id int64 580 79M | url stringlengths 31 175 | text stringlengths 9 245k | source stringlengths 1 109 | categories stringclasses 160
values | token_count int64 3 51.8k |
|---|---|---|---|---|---|
70,876,095 | https://en.wikipedia.org/wiki/Schilling%20%28unit%29 | As well as being the name of a coin, the Schilling was an historical unit in three areas of measurement: numbers, volume and weight. It can be regarded as a European measure, because it was used in Bohemia, Bavaria, Silesia, Austria and Lusatia.
In Bohemian mines it was a measure of volume that corresponded to 5 wheelbarrows. The schilling was determined as follows:
1 schilling = 12 leather skins filled with water = 480 Prague pints
18 schillings = 1 quantity (Losung) of water
In Regensburg the measure was applied to salt. In Bavaria, for example, it was used as a number and a weight.
1 schilling salt = 40 'slices' (Salzscheiben)
8 schillings = 1 Pfund ("pound") of salt
In Austria a schilling corresponded to the number 30 and
in Silesia and Lusatia, the number 12. In the regional dialect it was called a Schilger in Silesia and a Schilger or Schilk in Lusatia.
240 pfennigs were minted from the 367 g Carolingian pound of silver. A schilling was determined to be twelve pfennigs, but was initially not an actual coin.
Footnotes
References
Literature
Joachim Heinrich Campe: Wörterbuch der deutschen Sprache. Volume 4, Brunswick: Schulbuchhandlung, 1810, p. 141
Obsolete units of measurement
Units of amount
Units of mass
Units of volume
Units of measurement of the Holy Roman Empire | Schilling (unit) | Physics,Mathematics | 322 |
614,192 | https://en.wikipedia.org/wiki/Paschen%27s%20law | Paschen's law is an equation that gives the breakdown voltage, that is, the voltage necessary to start a discharge or electric arc, between two electrodes in a gas as a function of pressure and gap length. It is named after Friedrich Paschen who discovered it empirically in 1889.
Paschen studied the breakdown voltage of various gases between parallel metal plates as the gas pressure and gap distance were varied:
With a constant gap length, the voltage necessary to arc across the gap decreased as the pressure was reduced and then increased gradually, exceeding its original value.
With a constant pressure, the voltage needed to cause an arc reduced as the gap size was reduced but only to a point. As the gap was reduced further, the voltage required to cause an arc began to rise and again exceeded its original value.
For a given gas, the voltage is a function only of the product of the pressure and gap length. The curve he found of voltage versus the pressure-gap length product (right) is called Paschen's curve. He found an equation that fit these curves, which is now called Paschen's law.
At higher pressures and gap lengths, the breakdown voltage is approximately proportional to the product of pressure and gap length, and the term Paschen's law is sometimes used to refer to this simpler relation. However, this is only roughly true, over a limited range of the curve.
Paschen curve
Early vacuum experimenters found a rather surprising behavior. An arc would sometimes take place in a long irregular path rather than at the minimal distance between the electrodes. For example, in air, at a pressure of one atmosphere, the distance for minimal breakdown voltage is about 7.5 μm. The voltage required to arc this distance is 327 V, which is insufficient to ignite the arcs for gaps that are either wider or narrower. For a 3.5 μm gap, the required voltage is 533 V, nearly twice as much. If 500 V were applied, it would not be sufficient to arc at the 2.85 μm distance, but would arc at a 7.5 μm distance.
Paschen found that breakdown voltage was described by the equation
where is the breakdown voltage in volts, is the pressure in pascals, is the gap distance in meters, is the secondary-electron-emission coefficient (the number of secondary electrons produced per incident positive ion), is the saturation ionization in the gas at a particular (electric field/pressure), and is related to the excitation and ionization energies.
The constants and interpolate the first Townsend coefficient . They are determined experimentally and found to be roughly constant over a restricted range of for any given gas. For example, air with an in the range of 450 to 7500 V/(kPa·cm), = 112.50 (kPa·cm)−1 and = 2737.50 V/(kPa·cm).
The graph of this equation is the Paschen curve. By differentiating it with respect to and setting the derivative to zero, the minimal voltage can be found. This yields
and predicts the occurrence of a minimal breakdown voltage for = 7.5×10−6 m·atm. This is 327 V in air at standard atmospheric pressure at a distance of 7.5 μm.
The composition of the gas determines both the minimal arc voltage and the distance at which it occurs. For argon, the minimal arc voltage is 137 V at a larger 12 μm. For sulfur dioxide, the minimal arc voltage is 457 V at only 4.4 μm.
Long gaps
For air at standard conditions for temperature and pressure (STP), the voltage needed to arc a 1-metre gap is about 3.4 MV. The intensity of the electric field for this gap is therefore 3.4 MV/m.
The electric field needed to arc across the minimal-voltage gap is much greater than what is necessary to arc a gap of one metre. At large gaps (or large pd) Paschen's Law is known to fail. The Meek Criteria for breakdown is usually used for large gaps.
It takes into account non-uniformity in the electric field and formation of streamers due to the build up of charge within the gap that can occur over long distances. For a 7.5 μm gap the arc voltage is 327 V, which is 43 MV/m. This is about 14 times greater than the field strength for the 1.5-metre gap. The phenomenon is well verified experimentally and is referred to as the Paschen minimum.
The equation loses accuracy for gaps under about 10 μm in air at one atmosphere
and incorrectly predicts an infinite arc voltage at a gap of about 2.7 μm. Breakdown voltage can also differ from the Paschen curve prediction for very small electrode gaps, when field emission from the cathode surface becomes important.
Physical mechanism
The mean free path of a molecule in a gas is the average distance between its collision with other molecules. This is inversely proportional to the pressure of the gas, given constant temperature. In air at STP the mean free path of molecules is about 96 nm. Since electrons are much smaller, their average distance between colliding with molecules is about 5.6 times longer, or about 0.5 μm. This is a substantial fraction of the 7.5 μm spacing between the electrodes for minimal arc voltage. If the electron is in an electric field of 43 MV/m, it will be accelerated and acquire 21.5 eV of energy in 0.5 μm of travel in the direction of the field. The first ionization energy needed to dislodge an electron from nitrogen molecule is about 15.6 eV. The accelerated electron will acquire more than enough energy to ionize a nitrogen molecule. This liberated electron will in turn be accelerated, which will lead to another collision. A chain reaction then leads to avalanche breakdown, and an arc takes place from the cascade of released electrons.
More collisions will take place in the electron path between the electrodes in a higher-pressure gas. When the pressure–gap product is high, an electron will collide with many different gas molecules as it travels from the cathode to the anode. Each of the collisions randomizes the electron direction, so the electron is not always being accelerated by the electric field—sometimes it travels back towards the cathode and is decelerated by the field.
Collisions reduce the electron's energy and make it more difficult for it to ionize a molecule. Energy losses from a greater number of collisions require larger voltages for the electrons to accumulate sufficient energy to ionize many gas molecules, which is required to produce an avalanche breakdown.
On the left side of the Paschen minimum, the product is small. The electron mean free path can become long compared to the gap between the electrodes. In this case, the electrons might gain large amounts of energy, but have fewer ionizing collisions. A greater voltage is therefore required to assure ionization of enough gas molecules to start an avalanche.
Derivation
Basics
To calculate the breakthrough voltage, a homogeneous electrical field is assumed. This is the case in a parallel-plate capacitor setup. The electrodes may have the distance . The cathode is located at the point .
To get impact ionization, the electron energy must become greater than the ionization energy of the gas atoms between the plates. Per length of path a number of ionizations will occur. is known as the first Townsend coefficient as it was introduced by Townsend.
The increase of the electron current , can be described for the assumed setup as
(So the number of free electrons at the anode is equal to the number of free electrons at the cathode that were multiplied by impact ionization. The larger and/or , the more free electrons are created.)
The number of created electrons is
Neglecting possible multiple ionizations of the same atom, the number of created ions is the same as the number of created electrons:
is the ion current. To keep the discharge going on, free electrons must be created at the cathode surface. This is possible because the ions hitting the cathode release secondary electrons at the impact. (For very large applied voltages also field electron emission can occur.) Without field emission, we can write
where is the mean number of generated secondary electrons per ion. This is also known as the second Townsend coefficient. Assuming that , one gets the relation between the Townsend coefficients by putting () into () and transforming:
Impact ionization
What is the amount of ? The number of ionization depends upon the probability that an electron hits a gas molecule. This probability is the relation of the cross-sectional area of a collision between electron and ion in relation to the overall area that is available for the electron to fly through:
As expressed by the second part of the equation, it is also possible to express the probability as relation of the path traveled by the electron to the mean free path (distance at which another collision occurs).
is the number of molecules which electrons can hit. It can be calculated using the equation of state of the ideal gas
(: pressure, : volume, : Boltzmann constant, : temperature)
The adjoining sketch illustrates that . As the radius of an electron can be neglected compared to the radius of an ion it simplifies to . Using this relation, putting () into () and transforming to one gets
where the factor was only introduced for a better overview.
The alteration of the current of not yet collided electrons at every point in the path can be expressed as
This differential equation can easily be solved:
The probability that (that there was not yet a collision at the point ) is
According to its definition is the number of ionizations per length of path and thus the relation of the probability that there was no collision in the mean free path of the ions, and the mean free path of the electrons:
It was hereby considered that the energy that a charged particle can get between a collision depends on the electric field strength and the charge :
Breakdown voltage
For the parallel-plate capacitor we have , where is the applied voltage. As a single ionization was assumed is the elementary charge . We can now put () and () into () and get
Putting this into (5) and transforming to we get the Paschen law for the breakdown voltage that was first investigated by Paschen in
and whose formula was first derived by Townsend in
with
Plasma ignition
Plasma ignition in the definition of Townsend (Townsend discharge) is a self-sustaining discharge, independent of an external source of free electrons. This means that electrons from the cathode can reach the anode in the distance and ionize at least one atom on their way. So according to the definition of this relation must be fulfilled:
If is used instead of () one gets for the breakdown voltage
Conclusions, validity
Paschen's law requires that:
There are already free electrons at the cathode () which can be accelerated to trigger impact ionization. Such so-called seed electrons can be created by ionization by natural radioactivity or cosmic rays.
The creation of further free electrons is only achieved by impact ionization. Thus Paschen's law is not valid if there are external electron sources. This can, for example, be a light source creating secondary electrons by the photoelectric effect. This has to be considered in experiments.
Each ionized atom leads to only one free electron. However, multiple ionizations occur always in practice.
Free electrons at the cathode surface are created by the impacting ions. The problem is that the number of thereby created electrons strongly depends on the material of the cathode, its surface (roughness, impurities) and the environmental conditions (temperature, humidity etc.). The experimental, reproducible determination of the factor is therefore nearly impossible.
The electrical field is homogeneous.
Effects with different gases
Different gases will have different mean free paths for molecules and electrons. This is because different molecules have ionization cross sections, that is, different effective diameters. Noble gases like helium and argon are monatomic, which makes them harder to ionize and tend to have smaller effective diameters. This gives them greater mean free paths.
Ionization potentials differ between molecules, as well as the speed that they recapture electrons after they have been knocked out of orbit. All three effects change the number of collisions needed to cause an exponential growth in free electrons. These free electrons are necessary to cause an arc.
See also
Atmospheric pressure
Breakdown voltage
Dielectric strength
Townsend discharge
References
External links
Electrical breakdown limits for MEMS
High Voltage Experimenter's Handbook
Paschen's law calculator
Breakdown Voltage vs. PressureIn the internet archive 16.04.2023
Electrical Breakdown of Low Pressure Gases
Electrical Discharges
Pressure Dependence of Plasma Structure in Microwave Gas Breakdown at 110GHz
Electrical discharge in gases
Electrochemistry
Electrostatics
Electrical breakdown
Eponymous laws of physics
Plasma physics equations | Paschen's law | Physics,Chemistry | 2,643 |
78,357,865 | https://en.wikipedia.org/wiki/Redmi%209A | The Redmi 9A is a series of Android-based smartphones developed and manufactured by Xiaomi's sub-brand Redmi. It was unveiled on June 30, 2020, alongside the Redmi 9C, and was released on July 7, 2020.
On September 9, the Redmi 9AT was announced in Spain, which differs from the standard model by the addition of a second microphone for improved noise cancellation. Additionally, on September 15, 2020, the Redmi 9i was introduced in India as a version of the Redmi 9A with increased memory. Further, on September 28, 2021, the Redmi 9A Sport and Redmi 9i Sport were launched in India, primarily distinguished from the regular models by their new color options.
Specifications
Design
The screen is made of glass and the smartphone's body is made of plastic.
On the bottom, there is a microUSB port, a speaker, and a microphone. On the top, there is a 3.5mm audio jack, and a second microphone in the Redmi 9AT. On the left side, there is a slot for 2 SIM cards and a microSD memory card. Under the main camera and flash, there is a line with the Redmi logo.
The phone is available with multiple colors, depending on the variant:
The Redmi 9A and 9AT (in Spain) and was sold in 3 colors: Carbon Gray (Midnight Black), Sky Blue (Sea Blue), Ocean Green and (Nature Green).
In India, the Redmi 9i was sold in 3 colors: Midnight Black, Sea Blue, and Nature Green.
In India, the Redmi 9A Sport and 9i Sport were sold in 3 colors: Carbon Black (black), Metallic Blue (silver-blue), and Coral Green (green-blue).
Processor and GPU
All models (9A, 9AT, 9A Sport, 9i Sport) except the Redmi 9i featured with a MediaTek Helio G25 processor and a PowerVR GE8320 graphics processor.
The Redmi 9i featured with an Octa-core 4x2.0 GHz Cortex-A53 & 4x1.5 GHz Cortex-A53 processor.
Battery
The battery has a capacity of 5000 mAh.
Camera
The smartphones received a 13 MP main camera with f/2.2 aperture, phase-detection autofocus, and the ability to record video in 1080p@60fps resolution. The front camera received a 5 MP resolution, f/2.2 aperture, and the ability to record video in 1080p@30fps resolution.
Display
All phone has as IPS LCD screen, sizing about 6.53 inches, an HD+ resolution (1600 x 720 pixels) with a 20:9 aspect ratio with 269 pixels per inch, and a waterdrop notch for the front camera.
Storage
The phone's storages has a 32, 64, or 128 GB configuration with a 2/3/4 GB RAM, depending on the variant:
The Redmi 9A was sold in configurations of 2/32GB, 3/32GB, 4/64GB, 4/128GB, and 6/128GB. In Ukraine, the smartphone was only available in the 2/32GB configuration.
The Redmi 9AT was sold in the 2/32GB configuration.
The Redmi 9A Sport was sold in configurations of 2/32GB and 3/32GB.
The Redmi 9i and 9i Sport were sold in configurations of 4/64GB and 4/128GB.
Software
Smartphones were released with MIUI 12 based on Android 10. Later, Chinese and Russian versions of the Redmi 9A with MIUI were updated to MIUI 12.5 based on Android 11.
See also
Redmi 9C
Redmi 9T
Redmi Note 9
References
External links
9A
Mobile phones introduced in 2020
Phablets
Discontinued smartphones | Redmi 9A | Technology | 808 |
8,331,953 | https://en.wikipedia.org/wiki/HealthBridge | HealthBridge is a service line of The Health Collaborative, a not-for-profit corporation located in Cincinnati, Ohio, United States. HealthBridge supports health information technology (HIT) adoption, health information exchange (HIE), and innovative use of information for improved health care outcomes. HealthBridge is recognized as one of the nation’s largest, most advanced, and most financially sustainable health information exchange (HIE) organizations.
HealthBridge was founded in 1997 as a community effort to develop a common technology infrastructure for sharing health information electronically in the Greater Cincinnati tri-state area.
As a result of HealthBridge and its community partners’ efforts, more than 30 million clinical tests, images, and other clinical results are transmitted each year to authorized physicians through HealthBridge’s secure electronic network. HealthBridge serves more than 30 hospitals, 7500 physicians, 800 practices, as well as local health departments, nursing homes, independent labs, radiology centers and other health care entities across multiple communities in four states.
References
External links
Creating Sustainable Local Health Information Exchanges: Can Barriers to Stakeholder Participation be Overcome?
eHealth Initiative Value and Sustainability Model Tool Kit
RHIOs for beginners
Companies based in Ohio
Organizations established in 1997
Health informatics
Health in Ohio | HealthBridge | Biology | 252 |
72,391,184 | https://en.wikipedia.org/wiki/2%20Ursae%20Majoris | 2 Ursae Majoris (2 UMa) is an Am star in the northern circumpolar constellation of Ursa Major, located 150 light-years from the Sun. It has the Bayer designation A Ursae Majoris; 2 Ursae Majoris is the Flamsteed designation. It is visible to the naked eye as a faint white star with an apparent visual magnitude of 5.5. Currently 150 light years away, it is moving closer to the Earth with a heliocentric radial velocity of −17 km/s.
Description
2 UMa has a stellar classification of kA3hA5mA7s, meaning it has hydrogen absorption lines typical of an A5 star, calcium K lines typical of an A3 star, and other metal absorption lines typical of an A7 star. This form of spectral type is used for Am stars, stars which show an over-abundance of metal lines in their spectrum due to slow rotation that allows stratification of elements within its photosphere. The 's' suffix indicates that the lines are sharp, another indicator of slow rotation. At an estimated age of 560 million years, 2 UMa is a main sequence star, fusing hydrogen into helium within its core. The projected rotational velocity is , very slow for a hot main sequence star.
This star has 1.9 times the mass of the Sun and 1.9 times its radius. It is radiating 11 times the Sun's luminosity from its photosphere at an effective temperature of .
Nomenclature
With π1, π2, σ1, σ2, ρ and 24 Ursae Majoris, it composed the Arabic asterism Al Ṭhibā᾽, the Gazelle. According to the catalogue of stars in the Technical Memorandum 33-507 - A Reduced Star Catalog Containing 537 Named Stars, Al Ṭhibā were the title for seven stars : this star as Althiba I, π1 as Althiba II, π2 as Althiba III, ρ as Althiba IV, σ1 as Althiba V, σ2 as Althiba VI, and 24 UMa as Althiba VII.
References
Ursa Major
Ursae Majoris, A
Durchmusterung objects
Ursae Majoris, 2
072037
042080
3354
Am stars
A-type main-sequence stars | 2 Ursae Majoris | Astronomy | 480 |
1,735,625 | https://en.wikipedia.org/wiki/Yolk%20plug | Yolk plug is the remaining patch of endodermal cells that is created during the formation of the dorsal lip of the blastopore in the amphibian. It is a patch of large endodermal cells which remains exposed on the vegetal surface of the blastula that will eventually be internalized by epiboly.
References
Amphibians
Vertebrate developmental biology | Yolk plug | Biology | 79 |
2,913,762 | https://en.wikipedia.org/wiki/Foldamer | In chemistry, a foldamer is a discrete chain molecule (oligomer) that folds into a conformationally ordered state in solution. They are artificial molecules that mimic the ability of proteins, nucleic acids, and polysaccharides to fold into well-defined conformations, such as α-helices and β-sheets. The structure of a foldamer is stabilized by noncovalent interactions between nonadjacent monomers. Foldamers are studied with the main goal of designing large molecules with predictable structures. The study of foldamers is related to the themes of molecular self-assembly, molecular recognition, and host–guest chemistry.
Design
Foldamers can vary in size, but they are defined by the presence of noncovalent, nonadjacent interactions. This definition excludes molecules like poly(isocyanates) (commonly known as polyurethane) and poly(prolines) as they fold into helices reliably due to adjacent covalent interactions. Foldamers have a dynamic folding reaction (unfolded → folded), in which large macroscopic folding is caused by solvophobic effects (hydrophobic collapse), while the final energy state of the folded foldamer is due to the noncovalent interactions. These interactions work cooperatively to form the most stable tertiary structure, as the completely folded and unfolded states are more stable than any partially folded state.
Prediction of folding
The structure of a foldamer can often be predicted from its primary sequence. This process involves dynamic simulations of the folding equilibria at the atomic level under various conditions. This type of analysis may be applied to small proteins as well; however, as of 2024, computational technology is unable to simulate all but the shortest of sequences.
The folding pathway of a foldamer can be determined by measuring the variation from the experimentally-determined favored structure under different thermodynamic and kinetic conditions. The change in structure is measured by calculating the root mean square deviation from the backbone atomic position of the favored structure. The structure of the foldamer under different conditions can be determined computationally and then verified experimentally. Changes in the temperature, solvent viscosity, pressure, pH, and salt concentration can all yield valuable information about the structure of the foldamer. Measuring the kinetics of folding as well as folding equilibria allow one to observe the effects of these different conditions on the foldamer structure.
Solvents often influence folding. For example, a folding pathway involving hydrophobic collapse would fold differently in a nonpolar solvent. This difference is due to the fact that different solvents stabilize different intermediates of the folding pathway as well as different final foldamer structures based on intermolecular noncovalent interactions.
Noncovalent interactions
Noncovalent intermolecular interactions, albeit individually small, collectively alter chemical reactions in major ways. Listed below are common intermolecular forces that chemists have used to design foldamers.
Hydrogen bonding (especially with peptide bonds)
Pi stacking
Solvophobic effects, which lead to hydrophobic collapse
Van der Waals forces
Electrostatic attraction
Common designs
Foldamers are classified into three different categories: peptidomimetic foldamers, nucleotidomimetic foldamers, and abiotic foldamers. Peptidomimetic foldamers are synthetic molecules that mimic the structure of proteins, while nucleotidomimetic foldamers are based on the interactions in nucleic acids. Abiotic foldamers are stabilized by aromatic and charge-transfer interactions which are not generally found in nature. The three designs described below deviate from Moore's strict definition of a foldamer, which excludes helical foldamers.
Peptidomimetic
Peptidomimetic foldamers often break the previously mentioned definition of foldamers as they often adopt helical structures. They represent a major landmark of foldamer research due to their design and capabilities. The largest groups of peptidomimetic consist of β-peptides, γ-peptides and δ-peptides, and the possible monomeric combinations. The amino acids of these peptides only differ by one (β), two (γ), or three (δ) methylene carbons, yet the structural changes were profound. These peptide sequences are highly studied as sequence control leads to reliable folding prediction. Additionally, with multiple methylene carbons between the carboxyl and amino termini of the flanking peptide bonds, varying R-group side chains can be designed. One example of the novelty of β-peptides can be seen in the findings of Reiser and coworkers. Using a heteroligopeptide consisting of α-amino acids and cis-β-aminocyclopropanecarboxulic acids (cis-β-ACCs), they found the formation of helical sequences in oligomers as short as seven residues and defined conformation in five residues, a quality unique to peptides containing cyclic β-amino acids.
Nucleotidomimetic
Nucleotidomimetics do not generally qualify as foldamers. Most are designed to mimic single DNA bases, nucleosides, or nucleotides in order to nonspecifically target DNA. These have several different medicinal uses including anti-cancer, anti-viral, and anti-fungal applications.
Abiotic
Abiotic foldamers are again organic molecules designed to exhibit dynamic folding. They exploit a few known key intermolecular interactions, as optimized by their design. One example is oligopyrroles that organize upon binding anions like chloride through hydrogen bonding (see figure). Folding is induced in the presence of an anion: the polypyrrole groups have little conformational restriction otherwise.
Other examples
m-Phenylene ethynylene oligomers are driven to fold into a helical conformation by solvophobic forces and aromatic stacking interactions.
β-peptides are composed of amino acids containing an additional unit between the amine and carboxylic acid. They are more stable to enzymatic degradation and have been demonstrated to have antimicrobial activity.
Peptoids are N-substituted polyglycines that utilize steric interactions to fold into polyproline type-I-like helical structures.
Aedamers that fold in aqueous solutions driven by hydrophobic and aromatic stacking interactions.
Aromatic oligoamide foldamers. These examples are some of the largest and best structurally characterized foldamers.
Arylamide foldamers, such as brilacidin.
References
Further reading
Reviews
Supramolecular chemistry
Articles containing video clips | Foldamer | Chemistry,Materials_science | 1,391 |
26,633,325 | https://en.wikipedia.org/wiki/Lnt%20RNA%20motif | The Lnt RNA motif refers to a conserved RNA structure found in certain bacteria. Specifically, Lnt RNAs are known only in species within the phylum Chlorobiota, and are located in the possible 5' untranslated regions (5' UTRs) of genes that are annotated as encoding apolipoprotein N-acyltransferase enzymes. There is some doubt as to whether the indicated motif is transcribed as RNA, or whether its reverse complement is transcribed. If the reverse complement is transcribed it would potentially in 5' UTRs of genes encoding bacteriochlorophyll A, and would be close to the start codon of those genes.
References
External links
Cis-regulatory RNA elements | Lnt RNA motif | Chemistry | 154 |
64,440,565 | https://en.wikipedia.org/wiki/Miro%20Erkintalo | Miro Erkintalo is a New Zealand physicist specialising in nonlinear optics and laser physics, based at the University of Auckland.
Education
Erkintalo was born and grew up in Pori, Finland, with an interest in science and maths. He attended the Tampere University of Technology intending to get his MSc and become a teacher or technologist, but after interning in a research lab decided to become a physicist. He completed three degrees in succession: a BSc (March 2009), an MSc (November 2009) and Doctor of Science in Physics (January 2012).
After his PhD, Erkintalo came to New Zealand in 2012 to take up a postdoctoral fellowship at the University of Auckland, at the suggestion of his mentor John Dudley. He had intended to just stay for two years, but enjoyed New Zealand so much he became a permanent resident. He became a Lecturer in the Department of Physics in 2014, Senior Lecturer in February 2017 and Associate Professor in February 2021. He is a principal investigator at the Dodd-Walls Centre for Photonic and Quantum Technologies.
Areas of research
Erkintalo studies laser light and how it interacts with matter, both fundamental physics and technological applications. He developed the theoretical model for microresonator frequency combs, which can convert a single laser beam into hundreds or thousands of different-coloured beams. Currently fibre-optic communications systems use hundreds of lasers with different wavelengths to increase the amount of information transmitted; a microresonator frequency comb could allow a single beam to do this work, greatly improving performance and energy efficiency. His work on temporal cavity solitons has potential for the development of light-based computer memory.
Erkintalo has also been part of the development of inexpensive ultrashort pulsed lasers with potential applications in microscopy and micro-machining. These lasers have extremely short pulses of hundreds of femtoseconds, which have very high peak energy and can be used in environments where they would have to work under extreme noise, temperature, and vibration.
Honours and awards
Erkintalo was awarded a Rutherford Discovery Fellowship in 2015 and two Marsden Fund grants. He won the Hamilton Award, the Royal Society Te Apārangi's Early Career Research Excellence Award for Science, in 2016 for his work in nonlinear optics and laser physics.
On 30 June 2020 Erkintalo was presented with the 2019 Prime Minister’s MacDiarmid Emerging Scientist Prize for his contributions to new laser technologies. Most of the $200,000 prize will go towards exploring microresonator frequency comb architecture.
Selected publications
References
External links
2016 Hamilton Award winner: Dr Miro Erkintalo (YouTube)
University of Auckland staff profile
Research website
Living people
Optical physicists
Theoretical physicists
Tampere University of Technology alumni
Year of birth missing (living people)
Recipients of Marsden grants
20th-century New Zealand physicists
21st-century New Zealand physicists
Expatriates in New Zealand
Finnish expatriates | Miro Erkintalo | Physics | 599 |
13,503,628 | https://en.wikipedia.org/wiki/Wii%20system%20software | The Wii system software is a discontinued set of updatable firmware versions and a software frontend on the Wii, a home video game console. Updates, which could be downloaded over the Internet or read from a game disc, allowed Nintendo to add additional features and software, as well as to patch security vulnerabilities used by users to load homebrew software. When a new update became available, Nintendo sent a message to the Wii Message Board of Internet-connected systems notifying them of the available update.
Most game discs, including first-party and third-party games, include system software updates so that systems that are not connected to the Internet can still receive updates. The system menu will not start such games if their updates have not been installed, so this has the consequence of forcing users to install updates in order to play these games. Some games, such as online games like Super Smash Bros. Brawl and Mario Kart Wii, contain specific extra updates, such as the ability to receive Wii Message Board posts from game-specific addresses; therefore, these games always require that an update be installed before their first time running on a given console.
Technology
IOS
The Wii's firmware has many active branches known as IOSes, thought by the Wii homebrew developers to stand for "Input Output Systems" or "Internal Operating Systems". The currently active IOS, also simply referred to as just "IOS," runs on a separate ARM926EJ-S processor unofficially nicknamed Starlet, which resides within the Hollywood GPU. The patent for the Wii U shows a similar device which is simply named "Input/Output Processor". IOS controls I/O between the code running on the main Broadway processor and the various Wii hardware that does not also exist on the GameCube.
Except for bug fixes, new IOS versions do not replace existing IOS versions. Instead, Wii consoles have multiple IOS versions installed. All native Wii software (including games distributed on Nintendo optical discs, the System Menu itself, Virtual Console games, WiiWare, and Wii Channels), with the exception of certain homebrew applications, have the IOS version hardcoded into the software.
When the software is run, the IOS that is hardcoded gets loaded by the Wii, which then loads the software itself. If that IOS does not exist on the Wii, in the case of disc-based software, it gets installed automatically with a system update (after the user is prompted). With downloaded software, this should not theoretically happen, as the user cannot access the shop to download software unless the player has all the IOS versions that they require. However, if homebrew is used to forcefully install or run a piece of software when the required IOS does not exist, the user is brought back to the system menu.
Nintendo created this system so that new updates would not unintentionally break compatibility with older games, but it does have the side effect that it uses up space on the Wii's internal NAND Flash memory. IOSes are referred to by their number, which can theoretically be between 3 and 255, although many numbers are skipped, presumably being development versions that were never completed.
Only one IOS version can run at any given time. The only time an IOS is not running is when the Wii enters GameCube backward compatibility mode, during which the Wii runs a variant of IOS specifically for GameCube games, MIOS, which contains a modified version of the GameCube's IPL. Custom IOSes, called cIOSes, can be installed with homebrew. The main purpose of cIOS is to allow homebrew users to use other homebrew apps such as USB Loader GX (allows games stored in the WBFS file format to be run from a USB stick).
User interface
The system provides a graphical interface to the Wii's abilities. All games run directly on the Broadway processor, and either directly interface with the hardware (for the hardware common to the Wii and GameCube), or interface with IOS running on the ARM architecture processor (for Wii-specific hardware). The ARM processor does not have access to the screen, and therefore neither does IOS. This means that while a piece of software is running, everything seen on the screen (including the HOME button menu) comes from that software, and not from any operating system or firmware. Therefore, the version number reported by the Wii is actually only the version number of the System Menu. This is why some updates do not result in a change of the version number: the System Menu itself is not updated, only (for example) IOSes and channels. As a side effect, this means it is impossible for Nintendo to implement any functions that would affect the games themselves, for example an in-game system menu (similar to the Xbox 360's in-game Dashboard or the PlayStation 3's in-game XMB).
The Wii Menu (known internally as the System Menu) is the name of the user interface for the Wii game console, and it is the first thing to be seen when the system boots up. It has four pages, each with a 4:3 grid, and each displaying the current time and date. Available applications, known as "channels", are displayed and can be navigated using the pointer capability of the Wii Remote. The grid is customizable; users can move channels (except for the Disc Channel) among the menu's 48 customizable slots. By pressing the plus and minus buttons on the Wii Remote users can scroll across accessing empty slots. Similar to many other video game consoles, the Wii is not only about games. For example, it is possible to install applications such as Netflix to stream media (without requiring a disc) on the Wii. The Wii Menu let users access both game and no-game functions through built-in applications called Channels, which are designed to represent television channels. There are six primary channels: the Disc Channel, Mii Channel, Photo Channel, Wii Shop Channel, Forecast Channel and News Channel, although the latter two were not initially included and only became available via system updates. Some of the functions provided by these Channels on the Wii used to be limited to a computer, such as a full-featured web browser and digital photo viewer. Users can also use Channels to create and share cartoon-like digital avatars called Miis and download new games and Channels directly from the Wii Shop Channel. New Channels include, for example, the Everybody Votes Channel and the Internet Channel. Separate Channels are graphically displayed in a grid and can be navigated using the pointer capability of the Wii Remote. Users can also rearrange these Channels if they are not satisfied with how the Channels are originally organized on the menu.
Network features
The Wii system supports wireless connectivity with the Nintendo DS handheld console with no additional accessories. This connectivity allows players to use the Nintendo DS microphone and touch screen as inputs for Wii games. Pokémon Battle Revolution is the first example Nintendo has given of a game using Nintendo DS-Wii connectivity. Nintendo later released the Nintendo Channel for the Wii allowing its users to download game demos or additional data to their Nintendo DS.
Like many other video game consoles, the Wii console is able to connect to the Internet, although this is not required for the Wii system itself to function. Each Wii has its own unique 16-digit Wii Code for use with Wii's non-game features. With Internet connection enabled users are able to access the established Nintendo Wi-Fi Connection service. Wireless encryption by WEP, WPA (TKIP/RC4) and WPA2 (CCMP/AES) is supported. AOSS support was added in System Menu version 3.0.
As with the Nintendo DS, Nintendo does not charge for playing via the service; the 12-digit Friend Code system controls how players connect to one another. The service has a few features for the console, including the Virtual Console, WiiConnect24 and several Channels. The Wii console can also communicate and connect with other Wii systems through a self-generated wireless LAN, enabling local wireless multiplayer on different television sets. The system also implements console-based software, including the Wii Message Board. One can connect to the Internet with third-party devices as well.
The Wii console also includes a web browser known as the Internet Channel, which is a version of the Opera 9 browser with menus. It is meant to be a convenient way to access the web on the television screen, although it is far from offering a comfortable user interface compared with modern web browsers. A virtual keyboard pops up when needed for input, and the Wii Remote acts like a mouse, making it possible to click anywhere on the screen and navigate through web links. However, the browser cannot always handle all the features of most normal web pages, although it does support Adobe Flash, thus capable of playing Flash files. Some third-party services such as the online BBC iPlayer were also available on the Wii via the Internet Channel browser, although BBC iPlayer was later relaunched as the separate BBC iPlayer Channel on the Wii. In addition, Internet access including the Internet Channel and system updates may be restricted by the parental controls feature of the Wii.
Backward compatibility
The original designs of the Nintendo Wii console, more specifically the Wii models made pre-2011 were fully backward compatible with GameCube devices including game discs, memory cards and controllers. This was because the Wii hardware had ports for both GameCube memory cards, and peripherals and its slot-loading drive was able to accept and read the previous console's discs. GameCube games work with the Wii without any additional configuration, but a GameCube controller is required to play GameCube titles; neither the Wii Remote or the Classic Controller functions in this capacity. The Wii supports progressive-scan output in 480p-enabled GameCube titles. Peripherals can be connected via a set of four GameCube controller sockets and two Memory Card slots (concealed by removable flip-open panels). The console retains connectivity with the Game Boy Advance and e-Reader through the Game Boy Advance Cable, which is used in the same manner as with the GameCube; however, this feature can only be accessed on select GameCube titles which previously utilized it.
There are also a few limitations in the backward compatibility. For example, online and LAN features of certain GameCube games were not available since the Wii does not have serial ports for the GameCube Broadband Adapter and Modem Adapter. The Wii uses a proprietary port for video output, and is incompatible with all GameCube audio/video cables (composite video, S-Video, component video and RGB SCART). The console also lacks the GameCube footprint and high-speed port needed for Game Boy Player support. Furthermore, only GameCube functions were available and only compatible memory cards and controllers could be used when playing a GameCube game. This is due to the fact that the Wii's internal memory would not save GameCube data.
Because of the original device's backward compatibility with earlier Nintendo products players can play older games on the console in addition to newer Wii game titles. However, South Korean units lack GameCube backward compatibility. Also, the redesigned Wii Family Edition and Wii Mini, launched in 2011 and 2013 respectively, had this compatibility stripped out. Nevertheless, there is another service called Virtual Console which allow users to download older games from prior Nintendo platforms (namely the Nintendo Entertainment System, Super NES and Nintendo 64) onto their Wii console, as well as games from non-Nintendo platforms such as the Genesis and TurboGrafx-16.
List of additional Channels
This is a list of new Wii Channels released beyond the four initial Channels (i.e. Disc Channel, Mii Channel, Photo Channel and Wii Shop Channel) included in the original consoles. The News Channel and the Forecast Channel were released as part of system updates so separate downloads were not required. As of January 30, 2019, all channels listed below have been discontinued with the exception of the Wii Fit Channel and the Internet Channel.
Pre-installed channels
Disc Channel
The Disc Channel is the primary way to play Wii and GameCube titles from supported Nintendo optical discs inserted into the console.
Each Wii game disc includes a system update partition, which includes the latest Wii software from the time the game was released. If a disc that is inserted contains newer software than the one installed on the console, installing the new software will be required to play the game. This allows users without an internet connection to still receive system updates. When loaded into the disc slot, an icon on the Disc Channel that says "Wii System Update" appears. After selecting the channel, the Wii will automatically update. If these updates are not installed, the game will remain unplayable until the update is installed, as each time the channel is loaded with the game inserted, the update prompt will appear, and declining the update will return the player to the Wii Menu instead of starting the game.
Games requiring a system update can still be played without updating using homebrew software, such as Gecko OS or a USB loader.
Mii Channel
The Mii Channel is an avatar creator, where users can design 3D caricatures of people called Miis by selecting from a group of facial and bodily features. At the Game Developers Conference 2007, Shigeru Miyamoto explained that the look and design of the Mii characters are based on Kokeshi, a form of Japanese doll used as souvenir gifts.
A Wired interview of Katsuya Eguchi (producer of Animal Crossing and Wii Sports) held in 2006 confirmed that the custom player avatar feature shown at Nintendo's E3 Media Briefing would be included in the hardware. The feature was described as part of a "profile" system that contains the Mii and other pertinent player information. This application was officially unveiled by Nintendo in September 2006. It is incorporated into Wii's operating system interface as the "Mii Channel". Users can select from pre-made Miis or create their own by choosing custom facial shapes, colors, and positioning. In certain games, each player's Mii will serve as the character the player controls in some/all forms of gameplay. Miis can interact with other Wii users by showing up on their Wii consoles through the WiiConnect24 feature or by talking with other Miis created by Wii owners all over the world. This feature is called Mii Parade. Early-created Miis as well as those encountered in Mii Parades may show up as spectators in some games. Miis can be stored on Wii Remotes and taken to other Wii consoles. The Wii Remote can hold a maximum of 10 Miis.
In addition, Mii characters can be transferred from a user's Wii to Nintendo 3DS consoles, as well as supported Nintendo DS games via the Mii Channel. While in the channel, pressing A, followed by B, then 1, and holding 2 on the Wii Remote allows the user to unlock the feature. The Mii Channel is succeeded by the Mii Maker app for both Nintendo 3DS and Wii U, and the Mii options in Settings for Nintendo Switch.
According to Nintendo president Satoru Iwata, over 160 million Mii characters had been created using the Mii Channel as of May 2010.
Photo Channel
If a user inserts an SD card into the console, or receives photos (JPEG) or videos (MJPEG) via email, they can be viewed using the Photo Channel. The user can create a slideshow simply by inserting an SD card with photos and, optionally, MP3 or AAC files (see note regarding December 10, 2007 update to version 1.1). The Wii will automatically add Ken Burns Effect transitions between the photos and play either the music on the SD card or built-in music in the background. A built-in editor allows users to add markings and effects to their photos or videos (The edits float statically above the videos). Mosaics can also be created with this feature. In "Doodle" mode, the user can draw on or make art on the photos. The "Mood" mode allows the user to make all the photos on these four following effects which is either brightening up the photo, making the photo grayscale, zapping the photo, or cooking up a hard-boiled photo. Puzzles can be created from photos or videos with varying degrees of difficulty (However, your first puzzle will be six-pieces) with 6, 12, 24 and 48 piece puzzles available, with 192 selectable while holding down 1 on the Wii Remote. Edited photos can be saved to the Wii and sent to other Wiis via the message board. According to the system's manual, the following file extensions (i.e. formats) are supported: Photos (jpeg/jpg), Movies (mov/avi), and Music (mp3/aac).
JPEG files can be up to 8192x8192 resolution and in baseline format. Video data contained within the .mov or .avi files must be in an OpenDML-compliant MotionJPEG and use some variant of this format for their videos, with a resolution of up to 848×480 pixels (Wide VGA). Photos, even high resolution ones, are compressed and decreased in resolution.
Photo Channel 1.1
Photo Channel 1.1 is an optional update to the Photo Channel that became available on the Wii Shop Channel on December 10, 2007. It allows users to customize the Photo Channel icon on the Wii Menu with photos from an SD card or the Wii Message Board. It also allows playback of songs in random order. The update replaced MP3 support with support for MPEG-4 encoded audio files encoded with AAC in the .m4a extension.
Wii owners who updated to version 1.1 can revert to version 1.0 by deleting it from the channels menu in the data management setup. Consoles released after December 10, 2007 come with the version 1.1 update pre-installed, and cannot be downgraded to version 1.0.
Owners of systems on a Japanese firmware can download a "Revert to Photo Channel 1.0" Channel from the Wii Shop Channel if they wish to do so.
Wii Shop Channel
The Wii Shop Channel allowed users to download games and other software by redeeming Wii Points, which could be obtained by purchasing Nintendo Points cards from retail outlets or directly through the Wii Shop Channel using MasterCard or Visa credit cards online. Users could browse in the Virtual Console, WiiWare, or Wii Channels sections for downloads. A feature to purchase downloaded software as gifts for others became available worldwide on December 10, 2007. Additional channels that were not released at the console's launch were available for purchase in the Wii Shop Channel. These included: Internet Channel, Everybody Votes Channel, Check Mii Out Channel, Nintendo Channel, Netflix Channel, and the Japan-only Television Friend Channel. Until the channel's shut down on January 30, 2019, all downloadable channels were free of charge. The name was originally going to be called the Shopping Channel.
Nintendo discontinued the Wii Shop Channel on January 30, 2019 (having announced that they planned to do so on September 29, 2017), with the purchase of Wii Points ending on March 26, 2018. The ability to redownload previously purchased content and/or transfer Wii data from the Wii to the Wii U still remains available.
Forecast Channel
The Forecast Channel allowed weather reports and forecasts provided by Weathernews to be shown on the console from the Internet via the WiiConnect24 service. The Forecast Channel displayed a view of the Earth as a globe (courtesy of NASA's The Blue Marble image), with which users can view weather in other regions. When fully zoomed out, an accurate star map was visible in the background. (The Big Dipper and the constellation Orion were easily recognizable, for example.) The Forecast Channel features included the current forecast, the UV index, today's overall forecast, tomorrow's forecast, a 5-day forecast (only for the selected country in which the user lives), a laundry check (Japan only) and pollen count (Japan only). The Forecast Channel first became available on December 19, 2006. Certain games could use the Forecast Channel to simulate weather conditions depending on the player's region.
There are slight variations of Forecast Channel versions in different regions. When viewing weather conditions in Japan, a different set of weather icons is used. Additionally, the laundry index was only featured in the Japanese version.
After the August 6, 2007 update, the Forecast Channel showed the icon for the current weather on the Wii Menu.
The Forecast Channel (along with the News Channel) was not available in South Korea.
Like the four other Wii channels (News Channel, Everybody Votes Channel, Check Mii Out Channel/Mii Contest Channel, Nintendo Channel), the Forecast Channel ended its seven-year support on June 27, 2013.
News Channel
The News Channel allowed users to access news headlines and current news events obtained from the Internet. News articles were available on a globe view, allowing users to view news from certain areas of the world (similar to the Forecast Channel), and as a slide show. The content was automatically updated and viewable via WiiConnect24 with clickable news images supported. The channel contained seven categories: National News, International News, Sports, Arts/Entertainment, Business, Technology and Oddities.
The News Channel became available in North America, Europe, and Australia on January 26, 2007. Content was in a variety of languages provided by the Associated Press, who had a two-year contract to provide news and photos to Nintendo. Canadian news was submitted by the Canadian Press for publication. Japanese news was provided by Goo. European news was provided by Agence France-Presse.
Starting with the August 6, 2007 update, the News Channel showed a news ticker in the Wii Menu, and when selecting the channel. However, not visiting the channel for a period of time resulted in the ticker not appearing, instead displaying "You must use the News Channel regularly for news to be displayed on this screen." on the preview screen until the channel was opened up. A December 20, 2007 PAL region update increased the number of news feeds to the channel, sourced from a larger number of news resources and agencies, providing more news that were available per country.
