id int64 580 79M | url stringlengths 31 175 | text stringlengths 9 245k | source stringlengths 1 109 | categories stringclasses 160
values | token_count int64 3 51.8k |
|---|---|---|---|---|---|
2,012,094 | https://en.wikipedia.org/wiki/Schiffler%20point | In geometry, the Schiffler point of a triangle is a triangle center, a point defined from the triangle that is equivariant under Euclidean transformations of the triangle. This point was first defined and investigated by Schiffler et al. (1985).
Definition
A triangle with the incenter has its Schiffler point at the point of concurrence of the Euler lines of the four triangles . Schiffler's theorem states that these four lines all meet at a single point.
Coordinates
Trilinear coordinates for the Schiffler point are
or, equivalently,
where denote the side lengths of triangle .
References
External links
Triangle centers | Schiffler point | Physics,Mathematics | 135 |
71,888,296 | https://en.wikipedia.org/wiki/Thallium%28I%29%20nitrate | Thallium(I) nitrate, also known as thallous nitrate, is a thallium compound with the formula TlNO3. It is a colorless and highly toxic salt.
Preparation
Thallium(I) nitrate can be produced by reacting thallium(I) iodide with nitric acid.
However, the production is simpler starting from the metal, its hydroxide or the carbonate:
Toxicity
Thallium(I) nitrate is extremely toxic, like many other thallium compounds. It is highly toxic by ingestion but can also be absorbed through skin due to its solubility in water.
See also
Thallium(III) nitrate
References
Thallium(I) compounds
Nitrates | Thallium(I) nitrate | Chemistry | 150 |
66,155,057 | https://en.wikipedia.org/wiki/Electrified%20reef | An electric reef (also electrified reef) is an artificial reef made from biorock, being limestone that forms rapidly in seawater on a metal structure from dissolved minerals in the presence of a small electric current. The first reefs of this type were created by Wolf Hilbertz and Thomas J. Goreau in the 1980s. By 2011 there were examples in over 20 countries.
History
Artificial reefs have been built since the 1950s using materials including sunken ships and concrete blocks. While artificial reefs have been effective at boosting fish populations and are valuable areas for benthic organisms and other marine life (e.g. sponges) to colonise, they are less viable for coral restoration due to the slow growth of corals and their susceptibility to environmental changes.
In the 1970s, whilst studying how seashells and reefs grow, Wolf Hilbertz discovered a simple method of creating limestone from minerals dissolved in seawater, which he called biorock. Together with Thomas J. Goreau he realised that this process could be adapted to rapidly create artificial coral reefs during the 1980s. Using the names "Sea-ment" and "sea cement", the process was publicised in the 1992 futurology book titled The Millennial Project.
With others, Hilbertz and Goreau made expeditions to the Saya de Malha bank in 1997 and 2002 where they grew an artificial island around steel structures anchored to the sea floor using this process. In the Maldives, 80% of the electric reefs survived the 1998 warming which killed 95% of the natural reef corals.
Goreau continued the work after Hilbertz's death in 2007. By 2011 there were electric reef projects installed in over 20 countries. In 2012, both Goreau and Robert K. Trench published works on how the process could generate building materials as well as restore damaged ecosystems.
Construction process
The base of an electrified reef is a welded electrically conductive frame, often made from construction grade rebar or wire mesh which submerged and attached to the seafloor to which an electrical field applied. The frame (cathode) and a much smaller metal plate (anode) placed at a suitable distance from the frame initiates the electrolytic reaction.
Dissolved calcium carbonate and magnesium hydroxide and other minerals naturally found in seawater breakdown in the vicinity of the anode and recombine and precipitate out of the water onto the cathode. The exact composition of the minerals within the crystal formation is depends on their abundance, the climatic conditions and the voltage used. The structure takes on a whitish appearance within days.
This electric field, together with shade and protection offered by the metal/limestone frame soon attracts colonizing marine life, including fish, crabs, clams, octopus, lobster and sea urchins. Once the structure is in place and minerals begin to coat the surface divers transplant coral fragments from other reefs to the frame which soon bond to the newly accreted mineral substrate.
Because of the availability of evolved oxygen at the cathode and the electrochemically facilitated accretion of dissolved ions such as bicarbonate, they start to grow, some three to five times faster than normal and soon the reef takes on the appearance and utility of a natural reef ecosystem.
As shore protection
Shorelines are increasingly susceptible to beach erosion and loss due to climate change which is resulting in rising sea levels and increasingly frequent and more powerful storms. Large structures such as breakwaters constructed to reflect waves to prevent erosion are problematic and can in fact contribute to further beach erosion since for force of waves is doubled due to the reversal of the wave direction vector with the reflected wave carrying sand from the structure's base back out to sea resulting in the structure failing over time.
Common electrified reef used for shore protection mimic the effect of a natural reef which prevent erosion by dissipating wave energy and causing waves to break before they impact the shore. In nature, large reefs, have been shown to dissipate up to 97% of their energy. They are based around the same open mesh frameworks as those used for coral restoration. Skeletons of dead coral and algae from the reef are then deposited and help grow beaches. Because these reefs mimic the properties of natural reefs they solve some of the challenges they have in storm dissipation and their self-healing qualities helps structures survive extreme storms as long as the electricity supply remains in operation.
In Turks and Caicos trials of electrified reefs of coastal protection survived the two worst hurricanes in the history of the islands, which occurred three days apart and damaged or destroyed 80% of the buildings on the island. Sand was observed to build up around the bases of the reef structure.
In Maldives in 1997, shore protection reefs helped save several buildings, including a hotel, that had risked washing away due to severe beach erosion. The 50-meter-long shore protection reef stabilized and ultimately reversed erosion in several years, even allowing the beach to survive a tsunami in 2004.
Distribution
Electric reef projects had been installed in over 20 countries, in the Caribbean, Indian Ocean, Pacific and Southeast Asia. Projects are located in French Polynesia, Indonesia, Maldives, Mexico, Panama, Papua New Guinea, Seychelles, the Philippines, Thailand and on one of the most remote and unexplored reef areas of the world, the Saya de Malha Bank in the Indian Ocean.
Indonesia has the most reef projects, with sites near over half a dozen islands, including the world's two largest reef restoration projects: Pemuteran with the Karang Lestari and the Gili islands with the Gili Eco Trust.
Non-coral reef projects have been conducted in places such as Barataria Bay, Galveston, seagrasses in the Mediterranean, oyster reefs and salt marshes in New York City, in Port Aransas, and in St. Croix.
Effectiveness
Electrolysis of electric reefs enhances coral growth, reproduction and ability to resist environmental stress. Coral species typically found on healthy reefs gain a major advantage over the weedy organisms that often overgrow them on stressed reefs.
Biorock can enable coral growth and regrowth even in the presence of environmental stress such as rising ocean temperatures, diseases, and nutrient, sediment, and other types of pollution. Biorock represents the only known method that can sustain and grow natural coral species using only basic conducting elements, typically of a common metal such as steel.
The process accelerated growth on coral reefs by as much as fivefold and restoration of physical damage by as much as 20 times. and the rate of growth can be varied by altering the amount of current flowing into the structure.
In one study, Porites colonies with and without an electric field were compared for 6 months after which time the current to the electric reef was eliminated. Growth differences were significant only during the first 4 months with longitudinal growth being relatively high in the presence of the field. The treatment corals survived at a higher rate.
On Vabbinfaru island in the Maldives, a 12-meter, 2 ton steel cage called the Lotus was secured on the sea floor. As of 2012, coral was so abundant on the structure that the cage is difficult to discern. The 1998 El Nino killed 98% of the reef around Vabbinfaru. Abdul Azeez, who led the Vabbinfaru project, said coral growth on the structure is up to five times that of elsewhere. A smaller prototype device was in place during the 1998 warming event and more than 80% of its corals survived, compared to just 2% elsewhere. However, power is no longer supplied to the project, leaving it vulnerable to the next round of bleaching.
Drawbacks
Electric reefs require electrical power to maintain them. In Maldives, several electric reefs successfully survived a 1998 bleaching event that killed off nearly all local wild coral, however after being depowered they were killed by the bleaching event of 2016.
A study conducted in the Bahamas in 2015 showed that the electric field deterred sharks, specifically the bull shark and the Caribbean reef shark, from swimming and feeding in the area. The electric field is believed to affect sharks because of their electroreception abilities, however species with similar capabilities such as the bar jack and Bermuda chub did not appear to be affected by the electric field.
See also
Gili Eco Trust
References
Further reading
"Changes in zooxanthellae density, morphology, and mitotic index in hermatypic corals and anemones exposed to cyanide", 2003
Goreau + Hilbertz: "Marine Ecosystem Restoration: Costs and benefits for coral reefs", World Resource Review, 2005
Vaccarella, R. + Goreau: "Applicazione della elettrodeposizione nel recupero die mattes di Posidonia oceanica", 2008
Goreau + Hilbertz, "Bottom-Up Community-Based Coral Reef and Fisheries Restoration in Indonesia, Panama, and Palau", 2008
Goreau + Hilbertz, "Reef Restoration as a Fisheries Management Tool", UK 2008, on GCRA website
Strömberg + Lundälv + Goreau: "Suitability of Mineral Accretion as a Rehabilitation Method for Cold-Water Coral Reefs", 2010
"Effect of severe hurricanes on Biorock Coral Reef Restoration Projects in Grand Turk, Turks and Caicos Islands", 2010
Goreau, T. J.: "Coral Reef and Fisheries Habitat Restoration in the Coral Triangle", Indonesia 2010
External links
Wolf Hilbertz website
Global Coral Reef Alliance
Biorock.net
CCell Supplier of equipment
Marine biology | Electrified reef | Biology | 1,928 |
22,824,905 | https://en.wikipedia.org/wiki/Hop%20%28networking%29 | In wired computer networking a hop occurs when a packet is passed from one network segment to the next. Data packets pass through routers as they travel between source and destination. The hop count refers to the number of network devices through which data passes from source to destination (depending on routing protocol, this may include the source/destination, that is, the first hop is counted as hop 0 or hop 1).
Since store and forward and other latencies are incurred through each hop, a large number of hops between source and destination implies lower real-time performance.
Hop count
In wired networks, the hop count refers to the number of networks or network devices through which data passes between source and destination (depending on routing protocol, this may include the source/destination, that is, the first hop is counted as hop 0 or hop 1). Thus, hop count is a rough measure of distance between two hosts. For a routing protocol using 1-origin hop counts (such as RIP), a hop count of n means that n networks separate the source host from the destination host. Other protocols such as DHCP use the term "hop" to refer to the number of times a message has been forwarded.
On a layer 3 network such as Internet Protocol (IP), each router along the data path constitutes a hop. By itself, this metric is, however, not useful for determining the optimum network path, as it does not take into consideration the speed, load, reliability, or latency of any particular hop, but merely the total count. Nevertheless, some routing protocols, such as Routing Information Protocol (RIP), use hop count as their sole metric.
Each time a router receives a packet, it modifies the packet, decrementing the time to live (TTL). The router discards any packets received with a zero TTL value. This prevents packets from endlessly bouncing around the network in the event of routing errors. Routers are capable of managing hop counts, but other types of network devices (e.g. Ethernet hubs and bridges) are not.
Hop limit
Known as time to live (TTL) in IPv4, and hop limit in IPv6, this field specifies a limit on the number of hops a packet is allowed before being discarded. Routers modify IP packets as they are forwarded, decrementing the respective TTL or hop limit fields. Routers do not forward packets with a resultant field of 0 or less. This prevents packets from following a loop forever.
Next hop
When configuring network devices the hop may refer to next hop. When a hop forwards network traffic the next hop is what the local hop considers to be the next element towards the final destination. A routing table usually consists of a list of possible destination networks or IP addresses for which the next hop is known. By only storing next-hop information, next-hop routing or next-hop forwarding reduces the size of routing tables. A given gateway only knows one step along the path, not the complete path to a destination. If no next hop is known a hop may silently discard a packet or return an error depending on the type of network. Devices in consumer networks are often only provided with routes for the local network as well as a default gateway as the traffic can only ever reach the local network or be forwarded to the internet service provider. Routers require multiple routes to be able to forward traffic between different networks. In practice routes are configured either implicitly with address assignment by means of a netmask, by manual assignment using tools such as route, or dynamically using configuration protocols like DHCP or routing protocols.
In TCP/IP networks using Ethernet as the link layer the destination is always an IP address, however the next hop is not technically required to be of the same address family. As the packet needs to be forwarded on the link layer the next hop needs only to resolve to a link layer address such as a MAC address. On Linux for instance the next hop is required to be either an IP address or an interface. The address families of the destination address and the next hop need not match, therefore it is possible to forward IPv4 traffic on an IPv6 network and vice versa. If no address is provided the destination is assumed to be present on the local link, otherwise the next hop is used. Either address is then passed to NDP or ARP for IPv6 and IPv4 respectively to be resolved to the link layer address required to pass the packet along on the network stack. In other scenarios link layer resolution may require different methods such as a virtual private network which needs to determine the peer to send the packet to. What is common to forwarding is that the next hop needs to be logically connected to the current hop, thereby building an uninterrupted chain between source and destination. A logical connection does not necessitate a physical connection as the packet may be passed on to a virtual tunnel.
Source routing describes networks in which data is encoded in the packet that allows a hop (such as the source of the packet) to influence routing decisions on intermediary hops. This allows for advanced teletraffic engineering used to improve network delay, decrease network congestion, or meet other requirements.
Diagnostics
The traceroute command can be used to measure the number of router hops from one host to another. Hop counts are often useful to find faults in a network or to discover if routing is indeed correct.
Wireless ad hoc networking
In a wireless ad hoc network, commonly, every participating node is also acting as a router. This means that the terms "hop" and "hop count" are often the subject of confusion. Often, the sending node is simply counted as the first hop, thus yielding the same number for "hops" for both interpretations of "hop" as "traversed routers" and "jumps from node to node". For example, RFC 6130 defines a "1-hop neighbor" as any other node that is directly reachable via the wireless interface.
See also
Internet Control Message Protocol
Ping (networking utility)
References
Computer networking
Routing
de:Hop (Netzwerktechnologie) | Hop (networking) | Technology,Engineering | 1,265 |
2,161,298 | https://en.wikipedia.org/wiki/Bioglass%2045S5 | Bioglass 45S5 or calcium sodium phosphosilicate, is a bioactive glass specifically composed of 45 wt% SiO2, 24.5 wt% CaO, 24.5 wt% Na2O, and 6.0 wt% P2O5. Typical applications of Bioglass 45S5 include: bone grafting biomaterials, repair of periodontal defects, cranial and maxillofacial repair, wound care, blood loss control, stimulation of vascular regeneration, and nerve repair.
The name "Bioglass" was trademarked by the University of Florida as a name for the original 45S5 composition. It should therefore only be used in reference to the 45S5 composition and not as a general term for bioactive glasses. Bioglass 45S5 is available commercially under the registered trade name NovaMin, which is owned by the pharmaceutical company GlaxoSmithKline. NovaMin is bioactive glass that has been ground into a fine particulate with a median size of less than 20 μm. It can reduce dentin hypersensitivity by blocking open dentinal tubules and by supplying calcium (Ca2+) and phosphate () ions to form hydroxycarbonate apatite (HCA), the principal mineral component of bone tissue in mammals. NovaMin is the active ingredient in Sensodyne "Repair & Protect" toothpaste, except when sold in the United States, containing stannous fluoride instead.
Characteristics
45S5 bioactive glass is white in color and is in powder form, with particulates with a median size of less than 20 μm. Its chemical composition by weight is: silica (SiO2) 43–47%, calcium oxide (CaO) 22.5–26.5%, phosphorus pentoxide (P2O5) 5–7% and sodium oxide (Na2O) 22.5–26.5%.
Glasses are non-crystalline disordered solids that are commonly composed of silica-based materials with other minor additives. Compared to soda-lime glass (commonly used, as in windows or bottles), Bioglass 45S5 contains less silica and higher amounts of calcium and phosphorus. The 45S5 name signifies glass with 45% by weight of SiO2 and 5:1 molar ratio of calcium to phosphorus. This high ratio of calcium to phosphorus promotes formation of apatite crystals; calcium and silica ions can act as crystallization nuclei. Lower Ca:P ratios do not bond to bone. Bioglass 45S5's specific composition is optimal in biomedical applications because of its similar composition to that of hydroxyapatite, the mineral component of bone. This similarity provides Bioglass 45S5's ability to be integrated with living bone.
This composition of bioactive glass is mechanically soft in comparison to other glasses. It can be machined, preferably with diamond tools, or ground to powder. Bioglass 45S5 has to be stored in a dry environment, as it readily absorbs moisture and reacts with it. Bioglass 45S5 is the first formulation of an artificial material that was found to chemically bond with bone, and its discovery led to a series of other bioactive glasses. One of its main medical advantages is its biocompatibility, seen in its ability to avoid an immune reaction and fibrous encapsulation. Its primary application is the repair of bone injuries or defects too large to be regenerated by the natural process.
History
Bioglass 45S5 is important to the field of biomimetic materials as one of the first completely synthetic materials that seamlessly bonds to bone. It was developed by Larry L. Hench in the late 1960s. The idea for the material came to him during a bus ride in 1967. While working as an assistant professor at the University of Florida, Hench decided to attend the U.S. Army Materials Research Conference held in Sagamore, New York, where he planned to talk about radiation resistant electronic materials. He began discussing his research with a fellow traveller on the bus, Colonel Klinker, who had recently returned to the United States after serving as an Army medical supply officer in Vietnam.
After listening to Hench's description of his research, the Colonel asked, “If you can make a material that will survive exposure to high energy radiation can you make a material that will survive exposure to the human body?” Klinker then went on to describe the amputations that he had witnessed in Vietnam, which resulted from the body's rejection of metal and plastic implants. Hench realized that there was a need for a novel material that could form a living bond with tissues in the body.
When Hench returned to Florida after the conference, he submitted a proposal to the U.S. Army Medical Research and Design Command. He received funding in 1968, and in November 1969 Hench began to synthesize small rectangles of what he called 45S5 glass. Ted Greenlee, Assistant Professor of Orthopaedic Surgery at the University of Florida, implanted them in rat femurs at the VA Hospital in Gainesville. Six weeks later, Greenlee called Hench asking, "Larry, what are those samples you gave me? They will not come out of the bone. I have pulled on them, I have pushed on them, I have cracked the bone and they are still bonded in place."
With this first successful experiment, Bioglass was born and the first compositions studied. Hench published his first paper on the subject in 1971 in the Journal of Biomedical Materials Research, and his lab continued to work on the project for the next 10 years with continued funding from the U.S. Army. By 2006, there were over 500 papers published on the topic of bioactive glasses from different laboratories and institutions around the world. The first successful surgical use of Bioglass 45S5 was in replacement of ossicles in the middle ear as a treatment of conductive hearing loss, and the material continues to be used in bone reconstruction applications today.
Other uses include cones for implantation into the jaw following a tooth extraction. Composite materials made of Bioglass 45S5 and patient's own bone can be used for bone reconstruction. Further research is being conducted for the development of new processing techniques to allow for more applications of Bioglass.
Applications
Bioglass 45S5 is used in jaw and orthopedics applications, in this way it dissolves and can stimulate the natural bone to repair itself. Bioactive glass offers good osteoconductivity and bioactivity, it can deliver cells and is biodegradable. This makes it an excellent candidate to be used in tissue engineering applications. Although this material is known to be brittle, it is still used extensively to enhance the growth of bone since new forms of bioactive glasses are based on borate and borosilicate compositions. Bioglass can also be doped with varying quantities of elements like copper, zinc, or strontium which can allow the growth and formation of healthy bone. The formation of neocartilage can also be induced with bioactive glass by using an in vitro culture of chondrocyte-seeded hydrogels and can serve as a subchondral substrate for tissue-engineered osteochondral constructs.
The borate-based bioactive glass has controllable degradation rates in order to match the rate at which actual bone is formed. Bone formation has been shown to enhance when using this type of material. When implanted into rabbit femurs, the 45S5 bioactive glass showed that it could induce bone proliferation at a much quicker rate than synthetic hydroxyapatite (HA). 45S5 glass can also be osteoconductive and osteoinductive because it allows for new bone growth along the bone-implant interface as well as within the bone-implant interface. Studies have been conducted to determine the process by which it can induce bone formation. It was shown that 45S5 glass degrades and releases sodium ions, as well as soluble silica, the combination of all these ions is said to produce new bone. Borate bioglass has proven that it can support cell proliferation and differentiation in vitro and in vivo. It also has shown that it is suitable to be used as a substrate for drug release when treating bone infection. However, there has been a concern as to whether or not the release of boron into a solution as borate ions will be toxic to the body. It has been shown that in static cell culture conditions, borate glasses were toxic to cells, but not in dynamic culture conditions.
Bioactive glass was applied to medical devices to help restore the hearing to a deaf patient using Bioglass 45S5 in 1984. The patient went deaf due to at ear infection that degraded two of the three bones in her middle ear. An implant was designed to replace the damaged bone and carry sound from the eardrum to the cochlea, restoring the patient's hearing. Before this material was available, plastics and metals would be used because they did not produce a reaction in the body; however, they eventually failed because tissue would grow around them after implantation. A prosthesis made up of Bioglass 45S5 was made to fit the patient and most of the prosthesis that were made were able to maintain functionality after 10 years. The Endosseous Ridge Maintenance Implant made of Bioglass 45S5 was another device that could be inserted into tooth extraction sites that would repair tooth roots and allow for a stable ridge for dentures.
Another area in which bioactive glass has been investigated to use is tooth enamel reconstruction, which has proven to be a difficult task in the field of dentistry. Enamel is made up of a very organized hierarchical microstructure of carbonated hydroxyapatite nanocrystals. It has been reported that Bioglass 45S5-phosphoric acid paste can be used to form an interaction layer that can obstruct dentinal tubule orifices and can therefore be useful in the treatment of dentin hypersensitivity lesions. This material in an aqueous environment could have an antibacterial property that is advantageous in periodontal surgical procedures. In a study done with 45S5 Bioglass, biofilms of Streptococcus sanguinis were grown on inactive glass particulates and the biofilm grown on the Bioglass was significantly lower than those that were on the inactive glass. It was concluded that Bioglass may reduce bacterial colonisation which could aid osseointegration. A highly effective antibacterial bioactive glass is S53P4, which has been reported to exhibit a high antimicrobial activity and did not seem to select for resistance in the microbial strains tested. Bioactive glasses that are sol-gel derived, such as CaPSiO and CaPSiO II, have also exhibited antibacterial properties. Studies done with S. epidermidis and E. coli cultured with bioactive glass have shown that the 45S5 bioactive glass have a very high antibacterial resistance. It was also observed in the experiment that there were needle-like bioglass debris which could have ruptured the cell walls of the bacteria and rendered them inactive.
GlaxoSmithKline is using this material as an active ingredient in toothpaste under the commercial name NovaMin, which can help repair tiny holes and decrease tooth sensitivity. More advanced fluoride-containing formulations of Bioglass have been developed, which provide stronger and longer-lasting protection against sensitivity. The inclusion of fluoride within the glass rather than as a soluble addition, such as the toothpaste BioMin, is claimed to optimise the rate of development of apatite, which shields the teeth from sensitivity for up to 12 hours.
Mechanism of action
When implanted, Bioglass 45S5 reacts with the surrounding physiological fluid, causing the formation of a hydroxyl carbonated apatite (HCA) layer at the material surface. The HCA layer has a similar composition to hydroxyapatite, the mineral phase of bone, a quality which allows for strong interaction and integration with bone. The process by which this reaction occurs can be separated into 12 steps. The first 5 steps are related to the Bioglass response to the environment within the body, and occur rapidly at the material surface over several hours. Reaction steps 6–10 detail the reaction of the body to the integration of the biomaterial, and the process of integration with bone. These stages occur over the scale of several weeks or months. The steps are separated as follows:
Alkali ions (such as Na+ and Ca2+) on the glass surface rapidly exchange with hydrogen ions or hydronium from surrounding bodily fluids. The reaction below shows this process, which causes hydrolysis of silica groups. As this occurs, the pH of the solution increases.
Si⎯O⎯Na+ + H+ + OH− → Si⎯OH+ + Na+ (aq) + OH−
Due to an increase in the hydroxyl (OH−) concentration at the surface (a result of step 1), a dissolution of the silica glass network occurs, seen by the breaking of Si⎯O⎯Si bonds. Soluble silica is transformed to the form of Si(OH)4 and silanols (Si⎯OH) creation occurs at the material surface. The reaction occurring in this stage is shown below:
Si⎯O⎯Si + H2O→ Si⎯OH + OH⎯Si
The silanol groups at the material surface condense and repolymerize to form a silica-gel layer at the surface of bioglass. As a result of the first steps, the surface contains very little alkali content. The condensation reaction is shown below:
Si⎯OH + Si⎯OH → Si⎯O⎯Si
Amorphous Ca2+ and gather at the silica-rich layer (created in step 3) from both the surrounding bodily fluid and the bulk of the Bioglass. This creates a layer composed primarily of CaO⎯P2O5 on top of the silica layer.
The CaO⎯P2O5 film created in step 4 incorporates OH− and from the bodily solution, causing it to crystallize. This layer is called a mixed carbonated hydroxyl apatite (HCA).
Growth factors adsorb (adsorption) to the surface of Bioglass due to its structural and chemical similarities to hydroxyapatite.
Adsorbed growth factors cause the activation of M2 macrophages. M2 macrophages tend to promote wound healing and initiate the migration of progenitor cells to an injury site. In contrast, M1 macrophages become activated when a non-biocompatible material is implanted, triggering an inflammatory response.
Triggered by M2 macrophage activation, mesenchymal stem cells and osteoprogenitor cells migrate to the Bioglass surface and attach to the HCA layer.
Stem cells and osteoprogenitor cells at the HCA surface differentiate to become osteogenic cells typically present in bone tissue, particularly osteoblasts.
The attached and differentiated osteoblasts generate and deposit extracellular matrix (ECM) components, primarily type I collagen, the main protein component of bone.
The collagen ECM becomes mineralized as normally occurs in native bone. Nanoscale hydroxyapatite crystals form a layered structure with the deposited collagen at the surface of the implant.
Following these reactions, bone growth continues as the newly recruited cells continue to function and facilitate tissue growth and repair. The Bioglass implant continues to degrade and be converted to new ECM material.
Manufacturing
There are two main manufacturing techniques that are used for the synthesis of bioglass. The first is melt quench synthesis, which is the conventional glassmaking technology used by Larry Hench when he first manufactured the material in 1969. This method includes melting a mixture of oxides such as SiO2, Na2O, CaO and P2O5 at high temperatures generally above 1100–1300 °C. Platinum or platinum alloy crucibles are used to avoid contamination, which would interfere with the product's chemical reactivity in organism. Annealing is a crucial step in forming bulk parts, due to high thermal expansion of the material. Heat treatment of Bioglass reduces the volatile alkali metal oxide content and precipitates apatite crystals in the glass matrix. However, the scaffolds that result from melt quench techniques are much less porous compared to other manufacturing methods, which may lead to defects in tissue integration when implanted in vivo.
The second method is sol-gel synthesis of Bioglass. This process is carried out at much lower temperatures than the traditional melting methods. It involves the creation of a solution (sol), which is composed of metal-organic and metal salt precursors. A gel is then formed through hydrolysis and condensation reactions, and it undergoes thermal treatment for drying, oxide formation, and organic removal. Because of the lower fabrication temperatures used in this method, there is a greater level of control on the composition and homogeneity of the product. In addition, sol-gel bioglasses have much higher porosity, which leads to a greater surface area and degree of integration in the body.
Newer methods include flame and microwave synthesis of Bioglass, which has been gaining attention in recent years. Flame synthesis works by baking the powders directly in a flame reactor. Microwave synthesis is a rapid and low-cost powder synthesis method in which precursors are dissolved in water, transferred to an ultrasonic bath, and irradiated.
Shortcomings
A setback to using Bioglass 45S5 is that it is difficult to process into porous 3D scaffolds. These porous scaffolds are usually prepared by sintering glass particles that are already formed into the 3D geometry and allowing them to bond to the particles into a strong glass phase made up of a network of pores. Since this particular type of bioglass cannot fully sinter by viscous flow above its Tg, and its Tg is close to the onset of crystallization, it is hard to sinter this material into a dense network.
45S5 glass also has a slow degradation and rate of conversion to an HA-like material. This setback makes it more difficult for the degradation rate of the scaffold to coincide with the rate of tissue formation. Another limitation is that the biological environment can be easily influenced by its degradation. Increases in the sodium and calcium ions and changing pH is due to its degradation. However, the roles of these ions and their toxicity to the body have not been fully researched.
Methods of improvement
Several studies have investigated methods to improve the mechanical strength and toughness of Bioglass 45S5. These include creating polymer–glass composites, which combine the bioactivity of Bioglass with the relative flexibility and wear resistance of different polymers. Another solution is coating a metallic implant with Bioglass, which takes advantage of the mechanical strength of the implant's bulk material while retaining bioactive effects at the surface. Some of the most notable modifications have used various forms of carbon to improve the properties of 45S5 glass.
For example, Touri et al. developed a method to incorporate carbon nanotubes (CNTs) into the structure without interfering with the material's bioactive properties. CNTs were chosen because of their large aspect ratio and high strength. By synthesizing Bioglass 45S5 on a CNT scaffold, the researchers were able to create a composite that more than doubled the compressive strength and the elastic modulus when compared to the pure glass.
Another study carried out by Li et al. looked into different properties, such as the fracture toughness and wear resistance of Bioglass 45S5. The authors loaded graphene nanoplatelets (GNP) into the glass structure through a spark plasma sintering method. Graphene was chosen because of its high specific surface area and strength, as well as its cytocompatibility and lack of interference with Bioglass 45S5's bioactivity. The composites that were created in this experiment achieved a fracture toughness of more than double the control. In addition, the tribological properties of the material were greatly improved.
See also
Mechanical properties of biomaterials
Synthesis of bioglass
References
Glass compositions
Biomaterials | Bioglass 45S5 | Physics,Chemistry,Biology | 4,174 |
9,146,267 | https://en.wikipedia.org/wiki/Optical%20solar%20reflector | An optical solar reflector (OSR) is a component of a vehicle or machine designed to fly in outer space. The reflector consists of a top layer made out of quartz, over a reflecting layer made of metal. OSRs are used for radiators on spacecraft.
The quartz outer layer lets the solar light through which reflects on the metal layer. This results in a low absorption coefficient. The quartz layer is a good IR emitter. The result of these properties is a good emitting, low absorbing material, thus making it a cold material.
OSRs are often used in Geostationary orbits, where high radiation levels would cause other thermal surface coatings to rapidly degrade. This is due to the fact that the vast majority of geostationary orbits lie in the Van Allen Radiation Belt.
Optical solar reflectors are a type of second surface mirror.
See also
Radiative cooling
Spacecraft components
References
Spacecraft components | Optical solar reflector | Physics,Astronomy | 187 |
23,241,429 | https://en.wikipedia.org/wiki/Sciography | Sciography, also spelled sciagraphy or skiagraphy, is a branch of the science of perspective dealing with the projection of shadows, or the delineation of an object in perspective with its gradations of light and shade. The term comes from the Greek "shadow" and , "write".
In architectural drawing, sciography is the study of shades and shadows cast by simple architectural forms on plane surfaces.
In general sciography, the light source is imagined as the sun inclined at 45 degrees to both vertical plane and horizontal plane coming from left hand side. The resultant shadow is then drawn.
See also
Index of optics articles
References
Bibliography
Technical drawing
Architecture | Sciography | Engineering | 135 |
12,900,165 | https://en.wikipedia.org/wiki/Myodocarpus%20angustialatus | Myodocarpus angustialatus is the provisional name for a threatened species of plant in the family Myodocarpaceae, which has not yet been formally described scientifically. It is endemic to New Caledonia.
References
Endemic flora of New Caledonia
angustialatus
Vulnerable plants
Undescribed plant species
Taxonomy articles created by Polbot | Myodocarpus angustialatus | Biology | 70 |
5,732,655 | https://en.wikipedia.org/wiki/Alternate%20ending | An alternate ending (or alternative ending) is an ending of a story that was considered, or even written or produced, but ultimately discarded in favour of another resolution. Generally, alternative endings are considered to have no bearing on the canonical narrative.
Examples in literature
Charles Dickens' novel Great Expectations originally had a bleaker conclusion, with Pip meeting Estella, but after she remarried. In a letter, Dickens stated that he had been persuaded by Edward Bulwer-Lytton to change it prior to publication.
Ernest Hemingway struggled with the ending of A Farewell to Arms. By his count, he wrote 39 of them "before I was satisfied." However, a 2012 edition of the book included 47 alternative endings.
Robert A. Heinlein originally killed off the protagonist of Podkayne of Mars, but grudgingly let her live in response to his publisher's objections.
John Green tied one of the characters to railway tracks in his second draft of The Fault in Our Stars to explore the trolley problem. He also wrote an ending in which Hazel and Van Houten die in a shootout with a drug lord.
The original German version of Felix Salten's The Hound of Florence differs greatly from the English translation. The German version ends in tragedy: the archduke stabs the dog to death, killing Lukas, and his body is disposed of. In the English translation, a wholly new ending of six more pages has been written: Lukas survives, gets medication and is united with the courtesan.
Examples in movies
An alternative ending is often filmed before being scrapped as a deleted scene, and may be included as a special feature in the film's home-media releases. Some movies also present the alternative ending on international releases as well as their international home media release. In other cases, ideas that were presented but discarded early on are alluded to by the production team in commentary or interviews.
The following are examples of alternative endings to movies:
1408: An alternative ending is present on the director's cut disc (much like The Butterfly Effect, with a few deleted scenes reinserted). Mike Enslin dies in the fire he causes. At his burial, his wife is approached by the hotel manager, offering his personal belongings. She refuses, and he lets her know that her husband did not die in vain. Back in his vehicle he listens to the tape recorder, and screams in fear as he sees Enslin's burned deformed body in his back seat for only a moment. The film closes with an apparition of Mike Enslin still in 1408, muttering to himself. He hears his daughter's voice, and finally exits the room with her.
28 Days Later: Several darker alternative endings were filmed and put on the DVD release. The first has Jim gravely injured and taken to a hospital. He dies before he can be given medical attention, and his body is left behind, completing a cycle; he woke up alone in a hospital and has now died there. Some versions also involve him dreaming of the accident that put him in the hospital at the beginning of the film. An unfilmed ending picks up after Frank has been infected, where they take him to a research complex and Jim sacrifices his own life to give him a total blood transfusion to restore him, and he is once again left alone in a hospital bed.
3 Ninjas: The American cut originally showed that the boys had won the basketball challenge and effortlessly won Emily's bike back. In an extended international version, they lose the basketball challenge along with their own bikes, so they fight the bullies to get them back. In the United States, this alternative ending can only be seen on certain television channels such as Starz, Showtime and Showtime MAX; international DVDs have this version, as well.
Apag: The domestic screening of the film in the Philippines as part of the 2023 Metro Manila Summer Film Festival features an alternate ending with a "culinary violence" twist. The film had a "happy ending" in prior screenings at international film festivals. The ending was introduced to make it eligible to enter the 2023 MMSFF.
Army of Darkness: In an alternative ending Ash inadvertently drinks too much of the potion that would make him sleep long enough to wake up in his own time, and wakes up in a post-apocalyptic wasteland.
The Astronaut's Wife: When Spencer is killed, Jillian is not possessed by the alien. Instead, she moves out to the country. Sitting beneath a tree, looking up at the stars, she tunes her radio to the same signals Spencer was receiving while possessed by the alien, her twin babies controlling her movements from inside the womb, listening, and waiting.
Blade: Trinity: The original ending is far more ambiguous with Dracula and Blade's fates not as determined. The ending only appears in the unrated DVD and was intended by the director David S. Goyer. In another alternative ending Hannibal King and Abigail Whistler confront a werewolf.
The Bourne Identity: An alternative ending on the DVD has Jason Bourne collapsing during the search for Marie, waking up with Abbot standing over him, and getting an offer to return to the CIA. The ending was filmed after the studio became concerned that the film's treatment of American foreign policy and the intelligence community would be perceived as anti-American following the September 11 attacks.
The Butterfly Effect: Evan watches a home video of his mother pregnant with him and returns to the memory of himself as a fetus. Convinced that his very existence has ruined the lives of those around him, he strangles himself with his umbilical cord and dies, stillborn. In the theatrical ending, he simply stops himself from becoming friends with Kayleigh.
Cats & Dogs: Mr. Tinkles was taken to a pet hospital by Sophie the Maid to be neutered, however his cat followers manage to free him by tackling Sophie.
Child's Play 2: An extended ending reveals that a chunk of Chucky's skin after his head exploded was mixed in with the Good Guy doll making plaster. A machine is then seen making a new Good Guy Doll head, which then forms a sinister smile.
Clash of the Titans: After defeating the Kraken and Hades, Andromeda falls into the sea and Perseus dives in to save her. When he reaches her, he embraces her with a passionate kiss, indicating that they have fallen in love. After reaching the shore and regaining consciousness, Perseus tells Andromeda that he will return. Getting on Pegasus, he flies to Mount Olympus and confronts Zeus, stating that he does not wish to be one of them. After slamming his sword into the gods' map and shattering the models of every living person, he flies on Pegasus over the sea, presumably back to Argos.
Clerks: Dante is still inside the Quick Stop after it closes. A customer enters and, without saying a word, shoots Dante and empties the cash register. A customer comes in and steals cigarettes without noticing Dante's body behind the counter.
Clue had four different endings, and each one distributed to theatres had one of three of them. The video and DVD version had all of these three endings on it. The fourth one has not been included because the director did not approve of it.
Die Hard with a Vengeance: In the first filmed ending, Simon Gruber smuggles the gold out of the country disguised as Empire State Building statuettes and McClane takes the blame for the failure to stop the robbery. McClane locates Gruber months later in a bar in Hungary and makes him play a game called "McClane Says". This involves a form of Russian roulette with a rocket launcher with the sights removed, so it cannot be determined which end is which. McClane poses riddles similar to the ones he played in New York. When Gruber gets a riddle wrong, McClane forces him at gunpoint to fire the launcher, which blows Gruber to bits. This ending is in the novelization, only McClane fools Gruber into thinking the tube-like launcher is pointed at McClane. Gruber guesses the trick question and shoots himself.
Diary of a Wimpy Kid: Rodrick Rules: Greg finds out Rodrick told the story of how he got stuck in the lady's room at Leisure Towers to his friends, and his friends told their family and friends and so on. But when he comes to school, everyone is congratulating him, figuring out someone messed up and exaggerated the story.
Dodgeball: A True Underdog Story: The Average Joes lose the game when White Goodman hits Peter with the ball. According to the DVD commentary, this was the writer's original intention for the movie, but the studio insisted it be changed when test audiences reacted poorly to the unhappy ending. (The antagonist references this at the end of the movie, by mocking the audience for wanting a happy ending and saying, "You happy now?")
Ella Enchanted: The movie originally ended after the wedding, where Hattie is turned into a frog by Lucinda, Ella's father demands a divorce from Dame Olga, Heston is still alive but suffering torment from the Char Fan Club, Slannen becomes a lawyer, and Dame Olga ends up with Nish. The scene was cut and replaced with a musical ending with the entire cast present, and they exit like they do on stage.
Ernest Goes to Jail: The network broadcast version of the film included an extra scene where the bank guards demonstrate a computerized security system to the branch manager while Ernest is seen working as a bank clerk (his dream job in the film). The movie concludes when Ernest's computer shocks him and two file cabinets move toward him.
Fatal Attraction: Alex Forrest was originally scripted to commit suicide and make it look like Dan murdered her, for which he is arrested. Test audiences did not respond well to this finale, mainly due to a lack of revenge from Beth and the family. This resulted in a three-week re-shoot for the action-filled sequence in the bathroom and Alex's death by shooting.
Final Destination: Alex is killed when he grabs the downed power line to save Claire, ending Death's pattern. In the final scene, it turns out that Claire is pregnant with Alex's baby.
Final Destination 2: The original movie was supposed to end with Kimberly and Officer Burke embracing in the hospital after Kimberly is revived. Instead, David Ellis, the director, decided to end the film with a bang and include the barbecue scene.
Final Destination 3: The film has two alternative endings. In the first ending, Ian is fully crushed by the sign and Wendy, Kevin, and Julie decide what to do next. In the second ending, which involves the subway, the train headed for Wendy actually hits her, instead of being a vision.
The Final Destination: In one alternative ending, Nick realizes he has to kill himself for the chain to end. He puts out the initial fire and then jumps out a window, killing himself. Janet and Lori sadly embrace, as Lori says, "The chain is broken." A piece of the chain holding the A/C unit breaks and lands next to Lori. Lori picks it up, and the unit drops and crushes Lori and Janet. In another, Nick is also crushed with Lori in the escalator, instead of it being a vision.
Final Destination 5: In the ending in the original script, Sam, Molly and Nathan take a walk through a memorial park believing they finally cheated Death, but Death is still in action after Nathan is crushed by Flight 180's landing gear while Sam and Molly stare at him in horror.
First Blood: In an alternative ending, John Rambo commits suicide rather than be arrested. This ending is included as an extra on the First Blood Ultimate Edition DVD released in 2004.
Friday the 13th Part III: Chris wakes up the morning after killing Jason Voorhees, only to find he is still alive when she opens the back door of the lake house. Jason cuts off Chris's head. Chris wakes up screaming in the back of the police car, revealing her entire death was a dream and Jason remains dead in the barn.
Friday the 13th: The Final Chapter: An alternative ending, included in the 2009 Deluxe Edition DVD, shows a dream sequence where Trish finds her mother drowned in the bathtub. Mrs. Jarvis' eyes open and Jason appears behind Trish, ready to strike. Trish then wakes up in the hospital in a scene reminiscent of the ending of the first movie. In his commentary, the director says this scene was cut because it interfered with the idea that this would be the final film.
Game of Death: This movie has two alternative endings. In the Hong Kong Cantonese print, after Billy defeats Dr. Land, who falls from the rooftop, the police and an ambulance arrive. The police arrest Billy and the ambulance takes Dr. Land. In the Mandarin print it shows that after defeating Dr. Land, Billy is with Ann at a harbor, saying good-bye to Jim. The next scene shows a ship departing and a picture of Bruce Lee. This scene is also in the Hong Kong ending.
Happy Death Day: An alternative ending has Tree recovering in the hospital from her ordeal with Lori, while being visited by her father and Carter. After they leave, a nurse enters and reveals herself as Stephanie Butler, the wife of Dr. Gregory Butler. She kills Tree out of revenge for her affair with Gregory.
Hide and Seek: This movie had many different endings on whether Dakota Fanning's character, Emily, had split personality and whether she ended up at a mental hospital or at a new home.
I Am Legend: As the "Alpha Monster" begins to break into the lab area, Robert Neville realizes that all they want is the "Monster Woman" back. Neville rolls her out of the lab and awakens her out of her medicated state, and the "Alpha Monster" picks her up and takes her away.
I Know What You Did Last Summer: In the alternative ending, Julie receives an invite to a pool party and reads an email that reads "I still know". This scene was used in the trailer for the film.
Infernal Affairs: In the mainland Chinese version, the police find evidence proving Lau Kin Ming is a triad mole and arrest him. The sequel, Infernal Affairs III, follows the original Hong Kong ending where Lau gets away with his crime.
Little Shop of Horrors: The original conclusion to the off-Broadway musical was filmed and preferred by the director Frank Oz and the majority of the actors. However, test audiences disliked how Audrey and Seymour, the main protagonists, were both killed by the evil alien plant, and the ending had to be re-shot so that their deaths were removed. The original ending is maintained in the film's DIrector's Cut.
Men in Black II: The original ending featured a scene in which the towers of the World Trade Center open to release a swarm of UFOs. After the terrorist attacks in 2001, the ending was reshot.
Orphan: In an alternative ending, Esther hurries into her room, face covered in blood. She re-applies her makeup, puts on the dress she wore for her first day of school, and greets the police, who arrived after receiving Kate's frantic call before she reached the house. It is not explained whether or not she has killed Kate or Max, although the dead body of John can be seen.
Paranormal Activity: In one version of the film that was shown at only one public viewing, Katie returns to the bedroom after struggling with Micah. She is holding a knife and covered in blood. She closes and locks the bedroom door, then slits her own throat. There is a third ending in which, after killing Micah, Katie returns to the bedroom and sits down against the bed with the knife in her hand, rocking back and forth, for almost two days straight. Katie's sister comes looking for her and screams after seeing Micah's body. The creature possessing Katie leaves her body and scares Katie's sister out of the house, before returning to Katie. The police arrive at the house about 30 minutes later, and Katie comes out of the bedroom with her knife, calling for Micah. Following a heated confrontation, a door behind the officers slams shut, causing the officers to shoot Katie.
Paycheck: Jennings and Rachel are wondering what to do next when Jennings spots the kid who stole the engagement ring from him on the subway coming out of a pawn shop. He goes into the shop for a few minutes and when he comes back he asks Rachel "do you believe in fate?" and they kiss. It is assumed he then proposes to her.
Pineapple Express: Both main characters are killed off by a man they forgot to shoot down.
Rocky Balboa: Rocky defeats Mason "The Line" Dixon by split decision.
Ronin: Deirdre decides against joining Sam and Vincent in the café. As she is getting into her car, she is snatched into a van and killed by men in the IRA who call her a traitor. Sam and Vincent finish their conversation and depart, completely unaware of what has just happened.
Scream 3: When Ghostface enters the screening room, he does not have a white sheet covering him. After Roman notices Sidney Prescott has disappeared after he supposedly killed her, he searches the screening room for her shouting and telling her all the doors are locked, most of the scene shows Sidney's point of view which was not shown in the actual ending. Also, Kincaid does not enter the screening room in this ending.
Scary Movie 3: Cindy is told Cody does not exist. After hitting a few people in the face with a shovel, Cindy asks everybody who is not real to stand a specific spot. Cody goes there, and is followed by Santa Claus. The aliens invade but George stops them by transforming into the Hulk. President Harris tries to hulk out, but ends up soiling his pants. Cindy enters the Logan House, where she is attacked by Tabitha. She is teleported away to Aunt Shaneequa, who teaches her how to defeat Tabitha. Cindy must then confront hundreds of Tabithas. She wins the battle by performing moves from The Matrix and teleports back to the Logan House. The cast then gets into a car with the President, but are horrified to learn that the driver happens to be M. Night Shyamalan.
Scott Pilgrim vs. the World: The original ending of the film saw Scott ending up with Knives, but was changed to fit in line with the ending of the graphic novels.
Seven: Writer Andrew Kevin Walker completed two separate drafts of the ending. The first was used in the theatrical edition. In the second, John Doe is killed by Somerset instead of Mills. This alternative ending sequence was storyboarded and is included in the published script, but never filmed.
Sliver: Carly Norris and the killer fly over a volcano when the killer suddenly confesses his crimes. He then veers the aircraft into the volcano and leaves the audience to decide whether they survive.
Smokin' Aces: Rather than pulling the life support cords of Israel and Sparazza as he does in the used ending, he instead draws his weapon and empties his pistol into them.
Super Troopers: Another ending was filmed that starts the same way as the real ending, by the police station being closed down. The former officers are now working in a meat packing plant. They tell their boss that bad meat should not be sent out for people to buy, and the boss says to do it anyway. The officers take off their jacket to reveal that they are now local police officers and chase him throughout the meat packing plant.
Swordfish: The DVD version contains an alternative ending wherein Ginger is told in the bank that the account is already empty, alluding to the possibility that Stanley has played one final trick on them and taken the money himself. In a companion scene to the alternative ending, Stanley is shown on a trip with his daughter in a brand new RV. While eating at a diner, Stanley transfers many billion dollars to various charities before continuing his trip.
The Terminator: The alternative ending, included in some DVD releases, shows the cleanup and police response at the factory. A group of company representatives find the terminator wreckage and decide to hide it from police and have it analyzed. The screen pans out to show the factory is owned by Cyberdyne Systems. The sequel is based on this alternative ending.
Terminator 2: Judgment Day: The alternative ending shows Sarah Connor alive and well on August 29, 2029. She is by then a grandmother (and John Connor is a Senator) in a world where Skynet was never able to start its war on humanity.
Titanic: Old Rose is seen by her granddaughter dropping the "Heart of the Ocean" diamond into the ocean.
Topaz: While Nicole and Michèle waiting in front of Stade Charléty, there was a duel between André and Jacques in the French football stadium. Jacques is shot down by a sniper. This ending was poorly received by audiences during test screenings.
X-Men: The Last Stand: Not only different endings were intended to use in this film, but nearly a whole different plot, significantly the role of Jean Grey being more aggressive and disobeying direct orders of Magneto several times. The alternative endings are: the re-opening of the Xavier Institute in which Beast is now a professor; Logan coming back to Alberta, Canada, specifically the tavern seen in the first X-Men; and Rogue keeping her powers.
Wallace and Gromit: The Curse of the Were-Rabbit had two different endings. One had Lady Totington marrying PC Mackintosh and another had Lady Totington visiting Wallace and giving Gromit the golden carrot.
Whisper: In the alternative ending, the kidnapper Max has chased the demon boy David through the forest. David makes him believe the wolves around him are the people who died. When they turn into wolves, they attack Max and maul him to death. The police show up and wrap David up in a blanket and take him to safety. As the police van leaves, David smiles.
Sailor of the King: Two endings were filmed, one in which Jeffrey Hunter's character dies and one in which he is rescued. Film audiences could vote on which ending they preferred.
Examples in television
In TV shows, producers may want to keep the ending of an episode a secret, even if it means keeping it from the stars themselves. In such a case, they will usually film more than one ending and not tell the cast which one will be used.
24: To keep the ending to Season 1 a surprise, the crew shot multiple endings. Teri's death was the one they aired. A second ending had Teri live through the gunshot, and a third had her not being shot at all, with the family embracing each other after the long day was over.
D.I.E: In the original ending, Yue Sir dies from a car accident, but the audience wanted a happier ending, so TVB created a new one in the style of mo lei tau comedy. In the new ending, the cast tries to stop the car accident that would kill Yue Sir from happening.
Do the Right Thing: BBC series 1994–1995, presented by Terry Wogan, in which audience members decided moral and ethical dilemmas in fictionalised examples with only one of multiple prerecorded story endings broadcast.
E.U.: Due to the popularity of Michael Tse's character Laughing Gor, who dies in episode 22, an ending was shot where Laughing changes into his police uniform and talks. The ending never implies whether Laughing is alive or not and leaves it open for the audience to decide.
Green Wing: In the final Special, Guy and Mac are dragged into the air in an attempt to rescue Caroline, who has been dragged into the air by holding too many helium balloons. Whilst in the air, Mac tells Caroline he has something to tell her. After walking into the sea, Alan and Joanna are last seen hanging onto a buoy, waiting to drown. The actors wanted to use this ending but it was turned down.
Sex and the City: In the series finale, three endings were shot, in which Carrie Bradshaw: (1) becomes engaged to Aleksandr Petrovsky, (2) resumes her relationship with Mr. Big, and (3) turns down both suitors and reaffirms her love for her friends.
The Simpsons: In the two-part episode "Who Shot Mr. Burns?" there was an alternative ending where it is revealed that the shooter of Mr. Burns was Waylon Smithers rather than Maggie Simpson. Shots of other characters shooting Mr. Burns were also fully animated, though no other complete ending scenes were produced. (These alternative shootings were intended to be intentionally 'leaked' as an elaborate practical joke on the media, but the producers could find no journalists who would take the bait.)
Lost: At the end of Season 4, the audience learns that one of the main characters will die in the future. To keep the identity of this person a secret, three different versions of the final scene were shot. The canonical ending shows that Locke will die, while the alternative endings had Sawyer and Desmond die.
Total Drama: For every season of this animated "reality show", two endings were filmed in which both finalists would win the competition. Every country Total Drama aired in got to decide which ending to air.
King of the Hill: Some episodes have alternative endings (including the episode "The Company Man"), which can be found on the DVD special features.
Psych: the episode "100 Clues", a parody of the board game Clue, had alternative endings where the fans decided who was the culprit of murdering a guest at a party. Also, the episode "Right Turn or Left for Dead" involves the main character, Shawn, playing out an alternative ending to the episode in his head had events in the previous episode been slightly different.
Pretty Little Liars: In the episode "The Lady Killer", three endings were shot, each revealing a member of the A-Team. Because the producers wanted to keep this member a secret from everyone (including the cast members), they shot three endings and did not tell anyone who the member of the A-Team was. Out of Paige's alternative ending, Caleb's ending, and Toby's ending, the producers ended up showing Toby's.
