content stringlengths 1 103k ⌀ | path stringlengths 8 216 | filename stringlengths 2 179 | language stringclasses 15
values | size_bytes int64 2 189k | quality_score float64 0.5 0.95 | complexity float64 0 1 | documentation_ratio float64 0 1 | repository stringclasses 5
values | stars int64 0 1k | created_date stringdate 2023-07-10 19:21:08 2025-07-09 19:11:45 | license stringclasses 4
values | is_test bool 2
classes | file_hash stringlengths 32 32 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
---\n:concurrency: <%= ENV.fetch('SIDEKIQ_CONCURRENCY', 5) %>\n:queues:\n - [default, 8]\n - [push, 6]\n - [ingress, 4]\n - [mailers, 2]\n - [pull]\n - [scheduler]\n\n:scheduler:\n :listened_queues_only: true\n :schedule:\n scheduled_statuses_scheduler:\n every: '5m'\n class: Scheduler::ScheduledStatusesScheduler\n queue: scheduler\n trends_refresh_scheduler:\n every: '5m'\n class: Scheduler::Trends::RefreshScheduler\n queue: scheduler\n trends_review_notifications_scheduler:\n every: '6h'\n class: Scheduler::Trends::ReviewNotificationsScheduler\n queue: scheduler\n indexing_scheduler:\n interval: 1 minute\n class: Scheduler::IndexingScheduler\n queue: scheduler\n vacuum_scheduler:\n cron: '<%= Random.rand(0..59) %> <%= Random.rand(3..5) %> * * *'\n class: Scheduler::VacuumScheduler\n queue: scheduler\n follow_recommendations_scheduler:\n cron: '<%= Random.rand(0..59) %> <%= Random.rand(6..9) %> * * *'\n class: Scheduler::FollowRecommendationsScheduler\n queue: scheduler\n user_cleanup_scheduler:\n cron: '<%= Random.rand(0..59) %> <%= Random.rand(4..6) %> * * *'\n class: Scheduler::UserCleanupScheduler\n queue: scheduler\n ip_cleanup_scheduler:\n cron: '<%= Random.rand(0..59) %> <%= Random.rand(3..5) %> * * *'\n class: Scheduler::IpCleanupScheduler\n queue: scheduler\n pghero_scheduler:\n cron: '0 0 * * *'\n class: Scheduler::PgheroScheduler\n queue: scheduler\n instance_refresh_scheduler:\n cron: '0 * * * *'\n class: Scheduler::InstanceRefreshScheduler\n queue: scheduler\n accounts_statuses_cleanup_scheduler:\n interval: 1 minute\n class: Scheduler::AccountsStatusesCleanupScheduler\n queue: scheduler\n suspended_user_cleanup_scheduler:\n interval: 1 minute\n class: Scheduler::SuspendedUserCleanupScheduler\n queue: scheduler\n software_update_check_scheduler:\n interval: 30 minutes\n class: Scheduler::SoftwareUpdateCheckScheduler\n queue: scheduler\n auto_close_registrations_scheduler:\n interval: 1 hour\n class: Scheduler::AutoCloseRegistrationsScheduler\n queue: scheduler\n | dataset_sample\yaml\ruby\sidekiq.yml | sidekiq.yml | YAML | 2,201 | 0.7 | 0.202899 | 0 | vue-tools | 498 | 2025-03-04T16:52:12.147555 | BSD-3-Clause | false | 9d96215212925bd0ec762e63d48a29e9 |
# Available options:\n#\n# default - The default value of the setting. For upload site settings, use the id of the upload seeded in db/fixtures/010_uploads.rb.\n# client - Set to true if the javascript should have access to this setting's value.\n# refresh - Set to true if clients should refresh when the setting is changed.\n# min - For a string setting, the minimum length. For an integer setting, the minimum value.\n# max - For a string setting, the maximum length. For an integer setting, the maximum value.\n# regex - A regex that the value must match.\n# validator - The name of the class that will be use to validate the value of the setting.\n# allow_any - For choice settings allow items not specified in the choice list (default true)\n# secret - Set to true if input type should be password and value needs to be scrubbed from logs (default false).\n# enum - The setting has a fixed set of allowed values, and only one can be chosen.\n# Set to the class name that defines the set.\n# locale_default - A hash which overrides according to `SiteSetting.default_locale`.\n# The key should be as the same as possible value of default_locale.\n#\n#\n# type: email - Must be a valid email address.\n# type: username - Must match the username of an existing user.\n# type: list - A list of values, chosen from a set of valid values\n# defined in the choices option. A type:list setting with the word 'colors' in\n# its name will make color values have a bold line of the corresponding color\n#\n# list_type: simple - Allow multiple values to be selected for the list, and new values can be defined if\n# allow_any is true. This list displays like a list of items with add/remove buttons,\n# and the ability to reorder items.\n# list_type: compact - Allow multiple values to be selected for the list, and new values can be defined if\n# allow_any is true. This list displays like the tag selector.\n#\n# type: enum - A single value, chosen from a set of valid values in the choices option.\n# type: json_schema - The setting value is stored as JSON in the database. Used\n# in the format `json_schema: ClassName` where the class implements\n# a `.schema` class method and returns a hash in the JSON schema\n# format (c.f. https://json-schema.org/)\n# type: host_list - A list of domain names that does not allow * or ? wildcards.\n# type: category_list - A list of category ids, which shows a special picker in the UI.\n# type: category - A single category ID, which shows a special picker in the UI.\n# type: uploaded_image_list - A list of upload IDs that should be images.\n# type: upload - A single upload ID.\n# type: group - A single group ID.\n# type: group_list - A list of group IDs.\n# type: tag_list - A list of tag names.\n# type: emoji_list - A list of emoji names (e.g. joy, cold_hands)\n# type: tag_group_list - A list of tag group names.\n# type: file_size_restriction - A file size restriction in bytes.\n#\nrequired:\n title:\n client: true\n default: "Discourse"\n area: "about"\n site_description:\n default: ""\n area: "about"\n short_site_description:\n default: ""\n client: true\n area: "about"\n contact_email:\n default: ""\n type: email\n area: "about|notifications|legal"\n client: true\n contact_url:\n default: ""\n area: "about|legal"\n notification_email:\n default: "noreply@unconfigured.discourse.org"\n type: email\n site_contact_username:\n default: ""\n type: username\n area: "about"\n site_contact_group_name:\n default: ""\n type: group\n area: "about"\n exclude_rel_nofollow_domains:\n client: true\n default: ""\n type: list\n list_type: simple\n area: "analytics"\n company_name:\n default: ""\n area: "about|legal"\n governing_law:\n default: ""\n area: "about|legal"\n city_for_disputes:\n default: ""\n area: "about|legal"\n\nbranding:\n logo:\n default: -5\n client: true\n type: upload\n logo_small:\n default: -6\n client: true\n type: upload\n digest_logo:\n default: ""\n client: true\n type: upload\n mobile_logo:\n default: ""\n client: true\n type: upload\n logo_dark:\n default: ""\n client: true\n type: upload\n logo_small_dark:\n default: ""\n client: true\n type: upload\n mobile_logo_dark:\n default: ""\n client: true\n type: upload\n large_icon:\n default: ""\n client: true\n type: upload\n manifest_icon:\n default: ""\n client: true\n type: upload\n manifest_screenshots:\n type: list\n list_type: simple\n client: true\n default: ""\n favicon:\n default: ""\n client: true\n type: upload\n apple_touch_icon:\n default: ""\n client: true\n type: upload\n opengraph_image:\n default: ""\n client: true\n type: upload\n twitter_summary_large_image:\n default: ""\n type: upload\n hidden: true\n x_summary_large_image:\n default: ""\n type: upload\n client: true\n\nbasic:\n display_local_time_in_user_card:\n client: true\n default: false\n area: "localization"\n allow_user_locale:\n client: true\n default: false\n area: "localization"\n set_locale_from_accept_language_header:\n default: false\n client: true\n validator: "AllowUserLocaleEnabledValidator"\n area: "localization"\n set_locale_from_cookie:\n default: false\n client: true\n validator: "AllowUserLocaleEnabledValidator"\n area: "localization"\n set_locale_from_param:\n default: false\n client: true\n validator: "AllowUserLocaleEnabledValidator"\n area: "localization"\n support_mixed_text_direction:\n client: true\n default: false\n area: "localization"\n categories_topics:\n default: 20\n validator: "CategoriesTopicsValidator"\n area: "interface"\n suggested_topics:\n client: true\n default: 5\n max: 2000\n area: "posts_and_topics"\n limit_suggested_to_category:\n default: false\n area: "posts_and_topics"\n suggested_topics_unread_max_days_old:\n default: 90\n min: 0\n max: 36500\n area: "posts_and_topics"\n suggested_topics_max_days_old:\n default: 365\n min: 7\n max: 36500\n area: "posts_and_topics"\n ga_version:\n type: enum\n default: v4_gtag\n choices:\n - v3_analytics\n - v4_gtag\n area: "analytics"\n ga_universal_tracking_code:\n client: true\n default: ""\n regex: "^(UA|G)-[\\w-]+"\n area: "analytics"\n ga_universal_domain_name:\n client: true\n default: "auto"\n area: "analytics"\n ga_universal_auto_link_domains:\n default: ""\n type: list\n list_type: simple\n area: "analytics"\n gtm_container_id:\n client: true\n default: ""\n regex: "^GTM-"\n area: "analytics"\n top_menu:\n client: true\n refresh: true\n type: list\n list_type: simple\n default: "latest|new|unread|hot|categories"\n regex: "latest"\n regex_error: "site_settings.errors.must_include_latest"\n validator: RegexPresenceValidator\n allow_any: false\n choices:\n - latest\n - new\n - unread\n - unseen\n - top\n - categories\n - read\n - posted\n - bookmarks\n - hot\n area: "navigation"\n post_menu:\n client: true\n type: list\n list_type: simple\n default: "read|like|copyLink|flag|edit|bookmark|delete|admin|reply"\n allow_any: false\n choices:\n - read\n - copyLink\n - share\n - like\n - edit\n - flag\n - delete\n - bookmark\n - admin\n - reply\n area: "posts_and_topics"\n post_menu_hidden_items:\n client: true\n type: list\n list_type: simple\n default: "flag|bookmark|edit|delete|admin"\n allow_any: false\n choices:\n - like\n - edit\n - flag\n - delete\n - share\n - bookmark\n - admin\n - reply\n area: "posts_and_topics"\n share_links:\n client: true\n type: list\n list_type: simple\n default: "twitter|facebook|email"\n allow_any: false\n choices:\n - twitter\n - facebook\n - email\n area: "sharing"\n allow_username_in_share_links:\n client: true\n default: true\n area: "sharing"\n share_quote_visibility:\n client: true\n type: enum\n default: "all"\n choices:\n - none\n - anonymous\n - all\n area: "sharing"\n share_quote_buttons:\n client: true\n type: list\n list_type: simple\n default: "twitter|email"\n allow_any: false\n choices:\n - twitter\n - facebook\n - email\n area: "sharing"\n desktop_category_page_style:\n client: true\n enum: "CategoryPageStyle"\n default: "categories_and_latest_topics"\n area: "navigation"\n mobile_category_page_style:\n client: true\n enum: "MobileCategoryPageStyle"\n default: "categories_with_featured_topics"\n area: "navigation"\n category_colors:\n client: true\n type: list\n list_type: compact\n default: "BF1E2E|F1592A|F7941D|9EB83B|3AB54A|12A89D|25AAE2|0E76BD|652D90|92278F|ED207B|8C6238|231F20|808281|B3B5B4|E45735"\n area: "interface"\n max_category_nesting:\n client: true\n default: 2\n min: 2\n max: 3\n hidden: true\n enable_mobile_theme:\n client: true\n default: true\n hidden: true\n enable_direct_s3_uploads:\n client: true\n default: false\n enable_upload_debug_mode:\n default: false\n hidden: true\n client: true\n default_theme_id:\n default: -1\n hidden: true\n default_dark_mode_color_scheme_id:\n default: -1\n type: enum\n enum: "ColorSchemeSetting"\n client: true\n relative_date_duration:\n client: true\n default: 30\n area: "posts_and_topics"\n topics_per_period_in_top_summary:\n default: 20\n min: 1\n area: "posts_and_topics"\n topics_per_period_in_top_page:\n default: 50\n min: 1\n area: "posts_and_topics"\n top_page_default_timeframe:\n client: true\n default: "yearly"\n type: enum\n choices:\n - all\n - yearly\n - quarterly\n - monthly\n - weekly\n - daily\n area: "posts_and_topics"\n fixed_category_positions:\n client: true\n default: false\n area: "interface"\n fixed_category_positions_on_create:\n client: true\n default: false\n area: "interface"\n enable_badges:\n client: true\n default: true\n area: "badges"\n show_badges_in_post_header:\n client: true\n default: true\n area: "badges"\n enable_badge_sql:\n client: true\n default: false\n hidden: true\n max_favorite_badges:\n client: true\n default: 2\n min: 0\n max: 6\n area: "badges"\n whispers_allowed_groups:\n type: group_list\n list_type: compact\n default: ""\n allow_any: false\n refresh: true\n area: "group_permissions"\n hidden_post_visible_groups:\n type: group_list\n list_type: compact\n default: "14"\n allow_any: false\n refresh: true\n area: "group_permissions"\n push_notifications_prompt:\n default: true\n client: true\n area: "notifications"\n push_notifications_icon:\n default: ""\n type: upload\n area: "notifications"\n enable_desktop_push_notifications:\n default: true\n client: true\n area: "notifications"\n push_notification_time_window_mins:\n default: 1\n min: 0\n area: "notifications"\n short_title:\n default: ""\n max: 12\n vapid_public_key_bytes:\n default: ""\n client: true\n hidden: true\n vapid_public_key:\n default: ""\n hidden: true\n vapid_private_key:\n default: ""\n hidden: true\n vapid_base_url:\n default: ""\n hidden: true\n base_font:\n default: "inter"\n choices: "BaseFontSetting.values"\n refresh: true\n type: list\n list_type: font\n area: "fonts"\n allow_any: false\n client: true\n heading_font:\n default: "inter"\n choices: "BaseFontSetting.values"\n refresh: true\n type: list\n list_type: font\n area: "fonts"\n allow_any: false\n client: true\n enable_sitemap:\n default: true\n area: "analytics"\n sitemap_page_size:\n default: 10000\n area: "analytics"\n enable_user_tips:\n client: true\n default: true\n refresh: true\n area: "users"\n page_loading_indicator:\n client: true\n type: enum\n default: "slider"\n choices:\n - spinner\n - slider\n area: "navigation"\n show_user_menu_avatars:\n client: true\n default: false\n area: "interface"\n about_page_hidden_groups:\n default: ""\n type: group_list\n area: "group_permissions"\n adobe_analytics_tags_url:\n default: ""\n regex: "assets.adobedtm.com"\n area: "analytics"\n extended_site_description:\n default: ""\n max: 10_000\n hidden: true\n area: "about"\n extended_site_description_cooked:\n default: ""\n hidden: true\n max: 15_000\n about_banner_image:\n default: ""\n type: upload\n hidden: true\n area: "about"\n community_owner:\n default: ""\n max: 300\n hidden: true\n area: "about"\n use_legacy_pageviews:\n default: false\n hidden: true\n client: true\n interface_color_selector:\n client: true\n enum: "InterfaceColorSelectorSetting"\n default: "disabled"\n area: "interface"\n\nlogin:\n invite_only:\n refresh: true\n client: true\n default: false\n login_required:\n refresh: true\n client: true\n default: false\n must_approve_users:\n client: true\n default: false\n invite_code: ""\n enable_local_logins:\n client: true\n default: true\n enable_local_logins_via_email:\n client: true\n default: true\n validator: "EnableLocalLoginsViaEmailValidator"\n enable_passkeys:\n client: true\n default: true\n hidden: true\n allow_new_registrations:\n client: true\n default: true\n enable_signup_cta:\n client: true\n default: true\n enable_google_oauth2_logins:\n default: false\n google_oauth2_client_id: ""\n google_oauth2_client_secret:\n default: ""\n secret: true\n google_oauth2_prompt:\n default: ""\n type: list\n choices:\n - ""\n - "none"\n - "consent"\n - "select_account"\n google_oauth2_hd:\n default: ""\n google_oauth2_hd_groups_service_account_admin_email:\n default: ""\n google_oauth2_hd_groups_service_account_json:\n default: ""\n textarea: true\n google_oauth2_verbose_logging:\n default: false\n enable_twitter_logins:\n default: false\n twitter_consumer_key:\n default: ""\n regex: "^[\\w+-]+$"\n twitter_consumer_secret:\n default: ""\n regex: "^[\\w+-]+$"\n secret: true\n enable_facebook_logins:\n default: false\n facebook_app_id:\n client: true\n default: ""\n regex: "^\\d+$"\n facebook_app_secret:\n default: ""\n regex: "^[a-f0-9]+$"\n secret: true\n enable_github_logins:\n default: false\n github_client_id:\n default: ""\n regex: "^[a-zA-Z0-9\\.]+$"\n github_client_secret:\n default: ""\n regex: "^[a-f0-9]+$"\n secret: true\n enable_discord_logins:\n default: false\n discord_client_id:\n default: ""\n discord_secret:\n default: ""\n secret: true\n discord_trusted_guilds:\n default: ""\n type: list\n list_type: simple\n enable_linkedin_oidc_logins:\n default: false\n validator: "LinkedinOidcCredentialsValidator"\n linkedin_oidc_client_id:\n default: ""\n regex: "^[a-z0-9]+$"\n linkedin_oidc_client_secret:\n default: ""\n regex: "^[a-zA-Z0-9_=\\.]+$"\n secret: true\n auth_skip_create_confirm:\n default: false\n client: true\n auth_immediately:\n default: true\n client: true\n auth_overrides_email:\n default: false\n validator: "SsoOverridesEmailValidator"\n client: true\n auth_overrides_username: false\n auth_overrides_name: false\n auth_require_interaction: true\n enable_discourse_connect:\n client: true\n default: false\n validator: "EnableSsoValidator"\n discourse_connect_allowed_redirect_domains:\n default: ""\n type: list\n list_type: simple\n verbose_discourse_connect_logging: false\n verbose_upload_logging:\n hidden: true\n default: false\n verbose_auth_token_logging:\n hidden: true\n default: false\n max_suspicious_distance_km:\n hidden: true\n default: 100\n discourse_connect_url:\n default: ""\n regex: '^https?:\/\/.