("size", SIZES) def test_vartuple_lengths(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(tuple) x = tuple(range(size)) res = dec.decode(enc.encode(x)) assert res == x @pytest.mark.parametrize("typ", [tuple, Tuple, Tuple[Any, ...]]) def test_vartuple_any(self, typ): enc = msgspec.Encoder() dec = msgspec.Decoder(typ) x = (1, "two", b"three") res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `tuple`"): dec.decode(enc.encode(1)) def test_vartuple_typed(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Tuple[int, ...]) x = (1, 2, 3) res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `int`"): dec.decode(enc.encode((1, 2, "three"))) def test_fixtuple_any(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Tuple[Any, Any, Any]) x = (1, "two", b"three") res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `tuple`"): dec.decode(enc.encode(1)) with pytest.raises( msgspec.DecodingError, match=r"Error decoding `Tuple\[Any, Any, Any\]`: expected tuple of length 3, got 2", ): dec.decode(enc.encode((1, 2))) def test_fixtuple_typed(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Tuple[int, str, bytes]) x = (1, "two", b"three") res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `bytes`"): dec.decode(enc.encode((1, "two", "three"))) with pytest.raises( msgspec.DecodingError, match=r"Error decoding `Tuple\[int, str, bytes\]`: expected tuple of length 3, got 2", ): dec.decode(enc.encode((1, 2))) @pytest.mark.parametrize("size", SIZES) def test_dict_lengths(self, size): enc = msgspec.Encoder() dec = msgspec.Decoder(dict) x = {i: i for i in range(size)} res = dec.decode(enc.encode(x)) assert res == x @pytest.mark.parametrize("typ", [dict, Dict, Dict[Any, Any]]) def test_dict_any_any(self, typ): enc = msgspec.Encoder() dec = msgspec.Decoder(typ) x = {1: "one", "two": 2, b"three": 3.0} res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `dict`"): dec.decode(enc.encode(1)) def test_dict_any_val(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Dict[str, Any]) x = {"a": 1, "b": "two", "c": b"three"} res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `str`"): dec.decode(enc.encode({1: 2})) def test_dict_any_key(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Dict[Any, str]) x = {1: "a", "two": "b", b"three": "c"} res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `str`"): dec.decode(enc.encode({1: 2})) def test_dict_typed(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Dict[str, int]) x = {"a": 1, "b": 2} res = dec.decode(enc.encode(x)) assert res == x with pytest.raises(msgspec.DecodingError, match="expected `str`"): dec.decode(enc.encode({1: 2})) with pytest.raises(msgspec.DecodingError, match="expected `int`"): dec.decode(enc.encode({"a": "two"})) def test_enum(self): enc = msgspec.Encoder() dec = msgspec.Decoder(FruitStr) a = enc.encode(FruitStr.APPLE) assert enc.encode("APPLE") == a assert dec.decode(a) == FruitStr.APPLE with pytest.raises(msgspec.DecodingError, match="truncated"): dec.decode(a[:-2]) with pytest.raises( msgspec.DecodingError, match="Error decoding enum `FruitStr`" ): dec.decode(enc.encode("MISSING")) with pytest.raises(msgspec.DecodingError): dec.decode(enc.encode(1)) def test_int_enum(self): enc = msgspec.Encoder() dec = msgspec.Decoder(FruitInt) a = enc.encode(FruitInt.APPLE) assert enc.encode(1) == a assert dec.decode(a) == FruitInt.APPLE with pytest.raises(msgspec.DecodingError, match="truncated"): dec.decode(a[:-2]) with pytest.raises( msgspec.DecodingError, match="Error decoding enum `FruitInt`" ): dec.decode(enc.encode(1000)) with pytest.raises(msgspec.DecodingError): dec.decode(enc.encode("INVALID")) def test_struct(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Person) x = Person(first="harry", last="potter", age=13) a = enc.encode(x) assert ( enc.encode( {"first": "harry", "last": "potter", "age": 13, "prefect": False} ) == a ) assert dec.decode(a) == x with pytest.raises(msgspec.DecodingError, match="truncated"): dec.decode(a[:-2]) with pytest.raises(msgspec.DecodingError, match="expected `struct`"): dec.decode(enc.encode(1)) with pytest.raises( msgspec.DecodingError, match=r"Error decoding `Person` field `first` \(`str`\): expected `str`, got `int`", ): dec.decode(enc.encode({1: "harry"})) def test_struct_field_wrong_type(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Person) bad = enc.encode({"first": "harry", "last": "potter", "age": "thirteen"}) with pytest.raises(msgspec.DecodingError, match="expected `int`"): dec.decode(bad) def test_struct_missing_fields(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Person) bad = enc.encode({"first": "harry", "last": "potter"}) with pytest.raises(msgspec.DecodingError, match="missing required field `age`"): dec.decode(bad) bad = enc.encode({}) with pytest.raises( msgspec.DecodingError, match="missing required field `first`" ): dec.decode(bad) @pytest.mark.parametrize( "extra", [None, False, True, 1, 2.0, "three", b"four", [1, 2], {3: 4}] ) def test_struct_ignore_extra_fields(self, extra): enc = msgspec.Encoder() dec = msgspec.Decoder(Person) a = enc.encode( { "extra1": extra, "first": "harry", "extra2": extra, "last": "potter", "age": 13, "extra3": extra, } ) res = dec.decode(a) assert res == Person("harry", "potter", 13) def test_struct_defaults_missing_fields(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Person) a = enc.encode({"first": "harry", "last": "potter", "age": 13}) res = dec.decode(a) assert res == Person("harry", "potter", 13) assert res.prefect is False def test_struct_gc_maybe_untracked_on_decode(self): class Test(msgspec.Struct): x: Any y: Any z: Tuple = () enc = msgspec.Encoder() dec = msgspec.Decoder(List[Test]) ts = [ Test(1, 2), Test(3, "hello"), Test([], []), Test({}, {}), Test(None, None, ()), ] a, b, c, d, e = dec.decode(enc.encode(ts)) assert not gc.is_tracked(a) assert not gc.is_tracked(b) assert gc.is_tracked(c) assert gc.is_tracked(d) assert not gc.is_tracked(e) def test_struct_recursive_definition(self): enc = msgspec.Encoder() dec = msgspec.Decoder(Node) x = Node(Node(Node(), Node(Node()))) s = enc.encode(x) res = dec.decode(s) assert res == x @pytest.mark.parametrize( "typ, value", [ (bool, False), (bool, True), (int, 1), (float, 2.5), (str, "a"), (bytes, b"a"), (bytearray, bytearray(b"a")), (FruitInt, FruitInt.APPLE), (FruitStr, FruitStr.APPLE), (Person, Person("harry", "potter", 13)), (list, [1]), (set, {1}), (tuple, (1, 2)), (Tuple[int, int], (1, 2)), (dict, {1: 2}), ], ) def test_optional(self, typ, value): enc = msgspec.Encoder() dec = msgspec.Decoder(Optional[typ]) s = enc.encode(value) s2 = enc.encode(None) assert dec.decode(s) == value assert dec.decode(s2) is None dec = msgspec.Decoder(typ) with pytest.raises(msgspec.DecodingError): dec.decode(s2) @pytest.mark.parametrize( "typ, value", [ (List[Optional[int]], [1, None]), (Tuple[Optional[int], int], (None, 1)), (Set[Optional[int]], {1, None}), (Dict[str, Optional[int]], {"a": 1, "b": None}), (Dict[Optional[str], int], {"a": 1, None: 2}), ], ) def test_optional_nested(self, typ, value): enc = msgspec.Encoder() dec = msgspec.Decoder(typ) s = enc.encode(value) assert dec.decode(s) == value def test_decoding_error_no_struct_toplevel(self): b = msgspec.Encoder().encode([{"a": 1}]) dec = msgspec.Decoder(List[Dict[str, str]]) with pytest.raises( msgspec.DecodingError, match=r"Error decoding `List\[Dict\[str, str\]\]`: expected `str`, got `int`", ): dec.decode(b) class CommonTypeTestBase: """Test msgspec untyped encode/decode""" def test_none(self): self.check(None) @pytest.mark.parametrize("x", [False, True]) def test_bool(self, x): self.check(x) @pytest.mark.parametrize("x", INTS) def test_int(self, x): self.check(x) @pytest.mark.parametrize("x", FLOATS) def test_float(self, x): self.check(x) @pytest.mark.parametrize("size", SIZES) def test_str(self, size): self.check(" " * size) @pytest.mark.parametrize("size", SIZES) def test_bytes(self, size): self.check(b" " * size) @pytest.mark.parametrize("size", SIZES) def test_dict(self, size): self.check({str(i): i for i in range(size)}) @pytest.mark.parametrize("size", SIZES) def test_list(self, size): self.check(list(range(size))) class TestDecodeArrayTypeUsesTupleIfHashableRequired: def test_decode_tuple_dict_keys_as_tuples(self): orig = {(1, 2): [1, 2, [3, 4]], (1, (2, 3)): [4, 5, 6]} data = msgspec.encode(orig) out = msgspec.decode(data) assert orig == out @pytest.mark.parametrize( "typ", [ Dict[Tuple[int, Tuple[int, int]], List[int]], Dict[Tuple[int, Tuple[int, ...]], Any], Dict[Tuple, List[int]], Dict[Tuple[Any, ...], Any], Dict[Tuple[Any, Any], Any], ], ) def test_decode_dict_key_status_forwarded_through_typed_tuples(self, typ): orig = {(1, (2, 3)): [1, 2, 3]} data = msgspec.encode(orig) out = msgspec.Decoder(typ).decode(data) assert orig == out def test_decode_tuple_set_keys_as_tuples(self): orig = {(1, 2), (3, (4, 5)), 6} data = msgspec.encode(orig) out = msgspec.decode(data, type=set) assert orig == out def test_decode_hashable_struct_in_key(self): class Test(msgspec.Struct): data: List[int] def __hash__(self): return hash(tuple(self.data)) orig = {(1, Test([1, 2])): [1, 2]} data = msgspec.encode(orig) out = msgspec.Decoder(Dict[Tuple[int, Test], List[int]]).decode(data) assert orig == out class TestUntypedDecoder(CommonTypeTestBase): """Check the untyped deserializer works for common types""" def check(self, x): enc = msgspec.Encoder() dec = msgspec.Decoder() assert_eq(dec.decode(enc.encode(x)), x) class TestCompatibility(CommonTypeTestBase): """Test compatibility with the existing python msgpack library""" def check(self, x): msgpack = pytest.importorskip("msgpack") enc = msgspec.Encoder() dec = msgspec.Decoder() assert_eq(dec.decode(msgpack.dumps(x)), x) assert_eq(msgpack.loads(enc.encode(x)), x)
0.650689
0.596081
import os os.chdir('../../..') from pipelineFunctions import parseConfigFindList, parseConfigFindPath root = os.getcwd()+'/' print root import sys version,buildSample,buildRef,constructSample,CDSspecies,CDSOld,CDSgeneNaming, BB, nuc, weights_file, references_dir, query_dir, output_dir, bin = tuple(sys.argv[1:]) """with open('scaffoldConfig.txt','r') as f: (version,buildSample,buildRef,constructSample,CDSspecies,CDSOld,CDSgeneNaming, BB, nuc) = tuple([parseConfigFindPath(x,f) for x in ['version','buildSample','buildRef','constructSample','CDS','CDSFasta','geneNameOld','com_bb','com_Nuc']]) weights = parseConfigFindList('weights',f)""" root, references_dir, query_dir, output_dir = os.path.abspath(bin)+'/', os.path.abspath(references_dir)+'/', os.path.abspath(query_dir)+'/', os.path.abspath(output_dir)+'/' with open(weights_file) as f: weights = map(lambda x: x.split(), f.read().splitlines()) try: BB = int(BB) except: BB = 0 try: nuc = int(nuc) except: nuc = 0 weightsText = '\n'.join([weights[0]]+[item for item in [CDSspecies+'nuc ' + str(int(weights[1].split()[-1]))] if nuc]+[item for item in [CDSspecies+'BB ' + str(int(weights[1].split()[-1]))] if BB]+weights[1:]) weights = {line.split()[0]:int(line.split()[-1]) for line in weights} with open('references.txt','w') as f: f.write('['+','.join("'%s'"%ref for ref in weights.keys())+']') listSamples = [folder for folder in os.listdir(query_dir+version) if folder.endswith(query_dir+version)] #listSamples = ['Bdist_100_v0','Bdist_001_v0','Bdist_011_v0'] headSh = """#!/bin/bash module load cufflinks/2.2.1 module load samtools/1.3.1 module load gmap module load parallel/20150222 module load bedtools/2.25.0 module unload gcc module load gcc/6.3.0 module load bbtools """ print weightsText for reference in weights.keys(): print reference os.chdir(references_dir + reference) fastaOld = [fasta for fasta in os.listdir('.') if 'cds' not in fasta.lower() and (fasta.endswith('.fa') or fasta.endswith('.fasta'))][0] with open('buildRef.sh','w') as f: f.write('\n'.join([headSh,'samtools faidx %s' % fastaOld, 'python -m jcvi.formats.gff load %s %s --parents=mRNA --children=CDS --id_attribute=Name -o %s' % ( [file for file in os.listdir('.') if 'cufflinks' not in file and reference in file and (file.endswith('.gff3') or file.endswith('.gff'))][ 0], fastaOld, reference + '.cds'), 'python -m jcvi.formats.gff bed --type=mRNA --key=Name %s -o %s' % ( [file for file in os.listdir('.') if 'cufflinks' not in file and reference in file and (file.endswith('.gff3') or file.endswith('.gff'))][ 0], reference + '.bed'), 'python %sreplacepath.py %s' % (root, reference + '.bed'), 'mv %s %s ..' % (reference + '.bed', reference + '.cds')]+ ['cd '+root,'python %sformatBed.py r %s %s' % (root, reference,version),'cd '+root, 'python %sformatCDS.py r %s %s' % (root, reference,version)])) linkReferences = ['ln -s %s/%s.cds %s.cds\nln -s %s/%s.bed %s.bed'%(references_dir,ref,ref,references_dir,ref,ref) for ref in weights.keys()] fastaNucOld = [fasta for fasta in os.listdir(references_dir+'%s'%CDSspecies) if 'cds' not in fasta.lower() and (fasta.endswith('.fa') or fasta.endswith('.fasta'))][0] nextVersion = 'v' + str(int(version.strip('v').strip('\n'))+1) for sample in listSamples: print sample.replace(version, nextVersion) os.chdir(query_dir+version + '/' + sample) with open('weights.txt','w') as f: f.write(weightsText) fastaNew = sample + '.fa' geneNaming = sample.replace('_', '') writeBuild = [headSh,'rm -r %s %s.gff3.db %s.chromosome *.iit %s.coords' % (geneNaming, geneNaming, geneNaming, geneNaming), 'dedupe.sh in=%s out=deduped.fasta ac=f requirematchingnames && mv deduped.fasta %s && samtools faidx %s' %(fastaNew, fastaNew, fastaNew), 'gmap_build --dir=. -d %s %s' % (geneNaming, fastaNew), 'gmap --dir=. -d %s -B 5 -A --format=gff3_gene -n 1 -t 6 %s > %s 2> %s' % ( geneNaming, '%s/%s/' % (references_dir,CDSspecies + CDSOld), geneNaming + '.gff3', geneNaming + '.log'), 'python %srenameGenes.py %s %s %s' % (root, geneNaming + '.gff3', CDSgeneNaming, geneNaming), 'python %sfixGFFCoordinates.py %s'%(root,geneNaming), 'python -m jcvi.formats.gff bed --type=mRNA --key=gene_name %s -o %s' % (geneNaming + '.gff3', sample + '.bed'), 'gffread -x %s.cds -g %s.fa %s.gff3 -E'%(sample,sample,geneNaming)]+linkReferences + ['cd '+root,'python %sformatBed.py s %s %s'%(root,sample,version),'cd '+root,'python %sformatCDS.py s %s %s'%(root,sample,version)] """'python -m jcvi.formats.gff load %s %s --parents=mRNA --children=CDS -o %s' % ( geneNaming+'.gff3', fastaNew,sample + '.cds')""" # key=Name was original, now gene_name with nucCommands = [headSh]+ ['nucmer -t 6 -p %s %s %s'%(CDSspecies+'nuc',references_dir+'/%s/'%CDSspecies+fastaNucOld,sample+'.fa'), 'delta-filter -m -q -i 85 -u 50 %snuc.delta > %snuc2.delta'%(CDSspecies,CDSspecies),'show-tiling -a %snuc2.delta > %snuc.tiling'%(CDSspecies,CDSspecies)] bbCommands = [headSh.replace('module load samtools/1.3.1\n','module unload samtools\nmodule load samtools/1.4\n')] + ['rm -r ref\nrm BBmapped.bed'] + ['bbmap.sh fastareadlen=600 in=%s.fa ref=%s minid=0.97 ef=0.01 outm=BBmapped.bam ambiguous=toss'%(sample,root+'referenceGenomes/%s/'%CDSspecies+fastaNucOld), 'python -m jcvi.formats.sam bed BBmapped.bed BBmapped.bam']#threads=6 commands1 = [headSh]+['rm *.anchors *.last *.filtered *.prj']+\ ['nohup python -m jcvi.compara.catalog ortholog --full %s %s\nmv %s %s'%(ref,sample,'%s.%s.1x1.lifted.anchors'%(ref,sample),'%s.%s.lifted.anchors'%(sample,ref)) for ref in weights.keys()] commands2=[headSh]+['rm multipleMapping.bed','\n'.join('python -m jcvi.assembly.syntenypath bed %s --switch --scale=10000 --qbed=%s --sbed=%s -o %s'%('%s.%s.lifted.anchors'%(sample,ref),ref+'_syn'+'.bed',sample+'_%ssyn'%ref+'.bed','%s.synteny.bed'%(ref)) for ref in weights.keys())] \ + [item for item in ['python -m jcvi.assembly.syntenypath bed %s --switch --scale=10000 --qbed=%s --sbed=%s -o %snuc.synteny.bed'%('nucMap.bed',CDSspecies+'_nucSyn.bed',sample+'_nucSyn.bed',CDSspecies)] if nuc] \ + [item for item in ['python -m jcvi.assembly.syntenypath bed %s --switch --scale=10000 --qbed=%s --sbed=%s -o %sBB.synteny.bed' % ( 'BBMap.bed', CDSspecies + '_BBSyn.bed', sample + '_BBSyn.bed', CDSspecies)] if BB] \ + ['nohup python -m jcvi.assembly.allmaps mergebed %s -o %s'%(' '.join(['%s.synteny.bed'%(ref) for ref in (weights.keys() + [item for item in [CDSspecies+'nuc'] if nuc] + [item for item in [CDSspecies+'BB'] if BB])]),'multipleMapping.bed')] qsub=[headSh]+['module swap python/2.7-anaconda_4.3.0 && source activate scaffolder\npython -m jcvi.assembly.allmaps path --skipconcorde --cpus=16 --ngen=400 --npop=60 multipleMapping.bed %s.fa' % (sample), 'mv multipleMapping.fasta %s%s/%s/%s.fa' % (output_dir,nextVersion,sample.replace(version, nextVersion), sample.replace(version, nextVersion))] with open('build.sh','w') as f: f.write('\n'.join(writeBuild)) with open('nucCommand.sh','w') as f: f.write('\n'.join(nucCommands)) with open('constructv1_1.sh','w') as f: f.write('\n'.join(commands1)) with open('constructv1_2.sh','w') as f: f.write('\n'.join(commands2)) with open('BB_build.sh','w') as f: f.write('\n'.join(bbCommands)) with open('qsub_build.sh','w') as f: f.write('\n'.join(qsub)) os.chdir(root)
scaffolding_tool_bin/writeShFiles.py
import os os.chdir('../../..') from pipelineFunctions import parseConfigFindList, parseConfigFindPath root = os.getcwd()+'/' print root import sys version,buildSample,buildRef,constructSample,CDSspecies,CDSOld,CDSgeneNaming, BB, nuc, weights_file, references_dir, query_dir, output_dir, bin = tuple(sys.argv[1:]) """with open('scaffoldConfig.txt','r') as f: (version,buildSample,buildRef,constructSample,CDSspecies,CDSOld,CDSgeneNaming, BB, nuc) = tuple([parseConfigFindPath(x,f) for x in ['version','buildSample','buildRef','constructSample','CDS','CDSFasta','geneNameOld','com_bb','com_Nuc']]) weights = parseConfigFindList('weights',f)""" root, references_dir, query_dir, output_dir = os.path.abspath(bin)+'/', os.path.abspath(references_dir)+'/', os.path.abspath(query_dir)+'/', os.path.abspath(output_dir)+'/' with open(weights_file) as f: weights = map(lambda x: x.split(), f.read().splitlines()) try: BB = int(BB) except: BB = 0 try: nuc = int(nuc) except: nuc = 0 weightsText = '\n'.join([weights[0]]+[item for item in [CDSspecies+'nuc ' + str(int(weights[1].split()[-1]))] if nuc]+[item for item in [CDSspecies+'BB ' + str(int(weights[1].split()[-1]))] if BB]+weights[1:]) weights = {line.split()[0]:int(line.split()[-1]) for line in weights} with open('references.txt','w') as f: f.write('['+','.join("'%s'"%ref for ref in weights.keys())+']') listSamples = [folder for folder in os.listdir(query_dir+version) if folder.endswith(query_dir+version)] #listSamples = ['Bdist_100_v0','Bdist_001_v0','Bdist_011_v0'] headSh = """#!/bin/bash module load cufflinks/2.2.1 module load samtools/1.3.1 module load gmap module load parallel/20150222 module load bedtools/2.25.0 module unload gcc module load gcc/6.3.0 module load bbtools """ print weightsText for reference in weights.keys(): print reference os.chdir(references_dir + reference) fastaOld = [fasta for fasta in os.listdir('.') if 'cds' not in fasta.lower() and (fasta.endswith('.fa') or fasta.endswith('.fasta'))][0] with open('buildRef.sh','w') as f: f.write('\n'.join([headSh,'samtools faidx %s' % fastaOld, 'python -m jcvi.formats.gff load %s %s --parents=mRNA --children=CDS --id_attribute=Name -o %s' % ( [file for file in os.listdir('.') if 'cufflinks' not in file and reference in file and (file.endswith('.gff3') or file.endswith('.gff'))][ 0], fastaOld, reference + '.cds'), 'python -m jcvi.formats.gff bed --type=mRNA --key=Name %s -o %s' % ( [file for file in os.listdir('.') if 'cufflinks' not in file and reference in file and (file.endswith('.gff3') or file.endswith('.gff'))][ 0], reference + '.bed'), 'python %sreplacepath.py %s' % (root, reference + '.bed'), 'mv %s %s ..' % (reference + '.bed', reference + '.cds')]+ ['cd '+root,'python %sformatBed.py r %s %s' % (root, reference,version),'cd '+root, 'python %sformatCDS.py r %s %s' % (root, reference,version)])) linkReferences = ['ln -s %s/%s.cds %s.cds\nln -s %s/%s.bed %s.bed'%(references_dir,ref,ref,references_dir,ref,ref) for ref in weights.keys()] fastaNucOld = [fasta for fasta in os.listdir(references_dir+'%s'%CDSspecies) if 'cds' not in fasta.lower() and (fasta.endswith('.fa') or fasta.endswith('.fasta'))][0] nextVersion = 'v' + str(int(version.strip('v').strip('\n'))+1) for sample in listSamples: print sample.replace(version, nextVersion) os.chdir(query_dir+version + '/' + sample) with open('weights.txt','w') as f: f.write(weightsText) fastaNew = sample + '.fa' geneNaming = sample.replace('_', '') writeBuild = [headSh,'rm -r %s %s.gff3.db %s.chromosome *.iit %s.coords' % (geneNaming, geneNaming, geneNaming, geneNaming), 'dedupe.sh in=%s out=deduped.fasta ac=f requirematchingnames && mv deduped.fasta %s && samtools faidx %s' %(fastaNew, fastaNew, fastaNew), 'gmap_build --dir=. -d %s %s' % (geneNaming, fastaNew), 'gmap --dir=. -d %s -B 5 -A --format=gff3_gene -n 1 -t 6 %s > %s 2> %s' % ( geneNaming, '%s/%s/' % (references_dir,CDSspecies + CDSOld), geneNaming + '.gff3', geneNaming + '.log'), 'python %srenameGenes.py %s %s %s' % (root, geneNaming + '.gff3', CDSgeneNaming, geneNaming), 'python %sfixGFFCoordinates.py %s'%(root,geneNaming), 'python -m jcvi.formats.gff bed --type=mRNA --key=gene_name %s -o %s' % (geneNaming + '.gff3', sample + '.bed'), 'gffread -x %s.cds -g %s.fa %s.gff3 -E'%(sample,sample,geneNaming)]+linkReferences + ['cd '+root,'python %sformatBed.py s %s %s'%(root,sample,version),'cd '+root,'python %sformatCDS.py s %s %s'%(root,sample,version)] """'python -m jcvi.formats.gff load %s %s --parents=mRNA --children=CDS -o %s' % ( geneNaming+'.gff3', fastaNew,sample + '.cds')""" # key=Name was original, now gene_name with nucCommands = [headSh]+ ['nucmer -t 6 -p %s %s %s'%(CDSspecies+'nuc',references_dir+'/%s/'%CDSspecies+fastaNucOld,sample+'.fa'), 'delta-filter -m -q -i 85 -u 50 %snuc.delta > %snuc2.delta'%(CDSspecies,CDSspecies),'show-tiling -a %snuc2.delta > %snuc.tiling'%(CDSspecies,CDSspecies)] bbCommands = [headSh.replace('module load samtools/1.3.1\n','module unload samtools\nmodule load samtools/1.4\n')] + ['rm -r ref\nrm BBmapped.bed'] + ['bbmap.sh fastareadlen=600 in=%s.fa ref=%s minid=0.97 ef=0.01 outm=BBmapped.bam ambiguous=toss'%(sample,root+'referenceGenomes/%s/'%CDSspecies+fastaNucOld), 'python -m jcvi.formats.sam bed BBmapped.bed BBmapped.bam']#threads=6 commands1 = [headSh]+['rm *.anchors *.last *.filtered *.prj']+\ ['nohup python -m jcvi.compara.catalog ortholog --full %s %s\nmv %s %s'%(ref,sample,'%s.%s.1x1.lifted.anchors'%(ref,sample),'%s.%s.lifted.anchors'%(sample,ref)) for ref in weights.keys()] commands2=[headSh]+['rm multipleMapping.bed','\n'.join('python -m jcvi.assembly.syntenypath bed %s --switch --scale=10000 --qbed=%s --sbed=%s -o %s'%('%s.%s.lifted.anchors'%(sample,ref),ref+'_syn'+'.bed',sample+'_%ssyn'%ref+'.bed','%s.synteny.bed'%(ref)) for ref in weights.keys())] \ + [item for item in ['python -m jcvi.assembly.syntenypath bed %s --switch --scale=10000 --qbed=%s --sbed=%s -o %snuc.synteny.bed'%('nucMap.bed',CDSspecies+'_nucSyn.bed',sample+'_nucSyn.bed',CDSspecies)] if nuc] \ + [item for item in ['python -m jcvi.assembly.syntenypath bed %s --switch --scale=10000 --qbed=%s --sbed=%s -o %sBB.synteny.bed' % ( 'BBMap.bed', CDSspecies + '_BBSyn.bed', sample + '_BBSyn.bed', CDSspecies)] if BB] \ + ['nohup python -m jcvi.assembly.allmaps mergebed %s -o %s'%(' '.join(['%s.synteny.bed'%(ref) for ref in (weights.keys() + [item for item in [CDSspecies+'nuc'] if nuc] + [item for item in [CDSspecies+'BB'] if BB])]),'multipleMapping.bed')] qsub=[headSh]+['module swap python/2.7-anaconda_4.3.0 && source activate scaffolder\npython -m jcvi.assembly.allmaps path --skipconcorde --cpus=16 --ngen=400 --npop=60 multipleMapping.bed %s.fa' % (sample), 'mv multipleMapping.fasta %s%s/%s/%s.fa' % (output_dir,nextVersion,sample.replace(version, nextVersion), sample.replace(version, nextVersion))] with open('build.sh','w') as f: f.write('\n'.join(writeBuild)) with open('nucCommand.sh','w') as f: f.write('\n'.join(nucCommands)) with open('constructv1_1.sh','w') as f: f.write('\n'.join(commands1)) with open('constructv1_2.sh','w') as f: f.write('\n'.join(commands2)) with open('BB_build.sh','w') as f: f.write('\n'.join(bbCommands)) with open('qsub_build.sh','w') as f: f.write('\n'.join(qsub)) os.chdir(root)
0.210523
0.090093
from collections import OrderedDict import itertools import sys from tensorflow.keras.layers import Input from tensorflow.keras.models import Model from tensorflow.keras.optimizers import Adam from tensorflow.keras.callbacks import TerminateOnNaN from flowket.callbacks.monte_carlo import TensorBoardWithGeneratorValidationData, \ default_wave_function_stats_callbacks_factory, BadEigenStateStopping from flowket.evaluation import evaluate from flowket.operators.j1j2 import J1J2 from flowket.machines import ConvNetAutoregressive2D from flowket.machines.ensemble import make_2d_obc_invariants from flowket.optimization import VariationalMonteCarlo, loss_for_energy_minimization from flowket.samplers import FastAutoregressiveSampler params_grid_config = { 'width': [32], 'depth': [5], 'lr': [5e-3, 1e-3, 5e-4], 'weights_normalization': [True, False] } run_index = int(sys.argv[-1].strip()) ks, vs = zip(*params_grid_config.items()) params_options = list(itertools.product(*vs)) chosen_v = params_options[run_index % len(params_options)] params = dict(zip(ks, chosen_v)) print('Chosen params: %s' % str(params)) hilbert_state_shape = (4, 4) inputs = Input(shape=hilbert_state_shape, dtype='int8') convnet = ConvNetAutoregressive2D(inputs, depth=params['depth'], num_of_channels=params['width'], weights_normalization=params['weights_normalization']) predictions, conditional_log_probs = convnet.predictions, convnet.conditional_log_probs model = Model(inputs=inputs, outputs=predictions) conditional_log_probs_model = Model(inputs=inputs, outputs=conditional_log_probs) batch_size = 2 ** 10 steps_per_epoch = 2 ** 8 true_ground_state_energy = -30.022227800323677 optimizer = Adam(lr=params['lr'], beta_1=0.9, beta_2=0.999) model.compile(optimizer=optimizer, loss=loss_for_energy_minimization) model.summary() operator = J1J2(hilbert_state_shape=hilbert_state_shape, j2=0.5, pbc=False) sampler = FastAutoregressiveSampler(conditional_log_probs_model, batch_size) monte_carlo_generator = VariationalMonteCarlo(model, operator, sampler) run_name = 'j1j2_4_monte_carlo_weights_normalization_%s_depth_%s_width_%s_adam_lr_%s_run_%s' % \ (params['weights_normalization'], params['depth'], params['width'], params['lr'], run_index) tensorboard = TensorBoardWithGeneratorValidationData(log_dir='tensorboard_logs/%s' % run_name, generator=monte_carlo_generator, update_freq='epoch', histogram_freq=1, batch_size=batch_size, write_output=False) warly_stopping = BadEigenStateStopping(true_ground_state_energy) callbacks = default_wave_function_stats_callbacks_factory(monte_carlo_generator, log_in_batch_or_epoch=False, true_ground_state_energy=true_ground_state_energy) + [ tensorboard, TerminateOnNaN(), warly_stopping] model.fit_generator(monte_carlo_generator.to_generator(), steps_per_epoch=steps_per_epoch, epochs=60, callbacks=callbacks, max_queue_size=0, workers=0) model.save_weights('before_increasing_batch__%s.h5' % run_name) if warly_stopping.stopped_epoch is not None: print('stopat epoch %s because of bad eigenstate' % warly_stopping.stopped_epoch) sys.exit() print('incresing batchsize to 8192') sampler = FastAutoregressiveSampler(conditional_log_probs_model, batch_size * 8) monte_carlo_generator.set_sampler(sampler) model.fit_generator(monte_carlo_generator.to_generator(), steps_per_epoch=steps_per_epoch, epochs=80, callbacks=callbacks, max_queue_size=0, workers=0) model.save_weights('final_%s.h5' % run_name) evaluation_inputs = Input(shape=hilbert_state_shape, dtype='int8') invariant_model = make_2d_obc_invariants(evaluation_inputs, model) generator = VariationalMonteCarlo(invariant_model, operator, sampler) evaluate(generator, steps=200, callbacks=callbacks[:4], keys_to_progress_bar_mapping={'energy/energy': 'energy', 'energy/relative_error': 'relative_error'})
examples/j1j2_2d_monte_carlo_4.py
from collections import OrderedDict import itertools import sys from tensorflow.keras.layers import Input from tensorflow.keras.models import Model from tensorflow.keras.optimizers import Adam from tensorflow.keras.callbacks import TerminateOnNaN from flowket.callbacks.monte_carlo import TensorBoardWithGeneratorValidationData, \ default_wave_function_stats_callbacks_factory, BadEigenStateStopping from flowket.evaluation import evaluate from flowket.operators.j1j2 import J1J2 from flowket.machines import ConvNetAutoregressive2D from flowket.machines.ensemble import make_2d_obc_invariants from flowket.optimization import VariationalMonteCarlo, loss_for_energy_minimization from flowket.samplers import FastAutoregressiveSampler params_grid_config = { 'width': [32], 'depth': [5], 'lr': [5e-3, 1e-3, 5e-4], 'weights_normalization': [True, False] } run_index = int(sys.argv[-1].strip()) ks, vs = zip(*params_grid_config.items()) params_options = list(itertools.product(*vs)) chosen_v = params_options[run_index % len(params_options)] params = dict(zip(ks, chosen_v)) print('Chosen params: %s' % str(params)) hilbert_state_shape = (4, 4) inputs = Input(shape=hilbert_state_shape, dtype='int8') convnet = ConvNetAutoregressive2D(inputs, depth=params['depth'], num_of_channels=params['width'], weights_normalization=params['weights_normalization']) predictions, conditional_log_probs = convnet.predictions, convnet.conditional_log_probs model = Model(inputs=inputs, outputs=predictions) conditional_log_probs_model = Model(inputs=inputs, outputs=conditional_log_probs) batch_size = 2 ** 10 steps_per_epoch = 2 ** 8 true_ground_state_energy = -30.022227800323677 optimizer = Adam(lr=params['lr'], beta_1=0.9, beta_2=0.999) model.compile(optimizer=optimizer, loss=loss_for_energy_minimization) model.summary() operator = J1J2(hilbert_state_shape=hilbert_state_shape, j2=0.5, pbc=False) sampler = FastAutoregressiveSampler(conditional_log_probs_model, batch_size) monte_carlo_generator = VariationalMonteCarlo(model, operator, sampler) run_name = 'j1j2_4_monte_carlo_weights_normalization_%s_depth_%s_width_%s_adam_lr_%s_run_%s' % \ (params['weights_normalization'], params['depth'], params['width'], params['lr'], run_index) tensorboard = TensorBoardWithGeneratorValidationData(log_dir='tensorboard_logs/%s' % run_name, generator=monte_carlo_generator, update_freq='epoch', histogram_freq=1, batch_size=batch_size, write_output=False) warly_stopping = BadEigenStateStopping(true_ground_state_energy) callbacks = default_wave_function_stats_callbacks_factory(monte_carlo_generator, log_in_batch_or_epoch=False, true_ground_state_energy=true_ground_state_energy) + [ tensorboard, TerminateOnNaN(), warly_stopping] model.fit_generator(monte_carlo_generator.to_generator(), steps_per_epoch=steps_per_epoch, epochs=60, callbacks=callbacks, max_queue_size=0, workers=0) model.save_weights('before_increasing_batch__%s.h5' % run_name) if warly_stopping.stopped_epoch is not None: print('stopat epoch %s because of bad eigenstate' % warly_stopping.stopped_epoch) sys.exit() print('incresing batchsize to 8192') sampler = FastAutoregressiveSampler(conditional_log_probs_model, batch_size * 8) monte_carlo_generator.set_sampler(sampler) model.fit_generator(monte_carlo_generator.to_generator(), steps_per_epoch=steps_per_epoch, epochs=80, callbacks=callbacks, max_queue_size=0, workers=0) model.save_weights('final_%s.h5' % run_name) evaluation_inputs = Input(shape=hilbert_state_shape, dtype='int8') invariant_model = make_2d_obc_invariants(evaluation_inputs, model) generator = VariationalMonteCarlo(invariant_model, operator, sampler) evaluate(generator, steps=200, callbacks=callbacks[:4], keys_to_progress_bar_mapping={'energy/energy': 'energy', 'energy/relative_error': 'relative_error'})
0.586286
0.322753
from src.constants import * from src.token import Token from src.tokenizer import Tokenizer from src.symbol_table import SymbolTable from src.variable import Variable from copy import copy CLASSES = [] SUBROUTINES = [] class Parser(object): def __init__(self, tokenizer): """ Constructs parser object. """ self.xml_data = [] # For xml export. self.symbol_table = SymbolTable() # Create symbol table for class scope. self.tokenizer = tokenizer # Tokenizer. self.token = None # Current token. self.compile_class() def check_for_value(self, value): """ Check if current token has expected value. """ self.token = self.tokenizer.advance() if self.token.value != value: raise Exception("Error: Excpected value => '{0}' but got => '{1}'".format(value, self.token.value)) if self.token.value in XML_REPLACE.keys(): self.xml_data.append("<{0}> {1} </{0}>".format(self.token.type, XML_REPLACE[self.token.value])) else: self.xml_data.append(self.token.__str__()) def check_for_identifier(self): """ Check if current token is valid identifier. """ self.token = self.tokenizer.advance() if self.token.type != "identifier" or (not re.match(R_IDENTIFIER, self.token.value)): raise Exception("Error: Identifier name not valid => '{0}'".format(self.token.value)) self.xml_data.append(self.token.__str__()) def check_for_type(self): """ Check if current token has valid type. """ self.token = self.tokenizer.advance() if self.token.value not in list(TYPES) + CLASSES: raise Exception("Error: Not valid type => '{0}'".format(self.token.value)) self.xml_data.append(self.token.__str__()) def check_for_operator(self): """ Check if current token is operator. """ self.token = self.tokenizer.advance() if self.token.value not in OP: raise Exception("Error: Invalid operator => '{0}'".format(self.token.value)) if self.token.value in XML_REPLACE.keys(): self.xml_data.append("<{0}> {1} </{0}>".format(self.token.type, XML_REPLACE[self.token.value])) else: self.xml_data.append(self.token.__str__()) def compile_class(self): """ Compile class. ------------------------------------------------------------- Rule => 'class' className '{' classVarDec* subroutineDec* '}' ------------------------------------------------------------- """ self.xml_data.append("<class>") # Xml rep: <class> self.check_for_value('class') # Xml rep: <keyword> class </keyword> self.check_for_identifier() # Xml rep: <identifier> className </identifier> CLASSES.append(self.token.value) # Add class name to list of classes. self.check_for_value('{') # Xml rep: <symbol> { </symbol> while self.tokenizer.next().value != "}": self.token = self.tokenizer.advance() if self.token.value in ['static', 'field']: self.compile_class_var_dec() # Compile class variable declarations. elif self.token.value in ['constructor', 'function', 'method']: self.compile_subroutine_dec() # Compile class subroutine declarations. self.check_for_value("}") # Xml rep: <symbol> } </symbol> self.xml_data.append("</class>") # Xml rep: </class> def compile_class_var_dec(self): """ Compile class variable declarations. ------------------------------------------------------------- Rule => ('static' | 'field') type varName (',', varName)* ';' ------------------------------------------------------------- """ self.xml_data.append("<classVarDec>") # Xml rep: <classVarDec> variable = Variable() self.xml_data.append(self.token.__str__()) # Xml rep: <keyword> ('static' | 'field') </keyword> variable.kind = self.token.value self.check_for_type() # Xml rep: <keyword> type </keyword> variable.type = self.token.value self.check_for_identifier() # Xml rep: <identifier> varName </identifier> variable.name = self.token.value self.symbol_table.add(variable) # Add variable to class scope symbol table. while self.tokenizer.next().value != ";": self.check_for_value(",") # Xml rep: <symbol> , </symbol> self.check_for_identifier() # Xml rep: <identifier> varName </identifier> v = copy(variable) v.name = self.token.value self.symbol_table.add(v) # Add variable to class scope symbol table. self.check_for_value(";") # Xml rep: <symbol> ; </symbol> self.xml_data.append("</classVarDec>") # Xml rep: </classVarDec> def compile_subroutine_dec(self): """ Compile class subroutine declarations. ------------------------------------------------------------------------------------------------------------------- Rule => ('constructor' | 'function' | 'method') ('void' | type) subroutineName '(' parameterList ')' subroutineBody ------------------------------------------------------------------------------------------------------------------- """ self.xml_data.append("<subroutineDec>") # Xml rep: <subroutineDec> self.xml_data.append(self.token.__str__()) # Xml rep: <keyword> ('constructor' | 'function' | 'method')) </keyword> self.check_for_type() # Xml rep: <keyword> type </keyword> self.check_for_identifier() # Xml rep: <identifier> subroutineName </identifier> SUBROUTINES.append(self.token.value) # Add subroutine name to subroutine list. self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_parameter_list() # Compile parameter list. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> self.compile_subroutine_body() # Compile subroutine body. self.xml_data.append("</subroutineDec>") # Xml rep: </subroutineDec> def compile_parameter_list(self): """ Compile parameter list. --------------------------------------------- Rule => ((type varName) (',' type varName)*)? --------------------------------------------- """ self.xml_data.append("<parameterList>") # Xml rep: <parameterList> if self.tokenizer.next().value != ")": self.check_for_type() # Xml rep: <keyword> type </keyword> self.check_for_identifier() # Xml rep: <identifier> varName </identifier> while self.tokenizer.next().value == ",": self.check_for_value(",") # Xml rep: <symbol> , </symbol> self.check_for_type() # Xml rep: <keyword> type </keyword> self.check_for_identifier() # Xml rep: <identifier> varName </identifier> self.xml_data.append("</parameterList>") # Xml rep: </parameterList> def compile_subroutine_body(self): """ Compile subroutine body. ---------------------------------- Rule => '{' varDec* statements '}' ---------------------------------- """ self.xml_data.append("<subroutineBody>") # Xml rep: <subroutineBody> self.check_for_value("{") # Xml rep: <symbol> { </symbol> while self.tokenizer.next().value == "var": self.compile_var_dec() # Compile variable declarations. self.compile_statements() # Compile statements. self.check_for_value("}") # Xml rep: <symbol> } </symbol> self.xml_data.append("</subroutineBody>") # Xml rep: </subroutineBody> def compile_var_dec(self): """ Compile variable declarations. ---------------------------------------------- Rule => 'var' type varName (',', varName)* ';' ---------------------------------------------- """ self.xml_data.append("<varDec>") # Xml rep: <varDec> self.check_for_value("var") # Xml rep: <keyword> var </keyword> self.check_for_type() # Xml rep: <keyword> type </keyword> self.check_for_identifier() # Xml rep: <identifier> varName </identifier> while self.tokenizer.next().value != ";": self.check_for_value(",") # Xml rep: <symbol> ; </symbol> self.check_for_identifier() # Xml rep: <identifier> varName </identifier> self.check_for_value(";") # Xml rep: <symbol> ; </symbol> self.xml_data.append("</varDec>") # Xml rep: </varDec> def compile_statements(self): """ Compile statements. ----------------------------------------------------------------------------------- Rule => letStatement | ifStatement | whileStatement | doStatement | returnStatement ----------------------------------------------------------------------------------- """ self.xml_data.append("<statements>") # Xml rep: <statements> while self.tokenizer.next().value != "}": token = self.tokenizer.next().value if token == 'let': self.compile_let_statement() # Compile let statement. elif token == 'while': self.compile_while_statement() # Compile while statement. elif token == 'if': self.compile_if_statement() # Compile if statement. elif token == 'do': self.compile_do_statement() # Compile do statement. elif token == 'return': self.compile_return_statement() # Compile return statement. self.xml_data.append("</statements>") # Xml rep: </statements> def compile_let_statement(self): """ Compile let statement. -------------------------------------------------------------- Rule => 'let' varName ('[' expression ']')? '=' expression ';' -------------------------------------------------------------- """ self.xml_data.append("<letStatement>") # Xml rep: <letStatement> self.check_for_value("let") # Xml rep: <keyword> let </keyword> self.check_for_identifier() # Xml rep: <identifier> varName </identifier> var = self.symbol_table.find(self.token.value) if self.tokenizer.next().value == '[': self.check_for_value("[") # Xml rep: <symbol> [ </symbol> self.compile_expression("]") # Compile expression. self.check_for_value("]") # Xml rep: <symbol> ] </symbol> self.check_for_value("=") # Xml rep: <symbol> = </symbol> self.compile_expression(";") # Compile expression. self.check_for_value(";") # Xml rep: <symbol> ; </symbol> self.xml_data.append("</letStatement>") # Xml rep: </letStatement> def compile_while_statement(self): """ Compile while statement. ----------------------------------------------------- Rule => 'while' '(' expression ')' '{' statements '}' ----------------------------------------------------- """ self.xml_data.append("<whileStatement>") # Xml rep: <whileStatement> self.check_for_value("while") # Xml rep: <keyword> while </keyword> self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_expression(")") # Compile expression. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> self.check_for_value("{") # Xml rep: <symbol> { </symbol> self.compile_statements() # Compile statements. self.check_for_value("}") # Xml rep: <symbol> } </symbol> self.xml_data.append("</whileStatement>") # Xml rep: </whileStatement> def compile_if_statement(self): """ Compile if statement. ------------------------------------------------------------------------------- Rule => 'if' '(' expression ')' '{' statements '}' ('else' '{' statements '}')? ------------------------------------------------------------------------------- """ self.xml_data.append("<ifStatement>") # Xml rep: <ifStatement> self.check_for_value("if") # Xml rep: <keyword> if </keyword> self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_expression(")") # Compile expression. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> self.check_for_value("{") # Xml rep: <symbol> { </symbol> self.compile_statements() # Compile statements. self.check_for_value("}") # Xml rep: <symbol> } </symbol> if self.tokenizer.next().value == 'else': self.check_for_value('else') # Xml rep: <keyword> else </keyword> self.check_for_value('{') # Xml rep: <symbol> { </symbol> self.compile_statements() # Compile statements. self.check_for_value('}') # Xml rep: <symbol> } </symbol> self.xml_data.append("</ifStatement>") # Xml rep: </ifStatement> def compile_do_statement(self): """ Compile do statement. ------------------------------- Rule => 'do' subroutineCall ';' ------------------------------- """ self.xml_data.append("<doStatement>") # Xml rep: <doStatement> self.check_for_value("do") # Xml rep: <keword> do </keyword> self.compile_subroutine_call() # Compile subroutine call. self.check_for_value(";") # Xml rep: <symbol> ; </symbol> self.xml_data.append("</doStatement>") # Xml rep: </doStatement> def compile_return_statement(self): """ Compile return statement. -------------------------------- Rule => 'return' expression? ';' -------------------------------- """ self.xml_data.append("<returnStatement>") # Xml rep: <returnStatement> self.check_for_value("return") # Xml rep: <keword> return </keyword> if self.tokenizer.next().value != ";": self.compile_expression(';') self.check_for_value(";") # Xml rep: <symbol> ; </symbol> self.xml_data.append("</returnStatement>") # Xml rep: </returnStatement> def compile_subroutine_call(self): """ Compile subroutine call. --------------------------------------------------------------------------------------------------------------- Rule => subroutineName '(' expressionList ')' | (className | varName) '.' subroutineName '(' expressionList ')' --------------------------------------------------------------------------------------------------------------- """ self.xml_data.append("<subroutineCall>") # Xml rep: <subroutineCall> self.check_for_identifier() # Xml rep: <identifier> subroutineName | (className | varName) </identifier> if self.tokenizer.next().value == ".": self.check_for_value(".") # Xml rep: <symbol> . </symbol> self.check_for_identifier() # Xml rep: <identifier> subroutineName </identifier> self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_expression_list() # Compile expression list. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> self.xml_data.append("</subroutineCall>") # Xml rep: </subroutineCall> def compile_expression(self, *end): """ Compile expression. ----------------------- Rule => term (op term)* ----------------------- """ self.xml_data.append("<expression>") # Xml rep:<expression> self.compile_term() # Compile term. while self.tokenizer.next().value not in end: self.check_for_operator() # Xml rep: <symbol> operator </symbol> self.compile_term() # Compile term. self.xml_data.append("</expression>") # Xml rep: </expression> def compile_term(self): """ Compile term. ---------------------------------------------------------------------------------- Rule => integerConstant | stringConstant | keywordConstant | unaryOp term | varName | varName'[' expression ']' | subroutineCall | '(' expression ')' ---------------------------------------------------------------------------------- """ self.xml_data.append("<term>") # Xml rep: <term> if self.tokenizer.next().type in ["integerConstant", "stringConstant"] or self.tokenizer.next().value in KEYWORD_CONSANTS: self.token = self.tokenizer.advance() self.xml_data.append(self.token.__str__()) # Xml rep: <integerConstant | stringConstant | keyword> value </integerConstant | stringConstant | keyword> elif self.tokenizer.next().value in UNARY_OP: self.token = self.tokenizer.advance() self.xml_data.append(self.token.__str__()) # Xml rep: <symbol> unaryOp </symbol> self.compile_term() # Compile term. elif self.tokenizer.next().value == "(": self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_expression(")") # Compile expression. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> else: self.check_for_identifier() # Xml rep: <identifier> varName </identifier> var = self.symbol_table.find(self.token.value) if self.tokenizer.next().value == "[": self.check_for_value("[") # Xml rep: <symbol> [ </symbol> self.compile_expression("]") # Compile expression. self.check_for_value("]") # Xml rep: <symbol> ] </symbol> elif self.tokenizer.next().value == ".": self.check_for_value(".") # Xml rep: <symbol> . </symbol> self.check_for_identifier() # Xml rep: <identifier> subroutineName </identifier> self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_expression_list() # Compile expression list. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> elif self.tokenizer.next().value == "(": self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_expression_list() # Compile expression list. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> self.xml_data.append("</term>") # Xml rep: </term> def compile_expression_list(self): """ Compile expression list. --------------------------------------- Rule => (expression (',' expression)*)? --------------------------------------- """ self.xml_data.append("<expressionList>") # Xml rep: <expressionList> if self.tokenizer.next().value != ")": self.compile_expression(",", ")") # Compile expression. while self.tokenizer.next().value == ",": self.check_for_value(",") # Xml rep: <symbol> , </symbol> self.compile_expression(",", ")") self.xml_data.append("</expressionList>") # Xml rep: </expressionList> def export_xml(self, file_name): """ Export code structure to file in xml format. """ with open("xml-export/{0}.structure.xml".format(file_name), "w") as xml_file: for line in self.xml_data: xml_file.write(line + "\n")
src/parser.py