Secrets and Lies: In order to keep the real killer's identity secret until the end, several multiple endings were shot.
How I Met Your Mother: An alternative ending was edited together for the Season 9 DVD. This ending omits the scene in which Tracy dies, which in turn results in the controversial ending in which Ted Mosby gets back in a relationship with Robin Scherbatsky being removed, while making no other changes to the plot.
Examples in music
English rock band Marillion's 1994 concept album Brave is one of the very few examples of an alternative ending appearing in music. The vinyl edition of Brave featured a double groove on side B of the second record, the final side of the album: depending on where the needle was dropped, the record would either play the standard track listing (the songs "The Great Escape" and "Made Again") or would instead play only an alternative version of "The Great Escape" with different lyrics, presenting an alternative, darker ending to the album's story.
Examples in video games
Many video games also have alternative endings. Since video games are an interactive medium, these endings are generally posed as a result of player action, such as completing the game in a harder difficulty, taking a different route through the game's storyline and succeeding or failing at given tasks. It is generally possible to play a game a second time, make different decisions or achieve a different degree of success, and arrive at a different ending than the first time, complicating the canonicity of the ending(s).
See also
Deleted scene
Types of fiction with multiple endings
References
Endings
Film and video terminology
Home video supplements | Alternate ending | Physics | 5,724 |
31,352,021 | https://en.wikipedia.org/wiki/Vincent%20Blondel | Vincent Daniel Blondel (born April 28, 1965) is a Belgian professor of applied mathematics and former rector of the University of Louvain (UCLouvain) and a visiting professor at the Massachusetts Institute of Technology (MIT). Blondel's research lies in the area of mathematical control theory and theoretical computer science. He is mostly known for his contributions in computational complexity in control, multi-agent coordination and complex networks.
Education
Blondel studied philosophy, mathematics, engineering and computer science in Louvain-la-Neuve, Grenoble, London and Oxford. He completed a master thesis in engineering at the Institut National Polytechnique de Grenoble, he holds a MSc in mathematics from Imperial College of Science and Technology and a degree in philosophy, a master's degree in engineering (summa cum laude) and a PhD in applied mathematics from Université catholique de Louvain.
Career
In 1993-1994 he was a Göran Gustafsson Fellow at the Royal Institute of Technology (Stockholm) and in 1994-1995 he was a Research Fellow at the National Institute for Research in Computer Science and Control (INRIA) in Paris. From 1995 to 1999 he was an assistant professor at the Institute of Mathematics of the Université de Liège before joining the Louvain School of Engineering of UCLouvain where he has been since then. He was a research visitor with the Australian National University, the University of California at Berkeley, the Santa Fe Institute, the Mittag-Leffler Institute of the Royal Swedish Academy of Sciences and Harvard University. He was a visiting professor of the Ecole Nationale Supérieure in Lyon in 1998 and at the Université Paris VII - Diderot in 1999, 2000 and 2002. In 2005-2006 he was a visiting professor and a Fulbright scholar with the Department of Electrical Engineering and Computer Science of the Massachusetts Institute of Technology. In 2010-2011 he was a visiting professor with the MIT Laboratory for Information and Decision Systems (LIDS) of the Massachusetts Institute of Technology.
Blondel is a former associate editor of the European Journal of Control (Springer) and of Systems and Control Letters (Elsevier). He is an editor of the journal Mathematics of Control, Signals, and Systems He has published about 100 journal articles and 6 books.
At UCLouvain, Blondel has founded the Group on Large Graphs and Networks. He has supervised 20 doctoral and postdoctoral researchers and 15 visiting professors. He was department head in 2003-2010 and a university president candidate in 2009.
In 2013, Blondel has become the dean of the Louvain School of Engineering.
He was elected the Rector of the University of Louvain for the term 2014-2019, and reelected again in 2019 until 2024.
Honors and awards
Named a Fellow of the Institute of Electrical and Electronics Engineers (IEEE) in 2013 for his contributions to computational analysis of systems and networks.
Teaching
In 2012, he is in charge of the following courses at UCLouvain :
LINMA 1691 : Discrete mathematics I : Graphs algorithmics and theory
LINMA 1702 : Optimisation Models and Methods
LINMA 2111 : Discrete mathematics II: Algorithms and complexity
LINMA 2120 : System theory seminar
LINMA 2472 : Special questions about discrete mathematics.
The last course is following the online course of M. Chiang from Princeton University : "20Q about networks : Friends, Money and Bytes"
References
External links
Home Page
UCLouvain Page
Mathematics Genealogy Project profile
Large Graphs and Networks research group (at UCLouvain)
Laboratory for Information and Decision Systems (at MIT)
Control theorists
Living people
Academic staff of the Université catholique de Louvain
1965 births
Network scientists
Fellows of the IEEE
21st-century Belgian engineers
Belgian computer scientists
Rectors of universities in Belgium | Vincent Blondel | Engineering | 761 |
2,070,566 | https://en.wikipedia.org/wiki/Dimethyl%20sulfate | Dimethyl sulfate (DMS) is a chemical compound with formula (CH3O)2SO2. As the diester of methanol and sulfuric acid, its formula is often written as (CH3)2SO4 or Me2SO4, where CH3 or Me is methyl. Me2SO4 is mainly used as a methylating agent in organic synthesis. Me2SO4 is a colourless oily liquid with a slight onion-like odour. Like all strong alkylating agents, Me2SO4 is toxic. Its use as a laboratory reagent has been superseded to some extent by methyl triflate, CF3SO3CH3, the methyl ester of trifluoromethanesulfonic acid.
History
Impure dimethyl sulfate was prepared in the early 19th century. J. P. Claesson later extensively studied its preparation.
It was investigated for possible use in chemical warfare in World War I in 75% to 25% mixture with methyl chlorosulfonate (CH3ClO3S) called "C-stoff" in Germany, or with chlorosulfonic acid called "Rationite" in France.
The esterification of sulfuric acid with methanol was described in 1835:
Production
Dimethyl sulfate is produced commercially by the continuous reaction of dimethyl ether with sulfur trioxide:
Dimethyl sulfate can be synthesized in the laboratory by several methods. The reaction of methyl nitrite and methyl chlorosulfonate also results in dimethyl sulfate:
CH3ONO + (CH3)OSO2Cl → (CH3)2SO4 + NOCl
Reactions and uses
Dimethyl sulfate is a reagent for the methylation of phenols, amines, and thiols. One methyl group is transferred more quickly than the second. Methyl transfer is assumed to occur via an SN2 reaction. Compared to other methylating agents, dimethyl sulfate is preferred by the industry because of its low cost and high reactivity.
Methylation at oxygen
Commonly dimethyl sulfate is employed to methylate phenols.
In some cases, simple alcohols are also methylated, as illustrated by the conversion of tert-butanol to t-butyl methyl ether:
The methylation of sugars is called Haworth methylation. The methylation of ketones is called the Lavergne reaction.
Methylation at amine nitrogen
Me2SO4 is used to prepare both quaternary ammonium salts or tertiary amines:
Quaternized fatty ammonium compounds are used as a surfactant or fabric softener. Methylation to create a tertiary amine is illustrated as:
CH3(C6H4)NH2 + (CH3O)2SO2 (in NaHCO3 aq) → CH3(C6H4)N(CH3)2 + Na(CH3)SO4
Methylation at sulfur
Thiolate salts are easily methylated by Me2SO4 to give methyl thioethers:
In a related example:
p-CH3C6H4SO2Na + (CH3O)2SO2 → p-CH3C6H4SO2CH3 + Na(CH3)SO4
This method has been used to prepare thioesters from thiocarboxylic acids:
RC(O)SH + (CH3O)2SO2 → RC(O)S(CH3) + HOSO3CH3
Reactions with nucleic acids
Dimethyl sulfate (DMS) is used to determine the secondary structure of RNA. At neutral pH, DMS methylates unpaired adenine and cytosine residues at their canonical Watson–Crick faces, but it cannot methylate base-paired nucleotides. Using the method known as DMS-MaPseq, RNA is incubated with DMS to methylate unpaired bases. Then the RNA is reverse-transcribed; the reverse transcriptase frequently adds an incorrect DNA base when it encounters a methylated RNA base. These mutations can be detected via sequencing, and the RNA is inferred to be single-stranded at bases with above-background mutation rates.
Dimethyl sulfate can effect the base-specific cleavage of DNA by attacking the imidazole rings present in guanine. Dimethyl sulfate also methylates adenine in single-stranded portions of DNA (for example, those with proteins like RNA polymerase progressively melting and re-annealing the DNA). Upon re-annealing, these methyl groups interfere with adenine-guanine base-pairing. Nuclease S1 can then be used to cut the DNA in single-stranded regions (anywhere with a methylated adenine). This is an important technique for analyzing protein-DNA interactions.
Alternatives
Although dimethyl sulfate is highly effective and affordable, its toxicity has encouraged the use of other methylating reagents. Methyl iodide is a reagent used for O-methylation, like dimethyl sulfate, but it is less hazardous and more expensive. Dimethyl carbonate, which is far less reactive, has far lower toxicity compared to both dimethyl sulfate and methyl iodide. High pressure can be used to accelerate methylation by dimethyl carbonate. In general, the toxicity of methylating agents is correlated with their efficiency as methyl transfer reagents.
Safety
Dimethyl sulfate is carcinogenic and mutagenic, highly poisonous, corrosive, and environmentally hazardous. It is absorbed through the skin, mucous membranes, and gastrointestinal tract, and can cause a fatal delayed respiratory tract reaction. An ocular reaction is also common. There is no strong odor or immediate irritation to warn of lethal concentration in the air. The LD50 (acute, oral) is 205 mg/kg (rat) and 140 mg/kg (mouse), and LC50 (acute) is 45 ppm per 4 hours (rat). The vapor pressure of 65 Pa is sufficiently large to produce a lethal concentration in air by evaporation at 20 °C. Delayed toxicity allows potentially fatal exposures to occur prior to development of any warning symptoms. Symptoms may be delayed 6–24 h. Concentrated solutions of bases (ammonia, alkalis) can be used to hydrolyze minor spills and residues on contaminated equipment, but the reaction may become violent with larger amounts of dimethyl sulfate (see ICSC). Although the compound hydrolyses, treatment with water cannot be assumed to decontaminate it.
One hypothesis regarding the apparently mysterious 1994 "toxic lady" incident is that the person at the centre of the incident had built up dimethyl sulfone crystals in her blood, which were converted by an unknown mechanism to dimethyl sulfate vapour that poisoned attending medical staff.
References
External links
WebBook page for C2H6SO4
International Chemic
Methyl esters
Methylating agents
IARC Group 2A carcinogens
Sulfate esters | Dimethyl sulfate | Chemistry | 1,450 |
4,251,329 | https://en.wikipedia.org/wiki/Bush%20%28brand%29 | Bush is a British consumer electronics brand owned by J Sainsbury plc (Sainsbury's), the parent company of the retailer Argos. The former Bush company is one of the most famous manufacturers of early British radios. The company is now defunct, but the Bush brand name survives as a private label brand for budget electronics. Today, all Bush are sold exclusively at Argos and Sainsbury's, with Argos having a wider selection.
History
Original Bush company
The company was founded in 1932 as Bush Radio from the remains of the Graham Amplion company, which had made horn loudspeakers as a subsidiary of the Gaumont British Picture Corporation. The brand name comes from Gaumont's Shepherd's Bush studios. The company expanded rapidly moving to a new factory at Power Road, Chiswick in 1936.
Bush became part of the Rank empire in 1945 and a brand new factory was opened at Ernesettle, Plymouth in 1949. In 1946 the DAC90, designed by Frank Middleditch, featured in the V&A exhibition Britain Can Make It. The original model in black became very popular and was succeeded by the DAC90A in other colours, and export models with dials in different languages. In 1950 the DAC10 radios were launched, along with the distinctive TV22 television.
The Bush TR82 transistor radio, designed by Ogle Design, and launched in 1959, is regarded as an icon of early radio design. Although the first radio to use the Ogle cabinet design was actually the MB60, a battery/mains valve set from 1957 to 1959.
The original Bush Radio company merged with Murphy Radio on 4 June 1962, and a new company was formed called Rank Bush Murphy Ltd. In 1978, Rank Bush Murphy was sold to British conglomerate Great Universal Stores.
Rank formed a joint venture with Toshiba in 1978 called Rank Toshiba, and manufactured Toshiba designed televisions in Ernesettle UK. In 1980 Rank terminated its agreement with Toshiba and the joint company was wound up. Toshiba took over the UK factory and continued to manufacture television sets alone.
Purchase in the 1980s
The Bush brand name disappeared from the British market during the 1980s. However, since the purchase of the brand by Alba Group in 1986 (now known as Harvard International), it once again became common, being used primarily on electronic goods produced in China and televisions made in Turkey.
Sale to Home Retail Group
In November 2008, the Bush brand name, along with Alba, was purchased by Home Retail Group, the parent company of Homebase and Argos, for £15.25 million. As a result, the former Alba Group has now been renamed Harvard International. Harvard International still owns the Bush brand in Oceania. In 2013 a 7-inch tablet called MyTablet was released under the Bush brand; it cost £99.99.
Purchase by Sainsbury's
In September 2016, the British supermarket chain Sainsbury's completed its acquisition of Home Retail Group, bringing Argos, along with the Alba and Bush brands, under its ownership.
In 2022 the Bush brand replaced the Alba brand, enabling Sainsbury's to have one main own brand electronics brand.
Product range
Current products
Bush now has products including: televisions, boomboxes, shelf stereos, set-top boxes, washing machines, radios, trimmers, headsets, headphones, ovens, cookers, fridges, computer mice, webcams, microphones, turntables, DVD players, Blu-ray players, home cinemas, MP3 players, MP4 players, dishwashers, vacuum cleaners, camcorders, smartphones and tablets.
At least some of the Bush TV sets and some white goods are made by Turkish company Vestel.
Reproductions of classic Bush Radio models from the 1950s and 1960s are also being sold today under the Bush brand. Some of these units also include DAB tuners.
Former products
A range known as Bush iD was used to brand items such as digital radios and set-top boxes under the Bush name since the 1980s. Since the purchase by Home Retail Group in 2008, the Bush iD branding is no longer used.
Marketing and branding
Bush has had a number of different logos over the years. It had a long-standing one between the 1990s and 2014, and a separate one for its former Bush iD range.
Gallery
References
Sources
Radio and television brands Alba and Bush sold to Argos owner Home Retail Group
Home Retail Group signs contract for Intellectual Property Rights to Bush and Alba Trademarks
Bush Freesat Website
External links
Bush at Argos.co.uk
Article on vintage Bush radios
1950 Bush television https://web.archive.org/web/20151004114901/http://www.sciencemuseum.org.uk/objects/radio_communication/1971-76.aspx
Traditional Bush Radios for sale
Bush Australia
Electronics companies of the United Kingdom
Electronics companies established in 1932
Consumer electronics brands
Audio equipment manufacturers of the United Kingdom
Headphones manufacturers
British brands
Companies based in Milton Keynes
Display technology companies
1932 establishments in England
Radio manufacturers
Sainsbury's | Bush (brand) | Engineering | 1,053 |
15,841,716 | https://en.wikipedia.org/wiki/Siemens%20C65 | The Siemens C65 is a mobile phone announced by Siemens. This phone is under “C-Class” leveling of Siemens for entry levels/ consumer regularly. It was released in March 2004. It weighs 86 g and its dimensions are 100 x 45 x 16 mm (length x width x depth). Its display is a 130x130 pixels, 65K colors CSTN LCD. Its carrier-engineered variants are Siemens CT65, CV65 and CO65, exclusively for three mainly mobile operators T-Mobile, Vodafone and O2 respectively. It is known in North America as the Siemens C66.
Reviews
GSM Arena praised it as good value but criticised the poor camera. CNet agreed that it provided good value.
References
Mobile phones introduced in 2004
Mobile phones with infrared transmitter
C65 | Siemens C65 | Technology | 165 |
71,111,564 | https://en.wikipedia.org/wiki/Melampsora%20hirculi | Melampsora hirculi is a pathogenic fungus in the order of Pucciniales or rust fungi. It is causes disease in Saxifraga hirculus.
References
Pucciniales
Fungi described in 1902
Fungi of Iceland
Fungus species | Melampsora hirculi | Biology | 52 |
15,227,316 | https://en.wikipedia.org/wiki/ATPIF1 | ATPase inhibitor, mitochondrial is an enzyme that in humans is encoded by the ATPIF1 gene.
This gene encodes a mitochondrial ATPase inhibitor. Alternative splicing occurs at this locus and three transcript variants encoding distinct isoforms have been identified.
It prevents ATPase from switching to ATP hydrolysis during collapse of the electrochemical gradient, for example during oxygen deprivation ATP synthase inhibitor forms a one-to-one complex with the F1 ATPase, possibly by binding at the alpha-beta interface. It is thought to inhibit ATP synthesis by preventing the release of ATP. The inhibitor has two oligomeric states, dimer (the active state) and tetramer. At low pH, the inhibitor forms a dimer via antiparallel coiled coil interactions between the C-terminal regions of two monomers. At high pH, the inhibitor forms tetramers and higher oligomers by coiled coil interactions involving the N terminus and inhibitory region, thus preventing the inhibitory activity.
References
External links
Further reading
Protein families
Genes mutated in mice | ATPIF1 | Biology | 214 |
45,332,639 | https://en.wikipedia.org/wiki/Puerto%20Rican%20units%20of%20measurement | Several units of measurements are used in Puerto Rico. The units of measure in use in Puerto Rico are based on the United States customary units with two major exceptions: roadway distance signs are measured in kilometers and gasoline is sold by the liter.
System before US customary units
Several units were used before the US takeover in 1898. These units were older Spanish units.
Area
Several units were used to measure area. Among them were the cuerda and the caballería.
Cuerda
In Puerto Rico, a cuerda is a traditional unit of land area nearly equivalent to 3,930 square meters, or 4,700 square yards, 0.971 acre, or 0.393 hectare (ha). The precise conversion is 1 cuerda = 3,930.395625 m2. The term "Spanish acre" instead has been used sometimes by mainlanders. A cuerda and an acre have often been treated as equal because they are nearly the same size. It continues to be an official unit of land measure in Puerto Rico today (2019).
Caballería
This was a unit of land measurement in the Spanish Viceroyalties in the Americas during the times of the Spanish Empire in the 16th through 19th centuries Puerto Rico. Widely used then, it was equivalent to . This unit of measure is now (2019) obsolete.
References
Culture of Puerto Rico
Puerto Rico | Puerto Rican units of measurement | Mathematics | 273 |
22,431,652 | https://en.wikipedia.org/wiki/FASTQ%20format | FASTQ format is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are each encoded with a single ASCII character for brevity.
It was originally developed at the Wellcome Trust Sanger Institute to bundle a FASTA formatted sequence and its quality data, but has become the de facto standard for storing the output of high-throughput sequencing instruments such as the Illumina Genome Analyzer.
Format
A FASTQ file has four line-separated fields per sequence:
Field 1 begins with a '@' character and is followed by a sequence identifier and an optional description (like a FASTA title line).
Field 2 is the raw sequence letters.
Field 3 begins with a '+' character and is optionally followed by the same sequence identifier (and any description) again.
Field 4 encodes the quality values for the sequence in Field 2, and must contain the same number of symbols as letters in the sequence.
A FASTQ file containing a single sequence might look like this:
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
The byte representing quality runs from 0x21 (lowest quality; '!' in ASCII) to 0x7e (highest quality; '~' in ASCII).
Here are the quality value characters in left-to-right increasing order of quality (ASCII):
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
The original Sanger FASTQ files split long sequences and quality strings over multiple lines, as is typically done for FASTA files. Accounting for this makes parsing more complicated due to the choice of "@" and "+" as markers (as these characters can also occur in the quality string). Multi-line FASTQ files (and consequently multi-line FASTQ parsers) are less common now that the majority of sequencing carried out is short-read Illumina sequencing, with typical sequence lengths of around 100bp.
Illumina sequence identifiers
Sequences from the Illumina software use a systematic identifier:
Versions of the Illumina pipeline since 1.4 appear to use #NNNNNN instead of #0 for the multiplex ID, where NNNNNN is the sequence of the multiplex tag.
With Casava 1.8 the format of the '@' line has changed:
Note that more recent versions of Illumina software output a sample number (defined by the order of the samples in the sample sheet) in place of an index sequence when an index sequence is not explicitly specified for a sample in the sample sheet. For example, the following header might appear in a FASTQ file belonging to the first sample of a batch of samples:
NCBI Sequence Read Archive
FASTQ files from the INSDC Sequence Read Archive often include a description, e.g.
In this example there is an NCBI-assigned identifier, and the description holds the original identifier from Solexa/Illumina (as described above) plus the read length. Sequencing was performed in paired-end mode (~500bp insert size), see SRR001666. The default output format of fastq-dump produces entire spots, containing any technical reads and typically single or paired-end biological reads.
$ fastq-dump.2.9.0 -Z -X 2 SRR001666
Read 2 spots for SRR001666
Written 2 spots for SRR001666
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9ICIIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
@SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72
GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
+SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBIIIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I
Modern usage of FASTQ almost always involves splitting the spot into its biological reads, as described in submitter-provided metadata:
$ fastq-dump -X 2 SRR001666 --split-3
Read 2 spots for SRR001666
Written 2 spots for SRR001666
$ head SRR001666_1.fastq SRR001666_2.fastq
==> SRR001666_1.fastq <==
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
@SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGA
+SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBI
==> SRR001666_2.fastq <==
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
AAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
IIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
@SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
AGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
+SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=36
IIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I
When present in the archive, fastq-dump can attempt to restore read names to original format. NCBI does not store original read names by default:
$ fastq-dump -X 2 SRR001666 --split-3 --origfmt
Read 2 spots for SRR001666
Written 2 spots for SRR001666
$ head SRR001666_1.fastq SRR001666_2.fastq
==> SRR001666_1.fastq <==
@071112_SLXA-EAS1_s_7:5:1:817:345
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
+071112_SLXA-EAS1_s_7:5:1:817:345
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
@071112_SLXA-EAS1_s_7:5:1:801:338
GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGA
+071112_SLXA-EAS1_s_7:5:1:801:338
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBI
==> SRR001666_2.fastq <==
@071112_SLXA-EAS1_s_7:5:1:817:345
AAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
+071112_SLXA-EAS1_s_7:5:1:817:345
IIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
@071112_SLXA-EAS1_s_7:5:1:801:338
AGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
+071112_SLXA-EAS1_s_7:5:1:801:338
IIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I
In the example above, the original read names were used rather than the accessioned read name. NCBI accessions runs and the reads they contain. Original read names, assigned by sequencers, are able to function as locally unique identifiers of a read, and convey exactly as much information as a serial number. The ids above were algorithmically assigned based upon run information and geometric coordinates. Early SRA loaders parsed these ids and stored their decomposed components internally. NCBI stopped recording read names because they are frequently modified from the vendors' original format in order to associate some additional information meaningful to a particular processing pipeline, and this caused name format violations that resulted in a high number of rejected submissions. Without a clear schema for read names, their function remains that of a unique read id, conveying the same amount of information as a read serial number. See various SRA Toolkit issues for details and discussions.
Also note that fastq-dump converts this FASTQ data from the original Solexa/Illumina encoding to the Sanger standard (see encodings below). This is because the SRA serves as a repository for NGS information, rather than format. The various *-dump tools are capable of producing data in several formats from the same source. The requirements for doing so have been dictated by users over several years, with the majority of early demand coming from the 1000 Genomes Project.
Variations
Quality
A quality value Q is an integer mapping of p (i.e., the probability that the corresponding base call is incorrect). Two different equations have been in use. The first is the standard Sanger variant to assess reliability of a base call, otherwise known as Phred quality score:
The Solexa pipeline (i.e., the software delivered with the Illumina Genome Analyzer) earlier used a different mapping, encoding the odds p/(1-p) instead of the probability p:
Although both mappings are asymptotically identical at higher quality values, they differ at lower quality levels (i.e., approximately p > 0.05, or equivalently, Q < 13).
At times there has been disagreement about which mapping Illumina actually uses. The user guide (Appendix B, page 122) for version 1.4 of the Illumina pipeline states that: "The scores are defined as , where is the probability of a base call corresponding to the base in question". In retrospect, this entry in the manual appears to have been an error. The user guide (What's New, page 5) for version 1.5 of the Illumina pipeline lists this description instead: "Important Changes in Pipeline v1.3 . The quality scoring scheme has changed to the Phred [i.e., Sanger] scoring scheme, encoded as an ASCII character by adding 64 to the Phred value. A Phred score of a base is: , where e is the estimated probability of a base being wrong.
Encoding
Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps). Also used in SAM format. Coming to the end of February 2011, Illumina's newest version (1.8) of their pipeline CASAVA will directly produce fastq in Sanger format, according to the announcement on seqanswers.com forum.
Element Biosciences AVITI reads are encoded following the Sanger convention: Phred quality scores from 0 to 93 are encoded using ASCII 33 to 126. Raw reads typically exhibit base quality scores in the range of [0, 55].
PacBio HiFi reads, which are typically stored in SAM/BAM format, use the Sanger convention: Phred quality scores from 0 to 93 are encoded using ASCII 33 to 126. Raw PacBio subreads use the same convention but typically assign a placeholder base quality (Q0) to all bases in the read.
Oxford Nanopore Duplex reads, called using the dorado basecaller are typically stored in SAM/BAM format. After changing to a 16-bit internal quality representation, the reported base quality limit is q50 (S).
Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score from -5 to 62 using ASCII 59 to 126 (although in raw read data Solexa scores from -5 to 40 only are expected)
Starting with Illumina 1.3 and before Illumina 1.8, the format encoded a Phred quality score from 0 to 62 using ASCII 64 to 126 (although in raw read data Phred scores from 0 to 40 only are expected).
Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0 to 2 have a slightly different meaning. The values 0 and 1 are no longer used and the value 2, encoded by ASCII 66 "B", is used also at the end of reads as a Read Segment Quality Control Indicator. The Illumina manual (page 30) states the following: If a read ends with a segment of mostly low quality (Q15 or below), then all of the quality values in the segment are replaced with a value of 2 (encoded as the letter B in Illumina's text-based encoding of quality scores)... This Q2 indicator does not predict a specific error rate, but rather indicates that a specific final portion of the read should not be used in further analyses. Also, the quality score encoded as "B" letter may occur internally within reads at least as late as pipeline version 1.6, as shown in the following example:
@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
+HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB
An alternative interpretation of this ASCII encoding has been proposed. Also, in Illumina runs using PhiX controls, the character 'B' was observed to represent an "unknown quality score". The error rate of 'B' reads was roughly 3 phred scores lower the mean observed score of a given run.
Starting in Illumina 1.8, the quality scores have basically returned to the use of the Sanger format (Phred+33).
For raw reads, the range of scores will depend on the technology and the base caller used, but will typically be up to 41 for recent Illumina chemistry. Since the maximum observed quality score was previously only 40, various scripts and tools break when they encounter data with quality values larger than 40. For processed reads, scores may be even higher. For example, quality values of 45 are observed in reads from Illumina's Long Read Sequencing Service (previously Moleculo).
SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS.....................................................
..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX......................
...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII......................
.................................JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ.....................
LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL....................................................
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN...........................................
EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
| | | | | | |
33 59 64 73 88 104 126
0........................26...31.......40
-5....0........9.............................40
0........9.............................40
3.....9..............................41
0.2......................26...31........41
0..................20........30........40........50
0..................20........30........40........50...55
0..................20........30........40........50..........................................93
S - Sanger Phred+33, raw reads typically (0, 40)
X - Solexa Solexa+64, raw reads typically (-5, 40)
I - Illumina 1.3+ Phred+64, raw reads typically (0, 40)
J - Illumina 1.5+ Phred+64, raw reads typically (3, 41)
with 0=unused, 1=unused, 2=Read Segment Quality Control Indicator (bold)
(Note: See discussion above).
L - Illumina 1.8+ Phred+33, raw reads typically (0, 41)
N - Nanopore Phred+33, Duplex reads typically (0, 50)
E - ElemBio AVITI Phred+33, raw reads typically (0, 55)
P - PacBio Phred+33, HiFi reads typically (0, 93)
Color space
For SOLiD data, the format is modified to a color space FASTQ sequence (CSFASTQ), where bases in the sequence are combined with the numbers 0, 1, 2, and 3, indicating how bases are modified relative to the previous base in the sequence (0: no change; 1: transition; 2: non-complementary transversion; 3: complementary transversion). This format matched the different sequencing chemistry used by SOLiD sequencers. Initial representations only used nucleotide bases at the start of the sequence, but later versions included bases embedded at periodic intervals to improve basecalling and mapping accuracy.
The quality values for CSFASTQ are identical to those of the Sanger format. Alignment tools differ in their preferred version of the quality values: some include a quality score (set to 0, i.e. '!') for the leading nucleotide, others do not. The sequence read archive includes this quality score.
FAST5 and HDF5 evolutions
The FAST4 format was invented as a derivative of the FASTQ format where each of the 4 bases (A,C,G,T) had separate probabilities stored. It was part of the Swift basecaller, an open source package for primary data analysis on next-gen sequence data "from images to basecalls".
The FAST5 format was invented as an extension of the FAST4 format. The FAST5 files are Hierarchical Data Format 5 (HDF5) files with a specific schema defined by Oxford Nanopore Technologies (ONT).
Simulation
FASTQ read simulation has been approached by several tools.
A comparison of those tools can be seen here.
Compression
General compressors
General-purpose tools such as Gzip and bzip2 regard FASTQ as a plain text file and result in suboptimal compression ratios. NCBI's Sequence Read Archive encodes metadata using the LZ-77 scheme.
General FASTQ compressors typically compress distinct fields (read names, sequences, comments, and quality scores) in a FASTQ file separately; these include DSRC and DSRC2, FQC, LFQC, Fqzcomp, and Slimfastq.
Reads
Having a reference genome around is convenient because then instead of storing the nucleotide sequences themselves, one can just align the reads to the reference genome and store the positions (pointers) and mismatches; the pointers can then be sorted according to their order in the reference sequence and encoded, e.g., with run-length encoding. When the coverage or the repeat content of the sequenced genome is high, this leads to a high compression ratio.
Unlike the SAM/BAM formats, FASTQ files do not specify a reference genome. Alignment-based FASTQ compressors supports the use of either user-provided or de novo assembled reference: LW-FQZip uses a provided reference genome and Quip, Leon, k-Path and KIC perform de novo assembly using a de Bruijn graph-based approach.
Explicit read mapping and de novo assembly are typically slow. Reordering-based FASTQ compressors first cluster reads that share long substrings and then independently compress reads in each cluster after reordering them or assembling them into longer contigs, achieving perhaps the best trade-off between the running time and compression rate. SCALCE is the first such tool, followed by Orcom and Mince. BEETL uses a generalized Burrows–Wheeler transform for reordering reads, and HARC achieves better performance with hash-based reordering. AssemblTrie instead assembles reads into reference trees with as few total number of symbols as possible in the reference.
Benchmarks for these tools are available in.
Quality values
Quality values account for about half of the required disk space in the FASTQ format (before compression), and therefore the compression of the quality values can significantly reduce storage requirements and speed up analysis and transmission of sequencing data. Both lossless and lossy compression are recently being considered in the literature. For example, the algorithm QualComp performs lossy compression with a rate (number of bits per quality value) specified by the user. Based on rate-distortion theory results, it allocates the number of bits so as to minimize the MSE (mean squared error) between the original (uncompressed) and the reconstructed (after compression) quality values. Other algorithms for compression of quality values include SCALCE and Fastqz. Both are lossless compression algorithms that provide an optional controlled lossy transformation approach. For example, SCALCE reduces the alphabet size based on the observation that “neighboring” quality values are similar in general. For a benchmark, see.
As of the HiSeq 2500 Illumina gives the option to output qualities that have been coarse grained into quality bins. The binned scores are computed directly from the empirical quality score table, which is itself tied to the hardware, software and chemistry that were used during the sequencing experiment.
File extension
There is no standard file extension for a FASTQ file, but .fq and .fastq are commonly used.
Format converters
Biopython version 1.51 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
EMBOSS version 6.1.0 patch 1 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
BioPerl version 1.6.1 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
BioRuby version 1.4.0 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
BioJava version 1.7.1 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
See also
The FASTA format, used to represent genome sequences.
The SAM and CRAM formats, used to represent genome sequencer reads that have been aligned to genome sequences.
The GVF format (Genome Variation Format), an extension based on the GFF3 format.
References
External links
MAQ webpage discussing FASTQ variants
Bioinformatics
Biological sequence format | FASTQ format | Engineering,Biology | 6,117 |
159,266 | https://en.wikipedia.org/wiki/Gene%20expression | Gene expression is the process by which information from a gene is used in the synthesis of a functional gene product that enables it to produce end products, proteins or non-coding RNA, and ultimately affect a phenotype. These products are often proteins, but in non-protein-coding genes such as transfer RNA (tRNA) and small nuclear RNA (snRNA), the product is a functional non-coding RNA.
The process of gene expression is used by all known life—eukaryotes (including multicellular organisms), prokaryotes (bacteria and archaea), and utilized by viruses—to generate the macromolecular machinery for life.
In genetics, gene expression is the most fundamental level at which the genotype gives rise to the phenotype, i.e. observable trait. The genetic information stored in DNA represents the genotype, whereas the phenotype results from the "interpretation" of that information. Such phenotypes are often displayed by the synthesis of proteins that control the organism's structure and development, or that act as enzymes catalyzing specific metabolic pathways.
All steps in the gene expression process may be modulated (regulated), including the transcription, RNA splicing, translation, and post-translational modification of a protein. Regulation of gene expression gives control over the timing, location, and amount of a given gene product (protein or ncRNA) present in a cell and can have a profound effect on the cellular structure and function. Regulation of gene expression is the basis for cellular differentiation, development, morphogenesis and the versatility and adaptability of any organism. Gene regulation may therefore serve as a substrate for evolutionary change.
Mechanism
Transcription
The production of a RNA copy from a DNA strand is called transcription, and is performed by RNA polymerases, which add one ribonucleotide at a time to a growing RNA strand as per the complementarity law of the nucleotide bases. This RNA is complementary to the template 3′ → 5′ DNA strand, with the exception that thymines (T) are replaced with uracils (U) in the RNA and possible errors.
In bacteria, transcription is carried out by a single type of RNA polymerase, which needs to bind a DNA sequence called a Pribnow box with the help of the sigma factor protein (σ factor) to start transcription. In eukaryotes, transcription is performed in the nucleus by three types of RNA polymerases, each of which needs a special DNA sequence called the promoter and a set of DNA-binding proteins—transcription factors—to initiate the process (see regulation of transcription below). RNA polymerase I is responsible for transcription of ribosomal RNA (rRNA) genes. RNA polymerase II (Pol II) transcribes all protein-coding genes but also some non-coding RNAs (e.g., snRNAs, snoRNAs or long non-coding RNAs). RNA polymerase III transcribes 5S rRNA, transfer RNA (tRNA) genes, and some small non-coding RNAs (e.g., 7SK). Transcription ends when the polymerase encounters a sequence called the terminator.
mRNA processing
While transcription of prokaryotic protein-coding genes creates messenger RNA (mRNA) that is ready for translation into protein, transcription of eukaryotic genes leaves a primary transcript of RNA (pre-RNA), which first has to undergo a series of modifications to become a mature RNA. Types and steps involved in the maturation processes vary between coding and non-coding preRNAs; i.e. even though preRNA molecules for both mRNA and tRNA undergo splicing, the steps and machinery involved are different. The processing of non-coding RNA is described below (non-coding RNA maturation).
The processing of pre-mRNA include 5′ capping, which is set of enzymatic reactions that add 7-methylguanosine (m7G) to the 5′ end of pre-mRNA and thus protect the RNA from degradation by exonucleases. The m7G cap is then bound by cap binding complex heterodimer (CBP20/CBP80), which aids in mRNA export to cytoplasm and also protect the RNA from decapping.
Another modification is 3′ cleavage and polyadenylation. They occur if polyadenylation signal sequence (5′- AAUAAA-3′) is present in pre-mRNA, which is usually between protein-coding sequence and terminator. The pre-mRNA is first cleaved and then a series of ~200 adenines (A) are added to form poly(A) tail, which protects the RNA from degradation. The poly(A) tail is bound by multiple poly(A)-binding proteins (PABPs) necessary for mRNA export and translation re-initiation. In the inverse process of deadenylation, poly(A) tails are shortened by the CCR4-Not 3′-5′ exonuclease, which often leads to full transcript decay.
A very important modification of eukaryotic pre-mRNA is RNA splicing. The majority of eukaryotic pre-mRNAs consist of alternating segments called exons and introns. During the process of splicing, an RNA-protein catalytical complex known as spliceosome catalyzes two transesterification reactions, which remove an intron and release it in form of lariat structure, and then splice neighbouring exons together. In certain cases, some introns or exons can be either removed or retained in mature mRNA. This so-called alternative splicing creates series of different transcripts originating from a single gene. Because these transcripts can be potentially translated into different proteins, splicing extends the complexity of eukaryotic gene expression and the size of a species proteome.
Extensive RNA processing may be an evolutionary advantage made possible by the nucleus of eukaryotes. In prokaryotes, transcription and translation happen together, whilst in eukaryotes, the nuclear membrane separates the two processes, giving time for RNA processing to occur.
Non-coding RNA maturation
In most organisms non-coding genes (ncRNA) are transcribed as precursors that undergo further processing. In the case of ribosomal RNAs (rRNA), they are often transcribed as a pre-rRNA that contains one or more rRNAs. The pre-rRNA is cleaved and modified (2′-O-methylation and pseudouridine formation) at specific sites by approximately 150 different small nucleolus-restricted RNA species, called snoRNAs. SnoRNAs associate with proteins, forming snoRNPs. While snoRNA part basepair with the target RNA and thus position the modification at a precise site, the protein part performs the catalytical reaction. In eukaryotes, in particular a snoRNP called RNase, MRP cleaves the 45S pre-rRNA into the 28S, 5.8S, and 18S rRNAs. The rRNA and RNA processing factors form large aggregates called the nucleolus.
In the case of transfer RNA (tRNA), for example, the 5′ sequence is removed by RNase P, whereas the 3′ end is removed by the tRNase Z enzyme and the non-templated 3′ CCA tail is added by a nucleotidyl transferase. In the case of micro RNA (miRNA), miRNAs are first transcribed as primary transcripts or pri-miRNA with a cap and poly-A tail and processed to short, 70-nucleotide stem-loop structures known as pre-miRNA in the cell nucleus by the enzymes Drosha and Pasha. After being exported, it is then processed to mature miRNAs in the cytoplasm by interaction with the endonuclease Dicer, which also initiates the formation of the RNA-induced silencing complex (RISC), composed of the Argonaute protein.
Even snRNAs and snoRNAs themselves undergo series of modification before they become part of functional RNP complex. This is done either in the nucleoplasm or in the specialized compartments called Cajal bodies. Their bases are methylated or pseudouridinilated by a group of small Cajal body-specific RNAs (scaRNAs), which are structurally similar to snoRNAs.
RNA export
In eukaryotes most mature RNA must be exported to the cytoplasm from the nucleus. While some RNAs function in the nucleus, many RNAs are transported through the nuclear pores and into the cytosol. Export of RNAs requires association with specific proteins known as exportins. Specific exportin molecules are responsible for the export of a given RNA type. mRNA transport also requires the correct association with Exon Junction Complex (EJC), which ensures that correct processing of the mRNA is completed before export. In some cases RNAs are additionally transported to a specific part of the cytoplasm, such as a synapse; they are then towed by motor proteins that bind through linker proteins to specific sequences (called "zipcodes") on the RNA.
Translation
For some non-coding RNA, the mature RNA is the final gene product. In the case of messenger RNA (mRNA) the RNA is an information carrier coding for the synthesis of one or more proteins. mRNA carrying a single protein sequence (common in eukaryotes) is monocistronic whilst mRNA carrying multiple protein sequences (common in prokaryotes) is known as polycistronic.
Every mRNA consists of three parts: a 5′ untranslated region (5′UTR), a protein-coding region or open reading frame (ORF), and a 3′ untranslated region (3′UTR). The coding region carries information for protein synthesis encoded by the genetic code to form triplets. Each triplet of nucleotides of the coding region is called a codon and corresponds to a binding site complementary to an anticodon triplet in transfer RNA. Transfer RNAs with the same anticodon sequence always carry an identical type of amino acid. Amino acids are then chained together by the ribosome according to the order of triplets in the coding region. The ribosome helps transfer RNA to bind to messenger RNA and takes the amino acid from each transfer RNA and makes a structure-less protein out of it. Each mRNA molecule is translated into many protein molecules, on average ~2800 in mammals.
In prokaryotes translation generally occurs at the point of transcription (co-transcriptionally), often using a messenger RNA that is still in the process of being created. In eukaryotes translation can occur in a variety of regions of the cell depending on where the protein being written is supposed to be. Major locations are the cytoplasm for soluble cytoplasmic proteins and the membrane of the endoplasmic reticulum for proteins that are for export from the cell or insertion into a cell membrane. Proteins that are supposed to be produced at the endoplasmic reticulum are recognised part-way through the translation process. This is governed by the signal recognition particle—a protein that binds to the ribosome and directs it to the endoplasmic reticulum when it finds a signal peptide on the growing (nascent) amino acid chain.
Folding
Each protein exists as an unfolded polypeptide or random coil when translated from a sequence of mRNA into a linear chain of amino acids. This polypeptide lacks any developed three-dimensional structure (the left hand side of the neighboring figure). The polypeptide then folds into its characteristic and functional three-dimensional structure from a random coil. Amino acids interact with each other to produce a well-defined three-dimensional structure, the folded protein (the right hand side of the figure) known as the native state. The resulting three-dimensional structure is determined by the amino acid sequence (Anfinsen's dogma).
The correct three-dimensional structure is essential to function, although some parts of functional proteins may remain unfolded. Failure to fold into the intended shape usually produces inactive proteins with different properties including toxic prions. Several neurodegenerative and other diseases are believed to result from the accumulation of misfolded proteins. Many allergies are caused by the folding of the proteins, for the immune system does not produce antibodies for certain protein structures.
Enzymes called chaperones assist the newly formed protein to attain (fold into) the 3-dimensional structure it needs to function. Similarly, RNA chaperones help RNAs attain their functional shapes. Assisting protein folding is one of the main roles of the endoplasmic reticulum in eukaryotes.
Translocation
Secretory proteins of eukaryotes or prokaryotes must be translocated to enter the secretory pathway. Newly synthesized proteins are directed to the eukaryotic Sec61 or prokaryotic SecYEG translocation channel by signal peptides. The efficiency of protein secretion in eukaryotes is very dependent on the signal peptide which has been used.
Protein transport
Many proteins are destined for other parts of the cell than the cytosol and a wide range of signalling sequences or (signal peptides) are used to direct proteins to where they are supposed to be. In prokaryotes this is normally a simple process due to limited compartmentalisation of the cell. However, in eukaryotes there is a great variety of different targeting processes to ensure the protein arrives at the correct organelle.
Not all proteins remain within the cell and many are exported, for example, digestive enzymes, hormones and extracellular matrix proteins. In eukaryotes the export pathway is well developed and the main mechanism for the export of these proteins is translocation to the endoplasmic reticulum, followed by transport via the Golgi apparatus.
Regulation of gene expression
Regulation of gene expression is the control of the amount and timing of appearance of the functional product of a gene. Control of expression is vital to allow a cell to produce the gene products it needs when it needs them; in turn, this gives cells the flexibility to adapt to a variable environment, external signals, damage to the cell, and other stimuli. More generally, gene regulation gives the cell control over all structure and function, and is the basis for cellular differentiation, morphogenesis and the versatility and adaptability of any organism.
Numerous terms are used to describe types of genes depending on how they are regulated; these include:
A constitutive gene is a gene that is transcribed continually as opposed to a facultative gene, which is only transcribed when needed.
A housekeeping gene is a gene that is required to maintain basic cellular function and so is typically expressed in all cell types of an organism. Examples include actin, GAPDH and ubiquitin. Some housekeeping genes are transcribed at a relatively constant rate and these genes can be used as a reference point in experiments to measure the expression rates of other genes.
A facultative gene is a gene only transcribed when needed as opposed to a constitutive gene.
An inducible gene is a gene whose expression is either responsive to environmental change or dependent on the position in the cell cycle.
Any step of gene expression may be modulated, from the DNA-RNA transcription step to post-translational modification of a protein. The stability of the final gene product, whether it is RNA or protein, also contributes to the expression level of the gene—an unstable product results in a low expression level. In general gene expression is regulated through changes in the number and type of interactions between molecules that collectively influence transcription of DNA and translation of RNA.
Some simple examples of where gene expression is important are:
Control of insulin expression so it gives a signal for blood glucose regulation.
X chromosome inactivation in female mammals to prevent an "overdose" of the genes it contains.
Cyclin expression levels control progression through the eukaryotic cell cycle.
Transcriptional regulation
Regulation of transcription can be broken down into three main routes of influence; genetic (direct interaction of a control factor with the gene), modulation interaction of a control factor with the transcription machinery and epigenetic (non-sequence changes in DNA structure that influence transcription).
Direct interaction with DNA is the simplest and the most direct method by which a protein changes transcription levels. Genes often have several protein binding sites around the coding region with the specific function of regulating transcription. There are many classes of regulatory DNA binding sites known as enhancers, insulators and silencers. The mechanisms for regulating transcription are varied, from blocking key binding sites on the DNA for RNA polymerase to acting as an activator and promoting transcription by assisting RNA polymerase binding.
The activity of transcription factors is further modulated by intracellular signals causing protein post-translational modification including phosphorylation, acetylation, or glycosylation. These changes influence a transcription factor's ability to bind, directly or indirectly, to promoter DNA, to recruit RNA polymerase, or to favor elongation of a newly synthesized RNA molecule.
The nuclear membrane in eukaryotes allows further regulation of transcription factors by the duration of their presence in the nucleus, which is regulated by reversible changes in their structure and by binding of other proteins. Environmental stimuli or endocrine signals may cause modification of regulatory proteins eliciting cascades of intracellular signals, which result in regulation of gene expression.
It has become apparent that there is a significant influence of non-DNA-sequence specific effects on transcription. These effects are referred to as epigenetic and involve the higher order structure of DNA, non-sequence specific DNA binding proteins and chemical modification of DNA. In general epigenetic effects alter the accessibility of DNA to proteins and so modulate transcription.
In eukaryotes the structure of chromatin, controlled by the histone code, regulates access to DNA with significant impacts on the expression of genes in euchromatin and heterochromatin areas.
Enhancers, transcription factors, mediator complex and DNA loops in mammalian transcription
Gene expression in mammals is regulated by many cis-regulatory elements, including core promoters and promoter-proximal elements that are located near the transcription start sites of genes, upstream on the DNA (towards the 5' region of the sense strand). Other important cis-regulatory modules are localized in DNA regions that are distant from the transcription start sites. These include enhancers, silencers, insulators and tethering elements. Enhancers and their associated transcription factors have a leading role in the regulation of gene expression.
Enhancers are genome regions that regulate genes. Enhancers control cell-type-specific gene expression programs, most often by looping through long distances to come in physical proximity with the promoters of their target genes. Multiple enhancers, each often tens or hundred of thousands of nucleotides distant from their target genes, loop to their target gene promoters and coordinate with each other to control gene expression.
The illustration shows an enhancer looping around to come into proximity with the promoter of a target gene. The loop is stabilized by a dimer of a connector protein (e.g. dimer of CTCF or YY1). One member of the dimer is anchored to its binding motif on the enhancer and the other member is anchored to its binding motif on the promoter (represented by the red zigzags in the illustration). Several cell function-specific transcription factors (among the about 1,600 transcription factors in a human cell) generally bind to specific motifs on an enhancer. A small combination of these enhancer-bound transcription factors, when brought close to a promoter by a DNA loop, govern transcription level of the target gene. Mediator (a complex usually consisting of about 26 proteins in an interacting structure) communicates regulatory signals from enhancer DNA-bound transcription factors directly to the RNA polymerase II (pol II) enzyme bound to the promoter.
Enhancers, when active, are generally transcribed from both strands of DNA with RNA polymerases acting in two different directions, producing two eRNAs as illustrated in the figure. An inactive enhancer may be bound by an inactive transcription factor. Phosphorylation of the transcription factor may activate it and that activated transcription factor may then activate the enhancer to which it is bound (see small red star representing phosphorylation of transcription factor bound to enhancer in the illustration). An activated enhancer begins transcription of its RNA before activating transcription of messenger RNA from its target gene.
DNA methylation and demethylation in transcriptional regulation
DNA methylation is a widespread mechanism for epigenetic influence on gene expression and is seen in bacteria and eukaryotes and has roles in heritable transcription silencing and transcription regulation. Methylation most often occurs on a cytosine (see Figure). Methylation of cytosine primarily occurs in dinucleotide sequences where a cytosine is followed by a guanine, a CpG site. The number of CpG sites in the human genome is about 28 million. Depending on the type of cell, about 70% of the CpG sites have a methylated cytosine.
Methylation of cytosine in DNA has a major role in regulating gene expression. Methylation of CpGs in a promoter region of a gene usually represses gene transcription while methylation of CpGs in the body of a gene increases expression. TET enzymes play a central role in demethylation of methylated cytosines. Demethylation of CpGs in a gene promoter by TET enzyme activity increases transcription of the gene.
Transcriptional regulation in learning and memory
In a rat, contextual fear conditioning (CFC) is a painful learning experience. Just one episode of CFC can result in a life-long fearful memory. After an episode of CFC, cytosine methylation is altered in the promoter regions of about 9.17% of all genes in the hippocampus neuron DNA of a rat. The hippocampus is where new memories are initially stored. After CFC about 500 genes have increased transcription (often due to demethylation of CpG sites in a promoter region) and about 1,000 genes have decreased transcription (often due to newly formed 5-methylcytosine at CpG sites in a promoter region). The pattern of induced and repressed genes within neurons appears to provide a molecular basis for forming the first transient memory of this training event in the hippocampus of the rat brain.
Some specific mechanisms guiding new DNA methylations and new DNA demethylations in the hippocampus during memory establishment have been established (see for summary). One mechanism includes guiding the short isoform of the TET1 DNA demethylation enzyme, TET1s, to about 600 locations on the genome. The guidance is performed by association of TET1s with EGR1 protein, a transcription factor important in memory formation. Bringing TET1s to these locations initiates DNA demethylation at those sites, up-regulating associated genes. A second mechanism involves DNMT3A2, a splice-isoform of DNA methyltransferase DNMT3A, which adds methyl groups to cytosines in DNA. This isoform is induced by synaptic activity, and its location of action appears to be determined by histone post-translational modifications (a histone code). The resulting new messenger RNAs are then transported by messenger RNP particles (neuronal granules) to synapses of the neurons, where they can be translated into proteins affecting the activities of synapses.
In particular, the brain-derived neurotrophic factor gene (BDNF) is known as a "learning gene". After CFC there was upregulation of BDNF gene expression, related to decreased CpG methylation of certain internal promoters of the gene, and this was correlated with learning.
Transcriptional regulation in cancer
The majority of gene promoters contain a CpG island with numerous CpG sites. When many of a gene's promoter CpG sites are methylated the gene becomes silenced. Colorectal cancers typically have 3 to 6 driver mutations and 33 to 66 hitchhiker or passenger mutations. However, transcriptional silencing may be of more importance than mutation in causing progression to cancer. For example, in colorectal cancers about 600 to 800 genes are transcriptionally silenced by CpG island methylation (see regulation of transcription in cancer). Transcriptional repression in cancer can also occur by other epigenetic mechanisms, such as altered expression of microRNAs. In breast cancer, transcriptional repression of BRCA1 may occur more frequently by over-transcribed microRNA-182 than by hypermethylation of the BRCA1 promoter (see Low expression of BRCA1 in breast and ovarian cancers).
Post-transcriptional regulation
In eukaryotes, where export of RNA is required before translation is possible, nuclear export is thought to provide additional control over gene expression. All transport in and out of the nucleus is via the nuclear pore and transport is controlled by a wide range of importin and exportin proteins.
Expression of a gene coding for a protein is only possible if the messenger RNA carrying the code survives long enough to be translated. In a typical cell, an RNA molecule is only stable if specifically protected from degradation. RNA degradation has particular importance in regulation of expression in eukaryotic cells where mRNA has to travel significant distances before being translated. In eukaryotes, RNA is stabilised by certain post-transcriptional modifications, particularly the 5′ cap and poly-adenylated tail.
