hexsha string | size int64 | ext string | lang string | max_stars_repo_path string | max_stars_repo_name string | max_stars_repo_head_hexsha string | max_stars_repo_licenses list | max_stars_count int64 | max_stars_repo_stars_event_min_datetime string | max_stars_repo_stars_event_max_datetime string | max_issues_repo_path string | max_issues_repo_name string | max_issues_repo_head_hexsha string | max_issues_repo_licenses list | max_issues_count int64 | max_issues_repo_issues_event_min_datetime string | max_issues_repo_issues_event_max_datetime string | max_forks_repo_path string | max_forks_repo_name string | max_forks_repo_head_hexsha string | max_forks_repo_licenses list | max_forks_count int64 | max_forks_repo_forks_event_min_datetime string | max_forks_repo_forks_event_max_datetime string | content string | avg_line_length float64 | max_line_length int64 | alphanum_fraction float64 | qsc_code_num_words_quality_signal int64 | qsc_code_num_chars_quality_signal float64 | qsc_code_mean_word_length_quality_signal float64 | qsc_code_frac_words_unique_quality_signal float64 | qsc_code_frac_chars_top_2grams_quality_signal float64 | qsc_code_frac_chars_top_3grams_quality_signal float64 | qsc_code_frac_chars_top_4grams_quality_signal float64 | qsc_code_frac_chars_dupe_5grams_quality_signal float64 | qsc_code_frac_chars_dupe_6grams_quality_signal float64 | qsc_code_frac_chars_dupe_7grams_quality_signal float64 | qsc_code_frac_chars_dupe_8grams_quality_signal float64 | qsc_code_frac_chars_dupe_9grams_quality_signal float64 | qsc_code_frac_chars_dupe_10grams_quality_signal float64 | qsc_code_frac_chars_replacement_symbols_quality_signal float64 | qsc_code_frac_chars_digital_quality_signal float64 | qsc_code_frac_chars_whitespace_quality_signal float64 | qsc_code_size_file_byte_quality_signal float64 | qsc_code_num_lines_quality_signal float64 | qsc_code_num_chars_line_max_quality_signal float64 | qsc_code_num_chars_line_mean_quality_signal float64 | qsc_code_frac_chars_alphabet_quality_signal float64 | qsc_code_frac_chars_comments_quality_signal float64 | qsc_code_cate_xml_start_quality_signal float64 | qsc_code_frac_lines_dupe_lines_quality_signal float64 | qsc_code_cate_autogen_quality_signal float64 | qsc_code_frac_lines_long_string_quality_signal float64 | qsc_code_frac_chars_string_length_quality_signal float64 | qsc_code_frac_chars_long_word_length_quality_signal float64 | qsc_code_frac_lines_string_concat_quality_signal float64 | qsc_code_cate_encoded_data_quality_signal float64 | qsc_code_frac_chars_hex_words_quality_signal float64 | qsc_code_frac_lines_prompt_comments_quality_signal float64 | qsc_code_frac_lines_assert_quality_signal float64 | qsc_codepython_cate_ast_quality_signal float64 | qsc_codepython_frac_lines_func_ratio_quality_signal float64 | qsc_codepython_cate_var_zero_quality_signal bool | qsc_codepython_frac_lines_pass_quality_signal float64 | qsc_codepython_frac_lines_import_quality_signal float64 | qsc_codepython_frac_lines_simplefunc_quality_signal float64 | qsc_codepython_score_lines_no_logic_quality_signal float64 | qsc_codepython_frac_lines_print_quality_signal float64 | qsc_code_num_words int64 | qsc_code_num_chars int64 | qsc_code_mean_word_length int64 | qsc_code_frac_words_unique null | qsc_code_frac_chars_top_2grams int64 | qsc_code_frac_chars_top_3grams int64 | qsc_code_frac_chars_top_4grams int64 | qsc_code_frac_chars_dupe_5grams int64 | qsc_code_frac_chars_dupe_6grams int64 | qsc_code_frac_chars_dupe_7grams int64 | qsc_code_frac_chars_dupe_8grams int64 | qsc_code_frac_chars_dupe_9grams int64 | qsc_code_frac_chars_dupe_10grams int64 | qsc_code_frac_chars_replacement_symbols int64 | qsc_code_frac_chars_digital int64 | qsc_code_frac_chars_whitespace int64 | qsc_code_size_file_byte int64 | qsc_code_num_lines int64 | qsc_code_num_chars_line_max int64 | qsc_code_num_chars_line_mean int64 | qsc_code_frac_chars_alphabet int64 | qsc_code_frac_chars_comments int64 | qsc_code_cate_xml_start int64 | qsc_code_frac_lines_dupe_lines int64 | qsc_code_cate_autogen int64 | qsc_code_frac_lines_long_string int64 | qsc_code_frac_chars_string_length int64 | qsc_code_frac_chars_long_word_length int64 | qsc_code_frac_lines_string_concat null | qsc_code_cate_encoded_data int64 | qsc_code_frac_chars_hex_words int64 | qsc_code_frac_lines_prompt_comments int64 | qsc_code_frac_lines_assert int64 | qsc_codepython_cate_ast int64 | qsc_codepython_frac_lines_func_ratio int64 | qsc_codepython_cate_var_zero int64 | qsc_codepython_frac_lines_pass int64 | qsc_codepython_frac_lines_import int64 | qsc_codepython_frac_lines_simplefunc int64 | qsc_codepython_score_lines_no_logic int64 | qsc_codepython_frac_lines_print int64 | effective string | hits int64 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
31c411f06ad582e4a0fa3fab2a675d3cd66653a8 | 88 | py | Python | md_autogen/__init__.py | vfdev-5/markdown-apidocs | 711c15e9cd93a2291501cc49e072786757d76386 | [
"MIT"
] | null | null | null | md_autogen/__init__.py | vfdev-5/markdown-apidocs | 711c15e9cd93a2291501cc49e072786757d76386 | [
"MIT"
] | null | null | null | md_autogen/__init__.py | vfdev-5/markdown-apidocs | 711c15e9cd93a2291501cc49e072786757d76386 | [
"MIT"
] | null | null | null | from __future__ import absolute_import
from .md_autogen import *
__version__ = "0.5"
| 12.571429 | 38 | 0.772727 | 12 | 88 | 4.833333 | 0.75 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.027027 | 0.159091 | 88 | 6 | 39 | 14.666667 | 0.756757 | 0 | 0 | 0 | 1 | 0 | 0.034091 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.666667 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
31eb67a6115f58b56d7f9e7ee853b1a3ec47352e | 14,459 | py | Python | test/wecall_acceptance/single_sample_diploid/test_quality_recalibration.py | dylex/wecall | 35d24cefa4fba549e737cd99329ae1b17dd0156b | [
"MIT"
] | 8 | 2018-10-08T15:47:21.000Z | 2021-11-09T07:13:05.000Z | test/wecall_acceptance/single_sample_diploid/test_quality_recalibration.py | dylex/wecall | 35d24cefa4fba549e737cd99329ae1b17dd0156b | [
"MIT"
] | 4 | 2018-11-05T09:16:27.000Z | 2020-04-09T12:32:56.000Z | test/wecall_acceptance/single_sample_diploid/test_quality_recalibration.py | dylex/wecall | 35d24cefa4fba549e737cd99329ae1b17dd0156b | [
"MIT"
] | 4 | 2019-09-03T15:46:39.000Z | 2021-06-04T07:28:33.000Z | # All content Copyright (C) 2018 Genomics plc
from unittest import expectedFailure
from wecall_test_drivers.ascii_quality_recalibration_runner import AsciiQualityRecalibrationTest
from wecall_test_drivers.ascii_wecall_runner import AsciiWecallRunnerTest
class TestQualityRecalibrationDeletion(AsciiQualityRecalibrationTest):
def test_should_not_recalibrate_good_read_data_for_deletion(self):
reference = "ATCTAATAGCTATCAGCAATATCGCGCGTATTATTTATTTAT"
bam_spec = [" ,,,,,,,,,,*,,,,,,,,,,,,,,,,,,,,,, ",
"..............*............. ",
" ,,,,,,,,*,,,,,,,,,,,,,,,,,,,, ",
"..............*....................... "]
self.assert_quality_recalibrated_in_output_bam(reference, bam_spec, bam_spec)
class TestQualityRecalibrationInsertion(AsciiQualityRecalibrationTest):
def test_should_not_recalibrate_good_read_data_for_deletion(self):
reference = "ATCTAATAGCTATC*GCAATATCGCGCGTATTATTTATTTAT"
bam_spec = [" ,,,,,,,,,,a,,,,,,,,,,,,,,,,,,,,,, ",
"..............A............. ",
" ,,,,,,,,a,,,,,,,,,,,,,,,,,,,, ",
"..............A....................... "]
self.assert_quality_recalibrated_in_output_bam(reference, bam_spec, bam_spec)
class TestQualityRecalibrationBespokeQualities(AsciiQualityRecalibrationTest):
def test_should_not_recalibrate_good_read_data_with_snp_1(self):
reference = "ATCTAATAGCTATCAGCAATATCGCGCGTATTATTTATTTAT"
bam_spec = [" ,,,,,,,,,,t,,,,,,,,,,,,,,,,,,,,,, ",
" 0 ",
"..............T............. ",
" 0 ",
" ,,,,,,,,t,,,,,,,,,,,,,,,,,,,, ",
" 0 ",
"..............T....................... ",
" 0 "]
self.assert_quality_recalibrated_in_output_bam(reference, bam_spec, bam_spec)
def test_should_not_recalibrate_good_read_data_with_snp_2(self):
reference = "ATCTAATAGCTATCAGCAATATCGCGCGTATTATTTATTTAT"
bam_spec = [" ,,,,,,,,,,t,,,,,,,,,,,,,,,,,,,,,, ",
" 1 ",
"..............T............. ",
" 1 ",
" ,,,,,,,,t,,,,,,,,,,,,,,,,,,,, ",
" 1 ",
"..............T....................... ",
" 1 "]
self.assert_quality_recalibrated_in_output_bam(reference, bam_spec, bam_spec)
class TestQualityRecalibrationSingleSNP(AsciiQualityRecalibrationTest):
def test_should_not_recalibrate_region_snp_on_two_forward_strands_out_of_eight(self):
reference = "ATCTAATAGCATCTAATAGCTAGCATCCGTAACAGCAATATCGCGCGTATTATTTATTTAT"
bam_spec = [
"..............................T..............................",
" .....................T..............................",
" ....................................................",
" ....................................................",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, "]
self.assert_quality_recalibrated_in_output_bam(reference, bam_spec, bam_spec)
def test_should_not_recalibrate_snp_on_one_forward_and_reverse_strand_out_of_eight(self):
reference = "ATCTAATAGCATCTAATAGCTAGCATCCGTAACAGCAATATCGCGCGTATTATTTATTTAT"
bam_spec = [
"..............................T.......................... ",
" ....................................................",
" ....................................................",
" ....................................................",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,t,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, "]
self.assert_quality_recalibrated_in_output_bam(reference, bam_spec, bam_spec)
def test_should_recalibrate_around_snp_on_two_forward_strands_out_of_nine(self):
reference = "ATCTAATAGCATCTAATAGCTAGCATCCGTAACAGCAATATCGCGCGTATTATTTATTTAT"
input_bam = [
"..............................T..............................",
" .....................T..............................",
" ....................................................",
" ....................................................",
" ....................................................",
" ....................................................",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, "]
output_bam = [
"..............................T..............................",
" 000000000000000000000000000000000000000000",
" .....................T..............................",
" 0000000000000000000000000000000000000000",
" ....................................................",
" ....................................................",
" ....................................................",
" ....................................................",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, "]
self.assert_quality_recalibrated_in_output_bam(reference, input_bam, output_bam)
def test_should_recalibrate_snp_on_one_forward_and_reverse_strand_out_of_nine(self):
reference = "ATCTAATAGCATCTAATAGCTAGCATCCGTAACAGCAATATCGCGCGTATTATTTATTTAT"
input_bam = [
"..............................T..............................",
" ....................................................",
" ....................................................",
" ....................................................",
" ....................................................",
" ....................................................",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,t,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, "]
output_bam = [
"..............................T..............................",
" 000000000000000000000000000000000000000000",
" ....................................................",
" ....................................................",
" ....................................................",
" ....................................................",
" ....................................................",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,t,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" 0000000000000000000000000000000000000000 ",
" ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, "]
self.assert_quality_recalibrated_in_output_bam(reference, input_bam, output_bam)
class TestRealDataExamplesFromNA12878(AsciiWecallRunnerTest):
def calls_variants_without_recalibration(self, ref, sequence_list, expected_ascii_haplotypes):
self.calls_variants(
ref, sequence_list,
config_dict={"recalibrateBaseQs": False, "overwrite": True},
expected_ascii_haplotypes=expected_ascii_haplotypes
)
def calls_variants_with_recalibration(self, ref, sequence_list, expected_ascii_haplotypes):
self.calls_variants(
ref, sequence_list,
config_dict={"recalibrateBaseQs": True, "overwrite": True},
expected_ascii_haplotypes=expected_ascii_haplotypes
)
def calls_variants_with_and_without_recalibration(self, ref, sequence_list, expected_ascii_haplotypes):
self.calls_variants_with_recalibration(
ref, sequence_list, expected_ascii_haplotypes)
self.calls_variants_without_recalibration(
ref, sequence_list, expected_ascii_haplotypes)
def test_calls_two_good_snps_with_and_without_recalibration(self):
self.calls_variants_with_and_without_recalibration(
"ACGCCCCCTGCAAAAACTACTAAAAA",
[".T........................",
".T........................",
"...........C..............",
"...........C.............."],
[".T........................", # Expected calls
"...........C.............."]
)
@expectedFailure
def test_calls_false_positive_snp_with_and_without_recalibration(self):
self.calls_variants_without_recalibration(
"AGTGCCTGTTGCAAACTTAAAGTAT**********AA**********TAAAATAAA**********ATAAATAAAAAAAAATAAAAAAAAGAATA",
[",,,,,,,,,,, ..........**********..**********.........**********.............................",
"................. ......**********..**********.........**********.............................",
",,,,,,,,,,,,,,,,,,,,,,,,,**********,,**********,,, ...**********.............................",
".........................**********..**********..... ..**********.............................",
",,,,,,,,,,,,,,,,,,,,,,,,,**********,,**********,,,,,,,, ,,,,,,,,,,,,,,,,,,,,,,,",
",,,,,,,,,,,,,,,,,,,,,,,,,**********,,**********,,,,,,,,,**********,,,,, ..................",
",,,,,,,,,,,,,,,,,,,,,,,,,**********,,**********,,,,,,,,,**********,,,,,,,, .................",
"...............T.........**********G.**********.........**********.............. ...........",
" 1 1 ",
",,,,,,,,,,,,,,,,,,,,,,,,,**********,,**********,,,,,,,,,**********,,,,,,,,,,,,,,,,, ..........",
",,,t,,,,,,,,,,,,,,,,,,,,,**********,,**********,,,,,,,,,**********,,,,, ................",
" 1 ",
",,,,,,,,,,,,,,,,,,,,,,,,,aataaaataa,,**********,,,,,,,,,**********,,,,,,,,,,,,, ........",
" 3333333333 ",
",,,,,,,,,,,,,,,,,,,,,,,,,**********,,**********,, ,,,,,",
",,,,,,,,,,,,,,,,,,,,,,,,,**********,,**********,,,,,,,,,**********,,,,,,,,,,,,,,,,,,,,,,,,,,,,,",
",,,,,,,,,,,,,,,,,,,,,,,,,aataaaataa,,**********,,,,,,,,,**********,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" 3333333333 ",
",,,,,,,,,,,,,,,,,,,,,,,,,aataaaataa,,**********,,,,,,,,,**********,,,,,,,,,,,,,,,,,,,,,,,,,,, ",
" 3333333333 ",
",,,,,,,,,,,,,,,,,,,,,,,,,**********,,**********,,,,,,,,,**********,,,,,,,,,,,,,,,,,,,,,,,,,,,,,",
",,aa,,,,,,,,,,,,,,,,,a,,,aataaaataa,,**********,,,,,,,,,**********,,,,,g,,,,,,,,,,,,,,,,,,,,,, ",
" 11 1 3333333333 1 ",
",,,,,,,,,,,,,,,,,,,,,,,,,**********,,taaaataaac,,,,,,,,,**********,,,,,,,,,,,,,,,,,,,,,,,,,,,,,",
" 3333333333 ",
",,,,,,,,,,,,,,,,,,,,,,,,,aataaaataa,,**********,,,,,,,,,**********,,,,,,,,,,,,,,,,,,,,,,,,,,,,,",
" 3333333333 ",
",,,,,,,,,,,,,,,,,,,,,,,,,**********,,**********,,,,,,,,,**********,,,,,,,,,,,,,,,,,,,,,,,,,,,,,",
",,,,,,,,,,,,,,,,,,,,,,,,,**********,,**********,,,,,,,,,**********,,,,,,,,,,,,,,,,,,,,,,,,,,,,,",
",,,,,,,,,,,,,,,,,,,,,,,,,**********,,**********,,,,,,,,,ataaaataaa,,,,,,,,,,,,,,,,,,,,,,,,,,,,,",
" 3333333333 ",
".........................**********..**********.........**********.....AT....T............ ,,",
" 1 ",
".........................**********..**********.........**********.............................",
".........................**********..**********.........**********.....AT....T................."],
[".........................**********..**********.........**********.....AT......................", # Expected calls # noqa
".........................AATAAAATAA..**********.........**********.....AT......................"] # Expected calls # noqa
)
| 65.722727 | 137 | 0.254859 | 504 | 14,459 | 6.861111 | 0.198413 | 0.036437 | 0.059861 | 0.067091 | 0.747831 | 0.710816 | 0.64546 | 0.614228 | 0.586466 | 0.562175 | 0 | 0.02575 | 0.298983 | 14,459 | 219 | 138 | 66.022831 | 0.31541 | 0.007054 | 0 | 0.631016 | 0 | 0 | 0.604878 | 0.455749 | 0 | 0 | 0 | 0 | 0.042781 | 1 | 0.069519 | false | 0 | 0.016043 | 0 | 0.112299 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
9eca174bbb96c3698dc1e23f38d14eee2c1a29a5 | 1,699 | py | Python | Dragan_Dorin_Alexandru/api/app.py | RazvanBalau/parallel-2020 | bd9c0dea6cc70e167320f64632d7a235522dfdb3 | [
"MIT"
] | null | null | null | Dragan_Dorin_Alexandru/api/app.py | RazvanBalau/parallel-2020 | bd9c0dea6cc70e167320f64632d7a235522dfdb3 | [
"MIT"
] | null | null | null | Dragan_Dorin_Alexandru/api/app.py | RazvanBalau/parallel-2020 | bd9c0dea6cc70e167320f64632d7a235522dfdb3 | [
"MIT"
] | 23 | 2020-01-15T15:02:39.000Z | 2020-01-15T17:23:03.000Z | from flask import Flask
from worker import celery
import celery.states as states
import csv
import time
app = Flask(__name__)
def chunker_list(seq, size):
return (seq[i::size] for i in range(size))
@app.route('/correct_addresses/<int:number_of_tasks>')
def correct_addresses(number_of_tasks: int) -> str:
dataset = ["Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catel", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", "Catels", ]
dataset = list(chunker_list(dataset, number_of_tasks))
celery.send_task('tasks.correct_addresses', args=[number_of_tasks, dataset], kwargs={})
return str(number_of_tasks) + " tasks started !"
@app.route('/check/<string:task_id>')
def check_task(task_id: str) -> str:
res = celery.AsyncResult(task_id)
if res.state == states.PENDING:
return res.state
else:
return str(res.result)
| 65.346154 | 966 | 0.637434 | 209 | 1,699 | 5.066986 | 0.22488 | 0.424929 | 0.566572 | 0.661001 | 0.519358 | 0.519358 | 0.519358 | 0.519358 | 0.519358 | 0.519358 | 0 | 0 | 0.130665 | 1,699 | 25 | 967 | 67.96 | 0.716994 | 0 | 0 | 0 | 0 | 0 | 0.383755 | 0.050618 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0 | 0.238095 | 0.047619 | 0.571429 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 4 |
9edebf441b9d33147c13ec2faedae7abbe689c00 | 96 | py | Python | tests/test_intervalmap.py | marciogameiro/intervalmap | 2ae87100dc3954a67e62d30f1f7882ea40a0e326 | [
"MIT"
] | null | null | null | tests/test_intervalmap.py | marciogameiro/intervalmap | 2ae87100dc3954a67e62d30f1f7882ea40a0e326 | [
"MIT"
] | null | null | null | tests/test_intervalmap.py | marciogameiro/intervalmap | 2ae87100dc3954a67e62d30f1f7882ea40a0e326 | [
"MIT"
] | null | null | null | # test_intervalmap.py
# Marcio Gameiro
# 2021-01-05
# MIT LICENSE
import intervalmap as intmap
| 13.714286 | 28 | 0.770833 | 14 | 96 | 5.214286 | 0.928571 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.098765 | 0.15625 | 96 | 6 | 29 | 16 | 0.802469 | 0.59375 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
730191f687faf0fb84d6fd6f958f9a55ee8c94ac | 93 | py | Python | src/sql_alchemy/02_final_svc5_data_auto_service/restful_auto_service/data/sqlalchemy_base.py | turing4ever/restful-services-in-pyramid | 953d8415f37c0d3d0040f35f9b139f45339939bc | [
"MIT"
] | 58 | 2017-02-16T18:17:00.000Z | 2021-11-12T02:18:32.000Z | src/sql_alchemy/02_final_svc5_data_auto_service/restful_auto_service/data/sqlalchemy_base.py | imbi7py/restful-services-in-pyramid | 8521dbdb186513f498752048699bc9379bba64f5 | [
"MIT"
] | 7 | 2017-08-31T00:37:28.000Z | 2019-09-08T16:04:45.000Z | src/sql_alchemy/02_final_svc5_data_auto_service/restful_auto_service/data/sqlalchemy_base.py | imbi7py/restful-services-in-pyramid | 8521dbdb186513f498752048699bc9379bba64f5 | [
"MIT"
] | 36 | 2017-08-24T19:53:32.000Z | 2021-11-12T02:18:33.000Z | from sqlalchemy.ext.declarative import declarative_base
SqlAlchemyBase = declarative_base()
| 23.25 | 55 | 0.860215 | 10 | 93 | 7.8 | 0.7 | 0.384615 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.086022 | 93 | 3 | 56 | 31 | 0.917647 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
731281ec640ebe7f98b3e4310429e5853297d28c | 244 | py | Python | rippl/legislature/admin.py | gnmerritt/dailyrippl | 9a0f9615ba597a475dbd6305b589827cb2d97b03 | [
"MIT"
] | 6 | 2016-12-03T20:30:43.000Z | 2017-01-10T01:50:09.000Z | rippl/legislature/admin.py | gnmerritt/dailyrippl | 9a0f9615ba597a475dbd6305b589827cb2d97b03 | [
"MIT"
] | 24 | 2016-11-30T02:31:13.000Z | 2020-02-25T22:47:27.000Z | rippl/legislature/admin.py | gnmerritt/dailyrippl | 9a0f9615ba597a475dbd6305b589827cb2d97b03 | [
"MIT"
] | 1 | 2016-12-25T21:42:31.000Z | 2016-12-25T21:42:31.000Z | from django.contrib import admin
from . import models
admin.site.register(models.State)
admin.site.register(models.District)
admin.site.register(models.Representative)
admin.site.register(models.Term)
admin.site.register(models.ContactInfo)
| 22.181818 | 42 | 0.82377 | 33 | 244 | 6.090909 | 0.393939 | 0.223881 | 0.422886 | 0.572139 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.065574 | 244 | 10 | 43 | 24.4 | 0.881579 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.285714 | 0 | 0.285714 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
733ac65472342a53c51bb203028ce20ee9757d52 | 3,537 | py | Python | python/sparkdl/transformers/keras_applications.py | alonsoir/spark-deep-learning | 3f668d9b4a0aa2ef6fe05df5bf5c1d705cd2530d | [
"Apache-2.0"
] | 54 | 2017-10-12T04:42:18.000Z | 2021-08-24T08:47:03.000Z | python/sparkdl/transformers/keras_applications.py | alonsoir/spark-deep-learning | 3f668d9b4a0aa2ef6fe05df5bf5c1d705cd2530d | [
"Apache-2.0"
] | null | null | null | python/sparkdl/transformers/keras_applications.py | alonsoir/spark-deep-learning | 3f668d9b4a0aa2ef6fe05df5bf5c1d705cd2530d | [
"Apache-2.0"
] | 17 | 2017-10-12T07:34:10.000Z | 2020-03-12T12:25:25.000Z | # Copyright 2017 Databricks, Inc.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
#
from abc import ABCMeta, abstractmethod
import keras.backend as K
from keras.applications import inception_v3, xception
import tensorflow as tf
from sparkdl.transformers.utils import (imageInputPlaceholder, InceptionV3Constants)
"""
Essentially a factory function for getting the correct KerasApplicationModel class
for the network name.
"""
def getKerasApplicationModel(name):
try:
return KERAS_APPLICATION_MODELS[name]()
except KeyError:
raise ValueError("%s is not a supported model. Supported models: %s" %
(name, ', '.join(KERAS_APPLICATION_MODELS.keys())))
class KerasApplicationModel:
__metaclass__ = ABCMeta
def getModelData(self, featurize):
sess = tf.Session()
with sess.as_default():
K.set_learning_phase(0)
inputImage = imageInputPlaceholder(nChannels=3)
preprocessed = self.preprocess(inputImage)
model = self.model(preprocessed, featurize)
return dict(inputTensorName=inputImage.name,
outputTensorName=model.output.name,
session=sess,
inputTensorSize=self.inputShape(),
outputMode="vector")
@abstractmethod
def preprocess(self, inputImage):
pass
@abstractmethod
def model(self, preprocessed, featurize):
pass
@abstractmethod
def inputShape(self):
pass
def _testPreprocess(self, inputImage):
"""
For testing only. The preprocess function to be called before kerasModel.predict().
"""
return self.preprocess(inputImage)
@abstractmethod
def _testKerasModel(self, include_top):
"""
For testing only. The keras model object to compare to.
"""
pass
class InceptionV3Model(KerasApplicationModel):
def preprocess(self, inputImage):
return inception_v3.preprocess_input(inputImage)
def model(self, preprocessed, featurize):
return inception_v3.InceptionV3(input_tensor=preprocessed, weights="imagenet",
include_top=(not featurize))
def inputShape(self):
return InceptionV3Constants.INPUT_SHAPE
def _testKerasModel(self, include_top):
return inception_v3.InceptionV3(weights="imagenet", include_top=include_top)
class XceptionModel(KerasApplicationModel):
def preprocess(self, inputImage):
return xception.preprocess_input(inputImage)
def model(self, preprocessed, featurize):
return xception.Xception(input_tensor=preprocessed, weights="imagenet",
include_top=(not featurize))
def inputShape(self):
return (299, 299)
def _testKerasModel(self, include_top):
return xception.Xception(weights="imagenet", include_top=include_top)
KERAS_APPLICATION_MODELS = {
"InceptionV3": InceptionV3Model,
"Xception": XceptionModel
}
| 31.300885 | 91 | 0.685327 | 373 | 3,537 | 6.404826 | 0.404826 | 0.037673 | 0.036836 | 0.041859 | 0.255337 | 0.228548 | 0.123064 | 0.123064 | 0.123064 | 0.069485 | 0 | 0.009989 | 0.235793 | 3,537 | 112 | 92 | 31.580357 | 0.873844 | 0.195646 | 0 | 0.349206 | 0 | 0 | 0.040419 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.238095 | false | 0.063492 | 0.079365 | 0.126984 | 0.555556 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 0 | 0 | 4 |
733f51061eb2713e3c023fe22c3f5f6e897b10a9 | 213 | py | Python | listener/normal/stats/urls.py | andymckay/arecibo | eb6787ea0a276047ef5add2df67a4dd051e5c961 | [
"Apache-2.0"
] | 6 | 2016-01-26T04:47:52.000Z | 2022-01-24T19:55:04.000Z | listener/normal/stats/urls.py | andymckay/arecibo | eb6787ea0a276047ef5add2df67a4dd051e5c961 | [
"Apache-2.0"
] | 6 | 2017-02-12T05:11:25.000Z | 2017-02-12T05:12:15.000Z | listener/normal/stats/urls.py | andymckay/arecibo | eb6787ea0a276047ef5add2df67a4dd051e5c961 | [
"Apache-2.0"
] | 2 | 2015-12-09T22:37:58.000Z | 2021-09-09T17:04:33.000Z | from django.conf.urls.defaults import *
urlpatterns = patterns('',
url(r'^$', 'stats.views.stats_view', name="stats-view"),
url(r'^view/(?P<key>[\w-]+)/$', 'stats.views.stats_view', name="stats-view"),
)
| 30.428571 | 81 | 0.629108 | 30 | 213 | 4.4 | 0.566667 | 0.272727 | 0.227273 | 0.287879 | 0.484848 | 0.484848 | 0.484848 | 0 | 0 | 0 | 0 | 0 | 0.107981 | 213 | 6 | 82 | 35.5 | 0.694737 | 0 | 0 | 0 | 0 | 0 | 0.41784 | 0.314554 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.2 | 0 | 0.2 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
b43daadc65f2076c7fc8d0b65301e47cddc4b0e8 | 186 | py | Python | argyle/tests/__init__.py | mlavin/argyle | 92cc6e1dd9b8e7cb41c5098a79d05e14b8243d72 | [
"BSD-2-Clause"
] | 6 | 2015-11-05T08:53:00.000Z | 2020-03-11T14:27:00.000Z | argyle/tests/__init__.py | mlavin/argyle | 92cc6e1dd9b8e7cb41c5098a79d05e14b8243d72 | [
"BSD-2-Clause"
] | 1 | 2017-12-18T07:50:47.000Z | 2017-12-18T07:50:47.000Z | argyle/tests/__init__.py | mlavin/argyle | 92cc6e1dd9b8e7cb41c5098a79d05e14b8243d72 | [
"BSD-2-Clause"
] | null | null | null | import os
from .utils import unittest
def main():
suite = unittest.loader.defaultTestLoader.discover(os.path.dirname(__file__))
unittest.TextTestRunner(verbosity=2).run(suite)
| 23.25 | 81 | 0.768817 | 23 | 186 | 6.043478 | 0.782609 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.006098 | 0.11828 | 186 | 7 | 82 | 26.571429 | 0.841463 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | false | 0 | 0.4 | 0 | 0.6 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
b44bc64c35e9214f1257cb65b012e32cd37b0036 | 51,098 | py | Python | tests/_andre/test_perf.py | mehdisadeghi/saga-python | 19950ec1a4a0409b3c102eb60fc18ec91d578ca6 | [
"MIT"
] | null | null | null | tests/_andre/test_perf.py | mehdisadeghi/saga-python | 19950ec1a4a0409b3c102eb60fc18ec91d578ca6 | [
"MIT"
] | null | null | null | tests/_andre/test_perf.py | mehdisadeghi/saga-python | 19950ec1a4a0409b3c102eb60fc18ec91d578ca6 | [
"MIT"
] | null | null | null |
__author__ = "Andre Merzky"
__copyright__ = "Copyright 2012-2013, The SAGA Project"
__license__ = "MIT"
# import gc
import os
import sys
import time
import saga
import pprint
import cProfile
import subprocess
import threading
def create_service (url, services) :
service = saga.job.Service (url)
# print "%s : %s" % (service.get_url (), id(service))
services.append (service)
def run_jobs (service, n_jobs) :
jd = saga.job.Description ()
jd.executable = '/bin/sleep'
jd.arguments = ['1']
for id in range (1, n_jobs+1) :
tmp_j = service.create_job (jd)
tmp_j.run ()
# print "id: %5d : %s [%s]" % (id, tmp_j.id, tmp_j.get_state ())
# time.sleep (5)
# time.sleep (1)
# sys.stdout.write ('\n')
# del (service)
def perf (n_jobs, tuples) :
try :
s = saga.Session ()
targets = ""
urls = []
threads = []
services = []
n_services = 0
for (n, url) in tuples :
for i in range (0, n) : urls.append (url)
n_services += n
targets += "%d*%s " % (n, url)
for url in urls :
thread = threading.Thread (target=create_service, args=[url, services])
thread.start ()
threads.append (thread)
for thread in threads :
thread.join ()
threads = []
start = time.time ()
for service in services :
thread = threading.Thread (target=run_jobs, args=[service, n_jobs // n_services])
thread.start ()
threads.append (thread)
for thread in threads :
thread.join ()
stop = time.time ()
seconds = stop - start
rate = n_jobs / (seconds)
print "%10s %5s %5.2f %7.2f %s" % (n_services, n_jobs, seconds, rate, targets)
except saga.exceptions.SagaException as e :
print "Exception: ==========\n%s" % e.get_message ()
print "%s=====================" % e.get_traceback ()
