Instruction
stringlengths
14
778
input_code
stringlengths
0
4.24k
output_code
stringlengths
1
5.44k
Update Net Monitor to 1.1.1 (3)
Categories:System,Multimedia,Internet License:GPL-3.0 Web Site:https://secuso.org/pfa Source Code:https://github.com/SecUSo/privacy-friendly-netmonitor Issue Tracker:https://github.com/SecUSo/privacy-friendly-netmonitor/issues Changelog:https://github.com/SecUSo/privacy-friendly-dicer/blob/HEAD/CHANGELOG.md Donate:https://secuso.org/pfa Auto Name:Net Monitor Summary:Shows network connections of installed apps Description: Privacy Friendly Net Monitor monitors active network activity and provides information on the scanned connections and apps. The Connection's local and remote socket information is displayed along with a resolved hostname information and protocol evaluation based on well-known ports. Known un-/encrypted protocols are automatically marked. This app belongs to the Privacy Friendly Apps group developed by the [https://secuso.org/ SECUSO research group] Universität Darmstadt, Germany. . Repo Type:git Repo:https://github.com/SecUSo/privacy-friendly-netmonitor/ Build:1.0,1 commit=v1.0 subdir=app gradle=yes Auto Update Mode:Version v%v Update Check Mode:Tags Current Version:1.0 Current Version Code:1
Categories:System,Multimedia,Internet License:GPL-3.0 Web Site:https://secuso.org/pfa Source Code:https://github.com/SecUSo/privacy-friendly-netmonitor Issue Tracker:https://github.com/SecUSo/privacy-friendly-netmonitor/issues Changelog:https://github.com/SecUSo/privacy-friendly-dicer/blob/HEAD/CHANGELOG.md Donate:https://secuso.org/pfa Auto Name:Net Monitor Summary:Shows network connections of installed apps Description: Privacy Friendly Net Monitor monitors active network activity and provides information on the scanned connections and apps. The Connection's local and remote socket information is displayed along with a resolved hostname information and protocol evaluation based on well-known ports. Known un-/encrypted protocols are automatically marked. This app belongs to the Privacy Friendly Apps group developed by the [https://secuso.org/ SECUSO research group] Universität Darmstadt, Germany. . Repo Type:git Repo:https://github.com/SecUSo/privacy-friendly-netmonitor/ Build:1.0,1 commit=v1.0 subdir=app gradle=yes Build:1.1.1,3 commit=v1.1.1 subdir=app gradle=yes Auto Update Mode:Version v%v Update Check Mode:Tags Current Version:1.1.1 Current Version Code:3
Update pipenv from 11.10.0 to 11.10.1
attrs==17.4.0 bandit==1.4.0 check-manifest==0.37 coveralls==1.3.0 codecov==2.0.15 flake8-bugbear==18.2.0;python_version>="3.5" flake8-docstrings==1.3.0 flake8-import-order==0.17.1 pycodestyle==2.3.1 flake8==3.5.0 hypothesis==3.56.5 mccabe==0.6.1 mypy==0.590 pep8-naming==0.5.0 pytest==3.5.0 pipdeptree==0.11.0 pipenv==11.10.0 pytest-cov==2.5.1 pytest-randomly==1.2.3 pytest-runner==4.2 readme_renderer==20.0 scipy==1.0.1 setuptools==39.0.1 twine==1.11.0 setuptools_scm==2.0.0 sphinx==1.7.4 sphinx-autobuild==0.7.1 nbsphinx==0.3.3 vulture==0.26 wheel==0.31.0
attrs==17.4.0 bandit==1.4.0 check-manifest==0.37 coveralls==1.3.0 codecov==2.0.15 flake8-bugbear==18.2.0;python_version>="3.5" flake8-docstrings==1.3.0 flake8-import-order==0.17.1 pycodestyle==2.3.1 flake8==3.5.0 hypothesis==3.56.5 mccabe==0.6.1 mypy==0.590 pep8-naming==0.5.0 pytest==3.5.0 pipdeptree==0.11.0 pipenv==11.10.1 pytest-cov==2.5.1 pytest-randomly==1.2.3 pytest-runner==4.2 readme_renderer==20.0 scipy==1.0.1 setuptools==39.0.1 twine==1.11.0 setuptools_scm==2.0.0 sphinx==1.7.4 sphinx-autobuild==0.7.1 nbsphinx==0.3.3 vulture==0.26 wheel==0.31.0
Use latest alabaster for stylin' fixes etc
# You should already have the dev version of Paramiko and your local Fabric # checkout installed! Stable Paramiko may not be sufficient! # Test runner/testing utils nose # Rudolf adds color to the output of 'fab test'. This is a custom fork # addressing Python 2.7 and Nose's 'skip' plugin compatibility issues. -e git+https://github.com/bitprophet/rudolf#egg=rudolf # Mocking library Fudge<1.0 # Documentation generation Sphinx>=1.2 releases==0.6.1 invoke==0.7.0 invocations==0.5.0 alabaster==0.3.1
# You should already have the dev version of Paramiko and your local Fabric # checkout installed! Stable Paramiko may not be sufficient! # Test runner/testing utils nose # Rudolf adds color to the output of 'fab test'. This is a custom fork # addressing Python 2.7 and Nose's 'skip' plugin compatibility issues. -e git+https://github.com/bitprophet/rudolf#egg=rudolf # Mocking library Fudge<1.0 # Documentation generation Sphinx>=1.2 releases==0.6.1 invoke==0.7.0 invocations==0.5.0 alabaster==0.4.1
Add another missing dependence on swift-syntax-generated-headers
add_swift_library(swiftImmediate STATIC Immediate.cpp REPL.cpp LINK_LIBRARIES swiftIDE swiftFrontend swiftSILGen swiftSILOptimizer swiftIRGen LLVM_COMPONENT_DEPENDS linker mcjit)
add_swift_library(swiftImmediate STATIC Immediate.cpp REPL.cpp DEPENDS swift-syntax-generated-headers LINK_LIBRARIES swiftIDE swiftFrontend swiftSILGen swiftSILOptimizer swiftIRGen LLVM_COMPONENT_DEPENDS linker mcjit)
Add pluginbase to the RTD requirements file
# this is a pip requirements file specifically for the ReadTheDocs environment # because it can not install certain packages such as matplotlib advancedhttpserver>=1.2.0 alembic>=0.8.5 boltons>=16.1.1 dnspython>=1.12.0 geoip2>=2.2.0 geojson>=1.3.2 icalendar>=3.9.2 ipaddress>=1.0.16 Jinja2>=2.8 markupsafe>=0.23 msgpack-python>=0.4.7 paramiko>=1.16.0 pyotp>=2.0.1 python-dateutil>=2.5.1 python-pam>=1.8.2 pytz>=2016.1 PyYAML>=3.11 requests>=2.9.1 six>=1.10.0 smoke-zephyr>=1.0.2 SQLAlchemy>=1.0.12 termcolor>=1.1.0 tzlocal>=1.2.2 XlsxWriter>=0.8.4 # additional sphinx-specific requirements docutils>=0.12 sphinx>=1.4.1 sphinxcontrib-domaintools>=0.1 sphinxcontrib-httpdomain>=1.4.0
# this is a pip requirements file specifically for the ReadTheDocs environment # because it can not install certain packages such as matplotlib advancedhttpserver>=1.2.0 alembic>=0.8.5 boltons>=16.1.1 dnspython>=1.12.0 geoip2>=2.2.0 geojson>=1.3.2 icalendar>=3.9.2 ipaddress>=1.0.16 Jinja2>=2.8 markupsafe>=0.23 msgpack-python>=0.4.7 paramiko>=1.16.0 pluginbase>=0.3 pyotp>=2.0.1 python-dateutil>=2.5.1 python-pam>=1.8.2 pytz>=2016.1 PyYAML>=3.11 requests>=2.9.1 six>=1.10.0 smoke-zephyr>=1.0.2 SQLAlchemy>=1.0.12 termcolor>=1.1.0 tzlocal>=1.2.2 XlsxWriter>=0.8.4 # additional sphinx-specific requirements docutils>=0.12 sphinx>=1.4.1 sphinxcontrib-domaintools>=0.1 sphinxcontrib-httpdomain>=1.4.0
Update dates on the license too
Copyright (c) 2011 Vivek Bhagwat, 2013-2014 Wesha Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
Copyright (c) 2011 Vivek Bhagwat, 2013-2020 Wesha Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
Bump ipython from 2.0.0 to 7.16.3
-r requirements.txt coveralls==2.1.2 bumpversion==0.5.0 ipython==2.0.0 ipdb==0.8 vim-debug==1.5.4 isort==3.9.0 pytest==4.0.1; python_version >= '2.6' and python_version < '3.5' pytest==6.1.1; python_version >= '3.6' pytest-cov==2.6.0; python_version == '2.6' or python_version=='2.7' pytest-cov==2.10.1; python_version >= '3.6' pytest-mock pytest-responses responses twine==1.12.1
-r requirements.txt coveralls==2.1.2 bumpversion==0.5.0 ipython==7.16.3 ipdb==0.8 vim-debug==1.5.4 isort==3.9.0 pytest==4.0.1; python_version >= '2.6' and python_version < '3.5' pytest==6.1.1; python_version >= '3.6' pytest-cov==2.6.0; python_version == '2.6' or python_version=='2.7' pytest-cov==2.10.1; python_version >= '3.6' pytest-mock pytest-responses responses twine==1.12.1
Add a licence file (MIT)
(C) Crown copyright 2015 Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
Update StockTicker to 4.00.00 (22)
Categories:Office License:MIT Web Site:https://github.com/premnirmal/StockTicker/blob/HEAD/README.md Source Code:https://github.com/premnirmal/StockTicker Issue Tracker:https://github.com/premnirmal/StockTicker/issues Auto Name:StockTicker Summary:Stock market ticker widget Description: Widget that shows your stock portolio in a resizable grid. You can sort the list by drag-and-drop and the list can be exported and re-imported. . Repo Type:git Repo:https://github.com/premnirmal/StockTicker Build:3.30.00,20 commit=ef9a373842cdb02795e6e32ead9b4a320d789c4e subdir=app gradle=yes prebuild=sed -i -e '/applicationId/d' build.gradle Build:3.40.00,21 commit=1bc34a98ace16b5a4bd5cfd5d5706272c2887cee subdir=app gradle=yes Auto Update Mode:None Update Check Mode:RepoManifest Current Version:4.00.00 Current Version Code:22
Categories:Office License:MIT Web Site:https://github.com/premnirmal/StockTicker/blob/HEAD/README.md Source Code:https://github.com/premnirmal/StockTicker Issue Tracker:https://github.com/premnirmal/StockTicker/issues Auto Name:StockTicker Summary:Stock market ticker widget Description: Widget that shows your stock portolio in a resizable grid. You can sort the list by drag-and-drop and the list can be exported and re-imported. . Repo Type:git Repo:https://github.com/premnirmal/StockTicker Build:3.30.00,20 commit=ef9a373842cdb02795e6e32ead9b4a320d789c4e subdir=app gradle=yes prebuild=sed -i -e '/applicationId/d' build.gradle Build:3.40.00,21 commit=1bc34a98ace16b5a4bd5cfd5d5706272c2887cee subdir=app gradle=yes Build:4.00.00,22 commit=f097a5841dabcb4a4e843e849116f5292c8ed64f subdir=app gradle=yes Auto Update Mode:None Update Check Mode:RepoManifest Current Version:4.00.00 Current Version Code:22
Make "action" a static library
# # Build the action submodule # set(SOURCE_FILES commands.c manager.c processor.c processor_stack.c ) add_library(action OBJECT ${SOURCE_FILES} )
# # Build the action submodule # set(SOURCE_FILES commands.c manager.c processor.c processor_stack.c ) add_library(action STATIC ${SOURCE_FILES} ) target_link_libraries(action command values )
Update jinja2 from 2.9.3 to 2.9.4
flake8==3.2.1 coverage==4.3.1 sphinx==1.5.1 alabaster>=0.6.2 aiohttp==1.2.0 jinja2==2.9.3 pytest==3.0.5 pytest-cov==2.4.0 yarl==0.8.1 multidict==2.1.4 pytest-aiohttp==0.1.3 -e .
flake8==3.2.1 coverage==4.3.1 sphinx==1.5.1 alabaster>=0.6.2 aiohttp==1.2.0 jinja2==2.9.4 pytest==3.0.5 pytest-cov==2.4.0 yarl==0.8.1 multidict==2.1.4 pytest-aiohttp==0.1.3 -e .
