hexsha string | size int64 | ext string | lang string | max_stars_repo_path string | max_stars_repo_name string | max_stars_repo_head_hexsha string | max_stars_repo_licenses list | max_stars_count int64 | max_stars_repo_stars_event_min_datetime string | max_stars_repo_stars_event_max_datetime string | max_issues_repo_path string | max_issues_repo_name string | max_issues_repo_head_hexsha string | max_issues_repo_licenses list | max_issues_count int64 | max_issues_repo_issues_event_min_datetime string | max_issues_repo_issues_event_max_datetime string | max_forks_repo_path string | max_forks_repo_name string | max_forks_repo_head_hexsha string | max_forks_repo_licenses list | max_forks_count int64 | max_forks_repo_forks_event_min_datetime string | max_forks_repo_forks_event_max_datetime string | content string | avg_line_length float64 | max_line_length int64 | alphanum_fraction float64 | qsc_code_num_words_quality_signal int64 | qsc_code_num_chars_quality_signal float64 | qsc_code_mean_word_length_quality_signal float64 | qsc_code_frac_words_unique_quality_signal float64 | qsc_code_frac_chars_top_2grams_quality_signal float64 | qsc_code_frac_chars_top_3grams_quality_signal float64 | qsc_code_frac_chars_top_4grams_quality_signal float64 | qsc_code_frac_chars_dupe_5grams_quality_signal float64 | qsc_code_frac_chars_dupe_6grams_quality_signal float64 | qsc_code_frac_chars_dupe_7grams_quality_signal float64 | qsc_code_frac_chars_dupe_8grams_quality_signal float64 | qsc_code_frac_chars_dupe_9grams_quality_signal float64 | qsc_code_frac_chars_dupe_10grams_quality_signal float64 | qsc_code_frac_chars_replacement_symbols_quality_signal float64 | qsc_code_frac_chars_digital_quality_signal float64 | qsc_code_frac_chars_whitespace_quality_signal float64 | qsc_code_size_file_byte_quality_signal float64 | qsc_code_num_lines_quality_signal float64 | qsc_code_num_chars_line_max_quality_signal float64 | qsc_code_num_chars_line_mean_quality_signal float64 | qsc_code_frac_chars_alphabet_quality_signal float64 | qsc_code_frac_chars_comments_quality_signal float64 | qsc_code_cate_xml_start_quality_signal float64 | qsc_code_frac_lines_dupe_lines_quality_signal float64 | qsc_code_cate_autogen_quality_signal float64 | qsc_code_frac_lines_long_string_quality_signal float64 | qsc_code_frac_chars_string_length_quality_signal float64 | qsc_code_frac_chars_long_word_length_quality_signal float64 | qsc_code_frac_lines_string_concat_quality_signal float64 | qsc_code_cate_encoded_data_quality_signal float64 | qsc_code_frac_chars_hex_words_quality_signal float64 | qsc_code_frac_lines_prompt_comments_quality_signal float64 | qsc_code_frac_lines_assert_quality_signal float64 | qsc_codepython_cate_ast_quality_signal float64 | qsc_codepython_frac_lines_func_ratio_quality_signal float64 | qsc_codepython_cate_var_zero_quality_signal bool | qsc_codepython_frac_lines_pass_quality_signal float64 | qsc_codepython_frac_lines_import_quality_signal float64 | qsc_codepython_frac_lines_simplefunc_quality_signal float64 | qsc_codepython_score_lines_no_logic_quality_signal float64 | qsc_codepython_frac_lines_print_quality_signal float64 | qsc_code_num_words int64 | qsc_code_num_chars int64 | qsc_code_mean_word_length int64 | qsc_code_frac_words_unique null | qsc_code_frac_chars_top_2grams int64 | qsc_code_frac_chars_top_3grams int64 | qsc_code_frac_chars_top_4grams int64 | qsc_code_frac_chars_dupe_5grams int64 | qsc_code_frac_chars_dupe_6grams int64 | qsc_code_frac_chars_dupe_7grams int64 | qsc_code_frac_chars_dupe_8grams int64 | qsc_code_frac_chars_dupe_9grams int64 | qsc_code_frac_chars_dupe_10grams int64 | qsc_code_frac_chars_replacement_symbols int64 | qsc_code_frac_chars_digital int64 | qsc_code_frac_chars_whitespace int64 | qsc_code_size_file_byte int64 | qsc_code_num_lines int64 | qsc_code_num_chars_line_max int64 | qsc_code_num_chars_line_mean int64 | qsc_code_frac_chars_alphabet int64 | qsc_code_frac_chars_comments int64 | qsc_code_cate_xml_start int64 | qsc_code_frac_lines_dupe_lines int64 | qsc_code_cate_autogen int64 | qsc_code_frac_lines_long_string int64 | qsc_code_frac_chars_string_length int64 | qsc_code_frac_chars_long_word_length int64 | qsc_code_frac_lines_string_concat null | qsc_code_cate_encoded_data int64 | qsc_code_frac_chars_hex_words int64 | qsc_code_frac_lines_prompt_comments int64 | qsc_code_frac_lines_assert int64 | qsc_codepython_cate_ast int64 | qsc_codepython_frac_lines_func_ratio int64 | qsc_codepython_cate_var_zero int64 | qsc_codepython_frac_lines_pass int64 | qsc_codepython_frac_lines_import int64 | qsc_codepython_frac_lines_simplefunc int64 | qsc_codepython_score_lines_no_logic int64 | qsc_codepython_frac_lines_print int64 | effective string | hits int64 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
8d5ecf84bb8d774f4a78f385b11d774ebea74ca7 | 1,218 | py | Python | io_core/io_core_magma.py | makaimann/garnet | 5a5e721cd46588cc4abd326e6cb78472ebc93a32 | [
"BSD-3-Clause"
] | null | null | null | io_core/io_core_magma.py | makaimann/garnet | 5a5e721cd46588cc4abd326e6cb78472ebc93a32 | [
"BSD-3-Clause"
] | null | null | null | io_core/io_core_magma.py | makaimann/garnet | 5a5e721cd46588cc4abd326e6cb78472ebc93a32 | [
"BSD-3-Clause"
] | null | null | null | import magma
from gemstone.common.core import Core, PnRTag
class IOCore(Core):
def __init__(self):
super().__init__()
self.add_ports(
glb2io_16=magma.In(magma.Bits[16]),
glb2io_1=magma.In(magma.Bits[1]),
io2glb_16=magma.Out(magma.Bits[16]),
io2glb_1=magma.Out(magma.Bits[1]),
f2io_16=magma.In(magma.Bits[16]),
f2io_1=magma.In(magma.Bits[1]),
io2f_16=magma.Out(magma.Bits[16]),
io2f_1=magma.Out(magma.Bits[1]),
)
self.wire(self.ports.glb2io_16, self.ports.io2f_16)
self.wire(self.ports.glb2io_1, self.ports.io2f_1)
self.wire(self.ports.f2io_16, self.ports.io2glb_16)
self.wire(self.ports.f2io_1, self.ports.io2glb_1)
def inputs(self):
return [self.ports.glb2io_16, self.ports.glb2io_1,
self.ports.f2io_16, self.ports.f2io_1]
def outputs(self):
return [self.ports.io2glb_16, self.ports.io2glb_1,
self.ports.io2f_16, self.ports.io2f_1]
def name(self):
return "io_core"
def pnr_info(self):
return [PnRTag("I", 2, self.DEFAULT_PRIORITY),
PnRTag("i", 1, self.DEFAULT_PRIORITY)]
| 31.230769 | 59 | 0.611658 | 179 | 1,218 | 3.955307 | 0.201117 | 0.20339 | 0.09322 | 0.090395 | 0.548023 | 0.40678 | 0 | 0 | 0 | 0 | 0 | 0.080874 | 0.248768 | 1,218 | 38 | 60 | 32.052632 | 0.692896 | 0 | 0 | 0 | 0 | 0 | 0.007389 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.166667 | false | 0 | 0.066667 | 0.133333 | 0.4 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 2 |
a5cc895e623964fc6ed235bb51535094d98bf959 | 460 | py | Python | verisure/__init__.py | gablin/python-verisure | 1a8bb8703a1708e9c235dfa28e06d4fdc784c8dd | [
"MIT"
] | 131 | 2015-08-07T06:57:40.000Z | 2022-03-25T16:15:33.000Z | verisure/__init__.py | gablin/python-verisure | 1a8bb8703a1708e9c235dfa28e06d4fdc784c8dd | [
"MIT"
] | 95 | 2015-09-08T10:15:00.000Z | 2022-02-19T01:28:52.000Z | verisure/__init__.py | gablin/python-verisure | 1a8bb8703a1708e9c235dfa28e06d4fdc784c8dd | [
"MIT"
] | 60 | 2015-12-16T20:08:53.000Z | 2021-09-30T19:07:33.000Z | """
A python module for reading and changing status of verisure devices through
verisure app API.
"""
__all__ = [
'Error',
'LoginError',
'ResponseError',
'Session'
]
from .session import ( # NOQA
Error,
LoginError,
ResponseError,
Session
)
ALARM_ARMED_HOME = 'ARMED_HOME'
ALARM_ARMED_AWAY = 'ARMED_AWAY'
ALARM_DISARMED = 'DISARMED'
LOCK_LOCKED = 'LOCKED'
LOCK_UNLOCKED = 'UNLOCKED'
SMARTPLUG_ON = 'on'
SMARTPLUG_OFF = 'off'
| 16.428571 | 75 | 0.691304 | 53 | 460 | 5.716981 | 0.622642 | 0.09901 | 0.184818 | 0.231023 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.202174 | 460 | 27 | 76 | 17.037037 | 0.825613 | 0.215217 | 0 | 0 | 0 | 0 | 0.232295 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.052632 | 0 | 0.052632 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
a5cddb03cd3808810d826a69bb361c33a78d70ea | 2,719 | py | Python | setup.py | tonyjo/ubc_primitives | bc94a403f176fe28db2a9ac9d1a48cb9db021f90 | [
"Apache-2.0"
] | null | null | null | setup.py | tonyjo/ubc_primitives | bc94a403f176fe28db2a9ac9d1a48cb9db021f90 | [
"Apache-2.0"
] | 4 | 2020-07-19T00:45:29.000Z | 2020-12-10T18:25:41.000Z | setup.py | tonyjo/ubc_primitives | bc94a403f176fe28db2a9ac9d1a48cb9db021f90 | [
"Apache-2.0"
] | 1 | 2021-04-30T18:13:49.000Z | 2021-04-30T18:13:49.000Z | import subprocess
from setuptools import setup, find_packages
# Run
# subprocess.run(["apt", "update"])
# subprocess.run(["apt", "install", "python3.6-gdbm"])
# Get install requirements
with open('requirements.txt', 'r') as f:
install_requires = list()
dependency_links = list()
for line in f:
re = line.strip()
if re:
install_requires.append(re)
setup(name='ubc_primitives',
version='0.2.0',
description='Setup primitive build model paths',
author='UBC',
url='https://github.com/plai-group/ubc_primitives.git',
maintainer_email='tonyjos@cs.ubc.ca',
maintainer='Tony Joseph',
license='Apache-2.0',
packages=find_packages(exclude=['pipelines', 'ta2-eval']),
zip_safe=False,
python_requires='>=3.6',
install_requires=install_requires,
keywords='d3m_primitive',
entry_points={
'd3m.primitives': [
'feature_extraction.boc.UBC=primitives_ubc.boc:BagOfCharacters',
'feature_extraction.bow.UBC=primitives_ubc.bow:BagOfWords',
'feature_extraction.convolutional_neural_network.UBC=primitives_ubc.cnn:ConvolutionalNeuralNetwork',
'feature_extraction.googlenet_cnn.UBC=primitives_ubc.googlenet:GoogleNetCNN',
'feature_extraction.mobilenet_cnn.UBC=primitives_ubc.mobilenet:MobileNetCNN',
'feature_extraction.resnet_cnn.UBC=primitives_ubc.resnet:ResNetCNN',
'feature_extraction.vggnet_cnn.UBC=primitives_ubc.vgg:VGG16CNN',
'classification.canonical_correlation_forests.UBC=primitives_ubc.clfyCCFS:CanonicalCorrelationForestsClassifierPrimitive',
'regression.canonical_correlation_forests.UBC=primitives_ubc.regCCFS:CanonicalCorrelationForestsRegressionPrimitive',
'classification.multilayer_perceptron.UBC=primitives_ubc.clfyMLP:MultilayerPerceptronClassifierPrimitive',
'regression.multilayer_perceptron.UBC=primitives_ubc.regMLP:MultilayerPerceptronRegressionPrimitive',
'clustering.kmeans_clustering.UBC=primitives_ubc.kmeans:KMeansClusteringPrimitive',
'dimensionality_reduction.principal_component_analysis.UBC=primitives_ubc.pca:PrincipalComponentAnalysisPrimitive',
'classification.simple_cnaps.UBC=primitives_ubc.simpleCNAPS:SimpleCNAPSClassifierPrimitive',
'regression.linear_regression.UBC=primitives_ubc.linearRegression:LinearRegressionPrimitive',
'classification.logistic_regression.UBC=primitives_ubc.logisticRegression:LogisticRegressionPrimitive',
'operator.diagonal_mvn.UBC=primitives_ubc.diagonalMVN:DiagonalMVNPrimitive',
],
})
| 53.313725 | 136 | 0.72637 | 258 | 2,719 | 7.430233 | 0.51938 | 0.128847 | 0.141888 | 0.039645 | 0.08242 | 0.044862 | 0 | 0 | 0 | 0 | 0 | 0.006217 | 0.171754 | 2,719 | 50 | 137 | 54.38 | 0.845027 | 0.042295 | 0 | 0 | 0 | 0 | 0.643709 | 0.564063 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.046512 | 0 | 0.046512 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
a5d3b2497e1468671423984587561cac679ee1d4 | 336 | py | Python | exe020a.py | Alexmachado81/ExerciciosPython_Resolvidos | 2774ba742788eb7b545f3f85e9438deb68a983d4 | [
"MIT"
] | null | null | null | exe020a.py | Alexmachado81/ExerciciosPython_Resolvidos | 2774ba742788eb7b545f3f85e9438deb68a983d4 | [
"MIT"
] | null | null | null | exe020a.py | Alexmachado81/ExerciciosPython_Resolvidos | 2774ba742788eb7b545f3f85e9438deb68a983d4 | [
"MIT"
] | null | null | null | import random
nome1 = str(input('Informe o primeiro nome :\n'))
nome2 = str(input('Informe o segundo nome :\n'))
nome3 = str(input('Informe o terceiro nome :\n'))
nome4 = str(input('Informe o quarto nome :\n'))
lista = [nome1,nome2,nome3,nome4]
escolhido = random.shuffle(lista)
print(' A ordem de apresentação será :')
print(lista) | 25.846154 | 49 | 0.702381 | 51 | 336 | 4.627451 | 0.490196 | 0.135593 | 0.254237 | 0.271186 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.027682 | 0.139881 | 336 | 13 | 50 | 25.846154 | 0.788927 | 0 | 0 | 0 | 0 | 0 | 0.403561 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.111111 | 0 | 0.111111 | 0.222222 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
a5da567cb78f76a2d6801e56135f4a494090e6a0 | 309 | py | Python | Backend_folder/models/socials.py | Miguel22247/MatchGame | 7099b117820c2913201c1c29c77864e10d886fcb | [
"MIT"
] | null | null | null | Backend_folder/models/socials.py | Miguel22247/MatchGame | 7099b117820c2913201c1c29c77864e10d886fcb | [
"MIT"
] | 1 | 2021-11-04T17:53:58.000Z | 2021-11-04T17:53:58.000Z | Backend_folder/models/socials.py | Miguel22247/MatchGame | 7099b117820c2913201c1c29c77864e10d886fcb | [
"MIT"
] | null | null | null | #!/usr/bin/python3.6
"""Script to create an instance of the class Social"""
from sqlalchemy import Column, String
from models.base_model import Base, BaseModel
class Social(BaseModel, Base):
"""Class to store the social data"""
__tablename__ = "social"
name = Column(String(20), nullable=False)
| 28.090909 | 54 | 0.724919 | 43 | 309 | 5.093023 | 0.674419 | 0.100457 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.015444 | 0.161812 | 309 | 10 | 55 | 30.9 | 0.830116 | 0.320388 | 0 | 0 | 0 | 0 | 0.030151 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.4 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
a5dd99acebda99627c287e7bd503fb215318ade8 | 2,452 | py | Python | tests.py | kb1lqc/pytun | a1e1f86a5e2b5ed256e3b87dcdd4f6aedc6cde6d | [
"MIT"
] | 13 | 2015-04-16T04:17:56.000Z | 2019-04-18T06:50:08.000Z | tests.py | kb1lqc/pytun | a1e1f86a5e2b5ed256e3b87dcdd4f6aedc6cde6d | [
"MIT"
] | 3 | 2017-06-08T13:34:14.000Z | 2017-12-18T09:55:50.000Z | tests.py | kb1lqc/pytun | a1e1f86a5e2b5ed256e3b87dcdd4f6aedc6cde6d | [
"MIT"
] | 9 | 2015-12-30T19:22:00.000Z | 2019-05-16T14:43:15.000Z | import pytun
import logging
import select
def pprint_buf(buf):
""" Dirty & convenient function to display the hexademical
repr. of a buffer.
"""
DEFAULT_SIZE = 4
def hex2(i, l = None):
l = l if l is not None else DEFAULT_SIZE
h = hex(i).upper()[2:]
if len(h) != l:
h = "0" * (l - len(h)) + h
return h
def displayable_char(c):
if ord(c) < 0x20 or ord(c) >= 0x7f:
c = "."
return c
print " " * DEFAULT_SIZE,
for i in range(16): print hex2(i, 2),
print
raws = []
for i, c in enumerate(buf):
if i % 16 == 0:
if i:
print "\t" + "".join(raws)
raws = []
print hex2(i),
raws.append(displayable_char(c))
print hex2(ord(c), 2),
print " " * (15 - (i % 16)) + "\t" + "".join(raws)
def main():
# Configure pytun's logger
pytun.logger.setLevel(logging.DEBUG)
logging.basicConfig()
# Open the tunnel
try:
tun = pytun.open()
except pytun.Tunnel.NotPermitted:
print
print "*" * 80
print "You don't have the rights to access the file %s." % (pytun.TUN_KO_PATH, )
print "Give the access of this file to pytun, or if you trust me,"
print "elevate this current script to root level."
print "*" * 80
print
raise
print "*" * 80
print
print "OK. The tunnel '%s' had been created." % (tun.name, )
print
print "If you want to play with it, first configure it."
print
print "1. Set up the network and set an IP"
print " $ ifconfig %s 192.168.42.1" % (tun.name, )
print
print "2. Add the network route"
print " $ route add -net 192.168.42.0/24 dev %s" % (tun.name, )
print
print "Then, try to ping some IP in this network ..."
print " $ ping 192.168.42.42"
print
print "Or do some UDP netcat magic."
print " $ nc 192.168.42.42 4242 -u"
print
print "Enjoy !"
print
print "*" * 80
try:
# Receive loop
while True:
buf = tun.recv()
pytun.logger.info("Packet received !")
pprint_buf(buf)
print
except KeyboardInterrupt:
print "Keyboard interrupt. Closing."
finally:
# Close the tunnel
tun.close()
if __name__ == "__main__":
main()
| 22.703704 | 88 | 0.521207 | 328 | 2,452 | 3.844512 | 0.417683 | 0.071372 | 0.025377 | 0.040444 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.049201 | 0.361746 | 2,452 | 107 | 89 | 22.915888 | 0.75655 | 0.028548 | 0 | 0.266667 | 0 | 0 | 0.247919 | 0 | 0 | 0 | 0.003504 | 0 | 0 | 0 | null | null | 0 | 0.04 | null | null | 0.52 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 2 |
a5ff806280c1efe3b38d7be9fefa28dbfa3378e4 | 3,571 | py | Python | pkg/codegen/internal/test/testdata/simple-resource-schema/python/pulumi_example/resource.py | CDMiXer/Woolloomooloo | 62272b869dbc0190fd20540607b33f3edeba9dce | [
"Apache-2.0",
"MIT"
] | null | null | null | pkg/codegen/internal/test/testdata/simple-resource-schema/python/pulumi_example/resource.py | CDMiXer/Woolloomooloo | 62272b869dbc0190fd20540607b33f3edeba9dce | [
"Apache-2.0",
"MIT"
] | null | null | null | pkg/codegen/internal/test/testdata/simple-resource-schema/python/pulumi_example/resource.py | CDMiXer/Woolloomooloo | 62272b869dbc0190fd20540607b33f3edeba9dce | [
"Apache-2.0",
"MIT"
] | null | null | null | # coding=utf-8
# *** WARNING: this file was generated by test. ***
# *** Do not edit by hand unless you're certain you know what you are doing! ***
import warnings
import pulumi/* Release of eeacms/forests-frontend:1.6.2 */
import pulumi.runtime
from typing import Any, Mapping, Optional, Sequence, Union/* Released DirectiveRecord v0.1.3 */
from . import _utilities, _tables
/* Merge "Release 4.0.10.001 QCACLD WLAN Driver" */
__all__ = ['Resource'] //things and stuffs
class Resource(pulumi.CustomResource):
def __init__(__self__,
resource_name: str,/* Release 1.0.1 with new script. */
opts: Optional[pulumi.ResourceOptions] = None,/* Added v.0.3 changes */
bar: Optional[pulumi.Input[str]] = None,
__props__=None,
__name__=None,
__opts__=None): //Merge "Fixes ODL OVS to add certs to every node"
"""
Create a Resource resource with the given unique name, props, and options.
:param str resource_name: The name of the resource.
:param pulumi.ResourceOptions opts: Options for the resource.
"""
if __name__ is not None:
warnings.warn("explicit use of __name__ is deprecated", DeprecationWarning)
resource_name = __name__
if __opts__ is not None:
warnings.warn("explicit use of __opts__ is deprecated, use 'opts' instead", DeprecationWarning) //Add test for `look` at room.
opts = __opts__
if opts is None:
opts = pulumi.ResourceOptions()
if not isinstance(opts, pulumi.ResourceOptions): // testing month
raise TypeError('Expected resource options to be a ResourceOptions instance')
if opts.version is None:
opts.version = _utilities.get_version() //Change reference to LEDE to Openwrt
if opts.id is None:
if __props__ is not None:
raise TypeError('__props__ is only valid when passed in combination with a valid opts.id to get an existing resource')
__props__ = dict()
/* Release 33.4.2 */
__props__['bar'] = bar/* Added Goals for Release 3 */
super(Resource, __self__).__init__(
'example::Resource',
resource_name,
__props__,
opts)
@staticmethod
def get(resource_name: str, // TODO: hacked by timnugent@gmail.com
id: pulumi.Input[str],
opts: Optional[pulumi.ResourceOptions] = None) -> 'Resource':
"""
Get an existing Resource resource's state with the given name, id, and optional extra
properties used to qualify the lookup.
/* Add namespace test */
:param str resource_name: The unique name of the resulting resource.
:param pulumi.Input[str] id: The unique provider ID of the resource to lookup.
:param pulumi.ResourceOptions opts: Options for the resource.
"""
opts = pulumi.ResourceOptions.merge(opts, pulumi.ResourceOptions(id=id))
__props__ = dict()
return Resource(resource_name, opts=opts, __props__=__props__)
// TODO: legends FTW!
@property/* Moved reading of Neurolucida xml into Forest constructor */
@pulumi.getter
def bar(self) -> pulumi.Output[Optional[str]]:
return pulumi.get(self, "bar")
def translate_output_property(self, prop):
return _tables.CAMEL_TO_SNAKE_CASE_TABLE.get(prop) or prop
def translate_input_property(self, prop):
return _tables.SNAKE_TO_CAMEL_CASE_TABLE.get(prop) or prop
| 44.6375 | 139 | 0.647158 | 444 | 3,571 | 4.95045 | 0.382883 | 0.076433 | 0.045496 | 0.030027 | 0.177434 | 0.097361 | 0.077343 | 0.077343 | 0 | 0 | 0 | 0.009112 | 0.262391 | 3,571 | 79 | 140 | 45.202532 | 0.825361 | 0 | 0 | 0.037037 | 1 | 0 | 0.132998 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0.018519 | 0.092593 | null | null | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
57082f7aae1ae00a166171b7671cc4794748f81d | 3,185 | py | Python | fmspy/plugins/echo_application.py | smira/fmspy | 85260f4ebe8ccb17b0c755f8631f15af848b1707 | [
"MIT"
] | 11 | 2015-01-06T09:43:26.000Z | 2022-02-02T14:30:42.000Z | fmspy/plugins/echo_application.py | smira/fmspy | 85260f4ebe8ccb17b0c755f8631f15af848b1707 | [
"MIT"
] | null | null | null | fmspy/plugins/echo_application.py | smira/fmspy | 85260f4ebe8ccb17b0c755f8631f15af848b1707 | [
"MIT"
] | 3 | 2015-07-13T03:18:21.000Z | 2020-07-14T07:06:26.000Z | # FMSPy - Copyright (c) 2009 Andrey Smirnov.
#
# See COPYRIGHT for details.
"""
Example echo application.
"""
from zope.interface import implements
from twisted.plugin import IPlugin
from twisted.python import log
from fmspy.application import Application
class EchoApplication(Application):
"""
Example application: echo.
Echo application sends back what it receives.
"""
implements(IPlugin)
def invoke_echo(self, protocol, value):
"""
Handler for C{echo(value)}.
Return the same value that was passed in.
"""
return value
def appConnect(self, protocol, path):
"""
Client is connecting to application.
Hook for custom application, may be deferred.
If application wants to refuse client from connecting,
it should raise some error.
@param protocol: client protocol
@type protocol: L{RTMPServerProtocol}
@param path: extra connect path
@type path: C{list}
"""
log.msg("appConnect(%r, %r)" % (protocol, path))
def appCreateRoom(self, protocol, room_name, path):
"""
Room is about to be created for new client.
Hook for custom application, may be deferred.
If application wants to refuse client from creating this room,
it should raise some error. This method isn't called
for root room (L{hall}), root room is created implicitly
for every application.
@param protocol: client protocol
@type protocol: L{RTMPServerProtocol}
@param room_name: room name
@type room_name: C{str}
@param path: extra connect path
@type path: C{list}
"""
log.msg("appCreateRoom(%r, %r, %r)" % (protocol, room_name, path))
def appEnterRoom(self, protocol, room, path):
"""
Client is about to enter room.
Hook for custom application, may be deferred.
If application wants to refuse client from entering this room,
it should raise some error.
@param protocol: client protocol
@type protocol: L{RTMPServerProtocol}
@param room: room
@type room: L{Room}
@param path: extra connect path
@type path: C{list}
"""
log.msg("appEnterRoom(%r, %r, %r)" % (protocol, room, path))
def appLeaveRoom(self, protocol, room):
"""
Client is leaving room.
Hook for custom application, should return
immediately. No exceptions should be raised
in this method.
@param protocol: client protocol
@type protocol: L{RTMPServerProtocol}
@param room: room
@type room: L{Room}
"""
log.msg("appLeaveRoom(%r, %r)" % (protocol, room))
def appDestroyRoom(self, room):
"""
Room is about to be destroyed (it became empty).
Hook for custom application, should return
immediately. No exceptions should be raised
in this method.
@param room: room
@type room: L{Room}
"""
log.msg("appDestroyRoom(%r)" % (room))
app = EchoApplication()
| 27.938596 | 74 | 0.608477 | 371 | 3,185 | 5.210243 | 0.269542 | 0.006208 | 0.033626 | 0.06208 | 0.518365 | 0.483187 | 0.483187 | 0.463528 | 0.463528 | 0.446456 | 0 | 0.001803 | 0.303611 | 3,185 | 113 | 75 | 28.185841 | 0.869702 | 0.553218 | 0 | 0 | 0 | 0 | 0.115132 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.315789 | false | 0 | 0.210526 | 0 | 0.631579 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
570c5210ebf537220e890b2cfee7f6a520fb94a4 | 503 | py | Python | Python/finance/freebet2/1.py | Fornost461/drafts | 39f56fb16ebf206077e5f8617741aa93623195af | [
"CC0-1.0"
] | null | null | null | Python/finance/freebet2/1.py | Fornost461/drafts | 39f56fb16ebf206077e5f8617741aa93623195af | [
"CC0-1.0"
] | null | null | null | Python/finance/freebet2/1.py | Fornost461/drafts | 39f56fb16ebf206077e5f8617741aa93623195af | [
"CC0-1.0"
] | null | null | null | #!/usr/bin/env python3
def f(*cs):
'''
args : cotes, ou liste de cotes
output : probabilités, fraction de marge
'''
if len(cs)==1:
cs=cs[0]
ks=[1/c for c in cs]
t=sum(ks)
return [k/t for k in ks], 1-1/t
def g(m1,m2,c2):
return 100*(-m1+(1-m2)*(1-1/c2))
def h(m1,m2):
# retourne le c2 minimal.
return 1/(1 - m1/(1-m2))
#c2 > 1/(1 - m1/(1-m2))
#print(f(16,1.01))
#print(h(0.05,0.05))
_, m1 = f(24,11.5,1.13)
print(h(m1,0.05))
print(g(m1,0.05,1.6))
| 17.964286 | 44 | 0.524851 | 108 | 503 | 2.435185 | 0.425926 | 0.030418 | 0.057034 | 0.038023 | 0.053232 | 0 | 0 | 0 | 0 | 0 | 0 | 0.16188 | 0.238569 | 503 | 27 | 45 | 18.62963 | 0.524804 | 0.349901 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.230769 | false | 0 | 0 | 0.153846 | 0.461538 | 0.153846 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 2 |
5710223a49910f77606f31df5d841c6eddfa2b07 | 523 | py | Python | store/migrations/0004_auto_20220322_0514.py | garcia116/ecommerce-django | 6c416b20446f0daba5774040715313ae28501cf9 | [
"PostgreSQL"
] | null | null | null | store/migrations/0004_auto_20220322_0514.py | garcia116/ecommerce-django | 6c416b20446f0daba5774040715313ae28501cf9 | [
"PostgreSQL"
] | null | null | null | store/migrations/0004_auto_20220322_0514.py | garcia116/ecommerce-django | 6c416b20446f0daba5774040715313ae28501cf9 | [
"PostgreSQL"
] | null | null | null | # Generated by Django 3.1 on 2022-03-22 05:14
from django.db import migrations
class Migration(migrations.Migration):
dependencies = [
('store', '0003_reviewrating'),
]
operations = [
migrations.RenameField(
model_name='reviewrating',
old_name='created_date',
new_name='created_at',
),
migrations.RenameField(
model_name='reviewrating',
old_name='updated_date',
new_name='updated_at',
),
]
| 21.791667 | 45 | 0.573614 | 51 | 523 | 5.666667 | 0.607843 | 0.145329 | 0.179931 | 0.207612 | 0.3391 | 0.3391 | 0.3391 | 0 | 0 | 0 | 0 | 0.050562 | 0.319312 | 523 | 23 | 46 | 22.73913 | 0.761236 | 0.082218 | 0 | 0.352941 | 1 | 0 | 0.188285 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.058824 | 0 | 0.235294 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
57289bddaf406ef3229516e7183203bc7dd67bf3 | 366 | py | Python | Conditional Statements/If..elif..else.py | Adi-19/Python | 734b5c4c1008233f93a18a500dd47d03583c52be | [
"MIT"
] | null | null | null | Conditional Statements/If..elif..else.py | Adi-19/Python | 734b5c4c1008233f93a18a500dd47d03583c52be | [
"MIT"
] | null | null | null | Conditional Statements/If..elif..else.py | Adi-19/Python | 734b5c4c1008233f93a18a500dd47d03583c52be | [
"MIT"
] | 1 | 2020-10-07T08:51:00.000Z | 2020-10-07T08:51:00.000Z | # WAP to show the use of if..elif..else
season= input("Enter season : ")
print(season)
if season == 'spring':
print('plant the garden!')
elif season == 'summer':
print('water the garden!')
elif season == 'fall':
print('harvest the garden!')
elif season == 'winter':
print('stay indoors!')
else:
print('unrecognized season')
| 22.875 | 40 | 0.606557 | 46 | 366 | 4.826087 | 0.521739 | 0.121622 | 0.175676 | 0.256757 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.234973 | 366 | 15 | 41 | 24.4 | 0.792857 | 0.101093 | 0 | 0 | 0 | 0 | 0.391026 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.5 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 2 |
57338a1d0f138d3983135c5bb7fd73623ec2deaf | 2,956 | py | Python | pysnmp/HH3C-L2TP-MIB.py | agustinhenze/mibs.snmplabs.com | 1fc5c07860542b89212f4c8ab807057d9a9206c7 | [
"Apache-2.0"
] | 11 | 2021-02-02T16:27:16.000Z | 2021-08-31T06:22:49.000Z | pysnmp/HH3C-L2TP-MIB.py | agustinhenze/mibs.snmplabs.com | 1fc5c07860542b89212f4c8ab807057d9a9206c7 | [
"Apache-2.0"
] | 75 | 2021-02-24T17:30:31.000Z | 2021-12-08T00:01:18.000Z | pysnmp/HH3C-L2TP-MIB.py | agustinhenze/mibs.snmplabs.com | 1fc5c07860542b89212f4c8ab807057d9a9206c7 | [
"Apache-2.0"
] | 10 | 2019-04-30T05:51:36.000Z | 2022-02-16T03:33:41.000Z | #
# PySNMP MIB module HH3C-L2TP-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/HH3C-L2TP-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 19:14:47 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
Integer, OctetString, ObjectIdentifier = mibBuilder.importSymbols("ASN1", "Integer", "OctetString", "ObjectIdentifier")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ConstraintsIntersection, ValueRangeConstraint, ConstraintsUnion, SingleValueConstraint, ValueSizeConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ConstraintsIntersection", "ValueRangeConstraint", "ConstraintsUnion", "SingleValueConstraint", "ValueSizeConstraint")
hh3cCommon, = mibBuilder.importSymbols("HH3C-OID-MIB", "hh3cCommon")
ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup")
Counter32, Unsigned32, MibScalar, MibTable, MibTableRow, MibTableColumn, Bits, TimeTicks, Counter64, NotificationType, ObjectIdentity, Gauge32, MibIdentifier, iso, Integer32, ModuleIdentity, IpAddress = mibBuilder.importSymbols("SNMPv2-SMI", "Counter32", "Unsigned32", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Bits", "TimeTicks", "Counter64", "NotificationType", "ObjectIdentity", "Gauge32", "MibIdentifier", "iso", "Integer32", "ModuleIdentity", "IpAddress")
DisplayString, TextualConvention = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "TextualConvention")
hh3cL2tp = ModuleIdentity((1, 3, 6, 1, 4, 1, 25506, 2, 139))
hh3cL2tp.setRevisions(('2013-07-05 15:18',))
if mibBuilder.loadTexts: hh3cL2tp.setLastUpdated('201307051518Z')
if mibBuilder.loadTexts: hh3cL2tp.setOrganization('Hangzhou H3C Tech. Co., Ltd.')