# "xxxxxxxxxx xxxxxx xxxxxx xxxxxxxx xxxxxx xxxxxxx..."
print "n_services n_jobs time jobs/sec memory targets"
def main () :
perf (100, [(1, 'fork://localhost/')])
# cProfile.run('main()', 'test_perf.prof')
# perf (10000, [(10, 'ssh://merzky@localhost/')] + \
# [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')] + \
# [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf (100, [(2, 'fork://localhost/')])
# perf (100, [(2, 'ssh://merzky@localhost/')])
# perf (1000, [( 1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (1000, [( 2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (1000, [( 3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (1000, [( 4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (1000, [( 5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (1000, [( 6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (1000, [( 7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (1000, [( 8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (1000, [( 9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (1000, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (1, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (1, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf (1, [(1, 'gsissh://trestles-login.sdsc.edu/')])
# perf (1, [(1, 'ssh://india.futuregrid.org/')])
# perf (1, [(1, 'ssh://sierra.futuregrid.org/')])
perf (100, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
perf (100, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/'),
(10, 'ssh://repex1.tacc.utexas.edu/')])
perf (100, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/'),
(10, 'ssh://repex1.tacc.utexas.edu/'),
(10, 'gsissh://trestles-login.sdsc.edu/')])
perf (100, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/'),
(10, 'ssh://repex1.tacc.utexas.edu/'),
(10, 'gsissh://trestles-login.sdsc.edu/'),
(10, 'ssh://india.futuregrid.org/')])
perf (100, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/'),
(10, 'ssh://repex1.tacc.utexas.edu/'),
(10, 'gsissh://trestles-login.sdsc.edu/'),
(10, 'ssh://india.futuregrid.org/'),
(10, 'ssh://sierra.futuregrid.org/')])
# perf ( 100, [(1, 'fork://localhost/')])
# perf ( 100, [(1, 'ssh://merzky@localhost/')])
# perf ( 100, [(10, 'fork://localhost/')])
# perf ( 100, [(10, 'ssh://merzky@localhost/')])
# perf ( 1, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1, [(1, 'gsissh://stampede.tacc.utexas.edu/')])
# perf ( 10, [(10, 'fork://localhost/')])
# perf ( 10, [(10, 'fork://localhost/')])
# perf ( 10, [(10, 'fork://localhost/')])
#
# perf ( 10, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 10, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 10, [(10, 'ssh://repex1.tacc.utexas.edu/')])
#
# perf ( 10, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 10, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 10, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
#
# perf ( 10, [(10, 'ssh://localhost/')])
# perf ( 10, [(10, 'ssh://localhost/')])
# perf ( 10, [(10, 'ssh://localhost/')])
#
# perf ( 10, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 10, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 10, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 100, [(1, 'ssh://merzky@localhost/')])
# perf ( 0, [(1, 'fork://localhost/')])
# perf ( 1, [(1, 'fork://localhost/')])
# perf ( 2, [(1, 'fork://localhost/')])
# perf ( 4, [(1, 'fork://localhost/')])
# perf ( 8, [(1, 'fork://localhost/')])
# perf ( 16, [(1, 'fork://localhost/')])
# perf ( 32, [(1, 'fork://localhost/')])
# perf ( 64, [(1, 'fork://localhost/')])
# perf ( 128, [(1, 'fork://localhost/')])
# perf ( 256, [(1, 'fork://localhost/')])
# perf ( 512, [(1, 'fork://localhost/')])
# perf ( 1024, [(1, 'fork://localhost/')])
# perf ( 2048, [(1, 'fork://localhost/')])
# perf ( 4096, [(1, 'fork://localhost/')])
# perf ( 8192, [(1, 'fork://localhost/')])
# perf (16384, [(1, 'fork://localhost/')])
# perf (32768, [(1, 'fork://localhost/')])
# perf ( 0, [(2, 'fork://localhost/')])
# perf ( 1, [(2, 'fork://localhost/')])
# perf ( 2, [(2, 'fork://localhost/')])
# perf ( 4, [(2, 'fork://localhost/')])
# perf ( 8, [(2, 'fork://localhost/')])
# perf ( 16, [(2, 'fork://localhost/')])
# perf ( 32, [(2, 'fork://localhost/')])
# perf ( 64, [(2, 'fork://localhost/')])
# perf ( 128, [(2, 'fork://localhost/')])
# perf ( 256, [(2, 'fork://localhost/')])
# perf ( 512, [(2, 'fork://localhost/')])
# perf ( 1024, [(2, 'fork://localhost/')])
# perf ( 2048, [(2, 'fork://localhost/')])
# perf ( 4096, [(2, 'fork://localhost/')])
# perf ( 8192, [(2, 'fork://localhost/')])
# perf (16384, [(2, 'fork://localhost/')])
# perf (32768, [(2, 'fork://localhost/')])
# perf ( 0, [(3, 'fork://localhost/')])
# perf ( 1, [(3, 'fork://localhost/')])
# perf ( 2, [(3, 'fork://localhost/')])
# perf ( 4, [(3, 'fork://localhost/')])
# perf ( 8, [(3, 'fork://localhost/')])
# perf ( 16, [(3, 'fork://localhost/')])
# perf ( 32, [(3, 'fork://localhost/')])
# perf ( 64, [(3, 'fork://localhost/')])
# perf ( 128, [(3, 'fork://localhost/')])
# perf ( 256, [(3, 'fork://localhost/')])
# perf ( 512, [(3, 'fork://localhost/')])
# perf ( 1024, [(3, 'fork://localhost/')])
# perf ( 2048, [(3, 'fork://localhost/')])
# perf ( 4096, [(3, 'fork://localhost/')])
# perf ( 8192, [(3, 'fork://localhost/')])
# perf (16384, [(3, 'fork://localhost/')])
# perf (32768, [(3, 'fork://localhost/')])
# perf ( 0, [(4, 'fork://localhost/')])
# perf ( 1, [(4, 'fork://localhost/')])
# perf ( 2, [(4, 'fork://localhost/')])
# perf ( 4, [(4, 'fork://localhost/')])
# perf ( 8, [(4, 'fork://localhost/')])
# perf ( 16, [(4, 'fork://localhost/')])
# perf ( 32, [(4, 'fork://localhost/')])
# perf ( 64, [(4, 'fork://localhost/')])
# perf ( 128, [(4, 'fork://localhost/')])
# perf ( 256, [(4, 'fork://localhost/')])
# perf ( 512, [(4, 'fork://localhost/')])
# perf ( 1024, [(4, 'fork://localhost/')])
# perf ( 2048, [(4, 'fork://localhost/')])
# perf ( 4096, [(4, 'fork://localhost/')])
# perf ( 8192, [(4, 'fork://localhost/')])
# perf (16384, [(4, 'fork://localhost/')])
# perf (32768, [(4, 'fork://localhost/')])
# perf ( 0, [(5, 'fork://localhost/')])
# perf ( 1, [(5, 'fork://localhost/')])
# perf ( 2, [(5, 'fork://localhost/')])
# perf ( 4, [(5, 'fork://localhost/')])
# perf ( 8, [(5, 'fork://localhost/')])
# perf ( 16, [(5, 'fork://localhost/')])
# perf ( 32, [(5, 'fork://localhost/')])
# perf ( 64, [(5, 'fork://localhost/')])
# perf ( 128, [(5, 'fork://localhost/')])
# perf ( 256, [(5, 'fork://localhost/')])
# perf ( 512, [(5, 'fork://localhost/')])
# perf ( 1024, [(5, 'fork://localhost/')])
# perf ( 2048, [(5, 'fork://localhost/')])
# perf ( 4096, [(5, 'fork://localhost/')])
# perf ( 8192, [(5, 'fork://localhost/')])
# perf (16384, [(5, 'fork://localhost/')])
# perf (32768, [(5, 'fork://localhost/')])
# perf ( 0, [(6, 'fork://localhost/')])
# perf ( 1, [(6, 'fork://localhost/')])
# perf ( 2, [(6, 'fork://localhost/')])
# perf ( 4, [(6, 'fork://localhost/')])
# perf ( 8, [(6, 'fork://localhost/')])
# perf ( 16, [(6, 'fork://localhost/')])
# perf ( 32, [(6, 'fork://localhost/')])
# perf ( 64, [(6, 'fork://localhost/')])
# perf ( 128, [(6, 'fork://localhost/')])
# perf ( 256, [(6, 'fork://localhost/')])
# perf ( 512, [(6, 'fork://localhost/')])
# perf ( 1024, [(6, 'fork://localhost/')])
# perf ( 2048, [(6, 'fork://localhost/')])
# perf ( 4096, [(6, 'fork://localhost/')])
# perf ( 8192, [(6, 'fork://localhost/')])
# perf (16384, [(6, 'fork://localhost/')])
# perf (32768, [(6, 'fork://localhost/')])
# perf ( 0, [(7, 'fork://localhost/')])
# perf ( 1, [(7, 'fork://localhost/')])
# perf ( 2, [(7, 'fork://localhost/')])
# perf ( 4, [(7, 'fork://localhost/')])
# perf ( 8, [(7, 'fork://localhost/')])
# perf ( 16, [(7, 'fork://localhost/')])
# perf ( 32, [(7, 'fork://localhost/')])
# perf ( 64, [(7, 'fork://localhost/')])
# perf ( 128, [(7, 'fork://localhost/')])
# perf ( 256, [(7, 'fork://localhost/')])
# perf ( 512, [(7, 'fork://localhost/')])
# perf ( 1024, [(7, 'fork://localhost/')])
# perf ( 2048, [(7, 'fork://localhost/')])
# perf ( 4096, [(7, 'fork://localhost/')])
# perf ( 8192, [(7, 'fork://localhost/')])
# perf (16384, [(7, 'fork://localhost/')])
# perf (32768, [(7, 'fork://localhost/')])
# perf ( 0, [(8, 'fork://localhost/')])
# perf ( 1, [(8, 'fork://localhost/')])
# perf ( 2, [(8, 'fork://localhost/')])
# perf ( 4, [(8, 'fork://localhost/')])
# perf ( 8, [(8, 'fork://localhost/')])
# perf ( 16, [(8, 'fork://localhost/')])
# perf ( 32, [(8, 'fork://localhost/')])
# perf ( 64, [(8, 'fork://localhost/')])
# perf ( 128, [(8, 'fork://localhost/')])
# perf ( 256, [(8, 'fork://localhost/')])
# perf ( 512, [(8, 'fork://localhost/')])
# perf ( 1024, [(8, 'fork://localhost/')])
# perf ( 2048, [(8, 'fork://localhost/')])
# perf ( 4096, [(8, 'fork://localhost/')])
# perf ( 8192, [(8, 'fork://localhost/')])
# perf (16384, [(8, 'fork://localhost/')])
# perf (32768, [(8, 'fork://localhost/')])
# perf ( 0, [(9, 'fork://localhost/')])
# perf ( 1, [(9, 'fork://localhost/')])
# perf ( 2, [(9, 'fork://localhost/')])
# perf ( 4, [(9, 'fork://localhost/')])
# perf ( 8, [(9, 'fork://localhost/')])
# perf ( 16, [(9, 'fork://localhost/')])
# perf ( 32, [(9, 'fork://localhost/')])
# perf ( 64, [(9, 'fork://localhost/')])
# perf ( 128, [(9, 'fork://localhost/')])
# perf ( 256, [(9, 'fork://localhost/')])
# perf ( 512, [(9, 'fork://localhost/')])
# perf ( 1024, [(9, 'fork://localhost/')])
# perf ( 2048, [(9, 'fork://localhost/')])
# perf ( 4096, [(9, 'fork://localhost/')])
# perf ( 8192, [(9, 'fork://localhost/')])
# perf (16384, [(9, 'fork://localhost/')])
# perf (32768, [(9, 'fork://localhost/')])
# perf ( 0, [(10, 'fork://localhost/')])
# perf ( 1, [(10, 'fork://localhost/')])
# perf ( 2, [(10, 'fork://localhost/')])
# perf ( 4, [(10, 'fork://localhost/')])
# perf ( 8, [(10, 'fork://localhost/')])
# perf ( 16, [(10, 'fork://localhost/')])
# perf ( 32, [(10, 'fork://localhost/')])
# perf ( 64, [(10, 'fork://localhost/')])
# perf ( 128, [(10, 'fork://localhost/')])
# perf ( 256, [(10, 'fork://localhost/')])
# perf ( 512, [(10, 'fork://localhost/')])
# perf ( 1024, [(10, 'fork://localhost/')])
# perf ( 2048, [(10, 'fork://localhost/')])
# perf ( 4096, [(10, 'fork://localhost/')])
# perf ( 8192, [(10, 'fork://localhost/')])
# perf (16384, [(10, 'fork://localhost/')])
# perf (32768, [(10, 'fork://localhost/')])
#
# perf ( 0, [(1, 'ssh://merzky@localhost/')])
# perf ( 1, [(1, 'ssh://merzky@localhost/')])
# perf ( 2, [(1, 'ssh://merzky@localhost/')])
# perf ( 4, [(1, 'ssh://merzky@localhost/')])
# perf ( 8, [(1, 'ssh://merzky@localhost/')])
# perf ( 16, [(1, 'ssh://merzky@localhost/')])
# perf ( 32, [(1, 'ssh://merzky@localhost/')])
# perf ( 64, [(1, 'ssh://merzky@localhost/')])
# perf ( 128, [(1, 'ssh://merzky@localhost/')])
# perf ( 256, [(1, 'ssh://merzky@localhost/')])
# perf ( 512, [(1, 'ssh://merzky@localhost/')])
# perf ( 1024, [(1, 'ssh://merzky@localhost/')])
# perf ( 2048, [(1, 'ssh://merzky@localhost/')])
# perf ( 4096, [(1, 'ssh://merzky@localhost/')])
# perf ( 8192, [(1, 'ssh://merzky@localhost/')])
# perf (16384, [(1, 'ssh://merzky@localhost/')])
# perf (32768, [(1, 'ssh://merzky@localhost/')])
# perf ( 0, [(2, 'ssh://merzky@localhost/')])
# perf ( 1, [(2, 'ssh://merzky@localhost/')])
# perf ( 2, [(2, 'ssh://merzky@localhost/')])
# perf ( 4, [(2, 'ssh://merzky@localhost/')])
# perf ( 8, [(2, 'ssh://merzky@localhost/')])
# perf ( 16, [(2, 'ssh://merzky@localhost/')])
# perf ( 32, [(2, 'ssh://merzky@localhost/')])
# perf ( 64, [(2, 'ssh://merzky@localhost/')])
# perf ( 128, [(2, 'ssh://merzky@localhost/')])
# perf ( 256, [(2, 'ssh://merzky@localhost/')])
# perf ( 512, [(2, 'ssh://merzky@localhost/')])
# perf ( 1024, [(2, 'ssh://merzky@localhost/')])
# perf ( 2048, [(2, 'ssh://merzky@localhost/')])
# perf ( 4096, [(2, 'ssh://merzky@localhost/')])
# perf ( 8192, [(2, 'ssh://merzky@localhost/')])
# perf (16384, [(2, 'ssh://merzky@localhost/')])
# perf (32768, [(2, 'ssh://merzky@localhost/')])
# perf ( 0, [(3, 'ssh://merzky@localhost/')])
# perf ( 1, [(3, 'ssh://merzky@localhost/')])
# perf ( 2, [(3, 'ssh://merzky@localhost/')])
# perf ( 4, [(3, 'ssh://merzky@localhost/')])
# perf ( 8, [(3, 'ssh://merzky@localhost/')])
# perf ( 16, [(3, 'ssh://merzky@localhost/')])
# perf ( 32, [(3, 'ssh://merzky@localhost/')])
# perf ( 64, [(3, 'ssh://merzky@localhost/')])
# perf ( 128, [(3, 'ssh://merzky@localhost/')])
# perf ( 256, [(3, 'ssh://merzky@localhost/')])
# perf ( 512, [(3, 'ssh://merzky@localhost/')])
# perf ( 1024, [(3, 'ssh://merzky@localhost/')])
# perf ( 2048, [(3, 'ssh://merzky@localhost/')])
# perf ( 4096, [(3, 'ssh://merzky@localhost/')])
# perf ( 8192, [(3, 'ssh://merzky@localhost/')])
# perf (16384, [(3, 'ssh://merzky@localhost/')])
# perf (32768, [(3, 'ssh://merzky@localhost/')])
# perf ( 0, [(4, 'ssh://merzky@localhost/')])
# perf ( 1, [(4, 'ssh://merzky@localhost/')])
# perf ( 2, [(4, 'ssh://merzky@localhost/')])
# perf ( 4, [(4, 'ssh://merzky@localhost/')])
# perf ( 8, [(4, 'ssh://merzky@localhost/')])
# perf ( 16, [(4, 'ssh://merzky@localhost/')])
# perf ( 32, [(4, 'ssh://merzky@localhost/')])
# perf ( 64, [(4, 'ssh://merzky@localhost/')])
# perf ( 128, [(4, 'ssh://merzky@localhost/')])
# perf ( 256, [(4, 'ssh://merzky@localhost/')])
# perf ( 512, [(4, 'ssh://merzky@localhost/')])
# perf ( 1024, [(4, 'ssh://merzky@localhost/')])
# perf ( 2048, [(4, 'ssh://merzky@localhost/')])
# perf ( 4096, [(4, 'ssh://merzky@localhost/')])
# perf ( 8192, [(4, 'ssh://merzky@localhost/')])
# perf (16384, [(4, 'ssh://merzky@localhost/')])
# perf (32768, [(4, 'ssh://merzky@localhost/')])
# perf ( 0, [(5, 'ssh://merzky@localhost/')])
# perf ( 1, [(5, 'ssh://merzky@localhost/')])
# perf ( 2, [(5, 'ssh://merzky@localhost/')])
# perf ( 4, [(5, 'ssh://merzky@localhost/')])
# perf ( 8, [(5, 'ssh://merzky@localhost/')])
# perf ( 16, [(5, 'ssh://merzky@localhost/')])
# perf ( 32, [(5, 'ssh://merzky@localhost/')])
# perf ( 64, [(5, 'ssh://merzky@localhost/')])
# perf ( 128, [(5, 'ssh://merzky@localhost/')])
# perf ( 256, [(5, 'ssh://merzky@localhost/')])
# perf ( 512, [(5, 'ssh://merzky@localhost/')])
# perf ( 1024, [(5, 'ssh://merzky@localhost/')])
# perf ( 2048, [(5, 'ssh://merzky@localhost/')])
# perf ( 4096, [(5, 'ssh://merzky@localhost/')])
# perf ( 8192, [(5, 'ssh://merzky@localhost/')])
# perf (16384, [(5, 'ssh://merzky@localhost/')])
# perf (32768, [(5, 'ssh://merzky@localhost/')])
# perf ( 0, [(6, 'ssh://merzky@localhost/')])
# perf ( 1, [(6, 'ssh://merzky@localhost/')])
# perf ( 2, [(6, 'ssh://merzky@localhost/')])
# perf ( 4, [(6, 'ssh://merzky@localhost/')])
# perf ( 8, [(6, 'ssh://merzky@localhost/')])
# perf ( 16, [(6, 'ssh://merzky@localhost/')])
# perf ( 32, [(6, 'ssh://merzky@localhost/')])
# perf ( 64, [(6, 'ssh://merzky@localhost/')])
# perf ( 128, [(6, 'ssh://merzky@localhost/')])
# perf ( 256, [(6, 'ssh://merzky@localhost/')])
# perf ( 512, [(6, 'ssh://merzky@localhost/')])
# perf ( 1024, [(6, 'ssh://merzky@localhost/')])
# perf ( 2048, [(6, 'ssh://merzky@localhost/')])
# perf ( 4096, [(6, 'ssh://merzky@localhost/')])
# perf ( 8192, [(6, 'ssh://merzky@localhost/')])
# perf (16384, [(6, 'ssh://merzky@localhost/')])
# perf (32768, [(6, 'ssh://merzky@localhost/')])
# perf ( 0, [(7, 'ssh://merzky@localhost/')])
# perf ( 1, [(7, 'ssh://merzky@localhost/')])
# perf ( 2, [(7, 'ssh://merzky@localhost/')])
# perf ( 4, [(7, 'ssh://merzky@localhost/')])
# perf ( 8, [(7, 'ssh://merzky@localhost/')])
# perf ( 16, [(7, 'ssh://merzky@localhost/')])
# perf ( 32, [(7, 'ssh://merzky@localhost/')])
# perf ( 64, [(7, 'ssh://merzky@localhost/')])
# perf ( 128, [(7, 'ssh://merzky@localhost/')])
# perf ( 256, [(7, 'ssh://merzky@localhost/')])
# perf ( 512, [(7, 'ssh://merzky@localhost/')])
# perf ( 1024, [(7, 'ssh://merzky@localhost/')])
# perf ( 2048, [(7, 'ssh://merzky@localhost/')])
# perf ( 4096, [(7, 'ssh://merzky@localhost/')])
# perf ( 8192, [(7, 'ssh://merzky@localhost/')])
# perf (16384, [(7, 'ssh://merzky@localhost/')])
# perf (32768, [(7, 'ssh://merzky@localhost/')])
# perf ( 0, [(8, 'ssh://merzky@localhost/')])
# perf ( 1, [(8, 'ssh://merzky@localhost/')])
# perf ( 2, [(8, 'ssh://merzky@localhost/')])
# perf ( 4, [(8, 'ssh://merzky@localhost/')])
# perf ( 8, [(8, 'ssh://merzky@localhost/')])
# perf ( 16, [(8, 'ssh://merzky@localhost/')])
# perf ( 32, [(8, 'ssh://merzky@localhost/')])
# perf ( 64, [(8, 'ssh://merzky@localhost/')])
# perf ( 128, [(8, 'ssh://merzky@localhost/')])
# perf ( 256, [(8, 'ssh://merzky@localhost/')])
# perf ( 512, [(8, 'ssh://merzky@localhost/')])
# perf ( 1024, [(8, 'ssh://merzky@localhost/')])
# perf ( 2048, [(8, 'ssh://merzky@localhost/')])
# perf ( 4096, [(8, 'ssh://merzky@localhost/')])
# perf ( 8192, [(8, 'ssh://merzky@localhost/')])
# perf (16384, [(8, 'ssh://merzky@localhost/')])
# perf (32768, [(8, 'ssh://merzky@localhost/')])
# perf ( 0, [(9, 'ssh://merzky@localhost/')])
# perf ( 1, [(9, 'ssh://merzky@localhost/')])
# perf ( 2, [(9, 'ssh://merzky@localhost/')])
# perf ( 4, [(9, 'ssh://merzky@localhost/')])
# perf ( 8, [(9, 'ssh://merzky@localhost/')])
# perf ( 16, [(9, 'ssh://merzky@localhost/')])
# perf ( 32, [(9, 'ssh://merzky@localhost/')])
# perf ( 64, [(9, 'ssh://merzky@localhost/')])
# perf ( 128, [(9, 'ssh://merzky@localhost/')])
# perf ( 256, [(9, 'ssh://merzky@localhost/')])
# perf ( 512, [(9, 'ssh://merzky@localhost/')])
# perf ( 1024, [(9, 'ssh://merzky@localhost/')])
# perf ( 2048, [(9, 'ssh://merzky@localhost/')])
# perf ( 4096, [(9, 'ssh://merzky@localhost/')])
# perf ( 8192, [(9, 'ssh://merzky@localhost/')])
# perf (16384, [(9, 'ssh://merzky@localhost/')])
# perf (32768, [(9, 'ssh://merzky@localhost/')])
# perf ( 0, [(10, 'ssh://merzky@localhost/')])
# perf ( 1, [(10, 'ssh://merzky@localhost/')])
# perf ( 2, [(10, 'ssh://merzky@localhost/')])
# perf ( 4, [(10, 'ssh://merzky@localhost/')])
# perf ( 8, [(10, 'ssh://merzky@localhost/')])
# perf ( 16, [(10, 'ssh://merzky@localhost/')])
# perf ( 32, [(10, 'ssh://merzky@localhost/')])
# perf ( 64, [(10, 'ssh://merzky@localhost/')])
# perf ( 128, [(10, 'ssh://merzky@localhost/')])
# perf ( 256, [(10, 'ssh://merzky@localhost/')])
# perf ( 512, [(10, 'ssh://merzky@localhost/')])
# perf ( 1024, [(10, 'ssh://merzky@localhost/')])
# perf ( 2048, [(10, 'ssh://merzky@localhost/')])
# perf ( 4096, [(10, 'ssh://merzky@localhost/')])
# perf ( 8192, [(10, 'ssh://merzky@localhost/')])
# perf (16384, [(10, 'ssh://merzky@localhost/')])
# perf (32768, [(10, 'ssh://merzky@localhost/')])
#
#
# perf ( 0, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 16, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 32, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 64, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 128, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 256, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 512, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1024, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2048, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4096, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8192, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (16384, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (32768, [(1, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 0, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 16, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 32, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 64, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 128, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 256, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 512, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1024, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2048, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4096, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8192, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (16384, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (32768, [(2, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 0, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 16, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 32, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 64, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 128, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 256, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 512, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1024, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2048, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4096, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8192, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (16384, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (32768, [(3, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 0, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 16, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 32, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 64, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 128, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 256, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 512, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1024, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2048, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4096, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8192, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (16384, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (32768, [(4, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 0, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 16, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 32, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 64, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 128, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 256, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 512, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1024, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2048, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4096, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8192, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (16384, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (32768, [(5, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 0, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 16, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 32, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 64, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 128, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 256, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 512, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1024, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2048, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4096, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8192, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (16384, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (32768, [(6, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 0, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 16, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 32, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 64, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 128, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 256, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 512, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1024, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2048, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4096, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8192, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (16384, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (32768, [(7, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 0, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 16, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 32, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 64, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 128, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 256, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 512, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1024, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2048, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4096, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8192, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (16384, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (32768, [(8, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 0, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 16, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 32, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 64, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 128, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 256, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 512, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1024, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2048, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4096, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8192, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (16384, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (32768, [(9, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 0, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 16, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 32, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 64, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 128, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 256, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 512, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 1024, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 2048, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 4096, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf ( 8192, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (16384, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
# perf (32768, [(10, 'ssh://amerzky@cyder.cct.lsu.edu/')])
#
#
# perf ( 0, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 16, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 32, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 64, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 128, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 256, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 512, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1024, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2048, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4096, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8192, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf (16384, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf (32768, [(1, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 0, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 16, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 32, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 64, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 128, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 256, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 512, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1024, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2048, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4096, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8192, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf (16384, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf (32768, [(2, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 0, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 16, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 32, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 64, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 128, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 256, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 512, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1024, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2048, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4096, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8192, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf (16384, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf (32768, [(3, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 0, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 16, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 32, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 64, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 128, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 256, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 512, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1024, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2048, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4096, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8192, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf (16384, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf (32768, [(4, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 0, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 16, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 32, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 64, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 128, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 256, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 512, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1024, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2048, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4096, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8192, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf (16384, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf (32768, [(5, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 0, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 16, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 32, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 64, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 128, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 256, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 512, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1024, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2048, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4096, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8192, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf (16384, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf (32768, [(6, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 0, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 16, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 32, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 64, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 128, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 256, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 512, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1024, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2048, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4096, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8192, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf (16384, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf (32768, [(7, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 0, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 16, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 32, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 64, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 128, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 256, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 512, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1024, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2048, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4096, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8192, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf (16384, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf (32768, [(8, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 0, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 16, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 32, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 64, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 128, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 256, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 512, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1024, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2048, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4096, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8192, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf (16384, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf (32768, [(9, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 0, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 16, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 32, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 64, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 128, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 256, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 512, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 1024, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 2048, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 4096, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf ( 8192, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf (16384, [(10, 'ssh://repex1.tacc.utexas.edu/')])
# perf (32768, [(10, 'ssh://repex1.tacc.utexas.edu/')])
#
# perf ( 0, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 16, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 32, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 64, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 128, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 256, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 512, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1024, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2048, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4096, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8192, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (16384, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (32768, [(1, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 0, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 16, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 32, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 64, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 128, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 256, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 512, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1024, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2048, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4096, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8192, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (16384, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (32768, [(2, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 0, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 16, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 32, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 64, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 128, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 256, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 512, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1024, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2048, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4096, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8192, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (16384, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (32768, [(3, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 0, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 16, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 32, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 64, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 128, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 256, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 512, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1024, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2048, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4096, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8192, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (16384, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (32768, [(4, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 0, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 16, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 32, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 64, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 128, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 256, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 512, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1024, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2048, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4096, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8192, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (16384, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (32768, [(5, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 0, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 16, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 32, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 64, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 128, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 256, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 512, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1024, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2048, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4096, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8192, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (16384, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (32768, [(6, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 0, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 16, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 32, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 64, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 128, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 256, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 512, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1024, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2048, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4096, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8192, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (16384, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (32768, [(7, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 0, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 16, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 32, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 64, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 128, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 256, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 512, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1024, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2048, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4096, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8192, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (16384, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (32768, [(8, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 0, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 16, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 32, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 64, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 128, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 256, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 512, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1024, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2048, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4096, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8192, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (16384, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (32768, [(9, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 0, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 16, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 32, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 64, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 128, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 256, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 512, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 1024, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 2048, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 4096, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf ( 8192, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (16384, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
# perf (32768, [(10, 'gsissh://ranger.tacc.utexas.edu/')])
| 49.465634 | 93 | 0.525461 | 6,814 | 51,098 | 3.93484 | 0.019665 | 0.14046 | 0.17164 | 0.221916 | 0.826235 | 0.662614 | 0.655975 | 0.258466 | 0.049083 | 0.047106 | 0 | 0.085463 | 0.16304 | 51,098 | 1,032 | 94 | 49.513566 | 0.541469 | 0.908959 | 0 | 0.263889 | 0 | 0 | 0.178629 | 0.128548 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.111111 | null | null | 0.069444 | 0 | 0 | 0 | null | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
b45cbc2310b2fe5212db3beb0e669c9f10d913b3 | 60 | py | Python | Lesson_5/Plays/lets_to_play.py | Mike030668/Python--learning--UII | 4b0a3fe32b1bb4e6f98130aab09b3ab55eca2df4 | [
"Apache-2.0"
] | null | null | null | Lesson_5/Plays/lets_to_play.py | Mike030668/Python--learning--UII | 4b0a3fe32b1bb4e6f98130aab09b3ab55eca2df4 | [
"Apache-2.0"
] | null | null | null | Lesson_5/Plays/lets_to_play.py | Mike030668/Python--learning--UII | 4b0a3fe32b1bb4e6f98130aab09b3ab55eca2df4 | [
"Apache-2.0"
] | null | null | null | from Lesson_5.Plays import victorina
victorina.start_play() | 20 | 36 | 0.85 | 9 | 60 | 5.444444 | 0.888889 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.018182 | 0.083333 | 60 | 3 | 37 | 20 | 0.872727 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
b486b3ec9fdd13c49a29c9a48bd55d3a962a9108 | 1,204 | py | Python | src/SpiderPi/HiwonderSDK/BuzzerControlDemo.py | peteh/spiderpi | 19c4e254979a756acb641b67e944568c7c79520c | [
"MIT"
] | null | null | null | src/SpiderPi/HiwonderSDK/BuzzerControlDemo.py | peteh/spiderpi | 19c4e254979a756acb641b67e944568c7c79520c | [
"MIT"
] | null | null | null | src/SpiderPi/HiwonderSDK/BuzzerControlDemo.py | peteh/spiderpi | 19c4e254979a756acb641b67e944568c7c79520c | [
"MIT"
] | null | null | null | import time
import Board
print('''
**********************************************************
********Function:Hiwonder SpiderPi expansion board, serial servo control routine，buzzer control routine*********
**********************************************************
----------------------------------------------------------
Official website:http://www.hiwonder.com
Online mall:https://huaner.tmall.com/
----------------------------------------------------------
The following commands need to be used in the LX terminal, which can be opened by ctrl+alt+t, or click
Click the black LX terminal icon in the upper bar
----------------------------------------------------------
Usage:
sudo python3 BuzzerControlDemo.py
----------------------------------------------------------
Version: --V1.1 2020/11/07
----------------------------------------------------------
Tips:
* Press Ctrl+C to close the program, if it fails, please try multiple times!
----------------------------------------------------------
''')
Board.setBuzzer(0) # close
Board.setBuzzer(1) # open
time.sleep(0.1) # delay
Board.setBuzzer(0) # close
time.sleep(1) # delay
Board.setBuzzer(1)
time.sleep(0.5)
Board.setBuzzer(0)
| 33.444444 | 112 | 0.446013 | 117 | 1,204 | 4.589744 | 0.641026 | 0.130354 | 0.083799 | 0.074488 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.019248 | 0.093854 | 1,204 | 35 | 113 | 34.4 | 0.472961 | 0.023256 | 0 | 0.433333 | 0 | 0.033333 | 0.833333 | 0.417949 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.066667 | 0 | 0.066667 | 0.033333 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
b488066a0925814a00202a70c47ee90f52971945 | 135 | py | Python | backend/src/applications/user/get_user_request.py | Seina88/attendance-system | afa7ba64c7fd99623a1c5dd3b09151ade759d715 | [
"MIT"
] | 2 | 2021-05-12T14:09:44.000Z | 2021-06-19T12:38:33.000Z | backend/src/applications/user/get_user_request.py | Seina88/attendance-system | afa7ba64c7fd99623a1c5dd3b09151ade759d715 | [
"MIT"
] | 10 | 2021-05-13T12:09:47.000Z | 2021-06-07T13:28:17.000Z | backend/src/applications/user/get_user_request.py | Seina88/attendance-system | afa7ba64c7fd99623a1c5dd3b09151ade759d715 | [
"MIT"
] | 1 | 2021-06-17T00:54:04.000Z | 2021-06-17T00:54:04.000Z | class GetUserRequest:
def __init__(self, id: str, api_token: str) -> None:
self.id = id
self.api_token = api_token
| 27 | 56 | 0.62963 | 19 | 135 | 4.105263 | 0.526316 | 0.307692 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.266667 | 135 | 4 | 57 | 33.75 | 0.787879 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
81f6bc873588c44cb452c2efc36feed33e7dba7b | 2,102 | py | Python | pacu/models/awsapi/ec2-instance-connect.py | RyanJarv/Pacu2 | 27df4bcf296fc8f467d3dc671a47bf9519ce7a24 | [
"MIT"
] | 1 | 2022-03-09T14:51:54.000Z | 2022-03-09T14:51:54.000Z | pacu/models/awsapi/ec2-instance-connect.py | RyanJarv/Pacu2 | 27df4bcf296fc8f467d3dc671a47bf9519ce7a24 | [
"MIT"
] | null | null | null | pacu/models/awsapi/ec2-instance-connect.py | RyanJarv/Pacu2 | 27df4bcf296fc8f467d3dc671a47bf9519ce7a24 | [
"MIT"
] | null | null | null | # generated by datamodel-codegen:
# filename: openapi.yaml
# timestamp: 2021-12-31T02:48:35+00:00
from __future__ import annotations
from typing import Annotated, Any, Optional
from pydantic import BaseModel, Field
class AuthException(BaseModel):
__root__: Any
class InvalidArgsException(AuthException):
pass
class ServiceException(AuthException):
pass
class ThrottlingException(AuthException):
pass
class EC2InstanceNotFoundException(AuthException):
pass
class SerialConsoleAccessDisabledException(AuthException):
pass
class EC2InstanceTypeInvalidException(AuthException):
pass
class SerialConsoleSessionLimitExceededException(AuthException):
pass
class SerialConsoleSessionUnavailableException(AuthException):
pass
class AvailabilityZone(BaseModel):
__root__: Annotated[
str, Field(max_length=32, min_length=6, regex='^(\\w+-){2,3}\\d+\\w+$')
]
class InstanceId(BaseModel):
__root__: Annotated[str, Field(max_length=32, min_length=10, regex='^i-[a-f0-9]+$')]
class InstanceOSUser(BaseModel):
__root__: Annotated[
str,
Field(
max_length=32,
min_length=1,
regex='^[A-Za-z_][A-Za-z0-9\\@\\._-]{0,30}[A-Za-z0-9\\$_-]?$',
),
]
class RequestId(BaseModel):
__root__: str
class SSHPublicKey(BaseModel):
__root__: Annotated[str, Field(max_length=4096, min_length=256)]
class Success(BaseModel):
__root__: bool
class SerialPort(BaseModel):
__root__: Annotated[int, Field(ge=0.0, le=0.0)]
class SendSSHPublicKeyResponse(BaseModel):
RequestId: Optional[RequestId] = None
Success: Optional[Success] = None
class SendSSHPublicKeyRequest(BaseModel):
InstanceId: InstanceId
InstanceOSUser: InstanceOSUser
SSHPublicKey: SSHPublicKey
AvailabilityZone: AvailabilityZone
class SendSerialConsoleSSHPublicKeyResponse(SendSSHPublicKeyResponse):
pass
class SendSerialConsoleSSHPublicKeyRequest(BaseModel):
InstanceId: InstanceId
SerialPort: Optional[SerialPort] = None
SSHPublicKey: SSHPublicKey
| 20.019048 | 88 | 0.725975 | 204 | 2,102 | 7.25 | 0.377451 | 0.054767 | 0.118999 | 0.067613 | 0.127789 | 0.127789 | 0.127789 | 0.10142 | 0.10142 | 0.10142 | 0 | 0.029868 | 0.171741 | 2,102 | 104 | 89 | 20.211538 | 0.819644 | 0.045671 | 0 | 0.258621 | 1 | 0.017241 | 0.043956 | 0.037463 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0.155172 | 0.051724 | 0 | 0.689655 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 1 | 0 | 0 | 4 |
5ee34ca0f9dd76add60d238d407a47dadcff64cf | 185 | py | Python | run.py | ASHWINISINHA/pi-oled-intelligent-clock | 1452079bdd9c152eac6a20722de5601fb455dc78 | [
"MIT"
] | null | null | null | run.py | ASHWINISINHA/pi-oled-intelligent-clock | 1452079bdd9c152eac6a20722de5601fb455dc78 | [
"MIT"
] | null | null | null | run.py | ASHWINISINHA/pi-oled-intelligent-clock | 1452079bdd9c152eac6a20722de5601fb455dc78 | [
"MIT"
] | null | null | null | import subprocess
from time import sleep
y=(0.1)
subprocess.Popen(["python", 'rd1.py'])
sleep(y)
subprocess.Popen(["python", 'rs1.py'])
sleep(y)
subprocess.Popen(["python", 'rl1.py'])
| 18.5 | 38 | 0.691892 | 28 | 185 | 4.571429 | 0.5 | 0.140625 | 0.492188 | 0.28125 | 0.453125 | 0.453125 | 0 | 0 | 0 | 0 | 0 | 0.029586 | 0.086486 | 185 | 9 | 39 | 20.555556 | 0.727811 | 0 | 0 | 0.25 | 0 | 0 | 0.194595 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 0.25 | 0 | 1 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
5eeaa0320e60e8cb1e770189fadf3c208691cdae | 174 | py | Python | Compete/Class of Code/Reverse Mode/reverse1.py | H2u-Hwng/CodinGame | cbef4000b30b25475dfbf002f575d62ac6a61ce1 | [
"MIT"
] | null | null | null | Compete/Class of Code/Reverse Mode/reverse1.py | H2u-Hwng/CodinGame | cbef4000b30b25475dfbf002f575d62ac6a61ce1 | [
"MIT"
] | null | null | null | Compete/Class of Code/Reverse Mode/reverse1.py | H2u-Hwng/CodinGame | cbef4000b30b25475dfbf002f575d62ac6a61ce1 | [
"MIT"
] | null | null | null | drink = input()
straw = int(input())
if straw == 1:
print('____|____')
else:
print('_________')
print('\\ /')
print(' \\ ' + drink + ' /')
print(' \\___/')
| 15.818182 | 30 | 0.488506 | 15 | 174 | 4.333333 | 0.533333 | 0.307692 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.007634 | 0.247126 | 174 | 10 | 31 | 17.4 | 0.48855 | 0 | 0 | 0 | 0 | 0 | 0.252874 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.555556 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 4 |
6f2f7c4e8d8fb33a0c93291ce64b2977ac6d5cc9 | 196 | py | Python | minigest/contabilita/urls/bilancio.py | ctrlmaniac/minigest | 2bfceb57e41c872e4112e24d0e6991164846888b | [
"MIT"
] | null | null | null | minigest/contabilita/urls/bilancio.py | ctrlmaniac/minigest | 2bfceb57e41c872e4112e24d0e6991164846888b | [
"MIT"
] | 1 | 2021-09-22T19:10:20.000Z | 2021-09-22T19:10:20.000Z | minigest/contabilita/urls/bilancio.py | ctrlmaniac/minigest | 2bfceb57e41c872e4112e24d0e6991164846888b | [
"MIT"
] | null | null | null | from django.urls import path
from ..views import BilancioView
urlpatterns = [
path("<int:azienda>/", BilancioView.as_view()),
path("<int:azienda>/<periodo>/", BilancioView.as_view()),
]
| 21.777778 | 61 | 0.688776 | 23 | 196 | 5.782609 | 0.565217 | 0.105263 | 0.210526 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.132653 | 196 | 8 | 62 | 24.5 | 0.782353 | 0 | 0 | 0 | 0 | 0 | 0.193878 | 0.122449 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 0.333333 | 0 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
6f3235501d00dede1c66cda9ae6fab069df84e56 | 277 | py | Python | vsparsedvd/utils/utils.py | Setsugennoao/vs-parsedvd | fe89ff51b85758dca32e73b3c884acfccf583451 | [
"MIT"
] | 2 | 2021-12-06T05:48:14.000Z | 2022-02-10T09:17:18.000Z | vsparsedvd/utils/utils.py | Setsugennoao/vs-parsedvd | fe89ff51b85758dca32e73b3c884acfccf583451 | [
"MIT"
] | null | null | null | vsparsedvd/utils/utils.py | Setsugennoao/vs-parsedvd | fe89ff51b85758dca32e73b3c884acfccf583451 | [
"MIT"
] | null | null | null | from __future__ import annotations
from typing import Sequence
def opt_int(val: str | int | None) -> int | None:
return int(val) if val is not None else None
def opt_ints(vals: Sequence[str | int | None]) -> Sequence[int | None]:
return [opt_int(x) for x in vals]
| 23.083333 | 71 | 0.689531 | 46 | 277 | 4 | 0.478261 | 0.152174 | 0.108696 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.209386 | 277 | 11 | 72 | 25.181818 | 0.840183 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.333333 | false | 0 | 0.333333 | 0.333333 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 4 |
6f6fccf217ecb38f32e0056202da74b90bfbc6e0 | 683 | py | Python | ipymd/formats/tests/test_utils.py | nathanfdunn/ipymd | cca5f98e34a024396e21ab7a3f322bbe2e3f37d1 | [
"BSD-3-Clause"
] | 521 | 2015-01-01T09:22:05.000Z | 2022-02-06T23:54:10.000Z | ipymd/formats/tests/test_utils.py | nathanfdunn/ipymd | cca5f98e34a024396e21ab7a3f322bbe2e3f37d1 | [
"BSD-3-Clause"
] | 79 | 2015-01-04T21:17:29.000Z | 2018-08-28T16:39:21.000Z | ipymd/formats/tests/test_utils.py | nathanfdunn/ipymd | cca5f98e34a024396e21ab7a3f322bbe2e3f37d1 | [
"BSD-3-Clause"
] | 56 | 2015-03-01T08:48:26.000Z | 2022-01-29T03:11:13.000Z | # -*- coding: utf-8 -*-
"""Test utils."""
#------------------------------------------------------------------------------
# Imports
#------------------------------------------------------------------------------
import os.path as op
from ._utils import _test_file_path, _exec_test_file
#------------------------------------------------------------------------------
# Test Markdown parser
#------------------------------------------------------------------------------
def test_file_path():
filename = 'ex1'
assert op.exists(_test_file_path(filename, 'markdown'))
def test_exec_test_file():
filename = 'ex1'
assert isinstance(_exec_test_file(filename), list)
| 27.32 | 79 | 0.373353 | 51 | 683 | 4.647059 | 0.45098 | 0.202532 | 0.151899 | 0.168776 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.004862 | 0.096633 | 683 | 24 | 80 | 28.458333 | 0.379254 | 0.549048 | 0 | 0.25 | 0 | 0 | 0.047297 | 0 | 0 | 0 | 0 | 0 | 0.25 | 1 | 0.25 | false | 0 | 0.25 | 0 | 0.5 | 0 | 0 | 0 | 0 | null | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
6f7775072bcc1c947a80de9ca39c577d0a29f71e | 224 | py | Python | workalendar/usa/new_jersey.py | taiyeoguns/workalendar | 35ef15b0fe166ab2e73e419c83ad45738a62ac8d | [
"MIT"
] | 405 | 2017-11-21T14:33:58.000Z | 2021-06-03T01:58:55.000Z | workalendar/usa/new_jersey.py | taiyeoguns/workalendar | 35ef15b0fe166ab2e73e419c83ad45738a62ac8d | [
"MIT"
] | 236 | 2017-11-20T16:11:50.000Z | 2021-05-28T08:02:53.000Z | workalendar/usa/new_jersey.py | taiyeoguns/workalendar | 35ef15b0fe166ab2e73e419c83ad45738a62ac8d | [
"MIT"
] | 126 | 2017-12-12T14:04:25.000Z | 2021-05-29T14:27:11.000Z | from ..registry_tools import iso_register
from .core import UnitedStates
@iso_register('US-NJ')
class NewJersey(UnitedStates):
"""New Jersey"""
include_good_friday = True
include_election_day_every_year = True
| 22.4 | 42 | 0.763393 | 29 | 224 | 5.586207 | 0.758621 | 0.135802 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.147321 | 224 | 9 | 43 | 24.888889 | 0.848168 | 0.044643 | 0 | 0 | 0 | 0 | 0.024038 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 0.833333 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
48b04817aba5557350700788058f6de5ce4b787d | 29,778 | py | Python | pytests/test_cphd_consistency.py | pressler-vsc/sarpy | fa6c951c42b9a7d9df2edfa53c771494cb0246fb | [
"MIT"
] | null | null | null | pytests/test_cphd_consistency.py | pressler-vsc/sarpy | fa6c951c42b9a7d9df2edfa53c771494cb0246fb | [
"MIT"
] | null | null | null | pytests/test_cphd_consistency.py | pressler-vsc/sarpy | fa6c951c42b9a7d9df2edfa53c771494cb0246fb | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
#
# Copyright 2020-2021 Valkyrie Systems Corporation
#
# Licensed under MIT License. See LICENSE.
#
import copy
import os
import re
import shutil
import tempfile
from lxml import etree
import numpy as np
import pytest
from sarpy.consistency import cphd_consistency
from sarpy.io.phase_history.cphd_schema import get_schema_path
GOOD_CPHD = os.path.join(os.environ['SARPY_TEST_PATH'], 'cphd', 'spotlight_example.cphd')
DEFAULT_SCHEMA = get_schema_path(version='1.0.1')
def make_elem(tag, text=None, children=None, namespace=None, attributes=None, **attrib):
"""
Creates described element.
Creates the Element with tag name, text, and attributes given. Attributes
can be specified as either a dictionary or keyword arguments.
Parameters
----------
tag : str
A string that will become the tag name.