Add epdb to dev requirements
-r requirements.txt argparse==1.3.0 cov-core==1.15.0 coverage==3.7.1 mock==1.0.1 py==1.4.30 pytest==2.7.2 pytest-cov==1.8.1
-r requirements.txt argparse==1.3.0 cov-core==1.15.0 coverage==3.7.1 mock==1.0.1 py==1.4.30 pytest==2.7.2 pytest-cov==1.8.1 epdb=0.12
Update dependency google-auth to v1.19.2
cachetools==4.1.1 certifi==2020.6.20 chardet==3.0.4 coverage==5.2 google-api-core==1.21.0 google-api-python-client==1.10.0 google-auth==1.19.1 google-auth-httplib2==0.0.4 google-auth-oauthlib==0.4.1 googleapis-common-protos==1.52.0 httplib2==0.18.1 idna==2.10 oauth2client==4.1.3 oauthlib==3.1.0 protobuf==3.12.2 pyasn1==0.4.8 pyasn1-modules==0.2.8 python-slugify==4.0.1 pytube3==9.6.4 pytz==2020.1 requests==2.24.0 requests-oauthlib==1.3.0 rsa==4.6 sitemap-python==0.2.0 six==1.15.0 text-unidecode==1.3 typing-extensions==3.7.4.2 uritemplate==3.0.1 urllib3==1.25.9
cachetools==4.1.1 certifi==2020.6.20 chardet==3.0.4 coverage==5.2 google-api-core==1.21.0 google-api-python-client==1.10.0 google-auth==1.19.2 google-auth-httplib2==0.0.4 google-auth-oauthlib==0.4.1 googleapis-common-protos==1.52.0 httplib2==0.18.1 idna==2.10 oauth2client==4.1.3 oauthlib==3.1.0 protobuf==3.12.2 pyasn1==0.4.8 pyasn1-modules==0.2.8 python-slugify==4.0.1 pytube3==9.6.4 pytz==2020.1 requests==2.24.0 requests-oauthlib==1.3.0 rsa==4.6 sitemap-python==0.2.0 six==1.15.0 text-unidecode==1.3 typing-extensions==3.7.4.2 uritemplate==3.0.1 urllib3==1.25.9
Fix failing Pillow install for Python 3.9
Django==2.2.13 psycopg2-binary==2.8.4 elasticsearch>=7.0.0,<8.0.0 rdflib==4.2.2 django-guardian==2.3.0 python-memcached==1.59 celery==4.4.4 django-celery-results==1.2.1 mapbox-vector-tile==1.2.0 SPARQLWrapper==1.8.5 django-recaptcha==2.0.6 edtf==4.0.1 couchdb==1.2 django-revproxy==0.9.15 django-cors-headers==3.1.1 django-oauth-toolkit==1.2.0 python-docx==0.8.10 PyLD[requests]==1.0.5 pyprind==2.11.2 pycryptodome<4.0.0,>=3.3.1 pyshp==2.1.2 requests[security]>=2.18.1 python-slugify==4.0.0 pillow==7.0.0 arcgis2geojson==2.0.0
Django==2.2.13 psycopg2-binary==2.8.4 elasticsearch>=7.0.0,<8.0.0 rdflib==4.2.2 django-guardian==2.3.0 python-memcached==1.59 celery==4.4.4 django-celery-results==1.2.1 mapbox-vector-tile==1.2.0 SPARQLWrapper==1.8.5 django-recaptcha==2.0.6 edtf==4.0.1 couchdb==1.2 django-revproxy==0.9.15 django-cors-headers==3.1.1 django-oauth-toolkit==1.2.0 python-docx==0.8.10 PyLD[requests]==1.0.5 pyprind==2.11.2 pycryptodome<4.0.0,>=3.3.1 pyshp==2.1.2 requests[security]>=2.18.1 python-slugify==4.0.0 pillow>=7.0.0 arcgis2geojson==2.0.0
Add some test data which was left out of a previous commit
>SGN-E741070 [GI|170476] TCGCTTTACAACTAAAACAAAATGGAGGCAAAGTTTGCTCACATCATTCTGTTCTTTCTTCTTGCATTTTCTTTTGAAACTCTCATGGCACGAAAAGAAAGTGATGGGCCAGAAGTCATAAAACTTCTAAAAGAATTTGAATCCGACTCTCGGTGCAAAGGAAAACAATTCTGGCCAGAACTTATTGGTGTACCAGCACTATATGCTAAGGGAATAATTGAGAAGGAAAATCCATCCATAACTAATATTCCAATATTGTTGAATGGTTCTCCAGTCACAAAGGATTTTCGATGTGATCGAGTTCGTCTTTTTGTTAACATTTTGGGTGATGTCGTACAAATTCCCAGGGTGACTTAAATTAATGGATTATTGAAGTAATTAAGCAGCCACATGTTAAAAATAATTAGGGTTCATGTTGATTATAATGTCTCCATGTACTCTTACTATATATATAATTGAATAAATAAAACGTGGCTTAAT
Fix typo in Mike's name
Eyal Reuveni (eyalr) Danny Greenfield (pydanny) Low Kian Seong (lowks) Asheesh Laroia (asheesheventbrite) Michael Mangianello (michaelmanganiello-eb)
Eyal Reuveni (eyalr) Danny Greenfield (pydanny) Low Kian Seong (lowks) Asheesh Laroia (asheesheventbrite) Michael Manganiello (michaelmanganiello-eb)
Add Nehalem/Westmere tags for ICC
macro_name "INTEL" binary_name "icpc" compiler_has_tr1 yes compile_option "-c " output_to_option "-o " add_include_dir_option "-I" add_lib_dir_option "-L" add_lib_option "-l" lib_opt_flags "-O2 -ip -unroll" check_opt_flags "-O2" debug_flags "-g" no_debug_flags "-fomit-frame-pointer" lang_flags "" warning_flags "-w1" shared_flags "-fPIC" dll_import_flags "" dll_export_flags "" makefile_style unix <mach_opt> pentium3 -> "-march=pentium3" pentium4 -> "-march=pentium4" pentium-m -> "-march=pentium3" core2 -> "-march=core2" </mach_opt> <so_link_flags> default -> "$(CXX) -fPIC -shared" </so_link_flags>
macro_name "INTEL" binary_name "icpc" compiler_has_tr1 yes compile_option "-c " output_to_option "-o " add_include_dir_option "-I" add_lib_dir_option "-L" add_lib_option "-l" lib_opt_flags "-O2 -ip -unroll" check_opt_flags "-O2" debug_flags "-g" no_debug_flags "-fomit-frame-pointer" lang_flags "" warning_flags "-w1" shared_flags "-fPIC" dll_import_flags "" dll_export_flags "" makefile_style unix <mach_opt> pentium3 -> "-march=pentium3" pentium4 -> "-march=pentium4" pentium-m -> "-march=pentium3" core2 -> "-march=core2" # ICC 11.1 doesn't have native Nehalem or Westmere support nehalem -> "-march=core2" westmere -> "-march=core2" </mach_opt> <so_link_flags> default -> "$(CXX) -fPIC -shared" </so_link_flags>
Disable Tests related to former message.h
cmake_minimum_required (VERSION 2.6) add_library(utils utils) add_library(common common) target_link_libraries(common utils) set(tests hkdf-test diffie-hellman-test triple-diffie-hellman-test chain-key-derivation-test message-key-derivation-test root-and-chain-key-derivation-test initial-root-and-chain-key-derivation-test message-test message-manipulated-test message-extract-header-test message-keystore-test ratchet-test) foreach(test ${tests}) add_executable(${test} ${test}) target_link_libraries(${test} molch utils common) add_test(${test} "./${test}") if(NOT ("${MEMORYCHECK_COMMAND}" MATCHES "MEMORYCHECK_COMMAND-NOTFOUND")) add_test("${test}-valgrind" ${MEMORYCHECK_COMMAND} ${MEMORYCHECK_COMMAND_OPTIONS} "./${test}") endif(NOT ("${MEMORYCHECK_COMMAND}" MATCHES "MEMORYCHECK_COMMAND-NOTFOUND")) endforeach(test)
cmake_minimum_required (VERSION 2.6) add_library(utils utils) add_library(common common) target_link_libraries(common utils) set(tests hkdf-test diffie-hellman-test triple-diffie-hellman-test chain-key-derivation-test message-key-derivation-test root-and-chain-key-derivation-test initial-root-and-chain-key-derivation-test #message-test #message-manipulated-test #message-extract-header-test message-keystore-test ratchet-test) foreach(test ${tests}) add_executable(${test} ${test}) target_link_libraries(${test} molch utils common) add_test(${test} "./${test}") if(NOT ("${MEMORYCHECK_COMMAND}" MATCHES "MEMORYCHECK_COMMAND-NOTFOUND")) add_test("${test}-valgrind" ${MEMORYCHECK_COMMAND} ${MEMORYCHECK_COMMAND_OPTIONS} "./${test}") endif(NOT ("${MEMORYCHECK_COMMAND}" MATCHES "MEMORYCHECK_COMMAND-NOTFOUND")) endforeach(test)
Use falcon from my git repository
boto==2.11.0 cffi==0.6 cov-core==1.7 coverage==3.6 distribute==0.6.34 falcon==0.1.7.dev1 gunicorn==17.5 httplib2==0.8 ipython==1.0.0 nose==1.3.0 nose-cov==1.6 pyparsing==2.0.1 six==1.3.0 unittest2==0.5.1 wsgiref==0.1.2
boto==2.11.0 cffi==0.6 cov-core==1.7 coverage==3.6 distribute==0.6.34 -e git+http://github.com/sorenh/falcon.git#egg=falcon gunicorn==17.5 httplib2==0.8 ipython==1.0.0 nose==1.3.0 nose-cov==1.6 pyparsing==2.0.1 six==1.3.0 unittest2==0.5.1 wsgiref==0.1.2
Add CMake configuration for iree::modules::hal
# Copyright 2019 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. iree_cc_library( NAME hal HDRS "hal_module.h" SRCS "hal_module.cc" DEPS iree::base::api iree::base::api_util iree::base::tracing iree::hal::api iree::hal::command_queue iree::hal::device iree::vm2 absl::core_headers absl::memory absl::strings absl::span PUBLIC )
Correct 1 typo in typo3 login
/admin.asp /admin.aspx /admin.cfm /admin.jsp /admin.php /admin.php4 /admin.pl /admin.py /admin.rb /administrator /administrator.asp /administrator.aspx /administrator.cfm /administrator.jsp /administrator.php /administrator.php4 /administrator.pl /administrator.py /administrator.rb /admnistrator.php3 /cgi-bin/sqwebmail?noframes=1 /default.asp /exchange/logon.asp /gs/admin /index.php?u= /login.asp /login.aspx /login.cfm /login.php /login.php3 /login.php4 /login.jsp /login.pl /login.py /login.rb /logon.asp /logon.aspx /logon.jsp /logon.php /logon.php3 /logon.php4 /logon.pl /logon.py /logon.rb /typo3/in /utilities/TreeView.asp /webeditor.php /invocactf.php
/admin.asp /admin.aspx /admin.cfm /admin.jsp /admin.php /admin.php4 /admin.pl /admin.py /admin.rb /administrator /administrator.asp /administrator.aspx /administrator.cfm /administrator.jsp /administrator.php /administrator.php4 /administrator.pl /administrator.py /administrator.rb /admnistrator.php3 /cgi-bin/sqwebmail?noframes=1 /default.asp /exchange/logon.asp /gs/admin /index.php?u= /login.asp /login.aspx /login.cfm /login.php /login.php3 /login.php4 /login.jsp /login.pl /login.py /login.rb /logon.asp /logon.aspx /logon.jsp /logon.php /logon.php3 /logon.php4 /logon.pl /logon.py /logon.rb /typo3/ /utilities/TreeView.asp /webeditor.php /invocactf.php
Update fxapom from 1.9.0 to 1.9.1
fxapom==1.9.0 PyJWT==1.4.2 PyPOM==1.0 pytest==3.0.2 pytest-instafail==0.3.0 pytest-selenium==1.3.1 pytest-variables==1.4 pytest-xdist==1.15.0 selenium==3.0.2
fxapom==1.9.1 PyJWT==1.4.2 PyPOM==1.0 pytest==3.0.2 pytest-instafail==0.3.0 pytest-selenium==1.3.1 pytest-variables==1.4 pytest-xdist==1.15.0 selenium==3.0.2
Update pytest-selenium from 1.11.0 to 1.11.3
fxapom==1.10.1 PyPOM==1.2.0 pytest==3.3.1 pytest-selenium==1.11.0 pytest-xdist==1.18.2 selenium==3.8.0
fxapom==1.10.1 PyPOM==1.2.0 pytest==3.3.1 pytest-selenium==1.11.3 pytest-xdist==1.18.2 selenium==3.8.0
Add example file from bitbucket
remote: adding changesets remote: adding manifests remote: adding file changes remote: added 1 changesets with 1 changes to 1 files remote: remote: Create pull request for BRANCH: remote: https://bitbucket.org/jmine_team/jmine-tec/pull-requests/new?source=BRANCH&t=1 remote:
Update pytest from 3.2.3 to 3.2.5
-r requirements.txt coverage==4.4.2 flake8==3.5.0 mccabe==0.6.1 py==1.5.2 pycodestyle==2.3.1 pyflakes==1.6.0 pytest==3.2.3 pytest-cov==2.5.1 pytest-django==3.1.2
-r requirements.txt coverage==4.4.2 flake8==3.5.0 mccabe==0.6.1 py==1.5.2 pycodestyle==2.3.1 pyflakes==1.6.0 pytest==3.2.5 pytest-cov==2.5.1 pytest-django==3.1.2
Update aiohttp from 2.0.6 to 2.0.7
flake8==3.3.0 coverage==4.3.4 sphinx==1.5.4 alabaster>=0.6.2 aiohttp==2.0.6 jinja2==2.9.6 pytest==3.0.7 pytest-cov==2.4.0 yarl==0.10.0 multidict==2.1.4 pytest-aiohttp==0.1.3 -e .
flake8==3.3.0 coverage==4.3.4 sphinx==1.5.4 alabaster>=0.6.2 aiohttp==2.0.7 jinja2==2.9.6 pytest==3.0.7 pytest-cov==2.4.0 yarl==0.10.0 multidict==2.1.4 pytest-aiohttp==0.1.3 -e .
