hexsha string | size int64 | ext string | lang string | max_stars_repo_path string | max_stars_repo_name string | max_stars_repo_head_hexsha string | max_stars_repo_licenses list | max_stars_count int64 | max_stars_repo_stars_event_min_datetime string | max_stars_repo_stars_event_max_datetime string | max_issues_repo_path string | max_issues_repo_name string | max_issues_repo_head_hexsha string | max_issues_repo_licenses list | max_issues_count int64 | max_issues_repo_issues_event_min_datetime string | max_issues_repo_issues_event_max_datetime string | max_forks_repo_path string | max_forks_repo_name string | max_forks_repo_head_hexsha string | max_forks_repo_licenses list | max_forks_count int64 | max_forks_repo_forks_event_min_datetime string | max_forks_repo_forks_event_max_datetime string | content string | avg_line_length float64 | max_line_length int64 | alphanum_fraction float64 | qsc_code_num_words_quality_signal int64 | qsc_code_num_chars_quality_signal float64 | qsc_code_mean_word_length_quality_signal float64 | qsc_code_frac_words_unique_quality_signal float64 | qsc_code_frac_chars_top_2grams_quality_signal float64 | qsc_code_frac_chars_top_3grams_quality_signal float64 | qsc_code_frac_chars_top_4grams_quality_signal float64 | qsc_code_frac_chars_dupe_5grams_quality_signal float64 | qsc_code_frac_chars_dupe_6grams_quality_signal float64 | qsc_code_frac_chars_dupe_7grams_quality_signal float64 | qsc_code_frac_chars_dupe_8grams_quality_signal float64 | qsc_code_frac_chars_dupe_9grams_quality_signal float64 | qsc_code_frac_chars_dupe_10grams_quality_signal float64 | qsc_code_frac_chars_replacement_symbols_quality_signal float64 | qsc_code_frac_chars_digital_quality_signal float64 | qsc_code_frac_chars_whitespace_quality_signal float64 | qsc_code_size_file_byte_quality_signal float64 | qsc_code_num_lines_quality_signal float64 | qsc_code_num_chars_line_max_quality_signal float64 | qsc_code_num_chars_line_mean_quality_signal float64 | qsc_code_frac_chars_alphabet_quality_signal float64 | qsc_code_frac_chars_comments_quality_signal float64 | qsc_code_cate_xml_start_quality_signal float64 | qsc_code_frac_lines_dupe_lines_quality_signal float64 | qsc_code_cate_autogen_quality_signal float64 | qsc_code_frac_lines_long_string_quality_signal float64 | qsc_code_frac_chars_string_length_quality_signal float64 | qsc_code_frac_chars_long_word_length_quality_signal float64 | qsc_code_frac_lines_string_concat_quality_signal float64 | qsc_code_cate_encoded_data_quality_signal float64 | qsc_code_frac_chars_hex_words_quality_signal float64 | qsc_code_frac_lines_prompt_comments_quality_signal float64 | qsc_code_frac_lines_assert_quality_signal float64 | qsc_codepython_cate_ast_quality_signal float64 | qsc_codepython_frac_lines_func_ratio_quality_signal float64 | qsc_codepython_cate_var_zero_quality_signal bool | qsc_codepython_frac_lines_pass_quality_signal float64 | qsc_codepython_frac_lines_import_quality_signal float64 | qsc_codepython_frac_lines_simplefunc_quality_signal float64 | qsc_codepython_score_lines_no_logic_quality_signal float64 | qsc_codepython_frac_lines_print_quality_signal float64 | qsc_code_num_words int64 | qsc_code_num_chars int64 | qsc_code_mean_word_length int64 | qsc_code_frac_words_unique null | qsc_code_frac_chars_top_2grams int64 | qsc_code_frac_chars_top_3grams int64 | qsc_code_frac_chars_top_4grams int64 | qsc_code_frac_chars_dupe_5grams int64 | qsc_code_frac_chars_dupe_6grams int64 | qsc_code_frac_chars_dupe_7grams int64 | qsc_code_frac_chars_dupe_8grams int64 | qsc_code_frac_chars_dupe_9grams int64 | qsc_code_frac_chars_dupe_10grams int64 | qsc_code_frac_chars_replacement_symbols int64 | qsc_code_frac_chars_digital int64 | qsc_code_frac_chars_whitespace int64 | qsc_code_size_file_byte int64 | qsc_code_num_lines int64 | qsc_code_num_chars_line_max int64 | qsc_code_num_chars_line_mean int64 | qsc_code_frac_chars_alphabet int64 | qsc_code_frac_chars_comments int64 | qsc_code_cate_xml_start int64 | qsc_code_frac_lines_dupe_lines int64 | qsc_code_cate_autogen int64 | qsc_code_frac_lines_long_string int64 | qsc_code_frac_chars_string_length int64 | qsc_code_frac_chars_long_word_length int64 | qsc_code_frac_lines_string_concat null | qsc_code_cate_encoded_data int64 | qsc_code_frac_chars_hex_words int64 | qsc_code_frac_lines_prompt_comments int64 | qsc_code_frac_lines_assert int64 | qsc_codepython_cate_ast int64 | qsc_codepython_frac_lines_func_ratio int64 | qsc_codepython_cate_var_zero int64 | qsc_codepython_frac_lines_pass int64 | qsc_codepython_frac_lines_import int64 | qsc_codepython_frac_lines_simplefunc int64 | qsc_codepython_score_lines_no_logic int64 | qsc_codepython_frac_lines_print int64 | effective string | hits int64 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
7fea2dfb0cd8b9487c3b49625c0ea42fa85c036d | 8,800 | py | Python | Main.py | TrabelsiHoussem/smartParking | 7630c60bb46e77192114ea7fc4f2ed2b5746889f | [
"MIT"
] | null | null | null | Main.py | TrabelsiHoussem/smartParking | 7630c60bb46e77192114ea7fc4f2ed2b5746889f | [
"MIT"
] | null | null | null | Main.py | TrabelsiHoussem/smartParking | 7630c60bb46e77192114ea7fc4f2ed2b5746889f | [
"MIT"
] | null | null | null | # Main.py
import cv2
import numpy as np
import os
import DetectChars
import DetectPlates
import PossiblePlate
import RPi.GPIO as GPIO
import time
GPIO.setmode(GPIO.BCM)
GPIO.setwarnings(False)
GPIO.setup(21, GPIO.OUT)
TRIG = 23
ECHO = 24
GPIO.setup(TRIG, GPIO.OUT)
GPIO.setup(ECHO, GPIO.IN)
# module level variables ##... | 40.930233 | 162 | 0.575455 | 914 | 8,800 | 5.512035 | 0.306346 | 0.004764 | 0.004168 | 0.003176 | 0.169512 | 0.139738 | 0.12505 | 0.10917 | 0.074236 | 0.061929 | 0 | 0.029837 | 0.283977 | 8,800 | 214 | 163 | 41.121495 | 0.769719 | 0.22625 | 0 | 0.16 | 0 | 0 | 0.059721 | 0.006491 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.064 | null | null | 0.088 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7fea89f07c2e87948df2dd5a3d4723c2e2b3fa66 | 989 | py | Python | al_django/aluser/migrations/0001_initial.py | albatross9/AL_WEB | c41b5e2a78b85acb4d6851952eca8c75fb8da498 | [
"bzip2-1.0.6"
] | null | null | null | al_django/aluser/migrations/0001_initial.py | albatross9/AL_WEB | c41b5e2a78b85acb4d6851952eca8c75fb8da498 | [
"bzip2-1.0.6"
] | null | null | null | al_django/aluser/migrations/0001_initial.py | albatross9/AL_WEB | c41b5e2a78b85acb4d6851952eca8c75fb8da498 | [
"bzip2-1.0.6"
] | null | null | null | # -*- coding: utf-8 -*-
# Generated by Django 1.11.26 on 2019-11-17 15:46
from __future__ import unicode_literals
from django.db import migrations, models
class Migration(migrations.Migration):
initial = True
dependencies = [
]
operations = [
migrations.CreateModel(
name='Aluse... | 31.903226 | 114 | 0.583418 | 102 | 989 | 5.460784 | 0.656863 | 0.118492 | 0.05386 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.074334 | 0.27907 | 989 | 30 | 115 | 32.966667 | 0.706872 | 0.069767 | 0 | 0 | 1 | 0 | 0.19193 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.045455 | 0.090909 | 0 | 0.272727 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7feb3af0c7bc674de4f7784e90d5d1d22fbce700 | 4,812 | py | Python | venv/lib/python3.6/site-packages/ansible_collections/community/digitalocean/plugins/modules/digital_ocean_image_info.py | usegalaxy-no/usegalaxy | 75dad095769fe918eb39677f2c887e681a747f3a | [
"MIT"
] | 1 | 2020-01-22T13:11:23.000Z | 2020-01-22T13:11:23.000Z | venv/lib/python3.6/site-packages/ansible_collections/community/digitalocean/plugins/modules/digital_ocean_image_info.py | usegalaxy-no/usegalaxy | 75dad095769fe918eb39677f2c887e681a747f3a | [
"MIT"
] | 12 | 2020-02-21T07:24:52.000Z | 2020-04-14T09:54:32.000Z | venv/lib/python3.6/site-packages/ansible_collections/community/digitalocean/plugins/modules/digital_ocean_image_info.py | usegalaxy-no/usegalaxy | 75dad095769fe918eb39677f2c887e681a747f3a | [
"MIT"
] | null | null | null | #!/usr/bin/python
# -*- coding: utf-8 -*-
# Copyright: (c) 2018, Ansible Project
# Copyright: (c) 2018, Abhijeet Kasurde <akasurde@redhat.com>
# GNU General Public License v3.0+ (see COPYING or https://www.gnu.org/licenses/gpl-3.0.txt)
from __future__ import absolute_import, division, print_function
__metaclass__ = t... | 29.888199 | 103 | 0.649626 | 550 | 4,812 | 5.481818 | 0.370909 | 0.051741 | 0.056385 | 0.041791 | 0.220896 | 0.151575 | 0.137645 | 0.087231 | 0.056716 | 0 | 0 | 0.018671 | 0.243142 | 4,812 | 160 | 104 | 30.075 | 0.809171 | 0.050499 | 0 | 0.093023 | 0 | 0.015504 | 0.67872 | 0.121411 | 0 | 0 | 0 | 0 | 0 | 1 | 0.015504 | false | 0 | 0.03876 | 0 | 0.054264 | 0.007752 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7fecca80a2f5468d0d7353a322bfa14d4bb2d8b2 | 4,214 | py | Python | pybrain/rl/environments/functions/unimodal.py | schaul/pybrain | 6e1bd1e9b232044a4e0498fd63799b31ce50f460 | [
"BSD-3-Clause"
] | 4 | 2015-01-01T14:57:38.000Z | 2018-07-12T04:21:36.000Z | pybrain/rl/environments/functions/unimodal.py | abhishekgahlot/pybrain | c54661f13857d5bcb0095ba2fb12f5a403a4a70f | [
"BSD-3-Clause"
] | null | null | null | pybrain/rl/environments/functions/unimodal.py | abhishekgahlot/pybrain | c54661f13857d5bcb0095ba2fb12f5a403a4a70f | [
"BSD-3-Clause"
] | 2 | 2015-01-23T09:23:58.000Z | 2019-02-22T05:42:29.000Z | """ The functions implemented here are standard benchmarks from literature. """
__author__ = 'Tom Schaul, tom@idsia.ch'
from scipy import ones, sqrt, dot, sign, randn, power, rand, floor, array
from scipy.linalg import norm, orth
from function import FunctionEnvironment
class SphereFunction(FunctionEnvironment):
... | 28.093333 | 90 | 0.564784 | 555 | 4,214 | 4.190991 | 0.273874 | 0.027945 | 0.041273 | 0.046432 | 0.251935 | 0.22356 | 0.163801 | 0.163801 | 0.128117 | 0.128117 | 0 | 0.030687 | 0.288562 | 4,214 | 149 | 91 | 28.281879 | 0.745163 | 0.146417 | 0 | 0.348837 | 0 | 0 | 0.006843 | 0 | 0 | 0 | 0 | 0 | 0.011628 | 1 | 0.197674 | false | 0 | 0.046512 | 0.069767 | 0.604651 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
7ff36391bd5e609727e8135aa201deacabaa3313 | 640 | py | Python | scripts/update_rate.py | Guillerbr/opentrade-1 | dd1d84ff34aa256cd68c862c3f8777f1325a1a94 | [
"Apache-2.0"
] | null | null | null | scripts/update_rate.py | Guillerbr/opentrade-1 | dd1d84ff34aa256cd68c862c3f8777f1325a1a94 | [
"Apache-2.0"
] | null | null | null | scripts/update_rate.py | Guillerbr/opentrade-1 | dd1d84ff34aa256cd68c862c3f8777f1325a1a94 | [
"Apache-2.0"
] | 2 | 2020-08-31T10:39:34.000Z | 2021-04-27T10:10:40.000Z | #!/usr/bin/env python3
import pg8000
types = ('STK', 'CASH', 'CMDTY', 'FUT', 'OPT', 'IND', 'FOP', 'WAR', 'BOND',
'FUND')
def main():
conn = pg8000.connect(
host='127.0.0.1', database='opentrade', user='postgres', password='test')
cursor = conn.cursor()
exchanges = {}
cursor.execute(
's... | 22.857143 | 79 | 0.590625 | 87 | 640 | 4.241379 | 0.712644 | 0.070461 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.03937 | 0.20625 | 640 | 27 | 80 | 23.703704 | 0.687008 | 0.032813 | 0 | 0 | 0 | 0 | 0.28479 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.052632 | false | 0.052632 | 0.052632 | 0 | 0.105263 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
7ff5ed6014e773e7e4f525837e6a382e225693cb | 1,029 | py | Python | durra/__main__.py | linhuiwzqu/abeimlerh | 1cbdc919ea63a01980c1a03cef53988017b4a515 | [
"MIT"
] | 26 | 2018-06-30T01:00:24.000Z | 2022-02-21T15:02:24.000Z | durra/__main__.py | linhuiwzqu/abeimlerh | 1cbdc919ea63a01980c1a03cef53988017b4a515 | [
"MIT"
] | 1 | 2018-07-21T03:08:21.000Z | 2019-03-30T13:56:45.000Z | durra/__main__.py | linhuiwzqu/abeimlerh | 1cbdc919ea63a01980c1a03cef53988017b4a515 | [
"MIT"
] | 1 | 2020-06-20T08:06:37.000Z | 2020-06-20T08:06:37.000Z | import os
import sys
from PyQt5 import QtGui
from PyQt5.QtCore import QStandardPaths, QSettings
from PyQt5.QtWidgets import QApplication, QWidget, QMessageBox, QFileDialog
from PyQt5.QtXml import QDomDocument, QDomNode
try:
from krita import *
CONTEXT_KRITA = True
Krita = Krita # to stop Eric ide compl... | 26.384615 | 77 | 0.692906 | 126 | 1,029 | 5.555556 | 0.579365 | 0.051429 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.005175 | 0.248785 | 1,029 | 38 | 78 | 27.078947 | 0.900388 | 0.285714 | 0 | 0 | 0 | 0 | 0.011004 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.038462 | false | 0.038462 | 0.346154 | 0 | 0.384615 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
7ffa7aa58b09f81d730833f30c22ad6d25fb852b | 1,883 | py | Python | ui/configExportDialog.py | JargeZ/NtscQT | 1f7790b6ae9af81c56f44fbd689f9b43b1007b21 | [
"Apache-2.0"
] | 43 | 2021-06-30T22:33:59.000Z | 2021-12-31T14:27:30.000Z | ui/configExportDialog.py | JargeZ/NtscQT | 1f7790b6ae9af81c56f44fbd689f9b43b1007b21 | [
"Apache-2.0"
] | 14 | 2022-01-04T18:10:15.000Z | 2022-03-27T01:56:09.000Z | ui/configExportDialog.py | JargeZ/NtscQT | 1f7790b6ae9af81c56f44fbd689f9b43b1007b21 | [
"Apache-2.0"
] | 9 | 2021-08-05T21:25:39.000Z | 2022-01-01T23:41:57.000Z | # -*- coding: utf-8 -*-
# Form implementation generated from reading ui file 'ui/configExportDialog.ui'
#
# Created by: PyQt5 UI code generator 5.15.1
#
# WARNING: Any manual changes made to this file will be lost when pyuic5 is
# run again. Do not edit this file unless you know what you are doing.
from PyQt5 impor... | 48.282051 | 108 | 0.759958 | 178 | 1,883 | 8.016854 | 0.52809 | 0.06377 | 0.046251 | 0.033637 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.026892 | 0.150823 | 1,883 | 38 | 109 | 49.552632 | 0.865541 | 0.151885 | 0 | 0 | 1 | 0 | 0.071743 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.083333 | false | 0 | 0.041667 | 0 | 0.166667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
7ffbbaeee10156a026aadb10e6d57ad77aef668d | 695 | py | Python | resources/code/translation.py | GCBallesteros/imreg_dft | 3eb7137403dd0689711ff1dae78200b0fbdcedfb | [
"BSD-3-Clause"
] | 167 | 2015-02-28T19:14:52.000Z | 2022-03-30T03:42:33.000Z | resources/code/translation.py | GCBallesteros/imreg_dft | 3eb7137403dd0689711ff1dae78200b0fbdcedfb | [
"BSD-3-Clause"
] | 40 | 2015-01-18T23:58:41.000Z | 2021-08-02T13:36:48.000Z | resources/code/translation.py | GCBallesteros/imreg_dft | 3eb7137403dd0689711ff1dae78200b0fbdcedfb | [
"BSD-3-Clause"
] | 51 | 2015-02-27T21:19:55.000Z | 2022-03-24T12:28:45.000Z | import os
import scipy as sp
import scipy.misc
import imreg_dft as ird
basedir = os.path.join('..', 'examples')
# the TEMPLATE
im0 = sp.misc.imread(os.path.join(basedir, "sample1.png"), True)
# the image to be transformed
im1 = sp.misc.imread(os.path.join(basedir, "sample2.png"), True)
result = ird.translation(im0,... | 25.740741 | 64 | 0.689209 | 109 | 695 | 4.376147 | 0.53211 | 0.037736 | 0.062893 | 0.0587 | 0.121593 | 0.121593 | 0.121593 | 0 | 0 | 0 | 0 | 0.018676 | 0.152518 | 695 | 26 | 65 | 26.730769 | 0.791171 | 0.158273 | 0 | 0 | 0 | 0 | 0.160345 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.3125 | 0 | 0.3125 | 0.0625 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
7ffec1354733fc7c138307236e7f38a98439c9d2 | 470 | py | Python | src/bot/cogs/debug.py | Builditluc/kkst-bot | f1431fc7a8eb489794f5164ec328c44f3016e7a4 | [
"MIT"
] | null | null | null | src/bot/cogs/debug.py | Builditluc/kkst-bot | f1431fc7a8eb489794f5164ec328c44f3016e7a4 | [
"MIT"
] | null | null | null | src/bot/cogs/debug.py | Builditluc/kkst-bot | f1431fc7a8eb489794f5164ec328c44f3016e7a4 | [
"MIT"
] | null | null | null | from nextcord.ext import commands
from bot.checks import guild_allowed
from bot.cogs.cog import Cog
from log import init_logger, LogLevel
__all__ = ["Debug"]
log = init_logger(__name__, LogLevel.DEBUG)
class Debug(Cog):
def __init__(self, bot: commands.Bot, enabled=False) -> None:
super().__init__("debu... | 23.5 | 65 | 0.697872 | 62 | 470 | 4.967742 | 0.5 | 0.045455 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.193617 | 470 | 19 | 66 | 24.736842 | 0.812665 | 0 | 0 | 0 | 0 | 0 | 0.021277 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.071429 | false | 0.071429 | 0.285714 | 0 | 0.428571 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
3d01ac637b4c1567be407c41f998df95346e146e | 9,625 | py | Python | noiseplanet/ui/foroute.py | jks-liu/noiseplanet | 907b2bb9a93df48a266ad01c7cad0d8ef2367e78 | [
"Apache-2.0"
] | 27 | 2020-06-13T21:00:53.000Z | 2022-03-29T03:22:06.000Z | noiseplanet/ui/foroute.py | voodooed/noiseplanet | fca79ef3b81826a5286d566ebf3bf9340df13201 | [
"Apache-2.0"
] | 12 | 2020-12-24T08:14:00.000Z | 2022-02-06T18:01:51.000Z | noiseplanet/ui/foroute.py | voodooed/noiseplanet | fca79ef3b81826a5286d566ebf3bf9340df13201 | [
"Apache-2.0"
] | 9 | 2020-08-28T16:06:54.000Z | 2022-01-26T01:05:02.000Z | # -*- coding: utf-8 -*-
# Created on Thu Dec 5 16:49:20 2019
# @author: arthurd
"""
FoRoute Module.