The News Channel (along with the Forecast Channel) was not available in South Korea.
Like the four other Wii channels (Forecast Channel, Everybody Votes Channel, Mii Contest Channel, Nintendo Channel), the News Channel ended its seven-year support on June 27, 2013.
Get Connected Video Channel
The Get Connected Video Channel or Wii & the Internet Channel (or alternatively known as the Wii + Internet Channel or Wii: See What You Can Do On the Internet) is pre-installed onto Wii console units manufactured in October 2008 or later. It contains an informational video specifying the benefits of connecting the Wii console to the Internet, such as downloading extra channels, new software, Virtual Console titles, and playing games over Nintendo Wi-Fi Connection.
The Get Connected Video Channel is the only pre-installed channel that takes up spare internal memory, and the only channel that can be manually deleted or moved to an SD card by the user. The channel takes up over half of the Wii's internal memory space. Upon connecting to the Internet and running the channel, the user will be asked if they would like to delete it. It cannot be re-downloaded or restored upon deletion.
The same video presentation contained in the channel can also be viewed on an archived version of Nintendo's official website.
The channel is also available in multiple languages. Unlike the other channels, the video in the channel is not translated digitally, but is presented in multiple dubs, which means there are multiple copies of the same video in a single channel. The language of the video is presented is respectively according to the Wii's language setting. There are three languages available in the US versions: English, French and Spanish; and six in the PAL version: English, French, Spanish, German, Italian and Dutch.
Internet Channel
The Internet Channel is a version of the Opera web browser for use on the Wii by Opera Software and Nintendo. On December 22, 2006 a free demo version (promoted as "Internet Channel: Trial Version") of the browser was released. The final version (promoted as "Internet Channel: Final Version") of the browser was released on April 11, 2007 and was free to download until June 30, 2007. After this deadline had passed, the Internet Channel cost 500 Wii Points to download until September 1, 2009, though users who downloaded the browser before June 30, 2007, could continue to use it at no cost for the lifetime of the Wii system. An update (promoted as the "Internet Channel") on October 10, 2007 added USB keyboard compatibility. On September 1, 2009 the Internet Channel was made available to Wii owners for no cost of Wii Points and updated to include improved Adobe Flash Player support. A refund was issued to those who paid for the channel in the form of one free NES game download worth 500 Wii Points.
The Internet Channel uses whichever connection is chosen in the Wii settings, and utilizes the user's internet connection directly; there is no third party network that traffic is being routed through. It receives a connection from a router/modem and uses a web browser to pull up HTTP and HTTPS (secure and encrypted) web pages. Opera, the Wii's web browser, is capable of rendering most web sites in the same manner as its desktop counterpart by using Opera's Medium Screen Rendering technology.
The software is saved to the Wii's 512 MB internal flash memory (it can be copied to an SD card after it has been downloaded). The temporary Internet files (maximum of 5MB for the trial version) can only be saved to the Wii's internal memory. The application launches within a few seconds, after connecting to the Internet through a wireless LAN using the built-in interface or a wired LAN by using the USB to the Ethernet adapter.
The Opera-based Wii browser allows users full access to the Internet and supports all the same web standards that are included in the desktop versions of Opera, including CSS and JavaScript. It is also possible for the browser to use technologies such as Ajax, SVG, RSS, and Adobe Flash Player 8 and limited support for Adobe Flash Player 9. Opera Software has indicated that the functionality will allow for third parties to create web applications specifically designed for the use on the Wii Browser, and it will support widgets, standalone web-based applications using Opera as an application platform.
Third party APIs and SDKs have been released that allow developers to read the values of the Wii Remote buttons in both Flash and JavaScript. This allows for software that previously required keyboard controls to be converted for use with the Wii Remote. The browser was also used to stream BBC iPlayer videos from April 9, 2008 after an exclusive deal was made with Nintendo UK and the BBC to offer their catch-up service for the Wii. However, the September 2009 update caused the iPlayer to no longer operate. The BBC acknowledged the issue and created a dedicated channel instead. In June 2009, YouTube released YouTube XL, a TV-friendly version of the popular video-sharing website. The regular YouTube page would redirect the browser to YouTube XL, if the website detected that the Internet Channel or the PlayStation 3 browser is being used.
Everybody Votes Channel
Everybody Votes Channel allowed users to vote in simple opinion polls and compare and contrast opinions with those of friends, family, and people across the globe.
Everybody Votes Channel was launched on February 13, 2007, and was available in the Wii Channels section of the Wii Shop Channel. The application allowed Wii owners to vote on various questions using their Mii as a registered voter. Additionally, voters were also able to make predictions for the choice that will be the most popular overall after their own vote has been cast. Each Mii's voting and prediction record is tracked and voters can also view how their opinions compare to others. Whether the Mii is correct in its predictions or not is displayed on a statistics page along with a counter of how many times that Mii has voted. Up to six Miis would be registered to vote on the console. The channel was free to download. Each player would make a suggestion for a poll a day.
Like the other four Wii channels (Forecast Channel, News Channel, Nintendo Channel, Check Mii Out Channel/Mii Contest Channel), the Everybody Votes Channel ended its seven-year support on June 27, 2013 due to Nintendo shifting its resources to its next generation projects. Unlike the other discontinued channels, Everybody Votes Channel remains accessible with users able to view the latest poll data posted, albeit the channel will never be updated again.
Check Mii Out Channel
The Check Mii Out Channel (also known as the Mii Contest Channel in Australia, Europe and Japan and Canal Miirame in Spanish-speaking countries in Latin America) was a channel that allowed players to share their Miis and enter them into popularity contests. It was first available on November 11, 2007. It was available free to download from the Wii Channels section of the Wii Shop Channel.
Users would post their own Miis in the Posting Plaza, or import other user-submitted Miis to their own personal Mii Parade. Each submitted Mii was assigned a 12-digit entry number to aid in searching. Submitted Miis were given 2 initials by their creator and a notable skill/talent to aid in sorting.
In the Contests section, players submitted their own Miis to compete in contests to best fit a certain description (e.g. Mario without his cap). After the time period for sending a Mii had expired, the user had the choice of voting for three Miis featured on the judging panel, with ten random Miis being shown at a time. Once the judging period is over, the results of the contest may be viewed. Their selection and/or submission's popularity in comparison to others was displayed, as well as the winning Mii and user.
The Check Mii Out Channel sent messages to the Wii Message Board concerning recent contests. Participants in certain contests would add their user and submitted Mii to a photo with a background related to the contest theme. This picture would then be sent to the Wii Message Board.
This channel ended its seven-year support on June 27, 2013 like the four other channels (Forecast Channel, News Channel, Everybody Votes Channel, Nintendo Channel).
Nintendo Channel
The Nintendo Channel (known as the Everybody's Nintendo Channel in Japan) allowed Wii users to watch videos such as interviews, trailers, commercials, and even download demos for the Nintendo DS line of systems. The Nintendo Channel has the ability to support Nintendo Entertainment System games, Super NES games, Nintendo 64 games, and GameCube games. Later the channel was used for the Wii U, and the Nintendo Switch under the name of the Nintendo eShop. In this capacity the channel worked in a similar way to the DS Download Station. The channel provided games, info, pages and users could rate games that they have played. A search feature was also available to assist users in finding new games to try or buy. The channel had the ability to take the user directly into the Wii Shop Channel for buying the wanted game immediately. The Nintendo Channel was launched in Japan on November 27, 2007, in North America on May 7, 2008, and in Europe and Australia on May 30, 2008. The Nintendo Channel was updated with different Nintendo DS demos and new videos every week; the actual day of the week varies across different international regions. Nintendo DS demos can be transmitted to the handheld console.
An updated version of the Nintendo Channel was released in Japan on July 15, 2009, North America on September 14, 2009, and in Europe on December 15, 2009. The update introduced a new interface and additional features, options, and statistics for users to view. However, the European version was missing some of these new additional features, such as options for choosing video quality. In addition, a weekly show known as Nintendo Week began airing exclusively on the North American edition of the channel, while another show, Nintendo TV, was available on the UK version of the channel.
The Nintendo Channel and the other 4 channels (Forecast Channel, News Channel, Everybody Votes Channel, and Check Mii Out Channel/Mii Contest Channel) ended their seven-year support on June 27, 2013.
A few shows appeared on Nintendo Channel which were no more than 20 minutes long:
Nintendo Week: The hosts were Gary and Allison, but other co-hosts appeared as well like Dark Gary, Daniel, and others.
Ultimate Wii Challenge/New Super Mario Bros. Wii Challenge: The hosts were David and Ben. They tried to beat each other's time in Nintendo Games like New Super Mario Bros. Wii, Donkey Kong Country Returns, Super Mario Galaxy 2, and Kirby's Epic Yarn. In a few episodes, Ben and David worked together in levels of a few games.
Many Nintendo DS demos were available in Nintendo Channels DS Download Service.
Disconnection
Forecast Channel, the News Channel, the Everybody Votes Channel, the Check Mii Out Channel/Mii Contest Channel, were shut down permanently on June 27, 2013, as Nintendo terminated the WiiConnect24 service which these channels required, and shifted their resources to their next-generation projects, such as the Wii U and Nintendo 3DS.
Other channels
These channels were those that could be acquired through the usage of various games and accessories.
Wii Fit/Wii Fit Plus Channel
Wii Fit allowed users to install the Wii Fit Channel to the Wii Menu. The channel allowed them to view and compare their results, and those of others, as well as their progress in the game, without requiring the game disc to be inserted.
The channel allowed users to access some of the features of Wii Fit. It allowed users to view statistics from the game including users' BMI measurements and balance test scores in the form of a line graph, as well as keep track of the various activities they have undertaken with a calendar. Users were also able to weigh themselves and do a BMI and balance test with the channel once per day. However, if the player wishes to do any exercises or play any of the aerobics games and/or balance games, the game prompted the user to insert the Wii Fit game disc.
Mario Kart Channel
Mario Kart Wii allows players to install the Mario Kart Channel on their Wii console. The channel can work without inserting the Mario Kart Wii disc into the console, but to compete in races and time trials the disc is required. The use of the Mario Kart Channel allows for a number of options. A ranking option lets players see their best Time Trial scores for each track and compare their results to those of their friends and other players worldwide, represented by their Miis. Players will have the option of racing against the random or selective ghosts, or improving their results gradually by taking on the ghosts of rivals, those with similar race times. Users have the option to submit these times for others around the world to view. Players can also manage and register friends using the channel and see if any of them are currently online.
Another feature of the channel are Tournaments, where Nintendo invited players to challenges similar to the missions on Mario Kart DS. Players were also able to compare their competition rankings with other players.
As of May 20, 2014, most features of the channel have been discontinued, such as Tournaments.
Jam with the Band Live Channel (Japan and PAL regions only)
The Nintendo DS game Jam with the Band supports the Jam with the Band Live Channel (known as the Speaker Channel in Japan) that allows players to connect their game to a Wii console and let the game's audio be played through the channel. The channel supports multiple players.
Wii Speak Channel
Users with the Wii Speak peripheral are able to access the Wii Speak Channel. Users can join one of four rooms (with no limit to the number of people in each room) to chat with others online. Each user is represented by their own Mii, which lip-syncs to their words. In addition, users can also leave audio messages for other users by sending a message to their Wii Message Board. Users can also photo slideshows and comment on them. The Wii Speak Channel became available in North America and Europe on December 5, 2008, and was discontinued on May 20, 2014. The Wii Speak Channel is succeeded by Wii U Chat, which is standardized for the Wii U console.
Rabbids Channel
This is a channel created by Rabbids Go Home. When the game is started up for the first time or when the player goes to the player profile screen, the player may install the Rabbids Channel, which will appear on the Wii Menu once it is downloaded. Players can use the channel to view other people's Rabbids and enter contests.
Downloadable channels
Downloadable Channels are Channels that can be bought from the Wii Shop Channel.
Virtual Console Channels
Virtual Console channels were channels that allowed users to play their downloaded Virtual Console games obtained from the Wii Shop Channel. The Virtual Console portion of the Wii Shop Channel specialized in older software originally designed and released for home entertainment platforms that are now defunct. These games were played on the Wii through the emulation of the older hardware. The prices were generally the same in almost every region and were determined primarily by the software's original platform. There was initially planned to be a Virtual Console channel where users could launch their Virtual Console games sorted by console, but this idea was dropped.
WiiWare Channels
Functioning similarly to the Virtual Console channels, WiiWare channels allowed users to use their WiiWare games obtained from the Wii Shop Channel. The WiiWare section specialized in downloadable software specifically designed for the Wii. The first WiiWare games were made available on March 25, 2008 in Japan. WiiWare games launched in North America on May 12, 2008, and launched in Europe and Australia on May 20, 2008.nintendo.com.au – News from Nintendo
The WiiWare section was being touted as a forum to provide developers with small budgets to release smaller-scale games without the investment and risk of creating a title to be sold at retail (somewhat similar to the Xbox Live Arcade and the PlayStation Store). While actual games have been planned to appear in this section since its inception, there had been no official word on when any would be appearing until June 27, 2007, when Nintendo made an official confirmation in a press release which revealed the first titles would surface sometime in 2008. According to Nintendo, "The remarkable motion controls will give birth to fresh takes on established genres, as well as original ideas that currently exist only in developers' minds."
Like Virtual Console games, WiiWare games were purchased using Wii Points. Nintendo handled all pricing options for the downloadable games.
Television Friend Channel (Japan only)
The Television Friend Channel allowed Wii users to check what programs are on the television. Content was provided by Guide Plus. It was developed by HAL Laboratory. The channel had been said to be "very fun and Nintendo-esque". A "stamp" feature allowed users to mark programs of interest with a Mii-themed stamp. If an e-mail address or mobile phone number would have been registered in the address book, the channel could send out an alert 30 minutes prior to the start of the selected program. The channel tracked the stamps of all Wii users and allowed users to rate programs on a five-star scale. Additionally, when the channel was active the Wii Remote could be used to change the TV's volume and channel so that users can tune into their shows by way of the channel. The Television Friend Channel launched in Japan on March 4, 2008, and was discontinued on July 24, 2011, due to the shutdown of analog television broadcasts in Japan. It was never launched outside Japan, as most countries, unlike Japan, have a guide built into set-top boxes and/or TVs. The Television Friend Channel was succeeded by the now-defunct Nintendo TVii, which was standardized for the Wii U console. It also had the Kirby 1-UP sound, since it was made by HAL Laboratory. This was later removed before the release of the channel.
Digicam Print Channel (Japan only)
The Digicam Print Channel was a channel developed in collaboration with Fujifilm that allowed users to import their digital photos from an SD card and place them into templates for printable photo books and business cards through a software wizard. The user was also able to place their Mii on a business card. The completed design would then be sent online to Fujifilm who printed and delivered the completed product to the user. The processing of individual photos was also available.
The Digicam Print Channel became available from July 23, 2008 in Japan, and ceased operation on June 26, 2013.
Today and Tomorrow Channel
The Today and Tomorrow Channel became available in Japan on December 2, 2008, and in Europe, Australia, and South Korea on September 9, 2009. The channel was developed in collaboration with Media Kobo and allows users to view fortunes for up to six Miis across five categories: love, work, study, communications, and money. The channel also features a compatibility test that compares two Miis, and also gives out "lucky words" that must be interpreted by the user. The channel uses Mii birthdate data, but users must input a birth year when they are loaded onto the channel. This channel was never released in North America, and although it was discontinued on January 30, 2019 with the Wii Shop Channel discontinuation, it can still be redownloaded if obtained before the Wii Shop Channel'''s closure.
Wii no Ma (Japan only)
A video on-demand service channel was released in Japan on May 1, 2009. The channel was a joint venture between Nintendo and Japanese advertising agency Dentsu. The channel's interface was built around a virtual living room, where up to 8 Miis can be registered and interact with each other. The virtual living room contained a TV which took the viewer to the video list. Celebrity "concierge" Miis occasionally introduced special programming. Nintendo ceased operations of Wii no Ma on April 30, 2012.This channel is also known as Wii Room in EnglishDemae Channel (Japan only)
A food delivery service channel was released in Japan on May 26, 2009. The channel was a joint venture between Nintendo and the Japanese on-line food delivery portal service Demae-can, and was developed by Denyu-sha. The channel offered a wide range of foods provided by different food delivery companies which can be ordered directly through the Wii channel. A note was posted to the Wii Message Board containing what had been ordered and the total price. The food was then delivered to the address the Wii user has registered on the channel. On February 22, 2017, Demae Channel was delisted from the Wii Shop Channel, it was later discontinued alongside the Wii U version on March 31, 2017.
BBC iPlayer Channel (UK only)
Wii access to the BBC iPlayer was interrupted on April 9, 2008, when an update to the Opera Browser turned out to be incompatible with the BBC iPlayer. The BBC chose not to make the BBC iPlayer compatible with the upgrade. This was resolved on November 18, 2009 when they released the BBC iPlayer Channel, allowing easier access to the BBC iPlayer.
The BBC had since offered a free, dedicated Wii channel version of their BBC iPlayer application which was only available in the UK. By February 10, 2015, however, the channel was retired and consequently removed from Wii Shop Channel since newer versions are not compatible, and as per BBC's policy to retire older versions as a resource management. The channel had since been succeeded by the BBC iPlayer app on the UK edition of the Wii U eShop, which was released in May 2015.
Netflix Channel
The Netflix channel was released in the United States and Canada on October 18, 2010 and in the UK and Ireland on January 9, 2012. This channel allowed Netflix subscribers to use that service's "Watch Instantly" movie streaming service over the Wii with their regular Netflix subscription fee, and replaced the previous Wii "streaming disc" mailed to Netflix customers with Wii consoles from March 27 to October 17, 2010 due to contractual limitations involving Xbox 360 exclusivity. The channel was free to download in the Wii Channels section of the Wii Shop Channel. The channel displayed roughly 12 unique categories of videos with exactly 75 video titles in each category. The TV category had many seasons of videos (i.e. 15–100 episodes) associated with each title. There were also categories for videos just watched, new releases, and videos recommended (based on the user's Netflix subscription history). On July 31, 2018, the channel was delisted from the Wii Shop Channel; Netflix would drop support for the Wii on January 30, 2019.
LoveFilm Channel (UK and Germany only)
On 4 December 2012, the LoveFilm channel was available to download on Wii consoles in the UK and Germany; the channel was discontinued on 31 October 2017, along with the closure of LoveFilm itself.
Kirby TV Channel (PAL regions only)
The Kirby TV Channel launched on June 23, 2011 in Europe, Australia and New Zealand, and has since been discontinued. The channel allowed users to view episodes of the animated series Kirby: Right Back at Ya! for free. This channel was succeeded by the Nintendo Anime Channel, a Nintendo 3DS video-on-demand app, available in Australasia and Europe, which streamed curated anime or anime-inspired shows, such as Kirby: Right Back at Ya!Hulu Plus Channel (USA only)Hulu Plus Channel was a channel for the Wii, also as announced in Nintendo Updates on Nintendo Channel. Hulu Plus Channel included classic shows and other Hulu included shows. The channel launched in 2012, and was only available in the United States. On January 30, 2019, Hulu dropped support for the Wii.
The Legend of Zelda: Skyward Sword Save Data Update ChannelThe Legend of Zelda: Skyward Sword Save Data Update Channel fixed an issue in the game The Legend of Zelda: Skyward Sword. This title was the only Wii game to ever receive a downloadable, self-patching service, wherein previous titles with technical issues, such as Metroid: Other M, required the game's owners experiencing said issues to send their Wii consoles to customer service where Nintendo had to manually fix such issues.
YouTube Channel
The YouTube channel allowed the user to view YouTube videos on the television screen and had the ability to sign into an existing YouTube account. The YouTube channel, which became available without warning, was only available in the North American, UK, Japanese, and Australian versions of the Wii system, with the North American release on November 15, 2012, only three days before the Wii U was released in North America. Google planned to gradually make the channel available on Wii in other countries besides the aforementioned regions. The YouTube channel was initially categorized on the Wii Shop Channel as a WiiWare title by mistake, but this was later fixed when the Wii U Transfer Tool channel became available. On June 26, 2017, YouTube terminated legacy support for all devices that continue using the Flash-based YouTube app (typically found in most TV devices released before 2012), which includes the Wii.
Wii U Transfer Tool Channel
This application became available on the Wii Shop Channel the day the Wii U was released per respective region. The only purpose of this channel is to assist transferring all eligible content out from a Wii console to a Wii U console, where the said content would be available via Wii Mode on the target Wii U. The application can transfer all available listed WiiWare titles (initially with the sole exemption of LostWinds for unknown reasons, but the game had since become available for both transfer to and purchase on Wii U since May 2014), all available listed Virtual Console titles, game save data, DLC data, Mii Channel data, Wii Shop Channel data (including Wii Points, conditional that accumulated total does not exceed 10,000 Wii Points on target Wii U), and Nintendo Wi-Fi Connection ID data to a target Wii U (albeit now moot since the service was discontinued in May 2014), but it cannot transfer Wii settings data, pre-installed WiiWare/Virtual Console titles (such as Donkey Kong: Original Edition that came pre-installed in the PAL version of the Super Mario Bros. 25th Anniversary Wii bundle), any game or application software that had been since delisted from the Wii Shop Channel prior to the release of Wii U (such as the Donkey Kong Country trilogy), software that is already available on the target Wii U's Wii Mode, WiiConnect24-supported software and save data (which includes the 16-digit Wii console Friend Code), and GameCube save data since the Wii U does not support the latter two. It is possible to move content from multiple Wii consoles to a single target Wii U console, as well as multiple transfers from a single Wii console if required, albeit the last Wii console's content will overwrite any similar Wii data transferred to target Wii U earlier. Due to technical limitations, the channel cannot directly transfer any eligible background data which has been saved on the console's SD card.
The Wii U Transfer Tool Channel features an animation based on the Pikmin series, wherein a visual transfer display of various Pikmin would automatically carry the eligible data and software to a space ship, likely representing the SD card used to perform the transfer, bound for the Wii U. While context dynamic, this animation is not interactive, and only exists for entertainment purposes.
The ability to transfer content from the Wii to the Wii U is still available for the foreseeable future after the Wii Shop Channels shutdown on January 30, 2019.
Amazon Instant Video (USA only)
Amazon Instant Video, a video on demand service provided by Amazon, was released as a downloadable Wii channel in the United States on January 17, 2013; the service was discontinued on January 30, 2019.
Crunchyroll
In late 2014, Crunchyroll released their video app for the Wii's successor, Wii U, in North America. However, believing there are still many actively connected Wii consoles in its twilight years, Crunchyroll had surprised users with a Crunchyroll channel for the Wii as well, launching the app categorized under WiiWare on October 15, 2015 in North America and the PAL regions. The Crunchyroll Wii channel only permitted access to Premium account holders to the majority of the prime content. On May 5, 2017, less than 20 months after its launch, Crunchyroll ceased support for the Wii due to technical limitations after the service updated with new technology.
Wii Message Board
The Message Board allows users to leave messages for friends, family members, or other users on a calendar-based message board. Users could also use WiiConnect24 to trade messages and pictures with other Wii owners, conventional email accounts (email pictures to console, but not pictures to email), and mobile phones (through text messages). Each Wii has an individual wii.com email account containing the Wii Number. Prior to trading messages it is necessary to add and approve contacts in the address book, although the person added will not get an automatic notification of the request, and must be notified by other means. The service also alerts all users of incoming game-related information.
Message Board was available for users to post messages that are available to other Wii users by usage of Wii Numbers with WiiConnect24. In addition to writing text, players can also include images from an SD card in the body of messages, as well as attaching a Mii to the message. Announcements of software updates and video game news are posted by Nintendo. The Message Board can be used for posting memos for oneself or for family members without going online. These messages could then be put on any day of the calendar. The Wii Message Board could also be updated automatically by a real-time game like Animal Crossing.Wii Sports, Wii Play, Mario Kart Wii, Wii Speak Channel, Wii Sports Resort, Super Mario Galaxy & Super Mario Galaxy 2 use the Message Board to update the player on any new high scores or gameplay advancements, such as medal placements in the former two titles, completions of races including a photo, audio messages, and letters from the Mailtoad via the Wii Message Board. Metroid Prime 3: Corruption, Super Mario Galaxy, Super Smash Bros Brawl, Elebits, Animal Crossing: City Folk, Dewy's Adventure and the Virtual Console game Pokémon Snap allow players to take screenshots and post them to the Message Board to edit later or send to friends via messages. Except for GameCube games, the Message Board also records the play history in the form of "Today's Accomplishments". This feature automatically records details of what games or applications were played and for how long. It cannot be deleted or hidden without formatting the console itself. Prior to its closure, the Nintendo Channel was able to automatically tally all Wii game play data from the Message Board and display them in an ordered list within the channel.
Subsequent system updates added a number of minor features to the Message Board, including minor aesthetic changes, USB keyboard support and the ability to receive Internet links from friends, which can be launched in the Internet Channel.
An exploit in the Wii Message Board can be used to homebrew a Wii via a tool called LetterBomb.
Discontinuation
The WiiConnect24 service has been terminated as of June 27, 2013, completely ceasing the data exchange functionality of the Wii Message Board for all Wii consoles, whether as messages or game data. However, Nintendo is still able to continue sending some notification messages after that date to any continuously up and running Wii consoles.
SD Card Menu
The SD Card Menu is a feature made available with the release of Wii Menu version 4.0. This menu allows the user to run Virtual Console games, WiiWare games, and Wii Channels directly from the SD card, which makes it possible to free up the Wii's internal memory. Applications can be downloaded to the SD card directly from the Wii Shop Channel as well.
When running an application from the SD Card Menu, it is temporarily copied to the internal memory of the Wii, meaning the internal memory still must contain an amount of free blocks equal to the application's size. If the internal memory does not have enough space, the Channel will run an "Automanager" program, which clears up space for the user in one of many ways (selectable by the user).
The manager can place the largest channels on the user's Wii in the SD card, put smaller channels on the SD card until enough space remains to run the channel, clear channels from the left side of the Wii menu to the right side, or from the right side to the left until there are enough blocks to run the channel.
History of updates
System version 1.0 was released on launch day, and was designed mainly for offline use, as connecting to the internet would trigger an update prompt to install 2.0. For a while after that, the Wii received new features such as the Forecast Channel, as well as bug fixes.
Some of these updates also included fixes to block the early forms of homebrew, the first of which was an SSL issue in the Wii Shop Channel. Later in 2007, Nintendo added code to block the GameCube Action Replay, although this update was bundled with several other features in the 3.0 update.
A week after Wii Freeloader released, Nintendo released an update containing a new IOS with the bug exploited by Freeloader fixed, although this new IOS was not used by the Wii Menu. Later that year, Nintendo released a new Wii Menu that copied this fix to the IOS user by the Wii Menu. In addition, code was added to the Wii Menu to delete the primary homebrew entrypoint on every boot, although this code was very buggy and was easily bypassed. Nintendo also patched the hole used to extract the private encryption keys of the Wii, and finally made a small change to the Mii Channel to convince people to update.
Nintendo's next few updates made similar small changes to various channels, and one of them copied the fix for the previous IOS bug to every IOS, as well as a few other exploit fixes. A few weeks later, Nintendo ported these new fixes to every IOS, made a failed attempt to block a specific homebrew IOS, and made their second attempt at fixing the main homebrew entrypoint. This attempt at stopping the homebrew entrypoint was then superseded by a successful attempt in 2009, along with other IOS fixes, and some features.
Later that year, Nintendo released another homebrew-blocking update, but unlike the previous updates, it offered no new features; instead, it updated the Wii Shop Channel to require the new version. In addition to fixing homebrew bugs, it aggressively checks for the Homebrew Channel and deletes it if it is present, replaced several IOSes used by homebrew with nonfunctional versions, and updated a bootloader to overwrite the one used by homebrew, unexpectedly causing many consoles to refuse to boot. Two similar updates were then released throughout 2010, although the only attempts to stop Wii homebrew past that were in the Wii U's Wii Mode feature.
The final update delivered in PAL and American regions added support to transfer content to the Wii U. However, two updates were released in Japan past this point that only affected Dragon Quest X players, solely updating the IOS used by Dragon Quest X''.
See also
Nintendo Wi-Fi Connection
WiiConnect24
Wii Shop Channel
Other gaming platforms from Nintendo:
Nintendo 3DS system software
Nintendo DSi system software
Wii U system software
Nintendo Switch system software
Other gaming platforms from the next generation:
PlayStation 4 system software
PlayStation Vita system software
Xbox One system software
Other gaming platforms from this generation:
PlayStation 3 system software
PlayStation Portable system software
Xbox 360 system software
References
External links
Wii System Menu and Feature Updates
Site documenting all updates during an update and how they affect homebrew and other hacks
Wii
Nintendo Network
Game console operating systems
Discontinued operating systems
Proprietary operating systems
Graphical user interface elements
Video games scored by Kazumi Totaka | Wii system software | Technology | 11,955 |
34,769,089 | https://en.wikipedia.org/wiki/Ethenolysis | In organic chemistry, ethenolysis is a chemical process in which internal olefins are degraded using ethylene () as the reagent. The reaction is an example of cross metathesis. The utility of the reaction is driven by the low cost of ethylene as a reagent and its selectivity. It produces compounds with terminal alkene functional groups (α-olefins), which are more amenable to other reactions such as polymerization and hydroformylation.
The general reaction equation is:
Ethenolysis is a form of methylenation, i.e., the installation of methylene () groups.
Applications
Terminal alkenes
Using ethenolysis, higher molecular weight internal alkenes can be converted to more valuable terminal alkenes. The Shell higher olefin process (SHOP process) uses ethenolysis on an industrial scale. SHOP α-olefin mixtures are first separated by distillation. Higher molecular weight fractions are isomerized by alkaline alumina catalysts in the liquid phase. The resulting internal olefins are reacted with ethylene to regenerate α-olefins. The large excess of ethylene moves the reaction equilibrium to the terminal α-olefins. Catalysts are often prepared from rhenium(VII) oxide () supported on alumina.
Perfume
In one application, neohexene, a precursor to perfumes, is prepared by ethenolysis of diisobutene:
α,ω-Dienes, i.e., diolefins of the formula , are prepared industrially by ethenolysis of cyclic alkenes. For example, 1,5-hexadiene, a useful crosslinking agent and synthetic intermediate, is produced from 1,5-cyclooctadiene:
The catalyst is derived from rhenium(VII) oxide supported on alumina. 1,9-Decadiene, a related species, is produced similarly from cyclooctene.
Decenoic acid
In an application directed at using renewable feedstocks, methyl oleate, derived from natural seed oils, can be converted to 1-decene and methyl 9-decenoate:
Polyethylene and polypropylene recycling
Mixed polyolefins can be recycled via high selectivity isomerizing ethenolysation using a sodium on alumina catalyst followed by olefin metathesis using a stream of ethylene gas flowing into a reaction chamber containing a tungsten oxide on silica catalyst, albeit at high temperature. Carbon atoms freed by the breaking carbon-carbon bonds attach to ethylene molecules. Polyethylene is first converted to propylene, while polypropylene is ultimately converted to a mixture of propylene and isobutylene.
References
Carbon-carbon bond forming reactions
Organometallic chemistry
Homogeneous catalysis | Ethenolysis | Chemistry | 608 |
1,085,417 | https://en.wikipedia.org/wiki/Molisch%27s%20test | Molisch's test is a sensitive chemical test, named after Austrian botanist Hans Molisch, for the presence of carbohydrates, based on the dehydration of the carbohydrate by sulfuric acid or hydrochloric acid to produce an aldehyde, which condenses with two molecules of a phenol (usually α-naphthol, though other phenols such as resorcinol and thymol also give colored products), resulting in a violet ring.
Procedure
The test solution is combined with a small amount of Molisch's reagent (α-naphthol dissolved in ethanol) in a test tube. After mixing, a small amount of concentrated sulfuric acid is slowly added down the sides of the sloping test-tube, without mixing, to form a layer. A positive reaction is indicated by appearance of a purple red ring at the interface between the acid and test layers.
Reaction
All carbohydrates – monosaccharides, disaccharides, and polysaccharides (except trioses and tetroses)– should give a positive reaction, and nucleic acids and glycoproteins also give a positive reaction, as all these compounds are eventually hydrolyzed to monosaccharides by strong mineral acids. Pentoses are then dehydrated to furfural, while hexoses are dehydrated to 5-hydroxymethylfurfural. Either of these aldehydes, if present, will condense with two molecules of α-naphthol to form a purple-colored product, as illustrated below by the example of glucose:
See also
Rapid furfural test
References
Biochemistry detection methods
Carbohydrate methods | Molisch's test | Chemistry,Biology | 369 |
19,865,759 | https://en.wikipedia.org/wiki/Karin%20Lochte | Karin Lochte (born 20 September 1952) is a German oceanographer, researcher, and climate change specialist. She was director of German Polar Research Alfred Wegener Institute from 2007 to 2017 as well as chairman of the management committee of Jacobs University Bremen.
Biography
Lochte was born in Hanover. She received her PhD in marine biology at the University College of North Wales in 1984.
After her PhD, she worked on deep sea microbiology at the Institut für Meereskunde, University of Kiel. Earlier in her career, Lochte was a professor of Biological Oceanography at the Leibniz Institute for Marine Sciences at the Christian-Albrechts University in Kiel where she led a research unit that focused on chemical cycles in the sea. She lectured biological oceanography at the University of Rostock and Kiel from 1995 to 2000 and subsequently at the Leibniz Institute for Baltic Sea Research in Warnemünde until 2007. She was also the project coordinator for the Atlantic Data Base for Exchange Processes at the Deep Sea Floor (ADEPD), a European Union funded marine research project from 1998 to 2000. Her involvement in polar research began in 2007, when she started work at the Alfred Wegener Institute in Bremerhaven.
Lochte was appointed as the Director of the Alfred Wegener Institute in 2007 and hold that position to 2017. Her research focussed on the interactions between ocean nutrient cycles and climate. She has been the vice-president of Earth and Environment field research for the Helmholtz Association.
Affiliations
Lochte is a member of several national and international boards, scientific committees and research funding organizations. She was a member of the German Scientific Council, which advises the German Federal and state Governments and the on development of universities, science and research and is chair of the Scientific Commission of Lower Saxony. She is also a delegate of the Scientific Committee on Antarctic Research and chairperson of the Board of Governors of Jacobs University. She is on the advisory board of the Arctic Circle.
Honours
Order of Merit of the Federal Republic of Germany, 1st class, 2017, accepted by Lochte (see Hanseatic rejection)
References
External links
Karin Lochte profile - on academia-net.org
Curriculum Vitae - German language
1952 births
Living people
Scientists from Hanover
German oceanographers
German marine biologists
German women academics
German Antarctic scientists
German women scientists
Women Antarctic scientists
Women oceanographers
Officers Crosses of the Order of Merit of the Federal Republic of Germany
Environmental scientists | Karin Lochte | Environmental_science | 494 |
34,113,938 | https://en.wikipedia.org/wiki/Act%20on%20Health%20Sector%20Database | The Act on Health Sector Database, also known as Act on Health Sector Database, No. 139/1998, the Health Sector Database Act and in media by other colloquial names, was a 1998 act of the Icelandic Parliament which allowed the Icelandic government to grant a license to a private company for the creation of a national biological database to store health information which could be used for research. The act was noted for boldly introducing policy related to biobanks and was the subject of controversy.
deCODE genetics did most of the lobbying for the act and was the beneficiary of the license to create the database.
Controversies
The passing of this act spurred international discussion about what policies were already in place and what differences in policy existed among biobanks.
The establishment of a national database for all Icelandic citizens raised discussion about the nature of the informed consent process for the project.
References
External links
, English translation
World Health Organization summary
Biobanks
Health law in Iceland
Government databases
Biological databases
Database law
Databases
Science and technology in Iceland
1998 in Iceland
1998 in law | Act on Health Sector Database | Biology | 213 |
55,565,392 | https://en.wikipedia.org/wiki/TADIG%20code | TADIG code is a number uniquely identifying network operators in a GSM mobile network. The acronym TADIG expands to "Transferred Account Data Interchange Group". According to the GSM specification, the codes are used as "primary identifiers within file contents and file names" in multiple file formats defined by the GSMA. Network operators are required to register new codes and limit themselves to using code already registered with the GSMA.
TADIG codes are generally used by bilateral agreement for the purposes of billing roaming telephone calls.
Format
A TADIG code is 5 characters long, consisting of
Three-character country code. This is usually the ISO 3166-1 alpha-3 code for terrestrial operators. Non-terrestrial operators have the first two characters as AA. Wi-Fi operators have the first two characters as WW.
Two-character operator/ company identifier
Example
TADIG code: CANGW (for Freedom Mobile, formerly WIND Mobile)
TADIG code: SWE01 (for the Sweden1 bilateral Roaming Hub)
TADIG code: USAHI (for Mobi)
Notable exceptions
The GSMA specification lists the following in their list of "known issues" as discrepancies between codes registered with them against ones actually being used
US territories are not always represented in the USA
YUG continues to be used as country code by operators in Montenegro and Serbia. Each now has its own ISO code, MNE and SRB respectively
Kosovo is not recognised as a country within the ITU. As a placeholder, the value K00 is used to represent the country
References
Mobile telecommunications
Mobile telecommunications standards | TADIG code | Technology | 323 |
14,576,735 | https://en.wikipedia.org/wiki/Virtual%20design%20and%20construction | Virtual design and construction (VDC) is the management of integrated multi-disciplinary performance models of design–construction projects, including the product (facilities), work processes, and organization of the design – construction – operation team to support explicit and public business objectives. This is usually achieved creating a digital twin of the project, in where to manage the information.
The theoretical basis of VDC includes:
Engineering modeling methods: product, organization, process
Analysis methods – model-based design: including quantities, schedule, cost, 4D interactions, and process risks, these are termed building information modeling (BIM) tools
Visualization methods
Business metrics – within business analytics – and a focus on strategic management
Economic impact analysis, i.e., models of both the cost and value of capital investments
BIM managed project
"Virtual design and construction BIMs are virtual because they show computer-based descriptions of the project. The BIM project model emphasizes those aspects of the project that can be designed and managed, i.e., the product (typically a building or plant [and infrastructure]), the organization that will define, design, construct, and operate it, and the process the organization teams will follow, that is, the product–organization–process or POP. These models are logically integrated in the sense that they all can access shared data, and if a user highlights or changes an aspect of one, the integrated models can highlight or change the dependent aspects of related models. The models are multi-disciplinary in the sense that they represent the architect, engineering, construction (AEC), and owner of the project, as well as relevant sub-disciplines. The models are performance models in the sense that they predict some aspects of project performance, track many that are relevant, and can show predicted and measured performance in relationship to stated project performance objectives. Some companies now practice the first steps of BIM modeling, and they consistently find that they improve business performance by doing so." Companies are also now considering developing BIMs in various levels of detail, since depending on the application of BIM, more or less detail is needed, and there is varying modeling effort associated with generating building information models at different levels of detail.
Methodologies underpinning BIM
Advances in construction engineering began with the ten volumes on architecture completed by Vitruvi, a 1 century B.C. Roman. Vitruvi laid the key and lasting foundation for a study of construction.
A principle of construction is a use of an applied ontology based in the upper ontology. In practice, these ontologies take on a form of breakdown structures such as the work breakdown structure. Usually breakdown structures form metadata to represent a construction activity; there are notable cases at exceptionally large construction companies where they are simply numbered. In practice, an ontology approach requires a semantic integration approach to construction data so to capture a present status of construction activities (i.e., the project).
The research that forms virtual design and construction (VDC) is based in scientific evidence and a validation measured against a best theory opposed to a best practice. This approach, pioneered by the illustrious Dr. Kunz, was a departure from earlier construction engineering methodologies that focused on studies of best practices. The scientific evidence method requires formulating a hypothesis and then testing that hypothesis to failure so to validate. A range of scientific methodologies have proven useful in construction engineering research, in both qualitative research and quantitative research. Because construction is difficult to replicate in a controlled setting, the case-based reasoning, case study and action research methodologies prevail. Power of a method is important to include in results; the case study is often broad and the action research is often focused.
A core concept in VDC is spacetime dimensions. There are four dimensions; three space dimensions and a fourth, time. There are additional dimensions of cost and quality, but a core is formed by these four. The four dimensions were first understood by Vitruvi as an importance of perspective (i.e., 3D) and time (i.e., 4D). Prior to computing, a focus was on the fourth dimension of time. In practice, time is a focus of the critical path method. With advances in computing, the representation of three dimensions of space has increased. The merging of space and the above discussed ontology formed the information model, in the construction engineering field, known as building information modeling. The combination of space and time in practice is shown by the linear scheduling method and in close relation the 4D model.
Computing brought about the advent of the need to align with a software developer. Previously, pencil and paper was forgiving on the mixing of methods from different schools of thought. Software is not as forgiving and to mix software requires this as a goal. This forms the field of interoperability research. The practical application is demonstrated by the Industry Foundation Classes.
Today, the most compelling advances in VDC are in computer vision (List of computer vision topics), artificial intelligence, and the architecture of transmission (AoT), an object-oriented project lifecycle management process, which acts as a counterpoint to commissioned IoT technologies.
An important application of VDC is in the workzone. This is where the construction activities reside, and the workforce is a core component. To create an educated workforce with the technical knowhow to use the technology tools now available, VDC includes the development of advanced vocational education topics.
See also
Construction management
Construction engineering
List of project management topics
Research centers
Center for Integrated Facility Engineering (CIFE), Stanford University
mosaic, Carnegie Mellon University
BIM at UTexas
Field Systems and Construction Automation Laboratory (FSCAL), UTexas
Construction Information Technology Laboratory (CITL), Georgia Institute of Technology
RAPIDS Laboratory, Georgia Institute of Technology
References
Civil engineering
Building engineering
Computer-aided design
Building information modeling
Data modeling
Construction management | Virtual design and construction | Engineering | 1,198 |
25,709,428 | https://en.wikipedia.org/wiki/WHP%20Posttranscriptional%20Response%20Element | Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE) is a DNA sequence that, when transcribed, creates a tertiary structure enhancing expression. The sequence is commonly used in molecular biology to increase expression of genes delivered by viral vectors. WPRE is a tripartite regulatory element with gamma, alpha, and beta components. The alpha component is 80bp long:
GCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGT
When used alone without the gamma and beta WPRE components, the alpha component is only 9% as active as the full tripartite WPRE. The sequence for full tripartite WPRE is:
AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTA
TCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTG
GTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGG
AACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCT
CGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGG
CCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTG
This sequence has 100% homology with base pairs 1093 to 1684 of the Woodchuck hepatitis B virus (WHV8) genome. When used in the 3' untranslated region (UTR) of a mammalian expression cassette, it can significantly increase mRNA stability and protein yield.
References
Gene expression
DNA | WHP Posttranscriptional Response Element | Chemistry,Biology | 273 |
40,753,295 | https://en.wikipedia.org/wiki/Lumitrack | Lumitrack is a motion capture technology developed by Robert Xiao, Chris Harrison and Scott Hudson at Carnegie Mellon University. It combines projectors and sensors to provide high-fidelity motion-tracking. These types of sensors are used in video game controllers, such as Microsoft's Kinect, and in motion capture for movie and television production.
Although the research prototype of Lumitrack currently uses visible light, it could be adapted to utilize invisible infrared light. According to the university, the sensors require little power and should be cheap to mass-produce. They could even be built into smartphones.
Technology
The projectors cover the tracked area with structured patterns called a binary m-sequence that resemble barcodes. The series of bars encodes a series of an assortment of vertical lines of varying thicknesses, without repeating any combination of seven adjacent line types anywhere in the projected image. The sensors read the bars to assess motion. The initial implementation offers sub-millimeter accuracy. When two m-sequences are projected at right angles to each other, the sensor can determine its position in two dimensions; while additional sensors enable 3D tracking.
The sensors are simple to manufacture and require little power and features response times in the range of 2.5 milliseconds, making them candidates for incorporation into other devices, such as phones. The sensors can be attached to tracked objects or to fixed objects such as walls.
Applications
The developers target video games as an initial application. Other possibilities include including CGI for movies and television and human–robot interaction.
References
External links
Tracking
Computing input devices
Motion in computer vision | Lumitrack | Physics,Technology | 321 |
5,133,195 | https://en.wikipedia.org/wiki/Microcomputer%20Associates | Microcomputer Associates, Inc., was an American computer company founded by Manny Lemas and Ray Holt. It produced the low-cost Jolt Microcomputer, designed by Holt and released in 1975 for . A Jolt microcomputer was notably used in the Atari VCS prototype by Cyan Engineering.