+[^\/]$'\n discourse_connect_secret:\n default: ""\n secret: true\n discourse_connect_overrides_groups: false\n discourse_connect_overrides_bio: false\n discourse_connect_overrides_avatar:\n default: false\n client: true\n discourse_connect_overrides_profile_background: false\n discourse_connect_overrides_location: false\n discourse_connect_overrides_website: false\n discourse_connect_overrides_card_background: false\n discourse_connect_not_approved_url: ""\n discourse_connect_csrf_protection:\n default: true\n hidden: true\n enable_discourse_connect_provider: false\n discourse_connect_provider_secrets:\n default: ""\n type: list\n list_type: secret\n secret: true\n placeholder:\n key: "sso_provider.key_placeholder"\n value: "sso_provider.value_placeholder"\n blocked_email_domains:\n default: "mailinator.com"\n type: host_list\n list_type: simple\n allowed_email_domains:\n default: ""\n type: host_list\n list_type: simple\n normalize_emails:\n default: true\n auto_approve_email_domains:\n default: ""\n type: host_list\n list_type: simple\n hide_email_address_taken:\n client: true\n default: true\n log_out_strict: false\n pending_users_reminder_delay_minutes:\n min: -1\n default: 480\n persistent_sessions: true\n maximum_session_age:\n default: 1440\n min: 1\n max: 175200\n full_page_login:\n default: true\n client: true\n show_signup_form_email_instructions:\n client: true\n default: true\n show_signup_form_username_instructions:\n client: true\n default: false\n show_signup_form_full_name_instructions:\n client: true\n default: false\n show_signup_form_password_instructions:\n client: true\n default: false\n\nusers:\n min_username_length:\n client: true\n default: 3\n validator: "MinUsernameLengthValidator"\n area: "users"\n max_username_length:\n client: true\n default: 20\n validator: "MaxUsernameLengthValidator"\n area: "users"\n unicode_usernames:\n default: false\n client: true\n validator: "UnicodeUsernameValidator"\n area: "localization"\n allowed_unicode_username_characters:\n validator: "UnicodeUsernameAllowlistValidator"\n default: ""\n locale_default:\n cs: "[ěščřžýáíéóůúďťňĚŠČŘŽÝÁÍÉÓŮÚĎŤŇ]"\n de: "[äöüßÄÖÜẞ]"\n fi: "[åäöÅÄÖ]"\n ja: '[\p{Han}\p{Katakana}\p{Hiragana}ー]'\n ko: '\p{Hangul}'\n zh_CN: '\p{Han}'\n zh_TW: '\p{Han}'\n area: "localization"\n reserved_usernames:\n type: list\n list_type: compact\n default: "admin|moderator|administrator|mod|sys|system|community|info|you|name|username|user|nickname|discourse|discourseorg|discourseforum|support|all|here"\n mandatory_values: "admin|moderator|administrator|mod|sys|system|you|name|username|user|nickname|discourse|discourseorg|discourseforum|all|here"\n area: "users"\n min_password_length:\n client: true\n default: 10\n min: 8\n max: 500\n requires_confirmation: "simple"\n min_admin_password_length:\n client: true\n default: 15\n min: 8\n max: 500\n requires_confirmation: "simple"\n password_unique_characters:\n default: 6\n min: 1\n max: 10\n requires_confirmation: "simple"\n area: "users"\n block_common_passwords:\n default: true\n requires_confirmation: "simple"\n area: "users"\n username_change_period:\n default: 3\n area: "users"\n email_editable:\n client: true\n default: true\n area: "users"\n logout_redirect:\n client: true\n default: ""\n area: "users"\n full_name_requirement:\n type: enum\n default: hidden_at_signup\n enum: "FullNameRequirement"\n area: "users"\n enable_names:\n client: true\n default: true\n area: "users"\n invite_expiry_days:\n default: 90\n client: true\n max: 36500\n area: "users"\n invites_per_page:\n client: true\n default: 40\n hidden: true\n delete_user_max_post_age:\n client: true\n default: 60\n area: "users"\n delete_all_posts_max:\n client: true\n default: 15\n min: 1\n area: "users"\n delete_user_self_max_post_count:\n default: 1\n min: -1\n area: "users"\n redirect_users_to_top_page:\n default: true\n area: "users"\n prioritize_username_in_ux:\n client: true\n default: true\n area: "users"\n prioritize_full_name_in_ux:\n client: true\n default: false\n hidden: true\n area: "users"\n email_token_valid_hours:\n default: 48\n min: 1\n area: "users"\n purge_unactivated_users_grace_period_days:\n default: 14\n max: 36500\n area: "users"\n public_user_custom_fields:\n type: list\n list_type: simple\n default: ""\n area: "users"\n staff_user_custom_fields:\n type: list\n list_type: simple\n default: ""\n area: "users"\n enable_user_directory:\n client: true\n default: true\n area: "users"\n allow_anonymous_mode:\n default: false\n client: true\n area: "users"\n allow_likes_in_anonymous_mode:\n default: false\n client: true\n anonymous_posting_min_trust_level:\n default: 1\n enum: "TrustLevelSetting"\n client: true\n hidden: true\n anonymous_posting_allowed_groups:\n default: "3|11" # auto group staff and trust_level_1\n type: group_list\n allow_any: false\n refresh: true\n validator: "AtLeastOneGroupValidator"\n area: "group_permissions"\n anonymous_account_duration_minutes:\n default: 10080\n max: 99000\n area: "users"\n allow_users_to_hide_profile:\n default: true\n client: true\n area: "users"\n hide_user_profiles_from_public:\n default: false\n client: true\n area: "users"\n hide_new_user_profiles:\n default: true\n area: "users"\n allow_featured_topic_on_user_profiles:\n default: true\n client: true\n area: "users"\n show_inactive_accounts:\n default: false\n area: "users"\n allowed_user_website_domains:\n default: ""\n type: list\n list_type: simple\n area: "users"\n hide_suspension_reasons:\n default: false\n client: true\n area: "users"\n log_personal_messages_views:\n default: false\n area: "users"\n ignored_users_count_message_threshold:\n default: 5\n client: true\n min: 1\n area: "users"\n ignored_users_message_gap_days:\n default: 365\n client: true\n min: 1\n max: 36500\n area: "users"\n clean_up_inactive_users_after_days:\n default: 730\n min: 0\n max: 36500\n area: "users"\n clean_up_unused_staged_users_after_days:\n default: 365\n min: 0\n max: 36500\n area: "users"\n user_selected_primary_groups:\n default: false\n client: true\n area: "users"\n max_notifications_per_user:\n default: 10000\n hidden: true\n area: "notifications"\n gravatar_name:\n default: Gravatar\n client: true\n area: "users"\n gravatar_base_url:\n default: www.gravatar.com\n client: true\n area: "users"\n gravatar_login_url:\n default: /emails\n client: true\n area: "users"\n max_bookmarks_per_user:\n default: 2000\n hidden: true\n use_email_for_username_and_name_suggestions:\n default: false\n area: "users"\n use_name_for_username_suggestions:\n default: true\n area: "users"\n hide_user_activity_tab:\n default: false\n client: true\n area: "users"\n delete_associated_accounts_on_password_reset:\n default: false\n area: "users"\n enable_user_status:\n client: true\n default: false\n area: "users"\n\ngroups:\n enable_group_directory:\n client: true\n default: true\n group_in_subject:\n default: false\n enable_category_group_moderation:\n client: true\n default: false\n max_automatic_membership_email_domains:\n default: 50\n hidden: true\n\nposting:\n min_post_length:\n client: true\n min: 1\n default: 20\n locale_default:\n ja: 8\n zh_CN: 8\n zh_TW: 8\n area: "posts_and_topics"\n min_first_post_length:\n client: true\n min: 1\n default: 20\n locale_default:\n ja: 8\n zh_CN: 8\n zh_TW: 8\n area: "posts_and_topics"\n prevent_uploads_only_posts:\n client: true\n default: false\n area: "posts_and_topics"\n min_personal_message_post_length:\n client: true\n min: 1\n default: 10\n locale_default:\n ja: 3\n zh_CN: 3\n zh_TW: 3\n area: "posts_and_topics"\n max_post_length:\n client: true\n default: 32000\n max: 150000\n area: "posts_and_topics"\n topic_featured_link_enabled:\n client: true\n default: true\n area: "posts_and_topics"\n body_min_entropy:\n default: 7\n locale_default:\n ja: 3\n zh_CN: 3\n zh_TW: 3\n area: "posts_and_topics"\n min_topic_views_for_delete_confirm:\n client: true\n default: 5000\n area: "posts_and_topics"\n min_topic_title_length:\n client: true\n default: 15\n min: 1\n locale_default:\n ja: 6\n zh_CN: 6\n zh_TW: 6\n area: "posts_and_topics"\n max_topic_title_length:\n client: true\n default: 255\n min: 5\n max: 255\n area: "posts_and_topics"\n title_min_entropy:\n default: 10\n locale_default:\n ja: 3\n zh_CN: 3\n zh_TW: 3\n area: "posts_and_topics"\n allow_uppercase_posts:\n default: false\n locale_default:\n ja: true\n area: "posts_and_topics"\n max_consecutive_replies:\n default: 3\n area: "posts_and_topics"\n enable_filtered_replies_view:\n default: false\n client: true\n area: "posts_and_topics"\n title_prettify:\n default: true\n locale_default:\n ja: false\n zh_CN: false\n zh_TW: false\n area: "posts_and_topics"\n title_remove_extraneous_space:\n default: false\n locale_default:\n en: true\n en_GB: true\n area: "posts_and_topics"\n title_fancy_entities:\n default: true\n area: "posts_and_topics"\n min_personal_message_title_length:\n client: true\n default: 2\n min: 1\n area: "posts_and_topics"\n max_emojis_in_title:\n default: 1\n area: "emojis"\n default_emoji_reactions:\n type: emoji_list\n default: +1|heart|tada\n client: true\n area: "posts_and_topics"\n allow_uncategorized_topics:\n client: true\n default: false\n refresh: true\n area: "posts_and_topics"\n allow_duplicate_topic_titles:\n default: false\n area: "posts_and_topics"\n allow_duplicate_topic_titles_category:\n default: false\n area: "posts_and_topics"\n min_title_similar_length:\n client: true\n default: 10\n locale_default:\n ja: 4\n zh_CN: 4\n zh_TW: 4\n area: "posts_and_topics"\n enable_system_message_replies:\n default: true\n area: "posts_and_topics"\n personal_message_enabled_groups:\n default: "1|2|11" # auto group admins, moderators, trust_level_1\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n editing_grace_period:\n default: 300\n area: "posts_and_topics"\n editing_grace_period_max_diff:\n default: 100\n area: "posts_and_topics"\n editing_grace_period_max_diff_high_trust:\n default: 400\n area: "posts_and_topics"\n staff_edit_locks_post:\n default: false\n area: "posts_and_topics"\n shared_drafts_category:\n type: category\n default: ""\n area: "posts_and_topics"\n shared_drafts_min_trust_level:\n default: "staff"\n enum: "TrustLevelAndStaffSetting"\n hidden: true\n shared_drafts_allowed_groups:\n default: "3" # auto group staff\n type: group_list\n allow_any: false\n refresh: true\n validator: "AtLeastOneGroupValidator"\n area: "group_permissions"\n post_edit_time_limit:\n default: 1440\n max: 10080\n area: "posts_and_topics"\n tl2_post_edit_time_limit:\n default: 43200\n max: 525600\n area: "posts_and_topics"\n edit_history_visible_to_public:\n client: true\n default: true\n area: "posts_and_topics"\n delete_removed_posts_after:\n client: true\n default: 24\n max: 876000\n area: "posts_and_topics"\n notify_users_after_responses_deleted_on_flagged_post:\n default: false\n area: "posts_and_topics"\n traditional_markdown_linebreaks:\n client: true\n default: false\n area: "posts_and_topics"\n enable_markdown_typographer:\n client: true\n default: true\n area: "posts_and_topics"\n enable_markdown_linkify:\n client: true\n default: true\n area: "posts_and_topics"\n markdown_linkify_tlds:\n client: true\n type: list\n default: "com|net|org|io|onion|co|tv|ru|cn|us|uk|me|de|fr|fi|gov"\n list_type: compact\n validator: "MarkdownLinkifyTldsValidator"\n area: "posts_and_topics"\n markdown_typographer_quotation_marks:\n client: true\n type: list\n list_type: compact\n validator: "MarkdownTypographerQuotationMarksValidator"\n default: "“|”|‘|’"\n locale_default:\n de: "„|“|‚|‘"\n fr: "«\xA0|\xA0»|‹\xA0|\xA0›"\n area: "posts_and_topics"\n suppress_reply_directly_below:\n client: true\n default: true\n area: "posts_and_topics"\n suppress_reply_directly_above:\n client: true\n default: true\n area: "posts_and_topics"\n suppress_reply_when_quoting:\n default: true\n area: "posts_and_topics"\n remove_full_quote:\n default: true\n area: "posts_and_topics"\n max_reply_history:\n default: 1\n client: true\n area: "posts_and_topics"\n post_undo_action_window_mins:\n default: 10\n area: "posts_and_topics"\n enable_mentions:\n default: true\n client: true\n area: "posts_and_topics"\n max_mentions_per_post:\n default: 10\n area: "notifications"\n max_users_notified_per_group_mention:\n default: 100\n client: true\n area: "notifications"\n newuser_max_replies_per_topic:\n default: 3\n area: "posts_and_topics"\n newuser_max_mentions_per_post:\n default: 2\n area: "notifications"\n here_mention:\n default: "here"\n validator: "NotUsernameValidator"\n client: true\n area: "posts_and_topics"\n max_here_mentioned:\n default: 10\n area: "posts_and_topics"\n min_trust_level_for_here_mention:\n default: "2"\n enum: "TrustLevelAndStaffSetting"\n hidden: true\n here_mention_allowed_groups:\n default: "1|2|12" # auto group admins, moderators, trust_level_2\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n title_max_word_length:\n default: 30\n locale_default:\n ja: 50\n ko: 50\n zh_CN: 50\n zh_TW: 50\n area: "posts_and_topics"\n allowed_link_domains:\n default: ""\n type: list\n area: "posts_and_topics"\n newuser_max_links:\n default: 2\n area: "posts_and_topics"\n newuser_max_embedded_media:\n client: true\n default: 1\n area: "posts_and_topics"\n newuser_max_attachments:\n client: true\n default: 0\n area: "posts_and_topics"\n post_excerpt_maxlength:\n default: 300\n max: 1000\n locale_default:\n ja: 120\n zh_CN: 120\n zh_TW: 120\n area: "posts_and_topics"\n topic_excerpt_maxlength:\n default: 220\n max: 1000\n locale_default:\n ja: 120\n zh_CN: 120\n zh_TW: 120\n area: "posts_and_topics"\n default_subcategory_on_read_only_category:\n client: true\n default: false\n area: "posts_and_topics"\n show_pinned_excerpt_mobile:\n client: true\n default: true\n area: "posts_and_topics"\n show_pinned_excerpt_desktop:\n client: true\n default: true\n area: "posts_and_topics"\n display_name_on_posts:\n client: true\n default: false\n area: "posts_and_topics"\n show_time_gap_days:\n default: 7\n max: 36500\n client: true\n area: "posts_and_topics"\n short_progress_text_threshold:\n client: true\n default: 10000\n max: 99000\n area: "posts_and_topics"\n default_code_lang:\n client: true\n default: "auto"\n area: "posts_and_topics"\n warn_reviving_old_topic_age:\n default: 180\n area: "posts_and_topics"\n autohighlight_all_code:\n client: true\n default: false\n area: "posts_and_topics"\n highlighted_languages:\n default: "bash|c|cpp|csharp|css|diff|go|graphql|ini|java|javascript|json|kotlin|lua|makefile|markdown|objectivec|perl|php|php-template|plaintext|python|python-repl|r|ruby|rust|scss|shell|sql|swift|typescript|xml|yaml|wasm"\n choices: "HighlightJs.languages"\n type: list\n client: true\n list_type: compact\n area: "posts_and_topics"\n show_copy_button_on_codeblocks:\n client: true\n default: true\n hidden: true\n delete_old_hidden_posts:\n default: true\n area: "posts_and_topics"\n enable_emoji:\n default: true\n client: true\n area: "emojis"\n enable_emoji_shortcuts:\n default: true\n client: true\n area: "emojis"\n emoji_set:\n default: "twitter"\n client: true\n enum: "EmojiSetSiteSetting"\n area: "emojis"\n emoji_autocomplete_min_chars:\n client: true\n default: 0\n locale_default:\n fr: 1\n area: "emojis"\n enable_inline_emoji_translation:\n client: true\n default: false\n locale_default:\n zh_CN: true\n zh_TW: true\n ja: true\n ko: true\n area: "emojis"\n emoji_deny_list:\n type: emoji_list\n default: ""\n client: true\n refresh: true\n area: "emojis"\n approve_post_count:\n default: 0\n area: "posts_and_topics"\n approve_unless_trust_level:\n default: 0\n enum: "TrustLevelSetting"\n hidden: true\n approve_unless_allowed_groups:\n default: "1|2|10" # auto groups admins, moderators, trust_level_0\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n approve_new_topics_unless_trust_level:\n default: 0\n enum: "TrustLevelSetting"\n hidden: true\n approve_new_topics_unless_allowed_groups:\n default: "1|2|10" # auto groups admins, moderators, trust_level_0\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n approve_suspect_users:\n default: true\n area: "posts_and_topics"\n approve_unless_staged:\n default: false\n area: "posts_and_topics"\n notify_about_queued_posts_after:\n type: float\n default: 24\n min: 0\n area: "notifications"\n auto_close_messages_post_count:\n default: 500\n auto_close_topics_post_count:\n default: 10000\n auto_close_topics_create_linked_topic:\n default: true\n area: "posts_and_topics"\n code_formatting_style:\n client: true\n type: enum\n default: "code-fences"\n choices:\n - code-fences\n - 4-spaces-indent\n area: "posts_and_topics"\n embed_any_origin:\n default: false\n area: "embedding"\n embed_topics_list:\n default: false\n area: "embedding"\n embed_set_canonical_url:\n default: false\n area: "embedding"\n embed_unlisted:\n default: false\n area: "embedding"\n import_embed_unlisted:\n default: true\n area: "embedding"\n embed_truncate:\n default: true\n area: "embedding"\n embed_support_markdown:\n default: false\n area: "embedding"\n allowed_embed_selectors:\n default: ""\n area: "embedding"\n allowed_href_schemes:\n client: true\n default: ""\n type: list\n list_type: compact\n area: "posts_and_topics"\n max_allowed_message_recipients:\n default: 30\n min: 1\n area: "posts_and_topics"\n disable_watched_word_checking_in_user_fields:\n hidden: true\n default: false\n watched_words_regular_expressions:\n client: true\n default: false\n enable_fast_edit:\n default: true\n client: true\n area: "posts_and_topics"\n old_post_notice_days:\n default: 14\n max: 36500\n client: true\n area: "posts_and_topics"\n new_user_notice_tl:\n default: 2\n enum: "TrustLevelSetting"\n area: "posts_and_topics"\n returning_user_notice_tl:\n default: 2\n enum: "TrustLevelSetting"\n area: "posts_and_topics"\n returning_users_days:\n default: 120\n max: 36500\n area: "posts_and_topics"\n review_media_unless_trust_level:\n default: 0\n enum: "TrustLevelSetting"\n hidden: true\n skip_review_media_groups:\n default: "1|2|10" # auto groups admins, moderators, trust_level_0\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n blur_tl0_flagged_posts_media:\n default: true\n client: true\n area: "posts_and_topics"\n enable_page_publishing:\n default: false\n area: "posts_and_topics"\n show_published_pages_login_required:\n default: false\n area: "posts_and_topics"\n skip_auto_delete_reply_likes:\n default: 5\n area: "posts_and_topics"\n review_every_post:\n default: false\n area: "posts_and_topics"\n max_draft_length:\n default: 400_000\n hidden: true\n max_drafts_per_user:\n default: 10_000\n hidden: true\n max_form_template_title_length:\n default: 100\n min: 5\n max: 255\n area: "posts_and_topics"\n max_form_template_content_length:\n default: 5000\n max: 150000\n area: "posts_and_topics"\n group_pm_user_limit:\n default: 1000\n type: integer\n min: 1\n hidden: true\n\nemail:\n email_time_window_mins:\n default: 10\n client: true\n area: "email"\n personal_email_time_window_seconds:\n default: 20\n area: "email"\n email_posts_context:\n default: 5\n area: "email"\n digest_min_excerpt_length:\n default: 100\n locale_default:\n ja: 50\n zh_CN: 50\n zh_TW: 50\n area: "email"\n digest_topics:\n default: 5\n min: 1\n max: 20\n area: "email"\n digest_posts:\n default: 5\n min: 0\n max: 20\n area: "email"\n digest_other_topics:\n default: 5\n min: 0\n max: 20\n area: "email"\n suppress_digest_email_after_days:\n default: 180\n max: 36500\n area: "email"\n digest_suppress_categories:\n type: category_list\n default: ""\n area: "email"\n digest_suppress_tags:\n type: tag_list\n default: ""\n area: "email"\n disable_digest_emails:\n default: false\n client: true\n area: "email"\n apply_custom_styles_to_digest:\n default: true\n area: "email"\n email_accent_bg_color:\n type: color\n default: "#2F70AC"\n validator: "CssColorValidator"\n area: "email"\n email_accent_fg_color:\n type: color\n default: "#FFFFFF"\n validator: "CssColorValidator"\n area: "email"\n email_link_color:\n type: color\n default: "#006699"\n validator: "CssColorValidator"\n area: "email"\n show_topic_featured_link_in_digest:\n default: false\n area: "email"\n email_custom_headers:\n default: "Auto-Submitted: auto-generated"\n area: "email"\n email_subject:\n default: "[%{site_name}] %{optional_pm}%{optional_cat}%{topic_title}"\n area: "email"\n reply_by_email_enabled:\n default: false\n validator: "ReplyByEmailEnabledValidator"\n reply_by_email_address:\n default: ""\n validator: "ReplyByEmailAddressValidator"\n alternative_reply_by_email_addresses:\n default: ""\n validator: "AlternativeReplyByEmailAddressesValidator"\n area: "email"\n find_related_post_with_key:\n default: true\n area: "email"\n manual_polling_enabled:\n default: false\n pop3_polling_enabled:\n default: false\n validator: "POP3PollingEnabledSettingValidator"\n pop3_polling_ssl: true\n pop3_polling_openssl_verify: true\n pop3_polling_period_mins: 5\n pop3_polling_host: ""\n pop3_polling_port: 995\n pop3_polling_username: ""\n pop3_polling_password:\n default: ""\n secret: true\n pop3_polling_delete_from_server: true\n log_mail_processing_failures: false\n incoming_email_prefer_html:\n default: true\n area: "email"\n strip_incoming_email_lines:\n default: false\n area: "email"\n email_in:\n default: false\n client: true\n area: "email"\n email_in_min_trust:\n default: 2\n enum: "TrustLevelSetting"\n hidden: true\n email_in_allowed_groups:\n default: "1|2|12" # auto group admins, moderators, trust_level_2\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n email_in_authserv_id:\n default: ""\n area: "email"\n email_in_spam_header:\n type: enum\n default: "none"\n choices:\n - none\n - X-Spam-Flag\n - X-Spam-Status\n - X-SES-Spam-Verdict\n area: "email"\n enable_imap:\n default: false\n client: true\n hidden: true\n enable_imap_write:\n default: false\n hidden: true\n enable_imap_idle:\n default: false\n hidden: true\n enable_smtp:\n default: false\n client: true\n imap_polling_period_mins:\n default: 5\n imap_polling_old_emails:\n default: 1000\n imap_polling_new_emails:\n default: 250\n imap_batch_import_email:\n default: 100\n email_prefix:\n default: ""\n area: "email"\n email_site_title:\n default: ""\n area: "email"\n disable_emails:\n client: true\n type: enum\n default: "no"\n choices:\n - "no"\n - "yes"\n - "non-staff"\n area: "email"\n strip_images_from_short_emails:\n default: true\n area: "email"\n short_email_length:\n default: 2800\n area: "email"\n display_name_on_email_from:\n default: true\n area: "email"\n unsubscribe_via_email:\n default: true\n area: "email"\n unsubscribe_via_email_footer:\n default: false\n area: "email"\n disallow_reply_by_email_after_days:\n default: 90\n max: 36500\n area: "email"\n delete_email_logs_after_days:\n default: 90\n max: 36500\n area: "email"\n max_emails_per_day_per_user:\n default: 100\n area: "email"\n enable_staged_users:\n default: true\n area: "email"\n maximum_staged_users_per_email:\n default: 10\n area: "email"\n maximum_recipients_per_new_group_email:\n default: 10\n min: 1\n area: "email"\n auto_generated_allowlist:\n default: ""\n type: list\n list_type: simple\n area: "email"\n block_auto_generated_emails:\n default: true\n area: "email"\n ignore_by_title:\n type: list\n list_type: simple\n default: ""\n area: "email"\n mailgun_api_key:\n default: ""\n regex: '^((key-)?