Update pytest from 3.3.0 to 3.3.2
# Runtime requirements --requirement requirements.txt # Testing pytest==3.3.0 pytest-cov==2.5.1 # Documentation Sphinx==1.6.5 sphinx_rtd_theme==0.2.4
# Runtime requirements --requirement requirements.txt # Testing pytest==3.3.2 pytest-cov==2.5.1 # Documentation Sphinx==1.6.5 sphinx_rtd_theme==0.2.4
Update boto3 from 1.4.2 to 1.4.3
pip==9.0.1 bumpversion==0.5.3 wheel==0.29.0 watchdog==0.8.3 flake8==3.2.1 tox==2.5.0 coverage==4.2 Sphinx==1.5.1 sphinx_rtd_theme==0.1.10a0 cryptography==1.7.1 PyYAML==3.12 pytest==3.0.5 pytest_cov==2.4.0 pymongo==3.4.0 moto==0.4.30 boto3==1.4.2 click==6.6 git+https://github.com/PyFilesystem/pyfilesystem#egg=0.5.5a1
pip==9.0.1 bumpversion==0.5.3 wheel==0.29.0 watchdog==0.8.3 flake8==3.2.1 tox==2.5.0 coverage==4.2 Sphinx==1.5.1 sphinx_rtd_theme==0.1.10a0 cryptography==1.7.1 PyYAML==3.12 pytest==3.0.5 pytest_cov==2.4.0 pymongo==3.4.0 moto==0.4.30 boto3==1.4.3 click==6.6 git+https://github.com/PyFilesystem/pyfilesystem#egg=0.5.5a1
Update dependency flake8 to v5
flake8==4.0.1 pylint==2.14.5 pytype==2022.7.18
flake8==5.0.2 pylint==2.14.5 pytype==2022.7.18
Update dependency pytz to v2020.4
cachetools==4.1.1 certifi==2020.6.20 chardet==3.0.4 coverage==5.3 google-api-core==1.23.0 google-api-python-client==1.12.5 google-auth==1.23.0 google-auth-httplib2==0.0.4 google-auth-oauthlib==0.4.2 googleapis-common-protos==1.52.0 httplib2==0.18.1 idna==2.10 oauth2client==4.1.3 oauthlib==3.1.0 protobuf==3.13.0 pyasn1==0.4.8 pyasn1-modules==0.2.8 python-slugify==4.0.1 pytube3==9.6.4 pytz==2020.1 requests==2.24.0 requests-oauthlib==1.3.0 rsa==4.6 sitemap-python==0.2.0 six==1.15.0 text-unidecode==1.3 typing-extensions==3.7.4.3 uritemplate==3.0.1 urllib3==1.25.11
cachetools==4.1.1 certifi==2020.6.20 chardet==3.0.4 coverage==5.3 google-api-core==1.23.0 google-api-python-client==1.12.5 google-auth==1.23.0 google-auth-httplib2==0.0.4 google-auth-oauthlib==0.4.2 googleapis-common-protos==1.52.0 httplib2==0.18.1 idna==2.10 oauth2client==4.1.3 oauthlib==3.1.0 protobuf==3.13.0 pyasn1==0.4.8 pyasn1-modules==0.2.8 python-slugify==4.0.1 pytube3==9.6.4 pytz==2020.4 requests==2.24.0 requests-oauthlib==1.3.0 rsa==4.6 sitemap-python==0.2.0 six==1.15.0 text-unidecode==1.3 typing-extensions==3.7.4.3 uritemplate==3.0.1 urllib3==1.25.11
Update newrelic package to 2.102.0
# Core packages python-dotenv==0.7.1 # Read environment variables from .env Flask==0.12.2 # Web microframework Flask-Assets==0.12 # Merge and minify CSS and JS assets Jinja2>=2.8.1 # Templating for Flask; pinned past security update cssmin==0.2.0 # CSS minification uWSGI==2.0.15 # Application server # Features flask-sitemap==0.2.0 # Web sitemaps # Monitoring/tracking/logging blinker==1.4 # Dependency of rollbar newrelic==2.100.0.84 # Website monitoring rollbar==0.13.17 # rollbar.com error logging
# Core packages python-dotenv==0.7.1 # Read environment variables from .env Flask==0.12.2 # Web microframework Flask-Assets==0.12 # Merge and minify CSS and JS assets Jinja2>=2.8.1 # Templating for Flask; pinned past security update cssmin==0.2.0 # CSS minification uWSGI==2.0.15 # Application server # Features flask-sitemap==0.2.0 # Web sitemaps # Monitoring/tracking/logging blinker==1.4 # Dependency of rollbar newrelic==2.102.0.85 # Website monitoring rollbar==0.13.17 # rollbar.com error logging
Update flake8 from 3.5.0 to 3.7.5
-r requirements.txt # For tests coverage==4.5.2 coveralls==1.5.1 flake8==3.5.0 flake8-per-file-ignores==0.8.1 freezegun==0.3.11 hypothesis==3.82.1 mock==2.0.0 pytest==3.3.0 pytest-cov==2.6.0 requests-mock==1.5.2 testfixtures==6.3.0 git+https://github.com/alphagov/digitalmarketplace-test-utils.git@2.3.0#egg=digitalmarketplace-test-utils==2.3.0 # For schema generation alchemyjsonschema==0.5.0
-r requirements.txt # For tests coverage==4.5.2 coveralls==1.5.1 flake8==3.7.5 flake8-per-file-ignores==0.8.1 freezegun==0.3.11 hypothesis==3.82.1 mock==2.0.0 pytest==3.3.0 pytest-cov==2.6.0 requests-mock==1.5.2 testfixtures==6.3.0 git+https://github.com/alphagov/digitalmarketplace-test-utils.git@2.3.0#egg=digitalmarketplace-test-utils==2.3.0 # For schema generation alchemyjsonschema==0.5.0
Upgrade dependency requests to ==2.16.3
coreapi==2.3.1 Django==1.11.1 django-rest-swagger==2.1.2 django-webpack-loader==0.5.0 djangorestframework==3.6.3 djangorestframework-jwt==1.10.0 freezegun==0.3.9 itypes==1.1.0 openapi-codec==1.2.1 psycopg2==2.7.1 PyJWT==1.5.0 python-dateutil==2.6.0 requests==2.16.2 simplejson==3.10.0 six==1.10.0 uritemplate==3.0.0 uWSGI==2.0.15
coreapi==2.3.1 Django==1.11.1 django-rest-swagger==2.1.2 django-webpack-loader==0.5.0 djangorestframework==3.6.3 djangorestframework-jwt==1.10.0 freezegun==0.3.9 itypes==1.1.0 openapi-codec==1.2.1 psycopg2==2.7.1 PyJWT==1.5.0 python-dateutil==2.6.0 requests==2.16.3 simplejson==3.10.0 six==1.10.0 uritemplate==3.0.0 uWSGI==2.0.15
Update pytest from 4.6.2 to 4.6.3
pip==19.1.1 bumpversion==0.5.3 wheel==0.33.4 watchdog==0.9.0 flake8==3.7.7 tox==3.10.0 coverage==4.5.3 Sphinx==1.8.5 cryptography==2.6.1 PyYAML==5.1b5 pytest==4.6.2 pytest-cov==2.7.1 coveralls==1.7.0 pytest-runner==4.4 numpy==1.16.3 pandas==0.24.2
pip==19.1.1 bumpversion==0.5.3 wheel==0.33.4 watchdog==0.9.0 flake8==3.7.7 tox==3.10.0 coverage==4.5.3 Sphinx==1.8.5 cryptography==2.6.1 PyYAML==5.1b5 pytest==4.6.3 pytest-cov==2.7.1 coveralls==1.7.0 pytest-runner==4.4 numpy==1.16.3 pandas==0.24.2
Update sphinx from 1.8.5 to 2.0.0
nbsphinx==0.4.2 sphinx==1.8.5 sphinxcontrib-programoutput==0.13 sphinx_rtd_theme==0.4.3 ipython==7.4.0
nbsphinx==0.4.2 sphinx==2.0.0 sphinxcontrib-programoutput==0.13 sphinx_rtd_theme==0.4.3 ipython==7.4.0
Update pytest from 3.2.5 to 3.3.0
docker==2.6.1 molecule==1.25.0 pytest==3.2.5 python-vagrant==0.5.15 tox==2.9.1 testinfra==1.10.0
docker==2.6.1 molecule==1.25.0 pytest==3.3.0 python-vagrant==0.5.15 tox==2.9.1 testinfra==1.10.0
Update aiohttp from 3.5.2 to 3.5.4
pycparser==2.19 aioamqp==0.12.0 aiobotocore==0.10.0 aiodns==1.1.1 aiohttp==3.5.2 async-timeout==3.0.1 attrs==18.2.0 botocore==1.12.49 cchardet==2.1.4 chardet==3.0.4 codecov==2.0.15 colorama==0.4.1 coverage==4.5.2 docutils==0.14 execnet==1.5.0 jmespath==0.9.3 multidict==4.5.2 mypy==0.650 packaging==18.0 protobuf==3.6.1 pycares==2.4.0 pycodestyle==2.4.0 py==1.7.0 pyparsing==2.3.0 pytest==4.0.2 pytest-cov==2.6.0 pytest-forked==0.2 pytest-xdist==1.25.0 python-dateutil==2.7.5 pytz==2018.9 readme-renderer==24.0 requests==2.20.1 six==1.12.0 tzlocal==1.5.1 ujson==1.35 uvloop==0.11.3 yarl==1.3.0
pycparser==2.19 aioamqp==0.12.0 aiobotocore==0.10.0 aiodns==1.1.1 aiohttp==3.5.4 async-timeout==3.0.1 attrs==18.2.0 botocore==1.12.49 cchardet==2.1.4 chardet==3.0.4 codecov==2.0.15 colorama==0.4.1 coverage==4.5.2 docutils==0.14 execnet==1.5.0 jmespath==0.9.3 multidict==4.5.2 mypy==0.650 packaging==18.0 protobuf==3.6.1 pycares==2.4.0 pycodestyle==2.4.0 py==1.7.0 pyparsing==2.3.0 pytest==4.0.2 pytest-cov==2.6.0 pytest-forked==0.2 pytest-xdist==1.25.0 python-dateutil==2.7.5 pytz==2018.9 readme-renderer==24.0 requests==2.20.1 six==1.12.0 tzlocal==1.5.1 ujson==1.35 uvloop==0.11.3 yarl==1.3.0
Update molo.surveys from 6.1.3 to 6.1.4
molo.core==6.2.2 molo.commenting==6.0.0 molo.surveys==6.1.3 molo.pwa==6.0.0 molo.servicedirectory==6.0.1 molo.yourwords==6.0.0 molo.polls==6.0.0 mote-prk==0.2.1 django-daterange-filter dateutils==0.6.6 celery<4.0 Unidecode==0.04.16 gunicorn psycopg2 django-modelcluster>=2.0,<3.0 django_compressor==2.2 django-mptt==0.8.7 django-google-analytics-app==3.0.0 django-storages boto # Required by ImageHash, install a working version scipy==0.19.1 # need to remove ES from here when we add it to Molo.core elasticsearch>=2.0.0,<3.0.0
molo.core==6.2.2 molo.commenting==6.0.0 molo.surveys==6.1.4 molo.pwa==6.0.0 molo.servicedirectory==6.0.1 molo.yourwords==6.0.0 molo.polls==6.0.0 mote-prk==0.2.1 django-daterange-filter dateutils==0.6.6 celery<4.0 Unidecode==0.04.16 gunicorn psycopg2 django-modelcluster>=2.0,<3.0 django_compressor==2.2 django-mptt==0.8.7 django-google-analytics-app==3.0.0 django-storages boto # Required by ImageHash, install a working version scipy==0.19.1 # need to remove ES from here when we add it to Molo.core elasticsearch>=2.0.0,<3.0.0
Update pyenchant from 2.0.0 to 3.0.1
pyenchant==2.0.0 django-filebrowser-no-grappelli==3.7.8 Pillow==7.0.0 coverage==5.0.3
pyenchant==3.0.1 django-filebrowser-no-grappelli==3.7.8 Pillow==7.0.0 coverage==5.0.3
Update pyopenssl from 16.2.0 to 17.0.0
# # This file is autogenerated by pip-compile # Make changes in requirements.in, then run this to update: # # pip-compile requirements.in # cffi==1.10.0; platform_python_implementation != 'PyPy' characteristic==14.3.0 # via service-identity cryptography==1.8.1 # via pyopenssl enum34==1.1.6 # via cryptography idna==2.5 # via cryptography, twisted ipaddress==1.0.18 # via cryptography lxml==3.7.3 pyasn1-modules==0.0.8 # via service-identity pyasn1==0.2.3 # via cryptography, pyasn1-modules, service-identity pyopenssl==16.2.0 # via service-identity, twisted service-identity==16.0.0 # via twisted six==1.10.0 # via cryptography, pyopenssl Twisted[tls]==17.1.0 zope.interface==4.3.3 # via twisted # The following packages are commented out because they are # considered to be unsafe in a requirements file: # setuptools # via cryptography, zope.interface
# # This file is autogenerated by pip-compile # Make changes in requirements.in, then run this to update: # # pip-compile requirements.in # cffi==1.10.0; platform_python_implementation != 'PyPy' characteristic==14.3.0 # via service-identity cryptography==1.8.1 # via pyopenssl enum34==1.1.6 # via cryptography idna==2.5 # via cryptography, twisted ipaddress==1.0.18 # via cryptography lxml==3.7.3 pyasn1-modules==0.0.8 # via service-identity pyasn1==0.2.3 # via cryptography, pyasn1-modules, service-identity pyopenssl==17.0.0 # via service-identity, twisted service-identity==16.0.0 # via twisted six==1.10.0 # via cryptography, pyopenssl Twisted[tls]==17.1.0 zope.interface==4.3.3 # via twisted # The following packages are commented out because they are # considered to be unsafe in a requirements file: # setuptools # via cryptography, zope.interface
Add Python module for MySQL
boto==2.3.0 Flask-Compress==1.0.0 Flask-Login==0.2.9 Flask-Migrate==1.2.0 Flask-Script==0.6.6 Flask-SQLAlchemy==2.0 Flask-WTF==0.10.2 Flask==0.10.1 psycopg2==2.5.4 PyReact==0.4.0 pytz==2014.7 tornado==4.0.2 urldecode==0.1
boto==2.3.0 Flask-Compress==1.0.0 Flask-Login==0.2.9 Flask-Migrate==1.2.0 Flask-Script==0.6.6 Flask-SQLAlchemy==2.0 Flask-WTF==0.10.2 Flask==0.10.1 psycopg2==2.5.4 PyReact==0.4.0 pytz==2014.7 tornado==4.0.2 urldecode==0.1 MySQL-python==1.2.5
Update pytest from 3.3.1 to 3.3.2
