Update README.md

README.md

@@ -40,9 +40,10 @@ This dataset contains datas being collected from Genbank. The dataset is organiz
 ```python
 {DNA id: AP013063.1  
 Organism: Serratia marcescens SM39  
-year: 
+year: 2017
 region type:coding  
-coding type: BAO32072.1  
+specific_class: Protein
+Product:thr operon leader peptide
 sequence: ATGCGCAACATCAGCCTGAAAACCACAATTATTACCACCACCGATACCACAGGTAACGGGGCGGGCTGA  
 gc_content:0.52173913  
 translation code: MRNISLKTTIITTTDTTGNGAG}  
@@ -51,9 +52,10 @@ translation code: MRNISLKTTIITTTDTTGNGAG}
 ### Data Fields
 __DNA id__: id number for the whole DNA sequence, sequences with same DNA id are from same DNA  
 __Organism__: Organism of the DNA  
-__gene id__: locus tag of the gene, sequences with same gene id are from same gene      
-__region type__: determine whether the region is coding or non-coding; if the region is the type of regulator, it would be classified according to the class of regulators, such as terminator, ribosome binding ste, etc.  
-__coding type__: if the sequence is coding sequence, it would be classified according to their production type. sequence that produce protein would be marked with protein id. Sequences that produce either rRNA or tRNA would be marked as rRNA or tRNA.  
+__year__: the year of the DNA sequence       
+__region type__: determine the general type of the sequence, such as coding, regulator, repeat region, etc.
+__specific class__: if the sequence is coding sequence, it would be classified according to their production type such as RNA, Protein. The regulators would also be classified by their own class such as terminator, ribosome  
+__Product__ : if the sequence produce protein, the product name would be listed
 __sequence__: the actual sequence   
 __gc_content__: the gc_content of the sequence  
 __translation code__: if the sequence produce protein, then the translation code would be provided as a reference