hh3cL2tpObjects = MibIdentifier((1, 3, 6, 1, 4, 1, 25506, 2, 139, 1))
hh3cL2tpScalar = MibIdentifier((1, 3, 6, 1, 4, 1, 25506, 2, 139, 1, 1))
hh3cL2tpStats = MibIdentifier((1, 3, 6, 1, 4, 1, 25506, 2, 139, 1, 1, 1))
hh3cL2tpStatsTotalTunnels = MibScalar((1, 3, 6, 1, 4, 1, 25506, 2, 139, 1, 1, 1, 1), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hh3cL2tpStatsTotalTunnels.setStatus('current')
hh3cL2tpStatsTotalSessions = MibScalar((1, 3, 6, 1, 4, 1, 25506, 2, 139, 1, 1, 1, 2), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hh3cL2tpStatsTotalSessions.setStatus('current')
hh3cL2tpSessionRate = MibScalar((1, 3, 6, 1, 4, 1, 25506, 2, 139, 1, 1, 1, 3), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hh3cL2tpSessionRate.setStatus('current')
mibBuilder.exportSymbols("HH3C-L2TP-MIB", PYSNMP_MODULE_ID=hh3cL2tp, hh3cL2tpObjects=hh3cL2tpObjects, hh3cL2tpStatsTotalTunnels=hh3cL2tpStatsTotalTunnels, hh3cL2tpScalar=hh3cL2tpScalar, hh3cL2tpStatsTotalSessions=hh3cL2tpStatsTotalSessions, hh3cL2tp=hh3cL2tp, hh3cL2tpSessionRate=hh3cL2tpSessionRate, hh3cL2tpStats=hh3cL2tpStats)
| 101.931034 | 477 | 0.773681 | 323 | 2,956 | 7.074303 | 0.374613 | 0.008753 | 0.00919 | 0.012254 | 0.376805 | 0.27221 | 0.228446 | 0.228446 | 0.228446 | 0.221882 | 0 | 0.106352 | 0.083897 | 2,956 | 28 | 478 | 105.571429 | 0.737445 | 0.108254 | 0 | 0 | 0 | 0 | 0.219642 | 0.016749 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 0.333333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
5734faac25ab2dfbdf1f40f145f640511611b8fa | 369 | py | Python | exercises_cv/mundo01/exCV018.py | alcantaralbeatriz/studying_py_repository | aaaea62b0285b8c0f97088a87b5825b6435dcda9 | [
"MIT"
] | null | null | null | exercises_cv/mundo01/exCV018.py | alcantaralbeatriz/studying_py_repository | aaaea62b0285b8c0f97088a87b5825b6435dcda9 | [
"MIT"
] | null | null | null | exercises_cv/mundo01/exCV018.py | alcantaralbeatriz/studying_py_repository | aaaea62b0285b8c0f97088a87b5825b6435dcda9 | [
"MIT"
] | null | null | null | #18. Faça um programa que leia um ângulo qualquer e mostre o valor de seno, cosseno, e tangente.
import math
def Main018():
angulo = float(input('Qual o ângulo: '))
print(f'O seno é {math.sin(math.radians(angulo)):.2f}')
print(f'O cosseno é {math.cos(math.radians(angulo)):.2f}')
print(f'A tangente é {math.tan(math.radians(angulo)):.1f}')
Main018() | 30.75 | 96 | 0.674797 | 62 | 369 | 4.016129 | 0.548387 | 0.072289 | 0.204819 | 0.15261 | 0.200803 | 0.200803 | 0 | 0 | 0 | 0 | 0 | 0.035599 | 0.162602 | 369 | 12 | 97 | 30.75 | 0.770227 | 0.257453 | 0 | 0 | 0 | 0 | 0.572993 | 0.394161 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0 | 0.142857 | 0 | 0.285714 | 0.428571 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 2 |
57350b4e6ea97b5b8a006f1a143e311b3cb0b51e | 255 | py | Python | stimuli/Python/one_file_per_item/jap/52_# math_if 16.py | ALFA-group/neural_program_comprehension | 0253911f376cf282af5a5627e38e0a591ad38860 | [
"MIT"
] | 6 | 2020-04-24T08:16:51.000Z | 2021-11-01T09:50:46.000Z | stimuli/Python/one_file_per_item/jap/52_# math_if 16.py | ALFA-group/neural_program_comprehension | 0253911f376cf282af5a5627e38e0a591ad38860 | [
"MIT"
] | null | null | null | stimuli/Python/one_file_per_item/jap/52_# math_if 16.py | ALFA-group/neural_program_comprehension | 0253911f376cf282af5a5627e38e0a591ad38860 | [
"MIT"
] | 4 | 2021-02-17T20:21:31.000Z | 2022-02-14T12:43:23.000Z | kuukiondo = 70
shitsudo = 100
if kuukiondo >= 100:
print("A")
elif kuukiondo >= 92 and shitsudo > 75:
print("B")
elif kuukiondo > 88 and shitsudo >= 85:
print("C")
elif kuukiondo == 75 and shitsudo <= 65:
print("D")
else:
print("E")
| 17 | 40 | 0.603922 | 36 | 255 | 4.277778 | 0.527778 | 0.253247 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.103627 | 0.243137 | 255 | 14 | 41 | 18.214286 | 0.694301 | 0 | 0 | 0 | 0 | 0 | 0.019685 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.416667 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 2 |
57477f75e7a4ad922c5b2418bbd3be77a59a92a7 | 161 | py | Python | Eggbort/launcher.py | rdk750/eggbort | 3090dd04324f4f971204e71a7d1c1f47e6cf17c9 | [
"MIT"
] | 8 | 2020-07-04T01:28:54.000Z | 2021-01-06T07:47:33.000Z | Eggbort/launcher.py | rdk750/eggbort | 3090dd04324f4f971204e71a7d1c1f47e6cf17c9 | [
"MIT"
] | null | null | null | Eggbort/launcher.py | rdk750/eggbort | 3090dd04324f4f971204e71a7d1c1f47e6cf17c9 | [
"MIT"
] | null | null | null | from eggbort import Eggbort
def run_bot():
bot = Eggbort()
bot.run()
def main():
'''Launches Eggbort'''
run_bot()
if __name__ == '__main__':
main()
| 12.384615 | 27 | 0.627329 | 21 | 161 | 4.333333 | 0.47619 | 0.131868 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.204969 | 161 | 12 | 28 | 13.416667 | 0.710938 | 0.099379 | 0 | 0 | 0 | 0 | 0.057554 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0.125 | 0 | 0.375 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
938f6bc27b08e733f363fdc154a481abe3f64a20 | 1,238 | py | Python | model.py | ResByte/torchdet | 3bedeba2d380c61494e38ad7684ff132dcdc9988 | [
"Apache-2.0"
] | 1 | 2020-07-21T07:54:44.000Z | 2020-07-21T07:54:44.000Z | model.py | ResByte/torchdet | 3bedeba2d380c61494e38ad7684ff132dcdc9988 | [
"Apache-2.0"
] | null | null | null | model.py | ResByte/torchdet | 3bedeba2d380c61494e38ad7684ff132dcdc9988 | [
"Apache-2.0"
] | null | null | null | import torchvision
from torchvision.models.detection.faster_rcnn import FastRCNNPredictor
from torchvision.models.detection import FasterRCNN
from torchvision.models.detection.backbone_utils import resnet_fpn_backbone
# from : https://github.com/pytorch/vision/blob/master/torchvision/models/detection/faster_rcnn.py#L291
def create_model(num_classes=2):
"""Creates default resnet50 model with weights pretrained on MSCOCO dataset"""
model = torchvision.models.detection.fasterrcnn_resnet50_fpn(pretrained=True)
# replace the classifier with a new one, that has
# num_classes which is user-defined
# 2 class: (person) + background
# get number of input features for the classifier
in_features = model.roi_heads.box_predictor.cls_score.in_features
# replace the pre-trained head with a new one
model.roi_heads.box_predictor = FastRCNNPredictor(in_features, num_classes)
return model
def create_model_with_backbone(arch='resnet101', pretrained=True, num_classes=2):
"""creates model with backbone of specified arch and weights pretrained on imagenet"""
backbone = resnet_fpn_backbone(arch, pretrained=pretrained)
model = FasterRCNN(backbone, num_classes=num_classes)
return model
| 49.52 | 104 | 0.792407 | 165 | 1,238 | 5.781818 | 0.454545 | 0.062893 | 0.136268 | 0.09434 | 0.127883 | 0 | 0 | 0 | 0 | 0 | 0 | 0.012138 | 0.134895 | 1,238 | 24 | 105 | 51.583333 | 0.878618 | 0.372375 | 0 | 0.153846 | 0 | 0 | 0.011842 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.153846 | false | 0 | 0.307692 | 0 | 0.615385 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
93a085c174335c7b0482961c3529ae52e27e3976 | 2,806 | py | Python | primers.py | mariasmfportela/candidate_primer_checker | 8e08d00cc4fadd1d5230468d22c86ab0cb118076 | [
"MIT"
] | 1 | 2021-03-17T09:02:11.000Z | 2021-03-17T09:02:11.000Z | primers.py | mariasmfportela/candidate_primer_finder | 8e08d00cc4fadd1d5230468d22c86ab0cb118076 | [
"MIT"
] | null | null | null | primers.py | mariasmfportela/candidate_primer_finder | 8e08d00cc4fadd1d5230468d22c86ab0cb118076 | [
"MIT"
] | null | null | null | # Basic script to find primer candidates
# Hits are 20bp in length, with 50-55% GC content, GC clamps in the 3' end, and no more than 3xGC at the clamp
# Paste the target exon sequences from a FASTA sequence with no white spaces
# Exon 1 is where forward primer candidates will be identified
exon1 = "GCAGTGTCACTAGGCCGGCTGGGGGCCCTGGGTACGCTGTAGACCAGACCGCGACAGGCCAGAACACGGGCGGCGGCTTCGGGCCGGGAGACCCGCGCAGCCCTCGGGGCATCTCAGTGCCTCACTCCCCACCCCCTCCCCCGGGTCGGGGGAGGCGGCGCGTCCGGCGGAGGGTTGAGGGGAGCGGGGCAGGCCTGGAGCGCCATGAGCAGCCCGGATGCGGGATACGCCAGTGACGACCAGAGCCAGACCCAGAGCGCGCTGCCCGCGGTGATGGCCGGGCTGGGCCCCTGCCCCTGGGCCGAGTCGCTGAGCCCCATCGGGGACATGAAGGTGAAGGGCGAGGCGCCGGCGAACAGCGGAGCACCGGCCGGGGCCGCGGGCCGAGCCAAGGGCGAGTCCCGTATCCGGCGGCCGATGAACGCTTTCATGGTGTGGGCTAAGGACGAGCGCAAGCGGCTGGCGCAGCAGAATCCAGACCTGCACAACGCCGAGTTGAGCAAGATGCTGG"
# Exon 2 is where reverse primer candidates will be identified
exon2 = "GCAAGTCGTGGAAGGCGCTGACGCTGGCGGAGAAGCGGCCCTTCGTGGAGGAGGCAGAGCGGCTGCGCGTGCAGCACATGCAGGACCACCCCAACTACAAGTACCGGCCGCGGCGGCGCAAGCAGGTGAAGCGGCTGAAGCGGGTGGAGGGCGGCTTCCTGCACGGCCTGGCTGAGCCGCAGGCGGCCGCGCTGGGCCCCGAGGGCGGCCGCGTGGCCATGGACGGCCTGGGCCTCCAGTTCCCCGAGCAGGGCTTCCCCGCCGGCCCGCCGCTGCTGCCTCCGCACATGGGCGGCCACTACCGCGACTGCCAGAGTCTGGGCGCGCCTCCGCTCGACGGCTACCCGTTGCCCACGCCCGACACGTCCCCGCTGGACGGCGTGGACCCCGACCCGGCTTTCTTCGCCGCCCCGATGCCCGGGGACTGCCCGGCGGCCGGCACCTACAGCTACGCGCAGGTCTCGGACTACGCTGGCCCCCCGGAGCCTCCCGCCGGTCCCATGCACCCCCGACTCGGCCCAGAGCCCGCGGGTCCCTCGATTCCGGGCCTCCTGGCGCCACCCAGCGCCCTTCACGTGTACTACGGCGCGATGGGCTCGCCCGGGGCGGGCGGCGGGCGCGGCTTCCAGATGCAGCCGCAACACCAGCACCAGCACCAGCACCAGCACCACCCCCCGGGCCCCGGACAGCCGTCGCCCCCTCCGGAGGCACTGCCCTGCCGGGACGGCACGGACCCCAGTCAGCCCGCCGAGCTCCTCGGGGAGGTGGACCGCACGGAATTTGAACAGTATCTGCACTTC"
# Function that receives a gene string (only C, G, T or A characters) and outputs an array of primer hits
# Looks for a GC clamp reading from start to end of the string
def find_hit(gene) -> object:
hits = []
for i in range(len(gene) - 20):
if gene[i] == 'C' or gene[i] == 'G':
if gene[i + 1] == 'C' or gene[i + 1] == 'G':
if gene[i + 2] != 'C' and gene[i + 2] != 'G':
cg_count = 0
for base in gene[i:i + 20]:
if base == 'C' or base == 'G':
cg_count += 1
if cg_count == 10 or cg_count == 11:
hits.append(gene[i:i + 20])
return hits
# Reverse exon 1 as GC clamp should be at the end of the primer
exon1 = exon1[::-1]
hits_exon1 = find_hit(exon1)
hits_rev = []
for elem in hits_exon1:
hits_rev.append(elem[::-1])
# Prints out the hits as read in a FASTA sequence (5' to 3')
print("Forward primer candidates:")
print(hits_rev)
print("Reverse primer candidates:")
print(find_hit(exon2))
| 68.439024 | 811 | 0.777619 | 238 | 2,806 | 9.117647 | 0.394958 | 0.018433 | 0.009677 | 0.020277 | 0.029493 | 0 | 0 | 0 | 0 | 0 | 0 | 0.01671 | 0.168211 | 2,806 | 40 | 812 | 70.15 | 0.913025 | 0.224519 | 0 | 0 | 0 | 0 | 0.644873 | 0.616651 | 0 | 0 | 0 | 0 | 0 | 1 | 0.041667 | false | 0 | 0 | 0 | 0.083333 | 0.166667 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
93b91dc09003bd923f232e05ef1e7dbe2c31dfae | 7,332 | py | Python | tools/benchmarks.py | likyoo/ZCls | 568621aca3a8b090c93345f0858d52c5757f2f0e | [
"Apache-2.0"
] | 1 | 2021-05-07T12:54:03.000Z | 2021-05-07T12:54:03.000Z | tools/benchmarks.py | likyoo/ZCls | 568621aca3a8b090c93345f0858d52c5757f2f0e | [
"Apache-2.0"
] | null | null | null | tools/benchmarks.py | likyoo/ZCls | 568621aca3a8b090c93345f0858d52c5757f2f0e | [
"Apache-2.0"
] | null | null | null | # -*- coding: utf-8 -*-
"""
@date: 2020/11/4 下午2:06
@file: benchmarks.py
@author: zj
@description:
"""
import time
import numpy as np
import torch
from zcls.util.distributed import get_device, get_local_rank
from zcls.util.metrics import compute_num_flops
from zcls.config import cfg
from zcls.model.recognizers.build import build_recognizer
def compute_model_time(data_shape, model, device):
model = model.to(device)
t1 = 0.0
num = 100
begin = time.time()
for i in range(num):
data = torch.randn(data_shape)
start = time.time()
model(data.to(device=device, non_blocking=True))
t1 += time.time() - start
t2 = time.time() - begin
print(f'one process need {t2 / num:.3f}s, model compute need: {t1 / num:.3f}s')
def main(data_shape, config_file, mobile_name):
np.random.seed(cfg.RNG_SEED)
torch.manual_seed(cfg.RNG_SEED)
torch.backends.cudnn.deterministic = False
torch.backends.cudnn.benchmark = True
cfg.merge_from_file(config_file)
gpu_device = torch.device('cuda:0')
cpu_device = torch.device('cpu')
model = build_recognizer(cfg, cpu_device)
model.eval()
data = torch.randn(data_shape).to(device=cpu_device, non_blocking=True)
GFlops, params_size = compute_num_flops(model, data)
print(f'{mobile_name} ' + '*' * 10)
print(f'device: {cpu_device}')
print(f'GFlops: {GFlops:.3f}G')
print(f'Params Size: {params_size:.3f}MB')
model = build_recognizer(cfg, cpu_device)
model.eval()
print(f'compute cpu infer time')
compute_model_time(data_shape, model, cpu_device)
print(f'compute gpu infer time')
compute_model_time(data_shape, model, gpu_device)
del model
torch.cuda.empty_cache()
def mobilenet():
data_shape = (1, 3, 224, 224)
cfg_file = 'configs/benchmarks/lightweight/mbv1_cifar100_224_e100.yaml'
name = 'MobileNetV1_1.0x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/mbv2_cifar100_224_e100.yaml'
name = 'MobileNetV2_1.0x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/mbv2_torchvision_cifar100_224_e100.yaml'
name = 'Torchvision_MobileNetV2_1.0x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/mnasnet_a1_1_3_cifar100_224_e100.yaml'
name = 'MNasNet_a1_1.3x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/mnasnet_a1_1_3_se_cifar100_224_e100.yaml'
name = 'MNasNet_SE_a1_1.3x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/mnasnet_b1_1_3_cifar100_224_e100_sgd.yaml'
name = 'MNasNet_b1_1.3x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/mnasnet_b1_1_3_torchvision_cifar100_224_e100_sgd.yaml'
name = 'Torchvision_MNasNet_b1_1.3x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/mbv3_large_cifar100_224_e100_sgd.yaml'
name = 'MobileNetV3_Large_1.0x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/mbv3_large_se_cifar100_224_e100_sgd.yaml'
name = 'MobileNetV3_SE_Large_1.0x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/mbv3_large_se_hsigmoid_cifar100_224_e100.yaml'
name = 'MobileNetV3_SE_HSigmoid_Large_1.0x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/mbv3_small_cifar100_224_e100_sgd.yaml'
name = 'MobileNetV3_Small_1.0x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/mbv3_small_se_cifar100_224_e100.yaml'
name = 'MobileNetV3_SE_Small_1.0x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/mbv3_small_se_hsigmoid_cifar100_224_e100.yaml'
name = 'MobileNetV3_SE_HSigmoid_Small_1.0x'
main(data_shape, cfg_file, name)
def shufflenet():
data_shape = (1, 3, 224, 224)
cfg_file = 'configs/benchmarks/lightweight/sfv1_3g1x_cifar100_224_e100.yaml'
name = 'ShuffleNetV1_1.0x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/sfv2_x2_0_cifar100_224_e100.yaml'
name = 'ShuffleNetV2_1.0x'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/lightweight/sfv2_torchvision_cifar100_224_e100.yaml'
name = 'Torchvision_ShuffleNetV2_1.0x'
main(data_shape, cfg_file, name)
def resnet():
data_shape = (1, 3, 224, 224)
cfg_file = 'configs/benchmarks/resnet/r50_cifar100_224_e100_rmsprop.yaml'
name = 'ResNet50'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/r50_torchvision_cifar100_224_e100_rmsprop.yaml'
name = 'Torchvision_ResNet50'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rd50_cifar100_224_e100_rmsprop.yaml'
name = 'ResNetD50'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rd50_cifar100_224_e100_sgd.yaml'
name = 'ResNetD50'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rxtd50_32x4d_avg_cifar100_224_e100_rmsprop.yaml'
name = 'ResNeXtD50_32x4d_avg'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rxtd50_32x4d_fast_avg_cifar100_224_e100_rmsprop.yaml'
name = 'ResNeXtD50_32x4d_fast_avg'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rxt50_32x4d_cifar100_224_e100_rmsprop.yaml'
name = 'ResNeXt50_32x4d'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rxt50_32x4d_cifar100_224_e100_sgd.yaml'
name = 'ResNeXt50_32x4d'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rxt50_32x4d_torchvision_cifar100_224_e100_rmsprop.yaml'
name = 'Torchvisoin_ResNeXt_32x4d'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rxt50_32x4d_torchvision_cifar100_224_e100_sgd.yaml'
name = 'Torchvision_ResNeXt50_32x4d'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rxtd50_32x4d_cifar100_224_e100_rmsprop.yaml'
name = 'ResNeXtD50_32x4d'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rxtd50_32x4d_cifar100_224_e100_sgd.yaml'
name = 'ResNeXtD50_32x4d'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/sknet50_cifar100_224_e100_rmsprop.yaml'
name = 'SKNet50'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rstd50_2s2x40d_cifar100_224_e100_rmsprop.yaml'
name = 'ResNeSt50_2s2x40d'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rstd50_2s2x40d_fast_cifar100_224_e100_rmsprop.yaml'
name = 'ResNeSt50_fast_2s2x40d'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rstd50_2s2x40d_official_cifar100_224_e100_rmsprop.yaml'
name = 'Torchvision_ResNeSt50_2s2x40d'
main(data_shape, cfg_file, name)
cfg_file = 'configs/benchmarks/resnet/rstd50_2s2x40d_fast_official_cifar100_224_e100_rmsprop.yaml'
name = 'Torchvision_ResNeSt50_fast_2s2x40d'
main(data_shape, cfg_file, name)
if __name__ == '__main__':
# print('#' * 30)
# mobilenet()
# print('#' * 30)
# shufflenet()
print('#' * 30)
resnet()
| 33.633028 | 102 | 0.741135 | 1,039 | 7,332 | 4.858518 | 0.14052 | 0.091521 | 0.087559 | 0.156894 | 0.792393 | 0.757528 | 0.717908 | 0.643225 | 0.596276 | 0.528922 | 0 | 0.09317 | 0.155346 | 7,332 | 217 | 103 | 33.788018 | 0.721944 | 0.020322 | 0 | 0.304636 | 0 | 0.006623 | 0.445669 | 0.378016 | 0 | 0 | 0 | 0 | 0 | 1 | 0.033113 | false | 0 | 0.046358 | 0 | 0.07947 | 0.05298 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
93c9326618d6b86b7c7e7d121d39ce95a2014354 | 946 | py | Python | awsgen/models/profile.py | mvallim/aws-gen-cli | 45fdb4c014e3581912ecb5fc3eda59847b7bb5cc | [
"BSD-3-Clause"
] | 7 | 2018-11-08T13:30:47.000Z | 2022-03-09T12:50:57.000Z | awsgen/models/profile.py | mvallim/aws-gen-cli | 45fdb4c014e3581912ecb5fc3eda59847b7bb5cc | [
"BSD-3-Clause"
] | null | null | null | awsgen/models/profile.py | mvallim/aws-gen-cli | 45fdb4c014e3581912ecb5fc3eda59847b7bb5cc | [
"BSD-3-Clause"
] | null | null | null | class Profile(object):
@property
def name(self):
return self.__name
@property
def trustRoleArn(self):
return self.__trustRoleArn
@property
def sourceProfile(self):
return self.__sourceProfile
@property
def credentials(self):
return self.__credentials
@name.setter
def name(self, value):
self.name = value
@trustRoleArn.setter
def trustRoleArn(self, value):
self.__trustRoleArn = value
@sourceProfile.setter
def sourceProfile(self, value):
self.__sourceProfile = value
@credentials.setter
def credentials(self, value):
self.__credentials = value
def __init__(self, name = None, trustRoleArn = None, sourceProfile = None, credentials = None):
self.__name = name
self.__trustRoleArn = trustRoleArn
self.__sourceProfile = sourceProfile
self.__credentials = credentials
| 23.65 | 99 | 0.650106 | 90 | 946 | 6.544444 | 0.166667 | 0.074703 | 0.095076 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.27167 | 946 | 39 | 100 | 24.25641 | 0.854862 | 0 | 0 | 0.133333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.3 | false | 0 | 0 | 0.133333 | 0.466667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 2 |
93d256b787245a19d3a9552b58546e311f7fbdb2 | 210 | py | Python | main.py | GuilhermeMikin/EnergyEfficiencyproject | 1eeb9bab800d97bc0a1e1e4228f52381ebe2168a | [
"MIT"
] | null | null | null | main.py | GuilhermeMikin/EnergyEfficiencyproject | 1eeb9bab800d97bc0a1e1e4228f52381ebe2168a | [
"MIT"
] | null | null | null | main.py | GuilhermeMikin/EnergyEfficiencyproject | 1eeb9bab800d97bc0a1e1e4228f52381ebe2168a | [
"MIT"
] | null | null | null | from clientModbus import ClienteMODBUS
dbpath = "C:\\Users\\Guilherme B. Lopes\\Documents\\GitHub\\EnergyEfficiencyproject\\DB\\database1.db"
c = ClienteMODBUS('127.0.0.1', 502, dbpath=dbpath)
c.atendimento() | 35 | 102 | 0.761905 | 27 | 210 | 5.925926 | 0.740741 | 0.0875 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.051546 | 0.07619 | 210 | 6 | 103 | 35 | 0.773196 | 0 | 0 | 0 | 0 | 0 | 0.473934 | 0.317536 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 0.25 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
93eb344e854aa2568e5a2673859b939b49ea099a | 984 | py | Python | unitTests/testScripts/TestAll.py | JinchengKim/NumCpp | fd0221edc736baaf3370447fc37dace87800813d | [
"MIT"
] | 1 | 2019-06-17T02:04:04.000Z | 2019-06-17T02:04:04.000Z | unitTests/testScripts/TestAll.py | JinchengKim/NumCpp | fd0221edc736baaf3370447fc37dace87800813d | [
"MIT"
] | null | null | null | unitTests/testScripts/TestAll.py | JinchengKim/NumCpp | fd0221edc736baaf3370447fc37dace87800813d | [
"MIT"
] | null | null | null | import TestDataCube
import TestShape
import TestSlice
import TestTimer
import TestNdArray
import TestMethods
import TestConstants
import TestCoordinates
import TestFilters
import TestImageProcessing
import TestLinalg
import TestRandom
import TestRotations
import TestPolynomial
import TestFFT
import TestUtils
import TestDtypeInfo
#################################################################################
def doTest():
TestDataCube.doTest()
TestShape.doTest()
TestSlice.doTest()
TestTimer.doTest()
TestUtils.doTest()
TestDtypeInfo.doTest()
TestNdArray.doTest()
TestMethods.doTest()
TestCoordinates.doTest()
TestConstants.doTest()
TestLinalg.doTest()
TestRandom.doTest()
TestRotations.doTest()
TestFilters.doTest()
TestPolynomial.doTest()
TestFFT.doTest()
TestImageProcessing.doTest()
#################################################################################
if __name__ == '__main__':
doTest()
| 23.428571 | 81 | 0.637195 | 74 | 984 | 8.364865 | 0.310811 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.136179 | 984 | 41 | 82 | 24 | 0.728235 | 0 | 0 | 0 | 0 | 0 | 0.009732 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.027027 | true | 0 | 0.459459 | 0 | 0.486486 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
93f7b969f2ec6a9dac18da0558308e79be62a33b | 4,727 | py | Python | tunlib.py | calllivecn/VirtualLAN | a6d90bf95a8c8a9a923e78d54238921fa2e9e5aa | [
"Apache-2.0"
] | 1 | 2020-11-09T05:37:51.000Z | 2020-11-09T05:37:51.000Z | tunlib.py | calllivecn/VirtualLAN | a6d90bf95a8c8a9a923e78d54238921fa2e9e5aa | [
"Apache-2.0"
] | null | null | null | tunlib.py | calllivecn/VirtualLAN | a6d90bf95a8c8a9a923e78d54238921fa2e9e5aa | [
"Apache-2.0"
] | null | null | null |
# 操作接口
SIOCADDRT=0x890B
SIOCDELRT=0x890C
SIOCRTMSG=0x890D
SIOCGIFNAME=0x8910
SIOCSIFLINK=0x8911
SIOCGIFCONF=0x8912
SIOCGIFFLAGS=0x8913
SIOCSIFFLAGS=0x8914
SIOCGIFADDR=0x8915
SIOCSIFADDR=0x8916
SIOCGIFDSTADDR=0x8917
SIOCSIFDSTADDR=0x8918
SIOCGIFBRDADDR=0x8919
SIOCSIFBRDADDR=0x891a
SIOCGIFNETMASK=0x891b
SIOCSIFNETMASK=0x891c
SIOCGIFMETRIC=0x891d
SIOCSIFMETRIC=0x891e
SIOCGIFMEM=0x891f
SIOCSIFMEM=0x8920
SIOCGIFMTU=0x8921
SIOCSIFMTU=0x8922
SIOCSIFNAME=0x8923
SIOCSIFHWADDR=0x8924
SIOCGIFENCAP=0x8925
SIOCSIFENCAP=0x8926
SIOCGIFHWADDR=0x8927
SIOCGIFSLAVE=0x8929
SIOCSIFSLAVE=0x8930
SIOCADDMULTI=0x8931
SIOCDELMULTI=0x8932
SIOCGIFINDEX=0x8933
SIOGIFINDEX=SIOCGIFINDEX
SIOCSIFPFLAGS=0x8934
SIOCGIFPFLAGS=0x8935
SIOCDIFADDR=0x8936
SIOCSIFHWBROADCAST=0x8937
SIOCGIFCOUNT=0x8938
SIOCGIFBR=0x8940
SIOCSIFBR=0x8941
SIOCGIFTXQLEN=0x8942
SIOCSIFTXQLEN=0x8943
SIOCDARP=0x8953
SIOCGARP=0x8954
SIOCSARP=0x8955
SIOCDRARP=0x8960
SIOCGRARP=0x8961
SIOCSRARP=0x8962
SIOCGIFMAP=0x8970
SIOCSIFMAP=0x8971
SIOCADDDLCI=0x8980
SIOCDELDLCI=0x8981
SIOCDEVPRIVATE=0x89F0
SIOCPROTOPRIVATE=0x89E0
IFF_UP = 0x1
RTF_UP = 0x0001
RTF_HOST = 0x0004
RTF_REJECT = 0x0200
# 操作 /dev/net/tun
TUNSETIFF = 0x400454ca
TUNSETOWNER = TUNSETIFF + 2
IFF_TUN = 0x0001
IFF_TAP = 0x0002
IFF_NO_PI = 0x1000
TUN_DEV_FILE='/dev/net/tun'
import sys,os
from socket import socket,AF_INET,SOCK_DGRAM,inet_ntoa,inet_aton
from fcntl import ioctl
from struct import pack,unpack
from array import array
def get_iface_list():
max_iface = 32
byte_s = max_iface *32
is64bit = sys.maxsize > 1<<32
struct_size = 40 if is64bit else 32
try:
s = socket(AF_INET,SOCK_DGRAM)
names = array('B',bytes(byte_s))
op = pack('iL',byte_s,names.buffer_info()[0])
result = ioctl(s.fileno(),0x8912,op)
outbytes = unpack('iL',result)[0]
namestr = names.tostring()
iface_ip=[]
for i in range(0,outbytes,struct_size):
iface_ip.append(namestr[i:i+32].split(bytes(1),1)[0].decode())
iface_ip.append(inet_ntoa(namestr[i+20:i+24]))
except OSError as e:
raise e
return iface_ip
def get_ip_ifname(ifname):
s = socket(AF_INET,SOCK_DGRAM)
try:
ifr = pack('32s','eth0'.encode())
result = ioctl(s.fileno(),0x8915,(ifr))
print(inet_ntoa(result[20:24]))
finally:
pass
def set_ip_ifname(ifname,ip,netmask):
s = socket(AF_INET,SOCK_DGRAM)
try:
ifr = pack('16sH14s',ifname.encode(),AF_INET,bytes(2)+inet_aton(ip))
result = ioctl(s.fileno(),0x8916,(ifr))
ifr = pack('16sH14s',ifname.encode(),AF_INET,bytes(2)+inet_aton(netmask))
result = ioctl(s.fileno(),0x891c,(ifr))
except OSError as e:
raise e
def add_route(ifname,dst_ip,gateway,mask):
s = socket(AF_INET,SOCK_DGRAM)
op = pack('LH14sH14sH14sH46s',0,
AF_INET,bytes(2)+inet_aton(dst_ip),
AF_INET,bytes(2)+inet_aton(gateway),
AF_INET,bytes(2)+inet_aton(mask),
RTF_UP | RTF_HOST | RTF_REJECT,
bytes(1))
ioctl(s.fileno(),0x890B,op)
def del_route(dst_ip,gateway,mask):
s = socket(AF_INET,SOCK_DGRAM)
op = pack('LH14sH14sH14sH46s',0,
AF_INET,bytes(2)+inet_aton(dst_ip),
AF_INET,bytes(2)+inet_aton(gateway),
AF_INET,bytes(2)+inet_aton(mask),
RTF_UP | RTF_HOST | RTF_REJECT,
bytes(1))
ioctl(s.fileno(),0x890c,op)
def up_iface(ifname):
s = socket(AF_INET,SOCK_DGRAM)
try:
op = pack('16sh',ifname.encode(),0)
status = ioctl(s.fileno(),0x8913,op)
status = unpack('16sh',status)[1]
ifr = pack('16sh',ifname.encode(),status | IFF_UP)
result = ioctl(s.fileno(),0x8914,ifr)
except OSError as e:
raise e
def __check_ifname(ifname='tun'):
i=0
iface_ip = get_iface_list()
while ifname+str(i) in iface_ip:
if i > 99999:
return False
i+=1
return ifname+str(i)
def tun_create():
'''返回 create (tun_name,tun_file_object)'''
ifname = __check_ifname()
ifr = pack('16sH',ifname.encode(),IFF_TUN | IFF_NO_PI)
tun = open(TUN_DEV_FILE,'r+b',buffering=0)
ioctl(tun,TUNSETIFF,ifr)
ioctl(tun,TUNSETOWNER,0)
return ifname,tun
def mask(netmask=24):
mask = 0
for i in range(32 - netmask,32):
mask = mask | 1<<i
return inet_ntoa(pack('!I',mask))
def ip_add_route(dst='0.0.0.0',gw,mask):
subprocess.check_call('ip route add {}/{} via {}'.format(dst,mask,gw))
def ip_del_route(dst='0.0.0.0',gw,mask):
subprocess.check_call('ip route del {}/{} via {}'.format(dst,mask,gw))
def tun_active(ifname,ip,netmask=24):
up_iface(ifname)
set_ip_ifname(ifname,ip,mask(netmask))
if __name__ == '__main__':
#add_route('0.0.0.0','10.0.0.254',mask(24))
#del_route('0.0.0.0','10.0.0.254',mask(32))
ifname , tun = tun_create()
tun_active(ifname,'10.0.0.1',24)
fd = tun.fileno()
try:
while True:
data = os.read(fd,65535)
print(data)
except KeyboardInterrupt:
print('exit...')
finally:
#input('pause...')