MAI was later acquired by semiconductor manufacturer Synertek, a second source manufacturer of the 6502, and renamed Synertek Systems. It then created the SYM-1, a 6502-based single board microcomputer and spiritual successor to the KIM-1. In 1978 the company offered a number of processor and peripheral modules.
References
1975 establishments in California
1978 disestablishments in California
1978 mergers and acquisitions
American companies established in 1975
American companies disestablished in 1978
Companies based in Santa Clara, California
Computer companies established in 1975
Computer companies disestablished in 1978
Defunct companies based in California
Defunct computer companies of the United States
Defunct computer hardware companies
Early microcomputers | Microcomputer Associates | Technology | 205 |
2,455,406 | https://en.wikipedia.org/wiki/Halo%20%28religious%20iconography%29 | A halo (), also called a nimbus, aureole, glory or gloriole (), is a crown of light rays, circle or disk of light that surrounds a person in works of art. The halo occurs in the iconography of many religions to indicate holy or sacred figures, and has at various periods also been used in images of rulers and heroes. In the religious art of Ancient Greece, Ancient Rome, Christianity, Hinduism, and Buddhism (among other religions), sacred persons may be depicted with a halo in the form of a circular glow, or flames in Asian art, around the head or around the whole body—this last form is often called a mandorla.
Halos may be shown as almost any colour or combination of colours, but are most often depicted as golden, yellow or white (when representing light) or as red (when representing flames). The earliest artistic depictions of halos were probably in Ancient Egyptian art.
Ancient Mesopotamia and Persia
Sumerian religious literature frequently speaks of ( in Akkadian), a "brilliant, visible glamour which is exuded by gods, heroes, sometimes by kings, and also by temples of great holiness and by gods' symbols and emblems."
Persian mythology, and later Zoroastrian philosophy, speaks of the similar concept of Khvarenah (later farrah), a divine, radiant power that sanctified a king and his reign. It was most often depicted as a phoenix-like bird, the Simurgh.
Ancient Greek world
Homer describes a more-than-natural light around the heads of heroes in battle. Depictions of Perseus in the act of slaying Medusa, with lines radiating from his head, appear on a white-ground toiletry box and on a slightly later red-figured vase in the style of Polygnotos, . On painted wares from south Italy, radiant lines or simple haloes appear on a range of mythic figures: Lyssa, a personification of madness; a sphinx; a sea demon; and Thetis, the sea-nymph who was mother to Achilles. The Colossus of Rhodes was a statue of the sun-god Helios and had his usual radiate crown (copied for the Statue of Liberty). Hellenistic rulers are often shown wearing radiate crowns that seem clearly to imitate this effect.
Asian art
In India, the use of halo might date back to the second half of the second millennium BC. Two figures appliqued on a pottery vase fragment from Daimabad's Malwa phase (1600–1400 BC) have been interpreted as a holy figure resembling the later Hindu god Shiva and an attendant, both with halos surrounding their heads, Aureola have been widely used in Indian art, particularly in Buddhist iconography where it has appeared since at least the 1st century AD; the Kushan Bimaran casket in the British Museum is dated 60 AD (at least between 30BC and 200 AD). The rulers of the Kushan Empire were perhaps the earliest to give themselves haloes on their coins, and the nimbus in art may have originated in Central Asia and spread both east and west.
In Chinese and Japanese Buddhist art, the halo has also been used since the earliest periods in depicting the image of Amitabha Buddha and others. Tibetan Buddhism uses haloes and aureoles of many types, drawing from both Indian and Chinese traditions, extensively in statues and Thangka paintings of Buddhist saints such as Milarepa and Padmasambhava and deities. Different coloured haloes have specific meanings: orange for monks, green for the Buddha and other more elevated beings, and commonly figures have both a halo for the head, and another circular one for the body, the two often intersecting somewhere around the head or neck. Thin lines of gold often radiate outwards or inwards from the rim of the halo, and sometimes a whole halo is made up of these.
In India the head halo is called or , while the full body halo is . Elaborate haloes and especially aureoles also appear in Hindu sculpture, where they tend to develop into architectural frames in which the original idea can be hard to recognise. Theravada Buddhism and Jainism did not use the halo for many centuries, but later adopted it, though less thoroughly than other religious groups.
In Asian art, the nimbus is often imagined as consisting not just of light, but of flames. This type seems to first appear in Chinese bronzes of which the earliest surviving examples date from before 450. The depiction of the flames may be very formalized, as in the regular little flames on the ring aureole surrounding many Chola bronzes and other classic Hindu sculptures of divinities, or very prominent, as with the more realistic flames, and sometimes smoke, shown rising to a peak behind many Tibetan Buddhist depictions of the "wrathful aspect" of divinities, and also in Persian miniatures of the classic period. Sometimes a thin line of flames rise up from the edges of a circular halo in Buddhist examples. In Tibetan paintings the flames are often shown as blown by a wind, usually from left to right. This type is also very rarely found, and on a smaller scale, in medieval Christian art.
Halos are found in Islamic art from various places and periods, especially in Persian miniatures and Moghul and Ottoman art influenced by them. Flaming halos derived from Buddhist art surround angels, and similar ones are often seen around Muhammad and other sacred human figures. From the early 17th century, plainer round haloes appear in portraits of Mughal Emperors and subsequently Rajput and Sikh rulers; despite the more local precedents art historians believe the Mughals took the motif from European religious art, though it expresses a Persian idea of the God-given charisma of kingship that is far older. The Ottomans avoided using halos for the sultans, despite their title as Caliph, and they are only seen on Chinese emperors if they are posing as Buddhist religious figures, as some felt entitled to do.
Egypt and Asia
Roman art
The halo represents an aura or the glow of sanctity which was conventionally drawn encircling the head. It first appeared in the culture of Hellenistic Greece and Rome, possibly related to the Zoroastrian hvarena – "glory" or "divine lustre" – which marked the Persian kings, and may have been imported with Mithraism. Though Roman paintings have largely disappeared, save some fresco decorations, the haloed figure remains fresh in Roman mosaics. In a 2nd-century AD Roman floor mosaic preserved at Bardo, Tunisia, a haloed Poseidon appears in his chariot drawn by hippocamps. Significantly, the triton and nereid who accompany the sea-god are not haloed.
In a late 2nd century AD floor mosaic from Thysdrus, El Djem, (illustration) Apollo Helios is identified by his effulgent halo. Another haloed Apollo in mosaic, from Hadrumentum, is in the museum at Sousse. The conventions of this representation, head tilted, lips slightly parted, large-eyed, curling hair cut in locks grazing the neck, were developed in the 3rd century BC to depict Alexander the Great (Bieber 1964; Yalouris 1980). Sometime after this mosaic was executed, the Emperor began to be depicted with a halo, which was not abandoned when they became Christian; initially Christ only had one when shown on a throne as Christ in Majesty.
Christian art
The halo was incorporated into Early Christian art sometime in the 4th century with the earliest iconic images of Christ, initially the only figure shown with one (together with his symbol, the Lamb of God). Initially the halo was regarded by many as a representation of the Logos of Christ, his divine nature, and therefore in very early (before 500) depictions of Christ before his Baptism by John he tends not to be shown with a halo, it being a matter of debate whether his Logos was innate from conception (the Orthodox view), or acquired at Baptism (the Adoptionist view). At this period he is also shown as a child or youth in Baptisms, though this may be a hieratic rather than an age-related representation.
A cruciform halo, that is to say a halo with a cross within, or extending beyond, the circle is used to represent the persons of the Holy Trinity, especially Jesus, and especially in medieval art. In Byzantine and Orthodox images, inside each of the bars of the cross in Christ's halo is one of the Greek letters Ο Ω Ν, making up —"ho ōn", literally, "the Existing One"—indicating the divinity of Jesus. At least in later Orthodox images, each bar of this cross is composed of three lines, symbolising the dogmas of the Trinity, the oneness of God and the two natures of Christ.
In mosaics in Santa Maria Maggiore (432–40) the juvenile Christ has a four-armed cross either on top of his head in the radius of the nimbus, or placed above the radius, but this is unusual. In the same mosaics the accompanying angels have haloes (as, in a continuation of the Imperial tradition, does King Herod), but not Mary and Joseph. Occasionally other figures have crossed haloes, such as the seven doves representing the Seven gifts of the Holy Spirit in the 11th century Codex Vyssegradensis Tree of Jesse (where Jesse and Isaiah also have plain haloes, as do the Ancestors of Christ in other miniatures).
Later, triangular haloes are sometimes given to God the Father to represent the Trinity. When he is represented by a hand emerging from a cloud, this may be given a halo.
Plain round haloes are typically used to signify saints, the Virgin Mary, Old Testament prophets, angels, symbols of the Four Evangelists, and some other figures. Byzantine emperors and empresses were often shown with them in compositions including saints or Christ, however the haloes were outlined only. This was copied by Ottonian and later Russian rulers. Old Testament figures become less likely to have haloes in the West as the Middle Ages go on.
Beatified figures, not yet canonised as saints, are sometimes shown in medieval Italian art with linear rays radiating out from the head, but no circular edge of the nimbus defined; later this became a less obtrusive form of halo that could be used for all figures. Mary has, especially from the Baroque period onwards, a special form of halo in a circle of twelve stars, derived from her identification as the Woman of the Apocalypse.
were sometimes used for the living in donor portraits of about 500–1100 in Italy. Most surviving ones are of Popes and others in mosaics in Rome, including the Episcopa Theodora head of the mother of the Pope of the day. They seem merely an indication of a contemporary figure, as opposed to the saints usually accompanying them, with no real implication of future canonization. A late example is of Desiderius, Abbot of Monte Cassino, later Pope, from a manuscript of 1056–86; Pope Gregory the Great had himself depicted with one, according to the 9th-century writer of his vita, John, deacon of Rome. A figure who may represent Moses in the 3rd century Dura Europos Synagogue has one, where no round halos are found. Osbert Lancaster notes the presence of sqare haloes in donor portraits in the 7th-century church of St Demetrios in Thessalonika.
Personifications of the Virtues are sometimes given hexagonal haloes. Scalloped haloes, sometimes just appearing as made of radiating bars, are found in the manuscripts of the Carolingian "Ada School", such as the Ada Gospels.
The whole-body image of radiance is sometimes called the 'aureole' or glory; it is shown radiating from all round the body, most often of Christ or Mary, occasionally of saints (especially those reported to have been seen surrounded by one). Such an aureola is often a mandorla ("almond-shaped" vesica piscis), especially around Christ in Majesty, who may well have a halo as well. In depictions of the Transfiguration of Jesus a more complicated shape is often seen, especially in the Eastern Orthodox tradition, as in the famous 15th century icon in the Tretyakov Gallery in Moscow.
Where gold is used as a background in miniatures, mosaics and panel paintings, the halo is often formed by inscribing lines in the gold leaf, and may be decorated in patterns (diapering) within the outer radius, and thus becomes much less prominent. The gold leaf inside the halo may also be burnished in a circular manner, so as to produce the effect of light radiating out from the subject's head. In the early centuries of its use, the Christian halo may be in most colours (though black is reserved for Judas, Satan and other evil figures) or multicoloured; later gold becomes standard, and if the entire background is not gold leaf, the halo itself usually will be.
Decline of the halo
With increasing realism in painting, the halo came to be a problem for artists. So long as they continued to use the old compositional formulae which had been worked out to accommodate haloes, the problems were manageable, but as Western artists sought more flexibility in composition, this ceased to be the case. In free-standing medieval sculpture, the halo was already shown as a flat disk above or behind the head. When perspective came to be considered essential, painters also changed the halo from an aura surrounding the head, always depicted as though seen full-on, to a flat golden disk or ring that appeared in perspective, floating above the heads of the saints, or vertically behind, sometimes transparent. This can be seen first in Giotto, who still gives Christ the cruciform halo which began to be phased out by his successors. In northern Europe the radiant halo, made up of rays like a sunburst, came into fashion in French painting around the end of the 14th century.
In the early 15th century Jan van Eyck and Robert Campin largely abandoned their use, although some other Early Netherlandish artists continued to use them. In Italy at around the same time, Pisanello used them if they did not clash with one of the enormous hats he liked to paint. Generally they lasted longer in Italy, although often reduced to a thin gold band depicting the outer edge of the nimbus, usual for example in Giovanni Bellini. Christ began to be shown with a plain halo.
Fra Angelico, himself a monk, was a conservative as far as haloes are concerned, and some of his paintings demonstrate the problems well, as in several of his more crowded compositions, where they are shown as solid gold disks on the same plane as the picture surface, it becomes difficult to prevent them obstructing other figures. At the same time they were useful in crowded narrative scenes for distinguishing the main, identifiable, figures from the mass of a crowd. Giotto's Lamentation of Christ from the Scrovegni Chapel has eight figures with haloes and ten without, to whom the viewer knows they are not meant to attach a specific identity. In the same way, a Baptism of Christ by Perugino in Vienna gives neither Christ nor John the Baptist haloes, as sufficiently recognisable without them, but a saint in the background, not usually present in this scene, has a ring halo to denote his status.
In the High Renaissance, even most Italian painters dispensed with haloes altogether, but in the Church's reaction to the Protestant Reformation, that culminated in the decrees on images of the Council of Trent of 1563, their use was mandated by clerical writers on religious art such as Molanus and Saint Carlo Borromeo. Figures were placed where natural light sources would highlight their heads, or instead more discreet quasi-naturalistic flickering or glowing light was shown around the head of Christ and other figures (perhaps pioneered by Titian in his late period). Rembrandt's etchings, for example, show a variety of solutions of all of these types, as well as a majority with no halo effect at all. The disk halo was rarely used for figures from classical mythology in the Renaissance, although they are sometimes seen, especially in the classical radiant form, in Mannerist and Baroque art.
By the 19th century haloes had become unusual in Western mainstream art, although retained in iconic and popular images, and sometimes as a medievalising effect. When John Millais gives his otherwise realist St Stephen (1895) a ring halo, it seems rather surprising. In popular graphic culture, a simple ring has become the predominant representation of a halo since at least the late 19th century, as seen for example in the logo for the Simon Templar ("The Saint") series of novels and other adaptations.
Origins and usage of the different terms
The distinction between the alternative terms used in English for various types of halo is rather unclear. The oldest term in English is "glory", the only one available in the Middle Ages, but now largely obsolete. It came from the French which has much the same range of meanings as "glory". "Gloriole" does not appear in this sense until 1844, being a modern invention, as a diminutive, in French also. "Halo" is first found in English in this sense in 1646 (nearly a century after the optical or astronomical sense). Both "halos" and "haloes" may be used as plural forms, and halo may be used as a verb. Halo comes originally from the Greek for "threshing-floor" – a circular, slightly sloping area kept very clean, around which slaves or oxen walked to thresh the grain. In Greek, this came to mean a divine, bright disk.
means "a cloud" in Latin, and is found as "a divine cloud" in 1616, whereas as "a bright or golden disk surrounding the head" it does not appear until 1727. The plural is correct but "rare"; "nimbuses" is not in the OED but sometimes used. is an obsolete form of the noun, but not a verb, except that the obsolete "nimbated", like the commoner "nimbate", means "furnished with a nimbus". It is sometimes preferred by art-historians, as sounding more technical than halo.
, from the Latin for "golden", has been used in English as a term for a gold crown, especially that traditionally considered the reward of martyrs, since the Middle Ages (OED 1220). However, the first use recorded as a term for a halo is in 1848, very shortly after which matters were greatly complicated by the publication in 1851 of the English translation of Adolphe Napoléon Didron's important Christian Iconography: Or, The History of Christian Art in the Middle Ages. This, by what the OED calls a "strange blunder", derived the word from the Latin as a diminutive, and also defined it as meaning a halo or glory covering the whole body, whilst saying that "nimbus" referred only to a halo around the head. This, according to the OED, reversed the historical usage of both words, but whilst Didron's diktat was "not accepted in France", the OED noted it had already been picked up by several English dictionaries, and influenced usage in English, which still seems to be the case, as the word "nimbus" is mostly found describing whole-body haloes, and seems to have also influenced "gloriole" in the same direction.
The only English term that unequivocally means a full-body halo, and cannot be used for a circular disk around the head is "mandorla", first occurring in 1883. However, this term, which is the Italian word for "almond", is usually reserved for the vesica piscis shape, at least in describing Christian art. In discussing Asian art, it is used more widely. Otherwise, there could be said to be an excess of words that could refer to either a head-disk or a full-body halo, and no word that clearly denotes a full-body halo that is not vesica piscis shaped. "Halo" by itself, according to recent dictionaries, means only a circle around the head, although Rhie and Thurman use the word also for circular full-body aureoles.
Spiritual significance in Christianity
The early Church Fathers expended much rhetorical energy on conceptions of God as a source of light; among other things this was because "in the controversies in the 4th century over the consubstantiality of the Father and the Son, the relation of the ray to the source was the most cogent example of emanation and of distinct forms with a common substance" – key concepts in the theological thought of the time.
A more Catholic interpretation is that the halo represents the light of divine grace suffusing the soul, which is perfectly united and in harmony with the physical body.
In the theology of the Eastern Orthodox Church, an icon is a "window into heaven" through which Christ and the Saints in heaven can be seen and communicated with. The gold ground of the icon indicates that what is depicted is in heaven. The halo is a symbol of the Uncreated Light (Greek: Ἄκτιστον Φῶς) or grace of God shining forth through the icon. Pseudo-Dionysius the Areopagite in his Celestial Hierarchies speaks of the angels and saints being illuminated by the grace of God, and in turn illumining others.
Gallery – Christian art
See also
Aura (paranormal)
Aureola
Crown of Immortality
Glory (optical phenomenon)
Glory in art
Lesya
Velificatio
Notes
References
Aster, Shawn Zelig, The Unbeatable Light: Melammu and Its Biblical Parallels, Alter Orient und Altes Testament vol. 384 (Münster), 2012,
Crill, Rosemary, and Jariwala, Kapil. The Indian Portrait, 1560–1860, National Portrait Gallery, London, 2010,
Didron, Adolphe Napoléon, Christian Iconography: Or, The History of Christian Art in the Middle Ages, Translated by Ellen J. Millington, H. G. Bohn, (Original from Harvard University, Digitized for Google Books) – Volume I, Part I (pp. 25–165) is concerned with the halo in its different forms, though the book is not up to date.
Dodwell, C. R., The Pictorial arts of the West, 800–1200, 1993, Yale UP,
Rhie, Marylin and Thurman, Robert (eds.): Wisdom And Compassion: The Sacred Art of Tibet, 1991,
Schiller, Gertrud, Iconography of Christian Art, Vol. I, 1971 (English trans from German), Lund Humphries, London,
Further reading
Ainsworth, Maryan W., "Intentional Alterations of Early Netherlandish Paintings", Metropolitan Museum Journal, Vol. 40, Essays in Memory of John M. Brealey (2005), pp. 51–65, 10, University of Chicago Press on behalf of The Metropolitan Museum of Art, – on the later addition and removal of halos
External links
Article on some early Japanese Buddhist haloes
The Halos in Taoist, Buddhist, Christian, Hindu, Islam, Greek and Roman images
Ancient Greek art
Buddhist art
Christian iconography
Iconography
Religious iconography
Visual motifs | Halo (religious iconography) | Mathematics | 4,882 |
3,509,428 | https://en.wikipedia.org/wiki/Christos%20Papadimitriou | Christos Charilaos Papadimitriou (; born August 16, 1949) is a Greek-American theoretical computer scientist and the Donovan Family Professor of Computer Science at Columbia University.
Education
Papadimitriou studied at the National Technical University of Athens, where in 1972 he received his Bachelor of Arts degree in electrical engineering. He then pursued graduate studies at Princeton University, where he received his Ph.D. in electrical engineering and computer science in 1976 after completing a doctoral dissertation titled "The complexity of combinatorial optimization problems."
Career
Papadimitriou has taught at Harvard, MIT, the National Technical University of Athens, Stanford, UCSD, University of California, Berkeley and is currently the Donovan Family Professor of Computer Science at Columbia University.
Papadimitriou co-authored a paper on pancake sorting with Bill Gates, then a Harvard undergraduate. Papadimitriou recalled "Two years later, I called to tell him our paper had been accepted to a fine math journal. He sounded eminently disinterested. He had moved to Albuquerque, New Mexico to run a small company writing code for microprocessors, of all things. I remember thinking: 'Such a brilliant kid. What a waste.'" The company was Microsoft.
Papadimitriou co-authored "The Complexity of Computing a Nash Equilibrium" with his students Constantinos Daskalakis and Paul W. Goldberg, for which they received the 2008 Kalai Game Theory and Computer Science Prize from the Game Theory Society for "the best paper at the interface of game theory and computer science", in particular "for its key conceptual and technical contributions"; and the Outstanding Paper Prize from the Society for Industrial and Applied Mathematics.
In 2001, Papadimitriou was inducted as a Fellow of the Association for Computing Machinery and in 2002 he was awarded the Knuth Prize. Also in 2002, he became a member of the U.S. National Academy of Engineering for contributions to complexity theory, database theory, and combinatorial optimization. In 2009 he was elected to the US National Academy of Sciences. During the 36th International Colloquium on Automata, Languages and Programming (ICALP 2009), there was a special event honoring Papadimitriou's contributions to computer science. In 2012, he, along with Elias Koutsoupias, was awarded the Gödel Prize for their joint work on the concept of the price of anarchy.
Papadimitriou is the author of the textbook Computational Complexity, one of the most widely used textbooks in the field of computational complexity theory. He has also co-authored the textbook Algorithms (2006) with Sanjoy Dasgupta and Umesh Vazirani, and the graphic novel Logicomix (2009) with Apostolos Doxiadis.
His name was listed in the 19th position on the CiteSeer search engine academic database and digital library.
Honors and awards
In 1997, Papadimitriou received a doctorate honoris causa from the ETH Zurich.
In 2011, Papadimitriou received a doctorate honoris causa from the National Technical University of Athens.
In 2013, Papadimitriou received a doctorate honoris causa from the École polytechnique fédérale de Lausanne (EPFL).
Papadimitriou was awarded the IEEE John von Neumann Medal in 2016, the EATCS Award in 2015, the Gödel Prize in 2012, the IEEE Computer Society Charles Babbage Award in 2004, and the Knuth Prize in 2002. In 2019 he received the Harvey Prize of the Technion/Israel for the year 2018.
Publications
Elements of the Theory of Computation (with Harry R. Lewis). Prentice-Hall, 1982; second edition September 1997. greek edition
Combinatorial Optimization: Algorithms and Complexity (with Kenneth Steiglitz). Prentice-Hall, 1982; second edition, Dover, 1998.
The Theory of Database Concurrency Control. CS Press, 1986.
Computational Complexity. Addison Wesley, 1994.
Turing (a Novel about Computation). MIT Press, November 2003.
Life Sentence to Hackers? (in Greek). Kastaniotis Editions, 2004. A compilation of articles written for the Greek newspaper To Vima.
Algorithms (coauthored with Sanjoy Dasgupta and Umesh Vazirani). McGraw-Hill, September 2008
Logicomix, An Epic Search for Truth (coauthored with Apostolos Doxiadis, with artwork by Alecos Papadatos and Annie di Donna). Bloomsbury Publishing and Bloomsbury USA, September 2009.
He co-authored a paper with Bill Gates, co-founder of Microsoft, on pancake sorting.
Personal life
At UC Berkeley, in 2006, he joined a professor-and-graduate-student band called Lady X and The Positive Eigenvalues.
References
American computer scientists
Theoretical computer scientists
1949 births
Living people
American technology writers
American writers of Greek descent
2001 fellows of the Association for Computing Machinery
Members of the United States National Academy of Engineering
Members of the United States National Academy of Sciences
Gödel Prize laureates
Knuth Prize laureates
Harvard University faculty
Stanford University School of Engineering faculty
University of California, San Diego faculty
Massachusetts Institute of Technology faculty
UC Berkeley College of Engineering faculty
Greek emigrants to the United States
Scientists from California
National Technical University of Athens alumni
Princeton University alumni
20th-century American scientists
21st-century American scientists
Game theorists
People from Athens
20th-century Greek Americans | Christos Papadimitriou | Mathematics | 1,110 |
50,512,636 | https://en.wikipedia.org/wiki/Kepler-1229b | Kepler-1229b (also known by its Kepler Object of Interest designation KOI-2418.01) is a confirmed super-Earth exoplanet, likely rocky, orbiting within the habitable zone of the red dwarf Kepler-1229, located about 870 light years (267 parsecs) from Earth in the constellation of Cygnus. It was discovered in 2016 by the Kepler space telescope. The exoplanet was found by using the transit method, in which the dimming effect that a planet causes as it crosses in front of its star is measured.
Physical characteristics
Mass, radius and temperature
Kepler-1229b is likely a rocky super-Earth, an exoplanet with a radius and mass bigger than Earth, but smaller than that of the gas giants Neptune and Uranus. It is 2.7 times the mass of earth. It has an equilibrium temperature of .<ref nameosition.
Host star
The planet orbits a (M-type) star named Kepler-1229, orbited by a total of one planet. The star has a mass of 0.54 and a radius of 0.51 . It has a temperature of 3724 K and is about 3.72 billion years old. In comparison, the Sun is 4.6 billion years old and has a temperature of 5778 K.
The star's apparent magnitude, or how bright it appears from Earth's perspective, is 15.474. Therefore, it is too dim to be seen with the naked eye.
Orbit
Kepler-1229b orbits its host star with about 4% of the Sun's luminosity every 86.829 days at a distance of (close to that of Mercury, which orbits at a distance of 0.387 AU).
Habitability
The exoplanet, along with eight others, was announced to be orbiting in the habitable zone of its parent star, the region where, with the correct conditions and atmospheric properties, liquid water may exist on the surface of the planet. Kepler-1229b has a radius of 1.4 , so it is likely rocky. Its host star is a red dwarf, with about half as much mass than the Sun does. As a result, stars like Kepler-1229 have the ability to live up to 50–60 billion years, 5–6 times longer than the Sun will live.
Discovery and follow-up studies
In 2013, before the two wheels failed, NASA's Kepler spacecraft was completing observing stars on its photometer, the instrument it uses to detect transit events, in which a planet crosses in front of and dims its host star for a brief and near-regular period of time. In this last test, Kepler observed stars in the Kepler Input Catalog, including Kepler-1229; the preliminary light curves were sent to the Kepler science team for analysis, who chose obvious planetary companions from the bunch for follow-up at observatories. The radial velocity observations confirmed that a planetary body was responsible for the dips observed in Kepler-1229's light curve, thus confirming it as a planet. The planet was then announced in the newest catalog released by NASA on May 12, 2016, about 3 years later.
At nearly distant, Kepler-1229b is too remote and its star too far for current telescopes or the next generation of planned telescopes to determine its mass or whether it has an atmosphere. The Kepler spacecraft focused on a single small region of the sky but next-generation planet-hunting space telescopes, such as TESS and CHEOPS, will examine nearby stars throughout the sky. Nearby stars with planets can then be studied by the upcoming James Webb Space Telescope and future large ground-based telescopes to analyze atmospheres, determine masses and infer compositions. Additionally the Square Kilometer Array would significantly improve radio observations over the Arecibo Observatory and Green Bank Telescope.
See also
List of potentially habitable exoplanets
Kepler-62f – similar exoplanet with around the same radius and stellar flux.
Notes
References
1229b
Exoplanets discovered in 2016
Exoplanets in the habitable zone
Transiting exoplanets
Super-Earths in the habitable zone
Cygnus (constellation)
Kepler-1229 | Kepler-1229b | Astronomy | 864 |
64,182,930 | https://en.wikipedia.org/wiki/3-Amino-1-propanol | 3-Amino-1-propanol is the organic compound with the formula HOCH2CH2CH2NH2. A colorless liquid, the compound is one of the simplest aminopropanols.
References
Amino alcohols | 3-Amino-1-propanol | Chemistry | 49 |
29,769,799 | https://en.wikipedia.org/wiki/Reverse%20architecture | Reverse architecture is a process of deducing the underlying architecture and design of a system by observing its behaviour. It has its roots in the field of reverse engineering.
Practicing reverse architecture is used to decipher the logistics of building. There are a variety of techniques available, the most notable being architecture driven modelling.
See also
Object Management Group
Software modernization
Software mining
References
External links
About Reverse Architecture
Computer programming
Reverse engineering | Reverse architecture | Technology,Engineering | 84 |
9,018,683 | https://en.wikipedia.org/wiki/Sana%20lamjel | Sana lamjel was a customary unit of length used in the erstwhile kingdom of Manipur, now a state of India. The unit of length, defined by the ruler of the kingdom, Nongda Lairen Pakhangpa in 33 CE, being equal to the distance from the floor to the tips of the fingers of his raised right hand while standing (a fathom), plus 4 fingerwidths.
The and unit became a standard for land measurement. An area of 50×60 sana lamjel was equal to 1 pari. 1 pari was 2 lourak, 4 sangam, 8 loukhai, 16 loushal, or 32 tong.
The value was later redefined by King Khagemba (1597–1652) to be defined by distance between and the fingertips of that his outstretched arms, plus 4 fingerwidths. After metrication in India in the mid-20th century, the unit became obsolete.
See also
List of customary units of measurement in South Asia
References
Units of length
Customary units in India
Obsolete units of measurement | Sana lamjel | Mathematics | 223 |
54,975,315 | https://en.wikipedia.org/wiki/Embudo%20Stream%20Gauging%20Station | The Embudo Stream Gauging Station is a stream gauge established in 1888 as the United States Geologic Survey's first training center for hydrographers. The station, near the town of Embudo along the Rio Grande in northern New Mexico, was used to develop tools and techniques for measuring stream flow in the arid, western United States.
History
The Embudo Stream Gauging Station was established as part of the United States Geologic Survey Irrigation Survey, a project to map water basins and collect streamflow data in an effort to make informed irrigation infrastructure decisions, directed by Clarence Dutton. While Dutton was able to locate topographers and irrigation engineers for the survey, he was not able to locate hydrographers, so a training camp was established at Embudo, New Mexico. Engineers, including camp director Frederick H.Newell, first arrived in December 1888. While canvas tents and cots were purchased, the unanticipated cold of the higher elevation site led to the use of shallow trenches with blankets rather than cots and small cave dug in a nearby hillside for sleeping.
By early March 1889, the camp hosted 21 residents, including 15 students. The training period ended in April 1889 with ten of the students taking on hydrographer positions in the Irrigation Survey. Stream measurements were continued by the local railroad agent until 1904 and were then discontinued. Measurements resumed in 1912 by a new railroad agent, and in 1915 the station operation was taken on by the State of New Mexico. The USGS resumed operation of the stream gauging station in July 1931.
Recognition
The site was designated a Historic Civil Engineering Landmark by the American Society of Civil Engineers in 1973 and listed on the New Mexico State Register of Cultural Properties in 1974.
See also
Willow Beach Gauging Station
References
New Mexico State Register of Cultural Properties
Historic Civil Engineering Landmarks | Embudo Stream Gauging Station | Engineering | 370 |
31,948,706 | https://en.wikipedia.org/wiki/Circle%20packing%20in%20a%20circle | Circle packing in a circle is a two-dimensional packing problem with the objective of packing unit circles into the smallest possible larger circle.
Table of solutions, 1 ≤ n ≤ 20
If more than one optimal solution exists, all are shown.
Special cases
Only 26 optimal packings are thought to be rigid (with no circles able to "rattle"). Numbers in bold are prime:
Proven for n = 1, 2, 3, 4, 5, 6, 7, 10, 11, 12, 13, 14, 19
Conjectured for n = 15, 16, 17, 18, 22, 23, 27, 30, 31, 33, 37, 61, 91
Of these, solutions for n = 2, 3, 4, 7, 19, and 37 achieve a packing density greater than any smaller number > 1. (Higher density records all have rattles.)
See also
Disk covering problem
Square packing in a circle
References
External links
Mathematical analysis of 2D packing of circles (2022). H C Rajpoot from arXiv
"The best known packings of equal circles in a circle (complete up to N = 2600)"
"Online calculator for "How many circles can you get in order to minimize the waste?"
Circle packing | Circle packing in a circle | Mathematics | 257 |
47,565,351 | https://en.wikipedia.org/wiki/List%20of%20places%20with%20numeric%20names | Places that have numerals in their names include:
0
, ('zero'), Netherlands, old name for a hamlet in Putten
Nullarbor, locality in South Australia (Latin: no trees)
Nullarbor Plain, desert region in Western and South Australia (Latin: no trees)
1/2 (half)
Adabaria Union, Bangladesh ('half hamlet')
Halbstadt, ('half town'), several places
Half Hollow Hills, New York, US
Half Moon Bay, California, US
Half Rock, Missouri, US
Half Tree Hollow, Saint Helena
Halfway, Missouri, US
Halfway, Oregon, US
1
1 Decembrie ('1 December'), Romania, a commune south of Bucharest
Aintree, England ('one tree')
Een, The Netherlands ('one')
Einhaus, Germany ('Onehouse')
Einsiedeln, Switzerland
Einsiedelei ('one (person) living (place)', eremitage), a (forgotten) place on the foot of a hill in the West of Graz, Austria
Ichinomiya ('the first shrine'), Aichi, Japan
One Tree Hill, South Australia
Province No. 1, Nepal
2
Aberdaucleddau ('mouth of the two rivers Cleddau'), Welsh name for Milford Haven, Wales
Deux-Sèvres, France (refers to two rivers in the department called Sèvre)
Dois Vizinhos ('2 neighbours'), Paraná, Brazil
Duas Bocas Biological Reserve ('2 mouths'), Brazil
Duas Barras ('2 bars'), Rio de Janeiro, Brazil
Duas Estradas ('2 roads'), Paraíba, Brazil
Duas Igrejas ('2 churches'), Paredes, Portugal
Dos Pilas ('2 wells'), Guatemala
Dos Vientos and Dos Vientos Open Space ('2 winds'), California, US
Dos Hermanas ('two sisters'), Andalusia, Spain
Dvigrad ('two towns'), Croatia
El Segundo ('the second'), California, United States
Lak Song ('the second milestone'), Bangkok, Thailand
Río Segundo in Argentina and Costa Rica, 'second river'
Llanddeusant, Anglesey, Wales ('church of two saints')
Llanddeusant, Carmarthenshire, Wales ('church of two saints')
Second Garrotte, California, US
Second Mesa, Arizona, US
Song District, Phrae, Thailand but the name () is same as the Thai word () that means 'two'.