text : str
A string that will become the text in the element. (Default: ``None``)
parent : lxml.etree.ElementTree.Element
The parent element. (Default: ``None``)
children : lxml.etree.ElementTree
The children elements. (Default: ``None``)
namespace : str
The string containing the namespace. (Default: ``None``)
attributes : dict
A dictionary mapping attribute names to values. (Default: ``None``)
**attrib : list
Keyword arguments that map to attributes. (Default: ``None``)
Returns
-------
lxml.etree.ElementTree.Element
"""
if attributes is None:
attributes = {}
if text is not None:
if isinstance(text, bool):
text = str(text).lower()
if not isinstance(text, str):
text = repr(text)
attrib = copy.copy(attrib)
attrib.update(attributes)
attrib = {key: str(value) for key, value in attrib.items()}
if namespace is not None:
tag = '{{{namespace}}}{tag}'.format(namespace=namespace, tag=tag)
retval = etree.Element(tag, attrib)
if text is not None:
retval.text = str(text)
if children is not None:
retval.extend([child for child in children if child is not None])
return retval
@pytest.fixture
def tmpdir():
dirname = tempfile.mkdtemp()
yield dirname
shutil.rmtree(dirname)
@pytest.fixture(scope='module')
def good_xml_str():
with open(GOOD_CPHD, 'rb') as fid:
header = cphd_consistency.read_header(fid)
fid.seek(header['XML_BLOCK_BYTE_OFFSET'], 0)
xml_block_size = header['XML_BLOCK_SIZE']
return fid.read(xml_block_size).decode()
@pytest.fixture
def good_xml(good_xml_str):
good_xml_root = etree.fromstring(good_xml_str)
good_xml_root_no_ns = cphd_consistency.strip_namespace(etree.fromstring(good_xml_str))
yield {'with_ns': good_xml_root, 'without_ns': good_xml_root_no_ns,
'nsmap': {'ns': re.match(r'\{(.*)\}', good_xml_root.tag).group(1)}}
@pytest.fixture
def good_header():
with open(GOOD_CPHD, 'rb') as fid:
return cphd_consistency.read_header(fid)
def remove_nodes(*nodes):
for node in nodes:
node.getparent().remove(node)
def copy_xml(elem):
return etree.fromstring(etree.tostring(elem))
def test_from_file_cphd():
cphdcon = cphd_consistency.CphdConsistency.from_file(str(GOOD_CPHD), DEFAULT_SCHEMA, True)
assert isinstance(cphdcon, cphd_consistency.CphdConsistency)
cphdcon.check()
assert not cphdcon.failures()
def test_from_file_xml(good_xml_str, tmpdir):
xml_file = os.path.join(tmpdir, 'cphd.xml')
with open(xml_file, 'w') as fid:
fid.write(good_xml_str)
cphdcon = cphd_consistency.CphdConsistency.from_file(str(xml_file), DEFAULT_SCHEMA, False)
assert isinstance(cphdcon, cphd_consistency.CphdConsistency)
cphdcon.check()
assert not cphdcon.failures()
def test_main(good_xml_str, tmpdir):
assert not cphd_consistency.main([str(GOOD_CPHD), '--schema', DEFAULT_SCHEMA, '--signal-data'])
assert not cphd_consistency.main([str(GOOD_CPHD), '--noschema'])
assert not cphd_consistency.main([str(GOOD_CPHD)])
xml_file = os.path.join(tmpdir, 'cphd.xml')
with open(xml_file, 'w') as fid:
fid.write(good_xml_str)
assert not cphd_consistency.main([str(xml_file), '-v'])
def test_xml_schema_error(good_xml):
bad_xml = copy_xml(good_xml['with_ns'])
remove_nodes(*bad_xml.xpath('./ns:Global/ns:DomainType', namespaces=good_xml['nsmap']))
cphd_con = cphd_consistency.CphdConsistency(bad_xml, pvps={}, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
cphd_con.check('check_against_schema')
assert cphd_con.failures()
def test_check_classification_and_release_info_error(good_xml, good_header):
bad_xml = copy_xml(good_xml['without_ns'])
bad_xml.find('./CollectionID/ReleaseInfo').text += '-make-bad'
cphd_con = cphd_consistency.CphdConsistency(bad_xml, pvps={}, header=good_header, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
cphd_con.check('check_classification_and_release_info')
assert cphd_con.failures()
def test_error_in_check(good_xml):
bad_xml = copy_xml(good_xml['with_ns'])
remove_nodes(*bad_xml.xpath('./ns:Channel/ns:Parameters/ns:DwellTimes/ns:CODId', namespaces=good_xml['nsmap']))
cphd_con = cphd_consistency.CphdConsistency(bad_xml, pvps={}, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
tocheck = []
for chan_id in bad_xml.findall('./ns:Data/ns:Channel/ns:Identifier', namespaces=good_xml['nsmap']):
tocheck.append('check_channel_dwell_exist_{}'.format(chan_id.text))
cphd_con.check(tocheck)
assert cphd_con.failures()
def test_polygon_size_error(good_xml):
bad_xml = copy_xml(good_xml['with_ns'])
ia_polygon_node = bad_xml.find('./ns:SceneCoordinates/ns:ImageArea/ns:Polygon', namespaces=good_xml['nsmap'])
ia_polygon_node.attrib['size'] = "12345678890"
cphd_con = cphd_consistency.CphdConsistency(bad_xml, pvps={}, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
cphd_con.check('check_global_imagearea_polygon')
assert cphd_con.failures()
def test_polygon_winding_error(good_xml):
bad_xml = copy_xml(good_xml['with_ns'])
ia_polygon_node = bad_xml.find('./ns:SceneCoordinates/ns:ImageArea/ns:Polygon', namespaces=good_xml['nsmap'])
size = int(ia_polygon_node.attrib['size'])
# Reverse the order of the vertices
for vertex in ia_polygon_node:
vertex.attrib['index'] = str(size - int(vertex.attrib['index']) + 1)
cphd_con = cphd_consistency.CphdConsistency(bad_xml, pvps={}, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
cphd_con.check('check_global_imagearea_polygon')
assert cphd_con.failures()
@pytest.fixture
def xml_with_signal_normal(good_xml):
root = copy_xml(good_xml['with_ns'])
pvps = {}
for channel_node in root.findall('./ns:Data/ns:Channel', namespaces=good_xml['nsmap']):
chan_id = channel_node.findtext('./ns:Identifier', namespaces=good_xml['nsmap'])
num_vect = int(channel_node.findtext('./ns:NumVectors', namespaces=good_xml['nsmap']))
pvps[chan_id] = np.ones(num_vect, dtype=[('SIGNAL', 'i8')])
chan_param_node = root.xpath('./ns:Channel/ns:Parameters/ns:Identifier[text()="{}"]/..'.format(chan_id),
namespaces=good_xml['nsmap'])[0]
chan_param_node.append(make_elem('SignalNormal', 'true', namespace=good_xml['nsmap']['ns']))
return pvps, root, good_xml['nsmap']
def test_signalnormal(xml_with_signal_normal):
pvps, root, nsmap = xml_with_signal_normal
cphd_con = cphd_consistency.CphdConsistency(root, pvps=pvps, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
tocheck = ['check_channel_signalnormal_{}'.format(key) for key in pvps.keys()]
cphd_con.check(tocheck)
assert not cphd_con.failures()
def test_signalnormal_bad_pvp(xml_with_signal_normal):
pvps, root, nsmap = xml_with_signal_normal
for idx, pvp in enumerate(pvps.values()):
pvp['SIGNAL'][idx] = 0
cphd_con = cphd_consistency.CphdConsistency(root, pvps=pvps, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
tocheck = ['check_channel_signalnormal_{}'.format(key) for key in pvps.keys()]
cphd_con.check(tocheck)
assert len(cphd_con.failures()) == len(pvps)
for norm_node in root.findall('./ns:Channel/ns:Parameters/ns:SignalNormal', namespaces=nsmap):
norm_node.text = 'false'
cphd_con = cphd_consistency.CphdConsistency(root, pvps=pvps, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
cphd_con.check(tocheck)
assert not cphd_con.failures()
no_sig_pvp = {name: np.zeros(pvp.shape, dtype=[('notsignal', 'i8')]) for name, pvp in pvps.items()}
cphd_con = cphd_consistency.CphdConsistency(root, pvps=no_sig_pvp, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
cphd_con.check(tocheck)
assert cphd_con.failures()
@pytest.fixture
def xml_without_fxfixed(good_xml):
root = copy_xml(good_xml['with_ns'])
pvps = {}
for channel_node in root.findall('./ns:Data/ns:Channel', namespaces=good_xml['nsmap']):
chan_id = channel_node.findtext('./ns:Identifier', namespaces=good_xml['nsmap'])
num_vect = int(channel_node.findtext('./ns:NumVectors', namespaces=good_xml['nsmap']))
pvps[chan_id] = np.zeros(num_vect, dtype=[('FX1', 'f8'), ('FX2', 'f8')])
pvps[chan_id]['FX1'] = np.linspace(1.0, 1.1, num_vect)
pvps[chan_id]['FX2'] = np.linspace(2.0, 2.2, num_vect)
chan_param_node = root.xpath('./ns:Channel/ns:Parameters/ns:Identifier[text()="{}"]/..'.format(chan_id),
namespaces=good_xml['nsmap'])[0]
chan_param_node.find('./ns:FXFixed', namespaces=good_xml['nsmap']).text = 'false'
root.find('./ns:Channel/ns:FXFixedCPHD', namespaces=good_xml['nsmap']).text = 'false'
return pvps, root, good_xml['nsmap']
def test_fxfixed(xml_without_fxfixed):
pvps, root, nsmap = xml_without_fxfixed
cphd_con = cphd_consistency.CphdConsistency(root, pvps=pvps, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
tocheck = ['check_channel_fxfixed_{}'.format(key) for key in pvps.keys()]
tocheck.append('check_file_fxfixed')
cphd_con.check(tocheck)
assert not cphd_con.failures()
@pytest.fixture
def xml_without_toafixed(good_xml):
root = copy_xml(good_xml['with_ns'])
pvps = {}
for channel_node in root.findall('./ns:Data/ns:Channel', namespaces=good_xml['nsmap']):
chan_id = channel_node.findtext('./ns:Identifier', namespaces=good_xml['nsmap'])
num_vect = int(channel_node.findtext('./ns:NumVectors', namespaces=good_xml['nsmap']))
pvps[chan_id] = np.zeros(num_vect, dtype=[('TOA1', 'f8'), ('TOA2', 'f8')])
pvps[chan_id]['TOA1'] = np.linspace(1.0, 1.1, num_vect)
pvps[chan_id]['TOA2'] = np.linspace(2.0, 2.2, num_vect)
chan_param_node = root.xpath('./ns:Channel/ns:Parameters/ns:Identifier[text()="{}"]/..'.format(chan_id),
namespaces=good_xml['nsmap'])[0]
chan_param_node.find('./ns:TOAFixed', namespaces=good_xml['nsmap']).text = 'false'
root.find('./ns:Channel/ns:TOAFixedCPHD', namespaces=good_xml['nsmap']).text = 'false'
return pvps, root, good_xml['nsmap']
def test_channel_toafixed(xml_without_toafixed):
pvps, root, nsmap = xml_without_toafixed
cphd_con = cphd_consistency.CphdConsistency(root, pvps=pvps, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
tocheck = ['check_channel_toafixed_{}'.format(key) for key in pvps.keys()]
tocheck.append('check_file_toafixed')
cphd_con.check(tocheck)
assert not cphd_con.failures()
@pytest.fixture
def xml_without_srpfixed(good_xml):
root = copy_xml(good_xml['with_ns'])
pvps = {}
for channel_node in root.findall('./ns:Data/ns:Channel', namespaces=good_xml['nsmap']):
chan_id = channel_node.findtext('./ns:Identifier', namespaces=good_xml['nsmap'])
num_vect = int(channel_node.findtext('./ns:NumVectors', namespaces=good_xml['nsmap']))
pvps[chan_id] = np.zeros(num_vect, dtype=[('SRPPos', 'f8', 3)])
pvps[chan_id]['SRPPos'][:, 0] = np.linspace(1.0, 10, num_vect)
pvps[chan_id]['SRPPos'][:, 1] = np.linspace(2.0, 20, num_vect)
pvps[chan_id]['SRPPos'][:, 2] = np.linspace(3.0, 30, num_vect)
chan_param_node = root.xpath('./ns:Channel/ns:Parameters/ns:Identifier[text()="{}"]/..'.format(chan_id),
namespaces=good_xml['nsmap'])[0]
chan_param_node.find('./ns:SRPFixed', namespaces=good_xml['nsmap']).text = 'false'
root.find('./ns:Channel/ns:SRPFixedCPHD', namespaces=good_xml['nsmap']).text = 'false'
return pvps, root, good_xml['nsmap']
def test_channel_srpfixed(xml_without_srpfixed):
pvps, root, nsmap = xml_without_srpfixed
cphd_con = cphd_consistency.CphdConsistency(root, pvps=pvps, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
tocheck = ['check_channel_srpfixed_{}'.format(key) for key in pvps.keys()]
tocheck.append('check_file_srpfixed')
cphd_con.check(tocheck)
assert not cphd_con.failures()
@pytest.fixture
def xml_with_txrcv(good_xml):
root = copy_xml(good_xml['with_ns'])
root.append(make_elem('TxRcv', namespace=good_xml['nsmap']['ns'], children=[
make_elem('NumTxWFs', 2, namespace=good_xml['nsmap']['ns']),
make_elem('TxWFParameters', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Identifier', 'wf_unit_test_1', namespace=good_xml['nsmap']['ns']),
]),
make_elem('TxWFParameters', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Identifier', 'wf_unit_test_2', namespace=good_xml['nsmap']['ns']),
]),
make_elem('NumRcvs', 2, namespace=good_xml['nsmap']['ns']),
make_elem('RcvParameters', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Identifier', 'rcv_unit_test_1', namespace=good_xml['nsmap']['ns']),
]),
make_elem('RcvParameters', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Identifier', 'rcv_unit_test_2', namespace=good_xml['nsmap']['ns']),
])
]))
chan_param_node = root.xpath('./ns:Channel/ns:Parameters',
namespaces=good_xml['nsmap'])[0]
chan_param_node.append(make_elem('TxRcv', namespace=good_xml['nsmap']['ns'], children=[
make_elem('TxWFId', 'wf_unit_test_1', namespace=good_xml['nsmap']['ns']),
make_elem('TxWFId', 'wf_unit_test_2', namespace=good_xml['nsmap']['ns']),
make_elem('RcvId', 'rcv_unit_test_1', namespace=good_xml['nsmap']['ns']),
make_elem('RcvId', 'rcv_unit_test_2', namespace=good_xml['nsmap']['ns']),
]))
chan_ids = [chan_param_node.findtext('./ns:Identifier', namespaces=good_xml['nsmap'])]
return chan_ids, root, good_xml['nsmap']
def test_txrcv(xml_with_txrcv):
chan_ids, root, nsmap = xml_with_txrcv
cphd_con = cphd_consistency.CphdConsistency(root, pvps=None, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
tocheck = ['check_channel_txrcv_exist_{}'.format(key) for key in chan_ids]
cphd_con.check(tocheck)
assert not cphd_con.failures()
def test_txrcv_bad_txwfid(xml_with_txrcv):
chan_ids, root, nsmap = xml_with_txrcv
chan_param_node = root.xpath('./ns:Channel/ns:Parameters/ns:Identifier[text()="{}"]/..'.format(chan_ids[0]),
namespaces=nsmap)[0]
chan_param_node.xpath('./ns:TxRcv/ns:TxWFId', namespaces=nsmap)[-1].text = 'missing'
cphd_con = cphd_consistency.CphdConsistency(root, pvps=None, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
tocheck = ['check_channel_txrcv_exist_{}'.format(key) for key in chan_ids]
cphd_con.check(tocheck)
assert cphd_con.failures()
def test_txrcv_bad_rcvid(xml_with_txrcv):
chan_ids, root, nsmap = xml_with_txrcv
chan_param_node = root.xpath('./ns:Channel/ns:Parameters/ns:Identifier[text()="{}"]/..'.format(chan_ids[0]),
namespaces=nsmap)[0]
chan_param_node.xpath('./ns:TxRcv/ns:RcvId', namespaces=nsmap)[-1].text = 'missing'
cphd_con = cphd_consistency.CphdConsistency(root, pvps=None, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
tocheck = ['check_channel_txrcv_exist_{}'.format(key) for key in chan_ids]
cphd_con.check(tocheck)
assert cphd_con.failures()
@pytest.fixture
def xml_with_fxbwnoise(good_xml):
root = copy_xml(good_xml['with_ns'])
pvps = {}
for channel_node in root.findall('./ns:Data/ns:Channel', namespaces=good_xml['nsmap']):
chan_id = channel_node.findtext('./ns:Identifier', namespaces=good_xml['nsmap'])
num_vect = int(channel_node.findtext('./ns:NumVectors', namespaces=good_xml['nsmap']))
pvps[chan_id] = np.zeros(num_vect, dtype=[('FXN1', 'f8'), ('FXN2', 'f8')])
pvps[chan_id]['FXN1'] = np.linspace(1, 2, num_vect)
pvps[chan_id]['FXN2'] = pvps[chan_id]['FXN1'] * 1.1
pvps[chan_id]['FXN1'][10] = np.nan
pvps[chan_id]['FXN2'][10] = np.nan
chan_param_node = root.xpath('./ns:Channel/ns:Parameters/ns:Identifier[text()="{}"]/..'.format(chan_id),
namespaces=good_xml['nsmap'])[0]
chan_param_node.append(make_elem('FxBWNoise', 1.2, namespace=good_xml['nsmap']['ns']))
return pvps, root, good_xml['nsmap']
def test_fxbwnoise(xml_with_fxbwnoise):
pvps, root, nsmap = xml_with_fxbwnoise
cphd_con = cphd_consistency.CphdConsistency(root, pvps=pvps, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
tocheck = ['check_channel_fxbwnoise_{}'.format(key) for key in pvps.keys()]
cphd_con.check(tocheck)
assert not cphd_con.failures()
def test_fxbwnoise_bad_domain(xml_with_fxbwnoise):
pvps, root, nsmap = xml_with_fxbwnoise
root.find('./ns:Global/ns:DomainType', namespaces=nsmap).text = 'TOA'
cphd_con = cphd_consistency.CphdConsistency(root, pvps=pvps, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
tocheck = ['check_channel_fxbwnoise_{}'.format(key) for key in pvps.keys()]
cphd_con.check(tocheck)
assert cphd_con.failures()
def test_fxbwnoise_bad_value(xml_with_fxbwnoise):
pvps, root, nsmap = xml_with_fxbwnoise
chan_id = list(pvps.keys())[-1]
pvps[chan_id]['FXN1'][0] = 0.5
cphd_con = cphd_consistency.CphdConsistency(root, pvps=pvps, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
tocheck = ['check_channel_fxbwnoise_{}'.format(key) for key in pvps.keys()]
cphd_con.check(tocheck)
assert cphd_con.failures()
def test_geoinfo_polygons(good_xml):
root = copy_xml(good_xml['with_ns'])
root.append(make_elem('GeoInfo', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Polygon', size='3', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Vertex', index='1', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Lat', 0.0, namespace=good_xml['nsmap']['ns']),
make_elem('Lon', 0.0, namespace=good_xml['nsmap']['ns']),
]),
make_elem('Vertex', index='2', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Lat', 1.0, namespace=good_xml['nsmap']['ns']),
make_elem('Lon', 0.0, namespace=good_xml['nsmap']['ns']),
]),
make_elem('Vertex', index='3', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Lat', 1.0, namespace=good_xml['nsmap']['ns']),
make_elem('Lon', 1.0, namespace=good_xml['nsmap']['ns']),
]),
])
]))
cphd_con = cphd_consistency.CphdConsistency(root, pvps=None, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
cphd_con.check('check_geoinfo_polygons')
assert not cphd_con.failures()
def test_geoinfo_polygons_bad_order(good_xml):
root = copy_xml(good_xml['with_ns'])
root.append(make_elem('GeoInfo', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Polygon', size='3', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Vertex', index='1', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Lat', 0.0, namespace=good_xml['nsmap']['ns']),
make_elem('Lon', 0.0, namespace=good_xml['nsmap']['ns']),
]),
make_elem('Vertex', index='2', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Lat', 0.0, namespace=good_xml['nsmap']['ns']),
make_elem('Lon', 1.0, namespace=good_xml['nsmap']['ns']),
]),
make_elem('Vertex', index='3', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Lat', 1.0, namespace=good_xml['nsmap']['ns']),
make_elem('Lon', 1.0, namespace=good_xml['nsmap']['ns']),
]),
])
]))
cphd_con = cphd_consistency.CphdConsistency(root, pvps=None, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
cphd_con.check('check_geoinfo_polygons')
assert cphd_con.failures()
@pytest.fixture
def xml_with_channel_imagearea(good_xml):
root = copy_xml(good_xml['with_ns'])
for chan_param_node in root.xpath('./ns:Channel/ns:Parameters', namespaces=good_xml['nsmap']):
chan_param_node.append(make_elem('ImageArea', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X1Y1', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X', -50, namespace=good_xml['nsmap']['ns']),
make_elem('Y', -50, namespace=good_xml['nsmap']['ns']),
]),
make_elem('X2Y2', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X', 50, namespace=good_xml['nsmap']['ns']),
make_elem('Y', 50, namespace=good_xml['nsmap']['ns']),
]),
make_elem('Polygon', size='4', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Vertex', index='1', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X', -50.0, namespace=good_xml['nsmap']['ns']),
make_elem('Y', 0.0, namespace=good_xml['nsmap']['ns']),
]),
make_elem('Vertex', index='2', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X', 0.0, namespace=good_xml['nsmap']['ns']),
make_elem('Y', 50.0, namespace=good_xml['nsmap']['ns']),
]),
make_elem('Vertex', index='3', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X', 50.0, namespace=good_xml['nsmap']['ns']),
make_elem('Y', 0.0, namespace=good_xml['nsmap']['ns']),
]),
make_elem('Vertex', index='4', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X', 0.0, namespace=good_xml['nsmap']['ns']),
make_elem('Y', -50.0, namespace=good_xml['nsmap']['ns']),
]),
])
]))
return root, good_xml['nsmap']
def test_channel_image_area(xml_with_channel_imagearea):
root, nsmap = xml_with_channel_imagearea
cphd_con = cphd_consistency.CphdConsistency(root, pvps=None, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
tocheck = []
for chan_id in root.findall('./ns:Data/ns:Channel/ns:Identifier', namespaces=nsmap):
tocheck.append('check_channel_imagearea_x1y1_{}'.format(chan_id.text))
tocheck.append('check_channel_imagearea_polygon_{}'.format(chan_id.text))
cphd_con.check(tocheck)
assert not cphd_con.failures()
@pytest.fixture
def xml_with_extendedarea(good_xml):
root = copy_xml(good_xml['with_ns'])
scene = root.find('./ns:SceneCoordinates', namespaces=good_xml['nsmap'])
scene.append(make_elem('ExtendedArea', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X1Y1', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X', -1000, namespace=good_xml['nsmap']['ns']),
make_elem('Y', -1000, namespace=good_xml['nsmap']['ns']),
]),
make_elem('X2Y2', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X', 1000, namespace=good_xml['nsmap']['ns']),
make_elem('Y', 1000, namespace=good_xml['nsmap']['ns']),
]),
make_elem('Polygon', size='4', namespace=good_xml['nsmap']['ns'], children=[
make_elem('Vertex', index='1', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X', -1000.0, namespace=good_xml['nsmap']['ns']),
make_elem('Y', 0.0, namespace=good_xml['nsmap']['ns']),
]),
make_elem('Vertex', index='2', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X', 0.0, namespace=good_xml['nsmap']['ns']),
make_elem('Y', 1000.0, namespace=good_xml['nsmap']['ns']),
]),
make_elem('Vertex', index='3', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X', 1000.0, namespace=good_xml['nsmap']['ns']),
make_elem('Y', 0.0, namespace=good_xml['nsmap']['ns']),
]),
make_elem('Vertex', index='4', namespace=good_xml['nsmap']['ns'], children=[
make_elem('X', 0.0, namespace=good_xml['nsmap']['ns']),
make_elem('Y', -1000.0, namespace=good_xml['nsmap']['ns']),
]),
])
]))
return root, good_xml['nsmap']
def test_extended_imagearea(xml_with_extendedarea):
root, nsmap = xml_with_extendedarea
cphd_con = cphd_consistency.CphdConsistency(root, pvps=None, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
cphd_con.check(['check_extended_imagearea_polygon', 'check_extended_imagearea_x1y1_x2y2'])
assert not cphd_con.failures()
def test_extended_imagearea_polygon_bad_extent(xml_with_extendedarea):
root, nsmap = xml_with_extendedarea
root.find('./ns:SceneCoordinates/ns:ExtendedArea/ns:X2Y2/ns:X', namespaces=nsmap).text = '2000'
cphd_con = cphd_consistency.CphdConsistency(root, pvps=None, header=None, filename=None,
schema=DEFAULT_SCHEMA,
check_signal_data=False)
cphd_con.check('check_extended_imagearea_polygon')
assert cphd_con.failures()
| 45.741935 | 115 | 0.597119 | 3,585 | 29,778 | 4.705439 | 0.076709 | 0.069299 | 0.087498 | 0.099591 | 0.792815 | 0.759974 | 0.741478 | 0.717826 | 0.69684 | 0.67467 | 0 | 0.011525 | 0.25989 | 29,778 | 650 | 116 | 45.812308 | 0.753891 | 0.031433 | 0 | 0.607884 | 0 | 0 | 0.131682 | 0.055401 | 0 | 0 | 0 | 0 | 0.064315 | 1 | 0.080913 | false | 0 | 0.020747 | 0.002075 | 0.126556 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
48c7b95e25db83b298727eceeb0bb5aecb735fac | 16,616 | py | Python | venv/Lib/site-packages/Cryptodome/SelfTest/Cipher/test_Salsa20.py | JagahOrg/Voting | 893fbbda0584c63ac5b86328fffb44744a0e1239 | [
"Apache-2.0"
] | 4 | 2021-07-12T16:37:36.000Z | 2021-08-06T09:42:37.000Z | venv/Lib/site-packages/Cryptodome/SelfTest/Cipher/test_Salsa20.py | JagahOrg/Voting | 893fbbda0584c63ac5b86328fffb44744a0e1239 | [
"Apache-2.0"
] | 20 | 2021-05-03T18:02:23.000Z | 2022-03-12T12:01:04.000Z | Lib/site-packages/Cryptodome/SelfTest/Cipher/test_Salsa20.py | fochoao/cpython | 3dc84b260e5bced65ebc2c45c40c8fa65f9b5aa9 | [
"bzip2-1.0.6",
"0BSD"
] | 2 | 2021-03-16T12:41:29.000Z | 2021-03-16T14:50:08.000Z | # -*- coding: utf-8 -*-
#
# SelfTest/Cipher/Salsa20.py: Self-test for the Salsa20 stream cipher
#
# Written in 2013 by Fabrizio Tarizzo <fabrizio@fabriziotarizzo.org>
#
# ===================================================================
# The contents of this file are dedicated to the public domain. To
# the extent that dedication to the public domain is not available,
# everyone is granted a worldwide, perpetual, royalty-free,
# non-exclusive license to exercise all rights associated with the
# contents of this file for any purpose whatsoever.
# No rights are reserved.
#
# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
# EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
# MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
# NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
# BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
# ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
# CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
# SOFTWARE.
# ===================================================================
"""Self-test suite for Cryptodome.Cipher.Salsa20"""
import unittest
from Cryptodome.Util.py3compat import bchr
from Cryptodome.SelfTest.st_common import list_test_cases
from Cryptodome.Cipher import Salsa20
from .common import make_stream_tests
# This is a list of (plaintext, ciphertext, key[, description[, params]])
# tuples.
test_data = [
# Test vectors are taken from
# http://www.ecrypt.eu.org/stream/svn/viewcvs.cgi/ecrypt/trunk/submissions/salsa20/full/verified.test-vectors
( '00' * 512,
'4dfa5e481da23ea09a31022050859936da52fcee218005164f267cb65f5cfd7f'
+ '2b4f97e0ff16924a52df269515110a07f9e460bc65ef95da58f740b7d1dbb0aa'
+ 'd64cec189c7eb8c6bbf3d7376c80a481d43e628701f6a27afb9fe23919f24114'
+ '8db44f70d7063efcc3dd55a0893a613c3c6fe1c127bd6f59910589293bb6ef9e'
+ 'e24819066dee1a64f49b0bbad5988635272b169af861f85df881939f29ada6fd'
+ '0241410e8d332ae4798d929434a2630de451ec4e0169694cbaa7ebb121ea6a2b'
+ 'da9c1581f429e0a00f7d67e23b730676783b262e8eb43a25f55fb90b3e753aef'
+ '8c6713ec66c51881111593ccb3e8cb8f8de124080501eeeb389c4bcb6977cf95'
+ '7d5789631eb4554400e1e025935dfa7b3e9039d61bdc58a8697d36815bf1985c'
+ 'efdf7ae112e5bb81e37ecf0616ce7147fc08a93a367e08631f23c03b00a8da2f'
+ 'aa5024e5c8d30aca43fc2d5082067b21b234bc741d68fb292c6012c3764ccee3'
+ '1e364a5403e00cfee338a21a01e7d3cefd5a770ca0ab48c435ea6116435f7ad8'
+ '30b217b49f978a68e207ed9f462af7fb195b2115fe8f24f152e4ddc32202d6f2'
+ 'b52fafbcfbc202d8a259a611e901d3f62d065eb13f09bbc45cd45119b843efaa'
+ 'b375703739daced4dd4059fd71c3c47fc2f9939670fad4a46066adcc6a564578'
+ '3308b90ffb72be04a6b147cbe38cc0c3b9267c296a92a7c69873f9f263be9703',
'80000000000000000000000000000000',
'128 bits key, set 1, vector 0',
dict (iv='00'*8)),
( '00' * 512,
'e3be8fdd8beca2e3ea8ef9475b29a6e7003951e1097a5c38d23b7a5fad9f6844'
+ 'b22c97559e2723c7cbbd3fe4fc8d9a0744652a83e72a9c461876af4d7ef1a117'
+ '8da2b74eef1b6283e7e20166abcae538e9716e4669e2816b6b20c5c356802001'
+ 'cc1403a9a117d12a2669f456366d6ebb0f1246f1265150f793cdb4b253e348ae'
+ '203d89bc025e802a7e0e00621d70aa36b7e07cb1e7d5b38d5e222b8b0e4b8407'
+ '0142b1e29504767d76824850320b5368129fdd74e861b498e3be8d16f2d7d169'
+ '57be81f47b17d9ae7c4ff15429a73e10acf250ed3a90a93c711308a74c6216a9'
+ 'ed84cd126da7f28e8abf8bb63517e1ca98e712f4fb2e1a6aed9fdc73291faa17'
+ '958211c4ba2ebd5838c635edb81f513a91a294e194f1c039aeec657dce40aa7e'
+ '7c0af57cacefa40c9f14b71a4b3456a63e162ec7d8d10b8ffb1810d71001b618'
+ '2f9f73da53b85405c11f7b2d890fa8ae0c7f2e926d8a98c7ec4e91b65120e988'
+ '349631a700c6facec3471cb0413656e75e309456584084d7e12c5b43a41c43ed'
+ '9a048abd9b880da65f6a665a20fe7b77cd292fe62cae644b7f7df69f32bdb331'
+ '903e6505ce44fdc293920c6a9ec7057e23df7dad298f82ddf4efb7fdc7bfc622'
+ '696afcfd0cddcc83c7e77f11a649d79acdc3354e9635ff137e929933a0bd6f53'
+ '77efa105a3a4266b7c0d089d08f1e855cc32b15b93784a36e56a76cc64bc8477',
'8000000000000000000000000000000000000000000000000000000000000000',
'256 bits key, set 1, vector 0',
dict (iv='00'*8)),
( '00' * 512,
'169060ccb42bea7bee4d8012a02f3635eb7bca12859fa159cd559094b3507db8'
+ '01735d1a1300102a9c9415546829cbd2021ba217b39b81d89c55b13d0c603359'
+ '3f84159a3c84f4b4f4a0edcd9d38ff261a737909e0b66d68b5cac496f3a5be99'
+ 'cb12c321ab711afaab36cc0947955e1a9bb952ed54425e7711279fbc81bb83f5'
+ '6e55cea44e6daddb05858a153ea6213b3350c12aa1a83ef2726f09485fa71790'
+ 'f9b9f922c7dda1113b1f9d56658ed3402803f511bc1f122601d5e7f0ff036e23'
+ '23ef24bb24195b9fd574823cd8a40c29d86bd35c191e2038779ff696c712b6d8'
+ '2e7014dbe1ac5d527af076c088c4a8d44317958189f6ef54933a7e0816b5b916'
+ 'd8f12ed8afe9422b85e5cc9b8adec9d6cfabe8dbc1082bccc02f5a7266aa074c'
+ 'a284e583a35837798cc0e69d4ce937653b8cdd65ce414b89138615ccb165ad19'
+ '3c6b9c3d05eef4be921a10ea811fe61d11c6867600188e065daff90b509ec56b'
+ 'd41e7e8968c478c78d590c2d2ee24ea009c8f49bc3d81672cfc47895a9e21c9a'
+ '471ebf8e294bee5d2de436ac8d052bf31111b345f1da23c3a4d13b9fc5f0900a'
+ 'a298f98f538973b8fad40d4d159777de2cfe2a3dead1645ddb49794827dba040'
+ 'f70a0ff4ecd155e0f033604693a51e2363880e2ecf98699e7174af7c2c6b0fc6'
+ '59ae329599a3949272a37b9b2183a0910922a3f325ae124dcbdd735364055ceb',
'09090909090909090909090909090909',
'128 bits key, set 2, vector 9',
dict (iv='00'*8)),
( '00' * 512,
'7041e747ceb22ed7812985465f50333124f971da1c5d6efe5ca201b886f31046'
+ 'e757e5c3ec914f60ed1f6bce2819b6810953f12b8ba1199bf82d746a8b8a88f1'
+ '142002978ec4c35b95dc2c82990f9e847a0ab45f2ca72625f5190c820f29f3aa'
+ 'f5f0b5572b06b70a144f2a240c3b3098d4831fa1ce1459f8d1df226a6a79b0ab'
+ '41e91799ef31b5ff3d756c19126b19025858ee70fbd69f2be955cb011c005e31'
+ '32b271b378f39b0cb594e95c99ce6ff17735a541891845bbf0450afcb4a850b9'
+ '4ee90afb713ae7e01295c74381180a3816d7020d5a396c0d97aaa783eaabb6ec'
+ '44d5111157f2212d1b1b8fca7893e8b520cd482418c272ab119b569a2b9598eb'
+ '355624d12e79adab81153b58cd22eaf1b2a32395dedc4a1c66f4d274070b9800'
+ 'ea95766f0245a8295f8aadb36ddbbdfa936417c8dbc6235d19494036964d3e70'
+ 'b125b0f800c3d53881d9d11e7970f827c2f9556935cd29e927b0aceb8cae5fd4'
+ '0fd88a8854010a33db94c96c98735858f1c5df6844f864feaca8f41539313e7f'
+ '3c0610214912cd5e6362197646207e2d64cd5b26c9dfe0822629dcbeb16662e8'
+ '9ff5bf5cf2e499138a5e27bd5027329d0e68ddf53103e9e409523662e27f61f6'
+ '5cf38c1232023e6a6ef66c315bcb2a4328642faabb7ca1e889e039e7c444b34b'
+ 'b3443f596ac730f3df3dfcdb343c307c80f76e43e8898c5e8f43dc3bb280add0',
'0909090909090909090909090909090909090909090909090909090909090909',
'256 bits key, set 2, vector 9',
dict (iv='00'*8)),
( '00' * 1024,
'71daee5142d0728b41b6597933ebf467e43279e30978677078941602629cbf68'
+ 'b73d6bd2c95f118d2b3e6ec955dabb6dc61c4143bc9a9b32b99dbe6866166dc0'
+ '8631b7d6553050303d7252c264d3a90d26c853634813e09ad7545a6ce7e84a5d'
+ 'fc75ec43431207d5319970b0faadb0e1510625bb54372c8515e28e2accf0a993'
+ '0ad15f431874923d2a59e20d9f2a5367dba6051564f150287debb1db536ff9b0'
+ '9ad981f25e5010d85d76ee0c305f755b25e6f09341e0812f95c94f42eead346e'
+ '81f39c58c5faa2c88953dc0cac90469db2063cb5cdb22c9eae22afbf0506fca4'
+ '1dc710b846fbdfe3c46883dd118f3a5e8b11b6afd9e71680d8666557301a2daa'
+ 'fb9496c559784d35a035360885f9b17bd7191977deea932b981ebdb29057ae3c'
+ '92cfeff5e6c5d0cb62f209ce342d4e35c69646ccd14e53350e488bb310a32f8b'
+ '0248e70acc5b473df537ced3f81a014d4083932bedd62ed0e447b6766cd2604b'
+ '706e9b346c4468beb46a34ecf1610ebd38331d52bf33346afec15eefb2a7699e'
+ '8759db5a1f636a48a039688e39de34d995df9f27ed9edc8dd795e39e53d9d925'
+ 'b278010565ff665269042f05096d94da3433d957ec13d2fd82a0066283d0d1ee'
+ 'b81bf0ef133b7fd90248b8ffb499b2414cd4fa003093ff0864575a43749bf596'
+ '02f26c717fa96b1d057697db08ebc3fa664a016a67dcef8807577cc3a09385d3'
+ 'f4dc79b34364bb3b166ce65fe1dd28e3950fe6fa81063f7b16ce1c0e6daac1f8'
+ '188455b77752045e863c9b256ad92bc6e2d08314c5bba191c274f42dfbb3d652'
+ 'bb771956555e880f84cd8b827a4c5a52f3a099fa0259bd4aac3efd541f191170'
+ '4412d6e85fbcc628b335875b9fef24807f6e1bc66c3186159e1e7f5a13913e02'
+ 'd241ce2efdbcaa275039fb14eac5923d17ffbc7f1abd3b45e92127575bfbabf9'
+ '3a257ebef0aa1437b326e41b585af572f7239c33b32981a1577a4f629b027e1e'
+ 'b49d58cc497e944d79cef44357c2bf25442ab779651e991147bf79d6fd3a8868'
+ '0cd3b1748e07fd10d78aceef6db8a5e563570d40127f754146c34a440f2a991a'
+ '23fa39d365141f255041f2135c5cba4373452c114da1801bacca38610e3a6524'
+ '2b822d32de4ab5a7d3cf9b61b37493c863bd12e2cae10530cddcda2cb7a5436b'
+ 'ef8988d4d24e8cdc31b2d2a3586340bc5141f8f6632d0dd543bfed81eb471ba1'
+ 'f3dc2225a15ffddcc03eb48f44e27e2aa390598adf83f15c6608a5f18d4dfcf0'
+ 'f547d467a4d70b281c83a595d7660d0b62de78b9cca023cca89d7b1f83484638'
+ '0e228c25f049184a612ef5bb3d37454e6cfa5b10dceda619d898a699b3c8981a'
+ '173407844bb89b4287bf57dd6600c79e352c681d74b03fa7ea0d7bf6ad69f8a6'
+ '8ecb001963bd2dd8a2baa0083ec09751cd9742402ad716be16d5c052304cfca1',
'0F62B5085BAE0154A7FA4DA0F34699EC',
'128 bits key, Set 6, vector# 3',
dict (iv='288FF65DC42B92F9')),
( '00' * 1024,
'5e5e71f90199340304abb22a37b6625bf883fb89ce3b21f54a10b81066ef87da'
+ '30b77699aa7379da595c77dd59542da208e5954f89e40eb7aa80a84a6176663f'
+ 'd910cde567cf1ff60f7040548d8f376bfd1f44c4774aac37410ede7d5c3463fc'
+ '4508a603201d8495ad257894e5eb1914b53e8da5e4bf2bc83ac87ce55cc67df7'
+ '093d9853d2a83a9c8be969175df7c807a17156df768445dd0874a9271c6537f5'
+ 'ce0466473582375f067fa4fcdaf65dbc0139cd75e8c21a482f28c0fb8c3d9f94'
+ '22606cc8e88fe28fe73ec3cb10ff0e8cc5f2a49e540f007265c65b7130bfdb98'
+ '795b1df9522da46e48b30e55d9f0d787955ece720205b29c85f3ad9be33b4459'
+ '7d21b54d06c9a60b04b8e640c64e566e51566730e86cf128ab14174f91bd8981'
+ 'a6fb00fe587bbd6c38b5a1dfdb04ea7e61536fd229f957aa9b070ca931358e85'
+ '11b92c53c523cb54828fb1513c5636fa9a0645b4a3c922c0db94986d92f314ff'
+ '7852c03b231e4dceea5dd8cced621869cff818daf3c270ff3c8be2e5c74be767'
+ 'a4e1fdf3327a934fe31e46df5a74ae2021cee021d958c4f615263d99a5ddae7f'
+ 'eab45e6eccbafefe4761c57750847b7e75ee2e2f14333c0779ce4678f47b1e1b'
+ '760a03a5f17d6e91d4b42313b3f1077ee270e432fe04917ed1fc8babebf7c941'
+ '42b80dfb44a28a2a3e59093027606f6860bfb8c2e5897078cfccda7314c70035'
+ 'f137de6f05daa035891d5f6f76e1df0fce1112a2ff0ac2bd3534b5d1bf4c7165'
+ 'fb40a1b6eacb7f295711c4907ae457514a7010f3a342b4427593d61ba993bc59'
+ '8bd09c56b9ee53aac5dd861fa4b4bb53888952a4aa9d8ca8671582de716270e1'
+ '97375b3ee49e51fa2bf4ef32015dd9a764d966aa2ae541592d0aa650849e99ca'
+ '5c6c39beebf516457cc32fe4c105bff314a12f1ec94bdf4d626f5d9b1cbbde42'
+ 'e5733f0885765ba29e2e82c829d312f5fc7e180679ac84826c08d0a644b326d0'
+ '44da0fdcc75fa53cfe4ced0437fa4df5a7ecbca8b4cb7c4a9ecf9a60d00a56eb'
+ '81da52adc21f508dbb60a9503a3cc94a896616d86020d5b0e5c637329b6d396a'
+ '41a21ba2c4a9493cf33fa2d4f10f77d5b12fdad7e478ccfe79b74851fc96a7ca'
+ '6320c5efd561a222c0ab0fb44bbda0e42149611d2262bb7d1719150fa798718a'
+ '0eec63ee297cad459869c8b0f06c4e2b56cbac03cd2605b2a924efedf85ec8f1'
+ '9b0b6c90e7cbd933223ffeb1b3a3f9677657905829294c4c70acdb8b0891b47d'
+ '0875d0cd6c0f4efe2917fc44b581ef0d1e4280197065d07da34ab33283364552'
+ 'efad0bd9257b059acdd0a6f246812feb69e7e76065f27dbc2eee94da9cc41835'
+ 'bf826e36e5cebe5d4d6a37a6a666246290ce51a0c082718ab0ec855668db1add'
+ 'a658e5f257e0db39384d02e6145c4c00eaa079098f6d820d872de711b6ed08cf',
'0F62B5085BAE0154A7FA4DA0F34699EC3F92E5388BDE3184D72A7DD02376C91C',
'256 bits key, Set 6, vector# 3',
dict (iv='288FF65DC42B92F9')),
]
class KeyLength(unittest.TestCase):
def runTest(self):
nonce = bchr(0) * 8
for key_length in (15, 30, 33):
key = bchr(1) * key_length
self.assertRaises(ValueError, Salsa20.new, key, nonce)
class NonceTests(unittest.TestCase):
def test_invalid_nonce_length(self):
key = bchr(1) * 16
self.assertRaises(ValueError, Salsa20.new, key, bchr(0) * 7)
self.assertRaises(ValueError, Salsa20.new, key, bchr(0) * 9)
def test_default_nonce(self):
cipher1 = Salsa20.new(bchr(1) * 16)
cipher2 = Salsa20.new(bchr(1) * 16)
self.assertEqual(len(cipher1.nonce), 8)
self.assertNotEqual(cipher1.nonce, cipher2.nonce)
class ByteArrayTest(unittest.TestCase):
"""Verify we can encrypt or decrypt bytearrays"""
def runTest(self):
data = b"0123"
key = b"9" * 32
nonce = b"t" * 8
# Encryption
data_ba = bytearray(data)
key_ba = bytearray(key)
nonce_ba = bytearray(nonce)
cipher1 = Salsa20.new(key=key, nonce=nonce)
ct = cipher1.encrypt(data)
cipher2 = Salsa20.new(key=key_ba, nonce=nonce_ba)
key_ba[:1] = b'\xFF'
nonce_ba[:1] = b'\xFF'
ct_test = cipher2.encrypt(data_ba)
self.assertEqual(ct, ct_test)
self.assertEqual(cipher1.nonce, cipher2.nonce)
# Decryption
key_ba = bytearray(key)
nonce_ba = bytearray(nonce)
ct_ba = bytearray(ct)
cipher3 = Salsa20.new(key=key_ba, nonce=nonce_ba)
key_ba[:1] = b'\xFF'
nonce_ba[:1] = b'\xFF'
pt_test = cipher3.decrypt(ct_ba)
self.assertEqual(data, pt_test)
class MemoryviewTest(unittest.TestCase):
"""Verify we can encrypt or decrypt bytearrays"""
def runTest(self):
data = b"0123"
key = b"9" * 32
nonce = b"t" * 8
# Encryption
data_mv = memoryview(bytearray(data))
key_mv = memoryview(bytearray(key))
nonce_mv = memoryview(bytearray(nonce))
cipher1 = Salsa20.new(key=key, nonce=nonce)
ct = cipher1.encrypt(data)
cipher2 = Salsa20.new(key=key_mv, nonce=nonce_mv)
key_mv[:1] = b'\xFF'
nonce_mv[:1] = b'\xFF'
ct_test = cipher2.encrypt(data_mv)
self.assertEqual(ct, ct_test)
self.assertEqual(cipher1.nonce, cipher2.nonce)
# Decryption
key_mv = memoryview(bytearray(key))
nonce_mv = memoryview(bytearray(nonce))
ct_mv = memoryview(bytearray(ct))
cipher3 = Salsa20.new(key=key_mv, nonce=nonce_mv)
key_mv[:1] = b'\xFF'
nonce_mv[:1] = b'\xFF'
pt_test = cipher3.decrypt(ct_mv)
self.assertEqual(data, pt_test)
class TestOutput(unittest.TestCase):
def runTest(self):
# Encrypt/Decrypt data and test output parameter
key = b'4' * 32
nonce = b'5' * 8
cipher = Salsa20.new(key=key, nonce=nonce)
pt = b'5' * 16
ct = cipher.encrypt(pt)
output = bytearray(16)
cipher = Salsa20.new(key=key, nonce=nonce)
res = cipher.encrypt(pt, output=output)
self.assertEqual(ct, output)
self.assertEqual(res, None)
cipher = Salsa20.new(key=key, nonce=nonce)
res = cipher.decrypt(ct, output=output)
self.assertEqual(pt, output)
self.assertEqual(res, None)
output = memoryview(bytearray(16))
cipher = Salsa20.new(key=key, nonce=nonce)
cipher.encrypt(pt, output=output)
self.assertEqual(ct, output)
cipher = Salsa20.new(key=key, nonce=nonce)
cipher.decrypt(ct, output=output)
self.assertEqual(pt, output)
cipher = Salsa20.new(key=key, nonce=nonce)
self.assertRaises(TypeError, cipher.encrypt, pt, output=b'0'*16)
cipher = Salsa20.new(key=key, nonce=nonce)
self.assertRaises(TypeError, cipher.decrypt, ct, output=b'0'*16)
shorter_output = bytearray(7)
cipher = Salsa20.new(key=key, nonce=nonce)
self.assertRaises(ValueError, cipher.encrypt, pt, output=shorter_output)
cipher = Salsa20.new(key=key, nonce=nonce)
self.assertRaises(ValueError, cipher.decrypt, ct, output=shorter_output)
def get_tests(config={}):
tests = make_stream_tests(Salsa20, "Salsa20", test_data)
tests.append(KeyLength())
tests += list_test_cases(NonceTests)
tests.append(ByteArrayTest())
tests.append(MemoryviewTest())
tests.append(TestOutput())
return tests
if __name__ == '__main__':
import unittest
suite = lambda: unittest.TestSuite(get_tests())
unittest.main(defaultTest='suite')
# vim:set ts=4 sw=4 sts=4 expandtab:
| 45.152174 | 113 | 0.768897 | 1,028 | 16,616 | 12.358949 | 0.339494 | 0.015742 | 0.018418 | 0.01889 | 0.175049 | 0.160882 | 0.152853 | 0.147501 | 0.126013 | 0.094687 | 0 | 0.399575 | 0.150518 | 16,616 | 367 | 114 | 45.275204 | 0.500531 | 0.093885 | 0 | 0.243446 | 0 | 0 | 0.584955 | 0.565032 | 0 | 1 | 0 | 0.002725 | 0.078652 | 1 | 0.026217 | false | 0 | 0.022472 | 0 | 0.071161 | 0 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
48e039205b6042c1203a6f6039adda6bce80c257 | 278 | py | Python | milkviz/utils/__init__.py | Mr-Milk/milkviz | f2ebef805776301ddfe2ea1c778f9dbdd8edb420 | [
"MIT"
] | null | null | null | milkviz/utils/__init__.py | Mr-Milk/milkviz | f2ebef805776301ddfe2ea1c778f9dbdd8edb420 | [
"MIT"
] | 4 | 2021-09-17T10:56:25.000Z | 2022-03-19T09:17:02.000Z | milkviz/utils/__init__.py | Mr-Milk/milkviz | f2ebef805776301ddfe2ea1c778f9dbdd8edb420 | [
"MIT"
] | null | null | null | from .doc import doc
from .fig import adaptive_figsize, norm_arr, set_cbar, set_size_legend, set_category_legend, \
set_ticks, set_spines, color_mapper_cat, color_mapper_val, mask_triu, get_cmap_colors, create_cmap, get_render_size
from .geo import rotate_points, normalize
| 55.6 | 119 | 0.830935 | 45 | 278 | 4.688889 | 0.666667 | 0.085308 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.107914 | 278 | 4 | 120 | 69.5 | 0.850806 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.75 | 0 | 0.75 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
48e9d3da231af6fee11d152800a73020aaa605cb | 156 | py | Python | page278-c/question-1.py | CodyAaTherf/Grade9-ComputerSolutions-Python | 828648269a079e4b187ef9cdbd3c14262962d9d2 | [
"MIT"
] | null | null | null | page278-c/question-1.py | CodyAaTherf/Grade9-ComputerSolutions-Python | 828648269a079e4b187ef9cdbd3c14262962d9d2 | [
"MIT"
] | null | null | null | page278-c/question-1.py | CodyAaTherf/Grade9-ComputerSolutions-Python | 828648269a079e4b187ef9cdbd3c14262962d9d2 | [
"MIT"
] | null | null | null | x = float(input("Enter first number: "))
y = float(input("Enter second number: "))
q = x + y
r = x - y
print(f"{x} + {y} = {q}")
print(f"{x} - {y} = {r}") | 19.5 | 41 | 0.50641 | 28 | 156 | 2.821429 | 0.428571 | 0.101266 | 0.379747 | 0.202532 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.211538 | 156 | 8 | 42 | 19.5 | 0.642276 | 0 | 0 | 0 | 0 | 0 | 0.452229 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.333333 | 1 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
48f5360c26913d9d95e28ea8fefe16b18bea0fb0 | 27 | py | Python | muser/muser/__init__.py | briankim-pitt/muser | 55be568ff58c40517f53f555da59f1acdad57ae3 | [
"MIT"
] | 1 | 2021-10-01T02:35:22.000Z | 2021-10-01T02:35:22.000Z | muser/muser/__init__.py | briankim-pitt/muser | 55be568ff58c40517f53f555da59f1acdad57ae3 | [
"MIT"
] | null | null | null | muser/muser/__init__.py | briankim-pitt/muser | 55be568ff58c40517f53f555da59f1acdad57ae3 | [
"MIT"
] | null | null | null | """
Package for muser.