from src.constants import * from src.token import Token from src.tokenizer import Tokenizer from src.symbol_table import SymbolTable from src.variable import Variable from copy import copy CLASSES = [] SUBROUTINES = [] class Parser(object): def __init__(self, tokenizer): """ Constructs parser object. """ self.xml_data = [] # For xml export. self.symbol_table = SymbolTable() # Create symbol table for class scope. self.tokenizer = tokenizer # Tokenizer. self.token = None # Current token. self.compile_class() def check_for_value(self, value): """ Check if current token has expected value. """ self.token = self.tokenizer.advance() if self.token.value != value: raise Exception("Error: Excpected value => '{0}' but got => '{1}'".format(value, self.token.value)) if self.token.value in XML_REPLACE.keys(): self.xml_data.append("<{0}> {1} </{0}>".format(self.token.type, XML_REPLACE[self.token.value])) else: self.xml_data.append(self.token.__str__()) def check_for_identifier(self): """ Check if current token is valid identifier. """ self.token = self.tokenizer.advance() if self.token.type != "identifier" or (not re.match(R_IDENTIFIER, self.token.value)): raise Exception("Error: Identifier name not valid => '{0}'".format(self.token.value)) self.xml_data.append(self.token.__str__()) def check_for_type(self): """ Check if current token has valid type. """ self.token = self.tokenizer.advance() if self.token.value not in list(TYPES) + CLASSES: raise Exception("Error: Not valid type => '{0}'".format(self.token.value)) self.xml_data.append(self.token.__str__()) def check_for_operator(self): """ Check if current token is operator. """ self.token = self.tokenizer.advance() if self.token.value not in OP: raise Exception("Error: Invalid operator => '{0}'".format(self.token.value)) if self.token.value in XML_REPLACE.keys(): self.xml_data.append("<{0}> {1} </{0}>".format(self.token.type, XML_REPLACE[self.token.value])) else: self.xml_data.append(self.token.__str__()) def compile_class(self): """ Compile class. ------------------------------------------------------------- Rule => 'class' className '{' classVarDec* subroutineDec* '}' ------------------------------------------------------------- """ self.xml_data.append("<class>") # Xml rep: <class> self.check_for_value('class') # Xml rep: <keyword> class </keyword> self.check_for_identifier() # Xml rep: <identifier> className </identifier> CLASSES.append(self.token.value) # Add class name to list of classes. self.check_for_value('{') # Xml rep: <symbol> { </symbol> while self.tokenizer.next().value != "}": self.token = self.tokenizer.advance() if self.token.value in ['static', 'field']: self.compile_class_var_dec() # Compile class variable declarations. elif self.token.value in ['constructor', 'function', 'method']: self.compile_subroutine_dec() # Compile class subroutine declarations. self.check_for_value("}") # Xml rep: <symbol> } </symbol> self.xml_data.append("</class>") # Xml rep: </class> def compile_class_var_dec(self): """ Compile class variable declarations. ------------------------------------------------------------- Rule => ('static' | 'field') type varName (',', varName)* ';' ------------------------------------------------------------- """ self.xml_data.append("<classVarDec>") # Xml rep: <classVarDec> variable = Variable() self.xml_data.append(self.token.__str__()) # Xml rep: <keyword> ('static' | 'field') </keyword> variable.kind = self.token.value self.check_for_type() # Xml rep: <keyword> type </keyword> variable.type = self.token.value self.check_for_identifier() # Xml rep: <identifier> varName </identifier> variable.name = self.token.value self.symbol_table.add(variable) # Add variable to class scope symbol table. while self.tokenizer.next().value != ";": self.check_for_value(",") # Xml rep: <symbol> , </symbol> self.check_for_identifier() # Xml rep: <identifier> varName </identifier> v = copy(variable) v.name = self.token.value self.symbol_table.add(v) # Add variable to class scope symbol table. self.check_for_value(";") # Xml rep: <symbol> ; </symbol> self.xml_data.append("</classVarDec>") # Xml rep: </classVarDec> def compile_subroutine_dec(self): """ Compile class subroutine declarations. ------------------------------------------------------------------------------------------------------------------- Rule => ('constructor' | 'function' | 'method') ('void' | type) subroutineName '(' parameterList ')' subroutineBody ------------------------------------------------------------------------------------------------------------------- """ self.xml_data.append("<subroutineDec>") # Xml rep: <subroutineDec> self.xml_data.append(self.token.__str__()) # Xml rep: <keyword> ('constructor' | 'function' | 'method')) </keyword> self.check_for_type() # Xml rep: <keyword> type </keyword> self.check_for_identifier() # Xml rep: <identifier> subroutineName </identifier> SUBROUTINES.append(self.token.value) # Add subroutine name to subroutine list. self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_parameter_list() # Compile parameter list. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> self.compile_subroutine_body() # Compile subroutine body. self.xml_data.append("</subroutineDec>") # Xml rep: </subroutineDec> def compile_parameter_list(self): """ Compile parameter list. --------------------------------------------- Rule => ((type varName) (',' type varName)*)? --------------------------------------------- """ self.xml_data.append("<parameterList>") # Xml rep: <parameterList> if self.tokenizer.next().value != ")": self.check_for_type() # Xml rep: <keyword> type </keyword> self.check_for_identifier() # Xml rep: <identifier> varName </identifier> while self.tokenizer.next().value == ",": self.check_for_value(",") # Xml rep: <symbol> , </symbol> self.check_for_type() # Xml rep: <keyword> type </keyword> self.check_for_identifier() # Xml rep: <identifier> varName </identifier> self.xml_data.append("</parameterList>") # Xml rep: </parameterList> def compile_subroutine_body(self): """ Compile subroutine body. ---------------------------------- Rule => '{' varDec* statements '}' ---------------------------------- """ self.xml_data.append("<subroutineBody>") # Xml rep: <subroutineBody> self.check_for_value("{") # Xml rep: <symbol> { </symbol> while self.tokenizer.next().value == "var": self.compile_var_dec() # Compile variable declarations. self.compile_statements() # Compile statements. self.check_for_value("}") # Xml rep: <symbol> } </symbol> self.xml_data.append("</subroutineBody>") # Xml rep: </subroutineBody> def compile_var_dec(self): """ Compile variable declarations. ---------------------------------------------- Rule => 'var' type varName (',', varName)* ';' ---------------------------------------------- """ self.xml_data.append("<varDec>") # Xml rep: <varDec> self.check_for_value("var") # Xml rep: <keyword> var </keyword> self.check_for_type() # Xml rep: <keyword> type </keyword> self.check_for_identifier() # Xml rep: <identifier> varName </identifier> while self.tokenizer.next().value != ";": self.check_for_value(",") # Xml rep: <symbol> ; </symbol> self.check_for_identifier() # Xml rep: <identifier> varName </identifier> self.check_for_value(";") # Xml rep: <symbol> ; </symbol> self.xml_data.append("</varDec>") # Xml rep: </varDec> def compile_statements(self): """ Compile statements. ----------------------------------------------------------------------------------- Rule => letStatement | ifStatement | whileStatement | doStatement | returnStatement ----------------------------------------------------------------------------------- """ self.xml_data.append("<statements>") # Xml rep: <statements> while self.tokenizer.next().value != "}": token = self.tokenizer.next().value if token == 'let': self.compile_let_statement() # Compile let statement. elif token == 'while': self.compile_while_statement() # Compile while statement. elif token == 'if': self.compile_if_statement() # Compile if statement. elif token == 'do': self.compile_do_statement() # Compile do statement. elif token == 'return': self.compile_return_statement() # Compile return statement. self.xml_data.append("</statements>") # Xml rep: </statements> def compile_let_statement(self): """ Compile let statement. -------------------------------------------------------------- Rule => 'let' varName ('[' expression ']')? '=' expression ';' -------------------------------------------------------------- """ self.xml_data.append("<letStatement>") # Xml rep: <letStatement> self.check_for_value("let") # Xml rep: <keyword> let </keyword> self.check_for_identifier() # Xml rep: <identifier> varName </identifier> var = self.symbol_table.find(self.token.value) if self.tokenizer.next().value == '[': self.check_for_value("[") # Xml rep: <symbol> [ </symbol> self.compile_expression("]") # Compile expression. self.check_for_value("]") # Xml rep: <symbol> ] </symbol> self.check_for_value("=") # Xml rep: <symbol> = </symbol> self.compile_expression(";") # Compile expression. self.check_for_value(";") # Xml rep: <symbol> ; </symbol> self.xml_data.append("</letStatement>") # Xml rep: </letStatement> def compile_while_statement(self): """ Compile while statement. ----------------------------------------------------- Rule => 'while' '(' expression ')' '{' statements '}' ----------------------------------------------------- """ self.xml_data.append("<whileStatement>") # Xml rep: <whileStatement> self.check_for_value("while") # Xml rep: <keyword> while </keyword> self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_expression(")") # Compile expression. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> self.check_for_value("{") # Xml rep: <symbol> { </symbol> self.compile_statements() # Compile statements. self.check_for_value("}") # Xml rep: <symbol> } </symbol> self.xml_data.append("</whileStatement>") # Xml rep: </whileStatement> def compile_if_statement(self): """ Compile if statement. ------------------------------------------------------------------------------- Rule => 'if' '(' expression ')' '{' statements '}' ('else' '{' statements '}')? ------------------------------------------------------------------------------- """ self.xml_data.append("<ifStatement>") # Xml rep: <ifStatement> self.check_for_value("if") # Xml rep: <keyword> if </keyword> self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_expression(")") # Compile expression. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> self.check_for_value("{") # Xml rep: <symbol> { </symbol> self.compile_statements() # Compile statements. self.check_for_value("}") # Xml rep: <symbol> } </symbol> if self.tokenizer.next().value == 'else': self.check_for_value('else') # Xml rep: <keyword> else </keyword> self.check_for_value('{') # Xml rep: <symbol> { </symbol> self.compile_statements() # Compile statements. self.check_for_value('}') # Xml rep: <symbol> } </symbol> self.xml_data.append("</ifStatement>") # Xml rep: </ifStatement> def compile_do_statement(self): """ Compile do statement. ------------------------------- Rule => 'do' subroutineCall ';' ------------------------------- """ self.xml_data.append("<doStatement>") # Xml rep: <doStatement> self.check_for_value("do") # Xml rep: <keword> do </keyword> self.compile_subroutine_call() # Compile subroutine call. self.check_for_value(";") # Xml rep: <symbol> ; </symbol> self.xml_data.append("</doStatement>") # Xml rep: </doStatement> def compile_return_statement(self): """ Compile return statement. -------------------------------- Rule => 'return' expression? ';' -------------------------------- """ self.xml_data.append("<returnStatement>") # Xml rep: <returnStatement> self.check_for_value("return") # Xml rep: <keword> return </keyword> if self.tokenizer.next().value != ";": self.compile_expression(';') self.check_for_value(";") # Xml rep: <symbol> ; </symbol> self.xml_data.append("</returnStatement>") # Xml rep: </returnStatement> def compile_subroutine_call(self): """ Compile subroutine call. --------------------------------------------------------------------------------------------------------------- Rule => subroutineName '(' expressionList ')' | (className | varName) '.' subroutineName '(' expressionList ')' --------------------------------------------------------------------------------------------------------------- """ self.xml_data.append("<subroutineCall>") # Xml rep: <subroutineCall> self.check_for_identifier() # Xml rep: <identifier> subroutineName | (className | varName) </identifier> if self.tokenizer.next().value == ".": self.check_for_value(".") # Xml rep: <symbol> . </symbol> self.check_for_identifier() # Xml rep: <identifier> subroutineName </identifier> self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_expression_list() # Compile expression list. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> self.xml_data.append("</subroutineCall>") # Xml rep: </subroutineCall> def compile_expression(self, *end): """ Compile expression. ----------------------- Rule => term (op term)* ----------------------- """ self.xml_data.append("<expression>") # Xml rep:<expression> self.compile_term() # Compile term. while self.tokenizer.next().value not in end: self.check_for_operator() # Xml rep: <symbol> operator </symbol> self.compile_term() # Compile term. self.xml_data.append("</expression>") # Xml rep: </expression> def compile_term(self): """ Compile term. ---------------------------------------------------------------------------------- Rule => integerConstant | stringConstant | keywordConstant | unaryOp term | varName | varName'[' expression ']' | subroutineCall | '(' expression ')' ---------------------------------------------------------------------------------- """ self.xml_data.append("<term>") # Xml rep: <term> if self.tokenizer.next().type in ["integerConstant", "stringConstant"] or self.tokenizer.next().value in KEYWORD_CONSANTS: self.token = self.tokenizer.advance() self.xml_data.append(self.token.__str__()) # Xml rep: <integerConstant | stringConstant | keyword> value </integerConstant | stringConstant | keyword> elif self.tokenizer.next().value in UNARY_OP: self.token = self.tokenizer.advance() self.xml_data.append(self.token.__str__()) # Xml rep: <symbol> unaryOp </symbol> self.compile_term() # Compile term. elif self.tokenizer.next().value == "(": self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_expression(")") # Compile expression. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> else: self.check_for_identifier() # Xml rep: <identifier> varName </identifier> var = self.symbol_table.find(self.token.value) if self.tokenizer.next().value == "[": self.check_for_value("[") # Xml rep: <symbol> [ </symbol> self.compile_expression("]") # Compile expression. self.check_for_value("]") # Xml rep: <symbol> ] </symbol> elif self.tokenizer.next().value == ".": self.check_for_value(".") # Xml rep: <symbol> . </symbol> self.check_for_identifier() # Xml rep: <identifier> subroutineName </identifier> self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_expression_list() # Compile expression list. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> elif self.tokenizer.next().value == "(": self.check_for_value("(") # Xml rep: <symbol> ( </symbol> self.compile_expression_list() # Compile expression list. self.check_for_value(")") # Xml rep: <symbol> ) </symbol> self.xml_data.append("</term>") # Xml rep: </term> def compile_expression_list(self): """ Compile expression list. --------------------------------------- Rule => (expression (',' expression)*)? --------------------------------------- """ self.xml_data.append("<expressionList>") # Xml rep: <expressionList> if self.tokenizer.next().value != ")": self.compile_expression(",", ")") # Compile expression. while self.tokenizer.next().value == ",": self.check_for_value(",") # Xml rep: <symbol> , </symbol> self.compile_expression(",", ")") self.xml_data.append("</expressionList>") # Xml rep: </expressionList> def export_xml(self, file_name): """ Export code structure to file in xml format. """ with open("xml-export/{0}.structure.xml".format(file_name), "w") as xml_file: for line in self.xml_data: xml_file.write(line + "\n")
0.496094
0.123762
from zorro.di import di, has_dependencies, dependency from cairo import SolidPattern import cairo from .base import Widget from tilenol.commands import CommandDispatcher from tilenol.theme import Theme from tilenol.ewmh import get_title @has_dependencies class Title(Widget): dispatcher = dependency(CommandDispatcher, 'commander') theme = dependency(Theme, 'theme') stretched = True def __zorro_di_done__(self): bar = self.theme.bar self.color = bar.text_color_pat self.font = bar.font self.padding = bar.text_padding self.dispatcher.events['window'].listen(self.window_changed) self.oldwin = None def window_changed(self): if self.oldwin is not None: self.oldwin.property_changed.unlisten(self.bar.redraw.emit) win = self.dispatcher.get('window', None) if win is not None: win.property_changed.listen(self.bar.redraw.emit) self.oldwin = win self.bar.redraw.emit() def draw(self, canvas, l, r): win = self.dispatcher.get('window', None) if not win: return r, r canvas.set_source(self.color) self.font.apply(canvas) canvas.move_to(l + self.padding.left, self.height - self.padding.bottom) canvas.show_text(get_title(win) or '') return r, r @has_dependencies class Icon(Widget): dispatcher = dependency(CommandDispatcher, 'commander') theme = dependency(Theme, 'theme') def __zorro_di_done__(self): self.padding = self.theme.bar.box_padding self.dispatcher.events['window'].listen(self.window_changed) self.oldwin = None def window_changed(self): if self.oldwin is not None: self.oldwin.property_changed.unlisten(self.bar.redraw.emit) win = self.dispatcher.get('window', None) if win is not None: win.property_changed.listen(self.bar.redraw.emit) self.oldwin = win self.bar.redraw.emit() def draw(self, canvas, l, r): win = self.dispatcher.get('window', None) if not win or not getattr(win, 'icons', None): return l, r h = self.height - self.padding.bottom - self.padding.top if self.right: x = r - self.padding.right - h else: x = l + self.padding.left win.draw_icon(canvas, x, self.padding.top, h) if self.right: return l, r - h - self.padding.left - self.padding.right else: return l + h + self.padding.left + self.padding.right, r
tilenol/widgets/title.py
from zorro.di import di, has_dependencies, dependency from cairo import SolidPattern import cairo from .base import Widget from tilenol.commands import CommandDispatcher from tilenol.theme import Theme from tilenol.ewmh import get_title @has_dependencies class Title(Widget): dispatcher = dependency(CommandDispatcher, 'commander') theme = dependency(Theme, 'theme') stretched = True def __zorro_di_done__(self): bar = self.theme.bar self.color = bar.text_color_pat self.font = bar.font self.padding = bar.text_padding self.dispatcher.events['window'].listen(self.window_changed) self.oldwin = None def window_changed(self): if self.oldwin is not None: self.oldwin.property_changed.unlisten(self.bar.redraw.emit) win = self.dispatcher.get('window', None) if win is not None: win.property_changed.listen(self.bar.redraw.emit) self.oldwin = win self.bar.redraw.emit() def draw(self, canvas, l, r): win = self.dispatcher.get('window', None) if not win: return r, r canvas.set_source(self.color) self.font.apply(canvas) canvas.move_to(l + self.padding.left, self.height - self.padding.bottom) canvas.show_text(get_title(win) or '') return r, r @has_dependencies class Icon(Widget): dispatcher = dependency(CommandDispatcher, 'commander') theme = dependency(Theme, 'theme') def __zorro_di_done__(self): self.padding = self.theme.bar.box_padding self.dispatcher.events['window'].listen(self.window_changed) self.oldwin = None def window_changed(self): if self.oldwin is not None: self.oldwin.property_changed.unlisten(self.bar.redraw.emit) win = self.dispatcher.get('window', None) if win is not None: win.property_changed.listen(self.bar.redraw.emit) self.oldwin = win self.bar.redraw.emit() def draw(self, canvas, l, r): win = self.dispatcher.get('window', None) if not win or not getattr(win, 'icons', None): return l, r h = self.height - self.padding.bottom - self.padding.top if self.right: x = r - self.padding.right - h else: x = l + self.padding.left win.draw_icon(canvas, x, self.padding.top, h) if self.right: return l, r - h - self.padding.left - self.padding.right else: return l + h + self.padding.left + self.padding.right, r
0.505127
0.065995
import math from pathlib import Path from typing import Tuple import moderngl import moderngl_window as mglw from moderngl_window import geometry from moderngl_window.scene.camera import KeyboardCamera import numpy as np from pyrr import Matrix44 class Object: def __init__(self) -> None: self._scale = np.array((0.0, 0.0, 0.0)) self._rotation = np.array((0.0, 0.0, 0.0)) self._translation = np.array((0.0, 0.0, 0.0)) self._mt = np.eye(4) self._mr = np.eye(4) self._ms = np.eye(4) self.matrix = None # translation def set_translate(self, *xyz: float) -> None: """Set the current translation by overwriting the old one.""" self._translation = xyz self._mt = Matrix44.from_translation(self._translation) def translate(self, *xyz: float) -> None: """Translate by xyz.""" self._translation += xyz self._mt = Matrix44.from_translation(self._translation) # rotation def set_rotation(self, *xyz: float) -> None: """Set the current rotation by overwriting the old one.""" self._rotation = xyz self._mr = Matrix44.from_eulers(self._rotation) def rotate(self, *xyz: float) -> None: """Rotate by xyz.""" self._rotation += xyz self._mr = Matrix44.from_eulers(self._rotation) # scale def set_scale(self, *xyz: float) -> None: """Set the current scale by overwriting the old one.""" self._scale = xyz self._ms = Matrix44.from_scale(self._scale) def scale(self, *xyz: float) -> None: """Scale by xyz.""" self._scale += xyz self._ms = Matrix44.from_scale(self._scale) def render(self, *args) -> None: raise NotImplementedError() @property def matrix(self) -> Matrix44: return (self._mt * self._mr * self._ms).astype("f4") @matrix.setter def matrix(self, value: Matrix44) -> None: pass class Cube(Object): def __init__( self, pos: Tuple[float, float, float] = (0, 0, 0), size: Tuple[float, float, float] = (1, 1, 1), ) -> None: super().__init__() self._cube = geometry.cube(size=size, center=pos) def render(self, program) -> None: self._cube.render(program) class CubeViz(mglw.WindowConfig): """Base class with built in 3D camera support.""" title = "Cube" resource_dir = (Path(__file__) / "../resources").absolute() aspect_ratio = None window_size = 1280, 720 resizable = True samples = 16 def __init__(self, **kwargs): super().__init__(**kwargs) # self.wnd.mouse_exclusivity = True self.camera = KeyboardCamera(self.wnd.keys, aspect_ratio=self.wnd.aspect_ratio) self.camera_enabled = False self.render_program = self.load_program("cube_shader.glsl") self.render_program["projection"].write(self.camera.projection.tobytes()) self.render_program["m_camera"].write(self.camera.matrix.astype("f4").tobytes()) self.cube = Cube(size=(0.5, 0.5, 0.5)) def render(self, time: float, frame_time: float) -> None: self.ctx.clear(51 / 255, 51 / 255, 51 / 255) self.ctx.enable_only(moderngl.DEPTH_TEST | moderngl.CULL_FACE) s = math.sin(time * 2) / 2 + 1.5 self.cube.set_rotation(time, time / 2, time / 3) self.cube.set_translate(s * 4 - 6, 0, -3.0) self.render_program["model"].write(self.cube.matrix) self.render_program["m_camera"].write(self.camera.matrix.astype("f4")) self.cube.render(self.render_program) def resize(self, width: int, height: int) -> None: self.camera.projection.update(aspect_ratio=self.wnd.aspect_ratio) if __name__ == "__main__": CubeViz.run()
visualization/CubeViz/cube_viz.py
import math from pathlib import Path from typing import Tuple import moderngl import moderngl_window as mglw from moderngl_window import geometry from moderngl_window.scene.camera import KeyboardCamera import numpy as np from pyrr import Matrix44 class Object: def __init__(self) -> None: self._scale = np.array((0.0, 0.0, 0.0)) self._rotation = np.array((0.0, 0.0, 0.0)) self._translation = np.array((0.0, 0.0, 0.0)) self._mt = np.eye(4) self._mr = np.eye(4) self._ms = np.eye(4) self.matrix = None # translation def set_translate(self, *xyz: float) -> None: """Set the current translation by overwriting the old one.""" self._translation = xyz self._mt = Matrix44.from_translation(self._translation) def translate(self, *xyz: float) -> None: """Translate by xyz.""" self._translation += xyz self._mt = Matrix44.from_translation(self._translation) # rotation def set_rotation(self, *xyz: float) -> None: """Set the current rotation by overwriting the old one.""" self._rotation = xyz self._mr = Matrix44.from_eulers(self._rotation) def rotate(self, *xyz: float) -> None: """Rotate by xyz.""" self._rotation += xyz self._mr = Matrix44.from_eulers(self._rotation) # scale def set_scale(self, *xyz: float) -> None: """Set the current scale by overwriting the old one.""" self._scale = xyz self._ms = Matrix44.from_scale(self._scale) def scale(self, *xyz: float) -> None: """Scale by xyz.""" self._scale += xyz self._ms = Matrix44.from_scale(self._scale) def render(self, *args) -> None: raise NotImplementedError() @property def matrix(self) -> Matrix44: return (self._mt * self._mr * self._ms).astype("f4") @matrix.setter def matrix(self, value: Matrix44) -> None: pass class Cube(Object): def __init__( self, pos: Tuple[float, float, float] = (0, 0, 0), size: Tuple[float, float, float] = (1, 1, 1), ) -> None: super().__init__() self._cube = geometry.cube(size=size, center=pos) def render(self, program) -> None: self._cube.render(program) class CubeViz(mglw.WindowConfig): """Base class with built in 3D camera support.""" title = "Cube" resource_dir = (Path(__file__) / "../resources").absolute() aspect_ratio = None window_size = 1280, 720 resizable = True samples = 16 def __init__(self, **kwargs): super().__init__(**kwargs) # self.wnd.mouse_exclusivity = True self.camera = KeyboardCamera(self.wnd.keys, aspect_ratio=self.wnd.aspect_ratio) self.camera_enabled = False self.render_program = self.load_program("cube_shader.glsl") self.render_program["projection"].write(self.camera.projection.tobytes()) self.render_program["m_camera"].write(self.camera.matrix.astype("f4").tobytes()) self.cube = Cube(size=(0.5, 0.5, 0.5)) def render(self, time: float, frame_time: float) -> None: self.ctx.clear(51 / 255, 51 / 255, 51 / 255) self.ctx.enable_only(moderngl.DEPTH_TEST | moderngl.CULL_FACE) s = math.sin(time * 2) / 2 + 1.5 self.cube.set_rotation(time, time / 2, time / 3) self.cube.set_translate(s * 4 - 6, 0, -3.0) self.render_program["model"].write(self.cube.matrix) self.render_program["m_camera"].write(self.camera.matrix.astype("f4")) self.cube.render(self.render_program) def resize(self, width: int, height: int) -> None: self.camera.projection.update(aspect_ratio=self.wnd.aspect_ratio) if __name__ == "__main__": CubeViz.run()
0.900732
0.401043
from os import urandom from typing import Callable from typing import Collection from typing import Dict from typing import List from typing import Optional from typing import Text from delorean import Delorean from django.contrib.auth import get_user_model from django.test import Client from rest_framework import status from applications.onboarding.models import AuthProfile from applications.profile.models import Profile User = get_user_model() class UserTestMixin: def create_user( self, placeholder: Optional[str] = None, user_kw: Optional[Dict] = None, verified=False, ) -> User: placeholder = placeholder or urandom(4).hex() form_data = { "username": f"{placeholder}", "email": f"<EMAIL>", "password": <PASSWORD>, } user_kw = (user_kw or {}).copy() user_kw.update(form_data) user = User.objects.create_user(**user_kw) user.save() if verified: self.create_auth_profile(user) self.create_profile(user) return user @staticmethod def create_auth_profile(user: User) -> AuthProfile: auth = AuthProfile( user=user, verification_code=user.username, verified_at=Delorean().datetime, ) auth.save() return auth @staticmethod def create_profile(user) -> Profile: profile = Profile(user=user, name=f"name_{user.username}") profile.save() return profile def create_auth_token(self, user, client: Optional[Client] = None) -> str: cli = client or self.client credentials = {"username": user.username, "password": user.username} resp = cli.post("/api/obtain_auth_token/", credentials) self.assertEqual(status.HTTP_200_OK, resp.status_code) payload = resp.json() self.assertEqual(1, len(payload)) self.assertIsInstance(payload, dict) self.assertIn("token", payload) token = payload["token"] self.assertTrue(token) return token class TemplateResponseTestMixin: def validate_response( self, *, url: str, client: Optional = None, method: Optional[str] = "get", form_data: Optional[Dict] = None, expected_status_code: Optional[int] = 200, expected_view: Optional[type] = None, expected_view_name: Optional[str] = None, expected_template: Optional[str] = None, content_filters: Optional[Collection[Callable[[bytes], bool]]] = None, expected_redirect_chain: Optional[List] = None, ): cli = client or self.client meth = getattr(cli, method) meth_args = [] if form_data: meth_args.append(form_data) resp = meth(url, *meth_args, follow=True) self.assertEqual(expected_status_code, resp.status_code) if expected_redirect_chain is not None: self.assertEqual(expected_redirect_chain, resp.redirect_chain) good_resolver_codes = { 200, } if expected_status_code in good_resolver_codes: self.assertEqual(expected_view_name, resp.resolver_match.view_name) self.assertEqual( expected_view.as_view().__name__, resp.resolver_match.func.__name__, ) self.assertIn(expected_template, resp.template_name) for content_filter in content_filters or []: self.assertTrue(content_filter(resp.content)) class ApiTestMixin: def validate_response( self, url: str, *, client: Optional = None, method: Optional[str] = "get", headers: Optional[Dict[Text, Text]] = None, data: Optional = None, expected_status_code: Optional[int] = 200, expected_response_payload: Optional = None, ): cli = client or self.client meth = getattr(cli, method) kwargs = (headers or {}).copy() if data is not None: kwargs["data"] = data resp = meth(url, content_type="application/json", **kwargs) self.assertEqual(expected_status_code, resp.status_code) if expected_response_payload is not None: payload = resp.json() self.assertEqual(expected_response_payload, payload)
src/project/utils/xtests.py
from os import urandom from typing import Callable from typing import Collection from typing import Dict from typing import List from typing import Optional from typing import Text from delorean import Delorean from django.contrib.auth import get_user_model from django.test import Client from rest_framework import status from applications.onboarding.models import AuthProfile from applications.profile.models import Profile User = get_user_model() class UserTestMixin: def create_user( self, placeholder: Optional[str] = None, user_kw: Optional[Dict] = None, verified=False, ) -> User: placeholder = placeholder or urandom(4).hex() form_data = { "username": f"{placeholder}", "email": f"<EMAIL>", "password": <PASSWORD>, } user_kw = (user_kw or {}).copy() user_kw.update(form_data) user = User.objects.create_user(**user_kw) user.save() if verified: self.create_auth_profile(user) self.create_profile(user) return user @staticmethod def create_auth_profile(user: User) -> AuthProfile: auth = AuthProfile( user=user, verification_code=user.username, verified_at=Delorean().datetime, ) auth.save() return auth @staticmethod def create_profile(user) -> Profile: profile = Profile(user=user, name=f"name_{user.username}") profile.save() return profile def create_auth_token(self, user, client: Optional[Client] = None) -> str: cli = client or self.client credentials = {"username": user.username, "password": user.username} resp = cli.post("/api/obtain_auth_token/", credentials) self.assertEqual(status.HTTP_200_OK, resp.status_code) payload = resp.json() self.assertEqual(1, len(payload)) self.assertIsInstance(payload, dict) self.assertIn("token", payload) token = payload["token"] self.assertTrue(token) return token class TemplateResponseTestMixin: def validate_response( self, *, url: str, client: Optional = None, method: Optional[str] = "get", form_data: Optional[Dict] = None, expected_status_code: Optional[int] = 200, expected_view: Optional[type] = None, expected_view_name: Optional[str] = None, expected_template: Optional[str] = None, content_filters: Optional[Collection[Callable[[bytes], bool]]] = None, expected_redirect_chain: Optional[List] = None, ): cli = client or self.client meth = getattr(cli, method) meth_args = [] if form_data: meth_args.append(form_data) resp = meth(url, *meth_args, follow=True) self.assertEqual(expected_status_code, resp.status_code) if expected_redirect_chain is not None: self.assertEqual(expected_redirect_chain, resp.redirect_chain) good_resolver_codes = { 200, } if expected_status_code in good_resolver_codes: self.assertEqual(expected_view_name, resp.resolver_match.view_name) self.assertEqual( expected_view.as_view().__name__, resp.resolver_match.func.__name__, ) self.assertIn(expected_template, resp.template_name) for content_filter in content_filters or []: self.assertTrue(content_filter(resp.content)) class ApiTestMixin: def validate_response( self, url: str, *, client: Optional = None, method: Optional[str] = "get", headers: Optional[Dict[Text, Text]] = None, data: Optional = None, expected_status_code: Optional[int] = 200, expected_response_payload: Optional = None, ): cli = client or self.client meth = getattr(cli, method) kwargs = (headers or {}).copy() if data is not None: kwargs["data"] = data resp = meth(url, content_type="application/json", **kwargs) self.assertEqual(expected_status_code, resp.status_code) if expected_response_payload is not None: payload = resp.json() self.assertEqual(expected_response_payload, payload)
0.799521
0.288575
import sys import re import itertools class Moon: def __init__(self, position, velocity): self._position = position self._velocity = velocity def get_position(self): return self._position def pull_towards(self, position): self._velocity = tuple(map(lambda x: self._new_axis(x, position), range(3))) def _new_axis(self, i, position): if self._position[i] < position[i]: return self._velocity[i] + 1 elif self._position[i] > position[i]: return self._velocity[i] - 1 return self._velocity[i] def __repr__(self): return f'pos={self._position}, vel={self._velocity}' def apply_velocity(self): self._position = tuple(map(sum, zip(self._position, self._velocity))) def total_energy(self): return self.potential_energy() * self.kinetic_energy() def potential_energy(self): return sum(map(abs, self._position)) def kinetic_energy(self): return sum(map(abs, self._velocity)) class Simulation: def __init__(self, moons): self._moons = moons def run(self, steps): for i in range(steps): self._step() def _step(self): self._apply_gravity() self._apply_velocity() def _apply_gravity(self): for pair in itertools.combinations(self._moons, 2): a_pos = pair[0].get_position() b_pos = pair[1].get_position() pair[0].pull_towards(b_pos) pair[1].pull_towards(a_pos) def _apply_velocity(self): for moon in self._moons: moon.apply_velocity() def run(input): moons = parse_moons(input) simulation = create_simulation(moons) simulation.run(1000) return calc_total_energy(moons) def parse_moons(input): return list(map(parse_moon, input.splitlines())) def parse_moon(line): position = parse_vector3(line) return Moon(position, (0, 0, 0)) def parse_vector3(string): pattern = re.compile(r'<x=(.*), ?y=(.*), ?z=(.*)>') match = pattern.match(string) return (int(match.group(1)), int(match.group(2)), int(match.group(3))) def create_simulation(moons): return Simulation(moons) def calc_total_energy(moons): return sum(map(lambda x: x.total_energy(), moons)) if __name__ == '__main__': print(run(sys.stdin.read()))
python/2019_12_1.py
import sys import re import itertools class Moon: def __init__(self, position, velocity): self._position = position self._velocity = velocity def get_position(self): return self._position def pull_towards(self, position): self._velocity = tuple(map(lambda x: self._new_axis(x, position), range(3))) def _new_axis(self, i, position): if self._position[i] < position[i]: return self._velocity[i] + 1 elif self._position[i] > position[i]: return self._velocity[i] - 1 return self._velocity[i] def __repr__(self): return f'pos={self._position}, vel={self._velocity}' def apply_velocity(self): self._position = tuple(map(sum, zip(self._position, self._velocity))) def total_energy(self): return self.potential_energy() * self.kinetic_energy() def potential_energy(self): return sum(map(abs, self._position)) def kinetic_energy(self): return sum(map(abs, self._velocity)) class Simulation: def __init__(self, moons): self._moons = moons def run(self, steps): for i in range(steps): self._step() def _step(self): self._apply_gravity() self._apply_velocity() def _apply_gravity(self): for pair in itertools.combinations(self._moons, 2): a_pos = pair[0].get_position() b_pos = pair[1].get_position() pair[0].pull_towards(b_pos) pair[1].pull_towards(a_pos) def _apply_velocity(self): for moon in self._moons: moon.apply_velocity() def run(input): moons = parse_moons(input) simulation = create_simulation(moons) simulation.run(1000) return calc_total_energy(moons) def parse_moons(input): return list(map(parse_moon, input.splitlines())) def parse_moon(line): position = parse_vector3(line) return Moon(position, (0, 0, 0)) def parse_vector3(string): pattern = re.compile(r'<x=(.*), ?y=(.*), ?z=(.*)>') match = pattern.match(string) return (int(match.group(1)), int(match.group(2)), int(match.group(3))) def create_simulation(moons): return Simulation(moons) def calc_total_energy(moons): return sum(map(lambda x: x.total_energy(), moons)) if __name__ == '__main__': print(run(sys.stdin.read()))
0.389779
0.295211
import argparse import plotly.graph_objects as go import pandas as pd import os # Import processed data from vaccine_dataprep_Swedentots import ( first_two_timeseries, third_timseries, fourth_timseries, Swedish_population, ) aparser = argparse.ArgumentParser(description="Generate text insert json") aparser.add_argument("--output-dir", nargs="?", default="vaccine_plots", help="Output directory where the files will be saved") args = aparser.parse_args() # calculate percentages based on population size # first and second doses first_two_timeseries["Vacc_perc_population"] = ( first_two_timeseries["Antal vaccinerade"] / Swedish_population ) * 100 # Third dose third_timseries["Vacc_perc_population"] = ( third_timseries["Antal vaccinerade"] / Swedish_population ) * 100 # Fourth dose fourth_timseries["Vacc_perc_population"] = ( fourth_timseries["Antal vaccinerade"] / Swedish_population ) * 100 # separate the first and second doses least_one_dose = first_two_timeseries[(first_two_timeseries["Vaccinationsstatus"] == "Minst 1 dos")] least_two_doses = first_two_timeseries[(first_two_timeseries["Vaccinationsstatus"] == "Minst 2 doser")] ## Figure based on percentages calculated using population size trace1 = go.Bar( x=least_one_dose["date"], y=least_one_dose["Vacc_perc_population"], name="At Least One Dose", marker_color="rgb(5,48,97)", marker_line_color="black", hovertemplate="Number of Doses: One Dose" + "<br>Date: %{x}" + "<br>Percent Vaccinated: %{y:.2f}%<extra></extra>", ) trace2 = go.Bar( x=least_two_doses["date"], y=least_two_doses["Vacc_perc_population"], name="At Least Two Doses", marker_color="rgb(178,24,43)", marker_line_color="black", hovertemplate="Number of Doses: Two Doses" + "<br>Date: %{x}" + "<br>Percent Vaccinated: %{y:.2f}%<extra></extra>", ) trace3 = go.Bar( x=third_timseries["date"], y=third_timseries["Vacc_perc_population"], name="At Least Three Doses", marker_color="rgb(255, 234, 0)", marker_line_color="black", hovertemplate="Number of Doses: Three Doses" + "<br>Date: %{x}" + "<br>Percent Vaccinated: %{y:.2f}%<extra></extra>", ) trace4 = go.Bar( x=fourth_timseries["date"], y=fourth_timseries["Vacc_perc_population"], name="At Least Four Doses", marker_color="rgb(146,197,222)", marker_line_color="black", hovertemplate="Number of Doses: Four Doses" + "<br>Date: %{x}" + "<br>Percent Vaccinated: %{y:.2f}%<extra></extra>", ) # figure layout fig_pop = go.Figure(data=[trace1, trace2, trace3, trace4]) fig_pop.update_layout( plot_bgcolor="white", font=dict(size=14), margin=dict(l=0, r=50, t=0, b=0), showlegend=True, legend=dict( title=" ", # orientation="h", # yanchor="bottom", y=1.15, # xanchor="right", x=0.05, font=dict(size=14), ), ) # modify x-axis fig_pop.update_xaxes( title="<b>Date</b>", showgrid=True, linecolor="black", # set start point of x-axis tick0=least_one_dose["date"].iloc[0], ) # modify y-axis fig_pop.update_yaxes( title="<b>Percentage Vaccinated</b>", showgrid=True, gridcolor="lightgrey", linecolor="black", range=[0, 100], ) # fig_pop.show() if not os.path.isdir(args.output_dir): os.mkdir(args.output_dir) # make figure for web fig_pop.write_json(os.path.join(args.output_dir, "vaccine_timeseries_pop_barchart.json")) # fig_pop.write_image("Plots/vaccine_timeseries_pop_barchart.png")
Vaccine_page/vaccine_timeseries_barchart.py
import argparse import plotly.graph_objects as go import pandas as pd import os # Import processed data from vaccine_dataprep_Swedentots import ( first_two_timeseries, third_timseries, fourth_timseries, Swedish_population, ) aparser = argparse.ArgumentParser(description="Generate text insert json") aparser.add_argument("--output-dir", nargs="?", default="vaccine_plots", help="Output directory where the files will be saved") args = aparser.parse_args() # calculate percentages based on population size # first and second doses first_two_timeseries["Vacc_perc_population"] = ( first_two_timeseries["Antal vaccinerade"] / Swedish_population ) * 100 # Third dose third_timseries["Vacc_perc_population"] = ( third_timseries["Antal vaccinerade"] / Swedish_population ) * 100 # Fourth dose fourth_timseries["Vacc_perc_population"] = ( fourth_timseries["Antal vaccinerade"] / Swedish_population ) * 100 # separate the first and second doses least_one_dose = first_two_timeseries[(first_two_timeseries["Vaccinationsstatus"] == "Minst 1 dos")] least_two_doses = first_two_timeseries[(first_two_timeseries["Vaccinationsstatus"] == "Minst 2 doser")] ## Figure based on percentages calculated using population size trace1 = go.Bar( x=least_one_dose["date"], y=least_one_dose["Vacc_perc_population"], name="At Least One Dose", marker_color="rgb(5,48,97)", marker_line_color="black", hovertemplate="Number of Doses: One Dose" + "<br>Date: %{x}" + "<br>Percent Vaccinated: %{y:.2f}%<extra></extra>", ) trace2 = go.Bar( x=least_two_doses["date"], y=least_two_doses["Vacc_perc_population"], name="At Least Two Doses", marker_color="rgb(178,24,43)", marker_line_color="black", hovertemplate="Number of Doses: Two Doses" + "<br>Date: %{x}" + "<br>Percent Vaccinated: %{y:.2f}%<extra></extra>", ) trace3 = go.Bar( x=third_timseries["date"], y=third_timseries["Vacc_perc_population"], name="At Least Three Doses", marker_color="rgb(255, 234, 0)", marker_line_color="black", hovertemplate="Number of Doses: Three Doses" + "<br>Date: %{x}" + "<br>Percent Vaccinated: %{y:.2f}%<extra></extra>", ) trace4 = go.Bar( x=fourth_timseries["date"], y=fourth_timseries["Vacc_perc_population"], name="At Least Four Doses", marker_color="rgb(146,197,222)", marker_line_color="black", hovertemplate="Number of Doses: Four Doses" + "<br>Date: %{x}" + "<br>Percent Vaccinated: %{y:.2f}%<extra></extra>", ) # figure layout fig_pop = go.Figure(data=[trace1, trace2, trace3, trace4]) fig_pop.update_layout( plot_bgcolor="white", font=dict(size=14), margin=dict(l=0, r=50, t=0, b=0), showlegend=True, legend=dict( title=" ", # orientation="h", # yanchor="bottom", y=1.15, # xanchor="right", x=0.05, font=dict(size=14), ), ) # modify x-axis fig_pop.update_xaxes( title="<b>Date</b>", showgrid=True, linecolor="black", # set start point of x-axis tick0=least_one_dose["date"].iloc[0], ) # modify y-axis fig_pop.update_yaxes( title="<b>Percentage Vaccinated</b>", showgrid=True, gridcolor="lightgrey", linecolor="black", range=[0, 100], ) # fig_pop.show() if not os.path.isdir(args.output_dir): os.mkdir(args.output_dir) # make figure for web fig_pop.write_json(os.path.join(args.output_dir, "vaccine_timeseries_pop_barchart.json")) # fig_pop.write_image("Plots/vaccine_timeseries_pop_barchart.png")
0.617282
0.419172
import sys from drone.actions.emr_launcher import launch_emr_task from drone.actions.ssh_launcher import launch_ssh_task from drone.job_runner.dependency_manager import dependencies_are_met from drone.job_runner.job_progress_checker import check_running_job_progress from drone.metadata.metadata import get_job_info, job_status, set_ready, set_running, set_failed task_launcher = {'ssh': launch_ssh_task, 'emr': launch_emr_task} def process(job_config, settings): for job_id, schedule_time, execution_time, status, runs, uid in get_job_info(job_config.get('id'), db_name=settings.metadata): if status == job_status.get('failed'): if (int(job_config.get('retry')) if job_config.get('retry') else 0) > int(runs): settings.logger.debug( '%s runs %s. set retries %s.' % (job_config.get('id'), runs, job_config.get('retry'))) if dependencies_are_met(job_config, schedule_time, settings): set_ready(job_config.get('id'), schedule_time, db_name=settings.metadata) settings.logger.info('Job "%s" "%s" set as ready' % (job_config.get('id'), schedule_time)) run(job_config, schedule_time, settings) continue else: continue else: continue elif status == job_status.get('running'): check_running_job_progress(job_config, schedule_time, uid, settings) continue elif status == job_status.get('ready'): run(job_config, schedule_time, settings) elif status == job_status.get('succeeded'): continue elif status == job_status.get('not_ready'): if dependencies_are_met(job_config, schedule_time, settings): set_ready(job_config.get('id'), schedule_time, db_name=settings.metadata) settings.logger.info('Job "%s" "%s" set as ready' % (job_config.get('id'), schedule_time)) run(job_config, schedule_time, settings) else: continue else: settings.logger.error('Unknown job status "%s"' % status) sys.exit(1) def run(job_config, schedule_time, settings): settings.logger.info('Starting job "%s" "%s"' % (job_config.get('id'), schedule_time)) job_type = job_config.get('type') try: assert job_type in settings.supported_job_types except: settings.logger.warning( 'Unsupported job type %s. Valid types are %s' % (job_type, str(settings.supported_job_types))) task_lauched_successfully, uid = task_launcher.get(job_type)(job_config, schedule_time, settings) if task_lauched_successfully: set_running(job_config.get('id'), schedule_time, uid, db_name=settings.metadata) settings.logger.info('Started job "%s" "%s"' % (job_config.get('id'), schedule_time)) else: set_failed(job_config.get('id'), schedule_time, db_name=settings.metadata) settings.logger.warning('Failed to start job "%s" "%s"' % (job_config.get('id'), schedule_time))
drone/job_runner/job_runner.py
import sys from drone.actions.emr_launcher import launch_emr_task from drone.actions.ssh_launcher import launch_ssh_task from drone.job_runner.dependency_manager import dependencies_are_met from drone.job_runner.job_progress_checker import check_running_job_progress from drone.metadata.metadata import get_job_info, job_status, set_ready, set_running, set_failed task_launcher = {'ssh': launch_ssh_task, 'emr': launch_emr_task} def process(job_config, settings): for job_id, schedule_time, execution_time, status, runs, uid in get_job_info(job_config.get('id'), db_name=settings.metadata): if status == job_status.get('failed'): if (int(job_config.get('retry')) if job_config.get('retry') else 0) > int(runs): settings.logger.debug( '%s runs %s. set retries %s.' % (job_config.get('id'), runs, job_config.get('retry'))) if dependencies_are_met(job_config, schedule_time, settings): set_ready(job_config.get('id'), schedule_time, db_name=settings.metadata) settings.logger.info('Job "%s" "%s" set as ready' % (job_config.get('id'), schedule_time)) run(job_config, schedule_time, settings) continue else: continue else: continue elif status == job_status.get('running'): check_running_job_progress(job_config, schedule_time, uid, settings) continue elif status == job_status.get('ready'): run(job_config, schedule_time, settings) elif status == job_status.get('succeeded'): continue elif status == job_status.get('not_ready'): if dependencies_are_met(job_config, schedule_time, settings): set_ready(job_config.get('id'), schedule_time, db_name=settings.metadata) settings.logger.info('Job "%s" "%s" set as ready' % (job_config.get('id'), schedule_time)) run(job_config, schedule_time, settings) else: continue else: settings.logger.error('Unknown job status "%s"' % status) sys.exit(1) def run(job_config, schedule_time, settings): settings.logger.info('Starting job "%s" "%s"' % (job_config.get('id'), schedule_time)) job_type = job_config.get('type') try: assert job_type in settings.supported_job_types except: settings.logger.warning( 'Unsupported job type %s. Valid types are %s' % (job_type, str(settings.supported_job_types))) task_lauched_successfully, uid = task_launcher.get(job_type)(job_config, schedule_time, settings) if task_lauched_successfully: set_running(job_config.get('id'), schedule_time, uid, db_name=settings.metadata) settings.logger.info('Started job "%s" "%s"' % (job_config.get('id'), schedule_time)) else: set_failed(job_config.get('id'), schedule_time, db_name=settings.metadata) settings.logger.warning('Failed to start job "%s" "%s"' % (job_config.get('id'), schedule_time))
0.101673
0.057599
import io import unittest from contextlib import redirect_stdout from unittest.mock import patch class TestQ(unittest.TestCase): @patch('builtins.input', side_effect=[ '42 42', '__________________________________________', '__________________________________________', '__________________________________________', '__________________________________________', '__________________________________________', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '__________________________________________', '__________________________________________', '__________________________________________', '__________________________________________', '__________________________________________', ]) def test_case_0(self, input_mock=None): text_trap = io.StringIO() with redirect_stdout(text_trap): import solution self.assertEqual(text_trap.getvalue(), '1\n') if __name__ == '__main__': unittest.main()
hackerearth/Algorithms/Where is Checkerboard/test.py
import io import unittest from contextlib import redirect_stdout from unittest.mock import patch class TestQ(unittest.TestCase): @patch('builtins.input', side_effect=[ '42 42', '__________________________________________', '__________________________________________', '__________________________________________', '__________________________________________', '__________________________________________', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '______#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_____', '_____#_#_#_#_#_#_#_#_#_#_#_#_#_#_#_#______', '__________________________________________', '__________________________________________', '__________________________________________', '__________________________________________', '__________________________________________', ]) def test_case_0(self, input_mock=None): text_trap = io.StringIO() with redirect_stdout(text_trap): import solution self.assertEqual(text_trap.getvalue(), '1\n') if __name__ == '__main__': unittest.main()
0.228845
0.078501