Intentional degradation of mRNA is used not just as a defence mechanism from foreign RNA (normally from viruses) but also as a route of mRNA destabilisation. If an mRNA molecule has a complementary sequence to a small interfering RNA then it is targeted for destruction via the RNA interference pathway.
Three prime untranslated regions and microRNAs
Three prime untranslated regions (3′UTRs) of messenger RNAs (mRNAs) often contain regulatory sequences that post-transcriptionally influence gene expression. Such 3′-UTRs often contain both binding sites for microRNAs (miRNAs) as well as for regulatory proteins. By binding to specific sites within the 3′-UTR, miRNAs can decrease gene expression of various mRNAs by either inhibiting translation or directly causing degradation of the transcript. The 3′-UTR also may have silencer regions that bind repressor proteins that inhibit the expression of a mRNA.
The 3′-UTR often contains microRNA response elements (MREs). MREs are sequences to which miRNAs bind. These are prevalent motifs within 3′-UTRs. Among all regulatory motifs within the 3′-UTRs (e.g. including silencer regions), MREs make up about half of the motifs.
As of 2014, the miRBase web site, an archive of miRNA sequences and annotations, listed 28,645 entries in 233 biologic species. Of these, 1,881 miRNAs were in annotated human miRNA loci. miRNAs were predicted to have an average of about four hundred target mRNAs (affecting expression of several hundred genes). Friedman et al. estimate that >45,000 miRNA target sites within human mRNA 3′UTRs are conserved above background levels, and >60% of human protein-coding genes have been under selective pressure to maintain pairing to miRNAs.
Direct experiments show that a single miRNA can reduce the stability of hundreds of unique mRNAs. Other experiments show that a single miRNA may repress the production of hundreds of proteins, but that this repression often is relatively mild (less than 2-fold).
The effects of miRNA dysregulation of gene expression seem to be important in cancer. For instance, in gastrointestinal cancers, nine miRNAs have been identified as epigenetically altered and effective in down regulating DNA repair enzymes.
The effects of miRNA dysregulation of gene expression also seem to be important in neuropsychiatric disorders, such as schizophrenia, bipolar disorder, major depression, Parkinson's disease, Alzheimer's disease and autism spectrum disorders.
Translational regulation
Direct regulation of translation is less prevalent than control of transcription or mRNA stability but is occasionally used. Inhibition of protein translation is a major target for toxins and antibiotics, so they can kill a cell by overriding its normal gene expression control. Protein synthesis inhibitors include the antibiotic neomycin and the toxin ricin.
Post-translational modifications
Post-translational modifications (PTMs) are covalent modifications to proteins. Like RNA splicing, they help to significantly diversify the proteome. These modifications are usually catalyzed by enzymes. Additionally, processes like covalent additions to amino acid side chain residues can often be reversed by other enzymes. However, some, like the proteolytic cleavage of the protein backbone, are irreversible.
PTMs play many important roles in the cell. For example, phosphorylation is primarily involved in activating and deactivating proteins and in signaling pathways. PTMs are involved in transcriptional regulation: an important function of acetylation and methylation is histone tail modification, which alters how accessible DNA is for transcription. They can also be seen in the immune system, where glycosylation plays a key role. One type of PTM can initiate another type of PTM, as can be seen in how ubiquitination tags proteins for degradation through proteolysis. Proteolysis, other than being involved in breaking down proteins, is also important in activating and deactivating them, and in regulating biological processes such as DNA transcription and cell death.
Measurement
Measuring gene expression is an important part of many life sciences, as the ability to quantify the level at which a particular gene is expressed within a cell, tissue or organism can provide a lot of valuable information. For example, measuring gene expression can:
Identify viral infection of a cell (viral protein expression).
Determine an individual's susceptibility to cancer (oncogene expression).
Find if a bacterium is resistant to penicillin (beta-lactamase expression).
Gene expression profiling evaluates a panel of genes to help understand the fundamental mechanism of a cell. This is increasingly used in cancer therapy to target specific chemotherapy. (See RNA-Seq and DNA_microarray for details.)
Similarly, the analysis of the location of protein expression is a powerful tool, and this can be done on an organismal or cellular scale. Investigation of localization is particularly important for the study of development in multicellular organisms and as an indicator of protein function in single cells. Ideally, measurement of expression is done by detecting the final gene product (for many genes, this is the protein); however, it is often easier to detect one of the precursors, typically mRNA and to infer gene-expression levels from these measurements.
mRNA quantification
Levels of mRNA can be quantitatively measured by northern blotting, which provides size and sequence information about the mRNA molecules. A sample of RNA is separated on an agarose gel and hybridized to a radioactively labeled RNA probe that is complementary to the target sequence. The radiolabeled RNA is then detected by an autoradiograph. Because the use of radioactive reagents makes the procedure time-consuming and potentially dangerous, alternative labeling and detection methods, such as digoxigenin and biotin chemistries, have been developed. Perceived disadvantages of Northern blotting are that large quantities of RNA are required and that quantification may not be completely accurate, as it involves measuring band strength in an image of a gel. On the other hand, the additional mRNA size information from the Northern blot allows the discrimination of alternately spliced transcripts.
Another approach for measuring mRNA abundance is RT-qPCR. In this technique, reverse transcription is followed by quantitative PCR. Reverse transcription first generates a DNA template from the mRNA; this single-stranded template is called cDNA. The cDNA template is then amplified in the quantitative step, during which the fluorescence emitted by labeled hybridization probes or intercalating dyes changes as the DNA amplification process progresses. With a carefully constructed standard curve, qPCR can produce an absolute measurement of the number of copies of original mRNA, typically in units of copies per nanolitre of homogenized tissue or copies per cell. qPCR is very sensitive (detection of a single mRNA molecule is theoretically possible), but can be expensive depending on the type of reporter used; fluorescently labeled oligonucleotide probes are more expensive than non-specific intercalating fluorescent dyes.
For expression profiling, or high-throughput analysis of many genes within a sample, quantitative PCR may be performed for hundreds of genes simultaneously in the case of low-density arrays. A second approach is the hybridization microarray. A single array or "chip" may contain probes to determine transcript levels for every known gene in the genome of one or more organisms. Alternatively, "tag based" technologies like Serial analysis of gene expression (SAGE) and RNA-Seq, which can provide a relative measure of the cellular concentration of different mRNAs, can be used. An advantage of tag-based methods is the "open architecture", allowing for the exact measurement of any transcript, with a known or unknown sequence. Next-generation sequencing (NGS) such as RNA-Seq is another approach, producing vast quantities of sequence data that can be matched to a reference genome. Although NGS is comparatively time-consuming, expensive, and resource-intensive, it can identify single-nucleotide polymorphisms, splice-variants, and novel genes, and can also be used to profile expression in organisms for which little or no sequence information is available.
RNA profiles in Wikipedia
Profiles like these are found for almost all proteins listed in Wikipedia. They are generated by organizations such as the Genomics Institute of the Novartis Research Foundation and the European Bioinformatics Institute. Additional information can be found by searching their databases (for an example of the GLUT4 transporter pictured here, see citation). These profiles indicate the level of DNA expression (and hence RNA produced) of a certain protein in a certain tissue, and are color-coded accordingly in the images located in the Protein Box on the right side of each Wikipedia page.
Protein quantification
For genes encoding proteins, the expression level can be directly assessed by a number of methods with some clear analogies to the techniques for mRNA quantification.
One of the most commonly used methods is to perform a Western blot against the protein of interest. This gives information on the size of the protein in addition to its identity. A sample (often cellular lysate) is separated on a polyacrylamide gel, transferred to a membrane and then probed with an antibody to the protein of interest. The antibody can either be conjugated to a fluorophore or to horseradish peroxidase for imaging and/or quantification. The gel-based nature of this assay makes quantification less accurate, but it has the advantage of being able to identify later modifications to the protein, for example proteolysis or ubiquitination, from changes in size.
mRNA-protein correlation
While transcription directly reflects gene expression, the copy number of mRNA molecules does not directly correlate with the number of protein molecules translated from mRNA. Quantification of both protein and mRNA permits a correlation of the two levels. Regulation on each step of gene expression can impact the correlation, as shown for regulation of translation or protein stability. Post-translational factors, such as protein transport in highly polar cells, can influence the measured mRNA-protein correlation as well.
Localization
Analysis of expression is not limited to quantification; localization can also be determined. mRNA can be detected with a suitably labelled complementary mRNA strand and protein can be detected via labelled antibodies. The probed sample is then observed by microscopy to identify where the mRNA or protein is.
By replacing the gene with a new version fused to a green fluorescent protein marker or similar, expression may be directly quantified in live cells. This is done by imaging using a fluorescence microscope. It is very difficult to clone a GFP-fused protein into its native location in the genome without affecting expression levels, so this method often cannot be used to measure endogenous gene expression. It is, however, widely used to measure the expression of a gene artificially introduced into the cell, for example via an expression vector. By fusing a target protein to a fluorescent reporter, the protein's behavior, including its cellular localization and expression level, can be significantly changed.
The enzyme-linked immunosorbent assay works by using antibodies immobilised on a microtiter plate to capture proteins of interest from samples added to the well. Using a detection antibody conjugated to an enzyme or fluorophore the quantity of bound protein can be accurately measured by fluorometric or colourimetric detection. The detection process is very similar to that of a Western blot, but by avoiding the gel steps more accurate quantification can be achieved.
Expression system
An expression system is a system specifically designed for the production of a gene product of choice. This is normally a protein although may also be RNA, such as tRNA or a ribozyme. An expression system consists of a gene, normally encoded by DNA, and the molecular machinery required to transcribe the DNA into mRNA and translate the mRNA into protein using the reagents provided. In the broadest sense this includes every living cell but the term is more normally used to refer to expression as a laboratory tool. An expression system is therefore often artificial in some manner. Expression systems are, however, a fundamentally natural process. Viruses are an excellent example where they replicate by using the host cell as an expression system for the viral proteins and genome.
Inducible expression
Doxycycline is also used in "Tet-on" and "Tet-off" tetracycline controlled transcriptional activation to regulate transgene expression in organisms and cell cultures.
In nature
In addition to these biological tools, certain naturally observed configurations of DNA (genes, promoters, enhancers, repressors) and the associated machinery itself are referred to as an expression system. This term is normally used in the case where a gene or set of genes is switched on under well defined conditions, for example, the simple repressor switch expression system in Lambda phage and the lac operator system in bacteria. Several natural expression systems are directly used or modified and used for artificial expression systems such as the Tet-on and Tet-off expression system.
Gene networks
Genes have sometimes been regarded as nodes in a network, with inputs being proteins such as transcription factors, and outputs being the level of gene expression. The node itself performs a function, and the operation of these functions have been interpreted as performing a kind of information processing within cells and determines cellular behavior.
Gene networks can also be constructed without formulating an explicit causal model. This is often the case when assembling networks from large expression data sets. Covariation and correlation of expression is computed across a large sample of cases and measurements (often transcriptome or proteome data). The source of variation can be either experimental or natural (observational). There are several ways to construct gene expression networks, but one common approach is to compute a matrix of all pair-wise correlations of expression across conditions, time points, or individuals and convert the matrix (after thresholding at some cut-off value) into a graphical representation in which nodes represent genes, transcripts, or proteins and edges connecting these nodes represent the strength of association (see GeneNetwork GeneNetwork 2).
Techniques and tools
The following experimental techniques are used to measure gene expression and are listed in roughly chronological order, starting with the older, more established technologies. They are divided into two groups based on their degree of multiplexity.
Low-to-mid-plex techniques:
Reporter gene
Northern blot
Western blot
Fluorescent in situ hybridization
Reverse transcription PCR
Higher-plex techniques:
SAGE
DNA microarray
Tiling array
RNA-Seq
Gene expression databases
Gene expression omnibus (GEO) at NCBI
Expression Atlas at the EBI
Bgee Bgee at the SIB Swiss Institute of Bioinformatics
Mouse Gene Expression Database at the Jackson Laboratory
CollecTF: a database of experimentally validated transcription factor-binding sites in Bacteria.
COLOMBOS: collection of bacterial expression compendia.
Many Microbe Microarrays Database: microbial Affymetrix data
See also
References
External links
Plant Transcription Factor Database and Plant Transcriptional Regulation Data and Analysis Platform
Molecular biology | Gene expression | Chemistry,Biology | 8,503 |
54,606,306 | https://en.wikipedia.org/wiki/Letters%20in%20Organic%20Chemistry | Letters in Organic Chemistry (usually abbreviated as Lett. Org. Chem.), is a peer-reviewed monthly scientific journal, published since 2004 by Bentham Science Publishers. Letters in Organic Chemistry is indexed in: Chemical Abstracts Service (CAS), EBSCOhost, British Library, PubMed, Web of Science, and Scopus.
Letters in Organic Chemistry publishes letters and articles on all areas related to organic chemistry.
According to the Journal Citation Reports, the impact factor of this journal is 0.867 for the year 2020. The Editor-in-Chief is Alberto Marra (University of Montpellier, France). who took over from Gwilherm Evano (Université libre de Bruxelles, Belgium) who resigned in February 2018 after a strong disagreement with Bentham on the scientific management of this journal.
References
Organic chemistry journals
Bentham Science Publishers academic journals | Letters in Organic Chemistry | Chemistry | 180 |
12,415,416 | https://en.wikipedia.org/wiki/Amalgam%20%28dentistry%29 | In dentistry, amalgam is an alloy of mercury used to fill teeth cavities. It is made by mixing a combination of liquid mercury and particles of solid metals such as silver, copper or tin. The amalgam is mixed by the dentist just before use. It remains soft for a short while after mixing, which facilitates it being snugly packed into the cavity and shaped before it sets hard.
Dental amalgams were first documented in a Tang dynasty medical text written by Su Gong (苏恭) in 659, and appeared in Germany in 1528. In the 1800s, amalgam became the dental restorative material of choice due to its low cost, ease of application, strength, and durability.
History of use
There are, according to Geir Bjørklund, indications that dental amalgam was used in the first part of the Tang dynasty in China (AD 618–907), and in Germany by Strockerus in about 1528. Evidence of a dental amalgam first appears in the Tang dynasty medical text Xinxiu bencao (新修本草) written by Su Gong (苏恭) in 659, manufactured from tin and silver. Historical records hint that the use of amalgams may date to even earlier in the Tang dynasty. It was during the Ming dynasty that the composition of an early dental amalgam was first published, and a text written by Liu Wentai in 1505 states that it consists of "100 shares of mercury, 45 shares of silver and 900 shares of tin."
Ever since its introduction in the Western world from 1818 and into the 1830s, amalgam has been the subject of recurrent controversies because of its mercury content. Early amalgam was made by mixing mercury with the filings of silver coins. In 1833, Polish-Jewish dentists from London, Edward Crawcour and his nephew Moses Crawcour (incorrectly referred to as "the Crawcour Brothers"), brought amalgam to the United States; but they had to flee back to Europe one year later, leaving “a long trail of victimized patients and exasperated dentists” due to their malpractices.
However, the use of amalgam caught on in the following years, and in 1844 it was reported that fifty percent of all dental restorations placed in upstate New York consisted of amalgam. The same year, the use of dental amalgam was declared to be malpractice by the American Society of Dental Surgeons (ASDS), the only US dental association at the time, who forced all of its members to sign a pledge to abstain from using the mercury fillings. This was the beginning of what is known as the first dental amalgam war. The dispute ended in 1856 with the disbanding of the old association. The American Dental Association (ADA) was founded in its place in 1859, which has since then strongly defended dental amalgam from allegations of being too risky from the health standpoint.
The controversy about amalgam fillings continued throughout the rest of the nineteenth century, with regional dentist societies condemning them, such as the St. Louis Odontological Society did as early as 1867.
Low copper to high copper amalgam alloy
Amalgam has been used for many years for restorations, commonly known as fillings. Prior to 1900 many compositions were tried but few were successful when placed in the oral environment. Around 1900, small amounts of copper and occasionally zinc were added. Zinc acts as a scavenger because it prevents oxidation of the other metals in the alloy during the manufacturing process. Zinc accomplishes this by combining readily with oxygen to form zinc oxide. Amalgam restorations made from this balanced formula were reasonably successful and its longevity increased. However, one disadvantage that remained was fracture at the tooth-amalgam interface commonly called marginal fracture. Sn8Hg (γ2 phase) was considered to be responsible for this problem. This phase has been shown to be the weakest phase in the set amalgam and is subject to corrosion, particularly at the tooth-amalgam interface.
In 1962 a new amalgam alloy, called Dispersalloy, was introduced by William and Ralph Youdelis of Edmonton, Alberta, Canada. William was a metallurgist in the Faculty of Engineering at the University of Alberta. His younger brother Ralph was a 1955 graduate of the Faculty of Dentistry at the same university. William Youdelis added a spherical silver-copper eutectic particle to the traditional lathe-cut Ag3Sn particle in a ratio of 1:2. The mixture of these two types of particles is known as admix alloy. This alloy strengthened the set amalgam and reduced the γ2 phase (Sn8Hg). The increased copper in the silver-copper eutectic reacted preferentially with tin so that Sn8Hg could not form. Early results from the clinical use of this new amalgam showed an improvement in marginal integrity. Faculty members of the Department of Operative Dentistry at The University of Alberta Faculty of Dentistry conducted clinical trials on the new material. It was produced by a local Edmonton company, Western Metallurgical. Johnson & Johnson pharmaceuticals eventually purchased the patent from the Youdelis brothers. 10 years later, another alloy, called Tytin, was introduced by adding significant amount of Cu3Sn together with Ag3Sn, in the form of a unicompositional spherical particle to eliminate the γ2 phase. Both of these relatively new alloys raised the copper content from 5%, present in the older balanced composition alloy, to about 13% for the newer alloys.
Composition
Dental amalgam is produced by mixing liquid mercury with an alloy made of silver, tin, and copper solid particles. Small quantities of zinc, mercury and other metals may be present in some alloys. This combination of solid particles is known as amalgam alloy. The composition of the alloy particles are controlled by the ISO Standard (ISO 1559) for dental amalgam alloy in order to control properties of set amalgam such as corrosion and setting expansion. It is important to differentiate between dental amalgam and the amalgam alloy that is commercially produced and marketed as small filings, spheroid particles, or a combination of these, suitable for mixing with liquid mercury to produce the dental amalgam. Amalgam is used most commonly for direct, permanent, posterior restorations and for large foundation restorations, or cores, which are precursors to placing crowns.
The reaction between mercury and alloy when mixed together is termed an amalgamation reaction. It will result in the formation of a silver-grey workable mass which can be condensed into cavities. After condensing, the dental amalgam is shaped to generate the required anatomical features and then hardens with time. The standard composition of alloy prior to 1986 is referred to as conventional amalgam alloy. More recently (post-1986), there has been a change in the compositional standard of the alloy due to better understanding of structure-property relationships for the materials. Conventional amalgam alloy commonly consists of silver (~65%), tin (~29%), copper (~8%) and other trace metals; current amalgam alloy consists of silver (40%), tin (32%), copper (30%) and other metals.
Alloy powder is then mixed with liquid mercury to produce dental amalgam. Low-copper amalgam commonly consists of mercury (50%), silver (~22–32%), tin (~14%), zinc (~8%) and other trace metals.
Metallurgy of amalgam
To fabricate an amalgam filling, the dentist uses a mixing device to blend roughly equal parts (by mass) of shavings of a silver-base alloy with mercury until the shavings are thoroughly wetted. The silver alloy is typically 40–70% Ag, 25-29% Sn, 2–40% Cu and 0–2% Zn (when the alloy is formulated Zn is a scavenger and is mostly consumed during melting and lost as oxide). The dentist packs the plastic mass, before it sets, into the cavity. The amalgam expands ≈0.1% over 6–8 hours on setting.
The final structure is a metal matrix composite, where γ1, η and γ2 phases, are a matrix for unreacted original alloy, minus the fast-reacting β-phase and excess Sn.
Properties of amalgam
Amalgam is a mixture of two or more metals (alloy) with mercury which has been purified first by distillation to remove impurities. Major components of the alloy are silver, tin, and copper. The composition of the alloy powder is controlled by ISO standard for dental amalgam alloy (ISO 1559) to control the properties of amalgam.
Plastic deformation (creep)
Creep or plastic deformation happens when subjected to intra-oral stresses such as chewing or grinding. Creep causes the amalgam to flow and protrudes from the margin of the cavity forming unsupported edges. "Ditch" is formed around the margins of the amalgam restoration after fracture due to amalgam creep at the occlusal margins. The γ2 phase of amalgam is primarily responsible for high values of creep.
Corrosion
Corrosion occurs when an anode and cathode are set up in the presence of electrolytes, creating an electrolytic cell. The multiphase structure of dental amalgam can contribute as an anode or cathode with saliva as electrolytes. Corrosion may significantly affect the structure and mechanical properties of set dental amalgam. In conventional amalgam, γ2 phase is the most reactive and readily forms an anode. It will break down releasing corrosion products and mercury. Some of the mercury will combine rapidly with unreacted alloy and some will be ingested. The chances of ditching are further increased. Copper-enriched amalgams contain little or no γ2 phase. The copper–tin phase, which replaces γ2 in these materials, is still the most corrosion-prone phase in the amalgam. The corrosion however is still much lower than conventional amalgam.
In spite of that, it is thought that corrosion actually offers a clinical advantage. The corrosion products will gather at the tooth-amalgam interface and fill the microgap (marginal gap) which helps to decrease microleakage. Even so, there are no reports of increased marginal leakage for the copper-enriched amalgams indicating that sufficient quantities of corrosion product are produced to seal the margins.
Microleakage is the leakage of minute amounts of fluids, debris, and microorganisms through the microscopic space between a dental restoration and the adjacent surface of the cavity preparation. Microleakage can risk recurrent cavities.
Strength
An amalgam restoration develops its strength slowly and may take up to 24 hours or longer to reach a reasonably high value. At the time when the patient is dismissed from the surgery, typically some 15–20 minutes after placing the filling, the amalgam is relatively weak. Therefore, dentists need to instruct patients not to apply undue stress to their freshly placed amalgam fillings.
In addition, amalgam restorations are brittle and susceptible to corrosion.
Amalgam's reaction phases
γ : Ag3Sn (mechanically the strongest)
γ1 : Ag2Hg3 (major matrix phase in set amalgam)
γ2 : Sn8Hg (weakest phase, corrodes easily)
β : Ag5Sn
η' : Cu6Sn5
ε : Cu3Sn
The alloys are broadly classified as low-copper (5% or less copper) and high-copper alloys (13% to 30% copper). The solid particles of the alloy are either spherical or irregularly shaped microspheres of various sizes or a combination of the two. The low-copper alloys have either irregular or spherical particles. High-copper alloys contain either spherical particles of the same composition (unicompositional) or a mixture of irregular and spherical particles of different or the same composition (admixed). The properties of set amalgam depends upon the alloy composition—particle size, shape and distribution—and heat treatment controls the characteristic properties of the amalgam.
Low copper alloy
During trituration, mercury diffuses into the silver-tin particles. Then, silver and tin dissolve, to a very limited extent, into the mercury. As this occurs, the particles become smaller. Because the solubility of both silver and tin in mercury is limited and because silver is much less soluble in mercury than is tin, silver precipitates out first as silver-mercury (γ1) followed by tin in the form of tin-mercury (γ2). The set amalgam consists of unreacted gamma particles surrounded by a matrix of gamma 1 and gamma 2. The amalgamation is summarised as follows:
Ag3Sn, Ag5Sn + Hg → Ag2Hg3 + Sn8Hg + Ag3Sn
i.e. (γ + β) + Hg → γ1 + γ2 + γ
High copper alloy
In high copper alloy, copper is added to improve mechanical properties, resistance to corrosion and marginal integrity. The higher copper is supplied by either the silver-copper eutectic or the Cu3Sn (ε) phase. The fact that tin had a greater affinity for copper than for mercury meant that the gamma-2 phase was reduced or eliminated. This resulted in the dramatic improvement in physical properties. The higher copper content is supplied as two types:
High copper admix alloy (spherical particles of the silver-copper eutectic alloy to a low-copper lathe-cut alloy in a ratio of 1:2)
Uni/single-composition alloy
Admix alloy setting reaction
During trituration, the dissolved silver from the silver-tin particles reacts, as in low copper alloys, to form the γ1 phase. The dissolved tin migrates to the outside of the silver-copper particles to form Cu6Sn5, the eta prime (η′) phase of the copper-tin system. Thus, copper reacts with sufficient tin to prevent the formation of γ2. The amalgamation reaction may be simplified as follows (notice the absence of γ2 phase):
γ(Ag3Sn) + Ag-Cu (eutectic) + Hg → γ1 (Ag2Hg3)+ η ′ (Cu6Sn5)+ unreacted γ (Ag3Sn) + unreacted Ag-Cu (eutectic)
Uni/single composition alloy
Here, the alloy particles contain both Ag3Sn(γ) and Cu3Sn(ε), similar to the low-copper lathe-cut alloys, but with much greater amount of the Cu3Sn(ε) phase. These alloys are usually spherical. When liquid mercury is mixed with these alloys, it diffuses into the surface of these particles forming Ag2Hg3 as well as Cu6Sn5.
γ(Ag3Sn) + ɛ(Cu3Sn) + Hg → γ1 (Ag2Hg3) + η ′ (Cu6Sn5) + unreacted [γ (Ag3Sn)+ ɛ (Cu3Sn )]
The difference in eta prime phase of admixed alloy and unicomposition alloy is that in unicomposition alloy, Cu6Sn5 crystals are much larger and rod-shaped than those in admixed alloy. Copper added in unicomposition causes removal of the gamma2 phase.
Advantages of high copper compared to low copper alloy
Better corrosion resistance.
Less susceptible to creep.
Greater strength.
Less tarnish and corrosion.
Greater longevity.
Amalgam vs. polymer resins
Amalgam is tolerant to a wide range of clinical placement conditions and moderately tolerant to the presence of moisture during placement. In contrast, the techniques for composite resin placement are more sensitive to many factors.
Mercury has properties of a bacteriostatic agent whereas certain methacrylate polymers (for example TEGMA, triethylene glycol methacrylate) composing the matrix of resin composites "encourages the growth of microorganisms". In the Casa Pia study in Portugal (1986–1989), 1,748 posterior restorations were placed and 177 (10.1%) of them failed during the course of the study. Recurrent marginal decay was the main reason for failure in both amalgam and composite restorations, accounting for 66% (32/48) and 88% (113/129), respectively. Polymerization shrinkage, the shrinkage that occurs during the composite curing process, has been implicated in a 2002 review of the literature and a 2003 study as the primary reason for postoperative marginal leakage.
However, there is low-quality evidence in two 2014 studies to suggest that resin composites lead to higher failure rates and risk of secondary caries than amalgam restorations.
Several reviews have been made by using database in the Cochrane Library where randomized controlled trials of few studies comparing dental resin composite with dental amalgams in permanent posterior teeth were compared. This review supports the fact that amalgam restorations are particularly useful and successful in parts of the world where amalgam is still the material of choice to restore posterior teeth with proximal caries. Though, there is insufficient evidence to support or refute any adverse effects amalgam may have on patients, new research is unlikely to change opinion on its safety and due to the decision for a global phase-down of amalgam (Minamata Convention on Mercury) general opinion on its safety is unlikely to change.
These are some of the reasons why amalgam has remained a superior restorative material over resin-base composites. The New England Children's Amalgam Trial (NECAT), a randomized controlled trial, yielded results "consistent with previous reports suggesting that the longevity of amalgam is higher than that of resin-based compomer in primary teeth, according to a 2007 review of the study, with some similar claims in a 2003 paper, and composites in permanent teeth according to that 2007 review and a paper from 1986. Compomers were seven times as likely to require replacement and composites were seven times as likely to require repair. There are circumstances in which composite serves better than amalgam. For example, when a more conservative preparation would be beneficial, composite is the recommended restorative material. These situations would include small occlusal restorations, in which amalgam would require the removal of more sound tooth structure, as well as in "enamel sites beyond the height of contour". For cosmetic purposes, composite is preferred when a restoration is required on an immediately visible portion of a tooth.
Bonded amalgam
Dental amalgam does not by itself bond to tooth structure. This was recognized as a shortcoming by early practitioners such as Baldwin. He recommended that the prepared cavity be coated with zinc phosphate cement just prior to filling with amalgam, in order to improve the seal and retention. The practice did not become universally accepted and eventually fell into disuse. Until the 1980s, most amalgam restorations placed worldwide were done without adhesives, although in the 1970s a polycarboxylate-based adhesive liner was formulated specifically for this purpose In the mid-1980s the first reports of the use of resins to bond amalgam to etched tooth structure, much like is done for composite resins, appeared in the literature. Since then, a number of papers have been published on laboratory as well as clinical studies of the technique. For large cavity restorations, features such as pins, slots, holes and grooves can be used for the retention of large amalgam restorations, but they do not reinforce the amalgam or increase its strength.
There is no current scientific evidence to justify the extra cost and effort associated with the use of adhesively bonded amalgam restorations in comparison with nonbonded amalgam restorations. In view of the lack of evidence on the additional benefit of adhesively bonding amalgam compared with nonbonded amalgam, it is important that clinicians are mindful of the additional costs that may be incurred.
Liners and bases
The placement of amalgam restorations can potentially cause sensitivity post-operatively. According to R. Weiner, a protective layer or liner should be placed prior to the placement of amalgam to act as a buffer, helping to reduce sensitivity to the tooth. There are different liners that can be used in dental practices today, many of which contain zinc. Examples of lining materials include zinc oxide eugenol, zinc phosphate, glass ionomer cement, zinc poly-carboxylate and resin.
Sealing amalgam restorations
A varnish can be applied to the cavity wall to provide a good marginal seal. The varnish should be insoluble in water and is usually composed of a resin in a volatile solvent. When applied to the cavity, the solvent evaporates, leaving the resin behind to seal the dentinal tubules. The amalgam can then be packed into the cavity.
Dental amalgam toxicity
Concerns have been raised about the potential for mercury poisoning with dental amalgam when used in a dental filling. Major health and professional organizations regard amalgam as safe but questions have been raised and acute but rare allergic reactions have been reported.
Critics argue that it has toxic effects that make it unsafe, both for the patient and perhaps even more so for the dental professional manipulating it during a restoration. A study by the Life Sciences Research Office found that studies on mercury vapor and dental amalgam "provided insufficient information to enable definitive conclusions." They identified several "research gaps", including: "well-controlled studies using standardized measures that evaluate whether low level [mercury vapor exposures] produce neurotoxic and/or neuropsychological effect", studies on "co-exposure to Hg0 and methylmercury", studies on "in utero exposure to Hg0" (elemental mercury), "occupational studies on [pregnant workers] with well-defined Hg0 exposure", studies on the absorption of Hg2+ by the "human neonatal gut from breast milk", studies on "whether dental professionals have increased incidences of kidney disease, emotional instability, erethism, pulmonary dysfunction, or other characteristics of occupational Hg0 exposure", studies on whether there exist "potential gender differences" or "genetic basis for sensitivity to mercury exposure." The removal of amalgam fillings is not recommended for reasons other than a true hypersensitivity to mercury. Mercury levels in blood and urine have been shown to rise for a short period of time following the removal of amalgam restorations and no studies have demonstrated any health gain from restoration removal. Removal involves exposure to mercury vapor released during the removal process. Amalgams also contribute to mercury toxicity in the environment. With regard to amalgam placement and removal in pregnancy, research has not shown any adverse effects for the mother or fetus. However, research is inadequate to determine the chance of harm occurring and therefore placement and removal should be avoided during pregnancy if possible.
In response to The Minamata Convention on Mercury, the European Commission has confirmed its position that individual nations should work to gradually scale down the use of dental amalgam.
In July 2018 the EU, "in consideration of the persistent pollution and environmental toxicity of amalgam's mercury", prohibited amalgam for dental treatment of children under 15 years and of pregnant or breastfeeding women.
Environmental impact and prevention of amalgam poisoning
Dental amalgam is thought to be relatively safe to be used as a restorative material as it is used in low doses. Amalgam vapour can be released through chewing but this is minimal. However, there is an increased release of mercury following the exposure of electromagnetic fields generated by MRI machines, although the small amount released is not thought to pose a risk to health. Some patients may develop allergic reactions to it. Resin composite, glass ionomer cements and ceramic or gold inlays can be used as alternatives to amalgam.
U.S. amalgam disposal regulation
In the United States, dental offices have typically disposed of amalgam waste down the drain. The wastewater is sent to the local sewage treatment plant, which is not designed to treat or recycle mercury or other heavy metals. The mercury contaminates the sludge processed at the treatment plant, and thereby can spread the mercury in surrounding communities, if the sludge is land-applied for disposal. Dental amalgam is the largest source of mercury received by U.S. treatment plants.
The U.S. Environmental Protection Agency (EPA) promulgated an effluent guidelines regulation in 2017 which prohibits most dental practices from disposing dental amalgam waste down the drain. Most dental offices in the U.S. are required to use an amalgam separator in their drain system. The separator captures the waste material, which is then recycled.
EU amalgam disposal regulation
The European Commission has issued a Waste Directive that classifies amalgam waste as a hazardous waste. The waste should be separated from other waste by fitting amalgam separators in all dental practices.
Avoidance in pregnant women
Mercury can cross the placenta leading to stillbirths and birth defects. Although there is no evidence linking amalgam use and pregnancy damage, it is advisable to delay or avoid dealing with amalgam fillings in pregnant patients.
In July 2018 the EU prohibited amalgam for dental treatment of children under 15 years and of pregnant or breastfeeding women unless use of amalgam is medically indicated. There is no hint for a toxicity for the embryo of pregnant women. In addition, there is no scientific reason for avoiding amalgam for breastfeeding women. As the milk teeth won't remain for long, the avoidance of amalgam for children is driving by environmental considerations.
Awareness among dentists
The dental operating team should deal with amalgam with proper use of personal protective equipment to protect themselves. A popular methodology for removal and replacement is the Safe Mercury Amalgam Removal Technique or S.M.A.R.T. protocol.
Oral lesions
Some individuals have a sensitivity to amalgam and may develop oral lesions in which case a change of filling type is recommended.
References
External links
Position Paper on Amalgam Fillings , National Council Against Health Fraud
Composite Fillings - Tooth-Colored Fillings, American Dental Association
Amalgam Archives at Listserv.dfn.de (Forum)
Dental materials
Restorative dentistry
Chinese inventions
Amalgams | Amalgam (dentistry) | Physics,Chemistry | 5,568 |
4,157,363 | https://en.wikipedia.org/wiki/Stellated%20truncated%20hexahedron | In geometry, the stellated truncated hexahedron (or quasitruncated hexahedron, and stellatruncated cube) is a uniform star polyhedron, indexed as U19. It has 14 faces (8 triangles and 6 octagrams), 36 edges, and 24 vertices. It is represented by Schläfli symbol t'{4,3} or t{4/3,3}, and Coxeter-Dynkin diagram, . It is sometimes called quasitruncated hexahedron because it is related to the truncated cube, , except that the square faces become inverted into {8/3} octagrams.
Even though the stellated truncated hexahedron is a stellation of the truncated hexahedron, its core is a regular octahedron.
Orthographic projections
Related polyhedra
It shares the vertex arrangement with three other uniform polyhedra: the convex rhombicuboctahedron, the small rhombihexahedron, and the small cubicuboctahedron.
See also
List of uniform polyhedra
References
External links
Uniform polyhedra | Stellated truncated hexahedron | Physics | 232 |
6,529,224 | https://en.wikipedia.org/wiki/Mother%20Armenia | Mother Armenia () is a female personification of Armenia. Her most public visual rendering is a monumental statue in Victory Park overlooking the capital city of Yerevan, Armenia.
Mother Armenia statue in Yerevan
The current statue replaces a monumental statue of General Secretary Joseph Stalin that was created as a victory memorial for World War II. During Stalin's government of the Soviet Union, Grigor Harutyunyan, the first secretary of the Armenian Communist Party's Central Committee, and members of the government oversaw the construction of the monument which was completed and unveiled to the people on November 29, 1950. The statue was considered a masterpiece of the sculptor Sergey Merkurov. The pedestal was designed by architect Rafayel Israyelian. Realizing that occupying a pedestal can be a short-term honour, Israyelian designed the pedestal to resemble a three-nave basilica Armenian church, as he confessed many years later "Knowing that the glory of dictators is temporary, I have built a simple three-nave Armenian basilica". In contrast to the right-angled shapes of the external view, the interior is light and pleasing to the eye and resembled Echmiadzin's seventh-century St. Hripsime Church.
In spring 1962, the statue of Stalin was removed, with one soldier being killed and many injured during the process, and in 1967, the statue of Mother Armenia, designed by Ara Harutyunyan, was installed in its place.
The prototype of "Mother Armenia" was a 17-year-old girl Genya Muradian. Ara Harutyunyan met her at the store and persuaded her to pose for the sculpture.
"Mother Armenia" has a height of , thus making the overall height of the monument , including the pedestal. The statue is built of hammered copper while the pedestal-museum is of basalt.
Symbolism
The Mother Armenia statue symbolises peace through strength. It can remind viewers of some of the prominent female figures in Armenian history, such as Sose Mayrig and others, who took up arms to help their husbands in their clashes with Turkish troops and Kurdish irregulars. It also recalls the important status and value attributed to the older female members of an Armenian family.
Its location on a hill overlooking Yerevan makes it look like a guardian of the Armenian capital. Every year on 9 May, thousands of Armenians visit the statue of Mother Armenia and lay flowers to commemorate the Armenian martyrs of the Second World War. The pedestal hosts the Mother Armenia Military Museum of the Ministry of Defense. When first built it housed a military museum dedicated to World War II. Today, a large proportion of the exhibition space is devoted to the Nagorno-Karabakh War of 1988–1994. On display are the personal belongings, weapons, and documents of participants, and the walls are decorated with their portraits. Among other historical artifacts, there is a map on which Armenian forces worked out their campaign for the Battle of Shushi.
Gallery
See also
List of tallest statues
Kartlis Deda
Mother Ukraine
References
External links
Meeting 'Mother Armenia,' The Woman Behind Yerevan's Iconic Statue
National personifications
Buildings and structures in Yerevan
Monuments and memorials in Armenia
Monuments and memorials built in the Soviet Union
Colossal statues
Fictional Armenian people
Armenian Soviet Socialist Republic
Tourist attractions in Yerevan
Sculptures of women in Armenia
Statues in Armenia
Sculptures of women in the Soviet Union | Mother Armenia | Physics,Mathematics | 679 |
54,614,031 | https://en.wikipedia.org/wiki/John%20Gordon%20Rushbrooke | John Gordon Rushbrooke (1936–2003) was an Australian particle physicist.
The son of Neil and Vera Rushbrooke, with four sisters, Rushbrooke was born in Geelong in 1936 and was brought up there. He attended Geelong Grammar School, where he was at the top of every class.
Rushbrooke went on to Trinity College in Perth, graduating with a BSc in 1956. This was followed by a master's degree at Australia's first cyclotron, where he began his work as a high-energy physicist. His thesis from the University of Melbourne was on Coulomb excitations of the atom.
In 1959 Rushbrooke won a scholarship that took him to King's College, Cambridge. Following work at the Cavendish Laboratory and completion of his PhD, Rushbrooke spent a year at CERN in Geneva before returning to Cambridge to take up a fellowship at Downing College as director of studies in physics.
For five years from 1977 he was on leave from his duties at Cambridge, based again at CERN, where he became the spokesperson for the UA5 collaboration. The UA5 experiment searched for Centauro events at the Proton-Antiproton Collider, a modification of the Super Proton Synchrotron.
In 1983 Rushbrooke was promoted to a readership in physics at Cambridge, and in 1991 the university conferred on him a second doctorate. During the 1990s Rushbrooke worked on commercializing technology from scanning techniques developed at CERN. He moved to California in 2000 after securing a contract with a major US company.
Rushbrooke died in California in 2003, at the age of 67.
References
External links
List of publications, Inspire HEP
Australian physicists
Australian academics
People associated with CERN
1936 births
2003 deaths
Fellows of Downing College, Cambridge
People educated at Geelong Grammar School
Particle physicists | John Gordon Rushbrooke | Physics | 373 |
2,432,829 | https://en.wikipedia.org/wiki/Dorman%20Long | Dorman Long & Co was a UK steel producer, later diversifying into bridge building. The company was once listed on the London Stock Exchange.
History
The company was founded by Arthur Dorman and Albert de Lande Long when they acquired West Marsh Iron Works in 1875. In the 1920s Dorman Long took over the concerns of Bell Brothers and Bolckow and Vaughan and diversified into the construction of bridges. In 1938 Ellis Hunter took over as Managing Director and he continued to lead the business until 1961.
In 1967 Dorman Long was nationalised, along with 13 other British steel-making firms, becoming subsumed into the government-owned British Steel Corporation. In 1982 Redpath Dorman Long, the engineering part of the business, was acquired by Trafalgar House who in 1990 merged it into Cleveland Bridge & Engineering Company in Darlington.
Iron and steel
Iron-making has been known in Cleveland since the Romans found iron slags in North Yorkshire, with small-scale iron-making known to have taken place at Rievaulx and Whitby Abbeys and at Gisborough Priory in the 17th century.
Some of the key events connected with iron-making in Cleveland:
1837: The first Cleveland ironstone mine opens, at Grosmont, for the Losh, Wilson and Bell ironworks.
1841: Bolckow and Vaughan open the first ironworks in Middlesbrough.
1850: 8 June – The Discovery of the Cleveland Main Seam of Ironstone at Eston by Ironmaster John Vaughan and mining engineer John Marley both of Bolckow & Vaughan. The Cleveland iron rush begins.
1865: 30 blast furnaces operate within six miles (10 km) of Middlesbrough and one million tonnes per annum (TPA) of iron are produced to make the area one of the world's major centres of iron production.
1879: Sidney Gilchrist Thomas arrives in Cleveland and introduces the first commercial steel.
1903: Partial amalgamation of Bell companies with Dorman Long.
1917: The Redcar steel plant is opened, making steel in the open hearth process.
1928-9: Dorman Long takes over residues of Bell and Bolckow Vaughan.
1946: Dorman Long purchases of land between the Redcar and Cleveland Works to build the Lackenby development.
1955: The Dorman Long tower, a combined coal silo, firefighting water tower, and control room, was built on the Teesside steelworks site.
1967: Dorman Long, South Durham Steel Iron Co, and Stewarts and Lloyds come together to create British Steel and Tube Ltd.
1967: The steel industry is nationalised and the British Steel Corporation is born.
1989: Company is privatised becoming British Steel plc.
1990: Merged with The Cleveland Bridge & Engineering Company, Darlington.
1999: British Steel plc merges with the Dutch steel and aluminium company Koninklijke Hoogovens to become Corus Group.
2015: Former Dorman Long Steel plant on Teesside ceased production after SSI mothballed the Redcar works following a global downturn in the price of steel and later announced its UK arm had gone into liquidation.
2021: Cleveland Bridge goes into administration.
2021: The Dorman Long tower is demolished, despite its Grade II listed status.
Bridge building
The most famous bridge ever constructed by a Teesside company was Dorman Long's Sydney Harbour Bridge of 1932, of similar construction to but, contrary to popular belief, not modelled on the 1928 Tyne Bridge, a construction regarded as the symbol of Tyneside's Geordie pride, but also a product of Dorman Long's Teesside workmanship. The greatest example of Dorman Long's work in Teesside itself is the single-span Newport Lifting Bridge (a Grade II Listed Building). Opened by the Duke of York in February 1934 it was England's first vertical lift bridge.
List of bridges constructed
The following is a list of some of the bridges built by the Dorman Long: it is not fully comprehensive.
Dorman Museum
In 1904 Sir Arthur Dorman of Dorman Long gave the Dorman Museum to Middlesbrough in honour of his youngest son, George Lockwood Dorman, an avid collector who died in the Boer War. Amongst the museum's exhibits is a collection of ceramics from the local Linthorpe Pottery, which was known for its iridescent glazes which, at the time, were not produced anywhere else in Europe.
Dorman Long Tower
The Dorman Long tower was built from 1955 to 1956 as a coking plant for steel production. The tower was an early example of brutalist architecture. It was scheduled to be demolished in 2021 due its poor state of repair and granted Grade II listed status, in an emergency listing by Historic England on 10 September 2021. The emergency listing cited its significance as a "recognised and celebrated example of early Brutalist architecture", a "nationally unique surviving structure from the twentieth-century coal, iron and steel industries" as well as "for its association with, and an advert for, Dorman Long which dominated the steel and heavy engineering industry of Teesside".
In one of her first acts as Culture Secretary, Nadine Dorries revoked the listingamidst accusations of "cultural vandalism"enabling demolition of the building to be scheduled. The tower was demolished between 00:00 and 00:20 on 19 September 2021 in a series of controlled explosions.
References
External links
Companies based in County Durham
Companies based in Middlesbrough
British companies established in 1875
Companies formerly listed on the London Stock Exchange
Construction and civil engineering companies of the United Kingdom
Structural steel
1875 establishments in England
Construction and civil engineering companies established in 1875
Engineering consulting firms of the United Kingdom | Dorman Long | Engineering | 1,152 |
1,189,871 | https://en.wikipedia.org/wiki/Australian%20Medicines%20Handbook | Australian Medicines Handbook (AMH) is a peer-reviewed medicines prescribing guide for Australian health professionals. The handbook is available in paper and digital formats and is supplemented by the AMH Aged Care Companion and the AMH Children's Dosing Companion.
It is included in the Clinical Information Access Portal.
Development
The AMH was first published in May 1998 driven by the need for a local, independent and up-to-date source of drug information to foster rational prescribing. Reflecting contemporary Australian clinical practice and adhering to the principles of the quality use of medicines, it is generally considered the Australian equivalent to the British National Formulary on which it was partly modelled.
AMH Pty Ltd, the publishing company created to develop and maintain the AMH content, is a professional partnership between three organisations: the Australasian Society of Clinical and Experimental Pharmacologists and Toxicologists, the Pharmaceutical Society of Australia, and the Royal Australian College of General Practitioners.
See also
Australian Pharmaceutical Formulary
British National Formulary
References
External links
Australian Medicines Handbook[subscription required]
Pharmacology literature
Pharmacy in Australia | Australian Medicines Handbook | Chemistry | 227 |
26,467,595 | https://en.wikipedia.org/wiki/Bile%20salt%20sulfotransferase | Bile salt sulfotransferase also known as hydroxysteroid sulfotransferase (HST) or sulfotransferase 2A1 (ST2A1) is an enzyme that in humans is encoded by the SULT2A1 gene.
Function
Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene is primarily expressed in liver and adrenal tissues where the encoded protein sulfonates steroids and bile acids.
See also
Steroid sulfotransferase
Steroidogenic enzyme
References
Further reading
External links
Post-translational modification | Bile salt sulfotransferase | Chemistry | 175 |
37,335 | https://en.wikipedia.org/wiki/Drought | A drought is a period of drier-than-normal conditions. A drought can last for days, months or years. Drought often has large impacts on the ecosystems and agriculture of affected regions, and causes harm to the local economy. Annual dry seasons in the tropics significantly increase the chances of a drought developing, with subsequent increased wildfire risks. Heat waves can significantly worsen drought conditions by increasing evapotranspiration. This dries out forests and other vegetation, and increases the amount of fuel for wildfires.
Drought is a recurring feature of the climate in most parts of the world, becoming more extreme and less predictable due to climate change, which dendrochronological studies date back to 1900. There are three kinds of drought effects, environmental, economic and social. Environmental effects include the drying of wetlands, more and larger wildfires, loss of biodiversity.
Economic impacts of drought result due to negative disruptions to agriculture and livestock farming (causing food insecurity), forestry, public water supplies, maritime navigation (due to e.g.: lower water levels), electric power supply (by affecting hydropower systems) and impacts on human health.
Social and health costs include the negative effect on the health of people directly exposed to this phenomenon (excessive heat waves), high food costs, stress caused by failed harvests, water scarcity, etc. Drought can also lead to increased air pollution due to increased dust concentrations and wildfires. Prolonged droughts have caused mass migrations and humanitarian crisis.
Examples for regions with increased drought risks are the Amazon basin, Australia, the Sahel region and India. For example, in 2005, parts of the Amazon basin experienced the worst drought in 100 years. Australia could experience more severe droughts and they could become more frequent in the future, a government-commissioned report said on July 6, 2008. The long Australian Millennial drought broke in 2010. The 2020–2022 Horn of Africa drought has surpassed the horrific drought in 2010–2011 in both duration and severity. More than 150 districts in India are drought vulnerable, mostly concentrated in the state of Rajasthan, Gujarat, Madhya Pradesh and its adjoining Chhattisgarh, Uttar Pradesh, northern Karnataka and adjoining Maharashtra of the country.
Throughout history, humans have usually viewed droughts as disasters due to the impact on food availability and the rest of society. People have viewed drought as a natural disaster or as something influenced by human activity, or as a result of supernatural forces.
Definition
The IPCC Sixth Assessment Report defines a drought simply as "drier than normal conditions". This means that a drought is "a moisture deficit relative to the average water availability at a given location and season".
According to National Integrated Drought Information System, a multi-agency partnership, drought is generally defined as "a deficiency of precipitation over an extended period of time (usually a season or more), resulting in a water shortage". The National Weather Service office of the NOAA defines drought as "a deficiency of moisture that results in adverse impacts on people, animals, or vegetation over a sizeable area".
Drought is a complex phenomenon − relating to the absence of water − which is difficult to monitor and define. By the early 1980s, over 150 definitions of "drought" had already been published. The range of definitions reflects differences in regions, needs, and disciplinary approaches.
Categories
There are three major categories of drought based on where in the water cycle the moisture deficit occurs: meteorological drought, hydrological drought, and agricultural or ecological drought. A meteorological drought occurs due to lack of precipitation. A hydrological drought is related to low runoff, streamflow, and reservoir and groundwater storage. An agricultural or ecological drought is causing plant stress from a combination of evaporation and low soil moisture. Some organizations add another category: socioeconomic drought occurs when the demand for an economic good exceeds supply as a result of a weather-related shortfall in water supply. The socioeconomic drought is a similar concept to water scarcity.
The different categories of droughts have different causes but similar effects:
Meteorological drought occurs when there is a prolonged time with less than average precipitation. Meteorological drought usually precedes the other kinds of drought. As a drought persists, the conditions surrounding it gradually worsen and its impact on the local population gradually increases.
Hydrological drought happens when water reserves available in sources such as aquifers, lakes and reservoirs fall below average or a locally significant threshold. Hydrological drought tends to present more slowly because it involves stored water that is used but not replenished. Due to the close interaction with water use, this type of drought is can be heavily influenced by water management. Both positive and negative human influences have been discovered and strategic water management strategies seem key to mitigate drought impact. Like agricultural droughts, hydrological droughts can be triggered by more than just a loss of rainfall. For instance, around 2007 Kazakhstan was awarded a large amount of money by the World Bank to restore water that had been diverted to other nations from the Aral Sea under Soviet rule. Similar circumstances also place their largest lake, Balkhash, at risk of completely drying out.
Agricultural or ecological droughts affect crop production or ecosystems in general. This condition can also arise independently from any change in precipitation levels when either increased irrigation or soil conditions and erosion triggered by poorly planned agricultural endeavors cause a shortfall in water available to the crops.
Indices and monitoring
Several indices have been defined to quantify and monitor drought at different spatial and temporal scales. A key property of drought indices is their spatial comparability, and they must be statistically robust. Drought indices include:
Palmer drought index (sometimes called the Palmer drought severity index (PDSI)): a regional drought index commonly used for monitoring drought events and studying areal extent and severity of drought episodes. The index uses precipitation and temperature data to study moisture supply and demand using a simple water balance model.
Keetch-Byram Drought Index: an index that is calculated based on rainfall, air temperature, and other meteorological factors.
Standardized precipitation index (SPI): It is computed based on precipitation, which makes it a simple and easy-to-apply indicator for monitoring and prediction of droughts in different parts of the world. The World Meteorological Organization recommends this index for identifying and monitoring meteorological droughts in different climates and time periods.
Standardized Precipitation Evapotranspiration Index (SPEI): a multiscalar drought index based on climatic data. The SPEI accounts also for the role of the increased atmospheric evaporative demand on drought severity. Evaporative demand is particularly dominant during periods of precipitation deficit. The SPEI calculation requires long-term and high-quality precipitation and atmospheric evaporative demand datasets. These can be obtained from ground stations or gridded data based on reanalysis as well as satellite and multi-source datasets.
Indices related to vegetation: root-zone soil moisture, vegetation condition index (VDI) and vegetation health index (VHI). The VCI and VHI are computed based on vegetation indices such as the normalized difference vegetation index (NDVI) and temperature datasets.