Visualize Map Matching routes on HTML maps.
"""
from matplotlib import collections as mc
import matplotlib.pyplot as plt
import osmnx as ox
import webbrowser
import folium
import numpy as np
import noiseplanet.matc... | 35.25641 | 135 | 0.596052 | 1,190 | 9,625 | 4.653782 | 0.184034 | 0.086674 | 0.166125 | 0.187793 | 0.476345 | 0.44312 | 0.384074 | 0.352474 | 0.291622 | 0.247923 | 0 | 0.022532 | 0.299117 | 9,625 | 272 | 136 | 35.386029 | 0.798399 | 0.357091 | 0 | 0.222222 | 0 | 0 | 0.26314 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.025641 | false | 0 | 0.059829 | 0 | 0.111111 | 0.008547 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
3d0a0caba7e42c68f34c9ee17feb9495b1fa25d3 | 1,626 | bzl | Python | transitive_maven_jar_rule/transitive_maven_jar_rule.bzl | petroseskinder/transitive_maven_jar_rule | 895d6a4a323b10328882412903b13821964ba00c | [
"Apache-2.0"
] | null | null | null | transitive_maven_jar_rule/transitive_maven_jar_rule.bzl | petroseskinder/transitive_maven_jar_rule | 895d6a4a323b10328882412903b13821964ba00c | [
"Apache-2.0"
] | null | null | null | transitive_maven_jar_rule/transitive_maven_jar_rule.bzl | petroseskinder/transitive_maven_jar_rule | 895d6a4a323b10328882412903b13821964ba00c | [
"Apache-2.0"
] | null | null | null |
# Binary dependencies needed for running the bash commands
DEPS = ["mvn", "openssl", "awk"]
# helper function to encapsulate bash commands.
def _execute(ctx, command):
return ctx.execute(["bash", "-c", """
set -ex
%s""" % command])
# Assert that all relevant binaries are on class path
#TODO(petros): how should I de... | 28.034483 | 100 | 0.707872 | 235 | 1,626 | 4.744681 | 0.476596 | 0.026906 | 0.04843 | 0.039462 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.001447 | 0.150062 | 1,626 | 57 | 101 | 28.526316 | 0.805355 | 0.231242 | 0 | 0 | 0 | 0 | 0.207729 | 0.037842 | 0 | 0 | 0 | 0.017544 | 0 | 1 | 0.097561 | false | 0 | 0 | 0.02439 | 0.121951 | 0.195122 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
3d0a18dfa8835b938cf560e985a79894436087c4 | 5,074 | py | Python | ietf/group/admin.py | MatheusProla/Codestand | f9f13f2b6e8f9a1500f93ab54da977bb7de0bf9e | [
"BSD-3-Clause-No-Nuclear-License-2014",
"BSD-3-Clause"
] | 2 | 2021-11-20T03:40:40.000Z | 2021-11-20T03:40:42.000Z | ietf/group/admin.py | MatheusProla/Codestand | f9f13f2b6e8f9a1500f93ab54da977bb7de0bf9e | [
"BSD-3-Clause-No-Nuclear-License-2014",
"BSD-3-Clause"
] | null | null | null | ietf/group/admin.py | MatheusProla/Codestand | f9f13f2b6e8f9a1500f93ab54da977bb7de0bf9e | [
"BSD-3-Clause-No-Nuclear-License-2014",
"BSD-3-Clause"
] | null | null | null | from functools import update_wrapper
from django.contrib import admin
from django.contrib.admin.utils import unquote
from django.core.exceptions import PermissionDenied
from django.core.management import load_command_class
from django.http import Http404
from django.shortcuts import render
from django.utils.encoding i... | 36.503597 | 169 | 0.656287 | 601 | 5,074 | 5.34609 | 0.254576 | 0.028011 | 0.037037 | 0.048553 | 0.165266 | 0.13352 | 0.098039 | 0.085279 | 0.059757 | 0 | 0 | 0.001482 | 0.20201 | 5,074 | 138 | 170 | 36.768116 | 0.792047 | 0.002365 | 0 | 0.074766 | 0 | 0.009346 | 0.153983 | 0.029848 | 0 | 0 | 0 | 0 | 0 | 1 | 0.056075 | false | 0 | 0.11215 | 0.009346 | 0.588785 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
3d15e7a51c74b32909c30ef04f37051ae9b38262 | 1,334 | py | Python | modelchimp/migrations/0046_experimentasset.py | samzer/modelchimp-server | 48668d0f73025b2cc967006b3193b67aaf970ad7 | [
"BSD-2-Clause"
] | 134 | 2018-11-07T08:35:47.000Z | 2022-01-09T00:39:40.000Z | modelchimp/migrations/0046_experimentasset.py | samzer/modelchimp-server | 48668d0f73025b2cc967006b3193b67aaf970ad7 | [
"BSD-2-Clause"
] | 841 | 2018-11-06T19:45:04.000Z | 2022-03-31T13:07:16.000Z | modelchimp/migrations/0046_experimentasset.py | samzer/modelchimp-server | 48668d0f73025b2cc967006b3193b67aaf970ad7 | [
"BSD-2-Clause"
] | 16 | 2019-02-08T12:48:17.000Z | 2021-02-18T22:11:38.000Z | # Generated by Django 2.1.7 on 2019-02-21 15:50
import django.contrib.postgres.fields.jsonb
from django.db import migrations, models
import django.db.models.deletion
class Migration(migrations.Migration):
dependencies = [
('modelchimp', '0045_remove_machinelearningmodel_deep_learning_parameters'),
]... | 46 | 176 | 0.661169 | 146 | 1,334 | 5.869863 | 0.513699 | 0.03734 | 0.049008 | 0.077013 | 0.256709 | 0.18203 | 0.18203 | 0.18203 | 0.18203 | 0.18203 | 0 | 0.020716 | 0.203898 | 1,334 | 28 | 177 | 47.642857 | 0.786252 | 0.033733 | 0 | 0 | 1 | 0 | 0.18648 | 0.068376 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.136364 | 0 | 0.272727 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
3d2a7cf8258c007258897918737155eede2eafa6 | 1,917 | py | Python | docs/modeling/code/timingExample.py | pramodsu/ILA-Tools | e76bd90cf356ada8dd6f848fb377f57c83322c71 | [
"MIT"
] | 1 | 2021-11-29T03:51:27.000Z | 2021-11-29T03:51:27.000Z | docs/modeling/code/timingExample.py | pramodsu/ILA-Tools | e76bd90cf356ada8dd6f848fb377f57c83322c71 | [
"MIT"
] | 1 | 2018-06-25T08:49:22.000Z | 2018-06-25T08:49:22.000Z | docs/modeling/code/timingExample.py | pramodsu/ILA-Tools | e76bd90cf356ada8dd6f848fb377f57c83322c71 | [
"MIT"
] | 3 | 2018-06-26T11:31:40.000Z | 2021-12-01T20:16:21.000Z | Accelerator = ila.Abstraction('ExampleILA') # Define the Abstraction
# Define the Interface
write_grant = Accelerator.inp('write_grant', 1) # - request grant
write_data = Accelerator.reg('write_data' , 32) # - data port
write_length= Accelerator.re... | 53.25 | 80 | 0.51591 | 207 | 1,917 | 4.647343 | 0.415459 | 0.049896 | 0.045738 | 0.046778 | 0.035343 | 0 | 0 | 0 | 0 | 0 | 0 | 0.030329 | 0.398018 | 1,917 | 35 | 81 | 54.771429 | 0.803293 | 0.324465 | 0 | 0 | 0 | 0 | 0.078927 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0 | null | null | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
3d2b070a0fff4830f38e33310fb3da4f5d0542d0 | 2,153 | py | Python | metarecord/admin/function.py | City-of-Helsinki/helerm | b7475d0b8f73b134a3e5d2cbb12650d64ef0008a | [
"MIT"
] | 2 | 2017-04-21T15:36:23.000Z | 2020-12-04T09:32:39.000Z | metarecord/admin/function.py | City-of-Helsinki/helerm | b7475d0b8f73b134a3e5d2cbb12650d64ef0008a | [
"MIT"
] | 168 | 2016-10-05T12:58:41.000Z | 2021-08-31T14:29:56.000Z | metarecord/admin/function.py | City-of-Helsinki/helerm | b7475d0b8f73b134a3e5d2cbb12650d64ef0008a | [
"MIT"
] | 7 | 2016-10-13T12:51:36.000Z | 2021-01-21T13:05:04.000Z | from django.contrib import admin
from django.db import transaction
from django.urls import path
from django.utils.translation import gettext_lazy as _
from metarecord.models.function import Function, MetadataVersion
from metarecord.views.admin import tos_import_view
class MetadataVersionInline(admin.TabularInline):
... | 34.174603 | 103 | 0.69856 | 258 | 2,153 | 5.531008 | 0.348837 | 0.100911 | 0.03644 | 0.033637 | 0.039944 | 0 | 0 | 0 | 0 | 0 | 0 | 0.000574 | 0.190432 | 2,153 | 62 | 104 | 34.725806 | 0.81813 | 0 | 0 | 0 | 0 | 0 | 0.157455 | 0.020437 | 0 | 0 | 0 | 0 | 0 | 1 | 0.145833 | false | 0 | 0.1875 | 0.083333 | 0.75 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
3d3104bedb4c994b868bb6bcba28f35b045b41fe | 1,285 | py | Python | listings/feeds.py | wtrevino/django-listings | 0b11548bb86cc2bfca0a09deedcd192c60e884fb | [
"MIT"
] | 2 | 2015-07-28T13:19:18.000Z | 2019-04-01T20:13:28.000Z | listings/feeds.py | wtrevino/django-listings | 0b11548bb86cc2bfca0a09deedcd192c60e884fb | [
"MIT"
] | null | null | null | listings/feeds.py | wtrevino/django-listings | 0b11548bb86cc2bfca0a09deedcd192c60e884fb | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
from django.contrib.syndication.views import Feed
from django.shortcuts import get_object_or_404
from django.core.urlresolvers import reverse
from django.utils.translation import ugettext_lazy as _
from listings.models import Job
from categories.models import Category
from listings.conf.setting... | 29.204545 | 80 | 0.620233 | 166 | 1,285 | 4.638554 | 0.391566 | 0.051948 | 0.057143 | 0.036364 | 0.064935 | 0.064935 | 0.064935 | 0 | 0 | 0 | 0 | 0.009626 | 0.272374 | 1,285 | 43 | 81 | 29.883721 | 0.813904 | 0.016342 | 0 | 0.205882 | 0 | 0 | 0.115689 | 0.01664 | 0 | 0 | 0 | 0 | 0 | 1 | 0.147059 | false | 0 | 0.205882 | 0 | 0.617647 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
3d378eeb6212b138600d5c57837c116cf95c37bb | 1,247 | py | Python | algorithm/src/libs/algorithm.py | AleksandrIvanov89/trading | 36672cb47dee2c4a284d611b2a2bd0741f5c1c3f | [
"MIT"
] | null | null | null | algorithm/src/libs/algorithm.py | AleksandrIvanov89/trading | 36672cb47dee2c4a284d611b2a2bd0741f5c1c3f | [
"MIT"
] | null | null | null | algorithm/src/libs/algorithm.py | AleksandrIvanov89/trading | 36672cb47dee2c4a284d611b2a2bd0741f5c1c3f | [
"MIT"
] | null | null | null | import os
import numpy as np
from .logger import *
from .bot import *
from .mongo import *
from .data_service_api import *
class Algorithm():
def __init__(self, db, bot_id, logger):
self.bot= Bot(db, bot_id)
self.account_data_service_api = DataServiceAPI(
os.environ.get("ACCOUNTS_R... | 21.135593 | 60 | 0.614274 | 148 | 1,247 | 4.885135 | 0.317568 | 0.033195 | 0.058091 | 0.060858 | 0.185339 | 0 | 0 | 0 | 0 | 0 | 0 | 0.001147 | 0.300722 | 1,247 | 58 | 61 | 21.5 | 0.827982 | 0 | 0 | 0.195122 | 0 | 0 | 0.045016 | 0.0209 | 0 | 0 | 0 | 0 | 0 | 1 | 0.170732 | false | 0.121951 | 0.146341 | 0 | 0.341463 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
3d3e06943d53a22c98b1f5046ff84ac8dfe288ce | 4,500 | py | Python | src/algo/__tests__.py | TuringApp/Turing | 787bc0eb15af632e7a7a95fd6848db62e91822ea | [
"MIT"
] | 42 | 2018-05-02T07:07:27.000Z | 2022-02-01T19:49:49.000Z | src/algo/__tests__.py | TuringApp/Turing | 787bc0eb15af632e7a7a95fd6848db62e91822ea | [
"MIT"
] | 65 | 2018-03-08T11:53:13.000Z | 2018-09-17T09:00:09.000Z | src/algo/__tests__.py | TuringApp/Turing | 787bc0eb15af632e7a7a95fd6848db62e91822ea | [
"MIT"
] | 8 | 2018-03-31T16:01:36.000Z | 2022-03-06T14:49:24.000Z | # -*- coding: utf-8 -*-
from algo.stmts import *
from algo.worker import Worker
from maths.parser import quick_parse as parse
from tests.framework import expect
tests = [
(
[
AssignStmt(parse("sum"), parse("0")),
InputStmt(parse("N")),
ForStmt("i", parse("1"), parse("N"... | 25.139665 | 70 | 0.312667 | 325 | 4,500 | 4.286154 | 0.276923 | 0.137832 | 0.046662 | 0.050251 | 0.101938 | 0.035176 | 0 | 0 | 0 | 0 | 0 | 0.036659 | 0.521111 | 4,500 | 178 | 71 | 25.280899 | 0.609745 | 0.004667 | 0 | 0.4 | 0 | 0 | 0.077061 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.018182 | false | 0 | 0.024242 | 0 | 0.048485 | 0.018182 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
3d3e184906cf764fdd9495dbd90672a4126cb9e8 | 671 | py | Python | Program_RPI_IOT_code/Python/sr04.py | skyhigh8591/Learning_Test_Program | 5f3c0f11874618919002126863772e0dd06a1072 | [
"MIT"
] | null | null | null | Program_RPI_IOT_code/Python/sr04.py | skyhigh8591/Learning_Test_Program | 5f3c0f11874618919002126863772e0dd06a1072 | [
"MIT"
] | null | null | null | Program_RPI_IOT_code/Python/sr04.py | skyhigh8591/Learning_Test_Program | 5f3c0f11874618919002126863772e0dd06a1072 | [
"MIT"
] | null | null | null | #!/usr/bin/python
# -*- coding: UTF-8 -*-
import RPi.GPIO as GPIO
import time
trigPin=13
echoPin=15
GPIO.setmode(GPIO.BOARD)
GPIO.setup(trigPin,GPIO.OUT)
GPIO.setup(echoPin,GPIO.IN)
def getDistance():
GPIO.output(trigPin,False)
print "Waiting for sensor to settle"
time.sleep(2)
GPIO.output(trigPin,True)
time.sle... | 21.645161 | 40 | 0.745156 | 103 | 671 | 4.796117 | 0.466019 | 0.060729 | 0.103239 | 0.089069 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.035058 | 0.107303 | 671 | 31 | 41 | 21.645161 | 0.789649 | 0.056632 | 0 | 0.076923 | 0 | 0 | 0.064873 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.076923 | null | null | 0.076923 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
3d3fe69703b9e44bcb8aa4da559847e4154a8a85 | 875 | py | Python | Data_processing/post_load_mentee_behavior.py | maynard242/Database-Design-and-Analysis | 01006fce5b4fdca3915b2a1dc9b3e3c170c892af | [
"MIT"
] | 2 | 2018-11-17T05:44:26.000Z | 2018-11-17T07:16:25.000Z | Data_processing/post_load_mentee_behavior.py | maynard242/Database-Design-and-Analysis | 01006fce5b4fdca3915b2a1dc9b3e3c170c892af | [
"MIT"
] | null | null | null | Data_processing/post_load_mentee_behavior.py | maynard242/Database-Design-and-Analysis | 01006fce5b4fdca3915b2a1dc9b3e3c170c892af | [
"MIT"
] | null | null | null | #/usr/bin/env python3
# Program to create table mentee_behavior and load from csv
import psycopg2
conn = psycopg2.connect(database="awesome", user = "awesome_admin",
password="w205.Awesome", host = "34.193.7.196", port="5432")
cur = conn.cursor()
cur.execute('''CREATE TABLE IF NOT EXISTS mentee_beh... | 26.515152 | 71 | 0.738286 | 128 | 875 | 4.796875 | 0.601563 | 0.091205 | 0.032573 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.02861 | 0.161143 | 875 | 32 | 72 | 27.34375 | 0.807902 | 0.089143 | 0 | 0.083333 | 0 | 0 | 0.683727 | 0.066929 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.041667 | 0.041667 | 0 | 0.041667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
3d44bdde3582e6fb3ac48d80a0b4ca76cf4c3331 | 29,796 | py | Python | senn/trainer.py | LukasDeis/SENN | 0890e132159ee381c28f6315d5b6d00b17673477 | [
"MIT"
] | null | null | null | senn/trainer.py | LukasDeis/SENN | 0890e132159ee381c28f6315d5b6d00b17673477 | [
"MIT"
] | null | null | null | senn/trainer.py | LukasDeis/SENN | 0890e132159ee381c28f6315d5b6d00b17673477 | [
"MIT"
] | null | null | null | import csv
import os
from pprint import pprint
from types import SimpleNamespace
from tensorflow import keras
"""
import torch
import torch.nn.functional as F
import torch.optim as opt
from torch.utils.tensorboard import SummaryWriter
"""
from .models.senn import SENN, DiSENN
from .models.losses import *
from .utils... | 39.728 | 119 | 0.588871 | 3,240 | 29,796 | 5.219444 | 0.123765 | 0.031873 | 0.02661 | 0.022471 | 0.617468 | 0.600733 | 0.576607 | 0.550293 | 0.53888 | 0.516942 | 0 | 0.003909 | 0.313196 | 29,796 | 749 | 120 | 39.781041 | 0.822469 | 0.189287 | 0 | 0.576923 | 0 | 0 | 0.101869 | 0.032999 | 0 | 0 | 0 | 0.012016 | 0 | 1 | 0.06213 | false | 0 | 0.026627 | 0 | 0.112426 | 0.100592 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
3d4c979295876aeeb8dac802221a7000d097d6de | 28,877 | py | Python | psx/_dump_/23/_dump_ida_/overlay_c/set_funcs.py | maoa3/scalpel | 2e7381b516cded28996d290438acc618d00b2aa7 | [
"Unlicense"
] | 15 | 2018-06-28T01:11:25.000Z | 2021-09-27T15:57:18.000Z | psx/_dump_/23/_dump_ida_/overlay_c/set_funcs.py | maoa3/scalpel | 2e7381b516cded28996d290438acc618d00b2aa7 | [
"Unlicense"
] | 7 | 2018-06-29T04:08:23.000Z | 2019-10-17T13:57:22.000Z | psx/_dump_/23/_dump_ida_/overlay_c/set_funcs.py | maoa3/scalpel | 2e7381b516cded28996d290438acc618d00b2aa7 | [
"Unlicense"
] | 7 | 2018-06-28T01:11:34.000Z | 2020-05-23T09:21:48.000Z | del_items(0x80124F0C)
SetType(0x80124F0C, "void GameOnlyTestRoutine__Fv()")
del_items(0x80124F14)
SetType(0x80124F14, "int vecleny__Fii(int a, int b)")
del_items(0x80124F38)
SetType(0x80124F38, "int veclenx__Fii(int a, int b)")
del_items(0x80124F64)
SetType(0x80124F64, "void GetDamageAmt__FiPiT1(int i, int *mind, int *... | 48.208681 | 195 | 0.78959 | 4,326 | 28,877 | 5.032131 | 0.177762 | 0.109881 | 0.028113 | 0.055676 | 0.321237 | 0.241398 | 0.226607 | 0.204189 | 0.200606 | 0.187514 | 0 | 0.17618 | 0.094851 | 28,877 | 598 | 196 | 48.289298 | 0.656668 | 0 | 0 | 0 | 0 | 0.098662 | 0.523704 | 0.135125 | 0 | 0 | 0.207085 | 0 | 0 | 1 | 0 | true | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
3d51e3a89e3b3ccf074cdb5445473ccb253e3e08 | 4,173 | py | Python | sdk/python/pulumi_aws/ec2/get_local_gateway_virtual_interface_group.py | JakeGinnivan/pulumi-aws | c91ef78932964ac74eda7f5da81f65b0f1798c93 | [
"ECL-2.0",
"Apache-2.0"
] | null | null | null | sdk/python/pulumi_aws/ec2/get_local_gateway_virtual_interface_group.py | JakeGinnivan/pulumi-aws | c91ef78932964ac74eda7f5da81f65b0f1798c93 | [
"ECL-2.0",
"Apache-2.0"
] | null | null | null | sdk/python/pulumi_aws/ec2/get_local_gateway_virtual_interface_group.py | JakeGinnivan/pulumi-aws | c91ef78932964ac74eda7f5da81f65b0f1798c93 | [
"ECL-2.0",
"Apache-2.0"
] | null | null | null | # coding=utf-8
# *** WARNING: this file was generated by the Pulumi Terraform Bridge (tfgen) Tool. ***
# *** Do not edit by hand unless you're certain you know what you are doing! ***
import json
import warnings
import pulumi
import pulumi.runtime
from typing import Union
from .. import utilities, tables
class GetLoc... | 45.358696 | 264 | 0.724419 | 508 | 4,173 | 5.639764 | 0.307087 | 0.125654 | 0.092845 | 0.136824 | 0.316579 | 0.198255 | 0.024433 | 0.024433 | 0 | 0 | 0 | 0.002967 | 0.192428 | 4,173 | 91 | 265 | 45.857143 | 0.847181 | 0.336928 | 0 | 0 | 1 | 0 | 0.151038 | 0.057264 | 0 | 0 | 0 | 0 | 0 | 1 | 0.06 | false | 0 | 0.12 | 0 | 0.26 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
3d57318e52fd3aae2adf5cf2b310c74a9f710aaa | 2,850 | py | Python | build_matrix.py | mdepasca/miniature-adventure | 4672739d46d433c0487c0a673233f17e7d8a1b2a | [
"Unlicense"
] | 1 | 2018-07-03T18:03:08.000Z | 2018-07-03T18:03:08.000Z | build_matrix.py | mdepasca/miniature-adventure | 4672739d46d433c0487c0a673233f17e7d8a1b2a | [
"Unlicense"
] | null | null | null | build_matrix.py | mdepasca/miniature-adventure | 4672739d46d433c0487c0a673233f17e7d8a1b2a | [
"Unlicense"
] | null | null | null | import numpy as np
import gc
import argparse
import utilities as util
if __name__ == "__main__":
"""
The routine works by reading in a file containig in each line the
time stamp of the sub-matrix file (WARNING: they have to be in the
correct order, 1st line -> sub-matrix 00; 2nd line -> sub-matrix 01
etc.).