\h{32}|\h{32}-\h{8}-\h{8})$'\n secret: true\n sendgrid_verification_key:\n default: ""\n secret: true\n mailjet_webhook_token:\n default: ""\n secret: true\n mandrill_authentication_key:\n default: ""\n secret: true\n postmark_webhook_token:\n default: ""\n secret: true\n sparkpost_webhook_token:\n default: ""\n secret: true\n bounce_score_threshold:\n client: true\n default: 4\n min: 1\n area: "email"\n bounce_score_erode_on_send:\n default: 0.1\n hidden: true\n soft_bounce_score:\n default: 1\n min: 1\n area: "email"\n hard_bounce_score:\n default: 2\n min: 2\n area: "email"\n reset_bounce_score_after_days:\n default: 30\n max: 36500\n area: "email"\n blocked_attachment_content_types:\n type: list\n default: "pkcs7|x-vcard|pgp-keys|pgp-signature"\n list_type: compact\n area: "email"\n blocked_attachment_filenames:\n type: list\n default: "smime.p7s|signature.asc|winmail.dat"\n list_type: compact\n area: "email"\n forwarded_emails_behaviour:\n type: enum\n default: hide\n choices:\n - hide\n - quote\n - create_replies\n area: "email"\n always_show_trimmed_content:\n default: false\n area: "email"\n trim_incoming_emails:\n default: true\n area: "email"\n private_email:\n default: false\n area: "email"\n email_custom_template:\n default: ""\n hidden: true\n email_custom_css:\n default: ""\n hidden: true\n email_custom_css_compiled:\n default: ""\n hidden: true\n email_total_attachment_size_limit_kb:\n default: 0\n max: 51200\n type: file_size_restriction\n area: "email"\n post_excerpts_in_emails:\n default: false\n area: "email"\n raw_email_max_length:\n default: 220000\n area: "email"\n raw_rejected_email_max_length:\n default: 4000\n area: "email"\n delete_rejected_email_after_days:\n default: 90\n validator: "DeleteRejectedEmailAfterDaysValidator"\n area: "email"\n enable_secondary_emails:\n client: true\n default: true\n hidden: true\n max_participant_names:\n default: 10\n hidden: true\n require_change_email_confirmation:\n default: false\n area: "email"\n view_raw_email_allowed_groups:\n type: group_list\n list_type: compact\n default: "1|2"\n allow_any: false\n refresh: true\n area: "group_permissions"\n\nfiles:\n max_image_size_kb:\n client: true\n default: 4096\n max: 102400\n type: file_size_restriction\n max_attachment_size_kb:\n client: true\n default: 4096\n max: 1024000\n type: file_size_restriction\n system_user_max_attachment_size_kb:\n default: 0\n max: 4096000\n type: file_size_restriction\n hidden: true\n max_image_megapixels:\n default: 40\n min: 5\n max: 150\n max_export_file_size_kb:\n hidden: true\n default: 50000\n max: 1024000\n type: file_size_restriction\n theme_authorized_extensions:\n default: "wasm|jpg|jpeg|png|woff|woff2|svg|eot|ttf|otf|gif|webp|avif|js"\n type: list\n list_type: file_types\n theme_download_screenshots:\n default: false\n hidden: true\n authorized_extensions:\n client: true\n default: "jpg|jpeg|png|gif|heic|heif|webp|avif"\n refresh: true\n type: list\n list_type: file_types\n authorized_extensions_for_staff:\n client: true\n default: ""\n refresh: true\n type: list\n list_type: file_types\n export_authorized_extensions:\n hidden: true\n default: "zip"\n type: list\n list_type: compact\n responsive_post_image_sizes:\n default: "1|1.5|2"\n type: list\n list_type: compact\n max_image_width:\n client: true\n default: 690\n max_image_height:\n client: true\n default: 500\n download_remote_images_to_local:\n default: true\n download_remote_images_threshold: 10\n disabled_image_download_domains:\n type: list\n list_type: simple\n default: ""\n block_hotlinked_media:\n default: false\n block_hotlinked_media_exceptions:\n default: ""\n type: list\n regex: '\A((https?:\/\/.+)(\|https?:\/\/.+[|$])*)?\z'\n create_thumbnails: true\n clean_up_uploads: true\n clean_orphan_uploads_grace_period_hours:\n default: 48\n max: 168\n purge_deleted_uploads_grace_period_days:\n default: 30\n max: 36500\n prevent_anons_from_downloading_files:\n default: false\n client: true\n secure_uploads:\n default: false\n client: true\n secure_uploads_allow_embed_images_in_emails:\n default: true\n secure_uploads_max_email_embed_image_size_kb:\n default: 1024\n min: 1\n max: 10240\n type: file_size_restriction\n secure_uploads_pm_only:\n default: false\n hidden: true\n client: true\n enable_s3_uploads:\n default: false\n client: true\n enable_s3_transfer_acceleration:\n default: false\n hidden: true\n s3_use_iam_profile:\n default: false\n s3_access_key_id:\n default: ""\n secret: true\n s3_secret_access_key:\n default: ""\n secret: true\n s3_region:\n default: "us-east-1"\n enum: "S3RegionSiteSetting"\n s3_upload_bucket:\n default: ""\n regex: '^[a-z0-9\-\/_]+$' # can't use '.' when using HTTPS\n s3_endpoint:\n default: ""\n regex: '^https?:\/\/.+[^\/]$'\n s3_http_continue_timeout:\n default: 1\n hidden: true\n s3_install_cors_rule:\n default: true\n hidden: true\n s3_cdn_url:\n default: ""\n regex: '^https?:\/\/.+[^\/]$'\n s3_use_cdn_url_for_all_uploads:\n default: false\n s3_configure_tombstone_policy:\n default: true\n s3_use_acls:\n default: true\n s3_presigned_get_url_expires_after_seconds:\n default: 300\n hidden: true\n min: 60\n max: 604800\n allow_profile_backgrounds:\n client: true\n default: true\n automatically_download_gravatars: true\n allow_uploaded_avatars:\n client: true\n default: "0"\n enum: "TrustLevelAndStaffAndDisabledSetting"\n hidden: true\n uploaded_avatars_allowed_groups:\n default: "10"\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n default_avatars:\n default: ""\n type: url_list\n client: true\n avatar_sizes:\n default: "24|48|72|96|144|288"\n type: list\n list_type: compact\n client: true\n external_system_avatars_enabled:\n default: true\n client: true\n validator: "ExternalSystemAvatarsValidator"\n external_system_avatars_url:\n default: "/letter_avatar_proxy/v4/letter/{first_letter}/{color}/{size}.png"\n client: true\n regex: '^((https?:)?\/)?\/.+[^\/]'\n external_emoji_url:\n default: ""\n client: true\n area: "emojis"\n restrict_letter_avatar_colors:\n default: ""\n type: list\n list_type: compact\n validator: "ColorListValidator"\n selectable_avatars_mode:\n default: disabled\n client: true\n type: enum\n choices:\n - disabled\n - everyone\n - tl1\n - tl2\n - tl3\n - tl4\n - staff\n - no_one\n validator: "SelectableAvatarsModeValidator"\n selectable_avatars:\n default: ""\n client: true\n type: uploaded_image_list\n allow_all_attachments_for_group_messages: false\n png_to_jpg_quality:\n default: 95\n min: 1\n max: 100\n recompress_original_jpg_quality:\n default: 90\n min: 1\n max: 100\n image_preview_jpg_quality:\n default: 90\n min: 1\n max: 100\n allow_staff_to_upload_any_file_in_pm:\n default: true\n client: true\n strip_image_metadata: true\n min_ratio_to_crop:\n type: float\n default: 0.22\n min: 0\n max: 1\n simultaneous_uploads:\n client: true\n default: 5\n min: 0\n max: 20\n decompressed_theme_max_file_size_mb:\n default: 1000\n hidden: true\n decompressed_backup_max_file_size_mb:\n default: 100000\n hidden: true\n composer_media_optimization_image_enabled:\n default: true\n client: true\n composer_media_optimization_image_bytes_optimization_threshold:\n default: 524288\n client: true\n composer_media_optimization_image_resize_dimensions_threshold:\n default: 1920\n client: true\n composer_media_optimization_image_resize_width_target:\n default: 1920\n client: true\n composer_media_optimization_image_resize_pre_multiply:\n default: false\n hidden: true\n client: true\n composer_media_optimization_image_resize_linear_rgb:\n default: false\n hidden: true\n client: true\n composer_media_optimization_image_encode_quality:\n default: 75\n client: true\n composer_media_optimization_debug_mode:\n default: false\n client: true\n hidden: true\n composer_ios_media_optimisation_image_enabled:\n default: false\n client: true\n hidden: true\n video_thumbnails_enabled:\n default: true\n client: true\n hidden: true\n\ntrust:\n default_trust_level:\n default: 0\n enum: "TrustLevelSetting"\n area: "trust_levels"\n default_invitee_trust_level:\n default: 1\n enum: "TrustLevelSetting"\n area: "trust_levels"\n min_trust_to_create_topic:\n default: 0\n enum: "TrustLevelSetting"\n hidden: true\n create_topic_allowed_groups:\n default: "1|2|10" # auto group admins, moderators, trust_level_0\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n min_trust_to_edit_wiki_post:\n default: 1\n enum: "TrustLevelSetting"\n hidden: true\n edit_wiki_post_allowed_groups:\n default: "1|2|11" # auto group admins, moderators, trust_level_1\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n min_trust_to_edit_post:\n default: 0\n enum: "TrustLevelSetting"\n hidden: true\n edit_post_allowed_groups:\n default: "1|2|10" # auto group admins, moderators, trust_level_0\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n min_trust_to_allow_self_wiki:\n default: 3\n enum: "TrustLevelSetting"\n hidden: true\n self_wiki_allowed_groups:\n default: "1|2|13" # auto group admins, moderators, trust_level_3\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n min_trust_to_send_email_messages:\n default: "4"\n enum: "TrustLevelAndStaffSetting"\n hidden: true\n send_email_messages_allowed_groups:\n default: "1|2|14" # auto group admins, moderators, trust_level_4\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n min_trust_to_flag_posts:\n default: 1\n enum: "TrustLevelSetting"\n hidden: true\n flag_post_allowed_groups:\n default: "1|2|11" # auto group admins, moderators, trust_level_1\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n allow_all_users_to_flag_illegal_content:\n default: false\n area: "flags"\n client: true\n email_address_to_report_illegal_content:\n default: ""\n area: "flags"\n client: true\n min_trust_to_post_links:\n default: 0\n enum: "TrustLevelSetting"\n hidden: true\n post_links_allowed_groups:\n default: "1|2|10" # auto group admins, moderators, trust_level_0\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n min_trust_to_post_embedded_media:\n default: 0\n enum: "TrustLevelSetting"\n hidden: true\n embedded_media_post_allowed_groups:\n default: "1|2|10" # auto group admins, moderators, trust_level_0\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n min_trust_level_to_allow_profile_background:\n default: 0\n client: true\n enum: "TrustLevelSetting"\n hidden: true\n profile_background_allowed_groups:\n default: "1|2|10" # auto group admins, moderators, trust_level_0\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n min_trust_level_to_allow_user_card_background:\n default: 0\n client: true\n enum: "TrustLevelSetting"\n hidden: true\n user_card_background_allowed_groups:\n default: "1|2|10" # auto group admins, moderators, trust_level_0\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n min_trust_level_to_allow_invite:\n default: 2\n enum: "TrustLevelSetting"\n hidden: true\n invite_allowed_groups:\n default: "1|2|12" # auto group admins, moderators, trust_level_2\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n min_trust_level_to_allow_ignore:\n default: 2\n enum: "TrustLevelSetting"\n client: true\n hidden: true\n ignore_allowed_groups:\n default: "1|2|12" # auto group admins, moderators, trust_level_2\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n allow_flagging_staff: true\n send_tl1_welcome_message: true\n send_tl2_promotion_message: true\n tl1_requires_topics_entered:\n default: 5\n area: "trust_levels"\n tl1_requires_read_posts:\n default: 30\n client: true\n area: "trust_levels"\n tl1_requires_time_spent_mins:\n default: 10\n area: "trust_levels"\n tl2_requires_topics_entered:\n default: 20\n area: "trust_levels"\n tl2_requires_read_posts:\n default: 100\n area: "trust_levels"\n tl2_requires_time_spent_mins:\n default: 60\n area: "trust_levels"\n tl2_requires_days_visited:\n default: 15\n max: 36500\n area: "trust_levels"\n tl2_requires_likes_received:\n default: 1\n area: "trust_levels"\n tl2_requires_likes_given:\n default: 1\n area: "trust_levels"\n tl2_requires_topic_reply_count:\n default: 3\n area: "trust_levels"\n tl3_time_period:\n default: 100\n min: 1\n max: 1000000\n area: "trust_levels"\n tl3_requires_days_visited:\n default: 50\n max: 36500\n area: "trust_levels"\n tl3_requires_topics_replied_to:\n default: 10\n area: "trust_levels"\n tl3_requires_topics_viewed:\n default: 25\n max: 100\n area: "trust_levels"\n tl3_requires_topics_viewed_cap:\n default: 500\n area: "trust_levels"\n tl3_requires_posts_read:\n default: 25\n max: 100\n area: "trust_levels"\n tl3_requires_posts_read_cap:\n default: 20000\n max: 99000\n area: "trust_levels"\n tl3_requires_topics_viewed_all_time:\n default: 200\n area: "trust_levels"\n tl3_requires_posts_read_all_time:\n default: 500\n area: "trust_levels"\n tl3_requires_max_flagged:\n default: 5\n area: "trust_levels"\n tl3_promotion_min_duration:\n default: 14\n max: 10000\n area: "trust_levels"\n tl3_requires_likes_given:\n default: 30\n area: "trust_levels"\n tl3_requires_likes_received:\n default: 20\n area: "trust_levels"\n tl3_links_no_follow:\n default: false\n client: true\n area: "trust_levels"\n tl4_delete_posts_and_topics:\n default: false\n client: true\n hidden: true\n area: "trust_levels"\n delete_all_posts_and_topics_allowed_groups:\n default: ""\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n edit_all_topic_groups:\n default: "13"\n type: group_list\n area: "group_permissions"\n edit_all_post_groups:\n default: "14"\n type: group_list\n area: "group_permissions"\n\nsecurity:\n detailed_404: false\n enforce_second_factor_on_external_auth:\n client: true\n default: true\n enforce_second_factor:\n client: true\n type: enum\n default: "no"\n choices:\n - "no"\n - "staff"\n - "all"\n force_https:\n default: false\n same_site_cookies:\n default: Lax\n hidden: true\n type: enum\n choices:\n - Lax\n - Strict\n - Disabled\n - None\n regex: "^(Lax|Strict|Disabled|None)$"\n enable_escaped_fragments: true\n allow_index_in_robots_txt: true\n allow_indexing_non_canonical_urls:\n default: true\n hidden: true\n moderators_manage_categories_and_groups:\n default: false\n client: true\n moderators_change_post_ownership:\n client: true\n default: false\n moderators_view_emails:\n client: true\n default: false\n non_crawler_user_agents:\n hidden: true\n default: "trident|webkit|gecko|chrome|safari|msie|opera|goanna|discourse"\n type: list\n list_type: compact\n crawler_user_agents:\n hidden: true\n default: "rss|bot|spider|crawler|facebook|archive|wayback|ping|monitor|lighthouse|google-inspectiontool|gptbot|claudebot|anthropic-ai|brightbot|googleother"\n type: list\n list_type: compact\n browser_update_user_agents:\n hidden: true\n default: "MSIE 6|MSIE 7|MSIE 8|MSIE 9|Xbox|PlayStation"\n type: list\n list_type: compact\n crawler_check_bypass_agents:\n hidden: true\n default: "cubot"\n cors_origins:\n default: ""\n type: list\n list_type: simple\n keep_old_ip_address_count:\n default: 0\n hidden: true\n use_admin_ip_allowlist:\n default: false\n client: true\n blocked_ip_blocks:\n default: ""\n type: list\n list_type: compact\n allowed_internal_hosts:\n default: ""\n type: list\n allowed_onebox_iframes:\n default: "*"\n type: list\n allow_any: false\n choices: "['*'] + Onebox::Engine.all_iframe_origins"\n allowed_iframes:\n default: "https://www.google.com/maps/embed?|https://www.openstreetmap.org/export/embed.html?|https://calendar.google.com/calendar/embed?