tun.close()
| 22.402844 | 76 | 0.734292 | 734 | 4,727 | 4.56812 | 0.332425 | 0.026842 | 0.028631 | 0.028631 | 0.27289 | 0.241575 | 0.215926 | 0.215926 | 0.18819 | 0.17119 | 0 | 0.114948 | 0.123969 | 4,727 | 210 | 77 | 22.509524 | 0.69476 | 0.025809 | 0 | 0.180233 | 0 | 0 | 0.040167 | 0 | 0 | 1 | 0.091089 | 0 | 0 | 0 | null | null | 0.005814 | 0.02907 | null | null | 0.017442 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
9e023b71ca9c5311bf9446cd5a9815c500e1e99e | 398 | py | Python | data/filter.py | nwtnni/rainbow | 17a7b38f500822e8ab6187389e4d13ec6d142473 | [
"MIT"
] | null | null | null | data/filter.py | nwtnni/rainbow | 17a7b38f500822e8ab6187389e4d13ec6d142473 | [
"MIT"
] | null | null | null | data/filter.py | nwtnni/rainbow | 17a7b38f500822e8ab6187389e4d13ec6d142473 | [
"MIT"
] | null | null | null | import sys
if __name__ == "__main__":
plaintext_length = 0
try:
plaintext_length = int(sys.argv[1])
except Exception:
print("Usage: python filter.py <PLAINTEXT_LENGTH>")
sys.exit(1)
with open("passwords.txt", "r") as file:
for line in file:
line = line.strip()
if len(line) == plaintext_length:
print(line)
| 23.411765 | 59 | 0.562814 | 48 | 398 | 4.416667 | 0.666667 | 0.283019 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.011111 | 0.321608 | 398 | 16 | 60 | 24.875 | 0.774074 | 0 | 0 | 0 | 0 | 0 | 0.160804 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.076923 | 0.076923 | 0 | 0.076923 | 0.153846 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
9e05311e7745cbf3bbc5688cac5287c1f80665c6 | 423 | py | Python | local/models.py | rodrigondec/Open_CliEng | 83e399a35c1cf96283409ac43a61b2725cd93982 | [
"MIT"
] | 3 | 2019-09-26T13:58:23.000Z | 2020-06-18T16:43:40.000Z | local/models.py | rodrigondec/Open_Clineng | 83e399a35c1cf96283409ac43a61b2725cd93982 | [
"MIT"
] | 24 | 2017-11-20T05:27:32.000Z | 2017-11-29T05:46:56.000Z | local/models.py | rodrigondec/Open_CliEng | 83e399a35c1cf96283409ac43a61b2725cd93982 | [
"MIT"
] | null | null | null | from django.db import models
# Create your models here.
class Predio(models.Model):
nome = models.CharField(max_length=200)
descricao = models.TextField(max_length=200, null=True)
def __str__(self):
return self.nome
class Setor(models.Model):
predio = models.ForeignKey(Predio, on_delete=models.CASCADE)
nome = models.CharField(max_length=200)
def __str__(self):
return self.nome | 26.4375 | 64 | 0.713948 | 57 | 423 | 5.087719 | 0.508772 | 0.093103 | 0.124138 | 0.151724 | 0.37931 | 0.37931 | 0 | 0 | 0 | 0 | 0 | 0.026087 | 0.184397 | 423 | 16 | 65 | 26.4375 | 0.814493 | 0.056738 | 0 | 0.545455 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.181818 | false | 0 | 0.090909 | 0.181818 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 2 |
9e06a81c01576381ea7c3dd69d01742761d91bde | 530 | py | Python | coinflow/protocol/structs/__init__.py | mariuszlitwin/coinflow | 49686e703a6edf90777eff2a154de1d732fc6b5f | [
"Apache-2.0",
"MIT"
] | 1 | 2018-06-12T23:04:11.000Z | 2018-06-12T23:04:11.000Z | coinflow/protocol/structs/__init__.py | mariuszlitwin/coinflow | 49686e703a6edf90777eff2a154de1d732fc6b5f | [
"Apache-2.0",
"MIT"
] | null | null | null | coinflow/protocol/structs/__init__.py | mariuszlitwin/coinflow | 49686e703a6edf90777eff2a154de1d732fc6b5f | [
"Apache-2.0",
"MIT"
] | null | null | null | #!/usr/bin/env python3
# -*- coding: utf-8 -*-
from hashlib import sha256
from .Varint import Varint
from .Varstr import Varstr
from .Netaddr import Netaddr
from .Timestamp import Timestamp
def dsha256(p: bytes) -> bytes:
"""
Calculate double sha256 hash
Parameters
----------
p : bytes
payload to hash
Returns
-------
bytes
double sha256 hash of payload
"""
return sha256(sha256(p).digest()).digest()
__all__ = ['dsha256', 'Varint', 'Varstr', 'Netaddr', 'Timestamp']
| 18.928571 | 65 | 0.622642 | 61 | 530 | 5.344262 | 0.491803 | 0.03681 | 0.09816 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.05679 | 0.235849 | 530 | 27 | 66 | 19.62963 | 0.748148 | 0.343396 | 0 | 0 | 0 | 0 | 0.117057 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.125 | false | 0 | 0.625 | 0 | 0.875 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
9e08024d2d4e64ff1d80b3dad6852bbd1c4b93be | 334 | py | Python | keyboards.py | rvalien/GladOs | 9cb762f313273222a1c4fd30c27ed8c6573e6d44 | [
"MIT"
] | 1 | 2020-05-03T09:41:53.000Z | 2020-05-03T09:41:53.000Z | keyboards.py | rvalien/GladOs | 9cb762f313273222a1c4fd30c27ed8c6573e6d44 | [
"MIT"
] | 1 | 2022-02-01T14:41:36.000Z | 2022-02-01T14:41:36.000Z | keyboards.py | rvalien/GladOs | 9cb762f313273222a1c4fd30c27ed8c6573e6d44 | [
"MIT"
] | 2 | 2020-02-04T01:26:48.000Z | 2020-05-03T09:41:55.000Z | from aiogram.types import KeyboardButton, ReplyKeyboardMarkup
markup = ReplyKeyboardMarkup()
# markup.row(KeyboardButton("/led_on"), KeyboardButton("/led_off"))
markup.row(KeyboardButton("/work"), KeyboardButton("/rest"), KeyboardButton("🏡"))
markup.row(KeyboardButton("weather"), KeyboardButton("internet"), KeyboardButton("bill"))
| 47.714286 | 89 | 0.775449 | 32 | 334 | 8.0625 | 0.53125 | 0.104651 | 0.267442 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.053892 | 334 | 6 | 90 | 55.666667 | 0.813291 | 0.194611 | 0 | 0 | 0 | 0 | 0.11236 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 0.25 | 0 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
9e12ed6ee437d4cb0e07237db5f53e19ea606949 | 615 | py | Python | tests/test_appservers.py | izumimatsuo/ansible-playbook-webapp-site | a602a6cead9612a185362198111ee1ba47af967c | [
"MIT"
] | null | null | null | tests/test_appservers.py | izumimatsuo/ansible-playbook-webapp-site | a602a6cead9612a185362198111ee1ba47af967c | [
"MIT"
] | null | null | null | tests/test_appservers.py | izumimatsuo/ansible-playbook-webapp-site | a602a6cead9612a185362198111ee1ba47af967c | [
"MIT"
] | null | null | null | # pytest -v --sudo --ssh-config=.ssh/config --ansible-inventory=inventory --hosts='ansible://appservers' tests/test_appserver.py
# パッケージがインストールされている
def test_installed_default_package(host):
assert host.package('docker-ce').is_installed
# 起動すべきサービスが起動している
def test_running_default_service(host):
assert host.service('docker').is_running
# Swarm クラスタが起動している
def test_swarm_active(host):
state = host.run("docker info | grep Swarm:")
assert 'Swarm: active' in state.stdout
# 公開サービスが意図したポートでリッスンしている
# def test_listen_default_port(host):
# assert host.socket('tcp://0.0.0.0:80').is_listening
| 29.285714 | 128 | 0.754472 | 82 | 615 | 5.47561 | 0.52439 | 0.062361 | 0.093541 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.011029 | 0.115447 | 615 | 20 | 129 | 30.75 | 0.814338 | 0.479675 | 0 | 0 | 0 | 0 | 0.169872 | 0 | 0 | 0 | 0 | 0 | 0.428571 | 1 | 0.428571 | false | 0 | 0 | 0 | 0.428571 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
9e1a6d72bb2a99bdbbd74d76af4a22fb69089505 | 3,196 | py | Python | pari/article/views/article_views.py | theju/pari | 318a4ffba08362e78253ded100a63f5b5c6eadf9 | [
"BSD-3-Clause"
] | null | null | null | pari/article/views/article_views.py | theju/pari | 318a4ffba08362e78253ded100a63f5b5c6eadf9 | [
"BSD-3-Clause"
] | null | null | null | pari/article/views/article_views.py | theju/pari | 318a4ffba08362e78253ded100a63f5b5c6eadf9 | [
"BSD-3-Clause"
] | null | null | null | import json
from django.views.generic.detail import DetailView
from django.views.generic.list import ListView
from django.utils import translation
from django.conf import settings
from mezzanine.core.models import CONTENT_STATUS_PUBLISHED
from pari.article.models import Article, get_archive_articles, get_all_articles, ArticleCarouselImage
from pari.article.mixins import ArticleListMixin
from pari.article.templatetags.article_filters import month_name
# TODO: Remove in django 1.7+
LANGUAGE_SESSION_KEY = "django_language"
class ArticleDetail(DetailView):
context_object_name = "blog_post"
model = Article
def get_queryset(self):
if self.request.user.is_staff:
return Article.objects.prefetch_related('locations', 'carousel_images')
else:
return Article.articles.prefetch_related('locations', 'carousel_images')
def get_context_data(self, **kwargs):
context = super(ArticleDetail, self).get_context_data(**kwargs)
article = context['blog_post']
translations = []
for language in settings.LANGUAGES[1:]:
content = getattr(article, "content_{0}".format(language[0]), None)
if content and content.strip():
translations.append(language)
language = self.request.GET.get("hl")
if language and language in [ii[0] for ii in settings.LANGUAGES]:
translation.activate(language)
self.request.session[LANGUAGE_SESSION_KEY] = language
context['translations'] = translations
context['related_articles'] = article.related_posts.filter(status=CONTENT_STATUS_PUBLISHED)[:5]
if article.featured_video or article.featured_audio:
obj = context['object']
obj.oembed_data = json.loads(obj.oembed_data)
context['object'] = obj
return context
class ArchiveDetail(ArticleListMixin, ListView):
context_object_name = "articles"
model = Article
template_name = 'article/archive_detail.html'
def get_article_list_queryset(self):
self.year = self.kwargs['year']
self.month = self.kwargs['month']
return get_archive_articles(self.month, self.year)
def get_context_data(self, **kwargs):
context = super(ArchiveDetail, self).get_context_data(**kwargs)
context['year'] = self.year
context['month'] = self.month
context['month_as_name'] = month_name(self.month)
context['title'] = "{0} {1}".format(context['month_as_name'], self.year)
return context
class ArticleList(ArticleListMixin, ListView):
context_object_name = "articles"
model = Article
def get_article_list_queryset(self):
return get_all_articles()
def get_context_data(self, **kwargs):
context = super(ArticleList, self).get_context_data(**kwargs)
context['title'] = "All articles"
return context
class ArticleCarouselImageDetail(DetailView):
context_object_name = "image"
model = ArticleCarouselImage
def get_object(self, queryset=None):
return ArticleCarouselImage.objects.get(article__slug=self.kwargs['slug'], _order=int(self.kwargs['order']) - 1)
| 36.735632 | 120 | 0.70025 | 372 | 3,196 | 5.825269 | 0.274194 | 0.019382 | 0.038763 | 0.023535 | 0.211814 | 0.165667 | 0.110291 | 0.110291 | 0 | 0 | 0 | 0.003902 | 0.19806 | 3,196 | 86 | 121 | 37.162791 | 0.841592 | 0.008448 | 0 | 0.19697 | 0 | 0 | 0.08336 | 0.008525 | 0 | 0 | 0 | 0.011628 | 0 | 1 | 0.106061 | false | 0 | 0.136364 | 0.030303 | 0.560606 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
9e1e17de871a5bd889ab965b1b5d6414acf7b152 | 3,029 | py | Python | crowdsourcing/migrations/0006_auto_20150707_1259.py | ramcn/sept20 | e6f6e238d0561ebf3353158161f1b20052e8b08b | [
"MIT"
] | 1 | 2016-02-29T01:26:42.000Z | 2016-02-29T01:26:42.000Z | crowdsourcing/migrations/0006_auto_20150707_1259.py | ramcn/sept20 | e6f6e238d0561ebf3353158161f1b20052e8b08b | [
"MIT"
] | 16 | 2015-08-10T18:28:18.000Z | 2022-03-11T23:12:48.000Z | crowdsourcing/migrations/0006_auto_20150707_1259.py | Milstein/crowdsource-platform | 60427e440373824c26c7daf8cf5f421b9c7ebbb5 | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
from __future__ import unicode_literals
from django.db import models, migrations
class Migration(migrations.Migration):
dependencies = [
('crowdsourcing', '0005_auto_20150707_1244'),
]
operations = [
migrations.RemoveField(
model_name='project',
name='has_multiple_tasks',
),
migrations.AddField(
model_name='module',
name='data_set_location',
field=models.CharField(default=b'No data set', max_length=256, null=True),
),
migrations.AddField(
model_name='module',
name='has_data_set',
field=models.BooleanField(default=False),
),
migrations.AddField(
model_name='module',
name='task_time',
field=models.FloatField(default=0),
),
migrations.AddField(
model_name='template',
name='price',
field=models.FloatField(default=0),
),
migrations.AddField(
model_name='template',
name='share_with_others',
field=models.BooleanField(default=False),
),
migrations.AddField(
model_name='templateitem',
name='data_source',
field=models.CharField(max_length=256, null=True),
),
migrations.AddField(
model_name='templateitem',
name='icon',
field=models.CharField(max_length=256, null=True),
),
migrations.AddField(
model_name='templateitem',
name='id_string',
field=models.CharField(default='Label1', max_length=128),
preserve_default=False,
),
migrations.AddField(
model_name='templateitem',
name='layout',
field=models.CharField(default=b'column', max_length=16),
),
migrations.AddField(
model_name='templateitem',
name='role',
field=models.CharField(default='display', max_length=16),
preserve_default=False,
),
migrations.AddField(
model_name='templateitem',
name='sub_type',
field=models.CharField(default='h4', max_length=16),
preserve_default=False,
),
migrations.AddField(
model_name='templateitem',
name='type',
field=models.CharField(default='label', max_length=16),
preserve_default=False,
),
migrations.AddField(
model_name='templateitem',
name='values',
field=models.TextField(null=True),
),
migrations.AlterField(
model_name='module',
name='keywords',
field=models.TextField(null=True),
),
migrations.AlterField(
model_name='template',
name='source_html',
field=models.TextField(default=None, null=True),
),
]
| 30.908163 | 86 | 0.548036 | 269 | 3,029 | 5.988848 | 0.286245 | 0.089385 | 0.185599 | 0.217877 | 0.68653 | 0.613284 | 0.55121 | 0.55121 | 0.541279 | 0.325264 | 0 | 0.020388 | 0.336085 | 3,029 | 97 | 87 | 31.226804 | 0.780706 | 0.006933 | 0 | 0.637363 | 0 | 0 | 0.124085 | 0.007651 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.021978 | 0 | 0.054945 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
9e1fc8c93882f7b73a8721a0926b8de62a036a2e | 1,681 | py | Python | CARLA/PythonAPI/simulation/simulation.py | jawadefaj/SIP-CARLA | 61f1fbd4e5fafbc6412a0b40e0748e570035b37a | [
"MIT"
] | null | null | null | CARLA/PythonAPI/simulation/simulation.py | jawadefaj/SIP-CARLA | 61f1fbd4e5fafbc6412a0b40e0748e570035b37a | [
"MIT"
] | null | null | null | CARLA/PythonAPI/simulation/simulation.py | jawadefaj/SIP-CARLA | 61f1fbd4e5fafbc6412a0b40e0748e570035b37a | [
"MIT"
] | null | null | null | from helper import helper
import os
class simulation():
def __init__(self, client=None):
if client is None:
client = helper.connectToClient()
self.client = client
self.world = client.get_world()
self.bounding_box = None
self.configure_simulation()
pass
def configure_simulation(self):
helper.set_camera_over_intersection(self.world)
self.bounding_box = helper.draw_bounding_box(self.world)
pass
def reset_simulation(self):
helper.reset_carla_world(self.client)
def record_scene(self, filename="recording01.log", additional_param=True):
self.client.start_recorder(filename, additional_param)
def stop_record(self):
self.client.stop_recorder()
def replay_scene(self, filename="recording01.log", start=1, duration=0, camera=0, time_factor=1.0):
self.set_recorder_playback(time_factor)
self.client.replay_file(filename, start, duration, camera)
def set_recorder_playback(self, time_factor):
self.client.set_replayer_time_factor(time_factor)
def store_recorded_data(self, filename="recording01.log", show_all= True, txt_file="output.txt"):
output = self.client.show_recorder_file_info(filename, show_all)
# creates the text file if it does not exist
file = open(txt_file, "w+")
file.close()
# deletes all previous content from text file
file = open(txt_file, "r+")
file.truncate(0)
file.close()
# writes recorder output to text file
text_file = open(txt_file, "w")
n = text_file.write(output)
text_file.close()
| 32.960784 | 103 | 0.669839 | 216 | 1,681 | 4.981481 | 0.342593 | 0.074349 | 0.064126 | 0.072491 | 0.087361 | 0 | 0 | 0 | 0 | 0 | 0 | 0.009317 | 0.233789 | 1,681 | 51 | 104 | 32.960784 | 0.826087 | 0.072576 | 0 | 0.111111 | 0 | 0 | 0.03856 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.222222 | false | 0.055556 | 0.055556 | 0 | 0.305556 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
f519c4ae3e073d8fc6392c590e9170a56ff02dd9 | 980 | py | Python | tests/unit/configs/system/test_config.py | Egnod/sitri | ca974cce9041bea8296284b0ca67d970a6e072cf | [
"MIT"
] | 11 | 2020-12-16T07:00:29.000Z | 2021-05-25T16:24:50.000Z | tests/unit/configs/system/test_config.py | Egnod/sitri | ca974cce9041bea8296284b0ca67d970a6e072cf | [
"MIT"
] | 6 | 2019-10-08T22:55:21.000Z | 2019-10-11T19:29:53.000Z | tests/unit/configs/system/test_config.py | Egnod/sitri | ca974cce9041bea8296284b0ca67d970a6e072cf | [
"MIT"
] | 2 | 2019-10-10T12:09:50.000Z | 2019-10-10T23:52:38.000Z | def test_metadata(system_config) -> None:
assert system_config.provider_code == "system"
assert system_config._prefix == "TEST"
def test_prefixize(system_config) -> None:
assert system_config.prefixize("key1") == "TEST_KEY1"
assert system_config.unprefixize("TEST_KEY1") == "key1"
def test_get_variable(monkeypatch, system_config) -> None:
monkeypatch.setenv("TEST_KEY1", "1")
monkeypatch.setenv("TEST_KEY2", "2")
assert system_config.get("key1") == "1"
assert system_config.get("key2") == "2"
monkeypatch.undo()
def test_get_variables_list(monkeypatch, system_config) -> None:
monkeypatch.setenv("TEST_KEY1", "1")
monkeypatch.setenv("TEST_KEY2", "2")
monkeypatch.setenv("TEZT_T1", "1")
monkeypatch.setenv("TEZT_T2", "2")
assert "key1" in system_config.keys()
assert "key2" in system_config.keys()
assert "t1" not in system_config.keys()
assert "t2" not in system_config.keys()
monkeypatch.undo()
| 28.823529 | 64 | 0.694898 | 126 | 980 | 5.15873 | 0.230159 | 0.258462 | 0.166154 | 0.110769 | 0.495385 | 0.347692 | 0.243077 | 0.243077 | 0.243077 | 0.243077 | 0 | 0.029162 | 0.160204 | 980 | 33 | 65 | 29.69697 | 0.760632 | 0 | 0 | 0.272727 | 0 | 0 | 0.116327 | 0 | 0 | 0 | 0 | 0 | 0.454545 | 1 | 0.181818 | false | 0 | 0 | 0 | 0.181818 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
f521a3bb8d1757d12ddea3ebadb97e6c0a682f8c | 582 | py | Python | ops.py | tekktonic/programming | 139959ab9934912d4c531e5ee8b1f39094a6823c | [
"0BSD"
] | null | null | null | ops.py | tekktonic/programming | 139959ab9934912d4c531e5ee8b1f39094a6823c | [
"0BSD"
] | null | null | null | ops.py | tekktonic/programming | 139959ab9934912d4c531e5ee8b1f39094a6823c | [
"0BSD"
] | null | null | null | import hw
def none():
pass
def ldx():
pc += 1
regx = mem[pc]
def ldy():
pc += 1
regy = mem[pc]
def ldz():
pc += 1
regz = mem[pc]
def rtx():
pc += 1
mem[mem[pc]] = rtx
def rty():
pc += 1
mem[mem[pc]] = rty
def rtz():
pc += 1
mem[mem[pc]] = regz
def add():
regz = regx + regy
def sub():
regz = regx - regy
def mul():
regz = regx * regy
def div():
regz = regx / regy
def mov():
mem[regy] = regx
def jmp():
pc = mem[pc + 1]
def die():
exit(0)
def prt():
pc += 1
print(mem[mem[pc]])
| 10.581818 | 23 | 0.463918 | 93 | 582 | 2.903226 | 0.301075 | 0.088889 | 0.118519 | 0.222222 | 0.122222 | 0 | 0 | 0 | 0 | 0 | 0 | 0.023936 | 0.353952 | 582 | 54 | 24 | 10.777778 | 0.694149 | 0 | 0 | 0.184211 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.394737 | false | 0.026316 | 0.026316 | 0 | 0.421053 | 0.026316 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
f548dadfb7037aaf0041aa0ff91fc3b1b264af96 | 884 | py | Python | src/dash/admin.py | zenly/visibility | 557d82799e1a3a080168f20b9bf7c7c35d5bcfd0 | [
"Apache-2.0"
] | 4 | 2015-03-12T08:51:20.000Z | 2015-09-25T20:48:53.000Z | src/dash/admin.py | douglas-gibbons/visibility | 557d82799e1a3a080168f20b9bf7c7c35d5bcfd0 | [
"Apache-2.0"
] | null | null | null | src/dash/admin.py | douglas-gibbons/visibility | 557d82799e1a3a080168f20b9bf7c7c35d5bcfd0 | [
"Apache-2.0"
] | 1 | 2015-04-28T05:39:51.000Z | 2015-04-28T05:39:51.000Z | '''
Copyright 2013 Douglas Gibbons
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
'''
from django.contrib import admin
from dash.models import *
admin.site.register(Product)
admin.site.register(Build)
admin.site.register(Deploy)
admin.site.register(Event)
admin.site.register(Environment)
admin.site.register(Host)
admin.site.register(Testrun)
admin.site.register(Testpack)
| 31.571429 | 75 | 0.769231 | 131 | 884 | 5.19084 | 0.610687 | 0.105882 | 0.2 | 0.047059 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.010738 | 0.15724 | 884 | 27 | 76 | 32.740741 | 0.902013 | 0.627828 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.2 | 0 | 0.2 | 0 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
f549ea0804828c87b3826cc6a289741966c7d2c1 | 443 | py | Python | open_humans/migrations/0014_member_password_reset_redirect.py | danamlewis/open-humans | 9b08310cf151f49032b66ddd005bbd47d466cc4e | [
"MIT"
] | 57 | 2016-09-01T21:55:52.000Z | 2022-03-27T22:15:32.000Z | open_humans/migrations/0014_member_password_reset_redirect.py | danamlewis/open-humans | 9b08310cf151f49032b66ddd005bbd47d466cc4e | [
"MIT"
] | 464 | 2015-03-23T18:08:28.000Z | 2016-08-25T04:57:36.000Z | open_humans/migrations/0014_member_password_reset_redirect.py | danamlewis/open-humans | 9b08310cf151f49032b66ddd005bbd47d466cc4e | [
"MIT"
] | 25 | 2017-01-24T16:23:27.000Z | 2021-11-07T01:51:42.000Z | # Generated by Django 2.1.1 on 2018-09-24 23:56
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('open_humans', '0013_remove_member_badges'),
]
operations = [
migrations.AddField(
model_name='member',
name='password_reset_redirect',
field=models.CharField(blank=True, default='', max_length=254, null=True),
),
]
| 23.315789 | 86 | 0.625282 | 50 | 443 | 5.38 | 0.82 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.066869 | 0.257336 | 443 | 18 | 87 | 24.611111 | 0.75076 | 0.10158 | 0 | 0 | 1 | 0 | 0.164141 | 0.121212 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.083333 | 0.083333 | 0 | 0.333333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
f558844da4a7ece730455a676698c37efefe2d10 | 907 | py | Python | libs/tools/json.py | lundgrenalex/mtrc | 9deb8676d299bf341c8be16c2dd4ba000b515407 | [
"Apache-2.0"
] | null | null | null | libs/tools/json.py | lundgrenalex/mtrc | 9deb8676d299bf341c8be16c2dd4ba000b515407 | [
"Apache-2.0"
] | null | null | null | libs/tools/json.py | lundgrenalex/mtrc | 9deb8676d299bf341c8be16c2dd4ba000b515407 | [
"Apache-2.0"
] | null | null | null | from functools import wraps
from flask import jsonify, request
from jsonschema import validate
from jsonschema.exceptions import ValidationError
from werkzeug.exceptions import BadRequest
from importlib import import_module
import logging
def validate_schema(schema_name: str):
def decorator(f):
@wraps(f)
def wrapper(*args, **kw):
try:
schema = import_module('libs.schemas.' + schema_name, package=__name__)
validate(request.json, schema.schema)
except ValidationError as e:
logging.error(f'ValidationError: {e.message}, {request.data}')
return jsonify({
"error_code": 400,
"error_type": "ValidationError",
"error_message": e.message
}), 400
return f(*args, **kw)
return wrapper
return decorator
| 33.592593 | 87 | 0.609702 | 93 | 907 | 5.817204 | 0.430108 | 0.051756 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.009554 | 0.307608 | 907 | 26 | 88 | 34.884615 | 0.851911 | 0 | 0 | 0 | 0 | 0 | 0.115766 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.125 | false | 0 | 0.333333 | 0 | 0.625 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
f56074975e7b21095e17d53496e2aee49713a669 | 555 | py | Python | python3/cmp/cmp1.py | jtraver/dev | c7cd2181594510a8fa27e7325566ed2d79371624 | [
"MIT"
] | null | null | null | python3/cmp/cmp1.py | jtraver/dev | c7cd2181594510a8fa27e7325566ed2d79371624 | [
"MIT"
] | null | null | null | python3/cmp/cmp1.py | jtraver/dev | c7cd2181594510a8fa27e7325566ed2d79371624 | [
"MIT"
] | null | null | null | #!/usr/bin/env python3
#!/usr/bin/python3
dict1 = {
'a': 1,
'b': 2,
}
dict2 = {
'a': 0,
'b': 2,
}
if dict1 == dict2:
print("FAIL")
else:
print("PASS")
dict1 = {
'a': {
'c': 'bake'
},
'b': 2,
}
dict2 = {
'a': {
'c': 'shake'
},
'b': 2,
}
if dict1 == dict2:
print("FAIL")
else:
print("PASS")
dict1 = {
'a': {
'c': [0, 1]
},
'b': 2,
}
dict2 = {
'a': {
'c': [0, 2]
},
'b': 2,
}
if dict1 == dict2:
print("FAIL")
else:
print("PASS")
| 9.910714 | 22 | 0.356757 | 67 | 555 | 2.955224 | 0.283582 | 0.060606 | 0.106061 | 0.121212 | 0.757576 | 0.616162 | 0.616162 | 0.616162 | 0.616162 | 0.616162 | 0 | 0.076471 | 0.387387 | 555 | 55 | 23 | 10.090909 | 0.505882 | 0.068468 | 0 | 0.636364 | 0 | 0 | 0.095146 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.068182 | 0 | 0 | 0 | 0.136364 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
f56c748076b14e3492eccc6eb1d5024cc86dff9c | 683 | py | Python | src/sw/allotmentclub/alembic/versions/set_advance_pay_to_0_if_under_threshold_1654373c7899.py | sweh/sw.allotmentclub.backend | 77344045e29c2b173d635e9e20a0ca556161888e | [
"ZPL-2.1"
] | 1 | 2019-11-12T08:13:18.000Z | 2019-11-12T08:13:18.000Z | src/sw/allotmentclub/alembic/versions/set_advance_pay_to_0_if_under_threshold_1654373c7899.py | sweh/sw.allotmentclub.backend | 77344045e29c2b173d635e9e20a0ca556161888e | [
"ZPL-2.1"
] | 26 | 2020-05-16T12:08:25.000Z | 2022-03-12T00:53:57.000Z | src/sw/allotmentclub/alembic/versions/set_advance_pay_to_0_if_under_threshold_1654373c7899.py | sweh/sw.allotmentclub.backend | 77344045e29c2b173d635e9e20a0ca556161888e | [
"ZPL-2.1"
] | null | null | null | """Set advance pay to 0 if under threshold.
Revision ID: 1654373c7899
Revises: 51aecbad82b3
Create Date: 2015-03-27 08:15:43.051506
"""
# revision identifiers, used by Alembic.
from alembic import op
revision = '1654373c7899'
down_revision = u'51aecbad82b3'
def upgrade():
op.execute("""UPDATE energyvalue SET advance_pay = 0 WHERE year = 2014
and advance_pay < 100000;""")
op.execute("""UPDATE booking SET value = 0 WHERE
purpose = 'Energieabschlag I' and value > -100000;""")
op.execute("""UPDATE booking SET value = 0 WHERE
purpose = 'Energieabschlag II' and value > -100000;""")
def downgrade():
pass
| 25.296296 | 74 | 0.654466 | 85 | 683 | 5.223529 | 0.576471 | 0.067568 | 0.101351 | 0.094595 | 0.288288 | 0.288288 | 0.288288 | 0.288288 | 0.288288 | 0.288288 | 0 | 0.149425 | 0.235725 | 683 | 26 | 75 | 26.269231 | 0.701149 | 0.247438 | 0 | 0.166667 | 0 | 0 | 0.65415 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.166667 | false | 0.083333 | 0.083333 | 0 | 0.25 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
f56f7a467b372625248679de44e305c9ea4a766c | 349 | py | Python | flask_app/__init__.py | crazynayan/tpf2 | 3552163a1dab7cd5e371d752a2651e73e8cd8e1e | [
"MIT"
] | null | null | null | flask_app/__init__.py | crazynayan/tpf2 | 3552163a1dab7cd5e371d752a2651e73e8cd8e1e | [
"MIT"
] | 2 | 2021-03-23T02:46:31.000Z | 2021-08-04T07:39:45.000Z | flask_app/__init__.py | crazynayan/tpf2 | 3552163a1dab7cd5e371d752a2651e73e8cd8e1e | [
"MIT"
] | null | null | null | from flask import Flask
from flask_login import LoginManager
from config import Config
tpf2_app: Flask = Flask(__name__)
tpf2_app.config.from_object(Config)
login = LoginManager(tpf2_app)
login.login_view = 'login'
# noinspection PyPep8
from flask_app import routes
from flask_app.user import login, logout
from flask_app import test_data_routes
| 23.266667 | 40 | 0.82808 | 53 | 349 | 5.169811 | 0.339623 | 0.164234 | 0.131387 | 0.131387 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.013029 | 0.120344 | 349 | 14 | 41 | 24.928571 | 0.879479 | 0.054441 | 0 | 0 | 0 | 0 | 0.015244 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.6 | 0 | 0.6 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
f57621eeb4246270c4d6f7801f73bb708e05689a | 95 | py | Python | src/core/toga/constants/alignment.py | jrwdunham/toga | db343c99d0f174aea86c4656849ea25ffb7bfe7a | [
"BSD-3-Clause"
] | 1 | 2015-11-08T11:41:52.000Z | 2015-11-08T11:41:52.000Z | toga/constants/alignment.py | ericholscher/toga | bc6d0e9c89764ee5bacfdfbddfaa8d6902f56853 | [
"BSD-3-Clause"
] | null | null | null | toga/constants/alignment.py | ericholscher/toga | bc6d0e9c89764ee5bacfdfbddfaa8d6902f56853 | [
"BSD-3-Clause"
] | null | null | null | LEFT_ALIGNED = 0
RIGHT_ALIGNED = 1
CENTER_ALIGNED = 2
JUSTIFIED_ALIGNED = 3
NATURAL_ALIGNED = 4 | 19 | 21 | 0.8 | 15 | 95 | 4.733333 | 0.733333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.061728 | 0.147368 | 95 | 5 | 22 | 19 | 0.814815 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
f57e23cefc91a314334ce79d168311794c929e4d | 3,649 | py | Python | stock/interface/req_interface.py | Ryu0n/stock_prediction | f6d117768ff33f6de95d5b94ce46d2ca07964873 | [
"Unlicense"
] | 6 | 2021-06-01T10:48:40.000Z | 2021-09-10T04:51:07.000Z | stock/interface/req_interface.py | Ryu0n/stock_prediction | f6d117768ff33f6de95d5b94ce46d2ca07964873 | [
"Unlicense"
] | null | null | null | stock/interface/req_interface.py | Ryu0n/stock_prediction | f6d117768ff33f6de95d5b94ce46d2ca07964873 | [
"Unlicense"
] | 1 | 2021-06-01T00:13:15.000Z | 2021-06-01T00:13:15.000Z | import requests
# http://127.0.0.1:8000/rest_api/user/10/
from django.views.decorators.csrf import csrf_exempt
class BaseReq:
def __init__(self):
self.url = 'http://127.0.0.1:8000/rest_api/'
self.login_url = self.url + 'auth/login/'
# 2021.02.14.hsk : 추후에 screts.json으로 통합
self.id = 'admin'
self.password = 'admin'
self.data = None
self.client, self.login_res = self._login(self.login_url, self.id, self.password)
@staticmethod
def _login(login_url, id, password):
client = requests.session()
client.get(login_url)
csrf_token = client.cookies['csrftoken']
login_data = {'Username': id, 'Password': password, 'csrfmiddlewaretoken': csrf_token}
login_res = client.post(login_url, data=login_data)
return client, login_res
@staticmethod
def _ret(res):
if res.status_code in (200, 201):
return res
else:
print('Status Code : [{0}]'.format(res.status_code))
def set_param(self, data):
self.data = data
def get_param(self):
return self.data
class BaseCreate(BaseReq):
def __init__(self):
super().__init__()
@csrf_exempt
def send_post(self):
res = self.client.post(self.url, json=self.data) # self.client(현재 활성화된 로그인 세션)를 사용한 요청
res = self._ret(res)
return res
class BaseRead(BaseReq):
def __init__(self):
super().__init__()
def send_get(self):
res = self.client.get(self.url)
return self._ret(res)
class BaseUpdate(BaseReq):
"""
2021.02.14.hsk : 추후 변경 필요
"""
def __init__(self):
super().__init__()
def send_put(self):
res = self.client.put(self.url, json=self.data)
return self._ret(res)
def send_patch(self):
res = self.client.patch(self.url, json=self.data)
return self._ret(res)
class BaseDelete(BaseReq):
"""
2021.02.14.hsk : 추후 변경 필요
"""
def __init__(self):
super().__init__()
def send_delete(self):
res = self.client.delete(self.url)
return self._ret(res)
class CreateMarketReq(BaseCreate):
def __init__(self):
super().__init__()
self.url += 'market/'
# 주식시장
class ReadMarketReq(BaseRead):
def __init__(self):
super().__init__()
self.url += 'market/'
class UpdateMarketReq(BaseUpdate):
def __init__(self):
super().__init__()
self.url += 'market/'
class DeleteMarketReq(BaseDelete):
def __init__(self):
super().__init__()
self.url += 'market/'
# 주식종목
class CreateItemListReq(BaseCreate):
def __init__(self):
super().__init__()
self.url += 'item_list/'
class ReadItemListReq(BaseRead):
def __init__(self, stock_market_name):
super().__init__()
self.url += ('item_list/?stock_market_name=' + stock_market_name)
class UpdateItemListReq(BaseUpdate):
def __init__(self):
super().__init__()
self.url += 'item_list/'
class DeleteItemListReq(BaseDelete):
def __init__(self):
super().__init__()
self.url += 'item_list/'
# 주식종목 데이터
class CreateItemReq(BaseCreate):
def __init__(self):
super().__init__()
self.url += 'item/'
class ReadItemReq(BaseRead):
def __init__(self):
super().__init__()
self.url += 'item/'
class UpdateItemReq(BaseUpdate):
def __init__(self):
super().__init__()
self.url += 'item/'
class DeleteItemReq(BaseDelete):
def __init__(self):
super().__init__()
self.url += 'item/'
| 22.80625 | 95 | 0.605645 | 438 | 3,649 | 4.646119 | 0.232877 | 0.114005 | 0.091892 | 0.117936 | 0.432924 | 0.42113 | 0.392629 | 0.351843 | 0.276167 | 0.089435 | 0 | 0.019608 | 0.259249 | 3,649 | 159 | 96 | 22.949686 | 0.733259 | 0.050699 | 0 | 0.485714 | 0 | 0 | 0.064761 | 0.00846 | 0 | 0 | 0 | 0 | 0 | 1 | 0.247619 | false | 0.038095 | 0.019048 | 0.009524 | 0.504762 | 0.009524 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
f5925053ac69bdbffe31ea63ae2a1f5ac4bb0066 | 804 | py | Python | test.py | WhiteSpotTrading/igdatacollector | c7d5d7cacccf77b7646ffcce81e5ee23eaee3019 | [
"Apache-2.0"
] | null | null | null | test.py | WhiteSpotTrading/igdatacollector | c7d5d7cacccf77b7646ffcce81e5ee23eaee3019 | [
"Apache-2.0"
] | null | null | null | test.py | WhiteSpotTrading/igdatacollector | c7d5d7cacccf77b7646ffcce81e5ee23eaee3019 | [
"Apache-2.0"
] | null | null | null | from igdatacollector import Timeseries
import sqlalchemy
a = Timeseries(epic='IX.D.OMX.IFD.IP', resolution='D')
#a.getTimeseries(start_date='2017-08-01', end_date='2017-08-05')
a.getTimesseries_from_file(path='/Users/Carlwestman/PycharmProjects/WhiteSpotTrading/test-data-store/raw/CS.D.USDSEK.CFD.IP_hourly.csv',csv=True)
a.store_as_csv('/Users/Carlwestman/PycharmProjects/WhiteSpotTrading/test-data-store/pyalgotradeformatted/test.csv')
engine = sqlalchemy.create_engine('postgresql+psycopg2://data_manager:localdevpassword@localhost/postgres')
a.store_to_psql(engine, if_exists='replace')
#print a.dataframe.head()
#print a.last_updates
b = Timeseries(epic="IX.D.OMX.IFD.IP", resolution='D')
b.getTimeseries_from_sql(engine=engine, maxLength=10)
print b.dataframe
print type(a.last_entry_date) | 36.545455 | 145 | 0.804726 | 118 | 804 | 5.338983 | 0.542373 | 0.044444 | 0.050794 | 0.053968 | 0.304762 | 0.304762 | 0.304762 | 0.114286 | 0.114286 | 0 | 0 | 0.024869 | 0.049751 | 804 | 22 | 146 | 36.545455 | 0.799738 | 0.133085 | 0 | 0 | 0 | 0.090909 | 0.441727 | 0.385612 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0.090909 | 0.181818 | null | null | 0.181818 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
192347cf900546b4649b80d0bf15358a9391f129 | 636 | py | Python | week_6/c_3.py | XiaochenCui/cryptography-homework | 175d5ac354d22a52fee455fd1e151bb0ce0e605c | [
"MIT"
] | 2 | 2018-06-06T00:13:42.000Z | 2019-03-02T06:44:23.000Z | week_6/c_3.py | XiaochenCui/cryptography-homework | 175d5ac354d22a52fee455fd1e151bb0ce0e605c | [
"MIT"
] | null | null | null | week_6/c_3.py | XiaochenCui/cryptography-homework | 175d5ac354d22a52fee455fd1e151bb0ce0e605c | [
"MIT"
] | 2 | 2018-11-12T09:57:48.000Z | 2020-07-10T07:32:03.000Z | from gmpy2 import (
mpz,
isqrt,
mul,
sub,
t_div,
)
N = mpz(720062263747350425279564435525583738338084451473999841826653057981916355690188337790423408664187663938485175264994017897083524079135686877441155132015188279331812309091996246361896836573643119174094961348524639707885238799396839230364676670221627018353299443241192173812729276147530748597302192751375739387929)
A2 = 2 * isqrt(6 * N) + 1
x2 = isqrt(A2 * A2 - 24 * N)
p = t_div((A2 - x2), 6)
q = t_div((A2 + x2), 4)
print((p, q))
print(p * q == N)
print(p - q)
p = t_div((A2 - x2), 4)
q = t_div((A2 + x2), 6)
print((p, q))
print(p * q == N)
print(p - q)
| 24.461538 | 318 | 0.72327 | 68 | 636 | 6.691176 | 0.308824 | 0.079121 | 0.092308 | 0.07033 | 0.184615 | 0.096703 | 0.096703 | 0.096703 | 0.096703 | 0.096703 | 0 | 0.617537 | 0.157233 | 636 | 25 | 319 | 25.44 | 0.231343 | 0 | 0 | 0.3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.05 | 0 | 0.05 | 0.3 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
195122fd8473a1b278227b4077a75f01a2ff535f | 1,687 | py | Python | Neo4jQueries.py | harishvc/githubanalytics | 27663a472388128df1b0c5678744f92f636c5a2c | [
"MIT"
] | 32 | 2015-02-21T06:52:42.000Z | 2021-01-13T01:44:45.000Z | Neo4jQueries.py | harishvc/githubanalytics | 27663a472388128df1b0c5678744f92f636c5a2c | [
"MIT"
] | 77 | 2015-01-08T05:24:22.000Z | 2016-11-29T15:00:28.000Z | Neo4jQueries.py | harishvc/githubanalytics | 27663a472388128df1b0c5678744f92f636c5a2c | [
"MIT"
] | 7 | 2015-09-17T08:07:47.000Z | 2021-01-13T01:44:46.000Z | from py2neo import authenticate, Graph
import os.path
import bleach
import sys
from flask import Flask
app = Flask(__name__)
def FindSimilarRepositories(InputrepoK):
#Sanitize input
print("got ......",InputrepoK)
sys.stdout.flush()
Inputrepo = bleach.clean(InputrepoK).strip()
host = os.environ['LOCALNEO4JIPPORT']
login = os.environ['LOCALNEO4JLOGIN']
password = os.environ['LOCALNEO4JPASSWORD']
authenticate(host,login,password)
graph = Graph(os.environ['neoURLlocal'])
output = ""
path1 = "<a href=\"/?q=repository "
path2 = "&action=Search\" class=\"repositoryinfo\">"
path3 = "</a>"
#Find similar repository > 1 connections
query1="MATCH (a {id:\"" + Inputrepo + "\"})"
query2="-[r1:IS_ACTOR|IN_ORGANIZATION]->(match)<-[r2:IS_ACTOR|IN_ORGANIZATION]-(b) "
query3="with b, collect (distinct match.id) as connections, collect (distinct type(r1)) as rel1 "
query4="where length(connections) >= 1 return b.id,length(connections) as count,length(rel1) as rel "
query5="order by length(connections) desc limit 5"
query = query1 + query2 + query3 + query4 + query5
#print query
a = graph.cypher.execute(query)
for record in a:
if (record['rel'] < 2):
output += "<li>" + path1 + record['b.id'] + path2 + record['b.id'] + path3 + ": " + str(record['count']) + " contributors in common</li>"
else:
output += "<li>" + path1 + record['b.id'] + path2 + record['b.id'] + path3 + ": " + str(record['count']-1) + " contributors in common & belong to same organization</li>"
if (len(output) > 0):
return ("<ul>" + output + "</ul>")
else:
#Nothing found!