The ... | 19.93007 | 97 | 0.644561 | 378 | 2,850 | 4.777778 | 0.362434 | 0.049834 | 0.094131 | 0.022148 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.076625 | 0.184912 | 2,850 | 142 | 98 | 20.070423 | 0.700818 | 0.166667 | 0 | 0.028571 | 0 | 0 | 0.191083 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.057143 | null | null | 0.328571 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
3d5956c1ddfb609919100418482980421324c249 | 1,233 | py | Python | deploy/git.py | yuji3w/hknweb | 0df5369da28f46dc9016da97652cb6b8e2b7f3e6 | [
"MIT"
] | 3 | 2019-04-22T21:51:07.000Z | 2019-12-16T21:54:00.000Z | deploy/git.py | yuji3w/hknweb | 0df5369da28f46dc9016da97652cb6b8e2b7f3e6 | [
"MIT"
] | null | null | null | deploy/git.py | yuji3w/hknweb | 0df5369da28f46dc9016da97652cb6b8e2b7f3e6 | [
"MIT"
] | null | null | null | from fabric import Connection
from .path import repo_path, file_exists
def check(c: Connection):
return remote_reachable(c)
def update(c: Connection):
if repo_exists(c):
fetch(c)
else:
clone(c)
def repo_exists(c: Connection) -> bool:
return file_exists(c, "{}/HEAD".format(c.repo_path... | 32.447368 | 99 | 0.647202 | 198 | 1,233 | 3.929293 | 0.272727 | 0.113111 | 0.062982 | 0.051414 | 0.302057 | 0.186375 | 0.161954 | 0.161954 | 0.161954 | 0.161954 | 0 | 0.002976 | 0.182482 | 1,233 | 37 | 100 | 33.324324 | 0.768849 | 0 | 0 | 0.142857 | 0 | 0 | 0.151663 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.285714 | false | 0 | 0.071429 | 0.071429 | 0.5 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
3d5cb6fade874088fba1883a212ce48659833041 | 9,150 | py | Python | src/contrib/hod/hodlib/Common/util.py | hoppinghippo/HadoopMapReduce | d94db34701776378415e5732aca3079689e69fe1 | [
"Apache-2.0"
] | 194 | 2015-01-07T11:12:52.000Z | 2022-03-14T09:19:24.000Z | src/contrib/hod/hodlib/Common/util.py | hoppinghippo/HadoopMapReduce | d94db34701776378415e5732aca3079689e69fe1 | [
"Apache-2.0"
] | 10 | 2019-11-13T06:03:05.000Z | 2021-08-02T17:05:22.000Z | src/contrib/hod/hodlib/Common/util.py | hoppinghippo/HadoopMapReduce | d94db34701776378415e5732aca3079689e69fe1 | [
"Apache-2.0"
] | 172 | 2015-01-14T19:25:48.000Z | 2022-02-24T02:42:02.000Z | #Licensed to the Apache Software Foundation (ASF) under one
#or more contributor license agreements. See the NOTICE file
#distributed with this work for additional information
#regarding copyright ownership. The ASF licenses this file
#to you under the Apache License, Version 2.0 (the
#"License"); you may not use thi... | 29.516129 | 90 | 0.646995 | 1,153 | 9,150 | 5.06418 | 0.338248 | 0.002398 | 0.010276 | 0.00548 | 0.059942 | 0.059942 | 0.047611 | 0.027744 | 0.027744 | 0.027744 | 0 | 0.009712 | 0.234754 | 9,150 | 309 | 91 | 29.61165 | 0.824193 | 0.15541 | 0 | 0.223256 | 0 | 0 | 0.086534 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.013953 | null | null | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
e9e6952252e012cb3c4b6370c2e112928d899eba | 213 | py | Python | Examples/SpeechTests/GetAllSpeechesFromAuthor.py | cwf2/dices-client | 0ee2eb4ebbb4faaec40547fa8a429e52b6742aee | [
"MIT"
] | null | null | null | Examples/SpeechTests/GetAllSpeechesFromAuthor.py | cwf2/dices-client | 0ee2eb4ebbb4faaec40547fa8a429e52b6742aee | [
"MIT"
] | null | null | null | Examples/SpeechTests/GetAllSpeechesFromAuthor.py | cwf2/dices-client | 0ee2eb4ebbb4faaec40547fa8a429e52b6742aee | [
"MIT"
] | 2 | 2021-05-06T15:46:21.000Z | 2021-07-06T13:38:13.000Z | from dicesapi import DicesAPI
api = DicesAPI() #Create a link to the dicesAPI
speeches = api.getSpeeches(author_name="Homer") #Get all speeches from Homer
print(len(speeches)) #Print how many speeches there are | 30.428571 | 76 | 0.779343 | 32 | 213 | 5.15625 | 0.6875 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.140845 | 213 | 7 | 77 | 30.428571 | 0.901639 | 0.41784 | 0 | 0 | 0 | 0 | 0.040984 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 0.25 | 0.25 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
e9e6e98ea7a12e9d2ea9a328cdb34857c82a4b65 | 1,404 | py | Python | examples/gauss.pyre/tests/package/pi.py | PyreFramework/pyre | 345c7449a3416eea1c1affa74fb32faff30a6aaa | [
"BSD-3-Clause"
] | null | null | null | examples/gauss.pyre/tests/package/pi.py | PyreFramework/pyre | 345c7449a3416eea1c1affa74fb32faff30a6aaa | [
"BSD-3-Clause"
] | null | null | null | examples/gauss.pyre/tests/package/pi.py | PyreFramework/pyre | 345c7449a3416eea1c1affa74fb32faff30a6aaa | [
"BSD-3-Clause"
] | null | null | null | #!/usr/bin/env python3
# -*- coding: utf-8 -*-
#
# michael a.g. aïvázis
# orthologue
# (c) 1998-2022 all rights reserved
#
"""
Assemble an integration entirely through a local configuration file
"""
def test():
# load the local configuration file
# import pyre
# pyre.executive.configurator.dump()
# ... | 26 | 67 | 0.621795 | 187 | 1,404 | 4.59893 | 0.42246 | 0.089535 | 0.115116 | 0.162791 | 0.205814 | 0.102326 | 0 | 0 | 0 | 0 | 0 | 0.012739 | 0.217236 | 1,404 | 53 | 68 | 26.490566 | 0.769791 | 0.702279 | 0 | 0 | 0 | 0 | 0.031414 | 0 | 0 | 0 | 0 | 0 | 0.1 | 1 | 0.1 | false | 0 | 0.2 | 0 | 0.4 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
e9f0e8fb165034fbcf2120107748fb7f4ddf4bbf | 452 | py | Python | Other code/SQL Connection Scripts/Server Test.py | Ange-lina/BalticOffshorePotential | fd8af87bfe0bc069fe1ec6fd1c9e175ff1a5a1d3 | [
"MIT"
] | 2 | 2020-01-16T17:35:27.000Z | 2020-01-16T17:45:54.000Z | Other code/SQL Connection Scripts/Server Test.py | Ange-lina/BalticOffshorePotential | fd8af87bfe0bc069fe1ec6fd1c9e175ff1a5a1d3 | [
"MIT"
] | null | null | null | Other code/SQL Connection Scripts/Server Test.py | Ange-lina/BalticOffshorePotential | fd8af87bfe0bc069fe1ec6fd1c9e175ff1a5a1d3 | [
"MIT"
] | 2 | 2020-01-17T09:15:26.000Z | 2020-01-17T09:16:47.000Z | # -*- coding: utf-8 -*-
"""
Created on Mon Nov 18 16:17:59 2019
@author: Petronium
"""
import psycopg2
conn = psycopg2.connect("dbname='Baltic_project' \
host='localhost' \
user='postgres' \
password='1Michalak123'")
cur = conn.cursor()
cur.... | 18.08 | 50 | 0.530973 | 50 | 452 | 4.76 | 0.82 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.061688 | 0.318584 | 452 | 24 | 51 | 18.833333 | 0.711039 | 0.172566 | 0 | 0 | 0 | 0 | 0.224044 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.076923 | 0.076923 | 0 | 0.076923 | 0.076923 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
e9f21aca7cad4bf0a3999eb810369b96a9b95912 | 4,235 | py | Python | lecturer/models.py | VirginiaNdungu1/Grading-System | 7f30a81cf2b1717c9f0a5a7f5814404c646eee9d | [
"MIT"
] | 1 | 2021-05-13T12:38:51.000Z | 2021-05-13T12:38:51.000Z | lecturer/models.py | VirginiaNdungu1/Grading-System | 7f30a81cf2b1717c9f0a5a7f5814404c646eee9d | [
"MIT"
] | null | null | null | lecturer/models.py | VirginiaNdungu1/Grading-System | 7f30a81cf2b1717c9f0a5a7f5814404c646eee9d | [
"MIT"
] | null | null | null | from django.db import models
from django.contrib.auth.models import User
from django.db.models.signals import post_save
from django.dispatch import receiver
from django.core.validators import RegexValidator
from phonenumber_field.modelfields import PhoneNumberField
import student
import weekday_field
from datetime impo... | 30.035461 | 85 | 0.702007 | 526 | 4,235 | 5.45057 | 0.304183 | 0.047088 | 0.087897 | 0.117196 | 0.341123 | 0.289501 | 0.198814 | 0.162888 | 0.162888 | 0.097314 | 0 | 0.010286 | 0.173554 | 4,235 | 140 | 86 | 30.25 | 0.808857 | 0.005667 | 0 | 0.149533 | 0 | 0 | 0.080304 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.084112 | false | 0 | 0.084112 | 0.074766 | 0.654206 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
e9f37044ff374c0ce96ec5fe07a34b53d13d3d2d | 1,070 | py | Python | whisk/template/{{ cookiecutter.repo_name }}/setup.py | BookletAI/whisk | 814a3e3b0ee2a97d9c42044cde9571946b72910e | [
"MIT"
] | 8 | 2020-06-16T13:13:03.000Z | 2021-12-25T00:01:57.000Z | whisk/template/{{ cookiecutter.repo_name }}/setup.py | whisk-ml/whisk | 55e573f837a8a5f34279fa5e83a721582fdcb24e | [
"MIT"
] | 9 | 2020-05-13T22:15:25.000Z | 2021-01-24T23:41:57.000Z | whisk/template/{{ cookiecutter.repo_name }}/setup.py | whisk-ml/whisk | 55e573f837a8a5f34279fa5e83a721582fdcb24e | [
"MIT"
] | null | null | null | from setuptools import find_packages, setup
setup(
name='{{cookiecutter.project_name}}',
package_dir={'': 'src'},
packages=find_packages(where='src'),
version='0.1.0',
include_package_data=True,
# By default only whisk is added as a dependency. whisk is required for
# accessing the artifact... | 35.666667 | 94 | 0.668224 | 137 | 1,070 | 5.10219 | 0.620438 | 0.081545 | 0.098712 | 0.077253 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.005875 | 0.204673 | 1,070 | 29 | 95 | 36.896552 | 0.815511 | 0.307477 | 0 | 0.095238 | 0 | 0 | 0.437926 | 0.226467 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.047619 | 0 | 0.047619 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
e9f5a09ba297a9437f02cfccba14018fefa3ef16 | 13,691 | py | Python | patch/cfs/tools/cFS-GroundSystem/Subsystems/cmdGui/UdpCommands.py | cypher-me/HAS-Qualifier-Challenges | bb795303716155dad4a930880a58fecb5d9b50c5 | [
"MIT"
] | 75 | 2020-07-20T20:54:00.000Z | 2022-03-09T09:18:37.000Z | patch/cfs/tools/cFS-GroundSystem/Subsystems/cmdGui/UdpCommands.py | cypher-me/HAS-Qualifier-Challenges | bb795303716155dad4a930880a58fecb5d9b50c5 | [
"MIT"
] | 3 | 2020-09-13T00:46:49.000Z | 2021-07-06T16:18:22.000Z | patch/cfs/tools/cFS-GroundSystem/Subsystems/cmdGui/UdpCommands.py | cypher-me/HAS-Qualifier-Challenges | bb795303716155dad4a930880a58fecb5d9b50c5 | [
"MIT"
] | 14 | 2020-07-22T16:34:51.000Z | 2021-09-13T12:19:59.000Z | #!/usr/bin/env python
#
# UdpCommands.py -- This is a class that creates a simple command dialog and
# sends commands using the cmdUtil UDP C program.
#
# The commands that can be sent are defined in comma delimited text files.
# This class deals with ... | 37.102981 | 268 | 0.641516 | 1,408 | 13,691 | 6.115767 | 0.179688 | 0.06271 | 0.174196 | 0.101614 | 0.257345 | 0.029962 | 0.025084 | 0.025084 | 0.017884 | 0.017884 | 0 | 0.035373 | 0.250457 | 13,691 | 368 | 269 | 37.203804 | 0.803742 | 0.078957 | 0 | 0.132576 | 0 | 0.007576 | 0.066535 | 0.005825 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.041667 | null | null | 0.007576 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
e9f6bb73e6e52cad791f21cd41f104e487ab5762 | 3,901 | py | Python | Sim2RealNet/ssim.py | xiaoqi25478/Progressive-Data-Augmentation-Method | 989a7765383d061c43440ec062a970c0ade4f37a | [
"MIT"
] | 2 | 2021-10-11T10:14:06.000Z | 2021-12-16T06:15:57.000Z | Sim2RealNet/ssim.py | xiaoqi25478/Progressive-Data-Augmentation-Method | 989a7765383d061c43440ec062a970c0ade4f37a | [
"MIT"
] | 1 | 2021-12-15T05:10:30.000Z | 2022-03-14T06:21:46.000Z | Sim2RealNet/ssim.py | xiaoqi25478/Progressive-Data-Augmentation-Method | 989a7765383d061c43440ec062a970c0ade4f37a | [
"MIT"
] | 1 | 2021-12-16T06:15:59.000Z | 2021-12-16T06:15:59.000Z | import torch
import torch.nn.functional as F
import numpy as np
import math
from PIL import Image
import cv2
def gaussian(window_size, sigma):
"""
Generates a list of Tensor values drawn from a gaussian distribution with standard
diviation = sigma and sum of all elements = 1.