"""
| 6.75 | 18 | 0.555556 | 3 | 27 | 5 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.185185 | 27 | 3 | 19 | 9 | 0.681818 | 0.666667 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
48ff59ae8aaec2febd81a3a4cfa7a9cb57a188c0 | 327 | py | Python | src/utils/io.py | yasamangs/Anonymous-Telegram-bot | dfcc9115403ed85dab6c4b651fb12824a3e11376 | [
"MIT"
] | null | null | null | src/utils/io.py | yasamangs/Anonymous-Telegram-bot | dfcc9115403ed85dab6c4b651fb12824a3e11376 | [
"MIT"
] | null | null | null | src/utils/io.py | yasamangs/Anonymous-Telegram-bot | dfcc9115403ed85dab6c4b651fb12824a3e11376 | [
"MIT"
] | null | null | null | import json
def read_json_file(file_path):
with open(file_path, 'r') as f:
json.load(f)
def write_json_file(data, file_path, indent=4):
with open(file_path, 'a') as f:
json.dump(data, f, indent=indent)
def write_file(data, file_path):
with open(file_path, 'w') as f:
f.write(data)
| 19.235294 | 47 | 0.633028 | 56 | 327 | 3.5 | 0.339286 | 0.244898 | 0.183673 | 0.244898 | 0.244898 | 0.244898 | 0 | 0 | 0 | 0 | 0 | 0.004 | 0.235474 | 327 | 16 | 48 | 20.4375 | 0.78 | 0 | 0 | 0 | 0 | 0 | 0.009174 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.3 | false | 0 | 0.1 | 0 | 0.4 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
5b197ba86dff41ae0a9405f0648bcf80eebce69e | 320 | py | Python | qaseio/src/qaseio/client/models/__init__.py | aleksandr-kotlyar/qase-python | 3e6916eb4bf3518651e0a8e2e62281bfe0bfa464 | [
"Apache-2.0"
] | null | null | null | qaseio/src/qaseio/client/models/__init__.py | aleksandr-kotlyar/qase-python | 3e6916eb4bf3518651e0a8e2e62281bfe0bfa464 | [
"Apache-2.0"
] | null | null | null | qaseio/src/qaseio/client/models/__init__.py | aleksandr-kotlyar/qase-python | 3e6916eb4bf3518651e0a8e2e62281bfe0bfa464 | [
"Apache-2.0"
] | null | null | null | # flake8: noqa
from .attachments import *
from .base import *
from .cases import *
from .custom_fields import *
from .defects import *
from .milestones import *
from .plans import *
from .projects import *
from .results import *
from .runs import *
from .shared_steps import *
from .suites import *
from .users import *
| 21.333333 | 28 | 0.740625 | 43 | 320 | 5.465116 | 0.44186 | 0.510638 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.003774 | 0.171875 | 320 | 14 | 29 | 22.857143 | 0.883019 | 0.0375 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
5b1a14142cca0e0c2c2f0b27bf6b99e5490d946d | 5,197 | gyp | Python | third_party/css_parser/css_parser.gyp | PeterDaveHello/incubator-pagespeed-mod | 885f4653e204e1152cb3928f0755d93ec5fdceae | [
"Apache-2.0"
] | 2 | 2019-11-02T07:54:17.000Z | 2020-04-16T09:26:51.000Z | third_party/css_parser/css_parser.gyp | PeterDaveHello/incubator-pagespeed-mod | 885f4653e204e1152cb3928f0755d93ec5fdceae | [
"Apache-2.0"
] | 12 | 2017-03-14T18:26:11.000Z | 2021-10-01T15:33:50.000Z | third_party/css_parser/css_parser.gyp | PeterDaveHello/incubator-pagespeed-mod | 885f4653e204e1152cb3928f0755d93ec5fdceae | [
"Apache-2.0"
] | 1 | 2020-04-16T09:28:30.000Z | 2020-04-16T09:28:30.000Z | # Copyright 2009 Google Inc.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
{
'variables': {
# chromium_code indicates that the code is not
# third-party code and should be subjected to strict compiler
# warnings/errors in order to catch programming mistakes.
'chromium_code': 1,
'css_parser_root': 'src',
'instaweb_root': '../..',
},
'targets': [
{
'variables': {
'chromium_code': 0,
},
'target_name': 'utf',
'type': '<(library)',
'dependencies': [
'<(DEPTH)/base/base.gyp:base',
'<(DEPTH)/third_party/gflags/gflags.gyp:gflags',
],
'include_dirs': [
'<(css_parser_root)',
'<(DEPTH)',
],
'cflags': ['-funsigned-char', '-Wno-sign-compare', '-Wno-return-type'],
'sources': [
'<(css_parser_root)/third_party/utf/rune.c',
'<(css_parser_root)/third_party/utf/runestrcat.c',
'<(css_parser_root)/third_party/utf/runestrchr.c',
'<(css_parser_root)/third_party/utf/runestrcmp.c',
'<(css_parser_root)/third_party/utf/runestrcpy.c',
'<(css_parser_root)/third_party/utf/runestrecpy.c',
'<(css_parser_root)/third_party/utf/runestrlen.c',
'<(css_parser_root)/third_party/utf/runestrncat.c',
'<(css_parser_root)/third_party/utf/runestrncmp.c',
'<(css_parser_root)/third_party/utf/runestrncpy.c',
'<(css_parser_root)/third_party/utf/runestrrchr.c',
'<(css_parser_root)/third_party/utf/runestrstr.c',
'<(css_parser_root)/third_party/utf/runetype.c',
'<(css_parser_root)/third_party/utf/utf.h',
'<(css_parser_root)/third_party/utf/utfdef.h',
'<(css_parser_root)/third_party/utf/utfecpy.c',
'<(css_parser_root)/third_party/utf/utflen.c',
'<(css_parser_root)/third_party/utf/utfnlen.c',
'<(css_parser_root)/third_party/utf/utfrrune.c',
'<(css_parser_root)/third_party/utf/utfrune.c',
'<(css_parser_root)/third_party/utf/utfutf.c',
],
},
{
'target_name': 'css_parser_gperf',
'variables': {
'instaweb_gperf_subdir': 'third_party/css_parser/src/webutil/css',
},
'dependencies': [
'<(DEPTH)/base/base.gyp:base',
'<(DEPTH)/pagespeed/kernel.gyp:proto_util',
'<(DEPTH)/pagespeed/kernel.gyp:util',
'<(DEPTH)/third_party/google-sparsehash/google-sparsehash.gyp:include',
],
'sources': [
'<(css_parser_root)/webutil/css/identifier.gperf',
'<(css_parser_root)/webutil/css/property.gperf',
],
'include_dirs': [
'<(css_parser_root)',
'<(DEPTH)',
],
'includes': [
'../../net/instaweb/gperf.gypi',
],
},
{
'target_name': 'css_parser',
'type': '<(library)',
'dependencies': [
'<(DEPTH)/base/base.gyp:base',
'<(DEPTH)/third_party/gflags/gflags.gyp:gflags',
'<(DEPTH)/third_party/google-sparsehash/google-sparsehash.gyp:include',
'css_parser_gperf',
'utf',
],
'export_dependent_settings': [
'<(DEPTH)/third_party/google-sparsehash/google-sparsehash.gyp:include',
],
'include_dirs': [
'<(css_parser_root)',
'<(DEPTH)',
],
'cflags': ['-funsigned-char', '-Wno-sign-compare', '-Wno-return-type'],
'sources': [
'<(css_parser_root)/string_using.h',
'<(css_parser_root)/webutil/css/media.cc',
'<(css_parser_root)/webutil/css/parser.cc',
'<(css_parser_root)/webutil/css/selector.cc',
'<(css_parser_root)/webutil/css/string_util.cc',
'<(css_parser_root)/webutil/css/tostring.cc',
'<(css_parser_root)/webutil/css/util.cc',
'<(css_parser_root)/webutil/css/value.cc',
#'<(css_parser_root)/webutil/css/parse_arg.cc',
# Tests
#'<(css_parser_root)/webutil/css/gtest_main.cc',
#'<(css_parser_root)/webutil/css/identifier_test.cc',
#'<(css_parser_root)/webutil/css/parser_unittest.cc',
#'<(css_parser_root)/webutil/css/property_test.cc',
#'<(css_parser_root)/webutil/css/tostring_test.cc',
#'<(css_parser_root)/webutil/css/util_test.cc',
'<(css_parser_root)/webutil/html/htmlcolor.cc',
'<(css_parser_root)/webutil/html/htmltagenum.cc',
'<(css_parser_root)/webutil/html/htmltagindex.cc',
# UnicodeText
'<(css_parser_root)/util/utf8/internal/unicodetext.cc',
'<(css_parser_root)/util/utf8/internal/unilib.cc',
# Supporting interfaces.
'<(css_parser_root)/strings/ascii_ctype.cc',
'<(css_parser_root)/strings/stringpiece_utils.cc',
],
},
],
}
| 37.121429 | 79 | 0.620165 | 628 | 5,197 | 4.882166 | 0.278662 | 0.161448 | 0.207763 | 0.123288 | 0.573386 | 0.558382 | 0.431507 | 0.169276 | 0.169276 | 0.113503 | 0 | 0.002922 | 0.209736 | 5,197 | 139 | 80 | 37.388489 | 0.743608 | 0.210506 | 0 | 0.392523 | 0 | 0 | 0.672718 | 0.552012 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
5b1d1d0d618a7cef45f8eb019e394a33d379e8c4 | 687 | py | Python | neurokit2/ecg/__init__.py | TiagoTostas/NeuroKit | 664350463fc1c03eb81f0bba37296762be7c81ae | [
"MIT"
] | 1 | 2020-05-26T09:46:57.000Z | 2020-05-26T09:46:57.000Z | neurokit2/ecg/__init__.py | TiagoTostas/NeuroKit | 664350463fc1c03eb81f0bba37296762be7c81ae | [
"MIT"
] | null | null | null | neurokit2/ecg/__init__.py | TiagoTostas/NeuroKit | 664350463fc1c03eb81f0bba37296762be7c81ae | [
"MIT"
] | 1 | 2020-10-27T06:47:51.000Z | 2020-10-27T06:47:51.000Z | """Submodule for NeuroKit."""
from .ecg_simulate import ecg_simulate
from .ecg_clean import ecg_clean
from .ecg_findpeaks import ecg_findpeaks
from .ecg_fixpeaks import ecg_fixpeaks
from .ecg_peaks import ecg_peaks
from .ecg_rate import ecg_rate
from .ecg_segment import ecg_segment
from .ecg_process import ecg_process
from .ecg_plot import ecg_plot
from .ecg_delineate import ecg_delineate
from .ecg_rsp import ecg_rsp
from .ecg_hrv import ecg_hrv
from .ecg_phase import ecg_phase
from .ecg_rsa import ecg_rsa
from .ecg_quality import ecg_quality
from .ecg_eventrelated import ecg_eventrelated
from .ecg_intervalrelated import ecg_intervalrelated
from .ecg_analyze import ecg_analyze
| 32.714286 | 52 | 0.852984 | 111 | 687 | 4.954955 | 0.216216 | 0.229091 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.110626 | 687 | 20 | 53 | 34.35 | 0.900164 | 0.033479 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
d29ec8bb169267d50e52ac323768bca2dbf55690 | 3,658 | py | Python | dev_nb/nb_002b.py | lesscomfortable/fastai_v1 | bbc5c37329cf45f59bd2daaa2f56723cb7565643 | [
"Apache-2.0"
] | 1 | 2018-10-23T20:45:41.000Z | 2018-10-23T20:45:41.000Z | dev_nb/nb_002b.py | lesscomfortable/fastai_v1 | bbc5c37329cf45f59bd2daaa2f56723cb7565643 | [
"Apache-2.0"
] | null | null | null | dev_nb/nb_002b.py | lesscomfortable/fastai_v1 | bbc5c37329cf45f59bd2daaa2f56723cb7565643 | [
"Apache-2.0"
] | null | null | null |
#################################################
### THIS FILE WAS AUTOGENERATED! DO NOT EDIT! ###
#################################################
from nb_002 import *
import typing
from typing import Dict, Any, AnyStr, List, Sequence, TypeVar, Tuple, Optional, Union
def normalize(x, mean,std): return (x-mean[...,None,None]) / std[...,None,None]
def denormalize(x, mean,std): return x*std[...,None,None] + mean[...,None,None]
def normalize_batch(b, mean, std, do_y=False):
x,y = b
x = normalize(x,mean,std)
if do_y: y = normalize(y,mean,std)
return x,y
def normalize_funcs(mean, std, do_y=False, device=None):
if device is None: device=default_device
return (partial(normalize_batch, mean=mean.to(device),std=std.to(device)),
partial(denormalize, mean=mean, std=std))
@dataclass
class DeviceDataLoader():
dl: DataLoader
device: torch.device
tfms: List[Callable]=None
def __len__(self): return len(self.dl)
def proc_batch(self,b):
b = to_device(self.device,b)
return b if self.tfms is None else self.tfms(b)
def __iter__(self):
self.gen = map(self.proc_batch, self.dl)
return iter(self.gen)
@classmethod
def create(cls, *args, device=default_device, tfms=tfms, **kwargs):
return cls(DataLoader(*args, **kwargs), device=device, tfms=tfms)
class DataBunch():
def __init__(self, train_dl:DataLoader, valid_dl:DataLoader, device:torch.device=None, tfms=None):
self.device = default_device if device is None else device
self.train_dl = DeviceDataLoader(train_dl, self.device, tfms=tfms)
self.valid_dl = DeviceDataLoader(valid_dl, self.device, tfms=tfms)
@classmethod
def create(cls, train_ds, valid_ds, bs=64, train_tfm=None, valid_tfm=None, num_workers=4,
tfms=None, device=None, **kwargs):
if train_tfm or not isinstance(train_ds, DatasetTfm): train_ds = DatasetTfm(train_ds,train_tfm, **kwargs)
if valid_tfm or not isinstance(valid_ds, DatasetTfm): valid_ds = DatasetTfm(valid_ds,valid_tfm, **kwargs)
return cls(DataLoader(train_ds, bs, shuffle=True, num_workers=num_workers),
DataLoader(valid_ds, bs*2, shuffle=False, num_workers=num_workers), device=device, tfms=tfms)
@property
def train_ds(self): return self.train_dl.dl.dataset
@property
def valid_ds(self): return self.valid_dl.dl.dataset
@property
def c(self): return self.train_ds.c
def conv_layer(ni, nf, ks=3, stride=1):
return nn.Sequential(
nn.Conv2d(ni, nf, kernel_size=ks, bias=False, stride=stride, padding=ks//2),
nn.BatchNorm2d(nf),
nn.LeakyReLU(negative_slope=0.1, inplace=True))
class ResLayer(nn.Module):
def __init__(self, ni):
super().__init__()
self.conv1=conv_layer(ni, ni//2, ks=1)
self.conv2=conv_layer(ni//2, ni, ks=3)
def forward(self, x): return x + self.conv2(self.conv1(x))
class Darknet(nn.Module):
def make_group_layer(self, ch_in, num_blocks, stride=1):
return [conv_layer(ch_in, ch_in*2,stride=stride)
] + [(ResLayer(ch_in*2)) for i in range(num_blocks)]
def __init__(self, num_blocks, num_classes, nf=32):
super().__init__()
layers = [conv_layer(3, nf, ks=3, stride=1)]
for i,nb in enumerate(num_blocks):
layers += self.make_group_layer(nf, nb, stride=2-(i==1))
nf *= 2
layers += [nn.AdaptiveAvgPool2d(1), Flatten(), nn.Linear(nf, num_classes)]
self.layers = nn.Sequential(*layers)
def forward(self, x): return self.layers(x) | 38.914894 | 113 | 0.639967 | 527 | 3,658 | 4.263757 | 0.233397 | 0.021807 | 0.031153 | 0.018692 | 0.155763 | 0 | 0 | 0 | 0 | 0 | 0 | 0.012003 | 0.202843 | 3,658 | 94 | 114 | 38.914894 | 0.758573 | 0.011208 | 0 | 0.098592 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.267606 | false | 0 | 0.042254 | 0.15493 | 0.521127 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 4 |
d2ff39f2333f671356abe0fb9bfa6f02265efda9 | 18,507 | py | Python | vseq/modules/hmlstm.py | JakobHavtorn/vseq | bdd0258738b5f43d6f0f6c3df4b8b270f06d0aea | [
"MIT"
] | 7 | 2021-03-25T12:33:53.000Z | 2022-03-23T13:10:31.000Z | vseq/modules/hmlstm.py | JakobHavtorn/vseq | bdd0258738b5f43d6f0f6c3df4b8b270f06d0aea | [
"MIT"
] | null | null | null | vseq/modules/hmlstm.py | JakobHavtorn/vseq | bdd0258738b5f43d6f0f6c3df4b8b270f06d0aea | [
"MIT"
] | null | null | null | from typing import List, Optional, Union, Tuple
import math
import torch
import torch.nn as nn
from torch import sigmoid, tanh
from torch.nn import Parameter
from torchtyping import TensorType
from vseq.modules.straight_through import BernoulliSTE, BinaryThresholdSTE
def hard_sigmoid(x, slope: float = 1):
temp = torch.div(torch.add(torch.mul(x, slope), 1), 2.0)
output = torch.clamp(temp, min=0, max=1)
return output
class HMLSTMCell(nn.Module):
def __init__(
self,
hidden_size: int,
below_size: int,
above_size: Optional[int] = None,
threshold_fn: str = "threshold",
):
"""Hierarchical Multilevel LSTM cell (HM-LSTM) as described in [1].
Parameters:
W_10 is the state transition parameters from layer l-1 (bottom layer) to layer l
U_11 is the state transition parameters from layer l (current layer) to layer l
U_21 is the state transition parameters from layer l+1 (top layer) to layer l
Internal representations are (D, B), i.e. batch last and dimension first. This saves a transpose.
Args:
hidden_size (int): Dimensionality of hidden layer (transition from `l` to `l`).
above_size (int): Dimensionality of above layer (transition from `l+1` to `l`). Defaults to None.
below_size (int): Dimensionality of below layer (transition frmo `l-1` to `l`).
[1] Hierarchical Multiscale Recurrent Neural Networks. http://arxiv.org/abs/1609.01704
"""
super().__init__()
self.below_size = below_size
self.hidden_size = hidden_size
self.above_size = above_size
self.threshold_fn = threshold_fn
self.is_top_layer = above_size is None
self.gates_size = 4 * self.hidden_size + 1
self.W_10 = Parameter(torch.FloatTensor(self.gates_size, self.below_size))
self.U_11 = Parameter(torch.FloatTensor(self.gates_size, self.hidden_size))
if not self.is_top_layer:
self.U_21 = Parameter(torch.FloatTensor(self.gates_size, self.above_size))
self.bias = Parameter(torch.FloatTensor(self.gates_size))
if threshold_fn == "threshold":
self.threshold_ste = BinaryThresholdSTE(threshold=0.5)
elif threshold_fn == "bernoulli":
self.threshold_ste = BernoulliSTE()
elif threshold_fn == "soft":
self.threshold_ste = None
else:
raise ValueError(f"Unknown threshold function `{threshold_fn}`")
self.reset_parameters()
def reset_parameters(self):
stdv = 1.0 / math.sqrt(self.hidden_size)
for par in self.parameters():
par.data.uniform_(-stdv, stdv)
def forward(
self,
c: TensorType["D", "B"],
h_below: TensorType["D", "B"],
h: TensorType["D", "B"],
h_above: TensorType["D", "B"],
z: TensorType[1, "B"],
z_below: TensorType[1, "B"],
a: float = 1,
) -> Tuple[TensorType["D", "B"], TensorType["D", "B"], TensorType["D", 1]]:
"""Perform HM-LSTM forward pass.
Update logic:
if z == 1: (FLUSH)
c_new = i * g
h_new = o * F.tanh(c_new)
elif z_below == 0: (COPY)
c_new = c
h_new = h
else: (UPDATE)
c_new = f * c + i * g
h_new = o * F.tanh(c_new)
Update logic alternative (but seemingly slower) implementation:
c_new = torch.zeros_like(f)
z = z.expand_as(f)
flush = z == 1
update = torch.logical_and(z == 0, z_below == 1)
copy = torch.logical_and(z == 0, z_below == 0)
c_new[:, flush] = (i[:, flush] * g[:, flush])
c_new[:, update] = (f[:, update] * c[:, update] + i[:, update] * g[:, update])
c_new[:, copy] = c[:, copy]
Args:
c (torch.Tensor): Previous time step cell state for this layer
h_below (torch.Tensor): Current time step hidden state from layer below
h (torch.Tensor): Previous time step hidden state for this layer
h_above (torch.Tensor): Previous time step hidden state for layer above (if any, otherwise ignored)
z (torch.Tensor): Previous time step boundary detector from this layer
z_below (torch.Tensor): Current time step boundary detector from layer below
a (float, optional): Slope of hard sigmoid activation for boundary detector. Defaults to 1.
Returns:
tuple: (h, c, z) for this time step
"""
s_recurrent = torch.mm(self.U_11, h)
if self.is_top_layer:
s_topdown = torch.zeros_like(s_recurrent)
else:
s_topdown = z * torch.mm(self.U_21, h_above)
s_bottomup = z_below * torch.mm(self.W_10, h_below)
f_slice = s_recurrent + s_topdown + s_bottomup + self.bias.unsqueeze(1)
forgetgate, ingate, outgate, cellgate = f_slice[:-1, :].chunk(chunks=4, dim=0)
z_gate = f_slice[self.hidden_size * 4 : self.hidden_size * 4 + 1]
f = sigmoid(forgetgate)
i = sigmoid(ingate)
o = sigmoid(outgate)
g = tanh(cellgate)
z_hat = hard_sigmoid(z_gate, slope=a)
one = torch.ones_like(f)
c_new = z * (i * g) + (one - z) * (one - z_below) * c + (one - z) * z_below * (f * c + i * g)
h_new = (
z * o * tanh(c_new) + (one - z) * (one - z_below) * h + (one - z) * z_below * o * tanh(c_new)
)
z_new = self.threshold_ste(z_hat)
return h_new, c_new, z_new
def extra_repr(self) -> str:
return f"below_size={self.below_size}, hidden_size={self.hidden_size}, above_size={self.above_size}"
class LayerNormHMLSTMCell(nn.Module):
def __init__(
self,
hidden_size: int,
below_size: int,
above_size: Optional[int] = None,
threshold_fn: str = "threshold",
elementwise_affine: bool = True,
):
"""Hierarchical Multilevel LSTM cell (HM-LSTM) as described in [1].
Parameters:
W_10 is the state transition parameters from layer l-1 (bottom layer) to layer l
U_11 is the state transition parameters from layer l (current layer) to layer l
U_21 is the state transition parameters from layer l+1 (top layer) to layer l
Internal representations are (D, B), i.e. batch last and dimension first. This saves a transpose.
Args:
hidden_size (int): Dimensionality of hidden layer (transition from `l` to `l`).
above_size (int): Dimensionality of above layer (transition from `l+1` to `l`). Defaults to None.
below_size (int): Dimensionality of below layer (transition frmo `l-1` to `l`).
[1] Hierarchical Multiscale Recurrent Neural Networks. http://arxiv.org/abs/1609.01704
"""
super().__init__()
self.below_size = below_size
self.hidden_size = hidden_size
self.above_size = above_size
self.threshold_fn = threshold_fn
self.is_top_layer = above_size is None
self.gates_size = 4 * self.hidden_size + 1
self.W_10 = Parameter(torch.FloatTensor(self.gates_size, self.below_size))
self.U_11 = Parameter(torch.FloatTensor(self.gates_size, self.hidden_size))
if not self.is_top_layer:
self.U_21 = Parameter(torch.FloatTensor(self.gates_size, self.above_size))
self.ln_10 = nn.LayerNorm(self.gates_size, elementwise_affine=elementwise_affine)
self.ln_11 = nn.LayerNorm(self.gates_size, elementwise_affine=elementwise_affine)
self.ln_21 = nn.LayerNorm(self.gates_size, elementwise_affine=elementwise_affine)
if threshold_fn == "threshold":
self.threshold_ste = BinaryThresholdSTE()
elif threshold_fn == "bernoulli":
self.threshold_ste = BernoulliSTE()
elif threshold_fn == "soft":
self.threshold_ste = None
else:
raise ValueError(f"Unknown threshold function `{threshold_fn}`")
self.reset_parameters()
def reset_parameters(self):
stdv = 1.0 / math.sqrt(self.hidden_size)
for par in self.parameters():
par.data.uniform_(-stdv, stdv)
def forward(
self,
c: TensorType["D", "B"],
h_below: TensorType["D", "B"],
h: TensorType["D", "B"],
h_above: TensorType["D", "B"],
z: TensorType[1, "B"],
z_below: TensorType[1, "B"],
a: float = 1,
) -> Tuple[TensorType["D", "B"], TensorType["D", "B"], TensorType["D", 1]]:
"""Perform HM-LSTM forward pass.
Update logic:
if z == 1: (FLUSH)
c_new = i * g
h_new = o * F.tanh(c_new)
elif z_below == 0: (COPY)
c_new = c
h_new = h
else: (UPDATE)
c_new = f * c + i * g
h_new = o * F.tanh(c_new)
Update logic alternative (but seemingly slower) implementation:
c_new = torch.zeros_like(f)
z = z.expand_as(f)
flush = z == 1
update = torch.logical_and(z == 0, z_below == 1)
copy = torch.logical_and(z == 0, z_below == 0)
c_new[:, flush] = (i[:, flush] * g[:, flush])
c_new[:, update] = (f[:, update] * c[:, update] + i[:, update] * g[:, update])
c_new[:, copy] = c[:, copy]
Args:
c (torch.Tensor): Previous time step cell state for this layer
h_below (torch.Tensor): Current time step hidden state from layer below
h (torch.Tensor): Previous time step hidden state for this layer
h_above (torch.Tensor): Previous time step hidden state for layer above (if any, otherwise ignored)
z (torch.Tensor): Previous time step boundary detector from this layer
z_below (torch.Tensor): Current time step boundary detector from layer below
a (float, optional): Slope of hard sigmoid activation for boundary detector. Defaults to 1.
Returns:
tuple: (h, c, z) for this time step
"""
s_recurrent = self.ln_11(torch.mm(self.U_11, h).T).T
if self.is_top_layer:
s_topdown = torch.zeros_like(s_recurrent)
else:
s_topdown = z * self.ln_21(torch.mm(self.U_21, h_above).T).T
s_bottomup = z_below * self.ln_10(torch.mm(self.W_10, h_below).T).T
f_slice = s_recurrent + s_topdown + s_bottomup
forgetgate, ingate, outgate, cellgate = f_slice[:-1, :].chunk(chunks=4, dim=0)
z_gate = f_slice[self.hidden_size * 4 : self.hidden_size * 4 + 1]
f = sigmoid(forgetgate)
i = sigmoid(ingate)
o = sigmoid(outgate)
g = tanh(cellgate)
z_hat = hard_sigmoid(z_gate, slope=a)
one = torch.ones_like(f)
c_new = z * (i * g) + (one - z) * (one - z_below) * c + (one - z) * z_below * (f * c + i * g)
h_new = (z * o * tanh(c_new) + (one - z) * (one - z_below) * h + (one - z) * z_below * o * tanh(c_new))
z_new = self.threshold_ste(z_hat)
return h_new, c_new, z_new
def extra_repr(self) -> str:
return f"below_size={self.below_size}, hidden_size={self.hidden_size}, above_size={self.above_size}"
class HMLSTM(nn.Module):
def __init__(
self, input_size: int, sizes: Union[int, List[int]], num_layers: Optional[int] = None, layer_norm: bool = False
):
super().__init__()
assert (
(isinstance(sizes, list) and num_layers is None) or (isinstance(sizes, int) and num_layers is not None),
"Must give `sizes` as list and not `num_layers` OR `sizes` as int along with a number of layers",
)
self.input_size = input_size
self.sizes = sizes
self.num_layers = len(sizes) if num_layers is None else num_layers
self.layer_norm = layer_norm
cell = LayerNormHMLSTMCell if layer_norm else HMLSTMCell
sizes = [input_size, *sizes, None]
cells = torch.nn.ModuleList()
for l in range(self.num_layers):
cells.append(cell(below_size=sizes[l], hidden_size=sizes[l + 1], above_size=sizes[l + 2]))
self.cells = cells
def forward(
self,
x: TensorType["B", "T", "D"],
h_init: Optional[List[TensorType["B", "T", "D"]]] = None,
c_init: Optional[List[TensorType["B", "T", "D"]]] = None,
z_init: Optional[List[TensorType["B", "T", 1]]] = None,
a: float = 1,
):
# x.size = (B, T, D)
time_steps = x.size(1)
batch_size = x.size(0)
device = x.device
if h_init is None:
h = [[torch.zeros(self.sizes[l], batch_size, device=device)] for l in range(self.num_layers)]
else:
h = [[h.permute(2, 1, 0)] for h in h_init] # (B, T, D) to (D, T, B)
if c_init is None:
c = [[torch.zeros(self.sizes[l], batch_size, device=device)] for l in range(self.num_layers)]
else:
c = [[c.permute(2, 1, 0)] for c in c_init] # (B, T, D) to (D, T, B)
if z_init is None:
z = [[torch.zeros(1, batch_size, device=device)] for l in range(self.num_layers)]
else:
z = [[z.permute(2, 1, 0)] for z in z_init] # (B, T, D) to (D, T, B)
# create a fictive top layer that gives `h=None` for all time steps.
# used as `h_above` input for the actual top layer.
# h.append([torch.zeros(1, batch_size, device=device)] * time_steps)
h.append([None] * time_steps)
# z_below for layer 0
z_one = torch.ones(1, batch_size, device=device)
x = x.permute(2, 1, 0) # (B, T, D) to (D, T, B)
for t in range(time_steps):
# input layer
l = 0
h_tl, c_tl, z_tl = self.cells[l](
c=c[l][t],
h=h[l][t],
h_below=x[:, t, :],
h_above=h[l + 1][t],
z=z[l][t],
z_below=z_one, # Never skip input by copying (forces UPDATE or FLUSH)
a=a,
)
h[l].append(h_tl)
c[l].append(c_tl)
z[l].append(z_tl)
# additional layers
for l in range(1, self.num_layers):
h_tl, c_tl, z_tl = self.cells[l](
c=c[l][t],
h=h[l][t],
h_below=h[l - 1][t + 1],
h_above=h[l + 1][t],
z=z[l][t],
z_below=z[l - 1][t + 1],
a=a,
)
h[l].append(h_tl)
c[l].append(c_tl)
z[l].append(z_tl)
h = [hl[1:] for hl in h[:-1]] # Remove initial value and fictive layer
c = [cl[1:] for cl in c] # Remove initial value
z = [zl[1:] for zl in z] # Remove initial value
# collect final timestep per layer
h_out = [h[l][-1] for l in range(self.num_layers)]
c_out = [c[l][-1] for l in range(self.num_layers)]
z_out = [z[l][-1] for l in range(self.num_layers)]
return (
[torch.stack(hl, dim=1).permute(2, 1, 0) for hl in h], # (B, T, D)
[torch.stack(cl, dim=1).permute(2, 1, 0) for cl in c], # (B, T, D)
[torch.stack(zl, dim=1).permute(2, 1, 0) for zl in z], # (B, T, 1)
(h_out, c_out, z_out), # (B, D), (B, D), (B, 1)
)
def realized_operations(
self, z: List[TensorType["B", "T", 1]], x_sl: TensorType["B", int], seq_mask: TensorType["B", "T", bool]
):
"""Return the boolean masks incidating where the different operations took place and compute the clockrates"""
update_ops, copy_ops, flush_ops = [], [], []
update_rates, copy_rates, flush_rates = [], [], []
x_sl = x_sl.to(z[0].device)
for l, z_l in enumerate(z):
z_below = torch.ones_like(z[0]) if l == 0 else z[l - 1]
update_ops.append(((z_l[:, :-1, :] == 0) * (z_below[:, 1:, :] == 1)).squeeze())
copy_ops.append(((z_l[:, :-1, :] == 0) * (z_below[:, 1:, :] == 0)).squeeze())
flush_ops.append((z_l[:, :-1, :] == 1).squeeze())
update_rates.append((update_ops[l] * seq_mask[:, 1:]).sum(1) / x_sl)
copy_rates.append((copy_ops[l] * seq_mask[:, 1:]).sum(1) / x_sl)
flush_rates.append((flush_ops[l] * seq_mask[:, 1:]).sum(1) / x_sl)
return update_ops, copy_ops, flush_ops, update_rates, copy_rates, flush_rates
if __name__ == "__main__":
import timeit
import numpy as np
device = "cuda" if torch.cuda.is_available() else "cpu"
batch = 32
hidden_size = 256
below_size = 128
above_size = 512
cell = HMLSTMCell(
hidden_size=hidden_size,
below_size=below_size,
above_size=above_size,
threshold_fn="threshold",
).to(device)
lncell = HMLSTMCell(
hidden_size=hidden_size,
below_size=below_size,
above_size=above_size,
threshold_fn="threshold",
).to(device)
lstm = nn.LSTMCell(
input_size=hidden_size,
hidden_size=hidden_size,
).to(device)
c = torch.randn(hidden_size, batch).to(device)
h = torch.randn(hidden_size, batch).to(device)
z = torch.randint(low=0, high=2, size=(1, batch)).to(device)
h_above = torch.randn(above_size, batch).to(device)
h_below = torch.randn(below_size, batch).to(device)
z_below = torch.randint(low=0, high=2, size=(1, batch)).to(device)
cell(c, h_below, h, h_above, z, z_below)
timer = timeit.Timer("lstm(h, (h, c))", globals=dict(lstm=lstm, h=h.T, c=c.T))
number, time_taken = timer.autorange()
timings = timer.repeat(repeat=10, number=number)
print(f"LSTM: {number=:d}, {min(timings):.3e} +- {np.std(timings):.3e} s")
timer = timeit.Timer("cell(c, h_below, h, h_above, z, z_below)", globals=globals())
number, time_taken = timer.autorange()
timings = timer.repeat(repeat=10, number=number)
print(f"HM-LSTM: {number=:d}, {min(timings):.3e} +- {np.std(timings):.3e} s")
timer = timeit.Timer("lncell(c, h_below, h, h_above, z, z_below)", globals=globals())
number, time_taken = timer.autorange()
timings = timer.repeat(repeat=10, number=number)
print(f"HM-LSTM LayerNorm: {number=:d}, {min(timings):.3e} +- {np.std(timings):.3e} s")
| 39.044304 | 119 | 0.573026 | 2,651 | 18,507 | 3.834025 | 0.108638 | 0.032468 | 0.022039 | 0.018103 | 0.77804 | 0.757576 | 0.748131 | 0.72137 | 0.696183 | 0.670504 | 0 | 0.017793 | 0.295456 | 18,507 | 473 | 120 | 39.12685 | 0.761715 | 0.261739 | 0 | 0.554007 | 0 | 0.013937 | 0.062201 | 0.018444 | 0 | 0 | 0 | 0 | 0.003484 | 1 | 0.041812 | false | 0 | 0.034843 | 0.006969 | 0.111498 | 0.010453 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
826aafa7cf07e63c0a0fd1c82f2280ac3515e8bc | 100 | py | Python | flask_app/common/__init__.py | Jarrettluo/flask-restful-quick-start | 50b923baa80e769f07a89fba71745d9333cf9e88 | [
"MIT"
] | 6 | 2021-11-15T04:39:41.000Z | 2022-03-03T09:59:24.000Z | flask_app/common/__init__.py | Jarrettluo/flask-restful-quick-start | 50b923baa80e769f07a89fba71745d9333cf9e88 | [
"MIT"
] | null | null | null | flask_app/common/__init__.py | Jarrettluo/flask-restful-quick-start | 50b923baa80e769f07a89fba71745d9333cf9e88 | [
"MIT"
] | null | null | null | # encoding: utf-8
"""
@version: 1.0
@author: Jarrett
@file: __init__.py
@time: 2021/11/10 15:50
"""
| 12.5 | 23 | 0.64 | 17 | 100 | 3.529412 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.174419 | 0.14 | 100 | 7 | 24 | 14.285714 | 0.523256 | 0.9 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
8273790a5ce59a9fcfc206bec5e557c7014c8ce0 | 3,940 | py | Python | tests/charts-out/test_graphics_charts_piecharts_sample2.py | debragail/reportlab-mirror | 1e5814e1313ed50d5abb65487b207711cb4f7595 | [
"BSD-3-Clause"
] | 1 | 2020-05-21T23:34:55.000Z | 2020-05-21T23:34:55.000Z | tests/charts-out/test_graphics_charts_piecharts_sample2.py | debragail/reportlab-mirror | 1e5814e1313ed50d5abb65487b207711cb4f7595 | [
"BSD-3-Clause"
] | null | null | null | tests/charts-out/test_graphics_charts_piecharts_sample2.py | debragail/reportlab-mirror | 1e5814e1313ed50d5abb65487b207711cb4f7595 | [
"BSD-3-Clause"
] | null | null | null | #Autogenerated by ReportLab guiedit do not edit
from reportlab.graphics.shapes import _DrawingEditorMixin, Drawing, Group, Wedge, String
from reportlab.lib.colors import Color, CMYKColor, PCMYKColor
class ExplodedDrawing_Drawing(_DrawingEditorMixin,Drawing):
def __init__(self,width=400,height=200,*args,**kw):
Drawing.__init__(self,width,height,*args,**kw)
self.transform = (1,0,0,1,0,0)
self.add(Wedge(200,100,75,-21.6,90,yradius=75,annular=False,fillColor=Color(.27451,.509804,.705882,1),fillOpacity=None,strokeColor=Color(0,0,0,1),strokeWidth=1,strokeLineCap=0,strokeLineJoin=1,strokeMiterLimit=0,strokeDashArray=None,strokeOpacity=None))
self.add(Wedge(200,100,75,-74.88,-21.6,yradius=75,annular=False,fillColor=Color(.847059,.74902,.847059,1),fillOpacity=None,strokeColor=Color(0,0,0,1),strokeWidth=1,strokeLineCap=0,strokeLineJoin=1,strokeMiterLimit=0,strokeDashArray=None,strokeOpacity=None))
self.add(Wedge(200,100,75,-113.76,-74.88,yradius=75,annular=False,fillColor=Color(.392157,.584314,.929412,1),fillOpacity=None,strokeColor=Color(0,0,0,1),strokeWidth=1,strokeLineCap=0,strokeLineJoin=1,strokeMiterLimit=0,strokeDashArray=None,strokeOpacity=None))
self.add(Wedge(200,100,75,-141.12,-113.76,yradius=75,annular=False,fillColor=Color(.690196,.768627,.870588,1),fillOpacity=None,strokeColor=Color(0,0,0,1),strokeWidth=1,strokeLineCap=0,strokeLineJoin=1,strokeMiterLimit=0,strokeDashArray=None,strokeOpacity=None))
self.add(Wedge(200,100,75,-153,-141.12,yradius=75,annular=False,fillColor=Color(.498039,1,.831373,1),fillOpacity=None,strokeColor=Color(0,0,0,1),strokeWidth=1,strokeLineCap=0,strokeLineJoin=1,strokeMiterLimit=0,strokeDashArray=None,strokeOpacity=None))
self.add(Wedge(200,100,75,-163.8,-153,yradius=75,annular=False,fillColor=Color(.372549,.619608,.627451,1),fillOpacity=None,strokeColor=Color(0,0,0,1),strokeWidth=1,strokeLineCap=0,strokeLineJoin=1,strokeMiterLimit=0,strokeDashArray=None,strokeOpacity=None))
self.add(Wedge(200,100,75,-170.64,-163.8,yradius=75,annular=False,fillColor=Color(.941176,.501961,.501961,1),fillOpacity=None,strokeColor=Color(0,0,0,1),strokeWidth=1,strokeLineCap=0,strokeLineJoin=1,strokeMiterLimit=0,strokeDashArray=None,strokeOpacity=None))
self.add(Wedge(200,100,75,-216,-170.64,yradius=75,annular=False,fillColor=Color(.823529,.705882,.54902,1),fillOpacity=None,strokeColor=Color(0,0,0,1),strokeWidth=1,strokeLineCap=0,strokeLineJoin=1,strokeMiterLimit=0,strokeDashArray=None,strokeOpacity=None))
self.add(Wedge(200,100,75,-270,-216,yradius=75,annular=False,fillColor=Color(.560784,.737255,.545098,1),fillOpacity=None,strokeColor=Color(0,0,0,1),strokeWidth=1,strokeLineCap=0,strokeLineJoin=1,strokeMiterLimit=0,strokeDashArray=None,strokeOpacity=None))
self.add(String(274.4373,150.5875,'1',textAnchor='middle',fontName='Times-Roman',fontSize=10,fillColor=Color(0,0,0,1)))
self.add(String(259.9411,32.8653,'2',textAnchor='middle',fontName='Times-Roman',fontSize=10,fillColor=Color(0,0,0,1)))
self.add(String(193.2206,10.2557,'3',textAnchor='middle',fontName='Times-Roman',fontSize=10,fillColor=Color(0,0,0,1)))
self.add(String(145.2863,28.54086,'4',textAnchor='middle',fontName='Times-Roman',fontSize=10,fillColor=Color(0,0,0,1)))
self.add(String(124.4684,51.06156,'5',textAnchor='middle',fontName='Times-Roman',fontSize=10,fillColor=Color(0,0,0,1)))
self.add(String(116.3201,66.86879,'6',textAnchor='middle',fontName='Times-Roman',fontSize=10,fillColor=Color(0,0,0,1)))
self.add(String(112.2296,80.09127,'7',textAnchor='middle',fontName='Times-Roman',fontSize=10,fillColor=Color(0,0,0,1)))
self.add(String(112.4211,120.735,'8',textAnchor='middle',fontName='Times-Roman',fontSize=10,fillColor=Color(0,0,0,1)))
self.add(String(159.1409,180.1906,'X',textAnchor='middle',fontName='Times-Roman',fontSize=10,fillColor=Color(0,0,0,1)))
if __name__=="__main__": #NORUNTESTS
ExplodedDrawing_Drawing().save(formats=['pdf'],outDir='.',fnRoot=None)
| 127.096774 | 263 | 0.784264 | 609 | 3,940 | 5.041051 | 0.239737 | 0.024756 | 0.018567 | 0.046906 | 0.762215 | 0.762215 | 0.653094 | 0.653094 | 0.653094 | 0.653094 | 0 | 0.153746 | 0.024365 | 3,940 | 30 | 264 | 131.333333 | 0.644901 | 0.014213 | 0 | 0 | 1 | 0 | 0.044822 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.038462 | false | 0 | 0.076923 | 0 | 0.153846 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
8277c5f90252eb63190632587c07ff681043bb78 | 4,151 | py | Python | python/src/drop_one_align_feature.py | antlr/groom | 909c04b386c6d384344cd0d060dd1e3b4bde77a2 | [
"BSD-2-Clause"
] | 408 | 2016-04-21T09:40:08.000Z | 2022-03-22T02:05:29.000Z | python/src/drop_one_align_feature.py | antlr/groom | 909c04b386c6d384344cd0d060dd1e3b4bde77a2 | [
"BSD-2-Clause"
] | 25 | 2016-01-24T17:28:49.000Z | 2021-05-05T19:17:55.000Z | python/src/drop_one_align_feature.py | antlr/groom | 909c04b386c6d384344cd0d060dd1e3b4bde77a2 | [
"BSD-2-Clause"
] | 78 | 2016-02-14T07:22:21.000Z | 2022-02-10T08:23:12.000Z | #
# AUTO-GENERATED FILE. DO NOT EDIT
# CodeBuff 1.4.13 'Fri May 13 12:46:16 PDT 2016'
#
import matplotlib.pyplot as plt
fig = plt.figure()
ax = plt.subplot(111)
N = 19
featureIndexes = range(0,N)
java = [0.0, 0.0, 0.0, 0.042016808, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0]
ax.plot(featureIndexes, java, label="java")
sqlite = [0.25, 0.25, 0.2777778, 0.31034482, 0.25283018, 0.25925925, 0.25, 0.25, 0.25, 0.25, 0.26792452, 0.25, 0.26923078, 0.25283018, 0.2413793, 0.25, 0.25283018, 0.25, 0.25660378]
ax.plot(featureIndexes, sqlite, label="sqlite")
java8 = [0.0, 0.0, 0.0, 0.014814815, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0]
ax.plot(featureIndexes, java8, label="java8")
quorum = [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.10526316, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0]
ax.plot(featureIndexes, quorum, label="quorum")
antlr = [0.016200295, 0.016200295, 0.016200295, 0.041666668, 0.016200295, 0.02503682, 0.040257648, 0.016200295, 0.016200295, 0.016200295, 0.025, 0.016200295, 0.016200295, 0.016200295, 0.016200295, 0.016200295, 0.016200295, 0.016200295, 0.016200295]
ax.plot(featureIndexes, antlr, label="antlr")
tsql = [0.1875, 0.17460318, 0.22222222, 0.23569024, 0.1875, 0.18855219, 0.1875, 0.19865319, 0.1875, 0.1875, 0.1923077, 0.1875, 0.17391305, 0.1875, 0.17460318, 0.1875, 0.1875, 0.1875, 0.18855219]
ax.plot(featureIndexes, tsql, label="tsql")
labels = ['curated', 'LT(-1) right ancestor', ' LT(1)', 'Strt line', 'Big list', 'List elem.', 'token child index', 'LT(1) left ancestor', 'ancestor child index', ' parent', 'parent child index', ' parent^2', 'parent^2 child index', ' parent^3', 'parent^3 child index', ' parent^4', 'parent^4 child index', ' parent^5', 'parent^5 child index', 'LT(-1) right ancestor', 'LT(1)', 'Strt line', 'Big list', 'List elem.', 'token child index', 'LT(1) left ancestor', 'ancestor child index', 'parent', 'parent child index', 'parent^2', 'parent^2 child index', 'parent^3', 'parent^3 child index', 'parent^4', 'parent^4 child index', 'parent^5', 'parent^5 child index', 'LT(-1) right ancestor', 'LT(1)', 'Strt line', 'Big list', 'List elem.', 'token child index', 'LT(1) left ancestor', 'ancestor child index', 'parent', 'parent child index', 'parent^2', 'parent^2 child index', 'parent^3', 'parent^3 child index', 'parent^4', 'parent^4 child index', 'parent^5', 'parent^5 child index', 'LT(-1) right ancestor', 'LT(1)', 'Strt line', 'Big list', 'List elem.', 'token child index', 'LT(1) left ancestor', 'ancestor child index', 'parent', 'parent child index', 'parent^2', 'parent^2 child index', 'parent^3', 'parent^3 child index', 'parent^4', 'parent^4 child index', 'parent^5', 'parent^5 child index', 'LT(-1) right ancestor', 'LT(1)', 'Strt line', 'Big list', 'List elem.', 'token child index', 'LT(1) left ancestor', 'ancestor child index', 'parent', 'parent child index', 'parent^2', 'parent^2 child index', 'parent^3', 'parent^3 child index', 'parent^4', 'parent^4 child index', 'parent^5', 'parent^5 child index', 'LT(-1) right ancestor', 'LT(1)', 'Strt line', 'Big list', 'List elem.', 'token child index', 'LT(1) left ancestor', 'ancestor child index', 'parent', 'parent child index', 'parent^2', 'parent^2 child index', 'parent^3', 'parent^3 child index', 'parent^4', 'parent^4 child index', 'parent^5', 'parent^5 child index', 'LT(-1) right ancestor', 'LT(1)', 'Strt line', 'Big list', 'List elem.', 'token child index', 'LT(1) left ancestor', 'ancestor child index', 'parent', 'parent child index', 'parent^2', 'parent^2 child index', 'parent^3', 'parent^3 child index', 'parent^4', 'parent^4 child index', 'parent^5', 'parent^5 child index']
ax.set_xticklabels(labels, rotation=60, fontsize=8)
plt.xticks(featureIndexes, labels, rotation=60)
ax.yaxis.grid(True, linestyle='-', which='major', color='lightgrey', alpha=0.5)
ax.set_xlabel("Alignment Feature")
ax.set_ylabel("Median Error rate")
ax.set_title("Effect of Dropping One Feature on Alignment Decision\nMedian Leave-one-out Validation Error Rate")
plt.legend()
plt.tight_layout()
fig.savefig("images/drop_one_align_feature.pdf", format='pdf')
plt.show()
| 115.305556 | 2,245 | 0.668755 | 730 | 4,151 | 3.791781 | 0.173973 | 0.075867 | 0.107298 | 0.134393 | 0.666546 | 0.643786 | 0.643786 | 0.611633 | 0.611633 | 0.611633 | 0 | 0.184354 | 0.119248 | 4,151 | 35 | 2,246 | 118.6 | 0.572757 | 0.019032 | 0 | 0 | 1 | 0 | 0.476764 | 0.008114 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.035714 | 0 | 0.035714 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
827f584a8724a0574ee052fa46cdf97997fceb51 | 231 | py | Python | intro/part03-31_print_many_times/src/print_many_times.py | Hannah-Abi/python-pro-21 | 2ce32c4bf118054329d19afdf83c50561be1ada8 | [
"MIT"
] | null | null | null | intro/part03-31_print_many_times/src/print_many_times.py | Hannah-Abi/python-pro-21 | 2ce32c4bf118054329d19afdf83c50561be1ada8 | [
"MIT"
] | null | null | null | intro/part03-31_print_many_times/src/print_many_times.py | Hannah-Abi/python-pro-21 | 2ce32c4bf118054329d19afdf83c50561be1ada8 | [
"MIT"
] | null | null | null | # Write your solution here
def print_many_times(text, times):
print((text + "\n") * int(times) )
# You can test your function by calling it within the following block
if __name__ == "__main__":
print_many_times("python", 5) | 38.5 | 69 | 0.709957 | 35 | 231 | 4.342857 | 0.771429 | 0.118421 | 0.184211 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.005236 | 0.17316 | 231 | 6 | 70 | 38.5 | 0.790576 | 0.398268 | 0 | 0 | 0 | 0 | 0.116788 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0 | 0 | 0.25 | 0.75 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 4 |
82c6a6219f1368afbca59065c9a922bdbd956dea | 205 | py | Python | text/_cascade/block_format_context.py | jedhsu/text | 8525b602d304ac571a629104c48703443244545c | [
"Apache-2.0"
] | null | null | null | text/_cascade/block_format_context.py | jedhsu/text | 8525b602d304ac571a629104c48703443244545c | [
"Apache-2.0"
] | null | null | null | text/_cascade/block_format_context.py | jedhsu/text | 8525b602d304ac571a629104c48703443244545c | [
"Apache-2.0"
] | null | null | null | # [TODO] place more preicsely
from dataclasses import dataclass
@dataclass
class Overflow:
anchor: type
block: type
clip_margin: type
inline: type
wrap: type
x: type
y: type
| 13.666667 | 33 | 0.663415 | 26 | 205 | 5.192308 | 0.730769 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.278049 | 205 | 14 | 34 | 14.642857 | 0.912162 | 0.131707 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.071429 | 0 | 1 | 0 | true | 0 | 0.1 | 0 | 0.9 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 4 |
82d49e9b4bbcb41faa8653654b49687ef26ae5f2 | 113 | py | Python | src/config.py | jowtro/jx-flask-temp1 | 4d3d998469658c884ba706316381ac59628cfc5c | [
"MIT"
] | null | null | null | src/config.py | jowtro/jx-flask-temp1 | 4d3d998469658c884ba706316381ac59628cfc5c | [
"MIT"
] | null | null | null | src/config.py | jowtro/jx-flask-temp1 | 4d3d998469658c884ba706316381ac59628cfc5c | [
"MIT"
] | null | null | null | import os
from dotenv import load_dotenv
# load env vars from .env
load_dotenv()
TEST = os.getenv("test_var")
| 12.555556 | 30 | 0.743363 | 19 | 113 | 4.263158 | 0.526316 | 0.246914 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.168142 | 113 | 8 | 31 | 14.125 | 0.861702 | 0.20354 | 0 | 0 | 0 | 0 | 0.090909 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
7d5eb8d8bd72a42336471a51607777e70d6b8a0c | 135 | py | Python | django_misaka/apps.py | chiehtu/django-misaka | 943404ae68b5c70af1915b33693dbb7d891a3906 | [
"MIT"
] | 3 | 2015-03-09T22:37:18.000Z | 2017-10-18T19:27:35.000Z | django_misaka/apps.py | chiehtu/django-misaka | 943404ae68b5c70af1915b33693dbb7d891a3906 | [
"MIT"
] | 8 | 2017-02-10T01:35:31.000Z | 2022-01-07T10:06:17.000Z | django_misaka/apps.py | chiehtu/django-misaka | 943404ae68b5c70af1915b33693dbb7d891a3906 | [
"MIT"
] | 2 | 2017-01-26T23:02:55.000Z | 2019-09-25T13:36:28.000Z | from django.apps import AppConfig
class DjangoMisakaConfig(AppConfig):
name = 'django_misaka'
verbose_name = 'Django Misaka'
| 19.285714 | 36 | 0.755556 | 15 | 135 | 6.666667 | 0.666667 | 0.2 | 0.32 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.17037 | 135 | 6 | 37 | 22.5 | 0.892857 | 0 | 0 | 0 | 0 | 0 | 0.192593 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 4 |
7d67765f1fa1c229aef2a0cdf1a0c0f69960f80f | 132 | py | Python | djangosige/apps/cadastro/apps.py | limeiragabriel/sige | c7c1728aee1ed134cab1841db945223234e9a40e | [
"MIT"
] | 330 | 2017-07-03T08:41:24.000Z | 2022-03-31T04:34:17.000Z | djangosige/apps/cadastro/apps.py | limeiragabriel/sige | c7c1728aee1ed134cab1841db945223234e9a40e | [
"MIT"
] | 107 | 2017-07-03T22:21:35.000Z | 2022-03-30T08:10:24.000Z | djangosige/apps/cadastro/apps.py | limeiragabriel/sige | c7c1728aee1ed134cab1841db945223234e9a40e | [
"MIT"
] | 258 | 2017-06-27T20:11:46.000Z | 2022-03-20T21:46:34.000Z | from __future__ import unicode_literals
from django.apps import AppConfig
class CadastroConfig(AppConfig):
name = 'cadastro'
| 16.5 | 39 | 0.795455 | 15 | 132 | 6.666667 | 0.8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.151515 | 132 | 7 | 40 | 18.857143 | 0.892857 | 0 | 0 | 0 | 0 | 0 | 0.060606 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.5 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
7d67943b13b730875ff3da0d4948c019b04394f1 | 19,520 | py | Python | geosoft/gxapi/GXFFT.py | fearaschiarrai/gxpy | 4c5e7594b24e530a8cd94df1eef562c5c6ce3e92 | [
"BSD-2-Clause"
] | 25 | 2017-07-14T06:39:37.000Z | 2022-03-09T21:39:51.000Z | geosoft/gxapi/GXFFT.py | fearaschiarrai/gxpy | 4c5e7594b24e530a8cd94df1eef562c5c6ce3e92 | [
"BSD-2-Clause"
] | 100 | 2016-12-13T17:30:41.000Z | 2021-08-01T20:21:13.000Z | geosoft/gxapi/GXFFT.py | fearaschiarrai/gxpy | 4c5e7594b24e530a8cd94df1eef562c5c6ce3e92 | [
"BSD-2-Clause"
] | 28 | 2016-12-12T17:34:40.000Z | 2022-03-16T15:39:39.000Z | ### extends 'class_empty.py'
### block ClassImports
# NOTICE: Do not edit anything here, it is generated code
from . import gxapi_cy
from geosoft.gxapi import GXContext, float_ref, int_ref, str_ref
### endblock ClassImports
### block Header
# NOTICE: The code generator will not replace the code in this block
### endblock Header
### block ClassImplementation
# NOTICE: Do not edit anything here, it is generated code
class GXFFT(gxapi_cy.WrapFFT):
"""
GXFFT class.