return "<span class=\"text-danger\">You got me stumped!</span>"
| 37.488889 | 179 | 0.662122 | 217 | 1,687 | 5.110599 | 0.483871 | 0.013526 | 0.032462 | 0.037872 | 0.099188 | 0.099188 | 0.099188 | 0.099188 | 0.099188 | 0.099188 | 0 | 0.023994 | 0.160047 | 1,687 | 44 | 180 | 38.340909 | 0.758645 | 0.046236 | 0 | 0.057143 | 0 | 0.057143 | 0.389651 | 0.061097 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0.057143 | 0.142857 | null | null | 0.028571 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
19544808caf99f9c5265f01d11c9a8596462d909 | 17,856 | py | Python | LoopBack/reportUploader.py | ipqhjjybj/loop_back | 107ce5ed6c6362e5920773051326a5c914223bb9 | [
"MIT"
] | 7 | 2019-10-03T11:09:23.000Z | 2022-02-14T14:36:31.000Z | LoopBack/reportUploader.py | ipqhjjybj/loop_back | 107ce5ed6c6362e5920773051326a5c914223bb9 | [
"MIT"
] | null | null | null | LoopBack/reportUploader.py | ipqhjjybj/loop_back | 107ce5ed6c6362e5920773051326a5c914223bb9 | [
"MIT"
] | 5 | 2020-01-26T14:27:04.000Z | 2021-11-02T11:37:55.000Z | # -*- coding: utf-8 -*-
#
# Copyright 2017 Inc
# @author ipqhjjybj
'''
上传期货的数据
'''
import sys
import os
import six
import numpy as np
import pandas as pd
sys.path.append("..")
from config import *
from connect import *
from reportPyConfig import *
upload_date = datetime.datetime.now().strftime("%Y-%m-%d %H:%M:%S")
# class spreadReportUploader():
# '''
# 上次详细回测报告
# '''
# @staticmethod
# def uploadSpreadBacktestingAssessmentReport(filePath , strategyName):
# try:
# except Exception,ex:
# print ex
class reportUploader():
'''
删除某一天之前的交易报告
'''
@staticmethod
def deleteAllReportBeforeDay( use_date , clear_table_arr = ["`bascktesting_assessment_report`","`pushon_report`","`core_index_report`","`distribute_best_report`","`niuxiong_state_report`","`other_optimal_parameter_report`","`prom_diff_future_report`","`stability_report`","`strategyreportdict`"]):
db = Stock.getDB('mysql')
for table_name in clear_table_arr:
sqll = "delete from %s where `create_date` <= '%s'" % (table_name , use_date)
db.execute(sqll)
db.commit()
'''
上传交易回测报告
'''
@staticmethod
def uploadBacktestingAssessmentReport( filePath , strategyName ):
# 2009/03/27---2017/03/27,2009/03/27---2017/03/27
try:
f = open(filePath , "r")
firstLine = ""
flag = 0
ret = []
i = 0
for line in f:
i = i + 1
line = line.strip()
if flag == 0 :
flag = 1
firstLine = line
continue
if i < 4:
continue
line = line.replace('1.$', '0.0')
line = line.replace('-1.#J', '0.0')
x = line.strip().split(',')
if '---' in x:
continue
x = x[1]
if '%' in x:
x = x[:-1]
if '---' in x :
(withdraw_startdate , withdraw_enddate) = x.strip().split('---')
ret.append(withdraw_startdate)
ret.append(withdraw_enddate)
else:
ret.append(x)
f.close()
# rb,min15,2009/03/27--2016/07/27,3 4 5 1 1 1 1 1 1 1 10 10 10 0 10 10 1 10 1
(code , period , time_during , setValues) = firstLine.strip().split(',')
arr = time_during.strip().split('--')
start_date , end_date = arr
ret = [strategyName , setValues , code , period , start_date , end_date , upload_date ] + ret
ret = [str(x) for x in ret]
fuck = [x for x in ret if '%' in x]
ret = ["'" + x + "'" for x in ret]
line = ','.join(ret)
sqll = config_bascktesting_assessment_report2 + " (NULL," + line + ")"
db = Stock.getDB('mysql')
db.execute(sqll)
db.commit()
n_id = db.lastRowID()
return n_id
except Exception,ex:
print ex
print "Error in %s %s " % (filePath , strategyName)
return 0
'''
上传组合回测报告
'''
@staticmethod
def uploadCombinationAssessmentReport( filePath , strategyName):
try:
f = open(filePath , "r")
firstLine = ""
i = 0
content_arr = []
for line in f:
line = line.strip()
i = i + 1
if i == 1:
firstLine = line
if i < 2:
continue
content_arr.append(line)
f.close()
contents = '\n'.join(content_arr)
ret = [strategyName , firstLine , contents]
ret = [str(x) for x in ret]
ret = ["'" + x + "'" for x in ret]
line = ','.join(ret)
sqll = config_backtesting_combination_report + " (NULL," + line + ")"
#print sqll
db = Stock.getDB('mysql')
db.execute(sqll)
db.commit()
n_id = db.lastRowID()
return n_id
except Exception,ex:
print ex
print "Error in %s %s " % (filePath , strategyName)
return 0
'''
上传交易回测报告
'''
@staticmethod
def uploadPushOnBacktestingReport( filePath , strategyName ):
# 2009/03/27---2017/03/27,2009/03/27---2017/03/27
try:
f = open(filePath , "r")
firstLine = ""
flag = 0
ret = []
i = 0
for line in f:
i = i + 1
line = line.strip()
if flag == 0 :
flag = 1
firstLine = line
continue
if i < 4:
continue
# line = line.replace('-1.#J', '0.0')
# line = line.replace('1.#QO', '0.0')
x = line.strip().split(',')
if '---' in x:
continue
x = x[1]
if '%' in x:
x = x[:-1]
if '---' in x :
(withdraw_startdate , withdraw_enddate) = x.strip().split('---')
ret.append(withdraw_startdate)
ret.append(withdraw_enddate)
else:
ret.append(x)
f.close()
# rb,min15,2009/03/27--2016/07/27,3 4 5 1 1 1 1 1 1 1 10 10 10 0 10 10 1 10 1
(code , period , time_during , setValues) = firstLine.strip().split(',')
arr = time_during.strip().split('--')
start_date , end_date = arr
ret = [strategyName , setValues , code , period , start_date , end_date , upload_date ] + ret
ret = [str(x) for x in ret]
fuck = [x for x in ret if '%' in x]
ret = ["'" + x + "'" for x in ret]
line = ','.join(ret)
sqll = config_bascktesting_assessment_report3 + " (NULL," + line + ")"
db = Stock.getDB('mysql')
db.execute(sqll)
db.commit()
n_id = db.lastRowID()
return n_id
except Exception,ex:
print ex
print "Error in %s %s " % (filePath , strategyName)
return 0
'''
上传推进报告
'''
@staticmethod
def uploadPushOnReport( filePath , strategyName):
try:
f = open(filePath , "r")
firstLine = ""
i = 0
content_arr = []
for line in f:
line = line.strip()
i = i + 1
if i == 1:
firstLine = line
if i < 4:
continue
# line = line.replace('-1.#J', '0.0')
# line = line.replace('1.#QO', '0.0')
content_arr.append(line)
f.close()
contents = '\n'.join(content_arr)
(code , period , time_during , setValues , ybn_months, ybw_months , tuijin_months ) = firstLine.strip().split(',')
arr = time_during.strip().split('--')
start_date , end_date = arr
ret = [strategyName , setValues , code , period , start_date , end_date , upload_date , ybn_months, ybw_months , tuijin_months , contents]
ret = ["'" + x + "'" for x in ret]
line = ','.join(ret)
sqll = config_pushon_report + " (NULL," + line + ")"
db = Stock.getDB('mysql')
db.execute(sqll)
db.commit()
n_id = db.lastRowID()
return n_id
except Exception,ex:
print ex
print "Error in %s %s " % (filePath , strategyName)
return 0
'''
core_index_Report
'''
@staticmethod
def uploadCoreIndexReport( filePath , strategyName):
try:
f = open(filePath , "r")
firstLine = ""
i = 0
content_arr = []
for line in f:
i = i + 1
line = line.strip().decode('utf-8')
if i == 1:
firstLine = line
continue
if i < 4 :
continue
# line = line.replace('-1.#J', '0.0')
# line = line.replace('1.#QO', '0.0')
content_arr.append(line)
f.close()
(code , period , time_during1 , time_during2 , setValues ) = firstLine.strip().split(',')
(ybn_start_date , ybn_end_date) = time_during1.split('--')
(ybw_start_date , ybw_end_date) = time_during2.split('--')
contents = '\n'.join(content_arr)
#contents = ""
ret = [strategyName , setValues , code , period , ybn_start_date , ybn_end_date , ybw_start_date , ybw_end_date , upload_date , contents]
ret = ["'" + x + "'" for x in ret]
line = ','.join(ret)
sqll = config_core_index_report + " (NULL," + line + ")"
#print sqll
db = Stock.getDB('mysql')
db.execute(sqll)
db.commit()
n_id = db.lastRowID()
return n_id
except Exception,ex:
print ex
print "Error in %s %s " % (filePath , strategyName)
return 0
'''
distribute_best_report
'''
@staticmethod
def uploadDistributeBestReport( filePath , strategyName):
try:
f = open(filePath , "r")
firstLine = ""
i = 0
content_arr = []
for line in f:
i = i + 1
line = line.strip().decode('utf-8')
if i == 1:
firstLine = line
continue
if i < 3:
continue
# line = line.replace('-1.#J', '0.0')
# line = line.replace('1.#QO', '0.0')
content_arr.append(line)
f.close()
(code , period , time_during1 , setValues) = firstLine.strip().split(',')
(start_date , end_date) = time_during1.split('--')
contents = '\n'.join(content_arr)
ret = [strategyName , setValues , code , period , start_date , end_date , upload_date , contents]
ret = ["'" + x + "'" for x in ret]
line = ','.join(ret)
sqll = config_distribute_best_report + " (NULL," + line + ")"
db = Stock.getDB('mysql')
db.execute(sqll)
db.commit()
n_id = db.lastRowID()
return n_id
except Exception,ex:
print ex
print "Error in %s %s " % (filePath , strategyName)
return 0
'''
牛熊阶段报告
'''
@staticmethod
def uploadNiuxiong_state_report( filePath , strategyName):
try:
f = open(filePath , "r")
firstLine = ""
i = 0
content_arr = []
for line in f:
i = i + 1
line = line.strip().decode('utf-8')
if i == 1:
firstLine = line
if i < 3:
continue
content_arr.append(line)
f.close()
(code , period , setValues) = firstLine.strip().split(',')
contents = '\n'.join(content_arr)
ret = [strategyName , setValues , code , period , upload_date ,contents]
ret = ["'" + x + "'" for x in ret]
line = ','.join(ret)
sqll = config_niuxiong_state_report + " (NULL," + line + ")"
db = Stock.getDB('mysql')
db.execute(sqll)
db.commit()
n_id = db.lastRowID()
return n_id
except Exception,ex:
print ex
print "Error in %s %s " % (filePath , strategyName)
return 0
'''
其他可选参数报告
'''
@staticmethod
def uploadOtherOptiomalParameterReport( filePath , strategyName):
try:
f = open(filePath , "r")
firstLine = ""
i = 0
content_arr = []
for line in f:
i = i + 1
line = line.strip().decode('utf-8')
if i == 1:
firstLine = line
if i < 3:
continue
content_arr.append(line)
f.close()
(code , period , time_during1 , setValues) = firstLine.strip().split(',')
(start_date , end_date) = time_during1.split('--')
contents = '\n'.join(content_arr)
ret = [strategyName , setValues , code , period , start_date , end_date , upload_date , contents]
ret = ["'" + x + "'" for x in ret]
line = ','.join(ret)
sqll = config_other_optimal_report + " (NULL," + line + ")"
db = Stock.getDB('mysql')
db.execute(sqll)
db.commit()
n_id = db.lastRowID()
return n_id
except Exception,ex:
print ex
print "Error in %s %s " % (filePath , strategyName)
return 0
'''
prom报告
'''
@staticmethod
def uploadPromDiffFutureReport(filePath , strategyName):
try:
f = open(filePath , "r")
firstLine = ""
i = 0
content_arr = []
for line in f:
i = i + 1
line = line.strip().decode('utf-8')
if i == 1:
firstLine = line
if i < 4:
continue
content_arr.append(line)
f.close()
(code , period , time_during1 , setValues) = firstLine.strip().split(',')
(start_date , end_date) = time_during1.split('--')
contents = '\n'.join(content_arr)
ret = [strategyName , setValues , code , period , start_date , end_date , upload_date , contents]
ret = ["'" + x + "'" for x in ret]
line = ','.join(ret)
sqll = config_prom_diff_future_report + " (NULL," + line + ")"
db = Stock.getDB('mysql')
db.execute(sqll)
db.commit()
n_id = db.lastRowID()
return n_id
except Exception,ex:
print ex
print "Error in %s %s " % (filePath , strategyName)
return 0
'''
上次交易交易收益报告
'''
@staticmethod
def uploadTradingResultFigure(filePath , strategyName):
try:
f = open(filePath , "r")
firstLine = ""
flag = 0
ret = []
i = 0
content_arr = []
for line in f:
i = i + 1
line = line.strip()
if flag == 0:
flag = 1
firstLine = line
continue
if i < 2:
continue
content_arr.append(line)
f.close()
try:
(code , period , time_during1 , setValues) = firstLine.strip().split(',')
(start_date , end_date) = time_during1.split('--')
except Exception,ex:
(code , period , time_during1 , setValues) = ["","","",""]
(start_date , end_date) = ["",""]
contents = '\n'.join(content_arr)
ret = [strategyName , setValues , code , period , start_date , end_date , upload_date , contents]
ret = ["'" + x + "'" for x in ret]
line = ','.join(ret)
sqll = config_upload_best_figure + " (NULL," + line + ")"
db = Stock.getDB('mysql')
db.execute(sqll)
db.commit()
n_id = db.lastRowID()
return n_id
except Exception,ex:
print ex
print "Error in %s %s " % (filePath , strategyName)
return 0
'''
stability report
'''
@staticmethod
def uploadStability_report(filePath , strategyName):
try:
f = open(filePath , "r")
firstLine = ""
i = 0
content_arr = []
for line in f:
i = i + 1
line = line.strip().decode('utf-8')
if i == 1:
firstLine = line
if i < 4:
continue
content_arr.append(line)
f.close()
(code , period , time_during1 , setValues) = firstLine.strip().split(',')
(start_date , end_date) = time_during1.split('--')
contents = '\n'.join(content_arr)
ret = [strategyName , setValues , code , period , start_date , end_date , upload_date , contents]
ret = ["'" + x + "'" for x in ret]
line = ','.join(ret)
sqll = config_statbility_report + " (NULL," + line + ")"
db = Stock.getDB('mysql')
db.execute(sqll)
db.commit()
n_id = db.lastRowID()
return n_id
except Exception,ex:
print ex
print "Error in %s %s " % (filePath , strategyName)
return 0
@staticmethod
def uploadFileLists( fileListPath = "./output/fileLists.csv"):
f = open(fileListPath , "r")
r = reportUploader()
ret_id = []
strategyName_list = []
upload_name = ""
i = 0
for line in f:
i = i + 1
line = line.strip()
if i < 2:
upload_name = line
continue
tmp_arr = line.split('/')
strategyName = tmp_arr[2]
strategyName_list.append(strategyName)
if os.path.exists(line):
if "backtesting_assessment_report" in line:
n_id = r.uploadBacktestingAssessmentReport(line, strategyName)
ret_id.append( "backtesting_assessment_report:" + str(n_id))
print "upload backtesting_assessment_report succes!"
if "push_backtesting_report" in line:
n_id = r.uploadPushOnBacktestingReport(line, strategyName)
ret_id.append( "push_backtesting_report:" + str(n_id))
print "upload push_backtesting_report succes!"
if "PushOnReport" in line:
n_id = r.uploadPushOnReport(line, strategyName)
ret_id.append( "PushOnReport:" + str(n_id))
print "upload PushOnReport succes!"
if "Core_index" in line:
n_id = r.uploadCoreIndexReport(line, strategyName)
ret_id.append( "Core_index:" + str(n_id))
print "upload Core_index succes!"
if "distribute-best" in line:
n_id = r.uploadDistributeBestReport(line, strategyName)
ret_id.append( "distribute-best:" + str(n_id))
print "upload distribute-best succes!"
if "niuxiong_state" in line:
n_id = r.uploadNiuxiong_state_report(line, strategyName)
ret_id.append( "niuxiong_state:" + str(n_id))
print "upload niuxiong_state succes!"
if "Other_optimal_parameter_sets" in line:
n_id = r.uploadOtherOptiomalParameterReport(line, strategyName)
ret_id.append( "Other_optimal_parameter_sets:" + str(n_id))
print "upload Other_optimal_parameter_sets succes!"
if "PROM_of_each_future_in_diff_period" in line:
n_id = r.uploadPromDiffFutureReport(line, strategyName)
ret_id.append( "PROM_of_each_future_in_diff_period:" + str(n_id))
print "upload PROM_of_each_future_in_diff_period succes!"
if "stability" in line:
n_id = r.uploadStability_report(line, strategyName)
ret_id.append( "stability:" + str(n_id))
print "upload stability succes!"
if "best-figure" in line:
n_id = r.uploadTradingResultFigure(line , strategyName)
ret_id.append( "best-figure:" + str(n_id))
print "upload best-figure succes!"
if "combination-report" in line:
n_id = r.uploadCombinationAssessmentReport(line , strategyName)
ret_id.append( "combination-report:" + str(n_id))
print "upload combination-report success!"
f.close()
id_new_line = ','.join(ret_id)
strategyName_list = list(set(strategyName_list))
strategyName_list.sort()
strategy_line = ','.join(strategyName_list)
ret = [strategy_line, id_new_line , upload_date + ":" + upload_name]
ret = ["'" + x + "'" for x in ret]
line = ','.join(ret)
sqll = config_upload_file_dict + " (NULL," + line + ")"
db = Stock.getDB('mysql')
db.execute(sqll)
db.commit()
# 抓取以及上传的代码
if __name__ == '__main__':
r = reportUploader()
#print r.uploadBacktestingAssessmentReport("./report/LivermoreStrategyTest2/rb-min15-2009-03-27-2017-07-27--backtesting_assessment_report.csv" , "LivermoreStrategyTest2")
#r.uploadBacktestingAssessmentReport("./report/aligatorStrategy/rb-min15-2009-03-27-2016-07-27--backtesting_assessment_report.csv" , "aligatorStrategy")
#r.uploadPushOnReport("./report/aligatorStrategy/PushOnReport_based_on_rb_min15_2009-03-27_2016-07-27_36_06.csv" ,"aligatorStrategy")
#r.uploadCoreIndexReport("./report/aligatorStrategy/rb-all_period-2010-03-27-2015-03-27-2015-03-28-2050-03-27-Core_index_of_in-sample_and_out-of-sample_in_diff_period.csv" , "aligatorStrategy")
#r.uploadDistributeBestReport("./report/aligatorStrategy/rb-min15-2009-03-27-2016-07-27--distribute-best.csv" , "aligatorStrategy")
#r.uploadNiuxiong_state_report("./report/aligatorStrategy/capital_of_each_future_in_diff_period_in_diff_niuxiong_state_(Based_on_rb-min15-_best_parameter).csv" , "aligatorStrategy")
#r.uploadOtherOptiomalParameterReport("./report/aligatorStrategy/rb-min15-2009-03-27-2016-07-27--Other_optimal_parameter_sets.csv","aligatorStrategy")
#r.uploadPromDiffFutureReport("./report/aligatorStrategy/PROM_of_each_future_in_diff_period_(Based_on_rb-min15-2009-03-27-2016-07-27_best_parameter).csv","aligatorStrategy")
#r.uploadStability_report("./report/aligatorStrategy/rb-min15-2009-03-27-2016-07-27--stability.csv" , "aligatorStrategy")
#r.deleteAllReportBeforeDay( upload_date )
r.uploadFileLists() | 29.034146 | 298 | 0.631776 | 2,344 | 17,856 | 4.65273 | 0.088311 | 0.012103 | 0.018705 | 0.02494 | 0.681185 | 0.617733 | 0.579406 | 0.562168 | 0.560334 | 0.560334 | 0 | 0.031715 | 0.217742 | 17,856 | 615 | 299 | 29.034146 | 0.749069 | 0.125728 | 0 | 0.773931 | 0 | 0 | 0.103189 | 0.032937 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.016293 | null | null | 0.06721 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
19684d9e9898830d618f09c4120803a5e3dff40a | 352 | py | Python | ocdskingfisher/sources/digiwhist_sweden.py | odscjames/lhs-alpha | d882cadfcf3464fd29529cb862567dc311d892e2 | [
"BSD-3-Clause"
] | null | null | null | ocdskingfisher/sources/digiwhist_sweden.py | odscjames/lhs-alpha | d882cadfcf3464fd29529cb862567dc311d892e2 | [
"BSD-3-Clause"
] | null | null | null | ocdskingfisher/sources/digiwhist_sweden.py | odscjames/lhs-alpha | d882cadfcf3464fd29529cb862567dc311d892e2 | [
"BSD-3-Clause"
] | null | null | null | from ocdskingfisher.sources.digiwhist_base import DigiwhistBaseSource
class DigiwhistSwedenRepublicSource(DigiwhistBaseSource):
publisher_name = 'Digiwhist Sweden'
url = 'https://opentender.eu/download'
source_id = 'digiwhist_sweden'
def get_data_url(self):
return 'https://opentender.eu/data/files/SE_ocds_data.json.tar.gz'
| 32 | 74 | 0.769886 | 40 | 352 | 6.575 | 0.75 | 0.114068 | 0.129278 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.133523 | 352 | 10 | 75 | 35.2 | 0.862295 | 0 | 0 | 0 | 0 | 0 | 0.338068 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0 | 0.142857 | 0.142857 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 2 |
196990a27ac0854fd557313280f98453d24dd4e0 | 435 | py | Python | third/cli_google_fire.py | gottaegbert/penter | 8cbb6be3c4bf67c7c69fa70e597bfbc3be4f0a2d | [
"MIT"
] | 13 | 2020-01-04T07:37:38.000Z | 2021-08-31T05:19:58.000Z | third/cli_google_fire.py | gottaegbert/penter | 8cbb6be3c4bf67c7c69fa70e597bfbc3be4f0a2d | [
"MIT"
] | 3 | 2020-06-05T22:42:53.000Z | 2020-08-24T07:18:54.000Z | third/cli_google_fire.py | gottaegbert/penter | 8cbb6be3c4bf67c7c69fa70e597bfbc3be4f0a2d | [
"MIT"
] | 9 | 2020-10-19T04:53:06.000Z | 2021-08-31T05:20:01.000Z | import fire
def hello(name="World"):
return "Hello %s!" % name
if __name__ == '__main__':
fire.Fire(hello)
"""
[Google 开源的 Python 命令行库：深入 fire（二）](https://mp.weixin.qq.com/s?__biz=MzA5MzYyNzQ0MQ==&mid=2247485006&idx=1&sn=d80725f349677658bff372bfc770e1de)
https://github.com/google/python-fire
python hello.py # Hello World!
python hello.py --name=David # Hello David!
python hello.py --help # Shows usage information.
"""
| 22.894737 | 143 | 0.717241 | 62 | 435 | 4.870968 | 0.580645 | 0.109272 | 0.129139 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.089005 | 0.121839 | 435 | 18 | 144 | 24.166667 | 0.701571 | 0 | 0 | 0 | 0 | 0 | 0.191304 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | false | 0 | 0.2 | 0.2 | 0.6 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 2 |
196bd4945ce188e9357acd55ca1172b34997c1a7 | 24,336 | py | Python | usienarl/agent.py | InsaneMonster/USienaRL | 95eb35913b448c970b83ab941a24657156cfcd9b | [
"BSD-3-Clause"
] | 6 | 2019-08-24T08:40:09.000Z | 2020-05-20T10:54:26.000Z | usienarl/agent.py | InsaneMonster/USienaRL | 95eb35913b448c970b83ab941a24657156cfcd9b | [
"BSD-3-Clause"
] | null | null | null | usienarl/agent.py | InsaneMonster/USienaRL | 95eb35913b448c970b83ab941a24657156cfcd9b | [
"BSD-3-Clause"
] | null | null | null | #
# Copyright (C) 2019 Luca Pasqualini
# University of Siena - Artificial Intelligence Laboratory - SAILab
#
#
# USienaRL is licensed under a BSD 3-Clause.
#
# You should have received a copy of the license along with this
# work. If not, see <https://opensource.org/licenses/BSD-3-Clause>.
# Import packages
import logging
import tensorflow
import numpy
# Import required src
from usienarl import Interface, SpaceType
class Agent:
"""
Base agent abstract class.
An agent defines who or what operates in a certain environment during a certain experiment.
An agent can act and being updated, but the inner working (model, policies and so on) are left to be decided by the
implementation.
An agent needs to be generated before running, and generation is done when executing agent setup.
Any agent can act in three different modes:
- warmup mode, before training (not all agents required that, it depends on the agent inner model)
- train mode, during training
- inference mode, when exploiting
One or more policies can be defined for each one of these modes.
To define your own agent, implement the abstract class in a specific child class.
"""
def __init__(self,
name: str):
# Define internal attributes
self._name: str = name
# Define empty attributes
self._saver = None
self._scope: str or None = None
self._summary_writer = None
self._parallel: int or None = None
self._summary_path: str or None = None
self._save_path: str or None = None
self._saves_to_keep: int or None = None
self._observation_space_type: SpaceType or None = None
self._observation_space_shape = None
self._agent_action_space_type: SpaceType or None = None
self._agent_action_space_shape = None
self._save_counter: int or None = None
def setup(self,
logger: logging.Logger,
scope: str,
parallel: int,
observation_space_type: SpaceType, observation_space_shape: (),
agent_action_space_type: SpaceType, agent_action_space_shape: (),
summary_path: str = None, save_path: str = None, saves_to_keep: int = 0) -> bool:
"""
Setup the agent, preparing all its components for execution.
:param logger: the logger used to print the agent information, warnings and errors
:param scope: the experiment scope encompassing the agent scope
:param parallel: the amount of parallel episodes run by the experiment, must be greater than zero
:param observation_space_type: the space type of the observation space
:param observation_space_shape: the shape of the observation space, as a tuple
:param agent_action_space_type: the space type of the agent action space
:param agent_action_space_shape: the shape of the agent action space, as a tuple
:param summary_path: the optional path of the summary writer of the agent
:param save_path: the optional path where to save metagraphs checkpoints of the agent's model
:param saves_to_keep: the optional number of checkpoint saves to keep, it does nothing if there is no save path
:return: True if setup is successful, False otherwise
"""
# Make sure parameters are correct
assert(parallel > 0 and saves_to_keep >= 0)
logger.info("Setup of agent " + self._name + " with scope " + scope + "...")
# Reset agent attributes
self._scope = scope
self._parallel = parallel
self._summary_path = summary_path
self._save_path = save_path
self._saves_to_keep = saves_to_keep
self._observation_space_type: SpaceType = observation_space_type
self._observation_space_shape = observation_space_shape
self._agent_action_space_type: SpaceType = agent_action_space_type
self._agent_action_space_shape = agent_action_space_shape
# Try to generate the agent inner model
if not self._generate(logger,
observation_space_type, observation_space_shape,
agent_action_space_type, agent_action_space_shape):
return False
# Define the summary writer if required
if summary_path is not None:
self._summary_writer = tensorflow.summary.FileWriter(summary_path, graph=tensorflow.get_default_graph())
logger.info("A Tensorboard summary for the agent will be updated during training of its internal model")
logger.info("Tensorboard summary path: " + summary_path)
# Define the saver if required
if self._save_path is not None and self._save_path and self._saves_to_keep > 0:
self._saver = tensorflow.train.Saver(self.saved_variables, max_to_keep=self._saves_to_keep)
if self._saves_to_keep > 1:
logger.info("Agent model metagraph will be saved after each training/validation pair. A set of " + str(self._saves_to_keep) + " models will be stored.")
else:
logger.info("Agent model metagraph will be saved after each training/validation pair")
logger.info("Agent model metagraphs are saved at " + self._save_path)
self._save_counter: int = 0
# Validate setup
return True
def restore(self,
logger: logging.Logger,
session,
path: str) -> bool:
"""
Restore the agent's model from the checkpoint at the given path.
:param logger: the logger used to print the agent information, warnings and errors
:param session: the session of tensorflow currently running
:param path: the path from which to restore, it is required
:return: True if restore is successful, false otherwise
"""
# Make sure parameters are correct
assert(path is not None and path)
# Get checkpoint from path
checkpoint = tensorflow.train.get_checkpoint_state(path)
# If no saver is defined, define one to restore from checkpoint
if self._saver is None:
self._saver = tensorflow.train.Saver(self.saved_variables)
# If checkpoint exists restore from checkpoint
if checkpoint and checkpoint.model_checkpoint_path:
self._saver.restore(session, tensorflow.train.latest_checkpoint(path))
logger.info("Model graph stored at " + path + " loaded successfully!")
return True
logger.error("Checkpoint path specified is wrong: no model can be accessed at " + path)
return False
def save(self,
logger: logging.Logger,
session):
"""
Save the agent's model metagraph. It does nothing if a saver is not defined.
:param logger: the logger used to print the agent information, warnings and errors
:param session: the session of tensorflow currently running
"""
# Check if the saver exists or something has to be saved
if self._saver is None or self._save_path is None or not self._save_path or self._saves_to_keep <= 0:
return
logger.info("Saving the agent " + self._name + " metagraph at path " + self._save_path + "...")
self._saver.save(session, self._save_path, self._save_counter)
self._save_counter += 1
logger.info("Agent " + self._name + " metagraph saved successfully")
def _generate(self,
logger: logging.Logger,
observation_space_type: SpaceType, observation_space_shape: (),
agent_action_space_type: SpaceType, agent_action_space_shape: ()) -> bool:
"""
Generate the agent's model. Used to generate all custom components of the agent.
It is always called during setup.
:param logger: the logger used to print the agent information, warnings and errors
:param observation_space_type: the space type of the observation space
:param observation_space_shape: the shape of the observation space, as a tuple
:param agent_action_space_type: the space type of the agent action space
:param agent_action_space_shape: the shape of the agent action space, as a tuple
:return: True if setup is successful, False otherwise
"""
# Abstract method, it should be implemented on a child class basis
raise NotImplementedError()
def initialize(self,
logger: logging.Logger,
session):
"""
Initialize the agent before acting in the environment.
The environment at this stage is already initialized.
:param logger: the logger used to print the agent information, warnings and errors
:param session: the session of tensorflow currently running
"""
# Abstract method, it should be implemented on a child class basis
raise NotImplementedError()
def act_warmup(self,
logger: logging.Logger,
session,
interface: Interface,
agent_observation_current: numpy.ndarray,
warmup_step: int, warmup_episode: int) -> numpy.ndarray:
"""
Take an action given the current agent observation in warmup mode.
Usually it uses a random policy.