Length of list = window_s... | 33.921739 | 108 | 0.664445 | 561 | 3,901 | 4.459893 | 0.342246 | 0.047962 | 0.031974 | 0.043965 | 0.126299 | 0.074341 | 0.027978 | 0 | 0 | 0 | 0 | 0.046382 | 0.220713 | 3,901 | 115 | 109 | 33.921739 | 0.776645 | 0.190464 | 0 | 0 | 1 | 0 | 0.027858 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.054795 | false | 0 | 0.109589 | 0 | 0.232877 | 0.027397 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
e9f91a2408805e180c23d4d8e3e4c2568f94cf84 | 506 | py | Python | terra/projects/migrations/0020_project_owners.py | dymaxionlabs/platform | 98fe893d4632d62fea3e2357f16d970014037cdf | [
"BSD-3-Clause"
] | null | null | null | terra/projects/migrations/0020_project_owners.py | dymaxionlabs/platform | 98fe893d4632d62fea3e2357f16d970014037cdf | [
"BSD-3-Clause"
] | 1 | 2022-01-21T20:07:50.000Z | 2022-01-21T20:07:50.000Z | terra/projects/migrations/0020_project_owners.py | dymaxionlabs/platform | 98fe893d4632d62fea3e2357f16d970014037cdf | [
"BSD-3-Clause"
] | null | null | null | # Generated by Django 2.1.7 on 2019-03-09 16:27
from django.conf import settings
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
migrations.swappable_dependency(settings.AUTH_USER_MODEL),
('projects', '0019_auto_20190226_1238'),
]
operati... | 24.095238 | 70 | 0.65415 | 56 | 506 | 5.75 | 0.714286 | 0.062112 | 0.099379 | 0.130435 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.081152 | 0.245059 | 506 | 20 | 71 | 25.3 | 0.76178 | 0.088933 | 0 | 0 | 1 | 0 | 0.095861 | 0.050109 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.142857 | 0 | 0.357143 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
e9faa1f69d190d1e925730378a9dcbc206d19bb4 | 3,358 | py | Python | python/get_weather_data.py | notthatbreezy/nyc-taxi-spark-ml | e3a96e098e55147d8b02f2d8ac3e24866ec766fd | [
"Apache-2.0"
] | 11 | 2015-05-20T09:35:16.000Z | 2018-08-29T21:42:21.000Z | python/get_weather_data.py | notthatbreezy/nyc-taxi-spark-ml | e3a96e098e55147d8b02f2d8ac3e24866ec766fd | [
"Apache-2.0"
] | null | null | null | python/get_weather_data.py | notthatbreezy/nyc-taxi-spark-ml | e3a96e098e55147d8b02f2d8ac3e24866ec766fd | [
"Apache-2.0"
] | 10 | 2015-06-07T07:56:26.000Z | 2021-05-23T10:55:33.000Z | """Downloads and parses Forecast IO data"""
import requests
import json
import csv
from pytz import timezone
from datetime import datetime, timedelta
# INSERT YOUR KEY HERE
API_KEY = ""
BASE_URL = "https://api.forecast.io/forecast/%(api_key)s/%(latitude)s,%(longitude)s,%(dt)s"
def get_config():
"""Loads config ... | 32.288462 | 91 | 0.559559 | 348 | 3,358 | 5.247126 | 0.431034 | 0.026287 | 0.023001 | 0.020811 | 0.043812 | 0 | 0 | 0 | 0 | 0 | 0 | 0.015887 | 0.325194 | 3,358 | 104 | 92 | 32.288462 | 0.789938 | 0.005956 | 0 | 0 | 0 | 0.012048 | 0.170927 | 0.030671 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.072289 | null | null | 0.024096 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
e9fda7b703e9a76fa26a858ff52cb87294c73d69 | 229 | py | Python | py/problem_13.py | dfings/project-euler | f66389dcd8ff4e4d64fbd245cfdaebac7b9bd4ef | [
"Unlicense"
] | null | null | null | py/problem_13.py | dfings/project-euler | f66389dcd8ff4e4d64fbd245cfdaebac7b9bd4ef | [
"Unlicense"
] | null | null | null | py/problem_13.py | dfings/project-euler | f66389dcd8ff4e4d64fbd245cfdaebac7b9bd4ef | [
"Unlicense"
] | null | null | null | #!/usr/bin/env python
import os
def load_numbers():
with open(os.path.join(os.path.dirname(__file__), "../data/problem_13_data")) as f:
return map(int, f.read().splitlines())
print(str(sum(load_numbers()))[:10])
| 19.083333 | 87 | 0.659389 | 36 | 229 | 3.972222 | 0.805556 | 0.153846 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.020305 | 0.139738 | 229 | 11 | 88 | 20.818182 | 0.705584 | 0.087336 | 0 | 0 | 0 | 0 | 0.110577 | 0.110577 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | true | 0 | 0.2 | 0 | 0.6 | 0.2 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
1802971b73849805ede02eec362c8114b6e51c85 | 818 | py | Python | clonefinder/old/EmpiricalComputeExp.py | J-Moravec/CloneFinderAPI | 4670ec7522c42dec8b0dc0a79b251510cc216aa1 | [
"MIT"
] | null | null | null | clonefinder/old/EmpiricalComputeExp.py | J-Moravec/CloneFinderAPI | 4670ec7522c42dec8b0dc0a79b251510cc216aa1 | [
"MIT"
] | 5 | 2019-12-03T15:49:39.000Z | 2021-02-03T00:16:57.000Z | clonefinder/old/EmpiricalComputeExp.py | J-Moravec/CloneFinderAPI | 4670ec7522c42dec8b0dc0a79b251510cc216aa1 | [
"MIT"
] | 4 | 2019-10-21T02:25:48.000Z | 2021-01-26T02:19:07.000Z | import sys
import os
Ta=sys.argv[1] #_MutCount.txt
Out=Ta[:-4]+'Format.csv'
SigOrder='C:\\Users\\kumarlab\\Desktop\\CancerSoftware\\TrackSig-master\\TrackSig-master\\annotation\\cosmicSig.csv' #please change the path
SigOrder=open(SigOrder,'r').readlines()[1:]
Order=[]
for i in SigOrder:
Order.append(i.split(',')[... | 26.387097 | 140 | 0.652812 | 132 | 818 | 4.022727 | 0.484848 | 0.067797 | 0.022599 | 0.06403 | 0.090395 | 0.090395 | 0 | 0 | 0 | 0 | 0 | 0.02507 | 0.122249 | 818 | 31 | 141 | 26.387097 | 0.714485 | 0.096577 | 0 | 0 | 0 | 0.035714 | 0.173677 | 0.142469 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.071429 | null | null | 0.035714 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
1806520aa77c5c0472cde6c9e5f1f34a46752591 | 4,042 | py | Python | forml/runtime/asset/directory/lineage.py | mpearmain/forml | 3d69d27b1a64a237c739d2795512b6f9296d3874 | [
"Apache-2.0"
] | null | null | null | forml/runtime/asset/directory/lineage.py | mpearmain/forml | 3d69d27b1a64a237c739d2795512b6f9296d3874 | [
"Apache-2.0"
] | null | null | null | forml/runtime/asset/directory/lineage.py | mpearmain/forml | 3d69d27b1a64a237c739d2795512b6f9296d3874 | [
"Apache-2.0"
] | null | null | null | # Licensed to the Apache Software Foundation (ASF) under one
# or more contributor license agreements. See the NOTICE file
# distributed with this work for additional information
# regarding copyright ownership. The ASF licenses this file
# to you under the Apache License, Version 2.0 (the
# "License"); you may not u... | 34.254237 | 112 | 0.670708 | 518 | 4,042 | 5.19112 | 0.378378 | 0.032726 | 0.020826 | 0.026776 | 0.092228 | 0.044626 | 0 | 0 | 0 | 0 | 0 | 0.004522 | 0.234043 | 4,042 | 117 | 113 | 34.547009 | 0.864018 | 0.428253 | 0 | 0.093023 | 0 | 0 | 0.059587 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.186047 | false | 0 | 0.186047 | 0 | 0.55814 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
18182d9574307e5f63bd9f190951a91a90006bde | 638 | py | Python | data/secret.py | abaddontsoi/noodle | a475ccfc2d939ddef69d7c7ec593d4e5a923c5b6 | [
"MIT"
] | null | null | null | data/secret.py | abaddontsoi/noodle | a475ccfc2d939ddef69d7c7ec593d4e5a923c5b6 | [
"MIT"
] | null | null | null | data/secret.py | abaddontsoi/noodle | a475ccfc2d939ddef69d7c7ec593d4e5a923c5b6 | [
"MIT"
] | null | null | null | #!/usr/bin/env python3
from base64 import b64encode
import os, os.path, sys
abspath = os.path.abspath(sys.argv[0])
os.chdir(os.path.dirname(abspath))
print("=" * 48)
print("[*] Noodle - Secret writer")
print("[*] This will store your credentials in base64-encoded format.")
print("[*] Noodle needs this to authenticat... | 26.583333 | 71 | 0.623824 | 90 | 638 | 4.422222 | 0.588889 | 0.045226 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.031311 | 0.19906 | 638 | 23 | 72 | 27.73913 | 0.747554 | 0.032915 | 0 | 0.111111 | 0 | 0 | 0.37987 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.055556 | 0.111111 | 0 | 0.111111 | 0.333333 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
1819cf4a91969c5aedc76e80a708dbd70dc75533 | 661 | py | Python | trigger_alarms/change_interface_speed.py | ksator/event_driven_junos_device_maintenance_with_appformix_northstar_python | 9a445a55a287c6d1d78a76c6adc29a5758be6b52 | [
"MIT"
] | 5 | 2018-03-23T00:41:14.000Z | 2018-03-23T13:25:03.000Z | trigger_alarms/change_interface_speed.py | ksator/event_driven_network_automation_leveraging_appformix | 9a445a55a287c6d1d78a76c6adc29a5758be6b52 | [
"MIT"
] | null | null | null | trigger_alarms/change_interface_speed.py | ksator/event_driven_network_automation_leveraging_appformix | 9a445a55a287c6d1d78a76c6adc29a5758be6b52 | [
"MIT"
] | 4 | 2018-03-22T23:27:32.000Z | 2018-03-23T13:24:48.000Z | from jnpr.junos import Device
from lxml import etree
from yaml import load
from jnpr.junos.utils.config import Config
import time
f=open('configure_appformix/network_devices.yml', 'r')
my_vars = load(f.read())
f.close()
dev=Device(host="192.168.128.194", user=my_vars['jti']['username'], password=my_vars['jti']['pass... | 19.441176 | 104 | 0.729198 | 108 | 661 | 4.407407 | 0.564815 | 0.037815 | 0.054622 | 0.071429 | 0.10084 | 0 | 0 | 0 | 0 | 0 | 0 | 0.038786 | 0.102874 | 661 | 33 | 105 | 20.030303 | 0.763912 | 0 | 0 | 0.08 | 0 | 0 | 0.259091 | 0.059091 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0.04 | 0.2 | null | null | 0.04 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
181e28e75dc62a9f00e4439f1a00e6b4fee1c4ca | 3,618 | py | Python | USAP_H37Rv/Tools/smalt-0.7.5/test/splitReads_test.py | SANBI-SA-archive/s_bvc_pipeline | 43948b4ea5db6333633361dd91f7e7b320392fb2 | [
"Apache-2.0"
] | null | null | null | USAP_H37Rv/Tools/smalt-0.7.5/test/splitReads_test.py | SANBI-SA-archive/s_bvc_pipeline | 43948b4ea5db6333633361dd91f7e7b320392fb2 | [
"Apache-2.0"
] | null | null | null | USAP_H37Rv/Tools/smalt-0.7.5/test/splitReads_test.py | SANBI-SA-archive/s_bvc_pipeline | 43948b4ea5db6333633361dd91f7e7b320392fb2 | [
"Apache-2.0"
] | null | null | null | # test mapping of split reads (-p flag)
PROGNAM = "../src/smalt"
REF_FASTA_NAME = "genome_1.fa.gz"
KMER = 11
NSKIP = 4
READ_PAIRS = (("ATAAGAACAATTTCCATAAATTATTTGAAGATTATTTAGAAGATTATAAT"\
"AAGAAGTTTTTTCCACTTAAAAATATATTTATATATATATATATATATTT",
"GTACGTATTTATATATTTTAGAATAGAGAATTAATGAATAAATGCA... | 29.900826 | 77 | 0.599226 | 442 | 3,618 | 4.776018 | 0.330317 | 0.028423 | 0.019896 | 0.028423 | 0.180957 | 0.138323 | 0.048318 | 0.048318 | 0.048318 | 0.048318 | 0 | 0.090004 | 0.278331 | 3,618 | 120 | 78 | 30.15 | 0.718499 | 0.08513 | 0 | 0.101124 | 0 | 0 | 0.143765 | 0.067191 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0.011236 | 0.078652 | null | null | 0.033708 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
1823e888d917d7b778fae9619573943226f23d41 | 328 | py | Python | riskmetrics/test/test_riskmetrics.py | hacksmath/GHRiskMetrics | 71233f29be368e0be6d44d79c9da001696480af1 | [
"MIT"
] | 2 | 2019-12-23T10:20:30.000Z | 2020-06-03T06:19:38.000Z | riskmetrics/test/test_riskmetrics.py | micahswab/RiskMetrics | 71233f29be368e0be6d44d79c9da001696480af1 | [
"MIT"
] | 12 | 2017-02-27T19:41:42.000Z | 2017-03-30T07:17:32.000Z | riskmetrics/test/test_riskmetrics.py | hacksmath/GHRiskMetrics | 71233f29be368e0be6d44d79c9da001696480af1 | [
"MIT"
] | 2 | 2019-06-27T13:02:25.000Z | 2020-06-03T06:19:42.000Z | # SPDX-License-Identifier: MIT
from riskmetrics import riskmetrics
def test_construct_cpe():
cpe = riskmetrics.construct_cpe("vendor", "product", "0.1")
assert cpe == 'cpe:/a:vendor:product:0.1'
def test_get_latest_version():
version = riskmetrics.get_latest_version("35g3q", "fq34gf")
assert version... | 23.428571 | 63 | 0.710366 | 42 | 328 | 5.357143 | 0.52381 | 0.062222 | 0.124444 | 0.133333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.032258 | 0.14939 | 328 | 13 | 64 | 25.230769 | 0.774194 | 0.085366 | 0 | 0 | 0 | 0 | 0.175084 | 0.084175 | 0 | 0 | 0 | 0 | 0.285714 | 1 | 0.285714 | false | 0 | 0.142857 | 0 | 0.428571 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
18253ccc9eb3c1fe714bc7c37f0316da52829721 | 490 | py | Python | awesomeDP/users/migrations/0004_auto_20210305_2132.py | bentaro/AwesomeDatePlanBackend | d6403e885e190c4e37eeaadca3264f9a79add6f0 | [
"Unlicense"
] | null | null | null | awesomeDP/users/migrations/0004_auto_20210305_2132.py | bentaro/AwesomeDatePlanBackend | d6403e885e190c4e37eeaadca3264f9a79add6f0 | [
"Unlicense"
] | null | null | null | awesomeDP/users/migrations/0004_auto_20210305_2132.py | bentaro/AwesomeDatePlanBackend | d6403e885e190c4e37eeaadca3264f9a79add6f0 | [
"Unlicense"
] | null | null | null | # Generated by Django 3.1.7 on 2021-03-05 21:32
from django.db import migrations, models
import uuid
class Migration(migrations.Migration):
dependencies = [
('users', '0003_auto_20210305_2112'),
]
operations = [
migrations.AlterField(
model_name='user',
name='use... | 24.5 | 145 | 0.642857 | 57 | 490 | 5.421053 | 0.807018 | 0.05178 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.136364 | 0.236735 | 490 | 19 | 146 | 25.789474 | 0.68984 | 0.091837 | 0 | 0 | 1 | 0 | 0.1693 | 0.133183 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.153846 | 0 | 0.384615 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
1826a60ec780bd151837d8bbf751299e995ffe75 | 798 | py | Python | chapter7/authentication/authentication.py | GoodMonsters/Building-Data-Science-Applications-with-FastAPI | d2218d225c5b93723ecf46c19619ed5d3f2473e6 | [
"MIT"
] | 107 | 2021-03-26T20:18:51.000Z | 2022-03-26T03:38:08.000Z | chapter7/authentication/authentication.py | GoodMonsters/Building-Data-Science-Applications-with-FastAPI | d2218d225c5b93723ecf46c19619ed5d3f2473e6 | [
"MIT"
] | 4 | 2021-06-09T08:48:21.000Z | 2021-12-27T09:04:43.000Z | chapter7/authentication/authentication.py | GoodMonsters/Building-Data-Science-Applications-with-FastAPI | d2218d225c5b93723ecf46c19619ed5d3f2473e6 | [
"MIT"
] | 58 | 2021-03-12T20:51:19.000Z | 2022-03-27T15:49:49.000Z | from typing import Optional
from tortoise.exceptions import DoesNotExist
from chapter7.authentication.models import (
AccessToken,
AccessTokenTortoise,
UserDB,
UserTortoise,
)
from chapter7.authentication.password import verify_password
async def authenticate(email: str, password: str) -> Optional[U... | 25.741935 | 83 | 0.753133 | 91 | 798 | 6.450549 | 0.406593 | 0.093697 | 0.088586 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.00303 | 0.172932 | 798 | 30 | 84 | 26.6 | 0.886364 | 0 | 0 | 0.095238 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.142857 | 0.190476 | 0 | 0.380952 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
18274914cedd53b5a619c86c79edb3113497edeb | 1,581 | py | Python | setup.py | cloudsidekick/digocn | 2401c2351c96abee6c6a49d15e7286461b666e51 | [
"Apache-2.0"
] | 1 | 2017-08-31T03:28:11.000Z | 2017-08-31T03:28:11.000Z | setup.py | cloudsidekick/digocn | 2401c2351c96abee6c6a49d15e7286461b666e51 | [
"Apache-2.0"
] | null | null | null | setup.py | cloudsidekick/digocn | 2401c2351c96abee6c6a49d15e7286461b666e51 | [
"Apache-2.0"
] | null | null | null | #########################################################################
# Copyright 2011 Cloud Sidekick
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses... | 35.931818 | 74 | 0.631879 | 177 | 1,581 | 5.570621 | 0.627119 | 0.060852 | 0.10142 | 0.079108 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.012393 | 0.183428 | 1,581 | 43 | 75 | 36.767442 | 0.751356 | 0.347881 | 0 | 0 | 0 | 0 | 0.506897 | 0.03908 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.125 | 0 | 0.125 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
182d4e4c89ed18a61e26a5a21ca520f73cbccab4 | 611 | py | Python | Setup.py | michaeljohncalvey/survive | 33c7f45f56171d6f33d1dca35ffd1a0324649faa | [
"Apache-2.0"
] | 1 | 2016-01-07T18:15:57.000Z | 2016-01-07T18:15:57.000Z | Setup.py | michaeljohncalvey/survive | 33c7f45f56171d6f33d1dca35ffd1a0324649faa | [
"Apache-2.0"
] | null | null | null | Setup.py | michaeljohncalvey/survive | 33c7f45f56171d6f33d1dca35ffd1a0324649faa | [
"Apache-2.0"
] | 1 | 2016-02-02T20:15:31.000Z | 2016-02-02T20:15:31.000Z | from setuptools import setup, find_packages
setup(
name='Player',
packages=find_packages(),
)
setup(
name='Vendor',
version='0.0.1',
description='Vending machine software',
long_description='long_description',
url='https://github.com/LMCMLJ/samnple',
author='Michael Calvey',
license... | 26.565217 | 59 | 0.558101 | 60 | 611 | 5.6 | 0.733333 | 0.071429 | 0.10119 | 0.125 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.021176 | 0.304419 | 611 | 22 | 60 | 27.772727 | 0.769412 | 0 | 0 | 0.095238 | 0 | 0 | 0.407529 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.047619 | 0 | 0.047619 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
182f0f84fc58e79c886702bafff0172b8eea9f3c | 300 | py | Python | config.py | pyladieshamburg/games_in_python | 49a84ceaa3b0a3f322b02a8fccd44560e321e821 | [
"MIT"
] | 1 | 2018-12-19T09:15:30.000Z | 2018-12-19T09:15:30.000Z | config.py | pyladieshamburg/games_in_python | 49a84ceaa3b0a3f322b02a8fccd44560e321e821 | [
"MIT"
] | null | null | null | config.py | pyladieshamburg/games_in_python | 49a84ceaa3b0a3f322b02a8fccd44560e321e821 | [
"MIT"
] | 1 | 2018-12-18T17:51:30.000Z | 2018-12-18T17:51:30.000Z | config = {
"colors": {
"WHITE": (255, 255, 255),
"RED": (255, 0, 0),
"GREEN": (0, 255, 0),
"BLACK": (0, 0, 0)
},
"globals": {
"WIDTH": 600,
"HEIGHT": 400,
"BALL_RADIUS": 20,
"PAD_WIDTH": 8,
"PAD_HEIGHT": 80
}
}
| 18.75 | 33 | 0.37 | 32 | 300 | 3.375 | 0.59375 | 0.055556 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.188571 | 0.416667 | 300 | 15 | 34 | 20 | 0.428571 | 0 | 0 | 0 | 0 | 0 | 0.24 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
184204c472a92010e3bb4d1c7621690e769d799a | 2,263 | py | Python | TC/hmm_train.py | davideturco/SemEval2020-Task11 | 87a9e3105803cebcf1a4a3f0de94656846e17a03 | [
"MIT"
] | null | null | null | TC/hmm_train.py | davideturco/SemEval2020-Task11 | 87a9e3105803cebcf1a4a3f0de94656846e17a03 | [
"MIT"
] | 3 | 2021-01-29T08:28:25.000Z | 2021-01-29T08:29:11.000Z | TC/hmm_train.py | davideturco/SemEval2020-Task11 | 87a9e3105803cebcf1a4a3f0de94656846e17a03 | [
"MIT"
] | null | null | null | import dill
from nltk.tag import hmm
from nltk.metrics import *
from data_processing import *
from statistics import mean
from SI.hmm_train import return_in_nltk_format, f1, return_in_nltk_format_unique
TRAIN_FOLDER = '../datasets/train-articles'
TRAIN_LABELS_FOLDER = '../datasets/train-labels-task-flc-tc'
TRAIN_LABEL... | 39.017241 | 97 | 0.741935 | 319 | 2,263 | 4.924765 | 0.278997 | 0.057925 | 0.045831 | 0.068746 | 0.245703 | 0.185869 | 0.064927 | 0.064927 | 0.064927 | 0 | 0 | 0.008338 | 0.152011 | 2,263 | 57 | 98 | 39.701754 | 0.810318 | 0.088378 | 0 | 0 | 0 | 0 | 0.165129 | 0.144245 | 0 | 0 | 0 | 0.017544 | 0 | 1 | 0.046512 | false | 0 | 0.139535 | 0 | 0.186047 | 0.093023 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
184422656a2e8fe0c81cffec00d957db758f584f | 1,182 | py | Python | pyathenajdbc/util.py | laughingman7743/PyAthenaJDBC | 321abdfbb471657e4d7462fa910371fa3cec2462 | [
"MIT"
] | 99 | 2017-01-09T08:05:20.000Z | 2022-03-01T09:02:31.000Z | pyathenajdbc/util.py | snowphy/PyAthenaJDBC | 321abdfbb471657e4d7462fa910371fa3cec2462 | [
"MIT"
] | 117 | 2017-01-09T11:26:54.000Z | 2021-10-20T14:58:12.000Z | pyathenajdbc/util.py | snowphy/PyAthenaJDBC | 321abdfbb471657e4d7462fa910371fa3cec2462 | [
"MIT"
] | 34 | 2017-01-09T09:42:18.000Z | 2021-09-09T06:43:02.000Z | # -*- coding: utf-8 -*-
import functools
import threading
from typing import TYPE_CHECKING, Any, Callable
if TYPE_CHECKING:
from pandas import DataFrame
from pyathenajdbc.cursor import Cursor
def as_pandas(cursor: "Cursor", coerce_float: bool = False) -> "DataFrame":
from pandas import DataFrame
de... | 24.625 | 75 | 0.667513 | 135 | 1,182 | 5.725926 | 0.42963 | 0.051746 | 0.041397 | 0.064683 | 0.199224 | 0.199224 | 0.10608 | 0 | 0 | 0 | 0 | 0.002167 | 0.21912 | 1,182 | 47 | 76 | 25.148936 | 0.83532 | 0.067682 | 0 | 0.333333 | 0 | 0 | 0.013736 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.166667 | false | 0 | 0.233333 | 0 | 0.6 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
1848649201079ed6fa981740ed331e08e689b1ab | 426 | py | Python | students/k3342/laboratory_works/Kocheshkova_Kseniia/laboratory_work_1/flights/migrations/0003_flight_number_flight.py | Derimeer/ITMO_ICT_WebProgramming_2020 | afb4999d20d59c5d47e4f380e8ba06204a42c729 | [
"MIT"
] | null | null | null | students/k3342/laboratory_works/Kocheshkova_Kseniia/laboratory_work_1/flights/migrations/0003_flight_number_flight.py | Derimeer/ITMO_ICT_WebProgramming_2020 | afb4999d20d59c5d47e4f380e8ba06204a42c729 | [
"MIT"
] | null | null | null | students/k3342/laboratory_works/Kocheshkova_Kseniia/laboratory_work_1/flights/migrations/0003_flight_number_flight.py | Derimeer/ITMO_ICT_WebProgramming_2020 | afb4999d20d59c5d47e4f380e8ba06204a42c729 | [
"MIT"
] | null | null | null | # Generated by Django 3.1.2 on 2020-11-01 18:32
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('flights', '0002_auto_20201101_1957'),
]
operations = [
migrations.AddField(
model_name='flight',
name='number_flight... | 21.3 | 49 | 0.600939 | 45 | 426 | 5.555556 | 0.8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.10596 | 0.29108 | 426 | 19 | 50 | 22.421053 | 0.721854 | 0.105634 | 0 | 0 | 1 | 0 | 0.129288 | 0.060686 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.076923 | 0 | 0.307692 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
184ac4f71b3d1993fc4c7b23d3fb31c3ed95ff24 | 468 | py | Python | market/migrations/0008_auto_20201002_2256.py | leonolan2020/phoenix | b5956a7003e548f01255cbd5d0d76cfd0ac77a81 | [
"MIT"
] | 1 | 2020-09-19T21:56:40.000Z | 2020-09-19T21:56:40.000Z | market/migrations/0008_auto_20201002_2256.py | leonolan2020/phoenix | b5956a7003e548f01255cbd5d0d76cfd0ac77a81 | [
"MIT"
] | null | null | null | market/migrations/0008_auto_20201002_2256.py | leonolan2020/phoenix | b5956a7003e548f01255cbd5d0d76cfd0ac77a81 | [
"MIT"
] | 5 | 2020-09-18T18:53:03.000Z | 2020-10-21T14:42:00.000Z | # Generated by Django 3.1 on 2020-10-02 19:26
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('app', '0030_color'),
('market', '0007_auto_20201002_2108'),
]
operations = [
migrations.AlterField(
model_name='product',
... | 23.4 | 103 | 0.600427 | 52 | 468 | 5.288462 | 0.807692 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.099125 | 0.267094 | 468 | 19 | 104 | 24.631579 | 0.702624 | 0.09188 | 0 | 0 | 1 | 0 | 0.165485 | 0.054374 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.076923 | 0 | 0.307692 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
185af6c2df997578a68460884e0930b4c5cb3e74 | 870 | py | Python | syarpa_k8s/asgi.py | mathemartins/syarpa_k8s | 880be2ee3bd26613819d0bd2652be579f6a93886 | [
"Apache-2.0"
] | null | null | null | syarpa_k8s/asgi.py | mathemartins/syarpa_k8s | 880be2ee3bd26613819d0bd2652be579f6a93886 | [
"Apache-2.0"
] | null | null | null | syarpa_k8s/asgi.py | mathemartins/syarpa_k8s | 880be2ee3bd26613819d0bd2652be579f6a93886 | [
"Apache-2.0"
] | null | null | null | """
ASGI config for syarpa_k8s project.