This class allows for the application of predefined
filters to data in an OASIS database. The system uses
the Winograd algorithm to transform data in the spatial
domain to the wavenumber or Fourier domain.
"""
def __init__(self, handle=0):
super(GXFFT, self).__init__(GXContext._get_tls_geo(), handle)
@classmethod
def null(cls):
"""
A null (undefined) instance of `GXFFT <geosoft.gxapi.GXFFT>`
:returns: A null `GXFFT <geosoft.gxapi.GXFFT>`
:rtype: GXFFT
"""
return GXFFT()
def is_null(self):
"""
Check if this is a null (undefined) instance
:returns: True if this is a null (undefined) instance, False otherwise.
:rtype: bool
"""
return self._internal_handle() == 0
# Miscellaneous
def add_white_noise(self, amp, option):
"""
Add white noise to the power spectrum of an FFT object.
:param amp: The value added to the real part of all non-DC components of the current power spectrum
:param option: :ref:`FFT_WHITE_NOISE`
:type amp: float
:type option: int
.. versionadded:: 9.9
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._add_white_noise(amp, option)
def app_dens(self, thick, dens):
"""
Appparent density filter
:param thick: Thickness (meters) of the earth model
:param dens: Background density (g/cm3) (default = 0)
:type thick: float
:type dens: float
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._app_dens(thick, dens)
def app_susc(self, strength):
"""
Apparent susceptiblity filter
:param strength: Total magnetic field strength
:type strength: float
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
**Note:** Reduction to magnetic pole (`red_pol <geosoft.gxapi.GXFFT.red_pol>`) and downward continuation
(`contin <geosoft.gxapi.GXFFT.contin>`) should be called BEFORE using `app_susc <geosoft.gxapi.GXFFT.app_susc>`.
"""
self._app_susc(strength)
def band_pass(self, llen, hlen, pass_defined):
"""
Bandpass filter (using low and high wavelength cutoffs)
:param llen: Low Cutoff wavelength (meters)
:param hlen: High Cutoff wavelength (meter)
:param pass_defined: 1= Pass the defined band (default); 0= Reject the band
:type llen: float
:type hlen: float
:type pass_defined: int
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._band_pass(llen, hlen, pass_defined)
def b_worth(self, clen, degree, filter_type):
"""
Butterworth filter
:param clen: Central cutoff wavelength (meter)
:param degree: Degree of the filter function (default = 8.0)
:param filter_type: Filter type: 1= Low-pass (regional) filter (default) 0= High-pass (residual) filter
:type clen: float
:type degree: float
:type filter_type: int
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._b_worth(clen, degree, filter_type)
def rc_filter(self, clen, filter_type):
"""
RC filter
:param clen: Central cutoff wavelength (meter)
:param filter_type: Filter type: 1= Low-pass (regional) filter (default) 0= High-pass (residual) filter
:type clen: float
:type filter_type: int
.. versionadded:: 8.5
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._rc_filter(clen, filter_type)
def contin(self, dist):
"""
Upward/Downward continuation filter
:param dist: Distance to continue; positive = downwards negative = upwards
:type dist: float
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._contin(dist)
def cos_roll(self, llen, hlen, degree, type):
"""
Cosine roll-off filter
:param llen: Low wavelength start point (meters)
:param hlen: High wavelength end point (meters)
:param degree: Degree of the filter function (default = 2.0)
:param type: Filter type: 1= Low-pass (regional) filter (default) 0= High-pass (residual) filter
:type llen: float
:type hlen: float
:type degree: float
:type type: int
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._cos_roll(llen, hlen, degree, type)
@classmethod
def create(cls, gvv, interv, trend):
"""
Create a New `GXFFT <geosoft.gxapi.GXFFT>` with detrend options.
:param gvv: `GXVV <geosoft.gxapi.GXVV>` to transform.
:param interv: Element space interval
:param trend: :ref:`FFT_DETREND`
:type gvv: GXVV
:type interv: float
:type trend: int
:returns: `GXFFT <geosoft.gxapi.GXFFT>` Object
:rtype: GXFFT
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
**Note:** The detrending options control the removal of a trend from the data
before the `GXFFT <geosoft.gxapi.GXFFT>` is applied. The default data expansion is 10% before `GXFFT <geosoft.gxapi.GXFFT>`.
"""
ret_val = gxapi_cy.WrapFFT._create(GXContext._get_tls_geo(), gvv, interv, trend)
return GXFFT(ret_val)
@classmethod
def create_ex(cls, gvv, interv, trend, expansion):
"""
Create a New `GXFFT <geosoft.gxapi.GXFFT>` with detrend and expansion options.
:param gvv: `GXVV <geosoft.gxapi.GXVV>` to transform.
:param interv: Element space interval
:param trend: :ref:`FFT_DETREND`
:param expansion: Minimum expansion %
:type gvv: GXVV
:type interv: float
:type trend: int
:type expansion: float
:returns: `GXFFT <geosoft.gxapi.GXFFT>` Object
:rtype: GXFFT
.. versionadded:: 5.1.8
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
**Note:** The detrending options control the removal of a trend from the data
before the `GXFFT <geosoft.gxapi.GXFFT>` is applied. The expansion options control the minimum
data expansion before the `GXFFT <geosoft.gxapi.GXFFT>` is applied.
"""
ret_val = gxapi_cy.WrapFFT._create_ex(GXContext._get_tls_geo(), gvv, interv, trend, expansion)
return GXFFT(ret_val)
@classmethod
def create_ref(cls, gvv, interv, trend):
"""
Create `GXFFT <geosoft.gxapi.GXFFT>` object with detrend options from reference (original) channel,
but no `GXFFT <geosoft.gxapi.GXFFT>` process.
:param gvv: `GXVV <geosoft.gxapi.GXVV>` contains channel data to perform `GXFFT <geosoft.gxapi.GXFFT>` operations upon.
:param interv: Element space interval, should be the same as in `create_ex <geosoft.gxapi.GXFFT.create_ex>` call
:param trend: :ref:`FFT_DETREND`
:type gvv: GXVV
:type interv: float
:type trend: int
:returns: `GXFFT <geosoft.gxapi.GXFFT>` Object
:rtype: GXFFT
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
**Note:** This just creates an object. It is intended to be called
immediately after with `set_vv <geosoft.gxapi.GXFFT.set_vv>`.
"""
ret_val = gxapi_cy.WrapFFT._create_ref(GXContext._get_tls_geo(), gvv, interv, trend)
return GXFFT(ret_val)
@classmethod
def create_ref_ex(cls, gvv, interv, trend, expansion, d_cmult):
"""
Create `GXFFT <geosoft.gxapi.GXFFT>` object with detrend and expansion options from reference (original) channel,
but no `GXFFT <geosoft.gxapi.GXFFT>` process.
:param gvv: `GXVV <geosoft.gxapi.GXVV>` contains channel data to perform `GXFFT <geosoft.gxapi.GXFFT>` operations upon.
:param interv: Element space interval, should be the same as in `create_ex <geosoft.gxapi.GXFFT.create_ex>` call
:param trend: :ref:`FFT_DETREND`
:param expansion: Minimum expansion %, should be the same as in `create_ex <geosoft.gxapi.GXFFT.create_ex>` call
:param d_cmult: DC level multiple
:type gvv: GXVV
:type interv: float
:type trend: int
:type expansion: float
:type d_cmult: float
:returns: `GXFFT <geosoft.gxapi.GXFFT>` Object
:rtype: GXFFT
.. versionadded:: 5.1.8
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
**Note:** This just creates an object. It is intended to be called
immediately after with `set_vv <geosoft.gxapi.GXFFT.set_vv>`.
"""
ret_val = gxapi_cy.WrapFFT._create_ref_ex(GXContext._get_tls_geo(), gvv, interv, trend, expansion, d_cmult)
return GXFFT(ret_val)
def gaus(self, dev, type):
"""
Gaussian filter
:param dev: Standard deviation cutoff of function (meters)
:param type: Filter type: 1= Low-pass (residual) filter (default) 0= High-pass (regional) filter
:type dev: float
:type type: int
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._gaus(dev, type)
def get_vv(self, gv_vr, gv_vi):
"""
Copies real and imaginary `GXVV <geosoft.gxapi.GXVV>`'s to user `GXVV <geosoft.gxapi.GXVV>`'s.
:param gv_vr: Real component
:param gv_vi: Imaginary component
:type gv_vr: GXVV
:type gv_vi: GXVV
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._get_vv(gv_vr, gv_vi)
def h_drv(self, order):
"""
Horizontal derivative
:param order: Order of differentiation (default = 1)
:type order: float
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._h_drv(order)
def high_pass(self, wlen, fid_int):
"""
High bandpass filter
:param wlen: Cutoff wavelength (meter)
:param fid_int: Fiducial increment of the `GXFFT <geosoft.gxapi.GXFFT>`'s channel data
:type wlen: float
:type fid_int: float
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._high_pass(wlen, fid_int)
def h_int(self):
"""
Horizontal integration
.. versionadded:: 5.1.4
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._h_int()
def inverse(self, gvv, gv_vm):
"""
Inverse the `GXFFT <geosoft.gxapi.GXFFT>` from wave number domain to space domain
:param gvv: Output `GXVV <geosoft.gxapi.GXVV>`
:param gv_vm: Original `GXVV <geosoft.gxapi.GXVV>` which was used to create `GXFFT <geosoft.gxapi.GXFFT>` (will be used as mask for output `GXVV <geosoft.gxapi.GXVV>`; no masking if this parameter is NULL)
:type gvv: GXVV
:type gv_vm: GXVV
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._inverse(gvv, gv_vm)
def low_pass(self, wlen):
"""
Low bandpass filter
:param wlen: Cutoff wavelength (meters)
:type wlen: float
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._low_pass(wlen)
def red_pol(self, inc, dec, incp, dir):
"""
Reduction to magnetic pole
:param inc: Geomagnetic inclination (degrees)
:param dec: Geomagnetic declination (degrees)
:param incp: Inclination (degrees) for amplitude correction (default = 20.0)
:param dir: Direction (degrees) of Line from North
:type inc: float
:type dec: float
:type incp: float
:type dir: float
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._red_pol(inc, dec, incp, dir)
def nyquist(self):
"""
Gets the Nyquist frequency (wavenumbers/sample unit).
:returns: Nyquist frequency (wavenumbers/sample unit).
:rtype: float
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
ret_val = self._nyquist()
return ret_val
def samp_incr(self):
"""
Gets the original sample increment.
:returns: Original sample increment.
:rtype: float
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
ret_val = self._samp_incr()
return ret_val
def wave_incr(self):
"""
Get the wave number increment.
:returns: Wave number increment
:rtype: float
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
ret_val = self._wave_incr()
return ret_val
def set_vv(self, gv_vr, gv_vi):
"""
Sets real and imaginary VVs in `GXFFT <geosoft.gxapi.GXFFT>`.
:param gv_vr: Real component
:param gv_vi: Imaginary component
:type gv_vr: GXVV
:type gv_vi: GXVV
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
**Note:** The `GXVV <geosoft.gxapi.GXVV>` must have been obtained from the same `GXFFT <geosoft.gxapi.GXFFT>`
using the `set_vv <geosoft.gxapi.GXFFT.set_vv>` method.
"""
self._set_vv(gv_vr, gv_vi)
def spectrum(self, gvv):
"""
Calculates a power spectrum
:param gvv: Output power spectrum `GXVV <geosoft.gxapi.GXVV>`
:type gvv: GXVV
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._spectrum(gvv)
def v_drv(self, order):
"""
Vertical derivative
:param order: Order of differentiation (default = 1)
:type order: float
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._v_drv(order)
def v_int(self):
"""
Vertical integration
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._v_int()
def write_spectrum(self, gvv, out_file):
"""
Writes a power spectrum to a file
:param gvv: Output power spectrum `GXVV <geosoft.gxapi.GXVV>`
:param out_file: File name for output spectrum
:type gvv: GXVV
:type out_file: str
.. versionadded:: 5.0
**License:** `Geosoft Extended End-User License <https://geosoftgxdev.atlassian.net/wiki/spaces/GD/pages/2359406/License#License-ext-end-user-lic>`_
"""
self._write_spectrum(gvv, out_file.encode())
### endblock ClassImplementation
### block ClassExtend
# NOTICE: The code generator will not replace the code in this block
### endblock ClassExtend
### block Footer
# NOTICE: The code generator will not replace the code in this block
### endblock Footer | 30.837283 | 214 | 0.606557 | 2,343 | 19,520 | 4.959454 | 0.135723 | 0.033735 | 0.046816 | 0.060241 | 0.684079 | 0.650861 | 0.625732 | 0.610671 | 0.580981 | 0.552926 | 0 | 0.019969 | 0.28166 | 19,520 | 633 | 215 | 30.837283 | 0.808729 | 0.688678 | 0 | 0.155844 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.402597 | false | 0.077922 | 0.025974 | 0 | 0.558442 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 4 |
7dc2e4a999b96350f22e02f0f9ac5d6623fb8c94 | 55 | py | Python | ensconce/webapp/__init__.py | netwrkr/ensconce | eda938c67eb0af8fb7d3ccf668e07d2f76485aa5 | [
"BSD-3-Clause"
] | 1 | 2021-05-05T13:52:44.000Z | 2021-05-05T13:52:44.000Z | ensconce/webapp/__init__.py | netwrkr/ensconce | eda938c67eb0af8fb7d3ccf668e07d2f76485aa5 | [
"BSD-3-Clause"
] | null | null | null | ensconce/webapp/__init__.py | netwrkr/ensconce | eda938c67eb0af8fb7d3ccf668e07d2f76485aa5 | [
"BSD-3-Clause"
] | null | null | null | """
The top-level package for the cherrypy webapp.
""" | 18.333333 | 47 | 0.690909 | 8 | 55 | 4.75 | 0.875 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.163636 | 55 | 3 | 48 | 18.333333 | 0.826087 | 0.836364 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
7deccc78170f97c1f308154f730928b6045f3b60 | 152 | py | Python | Max_Waelbers/Code/Source_Data/data.py | ArtezGDA/MappingTheCity-Maps | a29377af7878907d30b4199d0859f007ba08b5e6 | [
"MIT"
] | null | null | null | Max_Waelbers/Code/Source_Data/data.py | ArtezGDA/MappingTheCity-Maps | a29377af7878907d30b4199d0859f007ba08b5e6 | [
"MIT"
] | null | null | null | Max_Waelbers/Code/Source_Data/data.py | ArtezGDA/MappingTheCity-Maps | a29377af7878907d30b4199d0859f007ba08b5e6 | [
"MIT"
] | null | null | null | #!/usr/bin/pyhton
#scrape brandstofelektrisch.json
import urllib
import json
def main():
with open("brandstofelektrisch.json"), 'r') as inputfile
| 15.2 | 57 | 0.743421 | 19 | 152 | 5.947368 | 0.789474 | 0.40708 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.131579 | 152 | 10 | 58 | 15.2 | 0.856061 | 0 | 0 | 0 | 0 | 0 | 0.240385 | 0.230769 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.5 | null | null | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
814a3241a7119f0f80b0e55dd020d4fc69437423 | 132 | py | Python | HIS_void/patient/signals.py | YuanchenZhu2020/HIS_void | 7289bf537e9fc4b09750bbca76a4cc8354dc770f | [
"MIT"
] | null | null | null | HIS_void/patient/signals.py | YuanchenZhu2020/HIS_void | 7289bf537e9fc4b09750bbca76a4cc8354dc770f | [
"MIT"
] | null | null | null | HIS_void/patient/signals.py | YuanchenZhu2020/HIS_void | 7289bf537e9fc4b09750bbca76a4cc8354dc770f | [
"MIT"
] | null | null | null | from django.dispatch import Signal
patient_logged_in = Signal()
patient_login_failed = Signal()
patient_logged_out = Signal()
| 22 | 35 | 0.780303 | 17 | 132 | 5.705882 | 0.647059 | 0.402062 | 0.391753 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.143939 | 132 | 5 | 36 | 26.4 | 0.858407 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 0.25 | 0 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
8151676fbd111d73aaf820188ecadf414d67b40e | 55 | py | Python | tests/__init__.py | Prior99/go2 | 837dc91717cd875b207ac4ebd44cad3f6ffdfadb | [
"FSFAP"
] | null | null | null | tests/__init__.py | Prior99/go2 | 837dc91717cd875b207ac4ebd44cad3f6ffdfadb | [
"FSFAP"
] | null | null | null | tests/__init__.py | Prior99/go2 | 837dc91717cd875b207ac4ebd44cad3f6ffdfadb | [
"FSFAP"
] | null | null | null | import config
config.database_uri = 'sqlite:///memory'
| 18.333333 | 40 | 0.763636 | 7 | 55 | 5.857143 | 0.857143 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.090909 | 55 | 2 | 41 | 27.5 | 0.82 | 0 | 0 | 0 | 0 | 0 | 0.290909 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
815bd59f2daf5e53f1fb4671188b22e365b14bde | 51 | py | Python | src/models/wgangp_g_model.py | universuen/RVGAN-TL | d370673063a3dfd9cc4a20bfd1c18bc95aadabca | [
"MIT"
] | null | null | null | src/models/wgangp_g_model.py | universuen/RVGAN-TL | d370673063a3dfd9cc4a20bfd1c18bc95aadabca | [
"MIT"
] | null | null | null | src/models/wgangp_g_model.py | universuen/RVGAN-TL | d370673063a3dfd9cc4a20bfd1c18bc95aadabca | [
"MIT"
] | null | null | null | from .gan_g_model import GANGModel as WGANGPGModel
| 25.5 | 50 | 0.862745 | 8 | 51 | 5.25 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.117647 | 51 | 1 | 51 | 51 | 0.933333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
8160498c3c38cd7845e475c12a1285069bb88303 | 147 | py | Python | gym_missile_command/__init__.py | ElieKadoche/gym_missile_command | e729721024005d2adcabc759768756516c70bc06 | [
"MIT"
] | 4 | 2021-02-22T11:07:11.000Z | 2022-03-30T04:14:46.000Z | gym_missile_command/__init__.py | ElieKadoche/gym_missile_command | e729721024005d2adcabc759768756516c70bc06 | [
"MIT"
] | null | null | null | gym_missile_command/__init__.py | ElieKadoche/gym_missile_command | e729721024005d2adcabc759768756516c70bc06 | [
"MIT"
] | 1 | 2021-06-04T04:02:49.000Z | 2021-06-04T04:02:49.000Z | from gym.envs.registration import register
register(
id="missile-command-v0",
entry_point="gym_missile_command.envs:MissileCommandEnv",
)
| 21 | 61 | 0.77551 | 18 | 147 | 6.166667 | 0.722222 | 0.252252 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.007692 | 0.115646 | 147 | 6 | 62 | 24.5 | 0.846154 | 0 | 0 | 0 | 0 | 0 | 0.408163 | 0.285714 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.2 | 0 | 0.2 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
817143745dff70101296903798e901861afafeab | 334 | py | Python | tests/test_site.py | GabrielIFPB/little-notes | cd1176275e9a2523801626a6c22b6218867bd21b | [
"MIT"
] | null | null | null | tests/test_site.py | GabrielIFPB/little-notes | cd1176275e9a2523801626a6c22b6218867bd21b | [
"MIT"
] | null | null | null | tests/test_site.py | GabrielIFPB/little-notes | cd1176275e9a2523801626a6c22b6218867bd21b | [
"MIT"
] | null | null | null | # def test_site_index(client, captured_templates):
# response = client.get("/")
# assert response.status_code == 200
# assert len(captured_templates) == 1
# template, context = captured_templates[0]
# assert template.name == "index.html"
# assert response.headers["content-Type"] == "text/html; charset=utf-8"
| 41.75 | 75 | 0.679641 | 40 | 334 | 5.525 | 0.675 | 0.230769 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.021739 | 0.173653 | 334 | 7 | 76 | 47.714286 | 0.778986 | 0.95509 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
8187b1f711a0d3747d35e21360ef5beff63489f6 | 130 | py | Python | utils/single_out.py | JBarmentlo/Piscine-Math-42 | 6d94d382e95010f0daf910fa9da712e878869351 | [
"MIT"
] | null | null | null | utils/single_out.py | JBarmentlo/Piscine-Math-42 | 6d94d382e95010f0daf910fa9da712e878869351 | [
"MIT"
] | null | null | null | utils/single_out.py | JBarmentlo/Piscine-Math-42 | 6d94d382e95010f0daf910fa9da712e878869351 | [
"MIT"
] | null | null | null | def single_out(a, index):
'''
returns a with all bits but the index bit set to 0
'''
return (a & (1 << index)) | 26 | 58 | 0.546154 | 21 | 130 | 3.333333 | 0.809524 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.022727 | 0.323077 | 130 | 5 | 59 | 26 | 0.772727 | 0.384615 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.5 | false | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 4 |
8192ace4c343bdf09ab21619981b7c91ee219fcc | 204 | py | Python | tests/simple_class.py | ssarangi/PyVyM | f96c46e7b8d38f938345ca915c5356b4d9c86d64 | [
"MIT"
] | 3 | 2017-09-24T17:35:29.000Z | 2021-02-14T21:53:03.000Z | tests/simple_class.py | ssarangi/PyVyM | f96c46e7b8d38f938345ca915c5356b4d9c86d64 | [
"MIT"
] | null | null | null | tests/simple_class.py | ssarangi/PyVyM | f96c46e7b8d38f938345ca915c5356b4d9c86d64 | [
"MIT"
] | 1 | 2019-08-22T01:09:15.000Z | 2019-08-22T01:09:15.000Z | class Foo:
def __init__(self):
self.member1 = 1
def print(self):
self.member1 += 5
print("Member1: %s" % self.member1)
def main():
foo = Foo()
foo.print()
main() | 15.692308 | 43 | 0.529412 | 26 | 204 | 4 | 0.423077 | 0.317308 | 0.288462 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.043165 | 0.318627 | 204 | 13 | 44 | 15.692308 | 0.705036 | 0 | 0 | 0 | 0 | 0 | 0.053659 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.3 | false | 0 | 0 | 0 | 0.4 | 0.3 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
81af4087dfc40937c5e9a5d883a350420adf9436 | 93 | py | Python | HealthKit/healthapp/apps.py | Koushik-Sarker-Seemanto/DatabaseProject | d936d83643242942b903381ef263dc10f8fbc177 | [
"MIT"
] | null | null | null | HealthKit/healthapp/apps.py | Koushik-Sarker-Seemanto/DatabaseProject | d936d83643242942b903381ef263dc10f8fbc177 | [
"MIT"
] | null | null | null | HealthKit/healthapp/apps.py | Koushik-Sarker-Seemanto/DatabaseProject | d936d83643242942b903381ef263dc10f8fbc177 | [
"MIT"
] | null | null | null | from django.apps import AppConfig
class HealthappConfig(AppConfig):
name = 'healthapp'
| 15.5 | 33 | 0.763441 | 10 | 93 | 7.1 | 0.9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.16129 | 93 | 5 | 34 | 18.6 | 0.910256 | 0 | 0 | 0 | 0 | 0 | 0.096774 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
81c65d327337882fa0595cb517fbaf5a266fd0e0 | 44 | py | Python | __init__.py | vyouzhis/energy | c9c9b0c7dc2e85a093fb531f80c3aa6f458e8b6e | [
"Apache-2.0"
] | null | null | null | __init__.py | vyouzhis/energy | c9c9b0c7dc2e85a093fb531f80c3aa6f458e8b6e | [
"Apache-2.0"
] | null | null | null | __init__.py | vyouzhis/energy | c9c9b0c7dc2e85a093fb531f80c3aa6f458e8b6e | [
"Apache-2.0"
] | 1 | 2019-07-19T03:03:43.000Z | 2019-07-19T03:03:43.000Z | __version__ = '0.0.1'
__author__ = 'EtoMC2'
| 14.666667 | 21 | 0.681818 | 6 | 44 | 3.666667 | 0.833333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.105263 | 0.136364 | 44 | 2 | 22 | 22 | 0.473684 | 0 | 0 | 0 | 0 | 0 | 0.25 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
81c77558a514adeba4130477ed1fc1b7f429e070 | 24 | py | Python | caller/textractcaller/_version.py | aws-samples/amazon-textract-textractor | 35da7d662b06f03d1fc9db5fbabb3d1f45b1edd6 | [
"Apache-2.0"
] | 187 | 2019-05-07T20:20:33.000Z | 2022-03-26T11:29:50.000Z | caller/textractcaller/_version.py | aws-samples/amazon-textract-textractor | 35da7d662b06f03d1fc9db5fbabb3d1f45b1edd6 | [
"Apache-2.0"
] | 37 | 2019-05-15T13:51:50.000Z | 2022-03-25T21:57:37.000Z | caller/textractcaller/_version.py | aws-samples/amazon-textract-textractor | 35da7d662b06f03d1fc9db5fbabb3d1f45b1edd6 | [
"Apache-2.0"
] | 84 | 2019-05-28T01:28:00.000Z | 2022-03-10T01:59:21.000Z | __version__ = '0.0.15'
| 8 | 22 | 0.625 | 4 | 24 | 2.75 | 0.75 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.2 | 0.166667 | 24 | 2 | 23 | 12 | 0.35 | 0 | 0 | 0 | 0 | 0 | 0.26087 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
81d1b538fa5a380347b8c66fb4e24794c1d2ab00 | 21 | py | Python | certbot_dns_duckdns/__init__.py | chaptergy/certbot_dns_duckdns | 13daa19a06e6cfbf8ca1c5cc7f0a31e9142d1da6 | [
"MIT"
] | null | null | null | certbot_dns_duckdns/__init__.py | chaptergy/certbot_dns_duckdns | 13daa19a06e6cfbf8ca1c5cc7f0a31e9142d1da6 | [
"MIT"
] | null | null | null | certbot_dns_duckdns/__init__.py | chaptergy/certbot_dns_duckdns | 13daa19a06e6cfbf8ca1c5cc7f0a31e9142d1da6 | [
"MIT"
] | null | null | null | __version__ = "v0.5"
| 10.5 | 20 | 0.666667 | 3 | 21 | 3.333333 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.111111 | 0.142857 | 21 | 1 | 21 | 21 | 0.444444 | 0 | 0 | 0 | 0 | 0 | 0.190476 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
81d29f9a18034cf0d9190547ac37fad69fe6780e | 142 | py | Python | simf/common/__init__.py | MartinJakomin/SIMF | e04110ddcaed887abc58084686d00f84fdc6a8c8 | [
"MIT"
] | 1 | 2021-01-22T05:15:30.000Z | 2021-01-22T05:15:30.000Z | simf/common/__init__.py | MartinJakomin/SIMF | e04110ddcaed887abc58084686d00f84fdc6a8c8 | [
"MIT"
] | null | null | null | simf/common/__init__.py | MartinJakomin/SIMF | e04110ddcaed887abc58084686d00f84fdc6a8c8 | [
"MIT"
] | null | null | null | from .data import build_test_set, split_streams, build_sparse_matrix
__all__ = ['build_sparse_matrix', 'split_streams', 'build_test_set']
| 35.5 | 69 | 0.795775 | 20 | 142 | 4.95 | 0.55 | 0.181818 | 0.242424 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.105634 | 142 | 3 | 70 | 47.333333 | 0.779528 | 0 | 0 | 0 | 0 | 0 | 0.330935 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
c4b128ac557de255d8f01c1bb376ec1b5cedffbb | 140 | py | Python | python/pangram/pangram.py | cjcbusatto/exercism-solved | 51cfe3d0134899b043d5668bc270bf480e6d9644 | [
"MIT"
] | null | null | null | python/pangram/pangram.py | cjcbusatto/exercism-solved | 51cfe3d0134899b043d5668bc270bf480e6d9644 | [
"MIT"
] | null | null | null | python/pangram/pangram.py | cjcbusatto/exercism-solved | 51cfe3d0134899b043d5668bc270bf480e6d9644 | [
"MIT"
] | 1 | 2018-12-25T22:14:40.000Z | 2018-12-25T22:14:40.000Z | def is_pangram(sentence):
if len(set(sentence.lower()) & set("abcdefghijklmnopqrstuvwxyz")) == 26:
return True
return False
| 28 | 76 | 0.671429 | 16 | 140 | 5.8125 | 0.8125 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.017857 | 0.2 | 140 | 4 | 77 | 35 | 0.8125 | 0 | 0 | 0 | 0 | 0 | 0.185714 | 0.185714 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0 | 0 | 0.75 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 4 |
c4f37043eaa55b7d635818bedd81a249aff9fc87 | 83 | py | Python | captain_hook/services/scrutinizer/__init__.py | brantje/captain_hook | dde076a96afffa2235b7d8d01d47c4e61099c6b6 | [
"Apache-2.0"
] | 1 | 2017-01-07T16:22:05.000Z | 2017-01-07T16:22:05.000Z | captain_hook/services/scrutinizer/__init__.py | brantje/captain_hook | dde076a96afffa2235b7d8d01d47c4e61099c6b6 | [
"Apache-2.0"
] | 3 | 2017-02-27T00:34:19.000Z | 2017-02-27T14:25:44.000Z | captain_hook/services/scrutinizer/__init__.py | brantje/telegram-github-bot | dde076a96afffa2235b7d8d01d47c4e61099c6b6 | [
"Apache-2.0"
] | null | null | null | from __future__ import absolute_import
from .scrutinizer import ScrutinizerService
| 27.666667 | 43 | 0.891566 | 9 | 83 | 7.666667 | 0.666667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.096386 | 83 | 2 | 44 | 41.5 | 0.92 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
f201efd0e1a3771cdd775b1c1d1798d4da78978a | 130 | py | Python | lib/plugs/snowflake.py | bankova-gabriella/layer | 87feadbca7bcb935b91e1a4b29fd15ea26103075 | [
"MIT"
] | null | null | null | lib/plugs/snowflake.py | bankova-gabriella/layer | 87feadbca7bcb935b91e1a4b29fd15ea26103075 | [
"MIT"
] | null | null | null | lib/plugs/snowflake.py | bankova-gabriella/layer | 87feadbca7bcb935b91e1a4b29fd15ea26103075 | [
"MIT"
] | null | null | null | import snowflake
class Snowflake:
def __init__(self, layer):
self.layer = layer
self.snowflake = snowflake
| 14.444444 | 34 | 0.653846 | 14 | 130 | 5.785714 | 0.5 | 0.222222 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.276923 | 130 | 8 | 35 | 16.25 | 0.861702 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | false | 0 | 0.2 | 0 | 0.6 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 4 |
f207144b351ffd741359857d5183bbc812a5bb2f | 102 | py | Python | 7_kyu/Triangle_area.py | UlrichBerntien/Codewars-Katas | bbd025e67aa352d313564d3862db19fffa39f552 | [
"MIT"
] | null | null | null | 7_kyu/Triangle_area.py | UlrichBerntien/Codewars-Katas | bbd025e67aa352d313564d3862db19fffa39f552 | [
"MIT"
] | null | null | null | 7_kyu/Triangle_area.py | UlrichBerntien/Codewars-Katas | bbd025e67aa352d313564d3862db19fffa39f552 | [
"MIT"
] | null | null | null | def t_area(t_str: str) -> float:
rows = sum(c == '\n' for c in t_str) - 2
return (rows*rows)/2 | 34 | 44 | 0.568627 | 21 | 102 | 2.619048 | 0.619048 | 0.145455 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.025974 | 0.245098 | 102 | 3 | 45 | 34 | 0.688312 | 0 | 0 | 0 | 0 | 0 | 0.019417 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.333333 | false | 0 | 0 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 4 |
f207bef41b000bbce592a8e78f6aacb879188ea2 | 623 | py | Python | src/compas_occ/geometry/__init__.py | jf---/compas_occ | 8f8a4d7f38984d06e6c32c851625275735503611 | [
"MIT"
] | 1 | 2021-06-15T22:49:40.000Z | 2021-06-15T22:49:40.000Z | src/compas_occ/geometry/__init__.py | jf---/compas_occ | 8f8a4d7f38984d06e6c32c851625275735503611 | [
"MIT"
] | null | null | null | src/compas_occ/geometry/__init__.py | jf---/compas_occ | 8f8a4d7f38984d06e6c32c851625275735503611 | [
"MIT"
] | null | null | null | """
********************************************************************************
compas_occ.geometry
********************************************************************************
.. currentmodule:: compas_occ.geometry
Curves
======
.. autosummary::
:toctree: generated/
:nosignatures:
Curve
NurbsCurve
Surfaces
========
.. autosummary::
:toctree: generated/
:nosignatures:
Surface
NurbsSurface
"""
from .curves import Curve # noqa: F401
from .curves import NurbsCurve # noqa: F401
from .surfaces import Surface # noqa: F401
from .surfaces import NurbsSurface # noqa: F401
| 18.878788 | 80 | 0.495987 | 45 | 623 | 6.822222 | 0.4 | 0.104235 | 0.117264 | 0.254072 | 0.169381 | 0 | 0 | 0 | 0 | 0 | 0 | 0.022857 | 0.157303 | 623 | 32 | 81 | 19.46875 | 0.561905 | 0.770465 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
f20aeb65920da97fa582a49f9f3ecd700ffacafa | 2,304 | py | Python | parlai/mturk/core/worlds.py | ysglh/ParlAI | e0f16e9168839be12f72d3431b9819cf3d51fe10 | [
"BSD-3-Clause"
] | 2 | 2017-09-30T23:23:44.000Z | 2021-07-08T17:12:58.000Z | parlai/mturk/core/worlds.py | ysglh/ParlAI | e0f16e9168839be12f72d3431b9819cf3d51fe10 | [
"BSD-3-Clause"
] | 1 | 2018-03-08T20:44:39.000Z | 2018-03-08T23:49:29.000Z | parlai/mturk/core/worlds.py | ysglh/ParlAI | e0f16e9168839be12f72d3431b9819cf3d51fe10 | [
"BSD-3-Clause"
] | 1 | 2018-03-08T20:42:57.000Z | 2018-03-08T20:42:57.000Z | # Copyright (c) 2017-present, Facebook, Inc.