Deciles index
Standardized runoff index
High-resolution drought information helps to better assess the spatial and temporal changes and variability in drought duration, severity, and magnitude at a much finer scale. This supports the development of site-specific adaptation measures.
The application of multiple indices using different datasets helps to better manage and monitor droughts than using a single dataset, This is particularly the case in regions of the world where not enough data is available such as Africa and South America. Using a single dataset can be limiting, as it may not capture the full spectrum of drought characteristics and impacts.
Careful monitoring of moisture levels can also help predict increased risk for wildfires.
Causes
General precipitation deficiency
Mechanisms of producing precipitation include convective, stratiform, and orographic rainfall. Convective processes involve strong vertical motions that can cause the overturning of the atmosphere in that location within an hour and cause heavy precipitation, while stratiform processes involve weaker upward motions and less intense precipitation over a longer duration.
Precipitation can be divided into three categories, based on whether it falls as liquid water, liquid water that freezes on contact with the surface, or ice.
Droughts occur mainly in areas where normal levels of rainfall are, in themselves, low. If these factors do not support precipitation volumes sufficiently to reach the surface over a sufficient time, the result is a drought. Drought can be triggered by a high level of reflected sunlight and above average prevalence of high pressure systems, winds carrying continental, rather than oceanic air masses, and ridges of high pressure areas aloft can prevent or restrict the developing of thunderstorm activity or rainfall over one certain region. Once a region is within drought, feedback mechanisms such as local arid air, hot conditions which can promote warm core ridging, and minimal evapotranspiration can worsen drought conditions.
Dry season
Within the tropics, distinct, wet and dry seasons emerge due to the movement of the Intertropical Convergence Zone or Monsoon trough. The dry season greatly increases drought occurrence, and is characterized by its low humidity, with watering holes and rivers drying up. Because of the lack of these watering holes, many grazing animals are forced to migrate due to the lack of water in search of more fertile lands. Examples of such animals are zebras, elephants, and wildebeest. Because of the lack of water in the plants, bushfires are common. Since water vapor becomes more energetic with increasing temperature, more water vapor is required to increase relative humidity values to 100% at higher temperatures (or to get the temperature to fall to the dew point). Periods of warmth quicken the pace of fruit and vegetable production, increase evaporation and transpiration from plants, and worsen drought conditions.
El Niño–Southern Oscillation (ENSO)
The El Niño–Southern Oscillation (ENSO) phenomenon can sometimes play a significant role in drought. ENSO comprises two patterns of temperature anomalies in the central Pacific Ocean, known as La Niña and El Niño. La Niña events are generally associated with drier and hotter conditions and further exacerbation of drought in California and the Southwestern United States, and to some extent the U.S. Southeast. Meteorological scientists have observed that La Niñas have become more frequent over time.
Conversely, during El Niño events, drier and hotter weather occurs in parts of the Amazon River Basin, Colombia, and Central America. Winters during the El Niño are warmer and drier than average conditions in the Northwest, northern Midwest, and northern Mideast United States, so those regions experience reduced snowfalls. Conditions are also drier than normal from December to February in south-central Africa, mainly in Zambia, Zimbabwe, Mozambique, and Botswana. Direct effects of El Niño resulting in drier conditions occur in parts of Southeast Asia and Northern Australia, increasing bush fires, worsening haze, and decreasing air quality dramatically. Drier-than-normal conditions are also in general observed in Queensland, inland Victoria, inland New South Wales, and eastern Tasmania from June to August. As warm water spreads from the west Pacific and the Indian Ocean to the east Pacific, it causes extensive drought in the western Pacific. Singapore experienced the driest February in 2014 since records began in 1869, with only 6.3 mm of rain falling in the month and temperatures hitting as high as 35 °C on 26 February. The years 1968 and 2005 had the next driest Februaries, when 8.4 mm of rain fell.
Climate change
Globally, the occurrence of droughts has increased as a result of the increase in temperature and atmospheric evaporative demand. In addition, increased climate variability has increased the frequency and severity of drought events. Moreover, the occurrence and impact of droughts are aggravated by anthropogenic activities such as land use change and water management and demand.
The IPCC Sixth Assessment Report also pointed out that "Warming over land drives an increase in atmospheric evaporative demand and in the severity of drought events" and "Increased atmospheric evaporative demand increases plant water stress, leading to agricultural and ecological drought".
There is a rise of compound warm-season droughts in Europe that are concurrent with an increase in potential evapotranspiration.
Erosion and human activities
Human activity can directly trigger exacerbating factors such as over-farming, excessive irrigation, deforestation, and erosion adversely impact the ability of the land to capture and hold water. In arid climates, the main source of erosion is wind. Erosion can be the result of material movement by the wind. The wind can cause small particles to be lifted and therefore moved to another region (deflation). Suspended particles within the wind may impact on solid objects causing erosion by abrasion (ecological succession). Wind erosion generally occurs in areas with little or no vegetation, often in areas where there is insufficient rainfall to support vegetation.
Impacts
Drought is one of the most complex and major natural hazards, and it has devastating impacts on the environment, economy, water resources, agriculture, and society worldwide.
One can divide the impacts of droughts and water shortages into three groups: environmental, economic and social (including health).
Environmental and economic impacts
Environmental effects of droughts include: lower surface and subterranean water-levels, lower flow-levels (with a decrease below the minimum leading to direct danger for amphibian life), increased pollution of surface water, the drying out of wetlands, more and larger wildfires, higher deflation intensity, loss of biodiversity, worse health of trees and the appearance of pests and dendroid diseases. Drought-induced mortality of trees lacks in most climate models in their representation of forests as land carbon sink.
Economic losses as a result of droughts include lower agricultural, forests, game and fishing output, higher food-production costs, lower energy-production levels in hydro plants, losses caused by depleted water tourism and transport revenue, problems with water supply for the energy sector and for technological processes in metallurgy, mining, the chemical, paper, wood, foodstuff industries etc., disruption of water supplies for municipal economies.
Further examples of common environmental and economic consequences of drought include:
Alteration of diversity of plant communities, which can have an impact on net primary production and other ecosystem services.
Wildfires, such as Australian bushfires and wildfires in the United States, become more common during times of drought and may cause human deaths.
Dust Bowls, themselves a sign of erosion, which further erode the landscape
Dust storms, when drought hits an area suffering from desertification and erosion
Habitat damage, affecting both terrestrial and aquatic wildlife
Snake migration, which results in snake-bites
Reduced electricity production due to reduced water-flow through hydroelectric dams
Shortages of water for industrial users
Agricultural impacts
Droughts can cause land degradation and loss of soil moisture, resulting in the destruction of cropland productivity. This can result in diminished crop growth or yield productions and carrying capacity for livestock. Drought in combination with high levels of grazing pressure can function as the tipping point for an ecosystem, causing woody encroachment.
Water stress affects plant development and quality in a variety of ways: firstly drought can cause poor germination and impaired seedling development. At the same time plant growth relies on cellular division, cell enlargement, and differentiation. Drought stress impairs mitosis and cell elongation via loss of turgor pressure which results in poor growth. Development of leaves is also dependent upon turgor pressure, concentration of nutrients, and carbon assimilates all of which are reduced by drought conditions, thus drought stress lead to a decrease in leaf size and number. Plant height, biomass, leaf size and stem girth has been shown to decrease in maize under water limiting conditions. Crop yield is also negatively effected by drought stress, the reduction in crop yield results from a decrease in photosynthetic rate, changes in leaf development, and altered allocation of resources all due to drought stress. Crop plants exposed to drought stress suffer from reductions in leaf water potential and transpiration rate. Water-use efficiency increases in crops such as wheat while decreasing in others, such as potatoes.
Plants need water for the uptake of nutrients from the soil, and for the transport of nutrients throughout the plant: drought conditions limit these functions leading to stunted growth. Drought stress also causes a decrease in photosynthetic activity in plants due to the reduction of photosynthetic tissues, stomatal closure, and reduced performance of photosynthetic machinery. This reduction in photosynthetic activity contributes to the reduction in plant growth and yields. Another factor influencing reduced plant growth and yields include the allocation of resources; following drought stress plants will allocate more resources to roots to aid in water uptake increasing root growth and reducing the growth of other plant parts while decreasing yields.
Social and health impacts
The most negative impacts of drought for humans include crop failure, food crisis, famine, malnutrition, and poverty, which lead to loss of life and mass migration of people.
There are negative effects on the health of people who are directly exposed to this phenomenon (excessive heat waves). Droughts can also cause limitations of water supplies, increased water pollution levels, high food-costs, stress caused by failed harvests, water scarcity, etc. Reduced water quality can occur because lower water-flows reduce dilution of pollutants and increase contamination of remaining water sources.
This explains why droughts and water scarcity operate as a factor which increases the gap between developed and developing countries.
Effects vary according to vulnerability. For example, subsistence farmers are more likely to migrate during drought because they do not have alternative food-sources. Areas with populations that depend on water sources as a major food-source are more vulnerable to famine.
Further examples of social and health consequences include:
Water scarcity, crop failure, famine and hunger – drought provides too little water to support food crops; malnutrition, dehydration and related diseases
Mass migration, resulting in internal displacement and international refugees
Social unrest
War over natural resources, including water and food
Cyanotoxin accumulation within food chains and water supply (some of which are among the most potent toxins known to science) can cause cancer with low exposure over the long term. High levels of microcystin appeared in San Francisco Bay Area salt-water shellfish and fresh-water supplies throughout the state of California in 2016.
Loss of fertile soils
Wind erosion is much more severe in arid areas and during times of drought. For example, in the Great Plains, it is estimated that soil loss due to wind erosion can be as much as 6100 times greater in drought years than in wet years.
Loess is a homogeneous, typically nonstratified, porous, friable, slightly coherent, often calcareous, fine-grained, silty, pale yellow or buff, windblown (Aeolian) sediment. It generally occurs as a widespread blanket deposit that covers areas of hundreds of square kilometers and tens of meters thick. Loess often stands in either steep or vertical faces. Loess tends to develop into highly rich soils. Under appropriate climatic conditions, areas with loess are among the most agriculturally productive in the world. Loess deposits are geologically unstable by nature, and will erode very readily. Therefore, windbreaks (such as big trees and bushes) are often planted by farmers to reduce the wind erosion of loess.
Regions particularly affected
Amazon basin
In 2005, parts of the Amazon basin experienced the worst drought in 100 years. A 2006 article reported results showing that the forest in its present form could survive only three years of drought. Scientists at the Brazilian National Institute of Amazonian Research argue in the article that this drought response, coupled with the effects of deforestation on regional climate, are pushing the rainforest towards a "tipping point" where it would irreversibly start to die. It concludes that the rainforest is on the brink of being turned into savanna or desert, with catastrophic consequences for the world's climate. According to the WWF, the combination of climate change and deforestation increases the drying effect of dead trees that fuels forest fires.
Australia
The 1997–2009 Millennium Drought in Australia led to a water supply crisis across much of the country. As a result, many desalination plants were built for the first time (see list).
By far the largest part of Australia is desert or semi-arid lands commonly known as the outback. A 2005 study by Australian and American researchers investigated the desertification of the interior, and suggested that one explanation was related to human settlers who arrived about 50,000 years ago. Regular burning by these settlers could have prevented monsoons from reaching interior Australia. In June 2008 it became known that an expert panel had warned of long term, maybe irreversible, severe ecological damage for the whole Murray-Darling basin if it did not receive sufficient water by October 2008. Australia could experience more severe droughts and they could become more frequent in the future, a government-commissioned report said on July 6, 2008. Australian environmentalist Tim Flannery, predicted that unless it made drastic changes, Perth in Western Australia could become the world's first ghost metropolis, an abandoned city with no more water to sustain its population. The long Australian Millennial drought broke in 2010.
East Africa
East Africa, including for example Ethiopia, Eritrea, Kenya, Somalia, South Sudan, Sudan, Tanzania, and Uganda, has a diverse climate, ranging from hot, dry regions to cooler, wetter highland regions. The region has considerable variability in seasonal rainfall and a very complex topography. In the northern parts of the region within the Nile basin (Ethiopia, Sudan), the rainfall is characterized by an unimodal cycle with a wet season from July to September. The rest of the region has a bimodal annual cycle, featuring long rains from March to May and the short rains from October to December. The frequent occurrence of hydrological extremes, like droughts and floods, harms the already vulnerable population suffering from severe poverty and economic turmoil. Droughts prompted food shortages for example in 1984–85, 2006 and 2011.
The Eastern African region experiences the impacts of climate change in different forms. For instance, below-average rainfall occurred for six consecutive rainy seasons in the Horn of Africa during the period 2020–2023 leading to the third longest and most widespread drought on record with dire implications for food security (see Horn of Africa drought (2020–present)). Conversely, other parts experienced extreme floods, e.g., the 2020 East Africa floods in Ethiopia, Rwanda, Kenya, Burundi, and Uganda, and the 2022 floods in South Sudan.
A key feature in the region is the heterogeneous distribution of hydrologic extremes in space and time. For instance, El Niño can cause droughts in one part of the region and floods in the other. This is also a common situation within a country, e.g., in Ethiopia. The recent years with consecutive droughts followed by floods are a testament to the need to better forecast these kinds of events and their impacts.
Himalayan river basins
Approximately 2.4 billion people live in the drainage basin of the Himalayan rivers. India, China, Pakistan, Bangladesh, Nepal and Myanmar could experience floods followed by droughts in coming decades. More than 150 districts in India are drought vulnerable, mostly concentrated in the state of Rajasthan, Gujarat, Madhya Pradesh and its adjoining Chhattisgarh, Uttar Pradesh, northern Karnataka and adjoining Maharashtra of the country. Drought in India affecting the Ganges is of particular concern, as it provides drinking water and agricultural irrigation for more than 500 million people.
North America
The west coast of North America, which gets much of its water from glaciers in mountain ranges such as the Rocky Mountains and Sierra Nevada, also would be affected.
By country or region
Droughts in particular countries:
See also:
Droughts and famines in Russia and USSR
Droughts in California
Droughts in the Sahel
2021 Madagascar food crisis
2010 China drought and dust storms
Cape Town water crisis in 2015–2018
Protection, mitigation and relief
Agriculturally, people can effectively mitigate much of the impact of drought through irrigation and crop rotation. Failure to develop adequate drought mitigation strategies carries a grave human cost in the modern era, exacerbated by ever-increasing population densities.
Strategies for drought protection or mitigation include:
Dams – many dams and their associated reservoirs supply additional water in times of drought.
Cloud seeding – a form of intentional weather modification to induce rainfall. This remains a hotly debated topic, as the United States National Research Council released a report in 2004 stating that to date, there is still no convincing scientific proof of the efficacy of intentional weather modification.
Land use – Carefully planned crop rotation can help to minimize erosion and allow farmers to plant less water-dependent crops in drier years.
Transvasement – Building canals or redirecting rivers as massive attempts at irrigation in drought-prone areas.
When water is scarce due to droughts, there are a range of options for people to access other sources of water, such as wastewater reuse, rainwater harvesting and stormwater recovery, or seawater desalination.
History
Throughout history, humans have usually viewed droughts as disasters due to the impact on food availability and the rest of society. Drought is among the earliest documented climatic events, present in the Epic of Gilgamesh and tied to the Biblical story of Joseph's arrival in and the later Exodus from ancient Egypt. Hunter-gatherer migrations in 9,500 BC Chile have been linked to the phenomenon, as has the exodus of early humans out of Africa and into the rest of the world around 135,000 years ago.
Droughts can be scientifically explained in terms of physical mechanisms, which underlie natural disasters and are influenced by human impact on the environment.
Beliefs about drought are further shaped by cultural factors including local knowledge, perceptions, values, beliefs and religion. In some places and times, droughts have been interpreted as the work of supernatural forces. Globally, people in many societies have been more likely to explain natural events like drought, famine and disease in terms of the supernatural than they are to explain social phenomena like war, murder, and theft.
Historically, rituals have been used in an attempt to prevent or avert drought. Rainmaking rituals have ranged from dances to scapegoating to human sacrifices. Many ancient practices are now a matter of folklore while others may still be practiced.
In areas where people have limited understanding of the scientific basis of drought, beliefs about drought continue to reflect indigenous beliefs in the power of spirits and Christian philosophies that see drought as a divine punishment. Such beliefs can influence people's thinking and affect their resilience and ability to adapt to stress and respond to crises. In the case of Creationism, curricula sometimes give religious explanations of natural phenomena rather than scientific ones. Teaching explicitly denies evolution, that human agency is affecting climate, and that climate change is occurring.
Some historical droughts include:
The 4.2-kiloyear event, a megadrought that took place in Africa and Asia between 5,000 and 4,000 years ago, has been linked with the collapse of the Old Kingdom in Egypt, the Akkadian Empire in Mesopotamia, the Liangzhu culture in the lower Yangtze River area, and the Indus Valley Civilization.
The longest drought in recorded history started 400 years ago in the Atacama Desert in Chile and still continues.
Drought might have been a contributing factor to Classic Maya collapse between the 7th and 9th centuries.
1540 Central Europe, said to be the "worst drought of the millennium" with eleven months without rain and temperatures of 5–7 °C above the average of the 20th century
1900 India killing between 250,000 and 3.25 million.
1921–22 Soviet Union in which over 5 million perished from starvation due to the combined effects of severe drought and war.
1928–1930 Northwest China resulting in over 3 million deaths by famine.
See also
Aridity index
Drought refuge
Flash drought
Food security
Leaf Sensor
List of droughts
List of famines
Permanent wilting point
United Nations Convention to Combat Desertification
Water security
References
External links
GIDMaPS Global Integrated Drought Monitoring and Prediction System, University of California, Irvine
Meteorological phenomena
Civil defense
Climate variability and change
Hydrology
Water and the environment
Weather hazards
Articles containing video clips
Natural disasters | Drought | Physics,Chemistry,Engineering,Environmental_science | 5,783 |
60,078,637 | https://en.wikipedia.org/wiki/Reactive%20synthesis | Reactive synthesis (or temporal synthesis) is the field of computer science that studies automatic generation of state machines (e.g. Moore machines) from high-level specifications (e.g. formulas in linear temporal logic). "Reactivity" highlights the fact that the synthesized machine interacts with the user, reading an input and producing an output, and never stops its operation.
The synthesis problem was introduced by Alonzo Church in 1962, with specifications being formulas in monadic second-order logic and state machines in the form of digital circuits.
See also
Program synthesis
Model checking
References
Subfields of computer science
Logic | Reactive synthesis | Technology | 124 |
59,046,055 | https://en.wikipedia.org/wiki/List%20of%20Mallomonas%20species | The algae genus Mallomonas contains the following species, forms, and varieties:
A
Mallomonas acaroides Zacharias
Mallomonas actinoloma E.Takahashi
Mallomonas actinoloma var. maramuresensis L.Péterfi & Momeu
Mallomonas actinoloma var. nadiensis Dürrschmidt
Mallomonas aculeata
Mallomonas adamas K.Harris & D.E.Bradley
Mallomonas aerolata Nygaard
Mallomonas akrokomos Ruttner
Mallomonas alata Asmund, Cronberg & Dürrschmidt
Mallomonas alata f. hualvensis Asmund, Cronberg & Dürrschmidt
Mallomonas allorgei (Deflandre) W.Conrad
Mallomonas alpestrina Němcová & Zeisek
Mallomonas alphaphora Preisig
Mallomonas alpina Pascher & Ruttner
Mallomonas alveolata Dürrschmidt
Mallomonas amazonica Vigna, S.R.Duque & Múñez-Avellaneda
Mallomonas americana Dürrschmidt
Mallomonas ampla P.A.Siver & A.M.Lott
Mallomonas anglica (N.Carter) Huber-Pestalozzi
Mallomonas annulata (D.E.Bradley) K.Harris
Mallomonas aperturae Siver
Mallomonas apochromatica Conrad
Mallomonas areolata Nygaard
Mallomonas asmundiae (Wujek & van der Veer) Nicholls
Mallomonas asymmetrica C.-X. Ma & Y.-X.Wei
Mallomonas australica Playfair
Mallomonas australica var. gracillima Playfair
Mallomonas australica var. subglobosa Playfair
B
Mallomonas bacterium Conrad
Mallomonas bangladeshica (E.Takahashi & T.Hayakawa) Siver & A.P.Wolfe
Mallomonas baskettei P.A.Siver & A.M.Lott
Mallomonas binocularis P.A.Siver
Mallomonas bronchartiana Compère
C
Mallomonas caerula P.A.Siver
Mallomonas calceolus D.E.Bradley
Mallomonas camerunensis Piątek
Mallomonas canina Kristiansen
Mallomonas cattiensis E.S.Gusev, H.Doan-Nhu & L.Nguyen-Ngoc
Mallomonas caudata Iwanoff
Mallomonas ceylanica Dürrschmidt & G.Cronberg
Mallomonas charkoviensis Kisselew
Mallomonas clavata Conrad
Mallomonas clavus D.E.Bradley
Mallomonas connensis P.A.Siver & L.J.Marsicano
Mallomonas conspersa Dürrschmidt
Mallomonas convallis P.A.Siver & A.P.Wolfe
Mallomonas corcontica (Kalina) L.Péterfi & Momeu
Mallomonas coronata Bolochonzew
Mallomonas coronifera Matvienko
Mallomonas corymbosa Asmund
Mallomonas corymbosa var. interrupta M.S.Vigna & J.Kristiansen
Mallomonas corymbosa var. poseidonii P.A.Siver
Mallomonas costata Dürrschmidt
Mallomonas crassisquama (Asmund) Fott
Mallomonas crassisquama var. papillosa P.A.Siver & A.Skogstad
Mallomonas cratis K.Harris & D.E.Bradley
Mallomonas cristata Dürrschmidt
Mallomonas crocodilorum P.Hansen
Mallomonas cronbergiae Piątek
Mallomonas cucullata S.Barreto
Mallomonas cyathellata Wujek & Asmund
Mallomonas cyathellata var. chilensis Dürrschmidt
Mallomonas cyathellata var. kenyana Wujek & Asmund
Mallomonas cylindracea Pascher
D
Mallomonas delanciana P.A.Siver
Mallomonas denticulata Matvienko
Mallomonas dickii K.H.Nicholls
Mallomonas directa Nemková et al.
Mallomonas dispar Siver, Lott & Wolfe
Mallomonas distinguenda Gusev et al.
Mallomonas divida Němcová & J. Kreidlová
Mallomonas doignonii Bourrelly
Mallomonas doignonii var. robusticostis K.H.Nicholls
Mallomonas doignonii var. tenuicostis Asmund & Cronberg
Mallomonas duerrschmidtiae P.A.Siver, J.S.Hamer & H.J.Kling
E
Mallomonas elegans Lemmermann
Mallomonas elephantus P.A.Siver & A.P.Wolfe
Mallomonas elliptica (Kisselev) W.Conrad
Mallomonas elongata Reverdin
Mallomonas elongata var. americana Bourrelly
Mallomonas eoa E.Takahashi
Mallomonas epithallatia Droop
F
Mallomonas favosa K.H.Nicholls
Mallomonas favosa f. gemina Dürrschmidt & Croome
Mallomonas fenestrata Cronbeg & B.Hickel
Mallomonas fimbriata E.S.Gusev
Mallomonas flora K.Harris & D.E.Bradley
Mallomonas flora var. palermii Vigna
Mallomonas formosa S.Barreto
Mallomonas fresenii Kent
Mallomonas fuegiana Vigna & Kristiansen
Mallomonas furtiva Gusev, Certnerová, Škaloudová & Škaloud
Mallomonas fusiformis Wermel
G
Mallomonas galeiformis K.H.Nicholls
Mallomonas giraffensis P.A.Siver & A.P.Wolfe
Mallomonas glabra N.Woodhead & R.D.Tweed
Mallomonas globosa Schiller
Mallomonas grata E.Takahashi
Mallomonas grossa Dürrschmidt
Mallomonas guttata Wujek
Mallomonas guttata var. simplex K.H.Nicholls
H
Mallomonas hamata Asmund
Mallomonas harrisiae E.Takahashi
Mallomonas heimii Bourrelly
Mallomonas helvetica Pascher
Mallomonas heterospina J.W.G.Lund
Mallomonas heterospina f. calida Vigna
Mallomonas heterospina var. ornata Bourrelly
Mallomonas heverlensis (Conrad) Conrad
Mallomonas hexagonis K.H.Nicholls
Mallomonas hexareticulata B.Y.Jo, W.Shin, H.S.Kim, P.A.Siver & R.A.Andersen
Mallomonas hindonii K.H.Nicholls
Mallomonas hirsuta Conrad
I
Mallomonas inornata K.H.Nicholls
Mallomonas insignis Penard
Mallomonas insignis var. lacustris Bourrelly
Mallomonas intermedia Kisselew/Kisselev
Mallomonas intermedia var. salicaensis Péterfi & Momeu
J
Mallomonas jejuensis H.S.Kim & J.H.Kim
Mallomonas jubata Nemková et al.
K
Mallomonas kalinae Rezácova
Mallomonas koreana H.S.Kim & J.H.Kim
Mallomonas kristiansenii Wujek & C.M.Bicudo
Mallomonas kuzminii E.S.Gusev & M.S.Kulikovskiy
L
Mallomonas labyrinthina K.H.Nicholls
Mallomonas lacuna B.Y.Jo, W.Shin, H.S.Kim, P.A.Siver & R.A.Andersen
Mallomonas lanalhuensis Dürrschmidt
Mallomonas lancea Siver, Lott & Wolfe
Mallomonas leboimei Bourrelly
Mallomonas lefeuvrei Villeret
Mallomonas lefevriana Bourrelly
Mallomonas lelymene K.Harris & D.E.Bradley
Mallomonas lemuriocellata P.Hansen
Mallomonas lilloënsis Conrad
Mallomonas limnicola J.W.G.Lund
Mallomonas litomesa A.Stokes
Mallomonas litomesa var. curta Playfair
Mallomonas liturata K.H.Nicholls
Mallomonas longiseta (Lemmermann) Lemmermann
Mallomonas lychenensis W.Conrad
Mallomonas lychenensis f. ecuadorensis Wujek & Dziedzik
Mallomonas lychenensis f. symposiaca Skogstad & Kristiansen
M
Mallomonas maculata D.E.Bradley
Mallomonas madagascarensis P.Hansen
Mallomonas majorensis Skuja
Mallomonas mangofera K.Harris & D.E.Bradley
Mallomonas mangofera var. foveata (Dürrschmidt) Kristiansen
Mallomonas mangofera var. gracilis (Dürrschmidt) Kristiansen
Mallomonas mangofera var. reticulata (Cronberg) Kristiansen
Mallomonas mangofera var. sulcata Dürrschmidt
Mallomonas marsupialis R.Croome, J.Kristiansen & P.A.Tyler
Mallomonas matvienkoae B.Asmund & Kristiansen
Mallomonas matvienkoae f. litteata Dürrschmidt ex B.Asmund & J.Kristiansen
Mallomonas matvienkoae var. grandis Dürrschmidt & G.Cronberg
Mallomonas matvienkoae var. myakkana P.A.Siver
Mallomonas matvienkoae var. siveri Wujek & L.C.Saha
Mallomonas media P.A.Siver & A.M.Lott
Mallomonas minima L.Rehfous
Mallomonas mirabilis Conrad
Mallomonas monograptus K.Harris & D.E.Bradley
Mallomonas morrisonensis Croome & P.A.Tyler
Mallomonas moskowensis Wermel
Mallomonas multisetigera Dürrschmidt
Mallomonas multiunca Asmund
Mallomonas multiunca var. pocosinensis P.A.Siver
Mallomonas munda (Asmund, Cronberg & Dürrschmidt) Nemková
Mallomonas muskokana (K.H.Nicholls) P.A.Siver
N
Mallomonas neoampla E.Gusev & P.A.Siver
Mallomonas newfoundlandicus P.A. Siver
Mallomonas nieringii P.A.Siver
Mallomonas nuussuaqensis L.R.Wilken & J.Kristiansen
O
Mallomonas ocalensis P.A.Siver
Mallomonas ocellata Dürrschmidt & Croome
Mallomonas ouradion K.Harris & D.E.Bradley
Mallomonas oviformis Nygaard
P
Mallomonas padulosa Fott
Mallomonas palaestrica P.Hansen, J.E.Johansen & A.Skovgaard
Mallomonas paludosa Fott
Mallomonas papillosa K.Harris & D.E.Bradley
Mallomonas papillosa var. ellipsoidea K.Harris
Mallomonas papillosa var. monilifera K.Harris
Mallomonas paragrandis Gusev
Mallomonas parana Vigna & Kristiansen
Mallomonas parisiae Bourrelly
Mallomonas parvula Dürrschmidt
Mallomonas parvula var. nichollsii Wujek & R.G.Bland
Mallomonas paxillata (D.E.Bradley) L.S.Péterfi & Momeu
Mallomonas pechlaneri Němcová & Rott
Mallomonas perfossa K.H.Nicholls
Mallomonas peroneides (K.Harris) Momeu & L.S.Péterfi
Mallomonas perpusilla Dürrschmidt
Mallomonas phasma K.Harris & D.E.Bradley
Mallomonas pillula K.Harris
Mallomonas pillula f. exannulata K.Harris
Mallomonas pillula f. labyrinthopsis Wujek
Mallomonas pillula var. latimorginalis Dürrschmidt
Mallomonas pillula var. valdiviana Dürrschmidt
Mallomonas plantefolii Bourrelly
Mallomonas pleuriforamen P.A.Siver, Lott, B.Y.Jo, W.Shin, H.S.Kim & R.A.Andersen
Mallomonas ploesslii Perty - Type species
Mallomonas plumosa Croome & P.A.Tyler
Mallomonas porifera P.A.Siver & A.P.Wolfe
Mallomonas portae-ferreae L.Péterfi & Asmund
Mallomonas portae-ferreae var. reticulata Gretz, Sommerfeld & Wujek
Mallomonas preisigii P.A.Siver
Mallomonas producta Iwanhoff
Mallomonas producta var. marchica Lemmermann
Mallomonas prora Dürrschmidt
Mallomonas pseudobronchartiana E.S.Gusev, P.A. Siver & W.Shin
Mallomonas pseudocaudata P.A.Siver & A.P.Wolfe
Mallomonas pseudocoronata Prescott
Mallomonas pseudocratis Dürrschmidt
Mallomonas pseudohamata P.A.Siver & A.P.Wolfe
Mallomonas pseudomatvienkoae B.Y.Jo, W.Shin, H.S.Kim, P.A.Siver & R.A.Andersen
Mallomonas pseudotonsurata Bourrelly
Mallomonas pugio D.E.Bradley
Mallomonas pulcherrima (Stokes) Lemmermann
Mallomonas pulchra Conrad
Mallomonas pumilio K.Harris & D.E.Bradley
Mallomonas pumilio var. dispersa Nemková et al.
Mallomonas pumilio f. munda Asmund, Cronberg & Dürrschmidt
Mallomonas punctifera Korshikov
Mallomonas punctifera var. brasiliensis J.Kristiansen & M.Menezes
R
Mallomonas radiata Conrad
Mallomonas rasilis Dürrschmidt
Mallomonas recticostata E.Takahashi
Mallomonas reeuwlijkiana W.Conrad
Mallomonas retifera Dürrschmidt
Mallomonas retrorsa P.A.Siver
Mallomonas rhombica G.Cronberg
Mallomonas roscida Dürrschmidt
S
Mallomonas sabulosa Croome & P.A.Tyler
Mallomonas salina W.Conrad
Mallomonas scalaris Dürrschmidt
Mallomonas schumachii P.A.Siver
Mallomonas schwemmlei Glenk
Mallomonas scrobiculata K.H.Nicholls
Mallomonas serrata Nicholls
Mallomonas sexangularis K.H.Nicholls
Mallomonas silvicola (Harris & D.E.Bradley) Nemková
Mallomonas skvortsovii Gusev et al.
Mallomonas sonfonensis N.Woodhead & R.D.Tweed
Mallomonas sophiae Czosnowski
Mallomonas sorohexareticulata B.Y.Jo, W.Shin, H.S.Kim, P.A.Siver & R.A.Andersen
Mallomonas sphagniphila K.H.Nicholls
Mallomonas spinifera Schiller
Mallomonas spinosa E.S.Gusev
Mallomonas spinulosa Conrad
Mallomonas splendens (G.S.West) Playfair
Mallomonas splendens f. arnhemensis Croome, Dürrschmidt & P.A.Tyler
Mallomonas splendens var. biceps W.Conrad
Mallomonas splendens var. pusilla Playfair
Mallomonas stellata G.Cronberg
Mallomonas striata Asmund
Mallomonas striata var. balonovii Voloshko
Mallomonas striata var. getseniae Voloshko
Mallomonas striata var. serrata K.Harris & D.E.Bradley
Mallomonas strictopteris Péterfi & Momeu
Mallomonas subsalina Conrad & Kufferath
T
Mallomonas tasmanica (Croome & P.A.Tyler) Asmund & Kristiansen
Mallomonas teilingii W.Conrad
Mallomonas temonis Němcová
Mallomonas tenuis Conrad
Mallomonas tirolensis Pichrtová et al.
Mallomonas tolerans Asmund & J.Kristiansen
Mallomonas tongarirensis Dürrschmidt
Mallomonas tonsurata Teiling
Mallomonas tonsurata var. coroniferoides K.H.Nicholls
Mallomonas tonsurata var. etortisetifera X.Zhang, I.Inouye & M.Chihara
Mallomonas torquata B.Asmund & G.Cronberg
Mallomonas torquata var. simplex (K.H.Nicholls) Kristiansen
Mallomonas torulosa Kisselev
Mallomonas transsylvanica L.S.Péterfi & Momeu
Mallomonas trichophora Bourrelly
Mallomonas tropica Dürrschmidt & Croome
Mallomonas trummensis Cronberg
Mallomonas tubulosa S.Barreto
U
Mallomonas urnaformis Prescott
V
Mallomonas valkanoviana Conrad
Mallomonas vannigera Asmund
Mallomonas vannigera var. parallelicosta Balonov
Mallomonas variabilis G.Cronberg
Mallomonas velari E.S.Gusev, P.A. Siver & W.Shin
Mallomonas verrucosa Vigna
Mallomonas villosa Dürrschmidt
Mallomonas vorkutiensis Voloshko
W
Mallomonas weei D.E.Wujek, E.M.Wright & G.L.Williams
Mallomonas wujekii P.A.Siver
Z
Mallomonas zellensis Fott
References
Ochrophyta
Lists of algae
Taxonomic lists (species) | List of Mallomonas species | Biology | 4,039 |
3,545,884 | https://en.wikipedia.org/wiki/Rusty%20trombone | Rusty trombone is a sexual act in which a man stands with his knees and back slightly torqued with feet at least shoulder width apart to expose his anus. A person typically kneels behind the man and performs anilingus while reaching up beneath the scrotum or around the body to manually administer rapid back-and-forth motions of the penis, mimicking the motions of a trombone player. The act is defined primarily by the physical orientation of the partners, the combination of anilingus with manual sexual stimulation and the resemblance of the anal sphincter to a trombone mouthpiece; however, other positions and variations are possible.
Usage history
In 2003, the Detroit talk radio show Deminski & Doyle began an educational hour discussion of urban-legendary sex acts with the statement, "Try to describe carefully what a 'Cleveland steamer' would be..." and then went into details of the blumpkin and the rusty trombone. Fifteen months later, the Federal Communications Commission proposed a fine of $27,500 to the station's owner, Infinity Broadcasting, through a Notice of Apparent Liability (NAL) that specifically referenced rusty trombone.
Rusty trombone (dirty trombone) gained wider use in entertainment projects developed for release in 2005. For example, comedian Andy Dick used the term in the 2005 documentary film The Aristocrats as part of the infamous dirty joke of the same name. In seeming recognition of the phrase being a part of the filthiest of filthy language, news sources such as The Daily Telegraph, Slant Magazine, New Statesman, and The Globe and Mail highlighted rusty trombone in their review of The Aristocrats. In addition, in the 2005 movie The 40-Year-Old Virgin. the character Mooj stated, "It's not about these rusty trombones, and these dirty sanchez." In the film Tenacious D in The Pick of Destiny, actor Jack Black is seen in walking around the Venice Beach, California boardwalk in a Rusty Trombone T-shirt. In the Late Late Show with Craig Ferguson, host Craig Ferguson kept an actual rusty trombone under his desk, which he would occasionally mention and reveal for comedic effect.
Rusty trombone is part of the 2006 party game PervArtistry, where individuals draw sexual pictures on a board, and other players try to guess the sexual synonym for that image.
In 2007, Salt Lake City, Utah activist David Nelson started an online petition calling for the repeal of Utah's existing sodomy law. Reportedly, Utah's sodomy law then prohibited oral sex, anal sex, and the rusty trombone.
Also, in 2007, the rusty trombone was listed as one of 76 entries in The Contemporary Dictionary of Sexual Euphemisms (2007), with its literal definition and sexual corollary.
See also
Oral sex
Notes
References
Tate, Jordan. (January 9, 2007) The Contemporary Dictionary of Sexual Euphemisms. Publisher St. Martin's Press
External links
Anal eroticism
Sexual acts
Sexual slang
Sex positions
Human positions
Human penis | Rusty trombone | Biology | 608 |
35,034,038 | https://en.wikipedia.org/wiki/Small-conductance%20mechanosensitive%20channel | Small conductance mechanosensitive ion channels (MscS) provide protection against hypo-osmotic shock in bacteria, responding both to stretching of the cell membrane and to membrane depolarization. In eukaryotes, they fulfill a multitude of important functions in addition to osmoregulation. They are present in the membranes of organisms from the three domains of life: bacteria, archaea, fungi and plants.
Structure
There are two families of mechanosensitive (MS) channels: large-conductance MS channels (MscL) and small-conductance MS channels (MscS or YGGB). The MscS family is much larger and more variable in size and sequence than the MscL family. MscS family homologues vary in length between 248 and 1120 amino acyl residues and in topology, but the homologous region that is shared by most of them is only 200-250 residues long, exhibiting 4-5 transmembrane regions (TMSs). Much of the diversity in MscS proteins occurs in the number of TMSs, which ranges from three to eleven TMSs, although the three C-terminal helices are conserved.
Crystal structures of the Escherichia coli MscS in the open and closed conformations are available. E. coli MscS folds as a homoheptamer with a cylindrical shape, and can be divided into transmembrane and extramembrane regions: an N-terminal periplasmic region, a transmembrane region, and a C-terminal cytoplasmic region (middle and C-terminal domains). The transmembrane region forms a channel through the membrane that opens into a chamber enclosed by the extramembrane portion, the latter connecting to the cytoplasm through distinct portals.
Function
MS channels function as electromechanical switches with the capability to sense the physical state of lipid bilayers. Interactions with the membrane lipids are responsible for the sensing of mechanical force for most known MS channels. In bacterial and animal systems, MS ion channels are thought to mediate the perception of pressure, touch, and sound. With numerous members now electrophysiologically characterized, these channels displays a breadth of ion selectivity with both anion- and cation-selective members. The selectivities of these channels may be relatively weak in comparison to voltage-gated channels. In addition, some MscS channels may function in amino acid efflux, Ca2+ regulation and cell division.
Transport reaction
The generalized transport reaction proposed for MscS channels is:
Osmolytes (in) and ions (in) ⇌ osmolytes (out) and ions (out)
Mechanism
Application of a ramp of negative pressure to a patch excised from an E. coli giant spheroplast gave a small conductance (MscS; ~1 nS in 400 mM salt) with a sustained open state, and a large conductance (MscL; ~3 nS) with faster kinetics, activated at higher pressure. MscS was reported to exhibit a weak anionic preference and a voltage dependency, tending to open upon depolarization. Activation by membrane-intercalating amphipathic compounds suggested that the MscS channel is sensitive to mechanical perturbations in the lipid bilayer.
Sensitivity towards tension changes can be explained as result of the hydrophobic coupling between the membrane and TMSs of the channel. Pockets in between TMSs were identified in MscS and YnaI that are filled with lipids. Fewer lipids are present in the open state of MscS than the closed. Thus, exclusion of lipid fatty acyl chains from these pockets, as a consequence of increased tension, may trigger gating. Similarly, in the eukaryotic MS channel TRAAK it was found that a lipid chain blocks the conducting path in the closed state.
References
Protein families
Membrane proteins
Transmembrane proteins
Transmembrane transporters
Transport proteins
Integral membrane proteins
Ion channels | Small-conductance mechanosensitive channel | Chemistry,Biology | 831 |
14,880,541 | https://en.wikipedia.org/wiki/LYL1 | Protein lyl-1 is a protein that in humans is encoded by the LYL1 gene.
Interactions
LYL1 has been shown to interact with TCF3 and NFKB1.
References
Further reading
External links
Transcription factors | LYL1 | Chemistry,Biology | 48 |
13,032,011 | https://en.wikipedia.org/wiki/Legal%20issues%20with%20BitTorrent | The use of the BitTorrent protocol for the unauthorized sharing of copyrighted content generated a variety of novel legal issues. While the technology and related platforms are legal in many jurisdictions, law enforcement and prosecutorial agencies are attempting to address this avenue of copyright infringement. Notably, the use of BitTorrent in connection with copyrighted material may make the issuers of the BitTorrent file, link or metadata liable as an infringing party under some copyright laws. Similarly, the use of BitTorrent to procure illegal materials could potentially create liability for end users as an accomplice.
BitTorrent files can be seen conceptually as a hyperlink. However, it can also be a very specific instruction for how to obtain content on the internet. BitTorrent may transmit or include illegal or copyrighted content. Court decisions in various jurisdictions have deemed some BitTorrent files illegal.
Complicating the legal analysis are jurisdictional issues that are common when nation states attempt to regulate any activity. BitTorrent files and links can be accessed in different geographic locations and legal jurisdictions. Thus, it is possible to host a BitTorrent file in geographic jurisdictions where it is legal and others where it is illegal. A single link, file or data or download action may be actionable in some places, but not in others. This analysis applies to other sharing technologies and platforms.
Jurisdictional variations
Legal regimes vary from country to country. BitTorrent metafiles do not store copyrighted data and are ordinarily unobjectionable. Some accused parties argued that BitTorrent trackers are legal even if sharing the copyrighted data in question was a copyright violation. Despite these arguments, there has been tremendous legal pressure, usually on behalf of the MPAA, RIAA and similar organizations around the world, to shut down BitTorrent trackers.
Finland: Finreactor
In December 2004, Finnish police raided Finreactor, a major BitTorrent site. Seven system administrators and four others were ordered to pay hundreds of thousands of euros in damages. The defendants appealed the case all the way to the Supreme Court of Finland, but failed to overturn the verdict. Two other defendants were acquitted because they were underage at the time, but were held liable for legal fees and compensation for illegal distribution ranging up to 60,000 euros. The court set their fine at 10% of the retail price of products distributed.
Hong Kong: individual actions
On 24 October 2005, BitTorrent user Chan Nai-ming (陳乃明), using the handle 古惑天皇 (The Master of Cunning, although the magistrate referred to him as Big Crook) was convicted of violating copyright by uploading Daredevil, Red Planet and Miss Congeniality to a newsgroup (Chapter 528 of Hong Kong law). The magistrate remarked that Chan's act significantly damaged the interest of copyright holders. He was released on bail for HK$5,000, awaiting a sentencing hearing, though the magistrate himself admitted the difficulty of determining how he should be sentenced due to the lack of precedent. On 7 November 2005 he was sentenced to jail for three months, but was immediately granted bail pending an appeal. The appeal was dismissed by the Court of First Instance on 12 December 2006 and Chan was immediately jailed. On 3 January 2007, he was released pending appeal to the Court of Final Appeal on 9 May 2007.
In 2008 and 2009, an unidentified woman and man were arrested for illegally uploading files with BitTorrent in September 2008 and April 2009, respectively.
Singapore: Odex actions against users
Anime distributor Odex actively took down and sent legal threats against individual BitTorrent users in Singapore beginning in 2007. These Internet users allegedly downloaded fansubbed anime via BitTorrent. Court orders required ISPs to reveal subscribers' personal information. This led to cease-and-desist letters from Odex to users that led to out-of-court settlements for at least S$3,000 (US$2,000) per person. One person who received such a letter was 9 years old. These actions were considered controversial by the local anime community and attracted criticism, as they were seen by fans as heavy-handed.
Slovenia: Suprnova
In December 2004, Suprnova.org, a popular early BitTorrent site, closed purportedly due to the pressure felt by Andre Preston, aka Sloncek, the site's founder and administrator. In December 2005, Sloncek revealed that the Suprnova computer servers had been confiscated by Slovenian authorities.
Sweden: Pirate Bay
The Pirate Bay torrent website, formed by a Swedish anti-copyright group, is notorious for the "legal threats" section of its website in which letters and replies on the subject of alleged copyright infringements are publicly displayed. On 31 May 2006, their servers in Sweden were raided by Swedish police on allegations by the MPAA of copyright infringement. The site was back online in less than 72 hours, and returned to Sweden, accompanied by public and media backlash against the government's actions. Steal This Film, was made to cover these incidents. On 17 April 2009, as a result of the trial following the raid, the site's four co-founders were sentenced to one year of jail time each and to collectively pay 30 million SEK in damages. All the defendants appealed the decision, although two later served their sentences. In 2012, to minimize legal exposure and save computer resources, The Pirate Bay entirely switched to providing plaintext magnet links instead of traditional torrent files. As the most popular and well-known facilitator of copyright infringement, The Pirate Bay continues to shift between different hosting facilities and domain registrars in the face of legal prosecution and shutdown threats. Telenor was recently forced to ban the DNS of TPB (although other cloud based clones still are available).
United States: 2003–present
Soon after the closure of Suprnova, civil and criminal legal actions in the United States began to increase.
MPAA cease and desist messages
In 2003, the Motion Picture Association of America began to send cease and desist messages to BitTorrent sites, leading to the shutdown of Torrentse and Sharelive in July 2003.
LokiTorrent
In 2005, Edward Webber (known as "lowkee"), webmaster of LokiTorrent, was ordered by a U.S. court to pay a fine and supply the MPAA with server logs (including the IP addresses of visitors). Webber began a fundraising campaign to pay legal fees for actions brought by the MPAA. Webber raised approximately US$45,000 through a PayPal-based donation system. Following the agreement, the MPAA changed the LokiTorrent website to display a message intended to discourage filesharers from downloading illegal content.
EliteTorrents
On 25 May 2005, the popular BitTorrent website EliteTorrents.org was shut down by the United States Federal Bureau of Investigation and Immigration and Customs Enforcement. Ten search warrants relating to members of the website were executed.
Six site administrators pleaded guilty to conspiracy to commit criminal copyright infringement and criminal copyright infringement of a pre-commercial release work. Punishments included jail time, house arrest and fines. Jail sentences were issued to some defendants violations of criminal law, the Family Entertainment and Copyright Act.
Newnova
In June 2006, the popular website Newnova.org, a replicate of Suprnova, was closed.
TorrentSpy
On 29 May 2007, a U.S. federal judge ordered TorrentSpy to begin monitoring its users' activities and to submit logs to MPAA. TorrentSpy ultimately removed access for US visitors rather than operate in an "uncertain legal environment." In the face of destruction of evidence charges and a $111 million legal judgement, TorrentSpy voluntarily shut down and filed for bankruptcy in 2008, although appeals continued through 2009.
isoHunt
On 21 December 2009 a federal district court found the founder of isoHunt guilty of inducing copyright infringement. The ruling was upheld on appeal in Columbia Pictures Industries, Inc. v. Fung in March 2013 and the site finally shut down in October 2013.
Copyright holder actions
Copyright owners have undertaken a variety of tactics and strategies to try to curtail BitTorrent transmittal of their intellectual property. In 2005 HBO began "poisoning" torrents of its show Rome, by providing bad chunks of data to clients. In 2007 HBO sent cease and desist letters to the Internet Service Providers of BitTorrent users. Many users reported receiving letters from their ISP's that threatened to cut off their internet service if the alleged infringement continued. HBO, unlike the RIAA, has not been reported to have filed suit over file sharing as of April 2007.
Beginning in early 2010, the US Copyright Group, acting on behalf of several independent movie makers, has obtained the IP addresses of BitTorrent users illegally downloading specific movies. The group then sued these users, in order to obtain subpoenas forcing ISPs to reveal the users' true identities. The group then sent out settlement offers in the $1,000–$3,000 range. About 16,200 lawsuits were filed between March and September 2010.
In 2011, United States courts began determining the legality of suits brought against hundreds or thousands of BitTorrent users. Nearly simultaneously, a suit against 5,000 IP addresses was dismissed. A smaller suit, Pacific Century International, Ltd. v. Does against 100 IPs, has also been dismissed.
In October 2011, John Wiley and Sons brought suit against 27 New York "John Does" for illegally copying books from the For Dummies series. According to TorrentFreak, Wiley is thus "the first book publisher to take this kind of action".
Settlements
On 23 November 2005, the Motion Picture Association of America and Bram Cohen, the CEO of BitTorrent Inc., signed a deal to remove links to illegal content on the official BitTorrent website.
Other notable search engines also voluntarily self-censored licensed content from their results, or became "content distribution"-only search engines. Mininova, announced that it would only allow freely licensed content (especially free content distributed by its author under a Creative Commons license) to be indexed after November 2009, resulting in the immediate removal of a majority of Mininova's search.
Infringement's sales impact
Some commentators have suggested that copyright violation through BitTorrent need not mean a loss of sales.
In addition, the Game of Thrones director, HBO programming president and Time Warner CEO Jeff Bewkes spoke about the positive effects of file sharing.
Bewkes further commented that he did not consider the unauthorized distribution to result in the loss of HBO subscriptions, rather: "Our experience is, it all leads to more penetration, more paying subs and more health for HBO." The show is the most infringed TV show, and "the show's first season was the best-selling TV DVD of 2012.
Patent infringement
In June 2011, Tranz-Send Broadcasting Network filed a U.S. District Court lawsuit against BitTorrent Inc. for infringing a patent applied for in April 1999.
See also
BitTorrent
File sharing
Legal aspects of file sharing
Torrent poisoning
Virtual private network
Copyleft
Opposition to copyright
Kopimi
References
External links
BitTorrent
Copyright infringement
Computer law | Legal issues with BitTorrent | Technology | 2,304 |
65,252,408 | https://en.wikipedia.org/wiki/Spongiostromata | "Spongiostromata" is an antiquated form taxon that refers primarily to fossil cyanobacteria. "Spongiostromate" is also used to describe stromatolites and oncolites that do not preserve clear tubules or other cellular microstructure.
Pia (1927) erected the group to contain calcareous algal fossils that contain no visible cellular structure but which he presumed represented cyanobacteria based on comparisons to modern examples. He divided the taxon into two groups: the stromatolithi and the oncolithi.
Monty (1981) abolished the group as taxonomically uninformative but advocated for the use of "spongiostromata" to describe a form and texture of bacterial fossils. He defined a "spongiostromate" texture as follows:"Spongiostromate microstructures result from the individualization of micritic, spongious, fenestral, sparitic, pelloidal, detrital, etc. laminae or films, variously grouped and organized. "Throughout geologic history, spongiostromate stromatolites and oncolites have always seemed to vastly outnumber the porostromate forms.
References
Paleobotany
Cyanobacteria
Stromatolites
Trace fossils | Spongiostromata | Biology | 277 |
66,200,335 | https://en.wikipedia.org/wiki/Torin-1 | Torin_1 is a drug which was one of the first non-rapalog derived inhibitors of the mechanistic target of rapamycin (mTOR) subtypes mTORC1 and mTORC2. In animal studies it has anti-inflammatory, anti-cancer, and anti-aging properties, and shows activity against neuropathic pain.
References
Enzyme inhibitors | Torin-1 | Chemistry | 80 |
12,738,736 | https://en.wikipedia.org/wiki/Lipomannan | Lipomannan is a mycobacterium immune agonist. In addition, it is a major constituent of the mycobacterium cell wall. This glycoconjugate is a virulence factor that plays a key role in the human immune system via interaction with various immune cells. It is also considered to be a precursor of lipoarabinomannans.
It is a trigger for TLR 2.
It consists of an α-linked mannan, which consists of 50–70 residues, with some branches points linked glycosidically to a diglyceride of which the fatty acids are similar to those of the whole cell lipid. In addition, succinic acid residues are present as O-acyl substituents on about one in four of the mannose residues, the terminal carboxyl group of the succinic acid providing the whole polymer with a considerable number of acidic functions.
Lipomannan has functional components that resemble lipoteichoic acids; a lipophilic region and a hydrophilic portion with frequent acid groups.