docker==2.7.0 molecule==1.25.0 pytest==3.3.1 python-vagrant==0.5.15 testinfra==1.10.1 tox==2.9.1
docker==2.7.0 molecule==1.25.0 pytest==3.3.2 python-vagrant==0.5.15 testinfra==1.10.1 tox==2.9.1
Update fonttools from 3.27.0 to 3.28.0
FontTools==3.27.0 ufoLib==2.1.1 fontMath==0.4.5 defcon[pens]==0.5.1
FontTools==3.28.0 ufoLib==2.1.1 fontMath==0.4.5 defcon[pens]==0.5.1
Disable gtest-hist-hist-test-testTF1 is FFTW is not available
ROOT_ADD_GTEST(testTProfile2Poly test_tprofile2poly.cxx LIBRARIES Hist Matrix MathCore RIO) ROOT_ADD_GTEST(testTHn THn.cxx LIBRARIES Hist Matrix MathCore RIO) ROOT_ADD_GTEST(testTF1 test_tf1.cxx LIBRARIES Hist)
ROOT_ADD_GTEST(testTProfile2Poly test_tprofile2poly.cxx LIBRARIES Hist Matrix MathCore RIO) ROOT_ADD_GTEST(testTHn THn.cxx LIBRARIES Hist Matrix MathCore RIO) if(ffw3) ROOT_ADD_GTEST(testTF1 test_tf1.cxx LIBRARIES Hist) endif()
Update relese notes for 1.5.0
1.4.0: Disable color output when stdout is not a tty 1.3.1: Update moment to a more recent version 1.3.0: Allow hosting applications to provide a logger via the logger option in config 1.2.3: Fix a typo in ensure-no-development-scripts exception 1.2.2: Fix a bug with loading migrations when a development script was run before a production script. Calls to console replaced with calls to logger 1.2.1: Fix a major bug with ensuring that migrations that have been run aren't left after new ones in the migration order Also fixes the placeholder empty dependencies becoming real dependencies when the dependencies are reloaded after a failed order fixing. 1.2.0: The close functions of usings can now return promises 1.1.0: Add option skipProgressFlag to runMigrations 1.0.0: The whole code base is now written in typescript. This should not affect the functionality, although the conversion process did reveal a number of minor bugs that have now been fixed. 0.4.0: add output tracking 0.3.0: fix mongo storage returning before having saved migration status 0.3.0: add storage/none for those times when you care about what is available and not about what has been run 0.3.0: add dryRun option to runMigrations to pretend that migrations are being run 0.2.0: add support for rollback 0.1.3: added using/mongodb
1.5.0: Added support for archived/archiving old migrations Added support for implicit dependencies (plural), which takes into account all dead end migrations as the dependencies producing a more sane dependency tree 1.4.0: Disable color output when stdout is not a tty 1.3.1: Update moment to a more recent version 1.3.0: Allow hosting applications to provide a logger via the logger option in config 1.2.3: Fix a typo in ensure-no-development-scripts exception 1.2.2: Fix a bug with loading migrations when a development script was run before a production script. Calls to console replaced with calls to logger 1.2.1: Fix a major bug with ensuring that migrations that have been run aren't left after new ones in the migration order Also fixes the placeholder empty dependencies becoming real dependencies when the dependencies are reloaded after a failed order fixing. 1.2.0: The close functions of usings can now return promises 1.1.0: Add option skipProgressFlag to runMigrations 1.0.0: The whole code base is now written in typescript. This should not affect the functionality, although the conversion process did reveal a number of minor bugs that have now been fixed. 0.4.0: add output tracking 0.3.0: fix mongo storage returning before having saved migration status 0.3.0: add storage/none for those times when you care about what is available and not about what has been run 0.3.0: add dryRun option to runMigrations to pretend that migrations are being run 0.2.0: add support for rollback 0.1.3: added using/mongodb
Update CV of WhereAreTheEyes to 1.2.1 (5)
Categories:Security,Navigation License:NewBSD Author Name:Daylighting Society Author Email:eyes@daylightingsociety.org Web Site:https://eyes.daylightingsociety.org Source Code:https://github.com/DaylightingSociety/WhereAreTheEyes Issue Tracker:https://github.com/DaylightingSociety/WhereAreTheEyes/issues Auto Name:WhereAreTheEyes Summary:Build a map of surveillance cameras with other activists Description: Where are the Eyes is a tool for detecting and evading surveillance. Together, you and other users build a map of surveillance cameras to protect activists, students, and other at-risk minorities. When run, the map will display red pins on cameras near your location. To mark a new camera, or verify that a marked camera exists, just stand near it and press the "eye" button. . Repo Type:git Repo:https://github.com/DaylightingSociety/WhereAreTheEyes Build:1.2,4 commit=570b2282a156404c75b19d62396b51f9d85172ce subdir=Android/app gradle=yes Auto Update Mode:None Update Check Mode:RepoManifest Current Version:1.2 Current Version Code:4
Categories:Security,Navigation License:NewBSD Author Name:Daylighting Society Author Email:eyes@daylightingsociety.org Web Site:https://eyes.daylightingsociety.org Source Code:https://github.com/DaylightingSociety/WhereAreTheEyes Issue Tracker:https://github.com/DaylightingSociety/WhereAreTheEyes/issues Auto Name:WhereAreTheEyes Summary:Build a map of surveillance cameras with other activists Description: Where are the Eyes is a tool for detecting and evading surveillance. Together, you and other users build a map of surveillance cameras to protect activists, students, and other at-risk minorities. When run, the map will display red pins on cameras near your location. To mark a new camera, or verify that a marked camera exists, just stand near it and press the "eye" button. . Repo Type:git Repo:https://github.com/DaylightingSociety/WhereAreTheEyes Build:1.2,4 commit=570b2282a156404c75b19d62396b51f9d85172ce subdir=Android/app gradle=yes Auto Update Mode:None Update Check Mode:RepoManifest Current Version:1.2.1 Current Version Code:5
Update Derandom to 1.4 (5)
Categories:Security License:Apache2 Web Site:https://code.google.com/p/derandom Source Code:https://code.google.com/p/derandom/source Issue Tracker:https://code.google.com/p/derandom/issues Bitcoin:1NZz4TGpJ1VL4Qmqw7aRAurASAT3Cq5S6s Auto Name:Derandom Summary:Pseudo random number predictor Description: Predicts pseudo random numbers based on a sequence of observed numbers. . Repo Type:git Repo:https://code.google.com/p/derandom/ Build:1.3,4 commit=v1.3 subdir=app gradle=yes Auto Update Mode:Version v%v Update Check Mode:Tags Current Version:1.3 Current Version Code:4
Categories:Security License:Apache2 Web Site:https://code.google.com/p/derandom Source Code:https://code.google.com/p/derandom/source Issue Tracker:https://code.google.com/p/derandom/issues Bitcoin:1NZz4TGpJ1VL4Qmqw7aRAurASAT3Cq5S6s Auto Name:Derandom Summary:Pseudo random number predictor Description: Predicts pseudo random numbers based on a sequence of observed numbers. . Repo Type:git Repo:https://code.google.com/p/derandom/ Build:1.3,4 commit=v1.3 subdir=app gradle=yes Build:1.4,5 commit=v1.4 subdir=app gradle=yes Auto Update Mode:Version v%v Update Check Mode:Tags Current Version:1.4 Current Version Code:5
Update pytest-runner from 2.12.1 to 3.0
click==6.7 pytest==3.2.3 pytest-runner==2.12.1 requests==2.18.4 responses==0.8.1
click==6.7 pytest==3.2.3 pytest-runner==3.0 requests==2.18.4 responses==0.8.1
Add new libcap license to the license classifier.
Redistribution and use in source and binary forms of libcap, with or without modification, are permitted provided that the following conditions are met: 1. Redistributions of source code must retain any existing copyright notice, and this entire permission notice in its entirety, including the disclaimer of warranties. 2. Redistributions in binary form must reproduce all prior and current copyright notices, this list of conditions, and the following disclaimer in the documentation and/or other materials provided with the distribution. 3. The name of any author may not be used to endorse or promote products derived from this software without their specific prior written permission. THIS SOFTWARE IS PROVIDED ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR(S) BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
Update AN2Linux to 0.4.0 (5)
Categories:Connectivity License:GPL-3.0 Web Site: Source Code:https://github.com/rootkiwi/an2linuxclient Issue Tracker:https://github.com/rootkiwi/an2linuxclient/issues Auto Name:AN2Linux Summary:Sync Android notifications to a Linux desktop Description: Sync Android notifications encrypted to a Linux desktop with tcp or bluetooth. This is the client part of AN2Linux. . Repo Type:git Repo:https://github.com/rootkiwi/an2linuxclient Build:0.1,1 commit=f58b377ea23049a38be84b4bcf821f296a4ff392 subdir=app gradle=yes Build:0.1.1,2 commit=d7ca07655aea3a6649beee6ab4feeb3825f0a909 subdir=app gradle=yes Build:0.2.0,3 commit=v0.2.0 subdir=app gradle=yes Build:0.3.0,4 commit=v0.3.0 subdir=app gradle=yes Auto Update Mode:Version v%v Update Check Mode:Tags Current Version:0.3.0 Current Version Code:4
Categories:Connectivity License:GPL-3.0 Web Site: Source Code:https://github.com/rootkiwi/an2linuxclient Issue Tracker:https://github.com/rootkiwi/an2linuxclient/issues Auto Name:AN2Linux Summary:Sync Android notifications to a Linux desktop Description: Sync Android notifications encrypted to a Linux desktop with tcp or bluetooth. This is the client part of AN2Linux. . Repo Type:git Repo:https://github.com/rootkiwi/an2linuxclient Build:0.1,1 commit=f58b377ea23049a38be84b4bcf821f296a4ff392 subdir=app gradle=yes Build:0.1.1,2 commit=d7ca07655aea3a6649beee6ab4feeb3825f0a909 subdir=app gradle=yes Build:0.2.0,3 commit=v0.2.0 subdir=app gradle=yes Build:0.3.0,4 commit=v0.3.0 subdir=app gradle=yes Build:0.4.0,5 commit=v0.4.0 subdir=app gradle=yes Auto Update Mode:Version v%v Update Check Mode:Tags Current Version:0.4.0 Current Version Code:5
Update Ameixa to 3.0.7 (46)
Categories:Theming License:GPL-3.0 Web Site:https://xphnx.github.io/fento-suite Source Code:https://gitlab.com/xphnx/ameixa Issue Tracker:https://gitlab.com/xphnx/ameixa/issues Auto Name:Ameixa Summary:Port of TwelF CMTheme for many launchers Description: TwelF is a Material Design inspired theme aiming to provide a consistent and minimalistic look to your device. This theme only supports FLOSS apps icons. Suported launchers: * Trebuchet * Kiss * Nova * Apex * Holo * Asus * Adw * and many more . Repo Type:git Repo:https://gitlab.com/xphnx/ameixa.git Build:2.9.8-alpha,37 commit=v2.9.8-alpha subdir=app gradle=yes Build:3.0.6,45 commit=v3.0.6 subdir=app gradle=yes Auto Update Mode:Version v%v Update Check Mode:Tags Current Version:3.0.6 Current Version Code:45