|https://codepen.io/|https://www.instagram.com/|https://open.spotify.com/"\n type: list\n list_type: simple\n client: true\n validator: "AllowedIframesValidator"\n allowed_crawler_user_agents:\n type: list\n default: ""\n list_type: compact\n requires_confirmation: "simple"\n blocked_crawler_user_agents:\n type: list\n default: "mauibot|semrushbot|ahrefsbot|blexbot|seo spider"\n list_type: compact\n requires_confirmation: "simple"\n slow_down_crawler_user_agents:\n type: list\n default: "gptbot|claudebot|anthropic-ai|brightbot"\n list_type: compact\n requires_confirmation: "simple"\n slow_down_crawler_rate: 60\n content_security_policy:\n default: true\n content_security_policy_report_only:\n default: false\n content_security_policy_collect_reports:\n default: false\n hidden: true\n content_security_policy_frame_ancestors:\n default: true\n content_security_policy_script_src:\n type: simple_list\n default: ""\n validator: "CspScriptSrcValidator"\n invalidate_inactive_admin_email_after_days:\n default: 365\n min: 0\n max: 36500\n allow_embedding_site_in_an_iframe:\n default: false\n hidden: true\n send_old_credential_reminder_days:\n default: 0\n hidden: true\n disable_onebox_media_download_controls:\n default: false\n hidden: true\n can_permanently_delete:\n default: false\n client: true\n hidden: true\n suppress_secured_categories_from_admin:\n default: false\n include_secure_categories_in_tag_counts:\n default: false\n display_personal_messages_tag_counts:\n default: false\n cross_origin_opener_policy_header:\n default: "same-origin-allow-popups"\n type: enum\n choices:\n - "unsafe-none"\n - "same-origin"\n - "same-origin-allow-popups"\n hidden: true\n cross_origin_opener_unsafe_none_groups:\n type: group_list\n list_type: compact\n default: ""\n allow_any: false\n refresh: true\n hidden: true\n area: "group_permissions"\n\nonebox:\n post_onebox_maxlength:\n default: 500\n locale_default:\n ja: 200\n zh_CN: 200\n zh_TW: 200\n blocked_onebox_domains:\n default: ""\n type: host_list\n list_type: compact\n max_oneboxes_per_post:\n default: 50\n client: true\n allowed_inline_onebox_domains:\n default: ""\n type: list\n list_type: compact\n enable_inline_onebox_on_all_domains:\n default: true\n onebox_user_agent:\n default: ""\n hidden: true\n onebox_locale:\n default: ""\n type: enum\n enum: "OneboxLocaleSiteSetting"\n area: "localization"\n force_custom_user_agent_hosts:\n default: "http://codepen.io"\n type: list\n force_get_hosts:\n default: "us.battle.net|news.yahoo.com|*.medium.com"\n type: list\n hidden: true\n facebook_app_access_token:\n default: ""\n secret: true\n block_onebox_on_redirect:\n default: false\n github_onebox_access_tokens:\n default: ""\n type: list\n secret: true\n list_type: secret\nspam:\n add_rel_nofollow_to_user_content: true\n hide_post_sensitivity:\n type: enum\n enum: "ReviewableSensitivitySetting"\n default: 6\n cooldown_minutes_after_hiding_posts: 10\n silence_new_user_sensitivity:\n type: enum\n enum: "ReviewableSensitivitySetting"\n default: 3\n area: "flags"\n num_users_to_silence_new_user:\n default: 3\n area: "flags"\n notify_mods_when_user_silenced: false\n flag_sockpuppets:\n default: false\n area: "flags"\n newuser_spam_host_threshold: 3\n allowed_spam_host_domains:\n default: ""\n type: list\n list_type: simple\n levenshtein_distance_spammer_emails:\n default: 2\n max: 3\n max_new_accounts_per_registration_ip: 3\n min_ban_entries_for_roll_up: 5\n max_age_unmatched_emails: 365\n max_age_unmatched_ips: 365\n num_flaggers_to_close_topic:\n default: 5\n area: "flags"\n auto_close_topic_sensitivity:\n type: enum\n enum: "ReviewableSensitivitySetting"\n default: 9\n num_hours_to_close_topic:\n default: 4\n min: 1\n auto_respond_to_flag_actions:\n default: true\n area: "flags"\n min_first_post_typing_time:\n default: 3000\n hidden: true\n fast_typing_threshold:\n type: enum\n default: standard\n choices:\n - disabled\n - low\n - standard\n - high\n auto_silence_fast_typers_on_first_post: true\n auto_silence_fast_typers_max_trust_level:\n default: 0\n enum: "TrustLevelSetting"\n auto_silence_first_post_regex: ""\n high_trust_flaggers_auto_hide_posts:\n default: true\n area: "flags"\n cooldown_hours_until_reflag:\n default: 24\n min: 0\n slow_mode_prevents_editing: true\n\n reviewable_claiming:\n client: true\n type: enum\n default: disabled\n choices:\n - disabled\n - optional\n - required\n\n reviewable_default_topics:\n default: false\n client: true\n reviewable_default_visibility:\n client: true\n type: enum\n default: low\n enum: "ReviewablePrioritySetting"\n reviewable_low_priority_threshold:\n default: 0\n min: 0\n reviewable_revision_reasons:\n default: "Duplicate|Does not meet posting guidelines"\n type: list\n client: true\n\nrate_limits:\n unique_posts_mins: 5\n rate_limit_create_topic: 15\n rate_limit_create_post: 5\n rate_limit_new_user_create_post: 30\n rate_limit_search_anon_global_per_minute:\n hidden: true\n default: 150\n rate_limit_search_anon_user_per_minute:\n hidden: true\n default: 15\n rate_limit_search_anon_global_per_second:\n hidden: true\n default: 8\n rate_limit_search_anon_user_per_second:\n hidden: true\n default: 2\n rate_limit_search_user:\n hidden: true\n default: 30\n max_topics_per_day: 20\n max_personal_messages_per_day: 20\n max_likes_per_day: 50\n max_bookmarks_per_day: 20\n max_flags_per_day:\n default: 20\n area: "flags"\n max_edits_per_day: 30\n max_invites_per_day: 10\n max_topic_invitations_per_day: 30\n max_topic_invitations_per_minute: 5\n max_topics_in_first_day: 3\n max_replies_in_first_day: 10\n tl2_additional_likes_per_day_multiplier: 1.5\n tl3_additional_likes_per_day_multiplier: 2\n tl4_additional_likes_per_day_multiplier: 3\n tl2_additional_edits_per_day_multiplier: 1.5\n tl3_additional_edits_per_day_multiplier: 2\n tl4_additional_edits_per_day_multiplier: 3\n tl2_additional_flags_per_day_multiplier:\n default: 1.5\n area: "flags"\n tl3_additional_flags_per_day_multiplier:\n default: 2\n area: "flags"\n tl4_additional_flags_per_day_multiplier:\n default: 3\n area: "flags"\n alert_admins_if_errors_per_minute:\n client: true\n default: 0\n alert_admins_if_errors_per_hour:\n client: true\n default: 0\n max_prints_per_hour_per_user:\n default: 5\n client: true\n min: 0\n max_logins_per_ip_per_hour:\n min: 1\n default: 30\n max_logins_per_ip_per_minute:\n min: 1\n default: 6\n max_post_deletions_per_minute:\n min: 0\n default: 2\n max_post_deletions_per_day:\n min: 0\n default: 10\n invite_link_max_redemptions_limit:\n min: 1\n max: 1000000\n default: 5000\n client: true\n invite_link_max_redemptions_limit_users:\n min: 1\n max: 1000000\n default: 10\n client: true\n max_allowed_secondary_emails:\n default: 10\n hidden: true\n client: true\n max_batch_presign_multipart_per_minute:\n default: 20\n hidden: true\n max_presigned_put_per_minute:\n default: 10\n hidden: true\n max_create_multipart_per_minute:\n default: 10\n hidden: true\n max_complete_multipart_per_minute:\n default: 10\n hidden: true\n max_uploads_per_minute:\n default: 10\n hidden: true\n user_api_key_clients_create_per_day:\n default: 3\n min: 1\n max: 10\n hidden: true\n\ndeveloper:\n force_hostname:\n hidden: true\n default: ""\n port:\n hidden: true\n default: ""\n enable_chunked_encoding:\n hidden: true\n client: true\n default: true\n long_polling_base_url:\n hidden: true\n client: true\n default: "/"\n background_polling_interval:\n hidden: true\n client: true\n default: 60000\n max: 99000\n polling_interval:\n hidden: true\n client: true\n default: 3000\n max: 99000\n anon_polling_interval:\n hidden: true\n client: true\n default: 25000\n max: 99000\n flush_timings_secs:\n client: true\n default: 60\n active_user_rate_limit_secs: 60\n verbose_localization:\n default: false\n client: true\n top_topics_formula_log_views_multiplier:\n default: 2\n top_topics_formula_first_post_likes_multiplier:\n default: 0.5\n top_topics_formula_least_likes_per_post_multiplier:\n default: 3\n rebake_old_posts_count:\n hidden: true\n default: 80\n min: 1\n migrate_to_new_scheme:\n hidden: true\n default: false\n max_new_topics:\n default: 500\n client: true\n hidden: true\n wizard_enabled:\n default: true\n hidden: true\n bypass_wizard_check:\n default: false\n hidden: true\n bootstrap_error_pages:\n hidden: true\n default: false\n enable_safe_mode:\n default: true\n client: true\n include_associated_account_ids:\n default: false\n hidden: true\n max_sidebar_section_links:\n default: 50\n hidden: true\n instrument_gc_stat_per_request:\n default: false\n hidden: true\n warn_critical_js_deprecations:\n default: true\n client: true\n hidden: true\n warn_critical_js_deprecations_message:\n default: ""\n client: true\n hidden: true\n custom_flags_limit:\n default: 50\n hidden: true\n client: true\n\nnavigation:\n navigation_menu:\n client: true\n default: "sidebar"\n type: enum\n enum: "NavigationMenuSiteSetting"\n area: "navigation"\n default_navigation_menu_categories:\n type: category_list\n default: ""\n client: true\n area: "navigation"\n default_navigation_menu_tags:\n type: tag_list\n default: ""\n client: true\n area: "navigation"\n default_sidebar_switch_panel_position:\n default: "bottom"\n type: enum\n client: true\n choices:\n - "top"\n - "bottom"\n area: "navigation"\n\nembedding:\n embed_by_username:\n default: ""\n type: username\n hidden: true\n embed_post_limit:\n default: 100\n hidden: true\n embed_topic_limit_per_page:\n default: 200\n hidden: true\n embed_title_scrubber:\n default: ""\n hidden: true\n blocked_embed_selectors:\n default: ""\n hidden: true\n allowed_embed_classnames:\n default: "emoji"\n hidden: true\n\nlegal:\n tos_url:\n client: true\n default: ""\n area: "legal"\n privacy_policy_url:\n client: true\n default: ""\n area: "legal"\n faq_url:\n client: true\n default: ""\n area: "legal"\n log_anonymizer_details:\n default: true\n area: "legal"\n display_eu_visitor_stats:\n default: false\n client: true\n area: "legal"\n\nbackups:\n enable_backups:\n default: true\n client: true\n allow_restore:\n default: false\n backup_location:\n default: "local"\n type: enum\n enum: "BackupLocationSiteSetting"\n client: true\n maximum_backups:\n client: true\n default: 5\n remove_older_backups:\n client: true\n default: ""\n automatic_backups_enabled:\n default: true\n backup_frequency:\n min: 1\n max: 30\n default: 7\n s3_backup_bucket:\n default: ""\n regex: '^[a-z0-9\-\/]+$' # can't use '.' when using HTTPS\n s3_inventory_bucket:\n hidden: true\n default: ""\n regex: '^[a-z0-9\-\/_]+$' # can't use '.' when using HTTPS\n s3_inventory_bucket_region:\n hidden: true\n default: ""\n s3_disable_cleanup:\n default: false\n backup_time_of_day:\n default: "3:30"\n regex: "^((0?(0|1|2|3|4|5|6|7|8|9)|(10|11|12|13|14|15|16|17|18|19|20|21|22|23))):\\d\\d$"\n backup_with_uploads: true\n backup_gzip_compression_level_for_uploads:\n default: 1\n min: 1\n max: 9\n include_thumbnails_in_backups:\n default: false\n include_s3_uploads_in_backups:\n default: false\n hidden: true\n client: true\n\nsearch:\n prioritize_exact_search_title_match:\n default: true\n hidden: true\n max_duplicate_search_index_terms:\n default: 6\n hidden: true\n use_pg_headlines_for_excerpt:\n default: false\n hidden: true\n client: true\n search_max_indexed_word_length:\n default: 100\n hidden: true\n search_ranking_normalization:\n default: "0"\n hidden: true\n search_ranking_weights:\n default: ""\n hidden: true\n validator: "SearchRankingWeightsValidator"\n min_search_term_length:\n client: true\n default: 3\n locale_default:\n zh_CN: 1\n zh_TW: 1\n ko: 1\n ja: 1\n search_tokenize_chinese:\n default: false\n validator: "SearchTokenizeChineseValidator"\n search_tokenize_japanese:\n default: false\n validator: "SearchTokenizeJapaneseValidator"\n search_prefer_recent_posts: false\n search_recent_posts_size:\n default: 1000000\n max: 10000000\n search_recent_regular_posts_offset_post_id:\n default: 0\n hidden: true\n search_enable_recent_regular_posts_offset_size:\n default: 200000\n hidden: true\n log_search_queries:\n client: true\n default: true\n search_query_log_max_size:\n default: 1000000\n max: 1000000\n search_query_log_max_retention_days:\n default: 365 # 1 year\n max: 1825 # 5 years\n search_ignore_accents:\n default: false\n locale_default:\n ar: true\n ca: true\n cs: true\n el: true\n es: true\n fa_IR: true\n fr: true\n hu: true\n pt: true\n pt_BR: true\n ro: true\n sk: true\n tr_TR: true\n category_search_priority_low_weight:\n default: 0.8\n hidden: true\n validator: "CategorySearchPriorityWeightsValidator"\n category_search_priority_high_weight:\n default: 1.2\n hidden: true\n validator: "CategorySearchPriorityWeightsValidator"\n search_page_size:\n default: 50\n hidden: true\n search_default_sort_order:\n default: 0 # "relevance"\n client: true\n type: enum\n enum: "SearchSortOrderSiteSetting"\n search_experience:\n default: search_icon\n client: true\n type: enum\n enum: "SearchExperienceSiteSetting"\n\nuncategorized:\n version_checks:\n client: true\n default: true\n area: "site_admin"\n include_in_discourse_discover:\n default: false\n area: "site_admin"\n new_version_emails:\n default: true\n area: "site_admin"\n send_welcome_message: true\n\n suppress_uncategorized_badge:\n client: true\n default: true\n area: "categories_and_tags"\n\n header_dropdown_category_count:\n client: true\n default: 8\n area: "navigation"\n\n slug_generation_method:\n default: "ascii"\n enum: "SlugSetting"\n client: true\n locale_default:\n ja: "none"\n zh_CN: "none"\n zh_TW: "none"\n\n permalink_normalizations:\n default: ""\n type: list\n list_type: simple\n validator: "RegexpListValidator"\n area: "permalinks"\n\n max_similar_results:\n default: 5\n area: "posts_and_topics"\n minimum_topics_similar:\n default: 50\n area: "posts_and_topics"\n\n previous_visit_timeout_hours:\n default: 1\n area: "users"\n staff_like_weight: 3\n topic_view_duration_hours:\n default: 8\n area: "stats_and_thresholds"\n user_profile_view_duration_hours:\n default: 8\n area: "stats_and_thresholds"\n\n # Summary mode\n summary_score_threshold:\n default: 15\n area: "posts_and_topics"\n summary_posts_required:\n default: 50\n area: "posts_and_topics"\n summary_likes_required:\n default: 1\n area: "posts_and_topics"\n summary_percent_filter:\n default: 20\n area: "posts_and_topics"\n summary_max_results:\n default: 100\n area: "posts_and_topics"\n summary_timeline_button:\n client: true\n default: false\n area: "posts_and_topics"\n\n automatic_topic_heat_values:\n default: true\n area: "stats_and_thresholds"\n\n # View heat thresholds\n topic_views_heat_low:\n client: true\n default: 1000\n area: "stats_and_thresholds"\n topic_views_heat_medium:\n client: true\n default: 2000\n area: "stats_and_thresholds"\n topic_views_heat_high:\n client: true\n default: 3500\n area: "stats_and_thresholds"\n\n # Post/Like heat thresholds\n topic_post_like_heat_low:\n client: true\n default: 0.5\n area: "stats_and_thresholds"\n topic_post_like_heat_medium:\n client: true\n default: 1.0\n area: "stats_and_thresholds"\n topic_post_like_heat_high:\n client: true\n default: 2.0\n area: "stats_and_thresholds"\n\n # History edit heat thresholds\n history_hours_low:\n client: true\n default: 12\n area: "stats_and_thresholds"\n history_hours_medium:\n client: true\n default: 24\n area: "stats_and_thresholds"\n history_hours_high:\n client: true\n default: 48\n area: "stats_and_thresholds"\n\n # Cold map thresholds\n cold_age_days_low:\n default: 14\n max: 36500\n client: true\n area: "stats_and_thresholds"\n cold_age_days_medium:\n default: 90\n max: 36500\n client: true\n area: "stats_and_thresholds"\n cold_age_days_high:\n default: 180\n max: 36500\n client: true\n area: "stats_and_thresholds"\n\n # Warnings\n educate_until_posts:\n default: 2\n area: "users"\n sequential_replies_threshold:\n default: 2\n area: "stats_and_thresholds"\n get_a_room_threshold:\n default: 3\n area: "stats_and_thresholds"\n dont_feed_the_trolls_threshold:\n default: 2\n area: "stats_and_thresholds"\n dominating_topic_minimum_percent:\n default: 40\n area: "stats_and_thresholds"\n disable_avatar_education_message:\n default: false\n area: "users"\n pm_warn_user_last_seen_months_ago:\n default: 24\n area: "users"\n\n global_notice:\n default: ""\n client: true\n area: "site_admin"\n has_login_hint:\n default: false\n hidden: true\n\n # Nothing past this threshold is ever considered new\n # this is calculated dynamically every 15 minutes\n min_new_topics_time:\n default: 0\n hidden: true\n\n # Category IDs\n general_category_id:\n default: -1\n hidden: true\n client: true\n meta_category_id:\n default: -1\n hidden: true\n staff_category_id:\n default: -1\n hidden: true\n uncategorized_category_id:\n default: -1\n hidden: true\n default_composer_category:\n client: true\n type: category\n default: ""\n validator: "DefaultComposerCategoryValidator"\n area: "posts_and_topics"\n\n notify_about_reviewable_item_after:\n type: float\n default: 48\n\n use_site_small_logo_as_system_avatar:\n default: true\n area: "site_admin"\n\n enable_listing_suspended_users_on_search:\n default: false\n area: "site_admin"\n\n disable_system_edit_notifications:\n default: true\n area: "notifications"\n\n disable_category_edit_notifications:\n default: false\n area: "notifications"\n\n disable_tags_edit_notifications:\n default: false\n area: "notifications"\n\n notification_consolidation_threshold:\n default: 3\n min: 0\n area: "notifications"\n\n likes_notification_consolidation_window_mins:\n default: 120\n min: 1\n area: "notifications"\n\n linked_notification_consolidation_window_mins:\n default: 120\n min: 1\n area: "notifications"\n\n delete_drafts_older_than_n_days:\n default: 180\n max: 36500\n area: "posts_and_topics"\n\n delete_merged_stub_topics_after_days:\n default: 7\n min: -1\n area: "posts_and_topics"\n\n backup_drafts_to_pm_length:\n default: 0\n hidden: true\n\n view_user_route:\n default: "summary"\n hidden: true\n client: true\n\n tos_topic_id:\n default: -1\n hidden: true\n guidelines_topic_id:\n default: -1\n hidden: true\n privacy_topic_id:\n default: -1\n hidden: true\n welcome_topic_id:\n default: -1\n hidden: true\n admin_quick_start_topic_id:\n default: -1\n hidden: true\n client: true\n\n bootstrap_mode_min_users:\n default: 50\n client: true\n max: 5000\n area: "site_admin"\n\n bootstrap_mode_enabled:\n default: false\n client: true\n hidden: true\n\n automatically_unpin_topics:\n default: true\n client: true\n area: "posts_and_topics"\n\n read_time_word_count:\n default: 500\n client: true\n locale_default:\n ja: 350\n zh_CN: 350\n zh_TW: 350\n area: "posts_and_topics"\n\n topic_page_title_includes_category:\n default: true\n client: true\n area: "posts_and_topics"\n\n native_app_install_banner_ios:\n default: false\n area: "site_admin"\n\n native_app_install_banner_android:\n default: false\n area: "site_admin"\n\n ios_app_id:\n default: "1173672076"\n hidden: true\n\n android_app_id:\n default: "com.discourse"\n hidden: true\n\n pwa_display_browser_regex:\n default: "a^"\n hidden: true\n\n app_association_android:\n default: ""\n textarea: true\n area: "site_admin"\n\n app_association_ios:\n default: ""\n textarea: true\n area: "site_admin"\n\n share_anonymized_statistics:\n default: true\n area: "site_admin"\n\n enable_powered_by_discourse:\n default: true\n client: true\n area: "site_admin"\n\n auto_handle_queued_age:\n default: 60\n min: 0\n\n penalty_step_hours:\n default: "24|72|168|720"\n type: "list"\n list_type: "compact"\n\n penalty_include_post_message:\n default: false\n client: true\n\n svg_icon_subset:\n default: ""\n type: "list"\n list_type: "compact"\n client: true\n area: "site_admin"\n\n always_include_topic_excerpts:\n default: false\n hidden: true\n\n allow_bulk_invite:\n default: true\n client: true\n area: "users"\n\n max_bulk_invites:\n default: 50000\n hidden: true\n\n skip_email_bulk_invites:\n default: false\n hidden: true\n\n max_api_invites:\n default: 200\n hidden: true\n\n overridden_robots_txt:\n default: ""\n hidden: true\n show_category_definitions_in_topic_lists:\n default: false\n hidden: true\n client: true\n\n create_revision_on_bulk_topic_moves:\n default: true\n area: "posts_and_topics"\n\n allow_changing_staged_user_tracking:\n default: false\n area: "users"\n\n use_polymorphic_bookmarks:\n client: true\n default: true\n hidden: true\n\n splash_screen:\n default: true\n area: "interface"\n\n suggest_weekends_in_date_pickers:\n client: true\n default: true\n\n show_bottom_topic_map:\n client: true\n default: true\n area: "posts_and_topics"\n\n show_topic_map_in_topics_without_replies:\n client: true\n default: true\n area: "posts_and_topics"\n\n enable_welcome_banner:\n client: true\n default: true\n\nuser_preferences:\n default_email_digest_frequency:\n enum: "DigestEmailSiteSetting"\n default: 10080\n area: "user_defaults"\n default_include_tl0_in_digests:\n default: false\n area: "user_defaults"\n default_email_level:\n enum: "EmailLevelSiteSetting"\n default: 1\n area: "user_defaults"\n default_email_messages_level:\n enum: "EmailLevelSiteSetting"\n default: 0\n area: "user_defaults"\n default_email_mailing_list_mode:\n default: false\n area: "user_defaults"\n default_email_mailing_list_mode_frequency:\n enum: "MailingListModeSiteSetting"\n default: 1\n area: "user_defaults"\n disable_mailing_list_mode:\n default: true\n client: true\n area: "user_defaults"\n default_email_previous_replies:\n enum: "PreviousRepliesSiteSetting"\n default: 2\n area: "user_defaults"\n default_email_in_reply_to:\n default: false\n area: "user_defaults"\n default_hide_profile:\n default: false\n area: "user_defaults"\n default_hide_presence:\n default: false\n area: "user_defaults"\n default_other_new_topic_duration_minutes:\n enum: "NewTopicDurationSiteSetting"\n default: 2880\n area: "user_defaults"\n