import pykazoo.restrequest import pykazoo.phonenumbers from unittest import TestCase from unittest.mock import create_autospec mock_rest_request = create_autospec(pykazoo.restrequest.RestRequest) class TestPhoneNumbers(TestCase): def setUp(self): self.mock_rest_request = mock_rest_request self.phone_numbers = pykazoo.phonenumbers.PhoneNumbers( self.mock_rest_request) self.account_id = '<KEY>' self.phone_number = '+15555555555' self.data = {'test': 'data'} self.params = {'test': 'params'} def test_get_phone_numbers_request_call(self): self.phone_numbers.get_phone_numbers(self.account_id, self.params) self.mock_rest_request.get.assert_called_with('accounts/' + self.account_id + '/phone_numbers', self.params) def test_get_phone_numbers_returns_dict(self): self.mock_rest_request.get.return_value = self.data return_data = self.phone_numbers.get_phone_numbers(self.account_id, self.params) assert return_data is self.data def test_get_phone_number_request_call(self): self.phone_numbers.get_phone_number(self.account_id, self.phone_number, self.params) self.mock_rest_request.get.assert_called_with('accounts/' + self.account_id + '/phone_numbers/' + self.phone_number, self.params) def test_get_phone_number_returns_dict(self): self.mock_rest_request.get.return_value = self.data return_data = self.phone_numbers.get_phone_number(self.account_id, self.phone_number, self.params) assert return_data is self.data def test_create_phone_numbers_request_call(self): self.phone_numbers.create_phone_number(self.account_id, self.phone_number, self.data) self.mock_rest_request.put.assert_called_with('accounts/' + self.account_id + '/phone_numbers/' + str(self.phone_number), self.data) def test_create_phone_numbers_returns_dict(self): self.mock_rest_request.put.return_value = self.data return_data = self.phone_numbers.create_phone_number(self.account_id, self.phone_number, self.data) assert return_data is self.data def test_update_phone_numbers_request_call(self): self.phone_numbers.update_phone_number(self.account_id, self.phone_number, self.data) self.mock_rest_request.post.assert_called_with('accounts/' + self.account_id + '/phone_numbers/' + str(self.phone_number), self.data) def test_update_phone_numbers_returns_dict(self): self.mock_rest_request.post.return_value = self.data return_data = self.phone_numbers.update_phone_number(self.account_id, self.phone_number, self.data) assert return_data is self.data def test_delete_phone_numbers_request_call(self): self.phone_numbers.delete_phone_number(self.account_id, self.phone_number) self.mock_rest_request.delete.assert_called_with( 'accounts/' + self.account_id + '/phone_numbers/' + str(self.phone_number)) def test_delete_phone_numbers_returns_dict(self): self.mock_rest_request.delete.return_value = self.data return_data = self.phone_numbers.delete_phone_number(self.account_id, self.phone_number) assert return_data is self.data
tests/test_phonenumbers.py
import pykazoo.restrequest import pykazoo.phonenumbers from unittest import TestCase from unittest.mock import create_autospec mock_rest_request = create_autospec(pykazoo.restrequest.RestRequest) class TestPhoneNumbers(TestCase): def setUp(self): self.mock_rest_request = mock_rest_request self.phone_numbers = pykazoo.phonenumbers.PhoneNumbers( self.mock_rest_request) self.account_id = '<KEY>' self.phone_number = '+15555555555' self.data = {'test': 'data'} self.params = {'test': 'params'} def test_get_phone_numbers_request_call(self): self.phone_numbers.get_phone_numbers(self.account_id, self.params) self.mock_rest_request.get.assert_called_with('accounts/' + self.account_id + '/phone_numbers', self.params) def test_get_phone_numbers_returns_dict(self): self.mock_rest_request.get.return_value = self.data return_data = self.phone_numbers.get_phone_numbers(self.account_id, self.params) assert return_data is self.data def test_get_phone_number_request_call(self): self.phone_numbers.get_phone_number(self.account_id, self.phone_number, self.params) self.mock_rest_request.get.assert_called_with('accounts/' + self.account_id + '/phone_numbers/' + self.phone_number, self.params) def test_get_phone_number_returns_dict(self): self.mock_rest_request.get.return_value = self.data return_data = self.phone_numbers.get_phone_number(self.account_id, self.phone_number, self.params) assert return_data is self.data def test_create_phone_numbers_request_call(self): self.phone_numbers.create_phone_number(self.account_id, self.phone_number, self.data) self.mock_rest_request.put.assert_called_with('accounts/' + self.account_id + '/phone_numbers/' + str(self.phone_number), self.data) def test_create_phone_numbers_returns_dict(self): self.mock_rest_request.put.return_value = self.data return_data = self.phone_numbers.create_phone_number(self.account_id, self.phone_number, self.data) assert return_data is self.data def test_update_phone_numbers_request_call(self): self.phone_numbers.update_phone_number(self.account_id, self.phone_number, self.data) self.mock_rest_request.post.assert_called_with('accounts/' + self.account_id + '/phone_numbers/' + str(self.phone_number), self.data) def test_update_phone_numbers_returns_dict(self): self.mock_rest_request.post.return_value = self.data return_data = self.phone_numbers.update_phone_number(self.account_id, self.phone_number, self.data) assert return_data is self.data def test_delete_phone_numbers_request_call(self): self.phone_numbers.delete_phone_number(self.account_id, self.phone_number) self.mock_rest_request.delete.assert_called_with( 'accounts/' + self.account_id + '/phone_numbers/' + str(self.phone_number)) def test_delete_phone_numbers_returns_dict(self): self.mock_rest_request.delete.return_value = self.data return_data = self.phone_numbers.delete_phone_number(self.account_id, self.phone_number) assert return_data is self.data
0.57069
0.28049
from typing import TYPE_CHECKING, Optional from nats.js import api from nats.js.errors import KeyDeletedError from dataclasses import dataclass import base64 if TYPE_CHECKING: from nats.js import JetStreamContext KV_OP = "KV-Operation" KV_DEL = "DEL" KV_PURGE = "PURGE" MSG_ROLLUP_SUBJECT = "sub" class KeyValue: """ KeyValue uses the JetStream KeyValue functionality. .. note:: This functionality is EXPERIMENTAL and may be changed in later releases. :: import asyncio import nats async def main(): nc = await nats.connect() js = nc.jetstream() # Create a KV kv = await js.create_key_value(bucket='MY_KV') # Set and retrieve a value await kv.put('hello', b'world') entry = await kv.get('hello') print(f'KeyValue.Entry: key={entry.key}, value={entry.value}') # KeyValue.Entry: key=hello, value=world await nc.close() if __name__ == '__main__': asyncio.run(main()) """ @dataclass class Entry: """ An entry from a KeyValue store in JetStream. """ bucket: str key: str value: Optional[bytes] revision: Optional[int] @dataclass(frozen=True) class BucketStatus: """ BucketStatus is the status of a KeyValue bucket. """ stream_info: api.StreamInfo bucket: str @property def values(self) -> int: """ values returns the number of stored messages in the stream. """ return self.stream_info.state.messages @property def history(self) -> int: """ history returns the max msgs per subject. """ return self.stream_info.config.max_msgs_per_subject @property def ttl(self) -> Optional[float]: """ ttl returns the max age in seconds. """ if self.stream_info.config.max_age is None: return None return self.stream_info.config.max_age def __init__( self, name: str, stream: str, pre: str, js: "JetStreamContext", ) -> None: self._name = name self._stream = stream self._pre = pre self._js = js async def get(self, key: str) -> Entry: """ get returns the latest value for the key. """ msg = await self._js.get_last_msg(self._stream, f"{self._pre}{key}") data = None if msg.data: data = base64.b64decode(msg.data) entry = KeyValue.Entry( bucket=self._name, key=key, value=data, revision=msg.seq, ) # Check headers to see if deleted or purged. if msg.headers: op = msg.headers.get(KV_OP, None) if op == KV_DEL or op == KV_PURGE: raise KeyDeletedError(entry, op) return entry async def put(self, key: str, value: bytes) -> int: """ put will place the new value for the key into the store and return the revision number. """ pa = await self._js.publish(f"{self._pre}{key}", value) return pa.seq async def update(self, key: str, value: bytes, last: int) -> int: """ update will update the value iff the latest revision matches. """ hdrs = {} hdrs[api.Header.EXPECTED_LAST_SUBJECT_SEQUENCE] = str(last) pa = await self._js.publish(f"{self._pre}{key}", value, headers=hdrs) return pa.seq async def delete(self, key: str) -> bool: """ delete will place a delete marker and remove all previous revisions. """ hdrs = {} hdrs[KV_OP] = KV_DEL await self._js.publish(f"{self._pre}{key}", headers=hdrs) return True async def purge(self, key: str) -> bool: """ purge will remove the key and all revisions. """ hdrs = {} hdrs[KV_OP] = KV_PURGE hdrs[api.Header.ROLLUP] = MSG_ROLLUP_SUBJECT await self._js.publish(f"{self._pre}{key}", headers=hdrs) return True async def status(self) -> BucketStatus: """ status retrieves the status and configuration of a bucket. """ info = await self._js.stream_info(self._stream) return KeyValue.BucketStatus(stream_info=info, bucket=self._name)
nats/js/kv.py
from typing import TYPE_CHECKING, Optional from nats.js import api from nats.js.errors import KeyDeletedError from dataclasses import dataclass import base64 if TYPE_CHECKING: from nats.js import JetStreamContext KV_OP = "KV-Operation" KV_DEL = "DEL" KV_PURGE = "PURGE" MSG_ROLLUP_SUBJECT = "sub" class KeyValue: """ KeyValue uses the JetStream KeyValue functionality. .. note:: This functionality is EXPERIMENTAL and may be changed in later releases. :: import asyncio import nats async def main(): nc = await nats.connect() js = nc.jetstream() # Create a KV kv = await js.create_key_value(bucket='MY_KV') # Set and retrieve a value await kv.put('hello', b'world') entry = await kv.get('hello') print(f'KeyValue.Entry: key={entry.key}, value={entry.value}') # KeyValue.Entry: key=hello, value=world await nc.close() if __name__ == '__main__': asyncio.run(main()) """ @dataclass class Entry: """ An entry from a KeyValue store in JetStream. """ bucket: str key: str value: Optional[bytes] revision: Optional[int] @dataclass(frozen=True) class BucketStatus: """ BucketStatus is the status of a KeyValue bucket. """ stream_info: api.StreamInfo bucket: str @property def values(self) -> int: """ values returns the number of stored messages in the stream. """ return self.stream_info.state.messages @property def history(self) -> int: """ history returns the max msgs per subject. """ return self.stream_info.config.max_msgs_per_subject @property def ttl(self) -> Optional[float]: """ ttl returns the max age in seconds. """ if self.stream_info.config.max_age is None: return None return self.stream_info.config.max_age def __init__( self, name: str, stream: str, pre: str, js: "JetStreamContext", ) -> None: self._name = name self._stream = stream self._pre = pre self._js = js async def get(self, key: str) -> Entry: """ get returns the latest value for the key. """ msg = await self._js.get_last_msg(self._stream, f"{self._pre}{key}") data = None if msg.data: data = base64.b64decode(msg.data) entry = KeyValue.Entry( bucket=self._name, key=key, value=data, revision=msg.seq, ) # Check headers to see if deleted or purged. if msg.headers: op = msg.headers.get(KV_OP, None) if op == KV_DEL or op == KV_PURGE: raise KeyDeletedError(entry, op) return entry async def put(self, key: str, value: bytes) -> int: """ put will place the new value for the key into the store and return the revision number. """ pa = await self._js.publish(f"{self._pre}{key}", value) return pa.seq async def update(self, key: str, value: bytes, last: int) -> int: """ update will update the value iff the latest revision matches. """ hdrs = {} hdrs[api.Header.EXPECTED_LAST_SUBJECT_SEQUENCE] = str(last) pa = await self._js.publish(f"{self._pre}{key}", value, headers=hdrs) return pa.seq async def delete(self, key: str) -> bool: """ delete will place a delete marker and remove all previous revisions. """ hdrs = {} hdrs[KV_OP] = KV_DEL await self._js.publish(f"{self._pre}{key}", headers=hdrs) return True async def purge(self, key: str) -> bool: """ purge will remove the key and all revisions. """ hdrs = {} hdrs[KV_OP] = KV_PURGE hdrs[api.Header.ROLLUP] = MSG_ROLLUP_SUBJECT await self._js.publish(f"{self._pre}{key}", headers=hdrs) return True async def status(self) -> BucketStatus: """ status retrieves the status and configuration of a bucket. """ info = await self._js.stream_info(self._stream) return KeyValue.BucketStatus(stream_info=info, bucket=self._name)
0.905465
0.207255
import os import argparse import pandas as pd import torch import torch.nn as nn import torch.optim as optim from train_test_api.train_api import train from train_test_api.test_api import eval_training from conf import settings from utils import get_network, get_training_dataloader, get_valid_dataloader, get_test_dataloader, \ get_parameter_number, save_best_result import sys import csv rootPath = os.path.abspath(os.path.dirname(__file__)) sys.path.append(rootPath) if __name__ == '__main__': parser = argparse.ArgumentParser() args = parser.parse_args() args.with_cuda = True cuda_condition = torch.cuda.is_available() and args.with_cuda args.net = "msdensenet" args.device = torch.device("cuda:0" if cuda_condition else "cpu") args.b = 128 args.warm = 0 args.lr = 0.002 dataset_path = os.path.join("Dataset", "cell_dataset") dataset_list = sorted(os.listdir(dataset_path)) result_csv_dir = os.path.join(rootPath, "cell_datasets_result", "result_csv") if not os.path.exists(result_csv_dir): os.makedirs(result_csv_dir) data_index = 1 for dataset_ in dataset_list: print("This is the ", data_index, " dataset",dataset_) data_index += 1 net = get_network(args) # print("NET:") # print(net) patience = settings.PATIENCE # network parameters print(get_parameter_number(net)) # data preprocessing: dataset = os.path.join(dataset_path, dataset_) dna_training_loader = get_training_dataloader(path=dataset, num_workers=0, batch_size=args.b, shuffle=True) dna_valid_loader = get_valid_dataloader(path=dataset, num_workers=0, batch_size=args.b, shuffle=False) dna_test_loader = get_test_dataloader(path=dataset, num_workers=0, batch_size=args.b, shuffle=False) loss_function = nn.CrossEntropyLoss() softmax_output = nn.Softmax(dim=1) optimizer = optim.SGD(params=net.parameters(), lr=args.lr, momentum=0.9, weight_decay=5e-4) train_scheduler = optim.lr_scheduler.MultiStepLR(optimizer, milestones=settings.MILESTONES, gamma=0.8) recent_folder = "" checkpoint_path = os.path.join(settings.CHECKPOINT_PATH, args.net, settings.TIME_NOW, dataset_) # use tensorboard if not os.path.exists(settings.LOG_DIR): os.mkdir(settings.LOG_DIR) # record the epoch df_path = os.path.join(settings.LOG_DIR, args.net, settings.TIME_NOW, dataset_) if not os.path.exists(df_path): os.makedirs(df_path) df_file = os.path.join(df_path, "df_log.pickle") if not os.path.isfile(df_file): df_ = pd.DataFrame(columns=["epoch", "lr", "train_loss", "train_acc", "valid_loss", "valid_acc", "valid_auc", "test_loss", "test_acc", "test_auc"]) df_.to_pickle(df_file) print("log DataFrame created!") # create model_weights folder to save model if not os.path.exists(checkpoint_path): os.makedirs(checkpoint_path) checkpoint_path = os.path.join(checkpoint_path, '{net}-{epoch}-{type}.pth') best_auc = 0.0 best_testAUC = 0.0 best_testAcc = 0.0 best_testPrec = 0.0 best_testRecall = 0.0 best_testF1 = 0.0 best_epoch = 0 for epoch in range(1, settings.EPOCH + 1): output_interval = settings.OUTPUT_INTERVAL log_dic = train(net, dna_training_loader, optimizer, loss_function, epoch, args, output_interval) if epoch > args.warm: train_scheduler.step() epoch_, auc_valid, cur_result, pred_result_test, acc, prec, rec, f1 = eval_training(net, dna_valid_loader, dna_test_loader, loss_function, softmax_output, args, epoch=epoch, df_file=df_file, log_dic=log_dic, train_after=True) # start to save best performance model after learning rate decay to 0.01 if best_auc < auc_valid: weights_path = checkpoint_path.format(net=args.net, epoch=epoch, type='best') print('saving weights file to {}'.format(weights_path)) torch.save(net.state_dict(), weights_path) best_auc = auc_valid patience = settings.PATIENCE # save best result save_best_result(df_path, pred_result_test) best_testAUC = cur_result best_testAcc = acc best_testPrec = prec best_testRecall = rec best_testF1 = f1 best_epoch = epoch_ continue if not epoch % settings.SAVE_EPOCH: weights_path = checkpoint_path.format(net=args.net, epoch=epoch, type='regular') print('saving weights file to {}'.format(weights_path)) torch.save(net.state_dict(), weights_path) patience -= 1 if patience == 0: print("DatasetName:", dataset_,",The best epoch:",best_epoch , ", The best AUC:", best_testAUC) print("The end!") break """记录bestAUC""" bestAUC_csv = os.path.join(result_csv_dir, "CellDataset_BestResult.csv") if data_index == 2: with open(bestAUC_csv, 'w+', newline="") as f: csv_write = csv.writer(f) csv_head = ["dataset","epoch", "AUC", "ACC", "Precision", "Recall", "F1score"] csv_write.writerow(csv_head) with open(bestAUC_csv, 'a+', newline="") as f: csv_write = csv.writer(f) data_row = [dataset_, best_epoch, best_testAUC, best_testAcc, best_testPrec, best_testRecall, best_testF1] csv_write.writerow(data_row)
train_on_cell_datasets.py
import os import argparse import pandas as pd import torch import torch.nn as nn import torch.optim as optim from train_test_api.train_api import train from train_test_api.test_api import eval_training from conf import settings from utils import get_network, get_training_dataloader, get_valid_dataloader, get_test_dataloader, \ get_parameter_number, save_best_result import sys import csv rootPath = os.path.abspath(os.path.dirname(__file__)) sys.path.append(rootPath) if __name__ == '__main__': parser = argparse.ArgumentParser() args = parser.parse_args() args.with_cuda = True cuda_condition = torch.cuda.is_available() and args.with_cuda args.net = "msdensenet" args.device = torch.device("cuda:0" if cuda_condition else "cpu") args.b = 128 args.warm = 0 args.lr = 0.002 dataset_path = os.path.join("Dataset", "cell_dataset") dataset_list = sorted(os.listdir(dataset_path)) result_csv_dir = os.path.join(rootPath, "cell_datasets_result", "result_csv") if not os.path.exists(result_csv_dir): os.makedirs(result_csv_dir) data_index = 1 for dataset_ in dataset_list: print("This is the ", data_index, " dataset",dataset_) data_index += 1 net = get_network(args) # print("NET:") # print(net) patience = settings.PATIENCE # network parameters print(get_parameter_number(net)) # data preprocessing: dataset = os.path.join(dataset_path, dataset_) dna_training_loader = get_training_dataloader(path=dataset, num_workers=0, batch_size=args.b, shuffle=True) dna_valid_loader = get_valid_dataloader(path=dataset, num_workers=0, batch_size=args.b, shuffle=False) dna_test_loader = get_test_dataloader(path=dataset, num_workers=0, batch_size=args.b, shuffle=False) loss_function = nn.CrossEntropyLoss() softmax_output = nn.Softmax(dim=1) optimizer = optim.SGD(params=net.parameters(), lr=args.lr, momentum=0.9, weight_decay=5e-4) train_scheduler = optim.lr_scheduler.MultiStepLR(optimizer, milestones=settings.MILESTONES, gamma=0.8) recent_folder = "" checkpoint_path = os.path.join(settings.CHECKPOINT_PATH, args.net, settings.TIME_NOW, dataset_) # use tensorboard if not os.path.exists(settings.LOG_DIR): os.mkdir(settings.LOG_DIR) # record the epoch df_path = os.path.join(settings.LOG_DIR, args.net, settings.TIME_NOW, dataset_) if not os.path.exists(df_path): os.makedirs(df_path) df_file = os.path.join(df_path, "df_log.pickle") if not os.path.isfile(df_file): df_ = pd.DataFrame(columns=["epoch", "lr", "train_loss", "train_acc", "valid_loss", "valid_acc", "valid_auc", "test_loss", "test_acc", "test_auc"]) df_.to_pickle(df_file) print("log DataFrame created!") # create model_weights folder to save model if not os.path.exists(checkpoint_path): os.makedirs(checkpoint_path) checkpoint_path = os.path.join(checkpoint_path, '{net}-{epoch}-{type}.pth') best_auc = 0.0 best_testAUC = 0.0 best_testAcc = 0.0 best_testPrec = 0.0 best_testRecall = 0.0 best_testF1 = 0.0 best_epoch = 0 for epoch in range(1, settings.EPOCH + 1): output_interval = settings.OUTPUT_INTERVAL log_dic = train(net, dna_training_loader, optimizer, loss_function, epoch, args, output_interval) if epoch > args.warm: train_scheduler.step() epoch_, auc_valid, cur_result, pred_result_test, acc, prec, rec, f1 = eval_training(net, dna_valid_loader, dna_test_loader, loss_function, softmax_output, args, epoch=epoch, df_file=df_file, log_dic=log_dic, train_after=True) # start to save best performance model after learning rate decay to 0.01 if best_auc < auc_valid: weights_path = checkpoint_path.format(net=args.net, epoch=epoch, type='best') print('saving weights file to {}'.format(weights_path)) torch.save(net.state_dict(), weights_path) best_auc = auc_valid patience = settings.PATIENCE # save best result save_best_result(df_path, pred_result_test) best_testAUC = cur_result best_testAcc = acc best_testPrec = prec best_testRecall = rec best_testF1 = f1 best_epoch = epoch_ continue if not epoch % settings.SAVE_EPOCH: weights_path = checkpoint_path.format(net=args.net, epoch=epoch, type='regular') print('saving weights file to {}'.format(weights_path)) torch.save(net.state_dict(), weights_path) patience -= 1 if patience == 0: print("DatasetName:", dataset_,",The best epoch:",best_epoch , ", The best AUC:", best_testAUC) print("The end!") break """记录bestAUC""" bestAUC_csv = os.path.join(result_csv_dir, "CellDataset_BestResult.csv") if data_index == 2: with open(bestAUC_csv, 'w+', newline="") as f: csv_write = csv.writer(f) csv_head = ["dataset","epoch", "AUC", "ACC", "Precision", "Recall", "F1score"] csv_write.writerow(csv_head) with open(bestAUC_csv, 'a+', newline="") as f: csv_write = csv.writer(f) data_row = [dataset_, best_epoch, best_testAUC, best_testAcc, best_testPrec, best_testRecall, best_testF1] csv_write.writerow(data_row)
0.388618
0.202384
import attr from bokeh.models import VArea from bokeh.models.sources import DataSource from typing import List, Tuple, Type, cast from jira_analysis.cycle_time.cycle_time import CycleTime from jira_analysis.cycle_time.stats import ( rolling_average_cycle_time, standard_deviations, ) from jira_analysis.chart.base import IChart, Plot from .base import BaseCycleTimeLinePlot from .utils import sort_cycle_times, unsplit @attr.s(frozen=True) class CycleTimeDeviationPlot(Plot): cycle_times: List[CycleTime] = attr.ib() data_source: Type[DataSource] = attr.ib() def draw(self, chart: IChart) -> None: sorted_cycle_times = sort_cycle_times(self.cycle_times) _, completions, cycle_times = unsplit(sorted_cycle_times) upper_deviation, lower_deviation = _get_standard_deviations(sorted_cycle_times) data = self.to_data_source() upper_plot = _DeviationLinePlot( cycle_times=sorted_cycle_times, data_source=self.data_source, deviation_bound="Upper", deviations=upper_deviation, ) lower_plot = _DeviationLinePlot( cycle_times=sorted_cycle_times, data_source=self.data_source, deviation_bound="Lower", deviations=lower_deviation, ) deviation_glyph = VArea( x="x", y1="y1", y2="y2", fill_color="green", fill_alpha=0.3 ) chart.glyph(data, deviation_glyph) upper_plot.draw(chart) lower_plot.draw(chart) def to_data_source(self) -> DataSource: sorted_cycle_times = sort_cycle_times(self.cycle_times) _, completions, cycle_times = unsplit(sorted_cycle_times) upper_deviation, lower_deviation = _get_standard_deviations(sorted_cycle_times) return self.data_source( {"x": completions, "y1": upper_deviation, "y2": lower_deviation} ) def _get_standard_deviations( cycle_times: List[CycleTime], ) -> Tuple[Tuple[float, ...], Tuple[float, ...]]: cycle_time_values = [c.cycle_time for c in cycle_times] rolling_cycle_times = rolling_average_cycle_time(cycle_time_values) zipped_deviations = zip( rolling_cycle_times, standard_deviations(cycle_time_values), ) return cast( Tuple[Tuple[float, ...], Tuple[float, ...]], tuple(zip(*((ct + sd, ct - sd) for ct, sd in zipped_deviations))), ) @attr.s(frozen=True) class _DeviationLinePlot(BaseCycleTimeLinePlot): cycle_times: List[CycleTime] = attr.ib() data_source: Type[DataSource] = attr.ib() deviation_bound: str = attr.ib() deviations: Tuple[float, ...] = attr.ib() @property def alpha(self) -> float: return 0.3 @property def color(self) -> str: return "green" @property def label(self) -> str: return f"{self.deviation_bound} bound" @property def width(self) -> int: return 1 def to_data_source(self) -> DataSource: sorted_cycle_times = sort_cycle_times(self.cycle_times) _, completions, cycle_times = unsplit(sorted_cycle_times) return self.data_source( { "x": completions, "y": self.deviations, "label": [self.label for _ in completions], } )
jira_analysis/cycle_time/chart/cycle_time/deviation.py
import attr from bokeh.models import VArea from bokeh.models.sources import DataSource from typing import List, Tuple, Type, cast from jira_analysis.cycle_time.cycle_time import CycleTime from jira_analysis.cycle_time.stats import ( rolling_average_cycle_time, standard_deviations, ) from jira_analysis.chart.base import IChart, Plot from .base import BaseCycleTimeLinePlot from .utils import sort_cycle_times, unsplit @attr.s(frozen=True) class CycleTimeDeviationPlot(Plot): cycle_times: List[CycleTime] = attr.ib() data_source: Type[DataSource] = attr.ib() def draw(self, chart: IChart) -> None: sorted_cycle_times = sort_cycle_times(self.cycle_times) _, completions, cycle_times = unsplit(sorted_cycle_times) upper_deviation, lower_deviation = _get_standard_deviations(sorted_cycle_times) data = self.to_data_source() upper_plot = _DeviationLinePlot( cycle_times=sorted_cycle_times, data_source=self.data_source, deviation_bound="Upper", deviations=upper_deviation, ) lower_plot = _DeviationLinePlot( cycle_times=sorted_cycle_times, data_source=self.data_source, deviation_bound="Lower", deviations=lower_deviation, ) deviation_glyph = VArea( x="x", y1="y1", y2="y2", fill_color="green", fill_alpha=0.3 ) chart.glyph(data, deviation_glyph) upper_plot.draw(chart) lower_plot.draw(chart) def to_data_source(self) -> DataSource: sorted_cycle_times = sort_cycle_times(self.cycle_times) _, completions, cycle_times = unsplit(sorted_cycle_times) upper_deviation, lower_deviation = _get_standard_deviations(sorted_cycle_times) return self.data_source( {"x": completions, "y1": upper_deviation, "y2": lower_deviation} ) def _get_standard_deviations( cycle_times: List[CycleTime], ) -> Tuple[Tuple[float, ...], Tuple[float, ...]]: cycle_time_values = [c.cycle_time for c in cycle_times] rolling_cycle_times = rolling_average_cycle_time(cycle_time_values) zipped_deviations = zip( rolling_cycle_times, standard_deviations(cycle_time_values), ) return cast( Tuple[Tuple[float, ...], Tuple[float, ...]], tuple(zip(*((ct + sd, ct - sd) for ct, sd in zipped_deviations))), ) @attr.s(frozen=True) class _DeviationLinePlot(BaseCycleTimeLinePlot): cycle_times: List[CycleTime] = attr.ib() data_source: Type[DataSource] = attr.ib() deviation_bound: str = attr.ib() deviations: Tuple[float, ...] = attr.ib() @property def alpha(self) -> float: return 0.3 @property def color(self) -> str: return "green" @property def label(self) -> str: return f"{self.deviation_bound} bound" @property def width(self) -> int: return 1 def to_data_source(self) -> DataSource: sorted_cycle_times = sort_cycle_times(self.cycle_times) _, completions, cycle_times = unsplit(sorted_cycle_times) return self.data_source( { "x": completions, "y": self.deviations, "label": [self.label for _ in completions], } )
0.841142
0.394901
import pprint import re import os pp = pprint.PrettyPrinter(indent=4) #------------------------------------------------------------------ #Defining the function #------------------------------------------------------------------ def best_pos( sequence, primer): nr_comp = 0 primer.upper() sequence.upper() best_score = 0 position = [] for i in range(0, len(sequence) - len(primer)): # -1 here to avoid going over length of i local_score = 0 for j in range(0, len(primer)): nr_comp += 1 if sequence[i + j] == primer[j]: #Anchors I and then loops J over I local_score += 1 # Append local score #print best_score if (local_score > best_score): position = [] position.append( str(i) ) best_score = local_score elif ( local_score == best_score): #Appends best local score to global best score. pass position.append(str(i)) print "Comparisons : " + str(nr_comp) print "score:" + str(best_score) + ",".join(position) return (best_score, position) # ----------- MAIN LOOP -------------- def best_pos_bounds( sequence, primer): nr_comp = 0 primer.upper() sequence.upper() best_score = 0 position = [] for i in range(0, len(sequence) - len(primer)): # -1 here to avoid going over length of i local_score = 0 for j in range(0, len(primer)): if ( best_score > len(primer) - j + local_score): continue # print "%d > %d - %d + %d" % (best_score, len(primer), j, local_score) nr_comp += 1 if sequence[i + j] == primer[j]: #Anchors I and then loops J over I local_score += 1 # Append local score #print best_score if (local_score > best_score): position = [] position.append( str(i) ) best_score = local_score elif ( local_score == best_score): #Appends best local score to global best score. pass position.append(str(i)) print "Comparisons : " + str(nr_comp) print "Score: " + str(best_score) + ", - ".join(position) return (best_score, position) def best_pos_by_index_seq(sequence, primer, seed_length): nr_comp = 0 primer.upper() sequence.upper() best_score = 0 position = [] seeds = dict() # build the index for i in range(0, len(sequence) - seed_length): seed = sequence[ i: i + seed_length] if ( seed not in seeds): seeds[ seed ] = [] seeds[seed].append( i ) primer_seed = primer[0:seed_length] pp.pprint(seeds[ primer_seed]) for pos in (seeds[ primer_seed]): local_score = 0 for j in range(0, len(primer)): # if ( best_score > len(primer) - j + local_score): # continue nr_comp += 1 if sequence[pos + j] == primer[j]: #Anchors I and then loops J over I local_score += 1 # Append local score #print best_score if (local_score > best_score): position = [] position.append( str(i) ) best_score = local_score elif ( local_score == best_score): #Appends best local score to global best score. pass position.append(str(i)) print "Comparisons : " + str(nr_comp) return # ----------- MAIN LOOP -------------- best_pos("AGACCAGATCTGAGCTTGGGAGCTCTTGGCATAACTAGGGAACCACAGTTTGAAACGT", "CTTGGCATAA") best_pos_bounds("AGACCAGATCTGAGCTTGGGAGCTCTTGGCATAACTAGGGAACCACAGTTTGAAACGT", "CTTGGCATAA") best_pos_bounds("AGACCAGACTTGGCATAATCTGAGCTTGGGAGCTCTAGGGAACCACAGTTTGAAACGT", "CTTGGCATAA") best_pos_by_index_seq("AGACCAGACTTGGCATAATCTGAGCTTGGGAGCTCTAGGGAACCACAGTTTGAAACGT", "CTTGGCATAA", 3) best_pos_by_index_seq("AGACCAGACTTGGCATAATCTGAGCTTGGGAGCTCTAGGGAACCACAGTTTGAAACGT", "CTTGGCATAA", 5)
primer_seq_counts.py
import pprint import re import os pp = pprint.PrettyPrinter(indent=4) #------------------------------------------------------------------ #Defining the function #------------------------------------------------------------------ def best_pos( sequence, primer): nr_comp = 0 primer.upper() sequence.upper() best_score = 0 position = [] for i in range(0, len(sequence) - len(primer)): # -1 here to avoid going over length of i local_score = 0 for j in range(0, len(primer)): nr_comp += 1 if sequence[i + j] == primer[j]: #Anchors I and then loops J over I local_score += 1 # Append local score #print best_score if (local_score > best_score): position = [] position.append( str(i) ) best_score = local_score elif ( local_score == best_score): #Appends best local score to global best score. pass position.append(str(i)) print "Comparisons : " + str(nr_comp) print "score:" + str(best_score) + ",".join(position) return (best_score, position) # ----------- MAIN LOOP -------------- def best_pos_bounds( sequence, primer): nr_comp = 0 primer.upper() sequence.upper() best_score = 0 position = [] for i in range(0, len(sequence) - len(primer)): # -1 here to avoid going over length of i local_score = 0 for j in range(0, len(primer)): if ( best_score > len(primer) - j + local_score): continue # print "%d > %d - %d + %d" % (best_score, len(primer), j, local_score) nr_comp += 1 if sequence[i + j] == primer[j]: #Anchors I and then loops J over I local_score += 1 # Append local score #print best_score if (local_score > best_score): position = [] position.append( str(i) ) best_score = local_score elif ( local_score == best_score): #Appends best local score to global best score. pass position.append(str(i)) print "Comparisons : " + str(nr_comp) print "Score: " + str(best_score) + ", - ".join(position) return (best_score, position) def best_pos_by_index_seq(sequence, primer, seed_length): nr_comp = 0 primer.upper() sequence.upper() best_score = 0 position = [] seeds = dict() # build the index for i in range(0, len(sequence) - seed_length): seed = sequence[ i: i + seed_length] if ( seed not in seeds): seeds[ seed ] = [] seeds[seed].append( i ) primer_seed = primer[0:seed_length] pp.pprint(seeds[ primer_seed]) for pos in (seeds[ primer_seed]): local_score = 0 for j in range(0, len(primer)): # if ( best_score > len(primer) - j + local_score): # continue nr_comp += 1 if sequence[pos + j] == primer[j]: #Anchors I and then loops J over I local_score += 1 # Append local score #print best_score if (local_score > best_score): position = [] position.append( str(i) ) best_score = local_score elif ( local_score == best_score): #Appends best local score to global best score. pass position.append(str(i)) print "Comparisons : " + str(nr_comp) return # ----------- MAIN LOOP -------------- best_pos("AGACCAGATCTGAGCTTGGGAGCTCTTGGCATAACTAGGGAACCACAGTTTGAAACGT", "CTTGGCATAA") best_pos_bounds("AGACCAGATCTGAGCTTGGGAGCTCTTGGCATAACTAGGGAACCACAGTTTGAAACGT", "CTTGGCATAA") best_pos_bounds("AGACCAGACTTGGCATAATCTGAGCTTGGGAGCTCTAGGGAACCACAGTTTGAAACGT", "CTTGGCATAA") best_pos_by_index_seq("AGACCAGACTTGGCATAATCTGAGCTTGGGAGCTCTAGGGAACCACAGTTTGAAACGT", "CTTGGCATAA", 3) best_pos_by_index_seq("AGACCAGACTTGGCATAATCTGAGCTTGGGAGCTCTAGGGAACCACAGTTTGAAACGT", "CTTGGCATAA", 5)
0.056809
0.257048
import socketio import json import aiohttp from aiohttp import web import traceback from appdaemon.appdaemon import AppDaemon # socketio handler class DashStream(socketio.AsyncNamespace): def __init__(self, ADStream, path, AD): super().__init__(path) self.AD = AD self.ADStream = ADStream async def on_connect(self, sid, data): await self.ADStream.on_connect() async def on_up(self, sid, data): await self.ADStream.on_msg(data) class ADStream: def __init__(self, ad: AppDaemon, app, transport, on_connect, on_msg): self.AD = ad self.logger = ad.logging.get_child("_stream") self.access = ad.logging.get_access() self.app = app self.transport = transport self.on_connect = on_connect self.on_msg = on_msg if self.transport == "ws": self.app['websockets'] = {} self.app.router.add_get('/stream', self.wshandler) else: self.dash_stream = DashStream(self, '/stream', self.AD) self.sio = socketio.AsyncServer(async_mode='aiohttp') self.sio.attach(self.app) self.sio.register_namespace(self.dash_stream) async def send_update(self, data): try: jdata = json.dumps(data) if self.transport == "ws": if len(self.app['websockets']) > 0: self.logger.debug("Sending data: %s", jdata) for ws in self.app['websockets']: if "dashboard" in self.app['websockets'][ws]: await ws.send_str(jdata) else: await self.dash_stream.emit('down', jdata) except TypeError as e: self.logger.debug('-' * 60) self.logger.warning("Unexpected error in JSON conversion") self.logger.debug("Data is: %s", data) self.logger.debug("Error is: %s",e) self.logger.debug('-' * 60) except: self.logger.debug('-' * 60) self.logger.debug("Client disconnected unexpectedly") self.access.info("Client disconnected unexpectedly") self.logger.debug('-' * 60) self.logger.debug(traceback.format_exc()) self.logger.debug('-' * 60) #@securedata async def wshandler(self, request): ws = web.WebSocketResponse() await ws.prepare(request) request.app['websockets'][ws] = {} # noinspection PyBroadException try: while True: msg = await ws.receive() if msg.type == aiohttp.WSMsgType.TEXT: await self.on_msg(msg.data) request.app['websockets'][ws]["dashboard"] = msg.data elif msg.type == aiohttp.WSMsgType.ERROR: self.access.info("WebSocket connection closed with exception {}", ws.exception()) except: self.logger.debug('-' * 60) self.logger.debug("Unexpected client disconnection") self.access.info("Unexpected client disconnection") self.logger.debug('-' * 60) self.logger.debug(traceback.format_exc()) self.logger.debug('-' * 60) finally: request.app['websockets'].pop(ws, None) return ws # Websockets Handler async def on_shutdown(self, application): for ws in application['websockets']: try: print(ws.closed) await ws.close() print("done") except: self.logger.debug('-' * 60) self.logger.warning("Unexpected error in on_shutdown()") self.logger.debug('-' * 60) self.logger.debug(traceback.format_exc()) self.logger.debug('-' * 60)
appdaemon/stream.py
import socketio import json import aiohttp from aiohttp import web import traceback from appdaemon.appdaemon import AppDaemon # socketio handler class DashStream(socketio.AsyncNamespace): def __init__(self, ADStream, path, AD): super().__init__(path) self.AD = AD self.ADStream = ADStream async def on_connect(self, sid, data): await self.ADStream.on_connect() async def on_up(self, sid, data): await self.ADStream.on_msg(data) class ADStream: def __init__(self, ad: AppDaemon, app, transport, on_connect, on_msg): self.AD = ad self.logger = ad.logging.get_child("_stream") self.access = ad.logging.get_access() self.app = app self.transport = transport self.on_connect = on_connect self.on_msg = on_msg if self.transport == "ws": self.app['websockets'] = {} self.app.router.add_get('/stream', self.wshandler) else: self.dash_stream = DashStream(self, '/stream', self.AD) self.sio = socketio.AsyncServer(async_mode='aiohttp') self.sio.attach(self.app) self.sio.register_namespace(self.dash_stream) async def send_update(self, data): try: jdata = json.dumps(data) if self.transport == "ws": if len(self.app['websockets']) > 0: self.logger.debug("Sending data: %s", jdata) for ws in self.app['websockets']: if "dashboard" in self.app['websockets'][ws]: await ws.send_str(jdata) else: await self.dash_stream.emit('down', jdata) except TypeError as e: self.logger.debug('-' * 60) self.logger.warning("Unexpected error in JSON conversion") self.logger.debug("Data is: %s", data) self.logger.debug("Error is: %s",e) self.logger.debug('-' * 60) except: self.logger.debug('-' * 60) self.logger.debug("Client disconnected unexpectedly") self.access.info("Client disconnected unexpectedly") self.logger.debug('-' * 60) self.logger.debug(traceback.format_exc()) self.logger.debug('-' * 60) #@securedata async def wshandler(self, request): ws = web.WebSocketResponse() await ws.prepare(request) request.app['websockets'][ws] = {} # noinspection PyBroadException try: while True: msg = await ws.receive() if msg.type == aiohttp.WSMsgType.TEXT: await self.on_msg(msg.data) request.app['websockets'][ws]["dashboard"] = msg.data elif msg.type == aiohttp.WSMsgType.ERROR: self.access.info("WebSocket connection closed with exception {}", ws.exception()) except: self.logger.debug('-' * 60) self.logger.debug("Unexpected client disconnection") self.access.info("Unexpected client disconnection") self.logger.debug('-' * 60) self.logger.debug(traceback.format_exc()) self.logger.debug('-' * 60) finally: request.app['websockets'].pop(ws, None) return ws # Websockets Handler async def on_shutdown(self, application): for ws in application['websockets']: try: print(ws.closed) await ws.close() print("done") except: self.logger.debug('-' * 60) self.logger.warning("Unexpected error in on_shutdown()") self.logger.debug('-' * 60) self.logger.debug(traceback.format_exc()) self.logger.debug('-' * 60)
0.344003
0.069164
import pandas as pd data = { 'apples': [3,2,5,7], 'oranges': [1,8,4,0] } # initializing dataframe count = pd.DataFrame(data) print (count) ''' apples oranges 0 3 1 1 2 8 2 5 4 3 7 0 ''' # updating index count = pd.DataFrame(data, index=['Mon','Tue','Wed','Thu']) print (count) ''' apples oranges Mon 3 1 Tue 2 8 Wed 5 4 Thu 7 0 ''' # locate data by index name (day) print (count.loc['Wed']) ''' apples 5 oranges 4 Name: Wed, dtype: int64 ''' # get data of multiple rows by index name print (count.loc[['Mon', 'Wed']]) ''' apples oranges Mon 3 1 Wed 5 4 ''' # get 1st 2 rows print (count[0:2]) ''' apples oranges Mon 3 1 Tue 2 8 ''' # get 3rd and 4th rows print (count[2:4]) ''' apples oranges Wed 5 4 Thu 7 0 ''' # locate row data by its index id print (count.iloc[1]) ''' apples 2 oranges 8 Name: Tue, dtype: int64 ''' # print matrix length rows x cols print (count.shape) ''' (4, 2) ''' print (count.loc['Mon'].shape) ''' (2,) ''' print (count.iloc[0].shape) ''' (2,) ''' print (count.iloc[0:2].shape) ''' (2, 2) ''' print (count.loc[['Mon','Thu']].shape) ''' (2, 2) ''' # print column with heading 'apples' print (count['apples']) ''' Mon 3 Tue 2 Wed 5 Thu 7 Name: apples, dtype: int64 ''' # Grab data by slicing a colum print (count['oranges'].loc['Tue']) ''' 8 ''' print (count['oranges'].iloc[1]) ''' 8 ''' # Add a new dataframe to an existing dataframe data_a = { 'apples': [1,2,3], 'oranges': [4,5,6] } count_a = pd.DataFrame(data_a, index=['Fri','Sat','Sun']) print (count_a) ''' apples oranges Fri 1 4 Sat 2 5 Sun 3 6 ''' new_count = count.append(count_a) print(new_count) ''' apples oranges Mon 3 1 Tue 2 8 Wed 5 4 Thu 7 0 Fri 1 4 Sat 2 5 Sun 3 6 ''' # Adding an new column to exiting dataframe with unqual data in columns data_a = { 'apples': [1,2,3], 'oranges': [4,5,6], 'kiwi': [7,8,9] } count_a = pd.DataFrame(data_a, index=['Fri','Sat','Sun']) print(count_a) ''' apples oranges kiwi Fri 1 4 7 Sat 2 5 8 Sun 3 6 9 ''' new_count = count.append(count_a) print (new_count) ''' apples kiwi oranges Mon 3 NaN 1 Tue 2 NaN 8 Wed 5 NaN 4 Thu 7 NaN 0 Fri 1 7.0 4 Sat 2 8.0 5 Sun 3 9.0 6 '''
pandas/pandasBasics.py
import pandas as pd data = { 'apples': [3,2,5,7], 'oranges': [1,8,4,0] } # initializing dataframe count = pd.DataFrame(data) print (count) ''' apples oranges 0 3 1 1 2 8 2 5 4 3 7 0 ''' # updating index count = pd.DataFrame(data, index=['Mon','Tue','Wed','Thu']) print (count) ''' apples oranges Mon 3 1 Tue 2 8 Wed 5 4 Thu 7 0 ''' # locate data by index name (day) print (count.loc['Wed']) ''' apples 5 oranges 4 Name: Wed, dtype: int64 ''' # get data of multiple rows by index name print (count.loc[['Mon', 'Wed']]) ''' apples oranges Mon 3 1 Wed 5 4 ''' # get 1st 2 rows print (count[0:2]) ''' apples oranges Mon 3 1 Tue 2 8 ''' # get 3rd and 4th rows print (count[2:4]) ''' apples oranges Wed 5 4 Thu 7 0 ''' # locate row data by its index id print (count.iloc[1]) ''' apples 2 oranges 8 Name: Tue, dtype: int64 ''' # print matrix length rows x cols print (count.shape) ''' (4, 2) ''' print (count.loc['Mon'].shape) ''' (2,) ''' print (count.iloc[0].shape) ''' (2,) ''' print (count.iloc[0:2].shape) ''' (2, 2) ''' print (count.loc[['Mon','Thu']].shape) ''' (2, 2) ''' # print column with heading 'apples' print (count['apples']) ''' Mon 3 Tue 2 Wed 5 Thu 7 Name: apples, dtype: int64 ''' # Grab data by slicing a colum print (count['oranges'].loc['Tue']) ''' 8 ''' print (count['oranges'].iloc[1]) ''' 8 ''' # Add a new dataframe to an existing dataframe data_a = { 'apples': [1,2,3], 'oranges': [4,5,6] } count_a = pd.DataFrame(data_a, index=['Fri','Sat','Sun']) print (count_a) ''' apples oranges Fri 1 4 Sat 2 5 Sun 3 6 ''' new_count = count.append(count_a) print(new_count) ''' apples oranges Mon 3 1 Tue 2 8 Wed 5 4 Thu 7 0 Fri 1 4 Sat 2 5 Sun 3 6 ''' # Adding an new column to exiting dataframe with unqual data in columns data_a = { 'apples': [1,2,3], 'oranges': [4,5,6], 'kiwi': [7,8,9] } count_a = pd.DataFrame(data_a, index=['Fri','Sat','Sun']) print(count_a) ''' apples oranges kiwi Fri 1 4 7 Sat 2 5 8 Sun 3 6 9 ''' new_count = count.append(count_a) print (new_count) ''' apples kiwi oranges Mon 3 NaN 1 Tue 2 NaN 8 Wed 5 NaN 4 Thu 7 NaN 0 Fri 1 7.0 4 Sat 2 8.0 5 Sun 3 9.0 6 '''
0.162413
0.249893
from mako import runtime, filters, cache UNDEFINED = runtime.UNDEFINED STOP_RENDERING = runtime.STOP_RENDERING __M_dict_builtin = dict __M_locals_builtin = locals _magic_number = 10 _modified_time = 1516665949.6025667 _enable_loop = True _template_filename = 'C:/Users/mayaroney/PycharmProjects/fomo/homepage/templates/sections.html' _template_uri = 'sections.html' _source_encoding = 'utf-8' import django_mako_plus _exports = ['header_maintenance', 'content_left', 'content_right', 'content_center', 'top_center', 'bottom'] def _mako_get_namespace(context, name): try: return context.namespaces[(__name__, name)] except KeyError: _mako_generate_namespaces(context) return context.namespaces[(__name__, name)] def _mako_generate_namespaces(context): pass def _mako_inherit(template, context): _mako_generate_namespaces(context) return runtime._inherit_from(context, 'app_base.html', _template_uri) def render_body(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: __M_locals = __M_dict_builtin(pageargs=pageargs) def content_right(): return render_content_right(context._locals(__M_locals)) def header_maintenance(): return render_header_maintenance(context._locals(__M_locals)) def content_center(): return render_content_center(context._locals(__M_locals)) def bottom(): return render_bottom(context._locals(__M_locals)) def top_center(): return render_top_center(context._locals(__M_locals)) def content_left(): return render_content_left(context._locals(__M_locals)) __M_writer = context.writer() __M_writer('\r\n\r\n') if 'parent' not in context._data or not hasattr(context._data['parent'], 'header_maintenance'): context['self'].header_maintenance(**pageargs) __M_writer('\r\n\r\n') if 'parent' not in context._data or not hasattr(context._data['parent'], 'content_left'): context['self'].content_left(**pageargs) __M_writer('\r\n\r\n') if 'parent' not in context._data or not hasattr(context._data['parent'], 'content_right'): context['self'].content_right(**pageargs) __M_writer('\r\n\r\n') if 'parent' not in context._data or not hasattr(context._data['parent'], 'content_center'): context['self'].content_center(**pageargs) __M_writer('\r\n\r\n') if 'parent' not in context._data or not hasattr(context._data['parent'], 'top_center'): context['self'].top_center(**pageargs) __M_writer('\r\n\r\n') if 'parent' not in context._data or not hasattr(context._data['parent'], 'bottom'): context['self'].bottom(**pageargs) __M_writer('\r\n\r\n\r\n') return '' finally: context.caller_stack._pop_frame() def render_header_maintenance(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: def header_maintenance(): return render_header_maintenance(context) __M_writer = context.writer() __M_writer('\r\n The site is currently down. Please try again later.\r\n') return '' finally: context.caller_stack._pop_frame() def render_content_left(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: def content_left(): return render_content_left(context) __M_writer = context.writer() __M_writer('\r\n <h1>left side content</h1>\r\n') return '' finally: context.caller_stack._pop_frame() def render_content_right(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: def content_right(): return render_content_right(context) __M_writer = context.writer() __M_writer('\r\n <h1>right side content</h1>\r\n') return '' finally: context.caller_stack._pop_frame() def render_content_center(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: def content_center(): return render_content_center(context) __M_writer = context.writer() __M_writer('\r\n <h1>center content</h1>\r\n') return '' finally: context.caller_stack._pop_frame() def render_top_center(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: def top_center(): return render_top_center(context) __M_writer = context.writer() __M_writer('\r\n <h1>Top Center Area</h1>\r\n') return '' finally: context.caller_stack._pop_frame() def render_bottom(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: def bottom(): return render_bottom(context) __M_writer = context.writer() __M_writer('\r\n <h1>Bottom Area</h1>\r\n') return '' finally: context.caller_stack._pop_frame() """ __M_BEGIN_METADATA {"filename": "C:/Users/mayaroney/PycharmProjects/fomo/homepage/templates/sections.html", "uri": "sections.html", "source_encoding": "utf-8", "line_map": {"28": 0, "45": 1, "50": 5, "55": 9, "60": 13, "65": 17, "70": 21, "75": 25, "81": 3, "87": 3, "93": 7, "99": 7, "105": 11, "111": 11, "117": 15, "123": 15, "129": 19, "135": 19, "141": 23, "147": 23, "153": 147}} __M_END_METADATA """
homepage/templates/.cached_templates/sections.html.py