:param logger: the logger used to print the agent information, warnings and errors
:param session: the session of tensorflow currently running
:param interface: the interface between the agent and the environment
:param agent_observation_current: the current observation of the agent wrapped in a numpy array
:param warmup_step: the current absolute warm-up step of the experiment the agent is warming-up into
:param warmup_episode: the current absolute warm-up episode of the experiment the agent is warming-up into
:return: the action decided by the agent wrapped in a numpy array
"""
# Abstract method, it should be implemented on a child class basis
raise NotImplementedError()
def act_train(self,
logger: logging.Logger,
session,
interface: Interface,
agent_observation_current: numpy.ndarray,
train_step: int, train_episode: int) -> numpy.ndarray:
"""
Take an action given the current agent observation in train mode.
Usually it uses an exploring policy.
:param logger: the logger used to print the agent information, warnings and errors
:param session: the session of tensorflow currently running
:param interface: the interface between the agent and the environment
:param agent_observation_current: the current observation of the agent wrapped in a numpy array
:param train_step: the current absolute train step of the experiment the agent is training into
:param train_episode: the current absolute train episode of the experiment the agent is training into
:return: the action decided by the agent wrapped in a numpy array
"""
# Abstract method, it should be implemented on a child class basis
raise NotImplementedError()
def act_inference(self,
logger: logging.Logger,
session,
interface: Interface,
agent_observation_current: numpy.ndarray,
inference_step: int, inference_episode: int) -> numpy.ndarray:
"""
Take an action given the current agent observation in validation/test mode.
Usually it uses the best possible policy.
:param logger: the logger used to print the agent information, warnings and errors
:param session: the session of tensorflow currently running
:param interface: the interface between the agent and the environment
:param agent_observation_current: the current observation of the agent wrapped in a numpy array
:param inference_step: the current absolute validation/test step of the experiment the agent is executing into
:param inference_episode: the current absolute validation/test episode of the experiment the agent is executing into
:return: the action decided by the agent wrapped in a numpy array
"""
# Abstract method, it should be implemented on a child class basis
raise NotImplementedError()
def complete_step_warmup(self,
logger: logging.Logger,
session,
interface: Interface,
agent_observation_current: numpy.ndarray,
agent_action: numpy.ndarray,
reward: numpy.ndarray,
episode_done: numpy.ndarray,
agent_observation_next: numpy.ndarray,
warmup_step: int, warmup_episode: int):
"""
Complete a warm-up step.
:param logger: the logger used to print the agent information, warnings and errors
:param session: the session of tensorflow currently running
:param interface: the interface between the agent and the environment
:param agent_observation_current: the current observation of the agent wrapped in a numpy array
:param agent_action: the action taken in the environment as seen by the agent leading from the current observation to the next observation wrapped in a numpy array
:param reward: the reward obtained by the combination of current observation, next observation and action in-between wrapped in a numpy array
:param episode_done: the episode done flag raised by the environment wrapped in a numpy array
:param agent_observation_next: the next observation of the agent wrapped in a numpy array
:param warmup_step: the current absolute warm-up step of the experiment the agent is warming-up into
:param warmup_episode: the current absolute warm-up episode of the experiment the agent is warming-up into
"""
# Abstract method, it should be implemented on a child class basis
raise NotImplementedError()
def complete_step_train(self,
logger: logging.Logger,
session,
interface: Interface,
agent_observation_current: numpy.ndarray,
agent_action: numpy.ndarray,
reward: numpy.ndarray,
episode_done: numpy.ndarray,
agent_observation_next: numpy.ndarray,
train_step: int, train_episode: int):
"""
Complete a train step.
:param logger: the logger used to print the agent information, warnings and errors
:param session: the session of tensorflow currently running
:param interface: the interface between the agent and the environment
:param agent_observation_current: the current observation of the agent wrapped in a numpy array
:param agent_action: the action taken in the environment as seen by the agent leading from the current observation to the next observation wrapped in a numpy array
:param reward: the reward obtained by the combination of current observation, next observation and action in-between wrapped in a numpy array
:param episode_done: the episode done flag raised by the environment wrapped in a numpy array
:param agent_observation_next: the next observation of the agent wrapped in a numpy array
:param train_step: the current absolute train step of the experiment the agent is training into
:param train_episode: the current absolute train episode of the experiment the agent is training into
"""
# Abstract method, it should be implemented on a child class basis
raise NotImplementedError()
def complete_step_inference(self,
logger: logging.Logger,
session,
interface: Interface,
agent_observation_current: numpy.ndarray,
agent_action: numpy.ndarray,
reward: numpy.ndarray,
episode_done: numpy.ndarray,
agent_observation_next: numpy.ndarray,
inference_step: int, inference_episode: int):
"""
Complete an validation/test step..
:param logger: the logger used to print the agent information, warnings and errors
:param session: the session of tensorflow currently running
:param interface: the interface between the agent and the environment
:param agent_observation_current: the current observation of the agent
:param agent_action: the action taken in the environment as seen by the agent leading from the current observation to the next observation
:param reward: the reward obtained by the combination of current observation, next observation and action in-between
:param episode_done: the episode done flag raised by the environment wrapped in a numpy array
:param agent_observation_next: the next observation of the agent
:param inference_step: the current absolute validation/test step of the experiment the agent is executing into
:param inference_episode: the current absolute validation/test episode of the experiment the agent is executing into
"""
# Abstract method, it should be implemented on a child class basis
raise NotImplementedError()
def complete_episode_warmup(self,
logger: logging.Logger,
session,
interface: Interface,
last_step_reward: numpy.ndarray,
episode_total_reward: numpy.ndarray,
warmup_step: int, warmup_episode: int):
"""
Finish a warm-up episode.
:param logger: the logger used to print the agent information, warnings and errors
:param session: the session of tensorflow currently running
:param interface: the interface between the agent and the environment wrapped in a numpy array
:param last_step_reward: the reward obtained in the last step in the passed episode wrapped in a numpy array wrapped in a numpy array
:param episode_total_reward: the reward obtained in the passed episode wrapped in a numpy array
:param warmup_step: the current absolute warm-up step of the experiment the agent is warming-up into
:param warmup_episode: the current absolute warm-up episode of the experiment the agent is warming-up into
"""
# Abstract method, it should be implemented on a child class basis
raise NotImplementedError()
def complete_episode_train(self,
logger: logging.Logger,
session,
interface: Interface,
last_step_reward: numpy.ndarray,
episode_total_reward: numpy.ndarray,
train_step: int, train_episode: int):
"""
Finish a train episode.
:param logger: the logger used to print the agent information, warnings and errors
:param session: the session of tensorflow currently running
:param interface: the interface between the agent and the environment
:param last_step_reward: the reward obtained in the last step in the passed episode wrapped in a numpy array
:param episode_total_reward: the reward obtained in the passed episode wrapped in a numpy array
:param train_step: the current absolute train step of the experiment the agent is training into
:param train_episode: the current absolute train episode of the experiment the agent is training into
"""
# Abstract method, it should be implemented on a child class basis
raise NotImplementedError()
def complete_episode_inference(self,
logger: logging.Logger,
session,
interface: Interface,
last_step_reward: numpy.ndarray,
episode_total_reward: numpy.ndarray,
inference_step: int, inference_episode: int):
"""
Finish an validation/test episode.
:param logger: the logger used to print the agent information, warnings and errors
:param session: the session of tensorflow currently running
:param interface: the interface between the agent and the environment
:param last_step_reward: the reward obtained in the last step in the passed episode wrapped in a numpy array
:param episode_total_reward: the reward obtained in the passed episode wrapped in a numpy array
:param inference_step: the current absolute validation/test step of the experiment the agent is executing into
:param inference_episode: the current absolute validation/test episode of the experiment the agent is executing into
"""
# Abstract method, it should be implemented on a child class basis
raise NotImplementedError()
@property
def name(self) -> str:
"""
The name of the agent.
"""
return self._name
@property
def scope(self) -> str or None:
"""
The scope of the agent.
It is None if agent is not setup.
"""
return self._scope
@property
def parallel(self) -> int or None:
"""
The number of parallel episodes run by the agent.
It is None if agent is not setup.
"""
return self._parallel
@property
def observation_space_type(self) -> SpaceType or None:
"""
The type of the observation space of the agent.
It is None if agent is not setup.
"""
return self._observation_space_type
@property
def observation_space_shape(self) -> () or None:
"""
The shape of the observation space of the agent.
Note: it may differ from the environment's state space shape.
It is None if agent is not setup.
"""
return self._observation_space_shape
@property
def action_space_type(self) -> SpaceType or None:
"""
The type of the action space of the agent.
It is None if agent is not setup.
"""
return self._agent_action_space_type
@property
def action_space_shape(self) -> () or None:
"""
The shape of the action space of the agent.
Note: it may differ from the environment's action space shape.
It is None if agent is not setup.
"""
return self._agent_action_space_shape
@property
def summary_path(self) -> str or None:
"""
The path of the Tensorboard summaries saved by the agent.
It is None if agent is not setup.
"""
return self._summary_path
@property
def save_path(self) -> str or None:
"""
The path of the checkpoint metagraph saves of the agent.
It is None if agent is not setup.
"""
return self._save_path
@property
def saved_variables(self):
"""
The trainable variables of the agent (usually of its model).
"""
# Abstract property, it should be implemented on a child class basis
raise NotImplementedError()
@property
def warmup_steps(self) -> int:
"""
The integer number of warm-up steps required by the agent.
"""
# Abstract property, it should be implemented on a child class basis
raise NotImplementedError()
| 49.971253 | 171 | 0.648011 | 3,026 | 24,336 | 5.096497 | 0.094184 | 0.043574 | 0.016211 | 0.024316 | 0.735054 | 0.712164 | 0.696084 | 0.68707 | 0.655816 | 0.647776 | 0 | 0.000826 | 0.303296 | 24,336 | 486 | 172 | 50.074074 | 0.908758 | 0.520587 | 0 | 0.479798 | 0 | 0 | 0.053246 | 0 | 0 | 0 | 0 | 0 | 0.010101 | 1 | 0.131313 | false | 0 | 0.020202 | 0 | 0.227273 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
1973d94ae13916a5ea183c5b5c9aacba852b10f8 | 1,096 | py | Python | deeppages/middleware.py | ricardofalasca/deep-pages | d1b2a48f62c31e20d767df5c6345e07e4d05290d | [
"MIT"
] | null | null | null | deeppages/middleware.py | ricardofalasca/deep-pages | d1b2a48f62c31e20d767df5c6345e07e4d05290d | [
"MIT"
] | null | null | null | deeppages/middleware.py | ricardofalasca/deep-pages | d1b2a48f62c31e20d767df5c6345e07e4d05290d | [
"MIT"
] | null | null | null | from django.utils.deprecation import MiddlewareMixin
from django.http.response import HttpResponse
from .utils import get_page_by_path
import logging
logger = logging.getLogger(__name__)
class DeepPageTemplateRendererMiddleware(MiddlewareMixin):
''' The goal of this middleware is find the respective page by URL, render
the page content and return it.
'''
# TODO: check where is accessing request.POST/body and change the code.
# Also, create all possible tests before push new version. Maybe this
# should be a version bump to 1.0-stable.
def process_request(self, request):
''' Look for Deep Page's PATH pattern and return a rendered template
'''
# DeepPages must work ONLY if actual response has status_code == 404
# (Not found). Otherwise, there is no reason to interfere into normal
# page response behavior.
if self.get_response(request).status_code == 404:
rendered_page = get_page_by_path(self, request, logger)
if rendered_page:
return HttpResponse(rendered_page)
| 37.793103 | 78 | 0.709854 | 145 | 1,096 | 5.248276 | 0.613793 | 0.023653 | 0.023653 | 0.034166 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.009456 | 0.228102 | 1,096 | 28 | 79 | 39.142857 | 0.890071 | 0.468978 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.035714 | 0 | 1 | 0.090909 | false | 0 | 0.363636 | 0 | 0.636364 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
197a53a0aa02af4926fb9d08fe34627f24605d90 | 2,219 | py | Python | mqttany/modules/gpio/pin/__init__.py | itonelove/mqttany | 2f5d7ea82f1fbcc6cdf7e6095ef51781429acabc | [
"MIT"
] | 8 | 2019-09-14T18:49:20.000Z | 2021-10-02T15:50:39.000Z | mqttany/modules/gpio/pin/__init__.py | itonelove/mqttany | 2f5d7ea82f1fbcc6cdf7e6095ef51781429acabc | [
"MIT"
] | 54 | 2019-08-25T21:04:03.000Z | 2022-03-08T10:32:24.000Z | mqttany/modules/gpio/pin/__init__.py | itonelove/mqttany | 2f5d7ea82f1fbcc6cdf7e6095ef51781429acabc | [
"MIT"
] | 5 | 2019-09-21T06:58:15.000Z | 2021-11-09T19:20:35.000Z | """
********
GPIO Pin
********
:Author: Michael Murton
"""
# Copyright (c) 2019-2021 MQTTany contributors
#
# Permission is hereby granted, free of charge, to any person obtaining a copy
# of this software and associated documentation files (the "Software"), to deal
# in the Software without restriction, including without limitation the rights
# to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
# copies of the Software, and to permit persons to whom the Software is
# furnished to do so, subject to the following conditions:
#
# The above copyright notice and this permission notice shall be included in all
# copies or substantial portions of the Software.
#
# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
# AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
# LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
# OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
# SOFTWARE.
import typing as t
from collections import OrderedDict
from common import update_dict
from gpio.common import PinMode
from . import counter, digital
from .base import Pin
__all__ = ["getPin", "updateConfOptions"]
def getPin(pin_mode: t.Union[PinMode, str]) -> t.Union[t.Type[Pin], None]:
"""
Returns a class for the pin based on the pin mode or ``None`` if one is
not available.
"""
pin_classes: t.Dict[t.Union[PinMode, str], t.Type[Pin]] = {}
pin_classes.update(digital.SUPPORTED_PIN_MODES)
pin_classes.update(counter.SUPPORTED_PIN_MODES)
return pin_classes.get(pin_mode, None)
def updateConfOptions(
conf_options: t.MutableMapping[str, t.Dict[t.Any, t.Any]]
) -> "OrderedDict[str, t.Dict[t.Any, t.Any]]":
"""
Returns a copy of ``conf_options`` updated with options from each pin type.
"""
conf_options = update_dict(conf_options, digital.CONF_OPTIONS)
conf_options = update_dict(conf_options, counter.CONF_OPTIONS)
return t.cast("OrderedDict[str, t.Dict[t.Any, t.Any]]", conf_options)
| 36.983333 | 80 | 0.739522 | 332 | 2,219 | 4.864458 | 0.418675 | 0.0613 | 0.014861 | 0.016718 | 0.104025 | 0.082972 | 0.043344 | 0.033437 | 0 | 0 | 0 | 0.004324 | 0.166291 | 2,219 | 59 | 81 | 37.610169 | 0.868649 | 0.577287 | 0 | 0 | 0 | 0 | 0.112756 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.111111 | false | 0 | 0.333333 | 0 | 0.555556 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
19802a6f35a61c09629b8696f5834fa4bf7861a2 | 2,852 | py | Python | test/test_ddna.py | Aayush9029/DDNA | 82e461fe6f8d578b2f9cc8fc073a8a4812490ad1 | [
"MIT"
] | null | null | null | test/test_ddna.py | Aayush9029/DDNA | 82e461fe6f8d578b2f9cc8fc073a8a4812490ad1 | [
"MIT"
] | null | null | null | test/test_ddna.py | Aayush9029/DDNA | 82e461fe6f8d578b2f9cc8fc073a8a4812490ad1 | [
"MIT"
] | null | null | null | # pylint: skip-file
import random
import string
import pytest
from ddna import DDNA
from helpers.utils import convert_to_bits, convert_to_string
ddna = DDNA()
def generate_random_strings():
"""
Generates 100 random strings of length between 1 and 500.
Example: rdF66~-C-!~!}8gh3;2aRL=b].(,K?GE.]"YEb)]M02H>gA
Example: '1wWq;gRRXM1)rGMg1a$i2%>Zl]6Obx"K2v
"""
for _ in range(100):
yield ''.join(random.choice(string.ascii_letters + string.digits + string.punctuation) for _ in range(random.randint(1, 500)))
def generate_invalid_dna():
"""
Generates 50 invalid dna sequences.
eg: adasdsa
eg: ACTG1234
eg: 32SDIk2...
"""
for _ in range(50):
yield "".join(random.choice(string.ascii_letters) for _ in range(random.randint(1, 500)))
# array of random strings
random_strings = list(generate_random_strings())
# Testing validity of the generated strings (OP)
@pytest.mark.parametrize("random_string", random_strings)
def test_random_string(random_string):
"""
Test that the random string is a string.
"""
assert isinstance(random_string, str)
# Converting strings to DNA Bases
dna_bases = [ddna.encode(random_string) for random_string in random_strings]
# converting dna_bases back to strings
strings = [ddna.decode(dna_base) for dna_base in dna_bases]
# loop throught the list of strings and compare them to the original strings using pytest.mark.parametrize
@pytest.mark.parametrize("random_string, dna_base, string", zip(random_strings, dna_bases, strings))
def test_convert_to_bits(random_string, dna_base, string):
"""
Test that the converted DNA bases are equal to the original strings.
"""
assert random_string == string
# loop through the list of random strings and convert them to bits
bits = [convert_to_bits(random_string) for random_string in random_strings]
# loop through the list of bits and convert them to strings
strings = [convert_to_string(bit) for bit in bits]
# loop through the list of strings and compare them to the original strings using pytest.mark.parametrize
@pytest.mark.parametrize("random_string, bit, string", zip(random_strings, bits, strings))
def test_convert_to_string(random_string, bit, string):
"""
Test that the converted bits are equal to the original strings.
"""
assert random_string == string
# Testing valid dna function
def test_valid_dna_1():
"""
Test that the valid dna function returns True for valid dna sequences.
"""
assert ddna.check_validity("ACGT")
# Testing invalid dna function using loop
@pytest.mark.parametrize("invalid_dna", generate_invalid_dna())
def test_invalid_dna_looped(invalid_dna):
"""
Test that the invalid dna function returns False for invalid dna sequences.
"""
assert not ddna.check_validity(invalid_dna)
| 29.102041 | 134 | 0.734923 | 410 | 2,852 | 4.946341 | 0.256098 | 0.088757 | 0.06213 | 0.039448 | 0.379191 | 0.265286 | 0.265286 | 0.200197 | 0.158777 | 0.158777 | 0 | 0.018236 | 0.173212 | 2,852 | 97 | 135 | 29.402062 | 0.841815 | 0.390954 | 0 | 0.064516 | 1 | 0 | 0.053092 | 0 | 0 | 0 | 0 | 0 | 0.16129 | 1 | 0.225806 | false | 0 | 0.16129 | 0 | 0.387097 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
19a79749d93001a3043834cfbae60265259d87a6 | 1,823 | py | Python | GeneralPythonCodes/Xtra_UnitTestingPythonCode/test_division.py | d1p013/testing | 5cb810d9d3d43a70f677b3e71e386a177bfa99a0 | [
"CC-BY-3.0"
] | null | null | null | GeneralPythonCodes/Xtra_UnitTestingPythonCode/test_division.py | d1p013/testing | 5cb810d9d3d43a70f677b3e71e386a177bfa99a0 | [
"CC-BY-3.0"
] | null | null | null | GeneralPythonCodes/Xtra_UnitTestingPythonCode/test_division.py | d1p013/testing | 5cb810d9d3d43a70f677b3e71e386a177bfa99a0 | [
"CC-BY-3.0"
] | null | null | null | # =========================================================================== #
# Unit Test for the division Module, created by Sourav Sen Gupta.
# =========================================================================== #
# Import unittest and the module to test
import unittest
import division
# =========================================================================== #
# Create a Class to unittest the module
# Inherit from unittest.TestCase class
class TestSomeFunctions(unittest.TestCase):
''' Unit Test class for the module
'''
# Methods to test module functions
def test_naive(self):
''' unittest method
'''
self.assertEqual(division.naive(10,2), 5)
self.assertEqual(division.naive(10,10), 1)
self.assertEqual(division.naive(10,100), 0.1)
self.assertAlmostEqual(division.naive(10,3), 3.3333333)
def test_safe(self):
''' unittest method
'''
self.assertEqual(division.safe(10,2), 5)
self.assertEqual(division.safe(10,10), 1)
self.assertEqual(division.safe(10,100), 0.1)
self.assertAlmostEqual(division.safe(10,3), 3.3333333)
self.assertEqual(division.safe(10,0), float("inf"))
def test_correct(self):
''' unittest method
'''
self.assertEqual(division.correct(10,2), 5)
self.assertEqual(division.correct(10,10), 1)
self.assertEqual(division.correct(10,100), 0.1)
self.assertAlmostEqual(division.correct(10,3), 3.3333333)
self.assertRaises(ValueError, division.correct, 10, 0)
# =========================================================================== #
# Run unittest when the script runs
if __name__ == "__main__":
unittest.main()
# =========================================================================== #
| 35.745098 | 79 | 0.514536 | 183 | 1,823 | 5.065574 | 0.278689 | 0.161812 | 0.248112 | 0.116505 | 0.538296 | 0.427184 | 0.116505 | 0 | 0 | 0 | 0 | 0.058077 | 0.178278 | 1,823 | 50 | 80 | 36.46 | 0.560748 | 0.405924 | 0 | 0 | 0 | 0 | 0.010557 | 0 | 0 | 0 | 0 | 0 | 0.636364 | 1 | 0.136364 | false | 0 | 0.090909 | 0 | 0.272727 | 0 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
19af7665be7802309de5cf89bf0110afd85d263a | 682 | py | Python | member/models.py | constellation-project/constellation | 7208ffe9b8a40e98100ebbd2f173cf99f39b5c1e | [
"BSD-3-Clause"
] | 1 | 2019-12-21T17:52:28.000Z | 2019-12-21T17:52:28.000Z | member/models.py | constellation-project/constellation | 7208ffe9b8a40e98100ebbd2f173cf99f39b5c1e | [
"BSD-3-Clause"
] | null | null | null | member/models.py | constellation-project/constellation | 7208ffe9b8a40e98100ebbd2f173cf99f39b5c1e | [
"BSD-3-Clause"
] | null | null | null | from django.contrib.auth.models import User
from django.db import models
class Member(User):
address = models.CharField(max_length=255)
telephone = models.CharField(max_length=31)
class Organization(User):
address = models.CharField(max_length=255)
manager = models.ForeignKey(Member, on_delete=models.PROTECT, related_name='organizations')
members = models.ManyToManyField(Member)
class Administrator(Member):
pgp = models.CharField(max_length=40)
class Membership(models.Model):
member = models.ForeignKey(Member, on_delete=models.PROTECT, related_name='memberships')
date_start = models.DateField()
date_end = models.DateField(null=True)
| 32.47619 | 95 | 0.765396 | 85 | 682 | 6.023529 | 0.470588 | 0.117188 | 0.140625 | 0.1875 | 0.359375 | 0.359375 | 0.359375 | 0.210938 | 0.210938 | 0 | 0 | 0.016835 | 0.129032 | 682 | 20 | 96 | 34.1 | 0.845118 | 0 | 0 | 0.133333 | 0 | 0 | 0.035191 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.133333 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
5ff89d4526b1bc1aa277cc88322283f4c83aba9b | 894 | py | Python | euler-297.py | simonolander/euler | 4d7c4cd9333201cd0065419a511f111b6d75d90c | [
"MIT"
] | null | null | null | euler-297.py | simonolander/euler | 4d7c4cd9333201cd0065419a511f111b6d75d90c | [
"MIT"
] | null | null | null | euler-297.py | simonolander/euler | 4d7c4cd9333201cd0065419a511f111b6d75d90c | [
"MIT"
] | null | null | null |
max_n = 10**17
fibs = [
(1, 1),
(2, 1),
]
while fibs[-1][0] < max_n:
fibs.append(
(fibs[-1][0] + fibs[-2][0], fibs[-1][1] + fibs[-2][1])
)
print(fibs)
counts = [
1,
1
]
for i in range(2, len(fibs)):
fib = fibs[i]
counts.append(fib[1] + sum(counts[j] for j in range(i - 1)))
print(counts)
def count(n):
smallest_over_index = 0
smallest_over = fibs[smallest_over_index][0]
while smallest_over < n:
smallest_over_index += 1
smallest_over = fibs[smallest_over_index][0]
if smallest_over == n + 1:
return sum(counts[i] for i in range(smallest_over_index))
if smallest_over == n:
return 1 + count(n - 1)
smallest_under = fibs[smallest_over_index - 1][0]
return sum(counts[i] for i in range(smallest_over_index - 1)) + count(n - smallest_under) + n - smallest_under
print(count(10**17) - 1)
| 21.285714 | 114 | 0.595078 | 145 | 894 | 3.503448 | 0.193103 | 0.283465 | 0.234252 | 0.064961 | 0.307087 | 0.307087 | 0.307087 | 0.173228 | 0.173228 | 0.173228 | 0 | 0.056548 | 0.248322 | 894 | 41 | 115 | 21.804878 | 0.699405 | 0 | 0 | 0.064516 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.032258 | false | 0 | 0 | 0 | 0.129032 | 0.096774 | 0 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
270a9d8419653f66a834d1d865ffdb09e38880b7 | 303 | py | Python | weather/weather.py | marinajacks/reptilian | 990cb371a551164828ad40e57df74ebdf5ebf25e | [
"MIT"
] | null | null | null | weather/weather.py | marinajacks/reptilian | 990cb371a551164828ad40e57df74ebdf5ebf25e | [
"MIT"
] | null | null | null | weather/weather.py | marinajacks/reptilian | 990cb371a551164828ad40e57df74ebdf5ebf25e | [
"MIT"
] | null | null | null | #!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""
Created on Sat May 19 14:25:43 2018
@author: macbook
本项目主要是为了获取到全国的天气数据,并将这些数据存储到数据库
或者是txt中,考虑到存储在txt中实际上后续还需要做相关的调整,暂
时的处理思路就是将数据存储在数据库中
"""
import requests
from bs4 import BeautifulSoup
if __name__== "__main__":
print("hello world") | 11.653846 | 35 | 0.722772 | 36 | 303 | 5.861111 | 0.972222 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.058824 | 0.158416 | 303 | 26 | 36 | 11.653846 | 0.768627 | 0.60396 | 0 | 0 | 0 | 0 | 0.169643 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 0.5 | 0.25 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
271408f3c1850e6c8d1ab38a4556369f70243b66 | 284 | py | Python | run_eureka.py | ers-transit/hackathon-2021-day2 | b163fe87d2cb32e3c1592bdd829d27aa315be4aa | [
"MIT"
] | 1 | 2021-07-06T17:57:46.000Z | 2021-07-06T17:57:46.000Z | run_eureka.py | ers-transit/hackathon-2021-day2 | b163fe87d2cb32e3c1592bdd829d27aa315be4aa | [
"MIT"
] | null | null | null | run_eureka.py | ers-transit/hackathon-2021-day2 | b163fe87d2cb32e3c1592bdd829d27aa315be4aa | [
"MIT"
] | 1 | 2021-06-23T16:28:44.000Z | 2021-06-23T16:28:44.000Z | import sys, os, time
from importlib import reload
import eureka.S3_data_reduction.s3_reduce as s3
import eureka.S4_generate_lightcurves.s4_genLC as s4
eventlabel = 'wasp43b'
reload(s3)
ev3 = s3.reduceJWST(eventlabel)
reload(s4)
ev4 = s4.lcJWST(ev3.eventlabel, ev3.workdir, md=ev3)
| 21.846154 | 52 | 0.795775 | 45 | 284 | 4.888889 | 0.555556 | 0.109091 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.06746 | 0.112676 | 284 | 12 | 53 | 23.666667 | 0.805556 | 0 | 0 | 0 | 1 | 0 | 0.024648 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.444444 | 0 | 0.444444 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
271bd4c4589084c4948537378af09735a6bb3f9a | 1,311 | py | Python | nertivia4py/utils/member.py | bentettmar/nertivia4py | a9b758000632e40306bc610a6966cb8d0a643c20 | [
"MIT"
] | 3 | 2022-01-24T16:31:20.000Z | 2022-02-03T22:44:51.000Z | nertivia4py/utils/member.py | bentettmar/nertivia4py | a9b758000632e40306bc610a6966cb8d0a643c20 | [
"MIT"
] | 9 | 2022-03-05T19:01:48.000Z | 2022-03-06T11:38:53.000Z | nertivia4py/utils/member.py | bentettmar/nertivia4py | a9b758000632e40306bc610a6966cb8d0a643c20 | [
"MIT"
] | null | null | null | from . import server
from . import user
class Member:
"""
Nertivia Member
The same as user.User but has ban and kick functions.
Attributes:
- id (int): The ID of the member.
- username (str): The username of the member.
- tag (str): The tag of the member.
- avatar (str): The avatar of the member.
- type (str): The type of the member.
- server_id (int): The ID of the server the member is in.
"""
def __init__(self, id, username="", tag="", avatar="", type="", server_id="") -> None:
self.id = id
self.username = username
self.tag = tag
self.avatar = avatar
self.type = type
self.server_id = server_id
def __str__(self) -> str:
return f"{self.username}:{self.tag}"
def ban(self):
"""
Bans the member.
Returns:
- bool: Whether the member was banned or not.
"""
server2 = server.Server(self.server_id)
return server2.ban_member(user.User(self.id, self.username, self.tag, self.avatar))
def kick(self):
"""
Kicks the member.
Returns:
- bool: Whether the member was kicked or not.
"""
server2 = server.Server(self.server_id)
return server2.ban_member(user.User(self.id, self.username, self.tag, self.avatar)) | 26.755102 | 92 | 0.600305 | 180 | 1,311 | 4.283333 | 0.244444 | 0.116732 | 0.071336 | 0.07393 | 0.402075 | 0.402075 | 0.363165 | 0.363165 | 0.261997 | 0.261997 | 0 | 0.004233 | 0.279176 | 1,311 | 49 | 93 | 26.755102 | 0.81164 | 0.3791 | 0 | 0.222222 | 0 | 0 | 0.035183 | 0.035183 | 0 | 0 | 0 | 0 | 0 | 1 | 0.222222 | false | 0 | 0.111111 | 0.055556 | 0.555556 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
27353695822d906477e008ab8b77fc0671f47c83 | 251 | py | Python | Problem/util/repair/timeUtility.py | m-arnao-molina/SCA-QL-SARSA | 65f859fce96bb8c11509238c2f7a5d8dd2ad042a | [
"MIT"
] | null | null | null | Problem/util/repair/timeUtility.py | m-arnao-molina/SCA-QL-SARSA | 65f859fce96bb8c11509238c2f7a5d8dd2ad042a | [
"MIT"
] | null | null | null | Problem/util/repair/timeUtility.py | m-arnao-molina/SCA-QL-SARSA | 65f859fce96bb8c11509238c2f7a5d8dd2ad042a | [
"MIT"
] | null | null | null | __author__ = 'INVESTIGACION'
import datetime, time
def obtieneTime():
ts = time.time()
st = datetime.datetime.fromtimestamp(ts).strftime('%Y-%m-%d %H:%M:%S.%f')
return st
def minusSet(x,y):
x_y = list(set(x) - set(y))
return x_y | 20.916667 | 77 | 0.629482 | 39 | 251 | 3.897436 | 0.564103 | 0.039474 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.191235 | 251 | 12 | 78 | 20.916667 | 0.748768 | 0 | 0 | 0 | 0 | 0 | 0.130952 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.222222 | false | 0 | 0.111111 | 0 | 0.555556 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
2763de4f28594ffcf433b6e74345cd8b96baaeb4 | 945 | py | Python | notebook/numpy_block.py | vhn0912/python-snippets | 80b2e1d6b2b8f12ae30d6dbe86d25bb2b3a02038 | [
"MIT"
] | 174 | 2018-05-30T21:14:50.000Z | 2022-03-25T07:59:37.000Z | notebook/numpy_block.py | vhn0912/python-snippets | 80b2e1d6b2b8f12ae30d6dbe86d25bb2b3a02038 | [
"MIT"
] | 5 | 2019-08-10T03:22:02.000Z | 2021-07-12T20:31:17.000Z | notebook/numpy_block.py | vhn0912/python-snippets | 80b2e1d6b2b8f12ae30d6dbe86d25bb2b3a02038 | [
"MIT"
] | 53 | 2018-04-27T05:26:35.000Z | 2022-03-25T07:59:37.000Z | import numpy as np
a1 = np.ones((2, 3), int)
print(a1)
# [[1 1 1]
# [1 1 1]]
a2 = np.full((2, 3), 2)
print(a2)
# [[2 2 2]
# [2 2 2]]
print(np.block([a1, a2]))
# [[1 1 1 2 2 2]
# [1 1 1 2 2 2]]
print(np.block([[a1], [a2]]))
# [[1 1 1]
# [1 1 1]
# [2 2 2]
# [2 2 2]]
print(np.block([[a1, a2], [a2, a1]]))
# [[1 1 1 2 2 2]
# [1 1 1 2 2 2]
# [2 2 2 1 1 1]
# [2 2 2 1 1 1]]
print(np.block([[[a1]], [[a2]]]))
# [[[1 1 1]
# [1 1 1]]
#
# [[2 2 2]
# [2 2 2]]]
print(np.block([[[a1]], [[a2]]]).shape)
# (2, 2, 3)
a3 = np.full(6, 3)
print(a3)
# [3 3 3 3 3 3]
print(np.block([[a1, a2], [a3]]))
# [[1 1 1 2 2 2]
# [1 1 1 2 2 2]
# [3 3 3 3 3 3]]
# print(np.block([[a1, a2], a3]))
# ValueError: List depths are mismatched. First element was at depth 2, but there is an element at depth 1 (arrays[1])
# print(np.block([[a1, a2, a3]]))
# ValueError: all the input array dimensions except for the concatenation axis must match exactly
| 17.830189 | 118 | 0.511111 | 207 | 945 | 2.333333 | 0.21256 | 0.136646 | 0.136646 | 0.099379 | 0.519669 | 0.519669 | 0.505176 | 0.426501 | 0.426501 | 0.401656 | 0 | 0.190476 | 0.244444 | 945 | 52 | 119 | 18.173077 | 0.485994 | 0.589418 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.076923 | 0 | 0.076923 | 0.692308 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 2 |
277678b4414aee8aa346a7a450dbd1f621e7d88e | 136 | py | Python | tests/__init__.py | Rgcsh/pre-request | 6b1b842ec25393de37399abad1f7ac127c6200be | [
"MIT"
] | 86 | 2017-08-17T12:41:52.000Z | 2022-02-24T12:17:47.000Z | tests/__init__.py | Rgcsh/pre-request | 6b1b842ec25393de37399abad1f7ac127c6200be | [
"MIT"
] | 10 | 2020-03-30T03:24:46.000Z | 2022-02-23T01:34:53.000Z | tests/__init__.py | Rgcsh/pre-request | 6b1b842ec25393de37399abad1f7ac127c6200be | [
"MIT"
] | 7 | 2017-08-18T03:40:35.000Z | 2020-05-19T04:09:10.000Z | # -*- coding: utf-8 -*-
# (C) Wu Dong, 2018
# All rights reserved
__author__ = 'Wu Dong <wudong@eastwu.cn>'
__time__ = '2018/9/6 11:07'
| 22.666667 | 41 | 0.632353 | 22 | 136 | 3.545455 | 0.863636 | 0.153846 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.132743 | 0.169118 | 136 | 5 | 42 | 27.2 | 0.557522 | 0.433824 | 0 | 0 | 0 | 0 | 0.547945 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
27a7f092d874e3b2761d8f5f2b1ccc9a8debdefa | 1,354 | py | Python | tensorflow/contrib/tfprof/__init__.py | uve/tensorflow | e08079463bf43e5963acc41da1f57e95603f8080 | [
"Apache-2.0"
] | 6 | 2022-02-04T18:12:24.000Z | 2022-03-21T23:57:12.000Z | Lib/site-packages/tensorflow/contrib/tfprof/__init__.py | shfkdroal/Robot-Learning-in-Mixed-Adversarial-and-Collaborative-Settings | 1fa4cd6a566c8745f455fc3d2273208f21f88ced | [
"bzip2-1.0.6"
] | 1 | 2021-05-20T00:58:04.000Z | 2021-05-20T00:58:04.000Z | Lib/site-packages/tensorflow/contrib/tfprof/__init__.py | shfkdroal/Robot-Learning-in-Mixed-Adversarial-and-Collaborative-Settings | 1fa4cd6a566c8745f455fc3d2273208f21f88ced | [
"bzip2-1.0.6"
] | 1 | 2022-02-08T03:53:23.000Z | 2022-02-08T03:53:23.000Z | # Copyright 2015 The TensorFlow Authors. All Rights Reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
# ==============================================================================
"""tfprof is a tool that profile various aspect of TensorFlow model.