# All rights reserved.
# This source code is licensed under the BSD-style license found in the
# LICENSE file in the root directory of this source tree. An additional grant
# of patent rights can be found in the PATENTS file in the same directory.
from parlai.core.worlds import World
class MTurkOnboardWorld(World):
"""Generic world for onboarding a Turker and collecting
information from them."""
def __init__(self, opt, mturk_agent):
self.mturk_agent = mturk_agent
self.episodeDone = False
def parley(self):
self.episodeDone = True
def episode_done(self):
return self.episodeDone
def shutdown(self):
pass
class MTurkTaskWorld(World):
"""Generic world for MTurk tasks."""
def __init__(self, opt, mturk_agent):
self.mturk_agent = mturk_agent
self.episodeDone = False
def parley(self):
self.episodeDone = True
def episode_done(self):
return self.episodeDone
def report(self):
pass
def shutdown(self):
self.mturk_agent.shutdown()
"""
Use the following code if there are multiple MTurk agents:
global shutdown_agent
def shutdown_agent(mturk_agent):
mturk_agent.shutdown()
Parallel(
n_jobs=len(self.mturk_agents),
backend='threading'
)(delayed(shutdown_agent)(agent) for agent in self.mturk_agents)
"""
def review_work(self):
"""Programmatically approve/reject the turker's work.
For example:
.. code-block:: python
if self.turker_response == '0':
self.mturk_agent.reject_work(
'You rated our model's response as a 0/10 but we '
'know we\'re better than that'
)
else:
if self.turker_response == '10':
self.mturk_agent.pay_bonus(1, 'Thanks for a great rating!')
self.mturk_agent.approve_work()
"""
# self.mturk_agent.approve_work()
# self.mturk_agent.reject_work()
# self.mturk_agent.pay_bonus(1000) # Pay $1000 as bonus
# self.mturk_agent.block_worker() # Block this worker from future HITs
pass
| 30.72 | 79 | 0.619792 | 284 | 2,304 | 4.880282 | 0.419014 | 0.11544 | 0.10101 | 0.04329 | 0.307359 | 0.251082 | 0.251082 | 0.251082 | 0.204906 | 0.204906 | 0 | 0.011714 | 0.296007 | 2,304 | 74 | 80 | 31.135135 | 0.842787 | 0.43967 | 0 | 0.76 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.4 | false | 0.12 | 0.04 | 0.08 | 0.6 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 4 |
48524b96a63c4f9c7f28c9f360015d66badfb200 | 68 | py | Python | __main__.py | lwhjon/repo-labels-cli | 5a16638f45f0b13e9fdddc59b1a0952f3ba51287 | [
"MIT"
] | 1 | 2021-07-14T06:32:50.000Z | 2021-07-14T06:32:50.000Z | __main__.py | lwhjon/repo-labels-cli | 5a16638f45f0b13e9fdddc59b1a0952f3ba51287 | [
"MIT"
] | 2 | 2021-08-31T18:14:03.000Z | 2021-12-29T18:14:25.000Z | __main__.py | lwhjon/repo-labels-cli | 5a16638f45f0b13e9fdddc59b1a0952f3ba51287 | [
"MIT"
] | null | null | null | import repolabels
if __name__ == "__main__":
repolabels.main()
| 13.6 | 26 | 0.705882 | 7 | 68 | 5.714286 | 0.714286 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.176471 | 68 | 4 | 27 | 17 | 0.714286 | 0 | 0 | 0 | 0 | 0 | 0.117647 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.333333 | 0 | 0.333333 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
4871e17eb202394f9905e405eff685389769acab | 12,132 | py | Python | tests/unit/test_config.py | neuro-inc/platform-reports | 161c18733370235af0b63a772de49343e956c35c | [
"Apache-2.0"
] | null | null | null | tests/unit/test_config.py | neuro-inc/platform-reports | 161c18733370235af0b63a772de49343e956c35c | [
"Apache-2.0"
] | 9 | 2021-12-23T03:10:40.000Z | 2022-03-31T03:15:52.000Z | tests/unit/test_config.py | neuro-inc/platform-reports | 161c18733370235af0b63a772de49343e956c35c | [
"Apache-2.0"
] | null | null | null | from pathlib import Path
from yarl import URL
from platform_reports.config import (
EnvironConfigFactory,
GrafanaProxyConfig,
KubeClientAuthType,
KubeConfig,
MetricsConfig,
PlatformAuthConfig,
PlatformServiceConfig,
PrometheusProxyConfig,
SentryConfig,
ServerConfig,
ZipkinConfig,
)
class TestEnvironConfigFactory:
def test_create_metrics_defaults(self) -> None:
env = {
"NP_CONFIG_URL": "http://dev.neu.ro",
"NP_API_URL": "http://dev.neu.ro/api/v1",
"NP_TOKEN": "token",
"NP_CLUSTER_NAME": "default",
"NP_NODE_NAME": "node",
"NP_KUBE_URL": "https://kubernetes.default.svc",
}
result = EnvironConfigFactory(env).create_metrics()
assert result == MetricsConfig(
server=ServerConfig(),
platform_config=PlatformServiceConfig(
url=URL("http://dev.neu.ro"), token="token"
),
platform_api=PlatformServiceConfig(
url=URL("http://dev.neu.ro/api/v1"), token="token"
),
kube=KubeConfig(
url=URL("https://kubernetes.default.svc"),
auth_type=KubeClientAuthType.NONE,
),
cluster_name="default",
node_name="node",
)
def test_create_metrics_custom(self) -> None:
env = {
"NP_METRICS_API_SCHEME": "http",
"NP_METRICS_API_HOST": "metrics",
"NP_METRICS_API_PORT": "9500",
"NP_CONFIG_URL": "http://dev.neu.ro",
"NP_API_URL": "http://dev.neu.ro/api/v1",
"NP_TOKEN": "token",
"NP_CLUSTER_NAME": "default",
"NP_NODE_NAME": "node",
"NP_CLOUD_PROVIDER": "aws",
"NP_REGION": "us-east-1",
"NP_GCP_SERVICE_ACCOUNT_KEY_PATH": "sa.json",
"NP_AZURE_PRICES_URL": "https://azure-prices",
"NP_JOBS_NAMESPACE": "platform-jobs",
"NP_NODE_POOL_LABEL": "node-pool",
"NP_NODE_PREEMPTIBLE_LABEL": "preemptible",
"NP_JOB_LABEL": "job",
"NP_ZIPKIN_URL": "https://zipkin:9411",
"NP_SENTRY_DSN": "https://sentry",
"NP_SENTRY_CLUSTER_NAME": "test",
"NP_KUBE_URL": "https://kubernetes.default.svc",
}
result = EnvironConfigFactory(env).create_metrics()
assert result == MetricsConfig(
server=ServerConfig(scheme="http", host="metrics", port=9500),
platform_config=PlatformServiceConfig(
url=URL("http://dev.neu.ro"), token="token"
),
platform_api=PlatformServiceConfig(
url=URL("http://dev.neu.ro/api/v1"), token="token"
),
kube=KubeConfig(
url=URL("https://kubernetes.default.svc"),
auth_type=KubeClientAuthType.NONE,
),
cluster_name="default",
node_name="node",
cloud_provider="aws",
region="us-east-1",
gcp_service_account_key_path=Path("sa.json"),
azure_prices_url=URL("https://azure-prices"),
jobs_namespace="platform-jobs",
node_pool_label="node-pool",
node_preemptible_label="preemptible",
job_label="job",
zipkin=ZipkinConfig(
url=URL("https://zipkin:9411"), app_name="platform-metrics-exporter"
),
sentry=SentryConfig(
dsn=URL("https://sentry"),
app_name="platform-metrics-exporter",
cluster_name="test",
),
)
def test_create_prometheus_proxy_defaults(self) -> None:
env = {
"NP_CLUSTER_NAME": "default",
"NP_AUTH_ACCESS_TOKEN_COOKIE_NAMES": "sat,dat",
"NP_PROMETHEUS_HOST": "prometheus",
"NP_PROMETHEUS_PORT": "9090",
"NP_AUTH_URL": "-",
"NP_TOKEN": "token",
"NP_API_URL": "https://dev.neu.ro/api/v1",
}
result = EnvironConfigFactory(env).create_prometheus_proxy()
assert result == PrometheusProxyConfig(
cluster_name="default",
access_token_cookie_names=["sat", "dat"],
server=ServerConfig(),
prometheus_server=ServerConfig(host="prometheus", port=9090),
platform_auth=PlatformAuthConfig(url=None, token="token"),
platform_api=PlatformServiceConfig(
url=URL("https://dev.neu.ro/api/v1"), token="token"
),
)
def test_create_prometheus_proxy_custom(self) -> None:
env = {
"NP_CLUSTER_NAME": "default",
"NP_AUTH_ACCESS_TOKEN_COOKIE_NAMES": "sat,dat",
"NP_REPORTS_API_SCHEME": "https",
"NP_REPORTS_API_HOST": "platform-reports",
"NP_REPORTS_API_PORT": "80",
"NP_PROMETHEUS_SCHEME": "https",
"NP_PROMETHEUS_HOST": "prometheus",
"NP_PROMETHEUS_PORT": "9090",
"NP_AUTH_URL": "https://dev.neu.ro",
"NP_TOKEN": "token",
"NP_API_URL": "https://dev.neu.ro/api/v1",
"NP_ZIPKIN_URL": "https://zipkin:9411",
"NP_SENTRY_DSN": "https://sentry",
"NP_SENTRY_CLUSTER_NAME": "test",
}
result = EnvironConfigFactory(env).create_prometheus_proxy()
assert result == PrometheusProxyConfig(
cluster_name="default",
access_token_cookie_names=["sat", "dat"],
server=ServerConfig(scheme="https", host="platform-reports", port=80),
prometheus_server=ServerConfig(
scheme="https", host="prometheus", port=9090
),
platform_auth=PlatformAuthConfig(
url=URL("https://dev.neu.ro"), token="token"
),
platform_api=PlatformServiceConfig(
url=URL("https://dev.neu.ro/api/v1"), token="token"
),
zipkin=ZipkinConfig(
url=URL("https://zipkin:9411"), app_name="platform-prometheus-proxy"
),
sentry=SentryConfig(
dsn=URL("https://sentry"),
app_name="platform-prometheus-proxy",
cluster_name="test",
),
)
def test_create_grafana_proxy_defaults(self) -> None:
env = {
"NP_CLUSTER_NAME": "default",
"NP_AUTH_ACCESS_TOKEN_COOKIE_NAMES": "sat,dat",
"NP_GRAFANA_HOST": "grafana",
"NP_GRAFANA_PORT": "3000",
"NP_AUTH_URL": "-",
"NP_TOKEN": "token",
"NP_API_URL": "https://dev.neu.ro/api/v1",
}
result = EnvironConfigFactory(env).create_grafana_proxy()
assert result == GrafanaProxyConfig(
cluster_name="default",
access_token_cookie_names=["sat", "dat"],
server=ServerConfig(),
grafana_server=ServerConfig(host="grafana", port=3000),
platform_auth=PlatformAuthConfig(url=None, token="token"),
platform_api=PlatformServiceConfig(
url=URL("https://dev.neu.ro/api/v1"), token="token"
),
)
def test_create_grafana_proxy_custom(self) -> None:
env = {
"NP_CLUSTER_NAME": "default",
"NP_AUTH_ACCESS_TOKEN_COOKIE_NAMES": "sat,dat",
"NP_REPORTS_API_SCHEME": "https",
"NP_REPORTS_API_HOST": "platform-reports",
"NP_REPORTS_API_PORT": "80",
"NP_GRAFANA_SCHEME": "https",
"NP_GRAFANA_HOST": "grafana",
"NP_GRAFANA_PORT": "3000",
"NP_AUTH_URL": "https://dev.neu.ro",
"NP_TOKEN": "token",
"NP_API_URL": "https://dev.neu.ro/api/v1",
"NP_ZIPKIN_URL": "https://zipkin:9411",
"NP_SENTRY_DSN": "https://sentry",
"NP_SENTRY_CLUSTER_NAME": "test",
}
result = EnvironConfigFactory(env).create_grafana_proxy()
assert result == GrafanaProxyConfig(
cluster_name="default",
access_token_cookie_names=["sat", "dat"],
server=ServerConfig(scheme="https", host="platform-reports", port=80),
grafana_server=ServerConfig(scheme="https", host="grafana", port=3000),
platform_auth=PlatformAuthConfig(
url=URL("https://dev.neu.ro"), token="token"
),
platform_api=PlatformServiceConfig(
url=URL("https://dev.neu.ro/api/v1"), token="token"
),
zipkin=ZipkinConfig(
url=URL("https://zipkin:9411"), app_name="platform-grafana-proxy"
),
sentry=SentryConfig(
dsn=URL("https://sentry"),
app_name="platform-grafana-proxy",
cluster_name="test",
),
)
def test_create_zipkin_none(self) -> None:
result = EnvironConfigFactory({}).create_zipkin(default_app_name="app")
assert result is None
def test_create_zipkin_default(self) -> None:
env = {"NP_ZIPKIN_URL": "https://zipkin:9411"}
result = EnvironConfigFactory(env).create_zipkin(default_app_name="app")
assert result == ZipkinConfig(url=URL("https://zipkin:9411"), app_name="app")
def test_create_zipkin_custom(self) -> None:
env = {
"NP_ZIPKIN_URL": "https://zipkin:9411",
"NP_ZIPKIN_APP_NAME": "api",
"NP_ZIPKIN_SAMPLE_RATE": "1",
}
result = EnvironConfigFactory(env).create_zipkin(default_app_name="app")
assert result == ZipkinConfig(
url=URL("https://zipkin:9411"), app_name="api", sample_rate=1
)
def test_create_sentry_none(self) -> None:
result = EnvironConfigFactory({}).create_sentry(default_app_name="app")
assert result is None
def test_create_sentry_default(self) -> None:
env = {
"NP_SENTRY_DSN": "https://sentry",
"NP_SENTRY_CLUSTER_NAME": "test",
}
result = EnvironConfigFactory(env).create_sentry(default_app_name="app")
assert result == SentryConfig(
dsn=URL("https://sentry"), app_name="app", cluster_name="test"
)
def test_create_sentry_custom(self) -> None:
env = {
"NP_SENTRY_DSN": "https://sentry",
"NP_SENTRY_APP_NAME": "api",
"NP_SENTRY_CLUSTER_NAME": "test",
"NP_SENTRY_SAMPLE_RATE": "1",
}
result = EnvironConfigFactory(env).create_sentry(default_app_name="app")
assert result == SentryConfig(
dsn=URL("https://sentry"),
app_name="api",
cluster_name="test",
sample_rate=1,
)
def test_create_kube(self) -> None:
env = {
"NP_KUBE_URL": "https://kubernetes.default.svc",
"NP_KUBE_AUTH_TYPE": "token",
"NP_KUBE_TOKEN": "k8s-token",
"NP_KUBE_TOKEN_PATH": "k8s-token-path",
"NP_KUBE_CERT_AUTHORITY_DATA": "k8s-ca-data",
"NP_KUBE_CERT_AUTHORITY_PATH": "k8s-ca-path",
"NP_KUBE_CLIENT_CERT_PATH": "k8s-client-cert-path",
"NP_KUBE_CLIENT_KEY_PATH": "k8s-client-key-path",
"NP_KUBE_CONN_TIMEOUT": "100",
"NP_KUBE_READ_TIMEOUT": "200",
"NP_KUBE_CONN_POOL_SIZE": "300",
"NP_KUBE_CONN_KEEP_ALIVE_TIMEOUT": "400",
}
result = EnvironConfigFactory(env).create_kube()
assert result == KubeConfig(
url=URL("https://kubernetes.default.svc"),
auth_type=KubeClientAuthType.TOKEN,
token="k8s-token",
token_path="k8s-token-path",
cert_authority_data_pem="k8s-ca-data",
cert_authority_path="k8s-ca-path",
client_cert_path="k8s-client-cert-path",
client_key_path="k8s-client-key-path",
conn_timeout_s=100,
read_timeout_s=200,
conn_pool_size=300,
conn_keep_alive_timeout_s=400,
)
| 37.329231 | 85 | 0.561161 | 1,252 | 12,132 | 5.128594 | 0.091853 | 0.043607 | 0.024918 | 0.020558 | 0.800498 | 0.745678 | 0.705653 | 0.667653 | 0.651145 | 0.631833 | 0 | 0.016805 | 0.303495 | 12,132 | 324 | 86 | 37.444444 | 0.743077 | 0 | 0 | 0.588235 | 0 | 0 | 0.286515 | 0.057781 | 0 | 0 | 0 | 0 | 0.044983 | 1 | 0.044983 | false | 0 | 0.010381 | 0 | 0.058824 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
6f9000a11b2cc5bd11480c338dedf03621015a05 | 183 | py | Python | viocetotext/setup.py | ASaiun/voice_to_text | 6afcf3403c6d4365e7d1c7586fe250d0ade83b12 | [
"Apache-2.0"
] | null | null | null | viocetotext/setup.py | ASaiun/voice_to_text | 6afcf3403c6d4365e7d1c7586fe250d0ade83b12 | [
"Apache-2.0"
] | null | null | null | viocetotext/setup.py | ASaiun/voice_to_text | 6afcf3403c6d4365e7d1c7586fe250d0ade83b12 | [
"Apache-2.0"
] | null | null | null | #!/usr/bin/env python
# -*- coding: utf-8 -*-
# @Time : 11/28/2017 11:41 AM
# @Author : Siyuan(Saiun)
# @Site :
# @File : setup.py.py
# @Software: PyCharm Community Edition | 26.142857 | 38 | 0.590164 | 26 | 183 | 4.153846 | 0.923077 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.090278 | 0.213115 | 183 | 7 | 38 | 26.142857 | 0.659722 | 0.928962 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
6f90d64459bbbda4b0e6e2e16202d5046a2ed99b | 31,520 | py | Python | college/models.py | dwillis/fumblerooski | 68a1d4f759ac7c23023ccdcca558a0fbcfb1e48c | [
"BSD-3-Clause"
] | 6 | 2015-06-30T14:11:07.000Z | 2021-01-13T12:11:36.000Z | college/models.py | dwillis/fumblerooski | 68a1d4f759ac7c23023ccdcca558a0fbcfb1e48c | [
"BSD-3-Clause"
] | null | null | null | college/models.py | dwillis/fumblerooski | 68a1d4f759ac7c23023ccdcca558a0fbcfb1e48c | [
"BSD-3-Clause"
] | 4 | 2017-06-23T00:14:34.000Z | 2022-03-03T20:10:43.000Z | from django.db import models
from django import forms
import datetime
from django.template.defaultfilters import slugify
from django.conf import settings
CURRENT_SEASON = getattr(settings, 'CURRENT_SEASON', datetime.date.today().year)
STATUS_CHOICES = (
('FR', 'Freshman'),
('SO', 'Sophomore'),
('JR', 'Junior'),
('SR', 'Senior'),
)
POSITION_TYPE_CHOICES = (
('O', 'Offense'),
('D', 'Defense'),
('S', 'Special Teams'),
)
SIDE_CHOICES = (
('O', 'Own'),
('P', 'Opponents'),
)
RESULT_CHOICES = (
('W', 'Win'),
('L', 'Loss'),
('T', 'Tie'),
)
GAME_TYPE_CHOICES = (
('H', 'Home'),
('A', 'Away'),
('N', 'Neutral Site'),
)
PLAY_CHOICES = (
('R', 'Run'),
('P', 'Pass'),
('F', 'Field Goal'),
('X', 'Extra Point'),
('N', 'Penalty'),
('K', 'Kickoff'),
('U', 'Punt'),
('T', 'Turnover'),
)
DIVISION_CHOICES = (
('B', 'Bowl Subdivision'),
('C', 'Championship Subdivision'),
('D', 'Division II'),
('T', 'Division III'),
)
class State(models.Model):
id = models.CharField(max_length=2, editable=False, primary_key=True)
name = models.CharField(max_length=50)
def __unicode__(self):
return self.name
def get_absolute_url(self):
return "/states/%s/" % self.id.lower()
class StateForm(forms.Form):
name = forms.ModelChoiceField(queryset=State.objects.all().order_by('name'))
class City(models.Model):
name = models.CharField(max_length=75)
slug = models.SlugField(max_length=75)
state = models.ForeignKey(State, null=True, blank=True)
def __unicode__(self):
if self.state:
return "%s, %s" % (self.name, self.state.id)
else:
return self.name
def get_absolute_url(self):
return "/college/states/%s/%s/" % (self.state.id.lower(), self.slug)
class Meta:
verbose_name_plural = 'cities'
class Week(models.Model):
season = models.IntegerField()
week_num = models.IntegerField()
end_date = models.DateField()
def __unicode__(self):
return "Week %s, %s" % (self.week_num, self.season)
def week_games_url(self):
return "/college/seasons/%s/week/%s/" % (self.season, self.week_num)
class Conference(models.Model):
abbrev = models.CharField(max_length=10)
name = models.CharField(max_length=90)
def __unicode__(self):
return self.name
def get_absolute_url(self):
return '/college/conferences/%s/' % self.abbrev.lower()
class College(models.Model):
name = models.CharField(max_length=90)
slug = models.SlugField(max_length=90)
drive_slug = models.CharField(max_length=90)
# city = models.ForeignKey(City, blank=True) #
state = models.ForeignKey(State, blank=True)
official_url = models.CharField(max_length=120, blank=True)
official_rss = models.CharField(max_length=120, blank=True)
updated = models.BooleanField()
def __unicode__(self):
return self.name
def get_absolute_url(self):
return '/college/teams/%s/' % self.slug
def current_record(self):
current_season = self.collegeyear_set.get(season=datetime.date.today()).year
return "(%d-%d)" % (current_season.wins, current_season.losses)
class Meta:
ordering = ['name', 'state']
class CollegeYear(models.Model):
college = models.ForeignKey(College)
season = models.IntegerField()
wins = models.IntegerField(default=0)
losses = models.IntegerField(default=0)
ties = models.IntegerField(default=0)
conference_wins = models.IntegerField(default=0)
conference_losses = models.IntegerField(default=0)
conference_ties = models.IntegerField(default=0)
freshmen = models.IntegerField(default=0)
sophomores = models.IntegerField(default=0)
juniors = models.IntegerField(default=0)
seniors = models.IntegerField(default=0)
conference = models.ForeignKey(Conference, null=True, blank=True)
division = models.CharField(max_length=1, choices=DIVISION_CHOICES)
def __unicode__(self):
return "%s - %s" % (self.college.name, str(self.season))
def game_count(self):
return self.wins+self.losses+self.ties
def get_ncaa_week_url(self):
return 'http://web1.ncaa.org/football/exec/rankingSummary?year=%d&org=%d&week=' % (self.season, self.college.id)
def get_absolute_url(self):
return "/college/teams/%s/%s/" % (self.college.slug, self.season)
def get_conference_url(self):
if self.conference:
return "/college/conferences/%s/%s/" % (self.conference.abbrev, self.season)
def coaching_staff_url(self):
return self.get_absolute_url()+'coaches/'
def record(self):
if self.ties:
return "%s-%s-%s" % (self.wins, self.losses, self.ties)
else:
return "%s-%s" % (self.wins, self.losses)
def conference_record(self):
if self.conference_ties:
return "%s-%s-%s" % (self.conference_wins, self.conference_losses, self.conference_ties)
else:
return "%s-%s" % (self.conference_wins, self.conference_losses)
def coach_total(self):
return len(self.collegecoach_set.filter(end_date__isnull=True))
class Meta:
ordering = ['college', '-season']
class Coach(models.Model):
ncaa_name = models.CharField(max_length=90)
first_name = models.CharField(max_length=75)
last_name = models.CharField(max_length=75)
slug = models.CharField(max_length=75, editable=False)
college = models.ForeignKey(College, null=True, blank=True, related_name='School')
grad_year = models.IntegerField(null=True, blank=True)
birth_date = models.DateField(null=True, blank=True)
years = models.IntegerField(default=0, blank=True)
wins = models.IntegerField(default=0, blank=True)
losses = models.IntegerField(default=0, blank=True)
ties = models.IntegerField(default=0, blank=True)
def __unicode__(self):
return self.first_name + " " + self.last_name
def save(self):
super(Coach, self).save()
self.slug = '%s-%s-%s' % (str(self.id), slugify(self.first_name), slugify(self.last_name))
super(Coach, self).save()
def get_absolute_url(self):
return '/coaches/detail/%s/' % self.slug
def full_name(self):
return self.first_name + " " + self.last_name
def current_school(self):
try:
current_school = self.collegecoach_set.get(collegeyear__season__exact = CURRENT_SEASON, end_date = None).collegeyear.college
except:
current_school = None
return current_school
def seasons_at_school(self,school):
return [sorted([cy.collegeyear.season for cy in self.collegecoach_set.all() if cy.collegeyear.college == school])]
def seasons_at_current_school(self):
return len([cy.collegeyear.college.id for cy in self.collegecoach_set.all() if cy.collegeyear.college.id == self.current_school().id])
def current_job(self):
if self.current_school():
cy = self.collegecoach_set.filter(collegeyear__college=self.current_school).order_by('start_date')[0].jobs_display()
return cy
else:
return None
def head_coach_experience(self):
if 1 in sum([[j.id for j in job.jobs.all() if j.id == 1] for job in self.collegecoach_set.all()],[]):
return "Yes"
else:
return "No"
def years_since_2000(self):
return self.collegecoach_set.all().count()
def years_at_alma_mater_since_2000(self):
return len([a for a in self.collegecoach_set.all() if self.college == a.collegeyear.college])
def states_coached_in(self):
states = {}
state_list = [s.collegeyear.college.state.id for s in self.collegecoach_set.all()]
[states.setdefault(e,500) for e in state_list if e not in states]
return states
def coaching_peers(self):
from django.db import connection
cursor = connection.cursor()
year_ids = [str(c.collegeyear.id) for c in self.collegecoach_set.all()]
cursor.execute("SELECT distinct college_coach.id FROM college_coach INNER JOIN college_collegecoach ON college_coach.id=college_collegecoach.coach_id WHERE college_collegecoach.collegeyear_id IN (%s)" % ','.join(year_ids))
results = cursor.fetchall()
ids = [c[0] for c in results]
return Coach.objects.filter(id__in=ids).exclude(id=self.id)
class Meta:
ordering = ['last_name', 'first_name']
verbose_name_plural = 'Coaches'
class CoachForm(forms.Form):
name = forms.CharField(max_length=50, initial='Last name')
class CoachDetailForm(forms.Form):
coaches = forms.ModelChoiceField(queryset=Coach.objects.none())
def __init__(self, coaches, *args, **kwargs):
super(CoachDetailForm, self).__init__(*args, **kwargs)
self.fields["coaches"].queryset = coaches
class CoachingJob(models.Model):
name = models.CharField(max_length=75)
slug = models.SlugField(max_length=75)
def __unicode__(self):
return self.name
class CollegeCoach(models.Model):
coach = models.ForeignKey(Coach)
collegeyear = models.ForeignKey(CollegeYear)
jobs = models.ManyToManyField(CoachingJob)
start_date = models.DateField(null=True, blank=True)
end_date = models.DateField(null=True, blank=True)
is_head_coach = models.BooleanField(default=False)
def __unicode__(self):
return "%s: %s" % (self.coach, self.collegeyear)
def get_absolute_url(self):
return self.coach.get_absolute_url()
def jobs_display(self):
return ", ".join([x.name for x in self.jobs.all()])
def is_current_job(self):
if self.collegeyear.season == CURRENT_SEASON and self.end_date == None:
return True
else:
return False
def partial_season(self):
if end_date:
return True
else:
return False
def feed_date(self):
if self.start_date and self.end_date:
return self.end_date
elif self.start_date:
return self.start_date
elif self.end_date:
return self.end_date
def feed_action(self):
if self.start_date and self.end_date:
return "Departed"
elif self.start_date:
return "Hired"
elif self.end_date:
return "Departed"
class Meta:
ordering = ['coach__last_name','-collegeyear__season']
verbose_name_plural = 'College coaches'
class CollegeTotal(models.Model):
college = models.ForeignKey(College)
season = models.IntegerField()
third_down_attempts = models.IntegerField(default=0)
third_down_conversions = models.IntegerField(default=0)
fourth_down_attempts = models.IntegerField(default=0)
fourth_down_conversions = models.IntegerField(default=0)
first_downs_rushing = models.IntegerField(default=0)
first_downs_passing = models.IntegerField(default=0)
first_downs_penalty = models.IntegerField(default=0)
first_downs_total = models.IntegerField(default=0)
penalties = models.IntegerField(default=0)
penalty_yards = models.IntegerField(default=0)
fumbles = models.IntegerField(default=0)
fumbles_lost = models.IntegerField(default=0)
rushes = models.IntegerField(default=0)
rush_gain = models.IntegerField(default=0)
rush_loss = models.IntegerField(default=0)
rush_net = models.IntegerField(default=0)
rush_touchdowns = models.IntegerField(default=0)
total_plays = models.IntegerField(default=0)
total_yards = models.IntegerField(default=0)
pass_attempts = models.IntegerField(default=0)
pass_completions = models.IntegerField(default=0)
pass_interceptions = models.IntegerField(default=0)
pass_yards = models.IntegerField(default=0)
pass_touchdowns = models.IntegerField(default=0)
receptions = models.IntegerField(default=0)
receiving_yards = models.IntegerField(default=0)
receiving_touchdowns = models.IntegerField(default=0)
punts = models.IntegerField(default=0)
punt_yards = models.IntegerField(default=0)
punt_returns = models.IntegerField(default=0)
punt_return_yards = models.IntegerField(default=0)
punt_return_touchdowns = models.IntegerField(default=0)
kickoff_returns = models.IntegerField(default=0)
kickoff_return_yards = models.IntegerField(default=0)
kickoff_return_touchdowns = models.IntegerField(default=0)
touchdowns = models.IntegerField(default=0)
pat_attempts = models.IntegerField(default=0)
pat_made = models.IntegerField(default=0)
two_point_conversion_attempts = models.IntegerField(default=0)
two_point_conversions = models.IntegerField(default=0)
field_goal_attempts = models.IntegerField(default=0)
field_goals_made = models.IntegerField(default=0)
points = models.IntegerField(default=0)
class Position(models.Model):
abbrev = models.CharField(max_length=5)
name = models.CharField(max_length=25)
plural_name = models.CharField(max_length=25)
position_type = models.CharField(max_length=1, choices=POSITION_TYPE_CHOICES)
def __unicode__(self):
return self.abbrev
def get_absolute_url(self):
return '/recruits/positions/%s/' % self.abbrev.lower()
class BowlGame(models.Model):
name = models.CharField(max_length=75)
slug = models.CharField(max_length=75)
city = models.ForeignKey(City)
def __unicode__(self):
return self.name
def get_absolute_url(self):
return '/college/bowl-games/%s/' % self.slug
class Game(models.Model):
season = models.IntegerField()
team1 = models.ForeignKey(CollegeYear, related_name='team1')
coach1 = models.ForeignKey(Coach, null=True, related_name='first_coach')
team2 = models.ForeignKey(CollegeYear, related_name='team2')
coach2 = models.ForeignKey(Coach, null=True, related_name='second_coach')
date = models.DateField()
week = models.ForeignKey(Week)
t1_game_type = models.CharField(max_length=1, choices=GAME_TYPE_CHOICES)
t1_result = models.CharField(max_length=1, choices=RESULT_CHOICES, blank=True)
team1_score = models.IntegerField(null=True, blank=True)
team2_score = models.IntegerField(null=True, blank=True)
site = models.CharField(max_length=90, blank=True)
attendance = models.IntegerField(null=True, blank=True)
overtime = models.CharField(max_length=5, blank=True)
ncaa_xml = models.CharField(max_length=120, blank=True)
duration = models.TimeField(null=True, blank=True)
has_drives = models.BooleanField()
has_stats = models.BooleanField()
has_player_stats = models.BooleanField()
is_conference_game = models.BooleanField()
is_bowl_game = models.BooleanField()
bowl_game = models.ForeignKey(BowlGame, null=True, blank=True)
def __unicode__(self):
return '%s vs. %s, %s' % (self.team1, self.team2, self.date)
def get_absolute_url(self):
return '/college/teams/%s/vs/%s/%s/%s/%s/' % (self.team1.college.slug, self.team2.college.slug, self.date.year, self.date.month, self.date.day)
def get_matchup_url(self):
return '/college/teams/%s/vs/%s/' % (self.team1.college.slug, self.team2.college.slug)
def get_reverse_url(self):
return '/college/teams/%s/vs/%s/%s/%s/%s/' % (self.team2.college.slug, self.team1.college.slug, self.date.year, self.date.month, self.date.day)
def get_ncaa_xml_url(self):
return 'http://web1.ncaa.org/d1mfb/%s/Internet/worksheets/%s.xml' % (self.season, self.ncaa_xml.strip())
def get_ncaa_drive_url(self):
return "http://web1.ncaa.org/mfb/driveSummary.jsp?acadyr=%s&h=%s&v=%s&date=%s&game=%s" % (self.season, self.team1.college.id, self.team2.college.id, self.date.strftime("%d-%b-%y").upper(), self.ncaa_xml.strip())
def get_play_by_play_url(self):
return "http://web1.ncaa.org/mfb/driveSummary.jsp?expand=A&acadyr=%s&h=%s&v=%s&date=%s&game=%s" % (self.season, self.team1.college.id, self.team2.college.id, self.date.strftime("%d-%b-%y").upper(), self.ncaa_xml.strip())
def margin(self):
return self.team1_score-self.team2_score
def display(self):
if self.margin() > 0:
return "%s %s, %s %s" % (self.team1.college, self.team1_score, self.team2.college, self.team2_score)
else:
return "%s %s, %s %s" % (self.team2.college, self.team2_score, self.team1.college, self.team1_score)
class QuarterScore(models.Model):
"Represents a team's scoring during a quarter of a game. OT periods begin with 5."
"Not implemented yet."
game = models.ForeignKey(Game)
team = models.ForeignKey(CollegeYear)
season = models.IntegerField()
quarter = models.IntegerField(default=CURRENT_SEASON)
points = models.PositiveIntegerField(default=0)
def __unicode__(self):
return "%s - %s" (self.team, self.quarter)
class DriveOutcome(models.Model):
abbrev = models.CharField(max_length=10)
name = models.CharField(max_length=50, null=True)
slug = models.SlugField(max_length=50, null=True)
def __unicode__(self):
return self.name
class GameDrive(models.Model):
season = models.IntegerField()
game = models.ForeignKey(Game)
team = models.ForeignKey(CollegeYear)
drive = models.IntegerField()
quarter = models.PositiveSmallIntegerField()
start_how = models.CharField(max_length=25)
start_time = models.TimeField()
start_position = models.IntegerField()
start_side = models.CharField(max_length=1, choices=SIDE_CHOICES)
end_result = models.ForeignKey(DriveOutcome)
end_time = models.TimeField()
end_position = models.IntegerField(null=True)
end_side = models.CharField(max_length=1, choices=SIDE_CHOICES)
plays = models.IntegerField()
yards = models.IntegerField()
time_of_possession = models.TimeField()
def __unicode__(self):
return "%s: %s drive %s" % (self.game, self.team, self.drive)
class GameOffense(models.Model):
game = models.ForeignKey(Game)
team = models.ForeignKey(CollegeYear)
season = models.IntegerField()
third_down_attempts = models.IntegerField(default=0)
third_down_conversions = models.IntegerField(default=0)
fourth_down_attempts = models.IntegerField(default=0)
fourth_down_conversions = models.IntegerField(default=0)
time_of_possession = models.TimeField(null=True)
first_downs_rushing = models.IntegerField(default=0)
first_downs_passing = models.IntegerField(default=0)
first_downs_penalty = models.IntegerField(default=0)
first_downs_total = models.IntegerField(default=0)
penalties = models.IntegerField(default=0)
penalty_yards = models.IntegerField(default=0)
fumbles = models.IntegerField(default=0)
fumbles_lost = models.IntegerField(default=0)
rushes = models.IntegerField(default=0)
rush_gain = models.IntegerField(default=0)
rush_loss = models.IntegerField(default=0)
rush_net = models.IntegerField(default=0)
rush_touchdowns = models.IntegerField(default=0)
total_plays = models.IntegerField(default=0)
total_yards = models.IntegerField(default=0)
pass_attempts = models.IntegerField(default=0)
pass_completions = models.IntegerField(default=0)
pass_interceptions = models.IntegerField(default=0)
pass_yards = models.IntegerField(default=0)
pass_touchdowns = models.IntegerField(default=0)
receptions = models.IntegerField(default=0)
receiving_yards = models.IntegerField(default=0)
receiving_touchdowns = models.IntegerField(default=0)
punts = models.IntegerField(default=0)
punt_yards = models.IntegerField(default=0)
punt_returns = models.IntegerField(default=0)
punt_return_yards = models.IntegerField(default=0)
punt_return_touchdowns = models.IntegerField(default=0)
kickoff_returns = models.IntegerField(default=0)
kickoff_return_yards = models.IntegerField(default=0)
kickoff_return_touchdowns = models.IntegerField(default=0)
touchdowns = models.IntegerField(default=0)
pat_attempts = models.IntegerField(default=0)
pat_made = models.IntegerField(default=0)
two_point_conversion_attempts = models.IntegerField(default=0)
two_point_conversions = models.IntegerField(default=0)
field_goal_attempts = models.IntegerField(default=0)
field_goals_made = models.IntegerField(default=0)
points = models.IntegerField(default=0)
def __unicode__(self):
return '%s - %s' % (self.game, self.team)
def third_down_rate(self):
return float(self.third_down_conversions)/float(self.third_down_attempts)
def field_goal_rate(self):
return float(self.field_goals_made)/float(self.field_goal_attempts)
def penalty_yard_ratio(self):
return float(self.penalty_yards)/float(self.total_yards)
def yards_per_reception(self):
return float(self.receiving_yards)/float(self.receptions)
def yards_per_pass_attempt(self):
return float(self.receiving_yards)/(self.pass_attempts)
def rushing_first_downs_pct(self):
return float(self.first_downs_rushing)/float(self.first_downs_total)*100
"""
Returns a floating-point number representing the number
of touchdowns per rushing attempt for a single game.
"""
def touchdowns_per_rushes(self):
return float(self.rush_touchdowns)/float(self.rushes)*100
"""
Returns the opponent for a team's given Game Offense record.