Categories:Theming License:GPL-3.0 Web Site:https://xphnx.github.io/fento-suite Source Code:https://gitlab.com/xphnx/ameixa Issue Tracker:https://gitlab.com/xphnx/ameixa/issues Auto Name:Ameixa Summary:Port of TwelF CMTheme for many launchers Description: TwelF is a Material Design inspired theme aiming to provide a consistent and minimalistic look to your device. This theme only supports FLOSS apps icons. Suported launchers: * Trebuchet * Kiss * Nova * Apex * Holo * Asus * Adw * and many more . Repo Type:git Repo:https://gitlab.com/xphnx/ameixa.git Build:2.9.8-alpha,37 commit=v2.9.8-alpha subdir=app gradle=yes Build:3.0.6,45 commit=v3.0.6 subdir=app gradle=yes Build:3.0.7,46 commit=v3.0.7 subdir=app gradle=yes Auto Update Mode:Version v%v Update Check Mode:Tags Current Version:3.0.7 Current Version Code:46
Update Stoic Reading to 0.8.5 (10)
Categories:Reading License:GPL-3.0-or-later Author Name:Paul Hill Web Site:https://github.com/zikalify/StoicReading Source Code:https://github.com/zikalify/StoicReading Issue Tracker:https://github.com/zikalify/StoicReading/issues Auto Name:Stoic Reading Summary:Consolidation of Stoic texts Description: This app contains texts from Stoics including those of Emperor Marcus Aurelius, the freed slave Epictetus, and Seneca. It contains other, less well known, Stoic texts too. . Repo Type:git Repo:https://github.com/zikalify/StoicReading Build:0.7.1,4 commit=0.7.1 subdir=app gradle=yes Build:0.8.0,5 commit=0.8.0 subdir=app gradle=yes Build:0.8.2,7 commit=0.8.2 subdir=app gradle=yes Build:0.8.3,8 commit=0.8.3 subdir=app gradle=yes Auto Update Mode:Version %v Update Check Mode:Tags ^[0-9.]+$ Current Version:0.8.3 Current Version Code:8
Categories:Reading License:GPL-3.0-or-later Author Name:Paul Hill Web Site:https://github.com/zikalify/StoicReading Source Code:https://github.com/zikalify/StoicReading Issue Tracker:https://github.com/zikalify/StoicReading/issues Auto Name:Stoic Reading Summary:Consolidation of Stoic texts Description: This app contains texts from Stoics including those of Emperor Marcus Aurelius, the freed slave Epictetus, and Seneca. It contains other, less well known, Stoic texts too. . Repo Type:git Repo:https://github.com/zikalify/StoicReading Build:0.7.1,4 commit=0.7.1 subdir=app gradle=yes Build:0.8.0,5 commit=0.8.0 subdir=app gradle=yes Build:0.8.2,7 commit=0.8.2 subdir=app gradle=yes Build:0.8.3,8 commit=0.8.3 subdir=app gradle=yes Build:0.8.5,10 commit=0.8.5 subdir=app gradle=yes Auto Update Mode:Version %v Update Check Mode:Tags ^[0-9.]+$ Current Version:0.8.5 Current Version Code:10
Update isort from 4.2.13 to 4.2.15
-e . coverage==4.4.1 isort==4.2.13 py==1.4.33 pytest-django==3.1.2 pytest==3.1.1 selenium==3.4.2
-e . coverage==4.4.1 isort==4.2.15 py==1.4.33 pytest-django==3.1.2 pytest==3.1.1 selenium==3.4.2
Update pre-commit from 1.1.0 to 1.1.1
-e . coverage==4.4.1 flake8==3.4.1 isort==4.2.15 mccabe==0.6.1 pydocstyle==2.0.0 pep8==1.7.0 pep8-naming==0.4.1 pre-commit==1.1.0 py==1.4.34 pytest==3.2.2 pytest-django==3.1.2 mock==2.0.0 pbr==3.1.1
-e . coverage==4.4.1 flake8==3.4.1 isort==4.2.15 mccabe==0.6.1 pydocstyle==2.0.0 pep8==1.7.0 pep8-naming==0.4.1 pre-commit==1.1.1 py==1.4.34 pytest==3.2.2 pytest-django==3.1.2 mock==2.0.0 pbr==3.1.1
Update psycopg2 from 2.8.1 to 2.8.2
# Pro-tip: Try not to put anything here. There should be no dependency in # production that isn't in development. -r base.txt gunicorn==19.9.0 psycopg2==2.8.1 dj-database-url==0.5.0
# Pro-tip: Try not to put anything here. There should be no dependency in # production that isn't in development. -r base.txt gunicorn==19.9.0 psycopg2==2.8.2 dj-database-url==0.5.0
Install Clang's headers into the right place in the build tree, for regression testing
set(files iso646.h mmintrin.h stdarg.h stdbool.h stddef.h ) set(output_dir ${CMAKE_RUNTIME_OUTPUT_DIRECTORY}/../Headers) foreach( f ${files} ) set( src ${CMAKE_CURRENT_SOURCE_DIR}/${f} ) set( dst ${output_dir}/${f} ) add_custom_command(OUTPUT ${dst} DEPENDS ${src} COMMAND ${CMAKE_COMMAND} -E copy_if_different ${src} ${dst} COMMENT "Copying clang's ${f}...") endforeach( f ) add_custom_target(clang_headers ALL DEPENDS ${files}) install(FILES ${files} PERMISSIONS OWNER_READ OWNER_WRITE GROUP_READ WORLD_READ DESTINATION Headers)
set(files emmintrin.h float.h iso646.h limits.h mm_malloc.h mmintrin.h pmmintrin.h stdarg.h stdbool.h stddef.h stdint.h tgmath.h tmmintrin.h xmmintrin.h) #FIXME: Centralize Clang version info set(output_dir ${LLVM_BINARY_DIR}/${CMAKE_CFG_INTDIR}/lib/clang/1.0/include) foreach( f ${files} ) set( src ${CMAKE_CURRENT_SOURCE_DIR}/${f} ) set( dst ${output_dir}/${f} ) add_custom_command(OUTPUT ${dst} DEPENDS ${src} COMMAND ${CMAKE_COMMAND} -E copy_if_different ${src} ${dst} COMMENT "Copying clang's ${f}...") endforeach( f ) add_custom_target(clang_headers ALL DEPENDS ${files}) install(FILES ${files} PERMISSIONS OWNER_READ OWNER_WRITE GROUP_READ WORLD_READ DESTINATION Headers)
Update dependency sphinx to v5
-r ../requirements.txt sphinx==4.5.0 sphinx_rtd_theme==1.0.0 sphinxcontrib-svg2pdfconverter==1.2.0
-r ../requirements.txt sphinx==5.0.0 sphinx_rtd_theme==1.0.0 sphinxcontrib-svg2pdfconverter==1.2.0
Update pytest-cov from 2.8.1 to 2.9.0
# Test requirements pytest==5.4.2 pytest-cov==2.8.1 pytest-django==3.4.2 flake8==2.4.0 ipdb # wheel for PyPI installs wheel==0.24.0 # MkDocs for documentation previews/deploys mkdocs==0.11.1
# Test requirements pytest==5.4.2 pytest-cov==2.9.0 pytest-django==3.4.2 flake8==2.4.0 ipdb # wheel for PyPI installs wheel==0.24.0 # MkDocs for documentation previews/deploys mkdocs==0.11.1
Update pytest from 6.2.4 to 6.2.5
wheel==0.37.0 pip==21.2.4 watchdog==2.1.5 pip==21.2.4 flake8==3.9.2 Sphinx==4.1.2 tox==3.24.3 coverage==5.5 PyYAML==5.4.1 pytest==6.2.4
wheel==0.37.0 pip==21.2.4 watchdog==2.1.5 pip==21.2.4 flake8==3.9.2 Sphinx==4.1.2 tox==3.24.3 coverage==5.5 PyYAML==5.4.1 pytest==6.2.5
Update tox from 2.3.1 to 2.8.1
pip==9.0.1 bumpversion==0.5.3 wheel==0.29.0 watchdog==0.8.3 flake8==3.4.1 tox==2.3.1 coverage==4.1 Sphinx==1.4.8 cryptography==1.7 PyYAML==3.11 pytest==2.9.2 pytest-runner==2.11.1
pip==9.0.1 bumpversion==0.5.3 wheel==0.29.0 watchdog==0.8.3 flake8==3.4.1 tox==2.8.1 coverage==4.1 Sphinx==1.4.8 cryptography==1.7 PyYAML==3.11 pytest==2.9.2 pytest-runner==2.11.1
Update pygithub from 1.51 to 1.53
# install all base requirements -r requirements.txt python_http_client==3.3.1 invoke==1.4.1 twine==3.2.0 # Tests pytest==6.0.1 pytest-cov==2.10.1 codecov==2.1.9 python-coveralls==2.9.3 coveralls==2.1.2 mock==4.0.2 # Version update PyGithub==1.51 bumpversion==0.6.0
# install all base requirements -r requirements.txt python_http_client==3.3.1 invoke==1.4.1 twine==3.2.0 # Tests pytest==6.0.1 pytest-cov==2.10.1 codecov==2.1.9 python-coveralls==2.9.3 coveralls==2.1.2 mock==4.0.2 # Version update PyGithub==1.53 bumpversion==0.6.0
Add other authors to license
The MIT License (MIT) Copyright © 2014-2016 Chris Olstrom <chris@olstrom.com> Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the “Software”), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED “AS IS”, WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
The MIT License (MIT) Copyright © 2014-2016 Chris Olstrom <chris@olstrom.com> Copyright © 2016 Ben Visser Copyright © 2015 Steven Harradine Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the “Software”), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED “AS IS”, WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
Update intervals from 0.8.0 to 0.8.1
sortedcontainers==1.5.7 arrow==0.10.0 future==0.16.0 intervals==0.8.0
sortedcontainers==1.5.7 arrow==0.10.0 future==0.16.0 intervals==0.8.1
Update CV of StockTicker to 4.01.00 (23)
Categories:Office License:MIT Web Site:https://github.com/premnirmal/StockTicker/blob/HEAD/README.md Source Code:https://github.com/premnirmal/StockTicker Issue Tracker:https://github.com/premnirmal/StockTicker/issues Auto Name:StockTicker Summary:Stock market ticker widget Description: Widget that shows your stock portolio in a resizable grid. You can sort the list by drag-and-drop and the list can be exported and re-imported. . Repo Type:git Repo:https://github.com/premnirmal/StockTicker Build:3.30.00,20 commit=ef9a373842cdb02795e6e32ead9b4a320d789c4e subdir=app gradle=yes prebuild=sed -i -e '/applicationId/d' build.gradle Build:3.40.00,21 commit=1bc34a98ace16b5a4bd5cfd5d5706272c2887cee subdir=app gradle=yes Build:4.00.00,22 commit=f097a5841dabcb4a4e843e849116f5292c8ed64f subdir=app gradle=yes Auto Update Mode:None Update Check Mode:RepoManifest Current Version:4.00.00 Current Version Code:22
Categories:Office License:MIT Web Site:https://github.com/premnirmal/StockTicker/blob/HEAD/README.md Source Code:https://github.com/premnirmal/StockTicker Issue Tracker:https://github.com/premnirmal/StockTicker/issues Auto Name:StockTicker Summary:Stock market ticker widget Description: Widget that shows your stock portolio in a resizable grid. You can sort the list by drag-and-drop and the list can be exported and re-imported. . Repo Type:git Repo:https://github.com/premnirmal/StockTicker Build:3.30.00,20 commit=ef9a373842cdb02795e6e32ead9b4a320d789c4e subdir=app gradle=yes prebuild=sed -i -e '/applicationId/d' build.gradle Build:3.40.00,21 commit=1bc34a98ace16b5a4bd5cfd5d5706272c2887cee subdir=app gradle=yes Build:4.00.00,22 commit=f097a5841dabcb4a4e843e849116f5292c8ed64f subdir=app gradle=yes Auto Update Mode:None Update Check Mode:RepoManifest Current Version:4.01.00 Current Version Code:23
Update sphinx from 1.6.6 to 1.6.7
sphinx==1.6.6 sphinx-rtd-theme==0.2.4 Django==2.0.1 -e .
sphinx==1.6.7 sphinx-rtd-theme==0.2.4 Django==2.0.1 -e .
Update django from 2.1.1 to 2.1.2
crispy-forms-bulma==1.1.4 Django==2.1.1 django-avatar==4.1.0 django-allauth==0.37.1 django-configurations==2.1 django-crispy-forms==1.7.2 django-polymorphic==2.0.3 django-sendgrid-v5==0.6.893 django-storages==1.7.1 djangorestframework==3.8.2 django-debug-toolbar==1.10.1 django-extensions==2.1.3 dj_database_url==0.5.0 google-cloud-storage==1.12.0 Pillow==5.2.0 pyjwt==1.6.4 psycopg2==2.7.5 raven==6.9.0 requests==2.19.1 sh==1.12.14
crispy-forms-bulma==1.1.4 Django==2.1.2 django-avatar==4.1.0 django-allauth==0.37.1 django-configurations==2.1 django-crispy-forms==1.7.2 django-polymorphic==2.0.3 django-sendgrid-v5==0.6.893 django-storages==1.7.1 djangorestframework==3.8.2 django-debug-toolbar==1.10.1 django-extensions==2.1.3 dj_database_url==0.5.0 google-cloud-storage==1.12.0 Pillow==5.2.0 pyjwt==1.6.4 psycopg2==2.7.5 raven==6.9.0 requests==2.19.1 sh==1.12.14
Update sphinx from 1.6.5 to 1.6.6
sphinx==1.6.5 PyYAML==3.12 sphinx-issues==0.4.0
sphinx==1.6.6 PyYAML==3.12 sphinx-issues==0.4.0
Update to the lib list of llvm's / clang's trunk.