Lipomannan is a phosphorylated polysaccharide associated with the cell envelope and is considered to be the multimannosylated form of PIM which is primarily located in the plasma membrane. Structurally, LM is composed of two segments: a PI anchor to which is attached an α-D-mannan domain; both play key roles in inducing cytokine production by phagocytic cells. Mannose core consists of a linear α(1-6)-linked mannan backbone extending from the c-6 of the myo-inositol; the mannan chains is further substituted by α-(1-2) man-p side branches.
References
External links
Receptor agonists | Lipomannan | Chemistry,Biology | 374 |
48,825,894 | https://en.wikipedia.org/wiki/Comparison%20of%20IPv6%20support%20in%20common%20applications | This is a comparison of applications in regard to their support of the IPv6 protocol.
References
IPv6
Computing comparisons | Comparison of IPv6 support in common applications | Technology | 26 |
8,927,420 | https://en.wikipedia.org/wiki/EDDS | Ethylenediamine-N,N'-disuccinic acid (EDDS) is an aminopolycarboxylic acid. It is a colourless solid that is used as chelating agent that may offer a biodegradable alternative to EDTA, which is currently used on a large scale in numerous applications.
Structure and properties
EDDS has two chiral centers, and as such three stereoisomers. These are the enantiomeric (R,R) and (S,S) isomers and the achiral meso (R,S) isomer. As a biodegradable replacement for EDTA, only the (S,S) stereoisomer is of interest. The (R,S) and (R,R) stereoisomers are less biodegradable, whereas the (S,S) stereoisomer has been shown to be very effectively biodegraded even in highly polluted soils.
Synthesis
EDDS was first synthesized from maleic acid and ethylenediamine. Some microorganisms have been manipulated for industrial-scale synthesis of (S,S)-EDDS from ethylenediamine and fumaric acid or maleic acid, which proceeds as follows:
From aspartic acid
(S,S)-EDDS is produced stereospecifically by the alkylation of an ethylenedibromide with L-aspartic acid. Racemic EDDS is produced by the reaction of ethylenediamine with fumaric acid or maleic acid.
Coordination chemistry
In comparing the effectiveness of (S,S)-EDDS versus EDTA as chelating agents for iron(III):
Because of the lower stability for [Fe(S,S)-EDDS]−, the useful range being roughly 3<pH(S,S)-EDDS<9 and 2<pHEDTA<11. However, this range is sufficient for most applications.
Another comparison that can be made between (S,S)-EDDS and EDTA is the structure of the chelated complex. EDTA’s six donor sites form five five-membered chelate rings around the metal ion, four NC2OFe rings and one C2N2Fe ring. The C2N2Fe ring and two of NC2OFe rings define a plane, and two NC2OFe rings are perpendicular to the plane that contains the C2-symmetry axis. The five-membered rings are slightly strained. EDDS’s six donor sites form both five- and six-membered chelate rings around the metal ion: two NC2OFe rings, two NC3OFe rings, and one C2N2Fe ring. Studies of the crystal structure of the Fe[(S,S)-EDDS]− complex show that the two five-membered NC3OFe rings project out of the plane of the complex, reducing the equatorial ring strain that exists in the Fe[EDTA]− complex. The complex also has C2 symmetry.
Uses
(S,S)-EDDS is a biodegradable chelating agent that offers an alternative to EDTA, of which 80 million kilograms are produced annually. Under natural conditions, EDTA has been found to convert to ethylenediaminetriacetic acid and then cyclize to the diketopiperazine, which accumulates in the environment as a persistent organic pollutant. (S,S)-EDDS was developed commercially as a biodegradable chelator and stabilizing agent in detergent and cosmetic formulations. When EDDS is applied in chemical-enhanced soil remediation in excessive case (e.g., when applied for ex-situ soil washing), higher extraction efficiency for heavy metals can be achieved and the amount of extraction is less independent with the EDDS dosage; On the other hand, during soil remediation which involves continuous flushing, metal extraction is often limited by the amount of EDDS. Under EDDS deficiency, initial unselective extraction of heavy metals was observed, followed by heavy metal exchange and re-adsorption of heavy metals that have lower stability constant with EDDS.
External links
Sigma Aldrich page on EDDS, containing a link to a MSDS
References
Chelating agents
Amino acids | EDDS | Chemistry | 895 |
41,147,989 | https://en.wikipedia.org/wiki/Mobile%20Rocket%20Base | The Mobile Rocket Base (), abbreviated MORABA, is a department of the DLR Space Operations and Astronaut Training in Oberpfaffenhofen near Munich. Since the 1960s, the MORABA has performed scientific high altitude research missions with unmanned rockets and balloons, and has developed the required mechanical and electrical systems. Their operational areas include upper atmosphere research, microgravity research, astronomy, geophysics, materials science, as well as hypersonic research.
EuroLaunch, a cooperation between MORABA and SSC Esrange, offers international launch services for stratospheric balloons and sounding rockets.
Since 1971, MORABA also cooperates with the Brazilian Instituto de Aeronáutica e Espaço (IAE) of the Departamento de Ciência e Tecnologia Aeroespacial (DCTA).
Divisions of MORABA
Mobile Infrastructure
The mobile ground stations and antennas for telemetry (reception of data) and tele-command (transmission of control commands), as well as range instrumentation radar stations for the exact trajectory measurement, are part of the Mobile Infrastructure. This includes also ground support systems for communication, power supplies, etc.
The main tasks include tracking the trajectory of sounding rockets or research balloons, RF data reception, data processing, distribution and archiving. Transport, setup and maintenance of the mobile stations, as well as mission preparation, are also part of the activities.
Electrical Flight Systems
The Electrical Flight Systems group develops, builds, and qualifies the necessary electrical and electronic systems aboard the rockets and balloons. Among others, this includes onboard computer systems, control and measurement equipment, data management and telemetry components, and RF transmission systems. Attitude, rate, and acceleration sensors are calibrated and flown in these systems. Cold gas rate and attitude control systems are developed and qualified by this group. The construction of Electrical Ground Support Equipment (EGSE) is also in the scope of tasks.
Mechanical Flight Systems
The Mechanical Flight Systems group performs structural calculations, aerodynamic and thermal analyses. Also, mechanical configuration and design of the payload and the entire vehicle are planned and accomplished, as well as the integration of scientific experiments and the spin balancing of the final payload.
Furthermore, this group develops and maintains separation and payload recovery systems.
Launch Services
The tasks of the Launch Services group include procurement, inspection, modification and storage of rocket motors and pyrotechnics, setup of the mobile launch pads, assembling the rocket stages and ignition systems, integrating the payload and rocket motors, and loading the rocket onto the launcher.
Furthermore, the group is responsible for support of flight safety, trajectory calculations, aerodynamic calculations, and selection of the rocket configuration.
Mechanical and electronic flight systems developed by MORABA
Rocket fins and sub structures
Separation systems of the rocket stages
De-spin systems to eliminate rocket spin before the experiment phase
Parachute recovery systems
TV multichannel transmission systems
On-board systems for rate, attitude, spin rate, and precession control
Ignition units for safe ignition of rocket motors and payload pyrotechnics
Mobile electrical and mechanical ground systems, such as ground stations and launch pads
Telemetry and tele-command systems
Integrated radio frequency systems for rockets and balloons
History
The Mobile Rocket Base emerged from the "Working Group For Space Exploration", a common foundation of the Max Planck Institute for Extraterrestrial Physics (MPE) and the former German Laboratory for Aviation (DVL). This working group was founded in 1965 and had its first headquarters in Munich.
Since April 1969 the Mobile Rocket Base is located in Oberpfaffenhofen, near Munich, in the department "Space Operations and Astronaut Training" of the German Aerospace Center (DLR).
The first mobile campaign to study the solar eclipse in May 1966 on the Greek island of Euboea, on behalf of the European Space Research Organisation (ESRO), demonstrated the feasibility to move and set up extensive technical and scientific equipment in a short time in a remote location.
The beginning: Atmospheric research
In cooperation with the MPE, a campaign for the study of the magnetic field of the Earth was carried out in the spring of 1967, at Esrange (Sweden). With five Nike-Apache rockets, artificial barium clouds (Aurora Borealis) were created in about 100 km altitude, in order to visualize the magnetic field lines.
In addition to the rocket launch sites in Scandinavia (Kiruna and Andenes), also Sardinia, Wallops Island and Matagorda Island (USA), White Sands (USA), Greenland, Trivandrum (India), Woomera (Australia), Huelva (Spain), Natal (Brazil), and Adelaide Island (Antarctica) were used for the launch of payloads with various scientific purposes.
In the following years, sounding rockets were used mainly in the fields of upper atmosphere and research into the causes of global warming.
New fields of application: Microgravity research
With the start of the "HEATPIPE 1" payload, manufactured by Dornier, Friedrichshafen, a new field of application for sounding rockets emerged. The launch took place on January 22, 1976 at Esrange, with the aim to investigate the function of heat pipes and latent heat storage in a microgravity environment for their application in future satellite projects.
Initially intended as a supplementary programme for the German Spacelab missions, the first launch of a TEXUS payload took place on December 13, 1977 with a two-stage Skylark rocket at Esrange. In the following years, up to four TEXUS missions (6 minutes of microgravity) were flown per year, with numerous experiments. In order to meet the ever-increasing number of experiments with different requirements and objectives, the Swedish MASER programme, the MAXUS programme (13 minutes microgravity), and the MiniTEXUS programme (3 minutes microgravity) were initiated, under the aegis of the European Space Agency (ESA).
Further tasks: Launch of high altitude research balloons
Already in May 1975, the Mobile Rocket Base was involved in research balloons with the flight of the 2.5-ton "Spectro-Stratoscope" instrument in Palestine (Texas), for the reception of the PCM data from the payload.
Together with the Max Planck Institute for Aeronomy in Lindau (Harz, Germany), international balloon flights were carried out in Aire-sur-l'Adour (France), Mendoza (Argentina), and Hyderabad (India), to explore the chemical composition (and pollution) of the atmosphere in different altitudes and latitudes.
Technology transfer: From rockets to satellites
In the early years of German sounding rocket research, the payloads were designed and built by engineers and technicians from the companies Dornier, MBB, Kayser-Threde, and ERNO. Parallel to the withdrawal of Dornier and MBB from payload construction for sounding rockets, MORABA developed and tested, in addition to the already existing spin rate and attitude control modules and parachute recovery systems, mechanical and electrical flight systems which were difficult or impossible to obtain on the market. The first and successful application of a rocket-qualified data acquisition and transmission / reception system on a satellite was in the re-entry experiment "EXPRESS". For this project, in late 1994 a complete transmitting and receiving station with all necessary functions was set up by MORABA in the South Australian desert and was operated over the turn of the year. After the launch with a Japanese satellite launcher and a 7-day orbital flight, the landing of the EXPRESS capsule was planned to occur in the vicinity of the town of Coober Pedy (Australia). However, due to a malfunction of the rocket, the capsule entered an elliptical orbit with very low Perigee and landed in Africa after only a few revolutions.
Further applications of developments of MORABA in space flight missions included experiments aboard the Russian space station Mir and the DLR satellite BIRD.
Latest trend: Hypersonic research - the flying wind tunnel
Similar to the novel use of the rocket platform for microgravity research, the use of sounding rockets as a flying hypersonic wind tunnel has increased steadily. With the help of sounding rockets, large flight models are brought to speeds of above Mach 12 and reentry periods of up to one minute can be achieved.
For the DLR Sharp Edge Flight Experiment (SHEFEX) MORABA designed and built the payload subsystems and the rocket system. With its launch in October 2005 from Andenes (Norway) the project has been successfully completed.
Further experiments of this kind were the also successfully completed follow-up project SHEFEX II (launched in June 2012), as well as the scramjet engine research programs HIFiRE and Scramspace.
Missions conducted or supported by MORABA
Current projects of MORABA
TEXUS (): Technology Experiments in Microgravity Environment
REXUS/BEXUS: Sounding Rocket and Balloon Experiments for University Students
STERN: Students' Experimental Rockets (): Support program for students to develop innovative rocket engines
MAPHEUS: Material Physics Experiments in Microgravity ()
WADIS (): Research project of the Leibniz-Institute of Atmospheric Physics in Kühlungsborn, Germany, and the Institute of Space Systems (IRS) of the University of Stuttgart, Germany
SHEFEX (SHarp Edge Flight Experiment): Program of the German Aerospace Center (DLR)
MASER: Sounding rocket program of the Swedish Space Corporation (SSC), for microgravity research
MAXUS: Joint venture between Astrium and the Swedish Space Corporation (SSC) for materials science research in microgravity environment
HIFiRE: Australian program for the development of a supersonic combustion ramjet (Scramjet)
MAIUS: Study of a Bose–Einstein condensate in microgravity environment
ROTEX (ROcket Technology EXperiment): Students' flight experiments of the Institute of Aerodynamics at the RWTH Aachen University
Corsair (formerly CSSR: Comet Surface Sample Return): Cooperation with NASA. The goal is to take a sample from the surface of a comet nucleus and transport it to Earth.
Selected missions
List of rocket and balloon missions
Further reading
Peter Turner: Einmal ins All und zurück. DLR, Oberpfaffenhofen 2007, .
Burkhard Franke: Forschungsraketen - Technologische Experimente unter Schwerelosigkeit durchgeführt mit TEXUS, MiniTEXUS und MAXUS. Stedinger Verlag, Lemwerder 2007.
Wilfried Ley, Klaus Wittmann, Willi Hallmann: Handbuch der Raumfahrttechnik. Carl Hanser Verlag, München 2011, .
Kurt Trettner: Deutschlands Raketen starten in Schweden! In: hobby - Das Magazin der Technik. Nr. 15, 1967, S. 88–92.
Günther Seibert: The History of Sounding Rockets and Their Contribution to European Space Research. ESA Publications Division, November 2006, .
See also
Sounding rocket
List of sounding rockets
List of orbital launch systems
List of rockets launched from Esrange
External links
Encyclopedia Astronautica
Designation-Systems.Net
References
Space technology
Sounding rockets
Balloons (aeronautics) | Mobile Rocket Base | Astronomy | 2,287 |
2,330,435 | https://en.wikipedia.org/wiki/Kenny%20Dies | "Kenny Dies" is the thirteenth episode of the fifth season of the animated television series South Park, and the 78th episode of the series overall. "Kenny Dies" originally aired in the United States on December 5, 2001 on Comedy Central and in the United Kingdom on April 20, 2002 on Sky One. In the episode, Cartman comes across a truckload of fetuses he cannot sell thanks to a recent government ruling on stem cell research. When Kenny is diagnosed with a terminal illness, Cartman uses it to lobby Congress to restore stem cell research.
The episode was written and directed by series co-creator Trey Parker and is rated TV-MA in the United States, except on syndicated broadcasts and post-2017 reruns on Comedy Central, where the episode is instead rated TV-14. The gag of Kenny dying in almost every episode was dropped after this episode, and he did not reappear bodily until "Red Sleigh Down", due to fans being upset over his absence all throughout season 6 in 2002. This was the final appearance of the "4th Grade" title sequence, which was first seen in "4th Grade." On the DVD commentary for the episode, Parker and Matt Stone state that they had originally planned to kill Kyle off for a year, but decided to kill Kenny instead as they were running out of original ways to kill him.
Plot
The episode begins in an abortion clinic, a woman is giving her permission for scientists to use her dead fetus for stem cell research. However, during the transport of the fetuses the driver swerves and falls off a mountain road due to a deer running across the road and the truck gets destroyed which was carrying all the fetuses from the clinic to Alder Research Group. Cartman happens to be passing the crash at this moment, and he notices the fetuses from the truck. He then steals the fetuses, he starts calling companies hoping that he would be able to resell the fetuses and get a huge profit off of them.
Meanwhile, the boys find out that Kenny has been diagnosed with a terminal disease, which while not named in the show is confirmed to be muscular dystrophy. Everyone is shocked by the news, and everyone except Stan tries their best to be confident for Kenny's sake. Stan, however, is too upset to be near Kenny in his state and refuses to even visit him.
Cartman wants to restore stem cell research, and a researcher explains to Cartman about how the studies actually work. With this information, Cartman realizes that the SCR might also be used to help Kenny recover from his illness. He then thinks that the research could also be used to duplicate a "Shakey's Pizza". The researcher recommends using lumber for that second idea.
Then Cartman goes to the government court and gives a very thoughtful speech to the House of Representatives, requesting that the SCR ban be lifted, explaining about his best friend, Kenny, who is slowly dying as they speak. He then says that he believes the research can save Kenny's life. The House of Representatives committee then lifts the ban after Cartman sings "Heat of the Moment". Cartman begins visiting abortion clinics throughout the area, in order to collect even more aborted fetuses.
Meanwhile, after Chef gives Stan a little lecture on death, and why God lets it happen at any given time, Stan finally comes to terms with Kenny dying. He also finds out that Stem Cell Research has been made legal again, and with the hope that a cure might be found, rushes to visit Kenny. Unfortunately, Kenny's hospital room is empty, and the teddy bear he was given is on the floor, seemingly holding onto the unmade bed Kenny slept in. Stan knows what this means - Kyle says he just stopped breathing, and it was over. He also adds that Kenny's last words were "Where's Stan?"
At the funeral, Stan feels extremely guilty over not seeing Kenny before he died, and considers himself to have been Kenny's worst friend. As the funeral takes place, though, Cartman comes rushing in and drags Stan and Kyle out of the ceremony, explaining that they have to see the "miracle" that has just occurred. The boys are shocked and disgusted to see that, instead of using the stem cells to save Kenny, Cartman only wanted them so he could duplicate a Shakey's Pizza. Kyle is absolutely furious that Cartman used Kenny's illness and death just so he could have his own Shakey's and launches a furious beating against him, while Stan feels better now that he knows it was Cartman who was Kenny's worst friend.
Reception
Serene Dominic of the Detroit Metro Times called the scene where Cartman leads members of the United States Congress in a sing-along of "Heat of the Moment" as the "Greatest Cartoon Moment" in the career of the original four members of Asia. In an article for ESPN.com, Tim Kavanagh discussed stem cells and how they were used in the episode, writing, "This, as with many other important topics of our day, I learned from "South Park," specifically Episode 513, entitled 'Kenny Dies.'" In a review of the South Park season 5 DVD release, Choire Sicha of The New York Times gave a "not-so-surprising surprise ending alert" that "Kenny finally really dies" at the end of the episode. Alessandra Stanley of The New York Times cited the episode when noting that the political commentary on South Park, like The Simpsons and Freak Show, was genuinely "provocative" satire, unlike the "safer ... mainstream iconoclasm" of Saturday Night Live.
Home media
"Kenny Dies", along with the thirteen other episodes from South Park: the Complete Fifth Season, was released on a three-disc DVD set in the United States on February 22, 2005. The set includes brief audio commentaries by Parker and Stone for each episode.
References
Further reading
External links
"Kenny Dies" Full episode at South Park Studios
Television episodes about abortion
South Park season 5 episodes
Stem cell research
Television episodes about death | Kenny Dies | Chemistry,Biology | 1,254 |
35,382,631 | https://en.wikipedia.org/wiki/Singular%20boundary%20method | In numerical analysis, the singular boundary method (SBM) belongs to a family of meshless boundary collocation techniques which include the method of fundamental solutions (MFS), boundary knot method (BKM), regularized meshless method (RMM), boundary particle method (BPM), modified MFS, and so on. This family of strong-form collocation methods is designed to avoid singular numerical integration and mesh generation in the traditional boundary element method (BEM) in the numerical solution of boundary value problems with boundary nodes, in which a fundamental solution of the governing equation is explicitly known.
The salient feature of the SBM is to overcome the fictitious boundary in the method of fundamental solution, while keeping all merits of the latter. The method offers several advantages over the classical domain or boundary discretization methods, among which are:
meshless. The method requires neither domain nor boundary meshing but boundary-only discretization points;
integration-free. The numerical integration of singular or nearly singular kernels could be otherwise troublesome, expensive, and complicated, as in the case, for example, the boundary element method;
boundary-only discretization for homogeneous problems. The SBM shares all the advantages of the BEM over domain discretization methods such as the finite element or finite difference methods;
to overcome the perplexing fictitious boundary in the method of fundamental solutions (see Figs. 1 and 2), thanks to the introduction of the concept of the origin intensity factor, which isolates the singularity of the fundamental solutions.
The SBM provides a significant and promising alternative to popular boundary-type methods such as the BEM and MFS, in particular, for infinite domain, wave, thin-walled structures, and inverse problems.
History of the singular boundary method
The methodology of the SBM was firstly proposed by Chen and his collaborators in 2009. The basic idea is to introduce a concept of the origin intensity factor to isolate the singularity of the fundamental solutions so that the source points can be placed directly on the real boundary. In comparison, the method of fundamental solutions requires a fictitious boundary for placing the source points to avoid the singularity of fundamental solution. The SBM has since been successfully applied to a variety of physical problems, such as potential problems, infinite domain problem, Helmholtz problem, and plane elasticity problem.
There are the two techniques to evaluate the origin intensity factor. The first approach is to place a cluster of sample nodes inside the problem domain and to calculate the algebraic equations. The strategy leads to extra computational costs and makes the method is not as efficient as expected compared to the MFS. The second approach is to employ a regularization technique to cancel the singularities of the fundamental solution and its derivatives. Consequently, the origin intensity factors can be determined directly without using any sample nodes. This scheme makes the method more stable, accurate, efficient, and extends its applicability.
Recent developments
Boundary layer effect problems
Like all the other boundary-type numerical methods, also it is observed that the SBM encounters a dramatic drop of solution accuracy at the region nearby boundary. Unlike singularity at origin, the fundamental solution at near-boundary regions remains finite. However, instead of being a flat function, the interpolation function develops a sharp peak as the field point approaches the boundary. Consequently, the kernels become “nearly singular” and can not accurately be calculated. This is similar to the so-called boundary layer effect encountered in the BEM-based methods.
A nonlinear transformation, based on the sinh function, can be employed to remove or damp out the rapid variations of the nearly singular kernels. As a result, the troublesome boundary layer effect in the SBM has been successfully remedied. The implementation of this transformation is straightforward and can easily be embedded in existing SBM programs. For the test problems studied, very promising results are obtained even when the distance between the field point and the boundary is as small as 1.
Large-scale problems
Like the MFS and BEM, the SBM will produce dense coefficient matrices, whose operation count and the memory requirements for matrix equation buildup are of the order of O(N2) which is computationally too expensive to simulate large-scale problems.
The fast multipole method (FMM) can reduce both CPU time and memory requirement from O(N2) to O(N) or O(NlogN). With the help of FMM, the SBM can be fully capable of solving a large scale problem of several million unknowns on a desktop. This fast algorithm dramatically expands the applicable territory of the SBM to far greater problems than were previously possible.
See also
Meshfree methods
Radial basis function
Trefftz method
References
External links
Kernel distance functions and radial basis functions
Singular Boundary Method
Numerical analysis
Numerical differential equations | Singular boundary method | Mathematics | 982 |
76,554,532 | https://en.wikipedia.org/wiki/Gertrud%20Zwicknagl | Gertrud Zwicknagl is a retired German solid-state physicist whose research involved the development of renormalized band theory for intermetallic solids and its application to the theory of superconductors and heavy fermion materials, as well as the study of heavy quasiparticles in uranium compounds. Formerly a professor of physics at the Technical University of Braunschweig, she retired in 2020.
Education and career
After studying physics as an undergraduate at Ludwig Maximilian University of Munich from 1970 to 1975, Zwicknagl continued her studies at the University of Cologne, earning a doctorate (Dr. rer. nat.) in 1979.
She became a researcher at KFA Jülich (now the Forschungszentrum Jülich) from 1976 to 1980, at the Max Planck Institute for Solid State Research in Stuttgart from 1980 to 1986, at the Laboratory of Atomic and Solid State Physics at Cornell University in the US from 1983 to 1984, and at the Institute of Solid State Physics at the Technische Universität Darmstadt from 1986 to 1991. While at Darmstadt she completed a habilitation in 1991.
She returned to the Max Planck Institute for Solid State Research as a senior researcher in 1991, and moved to the Max Planck Institute for the Physics of Complex Systems in Dresden in 1996. In 1998 she took a professorship at the Technical University of Braunschweig, from which she retired in 2020.
Recognition
Zwicknagl was the 1993 recipient of the Walter Schottky Prize of the German Physical Society.
She was named a Fellow of the American Physical Society (APS) in 2023, after a nomination from the APS Division of Condensed Matter Physics, "for original and paramount contributions to the theory of emergent solid-state materials, in particular, for groundbreaking advances toward the quantitative microscopic understanding of strongly correlated systems on the basis of their atomistic and electronic structure".
References
External links
Interview with Zwicknagl (in German), German Physical Society
Year of birth missing (living people)
Living people
German physicists
German women physicists
Condensed matter physicists
Ludwig Maximilian University of Munich alumni
University of Cologne alumni
Academic staff of the Technical University of Braunschweig
Fellows of the American Physical Society | Gertrud Zwicknagl | Physics,Materials_science | 451 |
55,401,273 | https://en.wikipedia.org/wiki/Nordoxepin | Nordoxepin, also known as N-desmethyldoxepin, is an organic compound. A colorless solid, it attracted attention as the major active metabolite of the tricyclic antidepressant (TCA) doxepin (Sinequan). It has been found to play a significant role in the antidepressant effects of doxepin.
Nordoxepin is a mixture of (E) and (Z) stereoisomers. Whereas pharmaceutical doxepin is supplied in an approximate 85:15 ratio mixture of (E)- and (Z)-stereoisomers and plasma concentrations of doxepin remain roughly the same as this ratio with treatment, plasma levels of the (E)- and (Z)-stereoisomers of nordoxepin, due to stereoselective metabolism of doxepin by cytochrome P450 enzymes, are approximately 1:1.
Nordoxepin is pharmacologically active similarly to doxepin, but relative to doxepin, is much more potent and selective as a norepinephrine reuptake inhibitor. In general, the demethylated variants of tertiary amine TCAs like doxepin are much more potent inhibitors of norepinephrine reuptake, less potent inhibitors of serotonin reuptake, and less potent in their antiadrenergic, antihistamine, and anticholinergic activities.
Nordoxepin is formed from doxepin mainly by CYP2C19 (>50% contribution), while CYP1A2 and CYP2C9 are involved to a lesser extent, and CYP2D6 and CYP3A4 are not involved. Hydroxylation of doxepin and nordoxepin is mediated mainly by CYP2D6. Total exposures to both doxepin and nordoxepin differ by almost 10-fold in CYP2D6 ultra-rapid versus poor metabolizers. Both doxepin and nordoxepin are also transformed into glucuronide conjugates. The elimination half-life of nordoxepin is approximately 31 hours, which is almost twice that of doxepin (mean 17 hours).
See also
Cidoxepin
References
Alpha blockers
Amines
Antihistamines
Dibenzoxepins
H1 receptor antagonists
Human drug metabolites
Muscarinic antagonists
Norepinephrine reuptake inhibitors
Serotonin receptor antagonists
Tricyclic antidepressants | Nordoxepin | Chemistry | 550 |
7,065,881 | https://en.wikipedia.org/wiki/Ebastine | Ebastine is a H1 antihistamine with low potential for causing drowsiness.
It does not penetrate the blood–brain barrier to a significant amount and thus combines an effective block of the H1 receptor in peripheral tissue with a low incidence of central side effects, i.e. seldom causing sedation or drowsiness.
It was patented in 1983 by Almirall S.A and came into medical use in 1990. The substance is often provided in micronised form due to poor water solubility.
Uses
Ebastine is a second-generation H1 receptor antagonist that is indicated mainly for allergic rhinitis and chronic idiopathic urticaria. It is available in 10 and 20 mg tablets and as fast-dissolving tablets, as well as in pediatric syrup. It has a recommended flexible daily dose of 10 or 20 mg, depending on disease severity.
Data from over 8,000 patients in more than 40 clinical trials and studies suggest efficacy of ebastine in the treatment of intermittent allergic rhinitis, persistent allergic rhinitis and other indications.
Safety
Ebastine has shown overall safety and tolerability profile with no cognitive/psychomotor impairment and no sedation worse than placebo, and cardiac safety, that is, no QT prolongation. The incidence of most commonly reported adverse events was comparable between the ebastine and placebo groups, which confirms that ebastine has a favourable safety profile.
While experiments in pregnant animals showed no risk for the unborn, no such data are available in humans. It is not known whether ebastine passes into the breast milk.
Pharmacokinetic profile
After oral administration, ebastine undergoes extensive first-pass metabolism by hepatic cytochrome P450 3A4 into its active carboxylic acid metabolite, carebastine. This conversion is practically complete.
Brand names
Ebastine is available in different formulations (tablets, fast dissolving tablets and syrup) and commercialized under different brand names around the world, Ebast, Ebatin, Ebatin Fast, Ebatrol, Atmos, Ebet, Ebastel FLAS, Kestine, KestineLIO, KestinLYO, EstivanLYO, Evastel Z, Eteen (EURO Pharma Ltd.), Tebast (SQUARE), Ebasten (ACI), etc.
See also
Desloratadine
References
External links
H1 receptor antagonists
Ethers
Piperidines
Aromatic ketones
Peripherally selective drugs | Ebastine | Chemistry | 527 |
19,998,548 | https://en.wikipedia.org/wiki/I.430 | The I.431/430 Networking standards are recommendations produced by the ITU. They are Layer 1 specifications for ISDN networks, using either an E1 or T1 circuit. The I.431 standard is known as the 'PRI Physical Layer' whereas the I.430 is known as the 'BRI Physical Layer'.
External links
I.430 : Basic user-network interface - Layer 1 specification from the ITU
ITU-T recommendations
ITU-T I Series Recommendations | I.430 | Technology | 102 |
23,063,791 | https://en.wikipedia.org/wiki/Bus%20coupler | A bus coupler is a device which is used to couple one bus to the other without any interruption in power supply and without creating hazardous arcs. A bus coupler is a breaker used to couple two busbars to perform maintenance on other circuit breakers associated
with that busbar.
It is achieved with the help of a circuit breaker and isolators.
Characteristics
MIL-STD-1553B specifies the transformer characteristics and turns ratio of 1.4:1 with the higher turns on the isolation resistor side of the stub. The MIL-STD-1553B also specifies the isolation resistors that are placed in series with each connection to the bus. Normally bus couplers are available with 1.4:1 transformer ratios and 59 ohm (2 watt 1%) resistors. For special applications, couplers can be supplied with different transformer ratios (e.g., 1:1) and other resistance values (e.g., 54.9 ohms).
Bus coupler configurations are available as non-terminated or internally terminated. If two or more non-terminated couplers are used on a bus, then the couplers at each end of the bus must be terminated externally with 78-ohm terminators on the unused bus connections of the end couplers. Alternately, internally single-terminated couplers (with or without the non-functional bus connectors) can be supplied.
Even if only one non-terminated coupler acts as the bus because all devices (bus controller, remote terminals, etc.) are connected to the coupler stubs, the external bus connections of the coupler must be terminated. A dual-terminated coupler (with or without non-functional bus connectors) can be employed where the coupler acts as the bus without other couplers.
RFI dust caps (with or without safety chains) are recommended for all unused stub ports.
Data bus couplers are readily available in 2 through 8 stubs and in various sizes and shapes of boxes and slim inline models. Also, a variety of connectors are offered with couplers.
External links
How to use Bus Couplers Tutorial (video) from Excalibur Systems Inc. (No Registration Required)
MIL-STD-1553B Concepts and Considerations from MilesTek Corporation (No Registration Required)
Serial buses | Bus coupler | Technology | 480 |
9,409,435 | https://en.wikipedia.org/wiki/16-cell%20honeycomb | In four-dimensional Euclidean geometry, the 16-cell honeycomb is one of the three regular space-filling tessellations (or honeycombs), represented by Schläfli symbol {3,3,4,3}, and constructed by a 4-dimensional packing of 16-cell facets, three around every face.
Its dual is the 24-cell honeycomb. Its vertex figure is a 24-cell. The vertex arrangement is called the B4, D4, or F4 lattice.
Alternate names
Hexadecachoric tetracomb/honeycomb
Demitesseractic tetracomb/honeycomb
Coordinates
Vertices can be placed at all integer coordinates (i,j,k,l), such that the sum of the coordinates is even.
D4 lattice
The vertex arrangement of the 16-cell honeycomb is called the D4 lattice or F4 lattice. The vertices of this lattice are the centers of the 3-spheres in the densest known packing of equal spheres in 4-space; its kissing number is 24, which is also the same as the kissing number in R4, as proved by Oleg Musin in 2003.
The related D lattice (also called D) can be constructed by the union of two D4 lattices, and is identical to the C4 lattice:
∪ = =
The kissing number for D is 23 = 8, (2n – 1 for n < 8, 240 for n = 8, and 2n(n – 1) for n > 8).
The related D lattice (also called D and C) can be constructed by the union of all four D4 lattices, but it is identical to the D4 lattice: It is also the 4-dimensional body centered cubic, the union of two 4-cube honeycombs in dual positions.
∪ ∪ ∪ = = ∪ .
The kissing number of the D lattice (and D4 lattice) is 24 and its Voronoi tessellation is a 24-cell honeycomb, , containing all rectified 16-cells (24-cell) Voronoi cells, or .
Symmetry constructions
There are three different symmetry constructions of this tessellation. Each symmetry can be represented by different arrangements of colored 16-cell facets.
Related honeycombs
It is related to the regular hyperbolic 5-space 5-orthoplex honeycomb, {3,3,3,4,3}, with 5-orthoplex facets, the regular 4-polytope 24-cell, {3,4,3} with octahedral (3-orthoplex) cell, and cube {4,3}, with (2-orthoplex) square faces.
It has a 2-dimensional analogue, {3,6}, and as an alternated form (the demitesseractic honeycomb, h{4,3,3,4}) it is related to the alternated cubic honeycomb.
See also
Regular and uniform honeycombs in 4-space:
Tesseractic honeycomb
24-cell honeycomb
Truncated 24-cell honeycomb
Snub 24-cell honeycomb
5-cell honeycomb
Truncated 5-cell honeycomb
Omnitruncated 5-cell honeycomb
Notes
References
Coxeter, H.S.M. Regular Polytopes, (3rd edition, 1973), Dover edition,
pp. 154–156: Partial truncation or alternation, represented by h prefix: h{4,4} = {4,4}; h{4,3,4} = {31,1,4}, h{4,3,3,4} = {3,3,4,3}, ...
Kaleidoscopes: Selected Writings of H.S.M. Coxeter, edited by F. Arthur Sherk, Peter McMullen, Anthony C. Thompson, Asia Ivic Weiss, Wiley-Interscience Publication, 1995,
(Paper 24) H.S.M. Coxeter, Regular and Semi-Regular Polytopes III, [Math. Zeit. 200 (1988) 3-45]
George Olshevsky, Uniform Panoploid Tetracombs, Manuscript (2006) (Complete list of 11 convex uniform tilings, 28 convex uniform honeycombs, and 143 convex uniform tetracombs)
x3o3o4o3o - hext - O104
Honeycombs (geometry)
5-polytopes
Regular tessellations | 16-cell honeycomb | Physics,Chemistry,Materials_science | 931 |
2,191,566 | https://en.wikipedia.org/wiki/American%20Society%20for%20Artificial%20Internal%20Organs | American Society for Artificial Internal Organs (ASAIO) is an organization of individuals and groups that are interested in artificial internal organs and their development.
It supports research into artificial internal organs and holds an annual meeting, which attracts industry, researchers and government officials. ASAIO's most heavily represented areas are nephrology, cardiopulmonary devices (artificial hearts, heart-lung machines) and biomaterials. It publishes a peer-reviewed publication, the ASAIO Journal, 10 times a year.
References
External links
American Society for Artificial Internal Organs home page
ASAIO Journal - home
Implants (medicine)
Medical associations based in the United States
Prosthetics
Medical and health organizations based in Florida | American Society for Artificial Internal Organs | Engineering,Biology | 145 |
45,075,654 | https://en.wikipedia.org/wiki/High%20value%20resistors%20%28electronics%29 | High value resistors (HVR) are electronic components used for special applications, such as in bio-medical systems, measurement equipment and some condenser microphones. While discrete resistors in the range of few tens of megohm are very common, making giga-ohm range resistors is more complicated. Discrete resistors are available up to several tera-ohms, but are expensive because of limited demand. Sometimes, a combination of active and passive electronic devices is used to achieve such a high resistance.
References
Electrical components
Resistive components | High value resistors (electronics) | Physics,Technology,Engineering | 114 |
31,657,115 | https://en.wikipedia.org/wiki/Oral%20History%20of%20British%20Science | An Oral History of British Science is an oral history project conducted by National Life Stories at the British Library. The project began in 2009 with funding from the Arcadia Fund, the Royal Commission for the Exhibition of 1851 and a number of other private donors and focuses on audio interviews with British science and engineering figures.
Project background
The project focused on 200 video interviews lasting 8–15 hours, with four themes: Made in Britain, A Changing Planet, Cosmologies and Biomedicine. The project Advisory Committee included Jon Agar, Alec Broers, Tilly Blyth, Georgina Ferry, Dame Julia Higgins, Maja Kominko, Sir Harry Kroto, John Lynch, Chris Rapley and Simone Turchetti.
An Oral History of British Science was conducted by National Life Stories (NLS) at the British Library, and formed part of a wider institutional initiative to better document contemporary history of science and technology through the addition of audio visual sources as well as written sources.
Methodology
The oral history of British science follows the biographical, or life story, oral history approach with each audio interview averaging 8 to 15 hours in length. The interviews cover the individual’s career history, education, background and family.
Access to interviews
All interviews are catalogued on the Sound and Moving Image Catalogue. Interviews which are complete and open are accessible onsite at the Library in St Pancras, London and in Boston Spa, Yorkshire via the Library’s Listening & Viewing Service. Interviews which are open are also made accessible via the Archival Sound Recordings website under the ‘Oral history of British science’ content package.
People interviewed
Interviewed for ‘A Changing Planet’:
Barbara Bowen (Geophysics technician/ research assistant)
Joe Farman (Geophysicist)
John Glen (Glaciologist)
A.T. (Dick) Grove (Geographer/ geomorphologist)
David Jenkinson (Soil Scientist)
Desmond King-Hele (Physicist)
John Kington (Meteorologist and climatologist)
James Lovelock (Geochemist)
Melvyn Mason (Technician in seismic refraction)
Dan McKenzie (geophysicist)
Stephen Moorbath (Geologist and Geochronologist)
John Nye (scientist) (Physicist, Theoretical glaciologist)
Charles Swithinbank (Glaciologist)
Janet Thomson (Geologist)
Sue Vine (Geophysicist technician/ research assistant)
Richard West (Botanist and Quaternary Geologist)
Interviewed for ‘Made in Britain’:
Raymond Bird (Computer Engineer)
Tony Brooker (Computer Scientist)
Mary Coombs (Computer Programmer)
Sir Alan Cottrell (Metallurgist and Physicist)
Dai Edwards (Computer Engineer);
Roy Gibson (Aerospace Engineer)
Andy Hopper (Computer Engineer)
Frank Land (Computer Scientist)
Bob Parkinson (Aerospace Engineer)
Dame Stephanie Shirley (Computer Scientist)
Geoff Tootill (Computer Engineer)
Maurice Wilkes (Computer Engineer)
Interviewed under ‘Biomedicine’:
Sammy Lee (scientist) (Clinical embryologist)
References
External links
Oral History of British Science interviews available online
Oral History of British Science
The Arcadia Fund
The 1851 Royal Commission
Science education in the United Kingdom
Oral history
British Library collections
History of science
National Life Stories | Oral History of British Science | Technology | 648 |
2,702,964 | https://en.wikipedia.org/wiki/Sodium%20ethoxide | Sodium ethoxide, also referred to as sodium ethanolate, is the ionic, organic compound with the formula , , or NaOEt (Et = ethyl). It is a white solid, although impure samples appear yellow or brown. It dissolves in polar solvents such as ethanol. It is commonly used as a strong base.
Preparation
Few procedures have been reported to prepare the anhydrous solid. Instead the material is typically prepared in a solution with ethanol. It is commercially available and as a solution in ethanol. It is easily prepared in the laboratory by treating sodium metal with absolute ethanol:
The reaction of sodium hydroxide with anhydrous ethanol suffers from incomplete conversion to the ethoxide, but can still produce dry NaOEt by precipitation using acetone, or by drying using additional NaOH.
Structure
The crystal structure of sodium ethoxide has been determined by X-ray crystallography. It consists of layers of alternating and centres with disordered ethyl groups covering the top and bottom of each layer. The ethyl layers pack back-to-back resulting in a lamellar structure. The reaction of sodium and ethanol sometimes forms other products such as the disolvate . Its crystal structure has been determined, although the structure of other phases in the system remain unknown.
Reactions
Sodium ethoxide is commonly used as a base in the Claisen condensation and malonic ester synthesis. Sodium ethoxide may either deprotonate the α-position of an ester molecule, forming an enolate, or the ester molecule may undergo a nucleophilic substitution called transesterification. If the starting material is an ethyl ester, trans-esterification is irrelevant since the product is identical to the starting material. In practice, the alcohol/alkoxide solvating mixture must match the alkoxy components of the reacting esters to minimize the number of different products.
Many alkoxides are prepared by salt metathesis from sodium ethoxide.
Stability
Sodium ethoxide is prone to reaction with both water and carbon dioxide in the air. This leads to degradation of stored samples over time, even in solid form. The physical appearance of degraded samples may not be obvious, but samples of sodium ethoxide gradually turn dark on storage. It has been reported that even newly-obtained commercial batches of sodium ethoxide show variable levels of degradation, and responsible as a major source of irreproducibility when used in Suzuki reactions.In moist air, hydrolyses rapidly to sodium hydroxide (NaOH). The conversion is not obvious and typical samples of are contaminated with NaOH.
In moisture-free air, solid sodium ethoxide can form sodium ethyl carbonate from fixation of carbon dioxide from the air. Further reactions lead to degradation into a variety of other sodium salts and diethyl ether.
This instability can be prevented by storing sodium ethoxide under an inert atmosphere (e.g., ).
Safety
Sodium ethoxide is a strong base, and is therefore corrosive.
See also
Alkoxide
Phenolate
Sodium methoxide
Sodium phenoxide
Potassium methoxide
Potassium ethoxide
References
Ethoxides
Organic sodium salts | Sodium ethoxide | Chemistry | 661 |
7,772,482 | https://en.wikipedia.org/wiki/Lower%20risk | The IUCN has many ranks that define an animal's population and risk of extinction. Species are classified into one of nine Red List Categories: Extinct, Extinct in the Wild, Critically Endangered, Endangered, Vulnerable, Near Threatened, Least Concern, Data Deficient, and Not Evaluated. They formerly used a identification called lower risk to describe some animals.
The IUCN defined an animal with the conservation status of lower risk is one with populations levels high enough to ensure its survival. Animals with this status did not qualify as being threatened or extinct. However, natural disasters or certain human activities would cause them to change to either of these classifications.
When it was in use, this classification was sub-divided into three types:
Conservation dependent - where cessation of current conservation measures may result in it being classified at a higher risk level.
Near threatened - may become vulnerable to endangerment in the near future but not meeting the criteria.
Least concern - where neither of the two above apply.
See also
Biodiversity action plan
Endangered species
References
Conservation biology | Lower risk | Biology | 207 |
14,130,404 | https://en.wikipedia.org/wiki/VE-cadherin | Cadherin-5, or VE-cadherin (vascular endothelial cadherin), also known as CD144 (Cluster of Differentiation 144), is a type of cadherin. It is encoded by the human gene CDH5.
Function
VE-cadherin is a classical cadherin from the cadherin superfamily and the gene is located in a six-cadherin cluster in a region on the long arm of chromosome 16 that is involved in loss of heterozygosity events in breast and prostate cancer. The encoded protein is a calcium-dependent cell–cell adhesion glycoprotein composed of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Functioning as a classic cadherin by imparting to cells the ability to adhere in a homophilic manner, the protein may play an important role in endothelial cell biology through control of the cohesion and organization of the intercellular junctions.
Integrity of intercellular junctions is a major determinant of permeability of the endothelium, and the VE-cadherin-based adherens junction is thought to be particularly important. VE-cadherin is known to be required for maintaining a restrictive endothelial barrier – early studies using blocking antibodies to VE-cadherin increased monolayer permeability in cultured cells and resulted in interstitial edema and hemorrhage in vivo. A recent study has shown that TNFAIP3 (A20, a dual-ubiquitin editing enzyme) is essential for stability and expression of VE-cadherin. Deubiquitinase function of A20 was shown to remove ubiquitin chains from VE-cadherin, thereby prevented loss of VE-cadherin expression at the endothelial adherens junctions.
VE-cadherin is indispensable for proper vascular development – there have been two transgenic mouse models of VE-cadherin deficiency, both embryonic lethal due to vascular defects. Further studies using one of these models revealed that although vasculogenesis occurred, nascent vessels collapsed or disassembled in the absence of VE-cadherin. Therefore, it was concluded that VE-cadherin serves the purpose of maintaining newly formed vessels.
Interactions
VE-cadherin has been shown to interact with:
Beta-catenin
Plakoglobin
PTPRB
Catenin (cadherin-associated protein), alpha 1
CTNND1
PTPmu (PTPRM)
PTPrho (PTPRT)
As a biomarker
VE-cadherin may serve as a biomarker for radiation exposure.
See also
Vasculogenic Mimicry
References
Further reading
External links
Clusters of differentiation
Biomarkers | VE-cadherin | Biology | 586 |
44,858,871 | https://en.wikipedia.org/wiki/Clicked%20peptide%20polymer | Clicked peptide polymers are poly-triazole-poly-peptide hybrid polymers. They are made of repeating units of a 1,2,3-triazole and an oligopeptide. They can be visualized as an oligopeptide that is flanked at both the C-terminus and N-terminus by a triazole molecule.
Synthesis
Clicked peptide polymers are prepared by the azide-alkyne Huisgen cycloaddition also called the click reaction; which is commonly used in bioconjugation reactions to link molecules together with a stable triazole bridge. Peptide based polymers are produced from a cycloaddition variant of step-growth polymerization. The monomers used in this polymerization are oligopeptides with terminal azide and terminal alkyne groups
Monomer preparation
To prepare and oligopeptide with both a terminal azide and terminal alkyne two modifications must be carried out. The first is the amidation of the oligopeptide's C-terminus by propargylamine. This would done with all other reaction groups protected and with the C-terminus activated.
The second modification required is the addition of an azide to the N-terminus. Unlike the addition of the alkyne this can be done on the whole peptide, or solely on the N-terminal residue which is added to the rest of the oligopeptide by solid-phase peptide synthesis. The addition of the azide occurs by Cu(II)-catalyzed diazo transfer.
Degradation
The molecules linked to one another by the azide-alkyne Huisgen cycloaddition are connected by an aromatic triazole which is extremely stable, and can withstand high temperatures and extremes of pH. The oligopeptide units of a clicked peptide polymer are a different story. The triazole bridges do not confer any stability to oligopeptide. Degradation of the polymer occurs at the peptide bonds linking individual amino acids. The amide bonds can be attacked non-specifically by acid or base catalyzed hydrolysis.
The polymer's peptide bonds can also be attacked by endopeptidases which will cleave at a specific side of a specific peptide bond based upon the residues which make up that bond.
For example, if the first residue is a phenylalanine then the enzyme chymotrypsin will cleave at site 1, and if the third residue of the tripeptide is a lysine then trypsin would cleave at the third cleavage site.
See also
Biodegradable polymer
Peptide nucleic acid
Peptide synthesis
Peptidomimetic
References
Peptides
Organic polymers
Triazoles | Clicked peptide polymer | Chemistry | 563 |
75,448,824 | https://en.wikipedia.org/wiki/Mavorixafor | Mavorixafor, sold under the brand name Xolremdi, is a medication used for the treatment of WHIM syndrome. It is a CXC chemokine receptor 4 antagonist. It is taken by mouth. It was developed by X4 Pharmaceuticals.
The most frequently reported adverse reactions include thrombocytopenia (low platelet counts), rash, rhinitis (stuffy nose), epistaxis (nosebleed), vomiting, and dizziness.
Mavorixafor was approved for medical use in the United States in April 2024. The US Food and Drug Administration (FDA) considers it to be a first-in-class medication.
Medical uses
Mavorixafor is indicated in people twelve years of age and older with WHIM syndrome (warts, hypogammaglobulinemia, infections and myelokathexis) to increase the number of circulating mature neutrophils and lymphocytes.
Adverse effects
Mavorixafor is expected to cause harm to the baby.
History
The effectiveness of mavorixafor was evaluated in a 52-week, randomized, double-blind, placebo-controlled trial that enrolled 31 adolescents and adults with WHIM syndrome (NCT03995108). Mavorixafor improved absolute neutrophil counts and absolute lymphocyte counts, assessed over a 24-hour period four times throughout the study. Absolute neutrophil counts below 500 cells/μL and absolute lymphocyte counts below 1000 cells/μL are associated with an increased risk of infections. The average length of time over 24 hours that counts were above these levels was significantly longer with mavorixafor compared to the placebo group (15.0 hours compared to 2.8 hours for absolute neutrophil counts; 15.8 hours compared to 4.6 hours for absolute lymphocyte counts).
Society and culture
Names
Mavorixafor is the international nonproprietary name.
Research
Mavorixafor is in clinical trials for melanoma and renal cell carcinoma.
References
External links
Benzimidazoles
Tetrahydroquinolines
Amines | Mavorixafor | Chemistry | 466 |
1,433,442 | https://en.wikipedia.org/wiki/Anti-roll%20bar | An anti-roll bar (roll bar, anti-sway bar, sway bar, stabilizer bar) is an automobile suspension part that helps reduce the body roll of a vehicle during fast cornering or over road irregularities. It links opposite front or rear wheels to a torsion spring using short lever arms for anchors. This increases the suspension's roll stiffness—its resistance to roll in turns.
The first stabilizer bar patent was awarded to Canadian inventor Stephen Coleman of Fredericton, New Brunswick on April 22, 1919.
Anti-roll bars were unusual on pre-WW2 cars due to the generally much stiffer suspension and acceptance of body roll. From the 1950s on, however, production cars were more commonly fitted with anti-roll bars, especially those vehicles with softer coil spring suspension.
Purpose and operation
An anti-sway or anti-roll bar is intended to reduce the lateral tilt (roll) of the vehicle on curves, sharp corners, or large bumps. Although there are many variations in design, the object is to induce a vehicle's body to remain as level as possible by forcing the opposite wheel's shock absorber, spring, or suspension rod in the same direction as the one being impacted.
In a turn, a vehicle compresses its outer wheel's suspension. The anti-roll bar forces the opposite (inner) wheel's suspension to compress as well, thereby keeping the body in a more level lateral attitude. This has the additional benefit of lowering its center of gravity during a turn, increasing its stability.
When both front and rear anti-roll bars are fitted, their combined effect can help maintain a vehicle's tendency to roll towards the general slope of the terrain.
Principles
An anti-roll bar is usually a torsion spring anchored to resist body roll motions. It is usually constructed out of a cylindrical steel bar, formed into a "U" shape, that connects to the body at two points along its longer center section, and on each end. When the left and right wheels move together the bar simply rotates on its central mounting points. When the wheels move relative to each other, torsion forces cause the bar to twist.
Each end of the bar is connected to an end link through a flexible joint. The link is connected in turn to a spot near a wheel or axle, transferring forces from the heavily loaded side of a suspension to the opposite.
Forces are therefore transferred:
from the heavily loaded side of the suspension
to the connected end link via a bushing
to the anti-sway (torsion) bar via a flexible joint
to the connected end link on the opposite side of the vehicle
to the opposite side of the suspension.
The bar resists the torsion through its stiffness. The stiffness of an anti-roll bar is proportional to the stiffness of the material, the fourth power of its radius, and the inverse of the length of the lever arms (i.e., the shorter the lever arm, the stiffer the bar). Stiffness is also related to the geometry of the mounting points and the rigidity of the bar's mounting points. The stiffer the bar, the more force required to move the left and right wheels relative to each other. This increases the amount of force required to make the body roll.
In a turn the sprung mass of the vehicle's body produces a lateral force at the centre of gravity (CG), proportional to lateral acceleration. Because the CG is usually not on the roll axis, the lateral force creates a moment about the roll axis that tends to roll the body. (The roll axis is a line that joins the front and rear roll centers). The moment is called the roll couple.
Roll couple is resisted by the suspension roll stiffness, which is a function of the spring rate of the vehicle's springs and of the anti-roll bars, if any. The use of anti-roll bars allows designers to reduce roll without making the suspension's springs stiffer in the vertical plane, which allows improved body control with less compromise of ride quality.