Song Khwae District ('two waterways'), Nan, Thailand
Song Phi Nong District ('two siblings'), Suphan Buri, Thailand
Twee Riviere ('two rivers'), a town in South Africa
Twee Rivieren ('two rivers'), a suburb in South Africa
Tweebuffelsmeteenskootmorsdoodgeskietfontein, ('two buffaloes with one shot') South Africa
, ('two houses'), Netherlands
('two rivers'), Namibia
Tweedetol ('second toll'), near Dordrecht, Netherlands
Twin Cities, Minneapolis and Saint Paul, Minnesota, US
Twin Cities (disambiguation), several other places
Twin City, a developing concept for Vienna, Austria and Bratislava, Slovakia
Twin City, Georgia, in Emanuel County, Georgia, US
Twin City, nickname for Winston-Salem, North Carolina, US
Two Bridges, Manhattan, a neighborhood in New York City, United States
Two Buttes, Colorado
Two Guns, Arizona
Two Harbors, Minnesota, United States
Two Harbors, California, United States
Two Rivers, Wisconsin, United States
Two Rock, California
Two Rocks, Western Australia
Two Wells, South Australia
Twyford, Berkshire, England ('two fords')
Twyford, Buckinghamshire, England ('two fords')
Twyford, Hampshire, England ('two fords')
Twyford, Leicestershire, England ('two fords')
Zweibrücken ('two bridges'), Germany
Zweinitz, a cadastral municipality of Weitensfeld im Gurktal, Carinthia, Austria
Zweisimmen, Switzerland, at the confluence of the Gross and Klein Simme rivers (zwei means 'two')
3
Dreieich, Hesse, Germany ('three oaks')
Dreiflüssestadt, a colloquial name for Passau, Germany ('three (merging) rivers town')
Dreikirchen, Germany ('three churches')
Drie, Gelderland, The Netherlands ('three')
Driebergen, The Netherlands ('three mountains')
Driehuis, The Netherlands ('three houses')
Driemond, The Netherlands ('three (river) mouths')
Llantrisant, Wales ('church of three saints')
Río Tercero in Argentina, 'third river'
Salatiga ('three wrongs'), Indonesia
Sam Chai District, Kalasin, Thailand ('three wins' or 'three victories')
Sam Khok District, Pathum Thani, Thailand ('three mounds')
Sam Ngam District, Phichit, Thailand ('three prongs')
Sam Ngao District, Tak, Thailand ('three shadows')
Sam Phraeng ('three-way junction'), Bangkok, Thailand
Sam Phran District, Nakhon Pathom, Thailand ('three hunters')
Sam Yan ('three quarters'), Bangkok, Thailand
Sam Yot ('three peaks'), Bangkok, Thailand
Sansha ('three sands'), Hainan, China
Third Hill Mountain, West Virginia, US
Three Bridges (disambiguation), several places
Three Churches, West Virginia, US
Three Points, California, US
Three Rivers, California, US
Three Rivers, Michigan, US
Three Rivers, New Mexico, US
Three Rivers, Texas, US
Three Rivers, Prince Edward Island, Canada
Three Rivers District, England
Three Rivers South, Oregon, US
Three Rocks, California, US
Three Sisters (Australia)
Three Sisters (Northern Cape), South Africa
Three Sisters (Oregon), US
Three Springs, Pennsylvania, US
Three Springs, Western Australia
Three Mile Island, New Hampshire, US
Three Mile Island, Pennsylvania, US
Three Way, Tennessee, US
Tre Kronor castle ('three crowns castle'), Sweden
Trekroner ('three crowns'), Denmark
Trekroner Fort ('three crowns fort'), Denmark
Tres Cantos ('3 corners'), Madrid, Spain
Tres Cerros ('3 hills'), Argentina
Três Coroas ('3 crowns'), Rio Grande do Sul, Brazil
Tres Cruces ('3 crosses'), Uruguay
Tres de Febrero Partido ('3 February'), Argentina
Tres Islas, Guatemala
Tres Islas, Uruguay
Tres Pinos, California
Tres Valles ('3 valleys'), Mexico
Tri-cities, several places
Tricity, Poland of Gdynia, Sopot and Gdańsk
Triglav ('3 peaks/), Slovenia, a national symbol of the country
Triple cities, New York
Tripoli, Lebanon ('three towns')
Tripoli, Libya ('three towns')
Trishal ('3 Shal' = Shorea robusta), Bangladesh
Trois-Pistoles, Canada ('three pistoles (coins)')
Trois-Ponts (German: Dreibrücken), Belgium ('three bridges')
Trois-Rivières, Canada ('three rivers')
Trois-Rivières, Guadeloupe ('three rivers')
Uchquduq ('three draw-wells'), Navoiy, Uzbekistan
4
4S Ranch, California, US
Big Four, West Virginia, US
Charghat Upazila ('4 ghats'), Bangladesh
Cuatro Caminos ('4 roads'), one of the first metro stations in Madrid, Spain
Cuatro Cañadas ('4 paths'), Bolivia
Cuatro Ciénegas ('4 marshes'), Mexico
Cuatro Torres ('4 towers'), Madrid business district, Spain
Cuatro Vientos ('4 winds'), Madrid neighbourhood and military-civil airport and museum
Four Acres, California, US
Four Corners, a region of the United States
Four Crosses, Staffordshire, England
Four Lane Ends, a district within the ward of Richmond, South Yorkshire, England
Four Lane Ends, a hamlet near Tiverton, Cheshire, England
Four Lane Ends Interchange, a Metro station in Newcastle upon Tyne, England
Four Square Mile, Colorado, US
Fourth Crossing, California, US
Kiryat Arba, Israel ('City of Four')
Lak Si ('the fourth milestone'), Bangkok, Thailand
Mount Siguniang ('the four maidens'), Sichuan, China
Quad Cities, a region of the United States
Quad cities, Minnesota, US
Quart, Girona, a town in Spain
Quart, Aosta Valley, a town in Italy
Quart de Poblet, a town in Valencia, Spain
Quart de les Valls, a town in Valencia, Spain
Raja Ampat ('four kings'), Southwest Papua, Indonesia
Río Cuarto in Argentina and Costa Rica ('fourth river')
Shikoku ('four provinces'), Japan
Si Phraya ('four phrayas'), Bangkok, Thailand
Sichuan, China ('4 rivers')
Simpang Empat ('four corners'), various places in Malaysia and Indonesia
Tetrapolis (Attica)
Doric Tetrapolis
Vierhouten ('4 pieces of wood'), Nunspeet, The Netherlands
Vierlingsbeek (four brooks), The Netherlands
Vierwaldstättersee, Switzerland ('Lake of the four forested settlements')
5
Cinco Ranch, Texas, US
Cinque Ports, England
Cinque Terre ('five lands'), Italy, after the five villages along the coastline
Five Corners, Oregon, US
Five Corners, Washington, US
Five Dock, New South Wales, Australia
Five Fingers, New Brunswick, Canada
Five Forks, Calhoun County, West Virginia, US
Five Forks, Ritchie County, West Virginia, US
Five Forks, Upshur County, West Virginia, US
Five Islands, Nova Scotia, Canada
Five Mile Terrace, California, US
Five Towns, Long Island, New York; a group of communities in the Town of Hempstead
Five Ways, Birmingham, England
Five Ways railway station
Five Ways, Victoria, Australia
Fiveways, Brighton, a district of Brighton, England
Fünfhaus ('five houses'), in Rudolfsheim-Fünfhaus district, Vienna, Austria
Lak Ha ('the fifth milestone'), Ratchaburi/Samut Sakhon, Thailand
Llanpumsaint, Wales ('church of five saints')
Ma'ale HaHamisha, Israel ('ascent of the five')
Panchagarh ('5 forts'), Bangladesh
Panchbibi ('5 wives'), Bangladesh
Piatykhatky, Dnipropetrovsk Oblast ('five houses'), Ukraine
Pentapolis, five cities in Greek
Pompeii, Italy, after the five districts of the city
Pumsaint ('five saints'), Wales
Punjab, India and Punjab, Pakistan ('The Land of Five Waters')
Pyatigorsk, Stavropol Krai, Russia ('five mountains')
Río Quinto, Argentina ('fifth river')
Vijfhuizen, The Netherlands ('five houses')
Vyf Rand ('five rand'), Namibia
6
Doric Hexapolis in Greek
Blue Jay 6, West Virginia, US
Lak Hok ('the sixth milestone'), Pathum Thani, Thailand
Novi, Michigan, ("number six"), US
Roppongi ('six trees'), Tokyo, Japan
Sechshaus (Amtsbezirk) ('six houses'), former district of Lower Austria, Austria
Sechshaus ('six houses'), Rudolfsheim-Fünfhaus district, Vienna, Austria
Sechshaus ('six houses'), Brand-Nagelberg, Lower Austria, Austria
Sexdrega, Sweden ('six fishing places')
Six, West Virginia, US
Sixes, Georgia, US
Sixes, Oregon, US, named after the Sixes river (accounts vary as to how the river got its name; one local postmaster said Sixes was named for a Native American chief)
Six Hills in Stevenage, England
Six Mile Bottom, village near Cambridge, England
Six Mile Creek (disambiguation), several places
Six Shooter Canyon, Arizona
6th of October, in Egypt
6th of October Governorate
7
Beer Sheva ('seven wells'), Israel
Chet Samian ('seven clerks'), Ratchaburi, Thailand
Gunung Tujuh ('seven mountains'), Sumatra, Indonesia
Lake Gunung Tujuh, Sumatra, Indonesia
Heptapolis in Greek
Hét ('7'), Borsod-Abaúj-Zemplén, Hungary
Namtok Chet Sao Noi ('seven little girls waterfall'), Nakhon Ratchasima/Saraburi, Thailand
Pancuran Tujuh ('seven springs'), Central Java, Indonesia
Prampir Makara ('January 7'), Phnom Penh, Cambodia
Satara (Sat-Tara = 'seven forts'), Maharashtra, India
Satkhira ('7 Kheers'), Bangladesh
Sete Cidades (disambiguation), several places
Sete Fontes ('7 springs'), Braga, Portugal
Sete Lagoas ('7 lagoons'), Minas Gerais, Brazil
Seven Fields, Pennsylvania, US
Seven Hills, NSW, Australia
Seven Kings, London, England
Seven Mile, Arizona, US
Seven Mile, Ohio, US
Seven Oaks, California, US
Seven Oaks, Oregon, US
Seven Oaks, South Carolina, US
Seven Sisters, London, England
Seven Springs, Pennsylvania, US
Seven Troughs, Nevada, US
Sevenoaks, Kent, England
Seventh Mountain, Oregon, US
Shichigahama ('seven beaches'), Miyagi, Japan
Sieben ('seven' in German), Lewis and Clark County, Montana, US
Sieben, U.S. Virgin Islands, US
Siebenbürgen ('seven castles'), German for Transylvania, historical region in Romania
Siebenhengste-Hohgant-Höhle ('seven male horses'), cave in Switzerland
Siebenhirten ('seven shepherds'), Vienna, Austria
Sietes ('sevens'), Valles (Villaviciosa), in Asturias, Spain; in 2009 it was famous for the promotion of Microsoft Windows 7
Sungai Tujoh ('the seventh river'), Brunei
Zevenaar
Zevenhoven ('seven gardens'), the Netherlands
Zevenhuizen (disambiguation) ('seven houses'), several places in the Netherlands
8
Acht (Eifel), Germany
Acht, near Eindhoven, Netherlands
Achtmaal, The Netherlands ('eight times')
Austagram ('containing 8 villages'), Bangladesh
Babaoshan ('eight-treasure mountain'), Beijing, China
Eight, West Virginia, US
Eight Mile Plains, Brisbane, Australia
Eightmile, Oregon, US
Kiryat Shmona ('town of the eight'), Israel
Ocho Ríos ('8 rivers'), Jamaica
Paet Rio ('8 strips'), a colloquial name for Chachoengsao province, Thailand
Tuvalu ('8 (islands) together'), state in Oceania
9
Jiufen ('nine portions'), New Taipei City, Taiwan
Jiujiang ('nine rivers'), Jiangxi, China
Jiutai ('nine platforms'), Jilin, China
Jiuzhaigou ('nine settlement valley'), Sichuan, China
Kao Liao District ('9 turns' or '9 curves'), Nakhon Sawan, Thailand
Kelok 9 ('9 turns'), a bridge and road segment in Lima Puluh Kota Regency, Indonesia
Kowloon, a region of Hong Kong ('9 Dragons')
Kyushu ('nine provinces'), Japan
Mount Jiuhua ('nine glorious'), Anhui, China
, Netherlands ('9 houses')
Neunkirch, Schaffhausen ((German language) literally '9 churches', but derived from 'new church'), community in Switzerland
Neunkirchen, Austria ('9 churches', town and district
, Germany ('9 churches'), several towns, villages and district(s) in Germany
Nine Elms, London, England
Nine Mile Falls, Washington, US
Nueve de Julio (disambiguation) ('July 9'), several towns in Argentina
Nueve de Julio Department (disambiguation), several departments in Argentina
Nueve de Julio District, Peru
Nueve de Julio Partido, Argentina
Pont Neuf, crossing the river Seine in Paris, France ('bridge (number) 9')
Stowe Nine Churches, Northamptonshire, United Kingdom
10
10th of Ramadan, Egypt
Decapolis in Greek
Diez de Octubre ('October 10'), Cuba
Ten Mile (or Tenmile), lists several places in Canada, USA
Ten Sleep, Wyoming, US
Tiendeveen ('tenth peat'), Netherlands
('Ten Commandments'), The Netherlands
Tiengemeten ('Ten Acres'), The Netherlands
Washakie Ten, Wyoming, US
11
Lot 11 and Area, Prince Edward Island, Canada
Once de Octubre ('October 11'), Argentina
Once de Septiembre ('September 11'), Argentina
Ruyton-XI-Towns, England
12
, Germany ('a dozen lakes')
, Großer and Kleiner, two ponds in Germany ('dozen ponds')
, a statistical district (Statischer Bezirk) of Nürnberg, Germany
Zwölfaxing, Austria (Zwölf means 'twelve')
Doce de Octubre ('October 12'), Argentina
Baramulla ('12 roots'), India
Xishuangbanna ('12 districts', literally '12 township rice-fields'), China
13
Thirteen Mile Creek, Yukon, Canada
Trece Mártires ('13 martyrs'), Philippines
Treze Tílias (/ German: Dreizehnlinden) ('13 Lindens'), Brasilien
14
Chauddagram ('14 villages'), Bangladesh
Vierzehn, Rainbach im Mühlkreis, Austria
Catorce, San Luis Potosí, Mexico
Real de Catorce, Mexico (14 real (a currency of Spanish America), or from '14 killed soldiers')
Catorce de Noviembre ('November 14'), Panama
15
Le quinzième arrondissement de Paris ('15th arrondissement of Paris'), France
('15 farms'), Prussia
Rudolfsheim-Fünfhaus (15th municipal District of Vienna), Austria
16
Solapur, Maharashtra, India
17
Seventeen Mile Point, California, US
Seventeen Mile Rocks, Queensland, Australia
18
18-Hazari, 18-Hazari Tehsil, Jhang District, Punjab, Pakistan
Dieciocho Airport, Costa Rica
Dieciocho de Julio ('July 18'), Uruguay
Dieciocho de Mayo ('May 18'), Uruguay
20
Kurigram ('containing 20 villages'), Bangladesh
Twenty, Lincolnshire, England
Veinte de Junio ('June 20'), BBAA, Argentina
Veinte Reales, Philippines ('20 reales' (a coin), the price for the lands or for the use of a magical spring)
23
Mila 23 ('Mile 23'), Romania, a village in the Danube Delta
24
North 24 Parganas district
South 24 Parganas
Veinticuatro de Mayo and Veinticuatro de Mayo Canton ('May 24'), Ecuador
25
Veinticinco de Agosto ('August 25'), Uruguay
Veinticinco de Diciembre ('December 25'), Paraguay
Veinticinco de Mayo (disambiguation) ('May 25), several places in Argentina and Uruguay
26
Twentysix, Kentucky, United States
27
Veintisiete de Abril ('April 27'), Costa Rica
28
Veintiocho de Noviembre ('November 28'), Argentina
28 May, Azerbaijan
29
Twentynine Palms, California, United States
30
Thirtymile, Oregon, United States
33
Treinta y Tres and Treinta y Tres Department, Uruguay (from the 33 original fighters for the independence)
35
Netiv HaLamed-Heh, ('path of the 35') Kibbutz in Israel
36
Chhattisgarh ('36 forts'), a state in India
40
Chalisgaon ('40 cities') historic town, India
Cuarenta Casas ('40 houses') archaeological site, Mexico
Forty Mile, Yukon, Canada
Fortymile River, Yukon, Canada
50
Lima Puluh Kota ('50 towns'), Indonesia
56
Fifty-Six, Arkansas, United States
60
Hatvan ('sixty'), Hungary
Sixtymile, Yukon, Canada
Sixtymile River, Yukon, Canada
66
Sixty Six, South Carolina, United States
76
Seventy Six, Kentucky, United States
Seventy-Six, Missouri, United States
84
Eighty Four, Pennsylvania, United States
88
Eighty Eight, Kentucky, United States
96
Ninety Six, South Carolina, United States
99
Kujūkuri ('99 ri'''), Chiba, Japan
100
Hundred, West Virginia, United States
100 Mile House, British Columbia: named for being the location of a roadhouse at the 100 mile mark up the Old Cariboo Road during the Cariboo Gold Rush
Chafford Hundred, England, a 21st-century built settlement named for the historic Hundred of Chafford
List of hundreds of England and Wales; hundreds were an ancient subdivision of counties in England and Wales
Hundred Mile Landing, Yukon, Canada
101
Roi Et Province ('101'), Thailand
Wonowon, British Columbia ("one-oh-one"), located at Mile 101 on Highway 97, the Alaska Highway
108
108 Mile Ranch, Canada
300
Sam Roi Yot District ('three hundred peaks'), Prachuap Khiri Khan, Thailand
400
Fjärdhundra, Sweden
1,000
Chiba prefecture ('thousand leaves'), Japan
Thousand Islands, an archipelago in the St. Lawrence River along the boundary between New York, United States, and Ontario, Canada
Thousand Islands (Indonesia), an archipelago under the administrative division of Jakarta
Thousand Oaks, California, United States
Thousand Palms, California, United States
Thousandsticks, Kentucky, United States
Qianshan ('thousand mountains'), Liaoning, China
Vila Nova de Milfontes, Portugal
1,400
('fourteen hundred'), Bangladesh
1,770
Seventeen Seventy, Queensland, Australia, referred to locally as "1770"
2,500
Araihazar ('two-and-a-half thousand), Bangladesh
3,000
Bueng Sam Phan District ('Lake 3,000'), Phetchabun, Thailand
Khlong Chorakhe Sam Phan ('crocodile 3,000'), a canal in Kanchanaburi and Suphan Buri, Thailand
Sam Phan Bok ('3,000 shallow lakes'), Thailand
4,000
Si Phan Don ('Four Thousand Islands'), Laos
10,000
Na Muen District ('ten thousand (rice) paddy fields'), Nan, Thailand
Ten Thousand Islands, Florida, United States
11,000
Ilhas das Onze Mil Virgens (Portuguese: 'islands of eleven thousand virgins'), 1521 given name for today Saint Pierre Island, of Saint Pierre and Miquelon, a French overseas collectivity near Newfoundland, Canada
32186.9
Ventimiglia, Italy (coincidental, as it comes from Album Intimilium'')
40,010
Shimanto, Kōchi, Japan
100,000
Thong Saen Khan District ('hundred thousand bowls of gold'), Uttaradit, Thailand
Lakshadweep (100 thousand Islands), India
Names with trailing numbers
Kapur IX, a district in Lima Puluh Kota, Indonesia
Krems I, a part of the village Leezen, Germany
Krems II, a part of a different region, in Schleswig-Holstein, Germany
Peter I Island, Antarctica
Petersdorf I, Styria, Austria
Petersdorf II, until end of 2014, Styria, Austria
Takern I, part of the community St. Margarethen an der Raab, Styria, Austria
Takern II, part of the same community, Styria, Austria
Wakendorf I, a municipality in the district of Segeberg, in Schleswig-Holstein, Germany.
Wakendorf II, a different municipality in the district of Segeberg, in Schleswig-Holstein, Germany
See also
ZIP Code
Telephone numbering plan
References
Numeric names
Places | List of places with numeric names | Mathematics | 5,332 |
24,326,811 | https://en.wikipedia.org/wiki/C9H12N2O4S | {{DISPLAYTITLE:C9H12N2O4S}}
The molecular formula C9H12N2O4S (molar mass: 244.268 g/mol, exact mass: 244.0518 u) may refer to:
BRL-50481
Pidotimod
Molecular formulas | C9H12N2O4S | Physics,Chemistry | 69 |
2,879,966 | https://en.wikipedia.org/wiki/Nu%20Arietis | Nu Arietis, Latinized from ν Arietis, is the Bayer designation for a white-hued star in the northern constellation of Aries. It is faintly visible to the naked eye with an apparent visual magnitude of +5.43. Based upon an annual parallax shift of 9.68 mas as seen from Earth, it is located roughly 340 light years from the Sun. It is moving away from the Sun with a radial velocity of 8 km/s.
This is an A-type main sequence star with a stellar classification of A7 V. Nu Arietis has an estimated 2.4 times the mass of the Sun and about 1.8 times the Sun's radius. The star is radiating 63.5 times the Sun's luminosity from its photosphere at an effective temperature of around 8,000 K. It is roughly 621 million years old and is spinning with a projected rotational velocity of 133 km/s. A close companion was discovered in 2016 using the direct spectral detection method.
References
External links
Aladin previewer
Aladin sky atlas
HR 773
A-type main-sequence stars
Arietis, Nu
Aries (constellation)
Durchmusterung objects
Arietis, 32
016432
012332
0773 | Nu Arietis | Astronomy | 263 |
1,442,717 | https://en.wikipedia.org/wiki/Trigger%20guard | A trigger guard is a protective loop surrounding the trigger of a firearm designed to prevent unwanted contact with the trigger, which may cause an accidental discharge. Other devices that use a trigger-like actuator mechanism, such as inhalers, crossbows and power tools, may also have trigger guards.
On rifles with a bottom metal, the trigger guard is often incorporated as part of the bottom metal.
Winter trigger guards
Some firearms may have their trigger guard removed or repositioned as not to impair use with large cold weather gloves on, especially those intended to be used in arctic conditions. Quite notably, the Accuracy International Arctic Warfare line of rifles have enlarged trigger guards for use in cold climates, primarily northern Sweden.
Sources
Firearm components
Firearm safety | Trigger guard | Technology | 150 |
3,291,366 | https://en.wikipedia.org/wiki/Mrinal%20Kumar%20Das%20Gupta | Mrinal Kumar Das Gupta FNI (1 September 1923 – 28 November 2005, Kolkata) was an Indian astronomer. He was born in erstwhile Barishal district in present-day Bangladesh. He received his B.Sc and M.Sc degrees in Physics from Dhaka University in 1944 and 1945 respectively. Later he joined the department of Radio Physics and Electronics of the University of Calcutta as a researcher.
In 1954, he obtained his Ph.D. from the University of Manchester. Later he became the head of the department of the Institute of Radio Physics and Electronics at Calcutta University. Das Gupta worked with Robert Hanbury Brown and Roger Jennison, in building the first intensity interferometers at radio wavelength in the early 1950s and measured the apparent angular structures of two radio sources, Cygnus A and Cassiopeia A. Das Gupta was elected as a Fellow of the National Academy of Science in 1974 by the Indian National Science Academy, New Delhi and as a Fellow of the Academy of Science by the Indian Academy of Sciences, Bangalore. He was also the member of the now-infamous committee that investigated Dr. Subhash Mukhopadhyay who created the world's second and India's first child using in-vitro fertilisation. He died on 28 November 2005 in Kolkata.
Notes
1923 births
2005 deaths
20th-century Indian astronomers
Academic staff of the University of Calcutta | Mrinal Kumar Das Gupta | Astronomy | 285 |
49,781,132 | https://en.wikipedia.org/wiki/WR%20114 | WR 114 is a Wolf-Rayet star in the constellation of Scutum. It is an early type star of the carbon sequence (WCE) classified as WC5.
Companion
WR 114 is listed in the Catalogue of galactic Wolf Rayet stars as a possible binary system with an OB companion, but more recent studies have not confirmed this and it is now considered a single WC5 star. No x-rays have been detected from WR 114, which would be expected by a close hot companion.
Properties
The modelled temperature as a single star is 79,000 K, but this is an arbitrary temperature. A Wolf-Rayet star consists of a dense "core", with its surface defined as the sonic point, and a surrounding optically dense wind. The observed radiation from the star is entirely generated at different layers within the wind. The properties of a Wolf Rayet star are typically reported at an "inner boundary" of the wind, arbitrarily set at an optical depth of 20. The radius of this inner boundary in WR 114 is . The sonic point of WR 114 lies at about optical depth 60. At this level the temperature is much hotter. Another common definition for the surface of a star is at optical depth 2/3. For WR 114, this is at about and the corresponding temperature is around 65,000 K. The luminosity is around due to the extreme temperature, with most of this emitted as ultraviolet radiation.
The stellar wind from WR 114 is powered by the high temperature and luminosity to a speed of 2,000 km/s. It is calculated to have a current mass of and to be losing this mass at three millionths of per year.
IRC −10414
WR 114 is about 45" from another luminous star of similar brightness. IRC −10414 is a red supergiant about 6,500 light years away. At this distance, the projected separation between the two stars would be 0.43 parsecs. WR 114 is listed in the Catalogue of galactic Wolf Rayet stars at around 6,500 light years, but more recent modelling estimates it to be brighter and hence probably more distant. IRC −10414 is a runaway with a visible bow shock and it is thought that a Wolf-Rayet star less than half a parsec away would disrupt the bow shock. It is still speculated that the two stars may have a common origin.
References
Wolf–Rayet stars
Scutum (constellation)
169010
J18231633-1343261
TIC objects | WR 114 | Astronomy | 519 |
63,514,300 | https://en.wikipedia.org/wiki/Indian%20Vaccination%20Act%20of%201832 | Indian Vaccination Act of 1832 is a US federal law passed by the US Congress in 1832. The purpose of the act was to vaccinate the American Indians against smallpox to prevent the spread of the disease.
History
The act was first passed on May 5, 1832. Lewis Cass, Secretary of War, designed the act. Members of Congress appropriated US$12,000 (approximately $ in current money) to vaccinate them. By February 1, 1833, more than 17,000 Indians had been vaccinated.
Congress allocated $12,000 for the entire program, to be administered by Indian agents and sub-agents. Some US army surgeons refused to participate due to the lack of funds, leaving agents themselves and others with no medical training to produce and administer vaccines. However, not everyone was included. As a result, a few years later, smallpox killed 90% of the Mandan Indians, who had been excluded from the act. It also excluded Hidatsas and Arikaras.
References
See also
1721 Boston smallpox outbreak
1738–1739 North Carolina smallpox epidemic
1770s Pacific Northwest smallpox epidemic
1775–1782 North American smallpox epidemic
1837 Great Plains smallpox epidemic
1862 Pacific Northwest smallpox epidemic
Plenipotentiary letters regarding smallpox in Colonial America
General Court of Massachusetts Province Laws
Audio media archive
External links
1832 in American law
22nd United States Congress
Public health in the United States
Smallpox eradication
Smallpox in the United States
Smallpox vaccines
United States federal Native American legislation
Vaccination law
Vaccination in the United States | Indian Vaccination Act of 1832 | Biology | 304 |
11,273,128 | https://en.wikipedia.org/wiki/Monosodium%20phosphate | Monosodium phosphate (MSP), also known as monobasic sodium phosphate and sodium dihydrogen phosphate, is an inorganic compound with the chemical formula . It is a sodium salt of phosphoric acid. It consists of sodium cations () and dihydrogen phosphate anions (). One of many sodium phosphates, it is a common industrial chemical. The salt exists in an anhydrous form, as well as monohydrate and dihydrate ( and respectively).
Production and reactions
The salt is obtained by partial neutralization of phosphoric acid. The pKa of monosodium phosphate is 6.8-7.2 (depending on the physicochemical characteristics during pKa determination).
Heating this salt above 169 °C gives disodium pyrophosphate:
When heated at 550 °C, anhydrous trisodium trimetaphosphate is formed:
Uses
Phosphates are often used in foods and in water treatment. The pH of such formulations is generally adjusted by mixtures of various sodium phosphates, such as this salt.
The sodium chloride equivalent value, or E-Value, is 0.49. It is soluble in 4.5 parts water.
Food additive
It is added in animal feed, toothpaste, and evaporated milk. It is used as a thickening agent and emulsifier.
Detection of magnesium
Monosodium phosphate is used to detect the presence of magnesium ions in salts. Formation of a white precipitate on the addition of ammonium chloride, ammonium hydroxide and monosodium phosphate to an aqueous or dilute HCl solution of the salt indicates presence of magnesium ions.
Notes
Phosphates
Sodium compounds
Edible thickening agents | Monosodium phosphate | Chemistry | 362 |
1,752,068 | https://en.wikipedia.org/wiki/143%20%28number%29 | 143 (one hundred [and] forty-three) is the natural number following 142 and preceding 144. It is one less than a gross.
I Love You
143 is used as a shorthand for the phrase "I love you," based on the number of letters in each word.
It is associated with pager
On Mister Rogers' Neighborhood: "Transformations", 143 is used to mean "I love you". 1 meaning I for 1 letter, 4 meaning Love for the 4 letters, and 3 meaning You for the 3 letters. Reportedly, Fred Rogers maintained his weight at exactly for the last thirty years of his life, and associated the number with the phrase "I love you".
Jake Shimabukuro released the song "143" based on his experience in high school when 143 was sent on a pager to indicate "I Love You".
Sal Governale of The Howard Stern Show had a long running saga on the show about his wife who had an emotional friend. He discovered the severity of their relationship when he read their text messages and emails which included "143", shorthand for "I love you".
"Case 143", song by Stray Kids.
143 is a number frequently used in Omori meaning "I love you"
143, 2024 album by Katy Perry
References
External links
The Natural Number 143
143 at Urban Dictionary
143 at Virtual Science
Integers | 143 (number) | Mathematics | 281 |
59,648,370 | https://en.wikipedia.org/wiki/Redmi%20Note%207 | The Redmi Note 7 series refer to a series of smartphones released by Redmi, a sub-brand of Xiaomi. All (except the Redmi Note 7 variant in India) have 48 MP + 5 MP camera sensors. Most have a Qualcomm Snapdragon 660 SoC, except the Redmi Note 7 Pro, which has a better Qualcomm Snapdragon 675 SoC. The phones support mobile network frequencies in different regions. The Note 7 is available in many local versions and a global version, compatible with mobile phone providers in most places; the Pro model is supplied in slightly different Chinese and Indian versions. The Redmi Note 7S doesn't have much difference when compared to Redmi Note 7 except in case of the rear camera, hence the production of the Redmi Note 7S was discontinued and came under the Redmi Note 7 in India but it's still available separately in China and other countries.
In August 2019 Xiaomi announced that the Redmi Note 7 series had sold more than 20 million units worldwide.
Specifications
The Redmi Note 7 (lavender) is available in versions M1901F7C (for Hong Kong), 1901F7E (for China), 1901F7G (global), and 1901F7H (for Asia).
Design
The Redmi Note 7 (and Note 7 Pro) features a shiny glass back with a gradient that Xiaomi calls "Aura Design". Both the front and back of the device have 2.5D curved Gorilla Glass 5 glass. The phone also has a P2i nano-coating that makes it splash resistant, nevertheless the phone hasn't received an official IP Code. In other markets such as India, available color variants include Nebula Red, Space Black, and Neptune Blue.
The Redmi Note 7 (and Note 7 Pro) also features a dot notch in the display to accommodate the front-facing camera.
Software
The Redmi Note 7 and Pro run on Xiaomi's MIUI version 10, based on Android Pie (9), with minor version updates from time to time. Xiaomi has confirmed that these phones will be upgraded to Android 10; unofficial information suggests that this will be done in the third quarter of 2020. Updates to MIUI 11 (based on Android 9) for the Redmi Note 7 and the Redmi Note 7 Pro were available for download in late 2019, though not yet distributed over the air (OTA) for some ROM versions. From 19 November 2020, MIUI 12 based on Android 10 was being rolled out to Redmi Note 7/7s, with distribution to other phones after beta testing.
Hardware
The Redmi Note 7 (lavender) and Note 7 Pro (violet), both have a 6.3-inch full HD+ (2340×1080 pixels) display with a 19.5:9 aspect ratio. The Redmi Note 7 is powered by a 14 nm octa-core Snapdragon 660 SoC while the Note 7 Pro houses a Snapdragon 675 SoC, making it the first Xiaomi device to use the chip. The RN7 has an Adreno 512 GPU (612 for the Pro variant) and a 4000 mAh battery and supports Quick Charge 4. Various versions are fitted with 3, 4, or 6 GB of RAM, with 32, 64, or 128 GB of storage; a micro SD card of up to 256 GB is supported via a hybrid SIM card slot. The Pro version's camera has a Sony IMX586 sensor with f/1.8 aperture, slightly better than the RN7's similarly specified Samsung ISOCELL GM1 sensor; both have a secondary 5-megapixel depth sensor. The front camera has a resolution of 13 megapixels. The rear camera can record 4K video at 30 fps.
The RN7 Pro has a studio lighting mode live option, showing what the studio lighting effect will look like.
The phone has AI scene detection capable of recognizing up to 12 scenes, AI Portrait 2.0 and a Night Mode.
Connectivity
The Redmi Note 7 (and Note 7 Pro) supports Wi-Fi 802.11 a/b/g/n/ac, satellite navigation, Bluetooth v5.0, USB OTG, USB Type-C, 3G and 4G networks (with support for Band 40 used by some LTE networks in India), and VoLTE.
Other features
The phone has a gyroscope, proximity sensor, and fingerprint sensor. It has two Nano-SIM slots; one of them is a hybrid, capable of holding either a SIM or a microSD card. Either slot can, if equipped with a SIM, can be configured as the primary one.
Among other features, there is FM radio with recording, USB type-C, Dual SIM, face unlock, notification LED etc.
An IR blaster, emulating an infrared remote control, and a 3.5 mm headphone jack are fitted.
Release
The Chinese version of Redmi Note 7 was launched in Beijing on 15 January 2019.
The Indian versions of Redmi Note 7 and Redmi Note 7 Pro were launched together in New Delhi, India on 28 February 2019.
The Global version of Redmi Note 7 was launched on 6 March 2019.
The Chinese version of Redmi Note 7 Pro was launched on 18 March 2019.
There will not be a global version of the Redmi Note 7 Pro.
The Indian version of Redmi Note 7S was launched on 20 May 2019.
Rear camera images
References
External links
Official site (global version)
Specifications from GSM Arena
Phablets
Note 7
Ubuntu Touch devices
Mobile phones introduced in 2019
Mobile phones with multiple rear cameras
Mobile phones with infrared transmitter
Discontinued smartphones | Redmi Note 7 | Technology | 1,174 |
20,244,545 | https://en.wikipedia.org/wiki/NGC%201931 | NGC 1931 is an emission and reflection nebula in the constellation Auriga. The nebula has been referred to as a "miniature version of the Orion Nebula", as it shares some of the same characteristics. It is a mixed emission-reflection nebula, and contains a smaller version of the Trapezium in its hot young star cluster centered in the emission nebula. The entire cluster/nebula complex is only about 3 arcmin in size. The distance from earth is estimated at 7000 light years.
The nebula is Sharpless catalog Sh 2-237.
References
External links
NGC 1931 @ Wikisky
NGC 1931 @ SEDS NGC objects pages
Sharpless 237
Emission nebulae
Reflection nebulae
Auriga
1931
Sharpless objects
Star-forming regions | NGC 1931 | Astronomy | 149 |
311,441 | https://en.wikipedia.org/wiki/Data%20rate | Data rate and data transfer rate can refer to several related and overlapping concepts in communications networks:
Achieved rate
Bit rate, the number of bits that are conveyed or processed per unit of time
Data signaling rate or gross bit rate, a bit rate that includes protocol overhead
Symbol rate or baud rate, the number of symbol changes, waveform changes, or signaling events across the transmission medium per unit of time
Data-rate units, measures of the bit rate or baud rate of a link
Data transfer rate (disk drive), a data rate specific to disk drive operations
Throughput, the rate of successful message delivery, or level of bandwidth consumption
Transfers per second
Capacity
Bandwidth (computing), the maximum rate of data transfer across a given path
Channel capacity, an information-theoretic upper bound on the rate at which data can be reliably transmitted, given noise on a channel
Temporal rates
Broad-concept articles | Data rate | Physics | 183 |
31,199,987 | https://en.wikipedia.org/wiki/Chloroxine | Chloroxine (trade name Capitrol; Kloroxin, Dichlorchinolinol, chlorquinol, halquinol(s)); Latin cloroxinum, dichlorchinolinolum) is an antibacterial drug. Oral formulations (under trade name such as Endiaron) are used in infectious diarrhea, disorders of the intestinal microflora (e.g. after antibiotic treatment), giardiasis, inflammatory bowel disease. It is also useful for dandruff and seborrheic dermatitis., as used in shampoos (Capitrol) and dermal creams like (Valpeda, Triaderm).
Mechanism of action
Chloroxine has bacteriostatic, fungistatic, and antiprotozoal properties. It is effective against Streptococci, Staphylococci, Candida, Candida albicans, Shigella, and Trichomonads.
Adverse effects
Rarely occurs, but may cause nausea and vomiting associated with oral administration. It may also cause skin irritation.
Pregnancy and lactation
The FDA lists chloroxine in Pregnancy Category C (risk cannot be ruled out) because no pregnancy studies on the medication have been performed with animals or humans. For this reason, use of chloroxine oral or topical during pregnancy or when breast-feeding is not recommended.
History
Chloroxine was first prepared in 1888 by A. Hebebrand.
References
Antibiotics
Quinolinols
Chloroarenes | Chloroxine | Biology | 329 |
31,746,463 | https://en.wikipedia.org/wiki/Boletellus%20piakaii | Boletellus piakaii is a species of fungus in the family Boletaceae. It was found in Guyana and described in 2008.
References
Fungi described in 2008
Fungi of Guyana
piakaii
Fungus species | Boletellus piakaii | Biology | 43 |
6,518,056 | https://en.wikipedia.org/wiki/Quadient | Quadient is an international company specialized in mailing equipment, business process automation and customer experience management. It was originally founded as Neopost. As of 2019, the company had about 5,693 employees and annual sales of €1.14 billion. Its products and services are sold in about 90 countries. Quadient is a company listed on the Euronext Paris market (Compartment B). Its stock ticker is QDT.
History
1924 Founding of Neopost Limited (United Kingdom)
1929 Founding of SMH, Société des Machines Havas (France)
1930 Acquisition of Neopost by Roneo (United Kingdom)
1935 Creation of Neopost brand name (United Kingdom)
1970 Acquisition by C.G.E. of SMH-Adrex (France)
1979 Acquisition by C.G.E. of Friden (United States)
1980 Acquisition by C.G.E. of Roneo and Hadewe (United Kingdom and Netherlands)
1981 Attached to Alcatel, subsidiary of C.G.E. (France)
1992 Foundation of Neopost Group
1997 A group of investors, advised by BC Partners and in association with management, took control of Neopost
1999 Neopost was floated on the Premier Marché of Euronext Paris on 23 February at a price of €15 per share
2002 Acquisition of Stielow and Hasler (Germany and Switzerland)
2003 Neopost completed the integration of companies acquired in 2002, sold Stielow’s non-core label printing and print finishing businesses, and strengthened its operating structures
2005 Acquisition of BTA Digital Works, a software company
2006 Neopost adopted and modified the tagline "We value your mail" at the beginning of 2006.
2007 Acquisition of PFE, a supplier of high volume folder-inserters and Valipost
2008 Acquisition of RENA, addressing systems supplier and NBG-ID, integrator of RFID technology
2009 Acquisition of Satori Software, a postal address quality management software company
2009 Acquisition of Kontur Documents Systems (Suède) and Scani (Denmark)
2011 Acquisition of GBC – Fordigraph, an Australian distributor of document finishing and mailing products
2012 Acquisition of GMC Software Technology – a Swiss-based provider of customer communications management products
2012 Acquisition of Human Inference, a Dutch provider of contact data quality services
2013 Acquisition of DMTI Spatial – a Canadian provider of location-based service provider
2014 Acquisition of Data Capture Solutions Ltd, a document management business
2016 Acquisition of icon Systemhaus
2019 The company was renamed Quadient
In March 2020, Quadient sold ProShip, Inc. to FOG Software Group, a division of Constellation Software
2020 Acquisition of YayPay, an accounts receivable automation software company (United States)
2021 Acquisition of Beanworks, a Canadian accounts payable automation software company
Board
Chief Executive Officer: Geoffrey Godet (since February 2018).
Structure
Quadient employs around 6 000 people across 29 countries : Australia, Austria, Belgium, Brazil, Canada, China, Czech Republic, Denmark, Finland, France, Germany, Hungary, India, Ireland, Italy, Japan, Luxembourg, Mexico, Netherlands, Norway, Poland, Singapore, Spain, Sweden, Switzerland, the United Kingdom, the United States, Taiwan and Thailand. Aside from its branches, Quadient also has a network of 90 independent distributors.
Quadient's headquarters are located in Bagneux.
See also
Neopost web-enabled stamps
Postage meters
Franking
References
External links
Office supply companies of France
Postal systems
Manufacturing companies established in 1924
Multinational companies headquartered in France
Companies based in Bagneux
Data companies
Data quality companies
French brands
Information technology companies of France
Companies listed on Euronext Paris
1924 establishments in the United Kingdom | Quadient | Technology | 748 |
25,318,244 | https://en.wikipedia.org/wiki/DNA%20Repair%20and%20Mutagenesis | DNA Repair and Mutagenesis is a college-level textbook about DNA repair and mutagenesis written by Errol Friedberg, Graham Walker, Wolfram Siede, Richard D. Wood, and Roger Schultz. In its second edition as of 2009, DNA Repair and Mutagenesis contains over 1,000 pages, 10,000 references and 700 illustrations and has been described as "the most comprehensive book available in [the] field."
References
Biology books
DNA repair
2006 non-fiction books
2006 in biology | DNA Repair and Mutagenesis | Biology | 107 |
29,860,029 | https://en.wikipedia.org/wiki/Archaeology%20of%20religion%20and%20ritual | The archaeology of religion and ritual is a growing field of study within archaeology that applies ideas from religious studies, theory and methods, anthropological theory, and archaeological and historical methods and theories to the study of religion and ritual in past human societies from a material perspective.
Definitions
Religion may be defined as "a set of beliefs concerning the cause, nature, and purpose of the universe, especially when considered as the creation of a superhuman agency or agencies, usually involving devotional and ritual observances, and often containing a moral code governing the conduct of human affairs," whereas ritual is "an established or prescribed procedure for a religious or other rite." Archaeologists may study the material traces of religious ritual (for example, the ritual destruction of ceramic vessels during the Aztec New Fire ceremony) or the material correlates of religion as a totalized worldview (for example, Elizabeth Kyder-Reid's study of the Southern Redemptorists’ reconfiguration of landscape and artifacts to reflect their ideals of community and poverty in material form ).
As in religious studies and the Anthropology of religion, many archaeologists differentiate between "world religions," and "traditional" or "indigenous religions." "World religions" are defined by Bowie (2000: 26) as:
Based on written scriptures.
Has a notion of salvation, often from outside.
Universal, or potentially universal.
Can subsume or supplant primal religions.
Often forms a separate sphere of activity.
while indigenous religions are defined as:
Oral, or if literate, lacks written/formal scriptures and creeds.
‘This worldly’.
Confined to a single language or ethnic group.
Form basis from which world religions have developed.
Religious and social life are inseparable.
However, Timothy Insoll (2004: 9) has argued that these categorizations arise from a much-critiqued neo-evolutionary perspective. Strict dichotomies of religious forms may also contribute to skewing research toward state religions, leaving household religious practice, and the relationships between these, under-investigated (a trend noted by Elson and Smith, 2001 ). Insoll (2004:9) argues that archaeologists may contribute to blurring the boundaries of world and indigenous religions.
The archaeology of religion also incorporates related anthropological or religious concepts and terms such as magic, tradition, symbolism, and the sacred.
Theory
Anthropology of religion
Theory within the archaeology of religion borrows heavily from the Anthropology of religion, which encompasses a broad range of perspectives. These include: Émile Durkheim's functionalist understanding of religion as serving to separate the sacred and the profane; Karl Marx's idea of religion as "the opium of the masses" or a false consciousness, Clifford Geertz's loose definition of religion as a "system of symbols" that orders the world, Victor Turner's work on ritual, including rites of passage and liminality, Max Weber's religious types and thoughts on the relationship between economics and religion; Claude Lévi-Strauss’ structuralist understandings of totemism and myth; and Mary Douglas’ idea of the division of "purity and danger".
Religion, identity, and practice
Archaeological studies of religion increasingly recognize religion as an organizing principle in social life, rather than as a separate sphere of activity. They include religion as an axis of identity that structures social life and personal experience. Therefore, entire artifact assemblages (rather than specifically "religious" artifacts, such as rosary beads) can be interpreted according to the ways that they simultaneously create, display, and constrain notions of self according to religious ideas. For example, John Chenoweth (2009) interpreted ceramic assemblages and burials according to Quaker ideals of plainness and modesty.
Because social identity is both imposed and negotiated through social practice, including material practice, archaeologies of religion increasingly incorporate practice-based theory. Building upon Anthony Giddens’ idea of structuration and Pierre Bourdieu's ideas of both practice and cultural capital, theories of material practice posit that people use material goods to negotiate their places within social structures. Examples of the archaeological interpretation of religion and ritual as part of social negotiation, transformation or reinforcement include Chenoweth's work on Quaker religious practice, Kyder-Reid's work on the Southern Redemptorists, and Timothy Pauketat's work on feasting in Cahokia (Pauketat et al., 2002 ).
Religion, power, and inequality
Because religion and political power are often intertwined particularly in early states, the archaeology of religion may also engage theories of power and inequality. John Janusek's study of Tiwanaku religion, for example, explored the ways that religion served to integrate societies within the Andean state. Colonial regimes frequently justified expansion through a commitment to religious conversion; archaeologies of coloniality may therefore intersect with the archaeology of religion. James Delle's 2001 article on missions and landscape in Jamaica and Barbara Voss’ work on missions, sexuality and empire demonstrate how religion has intersected with colonial regimes.
Historical method and theory
Historical archaeologists have made major contributions to the understanding of the religion and ritual of peoples who have remained underrepresented (or misrepresented) in the historical record, such as colonized peoples, indigenous peoples, and enslaved peoples. Mandatory religious conversion was common in many colonial situations (e.g. the Spanish colonization of the Americas), which led to syncretic religious practice, rejection or resistance to new religions, covert practice of indigenous religions, and/or misunderstandings and misinterpretations of both indigenous and colonizer religions (Hanks 2010 Klor de Alva 1982, Wernke 2007).
This research combines archaeological and anthropological method and theory with historical method and theory. In addition to recovering, recording, and analyzing material culture, historical archaeologists use archives, oral histories, ethnohistorical accounts. Researchers read texts critically, emphasizing the historical context of the documents (especially regarding underrepresented peoples whose voices may be distorted or missing) in order to better understand religious practices that may have been discouraged or even severely punished. Combined archaeological, historical, and anthropological data sets may contradict each other, or the material record may illuminate the details of covert or syncretic religious practice, as well as resistance to dominant religious forms. For example, our understanding of the religious practice of enslaved peoples in the United States (e.g. Leone and Frye 2001, Fennell 2007 ) has increased dramatically thanks to research in historical archaeology.
Material correlates
Because archaeology studies human history through objects, buildings, bodies, and spaces, archaeologists must engage theories that connect anthropological and sociological theories of religion to material culture and landscapes. Theories of materiality and landscape serve to connect human activities, experiences, and behaviors to social practices, including religion. Theories of embodiment also serve to interpret human remains as they relate to religion and ritual.
The archaeology of religion makes use of the same material evidence as other branches of archaeology, but certain artifact classes are particularly emphasized in studying religion and ritual in the past:
Human remains and burial assemblages can offer many clues to religious and ritual activity. Human remains themselves are used in all branches of archaeology for information on sex, age, occupation, and disease. Methods of interment (including burial position, cremation, burial location, primary and secondary burials, etc.) contribute to understanding changing religious practice, as well as social difference within groups (e.g. Lohmann 2005 ). Total burial contexts, i.e., the setting, artifacts, ecofacts, and human remains themselves, may provide evidence of religious beliefs about death and the afterworld.
Religious buildings, such as temple complexes, kivas, and missions, are often used to examine communal religious and ritual activity (e.g. Barnes 1995, Graham 1998, Reid et al. 1997 ). Part of archaeoastronomy is the investigation of how buildings are aligned to astral bodies and events, such as solstices, which often coincide with religious or ritual activities. Archaeological examinations of religious buildings can reveal unequal access to religious knowledge and ritual. Religious buildings frequently contain religious iconography that provides insight into the symbolic dimensions of religious life.
Within landscape archaeology, sacred landscapes are an increasingly important focus of study (e.g. Clendinnen 1980 ). Landscapes are imbued with sacred meaning throughout the world; aboriginal Australian songlines, and the related belief that mythical events are marked on the landscape, are one example. Human modifications to landscapes, such as Kyder-Reid's study of the Redemptorists’ modifications of their estate to emphasize communality, may point to the enactment of religious views.
Religious iconography, symbols, ethnographic texts and ethnographic analogy are important tools that archaeologists use to compare with the material record to examine religions in the past (e.g. Clendinnen 1980, Elson and Smith 2001 ). Though texts are not direct "windows to the past," particularly for societies with few or no written records, they are valuable lines of evidence that may be contradicted or supported by the material record.
Common artifact classes such as ceramics have been increasingly reinterpreted within a religious framework. According to the idea of religion as a form of social practice and a total worldview, any artifact may potentially be used to embody religious ideas and ideals in material form. Patterns of artifact and ecofact use within ritual contexts may expose preferences or sacred meanings of certain materials; the ritual use of pine among the ancient Maya is one example (Morehart, Lentz, and Prufer 2005 ).
Examples of research by area
Africa
Evolving religious structure in Egypt (Baines 1987)
Ritual and political process in Tanzania (Hakansson 1998)
Tswana religion and Christianity in Botswana and South Africa (Reid et al. 1997)
Americas
Contemporary Maya shrines (Brown 2004)
Landscape and Yucatec Maya religious practice (Clendinnen 1980)
Christian missions in the Americas (Graham 1998)
Religion and the State in the Andes (Janusek 2006)
Religious architecture and religious transformation in colonial Peru (Wernke 2007)
Early American slavery and African American religion (Leone and Frye 2001), Fennell (2007)
Asia
Buddhism in India, Sri Lanka, and Southeast Asia (Barnes 1995)
Early Hinduism in Rajasthan (Hooja 2004)
Europe
Christianity and Anglo-Saxon burial practices (Crawford 2004)
Religion in Minoan Crete (Herva 2006)
Women and medieval burials (Gilchrist 2008)
Australia/South Pacific
Burials and religious practice in Papua New Guinea (Lohmann 2005)
Dreaming cosmology and Australian seascapes (McNiven 2003)
Modern debates
Modern religious use of archaeological sites
Contemporary religious groups often claim archaeological sites as part of their heritage, and make use of archaeological sites and artifacts in their religious practice (e.g. Wallis 2003 ). These practices and religious interpretations of sites may clash with archaeological interpretations, leading to disputes about heritage, preservation, use of sites, and the "ownership" of history (Bender 1999 ).
Biblical archaeology
Biblical archaeology is a field of archaeology that seeks to correlate events in the Bible with concrete archaeological sites and artifacts (Meyers 1984, Richardson 1916).
See also
References
External links
Society for Historical Archaeology
Society for American Archaeology
Archaeological sub-disciplines
Anthropology of religion
Ritual | Archaeology of religion and ritual | Biology | 2,324 |
63,848,237 | https://en.wikipedia.org/wiki/NFA%20minimization | In automata theory (a branch of theoretical computer science), NFA minimization is the task of transforming a given nondeterministic finite automaton (NFA) into an equivalent NFA that has a minimum number of states, transitions, or both. While efficient algorithms exist for DFA minimization, NFA minimization is PSPACE-complete. No efficient (polynomial time) algorithms are known, and under the standard assumption P ≠ PSPACE, none exist. The most efficient known algorithm is the Kameda‒Weiner algorithm.
Non-uniqueness of minimal NFA
Unlike deterministic finite automata, minimal NFAs may not be unique. There may be multiple NFAs of the same size which accept the same regular language, but for which there is no equivalent NFA or DFA with fewer states.
References
External links
A modified C# implementation of Kameda-Weiner (1970)
PSPACE-complete problems
Finite automata | NFA minimization | Mathematics | 201 |
859,275 | https://en.wikipedia.org/wiki/Displacement%20%28geometry%29 | In geometry and mechanics, a displacement is a vector whose length is the shortest distance from the initial to the final position of a point P undergoing motion. It quantifies both the distance and direction of the net or total motion along a straight line from the initial position to the final position of the point trajectory. A displacement may be identified with the translation that maps the initial position to the final position. Displacement is the shift in location when an object in motion changes from one position to another.
For motion over a given interval of time, the displacement divided by the length of the time interval defines the average velocity (a vector), whose magnitude is the average speed (a scalar quantity).
Formulation
A displacement may be formulated as a relative position (resulting from the motion), that is, as the final position of a point relative to its initial position . The corresponding displacement vector can be defined as the difference between the final and initial positions:
Rigid body
In dealing with the motion of a rigid body, the term displacement may also include the rotations of the body. In this case, the displacement of a particle of the body is called linear displacement (displacement along a line), while the rotation of the body is called angular displacement.
Derivatives
For a position vector that is a function of time , the derivatives can be computed with respect to . The first two derivatives are frequently encountered in physics.
Velocity
Acceleration
Jerk
These common names correspond to terminology used in basic kinematics. By extension, the higher order derivatives can be computed in a similar fashion. Study of these higher order derivatives can improve approximations of the original displacement function. Such higher-order terms are required in order to accurately represent the displacement function as a sum of an infinite series, enabling several analytical techniques in engineering and physics. The fourth order derivative is called jounce.