#set( LLVM_LINK_COMPONENTS # jit # linker # native # ) add_cling_executable(cling cling.cpp) target_link_libraries(cling clingUserInterface clingMetaProcessor clingInterpreter clingUtils clangFrontend clangSerialization clangDriver clangCodeGen clangParse clangSema clangAnalysis clangAST clangLex clangBasic clangEdit ) install(TARGETS cling RUNTIME DESTINATION bin)
set( LLVM_LINK_COMPONENTS ${LLVM_TARGETS_TO_BUILD} asmparser bitreader bitwriter irreader codegen instrumentation ipo # linker selectiondag jit native ) add_cling_executable(cling cling.cpp) target_link_libraries(cling clangAST clangAnalysis clangBasic clangCodeGen clangDriver clangEdit clangFrontend clangLex clangParse clangSema clangSerialization clangStaticAnalyzerCore clingUserInterface clingMetaProcessor clingInterpreter clingUtils ) install(TARGETS cling RUNTIME DESTINATION bin)
Enable SSE2 engine under VC++
realname "SSE2 Assembler Engine" define ENGINE_SSE2_ASSEMBLER load_on dep <add> eng_sse2.cpp eng_sse2.h </add> <arch> pentium-m pentium4 prescott amd64 </arch> <cc> gcc icc </cc>
realname "SSE2 Assembler Engine" define ENGINE_SSE2_ASSEMBLER load_on dep <add> eng_sse2.cpp eng_sse2.h </add> <arch> pentium-m pentium4 prescott amd64 </arch> <cc> gcc icc msvc </cc>
Update types-setuptools package to 65.4.0.0
# Testing coverage==6.5.0 # Test coverage flake8==5.0.4 # Python linting # Types mypy==0.982 # Static typing types-setuptools==63.2.2 # Type stubs for setuptools package
# Testing coverage==6.5.0 # Test coverage flake8==5.0.4 # Python linting # Types mypy==0.982 # Static typing types-setuptools==65.4.0.0 # Type stubs for setuptools package
Update easy-thumbnails from 2.5 to 2.6
git+git://github.com/liqd/adhocracy4.git@mB-v2.0.3#egg=adhocracy4 Django==1.11.20 # pyup: <2.0 wagtail==2.3 # pyup: <2.4 bcrypt==3.1.6 brotli==1.0.7 django-capture-tag==1.0 django_csp==3.5 requests==2.21.0 whitenoise==4.1.2 zeep==3.3.1 # Inherited a4-core requirements bleach==3.1.0 django-allauth==0.39.1 django-autoslug==1.9.4 django-background-tasks==1.2.0 django-cachalot==2.1.0 django-ckeditor==5.6.1 django-cloudflare-push==0.2.0 django-multiselectfield==0.1.8 django-filter==2.1.0 django-sites==0.10 django-widget-tweaks==1.4.3 djangorestframework==3.9.2 easy-thumbnails==2.5 html5lib==1.0.1 jsonfield==2.0.2 python-dateutil==2.7.3 python-magic==0.4.15 raven==6.9.0 rules==1.3 XlsxWriter==1.1.1
git+git://github.com/liqd/adhocracy4.git@mB-v2.0.3#egg=adhocracy4 Django==1.11.20 # pyup: <2.0 wagtail==2.3 # pyup: <2.4 bcrypt==3.1.6 brotli==1.0.7 django-capture-tag==1.0 django_csp==3.5 requests==2.21.0 whitenoise==4.1.2 zeep==3.3.1 # Inherited a4-core requirements bleach==3.1.0 django-allauth==0.39.1 django-autoslug==1.9.4 django-background-tasks==1.2.0 django-cachalot==2.1.0 django-ckeditor==5.6.1 django-cloudflare-push==0.2.0 django-multiselectfield==0.1.8 django-filter==2.1.0 django-sites==0.10 django-widget-tweaks==1.4.3 djangorestframework==3.9.2 easy-thumbnails==2.6 html5lib==1.0.1 jsonfield==2.0.2 python-dateutil==2.7.3 python-magic==0.4.15 raven==6.9.0 rules==1.3 XlsxWriter==1.1.1
Abort at cmake time instead of compile time if boost has not been found.
find_package( Boost REQUIRED ) configure_file(akonadi-prefix.h.cmake ${CMAKE_CURRENT_BINARY_DIR}/akonadi-prefix.h) check_include_files(execinfo.h HAVE_EXECINFO_H) configure_file(config-akonadi.h.cmake ${CMAKE_CURRENT_BINARY_DIR}/config-akonadi.h) if (XSLTPROC_EXECUTABLE) add_subdirectory(server) endif (XSLTPROC_EXECUTABLE) add_subdirectory(libakonadi) add_subdirectory(clients) add_subdirectory(resources) add_subdirectory(searchproviders) add_subdirectory(kioslave) add_subdirectory(plugins) add_subdirectory(models)
find_package( Boost REQUIRED ) macro_log_feature(Boost_FOUND "boost" "Boost C++ Libraries" "http://www.boost.org/" TRUE "" "Required by Akonadi") configure_file(akonadi-prefix.h.cmake ${CMAKE_CURRENT_BINARY_DIR}/akonadi-prefix.h) check_include_files(execinfo.h HAVE_EXECINFO_H) configure_file(config-akonadi.h.cmake ${CMAKE_CURRENT_BINARY_DIR}/config-akonadi.h) if (XSLTPROC_EXECUTABLE) add_subdirectory(server) endif (XSLTPROC_EXECUTABLE) add_subdirectory(libakonadi) add_subdirectory(clients) add_subdirectory(resources) add_subdirectory(searchproviders) add_subdirectory(kioslave) add_subdirectory(plugins) add_subdirectory(models)
Copy python test file to build dir
find_package(PythonInterp) find_package(PythonLibs ${PYTHON_VERSION_STRING}) include_directories(${PYTHON_INCLUDE_DIRS}) find_package(Boost COMPONENTS python) add_library(pyamgcl pyamgcl.cpp) set_target_properties(pyamgcl PROPERTIES PREFIX "") target_link_Libraries(pyamgcl amgcl ${Boost_LIBRARIES})
find_package(PythonInterp) find_package(PythonLibs ${PYTHON_VERSION_STRING}) include_directories(${PYTHON_INCLUDE_DIRS}) find_package(Boost COMPONENTS python) add_library(pyamgcl pyamgcl.cpp) set_target_properties(pyamgcl PROPERTIES PREFIX "") target_link_Libraries(pyamgcl amgcl ${Boost_LIBRARIES}) configure_file( ${CMAKE_CURRENT_SOURCE_DIR}/test.py ${CMAKE_CURRENT_BINARY_DIR}/test.py COPYONLY )
Update mypy package to 0.812
# Testing coverage==5.5 # Test coverage flake8==3.9.0 # Python linting mypy==0.800 # Type checking
# Testing coverage==5.5 # Test coverage flake8==3.9.0 # Python linting mypy==0.812 # Type checking
Update django-crispy-forms from 1.6.1 to 1.7.0
# Configuration django-environ==0.4.4 # Forms django-braces==1.11.0 django-crispy-forms==1.6.1 # Models django-model-utils==3.0.0 # For user registration, either via email or social # Well-built with regular release cycles! django-allauth==0.33.0 # For the persistence stores psycopg2==2.7.3.1 # Unicode slugification unicode-slugify==0.1.3 django-autoslug==1.9.3 # Time zones support pytz==2017.2 # Redis support django-redis==4.8.0 redis>=2.10.0 jsonfield==2.0.2 django-reversion==2.0.10 reportlab==3.4.0 django-filter==1.0.4 # API requests==2.18.4 django-ratelimit==1.0.1 django-grappelli==2.10.1 # Autocomplete django-autocomplete-light==3.2.10 #Babel Babel==2.5.1 #RQ rq==0.8.2 #Boto boto==2.48.0
# Configuration django-environ==0.4.4 # Forms django-braces==1.11.0 django-crispy-forms==1.7.0 # Models django-model-utils==3.0.0 # For user registration, either via email or social # Well-built with regular release cycles! django-allauth==0.33.0 # For the persistence stores psycopg2==2.7.3.1 # Unicode slugification unicode-slugify==0.1.3 django-autoslug==1.9.3 # Time zones support pytz==2017.2 # Redis support django-redis==4.8.0 redis>=2.10.0 jsonfield==2.0.2 django-reversion==2.0.10 reportlab==3.4.0 django-filter==1.0.4 # API requests==2.18.4 django-ratelimit==1.0.1 django-grappelli==2.10.1 # Autocomplete django-autocomplete-light==3.2.10 #Babel Babel==2.5.1 #RQ rq==0.8.2 #Boto boto==2.48.0
Update django-redis from 4.4.4 to 4.7.0
# Wheel 0.25+ needed to install certain packages on CPython 3.5+ # like Pillow and psycopg2 # See http://bitly.com/wheel-building-fails-CPython-35 # Verified bug on Python 3.5.1 wheel==0.29.0 # Bleeding edge Django django==1.10.1 # Configuration django-environ==0.4.0 # Forms django-braces==1.9.0 django-crispy-forms==1.6.1 django-floppyforms==1.7.0 # Models django-model-utils==2.5.2 # Images Pillow==4.0.0 # For user registration, either via email or social # Well-built with regular release cycles! django-allauth==0.27.0 # Python-PostgreSQL Database Adapter psycopg2==2.6.2 # Unicode slugification unicode-slugify==0.1.3 django-autoslug==1.9.3 # Time zones support pytz==2016.6.1 # Redis support django-redis==4.4.4 redis>=2.10.0 celery==4.0.2 # Your custom requirements go here packtools==1.3.2 pyclamd==0.3.17
# Wheel 0.25+ needed to install certain packages on CPython 3.5+ # like Pillow and psycopg2 # See http://bitly.com/wheel-building-fails-CPython-35 # Verified bug on Python 3.5.1 wheel==0.29.0 # Bleeding edge Django django==1.10.1 # Configuration django-environ==0.4.0 # Forms django-braces==1.9.0 django-crispy-forms==1.6.1 django-floppyforms==1.7.0 # Models django-model-utils==2.5.2 # Images Pillow==4.0.0 # For user registration, either via email or social # Well-built with regular release cycles! django-allauth==0.27.0 # Python-PostgreSQL Database Adapter psycopg2==2.6.2 # Unicode slugification unicode-slugify==0.1.3 django-autoslug==1.9.3 # Time zones support pytz==2016.6.1 # Redis support django-redis==4.7.0 redis>=2.10.0 celery==4.0.2 # Your custom requirements go here packtools==1.3.2 pyclamd==0.3.17
Update coverage from '4.3.4' to '4.4.2'.