One effect of body lean, for typical unibody suspension geometry, is positive camber of the wheels on the outside of the turn and negative on the inside, which reduces their cornering grip (especially with cross ply tires).
Main functions
Anti-roll bars provide two main functions. The first is to reduce body lean. This is dependent on the total roll stiffness of the vehicle. Increasing this stiffness does not change the steady state total load (weight) transfer from the inside wheels to the outside, it only reduces body lean. The total lateral load transfer is determined by the center of gravity height and track width.
The other function of anti-roll bars is to tune the handling balance of a car. Understeer or oversteer can be reduced by changing the proportion of the total roll stiffness that comes from the front and rear axles. Increasing it at the front increases the proportion of the total load transfer that the front axle reacts to—and decreases it in the rear. In general, this makes the outer front wheel run at a comparatively higher slip angle, and the outer rear wheel to run at a comparatively lower slip angle, increasing understeer. Increasing the proportion of roll stiffness at the rear axle has the opposite effect, decreasing understeer.
Drawbacks
Because an anti-roll bar connects wheels on opposite sides of the vehicle, the bar transmits the force of a bump on one wheel to the opposite wheel. On rough or broken pavement, anti-roll bars can produce jarring, side-to-side body motions (a "waddling" sensation), which increase in severity with the diameter and stiffness of the anti-roll bars. Other suspension techniques can delay or dampen this effect of the connecting bar.
Excessive roll stiffness, typically achieved by configuring an anti-roll bar too aggressively, can make the inside wheels lift off the ground during hard cornering. This can be used to advantage: many front wheel drive production cars lift a rear wheel when cornering hard in order to overload the opposite wheel, limiting understeer.
Adjustable bars
Some anti-roll bars, particularly those intended for use in auto racing, are externally adjustable while the car is in the pit, whereas some systems can be adjusted in real time by the driver from inside the car, such as in Super GT. This allows the stiffness to be altered, for example by increasing or reducing the length of the lever arms on some systems, or by rotating a flat lever arm from a stiff edge-on position to a more flexible flat-side-on position on other systems. This lets a mechanic tune the roll stiffness for different situations without replacing the entire bar.
MacPherson struts
The MacPherson strut is a common form of strut suspension. This was not the first attempt at strut suspension, but in MacPherson's original patent, the anti-roll bar forms an integral and essential part of the suspension, in addition to its usual function in controlling body roll. A strut suspension like MacPherson's requires a hinged lower member between the chassis and wheel hub to control the wheel position both inwards and outwards (controlling the track), and also forwards and backwards. This may be provided by a wishbone with a number of joints, or by using an additional radius rod. MacPherson's design replaced the wishbone with a simpler and cheaper track control arm, with a single inboard joint, to control the track. Forward and backward position was controlled through the anti-roll bar. Overall this required a simpler and cheaper set of suspension members than with wishbones, also allowing a reduction in unsprung weight.
As the anti-roll bar is required to control wheel position, the bars of a MacPherson strut suspension may be connected through ball joints. However many later "MacPherson strut" suspensions have reverted to using wishbones rather than the simplified track control arm of the original design.
Semi active anti-roll bars
Various methods of decoupling the anti-roll bar have been proposed. The first production car to use a semi-active anti-roll bar was the 1988 Mitsubishi Mirage Cyborg. The 16-valve turbo model's "Dual Mode Suspension" has a dashboard- operated hydraulic actuator built into the front anti-roll bar link, allowing it to toggle between sport and touring modes. The Jeep Wrangler (JK, JL) and Jeep Gladiator (JT) also have a switchable decoupler on Rubicon models, to increase wheel articulation for off-roading.
Active systems
The first active anti-roll bar system was Citroën's SC.CAR (Systeme Citroën de Contrôle Actif du Roulis), debuted in its 1994 Xantia Activa, a medium-sized European sedan. The anti-roll bar could be stiffened by the suspension ECU during hard cornering, minimizing body roll to 2 degrees.
The Mercedes-Benz S-Class Active Body Control system eliminates the anti-roll bar, instead using sensors to detect lateral load, lateral force, and height difference in the suspension strut, which then hydraulically raise or lower the spring to counter roll.
Toyota also uses a mechanical system called Kinetic Dynamic Suspension System (KDSS) that essentially disengages the stabilizer bars when off-road, allowing for greater vehicle articulation and ride quality.
See also
Panhard rod
Torsion bar suspension
References
External links
Canadian inventions
Automotive suspension technologies
Automotive safety technologies
Auto parts
Mechanical power control | Anti-roll bar | Physics | 1,974 |
933,736 | https://en.wikipedia.org/wiki/Saturn%20Nebula | The Saturn Nebula (also known as NGC 7009 or Caldwell 55) is a planetary nebula in the constellation Aquarius. It appears as a greenish-yellowish hue in a small amateur telescope. It was discovered by William Herschel on September 7, 1782, using a telescope of his own design in the garden at his home in Datchet, England, and was one of his earliest discoveries in his sky survey. The nebula was originally a low-mass star that ejected its layers into space, forming the nebula. The central star is now a bright white dwarf star of apparent magnitude 11.5. The Saturn Nebula gets its name from its superficial resemblance to the planet Saturn with its rings nearly edge-on to the observer. It was so named by Lord Rosse in the 1840s, when telescopes had improved to the point that its Saturn-like shape could be discerned. William Henry Smyth said that the Saturn Nebula was one of Struve's nine "Rare Celestial Objects".
The Saturn Nebula is a complex planetary nebula and contains many morphological and kinematic sub-systems in three dimensions. It includes a halo, jet-like streams, multiple shells, ansae ("handles"), and small-scale filaments and knots. The ansae are expanding non-radially from the central star. Although the ansae are most prominent in the Saturn Nebula, they are also visible in other planetary nebulae, including NGC 3242, NGC 6543 and NGC 2371-2.
The distance of the Saturn Nebula is not known precisely. estimates the distance to be 5,200 light-years (1.6 kpc). In 1963 O'Dell estimated it to be 3,900 light-years (1.2 kpc), which gives an approximate diameter of 0.5 light years for the object as a whole.
The central star, a very hot bluish dwarf with a temperature of 55,000 K, from which the nebula is believed to originate, has an absolute magnitude of +1.5, which equates to a luminosity of about 20 solar luminosities and a visual magnitude of 11.5. This strong ultraviolet irradiation from the central star creates the characteristic fluorescent green tint of the nebula via the radiation of doubly ionized oxygen. The object overall has a visual magnitude of 8 and a radial velocity of 28 miles per second towards the Earth.
The nebula is 1 degree west of the star Nu Aquarii. The central portion measures 25″ × 17″, while the outer shell extends to 41″ × 35″. The object is on many "best of" observing lists.
Gallery
Notes
References
External links
NASA APOD (1997-12-30) – NGC 7009: The Saturn Nebula
Planetary nebulae
Aquarius (constellation)
NGC objects
055b
Astronomical objects discovered in 1782 | Saturn Nebula | Astronomy | 585 |
523,166 | https://en.wikipedia.org/wiki/Free%20monoid | In abstract algebra, the free monoid on a set is the monoid whose elements are all the finite sequences (or strings) of zero or more elements from that set, with string concatenation as the monoid operation and with the unique sequence of zero elements, often called the empty string and denoted by ε or λ, as the identity element. The free monoid on a set A is usually denoted A∗. The free semigroup on A is the subsemigroup of A∗ containing all elements except the empty string. It is usually denoted A+.
More generally, an abstract monoid (or semigroup) S is described as free if it is isomorphic to the free monoid (or semigroup) on some set.
As the name implies, free monoids and semigroups are those objects which satisfy the usual universal property defining free objects, in the respective categories of monoids and semigroups. It follows that every monoid (or semigroup) arises as a homomorphic image of a free monoid (or semigroup). The study of semigroups as images of free semigroups is called combinatorial semigroup theory.
Free monoids (and monoids in general) are associative, by definition; that is, they are written without any parenthesis to show grouping or order of operation. The non-associative equivalent is the free magma.
Examples
Natural numbers
The monoid (N0,+) of natural numbers (including zero) under addition is a free monoid on a singleton free generator, in this case, the natural number 1.
According to the formal definition, this monoid consists of all sequences like "1", "1+1", "1+1+1", "1+1+1+1", and so on, including the empty sequence.
Mapping each such sequence to its evaluation result
and the empty sequence to zero establishes an isomorphism from the set of such sequences to N0.
This isomorphism is compatible with "+", that is, for any two sequences s and t, if s is mapped (i.e. evaluated) to a number m and t to n, then their concatenation s+t is mapped to the sum m+n.
Kleene star
In formal language theory, usually a finite set of "symbols" A (sometimes called the alphabet) is considered. A finite sequence of symbols is called a "word over A", and the free monoid A∗ is called the "Kleene star of A".
Thus, the abstract study of formal languages can be thought of as the study of subsets of finitely generated free monoids.
For example, assuming an alphabet A = {a, b, c}, its Kleene star A∗ contains all concatenations of a, b, and c:
{ε, a, ab, ba, caa, , ...}.
If A is any set, the word length function on A∗ is the unique monoid homomorphism from A∗ to (N0,+) that maps each element of A to 1. A free monoid is thus a graded monoid. (A graded monoid is a monoid that can be written as . Each is a grade; the grading here is just the length of the string. That is, contains those strings of length The symbol here can be taken to mean "set union"; it is used instead of the symbol because, in general, set unions might not be monoids, and so a distinct symbol is used. By convention, gradations are always written with the symbol.)
There are deep connections between the theory of semigroups and that of automata. For example, every formal language has a syntactic monoid that recognizes that language. For the case of a regular language, that monoid is isomorphic to the transition monoid associated to the semiautomaton of some deterministic finite automaton that recognizes that language. The regular languages over an alphabet A are the closure of the finite subsets of A*, the free monoid over A, under union, product, and generation of submonoid.
For the case of concurrent computation, that is, systems with locks, mutexes or thread joins, the computation can be described with history monoids and trace monoids. Roughly speaking, elements of the monoid can commute, (e.g. different threads can execute in any order), but only up to a lock or mutex, which prevent further commutation (e.g. serialize thread access to some object).
Conjugate words
We define a pair of words in A∗ of the form uv and vu as conjugate: the conjugates of a word are thus its circular shifts. Two words are conjugate in this sense if they are conjugate in the sense of group theory as elements of the free group generated by A.
Equidivisibility
A free monoid is equidivisible: if the equation mn = pq holds, then there exists an s such that either m = ps, sn = q (example see image) or ms = p, n = sq. This result is also known as Levi's lemma.
A monoid is free if and only if it is graded (in the strong sense that only the identity has gradation 0) and equidivisible.
Free generators and rank
The members of a set A are called the free generators for A∗ and A+. The superscript * is then commonly understood to be the Kleene star. More generally, if S is an abstract free monoid (semigroup), then a set of elements which maps onto the set of single-letter words under an isomorphism to a monoid A∗ (semigroup A+) is called a set of free generators for S.
Each free monoid (or semigroup) S has exactly one set of free generators, the cardinality of which is called the rank of S.
Two free monoids or semigroups are isomorphic if and only if they have the same rank. In fact, every set of generators for a free monoid or semigroup S contains the free generators, since a free generator has word length 1 and hence can only be generated by itself. It follows that a free semigroup or monoid is finitely generated if and only if it has finite rank.
A submonoid N of A∗ is stable if u, v, ux, xv in N together imply x in N. A submonoid of A∗ is stable if and only if it is free.
For example, using the set of bits { "0", "1" } as A, the set N of all bit strings containing an even number of "1"s is a stable submonoid because if u contains an even number of "1"s, and ux as well, then x must contain an even number of "1"s, too. While N cannot be freely generated by any set of single bits, it can be freely generated by the set of bit strings { "0", "11", "101", "1001", "10001", ... } – the set of strings of the form "10n1" for some nonnegative integer n (along with the string "0").
Codes
A set of free generators for a free monoid P is referred to as a basis for P: a set of words C is a code if C* is a free monoid and C is a basis. A set X of words in A∗ is a prefix, or has the prefix property, if it does not contain a proper (string) prefix of any of its elements. Every prefix in A+ is a code, indeed a prefix code.
A submonoid N of A∗ is right unitary if x, xy in N implies y in N. A submonoid is generated by a prefix if and only if it is right unitary.
Factorization
A factorization of a free monoid is a sequence of subsets of words with the property that every word in the free monoid can be written as a concatenation of elements drawn from the subsets. The Chen–Fox–Lyndon theorem states that the Lyndon words furnish a factorization. More generally, Hall words provide a factorization; the Lyndon words are a special case of the Hall words.
Free hull
The intersection of free submonoids of a free monoid A∗ is again free. If S is a subset of a free monoid A* then the intersection of all free submonoids of A* containing S is well-defined, since A* itself is free, and contains S; it is a free monoid and called the free hull of S. A basis for this intersection is a code.
The defect theorem states that if X is finite and C is the basis of the free hull of X, then either X is a code and C = X, or
|C| ≤ |X| − 1 .
Morphisms
A monoid morphism f from a free monoid B∗ to a monoid M is a map such that f(xy) = f(x)⋅f(y) for words x,y and f(ε) = ι, where ε and ι denote the identity elements of B∗ and M, respectively. The morphism f is determined by its values on the letters of B and conversely any map from B to M extends to a morphism. A morphism is non-erasing or continuous if no letter of B maps to ι and trivial if every letter of B maps to ι.
A morphism f from a free monoid B∗ to a free monoid A∗ is total if every letter of A occurs in some word in the image of f; cyclic or periodic if the image of f is contained in {w}∗ for some word w of A∗. A morphism f is k-uniform if the length |f(a)| is constant and equal to k for all a in A. A 1-uniform morphism is strictly alphabetic or a coding.
A morphism f from a free monoid B∗ to a free monoid A∗ is simplifiable if there is an alphabet C of cardinality less than that of B such the morphism f factors through C∗, that is, it is the composition of a morphism from B∗ to C∗ and a morphism from that to A∗; otherwise f is elementary. The morphism f is called a code if the image of the alphabet B under f is a code. Every elementary morphism is a code.
Test sets
For L a subset of B∗, a finite subset T of L is a test set for L if morphisms f and g on B∗ agree on L if and only if they agree on T. The Ehrenfeucht conjecture is that any subset L has a test set: it has been proved independently by Albert and Lawrence; McNaughton; and Guba. The proofs rely on Hilbert's basis theorem.
Map and fold
The computational embodiment of a monoid morphism is a map followed by a fold. In this setting, the free monoid on a set A corresponds to lists of elements from A with concatenation as the binary operation. A monoid homomorphism from the free monoid to any other monoid (M,•) is a function f such that
f(x1...xn) = f(x1) • ... • f(xn)
f() = e
where e is the identity on M. Computationally, every such homomorphism corresponds to a map operation applying f to all the elements of a list, followed by a fold operation which combines the results using the binary operator •. This computational paradigm (which can be generalized to non-associative binary operators) has inspired the MapReduce software framework.
Endomorphisms
An endomorphism of A∗ is a morphism from A∗ to itself. The identity map I is an endomorphism of A∗, and the endomorphisms form a monoid under composition of functions.
An endomorphism f is prolongable if there is a letter a such that f(a) = as for a non-empty string s.
String projection
The operation of string projection is an endomorphism. That is, given a letter a ∈ Σ and a string s ∈ Σ∗, the string projection pa(s) removes every occurrence of a from s; it is formally defined by
Note that string projection is well-defined even if the rank of the monoid is infinite, as the above recursive definition works for all strings of finite length. String projection is a morphism in the category of free monoids, so that
where is understood to be the free monoid of all finite strings that don't contain the letter a. Projection commutes with the operation of string concatenation, so that for all strings s and t. There are many right inverses to string projection, and thus it is a split epimorphism.
The identity morphism is defined as for all strings s, and .
String projection is commutative, as clearly
For free monoids of finite rank, this follows from the fact that free monoids of the same rank are isomorphic, as projection reduces the rank of the monoid by one.
String projection is idempotent, as
for all strings s. Thus, projection is an idempotent, commutative operation, and so it forms a bounded semilattice or a commutative band.
The free commutative monoid
Given a set A, the free commutative monoid on A is the set of all finite multisets with elements drawn from A, with the monoid operation being multiset sum and the monoid unit being the empty multiset.
For example, if A = {a, b, c}, elements of the free commutative monoid on A are of the form
{ε, a, ab, a2b, ab3c4, ...}.
The fundamental theorem of arithmetic states that the monoid of positive integers under multiplication is a free commutative monoid on an infinite set of generators, the prime numbers.
The free commutative semigroup is the subset of the free commutative monoid that contains all multisets with elements drawn from A except the empty multiset.
The free partially commutative monoid, or trace monoid, is a generalization that encompasses both the free and free commutative monoids as instances. This generalization finds applications in combinatorics and in the study of parallelism in computer science.
See also
String operations
Notes
References
External links
Semigroup theory
Formal languages
Free algebraic structures
Combinatorics on words | Free monoid | Mathematics | 3,108 |
56,036,030 | https://en.wikipedia.org/wiki/Fission%20barrier | In nuclear physics and nuclear chemistry, the fission barrier is the activation energy required for a nucleus of an atom to undergo fission. This barrier may also be defined as the minimum amount of energy required to deform the nucleus to the point where it is irretrievably committed to the fission process. The energy to overcome this barrier can come from either neutron bombardment of the nucleus, where the additional energy from the neutron brings the nucleus to an excited state and undergoes deformation, or through spontaneous fission, where the nucleus is already in an excited and deformed state.
Efforts to understand fission processes are ongoing and have been a very difficult problem since fission was first discovered by Lise Meitner, Otto Hahn, and Fritz Strassmann in 1938. While nuclear physicists understand many aspects of the fission process, there is currently no encompassing theoretical framework that gives a satisfactory account of the basic observations.
Scission
The fission process can be understood when a nucleus with some equilibrium deformation absorbs energy (through neutron capture, for example), becomes excited and deforms to a configuration known as the "transition state" or "saddle point" configuration. As the nucleus deforms, the nuclear Coulomb energy decreases while the nuclear surface energy increases. At the saddle point, the rate of change of the Coulomb energy is equal to the rate of change of the nuclear surface energy. The formation and eventual decay of this transition state nucleus is the rate-determining step in the fission process and corresponds to the passage over an activation energy barrier to the fission reaction. When this occurs, the neck between the nascent fragments disappears and the nucleus divides into two fragments. The point at which this occurs is called the "scission point".
Liquid drop model
From the description of the beginning of the fission process to the "scission point," it is apparent that the change of the shape of the nucleus is associated with a change of energy of some kind. In fact, it is the change of two types of energies: (1) the macroscopic energy related to the nuclear bulk properties as given by the liquid drop model and (2) the quantum mechanical energy associated with filling the shell model orbitals. For the nuclear bulk properties with small distortions, the surface, , and Coulomb, , energies are given by:
where and are the surface and Coulomb energies of the undistorted spherical drops, respectively, and is the quadrupole distortion parameter. When the changes in the Coulomb and surface energies (, ) are equal, the nucleus becomes unstable with respect to fission. At that point, the relationship between the undistorted surface and Coulomb energies becomes:
where is called the fissionability parameter. If , the liquid drop energy decreases with increasing , which leads to fission. If , then the liquid drop energy decreases with decreasing , which leads to spherical shapes of the nucleus.
The Coulomb and surface energies of a uniformly charged sphere can be approximated by the following expressions:
where is the atomic number of the nucleus, is the mass number of the nucleus, is the charge of an electron, is the radius of the undistorted spherical nucleus, is the surface tension per unit area of the nucleus, and . The equation for the fissionability parameter then becomes:
where the ratio of the constant is referred to as . The fissionability of a given nucleus can then be categorized relative to . As an example, plutonium-239 has a value of 36.97, while less fissionable nuclei like bismuth-209 have a value of 32.96.
For all stable nuclei, must be less than 1. In that case, the total deformation energy of nuclei undergoing fission will increase by an amount , as the nucleus deforms towards fission. This increase in potential energy can be thought of as the activation energy barrier for the fission reaction. However, modern calculations of the potential energy of deformation for the liquid drop model involve many deformation coordinates aside from and represent major computational tasks.
Shell corrections
In order to get more reasonable values for the nuclear masses in the liquid drop model, it is necessary to include shell effects. Soviet physicist Vilen Strutinsky proposed such a method using "shell correction" and corrections for nuclear pairing to the liquid drop model. In this method, the total energy of the nucleus is taken as the sum of the liquid drop model energy, , the shell, , and pairing, , corrections to this energy as:
The shell corrections, just like the liquid drop energy, are functions of the nuclear deformation. The shell corrections tend to lower the ground state masses of spherical nuclei with magic or near-magic numbers of neutrons and protons. They also tend to lower the ground state mass of mid shell nuclei at some finite deformation thus accounting for the deformed nature of the actinides. Without these shell effects, the heaviest nuclei could not be observed, as they would decay by spontaneous fission on a time scale much shorter than we can observe.
This combination of macroscopic liquid drop and microscopic shell effects predicts that for nuclei in the U-Pu region, a double-humped fission barrier with equal barrier heights and a deep secondary minimum will occur. For heavier nuclei, like californium, the first barrier is predicted to be much larger than the second barrier and passage over the first barrier is rate determining. In general, there is ample experimental and theoretical evidence that the lowest energy path in the fission process corresponds to having the nucleus, initially in an axially symmetric and mass (reflection) symmetric shape pass over the first maximum in the fission barrier with an axially asymmetric but mass symmetric shape and then to pass over the second maximum in the barrier with an axially symmetric but mass (reflection) asymmetric shape. Because of the complicated multidimensional character of the fission process, there are no simple formulas for the fission barrier heights. However, there are extensive tabulations of experimental characterizations of the fission barrier heights for various nuclei.
See also
Cold fission
Nuclear fusion
References
Nuclear physics
Nuclear fission
Nuclear chemistry
Otto Hahn
1938 in science
1938 in Germany | Fission barrier | Physics,Chemistry | 1,234 |
19,593,227 | https://en.wikipedia.org/wiki/Magnetic%20diffusivity | The magnetic diffusivity controls the rate of magnetic field diffusion.
Since its role in the evolution equation for the magnetic field is analogous to that of the viscosity for the velocity field, some authors refer to it as the 'magnetic viscosity'.
The magnetic diffusivity appears in the definition of the magnetic Reynolds number.
A finite value of the magnetic Reynolds number (i.e. a nonzero magnetic diffusivity) is associated with violation of Alfvén's theorem.
The magnetic diffusivity has SI units of m²/s and is defined as:
while in Gaussian units it can be defined as
In the above, is the permeability of free space, is the speed of light, and is the electrical conductivity of the material in question. In case of a plasma, this is the conductivity due to Coulomb or neutral collisions: , where
is the electron density.
is the electron charge.
is the electron mass.
is the collision frequency.
See also
Electrical resistivity and conductivity
References
Plasma parameters | Magnetic diffusivity | Physics | 218 |
2,120 | https://en.wikipedia.org/wiki/Aliphatic%20compound | In organic chemistry, hydrocarbons (compounds composed solely of carbon and hydrogen) are divided into two classes: aromatic compounds and aliphatic compounds (; G. aleiphar, fat, oil). Aliphatic compounds can be saturated (in which all the C-C bonds are single requiring the structure to be completed, or 'saturated', by hydrogen) like hexane, or unsaturated, like hexene and hexyne. Open-chain compounds, whether straight or branched, and which contain no rings of any type, are always aliphatic. Cyclic compounds can be aliphatic if they are not aromatic.
Structure
Aliphatic compounds can be saturated, joined by single bonds (alkanes), or unsaturated, with double bonds (alkenes) or triple bonds (alkynes). If other elements (heteroatoms) are bound to the carbon chain, the most common being oxygen, nitrogen, sulfur, and chlorine, it is no longer a hydrocarbon, and therefore no longer an aliphatic compound. However, such compounds may still be referred to as aliphatic if the hydrocarbon portion of the molecule is aliphatic, e.g. aliphatic amines, to differentiate them from aromatic amines.
The least complex aliphatic compound is methane (CH4).
Properties
Most aliphatic compounds are flammable, allowing the use of hydrocarbons as fuel, such as methane in natural gas for stoves or heating; butane in torches and lighters; various aliphatic (as well as aromatic) hydrocarbons in liquid transportation fuels like petrol/gasoline, diesel, and jet fuel; and other uses such as ethyne (acetylene) in welding.
Examples of aliphatic compounds
The most important aliphatic compounds are:
n-, iso- and cyclo-alkanes (saturated hydrocarbons)
n-, iso- and cyclo-alkenes and -alkynes (unsaturated hydrocarbons).
Important examples of low-molecular aliphatic compounds can be found in the list below (sorted by the number of carbon-atoms):
References
Organic compounds | Aliphatic compound | Chemistry | 462 |
23,434,351 | https://en.wikipedia.org/wiki/Session%20multiplexing | Session multiplexing in a computer network is a service provided by the transport layer (see OSI Layered Model). It multiplexes several message streams, or sessions onto one logical link and keeps track of which messages belong to which sessions (see session layer).
An example of session multiplexing—a single computer with one IP address has several websites open at once.
References
Computer networking | Session multiplexing | Technology,Engineering | 78 |
38,029,797 | https://en.wikipedia.org/wiki/HIV/AIDS%3A%20Research%20and%20Palliative%20Care | HIV/AIDS: Research and Palliative Care is a peer-reviewed medical journal covering HIV and its treatment. The journal was established in 2009 and is published by Dove Medical Press. It is abstracted and indexed in PubMed, EMBASE, EmCare, and Scopus.
External links
English-language journals
Open access journals
Dove Medical Press academic journals
HIV/AIDS journals
Academic journals established in 2009 | HIV/AIDS: Research and Palliative Care | Biology | 82 |
75,144,896 | https://en.wikipedia.org/wiki/Soara%20and%20the%20House%20of%20Monsters | is a Japanese fantasy adventure manga series written and illustrated by Hidenori Yamaji. Shogakukan publishes it since 2021 in their magazine Shōnen Sunday S and on their webcomic platform , and also releases it in collected tankōbon volumes. These have since 2023 been released in English by Seven Seas Entertainment.
The story follows the human woman Soara, who after the end of a war between monsters and humans joins a group of travelling dwarf architects who build houses for various types of monsters. It was nominated for the Next Manga Award for best web manga in 2022 and 2023, and was well received for its artwork of monster houses and its themes of prejudice and understanding.
Plot
Soara and the House of Monsters is a fantasy adventure story following , an orphan who has been trained to fight in the war between humans and monsters, but is left without a purpose and home when peace is declared just as she becomes old enough to be a knight. Wandering aimlessly, she encounters a group of traveling dwarf architects led by , who renovate and build dream homes for monsters, such as goblins, slimes, and dragons. Soara is distrustful of monsters, but is moved by the architects' work, and joins them in their travels.
Production and release
Soara and the House of Monsters is written and drawn by Hidenori Yamaji, who originally created the series from a desire to combine the fantasy genre with something relatable to readers. He considered housing as a theme to be simultaneously unusual in fantasy manga, and something very familiar to readers, so he chose to write a story about architecture with fantasy elements. When drawing the artwork, Yamaji focused on drawing houses that not only were entertaining and exciting to look at, but that also were structured in a believable way, that would have made sense for the monsters if they were real. To help reader better visualize the houses, he chose to draw detailed cross-sections of them.
The manga is serialized by Shogakukan since November 25, 2021, both in their monthly shōnen manga magazine Shōnen Sunday S and on their webcomic platform . Shogakukan also publishes the series in collected tankōbon volumes since May 12, 2022, under their imprint Sunday Webry Comics; since 2023, these have been released in English by Seven Seas Entertainment and in Chinese by Tong Li Publishing.
Volumes
Chapters not released in collected volumes
The following chapters have not been released in collected tankōbon volumes as of the release of volume 4:
Reception
Soara and the House of Monsters was nominated for the Next Manga Award in the Best Web Manga category in 2022 and 2023, and for the Japan Society and Anime NYC's first American Manga Awards in the Best New Manga category in 2024.
The manga has been well received by critics. Christopher Farris and Rebecca Silverman, both writing for Anime News Network, appreciated its themes of prejudice and understanding how all living things share in basic needs and comforts, without feeling too heavy-handed in its delivery. Farris found it refreshing to see a new take on the fantasy genre, with appealing and "hog-wild" house designs, and fun solutions to their problems, although felt a disconnect in the "before-and-after" visuals due to the monsters' homes often being demolished and rebuilt rather than renovated; Silverman also liked the artwork, calling it a "triumph of fantasy building". The Japanese entertainment news site Magmix also enjoyed the art of the houses, calling them "fantastic and powerful", and good at immersing the reader in the setting.
See also
Marry Grave, another manga series by Hidenori Yamaji
References
External links
2021 webcomic debuts
Adventure anime and manga
Fantasy anime and manga
Japanese webcomics
Seven Seas Entertainment titles
Shogakukan manga
Webcomics in print
Works about architecture | Soara and the House of Monsters | Engineering | 788 |
27,047,552 | https://en.wikipedia.org/wiki/Guided%20wave%20testing | Guided wave testing (GWT) is a non-destructive evaluation method. The method
employs acoustic waves that propagate along an elongated
structure while guided by its boundaries. This allows the
waves to travel a long distance with little loss in energy. Nowadays, GWT is widely used to inspect and screen many
engineering structures, particularly for the inspection
of metallic pipelines around the world. In
some cases, hundreds of meters can be inspected from a single
location. There are also some applications for inspecting
rail tracks, rods and metal plate structures.
Although guided wave testing is also commonly known as guided wave
ultrasonic testing (GWUT) or ultrasonic guided waves (UGWs) or long range ultrasonic testing (LRUT),
it is fundamentally very different from
conventional ultrasonic testing. The frequency used in the inspection depends on the thickness of the structure, but guided wave
testing typically uses ultrasonic frequencies in the range of 10 kHz to several MHz.
Higher frequencies can be used in some cases, but detection range is significantly reduced. In addition, the underlying physics of guided waves is more
complex than bulk waves. Much of the theoretical background has
been addressed in a separate article. In this
article, the practical aspect of GWT will be discussed.
History
The study of guided waves propagating in a structure can be
traced back to as early as the 1920s, mainly inspired by the field
of seismology. Since then, there has been an increased effort on
the analytical study of guided wave propagation in cylindrical
structures. It was only in the early 1990s that guided wave testing was
considered as a practical method for the
non-destructive testing of engineering
structures. Today, GWT is applied as an integrated health
monitoring program in the oil, gas and chemical industries.
How it works (pipeline inspections)
Unlike conventional ultrasonics, there are an infinite number of guided wave modes that exist for a pipe geometry, and they can be generally grouped into three families, namely the torsional, longitudinal and flexural modes. The acoustic properties of these wave modes are a function of the pipe geometry, the material and the frequency. Predicting these properties of the wave modes often relies on heavy mathematical modeling which is typically presented in graphical plots called dispersion curves.
In the guided wave testing of pipelines, an array of low frequency transducers is attached around the circumference of the pipe to generate an axially symmetric wave that propagates along the pipe in both the forward and backward directions of the transducer array. The torsional wave mode is most commonly used, although there is limited use of the longitudinal mode. The equipment operates in a pulse-echo configuration where the array of transducers is used for both the excitation and detection of the signals.
At a location where there is a change of cross-section or a change in local stiffness of the pipe, an echo is generated. Based on the
arrival time of the echoes, and the predicted speed of the wave mode at a
particular frequency, the distance of a feature in relation to the
position of the transducer array can be accurately calculated. GWT
uses a system of distance amplitude curves (DAC) to correct for
attenuation and amplitude drops when estimating the cross-section
change (CSC) from a reflection at a certain distance. The DACs are
usually calibrated against a series of echoes with known signal
amplitude such as weld echoes.
Once the DAC levels are set, the signal amplitude correlates well to the CSC of a defect. GWT does not measure the
remaining wall thickness directly, but it is possible to group the
defect severity in several categories. One method of doing this is
to exploit the mode conversion phenomenon of the excitation signal
where some energy of the axially symmetric wave mode is converted to
the flexural modes at a pipe feature. The
amount of mode conversion provides an accurate estimate of the
circumferential extent of the defect, and together with the CSC,
operators could establish the severity category.
A typical result of GWT is displayed in an A-scan style with the
reflection amplitude against the distance from the transducer array position.
In the past few years, some advanced systems have started to offer
C-scan type results where the orientation of each feature can
be easily interpreted. This has shown to be extremely useful when
inspecting large size pipelines.
Guided wave focusing
As well as incorporating C-scan type results, active focusing capacity can also be achieved by GWT utilising flexural wave modes. This gives two main advantages; firstly the signal to noise ratio (SNR) of a defect echo can be enhanced, secondly it can be used as an additional tool to help discriminate between 'real' and 'false' indications. However, there are disadvantages associated with this technique; firstly, the defect location must be known before the focusing can be applied, secondly, the separate data set required for the active focusing technique can also significantly reduce the time and cost efficiency of GWT.
Flexural wave modes have sinusoidal variation in their displacement pattern around the circumference, in integer values ranging from 1 to Infinity. Active focusing involves the transmission of multiple flexural wave modes, with time and amplitude corrections applied, in such a way that a circumferential node from each wave mode will arrive at the target position at the same time, the same circumferential position and with the same phase, causing constructive interference. At other circumferential positions the circumferential nodes of the flexural wave modes will arrive out of phase with each other and will interfere destructively. Adjusting the excitation conditions can rotate this focal spot around the pipes circumference. Comparing the response from different circumferential positions can allow the operator to more accurately predict the circumferential position and extent of a defect.
As previously mentioned, the focusing technique can also be used to help discriminate between 'real' and 'false' indications, a 'false' indication being a received signal that does not directly correspond to the position of a defect; such as those from reverberations or from incomplete cancellation of unwanted wave modes. If a 'false' indication is present in the A-scan data, it will also be re-represented in any C-scan type results as this type of processing uses the same original data. As active focusing involves a separate data collection, focusing at the position of a 'false' indication will give a negative result, whereas focusing on a 'true' indication will give a positive result. Therefore, the active focusing technique can help overcome the propensity of 'false calls' generated by guided wave testing systems.
Features
Advantages
Rapid screening for in-service degradation (Long range inspection) – potential to achieve hundreds of meters of inspection range.
Detection of internal or external metal loss
Reduction in costs of gaining access – insulated line with minimal insulation removal, corrosion under supports without need for lifting, inspection at elevated locations with minimal need for scaffolding, and inspection of road crossings and buried pipes.
Data is fully recorded.
Fully automated data collection protocols.
Disadvantages
Interpretation of data is highly operator dependent.
Difficult to find small pitting defects.
Not very effective at inspecting areas close to accessories.
Can't find gradual wall loss.
Needs good procedure
List of standards
British Standards (BSI)
BS 9690-1:2011, Non-destructive testing. Guided wave testing. General guidance and principles
BS 9690-2:2011, Non-destructive testing. Guided wave testing. Basic requirements for guided wave testing of pipes, pipelines and structural tubulars
ASTM International (ASTM)
E2775 – 16 (2023), Standard Practice for Guided Wave Testing of Above Ground Steel Pipework Using Piezoelectric Effect Transduction
E2929 – 13, Standard Practice for Guided Wave Testing of Above Ground Steel Piping with Magnetostrictive Transduction
References
Long Range Guided Wave Inspection Usage – Current Commercial Capabilities and Research Directions
Nondestructive testing | Guided wave testing | Materials_science | 1,637 |
32,102,343 | https://en.wikipedia.org/wiki/Npm | npm is a package manager for the JavaScript programming language maintained by npm, Inc., a subsidiary of GitHub. npm is the default package manager for the JavaScript runtime environment Node.js and is included as a recommended feature in the Node.js installer.
It consists of a command line client, also called npm, and an online database of public and paid-for private packages, called the npm registry. The registry is accessed via the client, and the available packages can be browsed and searched via the npm website. The package manager and the registry are managed by npm, Inc.
Although "npm" is commonly understood to be an abbreviation of "Node Package Manager", it is officially a recursive backronymic abbreviation for "npm is not an acronym".
History
npm was developed by Isaac Z. Schlueter as a result of having "seen module packaging done terribly" and with inspiration from other similar projects such as PEAR (PHP) and CPAN (Perl). npm is a JavaScript replacement for pm, a shell script.
The company npm, Inc. was founded in 2014 in Oakland, California, United States, with Laurie Voss as co-founder. Bryan Bogensberger joined the company as CEO in July 2018 and resigned in September 2019. Before Bogensberger's resignation, Laurie Voss resigned in July 2019.
In March 2020, npm was acquired by GitHub, which is a subsidiary of Microsoft.
Usage
npm can manage packages that are local dependencies of a particular project, as well as globally-installed JavaScript tools. When used as a dependency manager for a local project, npm can install, in one command, all the dependencies of a project through the package.json file. In the package.json file, each dependency can specify a range of valid versions using the semantic versioning scheme, allowing developers to auto-update their packages while at the same time avoiding unwanted breaking changes. npm also provides version-bumping tools for developers to tag their packages with a particular version. npm also provides the package-lock.json file which has the entry of the exact version used by the project after evaluating semantic versioning in package.json.
Client
npm's command-line interface client allows users to consume and distribute JavaScript modules that are available in the registry.
In February 2018, an issue was discovered in version 5.7.0 in which running sudo npm on Linux systems would change the ownership of system files, permanently breaking the operating system.
In npm version 6, the audit feature was introduced to help developers identify and fix security vulnerabilities in installed packages. The source of security vulnerabilities were taken from reports found on the Node Security Platform (NSP) and has been integrated with npm since npm's acquisition of NSP.
Registry
Packages in the registry are in ECMAScript Module (ESM) or CommonJS format and include a metadata file in JSON format.
Over 3.1 million packages are available in the main npm registry.
The registry does not have any vetting process for submission, which means that packages found there can potentially be low quality, insecure, or malicious. Instead, npm relies on user reports to take down packages if they violate policies by being low quality, insecure, or malicious. npm exposes statistics including number of downloads and number of depending packages to assist developers in judging the quality of packages.
Internally npm relies on the NoSQL Couch DB to manage publicly available data.
Security and disruption
left-pad
In March 2016, a package called left-pad was unpublished as the result of a naming dispute between Azer Koçulu, an individual software engineer, and Kik. The package was immensely popular on the platform, being depended on by thousands of projects and reaching 15 million downloads prior to its removal. Several projects critical to the JavaScript ecosystem including Babel and Webpack depended on left-pad and were rendered unusable. Although the package was republished three hours later, it caused widespread disruption, leading npm to change its policies regarding unpublishing to prevent a similar event in the future.
peacenotwar
In March 2022, developer Brandon Nozaki Miller, maintainer of the node-ipc package, added peacenotwar as a dependency to the package; peacenotwar recursively overwrites an affected machine's hard drive contents with the heart emoji if they have a Belarusian or Russian IP address. The package also leaves a text file on the machine containing a message in protest of the Russian invasion of Ukraine. Vue.js, which uses node-ipc as a dependency, did not pin its dependencies to a safe version, meaning that some users of Vue.js became affected by the malicious package if the dependency was fetched as the latest package. The affected dependency was also briefly present in version 3.1 of Unity Hub; a hotfix was released the same day to remove the issue, however.
Other notable incidents
In November 2018, it was discovered that a malicious package had been added as a dependency to version 3.3.6 of the popular package event-stream. The malicious package, called flatmap-stream, contained an encrypted payload that stole bitcoins from certain applications.
In May 2021, pac-resolver, an npm package that received over 3 million downloads per week, was discovered to have a remote code execution vulnerability. The vulnerability resulted from how the package handled config files, and was fixed in versions 5 and greater.
In January 2022, the maintainer of the popular package colors pushed changes printing garbage text in an infinite loop. The maintainer also cleared the repository of another popular package, faker, and its package on npm, and replaced it with a README that read, "What really happened to Aaron Swartz?"
In May 2023, several npm packages including bignum were found to be exploited, stealing user credentials and information from affected machines. Researchers discovered that these packages had been compromised through an exploit involving Amazon S3 buckets and the node-gyp command line tool.
Alternatives
There are a number of open-source alternatives to npm for installing modular JavaScript, including pnpm, Yarn, Bun and Deno. Deno and Bun also provide a JavaScript runtime, while only Deno operates independently from npm Registry or any centralized repository and its support of npm registry is still a subject of ongoing work in progress as of January 2024. They are all compatible with the public npm registry and use it by default, but provide different client-side experiences, usually focused on improving performance and determinism compared to the npm client.
See also
Software repository
pnpm
yarn (package manager)
References
External links
Command-line software
Free package management systems
Free software programmed in JavaScript
JavaScript programming tools
Microsoft free software
Software using the Artistic license
2010 software | Npm | Technology | 1,446 |
22,730,057 | https://en.wikipedia.org/wiki/Nanotoxicology%20%28journal%29 | Nanotoxicology is a peer-reviewed, scientific journal that focuses on environmental exposure, hazard, and risk of applied nanostructured materials. It publishes research that addresses the potentially toxic interactions between nanostructured materials and living matter. The journal publishes the results of studies that enhance safety during the production, use, and disposal of nanomaterials. The editor-in-chief is Håkan Wallin (National Research Centre for the Working Environment, Denmark).
According to the Journal Citation Reports, its 2020 impact factor is 5.913.
See also
Toxicology
Risk assessment
Ecotoxicology
Nanomedicine
References
External links
Academic journals established in 2007
Nanotechnology journals
Toxicology journals
Taylor & Francis academic journals
Quarterly journals
English-language journals | Nanotoxicology (journal) | Materials_science,Environmental_science | 153 |
23,039,832 | https://en.wikipedia.org/wiki/Melatonin%20receptor%201C | Melatonin receptor 1C, also known as MTNR1C, is a protein that is encoded by the Mtnr1c gene. This receptor has been identified in fish, amphibia, and birds, but not in humans.
References
Further reading
See also
Melatonin receptor
Further reading
Classification of protein families - Melatonin receptor type 1C
Sleep drops with melatonin and lavender in German
Melatonin receptor genes (mel-1a, mel-1b, mel-1c) are differentially expressed in the avian germ line
G protein-coupled receptors
1C | Melatonin receptor 1C | Chemistry | 121 |
199,014 | https://en.wikipedia.org/wiki/Infix%20notation | Infix notation is the notation commonly used in arithmetical and logical formulae and statements. It is characterized by the placement of operators between operands—"infixed operators"—such as the plus sign in .
Usage
Binary relations are often denoted by an infix symbol such as set membership a ∈ A when the set A has a for an element. In geometry, perpendicular lines a and b are denoted and in projective geometry two points b and c are in perspective when while they are connected by a projectivity when
Infix notation is more difficult to parse by computers than prefix notation (e.g. + 2 2) or postfix notation (e.g. 2 2 +). However many programming languages use it due to its familiarity. It is more used in arithmetic, e.g. 5 × 6.
Further notations
Infix notation may also be distinguished from function notation, where the name of a function suggests a particular operation, and its arguments are the operands. An example of such a function notation would be S(1, 3) in which the function S denotes addition ("sum"): .
Order of operations
In infix notation, unlike in prefix or postfix notations, parentheses surrounding groups of operands and operators are necessary to indicate the intended order in which operations are to be performed. In the absence of parentheses, certain precedence rules determine the order of operations.
See also
Tree traversal: Infix (In-order) is also a tree traversal order. It is described in a more detailed manner on this page.
Calculator input methods: comparison of notations as used by pocket calculators
Postfix notation, also called Reverse Polish notation
Prefix notation, also called Polish notation
Shunting yard algorithm, used to convert infix notation to postfix notation or to a tree
Operator (computer programming)
Subject–verb–object word order
References
External links
RPN or DAL? A brief analysis of Reverse Polish Notation against Direct Algebraic Logic
Infix to postfix convertor[sic]
Mathematical notation
Operators (programming) | Infix notation | Mathematics | 431 |
56,516,958 | https://en.wikipedia.org/wiki/Emergency%20locator%20beacon | An emergency locator beacon is a radio beacon, a portable battery powered radio transmitter, used to locate airplanes, vessels, and persons in distress and in need of immediate rescue. Various types of emergency locator beacons are carried by aircraft, ships, vehicles, hikers and cross-country skiers. In case of an emergency, such as the aircraft crashing, the ship sinking, or a hiker becoming lost, the transmitter is deployed and begins to transmit a continuous radio signal, which is used by search and rescue teams to quickly find the emergency and render aid. The purpose of all emergency locator beacons is to help rescuers find survivors within the so-called "golden day", the first 24 hours following a traumatic event, during which the majority of survivors can usually be saved.
Beacon types
COSPAS-SARSAT 406 MHz Distress Beacons
Cospas-Sarsat is an international humanitarian consortium of governmental and private agencies which acts as a worldwide dispatcher for search and rescue operations. It operates a network of about 47 satellites carrying radio receivers, which detect distress signals from emergency locator beacons anywhere on Earth transmitting on the international Cospas distress frequency of 406 MHz. The satellites calculate the geographic location of the beacon within 2 km by measuring the Doppler frequency shift of the radio waves due to the relative motion of the transmitter and the satellite, and quickly transmit the information to the appropriate local first responder organizations, which perform the search and rescue.
Defined officially as emergency position-indicating radiobeacon stations in the ITU Radio Regulations (Section IV. Radio Stations and Systems – Article 1.93), these transmit a coded data burst once every 50 seconds, conforming to the C/S T.001 Specification for Cospas-Sarsat 406 MHz Distress Beacons, compatible with the Cospas-Sarsat satellite receivers. The different types include:
ELTs (emergency locator transmitters) signal aircraft distress
EPIRBs (emergency position-indicating radio beacons) signal maritime distress
SEPIRBs (submarine emergency position-indicating radio beacons) are EPIRBs designed only for use on submarines
SSASes (ship security alert system) are used to indicate possible piracy or terrorism attacks on sea-going vessels
PLBs (personal locator beacons) are for personal use and are intended to indicate a person in distress who is away from normal emergency services; e.g., 9-1-1. They are also used for crewsaving applications in shipping and lifeboats at terrestrial systems. In New South Wales, Australia, some police stations and the National Parks and Wildlife Service provide personal locator beacons to hikers for no charge.
Auxiliary maritime beacons
ENOS Rescue-System
A rescue beacon system designed for use by divers who have drifted away from their dive boats.
Search and rescue transponder (SART)
A specialized radar beacon (RACON) that emits a string of 12 dots (replaced by arcs and circles when closer) for display on an X-band radar screen when scanned.
Man-overboard beacons
MSLDs (Maritime Survivor Locating Devices ) are man-overboard signalling devices, first standardized in 2016.
A Maritime Survivor Locator Device (MSLD) is a man-overboard locator beacon. In the U.S., rules were established in 2016 in 47 C.F.R. Part 95. A MSLD may transmit on 121.500 MHz, or one of these: 156.525 MHz, 156.750 MHz, 156.800 MHz, 156.850 MHz, 161.975 MHz, 162.025 MHz (bold are Canadian-required frequencies).
AIS-SART
A hand-held automatic identification system (AIS) transmitter that emits only an emergency beacon. It does not have a receiver and thus cannot be a transponder.
SEND—Satellite Emergency Notification Devices
SPOT
inReach
Spidertracks
Yellowbrick
Somewear Global Hotspot
Avalanche beacons
RECCO
Avalanche transceiver
Other beacons
Mountain Locator Unit
Automatic Packet Reporting System
Crash position indicator
Transponder (aeronautics)
Can be used as an emergency beacon of sorts by setting it to squawk 7700, the distress code
See also
References
Aircraft emergency systems
Emergency communication
Beacons
Radio geopositioning | Emergency locator beacon | Technology | 879 |
23,913,353 | https://en.wikipedia.org/wiki/Multiphase%20heat%20transfer | A multiphase flow system is one characterized by the simultaneous presence of several phases, the two-phase system being the simplest case. The term ‘two-component’ is sometimes used to describe flows in which the phases consist of different chemical substances. However, since the same mathematics describes two-phase and two-component flows, the two expressions can be treated as synonymous.
Analysis of multiphase systems can include consideration of multiphase flow and multiphase heat transfer. The former occurs only if all parts are at the same temperature, but interphase heat transfer also occurs when the temperatures of the individual phases are different.
If different phases of the same pure substance are present in a multiphase system, interphase heat transfer will result in a change of phase, which is always accompanied by interphase mass transfer.
Definitions
A multiphase flow system is one characterized by the simultaneous presence of several phases, the two-phase system being the simplest case. The term ‘two-component’ is sometimes used to describe flows in which the phases consist of different chemical substances. For example, steam-water flows are two-phase, while air-water flows are two-component. Some two-component flows (mostly liquid-liquid) technically consist of a single phase but are identified as two-phase flows in which the term “phase” is applied to each of the components. Since the same mathematics describes two-phase and two-component flows, the two expressions can be treated as synonymous.
Multiphase flow versus heat transfer
The analysis of multiphase systems can include consideration of multiphase flow and multiphase heat transfer. When all of the phases in a multiphase system exist at the same temperature, multiphase flow is the only concern. However, when the temperatures of the individual phases are different, interphase heat transfer also occurs.
Phase-change heat transfer
If different phases of the same pure substance are present in a multiphase system, interphase heat transfer will result in a change of phase, which is always accompanied by interphase mass transfer. The combination of heat transfer with mass transfer during phase change makes multiphase systems distinctly more challenging than simpler systems. Based on the phases that are involved in the system, phase change problems can be classified as: (1) solid–liquid phase change (melting and solidification), (2) solid–vapor phase change (sublimation and deposition), and (3) liquid–vapor phase change (boiling/evaporation and condensation). Melting and sublimation are also referred to as fluidification because both liquid and vapor are regarded as fluids.
References
Faghri, A., and Zhang, Y., 2020, Fundamentals of Multiphase Heat Transfer and Flow, , Springer Nature Switzerland AG.
Faghri, A., and Zhang, Y., 2006, Transport Phenomena in Multiphase Systems, , Elsevier, Burlington, MA.
Lock, G.S.H., 1994, Latent Heat Transfer, Oxford Science Publications, Oxford University, Oxford, UK.
Mechanical engineering
Transport phenomena
Heat transfer | Multiphase heat transfer | Physics,Chemistry,Engineering | 640 |
5,046,718 | https://en.wikipedia.org/wiki/BenQ-Siemens%20EL71 | The BenQ-Siemens EL71 is a slider-type GSM triband mobile phone had been developed before by Siemens Mobile and released by BenQ Mobile. It has a sleek design with brushed magnesium and aluminium alloys. The phone was introduced at CEBIT in March 2006.
The phone supports GPRS, EDGE and Internet access methods. Its dimensions are 90 mm × 46 mm × 17 mm, and it weighs 94 grams. The supplied battery has a capacity of 570 mAh and can last up to 300 hours in standby mode, or 300 minutes if the phone is used for calls. Other notable features of the phone include a QVGA display, Bluetooth, a Java virtual machine and 1.3 megapixel camera with LED flash.
References
BenQ-Siemens EL71 specifications
External links
EL71 site
Review by Mobile-Review
EL71 | BenQ-Siemens EL71 | Technology | 178 |
9,731,029 | https://en.wikipedia.org/wiki/Ceiling%20rose | In the United Kingdom and Australia, a ceiling rose is a decorative element affixed to the ceiling from which a chandelier or light fitting is often suspended. They are typically round in shape and display a variety of ornamental designs.
In modern British wiring setups, light fittings usually use loop-in ceiling roses, which also include the functionality of a junction box.
Etymology
The rose has symbolised secrecy since Roman times, due to a confused association with the Egyptian god Horus. For its associations with ceilings and confidentiality, refer to the Scottish Government's Sub Rosa initiative. Through its promise of secrecy, the rose, suspended above a meeting table, symbolises the freedom to speak plainly without repercussion. The physical carving of a rose on a ceiling was used for this purpose during the rule of England's Tudor King Henry VIII and has over the centuries evolved into a standard item of domestic vernacular architecture, to such an extent that it now constitutes a term for the aforementioned circular device that conceals and comprises the wiring box for an overhead light fitting.
See also
Sub rosa
References
Electrical wiring | Ceiling rose | Physics,Engineering | 223 |
5,798,355 | https://en.wikipedia.org/wiki/Inner%20measure | In mathematics, in particular in measure theory, an inner measure is a function on the power set of a given set, with values in the extended real numbers, satisfying some technical conditions. Intuitively, the inner measure of a set is a lower bound of the size of that set.