It exposes the ASGI callable as a module-level variable named ``application``.
For more information on this file, see
https://docs.djangoproject.com/en/4.0/howto/deployment/asgi/
"""
import os
import pathlib
import dotenv
import django
django.setup()
from syarpa_k8s.routin... | 23.513514 | 78 | 0.796552 | 116 | 870 | 5.767241 | 0.543103 | 0.040359 | 0.053812 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.006443 | 0.108046 | 870 | 36 | 79 | 24.166667 | 0.85567 | 0.248276 | 0 | 0 | 0 | 0 | 0.089783 | 0.034056 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.444444 | 0 | 0.444444 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
185f17c0eb39ea0bdecd3ab7f2f48378d6faa196 | 3,982 | py | Python | thermalprinter/constants.py | d21d3q/thermalprinter | a502fe8a7b7ab5a0773e92a37e6539f73b34b950 | [
"MIT"
] | 28 | 2016-08-31T15:50:38.000Z | 2022-03-24T15:19:17.000Z | thermalprinter/constants.py | d21d3q/thermalprinter | a502fe8a7b7ab5a0773e92a37e6539f73b34b950 | [
"MIT"
] | 11 | 2016-09-28T15:46:46.000Z | 2021-03-09T16:37:13.000Z | thermalprinter/constants.py | d21d3q/thermalprinter | a502fe8a7b7ab5a0773e92a37e6539f73b34b950 | [
"MIT"
] | 10 | 2017-03-02T19:08:15.000Z | 2021-02-19T16:11:06.000Z | # coding: utf-8
""" This is part of the Python's module to manage the DP-EH600 thermal printer.
Source: https://github.com/BoboTiG/thermalprinter
"""
from enum import Enum
# pylint: disable=unsubscriptable-object
class BarCode(Enum):
""" Available bar code types: """
# (code, (min len(text), max len(t... | 24.732919 | 79 | 0.549473 | 525 | 3,982 | 4.072381 | 0.48 | 0.032741 | 0.03087 | 0.047708 | 0.132834 | 0.089804 | 0.089804 | 0.031805 | 0.031805 | 0 | 0 | 0.151662 | 0.274736 | 3,982 | 160 | 80 | 24.8875 | 0.588643 | 0.151431 | 0 | 0.054054 | 0 | 0 | 0.218439 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.054054 | false | 0 | 0.009009 | 0.054054 | 0.981982 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
18619dad3d88f9019472972be80b99bf9a03cc24 | 1,138 | py | Python | configs/hpt-pretrain/imagenet/finetune/1000-labels/2500-iter-0.01-lr-finetune.py | Berkeley-Data/OpenSelfSup | 221191b88d891de57725b149caf237ffef72e529 | [
"Apache-2.0"
] | null | null | null | configs/hpt-pretrain/imagenet/finetune/1000-labels/2500-iter-0.01-lr-finetune.py | Berkeley-Data/OpenSelfSup | 221191b88d891de57725b149caf237ffef72e529 | [
"Apache-2.0"
] | 6 | 2021-03-11T05:35:54.000Z | 2021-04-03T22:25:11.000Z | configs/hpt-pretrain/imagenet/finetune/100-labels/2500-iter-0.01-lr-finetune.py | Berkeley-Data/OpenSelfSup | 221191b88d891de57725b149caf237ffef72e529 | [
"Apache-2.0"
] | 1 | 2021-07-04T00:47:46.000Z | 2021-07-04T00:47:46.000Z | _base_="finetune-eval-base.py"
data = dict()
custom_hooks = [
dict(
name="val",
type='ValidateHook',
dataset=data['val'],
by_epoch=False,
initial=False,
interval=100,
imgs_per_gpu=128,
workers_per_gpu=4,
eval_param=dict(topk=(1, 5))),
dict... | 22.76 | 69 | 0.62478 | 155 | 1,138 | 4.406452 | 0.477419 | 0.040996 | 0.070278 | 0.079063 | 0.237189 | 0.237189 | 0.237189 | 0.237189 | 0.237189 | 0.237189 | 0 | 0.059929 | 0.252197 | 1,138 | 49 | 70 | 23.22449 | 0.742656 | 0.156415 | 0 | 0.384615 | 0 | 0 | 0.07563 | 0.022059 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0 | null | null | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
186290fa728124b62b39acf1caf2fda117d47242 | 840 | py | Python | FileIO/writing.py | zahraaliaghazadeh/python | 2f2d0141a916c99e8724f803bd4e5c7246a7a02e | [
"MIT"
] | null | null | null | FileIO/writing.py | zahraaliaghazadeh/python | 2f2d0141a916c99e8724f803bd4e5c7246a7a02e | [
"MIT"
] | null | null | null | FileIO/writing.py | zahraaliaghazadeh/python | 2f2d0141a916c99e8724f803bd4e5c7246a7a02e | [
"MIT"
] | null | null | null | # cities = ["Adelaide", "Alice Springs", "Darwin", "Melbourne", "Sydney"]
#
# with open("cities.txt", 'w') as city_file:
# for city in cities:
# print(city, file=city_file)
# can add flush=True to line above
# cities = []
#
# with open("cities.txt", 'r') as city_file:
# for city in city_file:
# ... | 24.705882 | 85 | 0.62619 | 117 | 840 | 4.42735 | 0.444444 | 0.07722 | 0.052124 | 0.065637 | 0.148649 | 0.148649 | 0 | 0 | 0 | 0 | 0 | 0.014641 | 0.186905 | 840 | 33 | 86 | 25.454545 | 0.743777 | 0.707143 | 0 | 0 | 0 | 0 | 0.053812 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.5 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 |
1863a5960914dc7d296444c2bc052681f3087089 | 1,809 | py | Python | Python/leetcode/UniqueBinarySearchTreesIi.py | darrencheng0817/AlgorithmLearning | aec1ddd0c51b619c1bae1e05f940d9ed587aa82f | [
"MIT"
] | 2 | 2015-12-02T06:44:01.000Z | 2016-05-04T21:40:54.000Z | Python/leetcode/UniqueBinarySearchTreesIi.py | darrencheng0817/AlgorithmLearning | aec1ddd0c51b619c1bae1e05f940d9ed587aa82f | [
"MIT"
] | null | null | null | Python/leetcode/UniqueBinarySearchTreesIi.py | darrencheng0817/AlgorithmLearning | aec1ddd0c51b619c1bae1e05f940d9ed587aa82f | [
"MIT"
] | null | null | null | '''
Created on 1.12.2016
@author: Darren
''''''
Given n, generate all structurally unique BST s (binary search trees) that store values 1...n.
For example,
Given n = 3, your program should return all 5 unique BST s shown below.
1 3 3 2 1
\ / / / \ \
... | 26.217391 | 135 | 0.498618 | 215 | 1,809 | 4.176744 | 0.423256 | 0.055679 | 0.013363 | 0.048998 | 0.011136 | 0 | 0 | 0 | 0 | 0 | 0 | 0.040338 | 0.410724 | 1,809 | 69 | 136 | 26.217391 | 0.802064 | 0.491432 | 0 | 0.042553 | 1 | 0.06383 | 0.494354 | 0.013802 | 0 | 0 | 0 | 0 | 0 | 1 | 0.06383 | false | 0 | 0 | 0 | 0.212766 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
1866042433beb7be6b5cf77ee439b3e0661bd27c | 423 | py | Python | award/migrations/0006_auto_20191021_1114.py | mugendinjue/awwwards | 3ecff856f47d56a05ddcdb142ea517b36e98eaa8 | [
"MIT"
] | 1 | 2019-11-15T10:43:54.000Z | 2019-11-15T10:43:54.000Z | award/migrations/0006_auto_20191021_1114.py | mugendinjue/awwwards | 3ecff856f47d56a05ddcdb142ea517b36e98eaa8 | [
"MIT"
] | 9 | 2020-02-11T21:59:08.000Z | 2021-09-22T18:01:52.000Z | award/migrations/0006_auto_20191021_1114.py | mugendinjue/awwwards | 3ecff856f47d56a05ddcdb142ea517b36e98eaa8 | [
"MIT"
] | null | null | null | # Generated by Django 2.2.6 on 2019-10-21 08:14
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('award', '0005_rating_vote_average'),
]
operations = [
migrations.AlterField(
model_name='rating',
name='vote_average... | 22.263158 | 82 | 0.619385 | 48 | 423 | 5.3125 | 0.75 | 0.086275 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.067742 | 0.267139 | 423 | 18 | 83 | 23.5 | 0.754839 | 0.106383 | 0 | 0 | 1 | 0 | 0.125 | 0.06383 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.083333 | 0 | 0.333333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
1869c750b86c7d0bf822957c9b45c67cd1a991a9 | 46,406 | py | Python | tests/live_tests.py | lukegb/ehacktivities | bc04d02eaf36a106b943ce0cb8395e85a780f6fc | [
"MIT"
] | 1 | 2016-04-30T00:19:13.000Z | 2016-04-30T00:19:13.000Z | tests/live_tests.py | lukegb/ehacktivities | bc04d02eaf36a106b943ce0cb8395e85a780f6fc | [
"MIT"
] | null | null | null | tests/live_tests.py | lukegb/ehacktivities | bc04d02eaf36a106b943ce0cb8395e85a780f6fc | [
"MIT"
] | null | null | null | import unittest
import decimal
import os
import datetime
import hashlib
from nose.plugins.attrib import attr
from eactivities import EActivities
from eactivities.parsers.documentation import InventoryParser, RiskAssessmentParser, KeyListsParser
import eactivities.parsers.finances as finance_parsers
# l... | 52.259009 | 141 | 0.617162 | 5,190 | 46,406 | 5.326204 | 0.122929 | 0.138914 | 0.026915 | 0.047426 | 0.644575 | 0.542705 | 0.421807 | 0.356691 | 0.32265 | 0.274825 | 0 | 0.104349 | 0.228483 | 46,406 | 887 | 142 | 52.317926 | 0.667737 | 0.004547 | 0 | 0.244624 | 0 | 0.005376 | 0.270805 | 0.090128 | 0 | 0 | 0 | 0 | 0.426075 | 1 | 0.044355 | false | 0.004032 | 0.012097 | 0 | 0.069892 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
186a4f62ce7d12cb1c724f4d3a0ac6b14cd1634d | 1,484 | py | Python | components/homme/scripts_for_paper/calc_energy_error_baroclinicinstability_ars343.py | cjvogl/E3SM | d8990bc2efda76b6f9096f989eed46bd3ab87463 | [
"FTL",
"zlib-acknowledgement",
"RSA-MD"
] | 1 | 2019-12-11T16:41:13.000Z | 2019-12-11T16:41:13.000Z | components/homme/scripts_for_paper/calc_energy_error_baroclinicinstability_ars343.py | cjvogl/E3SM | d8990bc2efda76b6f9096f989eed46bd3ab87463 | [
"FTL",
"zlib-acknowledgement",
"RSA-MD"
] | null | null | null | components/homme/scripts_for_paper/calc_energy_error_baroclinicinstability_ars343.py | cjvogl/E3SM | d8990bc2efda76b6f9096f989eed46bd3ab87463 | [
"FTL",
"zlib-acknowledgement",
"RSA-MD"
] | null | null | null | from dictionaries import methodDict
import numpy as np
import sys
if (len(sys.argv) < 2):
print "Usage: python calc_error_baroclinicinstability_ars232.py <base_output_directory>"
exit()
outpath = sys.argv[1]
method = 'ARS343'
tsteps = [10, 20]
outputList = []
for tstep in tsteps:
fileNames = [outpath + '/tstep... | 36.195122 | 117 | 0.652965 | 186 | 1,484 | 5.05914 | 0.403226 | 0.068013 | 0.072264 | 0.093518 | 0.327311 | 0.286929 | 0.286929 | 0.286929 | 0.286929 | 0.234857 | 0 | 0.054191 | 0.204178 | 1,484 | 40 | 118 | 37.1 | 0.742591 | 0 | 0 | 0 | 0 | 0 | 0.268868 | 0.216307 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.081081 | null | null | 0.081081 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
186b5af300fb208f9b37a77f98f02d285ef659d7 | 1,714 | py | Python | Evaluation/OnlineEvaluation/get_nlp_papers.py | ashwath92/MastersThesis | f74755dc0c32f316da3c860dd5dbfa4c9cad97b3 | [
"MIT"
] | 5 | 2020-11-05T07:11:54.000Z | 2021-08-04T21:37:28.000Z | Evaluation/OnlineEvaluation/get_nlp_papers.py | ashwath92/MastersThesis | f74755dc0c32f316da3c860dd5dbfa4c9cad97b3 | [
"MIT"
] | null | null | null | Evaluation/OnlineEvaluation/get_nlp_papers.py | ashwath92/MastersThesis | f74755dc0c32f316da3c860dd5dbfa4c9cad97b3 | [
"MIT"
] | 4 | 2020-11-05T06:04:38.000Z | 2021-08-02T16:25:42.000Z | import pickle
import csv
from gensim.parsing import preprocessing
import re
import os
from tqdm import tqdm
import psycopg2
import psycopg2.extras
conn = psycopg2.connect("dbname=MAG19 user=mag password=1maG$ host=shetland.informatik.uni-freiburg.de")
cur = conn.cursor(cursor_factory=psycopg2.extras.RealDictCursor)
# ... | 47.611111 | 139 | 0.710618 | 180 | 1,714 | 6.761111 | 0.477778 | 0.006574 | 0.036976 | 0.054232 | 0.078883 | 0.036154 | 0.036154 | 0 | 0 | 0 | 0 | 0.027477 | 0.193116 | 1,714 | 36 | 140 | 47.611111 | 0.852495 | 0.046674 | 0 | 0.0625 | 0 | 0.03125 | 0.729945 | 0.235762 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.03125 | 0.25 | 0 | 0.25 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
186ec80c07453013eca7504fb02172769d2b031c | 726 | py | Python | src/models/gen_class_weights/test_gen_class_weights.py | weasysolutions/skin-lesion-dataset-cookiecutter | f3788b273f9c0caca21867f4846d6efd3683f646 | [
"MIT"
] | null | null | null | src/models/gen_class_weights/test_gen_class_weights.py | weasysolutions/skin-lesion-dataset-cookiecutter | f3788b273f9c0caca21867f4846d6efd3683f646 | [
"MIT"
] | null | null | null | src/models/gen_class_weights/test_gen_class_weights.py | weasysolutions/skin-lesion-dataset-cookiecutter | f3788b273f9c0caca21867f4846d6efd3683f646 | [
"MIT"
] | null | null | null |
import unittest
from class_weights import gen_class_weights
class TestGenClassWeights(unittest.TestCase):
"""
Test class_weigths module
"""
def test_gen_class_weights_1(self):
"""
'mel' attribute has weight 3.0 and 'bbc' attribute does not has weight 2... | 25.034483 | 95 | 0.586777 | 87 | 726 | 4.586207 | 0.471264 | 0.210526 | 0.112782 | 0.100251 | 0.175439 | 0 | 0 | 0 | 0 | 0 | 0 | 0.035363 | 0.298898 | 726 | 29 | 96 | 25.034483 | 0.748527 | 0.139118 | 0 | 0 | 0 | 0 | 0.052356 | 0 | 0 | 0 | 0 | 0 | 0.2 | 1 | 0.1 | false | 0 | 0.2 | 0 | 0.4 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
18758cfda8772d9ed5f1f7027ccbd7fdb86ea4ea | 633 | py | Python | Hackerrank/palin.py | nikunjlad/Coding-Playground | 900227cbbfbfb64eeda89e43dbfc1c5658d7dddc | [
"MIT"
] | null | null | null | Hackerrank/palin.py | nikunjlad/Coding-Playground | 900227cbbfbfb64eeda89e43dbfc1c5658d7dddc | [
"MIT"
] | null | null | null | Hackerrank/palin.py | nikunjlad/Coding-Playground | 900227cbbfbfb64eeda89e43dbfc1c5658d7dddc | [
"MIT"
] | null | null | null | # palindrome index checker
a = 'hgygsvlfcwnswtuhmyaljkqlqjjqlqkjlaymhutwsnwcwflvsgygh'
c = a[::-1]
print c
l = len(a) - 1
print l
for i in range(0, len(a) / 2):
if a == a[::-1]:
print -1
elif a[i] != a[l - i]:
if (a[i + 1] == a[l - i]) and (a[i + 2] == a[l - i - 1]):
... | 17.583333 | 68 | 0.401264 | 98 | 633 | 2.591837 | 0.285714 | 0.047244 | 0.059055 | 0.086614 | 0.149606 | 0.149606 | 0.149606 | 0 | 0 | 0 | 0 | 0.055096 | 0.42654 | 633 | 35 | 69 | 18.085714 | 0.644628 | 0.037915 | 0 | 0.133333 | 0 | 0 | 0.125891 | 0.125891 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0 | null | null | 0.333333 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
1877503448f64c78e9bb8f36da1769772fb61723 | 337 | py | Python | pagseguro/urls.py | felipecruz/django-pagseguro2 | fd57a0ead08812fbf4cfe551f5ea3b7d50b49fad | [
"MIT"
] | 1 | 2021-07-11T15:49:17.000Z | 2021-07-11T15:49:17.000Z | pagseguro/urls.py | felipecruz/django-pagseguro2 | fd57a0ead08812fbf4cfe551f5ea3b7d50b49fad | [
"MIT"
] | null | null | null | pagseguro/urls.py | felipecruz/django-pagseguro2 | fd57a0ead08812fbf4cfe551f5ea3b7d50b49fad | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
from __future__ import unicode_literals
try:
from django.conf.urls import patterns, url
except ImportError:
from django.conf.urls.defaults import patterns, url
urlpatterns = patterns(
'pagseguro.views',
url(
r'^$', 'receive_notification', name='pagseguro_receive_notific... | 21.0625 | 76 | 0.697329 | 38 | 337 | 5.973684 | 0.631579 | 0.088106 | 0.123348 | 0.15859 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.00365 | 0.186944 | 337 | 15 | 77 | 22.466667 | 0.824818 | 0.062315 | 0 | 0 | 0 | 0 | 0.213376 | 0.095541 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.363636 | 0 | 0.363636 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
1877ec4ad480ff0278fe9c113ff66bb9398fee4e | 409 | py | Python | algorithms/strange-advertising.py | gajubadge11/HackerRank-1 | 7b136ccaa1ed47ae737467ace6b494c720ccb942 | [
"MIT"
] | 340 | 2018-06-17T19:45:56.000Z | 2022-03-22T02:26:15.000Z | algorithms/strange-advertising.py | gajubadge11/HackerRank-1 | 7b136ccaa1ed47ae737467ace6b494c720ccb942 | [
"MIT"
] | 3 | 2021-02-02T17:17:29.000Z | 2021-05-18T10:06:04.000Z | algorithms/strange-advertising.py | gajubadge11/HackerRank-1 | 7b136ccaa1ed47ae737467ace6b494c720ccb942 | [
"MIT"
] | 229 | 2019-04-20T08:28:49.000Z | 2022-03-31T04:23:52.000Z | #!/bin/python3
import sys
def calc_pattern():
max_n = 50
ads = 5
output = []
for i in range(max_n):
output.append(ads//2)
ads = (ads//2)*3
return output
def viralAdvertising(n, pattern):
return sum(pattern[:n])
if __name__ == "__main__":
n = int(input().strip())
... | 17.782609 | 41 | 0.584352 | 53 | 409 | 4.283019 | 0.584906 | 0.096916 | 0.211454 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.023649 | 0.276284 | 409 | 22 | 42 | 18.590909 | 0.743243 | 0.031785 | 0 | 0 | 0 | 0 | 0.020253 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.125 | false | 0 | 0.0625 | 0.0625 | 0.3125 | 0.0625 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
187c2c5f4327a049866b56bbba965c8f59678e75 | 4,452 | py | Python | ingenialink/canopen/constants.py | RobertoRoos/ingenialink-python | c5e82dfbff17898bb316f5dc3f91a7f3c049ba20 | [
"MIT"
] | null | null | null | ingenialink/canopen/constants.py | RobertoRoos/ingenialink-python | c5e82dfbff17898bb316f5dc3f91a7f3c049ba20 | [
"MIT"
] | null | null | null | ingenialink/canopen/constants.py | RobertoRoos/ingenialink-python | c5e82dfbff17898bb316f5dc3f91a7f3c049ba20 | [
"MIT"