from mako import runtime, filters, cache UNDEFINED = runtime.UNDEFINED STOP_RENDERING = runtime.STOP_RENDERING __M_dict_builtin = dict __M_locals_builtin = locals _magic_number = 10 _modified_time = 1516665949.6025667 _enable_loop = True _template_filename = 'C:/Users/mayaroney/PycharmProjects/fomo/homepage/templates/sections.html' _template_uri = 'sections.html' _source_encoding = 'utf-8' import django_mako_plus _exports = ['header_maintenance', 'content_left', 'content_right', 'content_center', 'top_center', 'bottom'] def _mako_get_namespace(context, name): try: return context.namespaces[(__name__, name)] except KeyError: _mako_generate_namespaces(context) return context.namespaces[(__name__, name)] def _mako_generate_namespaces(context): pass def _mako_inherit(template, context): _mako_generate_namespaces(context) return runtime._inherit_from(context, 'app_base.html', _template_uri) def render_body(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: __M_locals = __M_dict_builtin(pageargs=pageargs) def content_right(): return render_content_right(context._locals(__M_locals)) def header_maintenance(): return render_header_maintenance(context._locals(__M_locals)) def content_center(): return render_content_center(context._locals(__M_locals)) def bottom(): return render_bottom(context._locals(__M_locals)) def top_center(): return render_top_center(context._locals(__M_locals)) def content_left(): return render_content_left(context._locals(__M_locals)) __M_writer = context.writer() __M_writer('\r\n\r\n') if 'parent' not in context._data or not hasattr(context._data['parent'], 'header_maintenance'): context['self'].header_maintenance(**pageargs) __M_writer('\r\n\r\n') if 'parent' not in context._data or not hasattr(context._data['parent'], 'content_left'): context['self'].content_left(**pageargs) __M_writer('\r\n\r\n') if 'parent' not in context._data or not hasattr(context._data['parent'], 'content_right'): context['self'].content_right(**pageargs) __M_writer('\r\n\r\n') if 'parent' not in context._data or not hasattr(context._data['parent'], 'content_center'): context['self'].content_center(**pageargs) __M_writer('\r\n\r\n') if 'parent' not in context._data or not hasattr(context._data['parent'], 'top_center'): context['self'].top_center(**pageargs) __M_writer('\r\n\r\n') if 'parent' not in context._data or not hasattr(context._data['parent'], 'bottom'): context['self'].bottom(**pageargs) __M_writer('\r\n\r\n\r\n') return '' finally: context.caller_stack._pop_frame() def render_header_maintenance(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: def header_maintenance(): return render_header_maintenance(context) __M_writer = context.writer() __M_writer('\r\n The site is currently down. Please try again later.\r\n') return '' finally: context.caller_stack._pop_frame() def render_content_left(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: def content_left(): return render_content_left(context) __M_writer = context.writer() __M_writer('\r\n <h1>left side content</h1>\r\n') return '' finally: context.caller_stack._pop_frame() def render_content_right(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: def content_right(): return render_content_right(context) __M_writer = context.writer() __M_writer('\r\n <h1>right side content</h1>\r\n') return '' finally: context.caller_stack._pop_frame() def render_content_center(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: def content_center(): return render_content_center(context) __M_writer = context.writer() __M_writer('\r\n <h1>center content</h1>\r\n') return '' finally: context.caller_stack._pop_frame() def render_top_center(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: def top_center(): return render_top_center(context) __M_writer = context.writer() __M_writer('\r\n <h1>Top Center Area</h1>\r\n') return '' finally: context.caller_stack._pop_frame() def render_bottom(context,**pageargs): __M_caller = context.caller_stack._push_frame() try: def bottom(): return render_bottom(context) __M_writer = context.writer() __M_writer('\r\n <h1>Bottom Area</h1>\r\n') return '' finally: context.caller_stack._pop_frame() """ __M_BEGIN_METADATA {"filename": "C:/Users/mayaroney/PycharmProjects/fomo/homepage/templates/sections.html", "uri": "sections.html", "source_encoding": "utf-8", "line_map": {"28": 0, "45": 1, "50": 5, "55": 9, "60": 13, "65": 17, "70": 21, "75": 25, "81": 3, "87": 3, "93": 7, "99": 7, "105": 11, "111": 11, "117": 15, "123": 15, "129": 19, "135": 19, "141": 23, "147": 23, "153": 147}} __M_END_METADATA """
0.344113
0.092401
import os import torch import math from pytorch_lightning.root_module.memory import ModelSummary from pytorch_lightning.root_module.grads import GradInformation from pytorch_lightning.root_module.model_saving import ModelIO, load_hparams_from_tags_csv from pytorch_lightning.root_module.hooks import ModelHooks class LightningModule(GradInformation, ModelIO, ModelHooks): def __init__(self, hparams): super(LightningModule, self).__init__() self.hparams = hparams self.dtype = torch.FloatTensor self.exp_save_path = None self.current_epoch = 0 self.global_step = 0 self.loaded_optimizer_states_dict = {} self.trainer = None self.experiment = None self.example_input_array = None # track if gpu was requested for checkpointing self.on_gpu = False # computed vars for the dataloaders self._tng_dataloader = None self._val_dataloader = None self._test_dataloader = None def forward(self, *args, **kwargs): """ Expand model in into whatever you need. Also need to return the target :param x: :return: """ raise NotImplementedError def validation_step(self, data_batch, batch_nb): """ return whatever outputs will need to be aggregated in validation_end :param data_batch: :return: """ raise NotImplementedError def validation_end(self, outputs): """ Outputs has the appended output after each validation step :param outputs: :return: dic_with_metrics for tqdm """ raise NotImplementedError def training_step(self, data_batch, batch_nb): """ return loss, dict with metrics for tqdm :param data_batch: :return: """ raise NotImplementedError def configure_optimizers(self): """ Return array of optimizers :return: """ raise NotImplementedError def loss(self, *args, **kwargs): """ Expand model_out into your components :param model_out: :return: """ raise NotImplementedError def summarize(self): model_summary = ModelSummary(self) print(model_summary) def freeze(self): for param in self.parameters(): param.requires_grad = False def unfreeze(self): for param in self.parameters(): param.requires_grad = True @property def tng_dataloader(self): """ Implement a function to load an h5py of this data :return: """ raise NotImplementedError @property def test_dataloader(self): """ Implement a function to load an h5py of this data :return: """ raise NotImplementedError @property def val_dataloader(self): """ Implement a function to load an h5py of this data :return: """ raise NotImplementedError @classmethod def load_from_metrics(cls, weights_path, tags_csv, on_gpu, map_location=None): """ Primary way of loading model from csv weights path :param weights_path: :param tags_csv: :param on_gpu: :param map_location: dic for mapping storage {'cuda:1':'cuda:0'} :return: """ hparams = load_hparams_from_tags_csv(tags_csv) hparams.__setattr__('on_gpu', on_gpu) if on_gpu: if map_location is not None: checkpoint = torch.load(weights_path, map_location=map_location) else: checkpoint = torch.load(weights_path) else: checkpoint = torch.load(weights_path, map_location=lambda storage, loc: storage) model = cls(hparams) # allow model to load model.load_model_specific(checkpoint) model.load_state_dict(checkpoint['state_dict'], strict=False) return model
pytorch_lightning/root_module/root_module.py
import os import torch import math from pytorch_lightning.root_module.memory import ModelSummary from pytorch_lightning.root_module.grads import GradInformation from pytorch_lightning.root_module.model_saving import ModelIO, load_hparams_from_tags_csv from pytorch_lightning.root_module.hooks import ModelHooks class LightningModule(GradInformation, ModelIO, ModelHooks): def __init__(self, hparams): super(LightningModule, self).__init__() self.hparams = hparams self.dtype = torch.FloatTensor self.exp_save_path = None self.current_epoch = 0 self.global_step = 0 self.loaded_optimizer_states_dict = {} self.trainer = None self.experiment = None self.example_input_array = None # track if gpu was requested for checkpointing self.on_gpu = False # computed vars for the dataloaders self._tng_dataloader = None self._val_dataloader = None self._test_dataloader = None def forward(self, *args, **kwargs): """ Expand model in into whatever you need. Also need to return the target :param x: :return: """ raise NotImplementedError def validation_step(self, data_batch, batch_nb): """ return whatever outputs will need to be aggregated in validation_end :param data_batch: :return: """ raise NotImplementedError def validation_end(self, outputs): """ Outputs has the appended output after each validation step :param outputs: :return: dic_with_metrics for tqdm """ raise NotImplementedError def training_step(self, data_batch, batch_nb): """ return loss, dict with metrics for tqdm :param data_batch: :return: """ raise NotImplementedError def configure_optimizers(self): """ Return array of optimizers :return: """ raise NotImplementedError def loss(self, *args, **kwargs): """ Expand model_out into your components :param model_out: :return: """ raise NotImplementedError def summarize(self): model_summary = ModelSummary(self) print(model_summary) def freeze(self): for param in self.parameters(): param.requires_grad = False def unfreeze(self): for param in self.parameters(): param.requires_grad = True @property def tng_dataloader(self): """ Implement a function to load an h5py of this data :return: """ raise NotImplementedError @property def test_dataloader(self): """ Implement a function to load an h5py of this data :return: """ raise NotImplementedError @property def val_dataloader(self): """ Implement a function to load an h5py of this data :return: """ raise NotImplementedError @classmethod def load_from_metrics(cls, weights_path, tags_csv, on_gpu, map_location=None): """ Primary way of loading model from csv weights path :param weights_path: :param tags_csv: :param on_gpu: :param map_location: dic for mapping storage {'cuda:1':'cuda:0'} :return: """ hparams = load_hparams_from_tags_csv(tags_csv) hparams.__setattr__('on_gpu', on_gpu) if on_gpu: if map_location is not None: checkpoint = torch.load(weights_path, map_location=map_location) else: checkpoint = torch.load(weights_path) else: checkpoint = torch.load(weights_path, map_location=lambda storage, loc: storage) model = cls(hparams) # allow model to load model.load_model_specific(checkpoint) model.load_state_dict(checkpoint['state_dict'], strict=False) return model
0.869146
0.432483
from . import array_create def atleast_1d(*arys): """ Convert inputs to arrays with at least one dimension. Scalar inputs are converted to 1-dimensional arrays, whilst higher-dimensional inputs are preserved. Parameters ---------- arys1, arys2, ... : array_like One or more input arrays. Returns ------- ret : ndarray An array, or list of arrays, each with ``a.ndim >= 1``. Copies are made only if necessary. See Also -------- atleast_2d, atleast_3d Examples -------- >>> np.atleast_1d(1.0) array_create.array([ 1.]) >>> x = np.arange(9.0).reshape(3,3) >>> np.atleast_1d(x) array_create.array([[ 0., 1., 2.], [ 3., 4., 5.], [ 6., 7., 8.]]) >>> np.atleast_1d(x) is x True >>> np.atleast_1d(1, [3, 4]) [array_create.array([1]), array_create.array([3, 4])] """ res = [] for ary in arys: ary = array_create.array(ary) if len(ary.shape) == 0: result = ary.reshape(1) else: result = ary res.append(result) if len(res) == 1: return res[0] else: return res def atleast_2d(*arys): """ View inputs as arrays with at least two dimensions. Parameters ---------- arys1, arys2, ... : array_like One or more array-like sequences. Non-array inputs are converted to arrays. Arrays that already have two or more dimensions are preserved. Returns ------- res, res2, ... : ndarray An array, or list of arrays, each with ``a.ndim >= 2``. Copies are avoided where possible, and views with two or more dimensions are returned. See Also -------- atleast_1d, atleast_3d Examples -------- >>> np.atleast_2d(3.0) array_create.array([[ 3.]]) >>> x = np.arange(3.0) >>> np.atleast_2d(x) array_create.array([[ 0., 1., 2.]]) >>> np.atleast_2d(x).base is x True >>> np.atleast_2d(1, [1, 2], [[1, 2]]) [array_create.array([[1]]), array_create.array([[1, 2]]), array_create.array([[1, 2]])] """ res = [] for ary in arys: ary = array_create.array(ary) if len(ary.shape) == 0: result = ary.reshape(1, 1) elif len(ary.shape) == 1: result = ary[None, :] else: result = ary res.append(result) if len(res) == 1: return res[0] else: return res def atleast_3d(*arys): """ View inputs as arrays with at least three dimensions. Parameters ---------- arys1, arys2, ... : array_like One or more array-like sequences. Non-array inputs are converted to arrays. Arrays that already have three or more dimensions are preserved. Returns ------- res1, res2, ... : ndarray An array, or list of arrays, each with ``a.ndim >= 3``. Copies are avoided where possible, and views with three or more dimensions are returned. For example, a 1-D array of shape ``(N,)`` becomes a view of shape ``(1, N, 1)``, and a 2-D array of shape ``(M, N)`` becomes a view of shape ``(M, N, 1)``. See Also -------- atleast_1d, atleast_2d Examples -------- >>> np.atleast_3d(3.0) array_create.array([[[ 3.]]]) >>> x = np.arange(3.0) >>> np.atleast_3d(x).shape (1, 3, 1) >>> x = np.arange(12.0).reshape(4,3) >>> np.atleast_3d(x).shape (4, 3, 1) >>> np.atleast_3d(x).base is x.base # x is a reshape, so not base itself True >>> for arr in np.atleast_3d([1, 2], [[1, 2]], [[[1, 2]]]): ... print(arr, arr.shape) ... [[[1] [2]]] (1, 2, 1) [[[1] [2]]] (1, 2, 1) [[[1 2]]] (1, 1, 2) """ res = [] for ary in arys: ary = array_create.array(ary) if len(ary.shape) == 0: result = ary.reshape(1, 1, 1) elif len(ary.shape) == 1: result = ary[None, :, None] elif len(ary.shape) == 2: result = ary[:, :, None] else: result = ary res.append(result) if len(res) == 1: return res[0] else: return res def concatenate(array_list, axis=0): """ concatenate((a1, a2, ...), axis=0) Join a sequence of arrays along an existing axis. Parameters ---------- a1, a2, ... : sequence of array_like The arrays must have the same shape, except in the dimension corresponding to `axis` (the first, by default). axis : int, optional The axis along which the arrays will be joined. Default is 0. Returns ------- res : ndarray The concatenated array. See Also -------- ma.concatenate : Concatenate function that preserves input masks. array_split : Split an array into multiple sub-arrays of equal or near-equal size. split : Split array into a list of multiple sub-arrays of equal size. hsplit : Split array into multiple sub-arrays horizontally (column wise) vsplit : Split array into multiple sub-arrays vertically (row wise) dsplit : Split array into multiple sub-arrays along the 3rd axis (depth). stack : Stack a sequence of arrays along a new axis. hstack : Stack arrays in sequence horizontally (column wise) vstack : Stack arrays in sequence vertically (row wise) dstack : Stack arrays in sequence depth wise (along third dimension) Notes ----- When one or more of the arrays to be concatenated is a MaskedArray, this function will return a MaskedArray object instead of an ndarray, but the input masks are *not* preserved. In cases where a MaskedArray is expected as input, use the ma.concatenate function from the masked array module instead. Examples -------- >>> a = np.array_create.array([[1, 2], [3, 4]]) >>> b = np.array_create.array([[5, 6]]) >>> np.concatenate((a, b), axis=0) array_create.array([[1, 2], [3, 4], [5, 6]]) >>> np.concatenate((a, b.T), axis=1) array_create.array([[1, 2, 5], [3, 4, 6]]) This function will not preserve masking of MaskedArray inputs. >>> a = np.ma.arange(3) >>> a[1] = np.ma.masked >>> b = np.arange(2, 5) >>> a masked_array(data = [0 -- 2], mask = [False True False], fill_value = 999999) >>> b array_create.array([2, 3, 4]) >>> np.concatenate([a, b]) masked_array(data = [0 1 2 2 3 4], mask = False, fill_value = 999999) >>> np.ma.concatenate([a, b]) masked_array(data = [0 -- 2 2 3 4], mask = [False True False False False False], fill_value = 999999) """ if len(array_list) == 0: return None # We form an assignment to the new 'ret' array, which has a shape[axis] that are the sum of # the axis dimensions in 'array_list'. Then we copy each array in 'array_list' into the axis dimension of 'ret' ret_shape = list(array_list[0].shape) ret_shape[axis] = 0 for ary in array_list: ret_shape[axis] += ary.shape[axis] ret = array_create.empty(ret_shape, dtype=array_list[0].dtype) slice = "ret[" for i in range(ret.ndim): if i == axis: slice += "AXIS" else: slice += ":" if i < ret.ndim - 1: slice += ", " slice += "]" len_count = 0 for i in range(len(array_list)): axis_slice = "%d:%d+%d" % (len_count, len_count, array_list[i].shape[axis]) cmd = slice.replace("AXIS", axis_slice) cmd += " = array_list[i]" exec (cmd) len_count += array_list[i].shape[axis] return ret def vstack(tup): """ Stack arrays in sequence vertically (row wise). Take a sequence of arrays and stack them vertically to make a single array. Rebuild arrays divided by `vsplit`. This function continues to be supported for backward compatibility, but you should prefer ``np.concatenate`` or ``np.stack``. The ``np.stack`` function was added in NumPy 1.10. Parameters ---------- tup : sequence of ndarrays Tuple containing arrays to be stacked. The arrays must have the same shape along all but the first axis. Returns ------- stacked : ndarray The array formed by stacking the given arrays. See Also -------- stack : Join a sequence of arrays along a new axis. hstack : Stack arrays in sequence horizontally (column wise). dstack : Stack arrays in sequence depth wise (along third dimension). concatenate : Join a sequence of arrays along an existing axis. vsplit : Split array into a list of multiple sub-arrays vertically. Notes ----- Equivalent to ``np.concatenate(tup, axis=0)`` if `tup` contains arrays that are at least 2-dimensional. Examples -------- >>> a = np.array_create.array([1, 2, 3]) >>> b = np.array_create.array([2, 3, 4]) >>> np.vstack((a,b)) array_create.array([[1, 2, 3], [2, 3, 4]]) >>> a = np.array_create.array([[1], [2], [3]]) >>> b = np.array_create.array([[2], [3], [4]]) >>> np.vstack((a,b)) array_create.array([[1], [2], [3], [2], [3], [4]]) """ return concatenate([atleast_2d(_m) for _m in tup], 0) def hstack(tup): """ Stack arrays in sequence horizontally (column wise). Take a sequence of arrays and stack them horizontally to make a single array. Rebuild arrays divided by `hsplit`. This function continues to be supported for backward compatibility, but you should prefer ``np.concatenate`` or ``np.stack``. The ``np.stack`` function was added in NumPy 1.10. Parameters ---------- tup : sequence of ndarrays All arrays must have the same shape along all but the second axis. Returns ------- stacked : ndarray The array formed by stacking the given arrays. See Also -------- stack : Join a sequence of arrays along a new axis. vstack : Stack arrays in sequence vertically (row wise). dstack : Stack arrays in sequence depth wise (along third axis). concatenate : Join a sequence of arrays along an existing axis. hsplit : Split array along second axis. Notes ----- Equivalent to ``np.concatenate(tup, axis=1)`` Examples -------- >>> a = np.array((1,2,3)) >>> b = np.array((2,3,4)) >>> np.hstack((a,b)) array_create.array([1, 2, 3, 2, 3, 4]) >>> a = np.array_create.array([[1],[2],[3]]) >>> b = np.array_create.array([[2],[3],[4]]) >>> np.hstack((a,b)) array_create.array([[1, 2], [2, 3], [3, 4]]) """ arrs = [atleast_1d(_m) for _m in tup] # As a special case, dimension 0 of 1-dimensional arrays is "horizontal" if arrs[0].ndim == 1: return concatenate(arrs, 0) else: return concatenate(arrs, 1) def stack(arrays, axis=0): """ Join a sequence of arrays along a new axis. The `axis` parameter specifies the index of the new axis in the dimensions of the result. For example, if ``axis=0`` it will be the first dimension and if ``axis=-1`` it will be the last dimension. .. versionadded:: 1.10.0 Parameters ---------- arrays : sequence of array_like Each array must have the same shape. axis : int, optional The axis in the result array along which the input arrays are stacked. Returns ------- stacked : ndarray The stacked array has one more dimension than the input arrays. See Also -------- concatenate : Join a sequence of arrays along an existing axis. split : Split array into a list of multiple sub-arrays of equal size. Examples -------- >>> arrays = [np.random.randn(3, 4) for _ in range(10)] >>> np.stack(arrays, axis=0).shape (10, 3, 4) >>> np.stack(arrays, axis=1).shape (3, 10, 4) >>> np.stack(arrays, axis=2).shape (3, 4, 10) >>> a = np.array_create.array([1, 2, 3]) >>> b = np.array_create.array([2, 3, 4]) >>> np.stack((a, b)) array_create.array([[1, 2, 3], [2, 3, 4]]) >>> np.stack((a, b), axis=-1) array_create.array([[1, 2], [2, 3], [3, 4]]) """ arrays = [array_create.array(arr) for arr in arrays] if not arrays: raise ValueError('need at least one array to stack') shapes = set(arr.shape for arr in arrays) if len(shapes) != 1: raise ValueError('all input arrays must have the same shape') result_ndim = arrays[0].ndim + 1 if not -result_ndim <= axis < result_ndim: msg = 'axis {0} out of bounds [-{1}, {1})'.format(axis, result_ndim) raise IndexError(msg) if axis < 0: axis += result_ndim sl = (slice(None),) * axis + (None,) expanded_arrays = [arr[sl] for arr in arrays] return concatenate(expanded_arrays, axis=axis)
bridge/npbackend/bohrium/concatenate.py
from . import array_create def atleast_1d(*arys): """ Convert inputs to arrays with at least one dimension. Scalar inputs are converted to 1-dimensional arrays, whilst higher-dimensional inputs are preserved. Parameters ---------- arys1, arys2, ... : array_like One or more input arrays. Returns ------- ret : ndarray An array, or list of arrays, each with ``a.ndim >= 1``. Copies are made only if necessary. See Also -------- atleast_2d, atleast_3d Examples -------- >>> np.atleast_1d(1.0) array_create.array([ 1.]) >>> x = np.arange(9.0).reshape(3,3) >>> np.atleast_1d(x) array_create.array([[ 0., 1., 2.], [ 3., 4., 5.], [ 6., 7., 8.]]) >>> np.atleast_1d(x) is x True >>> np.atleast_1d(1, [3, 4]) [array_create.array([1]), array_create.array([3, 4])] """ res = [] for ary in arys: ary = array_create.array(ary) if len(ary.shape) == 0: result = ary.reshape(1) else: result = ary res.append(result) if len(res) == 1: return res[0] else: return res def atleast_2d(*arys): """ View inputs as arrays with at least two dimensions. Parameters ---------- arys1, arys2, ... : array_like One or more array-like sequences. Non-array inputs are converted to arrays. Arrays that already have two or more dimensions are preserved. Returns ------- res, res2, ... : ndarray An array, or list of arrays, each with ``a.ndim >= 2``. Copies are avoided where possible, and views with two or more dimensions are returned. See Also -------- atleast_1d, atleast_3d Examples -------- >>> np.atleast_2d(3.0) array_create.array([[ 3.]]) >>> x = np.arange(3.0) >>> np.atleast_2d(x) array_create.array([[ 0., 1., 2.]]) >>> np.atleast_2d(x).base is x True >>> np.atleast_2d(1, [1, 2], [[1, 2]]) [array_create.array([[1]]), array_create.array([[1, 2]]), array_create.array([[1, 2]])] """ res = [] for ary in arys: ary = array_create.array(ary) if len(ary.shape) == 0: result = ary.reshape(1, 1) elif len(ary.shape) == 1: result = ary[None, :] else: result = ary res.append(result) if len(res) == 1: return res[0] else: return res def atleast_3d(*arys): """ View inputs as arrays with at least three dimensions. Parameters ---------- arys1, arys2, ... : array_like One or more array-like sequences. Non-array inputs are converted to arrays. Arrays that already have three or more dimensions are preserved. Returns ------- res1, res2, ... : ndarray An array, or list of arrays, each with ``a.ndim >= 3``. Copies are avoided where possible, and views with three or more dimensions are returned. For example, a 1-D array of shape ``(N,)`` becomes a view of shape ``(1, N, 1)``, and a 2-D array of shape ``(M, N)`` becomes a view of shape ``(M, N, 1)``. See Also -------- atleast_1d, atleast_2d Examples -------- >>> np.atleast_3d(3.0) array_create.array([[[ 3.]]]) >>> x = np.arange(3.0) >>> np.atleast_3d(x).shape (1, 3, 1) >>> x = np.arange(12.0).reshape(4,3) >>> np.atleast_3d(x).shape (4, 3, 1) >>> np.atleast_3d(x).base is x.base # x is a reshape, so not base itself True >>> for arr in np.atleast_3d([1, 2], [[1, 2]], [[[1, 2]]]): ... print(arr, arr.shape) ... [[[1] [2]]] (1, 2, 1) [[[1] [2]]] (1, 2, 1) [[[1 2]]] (1, 1, 2) """ res = [] for ary in arys: ary = array_create.array(ary) if len(ary.shape) == 0: result = ary.reshape(1, 1, 1) elif len(ary.shape) == 1: result = ary[None, :, None] elif len(ary.shape) == 2: result = ary[:, :, None] else: result = ary res.append(result) if len(res) == 1: return res[0] else: return res def concatenate(array_list, axis=0): """ concatenate((a1, a2, ...), axis=0) Join a sequence of arrays along an existing axis. Parameters ---------- a1, a2, ... : sequence of array_like The arrays must have the same shape, except in the dimension corresponding to `axis` (the first, by default). axis : int, optional The axis along which the arrays will be joined. Default is 0. Returns ------- res : ndarray The concatenated array. See Also -------- ma.concatenate : Concatenate function that preserves input masks. array_split : Split an array into multiple sub-arrays of equal or near-equal size. split : Split array into a list of multiple sub-arrays of equal size. hsplit : Split array into multiple sub-arrays horizontally (column wise) vsplit : Split array into multiple sub-arrays vertically (row wise) dsplit : Split array into multiple sub-arrays along the 3rd axis (depth). stack : Stack a sequence of arrays along a new axis. hstack : Stack arrays in sequence horizontally (column wise) vstack : Stack arrays in sequence vertically (row wise) dstack : Stack arrays in sequence depth wise (along third dimension) Notes ----- When one or more of the arrays to be concatenated is a MaskedArray, this function will return a MaskedArray object instead of an ndarray, but the input masks are *not* preserved. In cases where a MaskedArray is expected as input, use the ma.concatenate function from the masked array module instead. Examples -------- >>> a = np.array_create.array([[1, 2], [3, 4]]) >>> b = np.array_create.array([[5, 6]]) >>> np.concatenate((a, b), axis=0) array_create.array([[1, 2], [3, 4], [5, 6]]) >>> np.concatenate((a, b.T), axis=1) array_create.array([[1, 2, 5], [3, 4, 6]]) This function will not preserve masking of MaskedArray inputs. >>> a = np.ma.arange(3) >>> a[1] = np.ma.masked >>> b = np.arange(2, 5) >>> a masked_array(data = [0 -- 2], mask = [False True False], fill_value = 999999) >>> b array_create.array([2, 3, 4]) >>> np.concatenate([a, b]) masked_array(data = [0 1 2 2 3 4], mask = False, fill_value = 999999) >>> np.ma.concatenate([a, b]) masked_array(data = [0 -- 2 2 3 4], mask = [False True False False False False], fill_value = 999999) """ if len(array_list) == 0: return None # We form an assignment to the new 'ret' array, which has a shape[axis] that are the sum of # the axis dimensions in 'array_list'. Then we copy each array in 'array_list' into the axis dimension of 'ret' ret_shape = list(array_list[0].shape) ret_shape[axis] = 0 for ary in array_list: ret_shape[axis] += ary.shape[axis] ret = array_create.empty(ret_shape, dtype=array_list[0].dtype) slice = "ret[" for i in range(ret.ndim): if i == axis: slice += "AXIS" else: slice += ":" if i < ret.ndim - 1: slice += ", " slice += "]" len_count = 0 for i in range(len(array_list)): axis_slice = "%d:%d+%d" % (len_count, len_count, array_list[i].shape[axis]) cmd = slice.replace("AXIS", axis_slice) cmd += " = array_list[i]" exec (cmd) len_count += array_list[i].shape[axis] return ret def vstack(tup): """ Stack arrays in sequence vertically (row wise). Take a sequence of arrays and stack them vertically to make a single array. Rebuild arrays divided by `vsplit`. This function continues to be supported for backward compatibility, but you should prefer ``np.concatenate`` or ``np.stack``. The ``np.stack`` function was added in NumPy 1.10. Parameters ---------- tup : sequence of ndarrays Tuple containing arrays to be stacked. The arrays must have the same shape along all but the first axis. Returns ------- stacked : ndarray The array formed by stacking the given arrays. See Also -------- stack : Join a sequence of arrays along a new axis. hstack : Stack arrays in sequence horizontally (column wise). dstack : Stack arrays in sequence depth wise (along third dimension). concatenate : Join a sequence of arrays along an existing axis. vsplit : Split array into a list of multiple sub-arrays vertically. Notes ----- Equivalent to ``np.concatenate(tup, axis=0)`` if `tup` contains arrays that are at least 2-dimensional. Examples -------- >>> a = np.array_create.array([1, 2, 3]) >>> b = np.array_create.array([2, 3, 4]) >>> np.vstack((a,b)) array_create.array([[1, 2, 3], [2, 3, 4]]) >>> a = np.array_create.array([[1], [2], [3]]) >>> b = np.array_create.array([[2], [3], [4]]) >>> np.vstack((a,b)) array_create.array([[1], [2], [3], [2], [3], [4]]) """ return concatenate([atleast_2d(_m) for _m in tup], 0) def hstack(tup): """ Stack arrays in sequence horizontally (column wise). Take a sequence of arrays and stack them horizontally to make a single array. Rebuild arrays divided by `hsplit`. This function continues to be supported for backward compatibility, but you should prefer ``np.concatenate`` or ``np.stack``. The ``np.stack`` function was added in NumPy 1.10. Parameters ---------- tup : sequence of ndarrays All arrays must have the same shape along all but the second axis. Returns ------- stacked : ndarray The array formed by stacking the given arrays. See Also -------- stack : Join a sequence of arrays along a new axis. vstack : Stack arrays in sequence vertically (row wise). dstack : Stack arrays in sequence depth wise (along third axis). concatenate : Join a sequence of arrays along an existing axis. hsplit : Split array along second axis. Notes ----- Equivalent to ``np.concatenate(tup, axis=1)`` Examples -------- >>> a = np.array((1,2,3)) >>> b = np.array((2,3,4)) >>> np.hstack((a,b)) array_create.array([1, 2, 3, 2, 3, 4]) >>> a = np.array_create.array([[1],[2],[3]]) >>> b = np.array_create.array([[2],[3],[4]]) >>> np.hstack((a,b)) array_create.array([[1, 2], [2, 3], [3, 4]]) """ arrs = [atleast_1d(_m) for _m in tup] # As a special case, dimension 0 of 1-dimensional arrays is "horizontal" if arrs[0].ndim == 1: return concatenate(arrs, 0) else: return concatenate(arrs, 1) def stack(arrays, axis=0): """ Join a sequence of arrays along a new axis. The `axis` parameter specifies the index of the new axis in the dimensions of the result. For example, if ``axis=0`` it will be the first dimension and if ``axis=-1`` it will be the last dimension. .. versionadded:: 1.10.0 Parameters ---------- arrays : sequence of array_like Each array must have the same shape. axis : int, optional The axis in the result array along which the input arrays are stacked. Returns ------- stacked : ndarray The stacked array has one more dimension than the input arrays. See Also -------- concatenate : Join a sequence of arrays along an existing axis. split : Split array into a list of multiple sub-arrays of equal size. Examples -------- >>> arrays = [np.random.randn(3, 4) for _ in range(10)] >>> np.stack(arrays, axis=0).shape (10, 3, 4) >>> np.stack(arrays, axis=1).shape (3, 10, 4) >>> np.stack(arrays, axis=2).shape (3, 4, 10) >>> a = np.array_create.array([1, 2, 3]) >>> b = np.array_create.array([2, 3, 4]) >>> np.stack((a, b)) array_create.array([[1, 2, 3], [2, 3, 4]]) >>> np.stack((a, b), axis=-1) array_create.array([[1, 2], [2, 3], [3, 4]]) """ arrays = [array_create.array(arr) for arr in arrays] if not arrays: raise ValueError('need at least one array to stack') shapes = set(arr.shape for arr in arrays) if len(shapes) != 1: raise ValueError('all input arrays must have the same shape') result_ndim = arrays[0].ndim + 1 if not -result_ndim <= axis < result_ndim: msg = 'axis {0} out of bounds [-{1}, {1})'.format(axis, result_ndim) raise IndexError(msg) if axis < 0: axis += result_ndim sl = (slice(None),) * axis + (None,) expanded_arrays = [arr[sl] for arr in arrays] return concatenate(expanded_arrays, axis=axis)
0.930703
0.848784
from tkinter import * from tkinter import ttk, Text class Writing_Block_Remover: def __init__(self) -> None: self.root = Tk() self.root.geometry("800x400") self.root.title("Writing Block Remover") self.frm = ttk.Frame(self.root, padding=10) self.frm.grid() self.style = ttk.Style() # Instructions Label self.instruction_label = ttk.Label(text="Once you start, keep writing for 5 minutes. If you stop for more than 5 seconds, everything you have typed will disappear.") self.instruction_label.grid(row=0, column=0, columnspan=4, padx=15, pady=10) # Start Restart button self.start_restart_button = ttk.Button(text="Start/Restart", command=self.restart_test) self.start_restart_button.grid(row=1, column=0, padx=5, pady=5) # timer self.timer = None # time label self.time_label = ttk.Label(text="Time: 00:00") self.time_label.grid(row=1, column=3, padx=15, pady=5) # Input Text self.user_text = Text(self.root,width=105, height=20, wrap= "word") self.user_text.grid(row=2, column=0, columnspan=4, padx=20, pady=5) self.user_text.bind('<KeyPress>', self.typing) self.user_text.config(state=DISABLED) # TODO: export button # timer def update_time_label(self, mins, secs): self.time_label.config(text=f"Time: {mins:02}:{secs:02}") self.time_label.update() def start_restart_timer(self, timer_value_in_seconds): mins, secs = divmod(timer_value_in_seconds, 60) self.update_time_label(mins, secs) if timer_value_in_seconds > 1: self.timer = self.root.after(1000, self.start_restart_timer, timer_value_in_seconds - 1) else: self.time_label.config(text=f"Time's up!") self.time_label.update() self.root.after_cancel(self.five_sec_timer) self.start_restart_button['state'] = "normal" self.user_text.config(state=DISABLED) self.timer = None def five_second_timer(self, timer_value_in_seconds): print(timer_value_in_seconds) if timer_value_in_seconds > 0: self.five_sec_timer = self.root.after(1000, self.five_second_timer, timer_value_in_seconds - 1) else: self.user_text.delete('1.0', END) self.five_sec_timer = self.root.after(1000, self.five_second_timer, 5) def typing(self, key): if self.timer is not None: self.root.after_cancel(self.five_sec_timer) self.five_second_timer(5) # Start and Restart text def restart_test(self): if self.timer is not None: self.root.after_cancel(self.timer) self.start_restart_button['state'] = "disabled" self.user_text.config(state="normal") self.user_text.delete('1.0', END) self.timer = None self.start_restart_timer(300) self.five_second_timer(5) writing_block_remover = Writing_Block_Remover() writing_block_remover.root.mainloop()
main.py
from tkinter import * from tkinter import ttk, Text class Writing_Block_Remover: def __init__(self) -> None: self.root = Tk() self.root.geometry("800x400") self.root.title("Writing Block Remover") self.frm = ttk.Frame(self.root, padding=10) self.frm.grid() self.style = ttk.Style() # Instructions Label self.instruction_label = ttk.Label(text="Once you start, keep writing for 5 minutes. If you stop for more than 5 seconds, everything you have typed will disappear.") self.instruction_label.grid(row=0, column=0, columnspan=4, padx=15, pady=10) # Start Restart button self.start_restart_button = ttk.Button(text="Start/Restart", command=self.restart_test) self.start_restart_button.grid(row=1, column=0, padx=5, pady=5) # timer self.timer = None # time label self.time_label = ttk.Label(text="Time: 00:00") self.time_label.grid(row=1, column=3, padx=15, pady=5) # Input Text self.user_text = Text(self.root,width=105, height=20, wrap= "word") self.user_text.grid(row=2, column=0, columnspan=4, padx=20, pady=5) self.user_text.bind('<KeyPress>', self.typing) self.user_text.config(state=DISABLED) # TODO: export button # timer def update_time_label(self, mins, secs): self.time_label.config(text=f"Time: {mins:02}:{secs:02}") self.time_label.update() def start_restart_timer(self, timer_value_in_seconds): mins, secs = divmod(timer_value_in_seconds, 60) self.update_time_label(mins, secs) if timer_value_in_seconds > 1: self.timer = self.root.after(1000, self.start_restart_timer, timer_value_in_seconds - 1) else: self.time_label.config(text=f"Time's up!") self.time_label.update() self.root.after_cancel(self.five_sec_timer) self.start_restart_button['state'] = "normal" self.user_text.config(state=DISABLED) self.timer = None def five_second_timer(self, timer_value_in_seconds): print(timer_value_in_seconds) if timer_value_in_seconds > 0: self.five_sec_timer = self.root.after(1000, self.five_second_timer, timer_value_in_seconds - 1) else: self.user_text.delete('1.0', END) self.five_sec_timer = self.root.after(1000, self.five_second_timer, 5) def typing(self, key): if self.timer is not None: self.root.after_cancel(self.five_sec_timer) self.five_second_timer(5) # Start and Restart text def restart_test(self): if self.timer is not None: self.root.after_cancel(self.timer) self.start_restart_button['state'] = "disabled" self.user_text.config(state="normal") self.user_text.delete('1.0', END) self.timer = None self.start_restart_timer(300) self.five_second_timer(5) writing_block_remover = Writing_Block_Remover() writing_block_remover.root.mainloop()
0.314156
0.118666
"""Module that contains widgets for managing AiiDAlab applications.""" from subprocess import CalledProcessError import ipywidgets as ipw import traitlets from aiidalab.app import AppRemoteUpdateStatus as AppStatus from aiidalab.app import AppVersion from jinja2 import Template from packaging.version import parse from home.utils import load_logo from home.widgets import LogOutputWidget, Spinner, StatusHTML HTML_MSG_PROGRESS = """{}""" HTML_MSG_SUCCESS = """<i class="fa fa-check" style="color:#337ab7;font-size:1em;" ></i> {}""" HTML_MSG_FAILURE = """<i class="fa fa-times" style="color:red;font-size:1em;" ></i> {}""" class VersionSelectorWidget(ipw.VBox): """Class to choose app's version.""" disabled = traitlets.Bool() prereleases = traitlets.Bool() def __init__(self, *args, **kwargs): style = {"description_width": "100px"} self.version_to_install = ipw.Dropdown( description="Install version", disabled=True, style=style, ) self.installed_version = ipw.Text( description="Installed version", disabled=True, style=style, ) self.info = StatusHTML( value="", layout={"max_width": "600px"}, style=style, ) super().__init__( children=[self.installed_version, self.version_to_install, self.info], layout={"min_width": "300px"}, *args, **kwargs, ) @traitlets.observe("disabled") def _observe_disabled(self, change): self.version_to_install.disabled = change["new"] class AppManagerWidget(ipw.VBox): """Widget for management of apps. Shows basic information about the app (description, authors, etc.) and provides an interface to install, uninstall, and update the application, as well as change versions if possible. """ COMPATIBILTIY_WARNING = Template( """<div class="alert alert-danger"> The installed version of this app is not compatible with this AiiDAlab environment. </div>""" ) COMPATIBILITY_INFO = Template( """<div class="alert alert-warning alert-dismissible"> <a href="#" class="close" data-dismiss="alert" aria-label="close">&times;</a> Reasons for incompatibility: <ul> {% for spec in app.compatibility_info %} <li>{{ spec }}: <ul> {% for missing_req in app.compatibility_info[spec] %} <li>missing: {{ missing_req }}</li> {% endfor %} </ul> </li> {% endfor %} </ul> </div>""" ) TEMPLATE = Template( """<b> <div style="font-size: 30px; text-align:center;">{{ app.title }}</div></b> <br> <b>Authors:</b> {{ app.authors }} <br> <b>Description:</b> {{ app.description }} {% if app.url %} <br> <b>URL:</b> <a href="{{ app.url }}">{{ app.url }}</a> {% endif %}""" ) def __init__(self, app, with_version_selector=False): self.app = app self.compatibility_warning = ipw.HTML(self.COMPATIBILTIY_WARNING.render()) self.compatibility_warning.layout = {"width": "600px"} self.compatibility_warning.layout.visibility = "hidden" body = ipw.HTML(self.TEMPLATE.render(app=app)) body.layout = {"width": "600px"} # Setup install_info self.install_info = StatusHTML( message="<p><br></p>" ) # show empty line by default self.dependencies_log = LogOutputWidget( layout=ipw.Layout(min_height="0px", max_height="100px") ) # max_height controls the maximum height of the log field. self.dependencies_log.template = ( "Installing dependencies..." + self.dependencies_log.template ) # Setup buttons self.install_button = ipw.Button(description="Install", disabled=True) self.install_button.on_click(self._install_version) self.uninstall_button = ipw.Button(description="Uninstall", disabled=True) self.uninstall_button.on_click(self._uninstall_app) self.update_button = ipw.Button(description="Update", disabled=True) self.update_button.on_click(self._update_app) self.issue_indicator = ipw.HTML() self.blocked_ignore = ipw.Checkbox(description="Ignore") self.blocked_ignore.observe(self._refresh_widget_state) self.compatibility_info = ipw.HTML() self.spinner = Spinner("color:#337ab7;font-size:1em;") ipw.dlink((self.app, "busy"), (self.spinner, "enabled")) children = [ ipw.HBox([self.compatibility_warning]), ipw.HBox([load_logo(app), body]), ipw.HBox( [ self.uninstall_button, self.install_button, self.update_button, self.spinner, ] ), ipw.HBox([self.install_info]), ipw.HBox([self.dependencies_log]), ipw.HBox([self.issue_indicator, self.blocked_ignore]), ipw.HBox([self.compatibility_info]), ] self.version_selector = VersionSelectorWidget() ipw.dlink( (self.app, "available_versions"), (self.version_selector.version_to_install, "options"), transform=lambda versions: [ (self._formatted_version(version), version) for version in versions ], ) ipw.dlink( (self.app, "installed_version"), (self.version_selector.installed_version, "value"), transform=self._formatted_version, ) self.version_selector.layout.visibility = ( "visible" if with_version_selector else "hidden" ) self.version_selector.disabled = True self.version_selector.version_to_install.observe( self._refresh_widget_state, "value" ) children.insert(2, self.version_selector) # Prereleases opt-in self.include_prereleases = ipw.Checkbox(description="Include prereleases") ipw.dlink( (self.include_prereleases, "value"), (self.app, "include_prereleases") ) self.app.observe( self._refresh_prereleases, names=["has_prereleases", "installed_version"] ) self._refresh_prereleases(change=dict(owner=self.app)) # initialize children.insert(3, self.include_prereleases) super().__init__(children=children) self.app.observe(self._refresh_widget_state) self.app.refresh_async() # init all widgets @staticmethod def _formatted_version(version): """Format the unambigious version identifiee to a human-friendly representation.""" if version is AppVersion.NOT_INSTALLED: return "[not installed]" if version is AppVersion.UNKNOWN: return "[unknown version]" if not version: # will be displayed during transition phases return "[n/a]" return version def _refresh_prereleases(self, change): app = change["owner"] installed_version = app.installed_version has_prereleases = app.has_prereleases prerelease_installed = ( parse(installed_version).is_prerelease if isinstance(installed_version, str) else False ) with self.hold_trait_notifications(): # The checkbox can only be enabled when the app has prereleases, # and cannot be disabled when a prerelease is currently installed. self.include_prereleases.disabled = ( prerelease_installed or not has_prereleases ) # The checkbox is checked if it was already checked or a prerelease is installed: self.include_prereleases.value = ( self.include_prereleases.value or prerelease_installed ) def _refresh_widget_state(self, _=None): """Refresh the widget to reflect the current state of the app.""" with self.hold_trait_notifications(): # Collect information about app state. installed = self.app.is_installed() installed_version = self.app.installed_version compatible = len(self.app.available_versions) > 0 registered = self.app.remote_update_status is not AppStatus.NOT_REGISTERED cannot_reach_registry = ( self.app.remote_update_status is AppStatus.CANNOT_REACH_REGISTRY ) busy = self.app.busy detached = self.app.detached available_versions = self.app.available_versions override = detached and self.blocked_ignore.value blocked_install = ( detached or not compatible ) and not self.blocked_ignore.value blocked_uninstall = ( detached or not registered or cannot_reach_registry ) and not self.blocked_ignore.value # Check app compatibility and show banner if not compatible. self.compatibility_warning.layout.visibility = ( "visible" if (self.app.is_installed() and self.app.compatible is False) else "hidden" ) # Prepare warning icons and messages depending on whether we override or not. # These messages and icons are only shown if needed. warn_or_ban_icon = "warning" if override else "ban" if override: tooltip_danger = "Operation will lead to potential loss of local data!" else: tooltip_danger = "Operation blocked due to potential data loss." tooltip_incompatible = "The app is not supported for this environment." # Determine whether we can install, updated, and uninstall. can_switch = ( installed_version != self.version_selector.version_to_install.value and available_versions ) latest_selected = self.version_selector.version_to_install.index == 0 can_install = ( can_switch and (detached or not latest_selected) ) or not installed can_uninstall = installed try: can_update = ( self.app.remote_update_status is AppStatus.UPDATE_AVAILABLE and installed ) except RuntimeError: can_update = None # Update the install button state. self.install_button.disabled = busy or blocked_install or not can_install self.install_button.button_style = "info" if can_install else "" self.install_button.icon = ( "" if can_install and not detached else warn_or_ban_icon if can_install else "" ) if self.app.compatible: self.install_button.tooltip = ( "" if can_install and not detached else tooltip_danger if can_install else "" ) else: self.install_button.tooltip = ( "" if installed and not detached else tooltip_danger if installed else tooltip_incompatible ) self.install_button.description = ( "Install" if not (installed and can_install) else f"Install ({self._formatted_version(self.version_selector.version_to_install.value)})" ) # Update the uninstall button state. self.uninstall_button.disabled = ( busy or blocked_uninstall or not can_uninstall ) self.uninstall_button.button_style = "danger" if can_uninstall else "" self.uninstall_button.icon = warn_or_ban_icon if detached else "trash-o" self.uninstall_button.tooltip = ( "" if can_uninstall and not detached else tooltip_danger if can_uninstall else "" ) # Update the update button state. self.update_button.disabled = busy or blocked_install or not can_update if self.app.is_installed() and can_update is None: self.update_button.icon = "warning" self.update_button.tooltip = ( "Unable to determine availability of updates." ) else: self.update_button.icon = ( "arrow-circle-up" if can_update and not detached else warn_or_ban_icon if can_update else "" ) self.update_button.button_style = "success" if can_update else "" self.update_button.tooltip = ( "" if can_update and not detached else tooltip_danger if can_update else "" ) # Update the version_selector widget state. more_than_one_version = ( len(self.version_selector.version_to_install.options) > 1 ) self.version_selector.disabled = ( busy or blocked_install or not more_than_one_version ) # Indicate whether there are local modifications and present option for user override. if cannot_reach_registry: self.issue_indicator.value = f'<i class="fa fa-{warn_or_ban_icon}"></i> Unable to reach the registry server.' elif not registered: self.issue_indicator.value = f'<i class="fa fa-{warn_or_ban_icon}"></i> The app is not registered.' elif detached: self.issue_indicator.value = ( f'<i class="fa fa-{warn_or_ban_icon}"></i> The app has local modifications or was checked out ' "to an unknown version." ) elif not compatible: self.issue_indicator.value = f'<i class="fa fa-{warn_or_ban_icon}"></i> The app is not supported for this environment.' else: self.issue_indicator.value = "" self.blocked_ignore.layout.visibility = ( "visible" if (detached or not compatible) else "hidden" ) if ( any(self.app.compatibility_info.values()) and self.app.compatible is False ): self.compatibility_info.value = self.COMPATIBILITY_INFO.render( app=self.app ) else: self.compatibility_info.value = "" def _show_msg_success(self, msg): """Show a message indicating successful execution of a requested operation.""" self.install_info.show_temporary_message(HTML_MSG_SUCCESS.format(msg)) def _show_msg_failure(self, msg): """Show a message indicating failure to execute a requested operation.""" self.install_info.show_temporary_message(HTML_MSG_FAILURE.format(msg)) def _check_detached_state(self): """Check whether the app is in a detached state which would prevent any install or other operations.""" self.app.refresh() self._refresh_widget_state() blocked = self.app.detached and not self.blocked_ignore.value if blocked: raise RuntimeError( "Unable to perform operation, the app is in a detached state." ) def _install_version(self, _=None): """Attempt to install the a specific version of the app.""" version = self.version_selector.version_to_install.value # can be None try: self._check_detached_state() version = self.app.install_app( version=version, stdout=self.dependencies_log ) # argument may be None except (AssertionError, RuntimeError, CalledProcessError) as error: self._show_msg_failure(str(error)) else: self._show_msg_success( f"Installed app ({self._formatted_version(version)})." ) def _update_app(self, _): """Attempt to update the app.""" try: self._check_detached_state() self.app.update_app(stdout=self.dependencies_log) except (AssertionError, RuntimeError, CalledProcessError) as error: self._show_msg_failure(str(error)) else: self._show_msg_success("Updated app.") def _uninstall_app(self, _): """Attempt to uninstall the app.""" try: self._check_detached_state() self.app.uninstall_app() except RuntimeError as error: self._show_msg_failure(str(error)) else: self._show_msg_success("Uninstalled app.")