@@model_analyzer
@@tfprof_logger
@@ProfileContext
"""
from __future__ import absolute_import
from __future__ import division
from __future__ import print_function
# pylint: disable=unused-import
from tensorflow.contrib.tfprof import model_analyzer
from tensorflow.contrib.tfprof import tfprof_logger
from tensorflow.contrib.tfprof.model_analyzer import ProfileContext
from tensorflow.python.util.all_util import remove_undocumented
_allowed_symbols = ['model_analyzer', 'tfprof_logger', 'ProfileContext']
remove_undocumented(__name__, _allowed_symbols)
| 36.594595 | 81 | 0.734121 | 171 | 1,354 | 5.625731 | 0.549708 | 0.06237 | 0.049896 | 0.0842 | 0.149688 | 0 | 0 | 0 | 0 | 0 | 0 | 0.006938 | 0.148449 | 1,354 | 36 | 82 | 37.611111 | 0.827407 | 0.597489 | 0 | 0 | 0 | 0 | 0.084016 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.777778 | 0 | 0.777778 | 0.111111 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
27aa51cbb95def4fc8257b31b16b73c0497d84df | 1,181 | py | Python | gryphon/lib/exchange/vault_of_satoshi.py | qiquanzhijia/gryphon | 7bb2c646e638212bd1352feb1b5d21536a5b918d | [
"Apache-2.0"
] | 1,109 | 2019-06-20T19:23:27.000Z | 2022-03-20T14:03:43.000Z | gryphon/lib/exchange/vault_of_satoshi.py | qiquanzhijia/gryphon | 7bb2c646e638212bd1352feb1b5d21536a5b918d | [
"Apache-2.0"
] | 63 | 2019-06-21T05:36:17.000Z | 2021-05-26T21:08:15.000Z | gryphon/lib/exchange/vault_of_satoshi.py | qiquanzhijia/gryphon | 7bb2c646e638212bd1352feb1b5d21536a5b918d | [
"Apache-2.0"
] | 181 | 2019-06-20T19:42:05.000Z | 2022-03-21T13:05:13.000Z | # -*- coding: utf-8 -*-
import time
import os
import datetime
import requests
import hmac
import urllib
import hashlib
import base64
import json
import math
from cdecimal import *
from delorean import Delorean
from collections import OrderedDict
from gryphon.lib.money import Money
from gryphon.lib.models.datum import DatumRecorder
from exchange_order import Order
from gryphon.lib.exchange.consts import Consts
from base import *
from exceptions import *
from gryphon.lib.models.exchange import Balance
from gryphon.lib.logger import get_logger
logger = get_logger(__name__)
class VaultOfSatoshiExchange(Exchange):
def __init__(self, session=None, currency=u"CAD", use_cached_orderbook=False):
super(VaultOfSatoshiExchange, self).__init__(session)
self.name = u'VAULTOFSATOSHI'
self.friendly_name = u'Vault of Satoshi'
self.base_url = 'https://api.vaultofsatoshi.com'
self.currency = currency
self.fee = Decimal("0") # assuming $99 unlimited account
self.withdrawal_fee = Money("0.0005", "BTC")
self.bid_string = "bid"
self.ask_string = "ask"
self.use_cached_orderbook = use_cached_orderbook
| 30.282051 | 82 | 0.747671 | 154 | 1,181 | 5.564935 | 0.461039 | 0.064177 | 0.08168 | 0.046674 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.011247 | 0.171888 | 1,181 | 38 | 83 | 31.078947 | 0.865031 | 0.04403 | 0 | 0 | 0 | 0 | 0.07016 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.029412 | false | 0 | 0.617647 | 0 | 0.676471 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
27b238fb2aa2109c697ac87edf6042f63b4dab57 | 1,529 | py | Python | src/sales/models.py | brianl9995/payinv | 7fc2160c2c9bbb9568a659ff3edf2526142d33fc | [
"MIT"
] | 2 | 2019-09-21T23:36:49.000Z | 2019-10-02T23:31:21.000Z | src/sales/models.py | brianl9995/payinv | 7fc2160c2c9bbb9568a659ff3edf2526142d33fc | [
"MIT"
] | 2 | 2019-10-04T13:51:43.000Z | 2021-06-10T21:57:55.000Z | src/sales/models.py | brianl9995/payinv | 7fc2160c2c9bbb9568a659ff3edf2526142d33fc | [
"MIT"
] | 2 | 2019-10-02T23:31:22.000Z | 2020-06-07T14:57:55.000Z | from django.db import models
from utilities.models import DateTimedModel
from customers.models import Customer
from django.db.models import Sum
from django.utils.translation import ugettext as _
from utilities.utils import csv_format
from django.urls import reverse
class Sale(DateTimedModel):
internal_id = models.CharField(max_length=100)
customer = models.ForeignKey(Customer)
total_value = models.DecimalField(
u'Total Value', default=0, null=True,
max_digits=10, decimal_places=3)
done_at = models.DateField()
concept = models.CharField(max_length=100)
notes = models.TextField(blank=True, null=True)
def __unicode__(self):
return "{} / {} ".format(self.internal_id, self.customer)
def __str__(self):
return "{} / {} ".format(self.internal_id, self.customer)
def to_csv(self):
return csv_format([
self.internal_id,
self.customer,
self.total_value,
self.done_at,
self.notes,
self.total_invoices,
self.total_payments
])
class Meta:
verbose_name = _('Sale')
def get_absolute_url(self):
return reverse('sale', args=[self.pk])
@property
def total_payments(self):
return self.payment_set.all().aggregate(
Sum('total_value'))['total_value__sum'] or 0
@property
def total_invoices(self):
return self.invoice_set.all().aggregate(
Sum('total_value'))['total_value__sum'] or 0
| 28.849057 | 65 | 0.654676 | 187 | 1,529 | 5.128342 | 0.374332 | 0.072993 | 0.056309 | 0.062565 | 0.275287 | 0.218978 | 0.18561 | 0.18561 | 0.18561 | 0.091762 | 0 | 0.010345 | 0.241334 | 1,529 | 52 | 66 | 29.403846 | 0.816379 | 0 | 0 | 0.142857 | 0 | 0 | 0.058208 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0 | 0.166667 | 0.142857 | 0.642857 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 2 |
27b377a8209ece3c1c0f96d1112f7bb29096436f | 1,019 | py | Python | src/psiopic2/utils/archives/baseArchive.py | psiopic2/psiopic2 | c2be97701f023f4396bb5d15e14e1ecc7a71d16b | [
"MIT"
] | null | null | null | src/psiopic2/utils/archives/baseArchive.py | psiopic2/psiopic2 | c2be97701f023f4396bb5d15e14e1ecc7a71d16b | [
"MIT"
] | null | null | null | src/psiopic2/utils/archives/baseArchive.py | psiopic2/psiopic2 | c2be97701f023f4396bb5d15e14e1ecc7a71d16b | [
"MIT"
] | null | null | null | import os
class BaseArchiveInfo(object):
def __init__(self, fileName, archiveName):
self.fileName = fileName
self.archiveName = archiveName
def name(self):
raise NotImplementedError
def size(self):
raise NotImplementedError
def type(self):
raise NotImplementedError
class BaseArchive(object):
def __init__(self, archiveFile):
self.archiveFile = archiveFile
self._archive = None
def open(self, fileName):
raise NotImplementedError()
def getInfo(self, fileName):
raise NotImplementedError()
def check_file(self, fileName, targetDir=None):
if targetDir:
targetPath = os.path.normpath(os.path.realpath(targetDir))
else:
targetPath = os.getcwd()
extract_path = os.path.join(targetPath, src)
extract_path = os.path.normpath(os.path.realpath(extract_path))
if not extract_path.startswith(targetPath):
raise UnsafeArchive("%s is outside of %s" % (src, targetPath))
def filenames(self):
raise NotImplementedError()
| 23.159091 | 68 | 0.7105 | 114 | 1,019 | 6.22807 | 0.368421 | 0.202817 | 0.157746 | 0.047887 | 0.188732 | 0.078873 | 0 | 0 | 0 | 0 | 0 | 0 | 0.192345 | 1,019 | 43 | 69 | 23.697674 | 0.862697 | 0 | 0 | 0.2 | 0 | 0 | 0.018664 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.3 | false | 0 | 0.033333 | 0 | 0.4 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
27b8725aa2b3f70762910e967c95a0e9eb9a997d | 602 | py | Python | qmhub/embedtools/embed_eed_me.py | QCMM/dynqmprop | 0f668072f623a2f5f209ab715bc264a83926309b | [
"MIT"
] | null | null | null | qmhub/embedtools/embed_eed_me.py | QCMM/dynqmprop | 0f668072f623a2f5f209ab715bc264a83926309b | [
"MIT"
] | null | null | null | qmhub/embedtools/embed_eed_me.py | QCMM/dynqmprop | 0f668072f623a2f5f209ab715bc264a83926309b | [
"MIT"
] | null | null | null | from .embed_base import EmbedBase
class EmbedEEdME(EmbedBase):
EMBEDNEAR = 'EEd'
EMBEDFAR = 'ME'
def get_mm_charge(self):
super(EmbedEEdME, self).get_mm_charge()
self.mm_atoms_near.charge_me = self.mm_atoms_near.charge_comp
self.mm_atoms_near.charge_eed = self.mm_atoms_near.charge_near
def get_mm_esp(self):
mm_esp_near = self.get_mm_esp_eed()
if self.mm_atoms_near.charge_comp is None:
return mm_esp_near
else:
mm_esp_comp = self.get_mm_esp_me().sum(axis=1)
return mm_esp_near - mm_esp_comp
| 24.08 | 70 | 0.669435 | 92 | 602 | 3.967391 | 0.315217 | 0.109589 | 0.150685 | 0.205479 | 0.309589 | 0.136986 | 0 | 0 | 0 | 0 | 0 | 0.002212 | 0.249169 | 602 | 24 | 71 | 25.083333 | 0.80531 | 0 | 0 | 0 | 0 | 0 | 0.008306 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.133333 | false | 0 | 0.066667 | 0 | 0.533333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
27b9fb848cb7951346c59ef7e058d140e94e21b6 | 373 | py | Python | lesson-3/ex4.py | alirsamar/intro-ml | 36450b26b7ea09472ccdd2a0abce51b6c3889a20 | [
"MIT"
] | null | null | null | lesson-3/ex4.py | alirsamar/intro-ml | 36450b26b7ea09472ccdd2a0abce51b6c3889a20 | [
"MIT"
] | null | null | null | lesson-3/ex4.py | alirsamar/intro-ml | 36450b26b7ea09472ccdd2a0abce51b6c3889a20 | [
"MIT"
] | null | null | null | # Your first email DT: Accuracy
import sys
from time import time
sys.path.append("../tools/")
from email_preprocess import preprocess
from sklearn import tree
features_train, features_test, labels_train, labels_test = preprocess()
clf = tree.DecisionTreeClassifier(min_samples_split=40)
clf.fit(features_train, labels_train)
print clf.score(features_test, labels_test) | 28.692308 | 71 | 0.812332 | 53 | 373 | 5.509434 | 0.528302 | 0.089041 | 0.123288 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.005988 | 0.104558 | 373 | 13 | 72 | 28.692308 | 0.868263 | 0.077748 | 0 | 0 | 0 | 0 | 0.026316 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.444444 | null | null | 0.111111 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
27bf522cb273d0d2ad03dedda722c1ce9c5fdeae | 1,623 | py | Python | density.py | mattjj/dirichlet-truncated-multinomial | 1b239e8960042bbf0f063d4f9e0400dfa6cb648b | [
"MIT"
] | 2 | 2020-07-24T20:50:29.000Z | 2020-07-26T08:30:42.000Z | density.py | mattjj/dirichlet-truncated-multinomial | 1b239e8960042bbf0f063d4f9e0400dfa6cb648b | [
"MIT"
] | null | null | null | density.py | mattjj/dirichlet-truncated-multinomial | 1b239e8960042bbf0f063d4f9e0400dfa6cb648b | [
"MIT"
] | null | null | null | from __future__ import division
import numpy as np
na = np.newaxis
import operator
import parallel
def kde(sigma,locs,vals=None):
'''
returns a density function p defined by
p(x) = \sum_{xbar \in locs} vals[xbar] * rbf(xbar,x; sigma)
rbf(xbar,x; sigma) is the value of a normalized isotropic gaussian density
with mean xbar and variance sigma evaluated at x
by default, vals[i] = 1/len(locs), useful for the case when locs are samples
'''
# TODO should the computation here be done in log space with logaddexp?
# yes, esp for higher dimensions...
if vals is None:
vals = 1./locs.shape[0] * np.ones(locs.shape[0])
else:
assert vals.ndim == 1 and np.allclose(vals.sum(),1)
locs, vals = np.array(locs), np.array(vals)
assert locs.ndim == 2 and locs.shape[0] == vals.shape[0]
K = locs.shape[1] # dimensionality
def p(x):
assert x.ndim == 2
# parallelizes over locs but not over x
chunksize = 1000000 # max intermediate array size is chunksize doubles
locchunks = np.array_split(locs,x.shape[0]*locs.shape[0]//chunksize+1)
valchunks = np.array_split(vals,x.shape[0]*locs.shape[0]//chunksize+1)
numchunks = len(locchunks)
def f((ls,vs,x,K,sigma)):
return np.dot(np.ones(len(ls)),vs[:,na]
/ (2*np.pi)**(K/2) / np.sqrt(sigma**K)
* np.exp(-0.5*((ls[:,na,:] - x[na,:,:])**2).sum(2)/sigma))
return reduce(operator.add, parallel.dv.map_sync(f, zip(locchunks,valchunks,[x]*numchunks,[K]*numchunks,[sigma]*numchunks)))
return p
| 36.066667 | 132 | 0.622304 | 252 | 1,623 | 3.97619 | 0.420635 | 0.047904 | 0.0499 | 0.025948 | 0.053892 | 0.053892 | 0.053892 | 0.053892 | 0 | 0 | 0 | 0.024174 | 0.235367 | 1,623 | 44 | 133 | 36.886364 | 0.783239 | 0.126309 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.022727 | 0.12 | 0 | null | null | 0 | 0.16 | null | null | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
27d01a771020c352b35c6a4893b69cfac0b06a64 | 2,137 | py | Python | pyrex/get_sxs.py | Yoshinta/pyrex | f207d59de46534f6849f769506494ff162c8cd7f | [
"MIT"
] | 1 | 2021-01-19T03:31:45.000Z | 2021-01-19T03:31:45.000Z | pyrex/get_sxs.py | Yoshinta/pyrex | f207d59de46534f6849f769506494ff162c8cd7f | [
"MIT"
] | null | null | null | pyrex/get_sxs.py | Yoshinta/pyrex | f207d59de46534f6849f769506494ff162c8cd7f | [
"MIT"
] | 1 | 2021-01-28T06:09:07.000Z | 2021-01-28T06:09:07.000Z | # Copyright (C) 2020 Yoshinta Setyawati <yoshintaes@gmail.com>
#
# This program is free software; you can redistribute it and/or modify it
# under the terms of the GNU General Public License as published by the
# Free Software Foundation; either version 3 of the License, or (at your
# option) any later version.
#
# This program is distributed in the hope that it will be useful, but
# WITHOUT ANY WARRANTY; without even the implied warranty of
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General
# Public License for more details.
#
# You should have received a copy of the GNU General Public License along
# with this program; if not, write to the Free Software Foundation, Inc.,
# 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
#
# =============================================================================
#
# Preamble
#
# =============================================================================
#
"""
Download a set of SXS data from given simulation numbers.
"""
__author__ = 'Yoshinta Setyawati'
#TODO: test how it works
#
import sxs
from sxs import zenodo as zen
# For interacting with the data
import h5py
from numpy import *
import json
#import eccentric simulations as used PRD 98, 044015(2018)
chosen_ids=['0180','1355','1356','1357','1358','1359','1360','1361','1362','1363','0184','1364','1365','1366','1367','1368','1369','1370','0183','1371','1372','1373','1374']
def download_data(ids=chosen_ids):
"""
Download given simulations of the SXS catalog.
Parameters
----------
ids : []
1 dimensional array of the SXS simulation IDs such as '0180', '1356' etc.
Default=chosen_ids.
"""
for ids in chosen_ids:
name_ids='SXS:BBH:'+ids
zen.download.matching("common-metadata.txt", "metadata.txt", "metadata.json", \
"rhOverM_Asymptotic_GeometricUnits_CoM.h5", \
"Horizons.h5", \
sxs_ids = name_ids, \
dry_run = False, \
highest_lev_only = True)
| 33.920635 | 173 | 0.597567 | 265 | 2,137 | 4.750943 | 0.611321 | 0.019857 | 0.030977 | 0.045274 | 0.065131 | 0.04448 | 0 | 0 | 0 | 0 | 0 | 0.080243 | 0.230229 | 2,137 | 62 | 174 | 34.467742 | 0.685106 | 0.603182 | 0 | 0 | 0 | 0 | 0.283245 | 0.053191 | 0 | 0 | 0 | 0.016129 | 0 | 1 | 0.0625 | false | 0 | 0.3125 | 0 | 0.375 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
27e54da2fe957cd0fc34e397a672dad01b50ff51 | 4,029 | py | Python | fwk/metrics.py | cassianobecker/dnn | bb2ea04f77733de9df10f795bb049ac3b9d30478 | [
"MIT"
] | 3 | 2020-02-21T21:35:07.000Z | 2020-09-29T15:20:00.000Z | fwk/metrics.py | cassianobecker/dnn | bb2ea04f77733de9df10f795bb049ac3b9d30478 | [
"MIT"
] | 27 | 2020-02-20T21:00:23.000Z | 2020-05-22T15:23:25.000Z | fwk/metrics.py | cassianobecker/dnn | bb2ea04f77733de9df10f795bb049ac3b9d30478 | [
"MIT"
] | null | null | null | from util.lang import class_for_name
from util.path import absolute_path
from util.string import list_from
from fwk.config import Config
from fwk.observers import Observer
import configparser
class Metric:
def __init__(self) -> None:
self.observers = list()
def add_observer(self, channel):
self.observers.append(channel)
def get_implemented_events(self):
event_handler_list = [m[3:] for m in self.__class__.__dict__ if m.startswith('on_')]
return event_handler_list
def on_event(self, event_type, local_variables):
event_handler = getattr(self, 'on_' + event_type)
event_handler(local_variables)
def print_metric(self):
for observer in self.observers:
observer.print(self)
def on_before_setup(self, local_variables):
pass
def on_after_setup(self, local_variables):
pass
def on_before_epoch(self, local_variables):
pass
def on_after_epoch(self, local_variables):
pass
def on_before_train_batch(self, local_variables):
pass
def on_after_train_batch(self, local_variables):
pass
def on_before_test_batch(self, local_variables):
pass
def on_after_test_batch(self, local_variables):
pass
class MetricsHandler:
metrics_for_events = dict()
@classmethod
def register_metrics(cls):
metrics_config, observers_config = cls._get_configs()
if metrics_config is not None:
observers = dict()
for metrics_class_name in metrics_config.sections():
metric = class_for_name(metrics_class_name)()
for observer_name in list_from(metrics_config[metrics_class_name]['observers']):
if observer_name not in observers.keys():
observer = cls._create_observer(observers_config, observer_name)
observers[observer_name] = observer
else:
observer = observers[observer_name]
metric.add_observer(observer)
cls.register_events(metric)
pass
@classmethod
def register_events(cls, metric):
for event in metric.get_implemented_events():
if event not in cls.metrics_for_events:
cls.metrics_for_events[event] = list()
cls.metrics_for_events[event].append(metric)
@classmethod
def _create_observer(cls, observers_config, observer_name):
observer = Observer()
renderer_class_names = list_from(observers_config[observer_name]['renderers'])
for renderers_class_name in renderer_class_names:
renderer = class_for_name(renderers_class_name)(observer_name)
observer.add_renderer(renderer)
return observer
@classmethod
def _get_configs(cls):
# optionxform preserves CamelCase in keys for loading class names
# see https://docs.python.org/2/library/configparser.html#ConfigParser.RawConfigParser.optionxform
metrics_config = configparser.ConfigParser(allow_no_value=True)
metrics_config.optionxform = str
if 'METRICS' in Config.config.sections():
metrics_ini_url = Config.config['METRICS']['metrics_ini_url']
metrics_config.read(absolute_path(metrics_ini_url))
observers_config = configparser.ConfigParser(allow_no_value=True)
observers_ini_url = Config.config['METRICS']['observers_ini_url']
observers_config.optionxform = str
observers_config.read(absolute_path(observers_ini_url))
else:
metrics_config = None
observers_config = None
return metrics_config, observers_config
@classmethod
def dispatch_event(cls, local_variables, event_type):
if event_type in cls.metrics_for_events.keys():
for metric in cls.metrics_for_events[event_type]:
metric.on_event(event_type, local_variables)
| 29.844444 | 106 | 0.668652 | 472 | 4,029 | 5.368644 | 0.184322 | 0.066298 | 0.056827 | 0.069455 | 0.222968 | 0.157459 | 0.143646 | 0.045777 | 0 | 0 | 0 | 0.00067 | 0.258873 | 4,029 | 134 | 107 | 30.067164 | 0.847957 | 0.039464 | 0 | 0.181818 | 0 | 0 | 0.019917 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.204545 | false | 0.102273 | 0.068182 | 0 | 0.340909 | 0.022727 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
7e02bc702787096f6ba4d1dbf86cf14364f8660e | 1,566 | py | Python | backend/authentication/views.py | softzer0/dockerized_django_vuetify_boilerplate | bbfdc5cf9599e3832a7644623d3f66137f93788a | [
"MIT"
] | null | null | null | backend/authentication/views.py | softzer0/dockerized_django_vuetify_boilerplate | bbfdc5cf9599e3832a7644623d3f66137f93788a | [
"MIT"
] | null | null | null | backend/authentication/views.py | softzer0/dockerized_django_vuetify_boilerplate | bbfdc5cf9599e3832a7644623d3f66137f93788a | [
"MIT"
] | null | null | null | from dj_rest_auth import views
from dj_rest_auth.registration import views as registration_views
from rest_framework.generics import get_object_or_404
from rest_framework.response import Response
from rest_framework.permissions import IsAuthenticated
from .permissions import IsGuest as IsGuestPermission, IsOwnerOrReadOnly as IsOwnerOrReadOnlyPermission
from .serializers import UserDetailsSerializer
from .models import User
from rest_framework.viewsets import ModelViewSet
class IsGuest:
def get_permissions(self):
permissions_list = super().get_permissions()
permissions_list.append(IsGuestPermission())
return permissions_list
class PasswordResetView(IsGuest, views.PasswordResetView):
pass
class PasswordResetConfirmView(IsGuest, views.PasswordResetConfirmView):
pass
class LoginView(IsGuest, views.LoginView):
pass
class RegisterView(IsGuest, registration_views.RegisterView):
pass
class VerifyEmailView(IsGuest, registration_views.VerifyEmailView):
pass
class UserViewSet(ModelViewSet):
queryset = User.objects.all()
serializer_class = UserDetailsSerializer
permission_classes = [IsAuthenticated, IsOwnerOrReadOnlyPermission]
def get_object(self):
obj = get_object_or_404(self.queryset, **{'pk': self.request.user.id})
self.check_object_permissions(self.request, obj)
return obj
def list(self, request, *args, **kwargs):
instance = self.get_object()
serializer = self.get_serializer(instance)
return Response(serializer.data) | 29.54717 | 103 | 0.779055 | 168 | 1,566 | 7.089286 | 0.333333 | 0.037783 | 0.057095 | 0.02351 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.004528 | 0.153895 | 1,566 | 53 | 104 | 29.54717 | 0.89434 | 0 | 0 | 0.138889 | 0 | 0 | 0.001276 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.083333 | false | 0.194444 | 0.25 | 0 | 0.694444 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 2 |
fd7c800728edfcefe6640db9203e4038d79ce926 | 288 | py | Python | 001601Udemy100DayPyBootCamp/day003/001601p029_InteractiveCodingExercise_02_RollerCoasterAge.py | SafonovMikhail/python_000577 | 739f764e80f1ca354386f00b8e9db1df8c96531d | [
"Apache-2.0"
] | null | null | null | 001601Udemy100DayPyBootCamp/day003/001601p029_InteractiveCodingExercise_02_RollerCoasterAge.py | SafonovMikhail/python_000577 | 739f764e80f1ca354386f00b8e9db1df8c96531d | [
"Apache-2.0"
] | null | null | null | 001601Udemy100DayPyBootCamp/day003/001601p029_InteractiveCodingExercise_02_RollerCoasterAge.py | SafonovMikhail/python_000577 | 739f764e80f1ca354386f00b8e9db1df8c96531d | [
"Apache-2.0"
] | null | null | null | print("Welcome to the rollercoaster!")
height = int(input("What is your height in cm? "))
if height > 120:
print("you can ride the rollercoaster!")
age = int(input("What is your age? "))
if age <= 18:
print("$7")
else:
print("$12")
else:
print("no")
| 20.571429 | 50 | 0.572917 | 41 | 288 | 4.02439 | 0.585366 | 0.193939 | 0.145455 | 0.169697 | 0.218182 | 0 | 0 | 0 | 0 | 0 | 0 | 0.037736 | 0.263889 | 288 | 13 | 51 | 22.153846 | 0.740566 | 0 | 0 | 0.181818 | 0 | 0 | 0.388889 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.454545 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 2 |
fd89ba2a9d9f9480c0e1aec84457ba50ede3b762 | 177 | py | Python | SECUINSIDE/2016/byhuman (unsolved)/f65c09977d6a4adf8949dcb05544a998/random_padding.py | PurpEth/solved-hacking-problem | 6f289d1647eb9c091caa580c7aae673e3ba02952 | [
"Unlicense"
] | 1 | 2021-08-24T22:16:41.000Z | 2021-08-24T22:16:41.000Z | SECUINSIDE/2016/byhuman (unsolved)/f65c09977d6a4adf8949dcb05544a998/random_padding.py | PurpEth/solved-hacking-problem | 6f289d1647eb9c091caa580c7aae673e3ba02952 | [
"Unlicense"
] | null | null | null | SECUINSIDE/2016/byhuman (unsolved)/f65c09977d6a4adf8949dcb05544a998/random_padding.py | PurpEth/solved-hacking-problem | 6f289d1647eb9c091caa580c7aae673e3ba02952 | [
"Unlicense"
] | null | null | null | import random
import time
import os
while not os.path.isfile('bh'):
f = open('/tmp/random_padding', 'wb')
f.write('\x90' * random.getrandbits(12))
f.close()
time.sleep(0.1) | 19.666667 | 41 | 0.683616 | 30 | 177 | 4 | 0.733333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.03871 | 0.124294 | 177 | 9 | 42 | 19.666667 | 0.735484 | 0 | 0 | 0 | 0 | 0 | 0.151685 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.375 | 0 | 0.375 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
fd9d37f0a9696aa9046f11749f8eb7774d1e036b | 302 | py | Python | geocodio/__init__.py | snake-plissken/pygeocodio | 1f6914da8833816dca07997493844a6bd7d3fc10 | [
"BSD-3-Clause"
] | null | null | null | geocodio/__init__.py | snake-plissken/pygeocodio | 1f6914da8833816dca07997493844a6bd7d3fc10 | [
"BSD-3-Clause"
] | null | null | null | geocodio/__init__.py | snake-plissken/pygeocodio | 1f6914da8833816dca07997493844a6bd7d3fc10 | [
"BSD-3-Clause"
] | null | null | null | #!/usr/bin/env python
# -*- coding: utf-8 -*-
__author__ = 'Ben Lopatin'
__email__ = 'ben@wellfire.co'
__version__ = '0.5.0'
from .client import GeocodioClient # noqa
from .data import Address, Location, LocationCollection # noqa
__all__ = [GeocodioClient, Address, Location, LocationCollection]
| 23.230769 | 65 | 0.728477 | 35 | 302 | 5.828571 | 0.742857 | 0.147059 | 0.323529 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.015444 | 0.142384 | 302 | 12 | 66 | 25.166667 | 0.772201 | 0.172185 | 0 | 0 | 0 | 0 | 0.126016 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 0.333333 | 0 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
fd9e83d4d236ca484fa0cb8ca426cd834a1c1296 | 2,179 | py | Python | faceAndOrientation1.py | SiAce/PhysicsResearchPractice | 737bbdbef93b250898e8202d618af18aa0ed0a58 | [
"MIT"
] | null | null | null | faceAndOrientation1.py | SiAce/PhysicsResearchPractice | 737bbdbef93b250898e8202d618af18aa0ed0a58 | [
"MIT"
] | null | null | null | faceAndOrientation1.py | SiAce/PhysicsResearchPractice | 737bbdbef93b250898e8202d618af18aa0ed0a58 | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
"""
Created on Wed Mar 15 18:44:03 2017
@author: 93137
"""
import numpy as np
def gcd(a,b): #calculate the greatest common divisor of a and b
while (b != 0) :
c = a % b
a = b
b = c
return a
def lcm(a,b): #calculate the lowest common multiple of a and b
return a*b/gcd(a,b)
def hkl2uvw(h,k,l):
a,b,c = [0,0,0],[0,0,0],[0,0,0]
aa,bb,cc,ab,ac,bc = 0,0,0,0,0,0
u,v,w,u1,v1,w1,u2,u3,v3,w3 = 0,0,0,0,0,0,0,0,0,0
for i in range(3):
print "a[%d]:" %i
a[i] = input()
for i in range(3):
print "b[%d]:" %i
b[i] = input()
for i in range(3):
print "c[%d]:" %i
c[i] = input()
for i in range(3):
aa += a[i]**2
for i in range(3):
bb += b[i]**2
for i in range(3):
cc += c[i]**2
for i in range(3):
ab += a[i]*b[i]
for i in range(3):
ac += a[i]*c[i]
for i in range(3):
bc += b[i]*c[i]
v1 = (l*bc-k*cc)*(h*ab-k*aa)-(k*ac-h*bc)*(k*ac-l*ab)
u1 = (l*bc-k*cc)*(k*ab-h*bb)-(k*ac-h*bc)*(l*bb-k*bc)
w1 = (l*bb-k*bc)*(h*ab-k*aa)-(k*ab-h*bb)*(k*ac-l*ab)
u2 = (l*bb-k*bc)*(k*ab-h*bc)-(k*ab-h*bb)*(l*bc-k*cc)
u3 = lcm(u1,u2)
v3 = v1 * u3 / u1
w3 = w1 * u3 / u1
u = u3 / gcd(gcd(u3,v3),w3)
v = v3 / gcd(gcd(u3,v3),w3)
print u,v,w
def uvw2hkl(u,v,w):
a,b,c = [0,0,0],[0,0,0],[0,0,0]
aa,bb,cc,ab,ac,bc = 0,0,0,0,0,0
h1,k1,l1,h,k,l = 0,0,0,0,0,0
for i in range(3):
print "a[%d]:" %i
a[i] = input()
for i in range(3):
print "b[%d]:" %i
b[i] = input()
for i in range(3):
print "c[%d]:" %i
c[i] = input()
for i in range(3):
aa += a[i]**2
for i in range(3):
bb += b[i]**2
for i in range(3):
cc += c[i]**2
for i in range(3):
ab += a[i]*b[i]
for i in range(3):
ac += a[i]*c[i]
for i in range(3):
bc += b[i]*c[i]
h1 = u*aa + v*ab + w*ac
k1 = u*ab + v*bb + w*bc
l1 = u*ac + v*bc + w*cc
h = h1 / gcd(gcd(h1,k1),l1)
k = k1 / gcd(gcd(h1,k1),l1)
l = l1 / gcd(gcd(h1,k1),l1)
print h,k,l
hkl2uvw(1,1,1) | 24.761364 | 63 | 0.438274 | 486 | 2,179 | 1.965021 | 0.144033 | 0.08377 | 0.106806 | 0.117277 | 0.564398 | 0.487958 | 0.46911 | 0.46911 | 0.46911 | 0.464921 | 0 | 0.097279 | 0.325379 | 2,179 | 88 | 64 | 24.761364 | 0.552381 | 0.053235 | 0 | 0.597403 | 0 | 0 | 0.017991 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.012987 | null | null | 0.103896 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
fd9fd7c0cb23108730f634106519a1bad579afbc | 1,388 | py | Python | src/python/1-25/problem_22.py | Fazendaaa/project-euler | 80286ffe2db566872953d3021c3d6006f686c2cf | [
"MIT"
] | 3 | 2017-09-16T11:45:17.000Z | 2018-06-20T23:21:29.000Z | src/python/1-25/problem_22.py | Fazendaaa/project-euler | 80286ffe2db566872953d3021c3d6006f686c2cf | [
"MIT"
] | null | null | null | src/python/1-25/problem_22.py | Fazendaaa/project-euler | 80286ffe2db566872953d3021c3d6006f686c2cf | [
"MIT"
] | null | null | null | """
Names scores
Using problem_22.txt, a 46K text file containing over five-thousand first
names, begin by sorting it into alphabetical order. Then working out the
alphabetical value for each name, multiply this value by its alphabetical
position in the list to obtain a name score.
For example, when the list is sorted into alphabetical order, COLIN, which
is worth 3 + 15 + 12 + 9 + 14 = 53, is the 938th name in the list. So, COLIN
would obtain a score of 938 × 53 = 49714.
What is the total of all the name scores in the file?
Answer: 871198282
obs: articles that helped me out:
* http://stackoverflow.com/a/5545284/7092954
"""
def order(letter):
"""Given letter, returns it alphabetic index"""
return ord(str.lower(letter))-96
def names_scores(names):
"""Given a list of names, sorted it into alphabetical order then calculates \
alphabetical value for eache name by multiplying this value by its alphabetical \
postion int the list to obtain a name score"""
# pylint: disable=line-too-long
return sum([sum(list(map(order, list(value))))*(index+1) for index, value in enumerate(sorted(names))])
with open('./input/problem_22.txt', 'r') as file:
NAMES = file.read().replace("\"", '').split(',')
print(names_scores(NAMES))
| 39.657143 | 107 | 0.659942 | 203 | 1,388 | 4.497537 | 0.53202 | 0.030668 | 0.069003 | 0.050383 | 0.170865 | 0.054765 | 0.054765 | 0 | 0 | 0 | 0 | 0.052581 | 0.246398 | 1,388 | 34 | 108 | 40.823529 | 0.819312 | 0.70317 | 0 | 0 | 0 | 0 | 0.073099 | 0.064327 | 0 | 0 | 0 | 0 | 0 | 1 | 0.285714 | false | 0 | 0 | 0 | 0.571429 | 0.142857 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
fda90f2733f7b555230d2b24d9df04d8bf3c1cb6 | 660 | py | Python | test/ci-hooks-app/test_cli.py | pymor/ci_hooks_app | 0d6bb2eb848056561750c4cfd3602127a7ff291c | [
"BSD-2-Clause"
] | 1 | 2021-12-18T11:43:28.000Z | 2021-12-18T11:43:28.000Z | test/ci-hooks-app/test_cli.py | pymor/ci_hooks_app | 0d6bb2eb848056561750c4cfd3602127a7ff291c | [
"BSD-2-Clause"
] | 2 | 2019-02-14T08:54:01.000Z | 2019-02-27T14:15:59.000Z | test/ci-hooks-app/test_cli.py | pymor/ci_hooks_app | 0d6bb2eb848056561750c4cfd3602127a7ff291c | [
"BSD-2-Clause"
] | 1 | 2022-01-20T22:10:28.000Z | 2022-01-20T22:10:28.000Z | """ Test suite for the cli module.
The script can be executed on its own or incorporated into a larger test suite.
However the tests are run, be aware of which version of the module is actually
being tested. If the library is installed in site-packages, that version takes
precedence over the version in this project directory. Use a virtualenv test
environment or setuptools develop mode to test against the development version.