Discussion
In considering motions of objects over time, the instantaneous velocity of the object is the rate of change of the displacement as a function of time. The instantaneous speed, then, is distinct from velocity, or the time rate of change of the distance travelled along a specific path. The velocity may be equivalently defined as the time rate of change of the position vector. If one considers a moving initial position, or equivalently a moving origin (e.g. an initial position or origin which is fixed to a train wagon, which in turn moves on its rail track), the velocity of P (e.g. a point representing the position of a passenger walking on the train) may be referred to as a relative velocity; this is opposed to an absolute velocity, which is computed with respect to a point and coordinate axes which are considered to be at rest (a inertial frame of reference such as, for instance, a point fixed on the floor of the train station and the usual vertical and horizontal directions).
See also
Affine space
Deformation (mechanics)
Displacement field (mechanics)
Equipollence (geometry)
Motion vector
Position vector
Radial velocity
Screw displacement
References
External links
Motion (physics)
Length
Vector physical quantities
Geometric measurement
Kinematic properties | Displacement (geometry) | Physics,Mathematics | 622 |
30,764,139 | https://en.wikipedia.org/wiki/Affine%20plane | In geometry, an affine plane is a two-dimensional affine space.
Definitions
There are two ways to formally define affine planes, which are equivalent for affine planes over a field. The first way consists in defining an affine plane as a set on which a vector space of dimension two acts simply transitively. Intuitively, this means that an affine plane is a vector space of dimension two in which one has "forgotten" where the origin is. The second way occurs in incidence geometry, where an affine plane is defined as an abstract system of points and lines satisfying a system of axioms.
Coordinates and isomorphism
All the affine planes defined over a field are isomorphic. More precisely, the choice of an affine coordinate system (or, in the real case, a Cartesian coordinate system) for an affine plane over a field induces an isomorphism of affine planes between and .
In the more general situation, where the affine planes are not defined over a field, they will in general not be isomorphic. Two affine planes arising from the same non-Desarguesian projective plane by the removal of different lines may not be isomorphic.
Examples
Typical examples of affine planes are
Euclidean planes, which are affine planes over the reals equipped with a metric, the Euclidean distance. In other words, an affine plane over the reals is a Euclidean plane in which one has "forgotten" the metric (that is, one does not talk of lengths nor of angle measures).
Vector spaces of dimension two, in which the zero vector is not considered as different from the other elements.
For every field or division ring , the set of the pairs of elements of .
The result of removing any single line (and all the points on this line) from any projective plane.
Applications
In the applications of mathematics, there are often situations where an affine plane without the Euclidean metric is used instead of the Euclidean plane. For example, in a graph, which can be drawn on paper, and in which the position of a particle is plotted against time, the Euclidean metric is not adequate for its interpretation, since the distances between its points or the measures of the angles between its lines have, in general, no physical importance (in the affine plane the axes can use different units, which are not comparable, and the measures also vary with different units and scales).
Notes
References
Sources
Planes (geometry)
Mathematical physics | Affine plane | Physics,Mathematics | 498 |
66,713,762 | https://en.wikipedia.org/wiki/Melvin%20Romanoff | Melvin Romanoff was a physical chemist and corrosion engineer who specialized and wrote books about underground and soil corrosion. He worked for many years at the National Bureau of standards. His tenure at The National Bureau of Standards later renamed the National Institute of Standards and Technology was from 1937 to 1970. He was inducted into the hall of fame in 1995. For many years, NACE, the National Association of Corrosion Engineers, now NACE International presented a Melvin Romanoff award in his honor.
Work at the National Bureau of Standards
The Underground Corrosion of Steel Piling was originally written as a collection of papers as Monograph 58, for the National Bureau of standards. One of the two authors was Melvin Romanoff. After his death in October 1970 it was superseded by Monograph 158 and dedicated in his honor. It was published March 1972. The citation honoring him in this publication is in the form of a eulogy and reads in part "he was the guiding light and motivating force for research at the National Bureau of Standards on underground corrosion. His work is considered by corrosion engineers throughout the world to be indispensable for an understanding of the corrosion behavior of metals in soils. The studies described in the monograph embody pioneering concepts on the nature of driven piling corrosion developed by Mr. Romanoff toward the end of his career. Therefore this publication, which is a compilation of the papers resulting from those concepts, serves as a fitting memorial for Melvin Romanoff." He died October 1970.
See also
Michael Faraday
Herbert H. Uhlig
Ulick Richardson Evans
Marcel Pourbaix
Mars G Fontana
Corrosion
Corrosion engineering
References
American physical chemists
Corrosion prevention
Year of birth missing
1970 deaths | Melvin Romanoff | Chemistry | 335 |
59,676,344 | https://en.wikipedia.org/wiki/Saad%20Omer | Saad B. Omer is an American vaccinologist and infectious disease epidemiologist. He is the Founding Dean of the Peter O’Donnell Jr. School of Public Health at UT Southwestern Medical Center in Dallas. He is also a Professor in the O’Donnell School of Public Health and holds the Lyda Hill Deanship of the School of Public Health at UT Southwestern.
He was previously the inaugural Director of the Yale Institute for Global Health. He was also a Professor of Medicine (Infectious Diseases) at Yale School of Medicine and the Susan Dwight Bliss Professor of Epidemiology of Microbial Diseases at Yale School of Public Health.
In 2009, he received the Maurice R. Hilleman Early-Stage Career Investigator Award from the National Foundation for Infectious Diseases. His research on vaccination rates, exemptions, and outbreaks of vaccine-preventable diseases has been widely covered in the media. On March 5, 2019, he testified at a US Senate hearing on vaccines, stating that preventing the next potential resurgence of measles will require a broad-based federal response to improve vaccine access.
He has published widely in biomedical journals including the New England Journal of Medicine, JAMA, Lancet, Pediatrics, American Journal of Public Health, and Science. Moreover, he has written op-eds for publications such as the New York Times, Politico, and the Washington Post.
References
External links
Faculty page
Omer Research Group website
Living people
American epidemiologists
Vaccinologists
Emory University School of Medicine faculty
Emory University faculty
American public health doctors
Year of birth missing (living people)
Members of the National Academy of Medicine | Saad Omer | Biology | 334 |
2,321,587 | https://en.wikipedia.org/wiki/Degrees%20of%20freedom%20%28mechanics%29 | In physics, the degrees of freedom (DOF) of a mechanical system is the number of independent parameters that define its configuration or state. It is important in the analysis of systems of bodies in mechanical engineering, structural engineering, aerospace engineering, robotics, and other fields.
The position of a single railcar (engine) moving along a track has one degree of freedom because the position of the car is defined by the distance along the track. A train of rigid cars connected by hinges to an engine still has only one degree of freedom because the positions of the cars behind the engine are constrained by the shape of the track.
An automobile with highly stiff suspension can be considered to be a rigid body traveling on a plane (a flat, two-dimensional space). This body has three independent degrees of freedom consisting of two components of translation and one angle of rotation. Skidding or drifting is a good example of an automobile's three independent degrees of freedom.
The position and orientation of a rigid body in space is defined by three components of translation and three components of rotation, which means that it has six degrees of freedom.
The exact constraint mechanical design method manages the degrees of freedom to neither underconstrain nor overconstrain a device.
Motions and dimensions
The position of an n-dimensional rigid body is defined by the rigid transformation, [T] = [A, d], where d is an n-dimensional translation and A is an n × n rotation matrix, which has n translational degrees of freedom and n(n − 1)/2 rotational degrees of freedom. The number of rotational degrees of freedom comes from the dimension of the rotation group SO(n).
A non-rigid or deformable body may be thought of as a collection of many minute particles (infinite number of DOFs), this is often approximated by a finite DOF system. When motion involving large displacements is the main objective of study (e.g. for analyzing the motion of satellites), a deformable body may be approximated as a rigid body (or even a particle) in order to simplify the analysis.
The degree of freedom of a system can be viewed as the minimum number of coordinates required to specify a configuration. Applying this definition, we have:
For a single particle in a plane two coordinates define its location so it has two degrees of freedom;
A single particle in space requires three coordinates so it has three degrees of freedom;
Two particles in space have a combined six degrees of freedom;
If two particles in space are constrained to maintain a constant distance from each other, such as in the case of a diatomic molecule, then the six coordinates must satisfy a single constraint equation defined by the distance formula. This reduces the degree of freedom of the system to five, because the distance formula can be used to solve for the remaining coordinate once the other five are specified.
Rigid bodies
A single rigid body has at most six degrees of freedom (6 DOF) 3T3R consisting of three translations 3T and three rotations 3R.
See also Euler angles.
For example, the motion of a ship at sea has the six degrees of freedom of a rigid body, and is described as:
Translation and rotation:
Walking (or surging): Moving forward and backward;
Strafing (or swaying): Moving left and right;
Elevating (or heaving): Moving up and down;
Roll rotation: Pivots side to side;
Pitch rotation: Tilts forward and backward;
Yaw rotation: Swivels left and right;
For example, the trajectory of an airplane in flight has three degrees of freedom and its attitude along the trajectory has three degrees of freedom, for a total of six degrees of freedom.
For rolling in flight and ship dynamics, see roll (aviation) and roll (ship motion), respectively.
An important derivative is the roll rate (or roll velocity), which is the angular speed at which an aircraft can change its roll attitude, and is typically expressed in degrees per second.
For pitching in flight and ship dynamics, see pitch (aviation) and pitch (ship motion), respectively.
For yawing in flight and ship dynamics, see yaw (aviation) and yaw (ship motion), respectively.
One important derivative is the yaw rate (or yaw velocity), the angular speed of yaw rotation, measured with a yaw rate sensor.
Another important derivative is the yawing moment, the angular momentum of a yaw rotation, which is important for adverse yaw in aircraft dynamics.
Lower mobility
Physical constraints may limit the number of degrees of freedom of a single rigid body. For example, a block sliding around on a flat table has 3 DOF 2T1R consisting of two translations 2T and 1 rotation 1R. An XYZ positioning robot like SCARA has 3 DOF 3T lower mobility.
Mobility formula
The mobility formula counts the number of parameters that define the configuration of a set of rigid bodies that are constrained by joints connecting these bodies.
Consider a system of n rigid bodies moving in space has 6n degrees of freedom measured relative to a fixed frame. In order to count the degrees of freedom of this system, include the fixed body in the count of bodies, so that mobility is independent of the choice of the body that forms the fixed frame. Then the degree-of-freedom of the unconstrained system of N = n + 1 is
because the fixed body has zero degrees of freedom relative to itself.
Joints that connect bodies in this system remove degrees of freedom and reduce mobility. Specifically, hinges and sliders each impose five constraints and therefore remove five degrees of freedom. It is convenient to define the number of constraints c that a joint imposes in terms of the joint's freedom f, where c = 6 − f. In the case of a hinge or slider, which are one degree of freedom joints, have f = 1 and therefore c = 6 − 1 = 5.
The result is that the mobility of a system formed from n moving links and j joints each with freedom fi, i = 1, ..., j, is given by
Recall that N includes the fixed link.
There are two important special cases: (i) a simple open chain, and (ii) a simple closed chain.
A single open chain consists of n moving links connected end to end by n joints, with one end connected to a ground link. Thus, in this case N = j + 1 and the mobility of the chain is
For a simple closed chain, n moving links are connected end-to-end by n + 1 joints such that the two ends are connected to the ground link forming a loop. In this case, we have N = j and the mobility of the chain is
An example of a simple open chain is a serial robot manipulator. These robotic systems are constructed from a series of links connected by six one degree-of-freedom revolute or prismatic joints, so the system has six degrees of freedom.
An example of a simple closed chain is the RSSR spatial four-bar linkage. The sum of the freedom of these joints is eight, so the mobility of the linkage is two, where one of the degrees of freedom is the rotation of the coupler around the line joining the two S joints.
Planar and spherical movement
It is common practice to design the linkage system so that the movement of all of the bodies are constrained to lie on parallel planes, to form what is known as a planar linkage. It is also possible to construct the linkage system so that all of the bodies move on concentric spheres, forming a spherical linkage. In both cases, the degrees of freedom of the links in each system is now three rather than six, and the constraints imposed by joints are now c = 3 − f.
In this case, the mobility formula is given by
and the special cases become
planar or spherical simple open chain,
planar or spherical simple closed chain,
An example of a planar simple closed chain is the planar four-bar linkage, which is a four-bar loop with four one degree-of-freedom joints and therefore has mobility M = 1.
Systems of bodies
A system with several bodies would have a combined DOF that is the sum of the DOFs of the bodies, less the internal constraints they may have on relative motion. A mechanism or linkage containing a number of connected rigid bodies may have more than the degrees of freedom for a single rigid body. Here the term degrees of freedom is used to describe the number of parameters needed to specify the spatial pose of a linkage. It is also defined in context of the configuration space, task space and workspace of a robot.
A specific type of linkage is the open kinematic chain, where a set of rigid links are connected at joints; a joint may provide one DOF (hinge/sliding), or two (cylindrical). Such chains occur commonly in robotics, biomechanics, and for satellites and other space structures. A human arm is considered to have seven DOFs. A shoulder gives pitch, yaw, and roll, an elbow allows for pitch, and a wrist allows for pitch, yaw and roll. Only 3 of those movements would be necessary to move the hand to any point in space, but people would lack the ability to grasp things from different angles or directions. A robot (or object) that has mechanisms to control all 6 physical DOF is said to be holonomic. An object with fewer controllable DOFs than total DOFs is said to be non-holonomic, and an object with more controllable DOFs than total DOFs (such as the human arm) is said to be redundant. Although keep in mind that it is not redundant in the human arm because the two DOFs; wrist and shoulder, that represent the same movement; roll, supply each other since they can't do a full 360.
The degree of freedom are like different movements that can be made.
In mobile robotics, a car-like robot can reach any position and orientation in 2-D space, so it needs 3 DOFs to describe its pose, but at any point, you can move it only by a forward motion and a steering angle. So it has two control DOFs and three representational DOFs; i.e. it is non-holonomic. A fixed-wing aircraft, with 3–4 control DOFs (forward motion, roll, pitch, and to a limited extent, yaw) in a 3-D space, is also non-holonomic, as it cannot move directly up/down or left/right.
A summary of formulas and methods for computing the degrees-of-freedom in mechanical systems has been given by Pennestri, Cavacece, and Vita.
Electrical engineering
In electrical engineering degrees of freedom is often used to describe the number of directions in which a phased array antenna can form either beams or nulls. It is equal to one less than the number of elements contained in the array, as one element is used as a reference against which either constructive or destructive interference may be applied using each of the remaining antenna elements. Radar practice and communication link practice, with beam steering being more prevalent for radar applications and null steering being more prevalent for interference suppression in communication links.
See also
References
Mechanics
Robot kinematics
Rigid bodies | Degrees of freedom (mechanics) | Physics,Engineering | 2,329 |
28,183,104 | https://en.wikipedia.org/wiki/Polygon%20soup | A polygon soup is a set of unorganized polygons, typically triangles, before the application of any structuring operation, such as e.g. octree grouping.
The term must not to be confused with the "PolySoup" operation available in the 3D package Houdini, whose goal is to optimize the storage space needed by some piece of geometry through the reduction of the underlying number of polygon soups used in its representation. This is accomplished by removing redundant data points (e.g. vertices with the same position) without altering the topology or assigned properties of the optimized geometry in relation to the input one. As a result of this optimization, there can be savings in the storage and processing of large polygon meshes. These savings can have a bigger impact the larger the input data is. For instance, fluid simulations, particle simulations, rigid-body simulations, environments, and character models can reach into the millions of polygons for feature films, incurring in large storage and read/write costs. In those cases, reducing the number of polygon soups required to represent such data can lead to important savings in storage use and compute time.
References
3D computer graphics
Computer graphics data structures | Polygon soup | Mathematics | 254 |
4,352,469 | https://en.wikipedia.org/wiki/MIT%20Center%20for%20Theoretical%20Physics | The MIT Center for Theoretical Physics (CTP) is the hub of theoretical nuclear physics, particle physics, and quantum information research at MIT. It is a subdivision of MIT Laboratory for Nuclear Science and Department of Physics.
Research
CTP activities range from string theory and cosmology at the highest energies down through unification and beyond-the-standard-model physics, through the standard model, to QCD, hadrons, quark matter, and nuclei at the low energy scale.
Members of the CTP are also currently working on quantum computation and on energy policy. The breadth and depth of research in nuclear, particle, string, and gravitational physics at the CTP makes it a unique environment for researchers in these fields.
Members
In addition to the 15 MIT faculty members working in the CTP, at any one time there are roughly a dozen postdoctoral fellows, and as many, or more, long-term visitors working at the postdoctoral or faculty level. The CTP supports 25-35 MIT graduate students, who work with the faculty and postdocs on problems across the energy spectrum.
Current research areas in the center include particle physics, cosmology, string theory, phenomenology in and beyond the standard model, quantum field theory, lattice QCD, condensed matter physics, quantum computing, and energy research.
Notable current faculty include Nobel Laureate Frank Wilczek, Jeffrey Goldstone, inflationary cosmologist Alan Guth, cosmologist Max Tegmark, and quantum information scientist Peter Shor. Past CTP faculty members include US Secretary of Energy Ernest Moniz, Breakthrough Prize winner Daniel Freedman, particle theorist and author Lisa Randall, and many others.
Directors
Herman Feshbach, 1967–73
Francis Low, 1973–76
Arthur Kerman, 1976–83
Jeffrey Goldstone, 1983–89
John Negele, 1989–98
Robert Jaffe, 1998–2004
Eddie Farhi, 2004–16
Washington Taylor IV, 2016–19
Iain Stewart, 2019–present
Faculty
Current and former faculty members in the CTP include:
Michel Baranger, student of Hans Bethe, made contributions to plasma spectroscopy, nuclear collective motion, and quantum chaos
Netta Engelhardt, 2021 New Horizons in Physics Prize recipient for work on black holes
Edward Farhi, particle-physicist turned quantum information theorist
Herman Feshbach, founding director of the CTP
Daniel Freedman, Breakthrough Prize winner
Sergio Fubini, pioneer of string theory
Roscoe Giles, computer engineer and theoretical physicist; first African-American to earn a theoretical physics Ph.D. from Stanford
Jeffrey Goldstone, namesake of Goldstone bosons
Alan Guth, discoverer of inflation
Daniel Harlow, 2019 New Horizons in Physics Prize recipient for contributions to "quantum information, quantum field theory, and gravity"
Aram Harrow, quantum information scientist
Kerson Huang, known for contributions to statistical physics and quantum field theory alongside C. N. Yang, T. D. Lee, and Steven Weinberg
Roman Jackiw, of the Jackiw-Teitelboim model of 2d gravity
Robert Jaffe, CTP director, known for MIT Bag Model
Xiangdong Ji, recipient of Herman Feshbach Prize in nuclear physics
Kenneth Johnson, famous for fundamental contributions to quantum field theory and quark substructure
David Kaiser, cosmologist and historian of science
Francis Low, CTP director, Manhattan project alumnus and co-founder of Union of Concerned Scientists
Samir Mathur, string theorist and architect of "fuzzball" program for understanding black hole microstates
Ernest Moniz, former U.S. Secretary of Energy
John Negele, CTP director, nuclear physicist
Lisa Randall, particle physicist, cosmologist, and popular physics author; first female professor in the CTP
Peter Shor, quantum information scientist known for Shor's algorithm
Isadore Singer, winner of the Abel Prize
Tracy Slatyer, known for Fermi bubbles; second tenured female professor in the CTP
Max Tegmark, notable cosmologist and popular physics author
Jesse Thaler, Director of NSF AI Institute for Artificial Intelligence in Fundamental Interactions
Charles Thorn, noted string theorist
Gabriele Veneziano, pioneer of string theory
Felix Villars, of Pauli-Villars regularization method in quantum field theory
Steven Weinberg, Nobel Laureate
Victor Weisskopf, former MIT physics department chair
Frank Wilczek, Nobel Laureate known for asymptotic freedom and axions
James Young, notable nuclear physicist; founding member of National Society of Black Physicists; first tenured black professor in the MIT Physics Department
Barton Zwiebach, Peruvian string theorist, made central contributions to string field theory
See also
MIT Center for Theoretical Physics faculty
MIT Center for Theoretical Physics people
References
External links
MIT CTP website
Center for Theoretical Physics
Theoretical physics institutes | MIT Center for Theoretical Physics | Physics | 971 |
2,902,553 | https://en.wikipedia.org/wiki/15%20Andromedae | 15 Andromedae, abbreviated 15 And, is a single, variable star in the northern constellation of Andromeda. 15 Andromedae is the Flamsteed designation, while its variable star designation is V340 And. Its apparent visual magnitude is 5.55, which indicates it is faintly visible to the naked eye. Its estimated distance from the Earth is 252 light years, and it is moving further away with a heliocentric radial velocity of 13 km/s.
Rufener and Bartholdi (1982) included the star (under the name HD 221756) in their list of 333 variable, microvariable and suspected variable stars, based on multicolor photometry performed at several observatories in the 1960s and 1970s. However they were unable to conclusively demonstrate that the star's brightness varied. Proof of variability, along with a light curve and period estimate of 63 minutes, was published by Paunzen and Handler in 1996. The star was given its variable star designation, V340 Andromedae, in 1997.
Depending on the source, this star has been classified as a giant star with a stellar classification of A1 III, an A-type main-sequence star with a class of A1 Va, or a Lambda Boötis star with a class of kA1hA3mA0.5 Va+. It is a Delta Scuti variable that changes in brightness by 0.03 magnitude. Two variability cycles, with periods 0.0403 and 0.0449 days, have been observed, a common feature for Lambda Boötis stars. The star is around 130 million years old and has a high rotation rate, showing a projected rotational velocity of 105 km/s. It has 2.7 times the mass of the Sun and is radiating 27 times the Sun's luminosity from its photosphere at an effective temperature of 9,225 K.
This system has an excess emission of infrared radiation that suggests the presence of an orbiting disk of dust at a distance of around 50 AU from the host star.
References
External links
Image 15 Andromedae
A-type giants
A-type main-sequence stars
Delta Scuti variables
Lambda Boötis stars
Andromeda (constellation)
Durchmusterung objects
Andromedae, 15
221756
116354
8947
Andromedae, V340 | 15 Andromedae | Astronomy | 484 |
33,097,650 | https://en.wikipedia.org/wiki/Kepler-16 | Kepler-16 is an eclipsing binary star system in the constellation of Cygnus that was targeted by the Kepler spacecraft. Both stars are smaller than the Sun; the primary, Kepler-16A, is a K-type main-sequence star and the secondary, Kepler-16B, is an M-type red dwarf. They are separated by 0.22 AU, and complete an orbit around a common center of mass every 41 days.
The system is host to one known extrasolar planet in circumbinary orbit: the Saturn-sized Kepler-16b.
Eclipses
The Kepler-16 system is almost edge-on to Earth and the two stars eclipse each other as they orbit. The larger and brighter primary star is partially eclipsed by the secondary for about six hours and the brightness drops by about 0.15 magnitudes. The secondary star is completely occulted by the primary star for about two hours, but the overall brightness only drops by about 0.02 magnitudes.
There are also shallow eclipses caused by a large exoplanet. When this transits across the primary star, the brightness drops by slightly more than the secondary eclipse. When it transits the secondary star, the brightness drops by 0.001 magnitudes.
Planetary system
Kepler-16b is a gas giant that orbits the two stars in the Kepler-16 system. The planet is a third of Jupiter's mass and slightly smaller than Saturn at 0.7538 Jupiter radii, but is more dense. Kepler-16b completes a nearly circular orbit every 228.776 days.
References
K-type main-sequence stars
M-type main-sequence stars
Multi-star planetary systems
1611
Cygnus (constellation)
Eclipsing binaries
Planetary systems with one confirmed planet
J19161817+5145267 | Kepler-16 | Astronomy | 373 |
22,418,721 | https://en.wikipedia.org/wiki/Zenit-3SLB | The Zenit 3SLB or Zenit-3M was a Ukrainian expendable carrier rocket derived from the Zenit-2SB. It was a member of the Zenit family of rockets, which were designed by the Yuzhnoye Design Office. Produced at Yuzhmash, the rocket was a modified version of the Zenit-3SL, designed to be launched from a conventional launch pad rather than the Sea Launch Ocean Odyssey platform. Most of components of the rocket were produced in Russia. The Ukrainian space industry was highly integrated with that of Russia due to its Soviet heritage, but that cooperation was interrupted by the Russo-Ukrainian War beginning in 2014, which effectively led to a hiatus in the Zenit program. The subsequent Russian invasion of Ukraine in 2022 saw damage to its manufacturing facilities due to Russian missile strikes, and what survived those strikes pivoted to producing military weapons.
Launches of Zenit-3SLB rockets were conducted from Site 45/1 at the Baikonur Cosmodrome. Commercial launches were conducted by Land Launch, and used the designation 3SLB, whilst launches conducted by Federal Space Agency Roskosmos or the Russian Space Forces were planned to use the designation 3M.
It consisted of a Zenit 2SB (Zenit-2M) core vehicle, with a Block DM-SLB upper stage by RSC Energia (Russia). The rocket's fairing was developed by Lavochkin (Khimki, Moscow, Russia).
The launch services were provided by "Land Launch", a subsidiary of Sea Launch, and Space International Services, a Russian/Ukrainian joint venture.
The first launch of a Zenit-3SLB occurred on 28 April 2008, carrying the Israeli AMOS-3 satellite. This was also the first commercial Zenit launch from Baikonur since a failed Globalstar launch in 1998, and the first launch to be conducted by the Land Launch consortium.
Launches
References
Zenit (rocket family)
Vehicles introduced in 2008 | Zenit-3SLB | Astronomy | 411 |
16,669,744 | https://en.wikipedia.org/wiki/3789%20Zhongguo | 3789 Zhongguo, provisional designation , is a resonant asteroid from outermost region of the asteroid belt, approximately in diameter. It was discovered in 1928 by Chinese astronomer Zhang Yuzhe at the Yerkes Observatory in Williams Bay, Wisconsin, in the United States. Originally named "China", the asteroid became lost and its name was transferred to another asteroid. After its re-discovery in 1986, it was named Zhongguo, which is the Chinese word for "China". The T/Xk-type asteroid is the namesake of the resonant Zhongguo group, located in the asteroid belt's Hecuba gap. It has a short rotation period of 3.8 hours.
Discovery and re-discovery
While studying in Chicago, Chinese astronomer Zhang Yuzhe observed an unknown asteroid, provisionally designated for the first time on 25 October 1928. After it was (prematurely) given the number 1125, he named it "China" or "中国" (Zhōngguó) in honor of his native country. As it was not observed beyond its initial appearance, a precise orbit could not be calculated, and as a consequence, it became a lost asteroid.
In 1957, the Purple Mountain Observatory in China discovered another asteroid, . With the consent of Zhang Yuzhe, the designation 1125 China was transferred from the 1928-lost asteroid to this newly discovered one. However, in August 1986, the newly observed object was identified as the rediscovery of the originally lost asteroid. On 31 May 1988 its official name Zhongguo was published by the Minor Planet Center ().
Orbit and classification
Zhongguo is a non-family asteroid from the main belt's background population. It orbits the Sun in the outer main-belt at a distance of 2.7–3.9 AU once every 5 years and 11 months (2,175 days; semi-major axis of 3.29 AU). Its orbit has an eccentricity of 0.18 and an inclination of 3° with respect to the ecliptic. The body's observation arc begins at Williams Bay in November 1928, eleven days after its official discovery observation.
Zhongguo group
It is also the namesake of the Zhongguo asteroids, a dynamical group with rather stable orbits. The group is located in the Hecuba gap – one of the largest Kirkwood gaps in the main belt at 3.27 AU – and stays in a 2:1 mean motion resonance with the gas giant Jupiter. It occupies a similar proper element space as the Griqua asteroids. Both the Zhongguos and Griquas mark the outer rim of the asteroid belt. Further out are the Cybele asteroids, which are sometimes described as the "last outpost" of the asteroid belt. They are followed in turn by the resonant Hilda asteroids (3:2) and Jupiter trojans (1:1).
Physical characteristics
Zhongguo is classified as a T-type and X/k-subtype in the Tholen- and SMASS-like taxonomy of the Small Solar System Objects Spectroscopic Survey (S3OS2), respectively.
Diameter and albedo
According to the survey carried out by the NEOWISE mission of NASA's Wide-field Infrared Survey Explorer, Zhongguo measures 14.01 kilometers in diameter and its surface has an albedo of 0.099, while the Collaborative Asteroid Lightcurve Link assumes a standard albedo for a carbonaceous asteroidof 0.057 and calculates a diameter of 12.71 kilometers based on an absolute magnitude of 13.21.
Rotation period
In January 2012, a rotational lightcurve of Zhongguo obtained from photometric observations by astronomers at the Palomar Transient Factory in California. It gave a rotation period of hours with a brightness amplitude of 0.24 magnitude ().
References
External links
Asteroid Lightcurve Database (LCDB), query form (info )
Dictionary of Minor Planet Names, Google books
Discovery Circumstances: Numbered Minor Planets (1)-(5000) – Minor Planet Center
003789
003789
Named minor planets
19281025
Recovered astronomical objects | 3789 Zhongguo | Astronomy | 863 |
54,442,184 | https://en.wikipedia.org/wiki/Rofleponide | Rofleponide is a synthetic glucocorticoid corticosteroid which was never marketed.
References
Corticosteroid cyclic ketals
Cyclic acetals with aldehydes
Diketones
Diols
Organofluorides
Glucocorticoids
Pregnanes
Abandoned drugs | Rofleponide | Chemistry | 65 |
3,484,902 | https://en.wikipedia.org/wiki/Newell%27s%20algorithm | Newell's Algorithm is a 3D computer graphics procedure for elimination of polygon cycles in the depth sorting required in hidden surface removal. It was proposed in 1972 by brothers Martin Newell and Dick Newell, and Tom Sancha, while all three were working at CADCentre.
In the depth sorting phase of hidden surface removal, if two polygons have no overlapping extents or extreme minimum and maximum values in the x, y, and z directions, then they can be easily sorted. If two polygons, and , do have overlapping extents in the Z direction, then it is possible that cutting is necessary.
In that case, Newell's algorithm tests the following:
Test for Z overlap; implied in the selection of the face from the sort list
The extreme coordinate values in X of the two faces do not overlap (minimax test in X)
The extreme coordinate values in Y of the two faces do not overlap (minimax test in Y)
All vertices of P lie deeper than the plane of
All vertices of Q lie closer to the viewpoint than the plane of
The rasterisation of and do not overlap
The tests are given in order of increasing computational difficulty.
The polygons must be planar.
If the tests are all false, then switch the order of and in the sort, record having done so, and try again. If there is an attempt to switch the order of a polygon a second time, there is a visibility cycle, and the polygons must be split. Splitting is accomplished by selecting one polygon and cutting it along the line of intersection with the other polygon. The above tests are again performed, and the algorithm continues until all polygons pass the above tests.
References
.
.
See also
Painter's algorithm
Boolean operations on polygons
3D computer graphics
Computer graphics algorithms
History of computing in the United Kingdom
Science and technology in Cambridgeshire | Newell's algorithm | Technology | 381 |
59,108,522 | https://en.wikipedia.org/wiki/Aquisphaera | Aquisphaera is a chemoheterotrophic genus of bacteria from the family of Isosphaeraceae with one known species (Aquisphaera giovannonii). Aquisphaera giovannonii has been isolated from sediments from a freshwater aquarium from Porto in Portugal.
See also
List of bacterial orders
List of bacteria genera
References
Bacteria genera
Monotypic bacteria genera
Planctomycetota | Aquisphaera | Biology | 91 |
8,726,934 | https://en.wikipedia.org/wiki/Xenobiotica | Xenobiotica is a peer-reviewed medical journal that publishes comprehensive research papers on all areas of xenobiotics. It is published by Informa plc and covers six main areas:
General xenobiochemistry, including in vitro studies concerned with the metabolism, disposition and excretion of drugs, and other xenobiotics, as well as the structure, function and regulation of associated enzymes
Clinical pharmacokinetics and metabolism, covering the pharmacokinetics and absorption, distribution, metabolism and excretion of drugs and other xenobiotics in man.
Animal pharmacokinetics and metabolism, covering the pharmacokinetics, and absorption, distribution, metabolism and excretion of drugs and other xenobiotics in animals.
Pharmacogenetics, defined as the identification and functional characterisation of polymorphic genes that encode xenobiotic metabolising enzymes and transporters that may result in altered enzymatic, cellular and clinical responses to xenobiotics.
Molecular toxicology, concerning the mechanisms of toxicity and the study of toxicology of xenobiotics at the molecular level.
Topics in xenobiochemistry, in the form of reviews and commentaries are primarily intended to be a critical analysis of the issue, wherein the author offers opinions on the relevance of data or of a particular experimental approach or methodology.
According to the Journal Citation Reports, the journal received a 2014 impact factor of 2.199, ranking it 134th out of 254 journals in the category Pharmacology & Pharmacy and 50th out of 87 journals in the category Toxicology.
The editor in chief is Costas Ioannides (University of Surrey).
Abstracting and indexing
Xenobiotica is abstracted and indexed in Biochemistry and Biophysics Citation Index, BIOSIS, Chemical Abstracts; Current Contents/Life Science, EBSCO, Science Citation Index, PASCAL, SciSearch, Scopus, and Index Medicus/MEDLINE/PubMed.
References
External links
Academic journals established in 1971
Pharmacology journals
Toxicology journals
Taylor & Francis academic journals
Monthly journals
English-language journals | Xenobiotica | Environmental_science | 437 |
65,077,141 | https://en.wikipedia.org/wiki/CYP107G1 | Cytochrome P450 family 107 subfamily G member 1 (abbreviated CYP107G1) is an actinobacterial Cytochrome P450 enzyme originally from Streptomyces rapamycinicus, which catalyzes the oxidation reaction of C27 of pre-rapamycin in the biosynthesis pathway of the macrolide antibiotic rapamycin.
References
Cytochrome P450
EC 1.14.15
Prokaryote genes | CYP107G1 | Biology | 100 |
65,418,884 | https://en.wikipedia.org/wiki/NGC%207619 | NGC 7619 is an elliptical galaxy located in the constellation Pegasus. NGC 7619 and NGC 7626 are the dominant and brightest members of the Pegasus galaxy cluster. Both of them were discovered by William Herschel on September 26, 1785.
The radial velocity of this galaxy was measured in 1929 and found to be double that of any galaxy observed at that time. The measurement was consistent with the extrapolated value predicted by Edwin Hubble; a distance-velocity relation that would later become known as Hubble's law.
One supernova has been observed in NGC 7619: SN 1970J (type Ia, mag. 14.5) was discovered by Leonida Rosino on 24 September 1970.
References
External links
Elliptical galaxies
7619
Pegasus (constellation)
Astronomical objects discovered in 1785 | NGC 7619 | Astronomy | 160 |
12,811,705 | https://en.wikipedia.org/wiki/Shukhov%20cracking%20process | The Shukhov cracking process is a thermal cracking process invented by Vladimir Shukhov and Sergei Gavrilov.
Origins
Shukhov designed and built the first thermal cracking device for the petrochemical industry. His patent (Shukhov cracking process – patent of Russian empire No. 12926 from November 27, 1891) on cracking was used to invalidate Standard Oil's patents (Burton process – Patent of United States No. 1,049,667 on January 7, 1913) on oil refineries.
Present
In 1937 the Shukhov cracking process was superseded by catalytic cracking. It is still in use today to produce diesel.
See also
Cracking (chemistry)
Timeline of historic inventions
Burton process
References
Information on cracking in oil refining
Biography of Vladimir Shukhov
"Vladimir G. Suchov 1853-1939. Die Kunst der sparsamen Konstruktion.", Rainer Graefe und andere, 192 S., Deutsche Verlags-Anstalt, Stuttgart, 1990, .
Chemical processes
Oil refining
Vladimir Shukhov
History of the petroleum industry
Russian inventions | Shukhov cracking process | Chemistry | 216 |
19,483,125 | https://en.wikipedia.org/wiki/Enterprise%20mobility%20management | Enterprise mobility management (EMM) is the set of people, processes and technology focused on managing mobile devices, wireless networks, and other mobile computing services in a business context. As more workers have bought smartphone and tablet computing devices and have sought support for using these devices in the workplace, EMM has become increasingly significant.
The goal of EMM is to determine if and how available mobile IT should be integrated with work processes and objectives, and how to support workers when they are using these devices in the workplace.
Business use of consumer mobile technology
A 2012 study showed that about two-thirds of smartphone owners used their personal devices for enterprise-related activities. Supporting a wide variety of device types and operating systems can introduce security risks and added costs for businesses.
A 2011 survey showed that three quarters of U.K. and U.S. CIOs surveyed considered mobile technology to be a significant security problem, although consumers were generally less concerned.
Security
Because mobile devices are easily lost or stolen, data on those devices is vulnerable. Enterprise mobility management is a set of systems intended to prevent unauthorized access to enterprise applications and/or corporate data on mobile devices. These can include password protection, encryption and/or remote wipe technology, which allows an administrator to delete all data from a misplaced device. With many systems, security policies can be centrally managed and enforced. Such device management systems are programmed to support and cooperate with the application programming interfaces (APIs) from various device makers to increase security compliance.
The data transfer between mobile device and the enterprise should always be encrypted, for example through a VPN tunnel or over HTTPS.
Mobile devices in companies with "bring your own device" (BYOD) policies are often used both personally and professionally. In these cases, corporate IT has less control over whether malware is on the device and what damage may be caused to corporate data. Apart from careful user behavior - data storage on the mobile device should be limited and centrally organized.
The diversity of Android devices appeals to consumer buyers, but is a source of anxiety for IT security experts. OpenSignal, a UK-based mobile company, recently published a survey of almost 700,000 devices and reported approximately 12,000 distinct Android devices using eight different versions of the Google operating system. For many IT organizations charting out their BYOD strategy, this translates into security risks that are tough to monitor and control.
See also
List of Mobile Device Management Software
Mobile business intelligence
Mobile security
Mobile device management
Mobile application management
Bring your own device
Unified Endpoint Management
Notes
References
Enterprise Mobility Strategies, ACS, May 2009.
O'Sullivan, Cian, More Smartphones in the Enterprise Means More Security Risk (link dead), GoMo News, June 2011.
Mobile technology | Enterprise mobility management | Technology | 554 |
36,836,988 | https://en.wikipedia.org/wiki/Lambda%20Piscis%20Austrini | Lambda Piscis Austrini, Latinized from λ Piscis Austrini, is a solitary star in the southern constellation of Piscis Austrinus. It has a blue-white hue and is visible to the naked eye with an apparent visual magnitude of +5.42. Based upon an annual parallax shift of 6.51 mas as measured from Earth, it is located around 500 light years from the Sun. At that distance, the visual magnitude of the star is diminished by an extinction factor of 0.16 due to interstellar dust.
This is a B-type main sequence star with a stellar classification of B7 V. It has an estimated 3.58 times the mass of the Sun and about 4.2 times the Sun's radius. The star is spinning with a projected rotational velocity of 50 km/s and is 76% of the way through its main sequence lifetime. It is radiating 249 times the solar luminosity from its photosphere at an effective temperature of 12,023 K.
Lambda Piscis Austrini is moving through the Galaxy at a speed of 18.1 km/s relative to the Sun. Its projected Galactic orbit carries it between 23,800 and 29,300 light years from the center of the Galaxy.
Naming
In Chinese, (), meaning Palace Guard, refers to an asterism consisting of λ Piscis Austrini, 29 Aquarii, 35 Aquarii, 41 Aquarii, 47 Aquarii, 49 Aquarii, HD 212448, ε Piscis Austrini, 21 Piscis Austrini, 20 Piscis Austrini, υ Aquarii, 68 Aquarii, 66 Aquarii, 61 Aquarii, 53 Aquarii, 50 Aquarii, 56 Aquarii, 45 Aquarii, 58 Aquarii, 64 Aquarii, 65 Aquarii, 70 Aquarii, 74 Aquarii, τ2 Aquarii, τ1 Aquarii, δ Aquarii, 77 Aquarii, 88 Aquarii, 89 Aquarii, 86 Aquarii, 101 Aquarii, 100 Aquarii, 99 Aquarii, 98 Aquarii, 97 Aquarii, 94 Aquarii, ψ3Aquarii, ψ2Aquarii, ψ1Aquarii, 87 Aquarii, 85 Aquarii, 83 Aquarii, χ Aquarii, ω1 Aquarii and ω2 Aquarii. Consequently, the Chinese name for λ Piscis Austrini itself is (, .)
References
B-type main-sequence stars
Piscis Austrini, Lambda
Piscis Austrinus
Durchmusterung objects
Piscis Austrini, 16
210934
109789
8478 | Lambda Piscis Austrini | Astronomy | 594 |
2,784,647 | https://en.wikipedia.org/wiki/Pennyland | A pennyland () is an old Scottish land measurement. It was found in the West Highlands, and also Galloway, and believed to be of Norse origin. It is frequently found in minor placenames.
Skene in Celtic Scotland says:
"in the eastern district there is a uniform system of land denomination consisting of 'dabhachs', 'ploughgates' and 'oxgangs', each 'dabhach' consisting of four 'ploughgates' and each 'ploughgate' containing eight 'oxgangs'.
"As soon as we cross the great chain of mountains separating the eastern from the western waters, we find a different system equally uniform. The 'ploughgates' and 'oxgangs' disappear, and in their place we find 'dabhachs' and 'pennylands'. The portion of land termed a 'dabhach' is here also called a 'tirung' or 'ounceland', and each 'dabhach' contains 20 pennylands."
The Rev. Dr Campbell of Broadford on Skye says:
"the system of land measure which prevailed in the Western Isles, and then took root in Argyll was neither Pictish nor Irish, but Norse. The unit was the ‘ounce-’land, i.e. the extent of land which paid the rent of an ounce of silver. The word was borrowed by Gaelic and appears as ‘unnsa’. The land term was ‘unga’, e.g. Unganab in North Uist and in Tiree. It appears in the old charters as ‘teroung’, ‘teiroung’, &c. This extent was divided into twenty parts—sometimes into only 18 – which parts being called ‘peighinn’; hence many placenames, e.g. Pennymore, Peighinnchornach. In some places the pennyland was subdivided. On Loch Fyneside we meet with Lephinmore, Lephincorrach, (‘the big half-pennyland’, the ‘rough half pennyland’); also ‘an Fheòirling’ (the ‘farthingland’). A conventional use of the term ‘peighinn’ is met with in Skye—the crofting town of Elgol is separated by a march-dyke from the deer forest; each crofter is responsible for the upkeep of a specified length of the dyke, and it is called the ‘peighinn’ of his croft; similarly the part of the shore allotted to each croft for seaware is called the ‘peighinn’ of that croft."
It should not be confused with pen which is a Brythonic language element in placenames such as Penicuik, in Midlothian.
References
(Dabhach, Peighinn)
Further reading
MacQueen, John, Pennyland and Doach in South Western Scotland: A Preliminary Note in Scottish Studies #23, (1979)
See also
Obsolete Scottish units of measurement
In the East Highlands:
Rood
Scottish acre = 4 roods
Oxgang (Damh-imir) = the area an ox could plow in a year (around 20 acres)
Ploughgate (?) = 8 oxgangs
Daugh (Dabhach) = 4 ploughgates
In the West Highlands:
Markland (Marg-fhearann) = 8 Ouncelands (varied)
Ounceland (Tir-unga) =20 Pennylands
Pennyland (Peighinn) = basic unit; sub-divided into half penny-land and farthing-land
(Other terms in use; Quarterland (Ceathramh): variable value; Groatland (Còta bàn)
Penny Scots
Pennyland project (low-energy buildings at Milton Keynes)
Obsolete Scottish units of measurement
Units of area | Pennyland | Mathematics | 794 |
8,833,837 | https://en.wikipedia.org/wiki/Peter%20Cusack%20%28musician%29 | Peter Cusack is an English artist and musician who is a member of CRiSAP (Creative Research in Sound Arts Practice), and is a research staff member and founding member of the London College of Communication in the University of the Arts London. He was a founding member and director of the London Musicians' Collective.
He is best known as a member of the avant garde musical quartet, Alterations (1978–1986; with Steve Beresford, David Toop, and Terry Day), and the creator of field and wildlife recording-based albums including:
Where Is the Green Parrot? (1999) with tracks like "Toy Shop (Two Small Boys Go Shopping)" and "Siren", which are just as advertised.