home/app_manager.py
"""Module that contains widgets for managing AiiDAlab applications.""" from subprocess import CalledProcessError import ipywidgets as ipw import traitlets from aiidalab.app import AppRemoteUpdateStatus as AppStatus from aiidalab.app import AppVersion from jinja2 import Template from packaging.version import parse from home.utils import load_logo from home.widgets import LogOutputWidget, Spinner, StatusHTML HTML_MSG_PROGRESS = """{}""" HTML_MSG_SUCCESS = """<i class="fa fa-check" style="color:#337ab7;font-size:1em;" ></i> {}""" HTML_MSG_FAILURE = """<i class="fa fa-times" style="color:red;font-size:1em;" ></i> {}""" class VersionSelectorWidget(ipw.VBox): """Class to choose app's version.""" disabled = traitlets.Bool() prereleases = traitlets.Bool() def __init__(self, *args, **kwargs): style = {"description_width": "100px"} self.version_to_install = ipw.Dropdown( description="Install version", disabled=True, style=style, ) self.installed_version = ipw.Text( description="Installed version", disabled=True, style=style, ) self.info = StatusHTML( value="", layout={"max_width": "600px"}, style=style, ) super().__init__( children=[self.installed_version, self.version_to_install, self.info], layout={"min_width": "300px"}, *args, **kwargs, ) @traitlets.observe("disabled") def _observe_disabled(self, change): self.version_to_install.disabled = change["new"] class AppManagerWidget(ipw.VBox): """Widget for management of apps. Shows basic information about the app (description, authors, etc.) and provides an interface to install, uninstall, and update the application, as well as change versions if possible. """ COMPATIBILTIY_WARNING = Template( """<div class="alert alert-danger"> The installed version of this app is not compatible with this AiiDAlab environment. </div>""" ) COMPATIBILITY_INFO = Template( """<div class="alert alert-warning alert-dismissible"> <a href="#" class="close" data-dismiss="alert" aria-label="close">&times;</a> Reasons for incompatibility: <ul> {% for spec in app.compatibility_info %} <li>{{ spec }}: <ul> {% for missing_req in app.compatibility_info[spec] %} <li>missing: {{ missing_req }}</li> {% endfor %} </ul> </li> {% endfor %} </ul> </div>""" ) TEMPLATE = Template( """<b> <div style="font-size: 30px; text-align:center;">{{ app.title }}</div></b> <br> <b>Authors:</b> {{ app.authors }} <br> <b>Description:</b> {{ app.description }} {% if app.url %} <br> <b>URL:</b> <a href="{{ app.url }}">{{ app.url }}</a> {% endif %}""" ) def __init__(self, app, with_version_selector=False): self.app = app self.compatibility_warning = ipw.HTML(self.COMPATIBILTIY_WARNING.render()) self.compatibility_warning.layout = {"width": "600px"} self.compatibility_warning.layout.visibility = "hidden" body = ipw.HTML(self.TEMPLATE.render(app=app)) body.layout = {"width": "600px"} # Setup install_info self.install_info = StatusHTML( message="<p><br></p>" ) # show empty line by default self.dependencies_log = LogOutputWidget( layout=ipw.Layout(min_height="0px", max_height="100px") ) # max_height controls the maximum height of the log field. self.dependencies_log.template = ( "Installing dependencies..." + self.dependencies_log.template ) # Setup buttons self.install_button = ipw.Button(description="Install", disabled=True) self.install_button.on_click(self._install_version) self.uninstall_button = ipw.Button(description="Uninstall", disabled=True) self.uninstall_button.on_click(self._uninstall_app) self.update_button = ipw.Button(description="Update", disabled=True) self.update_button.on_click(self._update_app) self.issue_indicator = ipw.HTML() self.blocked_ignore = ipw.Checkbox(description="Ignore") self.blocked_ignore.observe(self._refresh_widget_state) self.compatibility_info = ipw.HTML() self.spinner = Spinner("color:#337ab7;font-size:1em;") ipw.dlink((self.app, "busy"), (self.spinner, "enabled")) children = [ ipw.HBox([self.compatibility_warning]), ipw.HBox([load_logo(app), body]), ipw.HBox( [ self.uninstall_button, self.install_button, self.update_button, self.spinner, ] ), ipw.HBox([self.install_info]), ipw.HBox([self.dependencies_log]), ipw.HBox([self.issue_indicator, self.blocked_ignore]), ipw.HBox([self.compatibility_info]), ] self.version_selector = VersionSelectorWidget() ipw.dlink( (self.app, "available_versions"), (self.version_selector.version_to_install, "options"), transform=lambda versions: [ (self._formatted_version(version), version) for version in versions ], ) ipw.dlink( (self.app, "installed_version"), (self.version_selector.installed_version, "value"), transform=self._formatted_version, ) self.version_selector.layout.visibility = ( "visible" if with_version_selector else "hidden" ) self.version_selector.disabled = True self.version_selector.version_to_install.observe( self._refresh_widget_state, "value" ) children.insert(2, self.version_selector) # Prereleases opt-in self.include_prereleases = ipw.Checkbox(description="Include prereleases") ipw.dlink( (self.include_prereleases, "value"), (self.app, "include_prereleases") ) self.app.observe( self._refresh_prereleases, names=["has_prereleases", "installed_version"] ) self._refresh_prereleases(change=dict(owner=self.app)) # initialize children.insert(3, self.include_prereleases) super().__init__(children=children) self.app.observe(self._refresh_widget_state) self.app.refresh_async() # init all widgets @staticmethod def _formatted_version(version): """Format the unambigious version identifiee to a human-friendly representation.""" if version is AppVersion.NOT_INSTALLED: return "[not installed]" if version is AppVersion.UNKNOWN: return "[unknown version]" if not version: # will be displayed during transition phases return "[n/a]" return version def _refresh_prereleases(self, change): app = change["owner"] installed_version = app.installed_version has_prereleases = app.has_prereleases prerelease_installed = ( parse(installed_version).is_prerelease if isinstance(installed_version, str) else False ) with self.hold_trait_notifications(): # The checkbox can only be enabled when the app has prereleases, # and cannot be disabled when a prerelease is currently installed. self.include_prereleases.disabled = ( prerelease_installed or not has_prereleases ) # The checkbox is checked if it was already checked or a prerelease is installed: self.include_prereleases.value = ( self.include_prereleases.value or prerelease_installed ) def _refresh_widget_state(self, _=None): """Refresh the widget to reflect the current state of the app.""" with self.hold_trait_notifications(): # Collect information about app state. installed = self.app.is_installed() installed_version = self.app.installed_version compatible = len(self.app.available_versions) > 0 registered = self.app.remote_update_status is not AppStatus.NOT_REGISTERED cannot_reach_registry = ( self.app.remote_update_status is AppStatus.CANNOT_REACH_REGISTRY ) busy = self.app.busy detached = self.app.detached available_versions = self.app.available_versions override = detached and self.blocked_ignore.value blocked_install = ( detached or not compatible ) and not self.blocked_ignore.value blocked_uninstall = ( detached or not registered or cannot_reach_registry ) and not self.blocked_ignore.value # Check app compatibility and show banner if not compatible. self.compatibility_warning.layout.visibility = ( "visible" if (self.app.is_installed() and self.app.compatible is False) else "hidden" ) # Prepare warning icons and messages depending on whether we override or not. # These messages and icons are only shown if needed. warn_or_ban_icon = "warning" if override else "ban" if override: tooltip_danger = "Operation will lead to potential loss of local data!" else: tooltip_danger = "Operation blocked due to potential data loss." tooltip_incompatible = "The app is not supported for this environment." # Determine whether we can install, updated, and uninstall. can_switch = ( installed_version != self.version_selector.version_to_install.value and available_versions ) latest_selected = self.version_selector.version_to_install.index == 0 can_install = ( can_switch and (detached or not latest_selected) ) or not installed can_uninstall = installed try: can_update = ( self.app.remote_update_status is AppStatus.UPDATE_AVAILABLE and installed ) except RuntimeError: can_update = None # Update the install button state. self.install_button.disabled = busy or blocked_install or not can_install self.install_button.button_style = "info" if can_install else "" self.install_button.icon = ( "" if can_install and not detached else warn_or_ban_icon if can_install else "" ) if self.app.compatible: self.install_button.tooltip = ( "" if can_install and not detached else tooltip_danger if can_install else "" ) else: self.install_button.tooltip = ( "" if installed and not detached else tooltip_danger if installed else tooltip_incompatible ) self.install_button.description = ( "Install" if not (installed and can_install) else f"Install ({self._formatted_version(self.version_selector.version_to_install.value)})" ) # Update the uninstall button state. self.uninstall_button.disabled = ( busy or blocked_uninstall or not can_uninstall ) self.uninstall_button.button_style = "danger" if can_uninstall else "" self.uninstall_button.icon = warn_or_ban_icon if detached else "trash-o" self.uninstall_button.tooltip = ( "" if can_uninstall and not detached else tooltip_danger if can_uninstall else "" ) # Update the update button state. self.update_button.disabled = busy or blocked_install or not can_update if self.app.is_installed() and can_update is None: self.update_button.icon = "warning" self.update_button.tooltip = ( "Unable to determine availability of updates." ) else: self.update_button.icon = ( "arrow-circle-up" if can_update and not detached else warn_or_ban_icon if can_update else "" ) self.update_button.button_style = "success" if can_update else "" self.update_button.tooltip = ( "" if can_update and not detached else tooltip_danger if can_update else "" ) # Update the version_selector widget state. more_than_one_version = ( len(self.version_selector.version_to_install.options) > 1 ) self.version_selector.disabled = ( busy or blocked_install or not more_than_one_version ) # Indicate whether there are local modifications and present option for user override. if cannot_reach_registry: self.issue_indicator.value = f'<i class="fa fa-{warn_or_ban_icon}"></i> Unable to reach the registry server.' elif not registered: self.issue_indicator.value = f'<i class="fa fa-{warn_or_ban_icon}"></i> The app is not registered.' elif detached: self.issue_indicator.value = ( f'<i class="fa fa-{warn_or_ban_icon}"></i> The app has local modifications or was checked out ' "to an unknown version." ) elif not compatible: self.issue_indicator.value = f'<i class="fa fa-{warn_or_ban_icon}"></i> The app is not supported for this environment.' else: self.issue_indicator.value = "" self.blocked_ignore.layout.visibility = ( "visible" if (detached or not compatible) else "hidden" ) if ( any(self.app.compatibility_info.values()) and self.app.compatible is False ): self.compatibility_info.value = self.COMPATIBILITY_INFO.render( app=self.app ) else: self.compatibility_info.value = "" def _show_msg_success(self, msg): """Show a message indicating successful execution of a requested operation.""" self.install_info.show_temporary_message(HTML_MSG_SUCCESS.format(msg)) def _show_msg_failure(self, msg): """Show a message indicating failure to execute a requested operation.""" self.install_info.show_temporary_message(HTML_MSG_FAILURE.format(msg)) def _check_detached_state(self): """Check whether the app is in a detached state which would prevent any install or other operations.""" self.app.refresh() self._refresh_widget_state() blocked = self.app.detached and not self.blocked_ignore.value if blocked: raise RuntimeError( "Unable to perform operation, the app is in a detached state." ) def _install_version(self, _=None): """Attempt to install the a specific version of the app.""" version = self.version_selector.version_to_install.value # can be None try: self._check_detached_state() version = self.app.install_app( version=version, stdout=self.dependencies_log ) # argument may be None except (AssertionError, RuntimeError, CalledProcessError) as error: self._show_msg_failure(str(error)) else: self._show_msg_success( f"Installed app ({self._formatted_version(version)})." ) def _update_app(self, _): """Attempt to update the app.""" try: self._check_detached_state() self.app.update_app(stdout=self.dependencies_log) except (AssertionError, RuntimeError, CalledProcessError) as error: self._show_msg_failure(str(error)) else: self._show_msg_success("Updated app.") def _uninstall_app(self, _): """Attempt to uninstall the app.""" try: self._check_detached_state() self.app.uninstall_app() except RuntimeError as error: self._show_msg_failure(str(error)) else: self._show_msg_success("Uninstalled app.")
0.691081
0.18508
import os # The DAG object; we'll need this to instantiate a DAG from airflow import DAG # Operators and utils required from airflow from airflow.operators.bash import BashOperator from airflow.operators.dummy import DummyOperator from airflow.operators.python import BranchPythonOperator from airflow.models import Variable from airflow.utils.task_group import TaskGroup home_directory = os.getenv('AIRFLOW_HOME', '/opt/airflow') metadata_directory = f"{home_directory}/metadata/" git_branch = Variable.get("git_branch", default_var='intake') git_repo = Variable.get("git_repo_metadata") # Task Configuration task_group_prefix = 'validate_metadata' git_user_email = '<EMAIL>' git_user_name = '<NAME>' def validate_metadata_folder(**kwargs): if not os.path.exists(metadata_directory): return f"{task_group_prefix}.clone_metadata" if len(os.listdir(metadata_directory)) == 0: return f"{task_group_prefix}.clone_metadata" return f"{task_group_prefix}.pull_metadata" def build_validate_metadata_taskgroup(dag: DAG) -> TaskGroup: validate_metadata_taskgroup = TaskGroup(group_id=task_group_prefix) bash_command_configure = f"git config --global user.email \"{git_user_email}\" && git config --global user.name \"{git_user_name}\"" configure_git = BashOperator( task_id='configure_git', bash_command=bash_command_configure, task_group=validate_metadata_taskgroup, dag=dag) """ Validates if the git folder is empty or not """ validate_git_folder = BranchPythonOperator( task_id=f"{task_group_prefix}_folder", python_callable=validate_metadata_folder, task_group=validate_metadata_taskgroup, dag=dag) """ If the git folder is empty, clone the repo """ bash_command_clone = f"git clone --single-branch --branch {git_branch} {git_repo} {metadata_directory}" git_clone = BashOperator( task_id='clone_metadata', bash_command=bash_command_clone, task_group=validate_metadata_taskgroup, dag=dag) """ If the git folder is not empty, pull the latest changes """ bash_command_pull = f"git -C {metadata_directory} pull origin {git_branch}" git_pull = BashOperator( task_id='pull_metadata', bash_command=bash_command_pull, task_group=validate_metadata_taskgroup, dag=dag) """ Dummy operator (DO NOT DELETE, IT WOULD BREAK THE FLOW) """ finished_pulling = DummyOperator( task_id='finished_pulling', trigger_rule='none_failed', task_group=validate_metadata_taskgroup, dag=dag) configure_git >> validate_git_folder >> [git_clone, git_pull] >> finished_pulling return validate_metadata_taskgroup
dlme_airflow/task_groups/validate_dlme_metadata.py
import os # The DAG object; we'll need this to instantiate a DAG from airflow import DAG # Operators and utils required from airflow from airflow.operators.bash import BashOperator from airflow.operators.dummy import DummyOperator from airflow.operators.python import BranchPythonOperator from airflow.models import Variable from airflow.utils.task_group import TaskGroup home_directory = os.getenv('AIRFLOW_HOME', '/opt/airflow') metadata_directory = f"{home_directory}/metadata/" git_branch = Variable.get("git_branch", default_var='intake') git_repo = Variable.get("git_repo_metadata") # Task Configuration task_group_prefix = 'validate_metadata' git_user_email = '<EMAIL>' git_user_name = '<NAME>' def validate_metadata_folder(**kwargs): if not os.path.exists(metadata_directory): return f"{task_group_prefix}.clone_metadata" if len(os.listdir(metadata_directory)) == 0: return f"{task_group_prefix}.clone_metadata" return f"{task_group_prefix}.pull_metadata" def build_validate_metadata_taskgroup(dag: DAG) -> TaskGroup: validate_metadata_taskgroup = TaskGroup(group_id=task_group_prefix) bash_command_configure = f"git config --global user.email \"{git_user_email}\" && git config --global user.name \"{git_user_name}\"" configure_git = BashOperator( task_id='configure_git', bash_command=bash_command_configure, task_group=validate_metadata_taskgroup, dag=dag) """ Validates if the git folder is empty or not """ validate_git_folder = BranchPythonOperator( task_id=f"{task_group_prefix}_folder", python_callable=validate_metadata_folder, task_group=validate_metadata_taskgroup, dag=dag) """ If the git folder is empty, clone the repo """ bash_command_clone = f"git clone --single-branch --branch {git_branch} {git_repo} {metadata_directory}" git_clone = BashOperator( task_id='clone_metadata', bash_command=bash_command_clone, task_group=validate_metadata_taskgroup, dag=dag) """ If the git folder is not empty, pull the latest changes """ bash_command_pull = f"git -C {metadata_directory} pull origin {git_branch}" git_pull = BashOperator( task_id='pull_metadata', bash_command=bash_command_pull, task_group=validate_metadata_taskgroup, dag=dag) """ Dummy operator (DO NOT DELETE, IT WOULD BREAK THE FLOW) """ finished_pulling = DummyOperator( task_id='finished_pulling', trigger_rule='none_failed', task_group=validate_metadata_taskgroup, dag=dag) configure_git >> validate_git_folder >> [git_clone, git_pull] >> finished_pulling return validate_metadata_taskgroup
0.419172
0.2349
from http import HTTPStatus from django.contrib.auth import get_user_model from django.test import Client, TestCase from django.urls import reverse from posts.models import Group, Post User = get_user_model() class PostsURLTests(TestCase): @classmethod def setUpClass(cls): super().setUpClass() cls.group = Group.objects.create( title='Тестовый заголовок группы', slug='test-slug', description='Тестовое описание группы', ) cls.user = User.objects.create_user(username='Testuser') cls.post = Post.objects.create( text='Тестовый текст', author=cls.user, group=cls.group ) def setUp(self): self.authorized_client = Client() self.authorized_client.force_login(PostsURLTests.user) def test_post_url_exists_at_desired_location(self): """Проверка доступности адресов в posts.url.""" username = PostsURLTests.user.username group_slug = PostsURLTests.group.slug post_id = PostsURLTests.post.id guest = self.client authorized = self.authorized_client permitted_url_names = ( ('/', guest), (f'/group/{group_slug}/', guest), ('/new/', authorized), ('/follow/', authorized), (f'/{username}/{post_id}/', guest), (f'/{username}/{post_id}/edit/', authorized), (f'/{username}/', guest) ) for url, client in permitted_url_names: with self.subTest(url=url): response = client.get(url) self.assertEqual(response.status_code, HTTPStatus.OK) def test_post_url_uses_correct_redirects(self): """Проверка redirect-ов для адресов posts.url.""" user2 = User.objects.create_user(username='Testuser2') reader = Client() reader.force_login(user2) username = PostsURLTests.user.username post_id = PostsURLTests.post.id guest = self.client auth_login = reverse('login') + '?next=' redirect_url_names = ( ('/new/', guest, auth_login + reverse('new_post')), (f'/{username}/{post_id}/edit/', guest, auth_login + reverse('post_edit', args=(username, post_id))), (f'/{username}/{post_id}/edit/', reader, reverse('post', args=(username, post_id))), (f'/{username}/follow/', guest, auth_login + reverse('profile_follow', args=(username,))), (f'/{username}/follow/', reader, reverse('profile', args=(username,))), (f'/{username}/unfollow/', guest, auth_login + reverse('profile_unfollow', args=(username,))), (f'/{username}/{post_id}/comment/', guest, auth_login + reverse('add_comment', args=(username, post_id))), ) for url, client, redirect in redirect_url_names: with self.subTest(url=url): response = client.get(url, follow=True) self.assertRedirects(response, redirect) def test_post_url_uses_correct_name_path(self): """Проверка name path() для адресов posts.url.""" username = PostsURLTests.user.username group_slug = PostsURLTests.group.slug post_id = PostsURLTests.post.id url_names = ( ('/', 'index', None), (f'/group/{group_slug}/', 'group_posts', (group_slug,)), ('/new/', 'new_post', None), ('/follow/', 'follow_index', None), (f'/{username}/{post_id}/', 'post', (username, post_id)), (f'/{username}/{post_id}/edit/', 'post_edit', (username, post_id)), (f'/{username}/{post_id}/comment/', 'add_comment', (username, post_id)), (f'/{username}/follow/', 'profile_follow', (username,)), (f'/{username}/unfollow/', 'profile_unfollow', (username,)), (f'/{username}/', 'profile', (username,)) ) for url, name, args in url_names: with self.subTest(url=url): self.assertEqual(url, reverse(name, args=args)) def test_incorrect_url_return_404_error(self): """Страница /abraabra/abraabra/ возвращает 404 код ответа.""" response = self.client.get('/abraabra/abraabra/') self.assertEqual(response.status_code, HTTPStatus.NOT_FOUND)
yatube/posts/tests/test_urls.py
from http import HTTPStatus from django.contrib.auth import get_user_model from django.test import Client, TestCase from django.urls import reverse from posts.models import Group, Post User = get_user_model() class PostsURLTests(TestCase): @classmethod def setUpClass(cls): super().setUpClass() cls.group = Group.objects.create( title='Тестовый заголовок группы', slug='test-slug', description='Тестовое описание группы', ) cls.user = User.objects.create_user(username='Testuser') cls.post = Post.objects.create( text='Тестовый текст', author=cls.user, group=cls.group ) def setUp(self): self.authorized_client = Client() self.authorized_client.force_login(PostsURLTests.user) def test_post_url_exists_at_desired_location(self): """Проверка доступности адресов в posts.url.""" username = PostsURLTests.user.username group_slug = PostsURLTests.group.slug post_id = PostsURLTests.post.id guest = self.client authorized = self.authorized_client permitted_url_names = ( ('/', guest), (f'/group/{group_slug}/', guest), ('/new/', authorized), ('/follow/', authorized), (f'/{username}/{post_id}/', guest), (f'/{username}/{post_id}/edit/', authorized), (f'/{username}/', guest) ) for url, client in permitted_url_names: with self.subTest(url=url): response = client.get(url) self.assertEqual(response.status_code, HTTPStatus.OK) def test_post_url_uses_correct_redirects(self): """Проверка redirect-ов для адресов posts.url.""" user2 = User.objects.create_user(username='Testuser2') reader = Client() reader.force_login(user2) username = PostsURLTests.user.username post_id = PostsURLTests.post.id guest = self.client auth_login = reverse('login') + '?next=' redirect_url_names = ( ('/new/', guest, auth_login + reverse('new_post')), (f'/{username}/{post_id}/edit/', guest, auth_login + reverse('post_edit', args=(username, post_id))), (f'/{username}/{post_id}/edit/', reader, reverse('post', args=(username, post_id))), (f'/{username}/follow/', guest, auth_login + reverse('profile_follow', args=(username,))), (f'/{username}/follow/', reader, reverse('profile', args=(username,))), (f'/{username}/unfollow/', guest, auth_login + reverse('profile_unfollow', args=(username,))), (f'/{username}/{post_id}/comment/', guest, auth_login + reverse('add_comment', args=(username, post_id))), ) for url, client, redirect in redirect_url_names: with self.subTest(url=url): response = client.get(url, follow=True) self.assertRedirects(response, redirect) def test_post_url_uses_correct_name_path(self): """Проверка name path() для адресов posts.url.""" username = PostsURLTests.user.username group_slug = PostsURLTests.group.slug post_id = PostsURLTests.post.id url_names = ( ('/', 'index', None), (f'/group/{group_slug}/', 'group_posts', (group_slug,)), ('/new/', 'new_post', None), ('/follow/', 'follow_index', None), (f'/{username}/{post_id}/', 'post', (username, post_id)), (f'/{username}/{post_id}/edit/', 'post_edit', (username, post_id)), (f'/{username}/{post_id}/comment/', 'add_comment', (username, post_id)), (f'/{username}/follow/', 'profile_follow', (username,)), (f'/{username}/unfollow/', 'profile_unfollow', (username,)), (f'/{username}/', 'profile', (username,)) ) for url, name, args in url_names: with self.subTest(url=url): self.assertEqual(url, reverse(name, args=args)) def test_incorrect_url_return_404_error(self): """Страница /abraabra/abraabra/ возвращает 404 код ответа.""" response = self.client.get('/abraabra/abraabra/') self.assertEqual(response.status_code, HTTPStatus.NOT_FOUND)
0.46393
0.124372
import itertools import re from collections import Counter import numpy as np import pandas as pd import pymystem3 mystem = pymystem3.Mystem() def clean_str(string): """ Tokenization/string cleaning for all datasets except for SST. Original taken from https://github.com/yoonkim/CNN_sentence/blob/master/process_data.py """ string = re.sub(r"[^A-Za-zА-Яа-я0-9(),!?\'\`]", " ", string) string = re.sub(r"\'s", " \'s", string) string = re.sub(r"\'ve", " \'ve", string) string = re.sub(r"n\'t", " n\'t", string) string = re.sub(r"\'re", " \'re", string) string = re.sub(r"\'d", " \'d", string) string = re.sub(r"\'ll", " \'ll", string) string = re.sub(r",", " , ", string) string = re.sub(r"!", " ! ", string) string = re.sub(r"\(", " \( ", string) string = re.sub(r"\)", " \) ", string) string = re.sub(r"\?", " \? ", string) string = re.sub(r"\s{2,}", " ", string) return string.strip().lower() def load_data_and_labels_pos_neg(): """ Loads MR polarity data from files, splits the data into words and generates labels. Returns split sentences and labels. """ # Load data from files positive_examples = list(open("./data/rt-polarity.pos").readlines()) positive_examples = [s.strip() for s in positive_examples] negative_examples = list(open("./data/rt-polarity.neg").readlines()) negative_examples = [s.strip() for s in negative_examples] # Split by words x_text = positive_examples + negative_examples x_text = [clean_str(sent) for sent in x_text] x_text = [s.split(" ") for s in x_text] # Generate labels positive_labels = [[0, 1] for _ in positive_examples] negative_labels = [[1, 0] for _ in negative_examples] y = np.concatenate([positive_labels, negative_labels], 0) return [x_text, y] def pad_sentences(sentences, maxlen=56, padding_word="<PAD/>"): """ Pads all sentences to the same length. Returns padded sentences. """ sequence_length = maxlen # max(len(x) for x in sentences) padded_sentences = [] for i in range(len(sentences)): sentence = sentences[i] num_padding = max(0, sequence_length - len(sentence)) new_sentence = sentence[:sequence_length] + [padding_word] * num_padding padded_sentences.append(new_sentence) return padded_sentences def build_vocab(sentences): """ Builds a vocabulary mapping from word to index based on the sentences. Returns vocabulary mapping and inverse vocabulary mapping. """ # Build vocabulary word_counts = Counter(itertools.chain(*sentences)) # Mapping from index to word vocabulary_inv = [x[0] for x in word_counts.most_common()] # Mapping from word to index vocabulary = {x: i for i, x in enumerate(vocabulary_inv)} return [vocabulary, vocabulary_inv] def build_input_x(sentences, vocabulary): """ Maps sentencs and labels to vectors based on a vocabulary. """ x = np.array([[vocabulary[word] for word in sentence] for sentence in sentences]) return x def build_input_data(sentences, labels, vocabulary): """ Maps sentencs and labels to vectors based on a vocabulary. """ x = build_input_x(sentences, vocabulary) y = np.array(labels) return [x, y] def load_data_pos_neg(): """ Loads and preprocessed data for the MR dataset. Returns input vectors, labels, vocabulary, and inverse vocabulary. """ # Load and preprocess data sentences, labels = load_data_and_labels_pos_neg() sentences_padded = pad_sentences(sentences) vocabulary, vocabulary_inv = build_vocab(sentences_padded) x, y = build_input_data(sentences_padded, labels, vocabulary) return [x, y, vocabulary, vocabulary_inv] def build_word_level_data(train_data, test_data): sentences_train, labels_train = train_data sentences_test, labels_test = test_data sentences_train = [clean_str(sent) for sent in sentences_train] sentences_train = [mystem.lemmatize(s) for s in sentences_train] sentences_test = [clean_str(sent) for sent in sentences_test] sentences_test = [mystem.lemmatize(s) for s in sentences_test] sentences_train_padded = pad_sentences(list(sentences_train)) sentences_test_padded = pad_sentences(list(sentences_test)) print(" ".join(sentences_train_padded[0])) vocabulary, vocabulary_inv = \ build_vocab(sentences_train_padded + sentences_test_padded) x_train, y_train = build_input_data(sentences_train_padded, labels_train, vocabulary) x_test, y_test = build_input_data(sentences_test_padded, labels_test, vocabulary) return x_train, y_train, x_test, y_test, vocabulary, vocabulary_inv def encode_word_level_data(prepared_x, vocabulary): x = build_input_x(pad_sentences(list(prepared_x.ix[:, 0])), vocabulary) return x def batch_iter(data, batch_size, num_epochs): """ Generates a batch iterator for a dataset. """ data = np.array(data) data_size = len(data.shape[0]) num_batches_per_epoch = int(len(data) / batch_size) + 1 for epoch in range(num_epochs): # Shuffle the data at each epoch shuffle_indices = np.random.permutation(np.arange(data_size)) shuffled_data = data[shuffle_indices] for batch_num in range(num_batches_per_epoch): start_index = batch_num * batch_size end_index = min((batch_num + 1) * batch_size, data_size) yield shuffled_data[start_index:end_index] def read_data_file(fname, target_index=0, normalize=True, binary=False): content = pd.read_csv(fname, header=None, index_col=False) content.dropna(inplace=True) content.reset_index(inplace=True, drop=True) x = content.ix[:, content.shape[1] - 1] x = np.array(x) y = content.ix[:, target_index].values + 0.0 if normalize: max_y = np.max(np.abs(y)) y /= max_y if binary: vals = list(set(y)) if len(vals) > 2: raise Exception("Binary input data is not binary! Dataset %s, target_index=%d" % (fname, target_index)) y = np.array([0 if a == vals[0] else 1 for a in y]) return x, y def load_ok_data_gender(): train_data = read_data_file('./data/ok/ok_train.csv', target_index=2, binary=True) test_data = read_data_file('./data/ok/ok_test.csv', target_index=2, binary=True) return train_data, test_data def load_ok_user_data_gender(): train_data = read_data_file('./data/ok/ok_user_train.csv', target_index=2, binary=True) test_data = read_data_file('./data/ok/ok_user_test.csv', target_index=2, binary=True) return train_data, test_data def load_sentirueval_data(): train_data = read_data_file('./data/sentirueval/train.csv') test_data = read_data_file('./data/sentirueval/test.csv') return train_data, test_data def shuffle_matrix(x, y): stacked = np.hstack((np.matrix(x).T, np.asmatrix(y).T)) np.random.shuffle(stacked) xi = np.array(stacked[:, 0]).flatten() yi = np.array(stacked[:, 1:]) return xi, yi def clean_data_np(x): # load data all = [s.strip() for s in list(x)] # split by words x_text = [clean_str(sent) for sent in all] x_text = [s.split(u" ") for s in x_text] return x_text def clean_data_lists(x): # load data all = [s.strip() for s in x] # split by words x_text = [clean_str(sent) for sent in all] x_text = [s.split(u" ") for s in x_text] return x_text if __name__ == '__main__': # read_w2v() df = pd.DataFrame([{"x": u"привет"}, {"x": u"пока"}])
data_helpers.py
import itertools import re from collections import Counter import numpy as np import pandas as pd import pymystem3 mystem = pymystem3.Mystem() def clean_str(string): """ Tokenization/string cleaning for all datasets except for SST. Original taken from https://github.com/yoonkim/CNN_sentence/blob/master/process_data.py """ string = re.sub(r"[^A-Za-zА-Яа-я0-9(),!?\'\`]", " ", string) string = re.sub(r"\'s", " \'s", string) string = re.sub(r"\'ve", " \'ve", string) string = re.sub(r"n\'t", " n\'t", string) string = re.sub(r"\'re", " \'re", string) string = re.sub(r"\'d", " \'d", string) string = re.sub(r"\'ll", " \'ll", string) string = re.sub(r",", " , ", string) string = re.sub(r"!", " ! ", string) string = re.sub(r"\(", " \( ", string) string = re.sub(r"\)", " \) ", string) string = re.sub(r"\?", " \? ", string) string = re.sub(r"\s{2,}", " ", string) return string.strip().lower() def load_data_and_labels_pos_neg(): """ Loads MR polarity data from files, splits the data into words and generates labels. Returns split sentences and labels. """ # Load data from files positive_examples = list(open("./data/rt-polarity.pos").readlines()) positive_examples = [s.strip() for s in positive_examples] negative_examples = list(open("./data/rt-polarity.neg").readlines()) negative_examples = [s.strip() for s in negative_examples] # Split by words x_text = positive_examples + negative_examples x_text = [clean_str(sent) for sent in x_text] x_text = [s.split(" ") for s in x_text] # Generate labels positive_labels = [[0, 1] for _ in positive_examples] negative_labels = [[1, 0] for _ in negative_examples] y = np.concatenate([positive_labels, negative_labels], 0) return [x_text, y] def pad_sentences(sentences, maxlen=56, padding_word="<PAD/>"): """ Pads all sentences to the same length. Returns padded sentences. """ sequence_length = maxlen # max(len(x) for x in sentences) padded_sentences = [] for i in range(len(sentences)): sentence = sentences[i] num_padding = max(0, sequence_length - len(sentence)) new_sentence = sentence[:sequence_length] + [padding_word] * num_padding padded_sentences.append(new_sentence) return padded_sentences def build_vocab(sentences): """ Builds a vocabulary mapping from word to index based on the sentences. Returns vocabulary mapping and inverse vocabulary mapping. """ # Build vocabulary word_counts = Counter(itertools.chain(*sentences)) # Mapping from index to word vocabulary_inv = [x[0] for x in word_counts.most_common()] # Mapping from word to index vocabulary = {x: i for i, x in enumerate(vocabulary_inv)} return [vocabulary, vocabulary_inv] def build_input_x(sentences, vocabulary): """ Maps sentencs and labels to vectors based on a vocabulary. """ x = np.array([[vocabulary[word] for word in sentence] for sentence in sentences]) return x def build_input_data(sentences, labels, vocabulary): """ Maps sentencs and labels to vectors based on a vocabulary. """ x = build_input_x(sentences, vocabulary) y = np.array(labels) return [x, y] def load_data_pos_neg(): """ Loads and preprocessed data for the MR dataset. Returns input vectors, labels, vocabulary, and inverse vocabulary. """ # Load and preprocess data sentences, labels = load_data_and_labels_pos_neg() sentences_padded = pad_sentences(sentences) vocabulary, vocabulary_inv = build_vocab(sentences_padded) x, y = build_input_data(sentences_padded, labels, vocabulary) return [x, y, vocabulary, vocabulary_inv] def build_word_level_data(train_data, test_data): sentences_train, labels_train = train_data sentences_test, labels_test = test_data sentences_train = [clean_str(sent) for sent in sentences_train] sentences_train = [mystem.lemmatize(s) for s in sentences_train] sentences_test = [clean_str(sent) for sent in sentences_test] sentences_test = [mystem.lemmatize(s) for s in sentences_test] sentences_train_padded = pad_sentences(list(sentences_train)) sentences_test_padded = pad_sentences(list(sentences_test)) print(" ".join(sentences_train_padded[0])) vocabulary, vocabulary_inv = \ build_vocab(sentences_train_padded + sentences_test_padded) x_train, y_train = build_input_data(sentences_train_padded, labels_train, vocabulary) x_test, y_test = build_input_data(sentences_test_padded, labels_test, vocabulary) return x_train, y_train, x_test, y_test, vocabulary, vocabulary_inv def encode_word_level_data(prepared_x, vocabulary): x = build_input_x(pad_sentences(list(prepared_x.ix[:, 0])), vocabulary) return x def batch_iter(data, batch_size, num_epochs): """ Generates a batch iterator for a dataset. """ data = np.array(data) data_size = len(data.shape[0]) num_batches_per_epoch = int(len(data) / batch_size) + 1 for epoch in range(num_epochs): # Shuffle the data at each epoch shuffle_indices = np.random.permutation(np.arange(data_size)) shuffled_data = data[shuffle_indices] for batch_num in range(num_batches_per_epoch): start_index = batch_num * batch_size end_index = min((batch_num + 1) * batch_size, data_size) yield shuffled_data[start_index:end_index] def read_data_file(fname, target_index=0, normalize=True, binary=False): content = pd.read_csv(fname, header=None, index_col=False) content.dropna(inplace=True) content.reset_index(inplace=True, drop=True) x = content.ix[:, content.shape[1] - 1] x = np.array(x) y = content.ix[:, target_index].values + 0.0 if normalize: max_y = np.max(np.abs(y)) y /= max_y if binary: vals = list(set(y)) if len(vals) > 2: raise Exception("Binary input data is not binary! Dataset %s, target_index=%d" % (fname, target_index)) y = np.array([0 if a == vals[0] else 1 for a in y]) return x, y def load_ok_data_gender(): train_data = read_data_file('./data/ok/ok_train.csv', target_index=2, binary=True) test_data = read_data_file('./data/ok/ok_test.csv', target_index=2, binary=True) return train_data, test_data def load_ok_user_data_gender(): train_data = read_data_file('./data/ok/ok_user_train.csv', target_index=2, binary=True) test_data = read_data_file('./data/ok/ok_user_test.csv', target_index=2, binary=True) return train_data, test_data def load_sentirueval_data(): train_data = read_data_file('./data/sentirueval/train.csv') test_data = read_data_file('./data/sentirueval/test.csv') return train_data, test_data def shuffle_matrix(x, y): stacked = np.hstack((np.matrix(x).T, np.asmatrix(y).T)) np.random.shuffle(stacked) xi = np.array(stacked[:, 0]).flatten() yi = np.array(stacked[:, 1:]) return xi, yi def clean_data_np(x): # load data all = [s.strip() for s in list(x)] # split by words x_text = [clean_str(sent) for sent in all] x_text = [s.split(u" ") for s in x_text] return x_text def clean_data_lists(x): # load data all = [s.strip() for s in x] # split by words x_text = [clean_str(sent) for sent in all] x_text = [s.split(u" ") for s in x_text] return x_text if __name__ == '__main__': # read_w2v() df = pd.DataFrame([{"x": u"привет"}, {"x": u"пока"}])
0.779783
0.555435
from unittest import mock import pytest @pytest.fixture def apps(): """ Mocks 'apps.get_model()' parameter in migration """ from .models import DummyModel mocked_apps = mock.MagicMock() mocked_apps.get_model = mock.MagicMock(return_value=DummyModel) return mocked_apps @pytest.fixture def schema_editor(): """ Mocks 'schema_editor.execute()' in migration """ mocked_schema_editor = mock.MagicMock() mocked_schema_editor.execute = mock.MagicMock() return mocked_schema_editor def test_AddAuditToModel_upgrade(apps, schema_editor): """ It should emit proper upgrade query for specified model """ from audit_trail.migrating import AddAuditToModel as Operation operation = Operation('DummyModel', 'tests') operation.code(apps, schema_editor) schema_editor.execute.assert_called_with( "SELECT audit.audit_table('tests_dummymodel', 't', 't', '{}')") def test_AddAuditToModel_upgrade_exclude_sql(apps, schema_editor): """ It should allow omission of SQL in audit log """ from audit_trail.migrating import AddAuditToModel as Operation operation = Operation('DummyModel', 'tests', include_query=False) operation.code(apps, schema_editor) schema_editor.execute.assert_called_with( "SELECT audit.audit_table('tests_dummymodel', 't', 'f', '{}')") def test_AddAuditToModel_upgrade_exclude_cols(apps, schema_editor): """ It should allow exclusion of certain columns """ from audit_trail.migrating import AddAuditToModel as Operation operation = Operation('DummyModel', 'tests', exclude=['id']) operation.code(apps, schema_editor) schema_editor.execute.assert_called_with( "SELECT audit.audit_table('tests_dummymodel', 't', 't', '{id}')") def test_AddAuditToModel_downgrade(apps, schema_editor): """ It should downgrade """ from audit_trail.migrating import AddAuditToModel as Operation operation = Operation('DummyModel', 'tests', exclude=['id']) operation.reverse_code(apps, schema_editor) assert schema_editor.execute.mock_calls == [ mock.call('DROP TRIGGER IF EXISTS audit_trigger_row ON tests_dummymodel'), mock.call('DROP TRIGGER IF EXISTS audit_trigger_stm ON tests_dummymodel') ]
tests/test_migrating.py
from unittest import mock import pytest @pytest.fixture def apps(): """ Mocks 'apps.get_model()' parameter in migration """ from .models import DummyModel mocked_apps = mock.MagicMock() mocked_apps.get_model = mock.MagicMock(return_value=DummyModel) return mocked_apps @pytest.fixture def schema_editor(): """ Mocks 'schema_editor.execute()' in migration """ mocked_schema_editor = mock.MagicMock() mocked_schema_editor.execute = mock.MagicMock() return mocked_schema_editor def test_AddAuditToModel_upgrade(apps, schema_editor): """ It should emit proper upgrade query for specified model """ from audit_trail.migrating import AddAuditToModel as Operation operation = Operation('DummyModel', 'tests') operation.code(apps, schema_editor) schema_editor.execute.assert_called_with( "SELECT audit.audit_table('tests_dummymodel', 't', 't', '{}')") def test_AddAuditToModel_upgrade_exclude_sql(apps, schema_editor): """ It should allow omission of SQL in audit log """ from audit_trail.migrating import AddAuditToModel as Operation operation = Operation('DummyModel', 'tests', include_query=False) operation.code(apps, schema_editor) schema_editor.execute.assert_called_with( "SELECT audit.audit_table('tests_dummymodel', 't', 'f', '{}')") def test_AddAuditToModel_upgrade_exclude_cols(apps, schema_editor): """ It should allow exclusion of certain columns """ from audit_trail.migrating import AddAuditToModel as Operation operation = Operation('DummyModel', 'tests', exclude=['id']) operation.code(apps, schema_editor) schema_editor.execute.assert_called_with( "SELECT audit.audit_table('tests_dummymodel', 't', 't', '{id}')") def test_AddAuditToModel_downgrade(apps, schema_editor): """ It should downgrade """ from audit_trail.migrating import AddAuditToModel as Operation operation = Operation('DummyModel', 'tests', exclude=['id']) operation.reverse_code(apps, schema_editor) assert schema_editor.execute.mock_calls == [ mock.call('DROP TRIGGER IF EXISTS audit_trigger_row ON tests_dummymodel'), mock.call('DROP TRIGGER IF EXISTS audit_trigger_stm ON tests_dummymodel') ]
0.559049
0.430267
from copy import deepcopy import numpy as np from random import Random class Matrix: # Initializes to zero matrix def __init__(self, row, col): self.row = row self.col = col self.matrix = [[0 for x in range(self.row)] for x in range(self.col) ] # String representation of matrix def __str__(self): return str(self.__dict__) def __eq__(self, other): return self.__dict__ == other.__dict__ # Allows index access to matrix, ex: matrix[2][3] def this(self, row, col): return self.matrix[row][col] # Get the number of rows in the matrix def getNumRow(self): return self.row # Get the number of columns in the matrix def getNumCol(self): return self.col # Converts 2d list to 1d array of floats def toPackedArray(self): pass # TO be added def fromPackedArray(self): pass # Create random matrix with single column def createColumnMatrix(self, values): self.matrix = self.matrix.append([values]) # Create random matrix with single row. def createRowMatrix(self, row): for i in row: self.matrix.append(np.random.rand) # Adds the value to every cell in the matrix def add(self, row, col, value): pass # Set every cell in a matrix to zero def clear(self): self.matrix = [[0 for x in range(self.row)] for x in range(self.col) ] # Clones matrix object def clone(self): return self.matrix # Determines if matrices are equal with precision def equals(self, precision): pass # Gets one column from matrix obj as new matrix obj def getCol(self, col): pass # Gets one row from matrix obj as new matrix obj def getRow(self, row): pass # isZero: Determines if every cell in a matrix object is zero. def isZero(self): pass def randomize(self, minimum, maximum): self.matrix = np.random.randint(minimum,maximum, size=(self.row, self.col)) # sumCell: Returns the sum of every cell in a matrix obj def sumCell(self): pass # Sets the value of a cell def setCell(self, row, col, value): self.matrix[row][col] = value
ANN Python/matrix.py
from copy import deepcopy import numpy as np from random import Random class Matrix: # Initializes to zero matrix def __init__(self, row, col): self.row = row self.col = col self.matrix = [[0 for x in range(self.row)] for x in range(self.col) ] # String representation of matrix def __str__(self): return str(self.__dict__) def __eq__(self, other): return self.__dict__ == other.__dict__ # Allows index access to matrix, ex: matrix[2][3] def this(self, row, col): return self.matrix[row][col] # Get the number of rows in the matrix def getNumRow(self): return self.row # Get the number of columns in the matrix def getNumCol(self): return self.col # Converts 2d list to 1d array of floats def toPackedArray(self): pass # TO be added def fromPackedArray(self): pass # Create random matrix with single column def createColumnMatrix(self, values): self.matrix = self.matrix.append([values]) # Create random matrix with single row. def createRowMatrix(self, row): for i in row: self.matrix.append(np.random.rand) # Adds the value to every cell in the matrix def add(self, row, col, value): pass # Set every cell in a matrix to zero def clear(self): self.matrix = [[0 for x in range(self.row)] for x in range(self.col) ] # Clones matrix object def clone(self): return self.matrix # Determines if matrices are equal with precision def equals(self, precision): pass # Gets one column from matrix obj as new matrix obj def getCol(self, col): pass # Gets one row from matrix obj as new matrix obj def getRow(self, row): pass # isZero: Determines if every cell in a matrix object is zero. def isZero(self): pass def randomize(self, minimum, maximum): self.matrix = np.random.randint(minimum,maximum, size=(self.row, self.col)) # sumCell: Returns the sum of every cell in a matrix obj def sumCell(self): pass # Sets the value of a cell def setCell(self, row, col, value): self.matrix[row][col] = value
0.850903
0.594993
from enum import Enum import datetime import pprint import xmltodict from connectinfo import RawConnectInfo class ManifestType(Enum): CREATE_SLIVER = 0 RENEW_OR_LIST_SLIVER = 1 class Manifest(object): '''Object to store parsed manifest''' def __init__(self, manifest, do_parse=True): self.data = xmltodict.parse(manifest.text) if do_parse else manifest if self.__has_indices('rspec', 'node', 0): self.__num_nodes = len(self.data['rspec']['node']) else: self.__num_nodes = 1 @property def num_nodes(self): return self.__num_nodes @property def expiration(self): tmp = self.data['rspec']['@expires'] if ManifestType.CREATE_SLIVER else self.data['rspec']['pg_expires'] return datetime.datetime.strptime(tmp, '%Y-%m-%dT%H:%M:%SZ') def __len__(self): return self.__num_nodes def __str__(self): return str(self.data) def __repr__(self): return self.__str__() def print_full(self): pprint.pprint(self.data) def __has_indices(self, *indices): ptr = self.data try: for x in indices: ptr = ptr[x] return True except KeyError as e: return False def get_connect_info(self): '''Returns iterable of `RawConnectInfo`:(name, user, ip_local, ip_public, port) for all found nodes''' if self.__num_nodes > 1: return [RawConnectInfo( str(self.data['rspec']['node'][idx]['@client_id']), str(self.data['rspec']['node'][idx]['services']['login']['@username']), str(self.data['rspec']['node'][idx]['interface']['ip']['@address']), str(self.data['rspec']['node'][idx]['host']['@ipv4']), str(self.data['rspec']['node'][idx]['services']['login']['@port'])) for idx in range(self.__num_nodes)] elif self.__num_nodes == 1: name = str(self.data['rspec']['node']['@client_id']) user = str(self.data['rspec']['node']['services']['login']['@username']) ip_local = str(self.data['rspec']['node']['interface']['ip']['@address']) ip_public = str(self.data['rspec']['node']['host']['@ipv4']) port = str(self.data['rspec']['node']['services']['login']['@port']) return [RawConnectInfo(name, user, ip_local, ip_public, port)] else: raise RuntimeError('No nodes found!')