default_other_auto_track_topics_after_msecs:\n enum: "AutoTrackDurationSiteSetting"\n default: 300000\n area: "user_defaults"\n default_other_notification_level_when_replying:\n enum: "NotificationLevelWhenReplyingSiteSetting"\n default: 2\n area: "notifications"\n default_other_external_links_in_new_tab:\n default: false\n area: "user_defaults"\n default_other_enable_quoting:\n default: true\n area: "user_defaults"\n default_other_enable_defer:\n default: false\n area: "user_defaults"\n default_other_enable_smart_lists:\n default: true\n area: "user_defaults"\n default_other_dynamic_favicon:\n default: false\n area: "user_defaults"\n default_other_skip_new_user_tips:\n default: false\n area: "user_defaults"\n default_other_like_notification_frequency:\n enum: "LikeNotificationFrequencySiteSetting"\n default: 1\n area: "notifications"\n\n default_topics_automatic_unpin:\n default: true\n client: true\n area: "user_defaults"\n\n default_categories_watching:\n type: category_list\n default: ""\n area: "user_defaults"\n default_categories_tracking:\n type: category_list\n default: ""\n area: "user_defaults"\n default_categories_muted:\n type: category_list\n default: ""\n area: "user_defaults"\n default_categories_watching_first_post:\n type: category_list\n default: ""\n area: "user_defaults"\n default_categories_normal:\n type: category_list\n default: ""\n area: "user_defaults"\n mute_all_categories_by_default:\n default: false\n client: true\n area: "user_defaults"\n\n default_tags_watching:\n type: tag_list\n default: ""\n area: "user_defaults"\n default_tags_tracking:\n type: tag_list\n default: ""\n area: "user_defaults"\n default_tags_muted:\n type: tag_list\n default: ""\n area: "user_defaults"\n default_tags_watching_first_post:\n type: tag_list\n default: ""\n area: "user_defaults"\n\n default_text_size:\n type: enum\n default: normal\n client: true\n choices: "DefaultTextSizeSetting.values"\n area: "fonts"\n\n default_title_count_mode:\n type: enum\n default: notifications\n choices:\n - notifications\n - contextual\n area: "user_defaults"\n enable_offline_indicator:\n default: false\n client: true\n area: "user_defaults"\n default_sidebar_link_to_filtered_list:\n default: false\n area: "navigation"\n default_sidebar_show_count_of_new_items:\n default: false\n area: "navigation"\n\napi:\n retain_web_hook_events_period_days:\n default: 30\n max: 36500\n retain_web_hook_events_aggregate_days:\n default: 720\n max: 36500\n retry_web_hook_events:\n default: false\n api_key_last_used_epoch:\n default: "" # Value is added in a migration\n hidden: true\n revoke_api_keys_unused_days:\n default: 180\n max: 36500\n revoke_api_keys_maxlife_days:\n default: 0\n max: 36500\n hidden: true\n\nuser_api:\n allow_user_api_key_scopes:\n default: "read|write|message_bus|push|notifications|session_info|one_time_password"\n type: list\n allow_user_api_key_client_scopes:\n default: ""\n type: list\n hidden: true\n push_api_secret_key:\n default: ""\n hidden: true\n min_trust_level_for_user_api_key:\n default: 0\n enum: "TrustLevelSetting"\n hidden: true\n user_api_key_allowed_groups:\n default: "1|2|10" # auto group admins, moderators, trust_level_0\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n allowed_user_api_push_urls:\n default: ""\n type: list\n hidden: true\n allowed_user_api_auth_redirects:\n default: "https://api.discourse.org/api/auth_redirect|discourse://auth_redirect"\n type: list\n revoke_user_api_keys_unused_days:\n default: 180\n max: 36500\n revoke_user_api_keys_maxlife_days:\n default: 0\n max: 36500\n hidden: true\n unused_registered_user_api_key_clients_days:\n default: 30\n max: 36500\n hidden: true\n create_user_api_key_client_ip_rate_limit_override_ips:\n default: ""\n type: list\n hidden: true\n\ntags:\n tagging_enabled:\n client: true\n default: true\n refresh: true\n area: "categories_and_tags"\n tag_style:\n client: true\n type: enum\n default: "simple"\n choices:\n - simple\n - bullet\n - box\n preview: '<div class="discourse-tags"><span class="discourse-tag {{value}}">tag1</span><span class="discourse-tag {{value}}">tag2</span></div>'\n area: "categories_and_tags"\n max_tags_per_topic:\n default: 5\n client: true\n area: "categories_and_tags"\n enable_max_tags_per_email_subject:\n default: false\n client: true\n area: "categories_and_tags"\n max_tags_per_email_subject:\n default: 5\n client: true\n min: 0\n area: "categories_and_tags"\n max_tag_length:\n default: 20\n client: true\n area: "categories_and_tags"\n min_trust_to_create_tag:\n default: "3"\n type: enum\n enum: "TrustLevelAndStaffSetting"\n hidden: true\n create_tag_allowed_groups:\n default: "1|2|13" # auto group admins, moderators, trust_level_3\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n area: "group_permissions"\n min_trust_level_to_tag_topics:\n default: "0"\n enum: "TrustLevelAndStaffSetting"\n client: true\n hidden: true\n tag_topic_allowed_groups:\n default: "1|2|10" # auto group admins, moderators, trust_level_0\n mandatory_values: "1|2" # auto group admins, moderators\n type: group_list\n allow_any: false\n refresh: true\n client: true\n area: "group_permissions"\n max_tag_search_results:\n client: true\n default: 5\n min: 1\n area: "categories_and_tags"\n max_tags_in_filter_list:\n client: true\n default: 30\n min: 1\n refresh: true\n area: "categories_and_tags"\n tags_sort_alphabetically:\n client: true\n default: false\n refresh: true\n area: "categories_and_tags"\n tags_listed_by_group:\n client: true\n default: false\n area: "categories_and_tags"\n pm_tags_allowed_for_groups:\n type: group_list\n list_type: compact\n default: ""\n allow_any: false\n refresh: true\n area: "group_permissions"\n suppress_overlapping_tags_in_list:\n default: false\n client: true\n area: "categories_and_tags"\n remove_muted_tags_from_latest:\n client: true\n type: enum\n default: always\n enum: RemoveMutedTagsFromLatestSiteSetting\n area: "categories_and_tags"\n watched_precedence_over_muted:\n client: true\n default: false\n area: "categories_and_tags"\n\n force_lowercase_tags:\n default: true\n client: true\n area: "categories_and_tags"\n create_post_for_category_and_tag_changes:\n default: false\n area: "categories_and_tags"\n automatically_clean_unused_tags:\n default: false\n area: "categories_and_tags"\n\ndashboard:\n dashboard_hidden_reports:\n client: true\n type: list\n list_type: compact\n default: ""\n allow_any: true\n area: "reports"\n dashboard_visible_tabs:\n client: true\n type: list\n list_type: compact\n default: "moderation|security|reports|features"\n allow_any: false\n choices:\n - moderation\n - security\n - reports\n - features\n area: "reports"\n dashboard_general_tab_activity_metrics:\n client: true\n type: list\n list_type: compact\n default: "page_view_total_reqs|visits|time_to_first_response|likes|flags|user_to_user_private_messages_with_replies"\n allow_any: false\n choices:\n - page_view_total_reqs\n - visits\n - time_to_first_response\n - likes\n - flags\n - user_to_user_private_messages_with_replies\n - signups\n area: "reports"\n verbose_user_stat_count_logging:\n hidden: true\n default: false\n hot_topics_gravity:\n hidden: true\n default: 1.2\n hot_topics_recent_days:\n hidden: true\n default: 7\n admin_allow_filter_untranslated_text:\n hidden: true\n default: false\n client: true\n\nexperimental:\n experimental_auto_grid_images:\n default: false\n client: true\n experimental_rename_faq_to_guidelines:\n default: false\n hidden: true\n client: true\n experimental_hashtag_search_result_limit:\n default: 20\n client: true\n hidden: true\n experimental_form_templates:\n client: true\n default: false\n show_preview_for_form_templates:\n client: true\n default: true\n experimental_new_new_view_groups:\n client: true\n type: group_list\n list_type: compact\n default: ""\n allow_any: false\n refresh: true\n area: "group_permissions|navigation"\n glimmer_post_stream_mode_auto_groups:\n client: true\n type: group_list\n list_type: compact\n default: ""\n allow_any: false\n refresh: true\n glimmer_post_stream_mode:\n client: true\n type: enum\n choices:\n - disabled\n - auto\n - enabled\n default: disabled\n enable_rich_text_paste:\n client: true\n default: true\n google_oauth2_hd_groups:\n default: false\n validator: GoogleOauth2HdGroupsValidator\n lazy_load_categories_groups:\n default: ""\n type: group_list\n list_type: compact\n area: "group_permissions"\n use_overhauled_theme_color_palette:\n default: false\n hidden: true\n client: true\n rich_editor:\n client: true\n default: false\n hidden: true\n experimental_content_localization:\n client: true\n default: false\n | dataset_sample\yaml\ruby\site_settings.yml | site_settings.yml | YAML | 92,419 | 0.75 | 0.003519 | 0.014164 | python-kit | 89 | 2023-10-16T20:38:39.668419 | MIT | false | 96b29850a508135d2e83c35b7fe4dfba |
prelude: |\n #!/usr/bin/ruby\n\n wc_input_base = <<EOS\n Subject: Re: Who was Izchak Miller?\n From: "Jane D. Anonymous" <nobody@yale.edu>\n Date: 1996/04/28\n Message-Id: <4lv7bc$oh@news.ycc.yale.edu>\n References: <317C405E.5DFA@panix.com> <4lk6vl$gde@ns.oar.net>\n To: 75176.2330@compuserve.com\n Content-Type: text/plain; charset=us-ascii\n Organization: Yale University\n X-Url: news:4lk6vl$gde@ns.oar.net\n Mime-Version: 1.0\n Newsgroups: rec.games.roguelike.nethack\n X-Mailer: Mozilla 1.1N (Macintosh; I; 68K)\n\n Hello there, Izchak Miller was my father. When I was younger I spent\n many a night, hunched over the keyboard with a cup of tea, playing\n nethack with him and my brother. my dad was a philosopher with a strong\n weakness for fantasy/sci fi. I remember when he started to get involved\n with the Nethack team- my brother's Dungeons and Dragons monster book\n found a regular place beside my dad's desk. it's nice to see him living\n on in the game he loved so much :-).\n Tamar Miller\n\n The following is a really long word of 5000 characters:\n\n wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww\n EOS\n\n # prepare 'wc.input'\n\n def prepare_wc_input(wcbase)\n wcinput = File.join(File.dirname($0), 'wc.input')\n unless FileTest.exist?(wcinput)\n data = wcbase.dup\n 13.times{\n data << data\n }\n File.write(wcinput, data)\n end\n at_exit {File.unlink(wcinput) rescue nil}\n end\n\n prepare_wc_input(wc_input_base)\n\nbenchmark:\n so_count_words: |\n # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $\n # http://www.bagley.org/~doug/shootout/\n # with help from Paul Brannan\n\n nl = nw = nc = 0\n File.open(File.join(File.dirname($0), 'wc.input'), 'rb') do |input|\n while tmp = input.read(4096)\n data = tmp << (input.gets || "")\n nc += data.length\n nl += data.count("\n")\n ((data.strip! || data).tr!("\n", " ") || data).squeeze!\n nw += data.count(" ") + 1\n end\n end\n # STDERR.puts "#{nl} #{nw} #{nc}"\n\nloop_count: 1\n | dataset_sample\yaml\ruby\so_count_words.yml | so_count_words.yml | YAML | 7,118 | 0.95 | 0.045455 | 0.107143 | node-utils | 166 | 2024-04-12T09:23:49.239057 | MIT | false | 52da6709d196128f8ac952c108f5c675 |
prelude: |\n bm_so_fasta = <<'EOS'\n # The Computer Language Shootout\n # http://shootout.alioth.debian.org/\n # Contributed by Sokolov Yura\n\n $last = 42.0\n def gen_random(max, im=139968, ia=3877, ic=29573)\n (max * ($last = ($last * ia + ic) % im)) / im\n end\n\n alu =\n "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+\n "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+\n "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+\n "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+\n "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+\n "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+\n "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"\n\n iub = [\n ["a", 0.27],\n ["c", 0.12],\n ["g", 0.12],\n ["t", 0.27],\n\n ["B", 0.02],\n ["D", 0.02],\n ["H", 0.02],\n ["K", 0.02],\n ["M", 0.02],\n ["N", 0.02],\n ["R", 0.02],\n ["S", 0.02],\n ["V", 0.02],\n ["W", 0.02],\n ["Y", 0.02],\n ]\n homosapiens = [\n ["a", 0.3029549426680],\n ["c", 0.1979883004921],\n ["g", 0.1975473066391],\n ["t", 0.3015094502008],\n ]\n\n def make_repeat_fasta(id, desc, src, n)\n puts ">#{id} #{desc}"\n v = nil\n width = 60\n l = src.length\n s = src * ((n / l) + 1)\n s.slice!(n, l)\n puts(s.scan(/.{1,#{width}}/).join("\n"))\n end\n\n def make_random_fasta(id, desc, table, n)\n puts ">#{id} #{desc}"\n rand, v = nil,nil\n width = 60\n chunk = 1 * width\n prob = 0.0\n table.each{|v| v[1]= (prob += v[1])}\n for i in 1..(n/width)\n puts((1..width).collect{\n rand = gen_random(1.0)\n table.find{|v| v[1]>rand}[0]\n }.join)\n end\n if n%width != 0\n puts((1..(n%width)).collect{\n rand = gen_random(1.0)\n table.find{|v| v[1]>rand}[0]\n }.join)\n end\n end\n\n\n n = (ARGV[0] or 250_000).to_i\n\n make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)\n make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)\n make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)\n EOS\nbenchmark:\n - name: so_k_nucleotide\n prelude: |\n script = File.join(File.dirname($0), 'bm_so_fasta.rb')\n File.write(script, bm_so_fasta)\n\n def prepare_fasta_output n\n filebase = File.join(File.dirname($0), 'fasta.output')\n script = File.join(File.dirname($0), 'bm_so_fasta.rb')\n file = "#{filebase}.#{n}"\n\n unless FileTest.exist?(file)\n STDERR.puts "preparing #{file}"\n\n open(file, 'w'){|f|\n ARGV[0] = n\n $stdout = f\n load script\n $stdout = STDOUT\n }\n end\n end\n prepare_fasta_output(100_000)\n script: |\n # The Computer Language Shootout\n # http://shootout.alioth.debian.org\n #\n # contributed by jose fco. gonzalez\n # modified by Sokolov Yura\n\n seq = String.new\n\n def frecuency( seq,length )\n n, table = seq.length - length + 1, Hash.new(0)\n f, i = nil, nil\n (0 ... length).each do |f|\n (f ... n).step(length) do |i|\n table[seq[i,length]] += 1\n end\n end\n [n,table]\n\n end\n\n def sort_by_freq( seq,length )\n n,table = frecuency( seq,length )\n a, b, v = nil, nil, nil\n table.sort{|a,b| b[1] <=> a[1]}.each do |v|\n puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]\n end\n puts\n end\n\n def find_seq( seq,s )\n n,table = frecuency( seq,s.length )\n puts "#{table[s].to_s}\t#{s.upcase}"\n end\n\n input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')\n\n line = input.gets while line !~ /^>THREE/\n line = input.gets\n\n while (line !~ /^>/) & line do\n seq << line.chomp\n line = input.gets\n end\n\n [1,2].each {|i| sort_by_freq( seq,i ) }\n\n %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }\n loop_count: 1\n | dataset_sample\yaml\ruby\so_k_nucleotide.yml | so_k_nucleotide.yml | YAML | 4,019 | 0.95 | 0.070968 | 0.06015 | vue-tools | 174 | 2023-08-08T13:29:51.719663 | BSD-3-Clause | false | 0378638d452282eebd6c567a35a948a0 |
prelude: |\n bm_so_fasta = <<'EOS'\n # The Computer Language Shootout\n # http://shootout.alioth.debian.org/\n # Contributed by Sokolov Yura\n\n $last = 42.0\n def gen_random(max, im=139968, ia=3877, ic=29573)\n (max * ($last = ($last * ia + ic) % im)) / im\n end\n\n alu =\n "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+\n "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+\n "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+\n "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+\n "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+\n "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+\n "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"\n\n iub = [\n ["a", 0.27],\n ["c", 0.12],\n ["g", 0.12],\n ["t", 0.27],\n\n ["B", 0.02],\n ["D", 0.02],\n ["H", 0.02],\n ["K", 0.02],\n ["M", 0.02],\n ["N", 0.02],\n ["R", 0.02],\n ["S", 0.02],\n ["V", 0.02],\n ["W", 0.02],\n ["Y", 0.02],\n ]\n homosapiens = [\n ["a", 0.3029549426680],\n ["c", 0.1979883004921],\n ["g", 0.1975473066391],\n ["t", 0.3015094502008],\n ]\n\n def make_repeat_fasta(id, desc, src, n)\n puts ">#{id} #{desc}"\n v = nil\n width = 60\n l = src.length\n s = src * ((n / l) + 1)\n s.slice!(n, l)\n puts(s.scan(/.{1,#{width}}/).join("\n"))\n end\n\n def make_random_fasta(id, desc, table, n)\n puts ">#{id} #{desc}"\n rand, v = nil,nil\n width = 60\n chunk = 1 * width\n prob = 0.0\n table.each{|v| v[1]= (prob += v[1])}\n for i in 1..(n/width)\n puts((1..width).collect{\n rand = gen_random(1.0)\n table.find{|v| v[1]>rand}[0]\n }.join)\n end\n if n%width != 0\n puts((1..(n%width)).collect{\n rand = gen_random(1.0)\n table.find{|v| v[1]>rand}[0]\n }.join)\n end\n end\n\n\n n = (ARGV[0] or 250_000).to_i\n\n make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)\n make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)\n make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)\n EOS\nbenchmark:\n - name: so_reverse_complement\n prelude: |\n script = File.join(File.dirname($0), 'bm_so_fasta.rb')\n File.write(script, bm_so_fasta)\n\n def prepare_fasta_output n\n filebase = File.join(File.dirname($0), 'fasta.output')\n script = File.join(File.dirname($0), 'bm_so_fasta.rb')\n file = "#{filebase}.#{n}"\n\n unless FileTest.exist?(file)\n STDERR.puts "preparing #{file}"\n\n open(file, 'w'){|f|\n ARGV[0] = n\n $stdout = f\n load script\n $stdout = STDOUT\n }\n end\n end\n prepare_fasta_output(2_500_000)\n script: |\n # The Great Computer Language Shootout\n # http://shootout.alioth.debian.org/\n #\n # Contributed by Peter Bjarke Olsen\n # Modified by Doug King\n\n seq=Array.new\n\n def revcomp(seq)\n seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')\n stringlen=seq.length\n 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}\n end\n\n input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')\n\n while input.gets\n if $_ =~ />/\n if seq.length != 0\n revcomp(seq.join)\n seq=Array.new\n end\n puts $_\n else\n $_.sub(/\n/,'')\n seq.push $_\n end\n end\n revcomp(seq.join)\n loop_count: 1\n | dataset_sample\yaml\ruby\so_reverse_complement.yml | so_reverse_complement.yml | YAML | 3,495 | 0.95 | 0.072993 | 0.066116 | python-kit | 88 | 2025-05-13T22:56:36.984317 | GPL-3.0 | false | f5c1c122347cd760dfc0d3eda7382e8f |
# Number of days of inactivity before an issue becomes stale\ndaysUntilStale: 90\n# Number of days of inactivity before a stale issue is closed\ndaysUntilClose: 7\n# Issues with these labels will never be considered stale\nexemptLabels:\n - pinned\n - security\n - With reproduction steps\n - attached PR\n - regression\n - release blocker\n# Issues on a milestone will never be considered stale\nexemptMilestones: true\n# Label to use when marking an issue as stale\nstaleLabel: stale\n# Comment to post when marking an issue as stale. Set to `false` to disable\nmarkComment: >\n This issue has been automatically marked as stale because it has not been commented on for at least three months.\n\n The resources of the Rails team are limited, and so we are asking for your help.\n\n If you can still reproduce this error on the `8-0-stable` branch or on `main`,\n please reply with all of the information you have about it in order to keep the issue open.\n\n Thank you for all your contributions.\n# Comment to post when closing a stale issue. Set to `false` to disable\ncloseComment: false\n# Limit to only `issues` or `pulls`\nonly: issues\n | dataset_sample\yaml\ruby\stale.yml | stale.yml | YAML | 1,126 | 0.8 | 0.1 | 0.296296 | react-lib | 948 | 2024-01-28T01:59:42.294276 | Apache-2.0 | false | 016dcbf2f6a4788c4728857032864c54 |
test:\n service: Disk\n root: <%= Rails.root.join("tmp/storage") %>\n\nlocal:\n service: Disk\n root: <%= Rails.root.join("storage") %>\n\n# Use rails credentials:edit to set the AWS secrets (as aws:access_key_id|secret_access_key)\n# amazon:\n# service: S3\n# access_key_id: <%= Rails.application.credentials.dig(:aws, :access_key_id) %>\n# secret_access_key: <%= Rails.application.credentials.dig(:aws, :secret_access_key) %>\n# region: us-east-1\n# bucket: your_own_bucket\n\n# Remember not to checkin your GCS keyfile to a repository\n# google:\n# service: GCS\n# project: your_project\n# credentials: <%= Rails.root.join("path/to/gcs.keyfile") %>\n# bucket: your_own_bucket\n\n# Use rails credentials:edit to set the Azure Storage secret (as azure_storage:storage_access_key)\n# microsoft:\n# service: AzureStorage\n# storage_account_name: your_account_name\n# storage_access_key: <%= Rails.application.credentials.dig(:azure_storage, :storage_access_key) %>\n# container: your_container_name\n\n# mirror:\n# service: Mirror\n# primary: local\n# mirrors: [ amazon, google, microsoft ]\n | dataset_sample\yaml\ruby\storage.yml | storage.yml | YAML | 1,093 | 0.8 | 0 | 0.793103 | vue-tools | 701 | 2024-03-26T03:24:44.186549 | MIT | false | 1df46a81af448338bf0103361f6d5d09 |