Day for Night (2000), with Max Eastley. This features "duets" between Eastley's kinetic sculpture and Cusack's field recordings.
Baikal Ice (2003), featuring tracks like "Banging Holes In Ice" and "Floating Icicles Rocked By Waves" and "Falling In".
Cusack has been involved in a wide range of projects throughout his career. Several of his pieces have been reviewed in Leonardo Music Journal, the annual music Journal published by MIT Press. He has also curated an album for Leonardo Music Journal.
He is currently research fellow on the Engineering and Physical Sciences Research Council's multidisciplinary 'Positive Soundscapes Project'.
Musical interests
Cusack is particularly interested in environmental sound and acoustic ecology. He has examined the sound properties of areas such as Lake Baikal, Siberia, and the Azerbaijan oil fields, and is interested in how sounds change as people migrate and as technology changes.
In 1998, Cusack started the "Your Favorite London Sound" project. The goal is to find out what London noises are found appealing by people who live in London. This was so popular that it has been repeated in Chicago, Beijing, and other cities. He is involved in the "Sound & The City" art project using sounds from Beijing in October 2005.
Cusack's Sounds From Dangerous Places is a project to collect sounds from sites which have sustained major environmental damage. Sites that Cusack is working on include Chernobyl, the Azerbaijan oil fields, and areas around controversial dams on the Tigris and Euphrates river systems in south east Turkey.
Cusack's performances are a central part of the book Haunted Weather: Music, Silence, and Memory (Toop, 2004) by his old collaborator and respected music critic and author, David Toop. Toop investigates the use of environmental sound and electronic instruments in experimental music in his book.
Other performances
With clarinetist Simon Mayo, he formed the duo known as "A Touch of the Sun". His first "major" recording was part of Fred Frith's 1974 record, "Guitar Solos".
He was one of the first to play the bouzouki in England, which gained him the respect of London's musical avant garde.
As a musician, he has collaborated with artists such as Clive Bell, Nic Collins, Alterations, Chris Cutler, Max Eastley, Evan Parker, Hugh Davies, Annette Krebs and Eastern Mediterranean singer Viv Corringham.
A live performance with Nicolas Collins was released as "A Host, of Golden Daffodils" in 1999.
Activities related to music
He co-founded an artist-owned record label called "Bead Records" which has released many previously unavailable pieces in 1972. It had released more than 30 albums, as of 2007.
In 1975 Derek Bailey, Steve Beresford, Max Boucher, Paul Burwell, Jack Cooke, Peter Cusack, Hugh Davies, Madelaine and Martin Davidson, Richard Leigh, Evan Parker, John Russell, David Toop, Philipp Wachsmann and Colin Wood formed the journal MUSICS, later described as "an impromental experivisation arts magazine".
Cusack produces the monthly radio program "Vermilion Sounds" with Isobel Clouter. Vermilion Sounds explores environmental sounds and is broadcast by Resonance FM in London. John Levack Drever, writing in Soundscape, comments:
Of significant note is the work of Peter Cusack and Isobel Clouter (from the British Library Sound Archive who we now welcome onto the UKISC Management Committee), who have done a sterling job producing Vermilion Sounds—a weekly radio show for Resonance FM...
Other projects
Soundlines: City of London Festival educational project on music and environmental sound in East London schools (April to November 2003).
Baku, 5 Quarters at the University of Baku, Azerbaijan. This was a collaboration with Swiss video artist Ursula Biemann in 2004.
Urban Grime, exhibition at the Museum of London Sept 2003 to Jan 2004
Send+Receive Festival performance & workshops, Winnipeg, Canada 2004:
LMC Guitar Festival performances, Museum of Garden History, London 2004
Frère Jacques et autres pièces à Francis: Expositions. 1997. Saint-Fons, with Ron Haselden, a British artist living in the French town of Brizard, in Brittany. This was a well-known interactive multimedia piece featuring the song Frère Jacques.
Selected recordings
Your Favourite London Sounds 1998–2001, Peter Cusack, Resonance (2002)
Day For Night, Peter Cusack, Max Eastley, Paradigm (2000). The compilation of recordings from a 25-year collaboration.
Interruptions, Terry Day, EMANEM 4125; Cusack plays on two tracks, recordings from 1978–1981.
Voila Enough! 1979–1981 (Atavistic ALP239CD) – CD release of the group Alterations (Steve Beresford, Peter Cusack, Terry Day, David Toop)
Baikal Ice, Peter Cusack, RER Megacorp / IODA (Spring 2003)
Where is the Green Parrot?, Peter Cusack, RER Megacorp / IODA (1999)
The Horse Was Alive, The Cow Was Dead, Peter Cusack album with 46 tracks
Butlers Wharf, Peter Cusack
Ghosts & Monsters: Technology & Personality in Contemporary Music, Composer: Robert Ashley, Frieder Butzmann, John Cage, Cornelius Cardew, Henning Christiansen, et al., Conductor: Christian von Borries, Guy Protheroe, Performers: Peter Cusack, Margaret Leng Tan, Jerry Hunt, Shelley Hirsch, Berliner Philharmoniker, Emf Media (2 May 2000) includes an extract from a Host, of Golden Daffodils – Nicolas Collins, Peter Cusack
Haunted Weather, assorted artists, Staubgold Germany, 25 May 2004, includes "Flight Path Trace" by Peter Cusack (companion CD to Ghosts and Monsters: Technology and Personality in Contemporary Music, Leonardo Music Journal 8 (1998), Leonardo / MIT Press, 1998)
Not Necessarily "English Music": A collection of experimental music from Great Britain, 1960–1977, curated by David Toop, Leonard Music Journal CD Series Volume 11, includes Geese recorded in 1974 by Peter Cusack and Simon Mayo (A Touch of the Sun), the companion CD to 2001 Volume of Leonardo Music Journal, MIT Press, 2001.
Nightjars and Roe Deer, and Squabble (both from CD to Musicworks #59, Peter Cusack) included in Songs Soaring, (René van Peer, catalogue for festival Whistling in the Dark/Pfeifen in Walde, organised by Matthias Osterwold and Nicolas Collins in Podewil, Berlin (Germany), 9 to 18 September 1994, organised by Matthias Osterwold and Nicolas Collins in Podewil, Berlin (Germany), 9 to 18 September 1994, pub. by Volker Straebel and Matthias Osterwold, in association with Nicolas Collins, Valerian Maly and Elke Moltrecht. Distribution through Podewil and Maly Verlag, 1994.)
TECHNO MIT STÖRUNGEN, an album recorded at festival "music unlimited" at Alter Schlachthof Wels, Austria, 11 November 1995. The album features Peter Cusack playing "bousouki & interactive birds"
Operet, Peter Cusack and Viv Corringham, Rere121
Sounds from dangerous places book with audio CDs
Curations
Interpreting the Soundscape, curated by Peter Cusack, contributions by Tonya Wimmer, Andrea Polli and Joe Gilmore, Jacob Kirkegaard, Chris Watson, Rafal Flejter, Chris DeLaurenti, Christina Kubisch, Charles Stankievech, Sonic Postcards, Yannick Dauby and Pascal Battus. LMJ CD Series Volume 16 accompanying the 2006 Volume of Leonardo Music Journal, Leonardo Music Journal Volume 16 (2006), MIT press, 2006.
Selected publications
"Ghosts and Monsters": Contributors' Notes", Alexander Abramovitch Krejn, Christian von Borries, John Cage, Andrew Culver, John Tilbury, Paul de Marinis, Robert Ashley, Henning Christiansen, Alvin Lucier, Peter Cusack, Shelley Hirsch, Jerry Hunt, Michael Schell, Frieder Butzmann, Michael Snow, Leonardo Music Journal, Vol. 8, Ghosts and Monsters: Technology and Personality in Contemporary Music (1998), pp. 64–74, MIT Press, 1998.
The Positive Soundscape Project: A re-evaluation of environmental sound, Mags Adams, Angus Carlyle, Peter Cusack, Bill Davies, Ken Hume, Paul Jennings, Chris Plack, Research Proposal.
Dialogue, Peter Cusack, Soundscape—The Journal of Acoustic Ecology 1 (2) p8, 2000.
References
Haunted Weather: Music, Silence, and Memory, David Toop, Serpent's Tail, 1 July 2004,
Notes
External links
Peter Cusack's official website
Favourite sounds project's website
Sounds from dangerous places project's website
Peter Cusack entry in Allmusic, François Couture
Alterations album reviews. This album was recorded in 1981 and released in 1999.
Bead Records website, the record company Cusack co-founded in 1972, which has released more than 30 albums.
Year of birth missing (living people)
Living people
English electronic musicians
English experimental musicians
Field recording
People associated with the University of the Arts London | Peter Cusack (musician) | Engineering | 2,080 |
53,695,856 | https://en.wikipedia.org/wiki/Complete%20topological%20vector%20space | In functional analysis and related areas of mathematics, a complete topological vector space is a topological vector space (TVS) with the property that whenever points get progressively closer to each other, then there exists some point towards which they all get closer.
The notion of "points that get progressively closer" is made rigorous by or , which are generalizations of , while "point towards which they all get closer" means that this Cauchy net or filter converges to
The notion of completeness for TVSs uses the theory of uniform spaces as a framework to generalize the notion of completeness for metric spaces.
But unlike metric-completeness, TVS-completeness does not depend on any metric and is defined for TVSs, including those that are not metrizable or Hausdorff.
Completeness is an extremely important property for a topological vector space to possess.
The notions of completeness for normed spaces and metrizable TVSs, which are commonly defined in terms of completeness of a particular norm or metric, can both be reduced down to this notion of TVS-completeness – a notion that is independent of any particular norm or metric.
A metrizable topological vector space with a translation invariant metric is complete as a TVS if and only if is a complete metric space, which by definition means that every -Cauchy sequence converges to some point in
Prominent examples of complete TVSs that are also metrizable include all F-spaces and consequently also all Fréchet spaces, Banach spaces, and Hilbert spaces.
Prominent examples of complete TVS that are (typically) metrizable include strict LF-spaces such as the space of test functions with it canonical LF-topology, the strong dual space of any non-normable Fréchet space, as well as many other polar topologies on continuous dual space or other topologies on spaces of linear maps.
Explicitly, a topological vector spaces (TVS) is complete if every net, or equivalently, every filter, that is Cauchy with respect to the space's necessarily converges to some point. Said differently, a TVS is complete if its canonical uniformity is a complete uniformity.
The canonical uniformity on a TVS is the unique translation-invariant uniformity that induces on the topology
This notion of "TVS-completeness" depends on vector subtraction and the topology of the TVS; consequently, it can be applied to all TVSs, including those whose topologies can not be defined in terms metrics or pseudometrics.
A first-countable TVS is complete if and only if every Cauchy sequence (or equivalently, every elementary Cauchy filter) converges to some point.
Every topological vector space even if it is not metrizable or not Hausdorff, has a , which by definition is a complete TVS into which can be TVS-embedded as a dense vector subspace. Moreover, every Hausdorff TVS has a completion, which is necessarily unique up to TVS-isomorphism. However, as discussed below, all TVSs have infinitely many non-Hausdorff completions that are TVS-isomorphic to one another.
Definitions
This section summarizes the definition of a complete topological vector space (TVS) in terms of both nets and prefilters.
Information about convergence of nets and filters, such as definitions and properties, can be found in the article about filters in topology.
Every topological vector space (TVS) is a commutative topological group with identity under addition and the canonical uniformity of a TVS is defined in terms of subtraction (and thus addition); scalar multiplication is not involved and no additional structure is needed.
Canonical uniformity
The of is the set
and for any the / is the set
where if then contains the diagonal
If is a symmetric set (that is, if ), then is , which by definition means that holds where and in addition, this symmetric set's with itself is:
If is any neighborhood basis at the origin in then the family of subsets of
is a prefilter on
If is the neighborhood filter at the origin in then forms a base of entourages for a uniform structure on that is considered canonical.
Explicitly, by definition, is the filter on generated by the above prefilter:
where denotes the of in
The same canonical uniformity would result by using a neighborhood basis of the origin rather the filter of all neighborhoods of the origin. If is any neighborhood basis at the origin in then the filter on generated by the prefilter is equal to the canonical uniformity induced by
Cauchy net
The general theory of uniform spaces has its own definition of a "Cauchy prefilter" and "Cauchy net". For the canonical uniformity on these definitions reduce down to those given below.
Suppose is a net in and is a net in
The product becomes a directed set by declaring if and only if and
Then
denotes the (Cartesian) , where in particular If then the image of this net under the vector addition map denotes the of these two nets:
and similarly their is defined to be the image of the product net under the vector subtraction map :
In particular, the notation denotes the -indexed net and not the -indexed net since using the latter as the definition would make the notation useless.
A net in a TVS is called a Cauchy net if
Explicitly, this means that for every neighborhood of in there exists some index such that for all indices that satisfy and
It suffices to check any of these defining conditions for any given neighborhood basis of in
A Cauchy sequence is a sequence that is also a Cauchy net.
If then in and so the continuity of the vector subtraction map which is defined by guarantees that in where and
This proves that every convergent net is a Cauchy net.
By definition, a space is called if the converse is also always true.
That is, is complete if and only if the following holds:
whenever is a net in then converges (to some point) in if and only if in
A similar characterization of completeness holds if filters and prefilters are used instead of nets.
A series is called a (respectively, a ) if the sequence of partial sums is a Cauchy sequence (respectively, a convergent sequence). Every convergent series is necessarily a Cauchy series. In a complete TVS, every Cauchy series is necessarily a convergent series.
Cauchy filter and Cauchy prefilter
A prefilter on a topological vector space is called a Cauchy prefilter if it satisfies any of the following equivalent conditions:
in
The family is a prefilter.
Explicitly, means that for every neighborhood of the origin in there exist such that
in
The family is a prefilter equivalent to (equivalence means these prefilters generate the same filter on ).
Explicitly, means that for every neighborhood of the origin in there exists some such that
For every neighborhood of the origin in contains some -small set (that is, there exists some such that ).
A subset is called -small or if
For every neighborhood of the origin in there exists some and some such that
This statement remains true if "" is replaced with ""
Every neighborhood of the origin in contains some subset of the form where and
It suffices to check any of the above conditions for any given neighborhood basis of in
A Cauchy filter is a Cauchy prefilter that is also a filter on
If is a prefilter on a topological vector space and if then in if and only if and is Cauchy.
Complete subset
For any a prefilter is necessarily a subset of ; that is,
A subset of a TVS is called a if it satisfies any of the following equivalent conditions:
Every Cauchy prefilter on converges to at least one point of
If is Hausdorff then every prefilter on will converge to at most one point of But if is not Hausdorff then a prefilter may converge to multiple points in The same is true for nets.
Every Cauchy net in converges to at least one point of
is a complete uniform space (under the point-set topology definition of "complete uniform space") when is endowed with the uniformity induced on it by the canonical uniformity of
The subset is called a if every Cauchy sequence in (or equivalently, every elementary Cauchy filter/prefilter on ) converges to at least one point of
Importantly, : If is not Hausdorff and if every Cauchy prefilter on converges to some point of then will be complete even if some or all Cauchy prefilters on converge to points(s) in In short, there is no requirement that these Cauchy prefilters on converge to points in The same can be said of the convergence of Cauchy nets in
As a consequence, if a TVS is Hausdorff then every subset of the closure of in is complete because it is compact and every compact set is necessarily complete. In particular, if is a proper subset, such as for example, then would be complete even though Cauchy net in (and also every Cauchy prefilter on ) converges to point in including those points in that do not belong to
This example also shows that complete subsets (and indeed, even compact subsets) of a non-Hausdorff TVS may fail to be closed. For example, if then if and only if is closed in
Complete topological vector space
A topological vector space is called a if any of the following equivalent conditions are satisfied:
is a complete uniform space when it is endowed with its canonical uniformity.
In the general theory of uniform spaces, a uniform space is called a complete uniform space if each Cauchy filter on converges to some point of in the topology induced by the uniformity. When is a TVS, the topology induced by the canonical uniformity is equal to 's given topology (so convergence in this induced topology is just the usual convergence in ).
is a complete subset of itself.
There exists a neighborhood of the origin in that is also a complete subset of
This implies that every locally compact TVS is complete (even if the TVS is not Hausdorff).
Every Cauchy prefilter on converges in to at least one point of
If is Hausdorff then every prefilter on will converge to at most one point of But if is not Hausdorff then a prefilter may converge to multiple points in The same is true for nets.
Every Cauchy filter on converges in to at least one point of
Every Cauchy net in converges in to at least one point of
where if in addition is pseudometrizable or metrizable (for example, a normed space) then this list can be extended to include:
is sequentially complete.
A topological vector space is if any of the following equivalent conditions are satisfied:
is a sequentially complete subset of itself.
Every Cauchy sequence in converges in to at least one point of
Every elementary Cauchy prefilter on converges in to at least one point of
Every elementary Cauchy filter on converges in to at least one point of
Uniqueness of the canonical uniformity
The existence of the canonical uniformity was demonstrated above by defining it. The theorem below establishes that the canonical uniformity of any TVS is the only uniformity on that is both (1) translation invariant, and (2) generates on the topology
This section is dedicated to explaining the precise meanings of the terms involved in this uniqueness statement.
Uniform spaces and translation-invariant uniformities
For any subsets let
and let
A non-empty family is called a or a if is a prefilter on satisfying all of the following conditions:
Every set in contains the diagonal of as a subset; that is, for every Said differently, the prefilter is on
For every there exists some such that
For every there exists some such that
A or on is a filter on that is generated by some base of entourages in which case we say that is a base of entourages
For a commutative additive group a is a fundamental system of entourages such that for every if and only if for all A uniformity is called a if it has a base of entourages that is translation-invariant.
The canonical uniformity on any TVS is translation-invariant.
The binary operator satisfies all of the following:
If and then
Associativity:
Identity:
Zero:
Symmetric entourages
Call a subset symmetric if which is equivalent to
This equivalence follows from the identity and the fact that if then if and only if
For example, the set is always symmetric for every
And because if and are symmetric then so is
Topology generated by a uniformity
Relatives
Let be arbitrary and let be the canonical projections onto the first and second coordinates, respectively.
For any define
where (respectively, ) is called the set of left (respectively, right) -relatives of (points in)
Denote the special case where is a singleton set for some by:
If then
Moreover, right distributes over both unions and intersections, meaning that if then and
Neighborhoods and open sets
Two points and are -close if and a subset is called -small if
Let be a base of entourages on The at a point and, respectively, on a subset are the families of sets:
and the filters on that each generates is known as the of (respectively, of ).
Assign to every the neighborhood prefilter
and use the neighborhood definition of "open set" to obtain a topology on called the topology induced by or the .
Explicitly, a subset is open in this topology if and only if for every there exists some such that that is, is open if and only if for every there exists some such that
The closure of a subset in this topology is:
Cauchy prefilters and complete uniformities
A prefilter on a uniform space with uniformity is called a Cauchy prefilter if for every entourage there exists some such that
A uniform space is called a (respectively, a ) if every Cauchy prefilter (respectively, every elementary Cauchy prefilter) on converges to at least one point of when is endowed with the topology induced by
Case of a topological vector space
If is a topological vector space then for any and
and the topology induced on by the canonical uniformity is the same as the topology that started with (that is, it is ).
Uniform continuity
Let and be TVSs, and be a map. Then is if for every neighborhood of the origin in there exists a neighborhood of the origin in such that for all if then
Suppose that is uniformly continuous. If is a Cauchy net in then is a Cauchy net in
If is a Cauchy prefilter in (meaning that is a family of subsets of that is Cauchy in ) then is a Cauchy prefilter in However, if is a Cauchy filter on then although will be a Cauchy filter, it will be a Cauchy filter in if and only if is surjective.
TVS completeness vs completeness of (pseudo)metrics
Preliminaries: Complete pseudometric spaces
We review the basic notions related to the general theory of complete pseudometric spaces.
Recall that every metric is a pseudometric and that a pseudometric is a metric if and only if implies Thus every metric space is a pseudometric space and a pseudometric space is a metric space if and only if is a metric.
If is a subset of a pseudometric space then the diameter of is defined to be
A prefilter on a pseudometric space is called a -Cauchy prefilter or simply a Cauchy prefilter if for each real there is some such that the diameter of is less than
Suppose is a pseudometric space. A net in is called a -Cauchy net or simply a Cauchy net if is a Cauchy prefilter, which happens if and only if
for every there is some such that if with and then
or equivalently, if and only if in This is analogous to the following characterization of the converge of to a point: if then in if and only if in
A Cauchy sequence is a sequence that is also a Cauchy net.
Every pseudometric on a set induces the usual canonical topology on which we'll denote by ; it also induces a canonical uniformity on which we'll denote by The topology on induced by the uniformity is equal to A net in is Cauchy with respect to if and only if it is Cauchy with respect to the uniformity
The pseudometric space is a complete (resp. a sequentially complete) pseudometric space if and only if is a complete (resp. a sequentially complete) uniform space.
Moreover, the pseudometric space (resp. the uniform space ) is complete if and only if it is sequentially complete.
A pseudometric space (for example, a metric space) is called complete and is called a complete pseudometric if any of the following equivalent conditions hold:
Every Cauchy prefilter on converges to at least one point of
The above statement but with the word "prefilter" replaced by "filter."
Every Cauchy net in converges to at least one point of
If is a metric on then any limit point is necessarily unique and the same is true for limits of Cauchy prefilters on
Every Cauchy sequence in converges to at least one point of
Thus to prove that is complete, it suffices to only consider Cauchy sequences in (and it is not necessary to consider the more general Cauchy nets).
The canonical uniformity on induced by the pseudometric is a complete uniformity.
And if addition is a metric then we may add to this list:
Every decreasing sequence of closed balls whose diameters shrink to has non-empty intersection.
Complete pseudometrics and complete TVSs
Every F-space, and thus also every Fréchet space, Banach space, and Hilbert space is a complete TVS. Note that every F-space is a Baire space but there are normed spaces that are Baire but not Banach.
A pseudometric on a vector space is said to be a if for all vectors
Suppose is pseudometrizable TVS (for example, a metrizable TVS) and that is pseudometric on such that the topology on induced by is equal to
If is translation-invariant, then is a complete TVS if and only if is a complete pseudometric space.
If is translation-invariant, then may be possible for to be a complete TVS but to be a complete pseudometric space (see this footnote for an example).
Complete norms and equivalent norms
Two norms on a vector space are called equivalent if and only if they induce the same topology. If and are two equivalent norms on a vector space then the normed space is a Banach space if and only if is a Banach space.
See this footnote for an example of a continuous norm on a Banach space that is equivalent to that Banach space's given norm.
All norms on a finite-dimensional vector space are equivalent and every finite-dimensional normed space is a Banach space. Every Banach space is a complete TVS. A normed space is a Banach space (that is, its canonical norm-induced metric is complete) if and only if it is complete as a topological vector space.
Completions
A completion of a TVS is a complete TVS that contains a dense vector subspace that is TVS-isomorphic to In other words, it is a complete TVS into which can be TVS-embedded as a dense vector subspace. Every TVS-embedding is a uniform embedding.
Every topological vector space has a completion. Moreover, every Hausdorff TVS has a completion, which is necessarily unique up to TVS-isomorphism. However, all TVSs, even those that are Hausdorff, (already) complete, and/or metrizable have infinitely many non-Hausdorff completions that are TVS-isomorphic to one another.
Examples of completions
For example, the vector space consisting of scalar-valued simple functions for which (where this seminorm is defined in the usual way in terms of Lebesgue integration) becomes a seminormed space when endowed with this seminorm, which in turn makes it into both a pseudometric space and a non-Hausdorff non-complete TVS; any completion of this space is a non-Hausdorff complete seminormed space that when quotiented by the closure of its origin (so as to obtain a Hausdorff TVS) results in (a space linearly isometrically-isomorphic to) the usual complete Hausdorff -space (endowed with the usual complete norm).
As another example demonstrating the usefulness of completions, the completions of topological tensor products, such as projective tensor products or injective tensor products, of the Banach space with a complete Hausdorff locally convex TVS results in a complete TVS that is TVS-isomorphic to a "generalized" -space consisting -valued functions on (where this "generalized" TVS is defined analogously to original space of scalar-valued functions on ). Similarly, the completion of the injective tensor product of the space of scalar-valued -test functions with such a TVS is TVS-isomorphic to the analogously defined TVS of -valued test functions.
Non-uniqueness of all completions
As the example below shows, regardless of whether or not a space is Hausdorff or already complete, every topological vector space (TVS) has infinitely many non-isomorphic completions.
However, every Hausdorff TVS has a completion that is unique up to TVS-isomorphism. But nevertheless, every Hausdorff TVS still has infinitely many non-isomorphic non-Hausdorff completions.
Example (Non-uniqueness of completions):
Let denote any complete TVS and let denote any TVS endowed with the indiscrete topology, which recall makes into a complete TVS.
Since both and are complete TVSs, so is their product
If and are non-empty open subsets of and respectively, then and which shows that is a dense subspace of
Thus by definition of "completion," is a completion of (it doesn't matter that is already complete).
So by identifying with if is a dense vector subspace of then has both and as completions.
Hausdorff completions
Every Hausdorff TVS has a completion that is unique up to TVS-isomorphism. But nevertheless, as shown above, every Hausdorff TVS still has infinitely many non-isomorphic non-Hausdorff completions.
Existence of Hausdorff completions
A Cauchy filter on a TVS is called a if there does exist a Cauchy filter on that is strictly coarser than (that is, "strictly coarser than " means contained as a proper subset of ).
If is a Cauchy filter on then the filter generated by the following prefilter:
is the unique minimal Cauchy filter on that is contained as a subset of
In particular, for any the neighborhood filter at is a minimal Cauchy filter.
Let be the set of all minimal Cauchy filters on and let be the map defined by sending to the neighborhood filter of in
Endow with the following vector space structure:
Given and a scalar let (resp. ) denote the unique minimal Cauchy filter contained in the filter generated by (resp. ).
For every balanced neighborhood of the origin in let
If is Hausdorff then the collection of all sets as ranges over all balanced neighborhoods of the origin in forms a vector topology on making into a complete Hausdorff TVS. Moreover, the map is a TVS-embedding onto a dense vector subspace of
If is a metrizable TVS then a Hausdorff completion of can be constructed using equivalence classes of Cauchy sequences instead of minimal Cauchy filters.
Non-Hausdorff completions
This subsection details how every non-Hausdorff TVS can be TVS-embedded onto a dense vector subspace of a complete TVS. The proof that every Hausdorff TVS has a Hausdorff completion is widely available and so this fact will be used (without proof) to show that every non-Hausdorff TVS also has a completion. These details are sometimes useful for extending results from Hausdorff TVSs to non-Hausdorff TVSs.
Let denote the closure of the origin in where is endowed with its subspace topology induced by (so that has the indiscrete topology).
Since has the trivial topology, it is easily shown that every vector subspace of that is an algebraic complement of in is necessarily a topological complement of in
Let denote any topological complement of in which is necessarily a Hausdorff TVS (since it is TVS-isomorphic to the quotient TVS ).
Since is the topological direct sum of and (which means that in the category of TVSs), the canonical map
is a TVS-isomorphism.
Let denote the inverse of this canonical map. (As a side note, it follows that every open and every closed subset of satisfies )
The Hausdorff TVS can be TVS-embedded, say via the map onto a dense vector subspace of its completion
Since and are complete, so is their product
Let denote the identity map and observe that the product map is a TVS-embedding whose image is dense in
Define the map
which is a TVS-embedding of onto a dense vector subspace of the complete TVS
Moreover, observe that the closure of the origin in is equal to and that and are topological complements in
To summarize, given any algebraic (and thus topological) complement of in and given any completion of the Hausdorff TVS such that then the natural inclusion
is a well-defined TVS-embedding of onto a dense vector subspace of the complete TVS where moreover,
Topology of a completion
Said differently, if is a completion of a TVS with and if is a neighborhood base of the origin in then the family of sets
is a neighborhood basis at the origin in
Grothendieck's Completeness Theorem
Let denote the on the continuous dual space which by definition consists of all equicontinuous weak-* closed and weak-* bounded absolutely convex subsets of (which are necessarily weak-* compact subsets of ). Assume that every is endowed with the weak-* topology.
A filter on is said to to if there exists some containing (that is, ) such that the trace of on which is the family converges to in (that is, if in the given weak-* topology).
The filter converges continuously to if and only if converges continuously to the origin, which happens if and only if for every the filter in the scalar field (which is or ) where denotes any neighborhood basis at the origin in denotes the duality pairing, and denotes the filter generated by
A map into a topological space (such as or ) is said to be if whenever a filter on converges continuously to then
Properties preserved by completions
If a TVS has any of the following properties then so does its completion:
Hausdorff
Locally convex
Pseudometrizable
Metrizable
Seminormable
Normable
Moreover, if is a normed space, then the completion can be chosen to be a Banach space such that the TVS-embedding of into is an isometry.
Hausdorff pre-Hilbert. That is, a TVS induced by an inner product.
Nuclear
Barrelled
Mackey
DF-space
Completions of Hilbert spaces
Every inner product space has a completion that is a Hilbert space, where the inner product is the unique continuous extension to of the original inner product The norm induced by is also the unique continuous extension to of the norm induced by
Other preserved properties
If is a Hausdorff TVS, then the continuous dual space of is identical to the continuous dual space of the completion of The completion of a locally convex bornological space is a barrelled space. If and are DF-spaces then the projective tensor product, as well as its completion, of these spaces is a DF-space.
The completion of the projective tensor product of two nuclear spaces is nuclear. The completion of a nuclear space is TVS-isomorphic with a projective limit of Hilbert spaces.
If (meaning that the addition map is a TVS-isomorphism) has a Hausdorff completion then
If in addition is an inner product space and and are orthogonal complements of each other in (that is, ), then and are orthogonal complements in the Hilbert space
Properties of maps preserved by extensions to a completion
If is a nuclear linear operator between two locally convex spaces and if be a completion of then has a unique continuous linear extension to a nuclear linear operator
Let and be two Hausdorff TVSs with complete. Let be a completion of Let denote the vector space of continuous linear operators and let denote the map that sends every to its unique continuous linear extension on Then is a (surjective) vector space isomorphism. Moreover, maps families of equicontinuous subsets onto each other. Suppose that is endowed with a -topology and that denotes the closures in of sets in Then the map is also a TVS-isomorphism.
Examples and sufficient conditions for a complete TVS
Any TVS endowed with the trivial topology is complete and every one of its subsets is complete. Moreover, every TVS with the trivial topology is compact and hence locally compact. Thus a complete seminormable locally convex and locally compact TVS need not be finite-dimensional if it is not Hausdorff.
An arbitrary product of complete (resp. sequentially complete, quasi-complete) TVSs has that same property. If all spaces are Hausdorff, then the converses are also true. A product of Hausdorff completions of a family of (Hausdorff) TVSs is a Hausdorff completion of their product TVS. More generally, an arbitrary product of complete subsets of a family of TVSs is a complete subset of the product TVS.
The projective limit of a projective system of Hausdorff complete (resp. sequentially complete, quasi-complete) TVSs has that same property. A projective limit of Hausdorff completions of an inverse system of (Hausdorff) TVSs is a Hausdorff completion of their projective limit.
If is a closed vector subspace of a complete pseudometrizable TVS then the quotient space is complete.
Suppose is a vector subspace of a metrizable TVS If the quotient space is complete then so is However, there exists a complete TVS having a closed vector subspace such that the quotient TVS is complete.
Every F-space, Fréchet space, Banach space, and Hilbert space is a complete TVS.
Strict LF-spaces and strict LB-spaces are complete.
Suppose that is a dense subset of a TVS If every Cauchy filter on converges to some point in then is complete.
The Schwartz space of smooth functions is complete.
The spaces of distributions and test functions is complete.
Suppose that and are locally convex TVSs and that the space of continuous linear maps is endowed with the topology of uniform convergence on bounded subsets of If is a bornological space and if is complete then is a complete TVS. In particular, the strong dual of a bornological space is complete. However, it need not be bornological.
Every quasi-complete DF-space is complete.
Let and be Hausdorff TVS topologies on a vector space such that If there exists a prefilter such that is a neighborhood basis at the origin for and such that every is a complete subset of then is a complete TVS.
Properties
Complete TVSs
Every TVS has a completion and every Hausdorff TVS has a Hausdorff completion.
Every complete TVS is quasi-complete space and sequentially complete.
However, the converses of the above implications are generally false.
There exists a sequentially complete locally convex TVS that is not quasi-complete.
If a TVS has a complete neighborhood of the origin then it is complete.
Every complete metrizable TVS is a barrelled space and a Baire space (and thus non-meager).
The dimension of a complete metrizable TVS is either finite or uncountable.
Cauchy nets and prefilters
Any neighborhood basis of any point in a TVS is a Cauchy prefilter.
Every convergent net (respectively, prefilter) in a TVS is necessarily a Cauchy net (respectively, a Cauchy prefilter).
Any prefilter that is subordinate to (that is, finer than) a Cauchy prefilter is necessarily also a Cauchy prefilter and any prefilter finer than a Cauchy prefilter is also a Cauchy prefilter.
The filter associated with a sequence in a TVS is Cauchy if and only if the sequence is a Cauchy sequence.
Every convergent prefilter is a Cauchy prefilter.
If is a TVS and if is a cluster point of a Cauchy net (respectively, Cauchy prefilter), then that Cauchy net (respectively, that Cauchy prefilter) converges to in
If a Cauchy filter in a TVS has an accumulation point then it converges to
Uniformly continuous maps send Cauchy nets to Cauchy nets.
A Cauchy sequence in a Hausdorff TVS when considered as a set, is not necessarily relatively compact (that is, its closure in is not necessarily compact) although it is precompact (that is, its closure in the completion of is compact).
Every Cauchy sequence is a bounded subset but this is not necessarily true of Cauchy net. For example, let have it usual order, let denote any preorder on the non-indiscrete TVS (that is, does not have the trivial topology; it is also assumed that ) and extend these two preorders to the union by declaring that holds for every and
Let be defined by if and otherwise (that is, if ), which is a net in since the preordered set is directed (this preorder on is also partial order (respectively, a total order) if this is true of ). This net is a Cauchy net in because it converges to the origin, but the set is not a bounded subset of (because does not have the trivial topology).
Suppose that is a family of TVSs and that denotes the product of these TVSs. Suppose that for every index is a prefilter on Then the product of this family of prefilters is a Cauchy filter on if and only if each is a Cauchy filter on
Maps
If is an injective topological homomorphism from a complete TVS into a Hausdorff TVS then the image of (that is, ) is a closed subspace of
If is a topological homomorphism from a complete metrizable TVS into a Hausdorff TVS then the range of is a closed subspace of
If is a uniformly continuous map between two Hausdorff TVSs then the image under of a totally bounded subset of is a totally bounded subset of
Uniformly continuous extensions
Suppose that is a uniformly continuous map from a dense subset of a TVS into a complete Hausdorff TVS Then has a unique uniformly continuous extension to all of
If in addition is a homomorphism then its unique uniformly continuous extension is also a homomorphism.
This remains true if "TVS" is replaced by "commutative topological group."
The map is not required to be a linear map and that is not required to be a vector subspace of
Uniformly continuous linear extensions
Suppose be a continuous linear operator between two Hausdorff TVSs. If is a dense vector subspace of and if the restriction to is a topological homomorphism then is also a topological homomorphism. So if and are Hausdorff completions of and respectively, and if is a topological homomorphism, then 's unique continuous linear extension is a topological homomorphism. (Note that it's possible for to be surjective but for to be injective.)
Suppose and are Hausdorff TVSs, is a dense vector subspace of and is a dense vector subspaces of If are and are topologically isomorphic additive subgroups via a topological homomorphism then the same is true of and via the unique uniformly continuous extension of (which is also a homeomorphism).
Subsets
Complete subsets
Every complete subset of a TVS is sequentially complete.
A complete subset of a Hausdorff TVS is a closed subset of
Every compact subset of a TVS is complete (even if the TVS is not Hausdorff or not complete).
Closed subsets of a complete TVS are complete; however, if a TVS is not complete then is a closed subset of that is not complete.
The empty set is complete subset of every TVS.
If is a complete subset of a TVS (the TVS is not necessarily Hausdorff or complete) then any subset of that is closed in is complete.
Topological complements
If is a non-normable Fréchet space on which there exists a continuous norm then contains a closed vector subspace that has no topological complement.
If is a complete TVS and is a closed vector subspace of such that is not complete, then does have a topological complement in
Subsets of completions
Let be a separable locally convex metrizable topological vector space and let be its completion. If is a bounded subset of then there exists a bounded subset of such that
Relation to compact subsets
A subset of a TVS ( assumed to be Hausdorff or complete) is compact if and only if it is complete and totally bounded.
Thus a closed and totally bounded subset of a complete TVS is compact.
In a Hausdorff locally convex TVS, the convex hull of a precompact set is again precompact. Consequently, in a complete locally convex Hausdorff TVS, the closed convex hull of a compact subset is again compact.
The convex hull of compact subset of a Hilbert space is necessarily closed and so also necessarily compact. For example, let be the separable Hilbert space of square-summable sequences with the usual norm and let be the standard orthonormal basis (that is at the -coordinate). The closed set is compact but its convex hull is a closed set because belongs to the closure of in but (since every sequence is a finite convex combination of elements of and so is necessarily in all but finitely many coordinates, which is not true of ). However, like in all complete Hausdorff locally convex spaces, the convex hull of this compact subset is compact. The vector subspace is a pre-Hilbert space when endowed with the substructure that the Hilbert space induces on it but is not complete and (since ). The closed convex hull of in (here, "closed" means with respect to and not to as before) is equal to which is not compact (because it is not a complete subset). This shows that in a Hausdorff locally convex space that is not complete, the closed convex hull of compact subset might to be compact (although it will be precompact/totally bounded).
Every complete totally bounded set is relatively compact.
If is any TVS then the quotient map is a closed map and thus A subset of a TVS is totally bounded if and only if its image under the canonical quotient map is totally bounded. Thus is totally bounded if and only if is totally bounded. In any TVS, the closure of a totally bounded subset is again totally bounded.
In a locally convex space, the convex hull and the disked hull of a totally bounded set is totally bounded. If is a subset of a TVS such that every sequence in has a cluster point in then is totally bounded. A subset of a Hausdorff TVS is totally bounded if and only if every ultrafilter on is Cauchy, which happens if and only if it is pre-compact (that is, its closure in the completion of is compact).
If is compact, then and this set is compact. Thus the closure of a compact set is compact (that is, all compact sets are relatively compact). Thus the closure of a compact set is compact. Every relatively compact subset of a Hausdorff TVS is totally bounded.
In a complete locally convex space, the convex hull and the disked hull of a compact set are both compact. More generally, if is a compact subset of a locally convex space, then the convex hull (resp. the disked hull ) is compact if and only if it is complete.
Every subset of is compact and thus complete. In particular, if is not Hausdorff then there exist compact complete sets that are not closed.
See also
Notes
Proofs
Citations
Bibliography
Functional analysis
Topological vector spaces
Uniform spaces | Complete topological vector space | Mathematics | 8,564 |
1,223,033 | https://en.wikipedia.org/wiki/Boss%20key | A boss key, or boss button, is a special keyboard shortcut used in PC games or other programs to hide the program quickly, possibly displaying a special screen that appears to be a normal productivity program (such as a spreadsheet application). One of the earliest implementations was by Friendlyware, a suite of entertainment and general interest programs written in BASIC and sold with the original IBM AT and XT computers from 1982 to 1985. When activated (by pressing F10), an ASCII bar graph with generic "Productivity" and "Time" labels appeared. Pressing F10 again would return to the Friendlyware application.
In PC games
The nominal purpose of the boss key is to make it appear to superiors and coworkers that employees are doing their job when they are actually playing games or using the Internet for non work-related tasks. It was a fairly common feature in early computer games for personal computers, because at the time people often did not have home computers and playing at work was their only option. Most boss keys were used to show dummy DOS prompts. The use has faded somewhat, as modern multitasking operating systems have evolved. However, some programs still retain a boss key feature, such as instant messaging clients or their add-ons or comic book viewers like MComix.
The boss key was first used in the Apple II game "Bezare", published by Southwestern Data Systems. The idea of it was proposed by Roger Wagner (founder of Southwestern Data Systems, and later Roger Wagner Publishing) on a hang-gliding trip in Mexico in March, 1981, in a conversation between Roger Wagner and Doug Carlston (of Broderbund Software). Steve Wozniak, Andy Hertzfeld and a number of other early personal computing pioneers were also part of that event. Wes Cherry, the author of the original Microsoft Solitaire, had included a boss key to display a fake spreadsheet or random C code, but was asked by his superiors to remove this on release.
Another early example of the boss key is in the IBM PC version of Asylum, which clears the screen when F9 is pressed. Certain games have taken the idea of the boss key and used it to comic effect. Infocom's adult-themed Leather Goddesses of Phobos (only the IBM PC version) had a boss key which would hide the game and show a screen designed to look like a Cornerstone database view. Upon closer inspection, however, the screen was not exactly boss safe, being populated with order info on rather ridiculous adult items, including an "inflatable milkman". Sierra On-Line's comedy/sci-fi adventure game Space Quest III had a so-called boss key available from the game's pulldown menu. However, when the user selected it, the game would call out the user on trying to avoid attention, display how long the user had been playing the game, and state "being the good company men that we are, we can't help you cheat like that." The first few games in Sierra's Leisure Suit Larry series included a boss key in the pulldown menus (shortcut usually Ctrl+B). However, when this is used, it results in an instantaneous game over, with the first game saying "Sorry, but you'll have to restore your game; when you panic, I forget everything!". Game creator Al Lowe explained this as being done for speed reasons, since saving the player’s position would take additional time. The boss key for the computer submarine game GATO was the Esc key, which, when pressed, brought up a Lotus 1-2-3 type spreadsheet screen.
Microsoft's implementation
In 1993 Microsoft introduced a five-pack collection of games whose boss button was the ESC key, positioned in the upper left corner of the keyboard, as contrasted to the use of two keys, the CTRL key plus the letter "B" (for "boss"). Moreover, to demonstrate the power of Windows, it could fill the entire screen or just a portion thereof.
In popular culture
The boss button has appeared on every NCAA tournament since the 2005 NCAA men's basketball tournament website for March Madness, which allowed viewers to watch every game.
Alternatives
On modern operating systems, applications may be minimized or switched to the background with a keyboard shortcut. Under desktop environments with multiple workspaces, one possibility is to maintain one "boss" workspace and to switch to it when the boss is coming. A 2014 newspaper article titled "How to watch the Olympics at work without getting caught" described a Mozilla Firefox feature that provides a keyboard shortcut named PanicButton.
References
Video game culture
Video game terminology
History of software
Computer keyboards | Boss key | Technology | 971 |
42,001 | https://en.wikipedia.org/wiki/Antonie%20van%20Leeuwenhoek | Antonie Philips van Leeuwenhoek ( ; ; 24 October 1632 – 26 August 1723) was a Dutch microbiologist and microscopist in the Golden Age of Dutch science and technology. A largely self-taught man in science, he is commonly known as "the Father of Microbiology", and one of the first microscopists and microbiologists. Van Leeuwenhoek is best known for his pioneering work in microscopy and for his contributions toward the establishment of microbiology as a scientific discipline.
Raised in Delft, Dutch Republic, Van Leeuwenhoek worked as a draper in his youth and founded his own shop in 1654. He became well-recognized in municipal politics and developed an interest in lensmaking. In the 1670s, he started to explore microbial life with his microscope.
Using single-lensed microscopes of his own design and make, Van Leeuwenhoek was the first to observe and to experiment with microbes, which he originally referred to as , or . He was the first to relatively determine their size. Most of the "animalcules" are now referred to as unicellular organisms, although he observed multicellular organisms in pond water. He was also the first to document microscopic observations of muscle fibers, bacteria, spermatozoa, red blood cells, crystals in gouty tophi, and among the first to see blood flow in capillaries. Although Van Leeuwenhoek did not write any books, he described his discoveries in chaotic letters to the Royal Society, which published many of his letters in their Philosophical Transactions.