"""
def opponent(self):
if self.team == self.game.team2:
return self.game.team1
else:
return self.game.team2
class GameDefense(models.Model):
game = models.ForeignKey(Game)
team = models.ForeignKey(CollegeYear)
season = models.IntegerField()
safeties = models.IntegerField(default=0)
unassisted_tackles = models.IntegerField(default=0)
assisted_tackles = models.IntegerField(default=0)
unassisted_tackles_for_loss = models.IntegerField(default=0)
assisted_tackles_for_loss = models.IntegerField(default=0)
tackles_for_loss_yards = models.IntegerField(default=0)
unassisted_sacks = models.IntegerField(default=0)
assisted_sacks = models.IntegerField(default=0)
sack_yards = models.IntegerField(default=0)
defensive_interceptions = models.IntegerField(default=0)
defensive_interception_yards = models.IntegerField(default=0)
defensive_interception_touchdowns = models.IntegerField(default=0)
pass_breakups = models.IntegerField(default=0)
fumbles_forced = models.IntegerField(default=0)
fumbles_number = models.IntegerField(default=0)
fumbles_yards = models.IntegerField(default=0)
fumbles_touchdowns = models.IntegerField(default=0)
def __unicode__(self):
return '%s - %s' % (self.game, self.team)
class Player(models.Model):
name = models.CharField(max_length=120)
slug = models.SlugField(max_length=120)
team = models.ForeignKey(CollegeYear)
season = models.IntegerField()
position = models.ForeignKey(Position)
number = models.CharField(max_length=4)
games_played = models.PositiveIntegerField(default=0)
status = models.CharField(max_length=2, choices=STATUS_CHOICES)
def __unicode__(self):
return u"%s - %s" % (self.name, self.team)
def get_absolute_url(self):
return '/college/teams/%s/%s/players/%s/' % (self.team.college.slug, self.season, self.slug)
def get_team_position_url(self):
return '/college/teams/%s/%s/players/positions/%s/' % (self.team.college.slug, self.season, self.position.abbrev.lower())
def get_team_class_url(self):
return '/college/teams/%s/%s/players/class/%s/' % (self.team.college.slug, self.season, self.status.lower())
class Meta:
ordering = ['id']
class PlayerCollegeCareer(models.Model):
player = models.ForeignKey(Player)
first_season = models.ForeignKey(CollegeYear, related_name='first_season')
last_season = models.ForeignKey(CollegeYear, related_name='last_season')
total_games = models.IntegerField(null=True, blank=True)
def __unicode__(self):
return self.player.name.full_name()
class PlayerGame(models.Model):
player = models.ForeignKey(Player)
game = models.ForeignKey(Game)
played = models.BooleanField()
starter = models.BooleanField()
total_plays = models.IntegerField()
total_yards = models.IntegerField()
def __unicode__(self):
return self.player.name
class PlayerRush(models.Model):
player = models.ForeignKey(Player)
game = models.ForeignKey(Game)
rushes = models.IntegerField(default=0)
gain = models.IntegerField(default=0)
loss = models.IntegerField(default=0)
net = models.IntegerField(default=0)
td = models.IntegerField(default=0)
long_yards = models.IntegerField(default=0)
average = models.FloatField(default=0)
total_plays = models.IntegerField(default=0)
total_yards = models.IntegerField(default=0)
def __unicode__(self):
return "%s - %s" % (self.player.name, self.game)
class Meta:
verbose_name_plural = "player rushing"
class PlayerPass(models.Model):
player = models.ForeignKey(Player)
game = models.ForeignKey(Game)
attempts = models.IntegerField(default=0)
completions = models.IntegerField(default=0)
interceptions = models.IntegerField(default=0)
yards = models.IntegerField(default=0)
td = models.IntegerField(default=0)
conversions = models.IntegerField(default=0)
total_plays = models.IntegerField(default=0)
total_yards = models.IntegerField(default=0)
pass_efficiency = models.FloatField(default=0)
def __unicode__(self):
return "%s - %s" % (self.player.name, self.game)
def comp_att(self):
return "%d of %d" % (self.completions, self.attempts)
class Meta:
verbose_name_plural = 'player passing'
class PlayerReceiving(models.Model):
player = models.ForeignKey(Player)
game = models.ForeignKey(Game)
receptions = models.IntegerField(default=0)
yards = models.IntegerField(default=0)
td = models.IntegerField(default=0)
long_yards = models.IntegerField(default=0)
average = models.FloatField(default=0)
def __unicode__(self):
return "%s - %s" % (self.player.name, self.game)
class PlayerScoring(models.Model):
player = models.ForeignKey(Player)
game = models.ForeignKey(Game)
td = models.IntegerField(default=0)
fg_att = models.IntegerField(default=0)
fg_made = models.IntegerField(default=0)
pat_att = models.IntegerField(default=0)
pat_made = models.IntegerField(default=0)
two_pt_att = models.IntegerField(default=0)
two_pt_made = models.IntegerField(default=0)
def_pat_att = models.IntegerField(default=0)
def_pat_made = models.IntegerField(default=0)
def_two_pt_att = models.IntegerField(default=0)
def_two_pt_made = models.IntegerField(default=0)
safeties = models.IntegerField(default=0)
points = models.IntegerField(default=0)
def __unicode__(self):
return "%s - %s" % (self.player.name, self.game)
class PlayerTackle(models.Model):
player = models.ForeignKey(Player)
game = models.ForeignKey(Game)
unassisted_tackles = models.IntegerField(default=0)
assisted_tackles = models.IntegerField(default=0)
def __unicode__(self):
return "%s - %s" % (self.player.name, self.game)
def total_tackles(self):
return self.unassisted_tackles+self.assisted_tackles
class PlayerTacklesLoss(models.Model):
player = models.ForeignKey(Player)
game = models.ForeignKey(Game)
unassisted_tackles_for_loss = models.IntegerField(default=0)
assisted_tackles_for_loss = models.IntegerField(default=0)
tackles_for_loss_yards = models.IntegerField(default=0)
unassisted_sacks = models.IntegerField(default=0)
assisted_sacks = models.IntegerField(default=0)
sack_yards = models.IntegerField(default=0)
def __unicode__(self):
return "%s - %s" % (self.player.name, self.game)
def total_sacks(self):
return self.unassisted_sacks+self.assisted_sacks
def total_tackles_for_loss(self):
return self.unassisted_tackles_for_loss+self.assisted_tackles_for_loss
class Meta:
verbose_name_plural = 'player tackles for loss'
class PlayerPassDefense(models.Model):
player = models.ForeignKey(Player)
game = models.ForeignKey(Game)
interceptions = models.IntegerField(default=0)
interception_yards = models.IntegerField(default=0)
interception_td = models.IntegerField(default=0)
pass_breakups = models.IntegerField(default=0)
def __unicode__(self):
return "%s - %s" % (self.player.name, self.game)
class PlayerFumble(models.Model):
player = models.ForeignKey(Player)
game = models.ForeignKey(Game)
fumbles_forced = models.IntegerField(default=0)
fumbles_number = models.IntegerField(default=0)
fumbles_yards = models.IntegerField(default=0)
fumbles_td = models.IntegerField(default=0)
def __unicode__(self):
return "%s - %s" % (self.player.name, self.game)
class PlayerReturn(models.Model):
player = models.ForeignKey(Player)
game = models.ForeignKey(Game)
punt_returns = models.IntegerField(default=0)
punt_return_yards = models.IntegerField(default=0)
punt_return_td = models.IntegerField(default=0)
kickoff_returns = models.IntegerField(default=0)
kickoff_return_yards = models.IntegerField(default=0)
kickoff_return_td = models.IntegerField(default=0)
def __unicode__(self):
return "%s - %s" % (self.player.name, self.game)
class PlayerSummary(models.Model):
player = models.ForeignKey(Player)
rushes = models.IntegerField(null=True)
rush_gain = models.IntegerField(null=True)
rush_loss = models.IntegerField(null=True)
rush_net = models.IntegerField(null=True)
rush_td = models.IntegerField(null=True)
pass_attempts = models.IntegerField(null=True)
pass_complete = models.IntegerField(null=True)
pass_intercept = models.IntegerField(null=True)
pass_yards = models.IntegerField(null=True)
pass_td = models.IntegerField(null=True)
conversions = models.IntegerField(null=True)
offense_plays = models.IntegerField(null=True)
offense_yards = models.IntegerField(null=True)
receptions = models.IntegerField(null=True)
reception_yards = models.IntegerField(null=True)
reception_td = models.IntegerField(null=True)
def __unicode__(self):
return "%s - %s" % (self.player.name, self.player.season)
class Poll(models.Model):
name = models.CharField(max_length=50)
slug = models.SlugField(max_length=50)
def __unicode__(self):
return self.name
class PollResults(models.Model):
poll = models.ForeignKey(Poll)
week = models.ForeignKey(Week)
team = models.ForeignKey(College)
rank = models.IntegerField()
def __unicode__(self):
return "%s: %s %s" % (self.poll, self.week, self.team)
| 37.568534 | 230 | 0.692259 | 3,900 | 31,520 | 5.414615 | 0.101538 | 0.180707 | 0.204811 | 0.211773 | 0.669792 | 0.565516 | 0.492731 | 0.436094 | 0.416489 | 0.395369 | 0 | 0.01243 | 0.188325 | 31,520 | 838 | 231 | 37.613365 | 0.812969 | 0.004029 | 0 | 0.427515 | 0 | 0.005917 | 0.057377 | 0.014424 | 0 | 0 | 0 | 0 | 0 | 1 | 0.133136 | false | 0.038462 | 0.008876 | 0.106509 | 0.85355 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 4 |
6fb04c6b934dbc2c2a8f1050502568403cd8b120 | 142 | py | Python | reddit2telegram/channels/azurlane_sub/app.py | mainyordle/reddit2telegram | 1163e15aed3b6ff0fba65b222d3d9798f644c386 | [
"MIT"
] | 187 | 2016-09-20T09:15:54.000Z | 2022-03-29T12:22:33.000Z | reddit2telegram/channels/azurlane_sub/app.py | mainyordle/reddit2telegram | 1163e15aed3b6ff0fba65b222d3d9798f644c386 | [
"MIT"
] | 84 | 2016-09-22T14:25:07.000Z | 2022-03-19T01:26:17.000Z | reddit2telegram/channels/azurlane_sub/app.py | mainyordle/reddit2telegram | 1163e15aed3b6ff0fba65b222d3d9798f644c386 | [
"MIT"
] | 172 | 2016-09-21T15:39:39.000Z | 2022-03-16T15:15:58.000Z | #encoding:utf-8
subreddit = 'AzureLane'
t_channel = '@AzurLane_sub'
def send_post(submission, r2t):
return r2t.send_simple(submission)
| 15.777778 | 38 | 0.746479 | 19 | 142 | 5.368421 | 0.842105 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.02439 | 0.133803 | 142 | 8 | 39 | 17.75 | 0.804878 | 0.098592 | 0 | 0 | 0 | 0 | 0.173228 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0 | 0.25 | 0.5 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 4 |
6fc618b732031598e6c69fb80b53fe55b2821831 | 11,533 | py | Python | tests/gdk/common/test_model_actions.py | timmattison/aws-greengrass-gdk-cli | 60a002f0f2fee84b79022662ba0cae9e0246b6f8 | [
"Apache-2.0"
] | 10 | 2022-01-15T09:50:32.000Z | 2022-03-26T16:39:49.000Z | tests/gdk/common/test_model_actions.py | timmattison/aws-greengrass-gdk-cli | 60a002f0f2fee84b79022662ba0cae9e0246b6f8 | [
"Apache-2.0"
] | 46 | 2021-11-30T19:49:16.000Z | 2022-03-31T07:14:23.000Z | tests/gdk/common/test_model_actions.py | timmattison/aws-greengrass-gdk-cli | 60a002f0f2fee84b79022662ba0cae9e0246b6f8 | [
"Apache-2.0"
] | 7 | 2021-11-30T19:49:42.000Z | 2022-03-17T16:25:34.000Z | from pathlib import Path
from unittest.mock import mock_open, patch
import gdk.common.consts as consts
import gdk.common.model_actions as model_actions
import pytest
def test_get_validated_model_file_not_exists(mocker):
mock_get_static_file_path = mocker.patch("gdk.common.utils.get_static_file_path", return_value=None)
mock_is_valid_model = mocker.patch("gdk.common.model_actions.is_valid_model", return_value=False)
with pytest.raises(Exception) as e_info:
model_actions.get_validated_model()
expected_err_message = "expected str, bytes or os.PathLike object, not NoneType"
assert e_info.value.args[0] == expected_err_message
assert not mock_is_valid_model.called
assert mock_get_static_file_path.call_count == 1
def test_get_validated_model_file_exists(mocker):
file_path = Path("path/to/open")
mock_get_static_file_path = mocker.patch("gdk.common.utils.get_static_file_path", return_value=file_path)
mock_is_valid_model = mocker.patch("gdk.common.model_actions.is_valid_model", return_value=True)
with patch("builtins.open", mock_open(read_data="{}")) as mock_file:
model_actions.get_validated_model()
assert open(file_path).read() == "{}"
mock_file.assert_called_with(file_path)
assert not mock_is_valid_model.called
assert mock_get_static_file_path.call_count == 1
def test_get_validated_model_with_valid_model(mocker):
# Should return model when the model is valid
mocker.patch("gdk.common.model_actions.is_valid_model", return_value=True)
command_model = model_actions.get_validated_model()
assert command_model
def test_get_validated_model_with_invalid_model(mocker):
# Should raise an exception when the model is invalid
mock_is_valid_model = mocker.patch("gdk.common.model_actions.is_valid_model", return_value=False)
model_actions.get_validated_model()
assert not mock_is_valid_model.called
def test_is_valid_argument_model_valid():
# Valid argument that contains both name and help.
valid_arg = {"name": ["-l", "--lang"], "help": "language help", "choices": ["p", "j"]}
assert model_actions.is_valid_argument_model(valid_arg)
def test_is_valid_argument_model_without_name():
# Invalid arg without name.
invalid_arg_without_name = {"names": ["-l", "--lang"], "help": "help"}
assert not model_actions.is_valid_model(invalid_arg_without_name, consts.cli_tool_name)
def test_is_valid_argument_model_without_help():
# Invalid arg without help.
invalid_arg_without_help = {"name": ["-l", "--lang"], "helper": "help"}
assert not model_actions.is_valid_model(invalid_arg_without_help, consts.cli_tool_name)
def test_is_valid_subcommand_model_valid():
# Valid subcommand with valid commmand key in the cli model.
model = {
"gdk": {"sub-commands": ["component"], "help": "help"},
"component": {"help": "help", "sub-commands": ["init", "build"]},
"build": {"help": "help"},
"init": {"help": "help"},
}
valid_model_subcommands = ["component"]
assert model_actions.is_valid_subcommand_model(model, valid_model_subcommands)
def test_is_valid_subcommand_model_valid_without_help():
# Valid subcommand without help in the cli model.
model = {
"gdk": {"sub-commands": ["component"]},
"component": {"sub-commands": ["init", "build"]},
"build": {},
"init": {},
}
valid_model_subcommands = ["component"]
assert not model_actions.is_valid_subcommand_model(model, valid_model_subcommands)
def test_is_valid_subcommand_model_invalid():
# Invalid subcommand with no key in the cli model.
model = {
"gdk": {"sub-commands": ["component"]},
"component": {"sub-commands": ["init", "build"]},
"init": {},
"build": {},
}
invalid_model_subcommands = ["component", "invalid-subcommand-that-is-not-present-as-key"]
assert not model_actions.is_valid_subcommand_model(model, invalid_model_subcommands)
def test_is_valid_model_call_counts(mocker):
valid_model = {
"gdk": {"sub-commands": ["component"], "help": "help"},
"component": {"sub-commands": ["init", "build"], "help": "help"},
"init": {
"arguments": {
"lang": {"name": ["-l", "--lang"], "help": "help"},
"temp": {"name": ["-t", "--temp"], "help": "help"},
},
"arg_groups": [
{
"title": "Greengrass component templates.",
"args": ["lang"],
"description": "description",
}
],
"help": "help",
},
"build": {"help": "help"},
}
spy_is_valid_argument_model = mocker.spy(model_actions, "is_valid_argument_model")
spy_is_valid_argument_group_model = mocker.spy(model_actions, "is_valid_argument_group_model")
spy_is_valid_sub_command = mocker.spy(model_actions, "is_valid_subcommand_model")
assert model_actions.is_valid_model(valid_model, consts.cli_tool_name)
assert spy_is_valid_argument_model.call_count == 2
assert spy_is_valid_argument_group_model.call_count == 1
assert spy_is_valid_sub_command.call_count == 2
def test_is_valid_model_invalid_argument_model(mocker):
invalid_model = {
"gdk": {"sub-commands": ["component"], "help": "help"},
"component": {"sub-commands": ["init", "build"], "help": "help"},
"init": {
"arguments": {
"lang": {"name": ["-l", "--lang"]},
"temp": {"name": ["-t", "--temp"]},
},
"arg_groups": [
{
"title": "Greengrass component templates.",
"args": ["lang"],
"description": "description",
}
],
"help": "help",
},
"build": {"help": "help"},
}
spy_is_valid_argument_model = mocker.spy(model_actions, "is_valid_argument_model")
spy_is_valid_argument_group_model = mocker.spy(model_actions, "is_valid_argument_group_model")
spy_is_valid_sub_command = mocker.spy(model_actions, "is_valid_subcommand_model")
assert not model_actions.is_valid_model(invalid_model, consts.cli_tool_name)
assert spy_is_valid_argument_model.call_count == 1
assert spy_is_valid_argument_group_model.call_count == 0
assert spy_is_valid_sub_command.call_count == 2 # gdk, component
def test_is_valid_model_invalid_argument_group_model(mocker):
valid_model = {
"gdk": {"sub-commands": ["init"], "help": "help"},
"init": {
"arguments": {
"lang": {"name": ["-l", "--lang"], "help": "help"},
"temp": {"name": ["-t", "--temp"], "help": "help"},
},
"arg_groups": [
{
"title": "Greengrass component templates.",
"args": ["lang", "template"],
"description": "description",
}
],
"help": "help",
},
"build": {"help": "help"},
}
spy_is_valid_argument_model = mocker.spy(model_actions, "is_valid_argument_model")
spy_is_valid_argument_group_model = mocker.spy(model_actions, "is_valid_argument_group_model")
spy_is_valid_sub_command = mocker.spy(model_actions, "is_valid_subcommand_model")
assert not model_actions.is_valid_model(valid_model, consts.cli_tool_name)
assert spy_is_valid_argument_model.call_count == 2
assert spy_is_valid_argument_group_model.call_count == 1
assert spy_is_valid_sub_command.call_count == 1 # gdk
def test_is_valid_model_invalid_sub_commands(mocker):
valid_model = {
"gdk": {"sub-commands": ["component"], "help": "help"},
"component": {"sub-commands": ["init", "not-valid"], "help": "help"},
"init": {
"arguments": {
"lang": {"name": ["-l", "--lang"], "help": "help"},
"temp": {"name": ["-t", "--temp"], "help": "help"},
},
"arg_groups": [
{
"title": "Greengrass component templates.",
"args": ["lang", "temp"],
"description": "description",
}
],
"help": "help",
},
"build": {"help": "help"},
}
spy_is_valid_argument_model = mocker.spy(model_actions, "is_valid_argument_model")
spy_is_valid_argument_group_model = mocker.spy(model_actions, "is_valid_argument_group_model")
spy_is_valid_sub_command = mocker.spy(model_actions, "is_valid_subcommand_model")
assert not model_actions.is_valid_model(valid_model, consts.cli_tool_name)
assert spy_is_valid_argument_model.call_count == 2
assert spy_is_valid_argument_group_model.call_count == 1
assert spy_is_valid_sub_command.call_count == 2 # gdk, component
def test_is_valid_argument_group_valid():
# Valid argument group model with correct arguments
t_arg_group = {"title": "Greengrass component templates.", "args": ["language", "template"], "description": "description"}
t_args = {
"language": {"name": ["-l", "--language"], "help": "help", "choices": ["p", "j"]},
"template": {"name": ["-t", "--template"], "help": "help"},
"repository": {"name": ["-r", "--repository"], "help": "help"},
}
assert model_actions.is_valid_argument_group_model(t_arg_group, t_args)
def test_is_valid_argument_group_invalid_group():
# Invalid argument group model without title
t_arg_group = {"args": ["language", "template"], "description": "description"}
t_args = {
"language": {"name": ["-l", "--language"], "help": "help", "choices": ["p", "j"]},
"template": {"name": ["-t", "--template"], "help": "help"},
"repository": {"name": ["-r", "--repository"], "help": "help"},
}
assert not model_actions.is_valid_argument_group_model(t_arg_group, t_args)
# Invalid argument group model without args
t_arg_group = {"title": "title", "description": "description"}
t_args = {
"language": {"name": ["-l", "--language"], "help": "help", "choices": ["p", "j"]},
"template": {"name": ["-t", "--template"], "help": "help"},
"repository": {"name": ["-r", "--repository"], "help": "help"},
}
assert not model_actions.is_valid_argument_group_model(t_arg_group, t_args)
# Invalid argument group model without description
t_arg_group = {"title": "title", "args": ["language", "template"]}
t_args = {
"language": {"name": ["-l", "--language"], "help": "help", "choices": ["p", "j"]},
"template": {"name": ["-t", "--template"], "help": "help"},
"repository": {"name": ["-r", "--repository"], "help": "help"},
}
assert not model_actions.is_valid_argument_group_model(t_arg_group, t_args)
def test_is_valid_argument_group_invalid_with_arg_not_in_arguments():
# Invalid argument group model with arg not in arguments
t_arg_group = {
"args": ["this-arg-not-in-arguments", "template"],
"description": "description",
"title": "title",
}
t_args = {
"language": {"name": ["-l", "--language"], "help": "help", "choices": ["p", "j"]},
"template": {"name": ["-t", "--template"], "help": "help"},
"repository": {"name": ["-r", "--repository"], "help": "help"},
}
assert not model_actions.is_valid_argument_group_model(t_arg_group, t_args)
| 42.091241 | 126 | 0.62759 | 1,381 | 11,533 | 4.877625 | 0.081825 | 0.077939 | 0.080166 | 0.087441 | 0.821704 | 0.779394 | 0.717191 | 0.692844 | 0.679335 | 0.664489 | 0 | 0.001658 | 0.215729 | 11,533 | 273 | 127 | 42.245421 | 0.743062 | 0.054192 | 0 | 0.557604 | 0 | 0 | 0.24433 | 0.055826 | 0 | 0 | 0 | 0 | 0.165899 | 1 | 0.078341 | false | 0 | 0.023041 | 0 | 0.101382 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
6fd04634351c4906a1efba5cd00441acf0488bd7 | 207 | py | Python | guet/steps/action/_print.py | AbhishekMashetty/pairprogrammingmasetty | 0528d4999b472ec6d94058193275a505eaf2c762 | [
"Apache-2.0"
] | 13 | 2018-12-21T22:47:28.000Z | 2021-12-17T14:27:35.000Z | guet/steps/action/_print.py | chiptopher/guet | 1099ee623311ba1d052237612efc9b06b7ff68bb | [
"Apache-2.0"
] | 63 | 2018-08-30T11:19:12.000Z | 2021-05-13T12:11:08.000Z | guet/steps/action/_print.py | chiptopher/guet | 1099ee623311ba1d052237612efc9b06b7ff68bb | [
"Apache-2.0"
] | 7 | 2019-05-21T13:52:37.000Z | 2022-01-30T22:57:21.000Z | from .action import Action
class PrintAction(Action):
def __init__(self, message: str):
super().__init__()
self.message = message
def execute(self, _):
print(self.message)
| 18.818182 | 37 | 0.63285 | 23 | 207 | 5.304348 | 0.565217 | 0.270492 | 0.245902 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.256039 | 207 | 10 | 38 | 20.7 | 0.792208 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.285714 | false | 0 | 0.142857 | 0 | 0.571429 | 0.142857 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
6ff86ddd5ce0c454281e6568c628bd3c49ea5024 | 394 | py | Python | examples/MMPT/mmpt/__init__.py | Shiguang-Guo/fairseq | c9d3df5679d0829cda8fc3c818b6cab52b78dc37 | [
"MIT"
] | 16,259 | 2018-05-02T02:31:30.000Z | 2022-03-31T21:50:23.000Z | examples/MMPT/mmpt/__init__.py | Shiguang-Guo/fairseq | c9d3df5679d0829cda8fc3c818b6cab52b78dc37 | [
"MIT"
] | 3,863 | 2018-05-02T13:42:39.000Z | 2022-03-31T19:03:32.000Z | examples/MMPT/mmpt/__init__.py | Shiguang-Guo/fairseq | c9d3df5679d0829cda8fc3c818b6cab52b78dc37 | [
"MIT"
] | 4,796 | 2018-05-02T07:55:51.000Z | 2022-03-31T14:46:45.000Z | # Copyright (c) Facebook, Inc. and its affiliates.
#
# This source code is licensed under the MIT license found in the
# LICENSE file in the root directory of this source tree.
try:
# fairseq user dir
from .datasets import FairseqMMDataset
from .losses import FairseqCriterion
from .models import FairseqMMModel
from .tasks import FairseqMMTask
except ImportError:
pass
| 30.307692 | 65 | 0.751269 | 52 | 394 | 5.692308 | 0.769231 | 0.067568 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.205584 | 394 | 12 | 66 | 32.833333 | 0.945687 | 0.469543 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0.142857 | 0.714286 | 0 | 0.714286 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 4 |
b50d441499382a84f41458396af0f4f8d532fb26 | 2,559 | py | Python | project/server/middlewares/auth.py | ecralx/rotten-potatoes-api | 7061eaff272cab04469777716dda3a620776ed1e | [
"MIT"
] | null | null | null | project/server/middlewares/auth.py | ecralx/rotten-potatoes-api | 7061eaff272cab04469777716dda3a620776ed1e | [
"MIT"
] | null | null | null | project/server/middlewares/auth.py | ecralx/rotten-potatoes-api | 7061eaff272cab04469777716dda3a620776ed1e | [
"MIT"
] | null | null | null | # project/server/middlewares/auth.py
from flask import request, make_response, jsonify
from functools import wraps
from project.server.models import User
def with_authorization_middleware(fn):
"""
Checks if there's an Authorization header in the request and supplies the valid user to the function (view)
"""
@wraps(fn)
def wrapper(*args, **kwargs):
# get the auth token
auth_header = request.headers.get('Authorization')
if auth_header:
try:
auth_token = auth_header.split(" ")[1]
except IndexError:
return fn(*args, **kwargs, user=None)
else:
auth_token = ''
if auth_token:
resp = User.decode_auth_token(auth_token)
if not isinstance(resp, str):
user = User.query.filter_by(id=resp).first()
return fn(*args, **kwargs, user=user)
return fn(*args, **kwargs, user=None)
else:
return fn(*args, **kwargs, user=None)
return wrapper
def auth_middleware(fn):
"""
Checks if there's an Authorization header in the request and supplies the valid user to the function (view)
Aborts if there's any problem with the header (user must be logged in)
"""
@wraps(fn)
def wrapper(*args, **kwargs):
# get the auth token
auth_header = request.headers.get('Authorization')
if auth_header:
try:
auth_token = auth_header.split(" ")[1]
except IndexError:
response_object = {
'status': 'fail',
'status_code': 401,
'message': 'Bearer token malformed.'
}
return make_response(jsonify(response_object)), 401
else:
auth_token = ''
if auth_token:
resp = User.decode_auth_token(auth_token)
if not isinstance(resp, str):
user = User.query.filter_by(id=resp).first()
return fn(*args, **kwargs, user=user)
response_object = {
'status': 'fail',
'status_code': 401,
'message': resp
}
return make_response(jsonify(response_object)), 401
else:
response_object = {
'status': 'fail',
'status_code': 401,
'message': 'Provide a valid auth token.'
}
return make_response(jsonify(response_object)), 401
return wrapper | 35.054795 | 111 | 0.550215 | 281 | 2,559 | 4.882562 | 0.266904 | 0.085277 | 0.056851 | 0.065598 | 0.794461 | 0.794461 | 0.77551 | 0.704082 | 0.543732 | 0.543732 | 0 | 0.01207 | 0.352481 | 2,559 | 73 | 112 | 35.054795 | 0.815932 | 0.14068 | 0 | 0.810345 | 0 | 0 | 0.074896 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.068966 | false | 0 | 0.051724 | 0 | 0.293103 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
82f97c32f939d4327706890dff7a052ac9a87566 | 3,151 | py | Python | mpvr/test/test.py | nearj/mpvr-motionfiltering | 478304391e031a11bd15a604a272017ce8e48abf | [
"MIT"
] | null | null | null | mpvr/test/test.py | nearj/mpvr-motionfiltering | 478304391e031a11bd15a604a272017ce8e48abf | [
"MIT"
] | null | null | null | mpvr/test/test.py | nearj/mpvr-motionfiltering | 478304391e031a11bd15a604a272017ce8e48abf | [
"MIT"
] | 1 | 2019-07-14T01:32:04.000Z | 2019-07-14T01:32:04.000Z | import numpy as np
import pandas as pd
import cv2
from numba import jit
from . import datamanager
class ThreeDI(datamanager.DataManager):
"""data manager for 3DI
:param _scenarios: list of scenario
:type _scenarios: dict
:param _sensored: sensored axis list in 3di experiment
:type _sensored: list
:param _unsensored: sensored axis list in 3di experiment
:type _unsensored: list
:param _time_column: time column name in 3di.csv
:type _time_column: str
:param _start_index: start index of experiment
:type _start_index: int
:param _end_index: end index of experiment
:type _end_index: int
:param _step_min: minimum time step size of time stamps
:type _step_min: int
:param _step_max: maximum time step size of time stamps
:type _step_max: int
"""
def __init__(self, *args, **kwargs):
"""Constructor for 3DI data manager"""
super(ThreeDI, self).__init__(*args, **kwargs)
# to make 6 axis motion, e.g.) (1.1, 2.2, 3.3) > (1.1, 2.2, 3.3, 0, 0, 0)
# def _load_with_preset(self):
# """Implementation method of :meth:'mpvr.datamanager.Datamanager.load()'
# :returns: Generator of classified motion and video process in experiment
# :rtype: Iterator[(int, list)]
# """
# motion_load_directory = self._load_motion_dir + self._scenario + self._extension['csv']
# video_load_directory = self._load_video_dir + self._scenario + '/'
# df = pd.read_csv(motion_load_directory)
# times = pd.to_datetime(df[self._time_column].str.split().str[1]).astype(int) / 10 ** 9
# times -= times[self._start_index] # to set timestamps 0 at start index
# sampled_indices, sampled_deltatimes = self._sampling_time(times)
# # to make sampling rate approximately about 3hz as previous works
# sensored_motion_vectors = np.diff(df[self._sensored.values()].values, axis = 0)
# # order: pitch, yaw, roll
# motion_vectors = np.hstack((
# sensored_motion_vectors, np.zeros((
# sensored_motion_vectors.shape[0], len(self._unsensored)))))
# # to make 6 axis motion, e.g.) (1.1, 2.2, 3.3) > (1.1, 2.2, 3.3, 0, 0, 0)
# sampled_motion = self._sampling_motion(sampled_deltatimes,
# sampled_indices,
# motion_vectors)
# sampled_video = self._sampling_visual_from_png(sampled_deltatimes,
# sampled_indices,
# video_load_directory)
# motion_bins = self._make_motion_bins(sampled_motion)
# # TODO: stands for rewind... >
# sampled_motion = self._sampling_motion(sampled_deltatimes,
# sampled_indices,
# motion_vectors)
# for sample in zip(*(sampled_motion, sampled_video)):
# yield self._classification_motion(sample[0], motion_bins), \
# self._classification_video(sample[1])
| 42.581081 | 97 | 0.606791 | 381 | 3,151 | 4.745407 | 0.32021 | 0.043142 | 0.006637 | 0.00885 | 0.19469 | 0.19469 | 0.19469 | 0.155973 | 0.120575 | 0.120575 | 0 | 0.021592 | 0.29451 | 3,151 | 73 | 98 | 43.164384 | 0.791723 | 0.827674 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.013699 | 0 | 1 | 0.125 | false | 0 | 0.625 | 0 | 0.875 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
d227a55a3a1ec41066cf45c9a1652ae46dbb46c9 | 103 | py | Python | BasicProject/HelloDjangoApp/apps.py | chimmilisrinivas/python-sample-vs-learning-django | 30ce250b187507a99bf35e2691d483ebf03aa7f8 | [
"MIT"
] | 13 | 2018-07-19T04:05:17.000Z | 2019-03-19T22:35:27.000Z | BasicProject/HelloDjangoApp/apps.py | chimmilisrinivas/python-sample-vs-learning-django | 30ce250b187507a99bf35e2691d483ebf03aa7f8 | [
"MIT"
] | 4 | 2018-10-02T04:39:11.000Z | 2018-11-29T01:06:30.000Z | BasicProject/HelloDjangoApp/apps.py | chimmilisrinivas/python-sample-vs-learning-django | 30ce250b187507a99bf35e2691d483ebf03aa7f8 | [
"MIT"
] | 16 | 2019-11-03T23:14:50.000Z | 2022-03-16T06:12:38.000Z | from django.apps import AppConfig
class HelloDjangoAppConfig(AppConfig):
name = 'HelloDjangoApp'
| 17.166667 | 38 | 0.786408 | 10 | 103 | 8.1 | 0.9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.145631 | 103 | 5 | 39 | 20.6 | 0.920455 | 0 | 0 | 0 | 0 | 0 | 0.135922 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
d22bd14dc917a4fe741f630af22e4772f91714c4 | 175 | py | Python | importance/download_pageviews.py | halfak/Article-importance-in-Wikipedia | 43dbb04e320fe2aed2bd72aa08ad6b7085ba84e9 | [
"MIT"
] | 2 | 2015-01-31T15:32:20.000Z | 2022-01-23T22:23:53.000Z | importance/download_pageviews.py | Seanpm2001-research/Article-importance-in-Wikipedia | 43dbb04e320fe2aed2bd72aa08ad6b7085ba84e9 | [
"MIT"
] | null | null | null | importance/download_pageviews.py | Seanpm2001-research/Article-importance-in-Wikipedia | 43dbb04e320fe2aed2bd72aa08ad6b7085ba84e9 | [
"MIT"
] | 4 | 2015-01-21T14:34:13.000Z | 2022-01-23T22:24:37.000Z | """
Downloads hourly pageview files for a directory.
Usage:
download_pageviews <web directory> <output directory>
"""
import docopt
def main():
args = docopt.docopt
| 15.909091 | 57 | 0.72 | 21 | 175 | 5.952381 | 0.809524 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.182857 | 175 | 10 | 58 | 17.5 | 0.874126 | 0.651429 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.333333 | false | 0 | 0.333333 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
d242a1b004c13331b65295d59929b3ce78ff0756 | 1,243 | py | Python | verbcalc/tests/test_calculating.py | syedatif4118/VerbCalc | 16834cbf1a78036b386ce1020bfd705fde7a0833 | [
"BSD-3-Clause"
] | null | null | null | verbcalc/tests/test_calculating.py | syedatif4118/VerbCalc | 16834cbf1a78036b386ce1020bfd705fde7a0833 | [
"BSD-3-Clause"
] | null | null | null | verbcalc/tests/test_calculating.py | syedatif4118/VerbCalc | 16834cbf1a78036b386ce1020bfd705fde7a0833 | [
"BSD-3-Clause"
] | null | null | null | """
Tests calculating.
"""
import unittest
import verbcalc
class TestCalculate(unittest.TestCase):
"""
Tests calculate function.
"""
def test_calculations(self):
self.assertEqual(verbcalc.calculate('2 plus 2'), 'The result is 4')
self.assertEqual(verbcalc.calculate
('what is 2 minus 2'), 'The result is 0')
self.assertEqual(verbcalc.calculate
('calculate 2 times 2'), 'The result is 4')
self.assertEqual(verbcalc.calculate
('2 divided by 2'), 'The result is 1')
self.assertEqual(verbcalc.calculate
('2 to the power of 2'), 'The result is 4')
self.assertEqual(verbcalc.calculate
('Absolute value of -2'), 'The result is 2')
self.assertEqual(verbcalc.calculate
('2 mod 2'), 'The result is 0')
self.assertEqual(verbcalc.calculate('2 root of 4'), 'The result is 2')
self.assertEqual(verbcalc.calculate('3 root of 27'), 'The result is 3')
self.assertEqual(verbcalc.calculate
('2 divided by 0'), 'You cannot divide by zero!')
if __name__ == '__main__':
unittest.main()
| 36.558824 | 79 | 0.572808 | 144 | 1,243 | 4.881944 | 0.305556 | 0.213371 | 0.327169 | 0.455192 | 0.623044 | 0.519203 | 0.519203 | 0.445235 | 0.320057 | 0 | 0 | 0.033998 | 0.313757 | 1,243 | 33 | 80 | 37.666667 | 0.790152 | 0.035398 | 0 | 0.304348 | 0 | 0 | 0.263605 | 0 | 0 | 0 | 0 | 0 | 0.434783 | 1 | 0.043478 | false | 0 | 0.086957 | 0 | 0.173913 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
d24608d5ddc47d0a079c9d18aaab34a2d9d7dd27 | 8,331 | py | Python | {{cookiecutter.project_slug}}/settings/base.py | yunior-dev/django-vue-cookie | 74f04a3aaaa4f40070c816d855a165c7ecc2d12e | [
"BSD-3-Clause"
] | 3 | 2020-10-10T20:08:08.000Z | 2021-03-26T05:46:25.000Z | {{cookiecutter.project_slug}}/settings/base.py | yunior-dev/django-cookie | 74f04a3aaaa4f40070c816d855a165c7ecc2d12e | [
"BSD-3-Clause"
] | null | null | null | {{cookiecutter.project_slug}}/settings/base.py | yunior-dev/django-cookie | 74f04a3aaaa4f40070c816d855a165c7ecc2d12e | [
"BSD-3-Clause"
] | 1 | 2021-11-19T21:25:45.000Z | 2021-11-19T21:25:45.000Z | """
Base settings to build other settings file upon.
"""
from pathlib import Path
from django.conf.locale.en import formats as en_formats
import environ
ROOT_DIR = Path(__file__).resolve(strict=True).parent.parent
# apps/ directory
APPS_DIR = ROOT_DIR / 'apps'
# resources/ directory
RESOURCES_DIR = ROOT_DIR / 'resources'
env = environ.Env()
READ_DOT_ENV_FILE = env.bool('APP_READ_DOT_ENV_FILE', default=False)
if READ_DOT_ENV_FILE:
# OS environment variables take precedence over variables from .env
env.read_env(str(ROOT_DIR / '.env'))
# GENERAL
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/dev/ref/settings/#debug
DEBUG = env.bool('APP_DEBUG', False)
# Local time zone. Choices are
# http://en.wikipedia.org/wiki/List_of_tz_zones_by_name
# though not all of them may be available with every OS.
# In Windows, this must be set to your system time zone.
TIME_ZONE = 'UTC'
# https://docs.djangoproject.com/en/dev/ref/settings/#language-code
LANGUAGE_CODE = 'en-us'
# https://docs.djangoproject.com/en/dev/ref/settings/#site-id
SITE_ID = 1
# https://docs.djangoproject.com/en/dev/ref/settings/#use-i18n
USE_I18N = True
# https://docs.djangoproject.com/en/dev/ref/settings/#use-l10n
USE_L10N = True
# https://docs.djangoproject.com/en/dev/ref/settings/#use-tz
USE_TZ = True
# https://docs.djangoproject.com/en/dev/ref/settings/#locale-paths
LOCALE_PATHS = [str(ROOT_DIR / 'locale')]
# URLS
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/dev/ref/settings/#root-urlconf
ROOT_URLCONF = 'config.urls'
# https://docs.djangoproject.com/en/dev/ref/settings/#wsgi-application
WSGI_APPLICATION = 'config.wsgi.application'
# APPS
# ------------------------------------------------------------------------------
DJANGO_APPS = [
'django.contrib.admin',
'django.contrib.auth',
'django.contrib.contenttypes',
'django.contrib.sessions',
'django.contrib.sites',
'django.contrib.messages',
'django.contrib.staticfiles',
# 'django.contrib.humanize', # Handy template tags
]
VENDOR_APPS = [
'djangomix',
# Third party apps go here.
]
LOCAL_APPS = [
{%- if cookiecutter.use_vuejs == "y" %}
'apps.client',
{%- endif %}
'apps.core',
# 'apps.users',
# Your apps: custom apps go here.
]
# https://docs.djangoproject.com/en/dev/ref/settings/#installed-apps
INSTALLED_APPS = DJANGO_APPS + VENDOR_APPS + LOCAL_APPS
# PASSWORDS
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/dev/ref/settings/#password-hashers
PASSWORD_HASHERS = [
# https://docs.djangoproject.com/en/dev/topics/auth/passwords/#using-argon2-with-django
'django.contrib.auth.hashers.PBKDF2PasswordHasher',
'django.contrib.auth.hashers.PBKDF2PasswordHasher',
'django.contrib.auth.hashers.PBKDF2SHA1PasswordHasher',
'django.contrib.auth.hashers.BCryptSHA256PasswordHasher',
]
# https://docs.djangoproject.com/en/dev/ref/settings/#auth-password-validators
AUTH_PASSWORD_VALIDATORS = [
{
'NAME': 'django.contrib.auth.password_validation.UserAttributeSimilarityValidator'
},
{
'NAME': 'django.contrib.auth.password_validation.MinimumLengthValidator'
},
{
'NAME': 'django.contrib.auth.password_validation.CommonPasswordValidator'
},
{
'NAME': 'django.contrib.auth.password_validation.NumericPasswordValidator'
},
]
# MIDDLEWARE
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/dev/ref/settings/#middleware
MIDDLEWARE = [
'django.middleware.security.SecurityMiddleware',
{%- if cookiecutter.use_whitenoise == "y" %}
'whitenoise.middleware.WhiteNoiseMiddleware',
{%- endif %}
'django.contrib.sessions.middleware.SessionMiddleware',
'django.middleware.locale.LocaleMiddleware',
'django.middleware.common.CommonMiddleware',
'django.middleware.csrf.CsrfViewMiddleware',
'django.contrib.auth.middleware.AuthenticationMiddleware',
'django.contrib.messages.middleware.MessageMiddleware',
'django.middleware.common.BrokenLinkEmailsMiddleware',
'django.middleware.clickjacking.XFrameOptionsMiddleware',
]
# STATIC
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/dev/ref/settings/#static-root
STATIC_ROOT = str(ROOT_DIR / 'staticfiles')
# https://docs.djangoproject.com/en/dev/ref/settings/#static-url
STATIC_URL = '/static/'
# https://docs.djangoproject.com/en/dev/ref/contrib/staticfiles/#std:setting-STATICFILES_DIRS
STATICFILES_DIRS = [str(ROOT_DIR / 'static')]
# https://docs.djangoproject.com/en/dev/ref/contrib/staticfiles/#staticfiles-finders
STATICFILES_FINDERS = [
'django.contrib.staticfiles.finders.FileSystemFinder',
'django.contrib.staticfiles.finders.AppDirectoriesFinder',
]
STATIC_URL = '/static/'
{%- if cookiecutter.use_whitenoise == "y" %}
# WHITENOISE STORAGE
# http://whitenoise.evans.io/en/stable/
STATICFILES_STORAGE = 'whitenoise.storage.CompressedManifestStaticFilesStorage'
{%- endif %}
# MEDIA
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/dev/ref/settings/#media-root
MEDIA_ROOT = str(ROOT_DIR / "media")
# https://docs.djangoproject.com/en/dev/ref/settings/#media-url
MEDIA_URL = "/media/"
# TEMPLATES
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/dev/ref/settings/#templates
TEMPLATES = [
{
# https://docs.djangoproject.com/en/dev/ref/settings/#std:setting-TEMPLATES-BACKEND
'BACKEND': 'django.template.backends.django.DjangoTemplates',
# https://docs.djangoproject.com/en/dev/ref/settings/#template-dirs
'DIRS': [str('templates')],
'OPTIONS': {
# https://docs.djangoproject.com/en/dev/ref/settings/#template-loaders
# https://docs.djangoproject.com/en/dev/ref/templates/api/#loader-types
'loaders': [
'django.template.loaders.filesystem.Loader',
'django.template.loaders.app_directories.Loader',
],
# https://docs.djangoproject.com/en/dev/ref/settings/#template-context-processors
'context_processors': [
'django.template.context_processors.debug',
'django.template.context_processors.request',
'django.contrib.auth.context_processors.auth',
'django.template.context_processors.i18n',
'django.template.context_processors.media',
'django.template.context_processors.static',
'django.template.context_processors.tz',
'django.contrib.messages.context_processors.messages',
],
},
}
]
# SECURITY
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/dev/ref/settings/#session-cookie-httponly
SESSION_COOKIE_HTTPONLY = True
# https://docs.djangoproject.com/en/dev/ref/settings/#csrf-cookie-httponly
CSRF_COOKIE_HTTPONLY = True
# https://docs.djangoproject.com/en/dev/ref/settings/#secure-browser-xss-filter
SECURE_BROWSER_XSS_FILTER = True
# https://docs.djangoproject.com/en/dev/ref/settings/#x-frame-options
X_FRAME_OPTIONS = 'DENY'
# ADMIN
# ------------------------------------------------------------------------------
# Django Admin URL.
# https://docs.djangoproject.com/en/dev/ref/settings/#admins
ADMIN_URL = 'admin/'
# DATE FORMATS
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/3.1/ref/settings/#date-input-formats
DATE_INPUT_FORMATS = ['%Y-%m-%d', '%m/%d/%Y', '%m/%d/%y']
en_formats.DATE_FORMAT = 'N j, Y'
# AUTO PRIMARY KEY FIELD
# ------------------------------------------------------------------------------
# https://docs.djangoproject.com/en/3.2/releases/3.2/#
DEFAULT_AUTO_FIELD = 'django.db.models.AutoField'