Lint/Debugger: # Remove any `binding.pry`\n Enabled: true\n Exclude: []\n\nRSpec/Focus: # Require full spec run on CI\n Enabled: true\n Exclude: []\n\nRails/Output: # Remove any `puts` debugging\n inherit_mode:\n merge:\n - Include\n Enabled: true\n Exclude: []\n Include:\n - spec/**/*.rb\n\nRails/FindEach: # Using `each` could impact performance, use `find_each`\n Enabled: true\n Exclude: []\n\nRails/UniqBeforePluck: # Require `uniq.pluck` and not `pluck.uniq`\n Enabled: true\n Exclude: []\n | dataset_sample\yaml\ruby\strict.yml | strict.yml | YAML | 496 | 0.8 | 0 | 0 | node-utils | 603 | 2024-05-11T16:42:49.895155 | Apache-2.0 | false | 5903fb344e09473d4b3179ba25ea8237 |
prelude: |\n str1 = [*"a".."m",*"N".."Z",*"0".."9"].join("")\n str10 = str1 * 10\n str100 = str10 * 10\n str1000 = str100 * 10\nbenchmark:\n capitalize-1: str1.capitalize\n capitalize-10: str10.capitalize\n capitalize-100: str100.capitalize\n capitalize-1000: str1000.capitalize\n | dataset_sample\yaml\ruby\string_capitalize.yml | string_capitalize.yml | YAML | 278 | 0.7 | 0 | 0 | vue-tools | 50 | 2023-11-05T03:07:32.119001 | BSD-3-Clause | false | d6b1038984c61282baf131b5064c3c0b |
prelude: |\n lstr1 = [*"a".."z",*"0".."9"].join("")\n lstr10 = lstr1 * 10\n lstr100 = lstr10 * 10\n lstr1000 = lstr100 * 10\n lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")\n lnonascii10 = lnonascii1 * 10\n lnonascii100 = lnonascii10 * 10\n lnonascii1000 = lnonascii100 * 10\n ustr1 = [*"A".."Z",*"0".."9"].join("")\n ustr10 = ustr1 * 10\n ustr100 = ustr10 * 10\n ustr1000 = ustr100 * 10\n unonascii1 = [*"\u{c0}".."\u{df}"].join("")\n unonascii10 = unonascii1 * 10\n unonascii100 = unonascii10 * 10\n unonascii1000 = unonascii100 * 10\nbenchmark:\n casecmp-1: lstr1.casecmp(ustr1)\n casecmp-10: lstr10.casecmp(ustr10)\n casecmp-100: lstr100.casecmp(ustr100)\n casecmp-1000: lstr1000.casecmp(ustr1000)\n casecmp-nonascii1: lnonascii1.casecmp(unonascii1)\n casecmp-nonascii10: lnonascii10.casecmp(unonascii10)\n casecmp-nonascii100: lnonascii100.casecmp(unonascii100)\n casecmp-nonascii1000: lnonascii1000.casecmp(unonascii1000)\n | dataset_sample\yaml\ruby\string_casecmp.yml | string_casecmp.yml | YAML | 924 | 0.7 | 0 | 0 | react-lib | 664 | 2024-02-02T22:18:45.275735 | BSD-3-Clause | false | 624ca8d428efda769e49eb86a193d51e |
prelude: |\n lstr1 = [*"a".."z",*"0".."9"].join("")\n lstr10 = lstr1 * 10\n lstr100 = lstr10 * 10\n lstr1000 = lstr100 * 10\n lnonascii1 = [*"\u{e0}".."\u{ff}"].join("")\n lnonascii10 = lnonascii1 * 10\n lnonascii100 = lnonascii10 * 10\n lnonascii1000 = lnonascii100 * 10\n ustr1 = [*"A".."Z",*"0".."9"].join("")\n ustr10 = ustr1 * 10\n ustr100 = ustr10 * 10\n ustr1000 = ustr100 * 10\n unonascii1 = [*"\u{c0}".."\u{df}"].join("")\n unonascii10 = unonascii1 * 10\n unonascii100 = unonascii10 * 10\n unonascii1000 = unonascii100 * 10\nbenchmark:\n casecmp_p-1: lstr1.casecmp?(ustr1)\n casecmp_p-10: lstr10.casecmp?(ustr10)\n casecmp_p-100: lstr100.casecmp?(ustr100)\n casecmp_p-1000: lstr1000.casecmp?(ustr1000)\n casecmp_p-nonascii1: lnonascii1.casecmp?(unonascii1)\n casecmp_p-nonascii10: lnonascii10.casecmp?(unonascii10)\n casecmp_p-nonascii100: lnonascii100.casecmp?(unonascii100)\n casecmp_p-nonascii1000: lnonascii1000.casecmp?(unonascii1000)\n | dataset_sample\yaml\ruby\string_casecmp_p.yml | string_casecmp_p.yml | YAML | 948 | 0.7 | 0 | 0 | react-lib | 175 | 2023-10-06T23:51:38.317397 | MIT | false | 2e02f5744118c23471f3640c9257c527 |
prelude: |\n CHUNK = "a" * 64\n UCHUNK = "é" * 32\n SHORT = "a" * (GC::INTERNAL_CONSTANTS[:BASE_SLOT_SIZE] / 2)\n LONG = "a" * (GC::INTERNAL_CONSTANTS[:BASE_SLOT_SIZE] * 2)\n GC.disable # GC causes a lot of variance\nbenchmark:\n binary_concat_7bit: |\n buffer = String.new(capacity: 4096, encoding: Encoding::BINARY)\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n utf8_concat_7bit: |\n buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n buffer << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK << CHUNK\n utf8_concat_UTF8: |\n buffer = String.new(capacity: 4096, encoding: Encoding::UTF_8)\n buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK\n buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK\n buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK\n buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK\n buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK\n buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK\n buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK\n buffer << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK << UCHUNK\n interpolation: |\n buffer = "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \\n "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \\n "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \\n "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \\n "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \\n "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \\n "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \\n "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}" \\n "#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}#{CHUNK}"\n interpolation_same_heap: |\n buffer = "#{SHORT}#{SHORT}"\n interpolation_switching_heaps: |\n buffer = "#{SHORT}#{LONG}"\n | dataset_sample\yaml\ruby\string_concat.yml | string_concat.yml | YAML | 3,488 | 0.8 | 0 | 0 | react-lib | 364 | 2024-03-16T00:50:30.255306 | Apache-2.0 | false | 929004a2373a72b1bcf4b1143daa9073 |
prelude: |\n str1 = [*"A".."Z",*"0".."9"].join("")\n str10 = str1 * 10\n str100 = str10 * 10\n str1000 = str100 * 10\n nonascii1 = [*"\u{c0}".."\u{df}"].join("")\n nonascii10 = nonascii1 * 10\n nonascii100 = nonascii10 * 10\n nonascii1000 = nonascii100 * 10\nbenchmark:\n downcase-1: str1.upcase\n downcase-10: str10.upcase\n downcase-100: str100.upcase\n downcase-1000: str1000.upcase\n downcase-nonascii1: nonascii1.downcase\n downcase-nonascii10: nonascii10.downcase\n downcase-nonascii100: nonascii100.downcase\n downcase-nonascii1000: nonascii1000.downcase\n | dataset_sample\yaml\ruby\string_downcase.yml | string_downcase.yml | YAML | 561 | 0.7 | 0 | 0 | node-utils | 723 | 2024-02-11T08:31:20.515342 | GPL-3.0 | false | bdbbd9ef7078402d1d5c6cc5de5dc823 |
prelude: |\n # frozen_string_literal: true\nbenchmark:\n uplus: |\n +"A"\n dup: |\n "A".dup\n | dataset_sample\yaml\ruby\string_dup.yml | string_dup.yml | YAML | 95 | 0.6 | 0 | 0.142857 | node-utils | 533 | 2024-12-22T23:51:05.870644 | BSD-3-Clause | false | d86b60c0af484e5af79d1bece0a00989 |
benchmark:\n fstring_random: |\n i = 0\n str = "same".dup\n while i < 5_000_000\n -(i.to_s.freeze)\n i += 1\n end\n fstring_same: |\n i = 0\n str = "same".dup\n while i < 10_000_000\n -str\n i += 1\n end\nloop_count: 1\n | dataset_sample\yaml\ruby\string_fstring.yml | string_fstring.yml | YAML | 250 | 0.7 | 0.125 | 0 | vue-tools | 552 | 2023-12-09T01:27:39.999784 | MIT | false | 178c975192ae3da35d8f8d8b9540cf1b |
prelude: |\n # frozen_string_literal: true\n STR = ((("a" * 31) + "<") * 1000).freeze\n STR_UNICODE = ((("a" * 30) + "\u2028") * 1000).freeze\n ESCAPED_CHARS_BINARY = {\n "\u2028".b => '\u2028'.b,\n "\u2029".b => '\u2029'.b,\n ">".b => '\u003e'.b.freeze,\n "<".b => '\u003c'.b.freeze,\n "&".b => '\u0026'.b.freeze,\n }\n BINARY_PATTERN = Regexp.union(ESCAPED_CHARS_BINARY.keys)\n\n ESCAPED_CHARS = {\n "\u2028" => '\u2028',\n "\u2029" => '\u2029',\n ">" => '\u003e',\n "<" => '\u003c',\n "&" => '\u0026',\n }\n ESCAPE_PATTERN = Regexp.union(ESCAPED_CHARS.keys)\n\n\nbenchmark:\n escape: |\n str = STR.dup\n str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)\n str\n\n escape_bin: |\n str = STR.b\n str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)\n str.force_encoding(Encoding::UTF_8)\n\n escape_utf8: |\n str = STR_UNICODE.dup\n str.gsub!(ESCAPE_PATTERN, ESCAPED_CHARS)\n str\n\n escape_utf8_bin: |\n str = STR_UNICODE.b\n str.gsub!(BINARY_PATTERN, ESCAPED_CHARS_BINARY)\n str.force_encoding(Encoding::UTF_8)\n | dataset_sample\yaml\ruby\string_gsub.yml | string_gsub.yml | YAML | 1,036 | 0.8 | 0 | 0.027027 | react-lib | 225 | 2025-04-28T01:25:35.789577 | BSD-3-Clause | false | ad3f85cb71adb3ead9a6bd4f28524eaa |
prelude: |\n str1 = [*"a".."z",*"0".."9"].join("")\n str10 = str1 * 10 + ":"\n str100 = str1 * 100 + ":"\n str1000 = str1 * 1000 + ":"\n nonascii1 = [*"\u{e0}".."\u{ff}"].join("")\n nonascii10 = nonascii1 * 10 + ":"\n nonascii100 = nonascii1 * 100 + ":"\n nonascii1000 = nonascii1 * 1000 + ":"\nbenchmark:\n rpartition-1: str1.rpartition(":")\n rpartition-10: str10.rpartition(":")\n rpartition-100: str100.rpartition(":")\n rpartition-1000: str1000.rpartition(":")\n rpartition-nonascii1: nonascii1.rpartition(":")\n rpartition-nonascii10: nonascii10.rpartition(":")\n rpartition-nonascii100: nonascii100.rpartition(":")\n rpartition-nonascii1000: nonascii1000.rpartition(":")\n | dataset_sample\yaml\ruby\string_rpartition.yml | string_rpartition.yml | YAML | 677 | 0.7 | 0 | 0 | node-utils | 795 | 2023-10-24T02:53:54.967671 | MIT | false | 0ed9c0703f7bc6ebf961402a6927c145 |
prelude: |\n long_string = "x"*1000+"-hår"\nbenchmark:\n regexp-short: |\n "x-hår".slice!(/-(.)(.)(.)/, 3)\n regexp-long: |\n long_string.dup.slice!(/-(.)(.)(.)/, 3)\n string-short: |\n "x-hår".slice!("r")\n string-long: |\n long_string.dup.slice!("r")\n | dataset_sample\yaml\ruby\string_slice.yml | string_slice.yml | YAML | 263 | 0.7 | 0 | 0 | awesome-app | 977 | 2025-03-05T21:03:42.881199 | Apache-2.0 | false | 9efeed9aa5616e66df4d6f1087127941 |
prelude: |\n str1 = [*0..5].join(" ") + " "\n str10 = str1 * 10\n str100 = str10 * 10\n str1000 = str100 * 10\nbenchmark:\n to_chars-1: str1.split('')\n to_chars-10: str10.split('')\n to_chars-100: str100.split('')\n to_chars-1000: str1000.split('')\n to_words-1: str1.split(' ')\n to_words-10: str10.split(' ')\n to_words-100: str100.split(' ')\n to_words-1000: str1000.split(' ')\n re_chars-1: str1.split(//)\n re_chars-10: str10.split(//)\n re_chars-100: str100.split(//)\n re_chars-1000: str1000.split(//)\n re_space-1: str1.split(/ /)\n re_space-10: str10.split(/ /)\n re_space-100: str100.split(/ /)\n re_space-1000: str1000.split(/ /)\n | dataset_sample\yaml\ruby\string_split.yml | string_split.yml | YAML | 641 | 0.8 | 0 | 0 | react-lib | 903 | 2025-06-03T16:19:45.092750 | GPL-3.0 | false | d11f3a5316e0872538557ba1b114b568 |
prelude: |\n str1 = [*"A".."M",*"n".."z",*"0".."9"].join("")\n str10 = str1 * 10\n str100 = str10 * 10\n str1000 = str100 * 10\n nonascii1 = [*"\u{c0}".."\u{cf}",*"\u{f0}".."\u{ff}"].join("")\n nonascii10 = nonascii1 * 10\n nonascii100 = nonascii10 * 10\n nonascii1000 = nonascii100 * 10\nbenchmark:\n swapcase-1: str1.swapcase\n swapcase-10: str10.swapcase\n swapcase-100: str100.swapcase\n swapcase-1000: str1000.swapcase\n swapcase-nonascii1: nonascii1.swapcase\n swapcase-nonascii10: nonascii10.swapcase\n swapcase-nonascii100: nonascii100.swapcase\n swapcase-nonascii1000: nonascii1000.swapcase\n | dataset_sample\yaml\ruby\string_swapcase.yml | string_swapcase.yml | YAML | 599 | 0.7 | 0 | 0 | python-kit | 521 | 2024-11-07T09:19:56.812055 | BSD-3-Clause | false | 4fba9e2e3ba2fe92274850b3e632622d |
prelude: |\n str1 = [*"a".."z",*"0".."9"].join("")\n str10 = str1 * 10\n str100 = str10 * 10\n str1000 = str100 * 10\n nonascii1 = [*"\u{e0}".."\u{ff}"].join("")\n nonascii10 = nonascii1 * 10\n nonascii100 = nonascii10 * 10\n nonascii1000 = nonascii100 * 10\nbenchmark:\n upcase-1: str1.upcase\n upcase-10: str10.upcase\n upcase-100: str100.upcase\n upcase-1000: str1000.upcase\n upcase-nonascii1: nonascii1.upcase\n upcase-nonascii10: nonascii10.upcase\n upcase-nonascii100: nonascii100.upcase\n upcase-nonascii1000: nonascii1000.upcase\n | dataset_sample\yaml\ruby\string_upcase.yml | string_upcase.yml | YAML | 537 | 0.7 | 0 | 0 | python-kit | 723 | 2024-09-23T02:06:42.226308 | Apache-2.0 | false | a758fb1fbeb292b3d3e8893a2ea016f8 |
prelude: |\n C = Struct.new(:x) do\n class_eval <<-END\n def r\n #{'x;'*256}\n end\n def w\n #{'self.x = nil;'*256}\n end\n def rm\n m = method(:x)\n #{'m.call;'*256}\n end\n def wm\n m = method(:x=)\n #{'m.call(nil);'*256}\n end\n END\n end\n obj = C.new(nil)\nbenchmark:\n member_reader: "obj.r"\n member_writer: "obj.w"\n member_reader_method: "obj.rm"\n member_writer_method: "obj.wm"\n | dataset_sample\yaml\ruby\struct_accessor.yml | struct_accessor.yml | YAML | 460 | 0.95 | 0.16 | 0.16 | node-utils | 636 | 2023-12-08T20:24:43.364567 | GPL-3.0 | false | 4bdc493f37642f94f883bd508b3c392a |
---\nStyle/ArrayIntersect:\n Enabled: false\n\nStyle/ClassAndModuleChildren:\n Enabled: false\n\nStyle/Documentation:\n Enabled: false\n\nStyle/FormatStringToken:\n AllowedMethods:\n - redirect_with_vary # Route redirects are not token-formatted\n inherit_mode:\n merge:\n - AllowedMethods\n\nStyle/HashAsLastArrayItem:\n Enabled: false\n\nStyle/HashSyntax:\n EnforcedShorthandSyntax: either\n EnforcedStyle: ruby19_no_mixed_keys\n\nStyle/IfUnlessModifier:\n Exclude:\n - '**/*.haml'\n\nStyle/KeywordArgumentsMerging:\n Enabled: false\n\nStyle/NumericLiterals:\n AllowedPatterns:\n - \d{4}_\d{2}_\d{2}_\d{6}\n\nStyle/PercentLiteralDelimiters:\n PreferredDelimiters:\n '%i': ()\n '%w': ()\n\nStyle/RedundantBegin:\n Enabled: false\n\nStyle/RedundantFetchBlock:\n Enabled: false\n\nStyle/RescueStandardError:\n EnforcedStyle: implicit\n\nStyle/SafeNavigationChainLength:\n Enabled: false\n\nStyle/SymbolArray:\n Enabled: false\n\nStyle/TrailingCommaInArrayLiteral:\n EnforcedStyleForMultiline: comma\n\nStyle/TrailingCommaInHashLiteral:\n EnforcedStyleForMultiline: comma\n\nStyle/WordArray:\n MinSize: 3 # Override default of 2\n | dataset_sample\yaml\ruby\style.yml | style.yml | YAML | 1,108 | 0.8 | 0 | 0 | vue-tools | 319 | 2023-11-16T22:18:26.417904 | GPL-3.0 | false | 3c940f884d10fd037f8f414b0bbcb49e |
default: styles/application.scss\ncontrast: styles/contrast.scss\nmastodon-light: styles/mastodon-light.scss\n | dataset_sample\yaml\ruby\themes.yml | themes.yml | YAML | 107 | 0.7 | 0 | 0 | react-lib | 964 | 2025-06-13T13:02:03.006686 | BSD-3-Clause | false | a5515dbdc8d1fe8f2663c5ac43568794 |
prelude: |\n # frozen_string_literal: true\nbenchmark:\n - 'Time.at(0)'\n - 'Time.at(0, 500)'\n - 'Time.at(0, in: "+09:00")'\n - 'Time.at(0, 500, in: "+09:00")'\n | dataset_sample\yaml\ruby\time_at.yml | time_at.yml | YAML | 160 | 0.8 | 0 | 0.142857 | react-lib | 649 | 2024-09-19T08:26:25.595954 | Apache-2.0 | false | 7a8b2843d06434decc3edec9f0546f1e |
benchmark:\n - 'Time.new(2021)'\n - 'Time.new(2021, 8, 22)'\n - 'Time.new(2021, 8, 22, in: "+09:00")'\n | dataset_sample\yaml\ruby\time_new.yml | time_new.yml | YAML | 102 | 0.7 | 0 | 0 | react-lib | 212 | 2023-11-10T10:23:15.230016 | Apache-2.0 | false | c267e561f623321502f5423092569218 |
prelude: |\n require 'time'\n inspect = "2021-08-23 09:57:02 +0900"\n iso8601 = "2021-08-23T09:57:02+09:00"\nbenchmark:\n - Time.iso8601(iso8601)\n - Time.parse(iso8601)\n - Time.parse(inspect)\n - Time.new(iso8601) rescue Time.iso8601(iso8601)\n - Time.new(inspect) rescue Time.parse(inspect)\n | dataset_sample\yaml\ruby\time_parse.yml | time_parse.yml | YAML | 293 | 0.85 | 0 | 0 | node-utils | 981 | 2024-11-08T08:17:37.775878 | BSD-3-Clause | false | 7bef89480b38e93c3b96c4736216012b |
prelude: |\n # frozen_string_literal: true\n time = Time.now\nbenchmark:\n - time.strftime("%FT%T") # 19B\n - time.strftime("%FT%T.%3N") # 23B\n - time.strftime("%FT%T.%6N") # 26B\n | dataset_sample\yaml\ruby\time_strftime.yml | time_strftime.yml | YAML | 183 | 0.8 | 0 | 0.142857 | awesome-app | 572 | 2025-04-17T16:23:18.508092 | BSD-3-Clause | false | e2c2e2bddec25773eaea60f539025673 |
prelude: |\n require 'time'\nbenchmark:\n - Time.strptime("28/Aug/2005:06:54:20 +0000", "%d/%b/%Y:%T %z")\n - Time.strptime("1", "%s")\n - Time.strptime("0 +0100", "%s %z")\n - Time.strptime("0 UTC", "%s %z")\n - Time.strptime("1.5", "%s.%N")\n - Time.strptime("1.000000000001", "%s.%N")\n - Time.strptime("20010203 -0200", "%Y%m%d %z")\n - Time.strptime("20010203 UTC", "%Y%m%d %z")\n - Time.strptime("2018-365", "%Y-%j")\n - Time.strptime("2018-091", "%Y-%j")\n | dataset_sample\yaml\ruby\time_strptime.yml | time_strptime.yml | YAML | 461 | 0.85 | 0 | 0 | python-kit | 156 | 2025-04-18T18:53:57.463858 | BSD-3-Clause | false | 9173c7b8f93c21bf2305ec6cd9608546 |
prelude: |\n # frozen_string_literal\n unless Time.method_defined?(:xmlschema)\n class Time\n def xmlschema(fraction_digits=0)\n fraction_digits = fraction_digits.to_i\n s = strftime("%FT%T")\n if fraction_digits > 0\n s << strftime(".%#{fraction_digits}N")\n end\n s << (utc? ? 'Z' : strftime("%:z"))\n end\n end\n end\n time = Time.now\n utc_time = Time.now.utc\n fraction_sec = Time.at(123456789.quo(9999999999)).getlocal("+09:00")\n future_time = Time.utc(10000)\nbenchmark:\n - time.xmlschema\n - utc_time.xmlschema\n - time.xmlschema(6)\n - utc_time.xmlschema(6)\n - time.xmlschema(9)\n - utc_time.xmlschema(9)\n - fraction_sec.xmlschema(10)\n - future_time.xmlschema\n | dataset_sample\yaml\ruby\time_xmlschema.yml | time_xmlschema.yml | YAML | 723 | 0.95 | 0.111111 | 0.037037 | awesome-app | 333 | 2025-03-05T13:25:35.797482 | Apache-2.0 | false | ef42cd144f8760b89778d4ce07fa4dc2 |
shared:\n deepl:\n api_key: <%= ENV.fetch('DEEPL_API_KEY', nil) %>\n plan: <%= ENV.fetch('DEEPL_PLAN', 'free') %>\n libre_translate:\n api_key: <%= ENV.fetch('LIBRE_TRANSLATE_API_KEY', nil) %>\n endpoint: <%= ENV.fetch('LIBRE_TRANSLATE_ENDPOINT', nil) %>\n | dataset_sample\yaml\ruby\translation.yml | translation.yml | YAML | 263 | 0.7 | 0 | 0 | react-lib | 881 | 2023-08-09T18:31:29.705114 | GPL-3.0 | false | 5ed4948ba52ef45f53a5010a8cc808b7 |