# adbwp/requirements/test.txt # # Requirements for executing the test suite. -r dev.txt coverage==4.3.4 # pyup: ignore pytest==3.2.3 pytest-benchmark==3.1.1 pytest-cov==2.5.1 pytest-mock==1.6.3 pytest-pep8==1.0.6
# adbwp/requirements/test.txt # # Requirements for executing the test suite. -r dev.txt coverage==4.4.2 pytest==3.2.3 pytest-benchmark==3.1.1 pytest-cov==2.5.1 pytest-mock==1.6.3 pytest-pep8==1.0.6
Update coverage from 5.3.1 to 5.4
coverage==5.3.1 mock>=1.0.1 flake8>=2.1.0 tox>=1.7.0 codecov>=2.0.0 # Additional test requirements go here
coverage==5.4 mock>=1.0.1 flake8>=2.1.0 tox>=1.7.0 codecov>=2.0.0 # Additional test requirements go here
TEST Python 3 version of the add group CLI command
FROM debian:9 MAINTAINER Jean Gabes <naparuba@gmail.com> ADD test/docker-helper/ / RUN /apt_get_install python3 # All need for debian, so faster test (we are testging feature here, not install) RUN /apt_get_install python3-jinja2 RUN /apt_get_install python3-crypto RUN /apt_get_install python3-setuptools RUN /apt_get_install python3-apt # Set python3 as default python RUN update-alternatives --install /usr/bin/python python /usr/bin/python3 1 ADD . /root/opsbro-oss WORKDIR /root/opsbro-oss RUN python setup.py install ENTRYPOINT test/test_feature_agent_groups_add.sh
Update CV of RasPi Check to v1.8.9 (50)
Categories:Connectivity,Development License:GPL-2.0+ Web Site:https://github.com/eidottermihi/rpicheck/blob/HEAD/README.md Source Code:https://github.com/eidottermihi/rpicheck Issue Tracker:https://github.com/eidottermihi/rpicheck/issues Changelog:https://github.com/eidottermihi/rpicheck/releases Auto Name:RasPi Check Summary:Check the status of your RasPi Description: Show the user the current system status of a running Raspberry Pi computer. To gather the information needed, RasPi Check uses a SSH connection. . Repo Type:git Repo:https://github.com/eidottermihi/rpicheck Build:1.8.0,39 commit=v1.8.0 subdir=app gradle=yes Auto Update Mode:None Update Check Mode:Tags Current Version:v1.8.8 Current Version Code:49
Categories:Connectivity,Development License:GPL-2.0+ Web Site:https://github.com/eidottermihi/rpicheck/blob/HEAD/README.md Source Code:https://github.com/eidottermihi/rpicheck Issue Tracker:https://github.com/eidottermihi/rpicheck/issues Changelog:https://github.com/eidottermihi/rpicheck/releases Auto Name:RasPi Check Summary:Check the status of your RasPi Description: Show the user the current system status of a running Raspberry Pi computer. To gather the information needed, RasPi Check uses a SSH connection. . Repo Type:git Repo:https://github.com/eidottermihi/rpicheck Build:1.8.0,39 commit=v1.8.0 subdir=app gradle=yes Auto Update Mode:None Update Check Mode:Tags Current Version:v1.8.9 Current Version Code:50
Fix build on Linux...I haven't even written anything yet. :(
PROJECT(0x40HUES) CMAKE_MINIMUM_REQUIRED(VERSION 3.0) # Release vs debug. set(CMAKE_CXX_FLAGS_Debug -ggdb -O0) set(CMAKE_CXX_FLAGS_Release -O2) add_compile_options(-Wall) # Build statically because it's cool. set(CMAKE_EXE_LINKER_FLAGS "-static-libgcc -static-libstdc++") # For platform-specific library checks. INCLUDE(ConfigureChecks.cmake) # Source directories go here. ADD_SUBDIRECTORY(pugixml) ADD_SUBDIRECTORY(src)
PROJECT(0x40HUES) CMAKE_MINIMUM_REQUIRED(VERSION 2.8) # Release vs debug. # Default build type to debug if not set IF(NOT CMAKE_BUILD_TYPE) SET(CMAKE_BUILD_TYPE Debug CACHE STRING "Choose the type of build, options are: None Debug Release RelWithDebInfo MinSizeRel." FORCE) ENDIF(NOT CMAKE_BUILD_TYPE) set(CMAKE_CXX_FLAGS_Debug -ggdb -O0) set(CMAKE_CXX_FLAGS_Release -O2) add_compile_options(-Wall) # Build statically because it's cool. set(CMAKE_EXE_LINKER_FLAGS "-static-libgcc -static-libstdc++") # For platform-specific library checks. INCLUDE(ConfigureChecks.cmake) # Source directories go here. ADD_SUBDIRECTORY(pugixml) ADD_SUBDIRECTORY(src)
Fix ProGuard configuration for 2.13
# Proguard rules specific to the common module. # Don't warn about checkerframework and Kotlin annotations -dontwarn org.checkerframework.** -dontwarn kotlin.annotations.jvm.** -dontwarn javax.annotation.** # From https://github.com/google/guava/wiki/UsingProGuardWithGuava -dontwarn java.lang.ClassValue -dontwarn java.lang.SafeVarargs -dontwarn javax.lang.model.element.Modifier -dontwarn sun.misc.Unsafe # Don't warn about Guava's compile-only dependencies. # These lines are needed for ProGuard but not R8. -dontwarn com.google.errorprone.annotations.** -dontwarn com.google.j2objc.annotations.** -dontwarn org.codehaus.mojo.animal_sniffer.IgnoreJRERequirement
# Proguard rules specific to the common module. # Don't warn about checkerframework and Kotlin annotations -dontwarn org.checkerframework.** -dontwarn kotlin.annotations.jvm.** -dontwarn javax.annotation.** # From https://github.com/google/guava/wiki/UsingProGuardWithGuava -dontwarn java.lang.ClassValue -dontwarn java.lang.SafeVarargs -dontwarn javax.lang.model.element.Modifier -dontwarn sun.misc.Unsafe # Don't warn about Guava's compile-only dependencies. # These lines are needed for ProGuard but not R8. -dontwarn com.google.errorprone.annotations.** -dontwarn com.google.j2objc.annotations.** -dontwarn org.codehaus.mojo.animal_sniffer.IgnoreJRERequirement # Workaround for https://issuetracker.google.com/issues/112297269 # This is needed for ProGuard but not R8. -keepnames class com.google.common.base.Function { *; }
Add sublime-text, paw and java casks
iterm2 virtualbox docker-toolbox kaleidoscope spectacle name-mangler appcleaner the-unarchiver flux dropbox chromium vlc transmission caskroom/fonts/font-open-sans caskroom/fonts/font-source-code-pro caskroom/fonts/font-source-sans-pro caskroom/fonts/font-hack caskroom/versions/sublime-text3
iterm2 virtualbox docker-toolbox sublime-text paw kaleidoscope java spectacle name-mangler appcleaner the-unarchiver flux dropbox chromium vlc transmission caskroom/fonts/font-open-sans caskroom/fonts/font-source-code-pro caskroom/fonts/font-source-sans-pro caskroom/fonts/font-hack
Update Nuntius to 1.0.2 (3)
Categories:Office License:GPLv2+ Web Site:https://github.com/holylobster/nuntius-android/blob/HEAD/README.md Source Code:https://github.com/holylobster/nuntius-android Issue Tracker:https://github.com/holylobster/nuntius-android/issues Auto Name:Nuntius Summary:Push notifications to a desktop PC Description: Nuntius delivers notifications from your phone or tablet to your computer over Bluetooth. To use Nuntius you will need to install a companion tool on your computer and pair your phone via Bluetooth. See the README for additional information. [https://github.com/holylobster/nuntius-android/HEAD/master/NEWS Changelog] . Repo Type:git Repo:https://github.com/holylobster/nuntius-android Build:1.0,1 commit=471e87d23ee4c898d5535c99923debecf54a32a5 subdir=app gradle=yes Build:1.0.1,2 commit=000fd01a57e5027fd0eeff4c88aaa5edeac5db06 subdir=app gradle=yes Auto Update Mode:Version v%v Update Check Mode:Tags Current Version:1.0.1 Current Version Code:2
Categories:Office License:GPLv2+ Web Site:https://github.com/holylobster/nuntius-android/blob/HEAD/README.md Source Code:https://github.com/holylobster/nuntius-android Issue Tracker:https://github.com/holylobster/nuntius-android/issues Auto Name:Nuntius Summary:Push notifications to a desktop PC Description: Nuntius delivers notifications from your phone or tablet to your computer over Bluetooth. To use Nuntius you will need to install a companion tool on your computer and pair your phone via Bluetooth. See the README for additional information. [https://github.com/holylobster/nuntius-android/HEAD/master/NEWS Changelog] . Repo Type:git Repo:https://github.com/holylobster/nuntius-android Build:1.0,1 commit=471e87d23ee4c898d5535c99923debecf54a32a5 subdir=app gradle=yes Build:1.0.1,2 commit=000fd01a57e5027fd0eeff4c88aaa5edeac5db06 subdir=app gradle=yes Build:1.0.2,3 commit=v1.0.2 subdir=app gradle=yes Auto Update Mode:Version v%v Update Check Mode:Tags Current Version:1.0.2 Current Version Code:3
Rename target for c_backend app. ``run`` is a bad name for a target given that target names are global in CMake.
# Generator halide_project(pipeline "apps" pipeline.cpp) set(pipeline_c_h "${CMAKE_CURRENT_BINARY_DIR}/pipeline_c.h") set(pipeline_c_src "${CMAKE_CURRENT_BINARY_DIR}/pipeline_c.c") set(pipeline_native_h "${CMAKE_CURRENT_BINARY_DIR}/pipeline_native.h") set(pipeline_native_obj "${CMAKE_CURRENT_BINARY_DIR}/pipeline_native.o") # Final executable add_executable(run run.cpp ${pipeline_c_src} ${pipeline_c_h} ${pipeline_native_h}) target_link_libraries(run PRIVATE ${pipeline_native_obj}) target_include_directories(run PRIVATE "${CMAKE_CURRENT_BINARY_DIR}") if (NOT WIN32) target_link_libraries(run PRIVATE dl pthread) endif() set_target_properties(run pipeline PROPERTIES RUNTIME_OUTPUT_DIRECTORY "${CMAKE_CURRENT_BINARY_DIR}") # HACK: Emitted C code isn't valid C code, just compile with # C++ compiler for now set_property(SOURCE "${pipeline_c_src}" PROPERTY LANGUAGE CXX) # FIXME: Cannot use halide_add_generator_dependency() because # pipeline.cpp doesn't handle the commandline args passed. add_custom_command(OUTPUT "${pipeline_c_h}" "${pipeline_c_src}" "${pipeline_native_h}" "${pipeline_native_obj}" COMMAND pipeline COMMENT "Generating pipeline outputs" )
# Generator halide_project(pipeline "apps" pipeline.cpp) set(pipeline_c_h "${CMAKE_CURRENT_BINARY_DIR}/pipeline_c.h") set(pipeline_c_src "${CMAKE_CURRENT_BINARY_DIR}/pipeline_c.c") set(pipeline_native_h "${CMAKE_CURRENT_BINARY_DIR}/pipeline_native.h") set(pipeline_native_obj "${CMAKE_CURRENT_BINARY_DIR}/pipeline_native.o") # Final executable set(run_target run_c_backend_and_native) add_executable(${run_target} run.cpp ${pipeline_c_src} ${pipeline_c_h} ${pipeline_native_h}) target_link_libraries(${run_target} PRIVATE ${pipeline_native_obj}) target_include_directories(${run_target} PRIVATE "${CMAKE_CURRENT_BINARY_DIR}") if (NOT WIN32) target_link_libraries(${run_target} PRIVATE dl pthread) endif() set_target_properties(${run_target} pipeline PROPERTIES RUNTIME_OUTPUT_DIRECTORY "${CMAKE_CURRENT_BINARY_DIR}") # HACK: Emitted C code isn't valid C code, just compile with # C++ compiler for now set_property(SOURCE "${pipeline_c_src}" PROPERTY LANGUAGE CXX) # FIXME: Cannot use halide_add_generator_dependency() because # pipeline.cpp doesn't handle the commandline args passed. add_custom_command(OUTPUT "${pipeline_c_h}" "${pipeline_c_src}" "${pipeline_native_h}" "${pipeline_native_obj}" COMMAND pipeline COMMENT "Generating pipeline outputs" )
Set the crit setting in the soft-configuration to -50, so people go into crit later. Hopefully it's not borked.
### HEALTH ### ## level of health at which a mob becomes unconscious (crit) HEALTH_THRESHOLD_CRIT 0 ## level of health at which a mob becomes dead HEALTH_THRESHOLD_DEAD -100 ### REVIVAL ### ## whether pod plants work or not REVIVAL_POD_PLANTS 1 ## whether cloning tubes work or not REVIVAL_CLONING 1 ## amount of time (in hundredths of seconds) for which a brain retains the "spark of life" after the person's death (set to -1 for infinite) REVIVAL_BRAIN_LIFE -1
### HEALTH ### ## level of health at which a mob becomes unconscious (crit) HEALTH_THRESHOLD_CRIT -50 ## level of health at which a mob becomes dead HEALTH_THRESHOLD_DEAD -100 ### REVIVAL ### ## whether pod plants work or not REVIVAL_POD_PLANTS 1 ## whether cloning tubes work or not REVIVAL_CLONING 1 ## amount of time (in hundredths of seconds) for which a brain retains the "spark of life" after the person's death (set to -1 for infinite) REVIVAL_BRAIN_LIFE -1
Add missing descriptions in CHANGE.txt
1.5.4 1.5.3 ----- * Bug fix: Fix error with Zenity choose albums dialog 1.5.2 ----- * Bug fix: Fix manually input the path of the image which will be uploaded 1.5.1 ----- * Bug fix: Error when not specify image file 1.5.0 ----- * Upload multiple images 1.4.0 ----- * Update abstract method of Imgur class * Fix coding style 1.3.0 ----- * Simplify the inheritance of Imgur * Update the methods which should be implemented with inheritance * Fix bug: Can't show delete link on Mac * Add support to elementary os 1.2.0 ----- * Add Zenity dialog 1.1.0 ----- * Add -s option: Add 'send to imgur' function in KDE dolphin 1.0.0 ----- * Update and refacoring all the code 0.1.2 ----- * Fix auth error * Remove some debug messages * Add a new line in auth message 0.1.1 ----- * Update description in doc 0.1.0 ----- * Implement Mac dialog 0.0.2 ----- * Change default config location to ~/.imgurup.conf 0.0.1 ------ * Initial release.
1.5.4 ----- * Refactoring and add testings 1.5.3 ----- * Bug fix: Fix error with Zenity choose albums dialog 1.5.2 ----- * Bug fix: Fix manually input the path of the image which will be uploaded 1.5.1 ----- * Bug fix: Error when not specify image file 1.5.0 ----- * Upload multiple images 1.4.0 ----- * Update abstract method of Imgur class * Fix coding style 1.3.0 ----- * Simplify the inheritance of Imgur * Update the methods which should be implemented with inheritance * Fix bug: Can't show delete link on Mac * Add support to elementary os 1.2.0 ----- * Add Zenity dialog 1.1.0 ----- * Add -s option: Add 'send to imgur' function in KDE dolphin 1.0.0 ----- * Update and refacoring all the code 0.1.2 ----- * Fix auth error * Remove some debug messages * Add a new line in auth message 0.1.1 ----- * Update description in doc 0.1.0 ----- * Implement Mac dialog 0.0.2 ----- * Change default config location to ~/.imgurup.conf 0.0.1 ------ * Initial release.
Add instructions for built version of Qt SDK
Preparing Qt for use with Visual Studio 2008 and rex This set of instructions is adapted from http://dcsoft.com/community_server/blogs/dcsoft/archive/2009/03/06/how-to-setup-qt-4-5-visual-studio-integration.aspx (which was a bit outdated). 1. Download Qt source package from http://www.qtsoftware.com/downloads Choose LGPL/Free -> Qt Framework only (Windows) -> Source code available on this link (direct link: http://get.qtsoftware.com/qt/source/qt-win-opensource-src-4.5.1.zip) 2. Extract zip to C: root. Rename the created directory to something more convenient, like Qt (assumed below) 3. Add C:\Qt\bin to your path 4. Open VS2008 command prompt, go to C:\Qt and run configure -platform win32-msvc2008 5. In the same directory, run nmake 6. Add QTDIR = C:\Qt to your environment variables. 7. Regenerate the rex VS project files from the cmake files. Remember to invoke cmake from a process that was created after steps 3 and 6 in order for the environment settings to take effect. This means restarting Visual Studio or any command prompts after changing the environment settings.