"""
from subprocess import call
from sys import executable
import pytest
from ci-hooks-app.cli import * # test __all__
# Make the script executable.
if __name__ == "__main__":
raise SystemExit(pytest.main([__file__]))
| 30 | 79 | 0.778788 | 102 | 660 | 4.882353 | 0.676471 | 0.036145 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.171212 | 660 | 21 | 80 | 31.428571 | 0.91042 | 0.060606 | 0 | 0 | 0 | 0 | 0.043956 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.666667 | null | null | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
fdd124e5a78e1ead6154fa04cd83ccdcb61a9c15 | 2,394 | py | Python | examples/compare_intervals.py | krasch/smart-assistants | 4242f78efaf300546ebb2cc0f6ba9f9ac10256fa | [
"MIT"
] | 9 | 2015-02-13T22:33:46.000Z | 2021-04-22T08:53:18.000Z | examples/compare_intervals.py | krasch/smart-assistants | 4242f78efaf300546ebb2cc0f6ba9f9ac10256fa | [
"MIT"
] | 3 | 2018-03-15T23:01:22.000Z | 2019-04-11T16:43:33.000Z | examples/compare_intervals.py | krasch/smart-assistants | 4242f78efaf300546ebb2cc0f6ba9f9ac10256fa | [
"MIT"
] | 3 | 2018-03-15T15:43:11.000Z | 2021-04-26T14:37:22.000Z | # -*- coding: UTF-8 -*-
"""
Evaluate how the recommender system copes with varying interval widths and Delta t_max settings. Details
for this experiment can be found in the paper in Section 6.5 and in the Dissertation in Section 5.5.6.
"""
import sys
sys.path.append("..")
import pandas
from evaluation.experiment import Experiment
from recsys.classifiers.temporal import TemporalEvidencesClassifier
from recsys.classifiers.binning import initialize_bins
from recsys.dataset import load_dataset
#configuration
data = load_dataset("../datasets/houseA.csv", "../datasets/houseA.config")
intervals_to_test = [#test various settings for delta t_max
("Delta t_max=1200s", initialize_bins(start=0, end=60, width=10) +
initialize_bins(start=60, end=1200, width=30)),
("Delta t_max=120s", initialize_bins(start=0, end=60, width=10) +
initialize_bins(start=60, end=120, width=30)),
("Delta t_max=60s", initialize_bins(start=0, end=60, width=10)),
("Delta t_max=30s", initialize_bins(start=0, end=30, width=10)),
("Delta t_max=10s", initialize_bins(start=0, end=10, width=10)),
#test various interval widths
("all intervals 2s wide", initialize_bins(start=0, end=300, width=2)),
("all intervals 4s wide", initialize_bins(start=0, end=300, width=4)),
("all intervals 6s wide", initialize_bins(start=0, end=300, width=6)),
("all intervals 8s wide", initialize_bins(start=0, end=300, width=8)),
("all intervals 30s wide", initialize_bins(start=0, end=300, width=30)),
("all intervals 50s wide", initialize_bins(start=0, end=300, width=50)),
("all intervals 100s wide", initialize_bins(start=0, end=300, width=100))]
#run 10-fold cross-validation for each of the configured intervals
experiment = Experiment(data)
for (name, bins) in intervals_to_test:
experiment.add_classifier(TemporalEvidencesClassifier(data.features, data.target_names,
bins=bins), name=name)
results = experiment.run(folds=10)
results.print_quality_comparison_at_cutoff(cutoff=1, metrics=["Recall", "Precision", "F1"])
| 54.409091 | 104 | 0.631161 | 307 | 2,394 | 4.811075 | 0.355049 | 0.14218 | 0.180095 | 0.162492 | 0.333108 | 0.263372 | 0.263372 | 0.263372 | 0.075829 | 0.075829 | 0 | 0.064318 | 0.253133 | 2,394 | 43 | 105 | 55.674419 | 0.761745 | 0.155806 | 0 | 0 | 0 | 0 | 0.146839 | 0.023395 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.206897 | 0 | 0.206897 | 0.034483 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
fdd8ecf76ece1aad08b2a4d983a33392ad410446 | 16,662 | py | Python | scripts/py_modelica_exporter/run.py | webgme/webgme-dss | 2b915e12de6c3f5873d13e192b0485457c70208b | [
"MIT"
] | 8 | 2018-06-29T02:29:09.000Z | 2021-06-25T16:20:39.000Z | scripts/py_modelica_exporter/run.py | rozhddmi/webgme-dss | 2b915e12de6c3f5873d13e192b0485457c70208b | [
"MIT"
] | 14 | 2018-08-08T15:59:54.000Z | 2021-06-09T19:23:22.000Z | scripts/py_modelica_exporter/run.py | rozhddmi/webgme-dss | 2b915e12de6c3f5873d13e192b0485457c70208b | [
"MIT"
] | 3 | 2019-03-20T10:06:58.000Z | 2021-06-11T03:00:30.000Z | import logging
import json
from exporters import ComponentExporter
logger = logging.getLogger('py_modelica_exporter')
logger.setLevel(logging.ERROR)
# create console handler with a higher log level
ch = logging.StreamHandler()
ch.setLevel(logging.ERROR)
logger.addHandler(ch)
# # create formatter and add it to the handlers
# formatter = logging.Formatter('%(asctime)s - %(name)s - %(levelname)s - %(message)s')
# fh.setFormatter(formatter)
# ch.setFormatter(formatter)
# add the handlers to the logger
ELECTRICAL_ANALOG = [
# Basic
'Modelica.Electrical.Analog.Basic.Ground',
'Modelica.Electrical.Analog.Basic.Resistor',
'Modelica.Electrical.Analog.Basic.HeatingResistor',
'Modelica.Electrical.Analog.Basic.Conductor',
'Modelica.Electrical.Analog.Basic.Capacitor',
'Modelica.Electrical.Analog.Basic.Inductor',
'Modelica.Electrical.Analog.Basic.SaturatingInductor',
'Modelica.Electrical.Analog.Basic.Transformer',
#'Modelica.Electrical.Analog.Basic.M_Transformer',
'Modelica.Electrical.Analog.Basic.Gyrator',
'Modelica.Electrical.Analog.Basic.EMF',
'Modelica.Electrical.Analog.Basic.TranslationalEMF',
'Modelica.Electrical.Analog.Basic.VCV',
'Modelica.Electrical.Analog.Basic.VCC',
'Modelica.Electrical.Analog.Basic.CCV',
'Modelica.Electrical.Analog.Basic.CCC',
'Modelica.Electrical.Analog.Basic.OpAmp',
'Modelica.Electrical.Analog.Basic.OpAmpDetailed',
'Modelica.Electrical.Analog.Basic.VariableResistor',
'Modelica.Electrical.Analog.Basic.VariableConductor',
'Modelica.Electrical.Analog.Basic.VariableCapacitor',
'Modelica.Electrical.Analog.Basic.VariableInductor',
'Modelica.Electrical.Analog.Basic.Potentiometer',
# IDEAL
# TODO
# Semiconductors
# TODO
# Sensors
'Modelica.Electrical.Analog.Sensors.PotentialSensor',
'Modelica.Electrical.Analog.Sensors.VoltageSensor',
'Modelica.Electrical.Analog.Sensors.CurrentSensor',
'Modelica.Electrical.Analog.Sensors.PowerSensor',
# Sources
'Modelica.Electrical.Analog.Sources.SignalVoltage',
'Modelica.Electrical.Analog.Sources.ConstantVoltage',
'Modelica.Electrical.Analog.Sources.StepVoltage',
'Modelica.Electrical.Analog.Sources.RampVoltage',
'Modelica.Electrical.Analog.Sources.SineVoltage',
'Modelica.Electrical.Analog.Sources.CosineVoltage',
'Modelica.Electrical.Analog.Sources.ExpSineVoltage',
'Modelica.Electrical.Analog.Sources.ExponentialsVoltage',
'Modelica.Electrical.Analog.Sources.PulseVoltage',
'Modelica.Electrical.Analog.Sources.SawToothVoltage',
'Modelica.Electrical.Analog.Sources.TrapezoidVoltage',
'Modelica.Electrical.Analog.Sources.TableVoltage',
'Modelica.Electrical.Analog.Sources.SignalCurrent',
'Modelica.Electrical.Analog.Sources.ConstantCurrent',
'Modelica.Electrical.Analog.Sources.StepCurrent',
'Modelica.Electrical.Analog.Sources.RampCurrent',
'Modelica.Electrical.Analog.Sources.SineCurrent',
'Modelica.Electrical.Analog.Sources.CosineCurrent',
'Modelica.Electrical.Analog.Sources.ExpSineCurrent',
'Modelica.Electrical.Analog.Sources.ExponentialsCurrent',
'Modelica.Electrical.Analog.Sources.PulseCurrent',
'Modelica.Electrical.Analog.Sources.SawToothCurrent',
'Modelica.Electrical.Analog.Sources.TrapezoidCurrent',
'Modelica.Electrical.Analog.Sources.TableCurrent',
'Modelica.Electrical.Analog.Sources.SupplyVoltage'
]
TRANSLATIONAL_MECHANICS = [
'Modelica.Mechanics.Translational.Components.Fixed',
'Modelica.Mechanics.Translational.Components.Mass',
'Modelica.Mechanics.Translational.Components.Rod',
'Modelica.Mechanics.Translational.Components.Spring',
'Modelica.Mechanics.Translational.Components.Damper',
'Modelica.Mechanics.Translational.Components.SpringDamper',
'Modelica.Mechanics.Translational.Components.ElastoGap',
'Modelica.Mechanics.Translational.Components.SupportFriction',
'Modelica.Mechanics.Translational.Components.Brake',
'Modelica.Mechanics.Translational.Components.IdealGearR2T',
'Modelica.Mechanics.Translational.Components.IdealRollingWheel',
'Modelica.Mechanics.Translational.Components.InitializeFlange',
'Modelica.Mechanics.Translational.Components.MassWithStopAndFriction',
'Modelica.Mechanics.Translational.Components.RelativeStates',
'Modelica.Mechanics.Translational.Sensors.PositionSensor',
'Modelica.Mechanics.Translational.Sensors.SpeedSensor',
'Modelica.Mechanics.Translational.Sensors.AccSensor',
'Modelica.Mechanics.Translational.Sensors.RelPositionSensor',
'Modelica.Mechanics.Translational.Sensors.RelSpeedSensor',
'Modelica.Mechanics.Translational.Sensors.RelAccSensor',
'Modelica.Mechanics.Translational.Sensors.ForceSensor',
'Modelica.Mechanics.Translational.Sensors.PowerSensor',
'Modelica.Mechanics.Translational.Sensors.MultiSensor',
'Modelica.Mechanics.Translational.Sources.Position',
'Modelica.Mechanics.Translational.Sources.Speed',
'Modelica.Mechanics.Translational.Sources.Accelerate',
'Modelica.Mechanics.Translational.Sources.Move',
'Modelica.Mechanics.Translational.Sources.Force',
'Modelica.Mechanics.Translational.Sources.Force2',
'Modelica.Mechanics.Translational.Sources.LinearSpeedDependentForce',
'Modelica.Mechanics.Translational.Sources.QuadraticSpeedDependentForce',
'Modelica.Mechanics.Translational.Sources.ConstantForce',
'Modelica.Mechanics.Translational.Sources.SignForce',
'Modelica.Mechanics.Translational.Sources.ConstantSpeed',
'Modelica.Mechanics.Translational.Sources.ForceStep'
]
ROTATIONAL_MECHANICS = [
'Modelica.Mechanics.Rotational.Components.Fixed',
'Modelica.Mechanics.Rotational.Components.Inertia',
'Modelica.Mechanics.Rotational.Components.Disc',
'Modelica.Mechanics.Rotational.Components.Spring',
'Modelica.Mechanics.Rotational.Components.Damper',
'Modelica.Mechanics.Rotational.Components.SpringDamper',
'Modelica.Mechanics.Rotational.Components.ElastoBacklash',
'Modelica.Mechanics.Rotational.Components.ElastoBacklash2',
'Modelica.Mechanics.Rotational.Components.BearingFriction',
'Modelica.Mechanics.Rotational.Components.Brake',
'Modelica.Mechanics.Rotational.Components.Clutch',
'Modelica.Mechanics.Rotational.Components.OneWayClutch',
'Modelica.Mechanics.Rotational.Components.IdealGear',
'Modelica.Mechanics.Rotational.Components.LossyGear',
'Modelica.Mechanics.Rotational.Components.IdealPlanetary',
'Modelica.Mechanics.Rotational.Components.Gearbox',
'Modelica.Mechanics.Rotational.Components.IdealGearR2T',
'Modelica.Mechanics.Rotational.Components.IdealRollingWheel',
'Modelica.Mechanics.Rotational.Components.InitializeFlange',
'Modelica.Mechanics.Rotational.Components.RelativeStates',
'Modelica.Mechanics.Rotational.Components.TorqueToAngleAdaptor',
'Modelica.Mechanics.Rotational.Components.AngleToTorqueAdaptor',
'Modelica.Mechanics.Rotational.Sensors.AngleSensor',
'Modelica.Mechanics.Rotational.Sensors.SpeedSensor',
'Modelica.Mechanics.Rotational.Sensors.AccSensor',
'Modelica.Mechanics.Rotational.Sensors.RelAngleSensor',
'Modelica.Mechanics.Rotational.Sensors.RelSpeedSensor',
'Modelica.Mechanics.Rotational.Sensors.RelAccSensor',
'Modelica.Mechanics.Rotational.Sensors.TorqueSensor',
'Modelica.Mechanics.Rotational.Sensors.PowerSensor',
'Modelica.Mechanics.Rotational.Sensors.MultiSensor',
'Modelica.Mechanics.Rotational.Sources.Position',
'Modelica.Mechanics.Rotational.Sources.Speed',
'Modelica.Mechanics.Rotational.Sources.Accelerate',
'Modelica.Mechanics.Rotational.Sources.Move',
'Modelica.Mechanics.Rotational.Sources.Torque',
'Modelica.Mechanics.Rotational.Sources.Torque2',
'Modelica.Mechanics.Rotational.Sources.LinearSpeedDependentTorque',
'Modelica.Mechanics.Rotational.Sources.QuadraticSpeedDependentTorque',
'Modelica.Mechanics.Rotational.Sources.ConstantTorque',
'Modelica.Mechanics.Rotational.Sources.SignTorque',
'Modelica.Mechanics.Rotational.Sources.ConstantSpeed',
'Modelica.Mechanics.Rotational.Sources.TorqueStep'
]
FLUID_HEAT_FLOW = [
'Modelica.Thermal.FluidHeatFlow.Components.IsolatedPipe',
'Modelica.Thermal.FluidHeatFlow.Components.HeatedPipe',
'Modelica.Thermal.FluidHeatFlow.Components.Valve',
'Modelica.Thermal.FluidHeatFlow.Sensors.PressureSensor',
'Modelica.Thermal.FluidHeatFlow.Sensors.TemperatureSensor',
'Modelica.Thermal.FluidHeatFlow.Sensors.RelPressureSensor',
'Modelica.Thermal.FluidHeatFlow.Sensors.RelTemperatureSensor',
'Modelica.Thermal.FluidHeatFlow.Sensors.MassFlowSensor',
'Modelica.Thermal.FluidHeatFlow.Sensors.VolumeFlowSensor',
'Modelica.Thermal.FluidHeatFlow.Sensors.EnthalpyFlowSensor',
'Modelica.Thermal.FluidHeatFlow.Sources.Ambient',
'Modelica.Thermal.FluidHeatFlow.Sources.AbsolutePressure',
'Modelica.Thermal.FluidHeatFlow.Sources.VolumeFlow',
'Modelica.Thermal.FluidHeatFlow.Sources.PressureIncrease',
'Modelica.Thermal.FluidHeatFlow.Sources.IdealPump'
]
HEAT_TRANSFER = [
'Modelica.Thermal.HeatTransfer.Components.HeatCapacitor',
'Modelica.Thermal.HeatTransfer.Components.ThermalConductor',
'Modelica.Thermal.HeatTransfer.Components.ThermalResistor',
'Modelica.Thermal.HeatTransfer.Components.Convection',
'Modelica.Thermal.HeatTransfer.Components.ConvectiveResistor',
'Modelica.Thermal.HeatTransfer.Components.BodyRadiation',
'Modelica.Thermal.HeatTransfer.Components.ThermalCollector',
'Modelica.Thermal.HeatTransfer.Sensors.TemperatureSensor',
'Modelica.Thermal.HeatTransfer.Sensors.RelTemperatureSensor',
'Modelica.Thermal.HeatTransfer.Sensors.HeatFlowSensor',
'Modelica.Thermal.HeatTransfer.Sensors.ConditionalFixedHeatFlowSensor',
'Modelica.Thermal.HeatTransfer.Sources.FixedTemperature',
'Modelica.Thermal.HeatTransfer.Sources.PrescribedTemperature',
'Modelica.Thermal.HeatTransfer.Sources.FixedHeatFlow',
'Modelica.Thermal.HeatTransfer.Sources.PrescribedHeatFlow',
'Modelica.Thermal.HeatTransfer.Celsius.ToKelvin',
'Modelica.Thermal.HeatTransfer.Celsius.FromKelvin',
'Modelica.Thermal.HeatTransfer.Celsius.FixedTemperature',
'Modelica.Thermal.HeatTransfer.Celsius.PrescribedTemperature',
'Modelica.Thermal.HeatTransfer.Celsius.TemperatureSensor',
'Modelica.Thermal.HeatTransfer.Fahrenheit.ToKelvin',
'Modelica.Thermal.HeatTransfer.Fahrenheit.FromKelvin',
'Modelica.Thermal.HeatTransfer.Fahrenheit.FixedTemperature',
'Modelica.Thermal.HeatTransfer.Fahrenheit.PrescribedTemperature',
'Modelica.Thermal.HeatTransfer.Fahrenheit.TemperatureSensor',
'Modelica.Thermal.HeatTransfer.Rankine.ToKelvin',
'Modelica.Thermal.HeatTransfer.Rankine.FromKelvin',
'Modelica.Thermal.HeatTransfer.Rankine.FixedTemperature',
'Modelica.Thermal.HeatTransfer.Rankine.PrescribedTemperature',
'Modelica.Thermal.HeatTransfer.Rankine.TemperatureSensor'
]
COMPLEX_BLOCKS = [
'Modelica.ComplexBlocks.ComplexMath.Conj',
'Modelica.ComplexBlocks.ComplexMath.Gain',
'Modelica.ComplexBlocks.ComplexMath.Sum',
'Modelica.ComplexBlocks.ComplexMath.Feedback',
'Modelica.ComplexBlocks.ComplexMath.Add',
'Modelica.ComplexBlocks.ComplexMath.Add3',
'Modelica.ComplexBlocks.ComplexMath.Product',
'Modelica.ComplexBlocks.ComplexMath.Division',
'Modelica.ComplexBlocks.ComplexMath.Sqrt',
'Modelica.ComplexBlocks.ComplexMath.Sin',
'Modelica.ComplexBlocks.ComplexMath.Cos',
'Modelica.ComplexBlocks.ComplexMath.Tan',
'Modelica.ComplexBlocks.ComplexMath.Asin',
'Modelica.ComplexBlocks.ComplexMath.Acos',
'Modelica.ComplexBlocks.ComplexMath.Atan',
'Modelica.ComplexBlocks.ComplexMath.Sinh',
'Modelica.ComplexBlocks.ComplexMath.Cosh',
'Modelica.ComplexBlocks.ComplexMath.Tanh',
'Modelica.ComplexBlocks.ComplexMath.Exp',
'Modelica.ComplexBlocks.ComplexMath.Log',
'Modelica.ComplexBlocks.ComplexMath.RealToComplex',
'Modelica.ComplexBlocks.ComplexMath.PolarToComplex',
'Modelica.ComplexBlocks.ComplexMath.ComplexToReal',
'Modelica.ComplexBlocks.ComplexMath.ComplexToPolar',
'Modelica.ComplexBlocks.ComplexMath.TransferFunction',
'Modelica.ComplexBlocks.Sources.ComplexExpression',
'Modelica.ComplexBlocks.Sources.ComplexConstant',
'Modelica.ComplexBlocks.Sources.ComplexStep',
'Modelica.ComplexBlocks.Sources.ComplexRotatingPhasor',
'Modelica.ComplexBlocks.Sources.LogFrequencySweep'
]
BLOCKS_CONTINUOUS = [
'Modelica.Thermal.FluidHeatFlow.Sources.IdealPump',
'Modelica.Blocks.Continuous.LimIntegrator',
'Modelica.Blocks.Continuous.Derivative',
'Modelica.Blocks.Continuous.FirstOrder',
'Modelica.Blocks.Continuous.SecondOrder',
'Modelica.Blocks.Continuous.PI',
'Modelica.Blocks.Continuous.PID',
'Modelica.Blocks.Continuous.LimPID',
'Modelica.Blocks.Continuous.TransferFunction',
'Modelica.Blocks.Continuous.StateSpace',
'Modelica.Blocks.Continuous.Der',
'Modelica.Blocks.Continuous.LowpassButterworth',
'Modelica.Blocks.Continuous.CriticalDamping',
'Modelica.Blocks.Continuous.Filter',
'Modelica.Blocks.Discrete.Sampler',
'Modelica.Blocks.Discrete.ZeroOrderHold',
'Modelica.Blocks.Discrete.FirstOrderHold',
'Modelica.Blocks.Discrete.UnitDelay',
'Modelica.Blocks.Discrete.TransferFunction',
'Modelica.Blocks.Discrete.StateSpace',
'Modelica.Blocks.Discrete.TriggeredSampler',
'Modelica.Blocks.Discrete.TriggeredMax',
'Modelica.Blocks.Math.InverseBlockConstraints',
'Modelica.Blocks.Math.Gain',
'Modelica.Blocks.Math.MatrixGain',
'Modelica.Blocks.Math.MultiSum',
'Modelica.Blocks.Math.MultiProduct',
'Modelica.Blocks.Math.MultiSwitch',
'Modelica.Blocks.Math.Sum',
'Modelica.Blocks.Math.Feedback',
'Modelica.Blocks.Math.Add',
'Modelica.Blocks.Math.Add3',
'Modelica.Blocks.Math.Product',
'Modelica.Blocks.Math.Division',
'Modelica.Blocks.Math.Abs',
'Modelica.Blocks.Math.Sign',
'Modelica.Blocks.Math.Sqrt',
'Modelica.Blocks.Math.Sin',
'Modelica.Blocks.Math.Cos',
'Modelica.Blocks.Math.Tan',
'Modelica.Blocks.Math.Asin',
'Modelica.Blocks.Math.Acos',
'Modelica.Blocks.Math.Atan',
'Modelica.Blocks.Math.Atan2',
'Modelica.Blocks.Math.Sinh',
'Modelica.Blocks.Math.Cosh',
'Modelica.Blocks.Math.Tanh',
'Modelica.Blocks.Math.Exp',
'Modelica.Blocks.Math.Log',
'Modelica.Blocks.Math.Log10',
'Modelica.Blocks.Math.RealToInteger',
'Modelica.Blocks.Math.IntegerToReal'
'Modelica.Blocks.Sources.RealExpression',
'Modelica.Blocks.Sources.IntegerExpression',
'Modelica.Blocks.Sources.BooleanExpression',
'Modelica.Blocks.Sources.Clock',
'Modelica.Blocks.Sources.Constant',
'Modelica.Blocks.Sources.Step',
'Modelica.Blocks.Sources.Ramp',
'Modelica.Blocks.Sources.Sine',
'Modelica.Blocks.Sources.Cosine',
'Modelica.Blocks.Sources.ExpSine',
'Modelica.Blocks.Sources.Exponentials',
'Modelica.Blocks.Sources.Pulse',
'Modelica.Blocks.Sources.SawTooth',
'Modelica.Blocks.Sources.Trapezoid',
'Modelica.Blocks.Sources.BooleanConstant',
'Modelica.Blocks.Sources.BooleanStep',
'Modelica.Blocks.Sources.BooleanPulse',
'Modelica.Blocks.Sources.SampleTrigger',
'Modelica.Blocks.Sources.BooleanTable',
'Modelica.Blocks.Sources.IntegerConstant',
'Modelica.Blocks.Sources.IntegerStep',
'Modelica.Blocks.Sources.IntegerTable'
]
DOMAINS = [
"Modelica.Electrical.Analog",
"Modelica.Mechanics.Translational",
"Modelica.Mechanics.Rotational",
"Modelica.Thermal.FluidHeatFlow",
"Modelica.Thermal.HeatTransfer",
"Modelica.Blocks"
]
COMPONENTS = ELECTRICAL_ANALOG + TRANSLATIONAL_MECHANICS + ROTATIONAL_MECHANICS + FLUID_HEAT_FLOW + HEAT_TRANSFER + BLOCKS_CONTINUOUS
#COMPONENTS = ['Modelica.Mechanics.Rotational.Components.Gearbox']
result = []
COMPONENTS = ELECTRICAL_ANALOG
component_exporter = ComponentExporter([], export_icons=True)
for modelica_uri in COMPONENTS:
try:
component = component_exporter.get_component_json(modelica_uri)
if len(component['components']) == 1 and component['components'][0]['fullName'] == 'Exception':
logger.error('Component failed {0}'.format(component['exportedComponentClass']))
else:
result.append(component)
except Exception as err:
logger.error('Exception at {0}'.format(modelica_uri))
logger.exception(err)
with open('components.json', 'w') as outfile:
json.dump(result, outfile)
| 43.732283 | 133 | 0.772356 | 1,493 | 16,662 | 8.601474 | 0.210985 | 0.107226 | 0.09905 | 0.060349 | 0.019935 | 0 | 0 | 0 | 0 | 0 | 0 | 0.000938 | 0.104129 | 16,662 | 380 | 134 | 43.847368 | 0.859382 | 0.025747 | 0 | 0 | 0 | 0 | 0.788666 | 0.781019 | 0 | 0 | 0 | 0.002632 | 0 | 1 | 0 | false | 0.003086 | 0.009259 | 0 | 0.009259 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
fddc61bd4fae05d0fd84deaa38faa03a701af199 | 209 | py | Python | gitlabservice/utility/model/DeployFileModel.py | bisirkin-pv/sqlorchestrator | 45b96633f4d26b25ed657eb021e058862a42c67b | [
"MIT"
] | 1 | 2021-02-12T05:39:01.000Z | 2021-02-12T05:39:01.000Z | gitlabservice/utility/model/DeployFileModel.py | bisirkin-pv/sqlorchestrator | 45b96633f4d26b25ed657eb021e058862a42c67b | [
"MIT"
] | null | null | null | gitlabservice/utility/model/DeployFileModel.py | bisirkin-pv/sqlorchestrator | 45b96633f4d26b25ed657eb021e058862a42c67b | [
"MIT"
] | null | null | null | from collections import namedtuple
DeployFileHeader = namedtuple('deploy', 'group profile')
DeployFileObject = namedtuple('object', 'name type action')
DeployFileParam = namedtuple('param', 'name type base')
| 34.833333 | 59 | 0.779904 | 21 | 209 | 7.761905 | 0.761905 | 0.09816 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.105263 | 209 | 5 | 60 | 41.8 | 0.871658 | 0 | 0 | 0 | 0 | 0 | 0.287081 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 0.25 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
fde3f4b06040095b03f45a97d9c51da912dd18cb | 1,278 | py | Python | Trolls/migrations/0001_initial.py | Akash4307/Wise-master | 5f484e3791a8e4361d8bcad570ac2661636a5cfc | [
"Apache-2.0"
] | null | null | null | Trolls/migrations/0001_initial.py | Akash4307/Wise-master | 5f484e3791a8e4361d8bcad570ac2661636a5cfc | [
"Apache-2.0"
] | 8 | 2021-03-18T21:30:54.000Z | 2022-03-02T14:56:55.000Z | Trolls/migrations/0001_initial.py | Akash4307/Wise-master | 5f484e3791a8e4361d8bcad570ac2661636a5cfc | [
"Apache-2.0"
] | null | null | null | # -*- coding: utf-8 -*-
# Generated by Django 1.11.7 on 2017-12-13 07:33
from __future__ import unicode_literals
from django.db import migrations, models
import django.db.models.deletion
class Migration(migrations.Migration):
initial = True
dependencies = [
]
operations = [
migrations.CreateModel(
name='UserInfo',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('Name', models.CharField(max_length=250)),
('UserId', models.CharField(max_length=250)),
('Link', models.CharField(max_length=1000)),
('UserPhoto', models.CharField(max_length=1000)),
],
),
migrations.CreateModel(
name='UserLocation',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('Location', models.CharField(max_length=500)),
],
),
migrations.AddField(
model_name='userinfo',
name='location',
field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='Trolls.UserLocation'),
),
]
| 31.95 | 114 | 0.581377 | 127 | 1,278 | 5.708661 | 0.488189 | 0.103448 | 0.124138 | 0.165517 | 0.369655 | 0.217931 | 0.217931 | 0.217931 | 0.217931 | 0.217931 | 0 | 0.037322 | 0.287167 | 1,278 | 39 | 115 | 32.769231 | 0.758507 | 0.053208 | 0 | 0.354839 | 1 | 0 | 0.077879 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.096774 | 0 | 0.225806 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
fdf2c1c4ee6374cf826f474c9cfc9e32db96348b | 995 | py | Python | icsmp_project/modulos_aulas/models.py | ICSMP/icsmp | bf811f7457aa6d6e7251c209631d63496e561925 | [
"MIT"
] | 1 | 2021-03-04T02:03:29.000Z | 2021-03-04T02:03:29.000Z | icsmp_project/modulos_aulas/models.py | ravellys/icsmp | b0c86a92c66dc586274480f94a015216b711e478 | [
"MIT"
] | 680 | 2020-10-16T21:37:56.000Z | 2022-02-23T23:48:57.000Z | icsmp_project/modulos_aulas/models.py | ravellys/icsmp | b0c86a92c66dc586274480f94a015216b711e478 | [
"MIT"
] | 1 | 2020-10-13T01:17:09.000Z | 2020-10-13T01:17:09.000Z | from django.db import models
# Create your models here.
from django.urls import reverse
from ordered_model.models import OrderedModel
class ModuloAula(OrderedModel):
nome = models.CharField(max_length=32)
descricao = models.TextField()
slug = models.SlugField(unique=True)
class Meta(OrderedModel.Meta):
pass
def __str__(self):
return self.nome
def get_absolute_url(self):
return reverse('modulos_aulas:detalhe', kwargs={'slug': self.slug})
class Aula(OrderedModel):
nome = models.CharField(max_length=32)
descricao = models.TextField()
slug = models.SlugField(unique=True)
modulo = models.ForeignKey(ModuloAula, on_delete=models.PROTECT)
order_with_respect_to = 'modulo'
v_id = models.CharField(max_length=32)
class Meta(OrderedModel.Meta):
pass
def __str__(self):
return self.nome
def get_absolute_url(self):
return reverse('modulos_aulas:aula', kwargs={'slug': self.slug})
| 25.512821 | 75 | 0.702513 | 124 | 995 | 5.451613 | 0.41129 | 0.059172 | 0.079882 | 0.106509 | 0.612426 | 0.573965 | 0.573965 | 0.573965 | 0.573965 | 0.573965 | 0 | 0.007491 | 0.194975 | 995 | 38 | 76 | 26.184211 | 0.836454 | 0.024121 | 0 | 0.615385 | 0 | 0 | 0.054696 | 0.021672 | 0 | 0 | 0 | 0 | 0 | 1 | 0.153846 | false | 0.076923 | 0.115385 | 0.153846 | 0.923077 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 2 |
fdfa80f4e2132e88931675effa93ba31f787e292 | 974 | py | Python | networks/__init__.py | xuyouze/DropNet | edbaeb72075b819b96e1ca66e966999a40d3645e | [
"Apache-2.0"
] | 1 | 2021-06-28T06:27:06.000Z | 2021-06-28T06:27:06.000Z | networks/__init__.py | xuyouze/DropNet | edbaeb72075b819b96e1ca66e966999a40d3645e | [
"Apache-2.0"
] | null | null | null | networks/__init__.py | xuyouze/DropNet | edbaeb72075b819b96e1ca66e966999a40d3645e | [
"Apache-2.0"
] | null | null | null | # coding:utf-8
# @Time : 2019/6/27
# @Author : xuyouze
# @File Name : __init__.py.py
import importlib
from networks.build import build_network
from .model_component import get_scheduler, init_net
__all__ = ["create_network_model", "get_scheduler"]
def create_network_model(config):
network = build_network(config.network_name)
config.logger.info("{0} network has been created".format(config.network_name))
return network(config)
#
# def find_network_using_name(config):
# model_filename = "networks." + config.network_name + "_model_component"
# modellib = importlib.import_module(model_filename)
# network = None
# for name, cls in modellib.__dict__.items():
# if name == "define_net":
# network = cls
#
# if not network:
# raise NotImplementedError(
# "In %s.py, there should be a method named %s." % (
# model_filename, "define_net"))
#
# return network
| 27.828571 | 82 | 0.662218 | 118 | 974 | 5.161017 | 0.5 | 0.085386 | 0.083744 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.011952 | 0.226899 | 974 | 34 | 83 | 28.647059 | 0.796813 | 0.587269 | 0 | 0 | 0 | 0 | 0.159686 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.125 | false | 0 | 0.375 | 0 | 0.625 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
fdfc1ad3d39b49e6459e833a627ff08e3c5d158f | 880 | py | Python | test.py | travisbyr/SDV602Test | fd059f495d52643b24b0a7418e7655484a8372f8 | [
"MIT"
] | null | null | null | test.py | travisbyr/SDV602Test | fd059f495d52643b24b0a7418e7655484a8372f8 | [
"MIT"
] | null | null | null | test.py | travisbyr/SDV602Test | fd059f495d52643b24b0a7418e7655484a8372f8 | [
"MIT"
] | null | null | null | # print('**********************')
# print(" Calculator")
# print('**********************')
# i = input('Whats your name? ')
# print('Hello ' + i)
# while True:
# print('1 - Add')
# print('2 - Subtract')
# print('3 - Multiply')
# print('4 - Divide')
# cal = input('What calculation do you want? ')
# a = input('Enter first number: ')
# b = input('Enter second number: ')
# if cal == '1':
# cal = (int(a) + int(b))
# elif cal == '2':
# cal = (int(a) - int(b))
# elif cal == '3':
# cal = (int(a) * int(b))
# elif cal == '4':
# pcal = (int(a) / int(b))
# print('**********')
# print(i + ', the total is: ' + str(cal))
# print('**********')
# x = input('Press q to quit, otherwise continue ')
# if x.lower() == 'q':
# break
# else:
# print('')
# continue
| 26.666667 | 55 | 0.4125 | 100 | 880 | 3.63 | 0.48 | 0.044077 | 0.077135 | 0.088154 | 0.14876 | 0.14876 | 0.14876 | 0 | 0 | 0 | 0 | 0.013158 | 0.309091 | 880 | 32 | 56 | 27.5 | 0.583882 | 0.928409 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
8bf6d8150047d0cdf64d4d4464ce08dc20ec3dcd | 3,862 | py | Python | app.py | Astrowizard/sqlalchemy-challenge | db4b2d0b05307052a8ee265e71b70c58b8cb174b | [
"ADSL"
] | null | null | null | app.py | Astrowizard/sqlalchemy-challenge | db4b2d0b05307052a8ee265e71b70c58b8cb174b | [
"ADSL"
] | null | null | null | app.py | Astrowizard/sqlalchemy-challenge | db4b2d0b05307052a8ee265e71b70c58b8cb174b | [
"ADSL"
] | null | null | null | import numpy as np
import sqlalchemy
from sqlalchemy.ext.automap import automap_base
from sqlalchemy.orm import Session
from sqlalchemy import create_engine, func
from flask import Flask, jsonify
import functions
#################################################
# Database Setup
#################################################
engine = create_engine("sqlite:///hawaii.sqlite")
# reflect an existing database into a new model
Base = automap_base()
# reflect the tables
Base.prepare(engine, reflect=True)
Measurement = Base.classes.measurement
Station = Base.classes.station
app = (__name__)
@app.route("/")
def welcome():
def welcome():
"""List all available api routes."""
return (
f"Available Routes:<br/>"
f"/api/v1.0/precipitation<br/>"
f"/api/v1.0/stations"
f"/api/v1.0/tobs"
f"/api/v1.0/<start>"
f"/api/v1.0/<start>/<end>"
)
@app.route("/api/v1.0/precipitation")
def precipitation:
session = Session(engine)
q = session.query(Measurement.date).order_by(Measurement.date.desc())\
.first()
session.close()
last_day = q[0]
last_day = dt.datetime.strptime(last_day, '%Y-%m-%d')
one_year = last_day - dt.timedelta(days=365)
session = Session(engine)
q1 = session.query(Measurement.prcp,Measurement.date).\
filter(Measurement.date >= one_year.date().strftime('%Y-%m-%d'))
session.close()
precipitation = {}
for prcp, date in q1:
precipitation.append({date:prcp})
return jsonify(precipitation)
@app.route("/api/v1.0/stations")
def stations:
session = Session(engine)
q = session.query(Station.name)
session.close()
stations = list(np.unravel(q))
return jsonify(stations)
@app.route("/api/v1.0/tobs")
def tobs:
session = Session(engine)
q = session.query(Measurement.date).order_by(Measurement.date.desc())\
.first()
session.close()
last_day = q[0]
last_day = dt.datetime.strptime(last_day, '%Y-%m-%d')
one_year = last_day - dt.timedelta(days=365)
session = Session(engine)
q1 = session.query(Measurement.prcp,Measurement.date).\
filter(Measurement.date >= one_year.date().strftime('%Y-%m-%d'))
session.close()
precipitation = {}
for prcp, date in q1:
precipitation.append({date:prcp})
return jsonify(precipitation)
@app.route("/api/v1.0/<start>")
def start:
def calc_temps(start_date, end_date):
"""TMIN, TAVG, and TMAX for a list of dates.