Definition
An inner measure is a set function
defined on all subsets of a set that satisfies the following conditions:
Null empty set: The empty set has zero inner measure (see also: measure zero); that is,
Superadditive: For any disjoint sets and
Limits of decreasing towers: For any sequence of sets such that for each and
If the measure is not finite, that is, if there exist sets with , then this infinity must be approached. More precisely, if for a set then for every positive real number there exists some such that
The inner measure induced by a measure
Let be a σ-algebra over a set and be a measure on
Then the inner measure induced by is defined by
Essentially gives a lower bound of the size of any set by ensuring it is at least as big as the -measure of any of its -measurable subsets. Even though the set function is usually not a measure, shares the following properties with measures:
is non-negative,
If then
Measure completion
Induced inner measures are often used in combination with outer measures to extend a measure to a larger σ-algebra. If is a finite measure defined on a σ-algebra over and and are corresponding induced outer and inner measures, then the sets such that form a σ-algebra with .
The set function defined by
for all is a measure on known as the completion of
See also
References
Halmos, Paul R., Measure Theory, D. Van Nostrand Company, Inc., 1950, pp. 58.
A. N. Kolmogorov & S. V. Fomin, translated by Richard A. Silverman, Introductory Real Analysis, Dover Publications, New York, 1970, (Chapter 7)
Measures (measure theory) | Inner measure | Physics,Mathematics | 412 |
29,953,491 | https://en.wikipedia.org/wiki/Hydrogen%20auto-transfer | Hydrogen auto-transfer, also known as borrowing hydrogen, is the activation of a chemical reaction by temporary transfer of two hydrogen atoms from the reactant to a catalyst and return of those hydrogen atoms back to a reaction intermediate to form the final product. Two major classes of borrowing hydrogen reactions exist: (a) those that result in hydroxyl substitution, and (b) those that result in carbonyl addition. In the former case, alcohol dehydrogenation generates a transient carbonyl compound that is subject to condensation followed by the return of hydrogen. In the latter case, alcohol dehydrogenation is followed by reductive generation of a nucleophile, which triggers carbonyl addition. As borrowing hydrogen processes avoid manipulations otherwise required for discrete alcohol oxidation and the use of stoichiometric organometallic reagents, they typically display high levels of atom-economy and, hence, are viewed as examples of Green chemistry.
History
The Guerbet reaction, reported in 1899, is an early example of a hydrogen auto-transfer process. The Guerbet reaction converts primary alcohols to β-alkylated dimers via alcohol dehydrogenation followed by aldol condensation and reduction of the resulting enones. Application of the Guerbet reaction to the development of ethanol-to-butanol processes has garnered interest as a method for the production of renewable fuels. In 1932 using heterogeneous nickel-catalysts Adkins reported the first alcohol aminations that occur through alcohol dehydrogenation-reductive amination. Homogenous catalysts for alcohol amination based on rhodium and ruthenium were developed by Grigg and Watanabe in 1981. The first hydrogen auto-transfer processes that convert primary alcohols to products of carbonyl addition were reported by Michael J. Krische in 2007-2008 using homogenous iridium and ruthenium catalysts.
Hydroxyl substitution
Alcohol aminations are among the most commonly utilized borrowing hydrogen processes. In reactions of this type, alcohol dehydrogenation is followed by reductive amination of the resulting carbonyl compound. This represents an alternative to two-step processes involving conversion of the alcohol to a halide or sulfonate ester followed by nucleophilic substitution
As shown below, alcohol amination has been used on kilogram scale by Pfizer for the synthesis of advanced pharmaceutical intermediates. Additionally, AstraZeneca has used methanol as an alternative to conventional genotoxic methylating agents such as methyl iodide or dimethyl sulfate. Nitroaromatics can also participate as amine precursors in borrowing hydrogen-type alcohol aminations.
The formation of carbon–carbon bonds have been achieved through borrowing hydrogen-type indirect Wittig, aldol, Knoevenagel condensations and also through various carbon nucleophiles. Related to the Guerbet reaction, Donohoe and coworkers have developed enantioselective borrowing hydrogen-type enolate alkylations.
Carbonyl addition
As exemplified by the Krische allylation, dehydrogenation of alcohol reactants can be balanced by reduction of allenes, dienes or allyl acetate to generate allylmetal-carbonyl pairs that combine to give products of carbonyl addition. In this way, lower alcohols are directly transformed to higher alcohols in a manner that significantly decreases waste.
In 2008, borrowing hydrogen reactions of 1,3-enynes with alcohols to form products of carbonyl propargylation was discovered. An enantioselective variant of this method was recently used in the total synthesis of leiodermatolide A.
References
Catalysis | Hydrogen auto-transfer | Chemistry | 773 |
2,312,855 | https://en.wikipedia.org/wiki/Isotope%20hydrology | Isotope hydrology is a field of geochemistry and hydrology that uses naturally occurring stable and radioactive isotopic techniques to evaluate the age and origins of surface and groundwater and the processes within the atmospheric hydrologic cycle. Isotope hydrology applications are highly diverse, and used for informing water-use policy, mapping aquifers, conserving water supplies, assessing sources of water pollution, investigating surface-groundwater interaction, refining groundwater flow models, and increasingly are used in eco-hydrology to study human impacts on all dimensions of the hydrological cycle and ecosystem services.
Details
Water molecules carry unique isotopic "fingerprints", based in part on differing ratios of the oxygen and hydrogen isotopes that constitute the water molecule. Isotopes are atoms of the same element that have a different number of neutrons in their nuclei.
Air, freshwater and seawater contain mostly oxygen-16 ( 16O). Oxygen-18 (18O) occurs in approximately one oxygen atom in every five hundred and has a slightly higher mass than oxygen-16, as it has two extra neutrons. From a simple energy and bond breakage standpoint this results in a preference for evaporating the lighter 16O containing water and leaving more of the 18O water behind in the liquid state (called isotope fractionation). Thus seawater tends to contain more 18O than rain and snow.
Dissolved ions in surface and groundwater water also contain useful isotopes for hydrological investigations. Dissolved species like sulfate and nitrate contain differing ratios of 34-S to 32-S or 15-N to 14-N, and are often diagnostic of pollutant sources. Natural radioisotopes like tritium (3-H) and radiocarbon (14-C) are also used as natural clocks to determine the residence times of water in aquifers, rivers, and the oceans.
Applications
The most commonly used isotope application in hydrology uses hydrogen and oxygen isotopes to evaluate sources or age of water, ice or snow. Isotopes in ice cores help to reveal conditions of past climate. Higher average global temperature would provide more energy and thus an increase the atmospheric 18O content of rain or snow, so that lower than modern amounts of 18O in groundwater or ice layer imply the water or ice represents a period of cooler climatic eras or even ice ages.
Another application involves the separation of groundwater flow and baseflow from streamflow in the field of catchment hydrology (i.e. a method of hydrograph separation). Since precipitation in each rain or snowfall event has a specific isotopic signature, and subsurface water can be identified by well sampling, the composite signature in the stream is an indicator the proportion of the streamflow comes from overland flow and what portion comes from subsurface flow.
Stable isotopes in the water molecule are also useful in tracing the sources (or proportion of sources) of water that plants use.
Current use
The isotope hydrology program at the International Atomic Energy Agency works to aid developing states to create a detailed portrait of Earth's water resources.
In Ethiopia, Libya, Chad, Egypt and Sudan, the International Atomic Energy Agency used radioisotope techniques to help local water policy identify and conserve fossil water.
The International Atomic Energy Agency maintains a publicly accessible global network and isotopic database for Earth's rainfall and rivers.
See also
Baseflow
Hydrograph
Water chemistry analysis
References
External links
Isotope Hydrology at the IAEA
Environmental isotopes in the hydrological cycle: Principles and applications
Water
Hydrology
Hydraulic engineering | Isotope hydrology | Physics,Chemistry,Engineering,Environmental_science | 710 |
19,264,415 | https://en.wikipedia.org/wiki/Norwegian%20Contractors | Norwegian Contractors AS was a concrete gravity base (GBS) structure supplier from 1974 to 1994. Aker Marine Contractors AS (AMC) was established in 1995 and is a continuance of the marine activities in Norwegian Contractors AS.
Norwegian Contractors AS have worked on following offshore platforms:
Ecofisk tank
Frigg 3 offshore platforms
Statfjord A
Statfjord B
Statfjord C
Gullfaks A
Gullfaks B
Oseberg A
Gullfaks C (heaviest object ever moved by mankind)
Draugen
Heidrun
Hibernia-Bohrplatform (1997)
Nordhordland-Brücke (1994)
Sleipner A (1993)
Snorre
Troll A platform (1995)
See also
Offshore concrete structure
References
Engineering companies of Norway
Oil platforms | Norwegian Contractors | Chemistry,Engineering | 165 |
40,758,949 | https://en.wikipedia.org/wiki/Schuster%20Line | The Schuster Line (, ) was a line of barriers and barricades erected by the Luxembourg government along its borders with Germany and France shortly before World War II. The line was named after Joseph Schuster, Luxembourg's chief engineer of bridges and highways, who was responsible for its construction.
The Schuster Line consisted of 41 sets of concrete blocks and iron gates, 18 bridgeblocks on the German border and five roadblocks on the French border. The roadblocks were set up a mile inland in a zigzag pattern, covered by barbed wire entanglements on either side. Nine radio outposts were erected along the German border, with a central receiving station in the St Espirit barracks in the capital.
The line failed significantly to slow the German advance during the invasion of Luxembourg on 10 May 1940. The iron gates were knocked down and ramps were built over the concrete blockades to drive over them; some were blown up.
See also
K-W Line – a contemporary defense line in Belgium
Maginot Line – a contemporary defense line in France
References
Further reading
Nilles, Léon N.: "Die Schusterlinie: Ein Betonklotz gegen die Wehrmacht." In: Lëtzebuerger Journal 53 (2000), Nr. 88 (9. May), pp. 10–11. OCLC 54517360
Milmeister, Jean: "Sturm auf die "Schusterlinie." In: Letzeburger Sonndesblad 113 (1980), Nr.19, p. 6.
Luxembourg in World War II
World War II defensive lines
Germany–Luxembourg border | Schuster Line | Engineering | 331 |
32,548,064 | https://en.wikipedia.org/wiki/SET%20domain | The SET domain is a protein domain that typically has methyltransferase activity. It was originally identified as part of a larger conserved region present in the Drosophila Trithorax protein and was subsequently identified in the Drosophila Su(var)3-9 and 'Enhancer of zeste' proteins, from which the acronym SET is derived [Su(var)3-9, Enhancer-of-zeste and Trithorax].
Structure
The SET domain appears generally as one part of a larger multidomain protein, and recently there were described three structures of very different proteins with distinct domain compositions:
Neurospora crassa DIM-5, a member of the Su(var) family of histone lysine methyltransferases (HKMTs) which methylate histone H3 on lysine 9,
human SETD7 (also called SET7 or SET9), which methylates H3 on lysine 4
garden pea Rubisco LSMT, an enzyme that does not modify histones, but instead methylates lysine 14 in the flexible tail of the large subunit of the enzyme Rubisco.
The SET domain itself turned out to be an uncommon structure. Although in all three studies, electron density maps revealed the location of the AdoMet or AdoHcy cofactor, the SET domain bears no similarity at all to the canonical/AdoMet-dependent methyltransferase fold. Strictly conserved in the C-terminal motif of the SET domain tyrosine could be involved in abstracting a proton from the protonated amino group of the substrate lysine, promoting its nucleophilic attack on the sulphonium methyl group of the AdoMet cofactor. In contrast to the AdoMet-dependent protein methyltranferases of the classical type, which tend to bind their polypeptide substrates on top of the cofactor, it is noted from the Rubisco LSMT structure that the AdoMet seems to bind in a separate cleft, suggesting how a polypeptide substrate could be subjected to multiple rounds of methylation without having to be released from the enzyme. In contrast, SET7/9 is able to add only a single methyl group to its substrate.
Function
It has been demonstrated that association of SET domain and myotubularin-related proteins modulates growth control. The SET domain-containing Drosophila melanogaster (Fruit fly) protein, enhancer of zeste, has a function in segment determination and the mammalian homologue may be involved in the regulation of gene transcription and chromatin structure.
Histone lysine methylation is part of the histone code that regulates chromatin function and epigenetic control of gene function. Histone lysine methyltransferases (HMTase) differ both in their substrate specificity for the various acceptor lysines as well as in their product specificity for the number of methyl groups (one, two, or three) they transfer. With just one exception, the HMTases belong to SET family that can be classified according to the sequences surrounding the SET domain. Structural studies on the human SET7/9, a mono-methylase, have revealed the molecular basis for the specificity of the enzyme for the histone-target and the roles of the invariant residues in the SET domain in determining the methylation specificities.
Associated domains
The N-terminal pre-SET domain (), as found in the SUV39 SET family, contains nine invariant cysteine residues that are grouped into two segments separated by a region of variable length. These 9 cysteines coordinate 3 zinc ions to form a triangular cluster, where each of the zinc ions is coordinated by 4 four cysteines to give a tetrahedral configuration. The function of this domain is structural, holding together 2 long segments of random coils.
The C-terminal region including the post-SET domain () is disordered when not interacting with a histone tail and in the absence of zinc. The three conserved cysteines in the post-SET domain form a zinc-binding site when coupled to a fourth conserved cysteine in the knot-like structure close to the SET domain active site. The structured post-SET region brings in the C-terminal residues that participate in S-adenosyl-L-methionine-binding and histone tail interactions. The three conserved cysteine residues are essential for HMTase activity, as replacement with serine abolishes HMTase activity.
Examples
Human genes encoding proteins containing this domain include:
ASH1L, also has an associated with SET domain (AWS)
EHMT1 (FP13812), EHMT2 (BAT8), EZH1, EZH2
MLL, MLL2, MLL3, MLL5
NSD1
PRDM1, PRDM2, PRDM5
SETD1A, SETD2, SETD3, SETD4, SETD5, SETD6, SETD7, SETD8, SETDB1, SETDB2, SETMAR, SMYD1, SMYD3, SMYD4, SMYD5, SUV39H1, SUV39H2, KMT5B, SUV420H2,
WBP7, WHSC1, WHSC1L1
References
Protein families | SET domain | Biology | 1,119 |
1,725,676 | https://en.wikipedia.org/wiki/ScrollKeeper | ScrollKeeper is a document cataloging system. It manages documentation metadata, as specified by the Open Source Metadata Framework (OMF). ScrollKeeper was used by the GNOME desktop help browser, Yelp, but has since been replaced by Rarian. It was also used by the KDE help browser and ScrollServer documentation server.
References
External links
ScrollKeeper
ScrollKeeper on SourceForge.net
Open Source Metadata Framework
GNOME obsolete
KDE
Metadata | ScrollKeeper | Technology | 91 |
17,766,039 | https://en.wikipedia.org/wiki/Lee%20distance | In coding theory, the Lee distance is a distance between two strings and of equal length n over the q-ary alphabet } of size . It is a metric defined as
If or the Lee distance coincides with the Hamming distance, because both distances are 0 for two single equal symbols and 1 for two single non-equal symbols. For this is not the case anymore; the Lee distance between single letters can become bigger than 1. However, there exists a Gray isometry (weight-preserving bijection) between with the Lee weight and with the Hamming weight.
Considering the alphabet as the additive group Zq, the Lee distance between two single letters and is the length of shortest path in the Cayley graph (which is circular since the group is cyclic) between them. More generally, the Lee distance between two strings of length is the length of the shortest path between them in the Cayley graph of . This can also be thought of as the quotient metric resulting from reducing with the Manhattan distance modulo the lattice . The analogous quotient metric on a quotient of modulo an arbitrary lattice is known as a or Mannheim distance.
The metric space induced by the Lee distance is a discrete analog of the elliptic space.
Example
If , then the Lee distance between 3140 and 2543 is .
History and application
The Lee distance is named after William Chi Yuan Lee (). It is applied for phase modulation while the Hamming distance is used in case of orthogonal modulation.
The Berlekamp code is an example of code in the Lee metric. Other significant examples are the Preparata code and Kerdock code; these codes are non-linear when considered over a field, but are linear over a ring.
References
Coding theory
String metrics | Lee distance | Mathematics | 361 |
74,337,896 | https://en.wikipedia.org/wiki/IEEE%20802.11bb | IEEE 802.11bb is a line-of-sight light-based wireless networking standard that is part of the 802.11 suite of standards, which defines an interoperable communications protocol for Li-Fi devices. Its proponents state that it will allow for very high speed communication that is faster than Wi-Fi.
Li-Fi is intended to provide better bandwidth compared to microwave. To achieve faster speeds the standard will likely need to adopt some of the technologies used with optical fiber based networking. Multiple channels can reach extremely high speeds.
The 802.11bb standard describes the use of light in the near-infrared 800 to 1000 nm waveband to implement data rates between 10 Mbit/s and 9.6 Gbit/s, with interoperability between devices with different capabilities.
Development of 802.11bb was carried out by the IEEE 802.11 Light Communications Task Group. Companies participating in the standardization effort included pureLiFi and Fraunhofer HHI.
See also
ITU-T G.9991, an ITU standard for line of sight optical networking approved in 2019
IrDA, an early low-speed infrared communication protocol
References
External links
802.11 Light Communications Task Group website
Networking standards
Wireless communication systems
IEEE 802.11
Optical communications | IEEE 802.11bb | Technology,Engineering | 255 |
1,473,244 | https://en.wikipedia.org/wiki/Scleroderma%20citrinum | Scleroderma citrinum, commonly known as the common earthball, pigskin poison puffball, or common earth ball, is a species of earthball fungus found in Europe and in North America. It is the most common species of earthball fungus in the UK and occurs widely in woods, heathland and in short grass from autumn to winter. Scleroderma citrinum has two synonyms, Scleroderma aurantium (Vaill.) and Scleroderma vulgare Horn.
Earthballs are superficially similar to, and considered look-alikes of, the edible puffball (particularly Apioperdon pyriforme), but whereas the puffball has a single opening on top through which the spores are dispersed, the earthball just breaks up to release the spores. Moreover, Scleroderma citrinum has much firmer flesh and a dark gleba (interior) much earlier in development than puffballs. Scleroderma citrinum has no stem but is attached to the soil by mycelial cords. The peridium, or outer wall, is thick and firm, usually ochre yellow externally with irregular warts.
Scleroderma citrinum is an ectomycorrhizal fungus with a symbiotic relationship with some tree species, and can influence the diversity of soil bacterial communities under some tree species.
The earthball may be parasitized by Pseudoboletus parasiticus.
Scleroderma citrinum can be mistaken with truffles by inexperienced mushroom hunters. Ingestion of Scleroderma citrinum can cause gastrointestinal distress in humans and animals. Some individuals may experience lacrimation, rhinitis and rhinorrhea, and conjunctivitis from exposure to its spores.
Pigments found in the fruiting body of Scleroderma citrinum Pers. are sclerocitrin, norbadione A, xerocomic acid, and badione A.
Notes
References
External links
Medicinal Mushrooms Description, bioactive compounds, medicinal properties
Mushroom Expert Additional information
Fungi of Europe
Poisonous fungi
Puffballs
Fungus species
Taxa named by Christiaan Hendrik Persoon
Scleroderma | Scleroderma citrinum | Biology,Environmental_science | 457 |
1,028,268 | https://en.wikipedia.org/wiki/Asterism%20%28typography%29 | In typography, an asterism, ⁂, is a typographic symbol consisting of three asterisks placed in a triangle, which is used for a variety of purposes. The name originates from the astronomical term for a group of stars.
The asterism was originally used as a type of dinkus in typography, though increasingly rarely. It can also be used to mean "untitled" or author or title withheld as seen, for example, in some editions of Album for the Young by composer Robert Schumann (№ 21, 26, and 30). In meteorology, an asterism in a station model indicates moderate snowfall.
Dinkus
A dinkus is a typographical device to divide text, such as at section breaks. Its purpose is to "indicate minor breaks in text", to call attention to a passage, or to separate sub-chapters in a book. An asterism used this way is thus a type of dinkus: nowadays this usage of the symbol is nearly obsolete. More commonly used dinkuses are three dots or three asterisks in a horizontal row. A small black and white drawing or a fleuron (❧) may be used for the same purpose. Otherwise, an extra space between paragraphs is used. A dinkus may be used in conjunction with the extra space to mark a smaller subdivision than a sub-chapter.
See also
Dingbat
Ellipsis (three dots in mid-sentence)
Signature mark
References
Typographical symbols
Punctuation | Asterism (typography) | Mathematics | 314 |
162,321 | https://en.wikipedia.org/wiki/Invariant%20mass | The invariant mass, rest mass, intrinsic mass, proper mass, or in the case of bound systems simply mass, is the portion of the total mass of an object or system of objects that is independent of the overall motion of the system. More precisely, it is a characteristic of the system's total energy and momentum that is the same in all frames of reference related by Lorentz transformations. If a center-of-momentum frame exists for the system, then the invariant mass of a system is equal to its total mass in that "rest frame". In other reference frames, where the system's momentum is nonzero, the total mass (a.k.a. relativistic mass) of the system is greater than the invariant mass, but the invariant mass remains unchanged.
Because of mass–energy equivalence, the rest energy of the system is simply the invariant mass times the speed of light squared. Similarly, the total energy of the system is its total (relativistic) mass times the speed of light squared.
Systems whose four-momentum is a null vector (for example, a single photon or many photons moving in exactly the same direction) have zero invariant mass and are referred to as massless. A physical object or particle moving faster than the speed of light would have space-like four-momenta (such as the hypothesized tachyon), and these do not appear to exist. Any time-like four-momentum possesses a reference frame where the momentum (3-dimensional) is zero, which is a center of momentum frame. In this case, invariant mass is positive and is referred to as the rest mass.
If objects within a system are in relative motion, then the invariant mass of the whole system will differ from the sum of the objects' rest masses. This is also equal to the total energy of the system divided by c2. See mass–energy equivalence for a discussion of definitions of mass. Since the mass of systems must be measured with a weight or mass scale in a center of momentum frame in which the entire system has zero momentum, such a scale always measures the system's invariant mass. For example, a scale would measure the kinetic energy of the molecules in a bottle of gas to be part of invariant mass of the bottle, and thus also its rest mass. The same is true for massless particles in such system, which add invariant mass and also rest mass to systems, according to their energy.
For an isolated massive system, the center of mass of the system moves in a straight line with a steady subluminal velocity (with a velocity depending on the reference frame used to view it). Thus, an observer can always be placed to move along with it. In this frame, which is the center-of-momentum frame, the total momentum is zero, and the system as a whole may be thought of as being "at rest" if it is a bound system (like a bottle of gas). In this frame, which exists under these assumptions, the invariant mass of the system is equal to the total system energy (in the zero-momentum frame) divided by . This total energy in the center of momentum frame, is the minimum energy which the system may be observed to have, when seen by various observers from various inertial frames.
Note that for reasons above, such a rest frame does not exist for single photons, or rays of light moving in one direction. When two or more photons move in different directions, however, a center of mass frame (or "rest frame" if the system is bound) exists. Thus, the mass of a system of several photons moving in different directions is positive, which means that an invariant mass exists for this system even though it does not exist for each photon.
Sum of rest masses
The invariant mass of a system includes the mass of any kinetic energy of the system constituents that remains in the center of momentum frame, so the invariant mass of a system may be greater than sum of the invariant masses (rest masses) of its separate constituents. For example, rest mass and invariant mass are zero for individual photons even though they may add mass to the invariant mass of systems. For this reason, invariant mass is in general not an additive quantity (although there are a few rare situations where it may be, as is the case when massive particles in a system without potential or kinetic energy can be added to a total mass).
Consider the simple case of two-body system, where object A is moving towards another object B which is initially at rest (in any particular frame of reference). The magnitude of invariant mass of this two-body system (see definition below) is different from the sum of rest mass (i.e. their respective mass when stationary). Even if we consider the same system from center-of-momentum frame, where net momentum is zero, the magnitude of the system's invariant mass is not equal to the sum of the rest masses of the particles within it.
The kinetic energy of such particles and the potential energy of the force fields increase the total energy above the sum of the particle rest masses, and both terms contribute to the invariant mass of the system. The sum of the particle kinetic energies as calculated by an observer is smallest in the center of momentum frame (again, called the "rest frame" if the system is bound).
They will often also interact through one or more of the fundamental forces, giving them a potential energy of interaction, possibly negative.
As defined in particle physics
In particle physics, the invariant mass is equal to the mass in the rest frame of the particle, and can be calculated by the particle's energy and its momentum as measured in any frame, by the energy–momentum relation:
or in natural units where ,
This invariant mass is the same in all frames of reference (see also special relativity). This equation says that the invariant mass is the pseudo-Euclidean length of the four-vector , calculated using the relativistic version of the Pythagorean theorem which has a different sign for the space and time dimensions. This length is preserved under any Lorentz boost or rotation in four dimensions, just like the ordinary length of a vector is preserved under rotations. In quantum theory the invariant mass is a parameter in the relativistic Dirac equation for an elementary particle. The Dirac quantum operator corresponds to the particle four-momentum vector.
Since the invariant mass is determined from quantities which are conserved during a decay, the invariant mass calculated using the energy and momentum of the decay products of a single particle is equal to the mass of the particle that decayed.
The mass of a system of particles can be calculated from the general formula:
where
is the invariant mass of the system of particles, equal to the mass of the decay particle.
is the sum of the energies of the particles
is the vector sum of the momentum of the particles (includes both magnitude and direction of the momenta)
The term invariant mass is also used in inelastic scattering experiments. Given an inelastic reaction with total incoming energy larger than the total detected energy (i.e. not all outgoing particles are detected in the experiment), the invariant mass (also known as the "missing mass") of the reaction is defined as follows (in natural units):
If there is one dominant particle which was not detected during an experiment, a plot of the invariant mass will show a sharp peak at the mass of the missing particle.
In those cases when the momentum along one direction cannot be measured (i.e. in the case of a neutrino, whose presence is only inferred from the missing energy) the transverse mass is used.
Example: two-particle collision
In a two-particle collision (or a two-particle decay) the square of the invariant mass (in natural units) is
Massless particles
The invariant mass of a system made of two massless particles whose momenta form an angle has a convenient expression:
Collider experiments
In particle collider experiments, one often defines the angular position of a particle in terms of an azimuthal angle and pseudorapidity . Additionally the transverse momentum, , is usually measured. In this case if the particles are massless, or highly relativistic () then the invariant mass becomes:
Rest energy
Rest energy (also called rest mass energy) is the energy associated with a particle's invariant mass.
The rest energy of a particle is defined as: where is the speed of light in vacuum. In general, only differences in energy have physical significance.
The concept of rest energy follows from the special theory of relativity that leads to Einstein's famous conclusion about equivalence of energy and mass. See .
See also
Mass in special relativity
Invariant (physics)
Transverse mass
References
Citations
Theory of relativity
Mass
Energy (physics)
Physical quantities | Invariant mass | Physics,Mathematics | 1,800 |
51,119,519 | https://en.wikipedia.org/wiki/Von%20Baeyer%20nomenclature | In organic chemistry, the von Baeyer nomenclature is a system for describing polycyclic (i.e. multi-ringed) hydrocarbons. The system was originally developed in 1900 by German chemist Adolf von Baeyer for bicyclic systems and in 1913 expanded by Eduard Buchner and Wilhelm Weigand for tricyclic systems. The system has been adopted and extended by the IUPAC as part of its nomenclature for organic chemistry. The modern version has been extended to cover more cases of compounds including an arbitrary number of cycles, heterocyclic compounds and unsaturated compounds.
Extended Von Baeyer
See also
Clar's rule
References
Chemical nomenclature | Von Baeyer nomenclature | Chemistry | 141 |
9,661,780 | https://en.wikipedia.org/wiki/TRPV1 | The transient receptor potential cation channel subfamily V member 1 (TRPV1), also known as the capsaicin receptor and the vanilloid receptor 1, is a protein that, in humans, is encoded by the TRPV1 gene. It was the first isolated member of the transient receptor potential vanilloid receptor proteins that in turn are a sub-family of the transient receptor potential protein group. This protein is a member of the TRPV group of transient receptor potential family of ion channels. Fatty acid metabolites with affinity for this receptor are produced by cyanobacteria, which diverged from eukaryotes at least 2000 million years ago (MYA).
The function of TRPV1 is detection and regulation of body temperature. In addition, TRPV1 provides a sensation of scalding heat and pain (nociception). In primary afferent sensory neurons, it cooperates with TRPA1 (a chemical irritant receptor) to mediate the detection of noxious environmental stimuli.
Function
TRPV1 is an element of or mechanism used by the mammalian somatosensory system. It is a nonselective cation channel that may be activated by a wide variety of exogenous and endogenous physical and chemical stimuli. The best-known activators of TRPV1 are: temperature greater than ; acidic conditions; capsaicin (the irritating compound in hot chili peppers); and allyl isothiocyanate, the pungent compound in mustard and wasabi. The activation of TRPV1 leads to a painful, burning sensation. Its endogenous activators include: low pH (acidic conditions), the endocannabinoid anandamide, N-oleyl-dopamine, and N-arachidonoyl-dopamine. TRPV1 receptors are found mainly in the nociceptive neurons of the peripheral nervous system, but they have also been described in many other tissues, including the central nervous system. TRPV1 is involved in the transmission and modulation of pain (nociception), as well as the integration of diverse painful stimuli.
Sensitization
The sensitivity of TRPV1 to noxious stimuli, such as high temperatures, is not static. Upon tissue damage and the consequent inflammation, a number of inflammatory mediators, such as various prostaglandins and bradykinin, are released. These agents increase the sensitivity of nociceptors to noxious stimuli. This manifests as an increased sensitivity to painful stimuli (hyperalgesia) or pain sensation in response to non-painful stimuli (allodynia). Most sensitizing pro-inflammatory agents activate the phospholipase C pathway. Phosphorylation of TRPV1 by protein kinase C has been shown to play a role in sensitization of TRPV1. The cleavage of PIP2 by PLC-beta can result in disinhibition of TRPV1 and, as a consequence, contribute to the sensitivity of TRPV1 to noxious stimuli.
Desensitization
Upon prolonged exposure to capsaicin, TRPV1 activity decreases, a phenomenon called desensitization. Extracellular calcium ions are required for this phenomenon, thus influx of calcium and the consequential increase of intracellular calcium mediate this effect. Various signaling pathways such as phosphorylation by PKA and PKC, interaction with calmodulin, dephosphorylation by calcineurin, and the decrease of PIP2, have been implicated in the regulation of desensitization of TRPV1. Desensitization of TRPV1 is thought to underlie the paradoxical analgesic effect of capsaicin.
Clinical significance
Peripheral nervous system
As a result of its involvement in nociception, TRPV1 has been a target for the development of pain reducers (analgesics). Three major strategies have been used:
TRPV1 use
The TRPV1 receptor can be used to measure how an organism can sense temperature change. In the lab the receptor may be removed from mice giving them the inability to detect differences in ambient temperature. In the pharmaceutical field this allows for the blocking of heat receptors giving patients with inflammatory disorders or severe burning pains a chance to heal without the pain. The lack of the TRPV1 receptor gives a glimpse into the developing brain as heat can kill most organisms in large enough doses, so this removal process shows researchers how the inability to sense heat may be detrimental to the survivability of an organism and then translate this to human heat disorders.
TRPV1 in immune cells
TRPV1 plays an important role not only in neurones but also in immune cells. Activation of TRPV1 modulates immune response including the release of inflammatory cytokines, chemokines, and the ability to phagocytose. However, the role of TRPV1 in immune cells is not entirely understood and it is currently intensely studied. TRPV1 is not the only TRP channel expressed in immune cells. TRPA1, TRPM8 and TRPV4 are the most relevant TRP channels that are also studied in immune cells.
The expression of TRPV1 was confirmed in the cells of innate immunity as well as the cells of adaptive immunity. TRPV1 can be found in monocytes, macrophages, dendritic cells, T lymphocytes, natural killer cells and neutrophiles. TRPV1 is said to be potentially very important in immune cell functioning as it senses higher temperature and lower pH, which can affect the immune cell performance.
TRPV1 and adaptive immunity
TRPV1 is an important membrane channel in T cells as it regulates the influx of calcium cations. TRPV1's involvement is mainly in T cell receptor signalling (TCR) signalling, T cell activation and TCR-mediated influx of calcium ions, but it is involved in T cell cytokine production as well. Indeed, T cells with TRPV1 knockout show impaired calcium uptake after T cell activation via TCR, thus they show dysregulation in signalling pathways such as NF-κB and NFAT.
TRPV1 and innate immunity
Regarding innate immunity, activation of TRPV1 by capsaicin has been shown to suppress the production of nitrite radical, superoxide anion and hydrogen peroxide by macrophages. Furthermore, administration of capsaicin, and subsequent activation of TRPV1, suppresses phagocytosis in dendritic cells. In a mouse model, TRPV1 affect dendritic cell maturation and function, however, further studies are needed to clarify this effect in humans. In neutrophils, the increase in cytosolic calcium cations leads to synthesis of prostaglandins. Activation of TRPV1 by capsaicin modulates neutrophil immune response due to the higher influx of calcium ions into the cell.
TRPV1 is also considered a novel therapeutic agent in many inflammatory diseases. Multiple studies have proven that TRPV1 influences the outcome of several inflammatory diseases such as chronic asthma, esophageal inflammation, rheumatoid arthritis and cancer. Studies using TRPV1's agonists and antagonists have shown that their administration indeed changes the course of inflammation. However, at this point, there is a lot of contradictive evidence about what type of response, pro-inflammatory or anti-inflammatory, TRPV1's activation induces. Further research needs to be carried out. Meanwhile, it is important to highlight that TRPV1's influence on inflammatory diseases is probably not limited to only immune cells as it is rather an interplay between immune cells, neurons, and other cell types (epithelial cells etc.).
TRPV1 and cancer
TRPV1 was found to be overexpressed in several types of cancers, e.g., pancreatic cancer and colon adenocarcinoma. This suggest that certain types of cancers might be more prone to cell death mediated by capsaicin-induced (and also other vanilloid-induced) cell death. Indeed, studies have shown inversed correlation of consumption of chili-based foods and all-cause mortality along with cancers. This beneficial impact of the consumption of chili-based foods was attributed to capsaicinoid content.
TRPV1 activation caused by its agonist capsaicin was shown to induce G0-G1 cell arrest and apoptosis in leukemic cell lines, adult T-cell leukaemia and multiple myeloma. Capsaicin reduces the expression of anti-apoptotic protein Bcl-2 and it also promotes activation of p53, a tumour-suppressor protein known as a major regulator of cell death. This effect of capsaicin in both cases subsequently leads to above-mentioned apoptosis.
TRPV1 and neuroinflammation
The interplay between neurons and immune cells is a well-known phenomenon. TRPV1 plays its role in neuroinflammation, being expressed both in neurons and in immune cells. Significant importance should be paid to the confirmed expression of TRPV1 in microglia and astrocytes, cells found close to neurons. The neuro-immune axis is the place of production of neuroinflammatory molecules and receptors that interplay between the two systems and ensure a complex response to external stimuli (or to the body's own pathologies). Studying TRPV1's involvement in neuroinflammation has a great therapeutical significance for the future.
Cutaneus neurons expressing TRPV1 and dendritic cells were found to be located close to each other. Activation of TRPV1 channels in neurons is associated with subsequent production of interleukin 23 (IL-23) by dendritic cells and further production of IL-17 by T cells. These interleukins are important for host defence against pathogenic fungi (such as Candida albicans) and bacteria (such as Staphylococcus aureus), thus TRPV1's activation can lead to better defence against these pathogens, thanks to the neuro-immune axis.
TRPV1 is said to contribute to autophagy of microglia via its Ca2+-signalling, which leads to mitochondria-induced cell death. The TRPV1 channel also influences microglia-induced inflammation. Migration and chemotaxis of microglia and astrocytes seems to be affected by TRPV1's interaction with the cytoskeleton and Ca2+-signalling. TRPV1 is therefore involved in the neuro-immune axis via its function in microglia as well.
TRPV1 was shown to have protective effect in neurologic disorders such as Huntington's disease, vascular dementia, and Parkinson's disease. However, its precise function needs to be further explored.
Ligands
Antagonists
Antagonists block TRPV1 activity, thus reducing pain. Identified antagonists include the competitive antagonist capsazepine and the non-competitive antagonist ruthenium red. These agents could be useful when applied systemically. Numerous TRPV1 antagonists have been developed by pharmaceutical companies. TRPV1 antagonists have shown efficacy in reducing nociception from inflammatory and neuropathic pain models in rats. This provides evidence that TRPV1 is capsaicin's sole receptor. In humans, drugs acting at TRPV1 receptors could be used to treat neuropathic pain associated with multiple sclerosis, chemotherapy, or amputation, as well as pain associated with the inflammatory response of damaged tissue, such as in osteoarthritis.
These drugs can affect body temperature (hyperthermia) which is a challenge to therapeutic application. For example, a transient temperature gain (~1 °C for a duration of approximately 40 minutes, reverting to baseline by 40 minutes) was measured in rats with the application of TRPV1 antagonist AMG-9810. The role of TRPV1 in the regulation of body temperature has emerged in the last few years. Based on a number of TRPV-selective antagonists' causing a mild increase in body temperature (hyperthermia), it was proposed that TRPV1 is tonically active in vivo and regulates body temperature by telling the body to "cool itself down". Without these signals, the body overheats. Likewise, this explains the propensity of capsaicin (a TRPV1 agonist) to cause sweating (i.e.: a signal to reduce body temperature). In a recent report, it was found that tonically active TRPV1 channels are present in the viscera and keep an ongoing suppressive effect on body temperature. Recently, it was proposed that predominant function of TRPV1 is body temperature maintenance. Experiments have shown that TRPV1 blockade increases body temperature in multiple species, including rodents and humans, suggesting that TRPV1 is involved in body temperature maintenance. In 2008, AMG-517, a highly selective TRPV1 antagonist was dropped out of clinical trials due to the causation of hyperthermia (~38.3 °C mean increase which was most intense on day 1 but was attenuated on days 2–7. Another molecule, SB-705498, was also evaluated in the clinic but its effect on body temperature was not reported. As we increase understanding of modality specific agonism of TRPV1 it seems that next generation therapeutics targeting TRPV1 have the potential to side-step hyperthermia. Moreover, for at least two indications or approaches this may be a secondary issue. Where the therapeutic approach (e.g., in analgesia) is agonist-mediated desensitization then the hyperthermic effects of antagonists may not be relevant. Secondarily in applications such as TRPV1 antagonism for the treatment of severe conditions such as heart failure, then there may be an acceptable trade-off with mild hyperthermia, although no hyperthermia was observed in rodent models of heart failure treated with BCTC, SB-366791 or AMG-9810. Post translational modification of TRPV1 protein by its phosphorylation is critical for its functionality. Reports published from NIH suggest that Cdk5-mediated phosphorylation of TRPV1 is required for its ligand-induced channel opening.
Agonists
TRPV1 is activated by numerous agonists from natural sources. Agonists such as capsaicin and resiniferatoxin activate TRPV1 and, upon prolonged application, cause TRPV1 activity to decrease (desensitization), leading to alleviation of pain via the subsequent decrease in the TRPV1 mediated release of inflammatory molecules following exposures to noxious stimuli. Agonists can be applied locally to the painful area in various forms, generally as a patch or an ointment. Numerous capsaicin-containing creams are available over the counter, containing low concentrations of capsaicin (0.025 - 0.075%). It is debated whether these preparations actually lead to TRPV1 desensitization; it is possible that they act via counter-irritation. Novel preparations containing higher capsaicin concentration (up to 10%) are under clinical trials. Eight percent capsaicin patches have recently become available for clinical use, with supporting evidence demonstrating that a 30-minute treatment can provide up to 3 months analgesia by causing regression of TRPV1-containing neurons in the skin. Currently, these treatments must be re-administered on a regular (albeit infrequent) schedule in order to maintain their analgesic effects.
Cannabinoid ligands
Cannabinoid ligands include:
Cannabidiol (CBD) agonist
Cannabigerol (CBG) agonist
Tetrahydrocannabivarin (THCV) agonist
Cannabigerovarin (CBGV) agonist
N-Acyl amides
N-Acyl Amides that activate cannabimimetic receptors include:
Anandamide (AEA)
N-Arachidonoyl dopamine
N-Oleoyl dopamine
N-Arachidonoyl taurine
N-Docosahexaenoyl ethanolamine
N-Docosahexaenoyl GABA
N-Docosahexaenoyl aspartic acid
N-Docosahexaenoyl glycine
N-Docosahexaenoyl serine
N-Arachidonoyl GABA
N-Linoleyl GABA
Fatty acid metabolites
Certain metabolites of polyunsaturated fatty acids have been shown to stimulate cells in a TRPV1-dependent fashion. The metabolites of linoleic acid, including 13(S)-hydroxy-9Z,11E-octadecadienoic acid (13(S)-HODE), 13(R)-hydroxy-9Z,11E-octadecadienoic acid (13(R)-HODE, 9(S)-hydroxy-10(E),12(Z)-octadecadienoic acid (9(S)-HODE), 9(R)-hydroxy-10(E),12(Z)-octadecadienoic acid (9(R)-HODE), and their respective keto analogs, 13-oxoODE and 9-oxoODE (see 13-HODE and 9-HODE sections on direct actions), activate peripheral and central mouse pain sensing neurons. Reports disagree on the potencies of these metabolites with, for example, the most potent one, 9(S)-HODE, requiring at least 10 micromoles/liter. or a more physiological concentration of 10 nanomoles/liter to activate TRPV1 in rodent neurons. The TRPV1-dependency of these metabolites' activities appears to reflect their direct interaction with TPRV1. Although relatively weak agonists of TRPV1 in comparison to anandamide, these linoleate metabolites have been proposed to act through TRPV1 in mediating pain perception in rodents and to cause injury to airway epithelial cells and thereby to contribute to asthma disease in mice and therefore possibly humans. Certain arachidonic acid metabolites, including 20-hydroxy-5Z,8Z,11Z,14Z-eicosatetraenoic acid (see 20-Hydroxyeicosatetraenoic acid) and 12(S)-hydroperoxy-5Z,8Z,10E,12S,14Z-eicosatetraenoic acid (12(S)-HpETE), 12(S)-hydroxy-5Z,8Z,10E,12S,14Z-eicosatetraenoic acid (12(S)-HETE (see 12-HETE), hepoxilin A3 (i.e. 8R/S-hydroxy-11,12-oxido-5Z,9E,14Z-eicosatrienoic acid) and HxB3 (i.e. 10R/S-hydroxy-11,12-oxido-5Z,8Z,14Z-eicosatrienoic acid) likewise activate TRPV1 and may thereby contribute to tactile hyperalgesia and allodynia (see ).
Studies with mice, guinea pig, and human tissues and in guinea pigs indicate that another arachidonic acid metabolite, Prostaglandin E2, operates through its prostaglandin EP3 G protein coupled receptor to trigger cough responses. Its mechanism of action involves activation and/or sensitization of TRPV1 (as well as TRPA1) receptors, presumably by an indirect mechanism. Genetic polymorphism in the EP3 receptor (rs11209716), has been associated with ACE inhibitor-induced cough in humans.
Resolvin E1 (RvE1), RvD2 (see resolvins), neuroprotectin D1 (NPD1), and maresin 1 (Mar1) are metabolites of the omega 3 fatty acids, eicosapentaenoic acid (for RvE1) or docosahexaenoic acid (for RvD2, NPD1, and Mar1). These metabolites are members of the specialized proresolving mediators (SPMs) class of metabolites that function to resolve diverse inflammatory reactions and diseases in animal models and, it is proposed, humans. These SPMs also dampen pain perception arising from various inflammation-based causes in animal models. The mechanism behind their pain-dampening effects involves the inhibition of TRPV1, probably (in at least certain cases) by an indirect effect wherein they activate other receptors located on the neurons or nearby microglia or astrocytes. CMKLR1, GPR32, FPR2, and NMDA receptors have been proposed to be the receptors through which these SPMs operate to down-regulate TRPV1 and thereby pain perception.
Fatty acid conjugates
N-Arachidonoyl dopamine, an endocannabinoid found in the human CNS, structurally similar to capsaicin, activates the TRPV1 channel with an EC50 of approximately of 50 nM.
N-Oleyl-dopamine, another endogenous agonist, binds to human VR1 with an Ki of 36 Nm.
Another endocannabinoid anandamide has also been shown to act on TRPV1 receptors.
AM404—an active metabolite of paracetamol (also known as acetaminophen)—that serves as an anandamide reuptake inhibitor and COX inhibitor also serves as a potent TRPV1 agonist.
The plant-biosynthesized cannabinoid cannabidiol also shows "either direct or indirect activation" of TRPV1 receptors. TRPV1 colocalizes with CB1 receptors and CB2 receptors in sensory and brain neurons respectively, and other plant-cannabinoids like CBN, CBG, CBC, THCV, and CBDV are also agonists of this ion channel. There is also evidence that non cannabinoid components of the Cannabis secondary metabolome such as myrcene activate TRPV1.
Vitamin D metabolites
The vitamin D metabolites calcifediol (25-hydroxy vitamin D or 25OHD) and calcitriol (1,25-hydroxy vitamin D or 1,25OHD) act as endogenous ligands of TRPV1.
Central nervous system
TRPV1 is also expressed at high levels in the central nervous system and has been proposed as a target for treatment not only of pain but also for other conditions such as anxiety.
Furthermore, TRPV1 appears to mediate long-term synaptic depression (LTD) in the hippocampus. LTD has been linked to a decrease in the ability to make new memories, unlike its opposite long-term potentiation (LTP), which aids in memory formation. A dynamic pattern of LTD and LTP occurring at many synapses provides a code for memory formation. Long-term depression and subsequent pruning of synapses with reduced activity is an important aspect of memory formation. In rat brain slices, activation of TRPV1 with heat or capsaicin induced LTD while capsazepine blocked capsaicin's ability to induce LTD. In the brainstem (solitary tract nucleus), TRPV1 controls the asynchronous and spontaneous release of glutamate from unmyelinated cranial visceral afferents - release processes that are active at normal temperatures and hence quite distinct from TRPV1 responses in painful heat. Hence, there may be therapeutic potential in modulating TRPV1 in the central nervous system, perhaps as a treatment for epilepsy (TRPV1 is already a target in the peripheral nervous system for pain relief).
Interactions
TRPV1 has been shown to interact with:
CALM1
SNAPAP
SYT9
CBD
AEA
NPR1
PKG
Discovery
The dorsal root ganglion (DRG) neurons of mammals were known to express a heat-sensitive ion channel that could be activated by capsaicin. The research group of David Julius, therefore, created a cDNA library of genes expressed in dorsal root ganglion neurons, expressed the clones in HEK 293 cells, and looked for cells that respond to capsaicin with calcium influx (which HEK-293 normally do not). After several rounds of screening and dividing the library, a single clone encoding the TRPV1 channel was finally identified in 1997. It was the first TRPV channel to be identified. Julius was awarded the 2021 Nobel prize in Physiology or Medicine for his discovery.
See also
Capsaicin
Capsinoids
Vanilloids
Vanillotoxin
Cannabinoid receptor
Discovery and development of TRPV1 antagonists
Ruthenium red
Thermoreceptor
:Category:Somatosensory system
Endocannabinoid system
References
Further reading
External links
The Endocannabinoidome The World of Endocannabinoids and Related Mediators Book • 2014
Ion channels | TRPV1 | Chemistry | 5,386 |
62,694 | https://en.wikipedia.org/wiki/Stromatolite | Stromatolites ( ) or stromatoliths () are layered sedimentary formations (microbialite) that are created mainly by photosynthetic microorganisms such as cyanobacteria, sulfate-reducing bacteria, and Pseudomonadota (formerly proteobacteria). These microorganisms produce adhesive compounds that cement sand and other rocky materials to form mineral "microbial mats". In turn, these mats build up layer by layer, growing gradually over time.
This process generates the characteristic lamination of stromatolites, a feature that is hard to interpret, in terms of its temporal and environmental significance. Different styles of stromatolite lamination have been described, which can be studied through microscopic and mathematical methods. A stromatolite may grow to a meter or more. Fossilized stromatolites provide important records of some of the most ancient life. As of the Holocene, living forms are rare.
Definition
Stromatolites are layered, biochemical, accretionary structures formed in shallow water by the trapping, binding and cementation of sedimentary grains in biofilms (specifically microbial mats), through the action of certain microbial lifeforms, especially cyanobacteria.
Ancient stromatolites
Morphology
Fossilized stromatolites exhibit a variety of forms and structures, or morphologies, including conical, stratiform, domal, columnar, and branching types. Stromatolites occur widely in the fossil record of the Precambrian but are rare today. Very few Archean stromatolites contain fossilized microbes, but fossilized microbes are sometimes abundant in Proterozoic stromatolites.
While features of some ancient apparent stromatolites are suggestive of biological activity, others possess features that are more consistent with abiotic (non-biological) precipitation. Finding reliable ways to distinguish between biologically formed and abiotic stromatolites is an active area of research in geology. Multiple morphologies of stromatolites may exist in a single local or geological stratum, depending on specific conditions at the time of their formation, such as water depth.
Most stromatolites are spongiostromate in texture, having no recognisable microstructure or cellular remains. A minority are porostromate, having recognisable microstructure; these are mostly unknown from the Precambrian but persist throughout the Palaeozoic and Mesozoic. Since the Eocene, porostromate stromatolites are known only from freshwater settings.
Fossil record
Some Archean rock formations show macroscopic similarity to modern microbial structures, leading to the inference that these structures represent evidence of ancient life, namely stromatolites. However, others regard these patterns as being the result of natural material deposition or some other abiogenic mechanism. Scientists have argued for a biological origin of stromatolites due to the presence of organic globule clusters within the thin layers of the stromatolites, of aragonite nanocrystals (both features of current stromatolites), and of other microstructures in older stromatolites that parallel those in younger stromatolites that show strong indications of biological origin.
Stromatolites are a major constituent of the fossil record of the first forms of life on Earth. They peaked about 1.25 billion years ago (Ga) and subsequently declined in abundance and diversity, so that by the start of the Cambrian they had fallen to 20% of their peak. The most widely supported explanation is that stromatolite builders fell victim to grazing creatures (the Cambrian substrate revolution); this theory implies that sufficiently complex organisms were common around 1 Ga. Another hypothesis is that protozoa such as foraminifera were responsible for the decline, favoring formation of thrombolites over stromatolites through microscopic bioturbation.
Proterozoic stromatolite microfossils (preserved by permineralization in silica) include cyanobacteria and possibly some forms of the eukaryote chlorophytes (that is, green algae). One genus of stromatolite very common in the geologic record is Collenia.
The connection between grazer and stromatolite abundance is well documented in the younger Ordovician evolutionary radiation; stromatolite abundance also increased after the Late Ordovician mass extinction and Permian–Triassic extinction event decimated marine animals, falling back to earlier levels as marine animals recovered. Fluctuations in metazoan population and diversity may not have been the only factor in the reduction in stromatolite abundance. Factors such as the chemistry of the environment may have been responsible for changes.
While prokaryotic cyanobacteria reproduce asexually through cell division, they were instrumental in priming the environment for the evolutionary development of more complex eukaryotic organisms. They are thought to be largely responsible for increasing the amount of oxygen in the primeval Earth's atmosphere through their continuing photosynthesis (see Great Oxygenation Event). They use water, carbon dioxide, and sunlight to create their food. A layer of polysaccharides often forms over mats of cyanobacterial cells. In modern microbial mats, debris from the surrounding habitat can become trapped within the polysaccharide layer, which can be cemented together by the calcium carbonate to grow thin laminations of limestone. These laminations can accrete over time, resulting in the banded pattern common to stromatolites. The domal morphology of biological stromatolites is the result of the vertical growth necessary for the continued infiltration of sunlight to the organisms for photosynthesis. Layered spherical growth structures termed oncolites are similar to stromatolites and are also known from the fossil record. Thrombolites are poorly laminated or non-laminated clotted structures formed by cyanobacteria, common in the fossil record and in modern sediments. There is evidence that thrombolites form in preference to stromatolites when foraminifera are part of the biological community.
The Zebra River Canyon area of the Kubis platform in the deeply dissected Zaris Mountains of southwestern Namibia provides a well-exposed example of the thrombolite-stromatolite-metazoan reefs that developed during the Proterozoic period, the stromatolites here being better developed in updip locations under conditions of higher current velocities and greater sediment influx.
Modern occurrence
Formation
Time lapse photography of modern microbial mat formation in a laboratory setting gives some revealing clues to the behavior of cyanobacteria in stromatolites. Biddanda et al. (2015) found that cyanobacteria exposed to localized beams of light moved towards the light, or expressed phototaxis, and increased their photosynthetic yield, which is necessary for survival. In a novel experiment, the scientists projected a school logo onto a petri dish containing the organisms, which accreted beneath the lighted region, forming the logo in bacteria. The authors speculate that such motility allows the cyanobacteria to seek light sources to support the colony.