Early life and career
Antonie van Leeuwenhoek was born in Delft, Dutch Republic, on 24 October 1632. On 4 November, he was baptized as Thonis. His father, Philips Antonisz van Leeuwenhoek, was a basket maker who died when Antonie was only five years old. His mother, Margaretha (Bel van den Berch), came from a well-to-do brewer's family. She remarried Jacob Jansz Molijn, a painter and the family moved to Warmond around 1640. Antonie had four older sisters: Margriet, Geertruyt, Neeltje, and Catharina. When he was around ten years old his step-father died. He was sent to live in Benthuizen with his uncle, an attorney. At the age of 16 he became a bookkeeper's apprentice (casher) at a linen-draper's shop at Warmoesstraat in Amsterdam, which was owned by William Davidson. Van Leeuwenhoek left there after six years.
In July 1654, Van Leeuwenhoek married Barbara de Mey in Delft, with whom he fathered one surviving daughter, Maria (four other children died in infancy). He would live and study for the rest of his life at Hypolytusbuurt in a house he bought in 1655. He opened a draper's shop, selling linen, yarn and ribbon to seamstresses and tailors. His status in Delft grew throughout the years. In 1660 he received a lucrative job as chamberlain for the sheriffs in the city hall, a position which he would hold for almost 40 years. His duties included maintaining the premises, heating, cleaning, opening for meetings, performing duties for those assembled, and maintaining silence on all matters discussed there.
In 1669 he was appointed as a land surveyor by the court of Holland; at some time he combined it with another municipal job, being the official "wine-gauger" of Delft and in charge of the city wine imports and taxation. His wife had died in 1666, and in 1671, Van Leeuwenhoek remarried to Cornelia Swalmius with whom he had no children.
Van Leeuwenhoek was a contemporary of another famous Delft citizen, the painter Johannes Vermeer, who was baptized just four days earlier. It has been suggested that he is the man portrayed in two Vermeer paintings of the late 1660s, The Astronomer and The Geographer, but others argue that there appears to be little physical similarity. Because they were both relatively important men in a city with only 24,000 inhabitants, living both close to the main market, it is likely they knew each other. Van Leeuwenhoek acted as the executor of Vermeer's will when the painter died in 1675.
Van Leeuwenhoek's religion was "Dutch Reformed" and Calvinist. Like Jan Swammerdam he often referred with reverence to the wonders God designed in making creatures great and small, and believed that his discoveries were merely further proof of the wonder of creation.
Microscopic study
While running his draper shop, Van Leeuwenhoek wanted to see the quality of the thread better than what was possible using the magnifying lenses of the time. He developed an interest in lensmaking, although few records exist of his early activity. By placing the middle of a small rod of soda lime glass in a hot flame, one can pull the hot section apart to create two long whiskers of glass. Then, by reinserting the end of one whisker into the flame, a very small, high-quality glass lens is created. Significantly, a May 2021 neutron tomography study of a high-magnification Leeuwenhoek microscope captured images of the short glass stem characteristic of this lens creation method. For lower magnifications he also made ground lenses. To help keep his methods confidential he apparently intentionally encouraged others to think grinding was his primary or only lens construction method.
Recognition by the Royal Society
After developing his method for creating powerful lenses and applying them to the study of the microscopic world, Van Leeuwenhoek introduced his work to his friend, the prominent Dutch physician Reinier de Graaf. When the Royal Society in London published the groundbreaking work of an Italian lensmaker in their journal Philosophical Transactions of the Royal Society, de Graaf wrote to the editor of the journal, Henry Oldenburg, with a ringing endorsement of Van Leeuwenhoek's microscopes which, he claimed, "far surpass those which we have hitherto seen". In response, in 1673 the society published a letter from Van Leeuwenhoek that included his microscopic observations on mold, bees, and lice. Then, in 1674, Van Leeuwenhoek made his most significant discovery. Starting from the assumption that life and motility are similar, he determined that the moving objects observed under his microscope were little animals. He later recorded his observations in his diary.
Van Leeuwenhoek's work fully captured the attention of the Royal Society, and he began corresponding regularly with the society regarding his observations. At first he had been reluctant to publicize his findings, regarding himself as a businessman with little scientific, artistic, or writing background, but de Graaf urged him to be more confident in his work. By the time Van Leeuwenhoek died in 1723, he had written some 190 letters to the Royal Society, detailing his findings in a wide variety of fields, centered on his work in microscopy. He only wrote letters in his own colloquial Dutch; he never published a proper scientific paper in Latin. He strongly preferred to work alone, distrusting the sincerity of those who offered their assistance. The letters were translated into Latin or English by Henry Oldenburg, who had learned Dutch for this very purpose. He was also the first to use the word animalcules to translate the Dutch words that Leeuwenhoek used to describe microorganisms. Despite the initial success of Van Leeuwenhoek's relationship with the Royal Society, soon relations became severely strained. His credibility was questioned when he sent the Royal Society a copy of his first observations of microscopic single-celled organisms dated 9 October 1676. Previously, the existence of single-celled organisms was entirely unknown. Thus, even with his established reputation with the Royal Society as a reliable observer, his observations of microscopic life were initially met with some skepticism.
Eventually, in the face of Van Leeuwenhoek's insistence, the Royal Society arranged for Alexander Petrie, minister to the English Reformed Church in Delft; Benedict Haan, at that time Lutheran minister at Delft; and Henrik Cordes, then Lutheran minister at the Hague, accompanied by Sir Robert Gordon and four others, to determine whether it was in fact Van Leeuwenhoek's ability to observe and reason clearly, or perhaps, the Royal Society's theories of life that might require reform. Finally in 1677, Van Leeuwenhoek's observations were fully acknowledged by the Royal Society.
Antonie van Leeuwenhoek was elected to the Royal Society in February 1680 on the nomination of William Croone, a then-prominent physician. Van Leeuwenhoek was "taken aback" by the nomination, which he considered a high honour, although he did not attend the induction ceremony in London, nor did he ever attend a Royal Society meeting. He had his portrait painted by Jan Verkolje with the certificate signed by James II of England on the table beside him.
Scientific fame
By the end of the seventeenth century, Van Leeuwenhoek had a virtual monopoly on microscopic study and discovery. His contemporary Robert Hooke, an early microscope pioneer, bemoaned that the field had come to rest entirely on one man's shoulders. In 1673, his first letter was published in the journal of the Royal Society of London. He was visited over the years by many notable individuals who gazed at the tiny creatures. One of the first was Jan Swammerdam. Around 1675, it was Johan Huydecoper, who was very interested in collecting and growing plants for his estate Goudestein, becoming in 1682 manager of the Hortus Botanicus Amsterdam. Christiaan Huygens, Leibniz (1676), John Locke (1678, 1685), James II of England (1679), William III of Orange, Mary II of England and Thomas Molyneux (in 1685) visited. In October 1697, Van Leeuwenhoek visited the Tsar Peter the Great on his boat, moored in the Schie or the Arsenaal. On this occasion, he presented the Tsar with an "eel-viewer", so Peter could study blood circulation whenever he wanted. In 1706, it was Govert Bidloo; in 1714, Richard Bradley (botanist); and, in 1716, Herman Boerhaave and Frederik Ruysch. To the disappointment of his guests, Van Leeuwenhoek refused to reveal the cutting-edge microscopes he relied on for his discoveries, instead showing visitors a collection of average-quality lenses.
Techniques
Antonie van Leeuwenhoek made more than 500 optical lenses. He also created at least 25 single-lens microscopes, of differing types, of which only nine have survived. These microscopes were made of silver or copper frames, holding hand-made lenses. Those that have survived are capable of magnification up to 275 times. It is suspected that Van Leeuwenhoek possessed some microscopes that could magnify up to 500 times. Although he has been widely regarded as a dilettante or amateur, his scientific research was of remarkably high quality.
The single-lens microscopes of Van Leeuwenhoek were relatively small devices, the largest being about 5 cm long. They are used by placing the lens very close in front of the eye. The other side of the microscope had a pin, where the sample was attached in order to stay close to the lens. There were also three screws to move the pin and the sample along three axes: one axis to change the focus, and the two other axes to navigate through the sample.
Van Leeuwenhoek maintained throughout his life that there are aspects of microscope construction "which I only keep for myself", in particular his most critical secret of how he made the lenses. For many years no one was able to reconstruct Van Leeuwenhoek's design techniques, but, in 1957, C.L. Stong used thin glass thread fusing instead of polishing, and successfully created some working samples of a Van Leeuwenhoek design microscope. Such a method was also discovered independently by A. Mosolov and A. Belkin at the Russian Novosibirsk State Medical Institute. In May 2021, researchers in the Netherlands published a non-destructive neutron tomography study of a Leeuwenhoek microscope. One image in particular shows a Stong/Mosolov-type spherical lens with a single short glass stem attached (Fig. 4). Such lenses are created by pulling an extremely thin glass filament, breaking the filament, and briefly fusing the filament end. The nuclear tomography article notes this lens creation method was first devised by Robert Hooke rather than Leeuwenhoek, which is ironic given Hooke's subsequent surprise at Leeuwenhoek's findings.
Van Leeuwenhoek used samples and measurements to estimate numbers of microorganisms in units of water. He also made good use of the huge advantage provided by his method. He studied a broad range of microscopic phenomena, and shared the resulting observations freely with groups such as the British Royal Society. Such work firmly established his place in history as one of the first and most important explorers of the microscopic world. Van Leeuwenhoek was one of the first people to observe cells, much like Robert Hooke. He also corresponded with Antonio Magliabechi.
Discoveries
Leeuwenhoek was one of the first to conduct experiments on himself. It was from his finger that blood was drawn for examination, and he placed pieces of his skin under a microscope, examining its structure in various parts of the body, and counting the number of vessels that permeate it.
Both Marcello Malpighi and Jan Swammerdam saw these structures before Leeuwenhoek, but Leeuwenhoek was the first to recognize what they are: red blood cells.
Infusoria (protists in modern zoological classification), in 1674
In 1675, he was studying a variety of minerals, especially salts, and parts of plants and animals.
The vacuole of the cell in 1676
Spermatozoa, in 1677
The banded pattern of muscular fibers, in 1682
Bacteria, (e.g., large Selenomonads from the human mouth), in 1683
It seems he used horseradish to find out what causes irritation on the tongue. He used the effect of vinegar.
Leeuwenhoek diligently began to search for his animalcules. He found them everywhere: in rotten water, in ditches, on his own teeth. "Although I am now fifty years old," he wrote to the Royal Society, "my teeth are well preserved, because I am in the habit of rubbing them with salt every morning." He described paradontitis.
In 1684 he published his research on the ovary.
In 1687, Van Leeuwenhoek reported his research on the coffee bean. He roasted the bean, cut it into slices and saw a spongy interior. The bean was pressed, and an oil appeared. He boiled the coffee with rain water twice and set it aside.
Leeuwenhoek corresponded regularly with Anthonie Heinsius, the Delft pensionary in the States of Holland and in 1687 member of the board of the Delft chamber of the VOC.
In 1696 Nicolaas Witsen sent him a map of Tartary and ore found near the Amur in Siberia.
Van Leeuwenhoek has been recognized as the first person to use a histological stain to color specimens observed under the microscope using saffron. He used this technique only once.
In 1702 he requested a book on Peruvian silver mines in Potosí.
Like Robert Boyle and Nicolaas Hartsoeker, Van Leeuwenhoek was interested in dried cochineal, trying to find out if the dye came from a berry or an insect.
He studied rainwater, the seeds of oranges, worms in sheep's liver, the eye of a whale, the blood of fishes, mites, coccinellidae, the skin of elephants, Celandine, and Cinchona.
Legacy and recognition
By the end of his life, Van Leeuwenhoek had written approximately 560 letters to the Royal Society and other scientific institutions concerning his observations and discoveries. Even during the last weeks of his life, Van Leeuwenhoek continued to send letters full of observations to London. The last few contained a precise description of his own illness. He suffered from a rare disease, an uncontrolled movement of the midriff, which now is named Van Leeuwenhoek's disease. He died at the age of 90, on 26 August 1723, and was buried four days later in the Oude Kerk in Delft.
In 1981, the British microscopist Brian J. Ford found that Van Leeuwenhoek's original specimens had survived in the collections of the Royal Society of London. They were found to be of high quality, and all were well preserved. Ford carried out observations with a range of single-lens microscopes, adding to our knowledge of Van Leeuwenhoek's work. In Ford's opinion, Leeuwenhoek remained imperfectly understood, the popular view that his work was crude and undisciplined at odds with the evidence of conscientious and painstaking observation. He constructed rational and repeatable experimental procedures and was willing to oppose received opinion, such as spontaneous generation, and he changed his mind in the light of evidence.
On his importance in the history of microbiology and science in general, the British biochemist Nick Lane wrote that he was "the first even to think of looking—certainly, the first with the power to see." His experiments were ingenious, and he was "a scientist of the highest calibre", attacked by people who envied him or "scorned his unschooled origins", not helped by his secrecy about his methods.
The Antoni van Leeuwenhoek Hospital in Amsterdam, named after Van Leeuwenhoek, is specialized in oncology. In 2004, a public poll in the Netherlands to determine the greatest Dutchman ("De Grootste Nederlander") named Van Leeuwenhoek the 4th-greatest Dutchman of all time.
On 24 October 2016, Google commemorated the 384th anniversary of Van Leeuwenhoek's birth with a Doodle that depicted his discovery of "little animals" or animalcules, now known as unicellular organisms.
The Leeuwenhoek Medal, Leeuwenhoek Lecture, Leeuwenhoek crater, Leeuwenhoeckia, Levenhookia (a genus in the family Stylidiaceae), Leeuwenhoekiella (an aerobic bacterial genus), and the scientific publication Antonie van Leeuwenhoek: International Journal of General and Molecular Microbiology are named after him.
As a fictional character, he appears as a flea circus owner, microscopist and magician in E.T.A. Hoffmann's novel Master Flea, together with Jan Swammerdam.
See also
Animalcule
Regnier de Graaf
Dutch Golden Age
History of microbiology
Microscopy
Microscope
Robert Hooke
Microscopic discovery of microorganisms
Microscopic scale
Science and technology in the Dutch Republic
Scientific Revolution
Nicolas Steno
Jan Swammerdam
Timeline of microscope technology
Johannes Vermeer
Notes
References
Sources
Cobb, Matthew: Generation: The Seventeenth-Century Scientists Who Unraveled the Secrets of Sex, Life, and Growth. (US: Bloomsbury, 2006)
Cobb, Matthew: The Egg and Sperm Race: The Seventeenth-Century Scientists Who Unlocked the Secrets of Sex and Growth. (London: Simon & Schuster, 2006)
Davids, Karel: The Rise and Decline of Dutch Technological Leadership: Technology, Economy and Culture in the Netherlands, 1350–1800 [2 vols.]. (Brill, 2008, )
Ford, Brian J.: Single Lens: The Story of the Simple Microscope. (London: William Heinemann, 1985, 182 pp)
Ford, Brian J.: The Revealing Lens: Mankind and the Microscope. (London: George Harrap, 1973, 208 pp)
Fournier, Marian: The Fabric of Life: The Rise and Decline of Seventeenth-Century Microscopy (Johns Hopkins University Press, 1996, )
Ratcliff, Marc J.: The Quest for the Invisible: Microscopy in the Enlightenment. (Ashgate, 2009, 332 pp)
Robertson, Lesley; Backer, Jantien et al.: Antoni van Leeuwenhoek: Master of the Minuscule. (Brill, 2016, )
Struik, Dirk J.: The Land of Stevin and Huygens: A Sketch of Science and Technology in the Dutch Republic during the Golden Century (Studies in the History of Modern Science). (Springer, 1981, 208 pp)
Wilson, Catherine: The Invisible World: Early Modern Philosophy and the Invention of the Microscope. (Princeton University Press, 1997, )
External links
to the Royal Society (archived)
The Correspondence of Anthonie van Leeuwenhoek in EMLO
Lens on Leeuwenhoek (site on Leeuwenhoek's life and observations; archived)
Vermeer connection website
University of California, Berkeley article on van Leeuwenhoek
Retrospective paper on the Leeuwenhoek research by Brian J. Ford.
Images seen through a van Leeuwenhoek microscope by Brian J. Ford.
Instructions on making a van Leeuwenhoek Microscope Replica by Alan Shinn (archived)
1632 births
1723 deaths
17th-century Dutch businesspeople
17th-century Dutch inventors
17th-century Dutch naturalists
17th-century Dutch biologists
18th-century Dutch biologists
Burials at the Oude Kerk, Delft
Dutch Calvinist and Reformed Christians
Dutch microbiologists
Fellows of the Royal Society
Microscopists
People from Delft
Protistologists
Dutch scientific instrument makers | Antonie van Leeuwenhoek | Chemistry | 4,613 |
21,085,092 | https://en.wikipedia.org/wiki/Synthetic%20Metals | Synthetic Metals is a peer-reviewed scientific journal covering electronic polymers and electronic molecular materials.
Abstracting and indexing
Synthetic Metals is abstracted and indexed in the following services:
According to the Journal Citation Reports, the journal has a 2020 impact factor of 3.266. It has published several highly cited papers (1 with ~1000 citations; 5 with >600 citations; 30 with >200 citations, according to Web of Science); most of them are devoted to conductive polymers (especially polyaniline) and one to optical properties of carbon nanotubes (see Kataura plot).
References
External links
Elsevier academic journals
English-language journals
Semi-monthly journals
Academic journals established in 1985
Materials science journals | Synthetic Metals | Materials_science,Engineering | 143 |
24,203,217 | https://en.wikipedia.org/wiki/Fail-stop | A fail-stop subset of a computer language is one that has the same semantics as the original, except in the case where an exceptional condition arises. The fail-stop subset must report an exceptional condition whenever the superset language reports one, but may additionally report an exceptional condition in other cases.
Fail-stop languages are often used in computer systems where correctness is very important, since it is easier to make such systems fail-fast. For example, the "+" operator in many programming languages is not associative because of the possibility of floating-point overflow. Repairing these languages to fail fast when commonly assumed properties do not hold makes it much easier to write and verify correct code.
Examples
In many widely used programming languages the code below might reduce the bank account value if the deposited amount or old account value is very large, by causing an overflowed value to be assigned to new_bank_account_value.
new_bank_account_value = old_bank_account_value + amount_deposited
// example calculation with 32-bit signed integers to demonstrate, which overflow above 2,147,483,647
// -2,147,483,646 = 2,147,483,640 + 10
But in a fail-stop language that treats overflow as an exceptional condition, it is either correct, or will terminate with an exceptional condition.
See also
Exception handling
Fail-safe
Fault-tolerant
Bottom type
Software engineering terminology
Computer security | Fail-stop | Technology,Engineering | 304 |
63,915,998 | https://en.wikipedia.org/wiki/Nico%20van%20der%20Vegt | Nico van der Vegt (born 1970 in Raalte) is a Dutch chemist and a professor for computational physical chemistry at Technische Universität Darmstadt.
Academic career
Van der Vegt studied chemical engineering and received his PhD from the University of Twente in 1998 on a study of methods for calculating thermodynamic and transport properties of small molecules in polymer membranes based on computer simulations. From 1998 to 2002, he was a lecturer at the University of Twente. Following this, he worked as a postdoctoral researcher at ETH Zürich with Wilfred F. van Gunsteren from 2002 to 2003. He then led a research group at the Max Planck Institute for Polymer Research, Mainz, Germany. In 2009, he was appointed as a full professor for computational physical chemistry at the Technische Universität Darmstadt.
Research
His main research interests center on the thermodynamics and statistical mechanics of liquids and soft matter systems. His work includes studies on the physical fundamentals and thermodynamics of aqueous solvation, including cosolvent and salt effects on the water solubility of macromolecules and the stability of proteins. To this end, he works on the development of intermolecular potential models and computational methods for atomistic and coarse-grained molecular dynamics simulations of liquids, polymers, and biological materials. (ResearcherID: B-3441-2010).
References
External links
Website Van der Vegt Group
Website Department of Chemistry TU Darmstadt
Living people
1970 births
People from Raalte
Dutch physical chemists
21st-century Dutch chemists
20th-century Dutch chemists
Academic staff of Technische Universität Darmstadt
Dutch expatriates in Germany
Max Planck Institute for Polymer Research people
Computational chemists
Dutch expatriates in Switzerland
University of Twente alumni | Nico van der Vegt | Chemistry | 373 |
20,362,577 | https://en.wikipedia.org/wiki/Tesetaxel | Tesetaxel is an orally administered taxane being investigated as a chemotherapy agent for various types of cancer, including breast cancer, gastric cancer, colorectal cancer, and other solid tumors. It differs from other members of the taxane class (e.g. paclitaxel or docetaxel) in that it is administered orally, not intravenously.
References
Mitotic inhibitors
Benzoate esters
Carbamates
Pyridines
Organofluorides
Ketones
Acetate esters
Taxanes
Tert-butyl compounds | Tesetaxel | Chemistry | 116 |
9,837 | https://en.wikipedia.org/wiki/Ethylene | Ethylene (IUPAC name: ethene) is a hydrocarbon which has the formula or . It is a colourless, flammable gas with a faint "sweet and musky" odour when pure. It is the simplest alkene (a hydrocarbon with carbon–carbon double bonds).
Ethylene is widely used in the chemical industry, and its worldwide production (over 150 million tonnes in 2016) exceeds that of any other organic compound. Much of this production goes toward creating polythene, which is a widely used plastic containing polymer chains of ethylene units in various chain lengths. Production emits greenhouse gases, including methane from feedstock production and carbon dioxide from any non-sustainable energy used.
Ethylene is also an important natural plant hormone and is used in agriculture to induce ripening of fruits. The hydrate of ethylene is ethanol.
Structure and properties
This hydrocarbon has four hydrogen atoms bound to a pair of carbon atoms that are connected by a double bond. All six atoms that comprise ethylene are coplanar. The H-C-H angle is 117.4°, close to the 120° for ideal sp² hybridized carbon. The molecule is also relatively weak: rotation about the C-C bond is a very low energy process that requires breaking the π-bond by supplying heat at 50 °C.
The π-bond in the ethylene molecule is responsible for its useful reactivity. The double bond is a region of high electron density, thus it is susceptible to attack by electrophiles. Many reactions of ethylene are catalyzed by transition metals, which bind transiently to the ethylene using both the π and π* orbitals.
Being a simple molecule, ethylene is spectroscopically simple. Its UV-vis spectrum is still used as a test of theoretical methods.
Uses
Major industrial reactions of ethylene include in order of scale: 1) polymerization, 2) oxidation, 3) halogenation and hydrohalogenation, 4) alkylation, 5) hydration, 6) oligomerization, and 7) hydroformylation. In the United States and Europe, approximately 90% of ethylene is used to produce ethylene oxide, ethylene dichloride, ethylbenzene and polyethylene. Most of the reactions with ethylene are electrophilic addition.
Polymerization
Polyethylene production uses more than half of the world's ethylene supply. Polyethylene, also called polyethene and polythene, is the world's most widely used plastic. It is primarily used to make films in packaging, carrier bags and trash liners. Linear alpha-olefins, produced by oligomerization (formation of short-chain molecules) are used as precursors, detergents, plasticisers, synthetic lubricants, additives, and also as co-monomers in the production of polyethylenes.
Oxidation
Ethylene is oxidized to produce ethylene oxide, a key raw material in the production of surfactants and detergents by ethoxylation. Ethylene oxide is also hydrolyzed to produce ethylene glycol, widely used as an automotive antifreeze as well as higher molecular weight glycols, glycol ethers, and polyethylene terephthalate.
Ethylene oxidation in the presence of a palladium catalyst can form acetaldehyde. This conversion remains a major industrial process (10M kg/y). The process proceeds via the initial complexation of ethylene to a Pd(II) center.
Halogenation and hydrohalogenation
Major intermediates from the halogenation and hydrohalogenation of ethylene include ethylene dichloride, ethyl chloride, and ethylene dibromide. The addition of chlorine entails "oxychlorination", i.e. chlorine itself is not used. Some products derived from this group are polyvinyl chloride, trichloroethylene, perchloroethylene, methyl chloroform, polyvinylidene chloride and copolymers, and ethyl bromide.
Alkylation
Major chemical intermediates from the alkylation with ethylene is ethylbenzene, precursor to styrene. Styrene is used principally in polystyrene for packaging and insulation, as well as in styrene-butadiene rubber for tires and footwear. On a smaller scale, ethyltoluene, ethylanilines, 1,4-hexadiene, and aluminium alkyls. Products of these intermediates include polystyrene, unsaturated polyesters and ethylene-propylene terpolymers.
Oxo reaction
The hydroformylation (oxo reaction) of ethylene results in propionaldehyde, a precursor to propionic acid and n-propyl alcohol.
Hydration
Ethylene has long represented the major nonfermentative precursor to ethanol. The original method entailed its conversion to diethyl sulfate, followed by hydrolysis. The main method practiced since the mid-1990s is the direct hydration of ethylene catalyzed by solid acid catalysts:
C2H4 + H2O → CH3CH2OH
Dimerization to butenes
Ethylene is dimerized by hydrovinylation to give n-butenes using processes licensed by Lummus or IFP. The Lummus process produces mixed n-butenes (primarily 2-butenes) while the IFP process produces 1-butene. 1-Butene is used as a comonomer in the production of certain kinds of polyethylene.
Fruit and flowering
Ethylene is a hormone that affects the ripening and flowering of many plants. It is widely used to control freshness in horticulture and fruits. The scrubbing of naturally occurring ethylene delays ripening. Adsorption of ethylene by nets coated in titanium dioxide gel has also been shown to be effective.
Niche uses
An example of a niche use is as an anesthetic agent (in an 85% ethylene/15% oxygen ratio). Another use is as a welding gas. It is also used as a refrigerant gas for low temperature applications under the name R-1150.
Production
Global ethylene production was 107 million tonnes in 2005, 109 million tonnes in 2006, 138 million tonnes in 2010, and 141 million tonnes in 2011. By 2013, ethylene was produced by at least 117 companies in 32 countries. To meet the ever-increasing demand for ethylene, sharp increases in production facilities are added globally, particularly in the Mideast and in China. Production emits greenhouse gas, namely significant amounts of carbon dioxide.
Industrial process
Ethylene is produced by several methods in the petrochemical industry. A primary method is steam cracking (SC) where hydrocarbons and steam are heated to 750–950 °C. This process converts large hydrocarbons into smaller ones and introduces unsaturation. When ethane is the feedstock, ethylene is the product. Ethylene is separated from the resulting mixture by repeated compression and distillation. In Europe and Asia, ethylene is obtained mainly from cracking naphtha, gasoil and condensates with the coproduction of propylene, C4 olefins and aromatics (pyrolysis gasoline). Other technologies employed for the production of ethylene include Fischer-Tropsch synthesis and methanol-to-olefins (MTO).
Laboratory synthesis
Although of great value industrially, ethylene is rarely synthesized in the laboratory and is ordinarily purchased. It can be produced via dehydration of ethanol with sulfuric acid or in the gas phase with aluminium oxide or activated alumina.
Biosynthesis
Ethylene is produced from methionine in nature. The immediate precursor is 1-aminocyclopropane-1-carboxylic acid.
Ligand
Ethylene is a fundamental ligand in transition metal alkene complexes. One of the first organometallic compounds, Zeise's salt is a complex of ethylene. Useful reagents containing ethylene include Pt(PPh3)2(C2H4) and Rh2Cl2(C2H4)4. The Rh-catalysed hydroformylation of ethylene is conducted on an industrial scale to provide propionaldehyde.
History
Some geologists and scholars believe that the famous Greek Oracle at Delphi (the Pythia) went into her trance-like state as an effect of ethylene rising from ground faults.
Ethylene appears to have been discovered by Johann Joachim Becher, who obtained it by heating ethanol with sulfuric acid; he mentioned the gas in his Physica Subterranea (1669). Joseph Priestley also mentions the gas in his Experiments and observations relating to the various branches of natural philosophy: with a continuation of the observations on air (1779), where he reports that Jan Ingenhousz saw ethylene synthesized in the same way by a Mr. Enée in Amsterdam in 1777 and that Ingenhousz subsequently produced the gas himself. The properties of ethylene were studied in 1795 by four Dutch chemists, Johann Rudolph Deimann, Adrien Paets van Troostwyck, Anthoni Lauwerenburgh and Nicolas Bondt, who found that it differed from hydrogen gas and that it contained both carbon and hydrogen. This group also discovered that ethylene could be combined with chlorine to produce the Dutch oil, 1,2-dichloroethane; this discovery gave ethylene the name used for it at that time, olefiant gas (oil-making gas.) The term olefiant gas is in turn the etymological origin of the modern word "olefin", the class of hydrocarbons in which ethylene is the first member.
In the mid-19th century, the suffix -ene (an Ancient Greek root added to the end of female names meaning "daughter of") was widely used to refer to a molecule or part thereof that contained one fewer hydrogen atoms than the molecule being modified. Thus, ethylene () was the "daughter of ethyl" (). The name ethylene was used in this sense as early as 1852.
In 1866, the German chemist August Wilhelm von Hofmann proposed a system of hydrocarbon nomenclature in which the suffixes -ane, -ene, -ine, -one, and -une were used to denote the hydrocarbons with 0, 2, 4, 6, and 8 fewer hydrogens than their parent alkane. In this system, ethylene became ethene. Hofmann's system eventually became the basis for the Geneva nomenclature approved by the International Congress of Chemists in 1892, which remains at the core of the IUPAC nomenclature. However, by that time, the name ethylene was deeply entrenched, and it remains in wide use today, especially in the chemical industry.
Following experimentation by Luckhardt, Crocker, and Carter at the University of Chicago, ethylene was used as an anesthetic. It remained in use through the 1940s use even while chloroform was being phased out. Its pungent odor and its explosive nature limit its use today.
Nomenclature
The 1979 IUPAC nomenclature rules made an exception for retaining the non-systematic name ethylene; however, this decision was reversed in the 1993 rules, and it remains unchanged in the newest 2013 recommendations, so the IUPAC name is now ethene. In the IUPAC system, the name ethylene is reserved for the divalent group -CH2CH2-. Hence, names like ethylene oxide and ethylene dibromide are permitted, but the use of the name ethylene for the two-carbon alkene is not. Nevertheless, use of the name ethylene for H2C=CH2 (and propylene for H2C=CHCH3) is still prevalent among chemists in North America.
Greenhouse gas emissions
"A key factor affecting petrochemicals life-cycle emissions is the methane intensity of feedstocks, especially in the production segment." Emissions from cracking of naptha and natural gas (common in the US as gas is cheap there) depend a lot on the source of energy (for example gas burnt to provide high temperatures) but that from naptha is certainly more per kg of feedstock. Both steam cracking and production from natural gas via ethane are estimated to emit 1.8 to 2kg of CO2 per kg ethylene produced, totalling over 260 million tonnes a year. This is more than all other manufactured chemicals except cement and ammonia. According to a 2022 report using renewable or nuclear energy could cut emissions by almost half.
Safety
Like all hydrocarbons, ethylene is a combustible asphyxiant. It is listed as an IARC group 3 agent, since there is no current evidence that it causes cancer in humans.
See also
RediRipe, an ethylene detector for fruits.
References
External links
International Chemical Safety Card 0475
MSDS
Alkenes
General anesthetics
Monomers
Commodity chemicals
Petrochemicals
Industrial gases
Greenhouse gases
Organic compounds with 2 carbon atoms | Ethylene | Chemistry,Materials_science,Environmental_science | 2,831 |
65,460,149 | https://en.wikipedia.org/wiki/Ovorubin | Ovorubin (PcOvo or PcPV1) is the most abundant perivitellin (>60 % total protein) of the perivitelline fluid from Pomacea canaliculata snail eggs. This glyco-lipo-caroteno protein complex is a approx. 300 kDa multimer of a combination of multiple copies of six different ~30 kDa subunits.
Together with the other perivitellins from Pomacea canaliculata eggs, ovorubin serves a nutrient source for developing embryos, notably to the intermediate and late stages. Moreover, after hatching, the protein is still detected in the lumen of the digestive gland ready to be endocytosed, therefore, acting as a nutrient source for the newly hatched snail.
Ovorubin contains carbohydrates and carotenoid pigments as main prosthetic groups, which are related to many physiological roles on Pomacea aerial egg-laying strategy. Given that carbohydrates tend to retain water, the high glycosylation of ovorubin (~17 % w/w) was proposed as an embryo defense against water loss. The carotenoid pigments stabilized by ovorubin also provide the eggs of antioxidant and photoprotective capacities, crucial roles to cope with the harsh conditions of the aerial environment. The presence of carotenoid pigments is also responsible for the brightly reddish coloration of Ovorubin, and therefore snail eggs, which was related to a warning coloration (aposematism) advertising predators about the presence of deterrents. In fact, field evidence of egg unpalatability is provided by the fact that most animals foraging in habitats where the apple snails live ignore these eggs.
Like most other studied perivitellins from Pomacea snails, ovorubin is highly stable in a wide range of pH values and withstands gastrointestinal digestion, characteristics associated with an antinutritive defense system that deters predation by lowering the nutritional value of the eggs.
References
Proteins | Ovorubin | Chemistry | 437 |
12,805,720 | https://en.wikipedia.org/wiki/CMN-GOMS | CMN-GOMS stands for Card, Moran and Newell GOMS. CMN-GOMS is the original version of the GOMS technique in human computer interaction. It takes the name after its creators Stuart Card, Thomas P. Moran and Allen Newell who first described GOMS in their 1983 book The Psychology of Human Computer Interaction.
Overview
This technique requires a strict goal-method-operation-selection rules structure. The structure is rigid enough that the evaluator represents the tasks in a pseudo-code format (no formal syntax is dictated). It also provides a guide for how to formulate selection rules. This method can also be used to estimate the load the task places on the user. For instance, examining the number of levels down the task-tree that a goal branch is can be used to estimate the memory demand the task places on the system. The process must remember information about all of the levels above the current branch.
This technique is more flexible than the Keystroke-Level Model (KLM) because the pseudo-code is in a general form. That is, it can be executed for different scenarios by going down different branches, while KLM's procedure is a simple list that has to be recreated for each different task.
Example of a simple goal
Deleting a file in Windows Explorer (NOTE: not all goals are fully expanded in this example).
GOAL: DELETE-FILE
. GOAL: SELECT-FILE
. . [select: GOAL: KEYBOARD-TAB-METHOD
. . GOAL: MOUSE-METHOD]
. . VERIFY-SELECTION
. GOAL: ISSUE-DELETE-COMMAND
. . [select*: GOAL: KEYBOARD-DELETE-METHOD
. . . PRESS-DELETE
. . . GOAL: CONFIRM-DELETE
. . GOAL: DROP-DOWN-MENU-METHOD
. . . MOVE-MOUSE-OVER-FILE-ICON
. . . CLICK-RIGHT-MOUSE-BUTTON
. . . LOCATE-DELETE-COMMAND
. . . MOVE-MOUSE-TO-DELETE-COMMAND
. . . CLICK-LEFT-MOUSE-BUTTON
. . . GOAL: CONFIRM-DELETE
. . GOAL: DRAG-AND-DROP-METHOD
. . . MOVE-MOUSE-OVER-FILE-ICON
. . . PRESS-LEFT-MOUSE-BUTTON
. . . LOCATE-RECYCLING-BIN
. . . MOVE-MOUSE-TO-RECYCLING-BIN
. . . RELEASE-LEFT-MOUSE-BUTTON]
*Selection rule for GOAL: ISSUE-DELETE-COMMAND
If hands are on keyboard, use KEYBOARD-DELETE-METHOD,
else if Recycle bin is visible, use DRAG-AND-DROP-METHOD,
else use DROP-DOWN-MENU-METHOD
See also
Human information processor model
CPM-GOMS
KLM-GOMS
NGOMSL
References
Notations
This article incorporates text from Dr. G. Abowd: GOMS Analysis Techniques - Final Essay, which has been released into GFDL by its author).
Footnotes
Human–computer interaction | CMN-GOMS | Engineering | 610 |
28,378,964 | https://en.wikipedia.org/wiki/Reeding | Reeding or milling is a technique wherein a number of narrow ridges called "reeds" are carved or milled into a surface with a castaing machine.
Numismatics
In numismatics, reeded edges are often referred to as "ridged" or "grooved" (American usage), or "milled" (British usage). Some coins, such as United States quarters and dimes, 1 euro, Australian 5, 10, 20 cents, 1 and 2 dollars, as well many other current coins, have reeded edges.
One reason for having reeded edges was to prevent counterfeiting. Some gold and silver coins were reeded to discourage clipping, i.e. scraping off the precious metals from the edge of the coin, to maintain its stated value in precious metal. This practice was made more difficult through the implementation of reeding by Isaac Newton in 1698, during his time as warden of the Royal Mint.
Another benefit of certain coins having reeded edges is that it helps the visually impaired identify different coin denominations by sense of touch alone.
This dual purpose of reeding is sometimes made explicit on the milled edges of coins themselves. For example, many issuances of the British pound coin have historically had their edges inscribed with the Latin phrase '', an adaption from Vergilius' Aeneid meaning 'an ornament and a safeguard'.
Furniture
In furniture, reeding is sometimes used around bedposts, and the legs of tables and chairs. Its use in this fashion was inspired by Greek and Roman architectural styles, and is the opposite of fluting.
Architecture
In architecture, reeding is a form of molding usually found on columns, and is sometimes considered to be synonymous with gadrooning.
See also
Knurling
Milled coinage
Spline (mechanical)
References
Architectural elements
Numismatics
Woodworking
Metalworking
Metal forming
Accessibility | Reeding | Technology,Engineering | 388 |
9,774,878 | https://en.wikipedia.org/wiki/Beale%20code | In geography and demography, a Beale code is the Rural-Urban Continuum Coding system originally developed by David L. Brown and later popularized by Calvin Beale at the United States Department of Agriculture in 1975. The Beale code system now is used by many other countries, such as Canada.
References
Demography | Beale code | Environmental_science | 61 |
48,461,396 | https://en.wikipedia.org/wiki/Sofia%20Romanskaya | Sofia Romanskaya (1886–1969) was a Soviet astronomer known as one of the first Russian women to have a significant role in the field.
Biography
Sofia (also spelled Sofya) Vasilievna Voroshilova-Romanskaya was born in St. Petersburg. She graduated from the Bestuzhev Courses, a prominent women's educational institution in the Russian Empire.
Romanskaya worked at the Pulkovo Observatory from 1908 to 1959. There, she carried out over 20,000 latitude observations in her studies of polar motion. She was a member of the International Astronomical Union and attended the organization's 1958 General Assembly in Moscow.
The asteroid (3761) Romanskaya, discovered by Grigory Neujmin in 1936, was named after her. A crater on planet Venus also bears her name.
References
1886 births
1969 deaths
Women astronomers
Soviet astronomers
Russian astronomers
Soviet women scientists
20th-century Russian astronomers
20th-century Russian women scientists | Sofia Romanskaya | Astronomy | 194 |
21,177,022 | https://en.wikipedia.org/wiki/Journal%20of%20Communications | Journal of Communications is a scholarly peer-reviewed scientific journal published monthly, focusing on theories, systems, methods, algorithms, and applications in communications. It was initially published by Academy Publisher, based in Oulu, Finland, but since 2013 has been published by Engineering and Technology Publishing (ETP), of San Jose, California. ETP was listed on Beall's list before it was taken down in 2017.
The journal is indexed by Scopus, INSPEC, and Communication Abstracts.
References
Electrical and electronic engineering journals
Open access journals
Academic journals established in 2006
Monthly journals
English-language journals | Journal of Communications | Engineering | 122 |
55,263,320 | https://en.wikipedia.org/wiki/Eduardo%20Fradkin | Eduardo Hector Fradkin (born February 21, 1950) is an Argentinian theoretical physicist known for working in various areas of condensed matter physics, primarily using quantum field theoretical approaches. He is a Donald Biggar Willett Professor of Physics at the University of Illinois at Urbana–Champaign, where he is the director of the Institute for Condensed Matter Theory,
and is the author of the books Quantum Field Theory: An Integrated Approach and Field Theories of Condensed Matter Physics.
Education and career
Fradkin earned a master's degree from the University of Buenos Aires. He completed his doctorate from Stanford University in 1979, under the supervision of Leonard Susskind, and came to Illinois faculty as a postdoctoral researcher with Gordon Baym and Michael Wortis, later staying on as an assistant professor.
Research
Fradkin has worked in many areas in theoretical condensed matter physics and is notably broad and versatile in his research topics. Among his most researched areas in condensed matter include the fractional quantum Hall systems and high-temperature superconductivity. He is considered one of the earliest proponents of, and one of the leading figures in, using quantum field theoretical concepts and methods in condensed matter physics, and is well known for popularizing such approaches through his early book Field Theories of Condensed Matter Physics (1st ed. Addison Wesley) in 1991.
In his doctoral work at Stanford, he made major contributions to lattice gauge theories, where his results (separately with Stephen Shenker, and Leonard Susskind) have, among other things, had far-reaching applications and implications to two-dimensional quantum spin liquids and other topologically ordered phases in two-dimensional lattices. He has done many important works in the area of fractional quantum Hall physics, in which he gave the first fermionic Chern-Simons field theory for the effect, described various field theories for non-Abelian fractional quantum Hall states (with Chetan Nayak and others), quantum Hall edge physics and, more recently, theories for describing nematicity and geometry in the fractional quantum Hall regime. One of his most influential works has been the introduction and elucidation of the powerful new paradigm in quantum many-body physics of electronic liquid crystalline phases in various strongly correlated systems (with Steven Kivelson and Victor Emery), in particular in quantum Hall systems and high-temperature superconductors, and, more recently in this area, elucidation of the notion and significance of "intertwined orders" in the context of cuprate high-temperature superconductors and more generally in strongly correlated systems (with Steven Kivelson and John Tranquada). He has also made important contributions to the physics of quantum dimer models (partly with Shivaji Sondhi and others), models for unconventional quantum phase transitions involving topologically ordered phases (with Paul Fendley and others), and quantum entanglement properties of these and related problems. He also gave one of the earliest approaches to higher dimensional bosonization of fermionic field theories (with Fidel Schaposnik) as well as two-dimensional Fermi surfaces (with his then student Antonio Castro-Neto) and has later applied them to important problems in condensed matter. Some of his other important works in recent times that have not already been mentioned above include a graph-theoretic lattice discretization scheme for Chern-Simons theories and its applications to condensed matter problems, and novel field theoretic approaches to describe fractional topological insulators.
Awards and honors
In 1998, he was awarded the Guggenheim fellowship. In 2013 he was elected to the National Academy of Sciences.
He is also a fellow of the American Academy of Arts and Sciences and of the American Physical Society. In 2024 he was awarded the Eugene Feenberg Memorial Medal "for pioneering applications of quantum field theory to the understanding of emergent, many-body physics of quantum systems, in particular composite fermions, and electronic liquid crystalline and pair density wave phases of correlated electronic systems."
References
External links
Homepage
Living people
Theoretical physicists
21st-century American physicists
Argentine physicists
University of Buenos Aires alumni
Stanford University alumni
University of Illinois Urbana-Champaign faculty
Members of the United States National Academy of Sciences
Fellows of the American Academy of Arts and Sciences
Fellows of the American Physical Society
1950 births | Eduardo Fradkin | Physics | 876 |
23,432,471 | https://en.wikipedia.org/wiki/C6H14N4O2 | {{DISPLAYTITLE:C6H14N4O2}}
The molecular formula C6H14N4O2 (molar mass: 174.20 g/mol, exact mass: 174.1117 u) may refer to:
Adipic acid dihydrazide (ADH)
Arginine (Arg or R)
Isobutylidenediurea (IBDU) | C6H14N4O2 | Chemistry | 87 |
612,837 | https://en.wikipedia.org/wiki/Qin%20Jiushao | Qin Jiushao (, ca. 1202–1261), courtesy name Daogu (道古), was a Chinese mathematician, meteorologist, inventor, politician, and writer. He is credited for discovering Horner's method as well as inventing Tianchi basins, a type of rain gauge instrument used to gather meteorological data.
Biography
Although Qin Jiushao was born in Ziyang, Sichuan, his family came from Shandong province. He is regarded as one of the greatest mathematicians in Chinese history. This is especially remarkable because Qin did not devote his life to mathematics. He was accomplished in many other fields and held a series of bureaucratic positions in several Chinese provinces.
Qin wrote Shùshū Jiǔzhāng ("Mathematical Treatise in Nine Sections") in 1247 CE. This treatise covered a variety of topics including indeterminate equations and the numerical solution of certain polynomial equations up to 10th order, as well as discussions on military matters and surveying. In the treatise Qin included a general form of the Chinese remainder theorem that used Da yan shu (大衍术) or algorithms to solve it. In geometry, he discovered "Qin Jiushao's formula" for finding the area of a triangle from the given lengths of three sides. This formula is the same as Heron's formula, proved by Heron of Alexandria about 60 BCE, though knowledge of the formula may go back to Archimedes.