# Configuration file for discourse-translator-bot\n\nfiles:\n - source_path: config/locales/client.en.yml\n destination_path: client.yml\n label: core\n - source_path: config/locales/server.en.yml\n destination_path: server.yml\n label: core\n\n - source_path: public/403.html\n destination_path: error_pages/403.html\n label: core\n\n - source_path: public/422.html\n destination_path: error_pages/422.html\n label: core\n\n - source_path: public/500.html\n destination_path: error_pages/500.html\n label: core\n\n - source_path: public/503.html\n destination_path: error_pages/503.html\n label: core\n\n - source_path: plugins/chat/config/locales/client.en.yml\n destination_path: plugins/chat/client.yml\n label: chat\n - source_path: plugins/chat/config/locales/server.en.yml\n destination_path: plugins/chat/server.yml\n label: chat\n\n - source_path: plugins/discourse-details/config/locales/client.en.yml\n destination_path: plugins/details/client.yml\n label: details\n - source_path: plugins/discourse-details/config/locales/server.en.yml\n destination_path: plugins/details/server.yml\n label: details\n\n - source_path: plugins/discourse-local-dates/config/locales/client.en.yml\n destination_path: plugins/local-dates/client.yml\n label: local-dates\n - source_path: plugins/discourse-local-dates/config/locales/server.en.yml\n destination_path: plugins/local-dates/server.yml\n label: local-dates\n\n - source_path: plugins/discourse-narrative-bot/config/locales/client.en.yml\n destination_path: plugins/narrative-bot/client.yml\n label: narrative-bot\n - source_path: plugins/discourse-narrative-bot/config/locales/server.en.yml\n destination_path: plugins/narrative-bot/server.yml\n label: narrative-bot\n\n - source_path: plugins/discourse-presence/config/locales/client.en.yml\n destination_path: plugins/presence/client.yml\n label: presence\n - source_path: plugins/discourse-presence/config/locales/server.en.yml\n destination_path: plugins/presence/server.yml\n label: presence\n\n - source_path: plugins/poll/config/locales/client.en.yml\n destination_path: plugins/poll/client.yml\n label: poll\n - source_path: plugins/poll/config/locales/server.en.yml\n destination_path: plugins/poll/server.yml\n label: poll\n\n - source_path: plugins/styleguide/config/locales/client.en.yml\n destination_path: plugins/styleguide/client.yml\n label: styleguide\n - source_path: plugins/styleguide/config/locales/server.en.yml\n destination_path: plugins/styleguide/server.yml\n label: styleguide\n\n - source_path: plugins/spoiler-alert/config/locales/client.en.yml\n destination_path: plugins/spoiler-alert/client.yml\n label: spoiler-alert\n - source_path: plugins/spoiler-alert/config/locales/server.en.yml\n destination_path: plugins/spoiler-alert/server.yml\n label: spoiler-alert\n\n - source_path: plugins/checklist/config/locales/client.en.yml\n destination_path: plugins/checklist/client.yml\n label: checklist\n - source_path: plugins/checklist/config/locales/server.en.yml\n destination_path: plugins/checklist/server.yml\n label: checklist\n\n - source_path: plugins/footnote/config/locales/server.en.yml\n destination_path: plugins/footnote/server.yml\n label: footnote\n\n - source_path: plugins/discourse-lazy-videos/config/locales/server.en.yml\n destination_path: plugins/lazy-videos/server.yml\n label: lazy-videos\n\n - source_path: plugins/automation/config/locales/client.en.yml\n destination_path: plugins/automation/client.yml\n label: automation\n - source_path: plugins/automation/config/locales/server.en.yml\n destination_path: plugins/automation/server.yml\n label: automation\n | dataset_sample\yaml\ruby\translator.yml | translator.yml | YAML | 3,711 | 0.8 | 0.009709 | 0.011628 | python-kit | 360 | 2024-11-26T18:58:44.510545 | Apache-2.0 | false | fa56539193c4e4094dcc799ac836b7d3 |
# Documentation: https://github.com/jonathanhefner/verba-sequentur\n\n"support request":\n comment: >\n This appears to be a request for technical support. We reserve the\n issue tracker for issues only. For technical support questions,\n please use the [rubyonrails-talk](https://discuss.rubyonrails.org/c/rubyonrails-talk/7)\n forum or [Stack Overflow](https://stackoverflow.com/questions/tagged/ruby-on-rails),\n where a wider community can help you.\n close: true\n\n"feature request":\n comment: >\n This appears to be a feature request. We generally do not take\n feature requests, and we reserve the issue tracker for issues only.\n We recommend you [try to implement the feature](\n https://guides.rubyonrails.org/contributing_to_ruby_on_rails.html#contributing-to-the-rails-code),\n and send us a pull request instead. If you are unsure if the feature\n would be accepted, please ask on the [rubyonrails-core](\n https://discuss.rubyonrails.org/c/rubyonrails-core/5) forum.\n close: true\n | dataset_sample\yaml\ruby\verba-sequentur.yml | verba-sequentur.yml | YAML | 1,017 | 0.8 | 0.238095 | 0.052632 | react-lib | 506 | 2024-10-18T22:26:33.506295 | Apache-2.0 | false | 067f28a96ec1d71843ce2d1626f2a8b2 |
prelude: |\n class C\n attr_reader :a, :b\n def initialize\n @a = nil\n @b = nil\n end\n end\n obj = C.new\nbenchmark:\n vm_attr_ivar: |\n j = obj.a\n k = obj.b\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_attr_ivar.yml | vm_attr_ivar.yml | YAML | 199 | 0.85 | 0.142857 | 0 | vue-tools | 934 | 2025-03-18T12:51:53.923840 | MIT | false | d330ec306a90555ad74d50c0b61b11af |
prelude: |\n class C\n attr_accessor :a, :b\n def initialize\n @a = nil\n @b = nil\n end\n end\n obj = C.new\nbenchmark:\n vm_attr_ivar_set: |\n obj.a = 1\n obj.b = 2\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_attr_ivar_set.yml | vm_attr_ivar_set.yml | YAML | 205 | 0.85 | 0.142857 | 0 | node-utils | 0 | 2025-05-12T03:26:57.111621 | MIT | false | e82a8a3d8ef5596d728dfb4ace9e235a |
benchmark:\n vm_bigarray: |\n a = [\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n 1,2,3,4,5,6,7,8,9,10,\n ]\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_bigarray.yml | vm_bigarray.yml | YAML | 2,864 | 0.7 | 0 | 0 | react-lib | 196 | 2023-12-22T21:43:38.670212 | BSD-3-Clause | false | f9ddd47403aa5a6438bdef5be67bf4f2 |
benchmark:\n vm_bighash: |\n a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}\nloop_count: 60000\n | dataset_sample\yaml\ruby\vm_bighash.yml | vm_bighash.yml | YAML | 4,845 | 0.7 | 0 | 0 | node-utils | 597 | 2025-06-25T13:22:05.156471 | GPL-3.0 | false | a232e45a12bb925fe527207e822e5794 |
prelude: |\n def m\n yield\n end\nbenchmark:\n vm_block: |\n m{\n }\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_block.yml | vm_block.yml | YAML | 94 | 0.65 | 0.111111 | 0 | node-utils | 294 | 2023-07-30T21:13:56.787945 | MIT | false | ab13ff87c2882ea3aa342b4329b1e7ce |
prelude: |\n def m &b\n b.call\n end\nbenchmark:\n vm_blockparam_call: |\n m{}\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_blockparam_call.yml | vm_blockparam_call.yml | YAML | 103 | 0.85 | 0.125 | 0 | react-lib | 409 | 2024-02-20T01:35:02.704132 | GPL-3.0 | false | 838bec02734821a3cee64ab337f3fcd6 |
prelude: |\n def bp_yield\n yield\n end\n\n def bp_pass &b\n bp_yield &b\n end\nbenchmark:\n vm_blockparam_pass: |\n bp_pass{}\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_blockparam_pass.yml | vm_blockparam_pass.yml | YAML | 152 | 0.85 | 0.166667 | 0 | node-utils | 438 | 2023-09-14T09:56:36.726419 | Apache-2.0 | false | d14856adaeef84b664e17feb454b4ffb |
prelude: |\n def bp_yield &b\n yield\n end\nbenchmark:\n vm_blockparam_yield: |\n bp_yield{}\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_blockparam_yield.yml | vm_blockparam_yield.yml | YAML | 117 | 0.85 | 0.125 | 0 | react-lib | 157 | 2024-04-25T07:27:20.772624 | MIT | false | 1b454088dbb07091209cd5122d0ac8f2 |
# :FIXME: is there a way to benchmark block_handler_type_ifunc?\n\nprelude: |\n p = proc{_1}\n o = Object.new\n def o.each\n i = 0\n while i < 3_000_000 do\n yield i\n i += 1\n end\n end\n\nbenchmark:\n - name: block_handler_type_iseq\n script: |\n o.each{_1}\n\n - name: block_handler_type_symbol\n script: |\n o.each(&:itself)\n\n - name: block_handler_type_proc\n script: |\n o.each(&p)\n\nloop_count: 1\n | dataset_sample\yaml\ruby\vm_block_handler.yml | vm_block_handler.yml | YAML | 431 | 0.95 | 0.074074 | 0.045455 | node-utils | 21 | 2024-01-11T18:48:28.433214 | BSD-3-Clause | false | d3d331d50bcd8b3ac873a180e9463116 |
prelude: |\n define_method(:a0){}\n define_method(:a1){|a| a}\n define_method(:s){|*a| a}\n define_method(:b){|kw: 1| kw}\n\n t0 = 0.times.to_a\n t1 = 1.times.to_a\n t10 = 10.times.to_a\n t100 = 100.times.to_a\n kw = {kw: 2}\nbenchmark:\n bmethod_simple_0: |\n a0\n bmethod_simple_1: |\n a1(1)\n bmethod_simple_0_splat: |\n a0(*t0)\n bmethod_simple_1_splat: |\n a1(*t1)\n bmethod_no_splat: |\n s\n bmethod_0_splat: |\n s(*t0)\n bmethod_1_splat: |\n s(*t1)\n bmethod_10_splat: |\n s(*t10)\n bmethod_100_splat: |\n s(*t100)\n bmethod_kw: |\n b(kw: 1)\n bmethod_no_kw: |\n b\n bmethod_kw_splat: |\n b(**kw)\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_call_bmethod.yml | vm_call_bmethod.yml | YAML | 646 | 0.7 | 0 | 0 | vue-tools | 898 | 2024-07-04T00:40:19.280589 | Apache-2.0 | false | cdbb4a9eadd5456e53996f61034e0604 |
prelude: |\n h1, h10, h100, h1000 = [1, 10, 100, 1000].map do |n|\n h = {kw: 1}\n n.times{|i| h[i.to_s.to_sym] = i}\n h\n end\n eh = {}\n def kw(kw: nil, **kws) end\nbenchmark:\n 1: |\n kw(**h1)\n 1_mutable: |\n kw(**eh, **h1)\n 10: |\n kw(**h10)\n 10_mutable: |\n kw(**eh, **h10)\n 100: |\n kw(**h100)\n 100_mutable: |\n kw(**eh, **h100)\n 1000: |\n kw(**h1000)\n 1000_mutable: |\n kw(**eh, **h1000)\n | dataset_sample\yaml\ruby\vm_call_kw_and_kw_splat.yml | vm_call_kw_and_kw_splat.yml | YAML | 422 | 0.85 | 0.04 | 0 | awesome-app | 856 | 2023-07-20T10:40:00.146338 | Apache-2.0 | false | 20117e72a8e16d2c72f168147e1dc017 |
prelude: |\n class A0\n def method_missing(m); m end\n end\n class A1\n def method_missing(m, a) a; end\n end\n class S\n def method_missing(m, *a) a; end\n end\n class B\n def method_missing(m, kw: 1) kw end\n end\n class SB\n def method_missing(m, *a, kw: 1) kw end\n end\n\n t0 = 0.times.to_a\n t1 = 1.times.to_a\n t10 = 10.times.to_a\n t200 = 200.times.to_a\n kw = {kw: 2}\n\n a0 = A0.new\n a1 = A1.new\n s = S.new\n b = B.new\n sb = SB.new\nbenchmark:\n method_missing_simple_0: |\n a0.()\n method_missing_simple_1: |\n a1.x(1)\n method_missing_simple_0_splat: |\n a0.(*t0)\n method_missing_simple_1_splat: |\n a1.(*t1)\n method_missing_no_splat: |\n s.()\n method_missing_0_splat: |\n s.(*t0)\n method_missing_1_splat: |\n s.(*t1)\n method_missing_10_splat: |\n s.(*t10)\n method_missing_200_splat: |\n s.(*t200)\n method_missing_kw: |\n b.(kw: 1)\n method_missing_no_kw: |\n b.()\n method_missing_kw_splat: |\n b.(**kw)\n method_missing_0_splat_kw: |\n sb.(*t0, **kw)\n method_missing_1_splat_kw: |\n sb.(*t1, **kw)\n method_missing_10_splat_kw: |\n sb.(*t10, **kw)\n method_missing_200_splat_kw: |\n sb.(*t200, **kw)\nloop_count: 1000000\n | dataset_sample\yaml\ruby\vm_call_method_missing.yml | vm_call_method_missing.yml | YAML | 1,184 | 0.85 | 0.16129 | 0 | awesome-app | 586 | 2024-08-05T12:07:36.150658 | BSD-3-Clause | false | 2f13df419ac5f9fcf1ea427729ad1bfc |
prelude: |\n def a0; end\n def a1(a) a; end\n def s(*a) a; end\n def b(kw: 1) kw end\n def sb(*a, kw: 1) kw end\n\n t0 = 0.times.to_a\n t1 = 1.times.to_a\n t10 = 10.times.to_a\n t200 = 200.times.to_a\n\n a0_t0 = [:a0, *t0]\n a1_t1 = [:a1, *t1]\n s_t0 = [:s, *t0]\n s_t1 = [:s, *t1]\n s_t10 = [:s, *t10]\n s_t200 = [:s, *t200]\n sb_t0 = [:sb, *t0]\n sb_t1 = [:sb, *t1]\n sb_t10 = [:sb, *t10]\n sb_t200 = [:sb, *t200]\n kw = {kw: 2}\nbenchmark:\n send_simple_0: |\n send(:a0)\n send_simple_1: |\n send(:a1, 1)\n send_simple_0_splat: |\n send(:a0, *t0)\n send_simple_1_splat: |\n send(:a1, *t1)\n send_simple_0_splat_comb: |\n send(*a0_t0)\n send_simple_1_splat_comb: |\n send(*a1_t1)\n send_no_splat: |\n send(:s)\n send_0_splat: |\n send(:s, *t0)\n send_1_splat: |\n send(:s, *t1)\n send_10_splat: |\n send(:s, *t10)\n send_200_splat: |\n send(:s, *t200)\n send_0_splat_comb: |\n send(*s_t0)\n send_1_splat_comb: |\n send(*s_t1)\n send_10_splat_comb: |\n send(*s_t10)\n send_200_splat_comb: |\n send(*s_t200)\n send_kw: |\n send(:b, kw: 1)\n send_no_kw: |\n send(:b)\n send_kw_splat: |\n send(:b, **kw)\n send_0_splat_kw: |\n send(:sb, *t0, **kw)\n send_1_splat_kw: |\n send(:sb, *t1, **kw)\n send_10_splat_kw: |\n send(:sb, *t10, **kw)\n send_200_splat_kw: |\n send(:sb, *t200, **kw)\n send_0_splat_comb_kw: |\n send(*sb_t0, **kw)\n send_1_splat_comb_kw: |\n send(*sb_t1, **kw)\n send_10_splat_comb_kw: |\n send(*sb_t10, **kw)\n send_200_splat_comb_kw: |\n send(*sb_t200, **kw)\nloop_count: 3000000\n | dataset_sample\yaml\ruby\vm_call_send_iseq.yml | vm_call_send_iseq.yml | YAML | 1,547 | 0.85 | 0.064935 | 0 | awesome-app | 914 | 2024-03-30T20:42:31.763212 | Apache-2.0 | false | b289d5f106746231dad79ba485e6244d |
prelude: |\n def self.a0; end\n def self.a1(a) a; end\n def self.s(*a) a; end\n def self.b(kw: 1) kw end\n def self.sb(*a, kw: 1) kw end\n\n t0 = 0.times.to_a\n t1 = 1.times.to_a\n t10 = 10.times.to_a\n t200 = 200.times.to_a\n\n a0_t0 = [self, *t0]\n a1_t1 = [self, *t1]\n s_t0 = [self, *t0]\n s_t1 = [self, *t1]\n s_t10 = [self, *t10]\n s_t200 = [self, *t200]\n sb_t0 = [self, *t0]\n sb_t1 = [self, *t1]\n sb_t10 = [self, *t10]\n sb_t200 = [self, *t200]\n kw = {kw: 2}\n\n a0 = :a0.to_proc\n a1 = :a1.to_proc\n s = :s.to_proc\n b = :b.to_proc\n sb = :sb.to_proc\nbenchmark:\n symproc_simple_0: |\n a0.(self)\n symproc_simple_1: |\n a1.(self, 1)\n symproc_simple_0_splat: |\n a0.(self, *t0)\n symproc_simple_1_splat: |\n a1.(self, *t1)\n symproc_simple_0_splat_comb: |\n a0.(*a0_t0)\n symproc_simple_1_splat_comb: |\n a1.(*a1_t1)\n symproc_no_splat: |\n s.(self)\n symproc_0_splat: |\n s.(self, *t0)\n symproc_1_splat: |\n s.(self, *t1)\n symproc_10_splat: |\n s.(self, *t10)\n symproc_200_splat: |\n s.(self, *t200)\n symproc_0_splat_comb: |\n s.(*s_t0)\n symproc_1_splat_comb: |\n s.(*s_t1)\n symproc_10_splat_comb: |\n s.(*s_t10)\n symproc_200_splat_comb: |\n s.(*s_t200)\n symproc_kw: |\n b.(self, kw: 1)\n symproc_no_kw: |\n b.(self)\n symproc_kw_splat: |\n b.(self, **kw)\n symproc_0_splat_kw: |\n sb.(self, *t0, **kw)\n symproc_1_splat_kw: |\n sb.(self, *t1, **kw)\n symproc_10_splat_kw: |\n sb.(self, *t10, **kw)\n symproc_200_splat_kw: |\n sb.(self, *t200, **kw)\n symproc_0_splat_comb_kw: |\n sb.(*sb_t0, **kw)\n symproc_1_splat_comb_kw: |\n sb.(*sb_t1, **kw)\n symproc_10_splat_comb_kw: |\n sb.(*sb_t10, **kw)\n symproc_200_splat_comb_kw: |\n sb.(*sb_t200, **kw)\nloop_count: 1000000\n | dataset_sample\yaml\ruby\vm_call_symproc.yml | vm_call_symproc.yml | YAML | 1,742 | 0.85 | 0.060241 | 0 | vue-tools | 983 | 2023-11-01T00:45:28.584158 | MIT | false | 636353dd709b2a2eebda7430e29cd753 |
benchmark:\n vm_case: |\n case :foo\n when :bar\n raise\n when :baz\n raise\n when :boo\n raise\n when :foo\n # noop\n end\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_case.yml | vm_case.yml | YAML | 171 | 0.8 | 0 | 0.076923 | react-lib | 713 | 2024-06-15T04:36:14.784775 | MIT | false | a5f2657d93afb13b7410fc9cc643a9c2 |
benchmark:\n vm_case_classes: |\n case :foo\n when Hash\n raise\n when Array\n raise\n end\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_case_classes.yml | vm_case_classes.yml | YAML | 127 | 0.7 | 0 | 0 | python-kit | 625 | 2024-12-24T10:54:15.761504 | MIT | false | a8aefffc182aa0bb80bf254a88d43877 |
# loop_count is not utilized since `i` is involved in the script\nbenchmark:\n vm_case_lit: |\n i = 0\n @ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]\n def foo(i)\n @ret[i % @ret.size]\n end\n\n while i<6_000_000\n case foo(i)\n when "foo" then :foo\n when true then true\n when false then false\n when :sym then :sym\n when 6 then :fix\n when nil then nil\n when 0.1 then :float\n when 0xffffffffffffffff then :big\n end\n i += 1\n end\nloop_count: 1\n | dataset_sample\yaml\ruby\vm_case_lit.yml | vm_case_lit.yml | YAML | 532 | 0.95 | 0.086957 | 0.045455 | vue-tools | 208 | 2025-01-31T16:57:45.963049 | MIT | false | dc531faa95df3ac4b83e31da7e251ce4 |
prelude: |\n Const = 1\n A = B = C = D = E = F = G = H = I = J = K = L = M = N = O = P = Q = R = S = T = U = V = W = X = Y = Z = 1\n def foo\n A; B; C; D; E; F; G; H; I; J; K; L; M; N; O; P; Q; R; S; T; U; V; W; X; Y; Z\n end\nbenchmark:\n vm_const: |\n j = Const\n k = Const\n vm_const_many: |\n foo\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_const.yml | vm_const.yml | YAML | 329 | 0.85 | 0.076923 | 0 | vue-tools | 196 | 2024-03-25T11:22:15.498159 | MIT | false | 3b983c5909538330a2cca387cd5fd99a |
prelude: |\n class A\n @@foo = 1\n\n def self.foo\n @@foo\n end\n\n ("A".."Z").each do |module_name|\n eval <<-EOM\n module #{module_name}\n end\n\n include #{module_name}\n EOM\n end\n end\nbenchmark:\n vm_cvar: A.foo\nloop_count: 600000\n | dataset_sample\yaml\ruby\vm_cvar.yml | vm_cvar.yml | YAML | 274 | 0.95 | 0.1 | 0 | python-kit | 661 | 2025-01-28T13:10:32.543687 | Apache-2.0 | false | 1517e78c9e409736933e8c6b7e642a83 |
prelude: |\n class Object\n define_method(:m){}\n end\nbenchmark:\n vm_defined_method: |\n m; m; m; m; m; m; m; m;\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_defined_method.yml | vm_defined_method.yml | YAML | 138 | 0.85 | 0.125 | 0 | react-lib | 135 | 2025-03-05T01:03:01.253367 | BSD-3-Clause | false | fe60401ffb098ac403880b684fa50ecf |
prelude: |\n x = y = 'z'\nbenchmark:\n vm_dstr: |\n str = "foo#{x}bar#{y}baz"\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_dstr.yml | vm_dstr.yml | YAML | 99 | 0.6 | 0 | 0 | react-lib | 634 | 2024-07-27T06:54:50.606812 | MIT | false | bf0eab490c35e2b38c34fe11029ed450 |
# Not utilizing loop_count since using it for this is too unstable for now\nbenchmark:\n vm_ensure: |\n i = 0\n while i<30_000_000\n i += 1\n begin\n begin\n ensure\n end\n ensure\n end\n end\nloop_count: 1\n | dataset_sample\yaml\ruby\vm_ensure.yml | vm_ensure.yml | YAML | 245 | 0.8 | 0.214286 | 0.071429 | node-utils | 638 | 2024-03-31T12:06:10.397757 | BSD-3-Clause | false | 24803e37a65ca88472f9633937ad77a5 |
prelude: |\n # Disable GC to see raw throughput:\n GC.disable\nbenchmark:\n vm_fiber_allocate: |\n fiber = Fiber.new{Fiber.yield}\n fiber.resume\nloop_count: 100000\n | dataset_sample\yaml\ruby\vm_fiber_allocate.yml | vm_fiber_allocate.yml | YAML | 167 | 0.8 | 0 | 0.125 | vue-tools | 446 | 2023-10-06T16:38:30.803112 | Apache-2.0 | false | 56cfaada63488bd4738cc77839e146a2 |
# On Linux, you will need to increase the maximum number of memory maps:\n# sudo sysctl -w vm.max_map_count=200000\nprelude: |\n fibers = []\nbenchmark:\n vm_fiber_count: |\n fiber = Fiber.new{Fiber.yield}\n fibers << fiber\n fiber.resume\nloop_count: 100000\n | dataset_sample\yaml\ruby\vm_fiber_count.yml | vm_fiber_count.yml | YAML | 261 | 0.8 | 0 | 0.2 | vue-tools | 669 | 2023-08-20T17:50:09.233269 | BSD-3-Clause | false | 8db85d320fd7530cb4e4bd2947b46e52 |
prelude: |\n GC.disable\n fibers = []\nbenchmark:\n vm_fiber_reuse: |\n 1024.times do\n fiber = Fiber.new{Fiber.yield}\n fibers << fiber\n fiber.resume\n end\n\n fibers.clear\n GC.start\nloop_count: 200\n | dataset_sample\yaml\ruby\vm_fiber_reuse.yml | vm_fiber_reuse.yml | YAML | 220 | 0.7 | 0 | 0 | python-kit | 983 | 2024-04-07T05:44:32.802925 | BSD-3-Clause | false | d56e59f2fd1473c58e3316c66be5220f |
# https://bugs.ruby-lang.org/issues/16009\nprelude: |\n fibers = []\nbenchmark:\n vm_fiber_reuse_gc: |\n 2000.times do\n fiber = Fiber.new{Fiber.yield}\n fibers << fiber\n fiber.resume\n end\n fibers.clear\nloop_count: 100\n | dataset_sample\yaml\ruby\vm_fiber_reuse_gc.yml | vm_fiber_reuse_gc.yml | YAML | 238 | 0.8 | 0 | 0.083333 | react-lib | 711 | 2024-11-15T11:42:17.958951 | GPL-3.0 | false | b2b5285c42cd5cfbd086c226464df44f |
prelude: |\n # based on benchmark for [ruby-core:65518] [Feature #10341] by Knut Franke\n fib = Fiber.new do\n loop { Fiber.yield }\n end\nbenchmark:\n vm_fiber_switch: |\n fib.resume\nloop_count: 20000000\n | dataset_sample\yaml\ruby\vm_fiber_switch.yml | vm_fiber_switch.yml | YAML | 208 | 0.8 | 0.111111 | 0.111111 | python-kit | 842 | 2023-09-02T18:52:18.864688 | GPL-3.0 | false | 34d9b9b7e3d467fc37e7c836d5f53227 |
prelude: |\n f = 0.0\nbenchmark:\n vm_float_simple: |\n f += 0.1; f -= 0.1\n f += 0.1; f -= 0.1\n f += 0.1; f -= 0.1\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_float_simple.yml | vm_float_simple.yml | YAML | 143 | 0.7 | 0 | 0 | awesome-app | 573 | 2024-05-31T00:33:08.321810 | GPL-3.0 | false | 872150666f2b65dffe3b5cfec25231b2 |