metareserve_geni/internal/gni/py2/manifest/manifest.py
from enum import Enum import datetime import pprint import xmltodict from connectinfo import RawConnectInfo class ManifestType(Enum): CREATE_SLIVER = 0 RENEW_OR_LIST_SLIVER = 1 class Manifest(object): '''Object to store parsed manifest''' def __init__(self, manifest, do_parse=True): self.data = xmltodict.parse(manifest.text) if do_parse else manifest if self.__has_indices('rspec', 'node', 0): self.__num_nodes = len(self.data['rspec']['node']) else: self.__num_nodes = 1 @property def num_nodes(self): return self.__num_nodes @property def expiration(self): tmp = self.data['rspec']['@expires'] if ManifestType.CREATE_SLIVER else self.data['rspec']['pg_expires'] return datetime.datetime.strptime(tmp, '%Y-%m-%dT%H:%M:%SZ') def __len__(self): return self.__num_nodes def __str__(self): return str(self.data) def __repr__(self): return self.__str__() def print_full(self): pprint.pprint(self.data) def __has_indices(self, *indices): ptr = self.data try: for x in indices: ptr = ptr[x] return True except KeyError as e: return False def get_connect_info(self): '''Returns iterable of `RawConnectInfo`:(name, user, ip_local, ip_public, port) for all found nodes''' if self.__num_nodes > 1: return [RawConnectInfo( str(self.data['rspec']['node'][idx]['@client_id']), str(self.data['rspec']['node'][idx]['services']['login']['@username']), str(self.data['rspec']['node'][idx]['interface']['ip']['@address']), str(self.data['rspec']['node'][idx]['host']['@ipv4']), str(self.data['rspec']['node'][idx]['services']['login']['@port'])) for idx in range(self.__num_nodes)] elif self.__num_nodes == 1: name = str(self.data['rspec']['node']['@client_id']) user = str(self.data['rspec']['node']['services']['login']['@username']) ip_local = str(self.data['rspec']['node']['interface']['ip']['@address']) ip_public = str(self.data['rspec']['node']['host']['@ipv4']) port = str(self.data['rspec']['node']['services']['login']['@port']) return [RawConnectInfo(name, user, ip_local, ip_public, port)] else: raise RuntimeError('No nodes found!')
0.38341
0.100834
import csv import re # Regular expression to detect potential string values with missing quotes sql_fun = ['true', 'false', 'avg', 'count', 'first', 'last', 'max', 'min', 'sum', 'ucase', 'lcase', 'mid', 'len', 'round', 'now', 'format'] string_exp = re.compile('^(?!["\']|{}).*[a-z]'.format('|'.join(sql_fun)), re.IGNORECASE) class CsvImporter(object): """ CsvImporter imports values from a csv file into records and creates sql insert statements to create the corresponding rows in the target db. :param path: Path to the csv file to import :param dialect: Dictionary with csv reader dialect specifications (see http://docs.python.org/2/library/csv.html#csv-fmt-params) :param import_specs: Dictionary with import specifications for each table. RecordSpecs are used to tell the script how to extract the csv columns into db records. Each entry can have multiple RecordSpecs, identified by a unique key which is used to resolve cross references in the attr_map of each RecordSpec. """ def __init__(self, path, dialect, import_specs): self.path = path self.dialect = dialect # Flatten import_specs to {(table, instance): record_spec} "t,i,s" form flat_specs = {} for (t, table_spec) in import_specs.items(): specs = {(t, i): s for (i, s) in table_spec.items()} flat_specs.update(specs) # Create a XReference dependency map and sort it topologically dependency_map = {} for (path, s) in flat_specs.items(): deps = set([(x.table_name, x.instance_name) for x in s.attr_map.values() if isinstance(x, XReference)]) dependency_map[path] = deps sorted_keys = [val for sub in _toposort(dependency_map) for val in sub] # Store sorted results in a list [(t, i, s), ...] try: self.specs = [(t, i, flat_specs[(t, i)]) for (t, i) in sorted_keys] except KeyError: print('ERROR: Could not find specification for "{}" in table ' '"{}". Check your XReferences.'.format(i, t)) exit(-1) def import_data(self, id_col=None): """ Imports the csv into DbRecords and returns them. The method uses the import specification (import_specs) that was passed to the importer on init to convert csv table columns to DbRecord objects. """ records = [] with open(self.path) as f: csv.register_dialect('csv2db', **self.dialect) reader = csv.DictReader(f, dialect='csv2db') row_num = 0 for row in reader: row_id = row[id_col] if id_col else row_num records += self._records_for_row(row, row_id); row_num += 1 return records def _records_for_row(self, row, row_id): """ Import one single row and return the resulting DbRecord objects """ records = [] xref_map = {} for (table, instance, spec) in self.specs: if spec.condition(row) is False: continue # Create record and import attributes according to spec record = DbRecord(table, row_id) record.import_attributes(spec.attr_map, xref_map, row) records.append(record) # Keep a reference to each record instance that we create for # resolving XReferences in later instances instance_path = (table, instance) xref_map[instance_path] = record return records class RecordSpec(object): """ Specifications for extracting csv columns into the corresponding database record. :param attr_map: A dictionary that maps database columns to csv columns using any of the ...Value classes below. :param condition: An optional callable that returns false if the object should not be created for the row that is currently. The callable must accept exactly one parameter (the current row). """ def __init__(self, attr_map, condition=None): self.attr_map = attr_map self.condition = condition if condition else lambda row: True class ColumnValue(object): """ Read an input value from a csv column :param col_name: Column name to read the value from :param convert: Optional conversion function that takes exactly one argument which is the row dict for the currently imported row """ def __init__(self, col_name, convert=None): self.col_name = col_name self.convert = convert def _read(self, row, **kw_args): value = row[self.col_name] return self.convert(value) if self.convert else value class MultiColumnValue(object): """ Reads input from multiple columns and contracts them into a single value using the (non-optional) callable given in *convert*. :param col_names: List of column names to read values from :param convert: Conversion function that takes exactly one argument (the row dict of the currently imported row) and contracts the values into a single return value """ def __init__(self, col_names, convert): if not convert: raise ValueError('ERROR: You must provide a convert function') self.col_names = col_names self.convert = convert def _read(self, row, **kw_args): values = {key: row[key] for key in self.col_names} return self.convert(values) class ConstValue(object): """ Always returns the same constant value :param value: The value to return for each row """ def __init__(self, value): self.value = value def _read(self, row, **kw_args): return self.value class DynamicValue(object): """ Creates a value dynamically using the callable *generate* :param generate: A function or other callable that takes a single argument (the current row dict) and returns a single value """ def __init__(self, generate): self.generate = generate def _read(self, row, **kw_args): return self.generate(row) class XReference(object): """ Takes the value of a specific attribute of another record. :param table_name: Table name in the import_specs table given to the *CsvImporter* :param instance_name: Identifies a specific instance under *table_name* :param attribute_name: Name of the attribute to return """ def __init__(self, table_name, instance_name, attribute_name): self.table_name = table_name self.instance_name = instance_name self.attribute_name = attribute_name def _read(self, row, **kw_args): existing_records = kw_args['existing_records'] path = (self.table_name, self.instance_name) value = existing_records[path].attributes[self.attribute_name] return value class DbRecord(object): """ One or more DbRecords are created for each imported row accoding to the RecordSpecs. """ def __init__(self, table_name, row_id): self.row_id = row_id self.table_name = table_name self.attributes = {} def import_attributes(self, attr_map, existing_records, row): """ Import attributes according to the attr_map and resolve cross references to existing_records. """ try: imported = {k: v._read(row, existing_records=existing_records) for (k, v) in attr_map.iteritems()} except AttributeError: k, v = next((k, v) for (k, v) in attr_map.iteritems() if '_read' not in dir(v)) print('ERROR: The RecordSpec for {} in {} does not seem to be ' 'valid'.format(k, self.table_name)) exit(-1) self.attributes.update(imported) def insert_statement(self): """ Returns the insert statement sequence for the current object """ col = ' (%s)' % ', '.join(self.attributes.keys()) # sanity checks error = False for k, v in self.attributes.iteritems(): if not isinstance(v, str): print('ERROR: The value ({}) for "{}" in table "{}" is not a ' 'string. Make sure your specs only produce string ' 'values (i.e. \'5\', \'TRUE\', \'"Some text"\', ' '...)'.format(v, k, self.table_name)) error = True elif string_exp.match(v): print ('WARNING: {} looks like a string value but is not in ' 'quotes. If "{}" in "{}" is a CHAR or VARCHAR type ' 'column, you should put the value in quotes.').\ format(v, k, self.table_name) if error: print 'Aborting due to errors.' exit(-1) val = ' (%s)' % ', '.join(self.attributes.values()) sql = 'INSERT INTO ' + self.table_name + col + ' VALUES' + val + ';\n' return sql # Private (internal) methods def _toposort(data): """ Sort dependencies topologically :param data: Dependency map of the form data = { 'business': set(['fleet','address']), 'device': set(['business','model','status','pack']), 'txn': set(['device','business','operator']) } """ # Ignore self dependencies. for k, v in data.items(): v.discard(k) # Find all items that don't depend on anything. extra_items = reduce(set.union, data.itervalues()) - set(data.iterkeys()) # Add empty dependences where needed data.update({item: set() for item in extra_items}) while True: ordered = set(item for item, dep in data.iteritems() if not dep) if not ordered: break yield ordered data = {item: (dep - ordered) for item, dep in data.iteritems() if item not in ordered} assert not data, "Cyclic dependencies:\n%s" % \ '\n'.join(repr(x) for x in data.iteritems())
csv2db.py
import csv import re # Regular expression to detect potential string values with missing quotes sql_fun = ['true', 'false', 'avg', 'count', 'first', 'last', 'max', 'min', 'sum', 'ucase', 'lcase', 'mid', 'len', 'round', 'now', 'format'] string_exp = re.compile('^(?!["\']|{}).*[a-z]'.format('|'.join(sql_fun)), re.IGNORECASE) class CsvImporter(object): """ CsvImporter imports values from a csv file into records and creates sql insert statements to create the corresponding rows in the target db. :param path: Path to the csv file to import :param dialect: Dictionary with csv reader dialect specifications (see http://docs.python.org/2/library/csv.html#csv-fmt-params) :param import_specs: Dictionary with import specifications for each table. RecordSpecs are used to tell the script how to extract the csv columns into db records. Each entry can have multiple RecordSpecs, identified by a unique key which is used to resolve cross references in the attr_map of each RecordSpec. """ def __init__(self, path, dialect, import_specs): self.path = path self.dialect = dialect # Flatten import_specs to {(table, instance): record_spec} "t,i,s" form flat_specs = {} for (t, table_spec) in import_specs.items(): specs = {(t, i): s for (i, s) in table_spec.items()} flat_specs.update(specs) # Create a XReference dependency map and sort it topologically dependency_map = {} for (path, s) in flat_specs.items(): deps = set([(x.table_name, x.instance_name) for x in s.attr_map.values() if isinstance(x, XReference)]) dependency_map[path] = deps sorted_keys = [val for sub in _toposort(dependency_map) for val in sub] # Store sorted results in a list [(t, i, s), ...] try: self.specs = [(t, i, flat_specs[(t, i)]) for (t, i) in sorted_keys] except KeyError: print('ERROR: Could not find specification for "{}" in table ' '"{}". Check your XReferences.'.format(i, t)) exit(-1) def import_data(self, id_col=None): """ Imports the csv into DbRecords and returns them. The method uses the import specification (import_specs) that was passed to the importer on init to convert csv table columns to DbRecord objects. """ records = [] with open(self.path) as f: csv.register_dialect('csv2db', **self.dialect) reader = csv.DictReader(f, dialect='csv2db') row_num = 0 for row in reader: row_id = row[id_col] if id_col else row_num records += self._records_for_row(row, row_id); row_num += 1 return records def _records_for_row(self, row, row_id): """ Import one single row and return the resulting DbRecord objects """ records = [] xref_map = {} for (table, instance, spec) in self.specs: if spec.condition(row) is False: continue # Create record and import attributes according to spec record = DbRecord(table, row_id) record.import_attributes(spec.attr_map, xref_map, row) records.append(record) # Keep a reference to each record instance that we create for # resolving XReferences in later instances instance_path = (table, instance) xref_map[instance_path] = record return records class RecordSpec(object): """ Specifications for extracting csv columns into the corresponding database record. :param attr_map: A dictionary that maps database columns to csv columns using any of the ...Value classes below. :param condition: An optional callable that returns false if the object should not be created for the row that is currently. The callable must accept exactly one parameter (the current row). """ def __init__(self, attr_map, condition=None): self.attr_map = attr_map self.condition = condition if condition else lambda row: True class ColumnValue(object): """ Read an input value from a csv column :param col_name: Column name to read the value from :param convert: Optional conversion function that takes exactly one argument which is the row dict for the currently imported row """ def __init__(self, col_name, convert=None): self.col_name = col_name self.convert = convert def _read(self, row, **kw_args): value = row[self.col_name] return self.convert(value) if self.convert else value class MultiColumnValue(object): """ Reads input from multiple columns and contracts them into a single value using the (non-optional) callable given in *convert*. :param col_names: List of column names to read values from :param convert: Conversion function that takes exactly one argument (the row dict of the currently imported row) and contracts the values into a single return value """ def __init__(self, col_names, convert): if not convert: raise ValueError('ERROR: You must provide a convert function') self.col_names = col_names self.convert = convert def _read(self, row, **kw_args): values = {key: row[key] for key in self.col_names} return self.convert(values) class ConstValue(object): """ Always returns the same constant value :param value: The value to return for each row """ def __init__(self, value): self.value = value def _read(self, row, **kw_args): return self.value class DynamicValue(object): """ Creates a value dynamically using the callable *generate* :param generate: A function or other callable that takes a single argument (the current row dict) and returns a single value """ def __init__(self, generate): self.generate = generate def _read(self, row, **kw_args): return self.generate(row) class XReference(object): """ Takes the value of a specific attribute of another record. :param table_name: Table name in the import_specs table given to the *CsvImporter* :param instance_name: Identifies a specific instance under *table_name* :param attribute_name: Name of the attribute to return """ def __init__(self, table_name, instance_name, attribute_name): self.table_name = table_name self.instance_name = instance_name self.attribute_name = attribute_name def _read(self, row, **kw_args): existing_records = kw_args['existing_records'] path = (self.table_name, self.instance_name) value = existing_records[path].attributes[self.attribute_name] return value class DbRecord(object): """ One or more DbRecords are created for each imported row accoding to the RecordSpecs. """ def __init__(self, table_name, row_id): self.row_id = row_id self.table_name = table_name self.attributes = {} def import_attributes(self, attr_map, existing_records, row): """ Import attributes according to the attr_map and resolve cross references to existing_records. """ try: imported = {k: v._read(row, existing_records=existing_records) for (k, v) in attr_map.iteritems()} except AttributeError: k, v = next((k, v) for (k, v) in attr_map.iteritems() if '_read' not in dir(v)) print('ERROR: The RecordSpec for {} in {} does not seem to be ' 'valid'.format(k, self.table_name)) exit(-1) self.attributes.update(imported) def insert_statement(self): """ Returns the insert statement sequence for the current object """ col = ' (%s)' % ', '.join(self.attributes.keys()) # sanity checks error = False for k, v in self.attributes.iteritems(): if not isinstance(v, str): print('ERROR: The value ({}) for "{}" in table "{}" is not a ' 'string. Make sure your specs only produce string ' 'values (i.e. \'5\', \'TRUE\', \'"Some text"\', ' '...)'.format(v, k, self.table_name)) error = True elif string_exp.match(v): print ('WARNING: {} looks like a string value but is not in ' 'quotes. If "{}" in "{}" is a CHAR or VARCHAR type ' 'column, you should put the value in quotes.').\ format(v, k, self.table_name) if error: print 'Aborting due to errors.' exit(-1) val = ' (%s)' % ', '.join(self.attributes.values()) sql = 'INSERT INTO ' + self.table_name + col + ' VALUES' + val + ';\n' return sql # Private (internal) methods def _toposort(data): """ Sort dependencies topologically :param data: Dependency map of the form data = { 'business': set(['fleet','address']), 'device': set(['business','model','status','pack']), 'txn': set(['device','business','operator']) } """ # Ignore self dependencies. for k, v in data.items(): v.discard(k) # Find all items that don't depend on anything. extra_items = reduce(set.union, data.itervalues()) - set(data.iterkeys()) # Add empty dependences where needed data.update({item: set() for item in extra_items}) while True: ordered = set(item for item, dep in data.iteritems() if not dep) if not ordered: break yield ordered data = {item: (dep - ordered) for item, dep in data.iteritems() if item not in ordered} assert not data, "Cyclic dependencies:\n%s" % \ '\n'.join(repr(x) for x in data.iteritems())
0.627038
0.539287
from django.db import models class MinistryTime(models.Model): Ministry = models.ForeignKey('Ministry', on_delete=models.CASCADE) start_date = models.DateField( auto_now=False, auto_now_add=False, default=None) end_date = models.DateField( auto_now=False, auto_now_add=False, default=None) DAY_OF_WEEK_CHOICES = [('Sun', 'Sunday'), ('Mon', 'Monday'), ('Tues', 'Tuesday'), ('Wed', 'Wednesday'), ('Thurs', 'Thursday'), ('Fri', 'Friday'), ('Sat', 'Saturday'), ('N/A', 'N/A')] day_of_week = models.CharField( max_length=5, choices=DAY_OF_WEEK_CHOICES, default='N/A') day_of_month = models.CharField(max_length=100, default='N/A') day_of_year = models.SmallIntegerField(default=0) start_time = models.TimeField() end_time = models.TimeField() created_at = models.DateTimeField(auto_now_add=True) updated_at = models.DateTimeField(auto_now=True) REQUIRED_FIELDS = [ 'start_time', 'end_time' ] def __str__(self): if self.start_date is not None: ministry_time_str = self.start_date + ' - ' ministry_time_str += self.end_date + '\n' elif self.day_of_week != 'N/A': ministry_time_str = self.day_of_week + 's\n' elif self.day_of_month != 'N/A': if self.day_of_month == 1 or 21 or 31: ministry_time_str = self.day_of_month + 'st of every month\n' elif self.day_of_month == 2 or 22: ministry_time_str = self.day_of_month + 'nd of every month\n' elif self.day_of_month == 3 or 23: ministry_time_str = self.day_of_month + 'rd of every month\n' else: ministry_time_str = self.day_of_month + 'th of every month\n' else: ministry_time_str = self.day_of_year + ' day of every year\n' ministry_time_str += '@ ' + self.start_time + ' till ' + self.end_time return ministry_time_str
cms/models/MinistryTime.py
from django.db import models class MinistryTime(models.Model): Ministry = models.ForeignKey('Ministry', on_delete=models.CASCADE) start_date = models.DateField( auto_now=False, auto_now_add=False, default=None) end_date = models.DateField( auto_now=False, auto_now_add=False, default=None) DAY_OF_WEEK_CHOICES = [('Sun', 'Sunday'), ('Mon', 'Monday'), ('Tues', 'Tuesday'), ('Wed', 'Wednesday'), ('Thurs', 'Thursday'), ('Fri', 'Friday'), ('Sat', 'Saturday'), ('N/A', 'N/A')] day_of_week = models.CharField( max_length=5, choices=DAY_OF_WEEK_CHOICES, default='N/A') day_of_month = models.CharField(max_length=100, default='N/A') day_of_year = models.SmallIntegerField(default=0) start_time = models.TimeField() end_time = models.TimeField() created_at = models.DateTimeField(auto_now_add=True) updated_at = models.DateTimeField(auto_now=True) REQUIRED_FIELDS = [ 'start_time', 'end_time' ] def __str__(self): if self.start_date is not None: ministry_time_str = self.start_date + ' - ' ministry_time_str += self.end_date + '\n' elif self.day_of_week != 'N/A': ministry_time_str = self.day_of_week + 's\n' elif self.day_of_month != 'N/A': if self.day_of_month == 1 or 21 or 31: ministry_time_str = self.day_of_month + 'st of every month\n' elif self.day_of_month == 2 or 22: ministry_time_str = self.day_of_month + 'nd of every month\n' elif self.day_of_month == 3 or 23: ministry_time_str = self.day_of_month + 'rd of every month\n' else: ministry_time_str = self.day_of_month + 'th of every month\n' else: ministry_time_str = self.day_of_year + ' day of every year\n' ministry_time_str += '@ ' + self.start_time + ' till ' + self.end_time return ministry_time_str
0.361954
0.150965
from django.test import TestCase from .models import * # Create your tests here. class ProfileTestClass(TestCase): # Set up method def setUp(self): """creation of profile for testing """ user = User.objects.create( username = 'ayubu', first_name = 'ayub', last_name = '254') Profile.objects.create( bio = 'hey', profile_photo = 'static/image/travel.webp', user_id = user.id ) def test_bio(self): """tests the profiles bio """ profile=Profile.objects.get(bio="hey") self.assertEqual(profile.bio, "hey") class ImageTestCase(TestCase): def setUp(self): """image creation """ user = User.objects.create( username = 'ayubu', first_name = 'ayub', last_name = '254') Image.objects.create( name="init", caption="ooops", profile_id=user.id, user_id=user.id ) def test_image_name(self): """tests image name """ image=Image.objects.get(name="init") self.assertEqual(image.name, "init") class LikeTestCase(TestCase): def setUp(self): user = User.objects.create( username = 'ayubu', first_name = 'ayub', last_name = '254') Profile.objects.create( bio = 'hey', profile_photo = 'static/image/travel.webp', user_id = user.id ) Image.objects.create( name="init", caption="ooops", profile_id=user.id, user_id=user.id ) def test_image_id(self): user = User.objects.create( username = 'yub', first_name = 'yubus', last_name = '_254') Image.objects.create( name="init", caption="ooops", profile_id=user.id, user_id=user.id )
insta/tests.py
from django.test import TestCase from .models import * # Create your tests here. class ProfileTestClass(TestCase): # Set up method def setUp(self): """creation of profile for testing """ user = User.objects.create( username = 'ayubu', first_name = 'ayub', last_name = '254') Profile.objects.create( bio = 'hey', profile_photo = 'static/image/travel.webp', user_id = user.id ) def test_bio(self): """tests the profiles bio """ profile=Profile.objects.get(bio="hey") self.assertEqual(profile.bio, "hey") class ImageTestCase(TestCase): def setUp(self): """image creation """ user = User.objects.create( username = 'ayubu', first_name = 'ayub', last_name = '254') Image.objects.create( name="init", caption="ooops", profile_id=user.id, user_id=user.id ) def test_image_name(self): """tests image name """ image=Image.objects.get(name="init") self.assertEqual(image.name, "init") class LikeTestCase(TestCase): def setUp(self): user = User.objects.create( username = 'ayubu', first_name = 'ayub', last_name = '254') Profile.objects.create( bio = 'hey', profile_photo = 'static/image/travel.webp', user_id = user.id ) Image.objects.create( name="init", caption="ooops", profile_id=user.id, user_id=user.id ) def test_image_id(self): user = User.objects.create( username = 'yub', first_name = 'yubus', last_name = '_254') Image.objects.create( name="init", caption="ooops", profile_id=user.id, user_id=user.id )
0.439747
0.197657
import pytest from django.test.client import Client from rest_framework.permissions import IsAuthenticated from rest_framework.response import Response from rest_framework.views import APIView from core import authentication from sso.user.tests.factories import UserFactory @pytest.fixture def user(): return UserFactory() @pytest.fixture def valid_session(user): client = Client() session = client.session session['_auth_user_id'] = user.id session.save() return session @pytest.fixture def expired_session(user): client = Client() session = client.session session['_auth_user_id'] = user.id session.set_expiry(-1) session.save() return session class TestView(APIView): authentication_classes = [authentication.SessionAuthentication] permission_classes = [IsAuthenticated] def get(self, request): return Response() @pytest.mark.django_db def test_sso_session_authentication_invalid_header(rf): request = rf.get('/', HTTP_AUTHORIZATION='SSO_SESSION_ID') response = TestView.as_view()(request) assert response.status_code == 401 assert response.render().content == (b'{"detail":"Invalid SSO_SESSION_ID header."}') @pytest.mark.django_db def test_sso_session_authentication_valid_session_key(valid_session, rf): request = rf.get('/', HTTP_AUTHORIZATION=f'SSO_SESSION_ID {valid_session._session_key}') response = TestView.as_view()(request) assert response.status_code == 200 @pytest.mark.django_db def test_sso_session_authentication_expired_session(expired_session, rf): request = rf.get('/', HTTP_AUTHORIZATION=f'SSO_SESSION_ID {expired_session._session_key}') response = TestView.as_view()(request) assert response.status_code == 401 assert response.render().content == b'{"detail":"Invalid session id"}' @pytest.mark.django_db def test_sso_session_authentication_no_user(rf): request = rf.get('/', HTTP_AUTHORIZATION='SSO_SESSION_ID not-exist') response = TestView.as_view()(request) assert response.status_code == 401 assert response.render().content == b'{"detail":"Invalid session id"}'
core/tests/test_authentication.py
import pytest from django.test.client import Client from rest_framework.permissions import IsAuthenticated from rest_framework.response import Response from rest_framework.views import APIView from core import authentication from sso.user.tests.factories import UserFactory @pytest.fixture def user(): return UserFactory() @pytest.fixture def valid_session(user): client = Client() session = client.session session['_auth_user_id'] = user.id session.save() return session @pytest.fixture def expired_session(user): client = Client() session = client.session session['_auth_user_id'] = user.id session.set_expiry(-1) session.save() return session class TestView(APIView): authentication_classes = [authentication.SessionAuthentication] permission_classes = [IsAuthenticated] def get(self, request): return Response() @pytest.mark.django_db def test_sso_session_authentication_invalid_header(rf): request = rf.get('/', HTTP_AUTHORIZATION='SSO_SESSION_ID') response = TestView.as_view()(request) assert response.status_code == 401 assert response.render().content == (b'{"detail":"Invalid SSO_SESSION_ID header."}') @pytest.mark.django_db def test_sso_session_authentication_valid_session_key(valid_session, rf): request = rf.get('/', HTTP_AUTHORIZATION=f'SSO_SESSION_ID {valid_session._session_key}') response = TestView.as_view()(request) assert response.status_code == 200 @pytest.mark.django_db def test_sso_session_authentication_expired_session(expired_session, rf): request = rf.get('/', HTTP_AUTHORIZATION=f'SSO_SESSION_ID {expired_session._session_key}') response = TestView.as_view()(request) assert response.status_code == 401 assert response.render().content == b'{"detail":"Invalid session id"}' @pytest.mark.django_db def test_sso_session_authentication_no_user(rf): request = rf.get('/', HTTP_AUTHORIZATION='SSO_SESSION_ID not-exist') response = TestView.as_view()(request) assert response.status_code == 401 assert response.render().content == b'{"detail":"Invalid session id"}'
0.572245
0.292456
import os from typing import List, Tuple import cv2 import numpy as np def get_data(muscima_pp_cropped_images_directory: str, visualise: bool = False) -> Tuple[List[dict], dict, dict]: found_bg = False all_imgs = {} classes_count = {} class_mapping = {} annotation_file = os.path.join(muscima_pp_cropped_images_directory, "Annotations.txt") with open(annotation_file, 'r') as f: print('Parsing annotation files') for line in f: line_split = line.strip().split(',') (filename, left, top, right, bottom, class_name) = line_split filename = os.path.join(muscima_pp_cropped_images_directory, filename) left, top, right, bottom = int(left), int(top), int(right), int(bottom) if class_name not in classes_count: classes_count[class_name] = 1 else: classes_count[class_name] += 1 if class_name not in class_mapping: if class_name == 'bg' and found_bg == False: print("Found class name with special name bg. Will be treated as a background region (this is " "usually for hard negative mining).") found_bg = True class_mapping[class_name] = len(class_mapping) if filename not in all_imgs: all_imgs[filename] = {} img = cv2.imread(filename) (rows, cols) = img.shape[:2] all_imgs[filename]['filepath'] = filename all_imgs[filename]['width'] = cols all_imgs[filename]['height'] = rows all_imgs[filename]['bboxes'] = [] if np.random.randint(0, 6) > 0: all_imgs[filename]['imageset'] = 'train' else: all_imgs[filename]['imageset'] = 'val' all_imgs[filename]['bboxes'].append( {'class': class_name, 'x1': left, 'x2': right, 'y1': top, 'y2': bottom}) if visualise: cv2.rectangle(img, (left, top), (right, bottom), (0, 0, 255)) cv2.imshow('img', img) cv2.waitKey(0) all_data = [] for key in all_imgs: all_data.append(all_imgs[key]) # make sure the bg class is last in the list if found_bg: if class_mapping['bg'] != len(class_mapping) - 1: key_to_switch = [key for key in class_mapping.keys() if class_mapping[key] == len(class_mapping) - 1][0] val_to_switch = class_mapping['bg'] class_mapping['bg'] = len(class_mapping) - 1 class_mapping[key_to_switch] = val_to_switch return all_data, classes_count, class_mapping if __name__ == "__main__": all_data, classes_count, class_mapping = get_data("../data/muscima_pp_cropped_images", False) number_of_bounding_boxes = sum(classes_count.values()) print("Found {0} samples with {1} bounding-boxes belonging to {2} classes".format(len(all_data), number_of_bounding_boxes, len(classes_count)))
keras_frcnn/muscima_pp_cropped_image_parser.py
import os from typing import List, Tuple import cv2 import numpy as np def get_data(muscima_pp_cropped_images_directory: str, visualise: bool = False) -> Tuple[List[dict], dict, dict]: found_bg = False all_imgs = {} classes_count = {} class_mapping = {} annotation_file = os.path.join(muscima_pp_cropped_images_directory, "Annotations.txt") with open(annotation_file, 'r') as f: print('Parsing annotation files') for line in f: line_split = line.strip().split(',') (filename, left, top, right, bottom, class_name) = line_split filename = os.path.join(muscima_pp_cropped_images_directory, filename) left, top, right, bottom = int(left), int(top), int(right), int(bottom) if class_name not in classes_count: classes_count[class_name] = 1 else: classes_count[class_name] += 1 if class_name not in class_mapping: if class_name == 'bg' and found_bg == False: print("Found class name with special name bg. Will be treated as a background region (this is " "usually for hard negative mining).") found_bg = True class_mapping[class_name] = len(class_mapping) if filename not in all_imgs: all_imgs[filename] = {} img = cv2.imread(filename) (rows, cols) = img.shape[:2] all_imgs[filename]['filepath'] = filename all_imgs[filename]['width'] = cols all_imgs[filename]['height'] = rows all_imgs[filename]['bboxes'] = [] if np.random.randint(0, 6) > 0: all_imgs[filename]['imageset'] = 'train' else: all_imgs[filename]['imageset'] = 'val' all_imgs[filename]['bboxes'].append( {'class': class_name, 'x1': left, 'x2': right, 'y1': top, 'y2': bottom}) if visualise: cv2.rectangle(img, (left, top), (right, bottom), (0, 0, 255)) cv2.imshow('img', img) cv2.waitKey(0) all_data = [] for key in all_imgs: all_data.append(all_imgs[key]) # make sure the bg class is last in the list if found_bg: if class_mapping['bg'] != len(class_mapping) - 1: key_to_switch = [key for key in class_mapping.keys() if class_mapping[key] == len(class_mapping) - 1][0] val_to_switch = class_mapping['bg'] class_mapping['bg'] = len(class_mapping) - 1 class_mapping[key_to_switch] = val_to_switch return all_data, classes_count, class_mapping if __name__ == "__main__": all_data, classes_count, class_mapping = get_data("../data/muscima_pp_cropped_images", False) number_of_bounding_boxes = sum(classes_count.values()) print("Found {0} samples with {1} bounding-boxes belonging to {2} classes".format(len(all_data), number_of_bounding_boxes, len(classes_count)))
0.483161
0.206494
class Operator: """ The preconditions represent the facts that have to be true before the operator can be applied. add_effects are the facts that the operator makes true. delete_effects are the facts that the operator makes false. """ def __init__(self, name, preconditions, add_effects, del_effects): self.name = name self.preconditions = frozenset(preconditions) self.add_effects = frozenset(add_effects) self.del_effects = frozenset(del_effects) def applicable(self, state): """ Operators are applicable when their set of preconditions is a subset of the facts that are true in "state". @return True if the operator's preconditions is a subset of the state, False otherwise """ return self.preconditions <= state def apply(self, state): """ Applying an operator means removing the facts that are made false by the operator from the set of true facts in state and adding the facts made true. Note that therefore it is possible to have operands that make a fact both false and true. This results in the fact being true at the end. @param state The state that the operator should be applied to @return A new state (set of facts) after the application of the operator """ assert self.applicable(state) assert type(state) in (frozenset, set) return (state - self.del_effects) | self.add_effects def __str__(self): s = '%s\n' % self.name for group, facts in [('PRE', self.preconditions), ('ADD', self.add_effects), ('DEL', self.del_effects)]: for fact in facts: s += ' %s: %s\n' % (group, fact) return s def __repr__(self): return '<Op %s>' % self.name class Task: """ A STRIPS planning task """ def __init__(self, name, facts, initial_state, goals, operators): """ @param name The task's name @param facts A set of all the fact names that are valid in the domain @param initial_state A set of fact names that are true at the beginning @param goals A set of fact names that must be true to solve the problem @param operators A set of operator instances for the domain """ self.name = name self.facts = facts self.initial_state = initial_state self.goals = goals self.operators = operators def goal_reached(self, state): """ The goal has been reached if all facts that are true in "goals" are true in "state". @return True if all the goals are reached, False otherwise """ return self.goals <= state def get_successor_states(self, state): """ @return A list with (op, new_state) pairs where "op" is the applicable operator and "new_state" the state that results when "op" is applied in state "state". """ return [(op, op.apply(state)) for op in self.operators if op.applicable(state)] def __str__(self): s = 'Task {0}\n Vars: {1}\n Init: {2}\n Goals: {3}\n Ops: {4}' return s.format(self.name, ', '.join(self.facts), self.initial_state, self.goals, '\n'.join(map(repr, self.operators))) def __repr__(self): string = '<Task {0}, vars: {1}, operators: {2}>' return string.format(self.name, len(self.facts), len(self.operators))
planner/mmp_explanations/src/grounder/task.py
class Operator: """ The preconditions represent the facts that have to be true before the operator can be applied. add_effects are the facts that the operator makes true. delete_effects are the facts that the operator makes false. """ def __init__(self, name, preconditions, add_effects, del_effects): self.name = name self.preconditions = frozenset(preconditions) self.add_effects = frozenset(add_effects) self.del_effects = frozenset(del_effects) def applicable(self, state): """ Operators are applicable when their set of preconditions is a subset of the facts that are true in "state". @return True if the operator's preconditions is a subset of the state, False otherwise """ return self.preconditions <= state def apply(self, state): """ Applying an operator means removing the facts that are made false by the operator from the set of true facts in state and adding the facts made true. Note that therefore it is possible to have operands that make a fact both false and true. This results in the fact being true at the end. @param state The state that the operator should be applied to @return A new state (set of facts) after the application of the operator """ assert self.applicable(state) assert type(state) in (frozenset, set) return (state - self.del_effects) | self.add_effects def __str__(self): s = '%s\n' % self.name for group, facts in [('PRE', self.preconditions), ('ADD', self.add_effects), ('DEL', self.del_effects)]: for fact in facts: s += ' %s: %s\n' % (group, fact) return s def __repr__(self): return '<Op %s>' % self.name class Task: """ A STRIPS planning task """ def __init__(self, name, facts, initial_state, goals, operators): """ @param name The task's name @param facts A set of all the fact names that are valid in the domain @param initial_state A set of fact names that are true at the beginning @param goals A set of fact names that must be true to solve the problem @param operators A set of operator instances for the domain """ self.name = name self.facts = facts self.initial_state = initial_state self.goals = goals self.operators = operators def goal_reached(self, state): """ The goal has been reached if all facts that are true in "goals" are true in "state". @return True if all the goals are reached, False otherwise """ return self.goals <= state def get_successor_states(self, state): """ @return A list with (op, new_state) pairs where "op" is the applicable operator and "new_state" the state that results when "op" is applied in state "state". """ return [(op, op.apply(state)) for op in self.operators if op.applicable(state)] def __str__(self): s = 'Task {0}\n Vars: {1}\n Init: {2}\n Goals: {3}\n Ops: {4}' return s.format(self.name, ', '.join(self.facts), self.initial_state, self.goals, '\n'.join(map(repr, self.operators))) def __repr__(self): string = '<Task {0}, vars: {1}, operators: {2}>' return string.format(self.name, len(self.facts), len(self.operators))
0.830766
0.669252
__author__ = 'HPE' import sushy from sushy.resources import base from sushy.resources.system import system from sushy import utils as sushy_utils from proliantutils import exception from proliantutils import log from proliantutils.redfish.resources.system import bios from proliantutils.redfish.resources.system import constants from proliantutils.redfish.resources.system import ethernet_interface from proliantutils.redfish.resources.system import mappings from proliantutils.redfish.resources.system import memory from proliantutils.redfish.resources.system import pci_device from proliantutils.redfish.resources.system import secure_boot from proliantutils.redfish.resources.system import smart_storage_config from proliantutils.redfish.resources.system.storage import simple_storage from proliantutils.redfish.resources.system.storage import \ smart_storage as hpe_smart_storage from proliantutils.redfish.resources.system.storage import storage from proliantutils.redfish import utils LOG = log.get_logger(__name__) PERSISTENT_BOOT_DEVICE_MAP = { 'CDROM': sushy.BOOT_SOURCE_TARGET_CD, 'NETWORK': sushy.BOOT_SOURCE_TARGET_PXE, 'ISCSI': sushy.BOOT_SOURCE_TARGET_UEFI_TARGET, 'HDD': sushy.BOOT_SOURCE_TARGET_HDD } class PowerButtonActionField(base.CompositeField): allowed_values = base.Field('Push<EMAIL>', adapter=list) target_uri = base.Field('target', required=True) class HpeActionsField(base.CompositeField): computer_system_ext_powerbutton = ( PowerButtonActionField('#HpeComputerSystemExt.PowerButton')) class HPESystem(system.System): """Class that extends the functionality of System resource class This class extends the functionality of System resource class from sushy """ model = base.Field(['Model']) rom_version = base.Field(['Oem', 'Hpe', 'Bios', 'Current', 'VersionString']) uefi_target_override_devices = (base.Field([ 'Boot', 'UefiTargetBootSourceOverride@<EMAIL>Values'], adapter=list)) smart_storage_config_identities = base.Field( ['Oem', 'Hpe', 'SmartStorageConfig'], adapter=sushy_utils.get_members_identities) supported_boot_mode = base.MappedField( ['Oem', 'Hpe', 'Bios', 'UefiClass'], mappings.SUPPORTED_BOOT_MODE, default=constants.SUPPORTED_LEGACY_BIOS_ONLY) """System supported boot mode.""" post_state = base.MappedField( ['Oem', 'Hpe', 'PostState'], mappings.POST_STATE_MAP, default=constants.POST_STATE_NULL) """System POST state""" _hpe_actions = HpeActionsField(['Oem', 'Hpe', 'Actions'], required=True) """Oem specific system extensibility actions""" _bios_settings = None # ref to BIOSSettings instance _secure_boot = None # ref to SecureBoot instance _smart_storage = None # SmartStorage instance _simple_storages = None # SimpleStorage instance _storages = None # Storage instance _pci_devices = None # PCIDevice instance _ethernet_interfaces = None # EthernetInterface instance _memory = None # Memory instance def _get_hpe_push_power_button_action_element(self): push_action = self._hpe_actions.computer_system_ext_powerbutton if not push_action: raise exception.MissingAttributeError( attribute='Oem/Hpe/Actions/#HpeComputerSystemExt.PowerButton', resource=self.path) return push_action def push_power_button(self, target_value): """Reset the system in hpe exclusive manner. :param target_value: The target value to be set. :raises: InvalidInputError, if the target value is not allowed. :raises: SushyError, on an error from iLO. """ if target_value not in mappings.PUSH_POWER_BUTTON_VALUE_MAP_REV: msg = ('The parameter "%(parameter)s" value "%(target_value)s" is ' 'invalid. Valid values are: %(valid_power_values)s' % {'parameter': 'target_value', 'target_value': target_value, 'valid_power_values': ( mappings.PUSH_POWER_BUTTON_VALUE_MAP_REV.keys())}) raise exception.InvalidInputError(msg) value = mappings.PUSH_POWER_BUTTON_VALUE_MAP_REV[target_value] target_uri = ( self._get_hpe_push_power_button_action_element().target_uri) self._conn.post(target_uri, data={'PushType': value}) @property def bios_settings(self): """Property to provide reference to `BIOSSettings` instance It is calculated once when the first time it is queried. On refresh, this property gets reset. """ if self._bios_settings is None: self._bios_settings = bios.BIOSSettings( self._conn, utils.get_subresource_path_by(self, 'Bios'), redfish_version=self.redfish_version) self._bios_settings.refresh(force=False) return self._bios_settings def update_persistent_boot(self, devices=[], persistent=False): """Changes the persistent boot device order in BIOS boot mode for host Note: It uses first boot device from the devices and ignores rest. :param devices: ordered list of boot devices :param persistent: Boolean flag to indicate if the device to be set as a persistent boot device :raises: IloError, on an error from iLO. :raises: IloInvalidInputError, if the given input is not valid. """ device = PERSISTENT_BOOT_DEVICE_MAP.get(devices[0].upper()) if device == sushy.BOOT_SOURCE_TARGET_UEFI_TARGET: try: uefi_devices = self.uefi_target_override_devices iscsi_device = None for uefi_device in uefi_devices: if uefi_device is not None and 'iSCSI' in uefi_device: iscsi_device = uefi_device break if iscsi_device is None: msg = 'No UEFI iSCSI bootable device found on system.' raise exception.IloError(msg) except sushy.exceptions.SushyError as e: msg = ('Unable to get uefi target override devices. ' 'Error %s') % (str(e)) raise exception.IloError(msg) uefi_boot_settings = { 'Boot': {'UefiTargetBootSourceOverride': iscsi_device} } self._conn.patch(self.path, data=uefi_boot_settings) elif device is None: device = sushy.BOOT_SOURCE_TARGET_NONE tenure = (sushy.BOOT_SOURCE_ENABLED_CONTINUOUS if persistent else sushy.BOOT_SOURCE_ENABLED_ONCE) self.set_system_boot_source(device, enabled=tenure) @property def pci_devices(self): """Provides the collection of PCI devices It is calculated once when the first time it is queried. On refresh, this property gets reset. """ if self._pci_devices is None: self._pci_devices = pci_device.PCIDeviceCollection( self._conn, utils.get_subresource_path_by( self, ['Oem', 'Hpe', 'Links', 'PCIDevices'])) self._pci_devices.refresh(force=False) return self._pci_devices @property def secure_boot(self): """Property to provide reference to `SecureBoot` instance It is calculated once when the first time it is queried. On refresh, this property gets reset. """ if self._secure_boot is None: self._secure_boot = secure_boot.SecureBoot( self._conn, utils.get_subresource_path_by(self, 'SecureBoot'), redfish_version=self.redfish_version) self._secure_boot.refresh(force=False) return self._secure_boot def _do_refresh(self, force): """Do custom resource specific refresh activities On refresh, all sub-resources are marked as stale, i.e. greedy-refresh not done for them unless forced by ``force`` argument. """ super(HPESystem, self)._do_refresh(force) if self._bios_settings is not None: self._bios_settings.invalidate(force) if self._pci_devices is not None: self._pci_devices.invalidate(force) if self._secure_boot is not None: self._secure_boot.invalidate(force) if self._ethernet_interfaces is not None: self._ethernet_interfaces.invalidate(force) if self._smart_storage is not None: self._smart_storage.invalidate(force) if self._storages is not None: self._storages.invalidate(force) if self._simple_storages is not None: self._simple_storages.invalidate(force) if self._memory is not None: self._memory.invalidate(force) def _get_hpe_sub_resource_collection_path(self, sub_res): path = None try: path = utils.get_subresource_path_by(self, sub_res) except exception.MissingAttributeError: path = utils.get_subresource_path_by( self, ['Oem', 'Hpe', 'Links', sub_res]) return path @property def ethernet_interfaces(self): """Provide reference to EthernetInterfacesCollection instance""" if self._ethernet_interfaces is None: sub_res = 'EthernetInterfaces' self._ethernet_interfaces = ( ethernet_interface.EthernetInterfaceCollection( self._conn, self._get_hpe_sub_resource_collection_path(sub_res), redfish_version=self.redfish_version)) self._ethernet_interfaces.refresh(force=False) return self._ethernet_interfaces @property def smart_storage(self): """This property gets the object for smart storage. This property gets the object for smart storage. There is no collection for smart storages. :returns: an instance of smart storage """ if self._smart_storage is None: self._smart_storage = hpe_smart_storage.HPESmartStorage( self._conn, utils.get_subresource_path_by( self, ['Oem', 'Hpe', 'Links', 'SmartStorage']), redfish_version=self.redfish_version) self._smart_storage.refresh(force=False) return self._smart_storage @property def storages(self): """This property gets the list of instances for Storages This property gets the list of instances for Storages :returns: a list of instances of Storages """ if self._storages is None: self._storages = storage.StorageCollection( self._conn, utils.get_subresource_path_by(self, 'Storage'), redfish_version=self.redfish_version) self._storages.refresh(force=False) return self._storages @property def simple_storages(self): """This property gets the list of instances for SimpleStorages :returns: a list of instances of SimpleStorages """ if self._simple_storages is None: self._simple_storages = simple_storage.SimpleStorageCollection( self._conn, utils.get_subresource_path_by( self, 'SimpleStorage'), redfish_version=self.redfish_version) self._simple_storages.refresh(force=False) return self._simple_storages @property def memory(self): """Property to provide reference to `MemoryCollection` instance It is calculated once when the first time it is queried. On refresh, this property gets reset. """ if self._memory is None: self._memory = memory.MemoryCollection( self._conn, utils.get_subresource_path_by( self, 'Memory'), redfish_version=self.redfish_version) self._memory.refresh(force=False) return self._memory def get_smart_storage_config(self, smart_storage_config_url): """Returns a SmartStorageConfig Instance for each controller.""" return (smart_storage_config. HPESmartStorageConfig(self._conn, smart_storage_config_url, redfish_version=self.redfish_version)) def _get_smart_storage_config_by_controller_model(self, controller_model): """Returns a SmartStorageConfig Instance for controller by model. :returns: SmartStorageConfig Instance for controller """ ac = self.smart_storage.array_controllers.array_controller_by_model( controller_model) for ssc_id in self.smart_storage_config_identities: ssc_obj = self.get_smart_storage_config(ssc_id) if ac.location == ssc_obj.location: return ssc_obj def check_smart_storage_config_ids(self): """Check SmartStorageConfig controllers is there in hardware. :raises: IloError, on an error from iLO. """ if self.smart_storage_config_identities is None: msg = ('The Redfish controller failed to get the ' 'SmartStorageConfig controller configurations.') LOG.debug(msg) raise exception.IloError(msg) def delete_raid(self): """Delete the raid configuration on the hardware. Loops through each SmartStorageConfig controller and clears the raid configuration. :raises: IloError, on an error from iLO. """ self.check_smart_storage_config_ids() any_exceptions = [] ld_exc_count = 0 for config_id in self.smart_storage_config_identities: try: ssc_obj = self.get_smart_storage_config(config_id) ssc_obj.delete_raid() except exception.IloLogicalDriveNotFoundError as e: ld_exc_count += 1 except sushy.exceptions.SushyError as e: any_exceptions.append((config_id, str(e))) if any_exceptions: msg = ('The Redfish controller failed to delete the ' 'raid configuration in one or more controllers with ' 'Error: %(error)s' % {'error': str(any_exceptions)}) raise exception.IloError(msg) if ld_exc_count == len(self.smart_storage_config_identities): msg = ('No logical drives are found in any controllers. Nothing ' 'to delete.') raise exception.IloLogicalDriveNotFoundError(msg) def _parse_raid_config_data(self, raid_config): """It will parse raid config data based on raid controllers :param raid_config: A dictionary containing target raid configuration data. This data stucture should be as follows: raid_config = {'logical_disks': [{'raid_level': 1, 'size_gb': 100, 'controller': 'HPE Smart Array P408i-a SR Gen10'}, <info-for-logical-disk-2>]} :returns: A dictionary of controllers, each containing list of their respected logical drives. """ default = ( self.smart_storage.array_controllers.get_default_controller.model) controllers = {default: []} for ld in raid_config['logical_disks']: if 'controller' not in ld.keys(): controllers[default].append(ld) else: ctrl = ld['controller'] if ctrl not in controllers: controllers[ctrl] = [] controllers[ctrl].append(ld) return controllers def create_raid(self, raid_config): """Create the raid configuration on the hardware. :param raid_config: A dictionary containing target raid configuration data. This data stucture should be as follows: raid_config = {'logical_disks': [{'raid_level': 1, 'size_gb': 100, 'physical_disks': ['6I:1:5'], 'controller': 'HPE Smart Array P408i-a SR Gen10'}, <info-for-logical-disk-2>]} :raises: IloError, on an error from iLO. """ self.check_smart_storage_config_ids() any_exceptions = [] controllers = self._parse_raid_config_data(raid_config) # Creating raid on rest of the controllers for controller in controllers: try: config = {'logical_disks': controllers[controller]} ssc_obj = ( self._get_smart_storage_config_by_controller_model( controller)) if ssc_obj: ssc_obj.create_raid(config) else: members = ( self.smart_storage.array_controllers.get_members()) models = [member.model for member in members] msg = ('Controller not found. Available controllers are: ' '%(models)s' % {'models': models}) any_exceptions.append((controller, msg)) except sushy.exceptions.SushyError as e: any_exceptions.append((controller, str(e))) if any_exceptions: msg = ('The Redfish controller failed to create the ' 'raid configuration for one or more controllers with ' 'Error: %(error)s' % {'error': str(any_exceptions)}) raise exception.IloError(msg)
proliantutils/redfish/resources/system/system.py