Preparing Qt for use with Visual Studio 2008 and rex This set of instructions is adapted from http://dcsoft.com/community_server/blogs/dcsoft/archive/2009/03/06/how-to-setup-qt-4-5-visual-studio-integration.aspx (which was a bit outdated). 1. Download Qt source package from http://www.qtsoftware.com/downloads Choose LGPL/Free -> Qt Framework only (Windows) -> Source code available on this link (direct link: http://get.qtsoftware.com/qt/source/qt-win-opensource-src-4.5.1.zip) 2. Extract zip to C: root. Rename the created directory to something more convenient, like Qt (assumed below) 3. Add C:\Qt\bin to your path 4. Open VS2008 command prompt, go to C:\Qt and run configure -platform win32-msvc2008 5. In the same directory, run nmake 6. Add QTDIR = C:\Qt to your environment variables. 7. Regenerate the rex VS project files from the cmake files. Remember to invoke cmake from a process that was created after steps 3 and 6 in order for the environment settings to take effect. This means restarting Visual Studio or any command prompts after changing the environment settings. * If configure and nmake doesn't work you can try to download built version of Qt SDK from: http://dev.realxtend.org/gf/project/viewerdeps/frs/ Built was made on Windows Vista 32bit 1) Download Qt.zip 2) Unzip to c:\ (ensure that folder structure is like below) 3) set environment variable: QTDIR=C:\Qt\2009.02-visual-studio\qt
Update django from 1.11.2 to 1.11.3
sphinx==1.6.3 sphinx-rtd-theme==0.2.4 Django==1.11.2 -e .
sphinx==1.6.3 sphinx-rtd-theme==0.2.4 Django==1.11.3 -e .
Update gevent from 1.1.1 to 1.2.0
# Pro-tip: Try not to put anything here. Avoid dependencies in # production that aren't in development. -r base.txt # WSGI Handler # ------------------------------------------------ gevent==1.1.1 gunicorn==19.6.0 # Static and Media Storage # ------------------------------------------------ boto==2.45.0 django-storages-redux==1.3.2 # Email backends for Mailgun, Postmark, SendGrid and more # ------------------------------------------------------- django-anymail==0.7 # Raven is the Sentry client # -------------------------- raven==5.21.0 newrelic==2.76.0.55
# Pro-tip: Try not to put anything here. Avoid dependencies in # production that aren't in development. -r base.txt # WSGI Handler # ------------------------------------------------ gevent==1.2.0 gunicorn==19.6.0 # Static and Media Storage # ------------------------------------------------ boto==2.45.0 django-storages-redux==1.3.2 # Email backends for Mailgun, Postmark, SendGrid and more # ------------------------------------------------------- django-anymail==0.7 # Raven is the Sentry client # -------------------------- raven==5.21.0 newrelic==2.76.0.55
Add temporary dependency on django-registration development version
Django >= 1.3, < 1.4 # For database migrations South >= 0.6, < 0.8 # For image handling PIL >= 1.1, < 1.2 # For crawling comics feedparser >= 4.0, < 6 lxml >= 2.0, < 3 # For static resource compression django_compressor >= 0.9, < 0.10 cssmin >= 0.1, < 2 jsmin >= 2.0, < 2.1 # For better password hashing py-bcrypt >= 0.2, < 0.3 django-bcrypt >= 0.9, < 0.10
Django >= 1.3, < 1.4 # For database migrations South >= 0.6, < 0.8 # For image handling PIL >= 1.1, < 1.2 # For crawling comics feedparser >= 4.0, < 6 lxml >= 2.0, < 3 # For static resource compression django_compressor >= 0.9, < 0.10 cssmin >= 0.1, < 2 jsmin >= 2.0, < 2.1 # For better password hashing py-bcrypt >= 0.2, < 0.3 django-bcrypt >= 0.9, < 0.10 # For user registration with email verification # 0.8 of django-registration has not been released yet, and 0.7 is archaic -e hg+https://bitbucket.org/ubernostrum/django-registration#egg=django-registation
Update tablib from 0.11.5 to 0.12.0
APScheduler==3.3.1 boto==2.48.0 cached-property==1.3.0 click==6.7 Flask-Sockets==0.2.1 Flask==0.12.2 future==0.16.0 gevent==1.2.2 greenlet==0.4.12 gunicorn==19.7.1 localconfig==0.4.2 pexpect==4.2.1 psycopg2==2.7.3 redis==2.10.6 requests==2.18.4 rq==0.8.1 selenium==3.5.0 SQLAlchemy==1.1.13 sqlalchemy-postgres-copy==0.5.0 tablib==0.11.5 ua-parser==0.7.3 user-agents==1.1.0 psutil==5.2.2
APScheduler==3.3.1 boto==2.48.0 cached-property==1.3.0 click==6.7 Flask-Sockets==0.2.1 Flask==0.12.2 future==0.16.0 gevent==1.2.2 greenlet==0.4.12 gunicorn==19.7.1 localconfig==0.4.2 pexpect==4.2.1 psycopg2==2.7.3 redis==2.10.6 requests==2.18.4 rq==0.8.1 selenium==3.5.0 SQLAlchemy==1.1.13 sqlalchemy-postgres-copy==0.5.0 tablib==0.12.0 ua-parser==0.7.3 user-agents==1.1.0 psutil==5.2.2
Update django-storages from 1.6.3 to 1.6.5
# Pro-tip: Try not to put anything here. Avoid dependencies in # production that aren't in development. -r base.txt # WSGI Handler # ------------------------------------------------ gevent==1.2.2 gunicorn==19.7.1 # Static and Media Storage # ------------------------------------------------ boto3==1.4.7 django-storages==1.6.3 # Email backends for Mailgun, Postmark, SendGrid and more # ------------------------------------------------------- django-anymail==0.10 # Raven is the Sentry client # -------------------------- raven==6.1.0
# Pro-tip: Try not to put anything here. Avoid dependencies in # production that aren't in development. -r base.txt # WSGI Handler # ------------------------------------------------ gevent==1.2.2 gunicorn==19.7.1 # Static and Media Storage # ------------------------------------------------ boto3==1.4.7 django-storages==1.6.5 # Email backends for Mailgun, Postmark, SendGrid and more # ------------------------------------------------------- django-anymail==0.10 # Raven is the Sentry client # -------------------------- raven==6.1.0
Update pytest from 4.3.1 to 4.4.0
pyflakes==2.1.1 pep8==1.7.1 pytest==4.3.1 ipdb==0.11
pyflakes==2.1.1 pep8==1.7.1 pytest==4.4.0 ipdb==0.11
Update faker from 1.0.1 to 1.0.2
coverage==4.5.2 requests-mock==1.5.2 faker==1.0.1 coveralls==1.5.1
coverage==4.5.2 requests-mock==1.5.2 faker==1.0.2 coveralls==1.5.1
Update boto3 from 1.11.7 to 1.12.2
dj-database-url==0.5.0 django-apiblueprint-view==2.1.1 django-basicauth==0.5.2 django-extensions==2.2.6 django-localflavor==2.2 django-markdown-deux==1.0.5 django==2.2.10 # pyup: >=2.2,<3.0 djangorestframework==3.11.0 djangorestframework-gis==0.15 django-cors-headers==3.2.1 fastkml==0.11 fuzzywuzzy==0.17.0 lxml==4.5.0 marshmallow==3.4.0 psycopg2-binary==2.8.4 pyshp==2.1.0 python-levenshtein==0.12.0 raven==6.10.0 requests==2.22.0 retry==0.9.2 boto==2.49.0 boto3==1.11.7 # pyup: update minor uk-geo-utils==0.9.0 git+git://github.com/DemocracyClub/dc_base_theme.git@0.3.10 git+https://github.com/DemocracyClub/dc_signup_form.git@2.1.0
dj-database-url==0.5.0 django-apiblueprint-view==2.1.1 django-basicauth==0.5.2 django-extensions==2.2.6 django-localflavor==2.2 django-markdown-deux==1.0.5 django==2.2.10 # pyup: >=2.2,<3.0 djangorestframework==3.11.0 djangorestframework-gis==0.15 django-cors-headers==3.2.1 fastkml==0.11 fuzzywuzzy==0.17.0 lxml==4.5.0 marshmallow==3.4.0 psycopg2-binary==2.8.4 pyshp==2.1.0 python-levenshtein==0.12.0 raven==6.10.0 requests==2.22.0 retry==0.9.2 boto==2.49.0 boto3==1.12.2 # pyup: update minor uk-geo-utils==0.9.0 git+git://github.com/DemocracyClub/dc_base_theme.git@0.3.10 git+https://github.com/DemocracyClub/dc_signup_form.git@2.1.0
Update argon2-cffi from 16.3.0 to 18.1.0
# Wheel 0.25+ needed to install certain packages on CPython 3.5+ # like Pillow and psycopg2 # See http://bitly.com/wheel-building-fails-CPython-35 # Verified bug on Python 3.5.1 wheel==0.29.0 # Bleeding edge Django django==1.10.7 # pyup: >=1.10,<1.11 # Configuration django-environ==0.4.3 whitenoise==3.3.0 # Forms django-braces==1.11.0 django-crispy-forms==1.6.1 # Models django-model-utils==3.0.0 # Images Pillow==4.1.1 # Password storage argon2-cffi==16.3.0 # For user registration, either via email or social # Well-built with regular release cycles! django-allauth==0.32.0 # Python-PostgreSQL Database Adapter psycopg2==2.7.1 # Unicode slugification awesome-slugify==1.6.5 # Time zones support pytz==2017.2 # Redis support django-redis==4.8.0 redis>=2.10.5 celery==3.1.25 graphene>=2.0 graphene-django>=2.0 django-solo django-cors-headers djangorestframework djangorestframework-jwt wagtail
# Wheel 0.25+ needed to install certain packages on CPython 3.5+ # like Pillow and psycopg2 # See http://bitly.com/wheel-building-fails-CPython-35 # Verified bug on Python 3.5.1 wheel==0.29.0 # Bleeding edge Django django==1.10.7 # pyup: >=1.10,<1.11 # Configuration django-environ==0.4.3 whitenoise==3.3.0 # Forms django-braces==1.11.0 django-crispy-forms==1.6.1 # Models django-model-utils==3.0.0 # Images Pillow==4.1.1 # Password storage argon2-cffi==18.1.0 # For user registration, either via email or social # Well-built with regular release cycles! django-allauth==0.32.0 # Python-PostgreSQL Database Adapter psycopg2==2.7.1 # Unicode slugification awesome-slugify==1.6.5 # Time zones support pytz==2017.2 # Redis support django-redis==4.8.0 redis>=2.10.5 celery==3.1.25 graphene>=2.0 graphene-django>=2.0 django-solo django-cors-headers djangorestframework djangorestframework-jwt wagtail
Update django from 1.11.29 to 3.1.5
Django==1.11.29 aioworkers==0.6.0 git+https://github.com/dvhbru/dvhb-hybrid@0.2.10
Django==3.1.5 aioworkers==0.6.0 git+https://github.com/dvhbru/dvhb-hybrid@0.2.10
Include current atom package list
Hydrogen@2.3.0 asciidoc-preview@2.10.4 atom-beautify@0.32.2 atom-clock@0.1.16 atom-ide-ui@0.9.3 atom-material-syntax@1.0.8 atom-material-ui@2.1.3 autocomplete-asciidoc@0.1.2 autocomplete-bibtex@1.2.1 autocomplete-haskell@1.0.1 autocomplete-python@1.10.5 busy-signal@1.4.3 dot-gov-syntax@1.1.0 file-icons@2.1.17 git-time-machine@1.5.9 haskell-ghc-mod@2.2.3 ide-haskell@2.3.0 ide-haskell-cabal@2.1.2 ide-haskell-hie@0.10.0 ide-python@0.8.1 intentions@1.1.5 language-asciidoc@1.11.0 language-docker@1.1.8 language-haskell@1.17.3 language-ini@1.19.0 language-knitr@0.4.0 language-latex@1.1.1 language-markdown@0.25.1 language-r@0.4.2 latex@0.49.0 latexer@0.3.0 linter@2.2.0 linter-pycodestyle@2.1.3 linter-ui-default@1.7.1 merge-conflicts@1.4.5 pdf-view@0.65.0 preview-inline@1.5.1 project-manager@3.3.5 script@3.17.3 seti-icons@1.5.4 split-diff@1.5.2 tablr@1.8.3 tree-view-git-status@1.4.0 wordcount@2.10.4
Update pytest from 3.2.0 to 3.2.1
pip==9.0.1 wheel==0.29.0 flake8==3.4.1 tox==2.7.0 coverage==4.4.1 pytest==3.2.0 pytest-cov==2.5.1 Sphinx==1.6.3 sphinx-rtd-theme==0.2.4 moto==0.4.31 pymongo==3.4.0 boto3==1.4.4 bumpversion==0.5.3 watchdog==0.8.3 cryptography==2.0.2 clatter==0.1.1
pip==9.0.1 wheel==0.29.0 flake8==3.4.1 tox==2.7.0 coverage==4.4.1 pytest==3.2.1 pytest-cov==2.5.1 Sphinx==1.6.3 sphinx-rtd-theme==0.2.4 moto==0.4.31 pymongo==3.4.0 boto3==1.4.4 bumpversion==0.5.3 watchdog==0.8.3 cryptography==2.0.2 clatter==0.1.1