In both light and dark conditions, the cyanobacteria form clumps that then expand outwards, with individual members remaining connected to the colony via long tendrils. In harsh environments where mechanical forces may tear apart the microbial mats, these substructures may provide evolutionary benefit to the colony, affording it at least some measure of shelter and protection.
Lichen stromatolites are a proposed mechanism of formation of some kinds of layered rock structure that are formed above water, where rock meets air, by repeated colonization of the rock by endolithic lichens.
Saline locations
Modern stromatolites are mostly found in hypersaline lakes and marine lagoons where high saline levels prevent animal grazing. One such location where excellent modern specimens can be observed is Hamelin Pool Marine Nature Reserve, Shark Bay in Western Australia. In 2010, a fifth type of chlorophyll, namely chlorophyll f, was discovered by Min Chen from stromatolites in Shark Bay. Halococcus hamelinensis, a halophilic archaeon, occurs in living stromatolites in Shark Bay where it is exposed to extreme conditions of UV radiation, salinity and desiccation. H. hamelinesis possesses genes that encode enzymes employed in the repair of UV induced damages in DNA by the processes of nucleotide excision repair and photoreactivation.
Other locations include Pampa del Tamarugal National Reserve in Chile; Lagoa Salgada, Rio Grande do Norte, Brazil, where modern stromatolites can be observed as both bioherms (domal type) and beds; and in the Puna de Atacama of the Andes.
Inland stromatolites can be found in saline waters in Cuatro Ciénegas Basin, a unique ecosystem in the Mexican desert. Alchichica Lake in Puebla, Mexico has two distinct morphologic generations of stromatolites: columnar-dome like structures, rich in aragonite, forming near the shore line, dated back to 1,100 years before present (ybp) and spongy-cauliflower like thrombolytic structures that dominate the lake from top to the bottom, mainly composed of hydromagnesite, huntite, calcite and dated back to 2,800 ybp. The only open marine environment where modern stromatolites are known to prosper is the Exuma Cays in the Bahamas.
Freshwater locations
Laguna de Bacalar in Mexico's southern Yucatán Peninsula has an extensive formation of living giant microbialites (that is, stromatolites or thrombolites). The microbialite bed is over long with a vertical rise of several meters in some areas. These may be the largest sized living freshwater microbialites, or any organism, on Earth.
A 1.5 km stretch of reef-forming stromatolites (primarily of the genus Scytonema) occurs in Chetumal Bay in Belize, just south of the mouth of the Rio Hondo and the Mexican border. Large microbialite towers up to 40 m high were discovered in the largest soda lake on Earth Lake Van in eastern Turkey. They are composed of aragonite and grow by precipitation of calcite from sub-lacustrine karst-water. Freshwater stromatolites are found in Lake Salda in southern Turkey. The waters are rich in magnesium and the stromatolite structures are made of hydromagnesite.
Two instances of freshwater stromatolites are found in Canada, at Pavilion Lake and Kelly Lake in British Columbia. Pavilion Lake has the largest known freshwater stromatolites, and NASA has conducted xenobiology research there, called the "Pavilion Lake Research Project." The goal of the project is to better understand what conditions would likely harbor life on other planets.
Microbialites have been discovered in an open pit pond at an abandoned asbestos mine near Clinton Creek, Yukon,
Canada. These microbialites are extremely young and presumably began forming soon after the mine closed in 1978. The combination of a low sedimentation rate, high calcification rate, and low microbial growth rate appears to result in the formation of these microbialites. Microbialites at an historic mine site demonstrates that an anthropogenically constructed environment can foster microbial carbonate formation. This has implications for creating artificial environments for building modern microbialites including stromatolites.
A very rare type of non-lake dwelling stromatolite lives in the Nettle Cave at Jenolan Caves, NSW, Australia. The cyanobacteria live on the surface of the limestone and are sustained by the calcium-rich dripping water, which allows them to grow toward the two open ends of the cave which provide light.
Stromatolites composed of calcite have been found in both the Blue Lake in the dormant volcano, Mount Gambier and at least eight cenote lakes including the Little Blue Lake in the Lower South-East of South Australia.
See also
Banded iron formation
Cotham Marble
Gunflint Range
Laguna Negra, Catamarca
Microbially induced sedimentary structure
Ojos de Mar
Thrombolites
References
Further reading
External links
Stromatolite photo gallery, a teaching set from Ohio State University
Trace fossils
Cyanobacteria
Sedimentary rocks | Stromatolite | Biology | 2,640 |
22,690,116 | https://en.wikipedia.org/wiki/Moving%20particle%20semi-implicit%20method | The moving particle semi-implicit (MPS) method is a computational method for the simulation of incompressible free surface flows. It is a macroscopic, deterministic particle method (Lagrangian mesh-free method) developed by Koshizuka and Oka (1996).
Method
The MPS method is used to solve the Navier-Stokes equations in a Lagrangian framework. A fractional step method is applied which consists of splitting each time step in two steps of prediction and correction. The fluid is represented with particles, and the motion of each particle is calculated based on the interactions with the neighboring particles by means of a kernel function. The MPS method is similar to the SPH (smoothed-particle hydrodynamics) method (Gingold and Monaghan, 1977; Lucy, 1977) in that both methods provide approximations to the strong form of the partial differential equations (PDEs) on the basis of integral interpolants. However, the MPS method applies simplified differential operator models solely based on a local weighted averaging process without taking the gradient of a kernel function. In addition, the solution process of MPS method differs to that of the original SPH method as the solutions to the PDEs are obtained through a semi-implicit prediction-correction process rather than the fully explicit one in original SPH method.
Applications
Through the past years, the MPS method has been applied in a wide range of engineering applications including Nuclear Engineering (e.g. Koshizuka et al., 1999; Koshizuka and Oka, 2001; Xie et al., 2005), Coastal Engineering (e.g. Gotoh et al., 2005; Gotoh and Sakai, 2006), Environmental Hydraulics (e.g. Shakibaeina and Jin, 2009; Nabian and Farhadi, 2016), Ocean Engineering (Shibata and Koshizuka, 2007; Sueyoshi et al., 2008; Zuo et al. 2022), Structural Engineering (e.g. Chikazawa et al., 2001), Mechanical Engineering (e.g. Heo et al., 2002; Sun et al., 2009), Bioengineering (e.g. Tsubota et al., 2006) and Chemical Engineering (e.g. Sun et al., 2009; Xu and Jin, 2018).
Improvements
Improved versions of MPS method have been proposed for enhancement of numerical stability (e.g. Koshizuka et al., 1998; Zhang et al., 2005; Ataie-Ashtiani and Farhadi, 2006;Shakibaeina and Jin, 2009; Jandaghian and Shakibaeinia, 2020; Cheng et al. 2021), momentum conservation (e.g. Hamiltonian MPS by Suzuki et al., 2007; Corrected MPS by Khayyer and Gotoh, 2008; Enhanced MPS by Jandaghian and Shakibaeinia, 2020), mechanical energy conservation (e.g. Hamiltonian MPS by Suzuki et al., 2007), pressure calculation (e.g. Khayyer and Gotoh, 2009, Kondo and Koshizuka, 2010, Khayyer and Gotoh, 2010, Xu and Jin, 2019), and for simulation of multiphase and granular flows (Nabian and Farhadi 2016; Xu and Jin, 2021; Xu and Li, 2022).
References
R.A. Gingold and J.J. Monaghan, "Smoothed particle hydrodynamics: theory and application to non-spherical stars," Mon. Not. R. Astron. Soc., Vol 181, pp. 375–89, 1977.
L.B. Lucy, "A numerical approach to the testing of the fission hypothesis," Astron. J., Vol 82, pp. 1013–1024, 1977.
S. Koshizuka and Y. Oka, "Moving particle semi-implicit method for fragmentation of incompressible fluid," Nuclear Science and Engineering, Vol 123, pp. 421–434, 1996.
S. Koshizuka, A. Nobe and Y. Oka, "Numerical Analysis of Breaking Waves Using the Moving Particle Semi-implicit Method," Int. J. Numer. Meth. Fluid, Vol 26, pp. 751–769, 1998.
S. Koshizuka, H. Ikeda and Y. Oka, "Numerical analysis of fragmentation mechanisms in vapor explosions," Nuclear Engineering and Design, Vol 189, pp. 423–433, 1999.
Y. Chikazawa, S. Koshizuka, and Y. Oka, "A particle method for elastic and visco-plastic structures and fluid-structure interactions," Comput. Mech. 27, pp. 97–106, 2001.
S. Koshizuka, S. and Y. Oka, "Application of Moving Particle Semi-implicit Method to Nuclear Reactor Safety," Comput. Fluid Dyn. J., Vol 9, pp. 366–375, 2001.
S. Heo, S. Koshizuka and Y. Oka, "Numerical analysis of boiling on high heat-flux and high subcooling condition using MPS-MAFL," International Journal of Heat and Mass Transfer, Vol 45, pp. 2633–2642, 2002.
H. Gotoh, H. Ikari, T. Memita and T. Sakai, "Lagrangian particle method for simulation of wave overtopping on a vertical seawall," Coast. Eng. J., Vol 47, No 2–3, pp. 157–181, 2005.
H. Xie, S. Koshizuka and Y. Oka, "Simulation of drop deposition process in annular mist flow using three-dimensional particle method," Nuclear Engineering and Design, Vol 235, pp. 1687–1697, 2005.
S. Zhang, K. Morita, K. Fukuda and N. Shirakawa, "An improved MPS method for numerical simulations of convective heat transfer problems," Int. J. Numer. Meth. Fluid, 51, 31–47, 2005.
B. Ataie-Ashtiani and L. Farhadi, "A stable moving particle semi-implicit method for free surface flows," Fluid Dynamics Research 38, pp. 241–256, 2006.
H. Gotoh and T. Sakai, "Key issues in the particle method for computation of wave breaking," Coastal Engineering, Vol 53, No 2–3, pp. 171–179, 2006.
K. Tsubota, S. Wada, H. Kamada, Y. Kitagawa, R. Lima and T. Yamaguchi, "A Particle Method for Blood Flow Simulation – Application to Flowing Red Blood Cells and Platelets–," Journal of the Earth Simulator, Vol 5, pp. 2–7, 2006.
K. Shibata and S. Koshizuka, "Numerical analysis of shipping water impact on a deck using a particle method," Ocean Engineering, Vol 34, pp. 585–593, 2007.
Y. Suzuki, S. Koshizuka, Y. Oka, "Hamiltonian moving-particle semi-implicit (HMPS) method for incompressible fluid flows," Computer Methods in Applied Mechanics and Engineering, Vol 196, pp. 2876-2894, 2007.
A. Khayyer and H. Gotoh, "Development of CMPS method for accurate water-surface tracking in breaking waves," Coast. Eng. J., Vol 50, No 2, pp. 179–207, 2008.
M. Sueyoshi, M. Kashiwagi and S. Naito, "Numerical simulation of wave-induced nonlinear motions of a two-dimensional floating body by the moving particle semi-implicit method," Journal of Marine Science and Technology, Vol 13, pp. 85–94, 2008.
A. Khayyer and H. Gotoh, "Modified Moving Particle Semi-implicit methods for the prediction of 2D wave impact pressure," Coastal Engineering, Vol 56, pp. 419–440, 2009.
A. Shakibaeinia and Y.C. Jin "A weakly compressible MPS method for simulation open-boundary free-surface flow." Int. J. Numer. Methods Fluids, 63 (10):1208–1232 (Published Online: 7 Aug 2009 ).
A. Shakibaeinia and Y.C. Jin "Lagrangian Modeling of flow over spillways using moving particle semi-implicit method." Proc. 33rd IAHR Congress, Vancouver, Canada, 2009, 1809–1816.
Z. Sun, G. Xi and X. Chen, "A numerical study of stir mixing of liquids with particle method," Chemical Engineering Science, Vol 64, pp. 341–350, 2009.
Z. Sun, G. Xi and X. Chen, "Mechanism study of deformation and mass transfer for binary droplet collisions with particle method," Phys. Fluids, Vol 21, 032106, 2009.
A. Khayyer and H. Gotoh, "A higher order Laplacian model for enhancement and stabilization of pressure calculation by the MPS method," Applied Ocean Research, Vol 32, pp. 124-131, 2010.
A. Shakibaeinia and Y.C. Jin "A mesh-free particle model for simulation of mobile-bed dam break." Advances in Water Resources, 34 (6):794–807 .
A. Shakibaeinia and Y.C. Jin "A MPS Based Mesh-free Particle Method for Open Channel flow." Journal of Hydraulic Engineering ASCE. 137(11): 1375–1384. 2011.
M. Kondo and S. Koshizuka, "Improvement of stability in moving particle semi-implicit method", Int. J. Numer. Meth. Fluid, Vol. 65, pp. 638-654, 2011.
A. Shakibaeinia and Y.C. Jin "MPS Mesh-Free Particle Method for Multiphase Flows." Computer methods in Applied Mechanics and Engineering. 229–232: 13–26. 2012.
K.S. Kim, M.H. Kim and J.C. Park, "Development of MPS (Moving Particle Simulation) method for Multi-liquid-layer Sloshing," Journal of Mathematical Problems in Engineering, Vol 2014,
M.A. Nabian and L. Farhadi, "Multiphase Mesh-Free Particle Method for Simulating Granular Flows and Sediment Transport," Journal of Hydraulic Engineering, 2016.
T. Xu, Y. C. Jin, Simulation the convective mixing of CO2 in geological formations with a meshless model. Chemical Engineering Science, 192, 187-198, 2018.
T. Xu, Y. C. Jin, Improvement of a projection-based particle method in free-surface flows by improved Laplacian model and stabilization techniques. Computers & Fluids, 191, 104235, 2019.
M. Jandaghian and A. Shakibaeinia "An enhanced weakly-compressible MPS method for free-surface flows," Computer Methods in Applied Mechanics and Engineering, vol. 360, p. 112771, 2020/03/01/ 2020, doi: https://doi.org/10.1016/j.cma.2019.112771.
L. Y. Cheng, R. A. Amaro Jr., E. H. Favero, "Improving stability of moving particle semi-implicit method by source terms based on time-scale correction of particle-level impulses," Engineering Analysis with Boundary Elements, Vol. 131, pp. 118-145, 2021.
T. Xu, Y. C. Jin, Two-dimensional continuum modelling granular column collapse by non-local peridynamics in a mesh-free method with rheology. Journal of Fluid Mechanics, 917, A51, 2021.
T. Xu, S. S. Li, Development of a non-local partial Peridynamic explicit mesh-free incompressible method and its validation for simulating dry dense granular flows. Acta Geotechnica, 1-20, 2022.
J. Zuo, T. Xu, D. Z. Zhu, H. Gu, Impact pressure of dam-break waves on a vertical wall with various downstream conditions by an explicit mesh-free method. Ocean Engineering, 256, 111569, 2022.
Specific
External links
Laboratory of Professor Seiichi Koshizuka at the University of Tokyo, Japan
Laboratory of Professor Hitoshi Gotoh at Kyoto University, Japan
MPS-RYUJIN by Fuji Technical Research
Fluid dynamics
Numerical differential equations | Moving particle semi-implicit method | Chemistry,Engineering | 2,664 |
21,906,457 | https://en.wikipedia.org/wiki/Electroglottograph | The electroglottograph, or EGG, (also referred to as a laryngograph) is a device used for the noninvasive measurement of the degree of contact between the vibrating vocal folds during voice production. Though it is difficult to verify the assumption precisely, the aspect of contact being measured by a typical EGG unit is considered to be the vocal fold contact area (VFCA). To measure VFCA, electrodes are applied on the surface of the neck so that the EGG records variations in the transverse electrical impedance of the larynx and nearby tissues by means of a small A/C electric current (in megaHertz). This electrical impedance will vary slightly with the area of contact between the moist vocal folds during the segment of the glottal vibratory cycle in which the folds are in contact. However, because the percentage variation in the neck impedance caused by vocal fold contact can be extremely small and varies considerably between subjects, no absolute measure of contact area is obtained, only the pattern of variation for a given subject.
Early commercial available EGG units were compared quite thoroughly by Baken. However, using modern low noise electronics, EGG noise levels can be brought down enough so that the noise is approximately 40 dB, a factor of 100 less than a typical EGG signal from an adult voice.
In addition, by using multiple channels simultaneously, the technique can be made easier to use and more reliable by giving the user an indication of the correct positioning of the electrodes, and providing a quantitative measure of vertical movements of the larynx during voice production.
Electroglottograph signals have also been used in stroboscope synchronization, voice fundamental frequency tracking, tracking vocal fold abductory movements and the study of the singing voice.
Electroglottographic wavegrams are a new technique for displaying and analyzing EGG signals. This technique provides an intuitive means for quickly assessing vocal fold contact phenomena and their variation over time.
References
External links
Glottal Enterprises EG2-PCX
Laryngograph Electro-Laryngograph
VoceVista Electroglottograph
Voice technology
Human voice
Impedance measurements | Electroglottograph | Physics | 437 |
8,591,753 | https://en.wikipedia.org/wiki/List%20of%20stars%20in%20Mensa | This is the list of notable stars in the constellation Mensa, sorted by decreasing brightness.
See also
List of stars by constellation
References
List
Mensa | List of stars in Mensa | Astronomy | 31 |
225,179 | https://en.wikipedia.org/wiki/Industrial%20design%20right | An industrial design right is an intellectual property right that protects the visual design of objects that are purely utilitarian. An industrial design consists of the creation of a shape, configuration or composition of pattern or color, or combination of pattern and color in three-dimensional form containing aesthetic value. An industrial design can be a two- or three-dimensional pattern used to produce a product, industrial commodity or handicraft.
Under the Hague Agreement Concerning the International Deposit of Industrial Designs, a WIPO-administered treaty, a procedure for an international registration exists. To qualify for registration, the national laws of most member states of WIPO require the design to be novel. An applicant can file for a single international deposit with WIPO or with the national office in a country party to the treaty. The design will then be protected in as many member countries of the treaty as desired. Design rights started in the United Kingdom in 1787 with the Designing and Printing of Linen Act and have expanded from there.
Registering for an industrial design right is related to granting a patent.
Law making
Kenya
According to industrial property Act 2001, an industrial design is defined as "any composition of lines or colours or any three-dimensional form whether or not associated with lines or colours, provided that such composition or form gives a special appearance to a product of industry or handicraft and can serve as pattern for a product of industry or handicraft" .
An industrial design is registrable if it is new. An industrial design is deemed to be new if it has not been disclosed to the public, anywhere in the world, by publication in tangible form or, in Kenya by use or in any other way, prior to the filing date or, where applicable, the priority date of the application for registration. However a disclosure of the industrial design is not taken into consideration if it occurred not earlier than twelve months before the filing date or, where applicable, the priority date of the application and if it was by reason or in consequence of acts committed by the applicant or his predecessor in title; or an evident abuse committed by a third party in relation to the applicant or his predecessor in title.
India
India's Design Act, 2000 was enacted to consolidate and amend the law relating to protection of design and to comply with the articles 25 and 26 of Trade-Related Aspects of Intellectual Property Rights TRIPS agreement. The new act, (earlier Patent and Design Act, 1911 was repealed by this act) now defines "design" to mean only the features of shape, configuration, pattern, ornament, or composition of lines or colours applied to any article, whether in two- or three-dimensional, or in both forms, by any industrial process or means, whether manual or mechanical or chemical, separate or combined, which in the finished article appeal to and are judged solely by the eye; but does not include any mode or principle of construction.
Indonesia
In Indonesia the protection of the Right to Industrial Design shall be granted for 10 (ten) years commencing from the filing date and there is not any renewal or annuity after the given period.
Industrial Designs that are Granted Protection
1. The Right to Industrial Design shall be granted for an Industrial Design that is novel/new
2. An Industrial Design shall be deemed new if on the filing date, such Industrial Design is not the same as any previous disclosure.
3. The previous disclosure as referred to in point 2 shall be one which before :
a. The filing date or
b. The Priority Date, if the applicant is filed with priority right.
c. Has been announced or used in Indonesia or outside Indonesia.
An industrial design shall not be deemed to have been announced if within the period of 6 (six) months at the latest before the filing date, such industrial design
a. Has been displayed in a national or international exhibition in Indonesia or overseas that is official or deemed to be official; or,
b. Has been used in Indonesia by the designer in an experiment for the purposes of education, research or development.
Canada
Canadian law affords ten years of protection to industrial designs that are registered; there is no protection for unregistered designs. The Industrial Design Act defines "design" or "industrial design" to mean "features of shape, configuration, pattern or ornament and any combination of those features that, in a finished article, appeal to and are judged solely by the eye." The design must also be original: in 2012, the Patent Appeal Board rejected a design for a trash can, and gave guidance as to what the Act requires:
The degree of originality required to register an original design is greater than that laid down by Canadian copyright legislation, but less than that required to register a patent.
The articles being compared should not be examined side by side, but separate so that imperfect recollection comes into play.
One is to look at the design as a whole.
Any change must be substantial. It must not be trivial or infinitesimal.
During the existence of an exclusive right, no person can "make, import for the purpose of trade or business, or sell, rent, or offer or expose for sale or rent, any article in respect of which the design is registered." The rule also applies to kits and substantial differences are in reference to previously published designs.
Registering an industrial design in Canada may be appropriate for a variety of articles such as consumer products, vehicles, sports equipment, packaging, etc., having an original aesthetic appearance, and may even be used to protect new technologies such as electronic icons. Industrial designs can also serve to complement other forms of intellectual property rights such as patents and trade-marks.
The Canadian courts see infrequent litigation concerning industrial designs the first case in almost two decades took place in 2012 between Bodum and Trudeau Corporation concerning visual features of double wall drinking glasses.
It is possible for a registered design to also receive protection under Canadian copyright or trademark law:
a "useful article" (ie, one with a utilitarian function) will receive copyright protection where it is reproduced in a quantity of fifty or less, but that limitation does not apply with respect to:
a graphic or photographic representation that is applied to the face of an article
a trade-mark or a representation thereof or a label
material that has a woven or knitted pattern or that is suitable for piece goods or surface coverings or for making wearing apparel
a representation of a real or fictitious being, event or place that is applied to an article as a feature of shape, configuration, pattern or ornament
where a registered design has become publicly identifiable with the product, it may be eligible for registration as a "distinguishing guise" under trademark law, but such registration cannot be used to limit the development of any art or industry
European Union
Registered and unregistered community designs are available which provide a unitary right covering the European Community. Protection for a registered community design is for up to 25 years, subject to the payment of renewal fees every five years. The unregistered community design lasts for three years after a design is made available to the public and infringement only occurs if the protected design has been copied.
United Kingdom
Legislation given in Britain during the years 1787 to 1839 protected designs for textiles. The Copyright of Design Act passed in 1842 allowed other material designs, such as those for metal and earthenware objects, to be registered with a diamond mark to indicate the date of registration.
In addition to the design protection available under community designs, UK law provides its own national registered design right (Registered Designs Act 1949, later amended by Copyright, Designs and Patents Act 1988) and an unregistered design right. The unregistered right, which exists automatically if the requirements are met, can last for up to 15 years. The registered design right can last up to 25 years subject to the payment of maintenance fees. The topography of semi-conductor circuits are also covered by integrated circuit layout design protection, a form of protection which lasts 10 years.
Japan
Article 1 of the Japanese Design Law states: "This law was designed to protect and utilize designs and to encourage creation of designs in order to contribute to industrial development". The protection period in Japan is 20 years from the day of registration.
United States
U.S. design patents last fifteen years from the date of grant if filed on or after May 13, 2015 (fourteen years if filed before May 13, 2015) and cover the ornamental aspects of utilitarian objects. Objects that lack a use beyond that conferred by their appearance or the information they convey, may be covered by copyright—a form of intellectual property of much longer duration that exists as soon as a qualifying work is created. In some circumstances, rights may also be acquired in trade dress, but trade dress protection is akin to trademark rights and requires that the design have source significance or "secondary meaning." It is useful only to prevent source misrepresentations; trade dress protection.
Australia
In Australia, design patent registration lasts for 5 years, with an option to be extended once for an additional 5 years. For the patent to be granted, a formalities exam is needed. If infringement action is to be taken, the design needs to become certified which involves a substantive examination. This process ensures that the design is truly unique and eligible for protection under Australian patent law.
Duration of design rights
Depending on the jurisdiction registered design rights have a duration between 15 and 50 years. Members of the WIPO Hague system have to publish their maximum term of protection for design rights. These terms are presented in the table below. Some of the jurisdiction below are unions or collaborative office for design registration like the African Intellectual Property Organization, the European Union and the Benelux.
Industrial design applications
Between 1883 and the early 1950s, the offices of Japan and the United States of America averaged a similar number of industrial design applications, rarely exceeding 10,000. The office of Japan received the highest number of applications per year from the 1950s thru to the late 1990s, reaching approximately 50,000 annual filings at its peak. The office of China, which received 640 applications when it first began receiving applications in 1985, has seen an unprecedented rate of growth, peaking at 805,710 applications filed in 2021. The office of the Republic of Korea surpassed the office of Japan in 2004 and has remained in second position ever since. In 2012, the office of the US moved ahead of Japan to become the third largest globally. The EUIPO began receiving applications in 2003 and moved up to fourth position in 2019. Among these top five offices, the EUIPO is the only one to have a multiple design system. Applications filed at the European Union IP Office contained 109,132 designs in 2022.
In 2022, about 1.1 million industrial design applications were filed worldwide. Asia accounted for 70.3% of all designs in applications filed worldwide in 2022. Asia was followed by Europe (22.4%) and North America (4.4%).
Bibliography
Brian W. Gray & Effie Bouzalas, editors, Industrial Design Rights: An International Perspective (Kluwer Law International: The Hague, 2001)
See also
Design patent (US patent law)
Geschmacksmuster (German design law)
Industrial design rights in the European Union
Open-design movement
Utility model
Design Law Treaty
Hague Agreement Concerning the International Deposit of Industrial Designs
References
External links
Information about industrial design rights on the Kenya Industrial Property Institute website.
Information about industrial design rights on the IPAustralia website.
Information about industrial design rights on the UK Patent Office web site
International Designs on the WIPO web site
Hague System for the International Registration of Industrial Designs on the WIPO web site
Intellectual property law | Industrial design right | Engineering | 2,358 |
3,056,687 | https://en.wikipedia.org/wiki/Hydrosere | A hydrosere is a plant succession which occurs in an area of fresh water such as in oxbow lakes and kettle lakes. In time, an area of open freshwater will naturally dry out, ultimately becoming woodland. During this change, a range of different landtypes such as swamp and marsh will succeed each other.
The succession from open water to climax woodland takes centuries or millennia. Some intermediate stages will last a shorter time than others. For example, swamp may change to marsh within a decade or less. How long it takes will depend largely on the amount of siltation occurring in the area of open water.
Stages
Hydrosere is the primary succession sequence which develops in aquatic environments such as lakes and ponds. It results in conversion of water body and its community into a land community. The early changes are allogenic as inorganic particles such as sand and clay are washed from catchment areas and begin filling the basin of the water body. Later, remains of dead plants also fill up these bodies and contribute to further changes in the environment.
If a water body is large and very deep, a strong wave action is at work, therefore in these bodies a noticeable change cannot easily be observed. However, in smaller water bodies such as a pond the succession is easily recognizable. Different plant communities occupy different zones in a water body and exhibit concentric zonation. The edges of the water body are occupied by rooted species, submerged species are found in the littoral zone and plankton and floating species occupy the open water zone.
There is nevertheless still debate about whether dry woodland is always the final climax community, or whether a watery, bog community can also be the final, stable, climax community.
Phytoplankton stage
Phytoplanktons (cyanobacteria), green algae (Spirogyra, Oedogonium), diatoms, etc. are the pioneer colonizers in the initial stage, starting from a water body, such as a pond. Their spores are carried by air to the pond. The phytoplankton are followed by zooplankton. They settle down to the bottom of the pond after death, and decay into humus that mixes with silt and clay particles brought into the basin by run off water and wave action and form soil. As soil builds up, the pond becomes shallower and further environmental changes follow.
Submerged stage
As the water body becomes shallower, more submerged rooted species are able to become established due to increasing light penetration in the shallower water. This is suitable for growth of rooted submerged species such as Myriophyllum, Vallisneria, Elodea, Hydrilla, and Ceratophyllum. These plants root themselves in mud. Once submerged species colonize the successional changes are more rapid and are mainly autogenic as organic matter accumulates. Inorganic sediment is still entering the lake and is trapped more quickly by the net of plant roots and rhizomes growing on the pond floor. The pond becomes sufficiently shallow (2–5 ft) for floating species and less suitable for rooted submerged plants.
Floating stage
The floating plants are rooted in the mud, but some or all their leaves float on the surface of the water. These include species like Nymphaea, Nelumbo and Potamogeton. Some free-floating species also become associated with root plants. The large and broad leaves of floating plants shade the water surface and conditions become unsuitable for growth of submerged species which start disappearing. The plants decay to form organic mud which makes the pond more shallow yet (1–3 ft).
Reed swamp stage
The pond is now invaded by emergent plants such as Phragmites (reed-grasses), Typha (cattail), and Zizania (wild rice) to form a reed-swamp (in North American usage, this habitat is called a marsh). These plants have creeping rhizomes which knit the mud together to produce large quantities of leaf litter. This litter is resistant to decay and reed peat builds up, accelerating the autogenic change. The surface of the pond is converted into water-saturated marshy land.
Sedge-meadow stage
Successive decreases in water level and changes in substratum help members of Cyperaceae and Graminae such as Carex spp. and Juncus to establish themselves. They form a mat of vegetation extending towards the centre of the pond. Their rhizomes knit the soil further. The above water leaves transpire water to lower the water level further and add additional leaf litter to the soil. Eventually the sedge peat accumulates above the water level and soil is no longer totally waterlogged. The habitat becomes suitable for invasion of herbs (secondary species) such as Mentha, Caltha, Iris, and Galium which grow luxuriantly and bring further changes to the environment. Mesic conditions develop and marshy vegetation begins to disappear.
Woodland stage
The soil now remains drier for most of the year and becomes suitable for development of wet woodland. It is invaded by shrubs and trees such as Salix (willow), Alnus (alder), and Populus (poplar). These plants react upon the habitat by producing shade, lower the water table still further by transpiration, build up the soil, and lead to the accumulation of humus with associated microorganisms. This type of wet woodland is also known as carr.
Climax stage
Finally a self-perpetuating climax community develops. It may be a forest if the climate is humid, grassland in case of sub-humid environment, or a desert in arid and semi-arid conditions. A forest is characterized by presence of all types of vegetation including herbs, shrubs, mosses, shade-loving plants and trees. Decomposers are frequent in climax vegetation.
The overall changes taking place during development of successional communities are building up of substratum, shallowing of water, addition of humus and minerals, soil building and aeration of soil. As the water body fills in with sediment, the area of open water decreases and the vegetation types moves inwards as the water becomes shallower. Many of the above-mentioned communities can be seen growing together in a water body. The center is occupied by floating and submerged plants with reeds nearer the shores, followed by sedges and rushes growing at the edges. Still further are shrubs and trees occupying the dry land.
Examples
An example is a small kettle lake called Sweetmere, in Shropshire, UK. Sweetmere is one of many small kettle lakes which formed at the end of the last glacial period when the temperatures began to increase. The ice began to melt and retreat approximately 10,000 years ago.
As the climate slowly began to warm this allowed algae, water lilies and floating aquatic plants to begin to colonise the lake. These, in essence, were the pioneer species. Once these began to die it provided organic matter to the lake bed sediment and therefore increased fertility and reduced depth. As a result, this allowed deeper rooted species to develop such as reed, bulrush and reedmace. At this point there is a growing floating raft of thick organic matter within the lake. Because the bulrushes and reeds have relatively deep roots, this encouraged bioconstruction which traps more sediment, allowing sedges, willow and alder to become established. This process further decreased the water depth and raised the lakebed thus making it drier.
Drier conditions now meant that a wider range of species could inhabit the area. Birch and alder came into dominance. All species which have grown have occurred because of seed transfer either by animals, birds, wind, or water transfer.
Water level is further reduced as a result of further bioconstruction and also due to increasing temperatures there is increased evaporation from the lake.
Underneath the birch canopy developed terrestrial shrubs and grasses. This then increased the acidity which increased the rates of nutrient exchange. The area has been artificially drained and this allowed the oak and ash community to develop. This is the seral stage.
The lake is now being managed by cutting down certain species in order to stop the whole lake becoming dried up and dominated by the oak and ash woodland.
Another example of a hydrosere is Loch a' Mhuilin, located on the Isle of Arran, Scotland. This small lake lies behind a ridge of material deposited towards the end of the last ice age. The lake exhibits characteristic features of a hydrosere, the succession from a fresh water surface with small pioneer plant species to a sub-climax vegetation of alder and willow. The climax vegetation of oak and beech woodland has not been achieved due to the impact of human activities of clearing grazing land, as well as grazing by red deer and rabbits.
See also
Psammosere
Lithosere
Seral community
Xerosere
References
Ecological succession
Limnology
Lakes | Hydrosere | Environmental_science | 1,813 |
45,580,841 | https://en.wikipedia.org/wiki/RS-27 | The RS-27 (Rocket System-27) was a liquid-propellant rocket engine developed in 1974 by Rocketdyne to replace the aging MB-3 in the Delta. Incorporating components of the venerable MB-3 and the H-1 designs, the RS-27 was a modernized version of the basic design used for two decades. It was used to power the first stage of the Delta 2000, 3000, 5000, and the first model of the Delta II, the Delta 6000.
The RS-27 was a modified Rocketdyne H-1 built to power the first stage of the Saturn I and Saturn IB and replaced the MB-3 engine that had been used on previous versions of the Delta launcher. NASA had a large supply of surplus H-1 engines in the early 1970s, as the Apollo program was ending. In addition to its main engine, the RS-27 included two vernier engines to provide vehicle roll control during flight. RS-27 was later developed into the RS-27A and RS-56.
RS-27A
The RS-27A is a liquid-fuel rocket engine developed in 1980s by Rocketdyne for use on the first stage of the Delta II and Delta III launch vehicles. It provides of thrust burning RP-1 and LOX in a gas-generator cycle. The engine is a modified version of its predecessor, the RS-27; its thrust nozzle has been extended to increase its area ratio from 8:1 to 12:1, which provides greater efficiency at altitude.
The RS-27A main engine is neither restartable nor throttleable. In addition to its main engine, it includes two vernier engines to provide vehicle roll control during flight. When used as the main booster propulsion system for the Delta II family of launch vehicles, has an operational duration of 265 seconds.
The last RS-27A engine was used for the ICESat-2 launch on 15 September, 2018.
External links
Aerojet Rocketdyne RS-27A Product Page
Pratt and Whitney RS-27A Brochure
References
Rocketdyne engines
Rocket engines using the gas-generator cycle
Rocket engines using kerosene propellant
Rocket engines of the United States | RS-27 | Astronomy | 443 |
10,881,572 | https://en.wikipedia.org/wiki/Domain%20drop%20catching | Domain drop catching, also known as domain sniping, is the practice of registering a domain name once registration has lapsed, immediately after expiry.
Background
When a domain is first registered, the customer is usually given the option of registering the domain for one year or longer, with automatic renewal as a possible option. Although some domain registrars often make multiple attempts to notify a registrant of a domain name's impending expiration, a failure on the part of the original registrant to provide the registrar with accurate contact information makes an unintended registration lapse possible. Practices also vary, and registrars are not required to notify customers of impending expiration. Unless the original registrant holds a trademark or other legal entitlement to the name, they are often left without any form of recourse in getting their domain name back. It is incumbent on registrants to be proactive in managing their name registrations and to be good stewards of their domain names. By law there are no perpetual rights to domain names after payment of registration fees lapses, aside from trademark rights granted by common law or statute.
Redemption Grace Period (RGP)
The Redemption Grace Period is an addition to ICANN's Registrar Accreditation Agreement (RAA) which allows a registrant to reclaim their domain name for a number of days after it has expired. This length of time varies by TLD, and is usually around 30 to 90 days. Prior to the implementation of the RGP by ICANN, individuals could easily engage in domain sniping to extort money from the original registrant to buy their domain name back.
After the period between the domain's expiry date and the beginning of the RGP, the domain's status changes to "redemption period" during which an owner may be required to pay a fee (typically around US$100) to re-activate and re-register the domain. ICANN's RAA requires registrars to delete domain registrations once a second notice has been given and the RGP has elapsed. At the end of the "pending delete" phase of 5 days, the domain will be dropped from the ICANN database.
Drop catch services
For particularly popular domain names, there are often multiple parties anticipating the expiration. Competition for expiring domain names has since become a purview of drop catching services. These services offer to dedicate their servers to securing a domain name upon its availability, usually at an auction price. Individuals with their limited resources find it difficult to compete with these drop catching firms for highly desirable domain names.
Retail registrars such as GoDaddy or eNom retain names for auction through services such as TDNAM or Snapnames through a practice known as domain warehousing. Drop catch services are performed by both ICANN-accredited registrars and non-accredited registrars.
Domain futures / options or back-orders
Some registry operators (for example dot-РФ, dot-PL, dot-RU, dot-ST, dot-TM, dot-NO) offer a service by which a back-order (also sometimes known as a "domain future" or "domain option") can be placed on a domain name.
If a domain name is due to return to the open market, then the owner of the back-order will be given the first opportunity to acquire the domain name before the name is deleted and is open to a free-for-all. In this way back-orders will usually take precedence over drop-catch.
There may be a fee for the back-order itself, often only one back-order can be placed per domain name and a further purchase or renewal fee may be applicable if the back-order succeeds.
Back-Orders typically expire in the same way domain names do, so are purchased for a specific number of years.
Different operators have different rules. In some cases back-orders can only be placed at certain times, for example after the domain name has expired, but before it has returned to the open market (see Redemption Grace Period).
In the Commodity market sense, a back-order is often more like an "option" than a "future" as there is often no obligation for the new registrant to take the name, even after it has been handed to the owner of the back-order. For example, some registries give the new registrant 30 days to purchase a renewal on the name before it is once again returned to the open market (or any new back-order registrant).
See also
Domain hijacking
Domain tasting
Domain warehousing
Drop registrar
References
Domain Name System
Internet ethics | Domain drop catching | Technology | 956 |
825,977 | https://en.wikipedia.org/wiki/Living%20room | In Western architecture, a living room, also called a lounge room (Australian English), lounge (British English), sitting room (British English), or drawing room, is a room for relaxing and socializing in a residential house or apartment. Such a room is sometimes called a front room when it is near the main entrance at the front of the house. In large, formal homes, a sitting room is often a small private living area adjacent to a bedroom, such as the Queens' Sitting Room and the Lincoln Sitting Room of the White House.
In the late 19th or early 20th century, Edward Bok advocated using the term living room for the room then commonly called a parlo[u]r or drawing room, and is sometimes erroneously credited with inventing the term. It is now a term used more frequently when referring to a space to relax and unwind within a household. Within different parts of the world, living rooms are designed differently and evolving, but all share the same purpose, to gather users in a comfortable space.
Overview
In homes that lack a parlour or family room, the living room may also function as a drawing room for guests. Objects in living rooms may be used "to instigate and mediate contemplation about significant others, as well as to regulate the amount of intimacy desired with guests."
A typical Western living room may contain furnishings such as a couch, chairs, occasional tables, coffee tables, bookshelves, televisions, electric lamps, rugs, or other furniture. Depending on climate, sitting rooms would traditionally contain a fireplace, dating from when this was necessary for heating. In a Japanese sitting room, called a washitsu, the floor is covered with tatami, sectioned mats, on which people can sit comfortably. They also typically consist of shoji, fusuma, and ramas which allow for the space to be very minimalistic and cohesive. Japanese living room design concepts contradicted UK and New Zealand ideals in the way that Japanese culture believed in warming the person, instead of the home. This consisted of owning a portable hibachi for cooking needs rather than heating needs, meanwhile people in the UK and New Zealand used fireplaces to warm the space and not for cooking needs. Japanese cultural belief systems affected their design characteristics in the way that ornamentation should be minimal while incorporating natural elements.
From parlour room to living room
Until the late 19th century, the front parlour was the room in the house used for formal social events, including where the recent deceased were laid out before their funeral. This room had only traditionally been used on Sundays or for formal occasions such as the ceremonies of deceased family members before proper burial; it was the buffer zone between the public and private area within the house. Sundays are now more typically used for watching football on large color televisions causing larger family rooms to become more popular during the 1970s. The term "living room" is found initially in the decorating literature of the 1890s, where a living room is understood to be a reflection of the personality of the designer, rather than the Victorian conventions of the day. Only the wealthy were able to afford several rooms within a space such as parlors, libraries, drawing rooms, and smoking rooms.
The change in terminology is credited to Edward Bok due to his accreditation of the magazine article, Ladies' Home Journal. The article was specifically targeted to women and provided them with reliance of popular content in relation to home design at an affordable price and Bok's vision of the ideal American household and the roles of the women. Bok strongly believed that the space should be "lived in" rather than having an expensively furnished room that was rarely used within the household. He had promoted the new name to encourage people to use the room in their daily lives as a gathering space.
Evolution of the modern living room
Interior designers and architects throughout time have continuously studied users within a space to design to best fit their needs and wants. King of France, Louis XIV’s Palace of Versailles can be considered having one of the most lavishly decorated living rooms in the late 1600s. During King Louis XIV's reign, the architectural Louis XIV style or Louis Quatorze was established. This style can also be identified as the French Classicism and had an influence on other countries. It included the bold use of marble and bronze materials. Louis XIV worked alongside Louis Le Vau and Augustin-Charles d’Aviler to design appartments de parade, otherwise known as formal rooms that usually consisted of discussing and conducting business matters. They also designed, appartements de commodité, which were rooms that the homeowners could relax and lounge in. This style, known as the Louis XV style, or Louis Quinze, was designed intentionally to combine formality with a new level of comfort. Charles Étienne Briseux, French architect whose architectural style was prominently Louis Quinze, published Architecture moderne ou L’art de bien bâtir in 1728, introduced comfort which later became an obsession to have specific materiality and furnishings within the interior of a space. Its influenced began in Paris, France, and then quickly spread across Europe reaching the attention of the wealthy and lavish.
The Industrial Revolution emerged in the late 1700s which completely shifted America from an artisan and handmade process to a society that was dominated by a machine manufacturing industry. This allowed the production of chairs, tables, light bulbs, telegraphs, and radios that allowed society to purchase at a reasonable price to add into their home. The rise of the Industrial Revolution played a huge role in the advancement of the living room because due to mass production, decorative items became more available to the middle class.
An example of this evolution is the Miller House designed by Eero Saarinen. Saarinen knew that he wanted to design a living room not only with an appropriate architectural style but to feature "conversation pit" that sunk users to the ground making them feel a bit more "grounded." It encouraged relaxation and conversing which the Miller House was one of the first spaces to celebrate and introduce the conversation pit. The Miller House's architectural style was known as Mid-century modern, this indicated that it was introduced after World War II between 1945 and 1960. The movement was associated with minimal ornamentation, simplicity, honest materials, and craftsmanship.
Architectural styles
Romanesque (800–200):
Thick walls
Coffered ceilings
Columns
Neutral colors
Gothic (1100–1450):
Stained glass windows
Ribbed vaults
Ornate decoration
Pointed arches
Renaissance (1400–1450):
Plasterwork
Color and geometric patterns
Fine wall paintings
Richly decorated
Baroque (1600–1830):
Luxuriously decorated
Rich color palette
Carved detailing
High-end materials
Rococo (1650–1790):
Pastel color palette
Elaborate ornamentation
Sensuous curvy lines
Superior craftsmanship
Neoclassicism (1730–1925):
Muted hues of color
Simple and symmetrical furniture
Decorative motifs
Geometric patterns
Art Nouveau (1890–1914):
Inspiration from nature
Flamboyant color palette
Sensuous curvy lines
Decorative and ornamental
Beaux Arts (1895–1925):
Highly decorative surfaces
Focus on symmetry
Curves and arches
Columns and detailed surfaces
Neo-Gothic (1905–1930):
Emphasis on vertical elements
Natural lighting
Stained glass windows
Highly detailed surfaces
Art Deco (1925–1937):
Rich colors
Bold geometry
Decadent detail work
Stylized geometric motifs
Modernist Styles (1900–present):
Simplicity
Clean lines
Natural lines
Mixture of bold and neutral colors
Postmodernism (1972–present):
Bold colors
Asymmetrical
Exaggerated scale
Unnatural materials
Neo-Modernism (1997–present):
Angles over curves
Monochrome or vibrant
Experiment with shapes
Use metallic and eco materials
Parametricism (1997–present):
Neutral colors
Large in scale
Sensuous lines
Natural materials
See also
Drawing room
Lobby
Lounge (disambiguation)
Parlour
References
External links
Rooms | Living room | Engineering | 1,610 |
8,756,160 | https://en.wikipedia.org/wiki/Westphalen%E2%80%93Lettr%C3%A9%20rearrangement | The Westphalen–Lettré rearrangement is a classic organic reaction in organic chemistry describing a rearrangement reaction of cholestane-3β,5α,6β-triol diacetate with acetic anhydride and sulfuric acid. In this reaction one equivalent of water is lost, a double bond is formed at C10–C11 and importantly the methyl group at the C10 position migrates to the C5 position.
The reaction is first-order in steroid in the presence of an excess of sulfuric acid and the first reaction step in the reaction mechanism is likely the formation of a sulfate ester followed by that of a carbocation at C5 after which the actual re-arrangement takes place.
References
Rearrangement reactions
Name reactions | Westphalen–Lettré rearrangement | Chemistry | 162 |
296,428 | https://en.wikipedia.org/wiki/Admittance | In electrical engineering, admittance is a measure of how easily a circuit or device will allow a current to flow. It is defined as the reciprocal of impedance, analogous to how conductance and resistance are defined. The SI unit of admittance is the siemens (symbol S); the older, synonymous unit is mho, and its symbol is ℧ (an upside-down uppercase omega Ω). Oliver Heaviside coined the term admittance in December 1887. Heaviside used to represent the magnitude of admittance, but it quickly became the conventional symbol for admittance itself through the publications of Charles Proteus Steinmetz. Heaviside probably chose simply because it is next to in the alphabet, the conventional symbol for impedance.
Admittance , measured in siemens, is defined as the inverse of impedance , measured in ohms:
Resistance is a measure of the opposition of a circuit to the flow of a steady current, while impedance takes into account not only the resistance but also dynamic effects (known as reactance). Likewise, admittance is not only a measure of the ease with which a steady current can flow, but also the dynamic effects of the material's susceptance to polarization:
where
is the admittance (siemens);
is the conductance (siemens);
is the susceptance (siemens); and
, the imaginary unit.
The dynamic effects of the material's susceptance relate to the universal dielectric response, the power law scaling of a system's admittance with frequency under alternating current conditions.
Conversion from impedance to admittance
The impedance, , is composed of real and imaginary parts,
where
is the resistance (ohms); and
is the reactance (ohms).
Admittance, just like impedance, is a complex number, made up of a real part (the conductance, ), and an imaginary part (the susceptance, ), thus:
where (conductance) and (susceptance) are given by:
The magnitude and phase of the admittance are given by:
where
is the conductance, measured in siemens; and
is the susceptance, also measured in siemens.
Note that (as shown above) the signs of reactances become reversed in the admittance domain; i.e. capacitive susceptance is positive and inductive susceptance is negative.
Shunt admittance in electrical power systems modeling
In the context of electrical modeling of transformers and transmission lines, shunt components that provide paths of least resistance in certain models are generally specified in terms of their admittance. Each side of most transformer models contains shunt components which model magnetizing current and core losses. These shunt components can be referenced to the primary or secondary side. For simplified transformer analysis, admittance from shunt elements can be neglected. When shunt components have non-negligible effects on system operation, the shunt admittance must be considered. In the diagram below, all shunt admittances are referred to the primary side. The real and imaginary components of the shunt admittance, conductance and susceptance, are represented by and , respectively.
Transmission lines can span hundreds of kilometers, over which the line's capacitance can affect voltage levels. For short length transmission line analysis, which applies to lines shorter than , this capacitance can be ignored and shunt components are not necessary in the model. Lines from , generally considered to be in the medium-line category, contain a shunt admittance governed by
where
is the total shunt admittance;
is the shunt admittance per unit length;
is the length of the transmission line; and
is the capacitance of the line.
See also
Nodal admittance matrix
SI electromagnetism units
Immittance
References
Physical quantities
Electrical resistance and conductance | Admittance | Physics,Mathematics | 801 |
740,995 | https://en.wikipedia.org/wiki/Otto%20Hesse | Ludwig Otto Hesse (22 April 1811 – 4 August 1874) was a German mathematician. Hesse was born in Königsberg, Prussia, and died in Munich, Bavaria. He worked mainly on algebraic invariants, and geometry. The Hessian matrix, the Hesse normal form, the Hesse configuration, the Hessian group, Hessian pairs, Hesse's theorem, Hesse pencil, and the Hesse transfer principle are named after him. Many of Hesse's research findings were presented for the first time in Crelle's Journal or Hesse's textbooks.
Life
Hesse was born in Königsberg (today Kaliningrad) as the son of Johann Gottlieb Hesse, a businessman and brewery owner and his wife Anna Karoline Reiter (1788–1865). He studied in his hometown at the Albertina under Carl Gustav Jacob Jacobi. Among his teachers were count Friedrich Wilhelm Bessel and Friedrich Julius Richelot. He earned his doctorate in 1840 at the University of Königsberg with the dissertation De octo punctis intersectionis trium superficium secundi ordinis. In 1841, Hesse completed his habilitation thesis. In the same year he married Sophie Marie Emilie Dulk, the daughter of pharmacists and chemistry professor Friedrich Philipp Dulk (1788–1852). The couple had a son and five daughters. Hesse taught for some time physics and chemistry at the Vocational School in Königsberg and lectured at the Albertina. In 1845 he was appointed associate professor in Königsberg. In 1855 he moved to Halle and in 1856 to Heidelberg until 1868, when he finally moved to Munich to the newly established Polytechnic School. In 1869 he joined the Bavarian Academy of Sciences.
His doctoral students include Olaus Henrici, Gustav Kirchhoff, Jacob Lüroth, Adolph Mayer, Carl Neumann, Max Noether, Ernst Schröder, and Heinrich Martin Weber.
Works
Vorlesungen über analytische Geometrie des Raumes. (Lectures on analytic geometry of space) Leipzig (3. A. 1876) (Internet Archive)
Vorlesungen aus der analytischen Geometrie der geraden Linie, des Punktes und des Kreises. (Lectures from the analytical geometry of the straight line, the point and the circle) Leipzig (1881). Hrsg. A. Gundelfinger (Internet Archive)
Die Determinanten elementar behandelt. (Determinants elementary treated) Leipzig (2. A. 1872) (Göttinger Digitalisierungszentrum)
Die vier Species. (The four Species) Leipzig (1872) (Internet Archive)
His collected works were published in 1897 by Bavarian Academy of Sciences and Humanities.
(Internet Archive)
References
External links
Vorlesungen über analytische Geometrie des Raumes, insbesondere über Oberflächen zweiter Ordnung
Complete Dictionary of Scientific Biography: "Hesse, Ludwig Otto"
1811 births
1874 deaths
19th-century German mathematicians
Algebraists
German geometers
Scientists from Königsberg
University of Königsberg alumni
Academic staff of the University of Königsberg
Academic staff of the Martin Luther University of Halle-Wittenberg
Academic staff of Heidelberg University
Academic staff of the Technical University of Munich
German textbook writers
Members of the Göttingen Academy of Sciences and Humanities | Otto Hesse | Mathematics | 685 |
40,208,274 | https://en.wikipedia.org/wiki/Michiei%20Oto | Michiei Oto is a molecular biologist and an expert on the application of biotechnology to genetic testing.
He was the first to propose gene literacy education.
Oto was born in Japan. He received a bachelor's degree in biochemistry from Chiba University in 1980 and a Ph.D. from the School of Medicine at Tokyo Medical and Dental University. He is the department director of biotechnology at Tokyo Technical College and a visiting Lecturer at Tokyo University of Agriculture and Technology, Maebashi Institute of Technology and Kogakuin University.
References
Japanese molecular biologists
Biotechnologists
Living people
Chiba University alumni
Tokyo Medical and Dental University alumni
Year of birth missing (living people) | Michiei Oto | Biology | 136 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.