__author__ = 'HPE' import sushy from sushy.resources import base from sushy.resources.system import system from sushy import utils as sushy_utils from proliantutils import exception from proliantutils import log from proliantutils.redfish.resources.system import bios from proliantutils.redfish.resources.system import constants from proliantutils.redfish.resources.system import ethernet_interface from proliantutils.redfish.resources.system import mappings from proliantutils.redfish.resources.system import memory from proliantutils.redfish.resources.system import pci_device from proliantutils.redfish.resources.system import secure_boot from proliantutils.redfish.resources.system import smart_storage_config from proliantutils.redfish.resources.system.storage import simple_storage from proliantutils.redfish.resources.system.storage import \ smart_storage as hpe_smart_storage from proliantutils.redfish.resources.system.storage import storage from proliantutils.redfish import utils LOG = log.get_logger(__name__) PERSISTENT_BOOT_DEVICE_MAP = { 'CDROM': sushy.BOOT_SOURCE_TARGET_CD, 'NETWORK': sushy.BOOT_SOURCE_TARGET_PXE, 'ISCSI': sushy.BOOT_SOURCE_TARGET_UEFI_TARGET, 'HDD': sushy.BOOT_SOURCE_TARGET_HDD } class PowerButtonActionField(base.CompositeField): allowed_values = base.Field('Push<EMAIL>', adapter=list) target_uri = base.Field('target', required=True) class HpeActionsField(base.CompositeField): computer_system_ext_powerbutton = ( PowerButtonActionField('#HpeComputerSystemExt.PowerButton')) class HPESystem(system.System): """Class that extends the functionality of System resource class This class extends the functionality of System resource class from sushy """ model = base.Field(['Model']) rom_version = base.Field(['Oem', 'Hpe', 'Bios', 'Current', 'VersionString']) uefi_target_override_devices = (base.Field([ 'Boot', 'UefiTargetBootSourceOverride@<EMAIL>Values'], adapter=list)) smart_storage_config_identities = base.Field( ['Oem', 'Hpe', 'SmartStorageConfig'], adapter=sushy_utils.get_members_identities) supported_boot_mode = base.MappedField( ['Oem', 'Hpe', 'Bios', 'UefiClass'], mappings.SUPPORTED_BOOT_MODE, default=constants.SUPPORTED_LEGACY_BIOS_ONLY) """System supported boot mode.""" post_state = base.MappedField( ['Oem', 'Hpe', 'PostState'], mappings.POST_STATE_MAP, default=constants.POST_STATE_NULL) """System POST state""" _hpe_actions = HpeActionsField(['Oem', 'Hpe', 'Actions'], required=True) """Oem specific system extensibility actions""" _bios_settings = None # ref to BIOSSettings instance _secure_boot = None # ref to SecureBoot instance _smart_storage = None # SmartStorage instance _simple_storages = None # SimpleStorage instance _storages = None # Storage instance _pci_devices = None # PCIDevice instance _ethernet_interfaces = None # EthernetInterface instance _memory = None # Memory instance def _get_hpe_push_power_button_action_element(self): push_action = self._hpe_actions.computer_system_ext_powerbutton if not push_action: raise exception.MissingAttributeError( attribute='Oem/Hpe/Actions/#HpeComputerSystemExt.PowerButton', resource=self.path) return push_action def push_power_button(self, target_value): """Reset the system in hpe exclusive manner. :param target_value: The target value to be set. :raises: InvalidInputError, if the target value is not allowed. :raises: SushyError, on an error from iLO. """ if target_value not in mappings.PUSH_POWER_BUTTON_VALUE_MAP_REV: msg = ('The parameter "%(parameter)s" value "%(target_value)s" is ' 'invalid. Valid values are: %(valid_power_values)s' % {'parameter': 'target_value', 'target_value': target_value, 'valid_power_values': ( mappings.PUSH_POWER_BUTTON_VALUE_MAP_REV.keys())}) raise exception.InvalidInputError(msg) value = mappings.PUSH_POWER_BUTTON_VALUE_MAP_REV[target_value] target_uri = ( self._get_hpe_push_power_button_action_element().target_uri) self._conn.post(target_uri, data={'PushType': value}) @property def bios_settings(self): """Property to provide reference to `BIOSSettings` instance It is calculated once when the first time it is queried. On refresh, this property gets reset. """ if self._bios_settings is None: self._bios_settings = bios.BIOSSettings( self._conn, utils.get_subresource_path_by(self, 'Bios'), redfish_version=self.redfish_version) self._bios_settings.refresh(force=False) return self._bios_settings def update_persistent_boot(self, devices=[], persistent=False): """Changes the persistent boot device order in BIOS boot mode for host Note: It uses first boot device from the devices and ignores rest. :param devices: ordered list of boot devices :param persistent: Boolean flag to indicate if the device to be set as a persistent boot device :raises: IloError, on an error from iLO. :raises: IloInvalidInputError, if the given input is not valid. """ device = PERSISTENT_BOOT_DEVICE_MAP.get(devices[0].upper()) if device == sushy.BOOT_SOURCE_TARGET_UEFI_TARGET: try: uefi_devices = self.uefi_target_override_devices iscsi_device = None for uefi_device in uefi_devices: if uefi_device is not None and 'iSCSI' in uefi_device: iscsi_device = uefi_device break if iscsi_device is None: msg = 'No UEFI iSCSI bootable device found on system.' raise exception.IloError(msg) except sushy.exceptions.SushyError as e: msg = ('Unable to get uefi target override devices. ' 'Error %s') % (str(e)) raise exception.IloError(msg) uefi_boot_settings = { 'Boot': {'UefiTargetBootSourceOverride': iscsi_device} } self._conn.patch(self.path, data=uefi_boot_settings) elif device is None: device = sushy.BOOT_SOURCE_TARGET_NONE tenure = (sushy.BOOT_SOURCE_ENABLED_CONTINUOUS if persistent else sushy.BOOT_SOURCE_ENABLED_ONCE) self.set_system_boot_source(device, enabled=tenure) @property def pci_devices(self): """Provides the collection of PCI devices It is calculated once when the first time it is queried. On refresh, this property gets reset. """ if self._pci_devices is None: self._pci_devices = pci_device.PCIDeviceCollection( self._conn, utils.get_subresource_path_by( self, ['Oem', 'Hpe', 'Links', 'PCIDevices'])) self._pci_devices.refresh(force=False) return self._pci_devices @property def secure_boot(self): """Property to provide reference to `SecureBoot` instance It is calculated once when the first time it is queried. On refresh, this property gets reset. """ if self._secure_boot is None: self._secure_boot = secure_boot.SecureBoot( self._conn, utils.get_subresource_path_by(self, 'SecureBoot'), redfish_version=self.redfish_version) self._secure_boot.refresh(force=False) return self._secure_boot def _do_refresh(self, force): """Do custom resource specific refresh activities On refresh, all sub-resources are marked as stale, i.e. greedy-refresh not done for them unless forced by ``force`` argument. """ super(HPESystem, self)._do_refresh(force) if self._bios_settings is not None: self._bios_settings.invalidate(force) if self._pci_devices is not None: self._pci_devices.invalidate(force) if self._secure_boot is not None: self._secure_boot.invalidate(force) if self._ethernet_interfaces is not None: self._ethernet_interfaces.invalidate(force) if self._smart_storage is not None: self._smart_storage.invalidate(force) if self._storages is not None: self._storages.invalidate(force) if self._simple_storages is not None: self._simple_storages.invalidate(force) if self._memory is not None: self._memory.invalidate(force) def _get_hpe_sub_resource_collection_path(self, sub_res): path = None try: path = utils.get_subresource_path_by(self, sub_res) except exception.MissingAttributeError: path = utils.get_subresource_path_by( self, ['Oem', 'Hpe', 'Links', sub_res]) return path @property def ethernet_interfaces(self): """Provide reference to EthernetInterfacesCollection instance""" if self._ethernet_interfaces is None: sub_res = 'EthernetInterfaces' self._ethernet_interfaces = ( ethernet_interface.EthernetInterfaceCollection( self._conn, self._get_hpe_sub_resource_collection_path(sub_res), redfish_version=self.redfish_version)) self._ethernet_interfaces.refresh(force=False) return self._ethernet_interfaces @property def smart_storage(self): """This property gets the object for smart storage. This property gets the object for smart storage. There is no collection for smart storages. :returns: an instance of smart storage """ if self._smart_storage is None: self._smart_storage = hpe_smart_storage.HPESmartStorage( self._conn, utils.get_subresource_path_by( self, ['Oem', 'Hpe', 'Links', 'SmartStorage']), redfish_version=self.redfish_version) self._smart_storage.refresh(force=False) return self._smart_storage @property def storages(self): """This property gets the list of instances for Storages This property gets the list of instances for Storages :returns: a list of instances of Storages """ if self._storages is None: self._storages = storage.StorageCollection( self._conn, utils.get_subresource_path_by(self, 'Storage'), redfish_version=self.redfish_version) self._storages.refresh(force=False) return self._storages @property def simple_storages(self): """This property gets the list of instances for SimpleStorages :returns: a list of instances of SimpleStorages """ if self._simple_storages is None: self._simple_storages = simple_storage.SimpleStorageCollection( self._conn, utils.get_subresource_path_by( self, 'SimpleStorage'), redfish_version=self.redfish_version) self._simple_storages.refresh(force=False) return self._simple_storages @property def memory(self): """Property to provide reference to `MemoryCollection` instance It is calculated once when the first time it is queried. On refresh, this property gets reset. """ if self._memory is None: self._memory = memory.MemoryCollection( self._conn, utils.get_subresource_path_by( self, 'Memory'), redfish_version=self.redfish_version) self._memory.refresh(force=False) return self._memory def get_smart_storage_config(self, smart_storage_config_url): """Returns a SmartStorageConfig Instance for each controller.""" return (smart_storage_config. HPESmartStorageConfig(self._conn, smart_storage_config_url, redfish_version=self.redfish_version)) def _get_smart_storage_config_by_controller_model(self, controller_model): """Returns a SmartStorageConfig Instance for controller by model. :returns: SmartStorageConfig Instance for controller """ ac = self.smart_storage.array_controllers.array_controller_by_model( controller_model) for ssc_id in self.smart_storage_config_identities: ssc_obj = self.get_smart_storage_config(ssc_id) if ac.location == ssc_obj.location: return ssc_obj def check_smart_storage_config_ids(self): """Check SmartStorageConfig controllers is there in hardware. :raises: IloError, on an error from iLO. """ if self.smart_storage_config_identities is None: msg = ('The Redfish controller failed to get the ' 'SmartStorageConfig controller configurations.') LOG.debug(msg) raise exception.IloError(msg) def delete_raid(self): """Delete the raid configuration on the hardware. Loops through each SmartStorageConfig controller and clears the raid configuration. :raises: IloError, on an error from iLO. """ self.check_smart_storage_config_ids() any_exceptions = [] ld_exc_count = 0 for config_id in self.smart_storage_config_identities: try: ssc_obj = self.get_smart_storage_config(config_id) ssc_obj.delete_raid() except exception.IloLogicalDriveNotFoundError as e: ld_exc_count += 1 except sushy.exceptions.SushyError as e: any_exceptions.append((config_id, str(e))) if any_exceptions: msg = ('The Redfish controller failed to delete the ' 'raid configuration in one or more controllers with ' 'Error: %(error)s' % {'error': str(any_exceptions)}) raise exception.IloError(msg) if ld_exc_count == len(self.smart_storage_config_identities): msg = ('No logical drives are found in any controllers. Nothing ' 'to delete.') raise exception.IloLogicalDriveNotFoundError(msg) def _parse_raid_config_data(self, raid_config): """It will parse raid config data based on raid controllers :param raid_config: A dictionary containing target raid configuration data. This data stucture should be as follows: raid_config = {'logical_disks': [{'raid_level': 1, 'size_gb': 100, 'controller': 'HPE Smart Array P408i-a SR Gen10'}, <info-for-logical-disk-2>]} :returns: A dictionary of controllers, each containing list of their respected logical drives. """ default = ( self.smart_storage.array_controllers.get_default_controller.model) controllers = {default: []} for ld in raid_config['logical_disks']: if 'controller' not in ld.keys(): controllers[default].append(ld) else: ctrl = ld['controller'] if ctrl not in controllers: controllers[ctrl] = [] controllers[ctrl].append(ld) return controllers def create_raid(self, raid_config): """Create the raid configuration on the hardware. :param raid_config: A dictionary containing target raid configuration data. This data stucture should be as follows: raid_config = {'logical_disks': [{'raid_level': 1, 'size_gb': 100, 'physical_disks': ['6I:1:5'], 'controller': 'HPE Smart Array P408i-a SR Gen10'}, <info-for-logical-disk-2>]} :raises: IloError, on an error from iLO. """ self.check_smart_storage_config_ids() any_exceptions = [] controllers = self._parse_raid_config_data(raid_config) # Creating raid on rest of the controllers for controller in controllers: try: config = {'logical_disks': controllers[controller]} ssc_obj = ( self._get_smart_storage_config_by_controller_model( controller)) if ssc_obj: ssc_obj.create_raid(config) else: members = ( self.smart_storage.array_controllers.get_members()) models = [member.model for member in members] msg = ('Controller not found. Available controllers are: ' '%(models)s' % {'models': models}) any_exceptions.append((controller, msg)) except sushy.exceptions.SushyError as e: any_exceptions.append((controller, str(e))) if any_exceptions: msg = ('The Redfish controller failed to create the ' 'raid configuration for one or more controllers with ' 'Error: %(error)s' % {'error': str(any_exceptions)}) raise exception.IloError(msg)
0.621311
0.107531
__author__ = '<NAME>' from LearningAlgorithm import * class Backpropagation(LearningAlgorithm): def learn(self, learningRate, input, output, network): """ :param learningRate: double :param input: list :param output: list :param network: [[Neuron]] :return: [[Neuron]] Training the network with Backpropagation algorithm, it does the following 1- Calculate the error signal for each neuron on each layer 2- Update the weights of each neuron according to its update formula 3- Return the new weights of the whole network """ for i in range(len(network) - 1, 0, -1): for j in range(0, len(network[i])): currentNeuron = network[i][j] if i == len(network) - 1: currentNeuron.SignalError = (output[j] - currentNeuron.Output) * \ currentNeuron.ActivationFunction.derivative(currentNeuron.Net) else: summation = 0.0 for k in range(0, len(network[i + 1])): nextNeuron = network[i + 1][k] summation += (nextNeuron.Weights[j] * nextNeuron.SignalError) currentNeuron.SignalError = summation * currentNeuron.ActivationFunction.derivative( currentNeuron.Net) network[i][j] = currentNeuron for i in range(0, len(network)): for j in range(0, len(network[i])): x = len(network[i]) currentWeights = network[i][j].Weights currentBias = network[i][j].Bias for k in range(0, len(currentWeights)): if i == 0: currentWeights[k] += learningRate * network[i][j].SignalError * input[k] else: currentWeights[k] += learningRate * network[i][j].SignalError * network[i - 1][k].Output currentBias += learningRate * network[i][j].SignalError network[i][j].update(currentWeights, currentBias) x = len(network[i]) return network
OptimizationAlgorithms/Backpropagation.py
__author__ = '<NAME>' from LearningAlgorithm import * class Backpropagation(LearningAlgorithm): def learn(self, learningRate, input, output, network): """ :param learningRate: double :param input: list :param output: list :param network: [[Neuron]] :return: [[Neuron]] Training the network with Backpropagation algorithm, it does the following 1- Calculate the error signal for each neuron on each layer 2- Update the weights of each neuron according to its update formula 3- Return the new weights of the whole network """ for i in range(len(network) - 1, 0, -1): for j in range(0, len(network[i])): currentNeuron = network[i][j] if i == len(network) - 1: currentNeuron.SignalError = (output[j] - currentNeuron.Output) * \ currentNeuron.ActivationFunction.derivative(currentNeuron.Net) else: summation = 0.0 for k in range(0, len(network[i + 1])): nextNeuron = network[i + 1][k] summation += (nextNeuron.Weights[j] * nextNeuron.SignalError) currentNeuron.SignalError = summation * currentNeuron.ActivationFunction.derivative( currentNeuron.Net) network[i][j] = currentNeuron for i in range(0, len(network)): for j in range(0, len(network[i])): x = len(network[i]) currentWeights = network[i][j].Weights currentBias = network[i][j].Bias for k in range(0, len(currentWeights)): if i == 0: currentWeights[k] += learningRate * network[i][j].SignalError * input[k] else: currentWeights[k] += learningRate * network[i][j].SignalError * network[i - 1][k].Output currentBias += learningRate * network[i][j].SignalError network[i][j].update(currentWeights, currentBias) x = len(network[i]) return network
0.717408
0.653922
from variational_clustering.clustering import furthest_init from variational_clustering.clustering import make_faces from variational_clustering.clustering import k_means from directional_clustering.clustering.kmeans import KMeans from directional_clustering.fields import VectorField __all__ = ["VariationalKMeans"] class VariationalKMeans(KMeans): """ The variational shape approximation method for vector clustering. Parameters ---------- mesh : `directional_clustering.mesh.MeshPlus` A reference mesh. vector_field : `directional_clustering.fields.VectorField` The vector field to cluster. n_clusters : `int` The number of clusters to generate. iters : `int` The iterations to run the algorithm for. tol : `float` The tolerance to declare convergence. Notes ----- This method normalizes all vectors before doing clustering. References ---------- [1] <NAME>., <NAME>., <NAME>. (2004). Variational Shape Approximation. RR-5371, INRIA. 2004, pp.29. inria-00070632 """ def __init__(self, mesh, vector_field, n_clusters, iters, tol): # parent class constructor args = mesh, vector_field, n_clusters, iters, tol super(VariationalKMeans, self).__init__(*args) # internal flag to control cluster splitting heuristic self.merge_split = True # to be set after initialization self._initial_clusters = None self._faces = None # create seeds self._create_seeds() def cluster(self): """ Cluster a vector field. Notes ----- It sets `self._clustered_field`, `self_labels`, `self.centers`, and `self.loss`. Returns `None`. """ # do clustering cluster_log = k_means(self._initial_clusters, self._faces, self.iters, self.merge_split) # last chunk in the cluster log final_clusters = cluster_log.pop() # create a new vector field clustered_field = VectorField() clustered_labels = {} centers = {} # fill arrays with results # TODO: Refactor this block! loss = 0 for i, cluster in final_clusters.items(): centroid = cluster.proxy centers[i] = centroid loss += cluster.distortion for fkey in cluster.faces_keys: clustered_field.add_vector(fkey, centroid) clustered_labels[fkey] = cluster.id # assign arrays as attributes self._clustered_field = clustered_field self._labels = clustered_labels self._centers = centers self._loss = loss def _create_seeds(self): """ Find the initial seeds for clustering using a farthest-point strategy. Notes ----- This is a private method. It internally sets `self._faces` and `self._initial_clusters`. Returns `None`. """ vectors = {key: vector for key, vector in self.vector_field.items()} self._faces = make_faces(self.mesh, vectors) self._initial_clusters = furthest_init(self.n_clusters, self._faces).pop()
src/directional_clustering/clustering/kmeans/variational.py
from variational_clustering.clustering import furthest_init from variational_clustering.clustering import make_faces from variational_clustering.clustering import k_means from directional_clustering.clustering.kmeans import KMeans from directional_clustering.fields import VectorField __all__ = ["VariationalKMeans"] class VariationalKMeans(KMeans): """ The variational shape approximation method for vector clustering. Parameters ---------- mesh : `directional_clustering.mesh.MeshPlus` A reference mesh. vector_field : `directional_clustering.fields.VectorField` The vector field to cluster. n_clusters : `int` The number of clusters to generate. iters : `int` The iterations to run the algorithm for. tol : `float` The tolerance to declare convergence. Notes ----- This method normalizes all vectors before doing clustering. References ---------- [1] <NAME>., <NAME>., <NAME>. (2004). Variational Shape Approximation. RR-5371, INRIA. 2004, pp.29. inria-00070632 """ def __init__(self, mesh, vector_field, n_clusters, iters, tol): # parent class constructor args = mesh, vector_field, n_clusters, iters, tol super(VariationalKMeans, self).__init__(*args) # internal flag to control cluster splitting heuristic self.merge_split = True # to be set after initialization self._initial_clusters = None self._faces = None # create seeds self._create_seeds() def cluster(self): """ Cluster a vector field. Notes ----- It sets `self._clustered_field`, `self_labels`, `self.centers`, and `self.loss`. Returns `None`. """ # do clustering cluster_log = k_means(self._initial_clusters, self._faces, self.iters, self.merge_split) # last chunk in the cluster log final_clusters = cluster_log.pop() # create a new vector field clustered_field = VectorField() clustered_labels = {} centers = {} # fill arrays with results # TODO: Refactor this block! loss = 0 for i, cluster in final_clusters.items(): centroid = cluster.proxy centers[i] = centroid loss += cluster.distortion for fkey in cluster.faces_keys: clustered_field.add_vector(fkey, centroid) clustered_labels[fkey] = cluster.id # assign arrays as attributes self._clustered_field = clustered_field self._labels = clustered_labels self._centers = centers self._loss = loss def _create_seeds(self): """ Find the initial seeds for clustering using a farthest-point strategy. Notes ----- This is a private method. It internally sets `self._faces` and `self._initial_clusters`. Returns `None`. """ vectors = {key: vector for key, vector in self.vector_field.items()} self._faces = make_faces(self.mesh, vectors) self._initial_clusters = furthest_init(self.n_clusters, self._faces).pop()
0.916465
0.633524
from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='CarePayment', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('unit_price', models.FloatField(default=150.0, verbose_name='看护费(元/月)')), ('start_pay', models.DateField(verbose_name='支付开始日期(年-月)')), ('end_pay', models.DateField(verbose_name='支付截止日期(年-月)')), ('pay_date', models.DateField(verbose_name='支付日期')), ], options={ 'verbose_name': '看护费支付信息', 'verbose_name_plural': '看护费支付信息', }, ), migrations.CreateModel( name='Caretaker', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('name', models.CharField(max_length=20, verbose_name='姓名')), ('gender', models.PositiveSmallIntegerField(choices=[(0, '男'), (1, '女')], default=0, verbose_name='性别')), ('id_card', models.CharField(max_length=64, verbose_name='身份证号')), ('address', models.CharField(max_length=256, verbose_name='地址')), ('status', models.PositiveSmallIntegerField(choices=[(1, '在看护'), (2, '曾看护'), (3, '中断'), (4, '其它')], verbose_name='状态')), ('start_time', models.DateField(blank=True, null=True, verbose_name='开始时间')), ('end_time', models.DateField(blank=True, null=True, verbose_name='结束时间')), ('remark', models.CharField(blank=True, max_length=256, null=True, verbose_name='备注')), ('is_main', models.BooleanField(default=True, verbose_name='主要看护人')), ], options={ 'verbose_name': '看护人信息', 'verbose_name_plural': '看护人信息', }, ), migrations.CreateModel( name='Network', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('code', models.CharField(max_length=10, unique=True, verbose_name='台网代码')), ('name', models.CharField(max_length=64, verbose_name='台网名称')), ('start_time', models.DateField(blank=True, null=True, verbose_name='开始时间')), ('end_time', models.DateField(blank=True, null=True, verbose_name='结束时间')), ('min_longitude', models.FloatField(blank=True, null=True, verbose_name='台网最小经度')), ('max_longitude', models.FloatField(blank=True, null=True, verbose_name='台网最大经度')), ('min_latitude', models.FloatField(blank=True, null=True, verbose_name='台网最小纬度')), ('max_latitude', models.FloatField(blank=True, null=True, verbose_name='台网最大纬度')), ('status', models.PositiveSmallIntegerField(choices=[(0, '运行'), (1, '测试'), (2, '下线')], default=0, verbose_name='台网状体')), ('describe', models.TextField(blank=True, null=True, verbose_name='台网描述')), ('c_time', models.DateTimeField(auto_now_add=True, verbose_name='创建时间')), ('m_time', models.DateTimeField(auto_now=True, verbose_name='更新日期')), ], options={ 'verbose_name': '台网信息', 'verbose_name_plural': '台网信息', }, ), migrations.CreateModel( name='Phone', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('number', models.CharField(max_length=20, verbose_name='号码')), ('owner', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.SET_NULL, to='seisnet.Caretaker', verbose_name='所有者')), ], ), migrations.CreateModel( name='Station', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('code', models.CharField(max_length=10, unique=True, verbose_name='台站代码')), ('en_name', models.CharField(max_length=64, verbose_name='台站名称(英文)')), ('zh_name', models.CharField(max_length=64, verbose_name='台站名称(中文)')), ('longitude', models.FloatField(verbose_name='台站经度')), ('latitude', models.FloatField(verbose_name='台站纬度')), ('altitude', models.FloatField(verbose_name='台站高程')), ('status', models.PositiveSmallIntegerField(choices=[(0, '运行'), (1, '测试'), (2, '故障'), (3, '下线')], default=0, verbose_name='台站状态')), ('describe', models.TextField(blank=True, null=True, verbose_name='台站描述')), ('location', models.TextField(blank=True, null=True, verbose_name='位置描述')), ('c_time', models.DateTimeField(auto_now_add=True, verbose_name='创建时间')), ('m_time', models.DateTimeField(auto_now=True, verbose_name='更新日期')), ('network', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.SET_NULL, to='seisnet.Network', verbose_name='所属台网')), ], options={ 'verbose_name': '台站信息', 'verbose_name_plural': '台站信息', }, ), migrations.AddField( model_name='caretaker', name='care_station', field=models.ForeignKey(on_delete=django.db.models.deletion.DO_NOTHING, to='seisnet.Station', verbose_name='看护的台站'), ), migrations.AddField( model_name='carepayment', name='caretaker', field=models.ForeignKey(on_delete=django.db.models.deletion.DO_NOTHING, to='seisnet.Caretaker', verbose_name='看护人'), ), ]
mnolms/seisnet/migrations/0001_initial.py
from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='CarePayment', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('unit_price', models.FloatField(default=150.0, verbose_name='看护费(元/月)')), ('start_pay', models.DateField(verbose_name='支付开始日期(年-月)')), ('end_pay', models.DateField(verbose_name='支付截止日期(年-月)')), ('pay_date', models.DateField(verbose_name='支付日期')), ], options={ 'verbose_name': '看护费支付信息', 'verbose_name_plural': '看护费支付信息', }, ), migrations.CreateModel( name='Caretaker', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('name', models.CharField(max_length=20, verbose_name='姓名')), ('gender', models.PositiveSmallIntegerField(choices=[(0, '男'), (1, '女')], default=0, verbose_name='性别')), ('id_card', models.CharField(max_length=64, verbose_name='身份证号')), ('address', models.CharField(max_length=256, verbose_name='地址')), ('status', models.PositiveSmallIntegerField(choices=[(1, '在看护'), (2, '曾看护'), (3, '中断'), (4, '其它')], verbose_name='状态')), ('start_time', models.DateField(blank=True, null=True, verbose_name='开始时间')), ('end_time', models.DateField(blank=True, null=True, verbose_name='结束时间')), ('remark', models.CharField(blank=True, max_length=256, null=True, verbose_name='备注')), ('is_main', models.BooleanField(default=True, verbose_name='主要看护人')), ], options={ 'verbose_name': '看护人信息', 'verbose_name_plural': '看护人信息', }, ), migrations.CreateModel( name='Network', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('code', models.CharField(max_length=10, unique=True, verbose_name='台网代码')), ('name', models.CharField(max_length=64, verbose_name='台网名称')), ('start_time', models.DateField(blank=True, null=True, verbose_name='开始时间')), ('end_time', models.DateField(blank=True, null=True, verbose_name='结束时间')), ('min_longitude', models.FloatField(blank=True, null=True, verbose_name='台网最小经度')), ('max_longitude', models.FloatField(blank=True, null=True, verbose_name='台网最大经度')), ('min_latitude', models.FloatField(blank=True, null=True, verbose_name='台网最小纬度')), ('max_latitude', models.FloatField(blank=True, null=True, verbose_name='台网最大纬度')), ('status', models.PositiveSmallIntegerField(choices=[(0, '运行'), (1, '测试'), (2, '下线')], default=0, verbose_name='台网状体')), ('describe', models.TextField(blank=True, null=True, verbose_name='台网描述')), ('c_time', models.DateTimeField(auto_now_add=True, verbose_name='创建时间')), ('m_time', models.DateTimeField(auto_now=True, verbose_name='更新日期')), ], options={ 'verbose_name': '台网信息', 'verbose_name_plural': '台网信息', }, ), migrations.CreateModel( name='Phone', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('number', models.CharField(max_length=20, verbose_name='号码')), ('owner', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.SET_NULL, to='seisnet.Caretaker', verbose_name='所有者')), ], ), migrations.CreateModel( name='Station', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('code', models.CharField(max_length=10, unique=True, verbose_name='台站代码')), ('en_name', models.CharField(max_length=64, verbose_name='台站名称(英文)')), ('zh_name', models.CharField(max_length=64, verbose_name='台站名称(中文)')), ('longitude', models.FloatField(verbose_name='台站经度')), ('latitude', models.FloatField(verbose_name='台站纬度')), ('altitude', models.FloatField(verbose_name='台站高程')), ('status', models.PositiveSmallIntegerField(choices=[(0, '运行'), (1, '测试'), (2, '故障'), (3, '下线')], default=0, verbose_name='台站状态')), ('describe', models.TextField(blank=True, null=True, verbose_name='台站描述')), ('location', models.TextField(blank=True, null=True, verbose_name='位置描述')), ('c_time', models.DateTimeField(auto_now_add=True, verbose_name='创建时间')), ('m_time', models.DateTimeField(auto_now=True, verbose_name='更新日期')), ('network', models.ForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.SET_NULL, to='seisnet.Network', verbose_name='所属台网')), ], options={ 'verbose_name': '台站信息', 'verbose_name_plural': '台站信息', }, ), migrations.AddField( model_name='caretaker', name='care_station', field=models.ForeignKey(on_delete=django.db.models.deletion.DO_NOTHING, to='seisnet.Station', verbose_name='看护的台站'), ), migrations.AddField( model_name='carepayment', name='caretaker', field=models.ForeignKey(on_delete=django.db.models.deletion.DO_NOTHING, to='seisnet.Caretaker', verbose_name='看护人'), ), ]
0.404037
0.16378
"""Tests for TPU Embeddings mid level API on TPU.""" from absl.testing import parameterized from tensorflow.python.compat import v2_compat from tensorflow.python.distribute import distribute_lib from tensorflow.python.eager import def_function from tensorflow.python.framework.tensor_shape import TensorShape from tensorflow.python.platform import test from tensorflow.python.tpu.tests import tpu_embedding_base_test class TPUEmbeddingTest(tpu_embedding_base_test.TPUEmbeddingBaseTest): @parameterized.parameters([True, False]) def test_sequence_feature(self, is_sparse): seq_length = 3 # Set the max_seq_length in feature config for feature in self.feature_config: feature.max_sequence_length = seq_length strategy, mid_level_api, _ = self._create_strategy_and_mid_level('sgd') if is_sparse: dataset = self._create_sparse_dataset(strategy) else: dataset = self._create_ragged_dataset(strategy) feature_iter = iter( strategy.experimental_distribute_dataset( dataset, options=distribute_lib.InputOptions( experimental_fetch_to_device=False))) @def_function.function def test_fn(): def step(): return mid_level_api.dequeue() mid_level_api.enqueue(next(feature_iter), training=False) return strategy.run(step) output = test_fn() self.assertEqual( self._get_replica_numpy(output[0], strategy, 0).shape, (2, 3, 4)) self.assertEqual( self._get_replica_numpy(output[1], strategy, 0).shape, (2, 3, 4)) self.assertEqual( self._get_replica_numpy(output[2], strategy, 0).shape, (2, 3, 2)) @parameterized.parameters([True, False]) def test_sequence_feature_with_build(self, is_updated_shape): seq_length = 3 # Set the max_seq_length in feature config for feature in self.feature_config: feature.max_sequence_length = seq_length strategy, mid_level_api, _ = self._create_strategy_and_mid_level('sgd') dataset = self._create_sparse_dataset(strategy) feature_iter = iter( strategy.experimental_distribute_dataset( dataset, options=distribute_lib.InputOptions( experimental_fetch_to_device=False))) if is_updated_shape: mid_level_api.build([ TensorShape([self.batch_size, seq_length, 2]), TensorShape([self.batch_size, seq_length, 2]), TensorShape([self.batch_size, seq_length, 3]) ]) else: mid_level_api.build([ TensorShape([self.batch_size, 2]), TensorShape([self.batch_size, 2]), TensorShape([self.batch_size, 3]) ]) @def_function.function def test_fn(): def step(): return mid_level_api.dequeue() mid_level_api.enqueue(next(feature_iter), training=False) return strategy.run(step) output = test_fn() self.assertEqual( self._get_replica_numpy(output[0], strategy, 0).shape, (2, 3, 4)) self.assertEqual( self._get_replica_numpy(output[1], strategy, 0).shape, (2, 3, 4)) self.assertEqual( self._get_replica_numpy(output[2], strategy, 0).shape, (2, 3, 2)) if __name__ == '__main__': v2_compat.enable_v2_behavior() test.main()
tensorflow/python/tpu/tests/tpu_embedding_v2_sequence_feature_test.py
"""Tests for TPU Embeddings mid level API on TPU.""" from absl.testing import parameterized from tensorflow.python.compat import v2_compat from tensorflow.python.distribute import distribute_lib from tensorflow.python.eager import def_function from tensorflow.python.framework.tensor_shape import TensorShape from tensorflow.python.platform import test from tensorflow.python.tpu.tests import tpu_embedding_base_test class TPUEmbeddingTest(tpu_embedding_base_test.TPUEmbeddingBaseTest): @parameterized.parameters([True, False]) def test_sequence_feature(self, is_sparse): seq_length = 3 # Set the max_seq_length in feature config for feature in self.feature_config: feature.max_sequence_length = seq_length strategy, mid_level_api, _ = self._create_strategy_and_mid_level('sgd') if is_sparse: dataset = self._create_sparse_dataset(strategy) else: dataset = self._create_ragged_dataset(strategy) feature_iter = iter( strategy.experimental_distribute_dataset( dataset, options=distribute_lib.InputOptions( experimental_fetch_to_device=False))) @def_function.function def test_fn(): def step(): return mid_level_api.dequeue() mid_level_api.enqueue(next(feature_iter), training=False) return strategy.run(step) output = test_fn() self.assertEqual( self._get_replica_numpy(output[0], strategy, 0).shape, (2, 3, 4)) self.assertEqual( self._get_replica_numpy(output[1], strategy, 0).shape, (2, 3, 4)) self.assertEqual( self._get_replica_numpy(output[2], strategy, 0).shape, (2, 3, 2)) @parameterized.parameters([True, False]) def test_sequence_feature_with_build(self, is_updated_shape): seq_length = 3 # Set the max_seq_length in feature config for feature in self.feature_config: feature.max_sequence_length = seq_length strategy, mid_level_api, _ = self._create_strategy_and_mid_level('sgd') dataset = self._create_sparse_dataset(strategy) feature_iter = iter( strategy.experimental_distribute_dataset( dataset, options=distribute_lib.InputOptions( experimental_fetch_to_device=False))) if is_updated_shape: mid_level_api.build([ TensorShape([self.batch_size, seq_length, 2]), TensorShape([self.batch_size, seq_length, 2]), TensorShape([self.batch_size, seq_length, 3]) ]) else: mid_level_api.build([ TensorShape([self.batch_size, 2]), TensorShape([self.batch_size, 2]), TensorShape([self.batch_size, 3]) ]) @def_function.function def test_fn(): def step(): return mid_level_api.dequeue() mid_level_api.enqueue(next(feature_iter), training=False) return strategy.run(step) output = test_fn() self.assertEqual( self._get_replica_numpy(output[0], strategy, 0).shape, (2, 3, 4)) self.assertEqual( self._get_replica_numpy(output[1], strategy, 0).shape, (2, 3, 4)) self.assertEqual( self._get_replica_numpy(output[2], strategy, 0).shape, (2, 3, 2)) if __name__ == '__main__': v2_compat.enable_v2_behavior() test.main()
0.874077
0.515559
import re # Regular expression operations import wikipedia # Python library that makes it easy to access and parse data from Wikipedia import wikipedia.exceptions # Exceptions of wikipedia library import requests.exceptions # HTTP for Humans from ava.utilities import nostderr # Submodule of Dragonfire to provide various utilities class FindInWikiCommand(): """Class to contains searching in wikipedia process with simply if-else struct. """ def first_compare(self, doc, h, user_answering, userin, user_prefix): """Method to ava's first command struct of searching in wikipedia ability. Args: doc: doc of com from __init__.py h: doc helper from __init__.py user_answering: User answering string array. userin: :class:`ava.utilities.TextToAction` instance. Keyword Args: user_prefix: user's preferred titles. """ if (h.check_lemma("search") or h.check_lemma("find")) and h.check_lemma("wikipedia"): with nostderr(): search_query = "" for token in doc: if not ( token.lemma_ == "search" or token.lemma_ == "find" or token.lemma_ == "wikipedia" or token.is_stop): search_query += ' ' + token.text search_query = search_query.strip() if search_query: try: wikiresult = wikipedia.search(search_query) if len(wikiresult) == 0: userin.say( "Sorry, " + user_prefix + ". But I couldn't find anything about " + search_query + " in Wikipedia.") return True wikipage = wikipedia.page(wikiresult[0]) wikicontent = "".join([i if ord(i) < 128 else ' ' for i in wikipage.content]) wikicontent = re.sub(r'\([^)]*\)', '', wikicontent) cmds = [{'distro': 'All', 'name': ["sensible-browser", wikipage.url]}] userin.execute(cmds, search_query) return userin.say(wikicontent, cmd=["sensible-browser", wikipage.url]) except requests.exceptions.ConnectionError: cmds = [{'distro': 'All', 'name': [" "]}] userin.execute(cmds, "Wikipedia connection error.") return userin.say("Sorry, " + user_prefix + ". But I'm unable to connect to Wikipedia servers.") except wikipedia.exceptions.DisambiguationError as disambiguation: user_answering['status'] = True user_answering['for'] = 'wikipedia' user_answering['reason'] = 'disambiguation' user_answering['options'] = disambiguation.options[:3] notify = "Wikipedia disambiguation. Which one of these you meant?:\n - " + disambiguation.options[0] msg = user_prefix + ", there is a disambiguation. Which one of these you meant? " + disambiguation.options[0] for option in disambiguation.options[1:3]: msg += ", or " + option notify += "\n - " + option notify += '\nSay, for example: "THE FIRST ONE" to choose.' cmds = [{'distro': 'All', 'name': [" "]}] userin.execute(cmds, notify) return userin.say(msg) except BaseException: pass return None def second_compare(self, com, user_answering, userin, user_prefix): """Method to ava's first command struct of searching in wikipedia ability. Args: com (str): User's command. user_answering: User answering string array. userin: :class:`ava.utilities.TextToAction` instance. user_prefix: user's preferred titles. """ if user_answering['status'] and user_answering['for'] == 'wikipedia': if com.startswith("FIRST") or com.startswith("THE FIRST") or com.startswith("SECOND") or com.startswith( "THE SECOND") or com.startswith("THIRD") or com.startswith("THE THIRD"): user_answering['status'] = False selection = None if com.startswith("FIRST") or com.startswith("THE FIRST"): selection = 0 elif com.startswith("SECOND") or com.startswith("THE SECOND"): selection = 1 elif com.startswith("THIRD") or com.startswith("THE THIRD"): selection = 2 with nostderr(): search_query = user_answering['options'][selection] try: wikiresult = wikipedia.search(search_query) if len(wikiresult) == 0: userin.say( "Sorry, " + user_prefix + ". But I couldn't find anything about " + search_query + " in Wikipedia.") return True wikipage = wikipedia.page(wikiresult[0]) wikicontent = "".join([i if ord(i) < 128 else ' ' for i in wikipage.content]) wikicontent = re.sub(r'\([^)]*\)', '', wikicontent) cmds = [{'distro': 'All', 'name': ["sensible-browser", wikipage.url]}] userin.execute(cmds, search_query) return userin.say(wikicontent, cmd=["sensible-browser", wikipage.url]) except requests.exceptions.ConnectionError: cmds = [{'distro': 'All', 'name': [" "]}] userin.execute(cmds, "Wikipedia connection error.") return userin.say( "Sorry, " + user_prefix + ". But I'm unable to connect to Wikipedia servers.") except Exception: return False return None
ava/commands/find_in_wikipedia.py