] | null | null | null | # Power Drive System
# Controlword common bits.
IL_MC_CW_SO = (1 << 0)
IL_MC_CW_EV = (1 << 1)
IL_MC_CW_QS = (1 << 2)
IL_MC_CW_EO = (1 << 3)
IL_MC_CW_FR = (1 << 7)
IL_MC_CW_H = (1 << 8)
# Statusword common bits.
IL_MC_SW_RTSO = (1 << 0)
IL_MC_SW_SO = (1 << 1)
IL_MC_SW_OE = (1 << 2)
IL_MC_SW_F = (1 << 3)
IL_MC_SW_VE = (1... | 32.028777 | 110 | 0.756289 | 943 | 4,452 | 3.015907 | 0.174973 | 0.21097 | 0.164557 | 0.059775 | 0.423347 | 0.355837 | 0.29993 | 0.294304 | 0.269691 | 0.253516 | 0 | 0.025513 | 0.146002 | 4,452 | 139 | 111 | 32.028777 | 0.722514 | 0.296945 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.009772 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
187e92135af2f17aab2758fbfddea639edfa0b03 | 914 | py | Python | sample/docs/source/alumni/parse.py | hdknr/flier | eca75b972ed91c3107b5c6007366caf93313d8e8 | [
"BSD-2-Clause-FreeBSD"
] | null | null | null | sample/docs/source/alumni/parse.py | hdknr/flier | eca75b972ed91c3107b5c6007366caf93313d8e8 | [
"BSD-2-Clause-FreeBSD"
] | null | null | null | sample/docs/source/alumni/parse.py | hdknr/flier | eca75b972ed91c3107b5c6007366caf93313d8e8 | [
"BSD-2-Clause-FreeBSD"
] | null | null | null | from docutils.core import publish_doctree
import sys
from bs4 import BeautifulSoup as Soup
import yaml
import json
def to_yaml(result):
# YAML
print yaml.dump(
yaml.load(json.dumps(result)), default_flow_style=False,
allow_unicode=True)
def to_json(result):
# JSON
print json.dumps(re... | 22.85 | 69 | 0.633479 | 139 | 914 | 4.093525 | 0.431655 | 0.026362 | 0.042179 | 0.038664 | 0.108963 | 0.063269 | 0.063269 | 0.063269 | 0 | 0 | 0 | 0.012245 | 0.195842 | 914 | 39 | 70 | 23.435897 | 0.761905 | 0.009847 | 0 | 0.074074 | 0 | 0 | 0.059867 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.185185 | null | null | 0.148148 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
187ef2ab0c1f2eb843efcf02da39a508b5cc10de | 1,220 | py | Python | backend/prod_db.py | yacf/yacf | 805bd0e077f39e4351d497c7cc2c7937b7def43f | [
"MIT"
] | null | null | null | backend/prod_db.py | yacf/yacf | 805bd0e077f39e4351d497c7cc2c7937b7def43f | [
"MIT"
] | 22 | 2019-12-09T20:24:23.000Z | 2022-02-26T18:43:46.000Z | backend/prod_db.py | yacf/yacf | 805bd0e077f39e4351d497c7cc2c7937b7def43f | [
"MIT"
] | null | null | null | import os, django
os.environ.setdefault("DJANGO_SETTINGS_MODULE", "core.settings")
django.setup()
import argparse, contextlib
import json
from django.utils import timezone
from datetime import timedelta
from core.settings import DATABASES
from django.contrib.auth.models import User
from teams.models import Team
from u... | 27.111111 | 82 | 0.709836 | 150 | 1,220 | 5.666667 | 0.46 | 0.037647 | 0.028235 | 0.037647 | 0.115294 | 0 | 0 | 0 | 0 | 0 | 0 | 0.001969 | 0.167213 | 1,220 | 45 | 83 | 27.111111 | 0.834646 | 0.090164 | 0 | 0 | 0 | 0 | 0.232579 | 0.01991 | 0 | 0 | 0 | 0 | 0 | 1 | 0.068966 | false | 0 | 0.310345 | 0 | 0.37931 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
18822e42842fdd90681e10d5f4c471a86227acdf | 6,338 | py | Python | fordev/consts.py | matheusfelipeog/tools-4-dev | a765de7971d38bda01b2bd32e575807b6dd936fb | [
"MIT"
] | 18 | 2020-10-01T05:51:42.000Z | 2022-03-16T15:55:39.000Z | fordev/consts.py | matheusfelipeog/tools-4-dev | a765de7971d38bda01b2bd32e575807b6dd936fb | [
"MIT"
] | 1 | 2021-03-19T00:44:10.000Z | 2021-06-03T19:41:16.000Z | fordev/consts.py | matheusfelipeog/tools-4-dev | a765de7971d38bda01b2bd32e575807b6dd936fb | [
"MIT"
] | 4 | 2020-10-02T19:39:52.000Z | 2022-03-16T16:25:59.000Z | # -*- coding: utf-8 -*-
"""
fordev.consts
-------------
Este módulo contém todas as variáveis com valores constantes usadas no pacote fordev.
"""
from fordev.__about__ import __version__
from fordev.__about__ import __author__
from fordev.__about__ import __email__
from fordev.__about__ import __author_github__
from ... | 40.890323 | 139 | 0.561376 | 910 | 6,338 | 3.751648 | 0.379121 | 0.22935 | 0.028998 | 0.032806 | 0.185999 | 0.159344 | 0.153486 | 0.12976 | 0.12976 | 0.12976 | 0 | 0.125146 | 0.190596 | 6,338 | 154 | 140 | 41.155844 | 0.540351 | 0.021616 | 0 | 0 | 0 | 0.071942 | 0.504279 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.035971 | 0 | 0.035971 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
43e58d4d4ed47dcd1c050d5d6ae243ae7a0f9030 | 4,705 | py | Python | scripts/mRNA_design/CAI_calculator.py | lcscs12345/Avoidance | ff38080c409c6bd8e7ac0d2eb5e51b644df8b1df | [
"MIT"
] | null | null | null | scripts/mRNA_design/CAI_calculator.py | lcscs12345/Avoidance | ff38080c409c6bd8e7ac0d2eb5e51b644df8b1df | [
"MIT"
] | null | null | null | scripts/mRNA_design/CAI_calculator.py | lcscs12345/Avoidance | ff38080c409c6bd8e7ac0d2eb5e51b644df8b1df | [
"MIT"
] | 1 | 2018-11-21T04:14:56.000Z | 2018-11-21T04:14:56.000Z | #!/usr/bin/env python2.7
'''
Created on 18/11/2013
@author: suu13
'''
from collections import Counter
from Bio.SeqUtils import CodonUsage
from Bio import SeqIO
import argparse
import re
from random import sample
from Bio.Data.CodonTable import standard_dna_table
from os import remove
def codon_count(sequence):
... | 35.643939 | 130 | 0.636557 | 621 | 4,705 | 4.592593 | 0.2657 | 0.053296 | 0.065568 | 0.065568 | 0.43864 | 0.433029 | 0.433029 | 0.402174 | 0.402174 | 0.392356 | 0 | 0.005147 | 0.256748 | 4,705 | 132 | 131 | 35.643939 | 0.810409 | 0.098831 | 0 | 0.436782 | 0 | 0 | 0.101148 | 0.022956 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0.011494 | 0.091954 | null | null | 0.229885 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
43ef2e18f82607feff3e6501f913eb68b6111c7f | 13,291 | py | Python | ucloud/services/isms/client.py | ucloud/ucloud-sdk-python3 | b96a079a5e747228049129d83f03a8067a05e881 | [
"Apache-2.0"
] | 37 | 2019-06-19T09:41:34.000Z | 2022-02-18T08:06:00.000Z | ucloud/services/isms/client.py | ucloud/ucloud-sdk-python3 | b96a079a5e747228049129d83f03a8067a05e881 | [
"Apache-2.0"
] | 90 | 2019-08-09T09:27:33.000Z | 2022-03-30T15:54:55.000Z | ucloud/services/isms/client.py | ucloud/ucloud-sdk-python3 | b96a079a5e747228049129d83f03a8067a05e881 | [
"Apache-2.0"
] | 19 | 2019-06-13T02:46:01.000Z | 2021-11-01T07:22:18.000Z | """ Code is generated by ucloud-model, DO NOT EDIT IT. """
import typing
from ucloud.core.client import Client
from ucloud.services.isms.schemas import apis
class ISMSClient(Client):
def __init__(
self, config: dict, transport=None, middleware=None, logger=None
):
super(ISMSClient, self).__... | 40.154079 | 478 | 0.61267 | 1,337 | 13,291 | 6.029918 | 0.26552 | 0.020094 | 0.03349 | 0.037956 | 0.525304 | 0.501737 | 0.494418 | 0.482759 | 0.454726 | 0.44257 | 0 | 0.013352 | 0.227974 | 13,291 | 330 | 479 | 40.275758 | 0.772342 | 0.591077 | 0 | 0.5 | 1 | 0 | 0.069508 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.09434 | false | 0 | 0.028302 | 0 | 0.216981 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
43efb191fc347a982a663764a586e53297409fcf | 1,490 | py | Python | Bistec.py | rllullt/angry-bears | 4cd739c461c74378b36cad328639acb256b22c29 | [
"MIT"
] | null | null | null | Bistec.py | rllullt/angry-bears | 4cd739c461c74378b36cad328639acb256b22c29 | [
"MIT"
] | null | null | null | Bistec.py | rllullt/angry-bears | 4cd739c461c74378b36cad328639acb256b22c29 | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
'''
Clase Bistec
Crea un bistec de alimento a partir de un archivo STL
'''
from OpenGL.GL import *
from OpenGL.GLU import *
from OpenGL.GLUT import *
from Alimento import Alimento
# Clase Bistec
# Campos:
# nombreArchivo (contiene el nombre del archivo STL): str
# rugosidad (si es rugoso o b... | 30.408163 | 124 | 0.624832 | 204 | 1,490 | 4.519608 | 0.421569 | 0.013015 | 0.013015 | 0.013015 | 0.006508 | 0 | 0 | 0 | 0 | 0 | 0 | 0.043946 | 0.251678 | 1,490 | 48 | 125 | 31.041667 | 0.78296 | 0.342953 | 0 | 0 | 0 | 0 | 0.017727 | 0 | 0 | 0 | 0 | 0.020833 | 0 | 1 | 0.105263 | false | 0 | 0.210526 | 0 | 0.421053 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
43f07abc9804da881ac5480be6845f7fd01fef7b | 2,960 | py | Python | proj04_lists/proj04.py | Katz05/VSA-2018 | 0bf9ff4b8a6ed17cedba4700c5dce8f1c5ee3d28 | [
"MIT"
] | null | null | null | proj04_lists/proj04.py | Katz05/VSA-2018 | 0bf9ff4b8a6ed17cedba4700c5dce8f1c5ee3d28 | [
"MIT"
] | null | null | null | proj04_lists/proj04.py | Katz05/VSA-2018 | 0bf9ff4b8a6ed17cedba4700c5dce8f1c5ee3d28 | [
"MIT"
] | null | null | null | # coding=utf-8
# Name:
# Date:
"""
proj04
practice with lists
"""
#Part I
#Take a list, say for example this one:
a_list = [1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89]
#and write a program that prints out all the elements of the list that are less than 5.