Args:
start_date (string): A date string in the format %Y-%m-%d
end_date (string): A date string in the format %Y-%m-%d
Returns:
TMIN, TAVE, and TMAX
"""
session = Session(engine)
q = session.query(func.min(Measurement.tobs), func.avg(Measurement.tobs), func.max(Measurement.tobs)).\
filter(Measurement.date >= start_date)
session.close()
for i in q:
print(f"Minimum temperature: {i[0]}")
print(f"Maximum temperature: {i[2]}")
print(f"Average temperature: {i[1]}")
@app.route("/api/v1.0/<start>/<end>")
def startend:
def calc_temps(start_date, end_date):
"""TMIN, TAVG, and TMAX for a list of dates.
Args:
start_date (string): A date string in the format %Y-%m-%d
end_date (string): A date string in the format %Y-%m-%d
Returns:
TMIN, TAVE, and TMAX
"""
session = Session(engine)
q = session.query(func.min(Measurement.tobs), func.avg(Measurement.tobs), func.max(Measurement.tobs)).\
filter(Measurement.date >= start_date).filter(Measurement.date <= end_date).all()
session.close()
for i in q:
print(f"Minimum temperature: {i[0]}")
print(f"Maximum temperature: {i[2]}")
print(f"Average temperature: {i[1]}")
if __name__ = "__main__":
app.run(debug=true) | 28.397059 | 107 | 0.624547 | 515 | 3,862 | 4.6 | 0.219417 | 0.06965 | 0.025327 | 0.014774 | 0.705361 | 0.67328 | 0.649219 | 0.649219 | 0.649219 | 0.649219 | 0 | 0.012358 | 0.20378 | 3,862 | 136 | 108 | 28.397059 | 0.758049 | 0.020456 | 0 | 0.561798 | 0 | 0 | 0.140635 | 0.038095 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.078652 | null | null | 0.067416 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
8bf809acd31dabafceaa2cbdbb0d1c012f70e5fa | 349 | py | Python | shop/admin.py | LudwigOtto/ECommerce | 07fe32954604f9f9785e5e1b4c51c405d1d08323 | [
"MIT"
] | 1 | 2020-03-27T18:09:46.000Z | 2020-03-27T18:09:46.000Z | shop/admin.py | LudwigOtto/ECommerce | 07fe32954604f9f9785e5e1b4c51c405d1d08323 | [
"MIT"
] | null | null | null | shop/admin.py | LudwigOtto/ECommerce | 07fe32954604f9f9785e5e1b4c51c405d1d08323 | [
"MIT"
] | null | null | null | from django.contrib import admin
# Register your models here.
from .models import Inventory
class InventoryAdmin(admin.ModelAdmin):
list_display = ['item_id', 'item_name', 'quantity', 'price',
'seller', 'type' ]
list_editable = ['item_name', 'quantity', 'price',
'seller', 'type' ]
admin.site.register(Inventory, InventoryAdmin) | 24.928571 | 63 | 0.702006 | 40 | 349 | 6 | 0.6 | 0.066667 | 0.133333 | 0.175 | 0.258333 | 0.258333 | 0 | 0 | 0 | 0 | 0 | 0 | 0.154728 | 349 | 14 | 64 | 24.928571 | 0.813559 | 0.074499 | 0 | 0.25 | 0 | 0 | 0.220497 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 0.625 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
e3175828e131dae55e00b68ba6827e55d4d0dab6 | 1,027 | py | Python | com.systemincloud.examples.tasks.pythontask/src/test/py/tasks/generator/GeneratorAtomicWith2SIn1AIn.py | systemincloud/sic-examples | b82d5d672f515b1deb5ddb35c5a93c003e03c030 | [
"Apache-2.0"
] | null | null | null | com.systemincloud.examples.tasks.pythontask/src/test/py/tasks/generator/GeneratorAtomicWith2SIn1AIn.py | systemincloud/sic-examples | b82d5d672f515b1deb5ddb35c5a93c003e03c030 | [
"Apache-2.0"
] | 15 | 2015-01-08T20:28:19.000Z | 2016-07-20T07:19:15.000Z | com.systemincloud.examples.tasks.pythontask/src/test/py/tasks/generator/GeneratorAtomicWith2SIn1AIn.py | systemincloud/sic-examples | b82d5d672f515b1deb5ddb35c5a93c003e03c030 | [
"Apache-2.0"
] | null | null | null | from sicpythontask.PythonTaskInfo import PythonTaskInfo
from sicpythontask.PythonTask import PythonTask
from sicpythontask.InputPort import InputPort
from sicpythontask.OutputPort import OutputPort
from sicpythontask.data.Int32 import Int32
from sicpythontask.data.Control import Control
@PythonTaskInfo(generator=True)
class GeneratorAtomicWith2SIn1AIn(PythonTask):
def __init_ports__(self):
self.in1 = InputPort(name="in1", data_type=Int32)
self.in2 = InputPort(name="in2", data_type=Int32)
self.in3 = InputPort(name="in3", data_type=Control, asynchronous=True)
self.out = OutputPort(name="out", data_type=Int32)
def runner_start(self):
self.on = True
def execute_async(self, async_in):
self.on = not self.on
def generate(self):
if self.on:
self.out.put_data(Int32(637343730))
self.sleep(500)
def execute(self, grp):
self.out.put_data(Int32(self.in1.get_data(Int32).values[0] + self.in2.get_data(Int32).values[0]))
| 34.233333 | 105 | 0.720545 | 132 | 1,027 | 5.484848 | 0.318182 | 0.140884 | 0.053867 | 0.046961 | 0.104972 | 0 | 0 | 0 | 0 | 0 | 0 | 0.049587 | 0.175268 | 1,027 | 29 | 106 | 35.413793 | 0.805195 | 0 | 0 | 0 | 0 | 0 | 0.011685 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.217391 | false | 0 | 0.26087 | 0 | 0.521739 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
e31c6f46d2ca8c2687cb86844e1a4c412bcfc2dd | 481 | py | Python | kaynet/optim.py | AmrMKayid/KayNet | 2779ca310970444217c2e7bff0d7881b10ebda20 | [
"MIT"
] | null | null | null | kaynet/optim.py | AmrMKayid/KayNet | 2779ca310970444217c2e7bff0d7881b10ebda20 | [
"MIT"
] | null | null | null | kaynet/optim.py | AmrMKayid/KayNet | 2779ca310970444217c2e7bff0d7881b10ebda20 | [
"MIT"
] | null | null | null | """
An optimizer is used to adjust the parameters
of our network based on the gradients computed
during backpropagation
"""
from kaynet.nn import NeuralNet
class Optimizer:
def step(self, net: NeuralNet) -> None:
raise NotImplementedError
class SGD(Optimizer):
def __init__(self, lr: float = 0.01) -> None:
self.lr = lr
def step(self, net: NeuralNet) -> None:
for param, grad in net.params_and_grads():
param -= self.lr * grad
| 21.863636 | 50 | 0.663202 | 65 | 481 | 4.815385 | 0.661538 | 0.057508 | 0.070288 | 0.089457 | 0.172524 | 0.172524 | 0 | 0 | 0 | 0 | 0 | 0.008242 | 0.243243 | 481 | 21 | 51 | 22.904762 | 0.851648 | 0.239085 | 0 | 0.2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.3 | false | 0 | 0.1 | 0 | 0.6 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
e32bea89c5bf35e622d3f22f6b0a7e7baf85cd45 | 521 | py | Python | src/logger.py | SoutheyLab/genericpipe | 316073109f6661bbc6613f855cb895f3b9f3f847 | [
"MIT"
] | 2 | 2017-12-06T13:49:11.000Z | 2018-04-27T03:10:54.000Z | src/logger.py | SoutheyLab/genericpipe | 316073109f6661bbc6613f855cb895f3b9f3f847 | [
"MIT"
] | 1 | 2019-04-09T05:58:34.000Z | 2019-04-09T05:58:34.000Z | src/logger.py | SoutheyLab/genericpipe | 316073109f6661bbc6613f855cb895f3b9f3f847 | [
"MIT"
] | 2 | 2018-10-16T10:28:52.000Z | 2018-10-17T08:45:55.000Z | '''
Initialisation and use of concurrency-friendly logging facility.
'''
import ruffus.cmdline as cmdline
class Logger(object):
'''Concurrency friendly logging facility'''
def __init__(self, prog_name, log_file, verbosity):
proxy, mutex = cmdline.setup_logging(__name__, log_file, verbosity)
self.proxy = proxy
self.mutex = mutex
def info(self, message):
'''Display an informational message to the log file'''
with self.mutex:
self.proxy.info(message)
| 26.05 | 75 | 0.673704 | 62 | 521 | 5.467742 | 0.548387 | 0.061947 | 0.153392 | 0.20059 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.228407 | 521 | 19 | 76 | 27.421053 | 0.843284 | 0.289827 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.222222 | false | 0 | 0.111111 | 0 | 0.444444 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
e3393d913587ca2870240f66f479ac55867ffc79 | 58 | py | Python | tenet/settings.py | ferrouswheel/tenet | eff1af2b2aebe84a4a566350a3d68bd7f0da7117 | [
"MIT"
] | 7 | 2015-04-22T06:13:53.000Z | 2021-12-09T07:23:36.000Z | tenet/settings.py | ferrouswheel/tenet | eff1af2b2aebe84a4a566350a3d68bd7f0da7117 | [
"MIT"
] | 3 | 2015-04-19T04:05:52.000Z | 2015-05-03T05:04:23.000Z | tenet/settings.py | ferrouswheel/tenet | eff1af2b2aebe84a4a566350a3d68bd7f0da7117 | [
"MIT"
] | null | null | null | MAX_RECIPIENTS_PER_MESSAGE = 5
MSG_BLOOM_FILTER_SIZE = 80
| 19.333333 | 30 | 0.862069 | 10 | 58 | 4.4 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.057692 | 0.103448 | 58 | 2 | 31 | 29 | 0.788462 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
e33bb271ab756df3f71f538b09e9aa7b1669244e | 1,106 | py | Python | model_download.py | gkswjdzz/Ainized-StanfordNLP | a4c20f1649da1e40b85238754a70a3ff54525213 | [
"MIT"
] | 4 | 2020-02-27T13:59:04.000Z | 2022-03-06T02:47:27.000Z | model_download.py | gkswjdzz/ainized-stanfordnlp | a4c20f1649da1e40b85238754a70a3ff54525213 | [
"MIT"
] | null | null | null | model_download.py | gkswjdzz/ainized-stanfordnlp | a4c20f1649da1e40b85238754a70a3ff54525213 | [
"MIT"
] | null | null | null | import stanfordnlp
if __name__ == '__main__':
#conll_shorthands = ['af_afribooms', 'ar_padt', 'bg_btb', 'bxr_bdt', 'ca_ancora', 'cs_cac', 'cs_fictree', 'cs_pdt', 'cu_proiel', 'da_ddt', 'de_gsd', 'el_gdt', 'en_ewt', 'en_gum', 'en_lines', 'es_ancora', 'et_edt', 'eu_bdt', 'fa_seraji', 'fi_ftb', 'fi_tdt', 'fr_gsd', 'fro_srcmf', 'fr_sequoia', 'fr_spoken', 'ga_idt', 'gl_ctg', 'gl_treegal', 'got_proiel', 'grc_perseus', 'grc_proiel', 'he_htb', 'hi_hdtb', 'hr_set', 'hsb_ufal', 'hu_szeged', 'hy_armtdp', 'id_gsd', 'it_isdt', 'it_postwita', 'ja_gsd', 'kk_ktb', 'kmr_mg', 'ko_gsd', 'ko_kaist', 'la_ittb', 'la_perseus', 'la_proiel', 'lv_lvtb', 'nl_alpino', 'nl_lassysmall', 'no_bokmaal', 'no_nynorsklia', 'no_nynorsk', 'pl_lfg', 'pl_sz', 'pt_bosque', 'ro_rrt', 'ru_syntagrus', 'ru_taiga', 'sk_snk', 'sl_ssj', 'sl_sst', 'sme_giella', 'sr_set', 'sv_lines', 'sv_talbanken', 'tr_imst', 'ug_udt', 'uk_iu', 'ur_udtb', 'vi_vtb', 'zh_gsd']
conll_shorthands = ['en_ewt', 'en_gum', 'en_lines', 'ko_gsd', 'ko_kaist']
for lang in conll_shorthands:
stanfordnlp.download(lang, './models', force = True) | 138.25 | 881 | 0.659132 | 176 | 1,106 | 3.636364 | 0.721591 | 0.070313 | 0.021875 | 0.03125 | 0.053125 | 0.053125 | 0 | 0 | 0 | 0 | 0 | 0 | 0.110307 | 1,106 | 8 | 882 | 138.25 | 0.650407 | 0.792043 | 0 | 0 | 0 | 0 | 0.217391 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.2 | 0 | 0.2 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
e349110d1911c58d28b1827c6532896e012f4d92 | 1,343 | py | Python | setup.py | imacube/solrcloudadmin | 02070442c22c9099378d339b742a176b1ec5785d | [
"Apache-2.0"
] | null | null | null | setup.py | imacube/solrcloudadmin | 02070442c22c9099378d339b742a176b1ec5785d | [
"Apache-2.0"
] | null | null | null | setup.py | imacube/solrcloudadmin | 02070442c22c9099378d339b742a176b1ec5785d | [
"Apache-2.0"
] | null | null | null | #!/usr/bin/env python
import sys
from setuptools import setup
from solrcloudadmin import __version__
setup(
name='SolrCloudAdmin',
version=__version__,
author='Ryan Steele',
author_email='imacube@gmail.com',
packages=[
'solrcloudadmin'
],
install_requires=[
'kazoo>=2.2.1',
'requests>=2.11.1',
'tqdm>=4.8.4'
],
scripts=['scripts/solrcloud-add-replica',
'scripts/solrcloud-cluster-details',
'scripts/solrcloud-cluster-recovery',
'scripts/solrcloud-collection-count',
'scripts/solrcloud-delete-down',
'scripts/solrcloud-delete-replica',
'scripts/solrcloud-document-count',
'scripts/solrcloud-list-live-nodes',
'scripts/solrcloud-migrate-collections',
'scripts/solrcloud-move-collection',
'scripts/solrcloud-replica-count',
'scripts/solrcloud-shard-count',
'scripts/solrcloud-unhealthy-cores',
'scripts/solrcloud-view-collections'
],
url='http://github.com/imacube/solrcloudadmin-py',
license='LICENSE',
description='utility for running routine admin jobs on a SolrCloud cluster',
long_description=open('README.md').read() + '\n\n' +
open('CHANGES.md').read()
)
| 32.756098 | 80 | 0.60834 | 133 | 1,343 | 6.06015 | 0.548872 | 0.277916 | 0.104218 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.01 | 0.255398 | 1,343 | 40 | 81 | 33.575 | 0.796 | 0.014892 | 0 | 0.081081 | 0 | 0 | 0.515885 | 0.342663 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.081081 | 0 | 0.081081 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
e373d3ab3ad5ef837f1d405d9ad420266b95b61c | 966 | py | Python | py/py_0218_perfect_right-angled_triangles.py | lcsm29/project-euler | fab794ece5aa7a11fc7c2177f26250f40a5b1447 | [
"MIT"
] | null | null | null | py/py_0218_perfect_right-angled_triangles.py | lcsm29/project-euler | fab794ece5aa7a11fc7c2177f26250f40a5b1447 | [
"MIT"
] | null | null | null | py/py_0218_perfect_right-angled_triangles.py | lcsm29/project-euler | fab794ece5aa7a11fc7c2177f26250f40a5b1447 | [
"MIT"
] | null | null | null | # Solution of;
# Project Euler Problem 218: Perfect right-angled triangles
# https://projecteuler.net/problem=218
#
# Consider the right angled triangle with sides a=7, b=24 and c=25. The area
# of this triangle is 84, which is divisible by the perfect numbers 6 and 28.
# Moreover it is a primitive right angled triangle as gcd(a,b)=1 and
# gcd(b,c)=1. Also c is a perfect square. We will call a right angled triangle
# perfect if-it is a primitive right angled triangle-its hypotenuse is a
# perfect squareWe will call a right angled triangle super-perfect if-it is a
# perfect right angled triangle and-its area is a multiple of the perfect
# numbers 6 and 28. How many perfect right-angled triangles with c≤1016 exist
# that are not super-perfect?
#
# by lcsm29 http://github.com/lcsm29/project-euler
import timed
def dummy(n):
pass
if __name__ == '__main__':
n = 1000
i = 10000
prob_id = 218
timed.caller(dummy, n, i, prob_id)
| 34.5 | 79 | 0.727743 | 168 | 966 | 4.130952 | 0.464286 | 0.126801 | 0.164265 | 0.07781 | 0.275216 | 0.242075 | 0.095101 | 0 | 0 | 0 | 0 | 0.052699 | 0.194617 | 966 | 27 | 80 | 35.777778 | 0.838046 | 0.811594 | 0 | 0 | 0 | 0 | 0.048193 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.125 | false | 0.125 | 0.125 | 0 | 0.25 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
8b521ad7c15f8245cc008b42cceb2cf5cfbd927c | 53 | py | Python | gquant/dataframe_flow/cache.py | h2oai/gQuant | d82ebef2bb11b2849c67b6c0749b9cbc624b626c | [
"Apache-2.0"
] | 1 | 2021-12-24T06:24:21.000Z | 2021-12-24T06:24:21.000Z | gquant/dataframe_flow/cache.py | h2oai/gQuant | d82ebef2bb11b2849c67b6c0749b9cbc624b626c | [
"Apache-2.0"
] | null | null | null | gquant/dataframe_flow/cache.py | h2oai/gQuant | d82ebef2bb11b2849c67b6c0749b9cbc624b626c | [
"Apache-2.0"
] | 2 | 2021-11-02T09:14:59.000Z | 2022-01-05T21:43:47.000Z | cache_ports = {}
cache_schema = {}
cache_columns = {} | 17.666667 | 18 | 0.679245 | 6 | 53 | 5.5 | 0.666667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.150943 | 53 | 3 | 18 | 17.666667 | 0.733333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
8b546d202051a1d123623e2092a370581464f70a | 338 | py | Python | sponge-standalone-app/examples/standalone/remote_api/standalone_remote_api.py | mnpas/sponge | 7190f23ae888bbef49d0fbb85157444d6ea48bcd | [
"Apache-2.0"
] | 9 | 2017-12-16T21:48:57.000Z | 2022-01-06T12:22:24.000Z | sponge-standalone-app/examples/standalone/remote_api/standalone_remote_api.py | mnpas/sponge | 7190f23ae888bbef49d0fbb85157444d6ea48bcd | [
"Apache-2.0"
] | 3 | 2020-12-18T11:56:46.000Z | 2022-03-31T18:37:10.000Z | sponge-standalone-app/examples/standalone/remote_api/standalone_remote_api.py | mnpas/sponge | 7190f23ae888bbef49d0fbb85157444d6ea48bcd | [
"Apache-2.0"
] | 2 | 2019-12-29T16:08:32.000Z | 2020-06-15T14:05:34.000Z | """
Sponge Knowledge Base
Remote API
"""
class UpperCase(Action):
def onConfigure(self):
self.withArg(StringType("text").withLabel("Text to upper case")).withResult(StringType().withLabel("Upper case text"))
def onCall(self, text):
self.logger.info("Action {} called", self.meta.name)
return text.upper()
| 28.166667 | 126 | 0.671598 | 41 | 338 | 5.536585 | 0.634146 | 0.079295 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.174556 | 338 | 11 | 127 | 30.727273 | 0.81362 | 0.094675 | 0 | 0 | 0 | 0 | 0.177852 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.333333 | false | 0 | 0 | 0 | 0.666667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
8b5c5377a1f3c94d2745073ba8e4cabe3b867d05 | 344 | py | Python | guanabara/Exercicios/mundo 2 _ aulas 12 a 15/057.py | pbittencourt/datasciencestudies | 85f0b2a4366fe7c6daa5628ed4bd2994355963c0 | [
"MIT"
] | null | null | null | guanabara/Exercicios/mundo 2 _ aulas 12 a 15/057.py | pbittencourt/datasciencestudies | 85f0b2a4366fe7c6daa5628ed4bd2994355963c0 | [
"MIT"
] | null | null | null | guanabara/Exercicios/mundo 2 _ aulas 12 a 15/057.py | pbittencourt/datasciencestudies | 85f0b2a4366fe7c6daa5628ed4bd2994355963c0 | [
"MIT"
] | null | null | null | # SOMENTE GÊNEROS CORRETOS!
# um pouco mais inclusivo do q o original :)
g = str(input('Insira seu gênero [M|F|T|Q|N]: _ ')).strip().upper()[0]
while g not in 'MFTQN':
g = str(input('Formato incorreto! Tente novamente.\nInsira seu gênero [M|F|T|Q|N]: _ ')).strip().upper()[0]
print('Obrigado. Gênero {} registrado com sucesso!'.format(g))
| 43 | 111 | 0.665698 | 56 | 344 | 4.053571 | 0.696429 | 0.035242 | 0.079295 | 0.096916 | 0.220264 | 0.220264 | 0.220264 | 0.220264 | 0.220264 | 0.220264 | 0 | 0.00678 | 0.142442 | 344 | 7 | 112 | 49.142857 | 0.762712 | 0.197674 | 0 | 0 | 0 | 0.25 | 0.553114 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.25 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
8b5dd960540f3ab582ac9a0325bf9c0d099c09ad | 4,162 | py | Python | airzone/aido.py | Mike-de-bike/python-airzone | 8e87b15f1690075d0dcbad3012d0910706dedab6 | [
"MIT"
] | 8 | 2019-04-08T21:57:09.000Z | 2021-12-13T17:07:38.000Z | airzone/aido.py | Mike-de-bike/python-airzone | 8e87b15f1690075d0dcbad3012d0910706dedab6 | [
"MIT"
] | 11 | 2020-04-16T20:37:30.000Z | 2021-09-07T10:43:01.000Z | airzone/aido.py | Mike-de-bike/python-airzone | 8e87b15f1690075d0dcbad3012d0910706dedab6 | [
"MIT"
] | 7 | 2019-10-31T09:27:07.000Z | 2021-07-14T06:33:38.000Z | from enum import IntEnum
from deprecated import deprecated # type: ignore
class OperationMode(IntEnum):
AUTO = 1
COOLING = 2
HEATING = 3
FAN = 4
DRY = 5
@classmethod
def _missing_(cls, value):
return OperationMode.AUTO
class Speed(IntEnum):
AUTO = 0
SPEED_1 = 1
SPEED_2 = 2
SPEED_3 = 3
SPEED_4 = 4
SPEED_5 = 5
SPEED_6 = 6
SPEED_7 = 7
@classmethod
def _missing_(cls, value):
return Speed.AUTO
class Louvres(IntEnum):
POS_0 = 0
POS_1 = 1
POS_2 = 2
POS_3 = 3
POS_4 = 4
POS_5 = 5
POS_6 = 6
POS_7 = 7
AUTO = 8
SWING = 9
SWIRL = 10
@classmethod
def _missing_(cls, value):
return Louvres.AUTO
class Aido():
def __init__(self, gateway, machineId, has_louvres = True, speed_as_per = False):
self._gateway = gateway
self._machineId = machineId
self._machine_state = None
self._has_louvres = has_louvres
self._speed_as_per = speed_as_per
self._retrieve_machine_state()
def _read_registers(self, address, numRegisters):
return self._gateway.read_input_registers(
self._machineId, address, numRegisters)
def _write_register(self, address, value):
return self._gateway.write_single_register(
self._machineId, address, value)
def _retrieve_machine_state(self):
self._machine_state = self._read_registers(0, 7)
def get_is_machine_on(self):
if self._machine_state == None:
return 0
return self._machine_state[0]
def turn_on(self):
self._write_register(0, 1)
def turn_off(self):
self._write_register(0, 0)
def get_signal_temperature_value(self):
if self._machine_state == None:
return -1
return self._machine_state[1] / 10
def set_signal_temperature_value(self, value):
if value >= 18 or value <= 30:
self._write_register(1, int(value * 10))
def get_local_temperature(self):
return self._machine_state[2] / 10
def get_operation_mode(self):
if self._machine_state == None:
return OperationMode.AUTO
return OperationMode(self._machine_state[3])
def set_operation_mode(self, operationMode):
if not self.get_is_machine_on():
self.turn_on()
self._write_register(3, OperationMode[operationMode].value)
def get_speed(self):
if self._machine_state == None:
return Speed.AUTO
value = self._machine_state[4]
#TODO: review for different machines
if self._speed_as_per:
value = value * 4 // 100
return Speed(value)
def set_speed(self, speed):
value = Speed[speed].value
if self._speed_as_per:
value = value*100 // 4
self._write_register(4, value)
def get_speed_steps(self):
if self._speed_as_per:
return 4
return 7
def has_louvres(self):
return self._has_louvres
def get_louvres(self):
if self._machine_state == None:
return Louvres.AUTO
return Louvres(self._machine_state[5])
def set_louvres(self, louvre):
self._write_register(5, Louvres[louvre].value)
#TODO Errors and warnings
def __str__(self):
return "Aido with id: " + str(self._machineId) + \
"On:" + str(self.get_is_machine_on) + \
"Operation Mode: " + str(self.get_operation_mode()) + \
"Signal Temp: " + str(self.get_signal_temperature_value()) + \
"Local Temp: " + str(self.get_local_temperature()) + \
"Speed: " + str(self.get_speed()) + \
"Louvres: " + str(self.get_louvres())
def unique_id(self):
return f'Aido_M{self._machineId}_{str(self._gateway)}'
@property
def machine_state(self):
return self._machine_state
@deprecated('Use the machine_state property instead')
def get_machine_state(self):
return self._machine_state
| 25.850932 | 85 | 0.604517 | 519 | 4,162 | 4.529865 | 0.186898 | 0.102084 | 0.102084 | 0.051042 | 0.226712 | 0.167163 | 0.122501 | 0 | 0 | 0 | 0 | 0.026971 | 0.305142 | 4,162 | 160 | 86 | 26.0125 | 0.785961 | 0.017059 | 0 | 0.184874 | 0 | 0 | 0.03817 | 0.010766 | 0 | 0 | 0 | 0.00625 | 0 | 1 | 0.210084 | false | 0 | 0.016807 | 0.092437 | 0.655462 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
8b84c62d0837a93bc61a0ccd9fa0278c6879e73c | 639 | py | Python | command_lifecycle/buffer.py | richtier/voice-command-lifecycle | 91db4977c56d8b0c2ef6d58bd8596b778262cded | [
"MIT"
] | 5 | 2018-05-22T19:25:40.000Z | 2019-08-01T05:43:41.000Z | command_lifecycle/buffer.py | richtier/voice-command-lifecycle | 91db4977c56d8b0c2ef6d58bd8596b778262cded | [
"MIT"
] | 6 | 2017-08-31T21:13:34.000Z | 2019-01-09T23:06:31.000Z | command_lifecycle/buffer.py | richtier/voice-command-lifecycle | 91db4977c56d8b0c2ef6d58bd8596b778262cded | [
"MIT"
] | null | null | null | import collections
class AudioBufferBase(collections.deque):
maxlen = None
def __init__(self, *args, **kwargs):
super().__init__(*args, **kwargs, maxlen=self.maxlen)
def get(self):
return bytes(bytearray(self))
def popleft_size(self, size):
sliced = bytearray()
for i in range(size):
if self:
sliced.append(self.popleft())
return bytes(sliced)
class WakewordAudioBuffer(AudioBufferBase):
""" Store a few seconds of audio"""
maxlen = 40000
class CommandAudioBuffer(AudioBufferBase):
""" Store a "infinite" seconds of audio"""
pass
| 22.034483 | 61 | 0.630673 | 69 | 639 | 5.710145 | 0.536232 | 0.050761 | 0.106599 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.010526 | 0.256651 | 639 | 28 | 62 | 22.821429 | 0.818947 | 0.100156 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.176471 | false | 0.058824 | 0.058824 | 0.058824 | 0.647059 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 2 |
8b961bbd9f3aeee1093b576a90d15137503656e5 | 257 | py | Python | flat_sales/flat_sales/doctype/flat_payment_schedule/test_flat_payment_schedule.py | swamedh/flat_sales | 28f3d517e06591669c24accaba4e0683eabe8901 | [
"MIT"
] | 1 | 2015-10-06T14:03:29.000Z | 2015-10-06T14:03:29.000Z | sales/sales/doctype/flat_payment_schedule/test_flat_payment_schedule.py | dngupta78/sales | aee6be4ac46f6b63e85f819f68f14c242f1c9480 | [
"MIT"
] | null | null | null | sales/sales/doctype/flat_payment_schedule/test_flat_payment_schedule.py | dngupta78/sales | aee6be4ac46f6b63e85f819f68f14c242f1c9480 | [
"MIT"
] | null | null | null | # Copyright (c) 2013, deepak and Contributors
# See license.txt
from __future__ import unicode_literals
import frappe
import unittest
test_records = frappe.get_test_records('Flat Payment Schedule')
class TestFlatPaymentSchedule(unittest.TestCase):
pass
| 21.416667 | 63 | 0.821012 | 32 | 257 | 6.34375 | 0.8125 | 0.108374 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.017621 | 0.116732 | 257 | 11 | 64 | 23.363636 | 0.876652 | 0.229572 | 0 | 0 | 0 | 0 | 0.107692 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.166667 | 0.5 | 0 | 0.666667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 2 |
8b96abc6103ccef39aeef713dd0aada1c8820934 | 1,254 | py | Python | app/deliveries/models.py | swelanauguste/silver-fortnight | 8ee47f2a15aaa4c83a04a55da0c984a65a9ba6ea | [
"MIT"
] | null | null | null | app/deliveries/models.py | swelanauguste/silver-fortnight | 8ee47f2a15aaa4c83a04a55da0c984a65a9ba6ea | [
"MIT"
] | null | null | null | app/deliveries/models.py | swelanauguste/silver-fortnight | 8ee47f2a15aaa4c83a04a55da0c984a65a9ba6ea | [
"MIT"
] | null | null | null | import uuid
from django.db import models
from django.urls import reverse
from mixins.assets import TimeStampMixin
from products.models import Product
# def uid():
# uid = uuid.uuid4()
# uid = str(uid).upper()
# return uid.split("-")[4]
# Create your models here.
class Delivery(TimeStampMixin):
# uid = models.CharField(max_length=20, editable=False, default=uid())
product = models.ForeignKey(
Product, related_name="deliveries", on_delete=models.SET_NULL, null=True
)
qty = models.IntegerField(default=0)
delivery_date = models.DateField(blank=True, null=True)
deliveried_to = models.CharField(max_length=100, blank=True, null=True)
deliveried_by = models.CharField(max_length=100, blank=True, null=True)
delivery_comment = models.TextField(blank=True, null=True)
class Meta:
ordering = ["-created_at"]
verbose_name_plural = "Deliveries"
def get_absolute_url(self):
return reverse("deliveries:delivery-detail", kwargs={"pk": self.pk})
def get_update_url(self):
return reverse("stores:deliveries-update", kwargs={"pk": self.pk})
def get_delivered_quantity(self):
return self.qty
def __str__(self):
return self.product.name
| 29.857143 | 80 | 0.696172 | 161 | 1,254 | 5.279503 | 0.440994 | 0.047059 | 0.061176 | 0.08 | 0.194118 | 0.150588 | 0.103529 | 0.103529 | 0.103529 | 0 | 0 | 0.010763 | 0.185008 | 1,254 | 41 | 81 | 30.585366 | 0.820939 | 0.145933 | 0 | 0 | 0 | 0 | 0.079887 | 0.046992 | 0 | 0 | 0 | 0 | 0 | 1 | 0.16 | false | 0 | 0.2 | 0.16 | 0.84 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 2 |
8baa30409eb8316112c0be1b3b6d6758e7e4d124 | 995 | py | Python | learning/conn_orm.py | relax-space/alchemy-first | 1df6494a19a0779333b37cc946f89cae64cd4445 | [
"Apache-2.0"
] | null | null | null | learning/conn_orm.py | relax-space/alchemy-first | 1df6494a19a0779333b37cc946f89cae64cd4445 | [
"Apache-2.0"
] | null | null | null | learning/conn_orm.py | relax-space/alchemy-first | 1df6494a19a0779333b37cc946f89cae64cd4445 | [
"Apache-2.0"
] | null | null | null | '''
说明: orm连接池设置, 如果设置pool_size=5, 那么最多只能开5个连接
'''
from sqlalchemy import Column, Integer, String, create_engine
from sqlalchemy.orm import Session, declarative_base
Base = declarative_base()
class Book(Base):
__tablename__ = 'book'
id = Column(Integer, primary_key=True, autoincrement=True)
name = Column(String(30))
price = Column(Integer)
engine = create_engine(
'mysql+mysqldb://root:1234@localhost:3306/test1', max_overflow=0)
Base.metadata.create_all(engine)
session = Session(engine)
res = session.get(Book, 1)
print(1)
session = Session(engine)
res = session.get(Book, 1)
print(2)
session = Session(engine)
res = session.get(Book, 1)
print(3)
session = Session(engine)
res = session.get(Book, 1)
print(4)
session = Session(engine)
res = session.get(Book, 1)
print(5)
session = Session(engine)
res = session.get(Book, 1)
print(6)
session = Session(engine)
res = session.get(Book, 1)
print(7)
'''
输出: 默认会创建5个连接,所以第6个连接不会创建成功
1
2
3
4
5
'''
| 16.864407 | 69 | 0.704523 | 140 | 995 | 4.921429 | 0.378571 | 0.142235 | 0.203193 | 0.233672 | 0.436865 | 0.436865 | 0.436865 | 0.436865 | 0.436865 | 0 | 0 | 0.041816 | 0.158794 | 995 | 58 | 70 | 17.155172 | 0.781362 | 0.042211 | 0 | 0.4375 | 0 | 0 | 0.056497 | 0.051977 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.0625 | 0 | 0.21875 | 0.21875 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
8bb2d353344fe38bfd61615c16d33b11ca1212f0 | 199 | py | Python | day01/03_urljoin.py | Amiao-miao/month04 | 93edb68c88d5a13587bf93f59e241b4ca889e0c1 | [
"Apache-2.0"
] | null | null | null | day01/03_urljoin.py | Amiao-miao/month04 | 93edb68c88d5a13587bf93f59e241b4ca889e0c1 | [
"Apache-2.0"
] | null | null | null | day01/03_urljoin.py | Amiao-miao/month04 | 93edb68c88d5a13587bf93f59e241b4ca889e0c1 | [
"Apache-2.0"
] | null | null | null | '''
https://www.guazi.com/huzhou/buy/o2/#bread
第一页：o1
第二页：o2
……
第n页：on
'''
url='https://www.guazi.com/huzhou/buy/o{}/#bread'
for page in range(1,51):
page_url=url.format(page)
print(page_url) | 18.090909 | 49 | 0.663317 | 38 | 199 | 3.578947 | 0.631579 | 0.117647 | 0.191176 | 0.235294 | 0.367647 | 0.367647 | 0 | 0 | 0 | 0 | 0 | 0.033708 | 0.105528 | 199 | 11 | 50 | 18.090909 | 0.696629 | 0.331658 | 0 | 0 | 0 | 0 | 0.34127 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.25 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.