As precipitation was important agriculture and food production, Qin developed precipitation gauges that was widely used in 1247 during the Mongol Empire/Southern Song dynasty to gather meteorological data. Qin Jiushao later records the application of rainfall measurements in the mathematical treatise. The book also discusses the use of large snow gauges made from bamboo situated in mountain passes and uplands which are speculated to be first referenced to snow measurement.
Qin recorded the earliest explanation of how Chinese calendar experts calculated astronomical data according to the timing of the winter solstice. Among his accomplishments are the introduction techniques for solving certain types of algebraic equations using a numerical algorithm (equivalent to the 19th century Horner's method) and for finding sums of arithmetic series. He also introduced the use of the zero symbol into written Chinese mathematics.
After he completed his work on mathematics, he ventured into politics. As a government official he was boastful, corrupt, and was accused of bribery and of poisoning his enemies. As a result, he was relieved of his duties multiple times. Yet in spite of these problems he managed to become very wealthy (Katz, 1993).
Main work
Shushu Jiuzhang (Mathematical Treatise in Nine Sections) (1248)
References
Bibliography
Guo, Shuchun. Encyclopedia of China (Mathematics Volume), 1st ed.
Qin Jiushao, . (Chinese History Timeline), 2007.
Ulrich Libbrecht: Chinese Mathematics in the Thirteenth Century (The Shu-Shu-Chiu-Chang of Chin Chiu shao) Dover Publication
Victor J. Katz "A history of mathematics: an introduction." New York (1993).
External links
Simon Fraser University biography for "Qin Jiushao"
1200s births
1261 deaths
13th-century Chinese mathematicians
13th-century Chinese writers
Chinese inventors
Chinese meteorologists
Medieval Chinese mathematicians
Number theorists
Politicians from Ziyang
Scientists from Sichuan
Song dynasty government officials
Song dynasty science writers
Writers from Ziyang | Qin Jiushao | Mathematics | 676 |
11,145,095 | https://en.wikipedia.org/wiki/Subcarrier%20multiplexing | Subcarrier Multiplexing (SCM) is a method for combining (multiplexing) many different communications signals so that they can be transmitted along a single optical fiber. SCM (also known as SCMA, SubCarrier Multiple Access) is used in passive optical network (PON) access infrastructures as a variant of wavelength division multiplexing (WDM).
SCM follows a different approach compared to WDM. In WDM an optical carrier is modulated with a baseband signal of typically hundred of Mbit/s. In an SCMA infrastructure, the baseband data is first modulated on a GHz wide subcarrier, that is subsequently modulated on the optical carrier. This way each signal occupies a different portion of the optical spectrum surrounding the centre frequency of the optical carrier. At the receiving side, as normally happens in a commercial radio service, the receiver is tuned to the correct subcarrier frequency, filtering out the other subcarriers.
The operation of multiplexing and demultiplexing the single subcarriers is carried out electronically. The conversion into the optical carrier is done at the multiplexer side. This gives an advantage over a pure WDM access, due to the lower cost of the electrical components if compared with an optical multiplexer.
SCM has the disadvantage of being limited in maximum subcarrier frequencies and data rates by the available bandwidth of the electrical and optical components. Therefore, SCM must be used in conjunction with WDM in order to take advantage of most of the available fiber bandwidth, but it can be used effectively for lower-speed, lower-cost multiuser systems.
References
External links
WDM - Wavelength Division Multiplexing
Subcarrier Multiplexing for High-Speed Optical Transmission
Multiplexing
Digital television
Digital radio
Broadcast engineering
Physical layer protocols | Subcarrier multiplexing | Engineering | 368 |
1,000,690 | https://en.wikipedia.org/wiki/Jacksonville%20University | Jacksonville University (JU) is a private university in Jacksonville, Florida, United States. Located in the city's Arlington district, the school was founded in 1934 as a two-year college and was known as Jacksonville Junior College until September 5, 1956, when it shifted focus to building four-year university degree programs and later graduated its first four-year degree candidates as Jacksonville University in June 1959. It is a member of the Independent Colleges and Universities of Florida and is accredited by the Southern Association of Colleges and Schools (SACS) and the Association to Advance Collegiate Schools of Business (AACSB). JU's student body currently represents more than 40 U.S. states and approximately 45 countries around the world. As a Division I institution, it fields 18 varsity athletics teams, known as the JU Dolphins, as well as intramural sports and clubs. Among the top majors declared by JU students are aviation management, biology, nursing, business, and marine science.
History
The school was founded in 1934 by William J. Porter. Originally known as William J. Porter University, it began as a private two-year college. Since a permanent site had not yet been acquired, classes were held on the third floor auditorium of the First Baptist Church Educational Building in downtown Jacksonville. Sixty students were enrolled in Porter University's first year of operation.
The school changed its name to Jacksonville Junior College in 1935. It relocated three times over the next fifteen years, including a period in the Florida Theatre building, but the influx of GI bill students following the end of World War II made it necessary for the school to find a permanent location. In 1947 the administration purchased land in Jacksonville's Arlington neighborhood on which to establish the current campus. The first building was completed in 1950 and classes officially began. The same year the school received full accreditation as a two-year college from the Southern Association of Colleges and Schools (SACS).
In 1958 Jacksonville Junior College merged with the Jacksonville College of Music, and the name was changed to Jacksonville University. In 1959 the first four-year class of 100 students graduated, and in 1961 JU received full accreditation as a four-year school from SACS. The 1960s saw the university grow substantially as enrollment increased, dormitories were built, two new colleges were established and the Swisher Gymnasium was constructed. The first student dormitories (Williams, McGehee, Brest, Merrill and Grether Halls) opened for the fall semester of 1965 on the south part of campus for a combined total of $2.4 million. The sixth dormitory, Botts Hall, opened in 1968. In 1970 the Jacksonville University Dolphins men's basketball team, under star center Artis Gilmore, went to the NCAA Division I Championship. However, the opening of the public University of North Florida in 1972 eroded JU's enrollment, while the removal of public funding hurt the school financially. In the 1990s Jacksonville University reconfigured itself as primarily a liberal arts college and embarked on a substantial fundraising campaign, which provided for the construction of new buildings and a revision of the campus master plan. In 1997 a new cafeteria was constructed, a Visual Arts Annex opened, and the on-campus Villages Apartments finished construction and opened for students on the north part of campus. Merrill and Grether Hall were demolished in 2007 to make way for Oak Hall, a modern 500-bed dormitory, and a new parking garage.
George Hallam, in conjunction with Jacksonville University and its library staff, published an extensive history of the university titled Our Place in the Sun, which details the development and progress of the institution between its inception in 1934 through the spring of 1988. Other university publications which have chronicled JU history throughout the decades include the JU Navigator, the Riparian, and The Wave magazine.
Academics
Jacksonville University offers more than 100 majors, minors, and programs at the undergraduate level, as well as 23 master's and doctorate degree programs, leading to the M.S., M.A., M.A.T., and Master of Business Administration, Doctor of Occupational Therapy (OTD), and Doctor of Nursing Practice (DNP).
The university is divided into five colleges: the College of Arts and Sciences, the Davis College of Business & Technology, the College of Fine Arts & Humanities, the College of Law, and the Brooks Rehabilitation College of Healthcare Sciences. Along with the five colleges, the university also consists of three institutes: the Marine Science Research Institute, the Public Policy Institute, and the STEAM Institute.
The College of Arts and Sciences offers a traditional liberal arts education and includes JU's School of Education, Wilma's Little People School, Science and Mathematics, Social Sciences, Humanities, and the Naval Reserve Officer Training Corps (NROTC). JU has the second-largest Naval Reserve Officer Training Corps program in the nation and the longest-running in Florida. Jacksonville is a military- and veteran-friendly town, and is home to three major military installations. It is also an approved Yellow Ribbon School and is home to the Jacksonville University Veterans and Military Resource Center (VMRC). University staff and administration includes many distinguished veterans from multiple branches of the U.S. military.
The College of Fine Arts & Humanities, with its integrated Alexander Brest Museum and Gallery, is one of the longest-standing colleges in JU history. Undergraduate programs include dance, theatre, music, and visual arts. Graduate programs are available in choreography and visual arts. The College of Fine Arts' annual artist series is open to the public and offers more than 20 concerts, events and exhibitions per season.
The Davis College of Business & Technology (DCOBT) received its AACSB accreditation in January 2010, and is the only private, AACSB-accredited business school in North Florida. DCOBT offers both MBA and EMBA degrees, along with undergraduate business degrees in accounting, aviation management, aviation management & flight operations, business administration, business analytics, business information systems, economics, finance, international business, management, marketing, and sport business. In both 2017 and 2018, the school's CFA Research Challenge team won the CFA Institute Research Challenge in Florida, beating out schools such as University of Miami and University of Florida, and went on to compete nationally. In 2018 they won the national competition and competed as finalists in the global CFA Institute Research Challenge in Kuala Lumpur, Malaysia. Jacksonville University has also teamed up with the Florida Coastal School of Law to offer a joint MBA/law degree, and joined forces with Aerosim Flight Academy to provide professional flight training to students of its ever-popular aviation major.
The inaugural class of Jacksonville University College of Law occurred in August 2022 with fourteen students. Twenty-six students joined the next year. Provisional accreditation was granted to the school by the American Bar Association during that organization's February 22–23, 2024 meeting.
The JU Flight Team competes in National Intercollegiate Flying Association Regional and National Safety and Flight Evaluation Conference (SAFECON) against other universities, with its best team performance in 2007. The program is the third largest in the nation, behind Spartan School in Tulsa, Oklahoma and the Embry-Riddle Aeronautical University in Daytona Beach. The team placed 10th in the nation at the National Intercollegiate Flying Association. In 2008, the team was awarded the Loening Trophy, which is given to the best collegiate aviation program in the country each year. It is currently on display in the Smithsonian in Washington, DC.
The Brooks Rehabilitation College of Healthcare Sciences (BRCHS), includes the School of Orthodontics and one of JU's many premier learning environments, the Simulation Training and Applied Research (STAR) Center where students can participate in simulations of everything from childbirth to wound care.
The university's BRCHS program offers Bachelor of Science in Kinesiology, Bachelor of Science in Nursing, and a Master of Science in Nursing degree, among many other degree programs and certifications. In 2014, Jacksonville University partnered with Brooks Rehabilitation Hospital to create the Brooks Rehabilitation Speech-Language Pathology program. BRCHS is affiliated with hundreds of local healthcare partners, including Nemours Children's Clinic, Baptist Health Systems, Shands, St. Vincent's Healthcare, Florida Blue, Duval County Public Schools, and Wolfson Children's Hospital.
In 2012, the university established the Public Policy Institute (PPI), offering the only Master in Public Policy (MPP) degree program in the state of Florida. The institute also offers dual degree programs in conjunction with the Davis College of Business and hosts a variety of politically related events, including televised debates for local and regional elections, a radio program titled Policy Matters, and internship opportunities with local companies, local government and the Office of the Governor.
On February 28, 2022, Jacksonville University announced that with the assistance of a Jacksonville municipal grant, it was starting a law school. The announcement was made by Jacksonville University President Tim Cost and Mayor Lenny Curry. The location will be in the VyStar Building downtown where Jacksonville University already has a facility for working students. The law school opened in August 2022 with an initial enrollment of 14 students, the first new law school to open in the U.S. since 2014.
In November 2022, the university announced that it had partnered with the Lake Erie College of Osteopathic Medicine to open a branch of the medical school at the Arlington Campus by 2026.
Rankings
Jacksonville University was ranked #34 (tie) in the Regional Universities South category of U.S. News & World Report's Best Colleges ranking in 2022–23.
Athletics
The JU athletic programs participate in NCAA Division I in the ASUN Conference, with the exception of the rowing program, which competes in the MAAC Conference (NCAA Division I).
Terry Alexander, the most successful coach in Jacksonville's baseball history with 631 wins, entered his 31st year at Jacksonville and his 20th year as the program's head coach. He has led the program to nine NCAA regional appearances, won six conference championships (1995, 1999, 2003, 2006, 2007, 2009) and has completed five 40-win seasons. He has also coached 10 All-America honorees, 50 all-conference selections and helped 44 players get drafted by Major League Baseball organizations.
The basketball program has produced professional basketball players such as Artis Gilmore, Otis Smith, Pembrook Burrows III and Rex Morgan. In 1970, Jacksonville University became the second smallest school (behind St. Bonaventure) to make it to the NCAA Final Four and the national championship game. The team was led by head coach Joe Williams. After defeating the St. Bonaventure team in the tournament semi-finals, the Dolphins lost to the UCLA Bruins in the national championship. The following season, Jacksonville became the first college basketball team to average 100+ points per game, at a time when there was no three-point shot and no shot clock in college basketball. In 2009, Jacksonville won the regular season Atlantic Sun Conference title in men's basketball, but fell to East Tennessee State in the conference tournament title game. The Dolphins were invited to the National Invitation Tournament, the school's first post-season tournament since 1986, but lost in the first round to the University of Florida Gators.
The football program began play in 1998, winning its first Pioneer League title in 2008. The Dolphins competed in the Football Championship Series (FCS), where they won two division titles and two conference championships. The university discontinued its football program at the conclusion of the 2019 season.
JU is noted for its rowing program after taking the overall FIRA Cup (Florida Intercollegiate Rowing Association) in 2007 and again in 2014. The women's rowing team won their first MAAC Championship in 2014 and won an automatic bid to the NCAA Div I National Championship (JU Website). Recently, JU has expanded its rowing program with the addition of the Negaard Rowing Center. The JU rowing program has had over 50 years of success around the world and has competed in locations such as the Nile River and England's Henley Royal Regatta.
The school added men's and women's lacrosse programs during the 2009–2010 academic year.
In 2016 Jacksonville University landed a pair of lacrosse icons to lead its men's lacrosse program as Providence College assistant coach John Galloway was named head coach. One of the young legends in the sport, he was at Providence for four years after spending one year as a volunteer assistant at Duke. He brought along one of the game's most famous players, Casey Powell, as his offensive coordinator.
Student life
The school's Greek system, including, by some estimates, 15% of the school, includes Alpha Phi Alpha, Pi Kappa Alpha, Kappa Alpha Psi, Sigma Chi, and Sigma Nu fraternities; and Alpha Kappa Alpha, Delta Delta Delta, Alpha Epsilon Phi, Alpha Delta Pi, and Gamma Phi Beta sororities.
53% of all students live on campus in one of three residential halls and eight apartment-style housing facilities. Most residence halls provide academic and social events as well as host programs to acclimate incoming students to the college experience.
While Greeks do offer some social events, many residence halls also host their own events. Alcohol policies are strictly enforced.
The student center (the Davis Student Commons Building) includes a fitness center overlooking the St. Johns River, a Chick-Fil-A, and a game room for all campus community members, while serving as a focal point for campus life. The facility opened in October 2006.
Student life at Jacksonville University includes a diverse range of activities and organizations. There are multicultural, arts, political and social action, service and professional, religious, sports and recreation, academic and professional, and special interest groups.
There are a variety of campus ministries on campus. In 2011, another campus ministry, the Campus to City Wesley Foundation, started meeting at JU.
Campus media organizations include the student newspaper (The Navigator), campus radio station (JU108), literary and arts magazine (The Aquarian), student-run broadcasting station (Dolphin Channel), and yearbook (The Riparian), which stopped its publication in 2010.
Jacksonville University's Student Government Association serves the needs of the student body as a whole by electing representatives from the university's student organizations, residential communities and colleges.
The Florida Leader magazine ranked JU as having the third-best positive student life experience out of the 28 private colleges and universities in the state, citing its small campus size, peer and faculty relationships, and the close-knit campus community.
Library
The Carl S. Swisher Library spans over 52,000 square feet and three floors. It offers scenic views of the St. Johns River and is situated in the academic center of campus. This building was funded by a former JU Board of Trustees chair, Carl S. Swisher, who contributed the necessary funds for its construction. The library was built in three phases, with the first phase completed in 1953, the second phase in 1961, and the third phase in 1971. In 1966, then-President of the University, Dr. Robert H. Spiro, established the “Friends of the Library." The library has completed several renovations over the years, the most recent being completed in early 2023.
Today, the Carl S. Swisher Library holds more than 350,000 volumes of books, periodicals, music scores, and other items, as well as a substantial collection of digital resources. The library provides services in support of the university's objectives, including research assistance, instruction sessions, and interlibrary loan services.
In partnership with the university's College of Law and Center for Gender + Sexuality, in March 2023 the Swisher Library became home to the American Bar Association's 19th Amendment exhibit.
Notable alumni
This list of Jacksonville University alumni includes graduates, non-graduate former students and current students of Jacksonville University.
List of University presidents
See also
Independent Colleges and Universities of Florida
Notes
References
External links
Private universities and colleges in Florida
Universities and colleges in Jacksonville, Florida
Universities and colleges established in 1934
Universities and colleges accredited by the Southern Association of Colleges and Schools
1934 establishments in Florida
Arlington, Jacksonville
Universities and colleges in the Jacksonville metropolitan area
Jacksonville Modern architecture
Glassmaking schools
Aviation schools in the United States | Jacksonville University | Materials_science,Engineering | 3,292 |
74,884,154 | https://en.wikipedia.org/wiki/Agrowth | Agrowth is a concept in economic policy according to which it is preferable to be indifferent to the growth of gross domestic product (GDP growth) when devising policies to further economic and societal progress. The reasoning behind agrowth is that GDP growth does not correlate closely with such progress.
The concept has been particularly discussed in the context of environmental policy, where it is opposed to both green growth and degrowth. Agrowth is supported by many scientists.
See also
Climate policy
Environmental economics
Eco-economic decoupling
Post-growth
Sustainability
References
Environmental social science concepts
Environmental economics | Agrowth | Environmental_science | 120 |
22,359,140 | https://en.wikipedia.org/wiki/Phred%20%28software%29 | Phred is a computer program for base calling, that is to say, identifying a nucleobase sequence from fluorescence "trace" data generated by an automated DNA sequencer that uses electrophoresis and 4-fluorescent dye method. When originally developed, Phred produced significantly fewer errors in the data sets examined than other methods, averaging 40–50% fewer errors. Phred quality scores have become widely accepted to characterize the quality of DNA sequences, and can be used to compare the efficacy of different sequencing methods.
Background
The fluorescent-dye DNA sequencing is a molecular biology technique that involves labeling single-strand DNA sequences of varied length with 4 fluorescent dyes (corresponding to 4 different bases used in DNA) and subsequently separating the DNA sequences by "slab gel"- or capillary-electrophoresis method (see DNA Sequencing). The electrophoresis run is monitored by a CCD on the DNA sequencer and this produces a time "trace" data (or "chromatogram") of the fluorescent "peaks" that passed the CCD point. Examining the fluorescence peaks in the trace data, we can determine the order of individual bases (nucleobase) in the DNA. Since the intensity, shape and the location of a fluorescence peak are not always consistent or unambiguous, however, sometimes it is difficult or time-consuming to determine (or "call") the correct bases for the peaks accurately if it is done manually.
Automated DNA sequencing techniques have revolutionized the field of molecular biology – generating vast amounts of DNA sequence data. However, the sequence data is produced at a significantly higher rate than can be manually processed (i.e. interpreting the trace data to produce the sequence data), thereby creating a bottleneck. To remove the bottleneck, both automated software that can speed up the processing with improved accuracy and a reliable measure of the accuracy are needed. To meet this need, many software programs have been developed. One such program is Phred.
History
Phred was originally conceived in the early 1990s by Phil Green, then a professor at Washington University in St. Louis. LaDeana Hillier, Michael Wendl, David Ficenec, Tim Gleeson, Alan Blanchard, and Richard Mott also contributed to the codebase and algorithm. Green moved to University of Washington in the mid 1990s, after which development was primarily managed by himself and Brent Ewing. Phred played a notable role in the Human Genome Project, where large amounts of sequence data were processed by automated scripts. It was at the time the most widely used base-calling software program by both academic and commercial DNA sequencing laboratories because of its high base calling accuracy. Phred is distributed commercially by CodonCode Corporation, and used to perform the "Call bases" function in the program CodonCode Aligner. It is also used by the MacVector plugin Assembler.
Methods
Phred uses a four-phase procedure as outlined by Ewing et al. to determine a sequence of base calls from the processed DNA sequence tracing:
Predicted peak locations are determined, based on the assumption that fragments are relatively evenly spaced, on average, in most regions of the gel, to determine the correct number of bases and their idealized evenly spaced locations in regions where the peaks are not well resolved, noisy, or displaced (as in compressions)
Observed peaks are identified in the trace
Observed peaks are matched to the predicted peak locations, omitting some peaks and splitting others; as each observed peak comes from a specific array and is thus associated with 1 of the 4 bases (A, G, T, or C), the ordered list of matched observed peaks determines a base sequence for the trace.
The unmatched observed peaks are checked for any peak that appears to represent a base but could not be assigned to a predicted peak in the third phase and if found, the corresponding base is inserted into the read sequence.
The entire procedure is rapid, usually taking less than half a second per trace. The results can be output as a PHD file, which contains base data as triples consisting of the base call, quality, and position.
Applications
Phred is often used together with another software program called Phrap, which is a program for DNA sequence assembly. Phrap was routinely used in some of the largest sequencing projects in the Human Genome Sequencing Project and is currently one of the most widely used DNA sequence assembly programs in the biotech industry. Phrap uses Phred quality scores to determine highly accurate consensus sequences and to estimate the quality of the consensus sequences. Phrap also uses Phred quality scores to estimate whether discrepancies between two overlapping sequences are more likely to arise from random errors, or from different copies of a repeated sequence.
References
External links
The Laboratory of Phil Green Phrap's homepage.
Molecular biology
DNA
Bioinformatics software | Phred (software) | Chemistry,Biology | 991 |
19,114,012 | https://en.wikipedia.org/wiki/Ursell%20number | In fluid dynamics, the Ursell number indicates the nonlinearity of long surface gravity waves on a fluid layer. This dimensionless parameter is named after Fritz Ursell, who discussed its significance in 1953.
The Ursell number is derived from the Stokes wave expansion, a perturbation series for nonlinear periodic waves, in the long-wave limit of shallow water – when the wavelength is much larger than the water depth. Then the Ursell number U is defined as:
which is, apart from a constant 3 / (32 π2), the ratio of the amplitudes of the second-order to the first-order term in the free surface elevation.
The used parameters are:
H : the wave height, i.e. the difference between the elevations of the wave crest and trough,
h : the mean water depth, and
λ : the wavelength, which has to be large compared to the depth, λ ≫ h.
So the Ursell parameter U is the relative wave height H / h times the relative wavelength λ / h squared.
For long waves (λ ≫ h) with small Ursell number, U ≪ 32 π2 / 3 ≈ 100, linear wave theory is applicable. Otherwise (and most often) a non-linear theory for fairly long waves (λ > 7 h) – like the Korteweg–de Vries equation or Boussinesq equations – has to be used.
The parameter, with different normalisation, was already introduced by George Gabriel Stokes in his historical paper on surface gravity waves of 1847.
Notes
References
In 2 parts, 967 pages.
722 pages.
Dimensionless numbers of fluid mechanics
Fluid dynamics
Water waves | Ursell number | Physics,Chemistry,Engineering | 335 |
56,061,707 | https://en.wikipedia.org/wiki/Moorella%20glycerini | Moorella glycerini is a thermophilic, homoacetogenic, anaerobic and endospore-forming bacterium from the genus Moorella, which has been isolated from a hot spring from the Calcite Spring area from the Yellowstone National Park in the United States. This microorganism utilizes glycerol as a growth substrate and is considered Gram-positive type.
References
Thermoanaerobacterales
Bacteria described in 1997
Thermophiles
Anaerobes
Acetogens | Moorella glycerini | Biology | 107 |
76,197,366 | https://en.wikipedia.org/wiki/Ministry%20of%20Physical%20Infrastructure%20Development | The Ministry of Physical Infrastructure Development is a governmental body of Koshi Province, Nepal mainly responsible for the construction and development of basic physical infrastructure including roads, bridges, buildings and urban development.
Introduction
After Nepal was transformed into a federal structure as envisioned by the Constitution of Nepal, according to the provisions related to the Provincial Executive in Part 13 of the Constitution, the Provincial Council of Ministers was formed on 15 February 2018.
The Ministry of Physical Infrastructure Development was established on 15 February 2018. On 2 November 2021 the portfolio of Urban development was added to the ministry resulting in the inclusion of the Ministry of Physical Infrastructure and Urban Development. Recently, according to the decision of the provincial government (council of ministers), the name of this ministry has been changed to Ministry of Physical Infrastructure Development.
List of former ministers
This is a list of all former Social Development Ministers since 2018–Present.
References
External links
Official Website of Ministry of Physical Infrastructure Development of Koshi Province
Koshi Province
Infrastructure | Ministry of Physical Infrastructure Development | Engineering | 194 |
17,077,434 | https://en.wikipedia.org/wiki/Comparative%20Toxicogenomics%20Database | The Comparative Toxicogenomics Database (CTD) is a public website and research tool launched in November 2004 that curates scientific data describing relationships between chemicals/drugs, genes/proteins, diseases, taxa, phenotypes, GO annotations, pathways, and interaction modules.
The database is maintained by the Department of Biological Sciences at North Carolina State University.
Background
The Comparative Toxicogenomics Database (CTD) is a public website and research tool that curates scientific data describing relationships between chemicals, genes/proteins, diseases, taxa, phenotypes, GO annotations, pathways, and interaction modules, launched on November 12, 2004.
The database is maintained by the Department of Biological Sciences at North Carolina State University.
Goals and objectives
One of the primary goals of CTD is to advance the understanding of the effects of environmental chemicals on human health on the genetic level, a field called toxicogenomics.
The etiology of many chronic diseases involves interactions between environmental factors and genes that modulate important physiological processes. Chemicals are an important component of the environment. Conditions such as asthma, cancer, diabetes, hypertension, immunodeficiency, and Parkinson's disease are known to be influenced by the environment; however, the molecular mechanisms underlying these correlations are not well understood. CTD may help resolve these mechanisms. The most up-to-date extensive list of peer-reviewed scientific articles about CTD is available at their publications page
Core data
CTD is a unique resource where biocurators read the scientific literature and manually curate four types of core data:
Chemical-gene interactions
Chemical-disease associations
Gene-disease associations
Chemical-phenotype associations
Data integration
By integrating the above four data sets, CTD automatically constructs putative chemical-gene-phenotype-disease networks to illuminate molecular mechanisms underlying environmentally-influenced diseases.
These inferred relationships are statistically scored and ranked and can be used by scientists and computational biologists to generate and verify testable hypotheses about toxicogenomic mechanisms and how they relate to human health.
Users can search CTD to explore scientific data for chemicals, genes, diseases, or interactions between any of these three concepts. Currently, CTD integrates toxicogenomic data for vertebrates and invertebrates.
CTD integrates data from or hyperlinks to these databases:
ChemIDplus, a dictionary of more than 400,000 chemicals housed in the US National Library of Medicine
DrugBank
Data Infrastructure for Chemical Safety project (diXa) Data Warehouse by the European Bioinformatics Institute which as of November 2015 contained 469 compounds, 188 disease datasets in three sub-categories liver, kidney and cardiovascular disease.
Gene Ontology Consortium
KEGG
NCBI Entrez-Gene
NCBI PubMed
NCBI Taxonomy
NLM Medical Subject Headings
OMIM
Reactome
References
External links
Comparative Toxicogenomics Database
MDI Biologicjfxal Laboratory
Biochemistry databases
Genetics databases
Ontology (information science)
Toxicology
Molecular genetics
Environmental science
Comparisons | Comparative Toxicogenomics Database | Chemistry,Biology,Environmental_science | 613 |
77,180,584 | https://en.wikipedia.org/wiki/John%20P.%20Fackler%20Jr. | John P. Fackler Jr. (July 31, 1934 – February 25, 2023) was an American inorganic chemist.
John P. Fackler Jr. was born in Toledo, Ohio, on July 31, 1934, to parents John Fackler Sr. and Ruth Eleanor Moehring Fackler. He had two younger brothers. After graduating from DeVilbiss High School in 1952, Fackler enrolled at the Massachusetts Institute of Technology for one year, then transferred to Valparaiso University, where he completed a Bachelor of Arts degree in chemistry, physics, and mathematics. Fackler subsequently obtained a doctorate in inorganic chemistry at MIT in 1960.
Fackler began his academic career at the University of California, Berkeley as an assistant professor. He moved to Case Western Reserve University in 1962, where he was named to a Teagle Professorship in 1978. He left Case Western in 1983 to serve as dean of the College of Science at Texas A&M University until 1992. Between 1987 and 2006, Fackler was a distinguished professor of chemistry at Texas A&M. He was granted emeritus status in 2008. For eleven years, Fackler served as editor-in-chief of the academic journal Comments on Inorganic Chemistry.
Fackler was awarded a Guggenheim Fellowship in 1976. He received the American Chemical Society Award for Distinguished Service in the Advancement of Inorganic Chemistry in 2001, and was named an inaugural fellow of the ACS in 2009. Fackler was also a fellow of the American Association for the Advancement of Science (1990) and the American Institute of Chemists, as well as a member of the Royal Society of Chemistry and Sigma Xi, among other organizations.
Fackler moved to The Woodlands, Texas in 2014, and died there on February 25, 2023, aged 88.
References
1934 births
2023 deaths
20th-century American chemists
21st-century American chemists
American inorganic chemists
People from Toledo, Ohio
Chemists from Ohio
Massachusetts Institute of Technology alumni
Valparaiso University alumni
Case Western Reserve University faculty
University of California, Berkeley faculty
Texas A&M University faculty
American university and college faculty deans
Fellows of the American Chemical Society
Fellows of the American Association for the Advancement of Science
Chemistry journal editors | John P. Fackler Jr. | Chemistry | 451 |
884,879 | https://en.wikipedia.org/wiki/Kapton | Kapton is a polyimide film used in flexible printed circuits (flexible electronics) and space blankets, which are used on spacecraft, satellites, and various space instruments. Invented by the DuPont Corporation in the 1960s, Kapton remains stable across a wide range of temperatures, from . Kapton is used in electronics manufacturing, space applications, with x-ray equipment, and in 3D printing applications. Its favorable thermal properties and outgassing characteristics result in its regular use in cryogenic applications and in situations where high vacuum environments are experienced.
History
Kapton was invented by DuPont in the 1960s. Kapton remains manufactured by DuPont to this day.
The name Kapton is a registered trademark of E. I. du Pont de Nemours and Company.
Chemistry and variants
Kapton synthesis is an example of the use of a dianhydride in step polymerization. The intermediate polymer, known as a poly(amic acid), is soluble because of strong hydrogen bonds to the polar solvents usually employed in the reaction. The ring closure is carried out at high temperatures of .
The chemical name for Kapton K and HN is poly (4,4'-oxydiphenylene-pyromellitimide). It is produced from the condensation of pyromellitic dianhydride (PMDA) and 4,4'-oxydiphenylamine (ODA).
Kapton E is a mix of two dianhydrides, PMDA and biphenyltetracarboxylic acid dianhydride (BPDA), and two diamines, ODA and p-phenylenediamine (PPD). The BPDA component adds greater dimensional stability and flatness in flexible circuitry applications. Kapton E offers reduced coefficient of thermal expansion (CTE), reduced moisture absorption, and reduced coefficient of hygroscopic expansion (CHE) compared to Kapton H.
Characteristics
In isolation, Kapton remains stable across a wide range of temperatures, from .
The thermal conductivity of Kapton at temperatures from 0.5 to 5 Kelvin is rather high for such low temperatures, κ = 4.638×10−3 T0.5678 W·m−1·K−1.
Kapton insulation ages poorly: an FAA study shows degradation in hot, humid environments or in the presence of seawater. It was found to have very poor resistance to mechanical wear, mainly abrasion within cable harnesses due to aircraft movement. Many aircraft models have had to undergo extensive rewiring modifications—sometimes completely replacing all the Kapton-insulated wiring—because of short circuits caused by the faulty insulation. Kapton-wire degradation and chafing due to vibration and heat has been implicated in multiple crashes of both fixed wing and rotary wing aircraft, with loss of life. The New York Times, citing a NASA OIG document, reported in 2005 that Kapton-insulated cables on the Space Shuttle "tended to break down over time, causing short circuits and, potentially, fires." The STS-93 mission saw electrical shorts on Kapton insulation disable two engine controllers and nearly cause catastrophe.
Usage
Electronics manufacturing
Due to its large range of temperature stability and its electrical isolation ability, Kapton tape is usually used in electronic manufacturing as an insulation and protection layer on electrostatic-sensitive and fragile components. As it can sustain the temperature needed for a reflow soldering operation, its protection is available throughout the whole production process, and Kapton is often still present in the final consumer product.
Spacecraft
The descent stage of the Apollo Lunar Module, and the bottom of the ascent stage surrounding the ascent engine, were covered in blankets of aluminized Kapton foil to provide thermal insulation. During the return journey from the Moon, Apollo 11 astronaut Neil Armstrong commented that during the launch of the Lunar Module Eagle ascent stage, he could see "Kapton and other parts of the LM staging scattering all around the area for great distances."
The NASA Jet Propulsion Laboratory has considered Kapton as a good plastic support for solar sails because of its durability in the space environment.
NASA's New Horizons spacecraft used Kapton in an innovative "Thermos bottle" insulation design to keep the craft operating between throughout its more than nine-year, journey to rendezvous with the dwarf planet Pluto on 14 July 2015. The main body is covered in lightweight, gold-colored, multilayered thermal insulation which holds in heat from operating electronics to keep the spacecraft warm. The thermal blanketing of 18 layers of Dacron mesh cloth sandwiched between aluminized Mylar and Kapton film also helped to protect the craft from micrometeorites.
The James Webb Space Telescope sunshield is made of five Kapton E sheets coated with aluminum and doped silicon to reflect heat away from the spacecraft body.
The crew aboard the International Space Station used Kapton tape to temporarily repair a slow leak in a Soyuz spacecraft attached to the Russian segment of the orbital complex in August 2018. It was used again in October 2020 to temporarily seal a leak in the transfer chamber of the Zvezda Service Module of the ISS.
X-rays
Kapton is also commonly used as a material for windows used with all kinds of X-ray sources (synchrotron beam-lines and X-ray tubes) and X-ray detectors. Its high mechanical and thermal stability as well as high transmittance of X-rays make it the preferred material. It is also relatively insensitive to radiation damage.
3D printing
Kapton and ABS adhere to each other very well, which has led to widespread use of Kapton as a build surface for 3D printers. Kapton is laid down on a flat surface and the ABS is extruded onto the Kapton surface. The ABS part being printed will not detach from the build platform as it cools and shrinks, a common cause of print failure by warping of the part. A more durable alternative is to use a polyetherimide surface.
Researchers have devised a method to 3D-print polyimide material including Kapton. The polyamic acid precursor to Kapton is mixed with an acrylate cross linker and photoinitiator that can form a gel when exposed to ultraviolet light during 3D printing. Subsequent heating of the 3D printed part up to 400 °C removes the sacrificial crosslinks and imidizes the part forming Kapton with a 3D printed geometry.
Others
Kapton's relatively high thermal conductivity at very low temperatures, together with its good dielectric qualities and its availability as thin sheets, have made it a favorite material in cryogenics, as it provides electrical insulation at low thermal gradients.
Kapton is regularly used as an insulator in ultra-high-vacuum environments due to its low outgassing rate.
Kapton-insulated electrical wiring has been widely used in civil and military aircraft because it is lighter than other insulators and has good insulating and temperature characteristics.
See also
Mylar
References
External links
Polyimide Films at DuPont
Aerospace materials
Dielectrics
Flexible electronics | Kapton | Physics,Engineering | 1,454 |
14,427,589 | https://en.wikipedia.org/wiki/GPR37 | Probable G-protein coupled receptor 37 is a protein that in humans is encoded by the GPR37 gene. GPR37 is primarily found in the central nervous system (CNS), with significant expression observed in various CNS regions including the amygdala, basal ganglia (caudate, putamen, and nucleus accumbens), substantia nigra, hippocampus, frontal cortex, and hypothalamus, particularly noteworthy is its exceptionally elevated expression in the spinal cord.
Interactions
GPR37 has been shown to interact with HSPA1A and Parkin (ligase). GPR37 is a receptor for prosaposin. It was previously thought to be a receptor for head activator, a neuropeptide found in the hydra, but early reports of head activator in mammals were never confirmed. To address challenges in confirming ligand-GPR37 interactions using recombinant GPR37 expressed in HEK293 cells, recent research has turned to primary cell cultures, leading to successful ligand identification. These investigations have unveiled the involvement of osteocalcin with GPR37 to regulate processes such as oligodendrocyte differentiation, myelination, myelin production, and remyelination following demyelinating injuries. Furthermore, osteocalcin treatment has demonstrated protective effects against Lipopolysaccharide-induced inflammation, which are absent in GPR37-deficient mice.
GPR37 signaling has been shown to modulate the migration of olfactory ensheathing cells (OECs) and gonadotropin-releasing hormone (GnRH) cells in mice.
References
Further reading
G protein-coupled receptors | GPR37 | Chemistry | 357 |
3,452,885 | https://en.wikipedia.org/wiki/Vinyl%20halide | In organic chemistry, a vinyl halide is a compound with the formula CH2=CHX (X = halide). The term vinyl is often used to describe any alkenyl group. For this reason, alkenyl halides with the formula RCH=CHX are sometimes called vinyl halides. From the perspective of applications, the dominant member of this class of compounds is vinyl chloride, which is produced on the scale of millions of tons per year as a precursor to polyvinyl chloride. Polyvinyl fluoride is another commercial product. Related compounds include vinylidene chloride and vinylidene fluoride.
Synthesis
Vinyl chloride is produced by dehydrochlorination of 1,2-dichloroethane.
Due to their high utility, many approaches to vinyl halides have been developed, such as:
reactions of vinyl organometallic species with halogens
Takai olefination
Stork-Zhao olefination with, e.g., (Chloromethylene)triphenylphosphorane - a modification of the Wittig reaction
Olefin metathesis
Reactions
Vinyl bromide and related alkenyl halides form the Grignard reagent and related organolithium reagents. Alkenyl halides undergo base elimination to give the corresponding alkyne. Most important is their use in cross-coupling reactions (e.g. Suzuki-Miyaura coupling, Stille coupling, Heck coupling, etc.).
See also
Vinyl iodide functional group
References
Organohalides | Vinyl halide | Chemistry | 324 |
9,560,493 | https://en.wikipedia.org/wiki/Smeltmill | Smeltmills were water-powered mills used to smelt lead or other metals.
The older method of smelting lead on wind-blown bole hills began to be superseded by artificially-blown smelters. The first such furnace was built by Burchard Kranich at Makeney, Derbyshire in 1554, but produced less good lead than the older bole hill. William Humfrey (the Queen's assay master), and a leading shareholder in the Company of Mineral and Battery Works introduced the ore hearth from the Mendips about 1577. This was initially blown by a foot-blast, but was soon developed into a water-powered smelt mill at Beauchief (now a suburb of Sheffield).
A typical smelt mill had an orehearth and a slaghearth, the latter being used to reprocess slags from the orehearth in order to recover further lead from the slag
Further reading
L. Willies, 'Lead: ore preparation and smelting' in J. Day and R. F. Tylecote, The Industrial Revolution in Metals (Institute of Metals, London 1991), 93-102.
Various articles in L. Willies and D. Cranstone (eds.), Boles and Smeltmills (Historical Metallurgy Society, 1992).
M. B. Donald, Elizabethan Monolopies (Oliver & Boyd Edinburgh 1961), 142-78.
See also Derbyshire lead mining history.
External links
North Pennine Smelt Mills – Interactive mapping and information on North Pennine Smelt Mills (Northern Mine Research Society)
Yorkshire Smelt Mills – Interactive mapping and information on Yorkshire Smelt Mills (Northern Mine Research Society)
Metallurgical processes
Lead
Smelting | Smeltmill | Chemistry,Materials_science | 365 |
11,820,442 | https://en.wikipedia.org/wiki/Graphium%20rubrum | Graphium rubrum is a plant pathogen.
References
External links
Index Fungorum
USDA ARS Fungal Database
Fungal plant pathogens and diseases
Microascales
Fungus species | Graphium rubrum | Biology | 35 |
15,110,665 | https://en.wikipedia.org/wiki/Glassine | Glassine is a smooth and glossy paper which is air-, water-, and grease-resistant. It is usually available in densities between . It is translucent unless dyes are added to the paper to color it or make it opaque. It is manufactured by supercalendering: after pressing and drying, the paper web is passed through a stack of alternating steel-covered and fiber-covered rolls called a supercalender at the end of the paper machine so that the paper fibers are oriented in the same direction.
Usage
Glassine is most commonly used as a base for further silicone coating for the manufacture of release liner.
Glassine is also used as an interleaving paper in bookbinding, especially to protect fine illustrations from contact with facing pages; the paper can be manufactured with a neutral pH and can prevent damage from spilling, exposure, or rubbing. Glassine adhesive tape has been used in book repair. In chemistry, glassine is used as an inexpensive weighing paper. It is applied in foodservice as a barrier between strips of products (for example: meat, baked goods). Glassine is resistant to grease and facilitates separation of individual foodstuffs.
Glassine has been recommended for protecting the surface of stored acrylic paintings. However, glassine will adhere to soft (not completely cured) and medium-rich paint, especially when stored for an extended period of time and it may cause permanent damage to the painted surface. Therefore, art conservators do not recommend that it be used to wrap paintings. Philatelists use glassine envelopes to store stamps, and stamp hinges are made of glassine. Amateur insect collectors use glassine envelopes to store specimens temporarily in the field before they are mounted in a collection. Entomologists collecting for research may likewise use such envelopes to store whole specimens in the field. Glassine envelopes carry pharmacy reformulated drugs and illicit drugs such as cocaine and heroin.
Photographers used glassine sleeves for many decades to safely store their processed films. Glassine is also used to pack firecrackers, as it is moisture resistant. It is used for its transparent qualities to fold origami tessellations. Glassine is an outer covering on paperboard tubes, particularly those used in model rocketry, for water protection.
In the mid-20th century, potato chips were packaged in glassine bags. Herman Lay was a pioneer of using glassine in the potato chips industry.
References
Paper
Transparent materials
Stamp collecting | Glassine | Physics | 507 |
63,871,926 | https://en.wikipedia.org/wiki/Silicatein | Silicateins are enzymes which catalyse the formation of biosilica from monomeric silicon compounds (such as silicic acid) extracted from the natural environment. Environmental silicates are absorbed by specific biota, including diatoms, radiolaria, silicoflagellates, and siliceous sponges; silicateins have so far only been found in sponges. Silicateins are homologous to the cysteine protease cathepsin.
In sponges, the silicatein enzymes reside in the axial filaments of the axial canals of the siliceous spicules.
In contrast, diatoms do not use silicateins but rather small specialised peptides called silaffins which attach long chain polyamines (LCPAs) to lysine groups. Free LCPAs can also cooperate with silaffins. Both silicateins and silaffins form higher-order structures which act both as structural templates (for exoskeletons) and mechanistic catalysts for the polycondensation reactions of silicon-compounds.
The Venus' flower basket siliceous sponge is a well-known example of an organism that utilises silicatein. It is known for its remarkable ability to extract silicic acid from surrounding seawater, which is then converted into complex 3D silica structures at ambient temperatures underwater, something human engineering capabilities are unable to replicate without the use of high-temperature.
Another example of silicatein-utilising organisms are the suberites, a genus of sea sponge in the family Suberitidae. Suberites consist mostly of cells, in contrast with other Porifera (such as the class Hexactinellida, to which the Venus' flower basket belongs) which are syncytial. The extracellular matrix of siliceous spicules give suberites their structural foundation; these consist of bio-silica, a silicon dioxide polymer. These inorganic structures provide support for the animals. Silica deposition begins intracellularly and is carried out by the enzyme silicatein. Silicateins are modulated by a group of proteins called silintaphins The process occurs in specialized cells known as sclerocytes.
Lubomirskia baikalensis, also known as Lake Baikal sponge, has been studied to explore the gene family of silicateins and their role in the morphogenesis of these sponges.
References
Protein families
Sponge biology | Silicatein | Biology | 520 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.