import re # Regular expression operations import wikipedia # Python library that makes it easy to access and parse data from Wikipedia import wikipedia.exceptions # Exceptions of wikipedia library import requests.exceptions # HTTP for Humans from ava.utilities import nostderr # Submodule of Dragonfire to provide various utilities class FindInWikiCommand(): """Class to contains searching in wikipedia process with simply if-else struct. """ def first_compare(self, doc, h, user_answering, userin, user_prefix): """Method to ava's first command struct of searching in wikipedia ability. Args: doc: doc of com from __init__.py h: doc helper from __init__.py user_answering: User answering string array. userin: :class:`ava.utilities.TextToAction` instance. Keyword Args: user_prefix: user's preferred titles. """ if (h.check_lemma("search") or h.check_lemma("find")) and h.check_lemma("wikipedia"): with nostderr(): search_query = "" for token in doc: if not ( token.lemma_ == "search" or token.lemma_ == "find" or token.lemma_ == "wikipedia" or token.is_stop): search_query += ' ' + token.text search_query = search_query.strip() if search_query: try: wikiresult = wikipedia.search(search_query) if len(wikiresult) == 0: userin.say( "Sorry, " + user_prefix + ". But I couldn't find anything about " + search_query + " in Wikipedia.") return True wikipage = wikipedia.page(wikiresult[0]) wikicontent = "".join([i if ord(i) < 128 else ' ' for i in wikipage.content]) wikicontent = re.sub(r'\([^)]*\)', '', wikicontent) cmds = [{'distro': 'All', 'name': ["sensible-browser", wikipage.url]}] userin.execute(cmds, search_query) return userin.say(wikicontent, cmd=["sensible-browser", wikipage.url]) except requests.exceptions.ConnectionError: cmds = [{'distro': 'All', 'name': [" "]}] userin.execute(cmds, "Wikipedia connection error.") return userin.say("Sorry, " + user_prefix + ". But I'm unable to connect to Wikipedia servers.") except wikipedia.exceptions.DisambiguationError as disambiguation: user_answering['status'] = True user_answering['for'] = 'wikipedia' user_answering['reason'] = 'disambiguation' user_answering['options'] = disambiguation.options[:3] notify = "Wikipedia disambiguation. Which one of these you meant?:\n - " + disambiguation.options[0] msg = user_prefix + ", there is a disambiguation. Which one of these you meant? " + disambiguation.options[0] for option in disambiguation.options[1:3]: msg += ", or " + option notify += "\n - " + option notify += '\nSay, for example: "THE FIRST ONE" to choose.' cmds = [{'distro': 'All', 'name': [" "]}] userin.execute(cmds, notify) return userin.say(msg) except BaseException: pass return None def second_compare(self, com, user_answering, userin, user_prefix): """Method to ava's first command struct of searching in wikipedia ability. Args: com (str): User's command. user_answering: User answering string array. userin: :class:`ava.utilities.TextToAction` instance. user_prefix: user's preferred titles. """ if user_answering['status'] and user_answering['for'] == 'wikipedia': if com.startswith("FIRST") or com.startswith("THE FIRST") or com.startswith("SECOND") or com.startswith( "THE SECOND") or com.startswith("THIRD") or com.startswith("THE THIRD"): user_answering['status'] = False selection = None if com.startswith("FIRST") or com.startswith("THE FIRST"): selection = 0 elif com.startswith("SECOND") or com.startswith("THE SECOND"): selection = 1 elif com.startswith("THIRD") or com.startswith("THE THIRD"): selection = 2 with nostderr(): search_query = user_answering['options'][selection] try: wikiresult = wikipedia.search(search_query) if len(wikiresult) == 0: userin.say( "Sorry, " + user_prefix + ". But I couldn't find anything about " + search_query + " in Wikipedia.") return True wikipage = wikipedia.page(wikiresult[0]) wikicontent = "".join([i if ord(i) < 128 else ' ' for i in wikipage.content]) wikicontent = re.sub(r'\([^)]*\)', '', wikicontent) cmds = [{'distro': 'All', 'name': ["sensible-browser", wikipage.url]}] userin.execute(cmds, search_query) return userin.say(wikicontent, cmd=["sensible-browser", wikipage.url]) except requests.exceptions.ConnectionError: cmds = [{'distro': 'All', 'name': [" "]}] userin.execute(cmds, "Wikipedia connection error.") return userin.say( "Sorry, " + user_prefix + ". But I'm unable to connect to Wikipedia servers.") except Exception: return False return None
0.516595
0.292608
import logging import confluent_kafka from oslo_utils import encodeutils log = logging.getLogger(__name__) class KafkaProducer(object): """Wrapper around asynchronous Kafka Producer""" def __init__(self, bootstrap_servers, **config): """ Create new Producer wrapper instance. :param str bootstrap_servers: Initial list of brokers as a CSV list of broker host or host:port. :param config Configuration properties """ config['bootstrap.servers'] = bootstrap_servers self._producer = confluent_kafka.Producer(config) @staticmethod def delivery_report(err, msg): """ Callback called once for each produced message to indicate the final delivery result. Triggered by poll() or flush(). :param confluent_kafka.KafkaError err: Information about any error that occurred whilst producing the message. :param confluent_kafka.Message msg: Information about the message produced. :returns: None :raises confluent_kafka.KafkaException """ if err is not None: log.exception('Message delivery failed: {}'.format(err)) raise confluent_kafka.KafkaException(err) else: log.debug('Message delivered to {} [{}]: {}'.format( msg.topic(), msg.partition(), msg.value())) def publish(self, topic, messages, key=None, timeout=2): """ Publish messages to the topic. :param str topic: Topic to produce messages to. :param list(str) messages: List of message payloads. :param str key: Message key. :param float timeout: Maximum time to block in seconds. :returns: Number of messages still in queue. :rtype int """ if not isinstance(messages, list): messages = [messages] try: for m in messages: m = encodeutils.safe_encode(m, incoming='utf-8') self._producer.produce(topic, m, key, callback=KafkaProducer.delivery_report) self._producer.poll(0) return self._producer.flush(timeout) except (BufferError, confluent_kafka.KafkaException, NotImplementedError): log.exception(u'Error publishing to {} topic.'.format(topic)) raise
monasca_common/confluent_kafka/producer.py
import logging import confluent_kafka from oslo_utils import encodeutils log = logging.getLogger(__name__) class KafkaProducer(object): """Wrapper around asynchronous Kafka Producer""" def __init__(self, bootstrap_servers, **config): """ Create new Producer wrapper instance. :param str bootstrap_servers: Initial list of brokers as a CSV list of broker host or host:port. :param config Configuration properties """ config['bootstrap.servers'] = bootstrap_servers self._producer = confluent_kafka.Producer(config) @staticmethod def delivery_report(err, msg): """ Callback called once for each produced message to indicate the final delivery result. Triggered by poll() or flush(). :param confluent_kafka.KafkaError err: Information about any error that occurred whilst producing the message. :param confluent_kafka.Message msg: Information about the message produced. :returns: None :raises confluent_kafka.KafkaException """ if err is not None: log.exception('Message delivery failed: {}'.format(err)) raise confluent_kafka.KafkaException(err) else: log.debug('Message delivered to {} [{}]: {}'.format( msg.topic(), msg.partition(), msg.value())) def publish(self, topic, messages, key=None, timeout=2): """ Publish messages to the topic. :param str topic: Topic to produce messages to. :param list(str) messages: List of message payloads. :param str key: Message key. :param float timeout: Maximum time to block in seconds. :returns: Number of messages still in queue. :rtype int """ if not isinstance(messages, list): messages = [messages] try: for m in messages: m = encodeutils.safe_encode(m, incoming='utf-8') self._producer.produce(topic, m, key, callback=KafkaProducer.delivery_report) self._producer.poll(0) return self._producer.flush(timeout) except (BufferError, confluent_kafka.KafkaException, NotImplementedError): log.exception(u'Error publishing to {} topic.'.format(topic)) raise
0.756088
0.104249
import os import pytest try: from cStringIO import StringIO except ImportError: from io import StringIO from nagare.renderers import xml from nagare.renderers import html_base as html def test_parse1(): h = html.HeadRenderer() root = h.fromfile(StringIO('<html><body/></html>')) assert isinstance(root, html.Tag) assert root.tostring() == b'<html><body></body></html>' root = h.fromfile(StringIO('<html><body/></html>'), xml.Tag) assert isinstance(root, xml.Tag) assert root.tostring() == b'<html><body/></html>' root = h.fromstring('<html><body/></html>') assert isinstance(root, html.Tag) assert root.tostring() == b'<html><body></body></html>' root = h.fromstring('<html><body/></html>', xml.Tag) assert isinstance(root, xml.Tag) assert root.tostring() == b'<html><body/></html>' def test_parse2(): h = html.Renderer() root = h.fromfile(StringIO('<html><body/></html>')) assert isinstance(root, html.Tag) assert root.tostring() == b'<html><body></body></html>' root = h.fromfile(StringIO('<html><body/></html>'), xml.Tag) assert isinstance(root, xml.Tag) assert root.tostring() == b'<html><body/></html>' root = h.fromstring('<html><body/></html>') assert isinstance(root, html.Tag) assert root.tostring() == b'<html><body></body></html>' root = h.fromstring('<html><body/></html>', xml.Tag) assert isinstance(root, xml.Tag) assert root.tostring() == b'<html><body/></html>' def test_parse3(): """ XHTML namespace unit test - HTMLRender - parse_html - bad encoding """ h = html.Renderer() filename = os.path.join(os.path.dirname(__file__), 'iso-8859.xml') with pytest.raises(UnicodeDecodeError): h.fromfile(filename, encoding='utf-8') h.fromfile(filename, encoding='iso8859-1') def test_parse4(): h = html.Renderer() root = h.fromstring('<html><head><body></body></head><html>') assert root.tostring() == b'<html><head></head><body></body></html>' def test_parse5(): h = html.Renderer() root = h.fromstring('test') assert root.tostring() == b'<html><body><p>test</p></body></html>' def test_parse6(): h = html.Renderer() root = h.fromstring('<a>text</a>') assert type(root) == html.Tag x = xml.Renderer() root = x.fromstring('<a>text</a>') assert type(root) == xml.Tag def test_parse8(): h = html.Renderer() root = h.fromstring('<a>text</a>', fragment=True) assert isinstance(root, tuple) assert len(root) == 1 assert root[0].tostring() == b'<a>text</a>' def test_parse9(): h = html.Renderer() root = h.fromstring('<a>text</a><b>text</b>', fragment=True) assert isinstance(root, tuple) assert len(root) == 2 assert root[0].tostring() == b'<a>text</a>' assert root[1].tostring() == b'<b>text</b>' def test_parse10(): h = html.Renderer() root = h.fromstring('hello<a>text</a><b>text</b>', fragment=True) assert isinstance(root, tuple) assert len(root) == 3 assert root[0] == b'hello' assert root[1].tostring() == b'<a>text</a>' assert root[2].tostring() == b'<b>text</b>' root = h.fromstring('hello<a>text</a><b>text</b>', fragment=True, no_leading_text=True) assert isinstance(root, tuple) assert len(root) == 2 assert root[0].tostring() == b'<a>text</a>' assert root[1].tostring() == b'<b>text</b>'
tests/test_parse.py
import os import pytest try: from cStringIO import StringIO except ImportError: from io import StringIO from nagare.renderers import xml from nagare.renderers import html_base as html def test_parse1(): h = html.HeadRenderer() root = h.fromfile(StringIO('<html><body/></html>')) assert isinstance(root, html.Tag) assert root.tostring() == b'<html><body></body></html>' root = h.fromfile(StringIO('<html><body/></html>'), xml.Tag) assert isinstance(root, xml.Tag) assert root.tostring() == b'<html><body/></html>' root = h.fromstring('<html><body/></html>') assert isinstance(root, html.Tag) assert root.tostring() == b'<html><body></body></html>' root = h.fromstring('<html><body/></html>', xml.Tag) assert isinstance(root, xml.Tag) assert root.tostring() == b'<html><body/></html>' def test_parse2(): h = html.Renderer() root = h.fromfile(StringIO('<html><body/></html>')) assert isinstance(root, html.Tag) assert root.tostring() == b'<html><body></body></html>' root = h.fromfile(StringIO('<html><body/></html>'), xml.Tag) assert isinstance(root, xml.Tag) assert root.tostring() == b'<html><body/></html>' root = h.fromstring('<html><body/></html>') assert isinstance(root, html.Tag) assert root.tostring() == b'<html><body></body></html>' root = h.fromstring('<html><body/></html>', xml.Tag) assert isinstance(root, xml.Tag) assert root.tostring() == b'<html><body/></html>' def test_parse3(): """ XHTML namespace unit test - HTMLRender - parse_html - bad encoding """ h = html.Renderer() filename = os.path.join(os.path.dirname(__file__), 'iso-8859.xml') with pytest.raises(UnicodeDecodeError): h.fromfile(filename, encoding='utf-8') h.fromfile(filename, encoding='iso8859-1') def test_parse4(): h = html.Renderer() root = h.fromstring('<html><head><body></body></head><html>') assert root.tostring() == b'<html><head></head><body></body></html>' def test_parse5(): h = html.Renderer() root = h.fromstring('test') assert root.tostring() == b'<html><body><p>test</p></body></html>' def test_parse6(): h = html.Renderer() root = h.fromstring('<a>text</a>') assert type(root) == html.Tag x = xml.Renderer() root = x.fromstring('<a>text</a>') assert type(root) == xml.Tag def test_parse8(): h = html.Renderer() root = h.fromstring('<a>text</a>', fragment=True) assert isinstance(root, tuple) assert len(root) == 1 assert root[0].tostring() == b'<a>text</a>' def test_parse9(): h = html.Renderer() root = h.fromstring('<a>text</a><b>text</b>', fragment=True) assert isinstance(root, tuple) assert len(root) == 2 assert root[0].tostring() == b'<a>text</a>' assert root[1].tostring() == b'<b>text</b>' def test_parse10(): h = html.Renderer() root = h.fromstring('hello<a>text</a><b>text</b>', fragment=True) assert isinstance(root, tuple) assert len(root) == 3 assert root[0] == b'hello' assert root[1].tostring() == b'<a>text</a>' assert root[2].tostring() == b'<b>text</b>' root = h.fromstring('hello<a>text</a><b>text</b>', fragment=True, no_leading_text=True) assert isinstance(root, tuple) assert len(root) == 2 assert root[0].tostring() == b'<a>text</a>' assert root[1].tostring() == b'<b>text</b>'
0.591841
0.320369
import datetime from sqlalchemy import create_engine from sqlalchemy.exc import SQLAlchemyError from sqlalchemy.orm import sessionmaker from configs import DatabaseConfig from database.models import Base, MoneyChanger, MoneyChangerBranch, PaymentRequest from balebot.utils.logger import Logger logger = Logger.get_logger() engine = create_engine(DatabaseConfig.database_url) Session = sessionmaker(engine) session = Session() def create_all_table(): Base.metadata.create_all(engine) return True def drop_all_table(): Base.metadata.drop_all(engine) return True def db_persist(func): def persist(*args, **kwargs): func(*args, **kwargs) try: session.commit() logger.info("success calling db func: " + func.__name__) return True except SQLAlchemyError as e: logger.error(e.args) session.rollback() return False return persist @db_persist def insert_to_table(table_object): if isinstance(table_object, list): session.add_all(table_object) else: session.add(table_object) @db_persist def delete_from_table(table_object): if isinstance(table_object, list): for obj in table_object: session.delete(obj) else: session.delete(table_object) @db_persist def insert_or_update(table_object): return session.merge(table_object) @db_persist def update_money_changer_remittance_fee_percent(money_changer, percent): if isinstance(money_changer, MoneyChanger): money_changer.remittance_fee_percent = percent @db_persist def update_money_changer_dollar_rial(money_changer, dollar_rial): if isinstance(money_changer, MoneyChanger): money_changer.dollar_rial = dollar_rial @db_persist def update_money_changer_dollar_afghani(money_changer, dollar_afghani): if isinstance(money_changer, MoneyChanger): money_changer.dollar_afghani = dollar_afghani @db_persist def update_money_changer_card_number(money_changer, card_number): if isinstance(money_changer, MoneyChanger): money_changer.card_number = card_number @db_persist def update_money_changer_access_hash(money_changer, access_hash): if isinstance(money_changer, MoneyChanger): money_changer.access_hash = access_hash @db_persist def update_payment_is_done(payment_request): if isinstance(payment_request, PaymentRequest): payment_request.is_done = True payment_request.pay_date_time = datetime.datetime.now() def select_money_changer_by_peer_id(peer_id): return session.query(MoneyChanger).filter(MoneyChanger.peer_id == peer_id).one_or_none() def select_money_changer_by_id(money_changer_id): return session.query(MoneyChanger).filter(MoneyChanger.id == money_changer_id).one_or_none() def select_ready_money_changers(): return session.query(MoneyChanger).filter(MoneyChanger.access_hash.isnot(None)).all() def select_all_province_names(): return [r.province_name for r in session.query(MoneyChangerBranch.province).distinct().all()] def select_branches_by_money_changer_id(money_changer_id): return session.query(MoneyChangerBranch).filter(MoneyChangerBranch.money_changer_id == money_changer_id).all() def select_last_payment_request(): return session.query(PaymentRequest).order_by(PaymentRequest.id.desc()).first() def select_payment_with_code(code): return session.query(PaymentRequest).filter(PaymentRequest.code == code).one_or_none() def select_all_payments(): return session.query(PaymentRequest).all()
database/operations.py
import datetime from sqlalchemy import create_engine from sqlalchemy.exc import SQLAlchemyError from sqlalchemy.orm import sessionmaker from configs import DatabaseConfig from database.models import Base, MoneyChanger, MoneyChangerBranch, PaymentRequest from balebot.utils.logger import Logger logger = Logger.get_logger() engine = create_engine(DatabaseConfig.database_url) Session = sessionmaker(engine) session = Session() def create_all_table(): Base.metadata.create_all(engine) return True def drop_all_table(): Base.metadata.drop_all(engine) return True def db_persist(func): def persist(*args, **kwargs): func(*args, **kwargs) try: session.commit() logger.info("success calling db func: " + func.__name__) return True except SQLAlchemyError as e: logger.error(e.args) session.rollback() return False return persist @db_persist def insert_to_table(table_object): if isinstance(table_object, list): session.add_all(table_object) else: session.add(table_object) @db_persist def delete_from_table(table_object): if isinstance(table_object, list): for obj in table_object: session.delete(obj) else: session.delete(table_object) @db_persist def insert_or_update(table_object): return session.merge(table_object) @db_persist def update_money_changer_remittance_fee_percent(money_changer, percent): if isinstance(money_changer, MoneyChanger): money_changer.remittance_fee_percent = percent @db_persist def update_money_changer_dollar_rial(money_changer, dollar_rial): if isinstance(money_changer, MoneyChanger): money_changer.dollar_rial = dollar_rial @db_persist def update_money_changer_dollar_afghani(money_changer, dollar_afghani): if isinstance(money_changer, MoneyChanger): money_changer.dollar_afghani = dollar_afghani @db_persist def update_money_changer_card_number(money_changer, card_number): if isinstance(money_changer, MoneyChanger): money_changer.card_number = card_number @db_persist def update_money_changer_access_hash(money_changer, access_hash): if isinstance(money_changer, MoneyChanger): money_changer.access_hash = access_hash @db_persist def update_payment_is_done(payment_request): if isinstance(payment_request, PaymentRequest): payment_request.is_done = True payment_request.pay_date_time = datetime.datetime.now() def select_money_changer_by_peer_id(peer_id): return session.query(MoneyChanger).filter(MoneyChanger.peer_id == peer_id).one_or_none() def select_money_changer_by_id(money_changer_id): return session.query(MoneyChanger).filter(MoneyChanger.id == money_changer_id).one_or_none() def select_ready_money_changers(): return session.query(MoneyChanger).filter(MoneyChanger.access_hash.isnot(None)).all() def select_all_province_names(): return [r.province_name for r in session.query(MoneyChangerBranch.province).distinct().all()] def select_branches_by_money_changer_id(money_changer_id): return session.query(MoneyChangerBranch).filter(MoneyChangerBranch.money_changer_id == money_changer_id).all() def select_last_payment_request(): return session.query(PaymentRequest).order_by(PaymentRequest.id.desc()).first() def select_payment_with_code(code): return session.query(PaymentRequest).filter(PaymentRequest.code == code).one_or_none() def select_all_payments(): return session.query(PaymentRequest).all()
0.416322
0.061848
class Ropa: def __init__(self): pass def tender(self, clima): # Ejemplo if clima == "lluvia": return "no tiendo" else: return "tiendo" def tender_con_negacion(self, clima): # Ejemplo """ Este ejemplo es equivalente (esto quiere decir que para la misma entrada dará el mismo resultado) a la función tender, solo que usamos la negación != que significa es distinto de, contrario a == que significa que es igual a """ if clima != "lluvia": return "tiendo" # El return corta el flujo ya no se ocupa else return "no tiendo" # En al función de arriba siempre que clima sea distinto de lluvia # vas a tender la ropa y regresaras el resultado "tiendo", el return # corta el flujo por lo que la linea 26 (return no tiendo) nunca se # ejecutará si clima es distinto de lluvia y la 25 sí, en cambio, # si clima es lluvia la 25 no se ejefcutará y continuara el flujo # en la línea 26 class Semaforo: def __init__(self): pass def avanza(self, color): """ Debe regresar "avanza" si el color es verde, y "no avanza" si es amarillo o rojo """ if color == "verde": return "avanza" return "no avanza" class Pastel: def __init__(self): pass def suficiente(self, cantidad_rebanadas, cantidad_comensales): """ Debe regresar "suficiente" si cantidad_rebanadas es mayor o igual que la cantidad de comensales, si es menor regresará "insuficiente" """ if cantidad_rebanadas >= cantidad_comensales: return "suficiente" return "insuficiente" def diferencia(self, cantidad_rebanadas, cantidad_comensales): """ Debe regresar el valor absoluto de la diferencia entre cantidad_rebanadas y cantidad_comensales """ return abs(cantidad_rebanadas - cantidad_comensales) def es_de_chocolate(self, sabor): """ Debe regresar "si" si el sabor es "chocolate", "no" si no lo es """ if sabor == "chocolate": return "si" return "no" class Futbol: def __init__(self): pass def equipo_valido(self, cantidad_jugadores): """ Debe regresar "valido" si tiene 11 jugadores, de lo contrario regresara no valido """ if cantidad_jugadores == 11: return "valido" return "no valido"
if_statement/if_statement.py
class Ropa: def __init__(self): pass def tender(self, clima): # Ejemplo if clima == "lluvia": return "no tiendo" else: return "tiendo" def tender_con_negacion(self, clima): # Ejemplo """ Este ejemplo es equivalente (esto quiere decir que para la misma entrada dará el mismo resultado) a la función tender, solo que usamos la negación != que significa es distinto de, contrario a == que significa que es igual a """ if clima != "lluvia": return "tiendo" # El return corta el flujo ya no se ocupa else return "no tiendo" # En al función de arriba siempre que clima sea distinto de lluvia # vas a tender la ropa y regresaras el resultado "tiendo", el return # corta el flujo por lo que la linea 26 (return no tiendo) nunca se # ejecutará si clima es distinto de lluvia y la 25 sí, en cambio, # si clima es lluvia la 25 no se ejefcutará y continuara el flujo # en la línea 26 class Semaforo: def __init__(self): pass def avanza(self, color): """ Debe regresar "avanza" si el color es verde, y "no avanza" si es amarillo o rojo """ if color == "verde": return "avanza" return "no avanza" class Pastel: def __init__(self): pass def suficiente(self, cantidad_rebanadas, cantidad_comensales): """ Debe regresar "suficiente" si cantidad_rebanadas es mayor o igual que la cantidad de comensales, si es menor regresará "insuficiente" """ if cantidad_rebanadas >= cantidad_comensales: return "suficiente" return "insuficiente" def diferencia(self, cantidad_rebanadas, cantidad_comensales): """ Debe regresar el valor absoluto de la diferencia entre cantidad_rebanadas y cantidad_comensales """ return abs(cantidad_rebanadas - cantidad_comensales) def es_de_chocolate(self, sabor): """ Debe regresar "si" si el sabor es "chocolate", "no" si no lo es """ if sabor == "chocolate": return "si" return "no" class Futbol: def __init__(self): pass def equipo_valido(self, cantidad_jugadores): """ Debe regresar "valido" si tiene 11 jugadores, de lo contrario regresara no valido """ if cantidad_jugadores == 11: return "valido" return "no valido"
0.574514
0.469216
import torch import numpy as np # 'department' will be classified as 'course' in GCN label2id = { 'student': 0, 'faculty': 1, 'project': 2, 'course': 3, 'staff': 4, 'department': 3, } id2label = { 0: 'student', 1: 'faculty', 2: 'project', 3: 'course', 4: 'staff', } def load_data(dataset_path, uni_lt=['cornell', 'texas', 'wisconsin', 'washington', 'misc'], cat_lt=['student', 'faculty', 'project', 'course', 'staff', 'department']): """Load the pre-processed data. Make sure all the ids of label in cat_ltare defined in preprocessor.id2label dictionary. Args: dataset_path: String of path to the pre-processed dataset, which is like './xxx/dataset.tsv' uni_lt: List of string containing the university names to load. Default as ['cornell', 'texas', 'wisconsin', 'washington', 'other'] cat_lt: List of string containing the category names to load. Default as ['student', 'faculty', 'project', 'course', 'staff', 'department'] Returns: A tuple of two list (texts, labels). texts is a list of string containing the clean text for tokenization. labels is a list of single integer list in shape (x, 1). """ texts = [] labels = [] with open(dataset_path, 'r') as data_file: for data_line in data_file: uni_name, cat_name, text, url = data_line.strip('\n').split('\t') if (uni_name in uni_lt) and (cat_name in cat_lt): texts.append(text) labels.append(label2id[cat_name]) return texts, labels def statistics(train_labels=None, val_labels=None, test_labels=None): """Compute the statistics info of the datasets. Args: train_labels: (Optional) List of training labels. val_labels: (Optional) List of validation labels. test_labels=None: (Optional) List of testing labels. Returns: String of the statistics info (for logging). """ names = ['train set', 'val set', 'test set'] tot_siz = 0 s_log = '' train_val_test_labels = [train_labels, val_labels, test_labels] for set_name, label_ids in zip(names, train_val_test_labels): if label_ids is not None: tot_siz += len(label_ids) s_log += f'[{set_name:>9}] ' for label_id, label_name in id2label.items(): label_siz = (np.array(label_ids) == label_id).sum() s_log += f'{label_name}: {label_siz:4} | ' s_log += f'total: {len(label_ids)}\n' s_log += f'total size = {tot_siz}\n' return s_log class WebKBDataset(torch.utils.data.Dataset): def __init__(self, encodings, labels): self.encodings = encodings self.labels = labels def __getitem__(self, idx): item = {key: torch.tensor(val[idx]) for key, val in self.encodings.items()} item['labels'] = torch.tensor(self.labels[idx]) return item def __len__(self): return len(self.labels) if __name__ == '__main__': uni_lt = ['wisconsin'] cat_lt = ['student', 'faculty', 'project', 'course', 'staff', 'department'] split_id = 0 print('uni_lt: ', uni_lt) train_texts, train_labels = load_split_data( './dataset.tsv', './dataset_split', split_id, 'train', uni_lt=uni_lt, cat_lt=cat_lt) val_texts, val_labels = load_split_data( './dataset.tsv', './dataset_split', split_id, 'val', uni_lt=uni_lt, cat_lt=cat_lt) test_texts, test_labels = load_split_data( './dataset.tsv', './dataset_split', split_id, 'test', uni_lt=uni_lt, cat_lt=cat_lt) # Print statistics of the splitting. s_stats = statistics(train_labels, val_labels, test_labels) print(s_stats)
utils/dataloader.py
import torch import numpy as np # 'department' will be classified as 'course' in GCN label2id = { 'student': 0, 'faculty': 1, 'project': 2, 'course': 3, 'staff': 4, 'department': 3, } id2label = { 0: 'student', 1: 'faculty', 2: 'project', 3: 'course', 4: 'staff', } def load_data(dataset_path, uni_lt=['cornell', 'texas', 'wisconsin', 'washington', 'misc'], cat_lt=['student', 'faculty', 'project', 'course', 'staff', 'department']): """Load the pre-processed data. Make sure all the ids of label in cat_ltare defined in preprocessor.id2label dictionary. Args: dataset_path: String of path to the pre-processed dataset, which is like './xxx/dataset.tsv' uni_lt: List of string containing the university names to load. Default as ['cornell', 'texas', 'wisconsin', 'washington', 'other'] cat_lt: List of string containing the category names to load. Default as ['student', 'faculty', 'project', 'course', 'staff', 'department'] Returns: A tuple of two list (texts, labels). texts is a list of string containing the clean text for tokenization. labels is a list of single integer list in shape (x, 1). """ texts = [] labels = [] with open(dataset_path, 'r') as data_file: for data_line in data_file: uni_name, cat_name, text, url = data_line.strip('\n').split('\t') if (uni_name in uni_lt) and (cat_name in cat_lt): texts.append(text) labels.append(label2id[cat_name]) return texts, labels def statistics(train_labels=None, val_labels=None, test_labels=None): """Compute the statistics info of the datasets. Args: train_labels: (Optional) List of training labels. val_labels: (Optional) List of validation labels. test_labels=None: (Optional) List of testing labels. Returns: String of the statistics info (for logging). """ names = ['train set', 'val set', 'test set'] tot_siz = 0 s_log = '' train_val_test_labels = [train_labels, val_labels, test_labels] for set_name, label_ids in zip(names, train_val_test_labels): if label_ids is not None: tot_siz += len(label_ids) s_log += f'[{set_name:>9}] ' for label_id, label_name in id2label.items(): label_siz = (np.array(label_ids) == label_id).sum() s_log += f'{label_name}: {label_siz:4} | ' s_log += f'total: {len(label_ids)}\n' s_log += f'total size = {tot_siz}\n' return s_log class WebKBDataset(torch.utils.data.Dataset): def __init__(self, encodings, labels): self.encodings = encodings self.labels = labels def __getitem__(self, idx): item = {key: torch.tensor(val[idx]) for key, val in self.encodings.items()} item['labels'] = torch.tensor(self.labels[idx]) return item def __len__(self): return len(self.labels) if __name__ == '__main__': uni_lt = ['wisconsin'] cat_lt = ['student', 'faculty', 'project', 'course', 'staff', 'department'] split_id = 0 print('uni_lt: ', uni_lt) train_texts, train_labels = load_split_data( './dataset.tsv', './dataset_split', split_id, 'train', uni_lt=uni_lt, cat_lt=cat_lt) val_texts, val_labels = load_split_data( './dataset.tsv', './dataset_split', split_id, 'val', uni_lt=uni_lt, cat_lt=cat_lt) test_texts, test_labels = load_split_data( './dataset.tsv', './dataset_split', split_id, 'test', uni_lt=uni_lt, cat_lt=cat_lt) # Print statistics of the splitting. s_stats = statistics(train_labels, val_labels, test_labels) print(s_stats)
0.545044
0.468365
import math import argparse import keras as K import numpy as np from KnowledgeGraph import KnowledgeGraph from common import * class TransE: @property def embedding_entity(self): return self.__embedding_entity @property def embedding_relation(self): return self.__embedding_relation def __init__(self, num_entity, num_relation, learning_rate, batch_size, num_epochs, margin, dimension, score_func): self.__num_entity = num_entity self.__num_relation = num_relation self.__learning_rate = learning_rate self.__batch_size = batch_size self.__num_epochs = num_epochs self.__margin = margin self.__dimension = dimension bound = 6 / math.sqrt(self.__dimension) self.__embedding_entity = K.layers.Embedding(self.__num_entity, self.__dimension, name='embedding_entity', embeddings_initializer=K.initializers.random_uniform(minval=-bound, maxval=bound), embeddings_constraint=K.constraints.max_norm(max_value=1, axis=1)) self.__embedding_relation = K.layers.Embedding(self.__num_relation, self.__dimension, name='embedding_relation', embeddings_initializer=K.initializers.random_uniform(minval=-bound, maxval=bound), embeddings_constraint=K.constraints.max_norm(max_value=1, axis=1)) self.__train_model = None self.__predict_model = None self.__test_model = None if score_func == 'l1': self.__score = K.layers.Lambda(lambda x: K.backend.sum(K.backend.abs(x[0] + x[1] - x[2]), axis=-1)) elif score_func == 'l2': self.__score = K.layers.Lambda(lambda x: K.backend.sum(K.backend.square(x[0] + x[1] - x[2]), axis=-1)) else: raise Exception('Invalid score_func value.') self.__loss = K.layers.Lambda(lambda x: K.backend.maximum(x[0] + self.__margin - x[1], 0.0)) def __compile_train_model(self): positive_head = K.Input((1,), dtype='int32', name='positive_heads') positive_relation = K.Input((1,), dtype='int32', name='positive_relations') positive_tail = K.Input((1,), dtype='int32', name='positive_tails') negative_head = K.Input((1,), dtype='int32', name='negative_heads') negative_tail = K.Input((1,), dtype='int32', name='negative_tails') embedding_positive_head = self.__embedding_entity(positive_head) embedding_positive_tail = self.__embedding_entity(positive_tail) embedding_positive_relation = self.__embedding_relation(positive_relation) embedding_negative_head = self.__embedding_entity(negative_head) embedding_negative_tail = self.__embedding_entity(negative_tail) embedding_positive_triple = [embedding_positive_head, embedding_positive_relation, embedding_positive_tail] embedding_negative_triple = [embedding_negative_head, embedding_positive_relation, embedding_negative_tail] score_positive = self.__score(embedding_positive_triple) score_negative = self.__score(embedding_negative_triple) loss = self.__loss([score_positive, score_negative]) self.__train_model = K.Model(inputs=[positive_head, positive_relation, positive_tail, negative_head, negative_tail], outputs=loss) opt = K.optimizers.Adam(lr=self.__learning_rate) self.__train_model.compile(opt, loss=lambda y_true, y_pred: y_pred) def __compile_eval_model(self): head = K.Input((1,), dtype='int32', name='heads') relation = K.Input((1,), dtype='int32', name='relations') tail = K.Input((1,), dtype='int32', name='tails') embedding_head = self.__embedding_entity(head) embedding_tail = self.__embedding_entity(tail) embedding_relation = self.__embedding_relation(relation) embedding_triple = [embedding_head, embedding_relation, embedding_tail] loss = self.__score(embedding_triple) self.__predict_model = K.Model(inputs=[head, relation, tail], outputs=loss) opt = K.optimizers.Adam(lr=self.__learning_rate) self.__predict_model.compile(opt, loss='binary_crossentropy') def __compile_test_model(self): head = K.Input((self.__num_entity,), dtype='int32', name='heads') relation = K.Input((self.__num_entity,), dtype='int32', name='relations') tail = K.Input((self.__num_entity,), dtype='int32', name='tails') embedding_head = self.__embedding_entity(head) embedding_tail = self.__embedding_entity(tail) embedding_relation = self.__embedding_relation(relation) embedding_triple = [embedding_head, embedding_relation, embedding_tail] loss = self.__score(embedding_triple) self.__test_model = K.Model(inputs=[head, relation, tail], outputs=loss) opt = K.optimizers.Adam(lr=self.__learning_rate) self.__test_model.compile(opt, loss='binary_crossentropy') def compile(self): self.__compile_train_model() self.__compile_eval_model() self.__compile_test_model() def train(self, ph, pr, pt, nh, nt): label = np.zeros((len(ph), 1)) self.__train_model.fit(x=[ph, pr, pt, nh, nt], y=label, epochs=self.__num_epochs, batch_size=self.__batch_size) def evaluate(self, h, r, t): score = self.__predict_model.predict(x=[h, r, t]) print(score) return score def predict_head(self, r, t): test_num = len(r) heads = np.tile(np.arange(0, self.__num_entity), [test_num, 1]) relations = np.tile(np.reshape(r, [test_num, 1]), [1, self.__num_entity]) tails = np.tile(np.reshape(t, [test_num, 1]), [1, self.__num_entity]) score = self.__test_model.predict(x=[heads, relations, tails]) return score def predict_tail(self, h, r): test_num = len(r) heads = np.tile(np.reshape(h, [test_num, 1]), [1, self.__num_entity]) relations = np.tile(np.reshape(r, [test_num, 1]), [1, self.__num_entity]) tails = np.tile(np.arange(0, self.__num_entity), [test_num, 1]) score = self.__test_model.predict(x=[heads, relations, tails]) return score def save_embeddings(self): w_entity = self.__embedding_entity.get_weights() np.savetxt('./entity.tsv', w_entity[0], delimiter='\t') w_relation = self.__embedding_relation.get_weights() np.savetxt('./relation.tsv', w_relation[0], delimiter='\t') if __name__ == '__main__': parser = argparse.ArgumentParser(description="TransE") parser.add_argument('--data_dir', dest='data_dir', type=str, default='../data/FB15k/') parser.add_argument('--learning_rate', dest='learning_rate', type=float, default=0.01) parser.add_argument('--batch_size', dest='batch_size', type=int, default=4096) parser.add_argument('--num_epochs', dest='num_epochs', type=int, default=100) parser.add_argument('--dimension', dest='dimension', type=int, default=50) parser.add_argument('--margin', dest='margin', type=float, help='margin', default=1.0) parser.add_argument('--negative_sampling', dest='negative_sampling', type=str, help='choose unit or bern to generate negative examples', default='bern') parser.add_argument('--score_func', dest='score_func', type=str, default='l1', help='choose l1 or l2 to calculate distance of vectors') args = parser.parse_args() print(args) KG = KnowledgeGraph(data_dir=args.data_dir, negative_sampling=args.negative_sampling) model = TransE(num_entity=KG.num_entity, num_relation=KG.num_relation, learning_rate=args.learning_rate, batch_size=args.batch_size, num_epochs=args.num_epochs, margin=args.margin, dimension=args.dimension, score_func=args.score_func) model.compile() tp, tn = KG.get_training_data() train_model(model, tp, tn) model.save_embeddings() test_model(model, KG.get_test_data())
src/TransE.py
import math import argparse import keras as K import numpy as np from KnowledgeGraph import KnowledgeGraph from common import * class TransE: @property def embedding_entity(self): return self.__embedding_entity @property def embedding_relation(self): return self.__embedding_relation def __init__(self, num_entity, num_relation, learning_rate, batch_size, num_epochs, margin, dimension, score_func): self.__num_entity = num_entity self.__num_relation = num_relation self.__learning_rate = learning_rate self.__batch_size = batch_size self.__num_epochs = num_epochs self.__margin = margin self.__dimension = dimension bound = 6 / math.sqrt(self.__dimension) self.__embedding_entity = K.layers.Embedding(self.__num_entity, self.__dimension, name='embedding_entity', embeddings_initializer=K.initializers.random_uniform(minval=-bound, maxval=bound), embeddings_constraint=K.constraints.max_norm(max_value=1, axis=1)) self.__embedding_relation = K.layers.Embedding(self.__num_relation, self.__dimension, name='embedding_relation', embeddings_initializer=K.initializers.random_uniform(minval=-bound, maxval=bound), embeddings_constraint=K.constraints.max_norm(max_value=1, axis=1)) self.__train_model = None self.__predict_model = None self.__test_model = None if score_func == 'l1': self.__score = K.layers.Lambda(lambda x: K.backend.sum(K.backend.abs(x[0] + x[1] - x[2]), axis=-1)) elif score_func == 'l2': self.__score = K.layers.Lambda(lambda x: K.backend.sum(K.backend.square(x[0] + x[1] - x[2]), axis=-1)) else: raise Exception('Invalid score_func value.') self.__loss = K.layers.Lambda(lambda x: K.backend.maximum(x[0] + self.__margin - x[1], 0.0)) def __compile_train_model(self): positive_head = K.Input((1,), dtype='int32', name='positive_heads') positive_relation = K.Input((1,), dtype='int32', name='positive_relations') positive_tail = K.Input((1,), dtype='int32', name='positive_tails') negative_head = K.Input((1,), dtype='int32', name='negative_heads') negative_tail = K.Input((1,), dtype='int32', name='negative_tails') embedding_positive_head = self.__embedding_entity(positive_head) embedding_positive_tail = self.__embedding_entity(positive_tail) embedding_positive_relation = self.__embedding_relation(positive_relation) embedding_negative_head = self.__embedding_entity(negative_head) embedding_negative_tail = self.__embedding_entity(negative_tail) embedding_positive_triple = [embedding_positive_head, embedding_positive_relation, embedding_positive_tail] embedding_negative_triple = [embedding_negative_head, embedding_positive_relation, embedding_negative_tail] score_positive = self.__score(embedding_positive_triple) score_negative = self.__score(embedding_negative_triple) loss = self.__loss([score_positive, score_negative]) self.__train_model = K.Model(inputs=[positive_head, positive_relation, positive_tail, negative_head, negative_tail], outputs=loss) opt = K.optimizers.Adam(lr=self.__learning_rate) self.__train_model.compile(opt, loss=lambda y_true, y_pred: y_pred) def __compile_eval_model(self): head = K.Input((1,), dtype='int32', name='heads') relation = K.Input((1,), dtype='int32', name='relations') tail = K.Input((1,), dtype='int32', name='tails') embedding_head = self.__embedding_entity(head) embedding_tail = self.__embedding_entity(tail) embedding_relation = self.__embedding_relation(relation) embedding_triple = [embedding_head, embedding_relation, embedding_tail] loss = self.__score(embedding_triple) self.__predict_model = K.Model(inputs=[head, relation, tail], outputs=loss) opt = K.optimizers.Adam(lr=self.__learning_rate) self.__predict_model.compile(opt, loss='binary_crossentropy') def __compile_test_model(self): head = K.Input((self.__num_entity,), dtype='int32', name='heads') relation = K.Input((self.__num_entity,), dtype='int32', name='relations') tail = K.Input((self.__num_entity,), dtype='int32', name='tails') embedding_head = self.__embedding_entity(head) embedding_tail = self.__embedding_entity(tail) embedding_relation = self.__embedding_relation(relation) embedding_triple = [embedding_head, embedding_relation, embedding_tail] loss = self.__score(embedding_triple) self.__test_model = K.Model(inputs=[head, relation, tail], outputs=loss) opt = K.optimizers.Adam(lr=self.__learning_rate) self.__test_model.compile(opt, loss='binary_crossentropy') def compile(self): self.__compile_train_model() self.__compile_eval_model() self.__compile_test_model() def train(self, ph, pr, pt, nh, nt): label = np.zeros((len(ph), 1)) self.__train_model.fit(x=[ph, pr, pt, nh, nt], y=label, epochs=self.__num_epochs, batch_size=self.__batch_size) def evaluate(self, h, r, t): score = self.__predict_model.predict(x=[h, r, t]) print(score) return score def predict_head(self, r, t): test_num = len(r) heads = np.tile(np.arange(0, self.__num_entity), [test_num, 1]) relations = np.tile(np.reshape(r, [test_num, 1]), [1, self.__num_entity]) tails = np.tile(np.reshape(t, [test_num, 1]), [1, self.__num_entity]) score = self.__test_model.predict(x=[heads, relations, tails]) return score def predict_tail(self, h, r): test_num = len(r) heads = np.tile(np.reshape(h, [test_num, 1]), [1, self.__num_entity]) relations = np.tile(np.reshape(r, [test_num, 1]), [1, self.__num_entity]) tails = np.tile(np.arange(0, self.__num_entity), [test_num, 1]) score = self.__test_model.predict(x=[heads, relations, tails]) return score def save_embeddings(self): w_entity = self.__embedding_entity.get_weights() np.savetxt('./entity.tsv', w_entity[0], delimiter='\t') w_relation = self.__embedding_relation.get_weights() np.savetxt('./relation.tsv', w_relation[0], delimiter='\t') if __name__ == '__main__': parser = argparse.ArgumentParser(description="TransE") parser.add_argument('--data_dir', dest='data_dir', type=str, default='../data/FB15k/') parser.add_argument('--learning_rate', dest='learning_rate', type=float, default=0.01) parser.add_argument('--batch_size', dest='batch_size', type=int, default=4096) parser.add_argument('--num_epochs', dest='num_epochs', type=int, default=100) parser.add_argument('--dimension', dest='dimension', type=int, default=50) parser.add_argument('--margin', dest='margin', type=float, help='margin', default=1.0) parser.add_argument('--negative_sampling', dest='negative_sampling', type=str, help='choose unit or bern to generate negative examples', default='bern') parser.add_argument('--score_func', dest='score_func', type=str, default='l1', help='choose l1 or l2 to calculate distance of vectors') args = parser.parse_args() print(args) KG = KnowledgeGraph(data_dir=args.data_dir, negative_sampling=args.negative_sampling) model = TransE(num_entity=KG.num_entity, num_relation=KG.num_relation, learning_rate=args.learning_rate, batch_size=args.batch_size, num_epochs=args.num_epochs, margin=args.margin, dimension=args.dimension, score_func=args.score_func) model.compile() tp, tn = KG.get_training_data() train_model(model, tp, tn) model.save_embeddings() test_model(model, KG.get_test_data())
0.830903
0.209227
import tflearn test = 'test' train = 'training' def getXY(): X, Y = tflearn.data_utils.image_preloader(train, image_shape=( 80, 80), mode='folder', categorical_labels='True', normalize=True) return X, Y def main(): ''' Establishes architecture for CNN-fully-connected-RNN neural net. ''' # Create the input layer: None: batch size, 120: frames, 80: height, 80: width, 3: RGB network = tflearn.input_data(shape=[None, 120, 80, 80, 3], name='input') # Convolutional network network = tflearn.conv_3d( network, 32, (3, 3, 3), activation='relu') # 32 conv layers of 3x3x3 (3x3x3 convolves for each 3 frames, 3px height, and 3px width) network = tflearn.max_pool_3d( network, (1, 2, 2), strides=(1, 2, 2)) # Pools results of the conv_3d layer network = tflearn.conv_3d( network, 64, (3, 3, 3), activation='relu') # 64 layers of 3x3x3 network = tflearn.max_pool_3d(network, (1, 2, 2), strides=(1, 2, 2)) network = tflearn.conv_3d( network, 128, (3, 3, 3), activation='relu') # 128 layers of 3x3x3 network = tflearn.conv_3d( network, 128, (3, 3, 3), activation='relu') # another one? network = tflearn.max_pool_3d(network, (1, 2, 2), strides=(1, 2, 2)) network = tflearn.conv_3d( network, 256, (2, 2, 2), activation='relu') # 256 layers of 2x2x2 network = tflearn.conv_3d( network, 256, (2, 2, 2), activation='relu') network = tflearn.max_pool_3d( network, (1, 2, 2), strides=(1, 2, 2)) network = tflearn.conv_2d( network, 64, 4, activation='relu', regularizer="L2") # 64 layers of 4x4 network = tflearn.max_pool_2d(network, 2) # and then max pool # Normalize activations of the previous layer at each batch. network = tflearn.local_response_normalization(network) # And now the fully-connected neural net (128 & 256 neurons + dropout) network = tflearn.fully_connected(network, 128, activation='tanh') network = tflearn.dropout(network, 0.8) network = tflearn.fully_connected(network, 256, activation='tanh') network = tflearn.dropout(network, 0.8) network = tflearn.reshape(network, [-1, 1, 256]) # Why 256? # LSTM layers network = tflearn.lstm(network, 128, return_seq=True) # LSTM of 128 units network = tflearn.lstm(network, 128) network = tflearn.fully_connected( network, 4, activation='softmax') # Just four neurons... okay? network = tflearn.regression( network, optimizer='adam', loss='categorical_crossentropy', name='target') model = tflearn.DNN(network, tensorboard_verbose=0) X, Y = getXY() model.fit(X, Y, n_epoch=1, validation_set=0.1, show_metric=True, snapshot_step=100) if __name__ == "__main__": main()
architecture.py
import tflearn test = 'test' train = 'training' def getXY(): X, Y = tflearn.data_utils.image_preloader(train, image_shape=( 80, 80), mode='folder', categorical_labels='True', normalize=True) return X, Y def main(): ''' Establishes architecture for CNN-fully-connected-RNN neural net. ''' # Create the input layer: None: batch size, 120: frames, 80: height, 80: width, 3: RGB network = tflearn.input_data(shape=[None, 120, 80, 80, 3], name='input') # Convolutional network network = tflearn.conv_3d( network, 32, (3, 3, 3), activation='relu') # 32 conv layers of 3x3x3 (3x3x3 convolves for each 3 frames, 3px height, and 3px width) network = tflearn.max_pool_3d( network, (1, 2, 2), strides=(1, 2, 2)) # Pools results of the conv_3d layer network = tflearn.conv_3d( network, 64, (3, 3, 3), activation='relu') # 64 layers of 3x3x3 network = tflearn.max_pool_3d(network, (1, 2, 2), strides=(1, 2, 2)) network = tflearn.conv_3d( network, 128, (3, 3, 3), activation='relu') # 128 layers of 3x3x3 network = tflearn.conv_3d( network, 128, (3, 3, 3), activation='relu') # another one? network = tflearn.max_pool_3d(network, (1, 2, 2), strides=(1, 2, 2)) network = tflearn.conv_3d( network, 256, (2, 2, 2), activation='relu') # 256 layers of 2x2x2 network = tflearn.conv_3d( network, 256, (2, 2, 2), activation='relu') network = tflearn.max_pool_3d( network, (1, 2, 2), strides=(1, 2, 2)) network = tflearn.conv_2d( network, 64, 4, activation='relu', regularizer="L2") # 64 layers of 4x4 network = tflearn.max_pool_2d(network, 2) # and then max pool # Normalize activations of the previous layer at each batch. network = tflearn.local_response_normalization(network) # And now the fully-connected neural net (128 & 256 neurons + dropout) network = tflearn.fully_connected(network, 128, activation='tanh') network = tflearn.dropout(network, 0.8) network = tflearn.fully_connected(network, 256, activation='tanh') network = tflearn.dropout(network, 0.8) network = tflearn.reshape(network, [-1, 1, 256]) # Why 256? # LSTM layers network = tflearn.lstm(network, 128, return_seq=True) # LSTM of 128 units network = tflearn.lstm(network, 128) network = tflearn.fully_connected( network, 4, activation='softmax') # Just four neurons... okay? network = tflearn.regression( network, optimizer='adam', loss='categorical_crossentropy', name='target') model = tflearn.DNN(network, tensorboard_verbose=0) X, Y = getXY() model.fit(X, Y, n_epoch=1, validation_set=0.1, show_metric=True, snapshot_step=100) if __name__ == "__main__": main()
0.83762
0.67858