prelude: |\n objs = 100000.times.map { Object.new }\nbenchmark:\n vm_freeze_obj: |\n objs.map(&:freeze)\nloop_count: 600\n | dataset_sample\yaml\ruby\vm_freezeobj.yml | vm_freezeobj.yml | YAML | 120 | 0.7 | 0 | 0 | awesome-app | 475 | 2023-07-11T08:41:48.032344 | Apache-2.0 | false | a5120b1cfbdc35e1cbd16d341ecb181e |
prelude: |\n class String\n def freeze\n -self\n end\n end\nbenchmark:\n vm_freezestring: |\n "tXnL1BP5T1WPXMjuFNLQtallEtRcay1t2lHtJSrlVsDgvunlbtfpr/DGdH0NGYE9".freeze\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_freezestring.yml | vm_freezestring.yml | YAML | 197 | 0.85 | 0.2 | 0 | node-utils | 144 | 2024-10-28T07:51:07.407927 | BSD-3-Clause | false | 1628605cf1e9fe7e9a2e4bb2523ce1bb |
benchmark:\n vm_gc_short_lived: |\n a = '' # short-lived String\n b = ''\n c = ''\n d = ''\n e = ''\n f = ''\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_gc_short_lived.yml | vm_gc_short_lived.yml | YAML | 142 | 0.8 | 0 | 0 | node-utils | 554 | 2025-06-12T12:52:21.174781 | Apache-2.0 | false | 54174d5a04d2fefc7921a83f2cee83df |
prelude: |\n def nested_hash h, n\n if n == 0\n ''\n else\n 10.times{\n h[Object.new] = nested_hash(h, n-1)\n }\n end\n end\n\n long_lived = Hash.new\n nested_hash long_lived, 6\n\n GC.start\n GC.start\nbenchmark:\n vm_gc_short_with_complex_long: |\n a = '' # short-lived String\n b = ''\n c = ''\n d = ''\n e = ''\n f = ''\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_gc_short_with_complex_long.yml | vm_gc_short_with_complex_long.yml | YAML | 378 | 0.95 | 0.08 | 0 | awesome-app | 321 | 2025-04-16T13:04:52.746600 | Apache-2.0 | false | 4a615084e32c7fb284ca8ab4d6233b4d |
prelude: |\n long_lived = Array.new(1_000_000){|i| "#{i}"}\n GC.start\n GC.start\nbenchmark:\n vm_gc_short_with_long: |\n a = '' # short-lived String\n b = ''\n c = ''\n d = ''\n e = ''\n f = ''\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_gc_short_with_long.yml | vm_gc_short_with_long.yml | YAML | 227 | 0.8 | 0 | 0 | react-lib | 738 | 2024-12-21T16:00:00.169749 | Apache-2.0 | false | 07f6b613547abacc5863ac5ec0aad4cd |
prelude: |\n 50_000.times{|i| sym = "sym#{i}".to_sym}\n GC.start\n GC.start\nbenchmark:\n vm_gc_short_with_symbol: |\n a = '' # short-lived String\n b = ''\n c = ''\n d = ''\n e = ''\n f = ''\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_gc_short_with_symbol.yml | vm_gc_short_with_symbol.yml | YAML | 224 | 0.8 | 0 | 0 | react-lib | 408 | 2023-08-17T08:49:13.392556 | MIT | false | b9692a2f16a2a2aa81efcf42fe6c1491 |
prelude: |\n short_lived_ary = []\n\n if RUBY_VERSION >= "2.2.0"\n GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)\n end\n\n short_lived = ''\nbenchmark:\n vm_gc_wb_ary: |\n short_lived_ary[0] = short_lived # write barrier\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_gc_wb_ary.yml | vm_gc_wb_ary.yml | YAML | 269 | 0.8 | 0.083333 | 0 | vue-tools | 296 | 2024-03-11T23:41:37.488630 | Apache-2.0 | false | 2d84df4ee721eb9e10d27b734b2d7c86 |
prelude: |\n long_lived = []\n\n if RUBY_VERSION > "2.2.0"\n 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }\n elsif\n GC.start\n end\n\n short_lived = ''\n\nbenchmark:\n vm_gc_wb_ary_promoted: |\n long_lived[0] = short_lived # write barrier\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_gc_wb_ary_promoted.yml | vm_gc_wb_ary_promoted.yml | YAML | 300 | 0.8 | 0.066667 | 0 | python-kit | 519 | 2025-03-25T08:43:41.626488 | MIT | false | f2f1c0eb49d83865527f93b9354b8eb4 |
prelude: |\n class C\n attr_accessor :foo\n end\n short_lived_obj = C.new\n\n if RUBY_VERSION >= "2.2.0"\n GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true)\n end\n\n short_lived = ''\nbenchmark:\n vm_gc_wb_obj: |\n short_lived_obj.foo = short_lived # write barrier\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_gc_wb_obj.yml | vm_gc_wb_obj.yml | YAML | 312 | 0.95 | 0.133333 | 0 | awesome-app | 661 | 2023-09-01T21:58:00.339654 | Apache-2.0 | false | a14daa0eb8c9a918d4d2b2e5230b0fde |
prelude: |\n class C\n attr_accessor :foo\n end\n long_lived = C.new\n\n if RUBY_VERSION >= "2.2.0"\n 3.times{ GC.start(full_mark: false, immediate_mark: true, immediate_sweep: true) }\n elsif\n GC.start\n end\n\n short_lived = ''\nbenchmark:\n vm_gc_wb_obj_promoted: |\n long_lived.foo = short_lived # write barrier\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_gc_wb_obj_promoted.yml | vm_gc_wb_obj_promoted.yml | YAML | 343 | 0.95 | 0.117647 | 0 | vue-tools | 158 | 2025-05-13T13:29:52.151787 | MIT | false | 62c3400674653a49773b72a810f1cf1d |
prelude: |\n class C\n def m\n 1\n end\n\n ("A".."M").each do |module_name|\n eval <<-EOM\n module #{module_name}\n def m; super; end\n end\n prepend #{module_name}\n EOM\n end\n end\n\n obj = C.new\nbenchmark:\n vm_iclass_super: obj.m\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_iclass_super.yml | vm_iclass_super.yml | YAML | 307 | 0.95 | 0.15 | 0 | python-kit | 234 | 2023-09-13T21:13:20.836744 | BSD-3-Clause | false | c3eb08ccd22c833127efc00a1c709d4c |
prelude: |\n class C\n def set_ivars\n @a = nil\n @b = nil\n @c = nil\n end\n end\n\n c = C.new\nbenchmark:\n vm_ivar_embedded_obj_init: |\n c.set_ivars\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_ivar_embedded_obj_init.yml | vm_ivar_embedded_obj_init.yml | YAML | 190 | 0.85 | 0.142857 | 0 | vue-tools | 127 | 2024-05-25T01:45:54.897674 | MIT | false | c4798dd81660fb62318cf9adf4f16883 |
prelude: |\n class C\n def set_ivars\n @a = nil\n @b = nil\n @c = nil\n @d = nil\n @e = nil\n end\n end\n\n c = C.new\nbenchmark:\n vm_ivar_extended_obj_init: |\n c.set_ivars\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_ivar_extended_obj_init.yml | vm_ivar_extended_obj_init.yml | YAML | 220 | 0.85 | 0.125 | 0 | node-utils | 292 | 2024-08-05T14:32:24.556388 | Apache-2.0 | false | a0f4fac43752aa48da8f9f65991000ed |
prelude: |\n class C < Array\n attr_reader :a, :b, :c\n def initialize\n @a = nil\n @b = nil\n @c = nil\n end\n end\n\n c = C.new\nbenchmark:\n vm_ivar_generic_get: |\n c.a\n c.b\n c.c\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_ivar_generic_get.yml | vm_ivar_generic_get.yml | YAML | 228 | 0.85 | 0.117647 | 0 | awesome-app | 827 | 2023-11-21T02:18:33.445600 | MIT | false | e5633ad3dc0c6e8aa7d6826243c76d75 |
prelude: |\n class C < Array\n def set_ivars\n @a = nil\n @b = nil\n @c = nil\n end\n end\n\n c = C.new\nbenchmark:\n vm_ivar_generic_set: |\n c.set_ivars\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_ivar_generic_set.yml | vm_ivar_generic_set.yml | YAML | 192 | 0.85 | 0.142857 | 0 | node-utils | 293 | 2024-02-15T16:30:21.894177 | Apache-2.0 | false | ce4e29fc0984bf88d15cfea45260fda1 |
prelude: |\n class Example\n def initialize\n @v0 = 1\n @v1 = 2\n @v3 = 3\n @levar = 1\n end\n\n def get_value_loop\n sum = 0\n\n i = 0\n while i < 1000000\n # 10 times to de-emphasize loop overhead\n sum += @levar\n sum += @levar\n sum += @levar\n sum += @levar\n sum += @levar\n sum += @levar\n sum += @levar\n sum += @levar\n sum += @levar\n sum += @levar\n i += 1\n end\n\n return sum\n end\n end\n\n obj = Example.new\nbenchmark:\n vm_ivar_get: |\n obj.get_value_loop\nloop_count: 100\n | dataset_sample\yaml\ruby\vm_ivar_get.yml | vm_ivar_get.yml | YAML | 602 | 0.95 | 0.108108 | 0.030303 | awesome-app | 278 | 2023-10-04T11:21:14.948721 | BSD-3-Clause | false | 73119ec5926f621dcd30bad7b55ae6dd |
prelude: |\n class Example\n def read\n @uninitialized\n end\n end\n\n obj = Example.new\nbenchmark:\n vm_ivar_get_uninitialized: |\n obj.read\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_ivar_get_unintialized.yml | vm_ivar_get_unintialized.yml | YAML | 172 | 0.85 | 0.166667 | 0 | vue-tools | 739 | 2023-12-25T09:18:28.629441 | Apache-2.0 | false | 0b36c40ed350df38f8bbfacfb28164d2 |
prelude: |\n class Foo\n def initialize diverge\n if diverge\n @a = 1\n end\n\n @a0 = @a1 = @a2 = @a3 = @a4 = @a5 = @a6 = @a7 = @a8 = @a9 = @a10 = @a11 = @a12 = @a13 = @a14 = @a15 = @a16 = @a17 = @a18 = @a19 = @a20 = @a21 = @a22 = @a23 = @a24 = @a25 = @a26 = @a27 = @a28 = @a29 = @a30 = @a31 = @a32 = @a33 = @a34 = @a35 = @a36 = @a37 = @a38 = @a39 = @a40 = @a41 = @a42 = @a43 = @a44 = @a45 = @a46 = @a47 = @a48 = @a49 = @a50 = @a51 = @a52 = @a53 = @a54 = @a55 = @a56 = @a57 = @a58 = @a59 = @a60 = @a61 = @a62 = @a63 = @a64 = @a65 = @a66 = @a67 = @a68 = @a69 = @a70 = @a71 = @a72 = @a73 = @a74 = @b = 1\n end\n\n def b; @b; end\n end\n\n a = Foo.new false\n b = Foo.new true\nbenchmark:\n vm_ivar_ic_miss: |\n a.b\n b.b\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_ivar_ic_miss.yml | vm_ivar_ic_miss.yml | YAML | 764 | 0.85 | 0.2 | 0 | python-kit | 901 | 2023-09-14T01:13:26.800491 | MIT | false | 3b8e8ed2a46a733656f904add712e2c9 |
prelude: |\n class Example\n def lazy_set\n @uninitialized ||= 123\n end\n end\n\n objs = 10000000.times.map { Example.new }\nbenchmark:\n vm_ivar_lazy_set: |\n objs.each(&:lazy_set)\nloop_count: 1\n | dataset_sample\yaml\ruby\vm_ivar_lazy_set.yml | vm_ivar_lazy_set.yml | YAML | 205 | 0.85 | 0.166667 | 0 | node-utils | 708 | 2025-01-23T22:16:11.202894 | MIT | false | 2ee80bca0c2464e2053d46522057856a |
prelude: |\n IVARS = 60\n class Record\n def initialize(offset = false)\n @offset = 1 if offset\n @first = 0\n IVARS.times do |i|\n instance_variable_set("@ivar_#{i}", i)\n end\n end\n\n def first\n @first\n end\n\n def lazy_set\n @lazy_set ||= 123\n end\n\n def undef\n @undef\n end\n end\n\n Record.new # Need one alloc to right size\n\n BASE = Record.new\n LAZY = Record.new\n LAZY.lazy_set\n\n class Miss < Record\n @first = 0\n IVARS.times do |i|\n instance_variable_set("@i_#{i}", i)\n end\n end\n\n Miss.new # Need one alloc to right size\n MISS = Miss.new\n\n DIVERGENT = Record.new(true)\n\nbenchmark:\n vm_ivar_stable_shape: |\n BASE.first\n BASE.first\n BASE.first\n BASE.first\n BASE.first\n BASE.first\n vm_ivar_memoize_unstable_shape: |\n BASE.first\n LAZY.first\n BASE.first\n LAZY.first\n BASE.first\n LAZY.first\n vm_ivar_memoize_unstable_shape_miss: |\n BASE.first\n MISS.first\n BASE.first\n MISS.first\n BASE.first\n MISS.first\n vm_ivar_unstable_undef: |\n BASE.undef\n LAZY.undef\n BASE.undef\n LAZY.undef\n BASE.undef\n LAZY.undef\n vm_ivar_divergent_shape: |\n BASE.first\n DIVERGENT.first\n BASE.first\n DIVERGENT.first\n BASE.first\n DIVERGENT.first\n vm_ivar_divergent_shape_imbalanced: |\n BASE.first\n DIVERGENT.first\n DIVERGENT.first\n DIVERGENT.first\n DIVERGENT.first\n DIVERGENT.first\n | dataset_sample\yaml\ruby\vm_ivar_memoize.yml | vm_ivar_memoize.yml | YAML | 1,441 | 0.95 | 0.082353 | 0 | python-kit | 106 | 2024-05-20T12:04:27.928012 | BSD-3-Clause | false | dbc261302ea205594cca534f0db37812 |
prelude: |\n class C\n @a = 1\n def self.a\n _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;\n _a = @a; _a = @a; _a = @a; _a = @a; _a = @a;\n end\n end\nbenchmark:\n vm_ivar_of_class: |\n a = C.a\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_ivar_of_class.yml | vm_ivar_of_class.yml | YAML | 229 | 0.85 | 0.166667 | 0 | node-utils | 165 | 2024-07-16T01:50:57.662356 | Apache-2.0 | false | b058696cf05ceece027b02729971b851 |
prelude: |\n class C\n @a = 1\n def self.a o\n @a = o; @a = o; @a = o; @a = o; @a = o; @a = o;\n end\n end\nbenchmark:\n vm_ivar_of_class_set: |\n a = C.a(nil)\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_ivar_of_class_set.yml | vm_ivar_of_class_set.yml | YAML | 192 | 0.85 | 0.181818 | 0 | node-utils | 466 | 2024-03-19T01:24:01.816826 | Apache-2.0 | false | 6f3809b1e6e77b812ce1c52e3ed42651 |
prelude: |\n class TheClass\n def initialize\n @v0 = 1\n @v1 = 2\n @v3 = 3\n @levar = 1\n end\n\n def set_value_loop\n # 1M\n i = 0\n while i < 1000000\n # 10 times to de-emphasize loop overhead\n @levar = i\n @levar = i\n @levar = i\n @levar = i\n @levar = i\n @levar = i\n @levar = i\n @levar = i\n @levar = i\n @levar = i\n i += 1\n end\n end\n end\n\n obj = TheClass.new\n\nbenchmark:\n vm_ivar_set_on_instance: |\n obj.set_value_loop\nloop_count: 100\n | dataset_sample\yaml\ruby\vm_ivar_set_on_instance.yml | vm_ivar_set_on_instance.yml | YAML | 565 | 0.95 | 0.114286 | 0.0625 | python-kit | 755 | 2023-10-15T09:06:40.794609 | MIT | false | 511f691108457f44fec107fe352f37cb |
prelude: |\n class A\n def set_ivars\n @a = nil\n @b = nil\n @c = nil\n @d = nil\n @e = nil\n end\n end\n class B < A; end\n class C < A; end\n\n b = B.new\n c = C.new\nbenchmark:\n vm_ivar_init_subclass: |\n b.set_ivars\n c.set_ivars\nloop_count: 3000000\n | dataset_sample\yaml\ruby\vm_ivar_set_subclass.yml | vm_ivar_set_subclass.yml | YAML | 281 | 0.85 | 0.2 | 0 | python-kit | 315 | 2024-03-10T00:56:58.856223 | BSD-3-Clause | false | d245d21c79c5eb12452b805e0790bf92 |
prelude: |\n a = 'abc'\n b = [1, 2, 3]\nbenchmark:\n vm_length: |\n a.length\n b.length\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_length.yml | vm_length.yml | YAML | 112 | 0.7 | 0 | 0 | node-utils | 891 | 2023-08-14T13:51:39.803365 | BSD-3-Clause | false | 4f342b7c69eadbb1eb58b75b83ad25a1 |
benchmark:\n vm_lvar_cond_set: |\n a ||= 1\n b ||= 1\n c ||= 1\n d ||= 1\n nil\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_lvar_cond_set.yml | vm_lvar_cond_set.yml | YAML | 110 | 0.7 | 0 | 0 | node-utils | 74 | 2025-04-11T08:10:03.370225 | BSD-3-Clause | false | a306404ae2c5d809c4c92b1f7563220b |
# while loop cost is not removed because `i` is used in the script\nbenchmark:\n vm_lvar_init: |\n def m v\n unless v\n # unreachable code\n v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =\n v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =\n v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =\n v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =\n v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1\n end\n end\n\n i = 0\n\n while i<30_000_000\n i += 1\n m i\n end\nloop_count: 1\n | dataset_sample\yaml\ruby\vm_lvar_init.yml | vm_lvar_init.yml | YAML | 581 | 0.95 | 0.142857 | 0.105263 | awesome-app | 250 | 2024-05-29T17:17:55.135184 | BSD-3-Clause | false | c58c6f463390fc04382549b2d7bd75f3 |
benchmark:\n vm_lvar_set: |\n a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_lvar_set.yml | vm_lvar_set.yml | YAML | 123 | 0.7 | 0 | 0 | python-kit | 783 | 2024-12-02T23:23:45.676186 | BSD-3-Clause | false | e373a053e3ac6b6ccf025af209114990 |
prelude: |\n def m\n nil\n end\nbenchmark:\n vm_method: |\n m; m; m; m; m; m; m; m;\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_method.yml | vm_method.yml | YAML | 107 | 0.85 | 0.125 | 0 | vue-tools | 37 | 2024-11-26T18:21:11.560855 | MIT | false | 9d9e5520c08153685106819e8d51af88 |
prelude: |\n class C\n def method_missing mid\n end\n end\n\n obj = C.new\nbenchmark:\n vm_method_missing: |\n obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_method_missing.yml | vm_method_missing.yml | YAML | 191 | 0.85 | 0.181818 | 0 | python-kit | 90 | 2024-07-09T00:09:02.611009 | Apache-2.0 | false | e535281bdcbfc0538ccc27ece9b70401 |
prelude: |\n def f(x=0, y: 0) end\n a = [1]\n ea = []\n kw = {y: 1}\n b = lambda{}\nbenchmark:\n arg_splat: "f(1, *ea)"\n arg_splat_block: "f(1, *ea, &b)"\n splat_kw_splat: "f(*a, **kw)"\n splat_kw_splat_block: "f(*a, **kw, &b)"\n splat_kw: "f(*a, y: 1)"\n splat_kw_block: "f(*a, y: 1, &b)"\n | dataset_sample\yaml\ruby\vm_method_splat_calls.yml | vm_method_splat_calls.yml | YAML | 290 | 0.85 | 0.076923 | 0 | node-utils | 471 | 2023-10-21T06:21:37.489751 | MIT | false | bd7f1ab535ec9341005e9304f1a73b69 |
prelude: |\n def named_arg_splat(*a) end\n def named_arg_kw_splat(*a, **kw) end\n def anon_arg_splat(*) end\n def anon_kw_splat(**) end\n def anon_arg_kw_splat(*, **) end\n def anon_fw_to_named(*, **) named_arg_kw_splat(*, **) end\n def fw_to_named(...) named_arg_kw_splat(...) end\n def fw_to_anon_to_named(...) anon_fw_to_named(...) end\n def fw_no_kw(...) named_arg_splat(...) end\n a = [1]\n kw = {y: 1}\nbenchmark:\n named_multi_arg_splat: "named_arg_splat(*a, *a)"\n named_post_splat: "named_arg_splat(*a, a)"\n anon_arg_splat: "anon_arg_splat(*a)"\n anon_arg_kw_splat: "anon_arg_kw_splat(*a, **kw)"\n anon_multi_arg_splat: "anon_arg_splat(*a, *a)"\n anon_post_splat: "anon_arg_splat(*a, a)"\n anon_kw_splat: "anon_kw_splat(**kw)"\n anon_fw_to_named_splat: "anon_fw_to_named(*a, **kw)"\n anon_fw_to_named_no_splat: "anon_fw_to_named(1, y: 1)"\n fw_to_named_splat: "fw_to_named(*a, **kw)"\n fw_to_named_no_splat: "fw_to_named(1, y: 1)"\n fw_to_anon_to_named_splat: "fw_to_anon_to_named(*a, **kw)"\n fw_to_anon_to_named_no_splat: "fw_to_anon_to_named(1, y: 1)"\n fw_no_kw: "fw_no_kw(1, 2)"\n | dataset_sample\yaml\ruby\vm_method_splat_calls2.yml | vm_method_splat_calls2.yml | YAML | 1,093 | 0.85 | 0.333333 | 0 | node-utils | 132 | 2025-02-05T06:28:41.099457 | MIT | false | f8c1d54299f6253868e934523dd11325 |
prelude: |\n def m\n nil\n end\nbenchmark:\n vm_method_with_block: |\n m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_method_with_block.yml | vm_method_with_block.yml | YAML | 134 | 0.85 | 0.125 | 0 | awesome-app | 706 | 2025-07-09T06:05:03.636609 | GPL-3.0 | false | ae6dc7e9e51bdd0a366a705a8ef8cb0e |
benchmark:\n vm_module_ann_const_set: |\n Module.new.const_set(:X, Module.new)\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_module_ann_const_set.yml | vm_module_ann_const_set.yml | YAML | 101 | 0.7 | 0 | 0 | vue-tools | 319 | 2025-04-16T06:03:06.946560 | BSD-3-Clause | false | d2327ef73429a00af2ac2cb4a424f222 |
prelude: |\n module M\n end\n $VERBOSE = nil\nbenchmark:\n vm_module_const_set: |\n M.const_set(:X, Module.new)\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_module_const_set.yml | vm_module_const_set.yml | YAML | 133 | 0.7 | 0 | 0 | node-utils | 737 | 2024-01-31T05:15:18.987660 | Apache-2.0 | false | 01d16d985d110930615761a4f35c4ca7 |
prelude: |\n require 'thread'\n\n m = Thread::Mutex.new\nbenchmark:\n vm_mutex: |\n m.synchronize{}\nloop_count: 6000000\n | dataset_sample\yaml\ruby\vm_mutex.yml | vm_mutex.yml | YAML | 120 | 0.85 | 0 | 0 | react-lib | 846 | 2024-12-28T01:42:25.674428 | Apache-2.0 | false | 61c0b214a56d7fd130a5bb13f9fd7262 |
prelude: |\n obj1 = Object.new\n obj2 = Object.new\nbenchmark:\n vm_neq: |\n obj1 != obj2\nloop_count: 30000000\n | dataset_sample\yaml\ruby\vm_neq.yml | vm_neq.yml | YAML | 112 | 0.7 | 0 | 0 | vue-tools | 216 | 2023-09-25T07:46:48.916064 | Apache-2.0 | false | ef1eb8223b272a67db025954b07436d2 |
# loop_count is not utilized since `i` is involved in the script\nbenchmark:\n vm_poly_method: |\n class C1\n def m\n 1\n end\n end\n class C2\n def m\n 2\n end\n end\n\n o1 = C1.new\n o2 = C2.new\n\n i = 0\n while i<6_000_000\n o = (i % 2 == 0) ? o1 : o2\n o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m\n i += 1\n end\nloop_count: 1\n | dataset_sample\yaml\ruby\vm_poly_method.yml | vm_poly_method.yml | YAML | 381 | 0.95 | 0.208333 | 0.045455 | node-utils | 258 | 2024-06-11T12:13:27.878337 | Apache-2.0 | false | c037839d65184467f284a8324466424f |
# loop_count is not utilized since `i` is involved in the script\nbenchmark:\n vm_poly_method_ov: |\n class C1\n def m\n 1\n end\n end\n class C2\n def m\n 2\n end\n end\n\n o1 = C1.new\n o2 = C2.new\n\n i = 0\n while i<6_000_000\n o = (i % 2 == 0) ? o1 : o2\n # o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m\n i += 1\n end\nloop_count: 1\n | dataset_sample\yaml\ruby\vm_poly_method_ov.yml | vm_poly_method_ov.yml | YAML | 385 | 0.95 | 0.208333 | 0.090909 | react-lib | 360 | 2025-03-25T09:35:39.576005 | MIT | false | cb7921973ce6d779ab017b27754fbfcd |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.