empty_list = []
for numbers in a_list:
if numbers < 5:
... | 23.68 | 115 | 0.705743 | 477 | 2,960 | 4.314465 | 0.295597 | 0.116618 | 0.023324 | 0.023324 | 0.436346 | 0.362488 | 0.109815 | 0.084548 | 0.056365 | 0.056365 | 0 | 0.084298 | 0.182432 | 2,960 | 124 | 116 | 23.870968 | 0.766116 | 0.223649 | 0 | 0.32 | 0 | 0 | 0.064458 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.266667 | null | null | 0.08 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
43f19045aef2ccb43fb6251e3888c23ec331d185 | 863 | py | Python | ee/clickhouse/queries/test/test_util.py | avoajaugochukwu/posthog | 7e7fd42b0542ebc4734aedb926df11d462e3dd4f | [
"MIT"
] | 1 | 2021-04-09T09:13:23.000Z | 2021-04-09T09:13:23.000Z | ee/clickhouse/queries/test/test_util.py | avoajaugochukwu/posthog | 7e7fd42b0542ebc4734aedb926df11d462e3dd4f | [
"MIT"
] | 1 | 2021-10-13T10:05:26.000Z | 2021-10-13T10:05:26.000Z | ee/clickhouse/queries/test/test_util.py | avoajaugochukwu/posthog | 7e7fd42b0542ebc4734aedb926df11d462e3dd4f | [
"MIT"
] | 1 | 2021-06-17T02:18:43.000Z | 2021-06-17T02:18:43.000Z | from datetime import datetime
from uuid import uuid4
import pytz
from freezegun.api import freeze_time
from ee.clickhouse.models.event import create_event
from ee.clickhouse.queries.util import get_earliest_timestamp
def _create_event(**kwargs):
pk = uuid4()
kwargs.update({"event_uuid": pk})
create_even... | 30.821429 | 96 | 0.752028 | 134 | 863 | 4.626866 | 0.358209 | 0.08871 | 0.16129 | 0.051613 | 0.454839 | 0.454839 | 0.454839 | 0.325806 | 0.325806 | 0.325806 | 0 | 0.085302 | 0.117034 | 863 | 27 | 97 | 31.962963 | 0.728346 | 0 | 0 | 0.111111 | 0 | 0 | 0.099652 | 0 | 0 | 0 | 0 | 0 | 0.111111 | 1 | 0.166667 | false | 0 | 0.333333 | 0 | 0.5 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
43f34c1adae596b6c31c33bdc75e8b1bf87b25c8 | 547 | py | Python | python/unixserver.py | icefoxen/lang | 628185020123aabe4753f96c6ab4378637a2dbf5 | [
"MIT"
] | null | null | null | python/unixserver.py | icefoxen/lang | 628185020123aabe4753f96c6ab4378637a2dbf5 | [
"MIT"
] | null | null | null | python/unixserver.py | icefoxen/lang | 628185020123aabe4753f96c6ab4378637a2dbf5 | [
"MIT"
] | null | null | null | #!/bin/env python
from socket import *
FILE = '/THINGY'
s = socket( AF_UNIX, SOCK_STREAM )
print 'Socket', `s`, 'created'
s.bind( FILE )
print 'Socket bound. Name is: [', s.getsockname(), ']'
s.listen( 1 )
conn, addr = s.accept()
print 'Connected by', addr
while 1:
data = conn.recv( 1024 )
if not data: break
... | 20.259259 | 55 | 0.648995 | 78 | 547 | 4.525641 | 0.589744 | 0.067989 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.013575 | 0.191956 | 547 | 26 | 56 | 21.038462 | 0.785068 | 0.043876 | 0 | 0 | 0 | 0 | 0.232246 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.095238 | null | null | 0.333333 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
43f7e3a802c5a824f5b96ac706d393a9829a476e | 8,533 | py | Python | src/slu/datareader.py | colincen/coach | 2b1b543851cc7ba359f48dac6a5c72f1ced9b530 | [
"MIT"
] | null | null | null | src/slu/datareader.py | colincen/coach | 2b1b543851cc7ba359f48dac6a5c72f1ced9b530 | [
"MIT"
] | null | null | null | src/slu/datareader.py | colincen/coach | 2b1b543851cc7ba359f48dac6a5c72f1ced9b530 | [
"MIT"
] | null | null | null |
from preprocess.gen_embeddings_for_slu import slot_list
import numpy as np
import logging
logger = logging.getLogger()
y1_set = ["O", "B", "I"]
y2_set = ['O', 'B-playlist', 'I-playlist', 'B-music_item', 'I-music_item', 'B-geographic_poi', 'I-geographic_poi', 'B-facility', 'I-facility', 'B-movie_name', 'I-movie_name'... | 51.715152 | 1,220 | 0.616548 | 1,036 | 8,533 | 4.822394 | 0.168919 | 0.036829 | 0.069055 | 0.032026 | 0.229584 | 0.142314 | 0.066453 | 0.029624 | 0.015212 | 0.015212 | 0 | 0.017118 | 0.246924 | 8,533 | 164 | 1,221 | 52.030488 | 0.760349 | 0.019571 | 0 | 0.128 | 0 | 0 | 0.229881 | 0.060204 | 0 | 0 | 0 | 0 | 0.032 | 1 | 0.04 | false | 0 | 0.024 | 0 | 0.096 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
43f86932e923ea178a875ecf2b33bed8d74288a0 | 427 | py | Python | reblur_package/reblur_package/utils.py | adityakrishnavamsy/SelfDeblur | 29d02605d64faf8428f4c862d8e004a85c2cd719 | [
"MIT"
] | 104 | 2020-02-09T00:58:00.000Z | 2022-03-23T07:59:56.000Z | reblur_package/reblur_package/utils.py | adityakrishnavamsy/SelfDeblur | 29d02605d64faf8428f4c862d8e004a85c2cd719 | [
"MIT"
] | 5 | 2020-03-06T04:21:41.000Z | 2022-03-21T01:04:05.000Z | reblur_package/reblur_package/utils.py | adityakrishnavamsy/SelfDeblur | 29d02605d64faf8428f4c862d8e004a85c2cd719 | [
"MIT"
] | 18 | 2020-02-10T13:02:46.000Z | 2021-09-05T14:45:54.000Z | import torch
import meshzoo
def generate_2D_mesh(H, W):
_, faces = meshzoo.rectangle(
xmin = -1., xmax = 1.,
ymin = -1., ymax = 1.,
nx = W, ny = H,
zigzag=True)
x = torch.arange(0, W, 1).float().cuda()
y = torch.arange(0, H, 1).float().cuda()
xx = x.repeat(H, 1)
y... | 22.473684 | 45 | 0.505855 | 66 | 427 | 3.227273 | 0.515152 | 0.028169 | 0.112676 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.044521 | 0.316159 | 427 | 19 | 46 | 22.473684 | 0.684932 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.071429 | false | 0 | 0.142857 | 0 | 0.285714 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
43fd926ee69177576f6d1e868b14d90bfed3da59 | 645 | py | Python | xt_base/decos.py | x-utest/xtest-server-base | 81579d94626751483920cb6fe5d6cd2a5fd8b1d3 | [
"Apache-2.0"
] | null | null | null | xt_base/decos.py | x-utest/xtest-server-base | 81579d94626751483920cb6fe5d6cd2a5fd8b1d3 | [
"Apache-2.0"
] | null | null | null | xt_base/decos.py | x-utest/xtest-server-base | 81579d94626751483920cb6fe5d6cd2a5fd8b1d3 | [
"Apache-2.0"
] | null | null | null | import functools
from dtlib.tornado.utils import save_api_counts
def get_callback_result(callback, res_str):
"""
根据callback后的jsonp语句
:param callback:
:param res_str:
:return:
"""
if callback is None:
return res_str
else:
return '%s(%s)' % (callback.encode("utf-8"), res... | 17.916667 | 61 | 0.64186 | 74 | 645 | 5.418919 | 0.527027 | 0.05985 | 0.064838 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.002049 | 0.243411 | 645 | 35 | 62 | 18.428571 | 0.819672 | 0.221705 | 0 | 0 | 0 | 0 | 0.024554 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.153846 | false | 0 | 0.153846 | 0 | 0.538462 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
a100d6b93f0ea1edc358dbd6290e295a3fac156e | 11,117 | py | Python | Engine/libs/freeType/src/tools/docmaker/sources.py | lampardwade/tetris_lua_playgroundOSS | 29373294cfa66f2324ac984e5d4102854696fcc0 | [
"DOC",
"Apache-2.0"
] | 175 | 2015-01-07T08:38:31.000Z | 2022-02-28T20:40:47.000Z | Engine/libs/freeType/src/tools/docmaker/sources.py | lampardwade/tetris_lua_playgroundOSS | 29373294cfa66f2324ac984e5d4102854696fcc0 | [
"DOC",
"Apache-2.0"
] | 1 | 2020-09-10T09:45:48.000Z | 2020-09-11T10:10:52.000Z | Engine/libs/freeType/src/tools/docmaker/sources.py | lampardwade/tetris_lua_playgroundOSS | 29373294cfa66f2324ac984e5d4102854696fcc0 | [
"DOC",
"Apache-2.0"
] | 46 | 2015-03-14T16:11:18.000Z | 2022-02-28T20:40:49.000Z | # Sources (c) 2002-2004, 2006-2009, 2012
# David Turner <david@freetype.org>
#
#
# this file contains definitions of classes needed to decompose
# C sources files into a series of multi-line "blocks". There are
# two kinds of blocks:
#
# - normal blocks, which contain source code or ordinary comments
#
... | 31.945402 | 85 | 0.503463 | 1,182 | 11,117 | 4.672589 | 0.241963 | 0.023538 | 0.012674 | 0.009958 | 0.2696 | 0.221438 | 0.20134 | 0.176716 | 0.164041 | 0.164041 | 0 | 0.007485 | 0.375101 | 11,117 | 347 | 86 | 32.037464 | 0.787534 | 0.345957 | 0 | 0.310811 | 0 | 0 | 0.318019 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.006757 | null | null | 0.027027 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
a10c11cde9ea41bde95c5d925e0f6deba2f59cc2 | 24,493 | py | Python | beetles/ml_intuition/models.py | ESA-PhiLab/hypernet | b33f7893d3dfcbbc2c10076fb61b2b1f1316402a | [
"MIT"
] | 34 | 2018-11-14T09:38:00.000Z | 2022-01-31T17:44:51.000Z | beetles/ml_intuition/models.py | ESA-PhiLab/hypernet | b33f7893d3dfcbbc2c10076fb61b2b1f1316402a | [
"MIT"
] | 5 | 2018-09-11T14:52:35.000Z | 2022-03-24T09:32:01.000Z | beetles/ml_intuition/models.py | ESA-PhiLab/hypernet | b33f7893d3dfcbbc2c10076fb61b2b1f1316402a | [
"MIT"
] | 11 | 2018-10-24T12:42:59.000Z | 2022-03-12T03:50:50.000Z | """
All models that are used in the project.
"""
import json
import sys
from copy import deepcopy
from typing import Union, List
import numpy as np
import tensorflow as tf
import yaml
from scipy.stats import mode
from sklearn.ensemble import RandomForestClassifier, RandomForestRegressor
from sklearn.multioutput import... | 43.350442 | 103 | 0.592577 | 2,927 | 24,493 | 4.861633 | 0.132901 | 0.050668 | 0.056219 | 0.084329 | 0.695221 | 0.687561 | 0.680183 | 0.668798 | 0.659452 | 0.655446 | 0 | 0.026806 | 0.302413 | 24,493 | 564 | 104 | 43.427305 | 0.80604 | 0.267546 | 0 | 0.505882 | 0 | 0 | 0.046506 | 0 | 0 | 0 | 0 | 0 | 0.002941 | 1 | 0.055882 | false | 0 | 0.035294 | 0 | 0.152941 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
a10f8f226cdd056e7781adcbd0c37d3f9d7e38e0 | 2,887 | py | Python | chmap/examples/development/example104_download-image-batch.py | predsci/CHD | 35f29d1b62861f4ffed57b38d18689b282664bcf | [
"Apache-2.0"
] | 3 | 2021-06-29T00:23:47.000Z | 2021-09-17T18:29:05.000Z | chmap/examples/development/example104_download-image-batch.py | predsci/CHD | 35f29d1b62861f4ffed57b38d18689b282664bcf | [
"Apache-2.0"
] | null | null | null | chmap/examples/development/example104_download-image-batch.py | predsci/CHD | 35f29d1b62861f4ffed57b38d18689b282664bcf | [
"Apache-2.0"
] | 1 | 2021-12-08T06:26:18.000Z | 2021-12-08T06:26:18.000Z | """
Specify times for synchronic image download.
Query available images and download best matches.
"""
import os
import numpy as np
import pandas as pd
from astropy.time import Time
import astropy.units as u
from chmap.settings.app import App
import chmap.database.db_classes as DBClass
from chmap.database.db_funs imp... | 40.097222 | 117 | 0.758919 | 431 | 2,887 | 4.867749 | 0.352668 | 0.031459 | 0.019066 | 0.024786 | 0.087703 | 0.048618 | 0.048618 | 0.048618 | 0.048618 | 0.048618 | 0 | 0.016522 | 0.161413 | 2,887 | 71 | 118 | 40.661972 | 0.850062 | 0.364392 | 0 | 0 | 0 | 0 | 0.094684 | 0.025471 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.055556 | 0.25 | 0 | 0.25 | 0.055556 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
a1129282e03235c72ec9ef4fa2321b003be4a617 | 254 | py | Python | icecrate/_version.py | Artanis/icecrate | 2655998734b9cc8bb2137349eac0d4fda659a6b4 | [
"BSD-2-Clause"
] | 1 | 2015-11-05T18:45:35.000Z | 2015-11-05T18:45:35.000Z | icecrate/_version.py | Artanis/icecrate | 2655998734b9cc8bb2137349eac0d4fda659a6b4 | [
"BSD-2-Clause"
] | 2 | 2019-06-20T22:32:47.000Z | 2019-06-20T22:32:47.000Z | icecrate/_version.py | Artanis/icecrate | 2655998734b9cc8bb2137349eac0d4fda659a6b4 | [
"BSD-2-Clause"
] | null | null | null | def split_version(vs):
import re
for v in re.findall(r"[\w\d]+", vs):
try:
v = int(v)
except ValueError:
pass
yield v
__version__ = "0.1.9-dev"
__version_info__ = tuple(split_version(__version__))
| 21.166667 | 52 | 0.559055 | 35 | 254 | 3.628571 | 0.714286 | 0.188976 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.017341 | 0.318898 | 254 | 11 | 53 | 23.090909 | 0.716763 | 0 | 0 | 0 | 0 | 0 | 0.062992 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.1 | false | 0.1 | 0.1 | 0 | 0.2 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
a1151b66e56a1cd94afa6df3f798d687dd6c5267 | 198 | py | Python | chapter02/knock14.py | m-star18/NLP100 | e199814f81943f7fb693fd5fe87d6df21da07f5b | [
"MIT"
] | 1 | 2020-07-15T17:21:13.000Z | 2020-07-15T17:21:13.000Z | chapter02/knock14.py | m-star18/NLP100 | e199814f81943f7fb693fd5fe87d6df21da07f5b | [
"MIT"
] | 1 | 2021-05-04T01:04:57.000Z | 2021-05-04T01:05:32.000Z | chapter02/knock14.py | m-star18/NLP100 | e199814f81943f7fb693fd5fe87d6df21da07f5b | [
"MIT"
] | null | null | null | import sys
import pandas as pd
if len(sys.argv) == 1:
print('Set arg n!!')
else:
n = int(sys.argv[1])
df = pd.read_csv('popular-names.txt', sep='\t', header=None)
print(df.head(n))
| 19.8 | 64 | 0.60101 | 36 | 198 | 3.277778 | 0.722222 | 0.118644 | 0.135593 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.012658 | 0.20202 | 198 | 9 | 65 | 22 | 0.734177 | 0 | 0 | 0 | 0 | 0 | 0.151515 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 0.25 | 0.25 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
a116e1357884fb9b03673199b85a5dca733631e1 | 192 | py | Python | trans.py | hackidemia/cognimates-l10n | d3b8437e46e5336a5df7d8678b44d1eafe6c9422 | [
"BSD-3-Clause"
] | 2 | 2019-05-23T09:26:37.000Z | 2019-09-01T08:31:29.000Z | trans.py | hackidemia/cognimates-l10n | d3b8437e46e5336a5df7d8678b44d1eafe6c9422 | [
"BSD-3-Clause"
] | 3 | 2019-08-30T10:43:29.000Z | 2021-05-08T11:02:07.000Z | trans.py | hackidemia/cognimates-l10n | d3b8437e46e5336a5df7d8678b44d1eafe6c9422 | [
"BSD-3-Clause"
] | 3 | 2019-05-10T18:39:31.000Z | 2019-08-30T10:33:09.000Z | import json
with open('es.json', 'rb') as f:
ext = json.load(f)
n = list(ext.keys())
d = {k:"" for k in n}
print(d)
with open('new.json', 'wb') as f:
print(type(n))
json.dump(d, f) | 21.333333 | 33 | 0.5625 | 39 | 192 | 2.769231 | 0.564103 | 0.148148 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.208333 | 192 | 9 | 34 | 21.333333 | 0.710526 | 0 | 0 | 0 | 0 | 0 | 0.098446 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.111111 | 0 | 0.111111 | 0.222222 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
a116e1e33167d9343b6233edd0bf75dbe4ec7106 | 465 | py | Python | api/conf/auth.py | nerdism/flask-restful-login | 1b5d4b45fd0e7f0d6183fa7233839a89e8d9ea5b | [
"MIT"
] | null | null | null | api/conf/auth.py | nerdism/flask-restful-login | 1b5d4b45fd0e7f0d6183fa7233839a89e8d9ea5b | [
"MIT"
] | null | null | null | api/conf/auth.py | nerdism/flask-restful-login | 1b5d4b45fd0e7f0d6183fa7233839a89e8d9ea5b | [
"MIT"
] | null | null | null | #!/usr/bin/python
# -*- coding: utf-8 -*-
from flask_httpauth import HTTPTokenAuth
from itsdangerous import TimedJSONWebSignatureSerializer as JsonWebToken
from config.config import JWT_SECRET, JWT_REF_SECRET
# JWT creation. Expires in one hour
jwt = JsonWebToken(JWT_SECRET, expires_in=3600)
# Refresh token creatio... | 27.352941 | 72 | 0.793548 | 62 | 465 | 5.790323 | 0.532258 | 0.100279 | 0.066852 | 0.111421 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.029412 | 0.122581 | 465 | 16 | 73 | 29.0625 | 0.85049 | 0.307527 | 0 | 0 | 0 | 0 | 0.018927 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.5 | 0 | 0.5 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
a119ee5fb164cd841628c06050e594c69c8e978b | 816 | py | Python | Python/matriz_junior.py | robertogoes/exercicios-coursera-python | 5093cc31ccda764b6131987fa81601b7179a9bfc | [
"MIT"
] | null | null | null | Python/matriz_junior.py | robertogoes/exercicios-coursera-python | 5093cc31ccda764b6131987fa81601b7179a9bfc | [
"MIT"
] | null | null | null | Python/matriz_junior.py | robertogoes/exercicios-coursera-python | 5093cc31ccda764b6131987fa81601b7179a9bfc | [
"MIT"
] | null | null | null | #a matriz é obrigatoriamente quadrada, entao eu só preciso passar um parâmetro i = j
def cria_matriz(m):
matriz = []
for i in range(1,(m*2)+1):
linha = []
k = 1
for j in range(1,(m*2)+1):
if i == j:
if m < j:
linha.append((m*2)+1-j)
... | 25.5 | 84 | 0.397059 | 106 | 816 | 3.037736 | 0.358491 | 0.204969 | 0.02795 | 0.055901 | 0.180124 | 0.068323 | 0 | 0 | 0 | 0 | 0 | 0.021429 | 0.485294 | 816 | 31 | 85 | 26.322581 | 0.745238 | 0.129902 | 0 | 0.192308 | 0 | 0 | 0.031073 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.038462 | false | 0 | 0 | 0 | 0.076923 | 0.038462 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
a11eebff2ef9e15a97615c6d7eb054367be28330 | 2,202 | py | Python | sensitive1.py | Jaykukreja/janseva | 21ffa8b515cb4a5bb9a190b291761636cd92ee00 | [
"Apache-2.0"
] | 1 | 2019-03-18T14:57:47.000Z | 2019-03-18T14:57:47.000Z | sensitive1.py | SacredCoders/JanSeva | 067c2c1648af19fe94f659a6f2577d73644aeabf | [
"Apache-2.0"
] | null | null | null | sensitive1.py | SacredCoders/JanSeva | 067c2c1648af19fe94f659a6f2577d73644aeabf | [
"Apache-2.0"
] | null | null | null |
import re
from sensitive_data import dataset,feature_set,no_of_items
'''print(dataset)
print("----------")
print(no_of_items)
print("----------")
print(feature_set)'''
# To calculate the basic probability of a word for a category
POSITIVE=0
NEGATIVE=0
def calc_prob(word,category):
if word not in feature_set or word... | 23.178947 | 107 | 0.707539 | 365 | 2,202 | 4.142466 | 0.254795 | 0.021164 | 0.029762 | 0.035714 | 0.083333 | 0.039683 | 0.039683 | 0 | 0 | 0 | 0 | 0.011989 | 0.166667 | 2,202 | 95 | 108 | 23.178947 | 0.811989 | 0.283379 | 0 | 0.040816 | 0 | 0 | 0.039872 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.040816 | null | null | 0.102041 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
a12eada62380ffc2716abe5e825332e1f61e1999 | 767 | py | Python | register/tests.py | SCCapstone/C-2319 | 4ab2b5b5511209dc4d7f9c25b6a4f70843287b77 | [
"bzip2-1.0.6"
] | null | null | null | register/tests.py | SCCapstone/C-2319 | 4ab2b5b5511209dc4d7f9c25b6a4f70843287b77 | [
"bzip2-1.0.6"
] | null | null | null | register/tests.py | SCCapstone/C-2319 | 4ab2b5b5511209dc4d7f9c25b6a4f70843287b77 | [
"bzip2-1.0.6"
] | null | null | null | from django.test import TestCase, Client
from register.views import remove_user
from django.contrib.auth.models import User
from django.urls import reverse
class TestRegisterViews(TestCase):
def setup(self):
self.user = User.objects.create_user('test', 'test@email.sc.edu')
self.user.set_password('... | 33.347826 | 81 | 0.693611 | 96 | 767 | 5.364583 | 0.489583 | 0.058252 | 0.054369 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.00638 | 0.182529 | 767 | 22 | 82 | 34.863636 | 0.814992 | 0.093872 | 0 | 0 | 0 | 0 | 0.081633 | 0 | 0 | 0 | 0 | 0 | 0.058824 | 1 | 0.117647 | false | 0.117647 | 0.235294 | 0 | 0.411765 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
a12f329a31d478f8582a246c9a704593cd3daad8 | 1,970 | py | Python | DynamicProgramming/Aditya_Verma/Type1__01Knapsack/0_1_KnapSack/0_1_Knapsack__DP__Backward.py | prash-kr-meena/GoogleR | 27aca71e51cc2442e604e07ab00406a98d8d63a4 | [
"Apache-2.0"
] | null | null | null | DynamicProgramming/Aditya_Verma/Type1__01Knapsack/0_1_KnapSack/0_1_Knapsack__DP__Backward.py | prash-kr-meena/GoogleR | 27aca71e51cc2442e604e07ab00406a98d8d63a4 | [
"Apache-2.0"
] | null | null | null | DynamicProgramming/Aditya_Verma/Type1__01Knapsack/0_1_KnapSack/0_1_Knapsack__DP__Backward.py | prash-kr-meena/GoogleR | 27aca71e51cc2442e604e07ab00406a98d8d63a4 | [
"Apache-2.0"
] | null | null | null | # Here, we are using index to traverse the array, But we are doing it in the reverse order
# Returns: an int denoting the maximum profit, that can be achieved
from Utils.Array import input_array
def max_profit_in_01knapsack(weight, value, capacity, n) -> int:
# Base Case --> Initialization step
"""
for i ... | 39.4 | 231 | 0.558376 | 356 | 1,970 | 2.935393 | 0.401685 | 0.084211 | 0.091866 | 0.084211 | 0.208612 | 0.156938 | 0.074641 | 0.074641 | 0.074641 | 0.074641 | 0 | 0.202703 | 0.361421 | 1,970 | 49 | 232 | 40.204082 | 0.627981 | 0.203553 | 0 | 0.1 | 0 | 0 | 0.018701 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.05 | false | 0 | 0.05 | 0 | 0.15 | 0.05 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
a13794c6cf2fab43102d8d315cebb769f64dfb9e | 3,293 | py | Python | mopro/config.py | fact-project/mopro3 | c5c0e47c40002292b12119c32056c04564585b06 | [
"MIT"
] | 1 | 2020-03-18T12:43:39.000Z | 2020-03-18T12:43:39.000Z | mopro/config.py | fact-project/mopro3 | c5c0e47c40002292b12119c32056c04564585b06 | [
"MIT"
] | null | null | null | mopro/config.py | fact-project/mopro3 | c5c0e47c40002292b12119c32056c04564585b06 | [
"MIT"
] | null | null | null | '''
Config class that loads yaml config files
At import, it tries to load $HOME/.mopro.yaml and $(pwd)/mopro.yaml
It also checks for the following environment variables:
* CORSIKA_PASSWORD
* CORSIKA_VERSION
* FLUKA_ID
* FLUKA_PASSWORD
'''
import os
from ruamel.yaml import YAML
from collections import namedtuple
yam... | 29.141593 | 88 | 0.651989 | 391 | 3,293 | 5.294118 | 0.268542 | 0.047826 | 0.021256 | 0.025121 | 0.05314 | 0.027053 | 0 | 0 | 0 | 0 | 0 | 0.005339 | 0.203766 | 3,293 | 112 | 89 | 29.401786 | 0.784134 | 0.099302 | 0 | 0 | 0 | 0 | 0.141746 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.04 | false | 0.066667 | 0.04 | 0 | 0.266667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
a1391c959bbeef2ec4156da36f0ffb2df82766c4 | 23,976 | py | Python | string-method/src/notebooks/MD_common/MD_spectral_clustering.py | delemottelab/gpcr-string-method-2019 | b50786a4a8747d56ad04ede525592eb31f1890fd | [
"MIT"
] | null | null | null | string-method/src/notebooks/MD_common/MD_spectral_clustering.py | delemottelab/gpcr-string-method-2019 | b50786a4a8747d56ad04ede525592eb31f1890fd | [
"MIT"
] | null | null | null | string-method/src/notebooks/MD_common/MD_spectral_clustering.py | delemottelab/gpcr-string-method-2019 | b50786a4a8747d56ad04ede525592eb31f1890fd | [
"MIT"
] | 3 | 2020-03-16T04:33:50.000Z | 2021-03-19T17:25:59.000Z | import argparse
import sys
import mdtraj as md
import numpy as np
import matplotlib.pyplot as plt
from numpy import linalg as LA
from sklearn import cluster, datasets
from scipy.optimize import minimize
from sklearn.neighbors import kneighbors_graph
from sklearn.manifold import SpectralEmbedding
from scipy.spatial.dist... | 40.228188 | 134 | 0.579288 | 2,664 | 23,976 | 5.142267 | 0.158033 | 0.026571 | 0.009928 | 0.012848 | 0.447332 | 0.41295 | 0.389882 | 0.364771 | 0.346741 | 0.340609 | 0 | 0.018963 | 0.287371 | 23,976 | 595 | 135 | 40.295798 | 0.782805 | 0.115532 | 0 | 0.392157 | 0 | 0 | 0.064446 | 0.003691 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.044118 | null | null | 0.090686 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
a14c4d206cf47443fcf62f0101c3b1490da17e1f | 2,850 | py | Python | eval.py | simjs00/salesman | 77016c2917c0d73e8e3fb0ccfce30e29d6021bb2 | [
"MIT"
] | null | null | null | eval.py | simjs00/salesman | 77016c2917c0d73e8e3fb0ccfce30e29d6021bb2 | [
"MIT"
] | null | null | null | eval.py | simjs00/salesman | 77016c2917c0d73e8e3fb0ccfce30e29d6021bb2 | [
"MIT"
] | null | null | null | import model
import helpers
import numpy as np
import pickle
import sys
import spacy
vocabs = set()
file = open("./training/"+"vocabs.pickle",'rb')
vocabs = list(pickle.load(file))
file.close()
model.saver.restore(model.sess, "./model/model.ckpt")
nlp = spacy.load('./en_core_web_sm1/en_core_web_sm-2.0.0')
def get_wor... | 25 | 110 | 0.641754 | 427 | 2,850 | 4.138173 | 0.24356 | 0.036786 | 0.050934 | 0.033956 | 0.34352 | 0.34352 | 0.34352 | 0.34352 | 0.254669 | 0.208829 | 0 | 0.022717 | 0.196842 | 2,850 | 114 | 111 | 25 | 0.749235 | 0.102456 | 0 | 0.270588 | 0 | 0 | 0.069128 | 0.014925 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.070588 | null | null | 0.129412 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
a14e8911dcc8dee24e72bbfc1ff37c9f805f5789 | 34,167 | py | Python | digsby/src/gui/pref/prefcontrols.py | ifwe/digsby | f5fe00244744aa131e07f09348d10563f3d8fa99 | [
"Python-2.0"
] | 35 | 2015-08-15T14:32:38.000Z | 2021-12-09T16:21:26.000Z | digsby/src/gui/pref/prefcontrols.py | niterain/digsby | 16a62c7df1018a49eaa8151c0f8b881c7e252949 | [
"Python-2.0"
] | 4 | 2015-09-12T10:42:57.000Z | 2017-02-27T04:05:51.000Z | digsby/src/gui/pref/prefcontrols.py | niterain/digsby | 16a62c7df1018a49eaa8151c0f8b881c7e252949 | [
"Python-2.0"
] | 15 | 2015-07-10T23:58:07.000Z | 2022-01-23T22:16:33.000Z | '''
Utility functions for building GUI controls bound to the preference dictionary.
'''
from __future__ import with_statement
from wx import Choice, EXPAND, LEFT, EVT_CHOICE, BOTTOM, ALIGN_CENTER_VERTICAL, ALL, \
EVT_LEFT_DOWN, EVT_LEFT_UP, HORIZONTAL,VERTICAL, Rect, RectS
from wx import StaticBox, StaticBoxSizer... | 29.918564 | 121 | 0.574853 | 4,104 | 34,167 | 4.654727 | 0.13962 | 0.007329 | 0.009894 | 0.01204 | 0.231796 | 0.154583 | 0.122808 | 0.106161 | 0.09276 | 0.077265 | 0 | 0.008481 | 0.313226 | 34,167 | 1,141 | 122 | 29.944785 | 0.805625 | 0.052068 | 0 | 0.261034 | 0 | 0.001261 | 0.028282 | 0.002462 | 0 | 0 | 0 | 0 | 0.001261 | 0 | null | null | 0.001261 | 0.031526 | null | null | 0.005044 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
a151ad5bec0640eb2f11bce2bc257aba1e65f7b4 | 847 | py | Python | zeri_di_funzioni/newton.py | Ro0t-set/metodi-numerici | d586bce78f94f1aa6736218c9123064a57cb87ec | [
"MIT"
] | 5 | 2021-05-21T12:22:18.000Z | 2021-07-02T16:48:32.000Z | zeri_di_funzioni/newton.py | AlePioggia/metodi-numerici | a231f4a857074d811eb230b1114545f05fabe65f | [
"MIT"
] | null | null | null | zeri_di_funzioni/newton.py | AlePioggia/metodi-numerici | a231f4a857074d811eb230b1114545f05fabe65f | [
"MIT"
] | 2 | 2021-06-22T10:20:58.000Z | 2021-07-02T19:58:24.000Z | # -*- coding: utf-8 -*-
"""
Metodo di newton
"""
import numpy as np
def newton(func, dfunc, x0, tolx, tolf, max_iterazioni):
xks = []
it = 0
if not (abs(dfunc(x0) > np.spacing(1))): # per evitare di dividere per zero
print("Derivata nulla in x0 - EXIT")
return [],it,xks
d = func(x0)... | 30.25 | 85 | 0.545455 | 131 | 847 | 3.503817 | 0.335878 | 0.076253 | 0.052288 | 0.056645 | 0.498911 | 0.498911 | 0.448802 | 0.309368 | 0.200436 | 0.200436 | 0 | 0.036851 | 0.295159 | 847 | 28 | 86 | 30.25 | 0.731993 | 0.085006 | 0 | 0.608696 | 0 | 0 | 0.119948 | 0 | 0 | 0 | 0 | 0.035714 | 0 | 1 | 0.043478 | false | 0 | 0.043478 | 0 | 0.217391 | 0.130435 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
a15742c2ed01f0ffaad137cf05d8c3e5c17d9530 | 10,516 | py | Python | pycrc/expr.py | jbosboom/pycrc | 240d4509e8592c7ee60aaed8a068351cf71c25fc | [
"MIT"
] | 118 | 2015-01-06T02:42:25.000Z | 2022-03-31T06:27:14.000Z | pycrc/expr.py | jbosboom/pycrc | 240d4509e8592c7ee60aaed8a068351cf71c25fc | [
"MIT"
] | 39 | 2015-01-20T09:15:14.000Z | 2022-03-21T07:59:48.000Z | pycrc/expr.py | jbosboom/pycrc | 240d4509e8592c7ee60aaed8a068351cf71c25fc | [
"MIT"
] | 37 | 2015-01-31T08:32:49.000Z | 2022-01-07T04:08:09.000Z | # pycrc -- parameterisable CRC calculation utility and C source code generator
#
# Copyright (c) 2017 Thomas Pircher <tehpeh-web@tty1.net>
#
# Permission is hereby granted, free of charge, to any person obtaining a copy
# of this software and associated documentation files (the "Software"), to
# deal in the Soft... | 26.35589 | 86 | 0.555249 | 1,283 | 10,516 | 4.436477 | 0.151208 | 0.03338 | 0.020907 | 0.029866 | 0.579585 | 0.567639 | 0.564301 | 0.554989 | 0.536015 | 0.514055 | 0 | 0.005131 | 0.332826 | 10,516 | 398 | 87 | 26.422111 | 0.806157 | 0.324363 | 0 | 0.62069 | 0 | 0 | 0.005596 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.206897 | false | 0 | 0 | 0.005747 | 0.597701 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
a159e5ececfb44304630a0c03154105a28382753 | 2,220 | py | Python | tests/conftest.py | ddnomad/blockkit-slack | 886598d73acc4e545bc5fca4e36902997b00168a | [
"MIT"
] | null | null | null | tests/conftest.py | ddnomad/blockkit-slack | 886598d73acc4e545bc5fca4e36902997b00168a | [
"MIT"
] | null | null | null | tests/conftest.py | ddnomad/blockkit-slack | 886598d73acc4e545bc5fca4e36902997b00168a | [
"MIT"
] | null | null | null | from collections import namedtuple
import pytest
from blockkit import (
Button,
Confirm,
Image,
MarkdownText,
Option,
OptionGroup,
PlainText,
Filter,
)
TestValues = namedtuple(
"TestValues",
(
"title text short_text image_url alt_text url deep_link "
"action_id... | 20.943396 | 77 | 0.678378 | 276 | 2,220 | 5.26087 | 0.326087 | 0.107438 | 0.132231 | 0.068871 | 0.092287 | 0 | 0 | 0 | 0 | 0 | 0 | 0.011422 | 0.211261 | 2,220 | 105 | 78 | 21.142857 | 0.817818 | 0 | 0 | 0.153846 | 0 | 0 | 0.180631 | 0.018018 | 0 | 0 | 0 | 0 | 0 | 1 | 0.153846 | false | 0 | 0.038462 | 0.153846 | 0.346154 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 |
a15f32b6a7c286e5594d33455b286fbf8e815c3f | 5,923 | py | Python | DistributedLedger.py | th148/CS346-blockchain | 1c9a6981196453fe676815ac1d25786cc8954d59 | [
"Apache-2.0"
] | null | null | null | DistributedLedger.py | th148/CS346-blockchain | 1c9a6981196453fe676815ac1d25786cc8954d59 | [
"Apache-2.0"
] | null | null | null | DistributedLedger.py | th148/CS346-blockchain | 1c9a6981196453fe676815ac1d25786cc8954d59 | [
"Apache-2.0"
] | null | null | null | import hashlib
import secrets
import time
from ProofOfWork import *
#
# This Python code demonstrates the "Distributed Ledger" aspect of
# the blockchain technology. This is how the blockchain is verified and
# how people are able to "own" a part of the blockchain if it is being
# used as digital currency..
#
... | 32.905556 | 117 | 0.622151 | 749 | 5,923 | 4.798398 | 0.312417 | 0.023372 | 0.012243 | 0.017807 | 0.046745 | 0.020033 | 0.020033 | 0.020033 | 0 | 0 | 0 | 0.003775 | 0.239743 | 5,923 | 179 | 118 | 33.089385 | 0.794359 | 0.384602 | 0 | 0.229167 | 0 | 0 | 0.196999 | 0.086691 | 0 | 0 | 0 | 0 | 0 | 1 | 0.1875 | false | 0 | 0.041667 | 0.114583 | 0.385417 | 0.229167 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 |
a165062c206ce69a08619b9a1b7b57653643ea52 | 2,701 | py | Python | chocs/http_message.py | danballance/chocs | 8a64ce47d98ec327ce709b46c6389c5c627f4157 | [
"MIT"
] | null | null | null | chocs/http_message.py | danballance/chocs | 8a64ce47d98ec327ce709b46c6389c5c627f4157 | [
"MIT"
] | null | null | null | chocs/http_message.py | danballance/chocs | 8a64ce47d98ec327ce709b46c6389c5c627f4157 | [
"MIT"
] | null | null | null | import json
from copy import copy
from io import BytesIO
from json.decoder import JSONDecodeError
from typing import Any, Dict, ItemsView, KeysView, Optional, ValuesView
import yaml
from .http_multipart_message_parser import parse_multipart_message
from .http_query_string import parse_qs
class HttpMessage(str):
... | 25.72381 | 99 | 0.659385 | 287 | 2,701 | 6.020906 | 0.254355 | 0.041667 | 0.032407 | 0.090278 | 0.266204 | 0.266204 | 0.266204 | 0.234375 | 0.234375 | 0.209491 | 0 | 0.003893 | 0.239171 | 2,701 | 104 | 100 | 25.971154 | 0.836983 | 0.009626 | 0 | 0.256757 | 0 | 0 | 0.066267 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.175676 | false | 0.013514 | 0.108108 | 0.094595 | 0.540541 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
a1664b7a485623a7628afd387559b700bd246191 | 231 | py | Python | ch07/ex1.py | gama79530/Coursera_Python_for_Everybody_2019 | 16a03db48accc4593dda085352f166874b39c874 | [
"MIT"
] | null | null | null | ch07/ex1.py | gama79530/Coursera_Python_for_Everybody_2019 | 16a03db48accc4593dda085352f166874b39c874 | [
"MIT"
] | null | null | null | ch07/ex1.py | gama79530/Coursera_Python_for_Everybody_2019 | 16a03db48accc4593dda085352f166874b39c874 | [
"MIT"
] | null | null | null | fname = input('Enter a file name:')
try :
fhand = open('ch07\\' + fname)
except :
print('File cannot be opened:',fname)
quit()
for str in fhand :
print(str.upper().rstrip())
try :
fhand.close()
except :
pass | 19.25 | 41 | 0.597403 | 32 | 231 | 4.3125 | 0.71875 | 0.115942 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.011364 | 0.238095 | 231 | 12 | 42 | 19.25 | 0.772727 | 0 | 0 | 0.333333 | 0 | 0 | 0.198276 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.083333 | 0 | 0 | 0 | 0.166667 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
a16c7ce3b643ab112c6c48db98901e5246177a07 | 2,386 | py | Python | strawberry/types/execution.py | TimPansino/strawberry | 10b411ff1ce1a9d80832e6e6c471c5648a206396 | [
"MIT"
] | null | null | null | strawberry/types/execution.py | TimPansino/strawberry | 10b411ff1ce1a9d80832e6e6c471c5648a206396 | [
"MIT"
] | 3 | 2021-11-08T01:12:10.000Z | 2022-03-21T06:33:38.000Z | strawberry/types/execution.py | uvicorn/strawberry | 100e47fd430f0552c9ef9549306faceac610431d | [
"MIT"
] | null | null | null | import dataclasses
from typing import TYPE_CHECKING, Any, Dict, List, Optional, Tuple, Type
from graphql import (
ASTValidationRule,
ExecutionResult as GraphQLExecutionResult,
specified_rules,
)
from graphql.error.graphql_error import GraphQLError
from graphql.language import DocumentNode, OperationDefinit... | 30.202532 | 80 | 0.730092 | 264 | 2,386 | 6.393939 | 0.30303 | 0.088863 | 0.074645 | 0.059242 | 0.090047 | 0.063981 | 0.063981 | 0.063981 | 0.063981 | 0 | 0 | 0 | 0.203688 | 2,386 | 78 | 81 | 30.589744 | 0.888421 | 0.062029 | 0 | 0.2 | 0 | 0 | 0.015667 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.072727 | false | 0 | 0.145455 | 0 | 0.618182 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
a1738c9c04b58753602ac6a9d24adaf786dd355b | 1,013 | py | Python | sdk/ml/azure-ai-ml/azure/ai/ml/_schema/automl/image_vertical/image_limit_settings.py | dubiety/azure-sdk-for-python | 62ffa839f5d753594cf0fe63668f454a9d87a346 | [
"MIT"
] | 1 | 2022-02-01T18:50:12.000Z | 2022-02-01T18:50:12.000Z | sdk/ml/azure-ai-ml/azure/ai/ml/_schema/automl/image_vertical/image_limit_settings.py | ellhe-blaster/azure-sdk-for-python | 82193ba5e81cc5e5e5a5239bba58abe62e86f469 | [
"MIT"
] | null | null | null | sdk/ml/azure-ai-ml/azure/ai/ml/_schema/automl/image_vertical/image_limit_settings.py | ellhe-blaster/azure-sdk-for-python | 82193ba5e81cc5e5e5a5239bba58abe62e86f469 | [
"MIT"
] | null | null | null | # ---------------------------------------------------------
# Copyright (c) Microsoft Corporation. All rights reserved.
# ---------------------------------------------------------
from marshmallow import fields, post_load
from azure.ai.ml.constants import AutoMLConstants
from azure.ai.ml._schema import PatchedSchemaMe... | 32.677419 | 86 | 0.674235 | 104 | 1,013 | 6.394231 | 0.471154 | 0.067669 | 0.066165 | 0.078195 | 0.303759 | 0.303759 | 0.303759 | 0.216541 | 0.216541 | 0.216541 | 0 | 0.009153 | 0.137216 | 1,013 | 30 | 87 | 33.766667 | 0.751716 | 0.1846 | 0 | 0.333333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.111111 | false | 0 | 0.277778 | 0.055556 | 0.888889 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.