# Replace the default user model with the custom model.
# AUTH_USER_MODEL = 'core.User'
# Your stuff...
# ------------------------------------------------------------------------------
| 35.909483 | 93 | 0.625375 | 880 | 8,331 | 5.8125 | 0.245455 | 0.058065 | 0.141935 | 0.16129 | 0.358358 | 0.358358 | 0.296188 | 0.289736 | 0.216422 | 0.084066 | 0 | 0.003425 | 0.123875 | 8,331 | 231 | 94 | 36.064935 | 0.697356 | 0.474733 | 0 | 0.094828 | 0 | 0 | 0.481948 | 0.411876 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0.086207 | 0.025862 | null | null | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 4 |
d24cef7075a55a780520530a7ea876fcd40efd6b | 2,649 | py | Python | test.py | santaclose/noose | e963138b81f380ca0f46369941cf65c4349bd4fb | [
"Apache-2.0"
] | 8 | 2021-01-31T11:30:05.000Z | 2021-09-01T07:48:34.000Z | test.py | santaclose/noose | e963138b81f380ca0f46369941cf65c4349bd4fb | [
"Apache-2.0"
] | 4 | 2021-09-01T08:17:18.000Z | 2021-09-24T22:32:24.000Z | test.py | santaclose/noose | e963138b81f380ca0f46369941cf65c4349bd4fb | [
"Apache-2.0"
] | 1 | 2021-09-01T07:49:58.000Z | 2021-09-01T07:49:58.000Z | import os
import time
import sys
defines = ["LINUX", "TEST"]
links = "-lsfml-graphics -lsfml-window -lsfml-system -lgtest -pthread"
output = "test"
defineString = ""
first = True
for item in defines:
if not first:
defineString += " "
else:
first = False
defineString += f"-D{item}"
os.chdir("test")
print('---------------------------')
print('-- graph operations test --')
print('---------------------------')
cppFiles = "../noose/nodeProvider/nodeFunctionality.cpp ../noose/nodeProvider/nodeProvider.cpp ../noose/logic/connectionSystem.cpp ../noose/logic/graphOperations.cpp ../noose/logic/node.cpp ../noose/logic/nodeSystem.cpp graphOperationsTest.cpp"
finalString = f"g++ -o {output} {cppFiles} {links} {defineString} -w"
os.system(finalString)
os.system("./test")
print('--------------------------')
print('-- node provider test --')
print('--------------------------')
cppFiles = "../noose/nodeProvider/nodeFunctionality.cpp ../noose/nodeProvider/nodeProvider.cpp ../noose/logic/connectionSystem.cpp ../noose/logic/graphOperations.cpp ../noose/logic/node.cpp ../noose/logic/nodeSystem.cpp nodeProviderTest.cpp"
finalString = f"g++ -o {output} {cppFiles} {links} {defineString} -w"
os.system(finalString)
os.system("./test")
print('--------------------------')
print('-- searcher test --')
print('--------------------------')
cppFiles = "../noose/nodeProvider/nodeFunctionality.cpp ../noose/nodeProvider/nodeProvider.cpp ../noose/logic/connectionSystem.cpp ../noose/logic/graphOperations.cpp ../noose/logic/node.cpp ../noose/logic/nodeSystem.cpp ../noose/searcher.cpp searcherTest.cpp"
finalString = f"g++ -o {output} {cppFiles} {links} {defineString} -w"
os.system(finalString)
os.system("./test")
print('--------------------------')
print('-- logic component test --')
print('--------------------------')
cppFiles = "../noose/nodeProvider/nodeFunctionality.cpp ../noose/nodeProvider/nodeProvider.cpp ../noose/logic/connectionSystem.cpp ../noose/logic/graphOperations.cpp ../noose/logic/node.cpp ../noose/logic/nodeSystem.cpp logicComponentTest.cpp"
finalString = f"g++ -o {output} {cppFiles} {links} {defineString} -w"
os.system(finalString)
os.system("./test")
'''
'''
'''
'''
if 'ui' not in sys.argv:
exit()
print('--------------------------')
print('-- ui node system test --')
print('--------------------------')
os.chdir("../noose/")
cppFiles = " ".join(["../noose" + file[1:] for file in os.popen("find . | grep cpp").read().split("\n") if len(file) > 0])
os.chdir("../test/")
finalString = f"g++ -o {output} {cppFiles} {links} {defineString} -w -DTEST"
os.system(finalString)
os.system("./test") | 32.703704 | 259 | 0.624764 | 291 | 2,649 | 5.687285 | 0.230241 | 0.101511 | 0.12568 | 0.042296 | 0.700302 | 0.700302 | 0.681571 | 0.681571 | 0.681571 | 0.653776 | 0 | 0.000831 | 0.091733 | 2,649 | 81 | 260 | 32.703704 | 0.687032 | 0 | 0 | 0.444444 | 0 | 0.074074 | 0.66692 | 0.430956 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.055556 | 0 | 0.055556 | 0.277778 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
d26ce16c5b304988a6b5d84632bb238d29a3ef83 | 337 | py | Python | sentiment/utils.py | SinanTang/simple-sentiment-analyser.lambda | 3830b9c96dc4d436ff8d99e3aad049b03ebda34e | [
"MIT"
] | 1 | 2020-11-29T12:50:41.000Z | 2020-11-29T12:50:41.000Z | sentiment/utils.py | SinanTang/simple-sentiment-analyser.lambda | 3830b9c96dc4d436ff8d99e3aad049b03ebda34e | [
"MIT"
] | null | null | null | sentiment/utils.py | SinanTang/simple-sentiment-analyser.lambda | 3830b9c96dc4d436ff8d99e3aad049b03ebda34e | [
"MIT"
] | null | null | null | import os
from pathlib import Path
def get_project_root():
return Path(__file__).parent
def get_training_data_path():
return os.path.join(get_project_root(), 'data/train')
def load_stop_word_list(lang):
fp = os.path.join(get_project_root(), 'data/stopwords/{}'.format(lang))
return open(fp, 'r').read().split('\n')
| 21.0625 | 75 | 0.706231 | 52 | 337 | 4.269231 | 0.557692 | 0.135135 | 0.189189 | 0.117117 | 0.252252 | 0.252252 | 0.252252 | 0 | 0 | 0 | 0 | 0 | 0.136499 | 337 | 15 | 76 | 22.466667 | 0.762887 | 0 | 0 | 0 | 0 | 0 | 0.089021 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.333333 | false | 0 | 0.222222 | 0.222222 | 0.888889 | 0 | 0 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 4 |
964919d97c14fc18d854e30c3b2fc87b564be138 | 359 | py | Python | elemental/admin.py | shawnadelic/django-elemental | 5c09e3add921c9a7f661c29a4871846fb4c28f22 | [
"MIT"
] | null | null | null | elemental/admin.py | shawnadelic/django-elemental | 5c09e3add921c9a7f661c29a4871846fb4c28f22 | [
"MIT"
] | null | null | null | elemental/admin.py | shawnadelic/django-elemental | 5c09e3add921c9a7f661c29a4871846fb4c28f22 | [
"MIT"
] | null | null | null | from django.contrib import admin
from .models import Link, Menu, Page
class LinkAdmin(admin.ModelAdmin):
pass
class MenuAdmin(admin.ModelAdmin):
pass
class PageAdmin(admin.ModelAdmin):
prepopulated_fields = {"slug": ("title",)}
admin.site.register(Link, MenuAdmin)
admin.site.register(Menu, MenuAdmin)
admin.site.register(Page, PageAdmin)
| 17.95 | 46 | 0.749304 | 44 | 359 | 6.090909 | 0.477273 | 0.16791 | 0.190299 | 0.179104 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.133705 | 359 | 19 | 47 | 18.894737 | 0.861736 | 0 | 0 | 0.181818 | 0 | 0 | 0.02507 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.181818 | 0.181818 | 0 | 0.545455 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 4 |
9650c0a4124b207d1bb0afc39614d847e36d7bd8 | 825 | py | Python | python/space-age/space_age.py | jjkeyser/exercism | c2c21eb04a6564d9d41c8b317ebec53d63e5a3e8 | [
"MIT"
] | null | null | null | python/space-age/space_age.py | jjkeyser/exercism | c2c21eb04a6564d9d41c8b317ebec53d63e5a3e8 | [
"MIT"
] | null | null | null | python/space-age/space_age.py | jjkeyser/exercism | c2c21eb04a6564d9d41c8b317ebec53d63e5a3e8 | [
"MIT"
] | null | null | null | class SpaceAge:
EARTH_YEAR_IN_SECONDS = 31557600
def __init__(self, seconds):
self.seconds = seconds
self.age_on_earth = self.seconds / self.EARTH_YEAR_IN_SECONDS
def on_earth(self):
return round(self.age_on_earth, 2)
def on_mercury(self):
return round(self.age_on_earth / 0.2408467, 2)
def on_venus(self):
return round(self.age_on_earth / 0.61519726, 2)
def on_mars(self):
return round(self.age_on_earth / 1.8808158, 2)
def on_jupiter(self):
return round(self.age_on_earth / 11.862615, 2)
def on_saturn(self):
return round(self.age_on_earth / 29.447498, 2)
def on_uranus(self):
return round(self.age_on_earth / 84.016846, 2)
def on_neptune(self):
return round(self.age_on_earth / 164.79132, 2)
| 25.78125 | 69 | 0.65697 | 127 | 825 | 3.984252 | 0.275591 | 0.13834 | 0.160079 | 0.249012 | 0.462451 | 0.462451 | 0.462451 | 0.118577 | 0 | 0 | 0 | 0.1168 | 0.242424 | 825 | 31 | 70 | 26.612903 | 0.6928 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.428571 | false | 0 | 0 | 0.380952 | 0.904762 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 4 |
9682eb99d1cd900ae2b2a969a51a352adce579b7 | 35 | py | Python | settings.py | softwaresaved/reposearch | cdf6422f9b674052e1867c02216cd01d64fe95f2 | [
"BSD-3-Clause"
] | null | null | null | settings.py | softwaresaved/reposearch | cdf6422f9b674052e1867c02216cd01d64fe95f2 | [
"BSD-3-Clause"
] | 2 | 2017-07-20T09:51:33.000Z | 2017-07-20T15:32:56.000Z | settings.py | softwaresaved/reposearch | cdf6422f9b674052e1867c02216cd01d64fe95f2 | [
"BSD-3-Clause"
] | null | null | null | MONGODATABASENAME = 'figsharedata'
| 17.5 | 34 | 0.828571 | 2 | 35 | 14.5 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.085714 | 35 | 1 | 35 | 35 | 0.90625 | 0 | 0 | 0 | 0 | 0 | 0.342857 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
96962c7303052c39c4919d316c9072a143ffa973 | 121 | py | Python | Python/Unsorted/112a.py | LittleEndu/Codeforces | 82c49b10702c58bc5ce062801d740a2f5f600062 | [
"MIT"
] | null | null | null | Python/Unsorted/112a.py | LittleEndu/Codeforces | 82c49b10702c58bc5ce062801d740a2f5f600062 | [
"MIT"
] | null | null | null | Python/Unsorted/112a.py | LittleEndu/Codeforces | 82c49b10702c58bc5ce062801d740a2f5f600062 | [
"MIT"
] | null | null | null | aa = input().lower()
bb = input().lower()
if aa == bb:
print("0")
elif aa > bb:
print("1")
else:
print("-1")
| 13.444444 | 20 | 0.495868 | 19 | 121 | 3.157895 | 0.526316 | 0.333333 | 0.3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.032967 | 0.247934 | 121 | 8 | 21 | 15.125 | 0.626374 | 0 | 0 | 0 | 0 | 0 | 0.033058 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.375 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
96b4dddfcd1a2da469fb76efebc1d459fa832367 | 127 | py | Python | FUNDADESK/APPS/HELPDESK/admin.py | flopezcpam/fundadesk-fmlc | 66275055828f6b6173155418d745f093d9e1fa2f | [
"CC0-1.0"
] | null | null | null | FUNDADESK/APPS/HELPDESK/admin.py | flopezcpam/fundadesk-fmlc | 66275055828f6b6173155418d745f093d9e1fa2f | [
"CC0-1.0"
] | null | null | null | FUNDADESK/APPS/HELPDESK/admin.py | flopezcpam/fundadesk-fmlc | 66275055828f6b6173155418d745f093d9e1fa2f | [
"CC0-1.0"
] | null | null | null | from django.contrib import admin
from .models import Incidencia
# Register your models here.
admin.site.register(Incidencia) | 21.166667 | 32 | 0.811024 | 17 | 127 | 6.058824 | 0.647059 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.125984 | 127 | 6 | 33 | 21.166667 | 0.927928 | 0.204724 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.666667 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
736ae0cab9222b017a1c6bfd6552e32df5d97870 | 129 | py | Python | submissions/abc080/a.py | m-star18/atcoder | 08e475810516602fa088f87daf1eba590b4e07cc | [
"Unlicense"
] | 1 | 2021-05-10T01:16:28.000Z | 2021-05-10T01:16:28.000Z | submissions/abc080/a.py | m-star18/atcoder | 08e475810516602fa088f87daf1eba590b4e07cc | [
"Unlicense"
] | 3 | 2021-05-11T06:14:15.000Z | 2021-06-19T08:18:36.000Z | submissions/abc080/a.py | m-star18/atcoder | 08e475810516602fa088f87daf1eba590b4e07cc | [
"Unlicense"
] | null | null | null | # sys.stdin.readline()
import sys
import math
input = sys.stdin.readline
n, a, b = map(int, input().split())
print(min(n*a, b))
| 16.125 | 35 | 0.666667 | 23 | 129 | 3.73913 | 0.608696 | 0.186047 | 0.372093 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.139535 | 129 | 7 | 36 | 18.428571 | 0.774775 | 0.155039 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.4 | 0 | 0.4 | 0.2 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
7370d6319aed0136ee694d5d67e4ac2834e1d6c0 | 54 | py | Python | mtg_ssm/scryfall/third_party/__init__.py | suniahk/mtg_ssm | 66912ff1a8d3532683d303b8d5d0c13287c28b32 | [
"MIT"
] | 29 | 2016-03-18T12:10:36.000Z | 2022-02-20T17:32:06.000Z | mtg_ssm/scryfall/third_party/__init__.py | gwax/mtgcdb | f45b45052f34bebd600c8be0c4fb787856971162 | [
"MIT"
] | 6 | 2016-04-26T08:25:01.000Z | 2021-02-22T11:56:27.000Z | mtg_ssm/scryfall/third_party/__init__.py | gwax/mtgcdb | f45b45052f34bebd600c8be0c4fb787856971162 | [
"MIT"
] | 8 | 2016-06-12T09:44:57.000Z | 2021-11-05T01:17:59.000Z | """Establish mtg_ssm.scryfall.third_party package."""
| 27 | 53 | 0.777778 | 7 | 54 | 5.714286 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.055556 | 54 | 1 | 54 | 54 | 0.784314 | 0.87037 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
737462f1355d5a240da40c16a10d16abce218a06 | 63 | py | Python | airtech/apps/tickets/__init__.py | sam-karis/airtech | 8e1cd7a9821719d27db046218625d70daaa46139 | [
"MIT"
] | null | null | null | airtech/apps/tickets/__init__.py | sam-karis/airtech | 8e1cd7a9821719d27db046218625d70daaa46139 | [
"MIT"
] | 4 | 2021-03-18T23:42:26.000Z | 2022-02-10T12:36:23.000Z | airtech/apps/tickets/__init__.py | sam-karis/airtech | 8e1cd7a9821719d27db046218625d70daaa46139 | [
"MIT"
] | null | null | null | default_app_config = 'airtech.apps.tickets.apps.TicketsConfig'
| 31.5 | 62 | 0.84127 | 8 | 63 | 6.375 | 0.875 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.047619 | 63 | 1 | 63 | 63 | 0.85 | 0 | 0 | 0 | 0 | 0 | 0.619048 | 0.619048 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
7389a6131435fe7fc464918852f62d1c95ba54d3 | 146 | py | Python | publicart_watcher/tests/test_command_line.py | rememberlenny/publicart-watcher | 1bf880355f675eca2c0e6fbb48aa7d57ff39e515 | [
"MIT"
] | null | null | null | publicart_watcher/tests/test_command_line.py | rememberlenny/publicart-watcher | 1bf880355f675eca2c0e6fbb48aa7d57ff39e515 | [
"MIT"
] | null | null | null | publicart_watcher/tests/test_command_line.py | rememberlenny/publicart-watcher | 1bf880355f675eca2c0e6fbb48aa7d57ff39e515 | [
"MIT"
] | null | null | null | from unittest import TestCase
from publicart_watcher.command_line import main
class TestCmd(TestCase):
def test_basic(self):
main() | 18.25 | 47 | 0.753425 | 19 | 146 | 5.631579 | 0.789474 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.184932 | 146 | 8 | 48 | 18.25 | 0.89916 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | false | 0 | 0.4 | 0 | 0.8 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
73a7b3a759250b8bb558898fe67d793d8c626091 | 485 | py | Python | src/ikazuchi/tests/data/rst/api_call_text_with_indent.py | t2y/ikazuchi | 7023111e92fa47360c50cfefd1398c554475f2c6 | [
"Apache-2.0"
] | null | null | null | src/ikazuchi/tests/data/rst/api_call_text_with_indent.py | t2y/ikazuchi | 7023111e92fa47360c50cfefd1398c554475f2c6 | [
"Apache-2.0"
] | null | null | null | src/ikazuchi/tests/data/rst/api_call_text_with_indent.py | t2y/ikazuchi | 7023111e92fa47360c50cfefd1398c554475f2c6 | [
"Apache-2.0"
] | null | null | null | # -*- coding: utf-8 -*-
DATA_SET = [
(
u"text line",
(u"", u"text line")
),
(
u" ",
(u" ", u" ")
),
(
u" \t ",
(u" \t", u" ")
),
(
u" text line",
(u" ", u"text line")
),
(
u"\ttext line",
(u"\t", u"text line")
),
(
u"\t text line",
(u"\t ", u"text line")
),
(
u"\t \ntext line",
(u"\t \n", u"text line")
),
]
| 14.69697 | 33 | 0.265979 | 54 | 485 | 2.37037 | 0.222222 | 0.351563 | 0.492188 | 0.46875 | 0.59375 | 0.59375 | 0.578125 | 0.578125 | 0 | 0 | 0 | 0.004132 | 0.501031 | 485 | 32 | 34 | 15.15625 | 0.524793 | 0.043299 | 0 | 0.5 | 0 | 0 | 0.281385 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
73a8cea2d222e9e117fbd8fe7aaa76df18700d0f | 91 | py | Python | intask_api/subtasks/apps.py | KirovVerst/intask | 4bdec6f49fa2873cca1354d7d3967973f5bcadc3 | [
"MIT"
] | null | null | null | intask_api/subtasks/apps.py | KirovVerst/intask | 4bdec6f49fa2873cca1354d7d3967973f5bcadc3 | [
"MIT"
] | 7 | 2016-08-17T23:08:31.000Z | 2022-03-02T02:23:08.000Z | intask_api/subtasks/apps.py | KirovVerst/intask | 4bdec6f49fa2873cca1354d7d3967973f5bcadc3 | [
"MIT"
] | null | null | null | from django.apps import AppConfig
class SubtasksConfig(AppConfig):
name = 'subtasks'
| 15.166667 | 33 | 0.758242 | 10 | 91 | 6.9 | 0.9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.164835 | 91 | 5 | 34 | 18.2 | 0.907895 | 0 | 0 | 0 | 0 | 0 | 0.087912 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
73c80160f8e80e22732257c8bf5bc870cf6196ae | 758 | py | Python | p99/python3/p31.py | jlou2u/katas | bbdeef5f2bf3c26d9764c173793724df3f01341f | [
"MIT"
] | null | null | null | p99/python3/p31.py | jlou2u/katas | bbdeef5f2bf3c26d9764c173793724df3f01341f | [
"MIT"
] | null | null | null | p99/python3/p31.py | jlou2u/katas | bbdeef5f2bf3c26d9764c173793724df3f01341f | [
"MIT"
] | null | null | null |
def is_prime(n):
if n <= 3:
return True
return not any([n % i == 0 for i in range(2, n)])
def test_is_prime():
assert is_prime(1)
assert is_prime(2)
assert is_prime(3)
assert is_prime(5)
assert is_prime(7)
assert is_prime(11)
assert is_prime(13)
assert is_prime(17)
assert is_prime(19)
assert is_prime(23)
assert is_prime(29)
assert is_prime(31)
assert is_prime(37)
assert is_prime(41)
assert is_prime(43)
assert is_prime(43)
assert is_prime(97)
assert not is_prime(4)
assert not is_prime(6)
assert not is_prime(8)
assert not is_prime(9)
assert not is_prime(10)
assert not is_prime(12)
assert not is_prime(14)
assert not is_prime(96)
| 19.435897 | 53 | 0.639842 | 133 | 758 | 3.43609 | 0.300752 | 0.413567 | 0.483589 | 0.280088 | 0.094092 | 0.094092 | 0.094092 | 0 | 0 | 0 | 0 | 0.079422 | 0.269129 | 758 | 38 | 54 | 19.947368 | 0.745487 | 0 | 0 | 0.066667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.833333 | 1 | 0.066667 | false | 0 | 0 | 0 | 0.133333 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
73d31f64b5fd041e2478f9b98b095c6eef171d5b | 735 | py | Python | thredo/queue.py | dabeaz/thredo | bd17c885bdad514fa2729998fe8b9388800b5fc2 | [
"MIT"
] | 340 | 2018-07-23T18:21:56.000Z | 2021-12-11T05:50:58.000Z | thredo/queue.py | dabeaz/thredo | bd17c885bdad514fa2729998fe8b9388800b5fc2 | [
"MIT"
] | 6 | 2018-07-31T11:52:56.000Z | 2019-11-25T19:52:32.000Z | thredo/queue.py | dabeaz/thredo | bd17c885bdad514fa2729998fe8b9388800b5fc2 | [
"MIT"
] | 25 | 2018-07-27T06:09:05.000Z | 2022-03-13T12:53:23.000Z | # queue.py
#
# A basic queue
__all__ = [ 'Queue' ]
import curio
# -- Thredo
from .thr import TAWAIT as AWAIT
class Queue(object):
def __init__(self, maxsize=0):
self._queue = curio.Queue(maxsize)
def empty(self):
return self._queue.empty()
def full(self):
return self._queue.full()
def get(self):
return AWAIT(self._queue.get)
def join(self):
return AWAIT(self._queue.join)
def put(self, item):
return AWAIT(self._queue.put, item)
def qsize(self):
return self._queue.qsize()
def task_done(self):
return AWAIT(self._queue.task_done)
def __iter__(self):
return self
def __next__(self):
return self.get()
| 17.5 | 43 | 0.608163 | 97 | 735 | 4.340206 | 0.329897 | 0.171021 | 0.166271 | 0.190024 | 0.171021 | 0 | 0 | 0 | 0 | 0 | 0 | 0.001876 | 0.27483 | 735 | 41 | 44 | 17.926829 | 0.787993 | 0.043537 | 0 | 0 | 0 | 0 | 0.007163 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.416667 | false | 0 | 0.083333 | 0.375 | 0.916667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 4 |
fb62541cdfbdf522f087d08126892db91d803f20 | 21 | py | Python | singer_tap_amazon_mws/cache.py | pys933/singer-tap-amazon-mws | f36649ee0127c41ebde3cb3797469a736c59680f | [
"Apache-2.0"
] | 4 | 2019-09-10T15:24:44.000Z | 2020-06-18T18:36:10.000Z | singer_tap_amazon_mws/cache.py | pys933/singer-tap-amazon-mws | f36649ee0127c41ebde3cb3797469a736c59680f | [
"Apache-2.0"
] | 1 | 2019-11-01T20:50:19.000Z | 2020-05-25T16:57:52.000Z | singer_tap_amazon_mws/cache.py | pys933/singer-tap-amazon-mws | f36649ee0127c41ebde3cb3797469a736c59680f | [
"Apache-2.0"
] | 6 | 2019-09-10T15:24:45.000Z | 2021-03-30T23:51:49.000Z |
InventoryCache = {}
| 7 | 19 | 0.666667 | 1 | 21 | 14 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.190476 | 21 | 2 | 20 | 10.5 | 0.823529 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
fb7c6d61e4eee6e1471882d1ec776feeceefe5aa | 57 | py | Python | models/synapses/PCDCNnMFDCN2015cSudhakar/__init__.py | HarshKhilawala/cerebmodels | d2a2f2ef947ef9dc23ddce6e55159240cd3233cb | [
"BSD-3-Clause"
] | null | null | null | models/synapses/PCDCNnMFDCN2015cSudhakar/__init__.py | HarshKhilawala/cerebmodels | d2a2f2ef947ef9dc23ddce6e55159240cd3233cb | [
"BSD-3-Clause"
] | 9 | 2020-03-24T17:09:03.000Z | 2021-05-17T16:11:17.000Z | models/synapses/PCDCNnMFDCN2015cSudhakar/__init__.py | myHBPwork/cerebmodels | 371ea7f1bbe388f1acade17c7128b8ca6ab8fb7a | [
"BSD-3-Clause"
] | 1 | 2021-05-21T03:08:41.000Z | 2021-05-21T03:08:41.000Z | # ~/models/synapses/PCDCNnMFDCN2015cSudhakar/__init__.py
| 28.5 | 56 | 0.842105 | 5 | 57 | 8.8 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.072727 | 0.035088 | 57 | 1 | 57 | 57 | 0.727273 | 0.947368 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
fb7e349445e31e2c6f83c3028f877ba44b231032 | 8,837 | py | Python | tests/test_decorators.py | simonw/django-sharding | 06258973963eae1112ac4bc572592f729f6957fc | [
"BSD-3-Clause"
] | null | null | null | tests/test_decorators.py | simonw/django-sharding | 06258973963eae1112ac4bc572592f729f6957fc | [
"BSD-3-Clause"
] | null | null | null | tests/test_decorators.py | simonw/django-sharding | 06258973963eae1112ac4bc572592f729f6957fc | [
"BSD-3-Clause"
] | null | null | null | import unittest
from django.conf import settings
from django.db import models
from django_sharding_library.id_generation_strategies import TableStrategyModel
from django_sharding_library.decorators import model_config
from django_sharding_library.exceptions import NonExistentDatabaseException, ShardedModelInitializationException
from django_sharding_library.fields import PostgresShardGeneratedIDField, TableShardedIDField
from django.test import TestCase
from django_sharding_library.manager import ShardManager
from django_sharding_library.constants import Backends
class ModelConfigDecoratorTestCase(TestCase):
def test_model_cannot_be_both_sharded_and_marked_for_a_specific_db(self):
with self.assertRaises(ShardedModelInitializationException):
@model_config(shard_group='default', database='default')
class TestModelTwo(models.Model):
id = TableShardedIDField(primary_key=True, source_table_name="blah")
random_string = models.CharField(max_length=120)
user_pk = models.PositiveIntegerField()
def get_shard(self):
pass
def test_sharded_model_requires_a_get_shard_method(self):
with self.assertRaises(ShardedModelInitializationException):
@model_config(shard_group='default')
class TestModelTwo(models.Model):
id = TableShardedIDField(primary_key=True, source_table_name="blah")
random_string = models.CharField(max_length=120)
user_pk = models.PositiveIntegerField()
def test_sharded_id_field_must_be_primary_key(self):
with self.assertRaises(ShardedModelInitializationException):
@model_config(shard_group='default')
class TestModelTwo(models.Model):
id = TableShardedIDField(source_table_name="blah")
random_string = models.CharField(max_length=120)
user_pk = models.PositiveIntegerField(primary_key=True)
def get_shard(self):
pass
def test_sharded_model_must_have_sharded_id_fied(self):
with self.assertRaises(ShardedModelInitializationException):
@model_config(shard_group='default')
class TestModelTwo(models.Model):
random_string = models.CharField(max_length=120)
user_pk = models.PositiveIntegerField()
def get_shard(self):
from django.contrib.auth import get_user_model
return get_user_model().objects.get(pk=self.user_pk).shard
def test_puts_shard_group_on_the_model_class(self):
@model_config(shard_group='testing')
class TestModelThree(models.Model):
id = TableShardedIDField(source_table_name="blah", primary_key=True)
random_string = models.CharField(max_length=120)
user_pk = models.PositiveIntegerField()
def get_shard(self):
from django.contrib.auth import get_user_model
return get_user_model().objects.get(pk=self.user_pk).shard
self.assertEqual(getattr(TestModelThree, 'django_sharding__shard_group', None), 'testing')
@unittest.skipIf(settings.DATABASES['default']['ENGINE'] not in Backends.POSTGRES, "Not a postgres backend")
def test_two_postgres_sharded_id_generator_fields(self):
@model_config(shard_group='testing')
class TestModelThree(models.Model):
id = PostgresShardGeneratedIDField(primary_key=True)
something = PostgresShardGeneratedIDField()
random_string = models.CharField(max_length=120)
user_pk = models.PositiveIntegerField()
def get_shard(self):
from django.contrib.auth import get_user_model
return get_user_model().objects.get(pk=self.user_pk).shard
self.assertEqual(getattr(TestModelThree, 'django_sharding__shard_group', None), 'testing')
def test_cannot_place_database_on_replica_db(self):
with self.assertRaises(NonExistentDatabaseException):
@model_config(database='app_shard_001_replica_001')
class ShardedTestModelIDsTwo(TableStrategyModel):
pass
def test_cannot_place_database_on_non_existant_db(self):
with self.assertRaises(NonExistentDatabaseException):
@model_config(database='i_do_not_exist')
class ShardedTestModelIDsTwo(TableStrategyModel):
pass
def test_puts_database_name_on_model_stored_on_another_database(self):
@model_config(database='app_shard_002')
class ShardedTestModelIDsThree(TableStrategyModel):
pass
self.assertEqual(getattr(ShardedTestModelIDsThree, 'django_sharding__database', None), 'app_shard_002')
def test_abstract_model_with_defined_manager_raises_exception_if_not_instance_of_shard_manager(self):
# Manager is defined and not shard model, should raise an exception
with self.assertRaises(ShardedModelInitializationException):
@model_config(shard_group='default', sharded_by_field="user_pk")
class TestModelOne(models.Model):
id = TableShardedIDField(primary_key=True, source_table_name="blah")
random_string = models.CharField(max_length=120)
user_pk = models.PositiveIntegerField()
objects = models.Manager()
class Meta:
abstract = True
def get_shard(self):
pass
@staticmethod
def get_shard_from_id(id):
pass
# Manager is not defined, should NOT raise an exception
@model_config(shard_group='default', sharded_by_field="user_pk")
class TestModelTwo(models.Model):
id = TableShardedIDField(primary_key=True, source_table_name="blah")
random_string = models.CharField(max_length=120)
user_pk = models.PositiveIntegerField()
class Meta:
abstract = True
def get_shard(self):
pass
@staticmethod
def get_shard_from_id(id):
pass
# Manager is defines but is a shardmanager, should not raise an exception
@model_config(shard_group='default', sharded_by_field="user_pk")
class TestModelThree(models.Model):
id = TableShardedIDField(primary_key=True, source_table_name="blah")
random_string = models.CharField(max_length=120)
user_pk = models.PositiveIntegerField()
objects = ShardManager()
class Meta:
abstract = True
def get_shard(self):
pass
@staticmethod
def get_shard_from_id(id):
pass
def test_decorator_raises_exception_when_sharded_by_field_is_defined_with_no_get_shard_from_id_function(self):
with self.assertRaises(ShardedModelInitializationException):
@model_config(shard_group='default', sharded_by_field="user_pk")
class TestModelOne(models.Model):
id = TableShardedIDField(primary_key=True, source_table_name="blah")
random_string = models.CharField(max_length=120)
user_pk = models.PositiveIntegerField()
def get_shard(self):
pass
def test_decorator_raises_exception_when_using_sharded_by_field_and_custom_manager_is_not_shard_manager_instance(self):
class CustomManager(models.Manager):
pass
with self.assertRaises(ShardedModelInitializationException):
@model_config(shard_group='default', sharded_by_field="user_pk")
class TestModelOne(models.Model):
id = TableShardedIDField(primary_key=True, source_table_name="blah")
random_string = models.CharField(max_length=120)
user_pk = models.PositiveIntegerField()
objects = CustomManager()
def get_shard(self):
pass
@staticmethod
def get_shard_from_id(id):
pass
def test_decorator_raises_exception_when_no_arguments_passed_in(self):
with self.assertRaises(ShardedModelInitializationException):
@model_config()
class TestModelOne(models.Model):
id = TableShardedIDField(primary_key=True, source_table_name="blah")
random_string = models.CharField(max_length=120)
user_pk = models.PositiveIntegerField()
def get_shard(self):
pass
@staticmethod
def get_shard_from_id(id):
pass
| 42.690821 | 123 | 0.665724 | 910 | 8,837 | 6.128571 | 0.148352 | 0.021517 | 0.031558 | 0.058096 | 0.720459 | 0.713825 | 0.681729 | 0.664156 | 0.657343 | 0.622198 | 0 | 0.007381 | 0.264117 | 8,837 | 206 | 124 | 42.898058 | 0.850223 | 0.021614 | 0 | 0.740506 | 0 | 0 | 0.040963 | 0.012266 | 0 | 0 | 0 | 0 | 0.082278 | 1 | 0.183544 | false | 0.113924 | 0.082278 | 0 | 0.411392 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 4 |
fb99f9ca00b3ff6d12f0884a7212dcf42fdfda5b | 402 | py | Python | KlasaDecyzyjna.py | Grundi1410/uwm-ssi | 522e573203858f85d9cbe5e89daa7c0a5cdac7db | [
"MIT"
] | null | null | null | KlasaDecyzyjna.py | Grundi1410/uwm-ssi | 522e573203858f85d9cbe5e89daa7c0a5cdac7db | [
"MIT"
] | null | null | null | KlasaDecyzyjna.py | Grundi1410/uwm-ssi | 522e573203858f85d9cbe5e89daa7c0a5cdac7db | [
"MIT"
] | null | null | null | class KlasaDecyzyjna:
def __init__(self, klasaDecyzyjna=0, attributes=0):
self.klasaDecyzyjna = ""
self.attributes = []
def setKlasaDecyzyjna(self, a):
self.klasaDecyzyjna = a
def setAttributes(self, a):
self.attributes = a
def getKlasaDecyzyjna(self):
return self.klasaDecyzyjna
def getAttributes(self):
return self.attributes
| 22.333333 | 55 | 0.646766 | 39 | 402 | 6.564103 | 0.333333 | 0.28125 | 0.070313 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.006757 | 0.263682 | 402 | 17 | 56 | 23.647059 | 0.858108 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.416667 | false | 0 | 0 | 0.166667 | 0.666667 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 4 |
fba4a3752567cdbbfd0894624db7edce08ab87da | 85 | py | Python | flash/apps.py | mdrichar/speedymc | 525dccf1f7629b50b3a7275991fd6d8efcf18701 | [
"MIT"
] | null | null | null | flash/apps.py | mdrichar/speedymc | 525dccf1f7629b50b3a7275991fd6d8efcf18701 | [
"MIT"
] | null | null | null | flash/apps.py | mdrichar/speedymc | 525dccf1f7629b50b3a7275991fd6d8efcf18701 | [
"MIT"
] | null | null | null | from django.apps import AppConfig
class FlashConfig(AppConfig):
name = 'flash'
| 14.166667 | 33 | 0.741176 | 10 | 85 | 6.3 | 0.9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.176471 | 85 | 5 | 34 | 17 | 0.9 | 0 | 0 | 0 | 0 | 0 | 0.058824 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 4 |
fbb4b49cd4c8e4b50a3868ea30cc9e09b860d880 | 6,612 | py | Python | pymars/tests/test_reduce_model.py | tsikes/pyMARS | ca393697f3bcc78d93c9f9d0254ea3f1dd049524 | [
"MIT"
] | 39 | 2016-03-23T19:52:11.000Z | 2022-02-17T12:50:44.000Z | pymars/tests/test_reduce_model.py | tsikes/pyMARS | ca393697f3bcc78d93c9f9d0254ea3f1dd049524 | [
"MIT"
] | 62 | 2017-06-16T23:24:17.000Z | 2021-07-23T03:01:34.000Z | pymars/tests/test_reduce_model.py | tsikes/pyMARS | ca393697f3bcc78d93c9f9d0254ea3f1dd049524 | [
"MIT"
] | 41 | 2016-02-25T18:38:12.000Z | 2022-03-15T02:57:06.000Z | """ Tests the create trimmed model unit used by pyMARS """
import os
import pkg_resources
import pytest
import cantera as ct
from ..reduce_model import trim
def relative_location(file):
file_path = os.path.join(file)
return pkg_resources.resource_filename(__name__, file_path)
class TestTrim:
def test_GRI_minus_three(self):
"""Tests removal of three species from GRI Mech 3.0.
"""
# Original model to remove things from
initial_model = 'gri30.cti'
# Create exclusion list for test case
exclusion_list = ["CH4", "O2", "N2"]
# Run trim unit
reduced_model = trim(initial_model, exclusion_list, 'gri30.cti')
# Expected answer
expected_species_num = 50
expected_reactions_num = 237
# Make sure number matches what is expected
assert reduced_model.n_species == expected_species_num
assert reduced_model.n_reactions == expected_reactions_num
# Make sure removed species are not included
assert "CH4" not in reduced_model.species_names
assert "O2" not in reduced_model.species_names
assert "N2" not in reduced_model.species_names
def test_GRI_minus_zero(self):
"""Tests removal of zero species from GRI Mech 3.0.
"""
# Original model to remove things from
initial_model = 'gri30.cti'
# Create exclusion list for test case
exclusion_list = []
# Run trim unit
reduced_model = trim(initial_model, exclusion_list, 'reduced_gri30.cti')
# Expected answer
expected_species_num = 53
expected_reactions_num = 325
# Make sure number matches what is expected
assert reduced_model.n_species == expected_species_num
assert reduced_model.n_reactions == expected_reactions_num
assert reduced_model.name == 'reduced_gri30'
def test_artificial_minus_one(self):
"""Test removing one species from artificial model.
"""
# Original model to remove things from
initial_model = relative_location(os.path.join('assets', 'artificial-mechanism.cti'))
# Create exclusion list for test case
exclusion_list = ['H']
# Run trim unit
reduced_model = trim(initial_model, exclusion_list, 'a-m.cti')
# Expected answer
expected_species_num = 3
expected_reactions_num = 1
# Make sure number matches what is expected
assert reduced_model.n_species == expected_species_num
assert reduced_model.n_reactions == expected_reactions_num
# Make sure removed species are not included
assert 'H' not in reduced_model.species_names
for sp in exclusion_list:
assert all([sp not in {**rxn.reactants, **rxn.products} for rxn in reduced_model.reactions()])
def testArtRemoveAll(self):
"""Test removing all four species in an artificial model.
Raises exception because Cantera will not produce a Solution with no species/reactions.
"""
# Original model to remove things from
initial_model = relative_location(os.path.join('assets', 'artificial-mechanism.cti'))
# Create exclusion list for test case
exclusion_list = ["H", "H2", "O2", "H2O"]
with pytest.raises(ValueError):
reduced_model = trim(initial_model, exclusion_list, "a-m.cti")
def testArtRemoveInvalid(self):
"""Test removing species not present in model.
"""
# Original model to remove things from
initial_model = relative_location(os.path.join('assets', 'artificial-mechanism.cti'))
# Create exclusion list for test case
exclusion_list = ['CH4']
# Run trim unit
reduced_model = trim(initial_model, exclusion_list, 'a-m.cti')
# Expected answer
expected_species_num = 4
expected_reactions_num = 2
# Make sure number matches what is expected
assert reduced_model.n_species == expected_species_num
assert reduced_model.n_reactions == expected_reactions_num
for sp in exclusion_list:
assert all([sp not in {**rxn.reactants, **rxn.products} for rxn in reduced_model.reactions()])
def testArtRemoveInvalidAnd1(self):
"""Test removing mixture of species both in and not in artificial model.
"""
# Original model to remove things from
initial_model = relative_location(os.path.join('assets', 'artificial-mechanism.cti'))
# Create exclusion list for test case
exclusion_list = ["H", "CH4"]
# Run trim unit
reduced_model = trim(initial_model, exclusion_list, "a-m.cti")
# Expected answer
expected_species_num = 3
expected_reactions_num = 1
# Make sure number matches what is expected
assert reduced_model.n_species == expected_species_num
assert reduced_model.n_reactions == expected_reactions_num
# Make sure removed species are not included
assert "H" not in reduced_model.species_names
for sp in exclusion_list:
assert all([sp not in {**rxn.reactants, **rxn.products} for rxn in reduced_model.reactions()])
def test_GRI_minus_10(self):
"""Test removing 10 species from GRI Mech 3.0
"""
# Original model to remove things from
initial_model = 'gri30.cti'
# Create exclusion list for test case
exclusion_list = ["CH4", "O2", "N2", "H", "OH", "H2O", "CH2", "CH3", "CO", "AR"]
# Run trim unit
reduced_model = trim(initial_model, exclusion_list, 'reduced_gri30.cti')
# Expected answer
expected_species_num = 43
expected_reactions_num = 14
# Make sure number matches what is expected
assert reduced_model.n_species == expected_species_num
assert reduced_model.n_reactions == expected_reactions_num
# Make sure removed species are not included
for sp in exclusion_list:
assert sp not in reduced_model.species_names
assert all([sp not in {**rxn.reactants, **rxn.products} for rxn in reduced_model.reactions()])
def test_remove_explicit_third_bodies(self):
"""Tests appropriate removal of reactions with explicit third body species.
"""
initial_model = relative_location(os.path.join('assets', 'model-third-bodies.cti'))
reduced_model = trim(initial_model, ['ar', 'he'], 'test.cti')
assert reduced_model.n_species == 4
assert reduced_model.n_reactions == 1
| 36.131148 | 106 | 0.660012 | 831 | 6,612 | 5.046931 | 0.158845 | 0.094421 | 0.064378 | 0.063424 | 0.768479 | 0.748927 | 0.735813 | 0.70267 | 0.692179 | 0.692179 | 0 | 0.013093 | 0.260738 | 6,612 | 182 | 107 | 36.32967 | 0.844926 | 0.26588 | 0 | 0.45122 | 0 | 0 | 0.068559 | 0.024816 | 0 | 0 | 0 | 0 | 0.304878 | 1 | 0.109756 | false | 0 | 0.060976 | 0 | 0.195122 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
83734422d52fcc66a3ec353f44ee1bb102e69dda | 77 | py | Python | gpcrawler/entrypoint.py | fst034356/crawler | 98f0c1a129b3b5b77fe88971f4f0c6aae5a8964f | [
"MIT"
] | 92 | 2017-03-06T06:32:49.000Z | 2020-04-05T02:14:56.000Z | gpcrawler/entrypoint.py | GeraldDoubleJ/crawler | ab068b1b4d8d00336bb11cea0860244e0817e472 | [
"MIT"
] | 1 | 2018-06-03T10:38:26.000Z | 2018-09-04T09:17:40.000Z | gpcrawler/entrypoint.py | GeraldDoubleJ/crawler | ab068b1b4d8d00336bb11cea0860244e0817e472 | [
"MIT"
] | 58 | 2017-04-09T11:18:40.000Z | 2020-03-23T11:20:17.000Z | from scrapy.cmdline import execute
execute(['scrapy', 'crawl', 'googleplay']) | 38.5 | 42 | 0.753247 | 9 | 77 | 6.444444 | 0.777778 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.077922 | 77 | 2 | 42 | 38.5 | 0.816901 | 0 | 0 | 0 | 0 | 0 | 0.269231 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 4 |
83a3a1112068729b380736efe81c6a6773f992fa | 241 | py | Python | pyleecan/Methods/Simulation/OPslip/get_slip.py | Eomys/Pyleecan | 4d7f0cbabf0311006963e7a2f435db2ecd901118 | [
"Apache-2.0"
] | 4 | 2017-11-27T10:14:34.000Z | 2018-09-20T11:30:32.000Z | pyleecan/Methods/Simulation/OPslip/get_slip.py | Eomys/Pyleecan | 4d7f0cbabf0311006963e7a2f435db2ecd901118 | [
"Apache-2.0"
] | null | null | null | pyleecan/Methods/Simulation/OPslip/get_slip.py | Eomys/Pyleecan | 4d7f0cbabf0311006963e7a2f435db2ecd901118 | [
"Apache-2.0"
] | null | null | null | def get_slip(self):
"""Returns the Rotor mechanical slip
Parameters
----------
self : OPslip
An OPslip object
Returns
-------
slip : float
Rotor mechanical slip
"""
return self.slip_ref
| 15.0625 | 40 | 0.543568 | 25 | 241 | 5.16 | 0.6 | 0.232558 | 0.294574 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.3361 | 241 | 15 | 41 | 16.066667 | 0.80625 | 0.609959 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.5 | false | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
83a618abd558f910856d16b1c240006ee4587c42 | 176 | py | Python | Functions and modules/lambda_function.py | UgainJain/LearnPythonByDoing | 4784c334d7f485223a29592ab47c6c017ec67145 | [
"MIT"
] | 5 | 2018-11-06T11:15:35.000Z | 2020-07-29T21:54:28.000Z | Functions and modules/lambda_function.py | UgainJain/LearnPythonByDoing | 4784c334d7f485223a29592ab47c6c017ec67145 | [
"MIT"
] | 1 | 2018-11-13T13:22:11.000Z | 2018-11-13T13:22:11.000Z | Functions and modules/lambda_function.py | UgainJain/LearnPythonByDoing | 4784c334d7f485223a29592ab47c6c017ec67145 | [
"MIT"
] | 11 | 2018-11-06T11:12:21.000Z | 2019-07-12T11:43:05.000Z | cube=lambda a : a*a*a; #lambda function declaration
print("cube of 6 :",cube(6))
print("cube of 9 :",cube(9))
print("cube of 11 :",cube(11)) | 35.2 | 83 | 0.522727 | 27 | 176 | 3.407407 | 0.37037 | 0.065217 | 0.358696 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.065574 | 0.306818 | 176 | 5 | 84 | 35.2 | 0.688525 | 0.153409 | 0 | 0 | 0 | 0 | 0.234483 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.75 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 4 |
83ce5331863c9703df63c671f015a407cc6f3ce3 | 340 | py | Python | Instagram_Web_Scraper/public_account.py | rahulnair502/Projects | 168572d99bb4c266b3f57a325edd8e10bc2e8344 | [
"MIT"
] | null | null | null | Instagram_Web_Scraper/public_account.py | rahulnair502/Projects | 168572d99bb4c266b3f57a325edd8e10bc2e8344 | [
"MIT"
] | null | null | null | Instagram_Web_Scraper/public_account.py | rahulnair502/Projects | 168572d99bb4c266b3f57a325edd8e10bc2e8344 | [
"MIT"
] | null | null | null | ##used for accounts that are not yours
class Public_account:
def __init__(self, username):
self.username = username
def insta_page2(self):
print(f"https://www.instagram.com/{self.username}/?hl=en")
driver.get(f"https://www.instagram.com/{self.username}/?hl=en")
time.sleep(random.uniform(.75, 1.5))
| 34 | 71 | 0.658824 | 49 | 340 | 4.44898 | 0.673469 | 0.220183 | 0.082569 | 0.165138 | 0.33945 | 0.33945 | 0.33945 | 0.33945 | 0.33945 | 0 | 0 | 0.017986 | 0.182353 | 340 | 9 | 72 | 37.777778 | 0.766187 | 0.105882 | 0 | 0 | 0 | 0 | 0.317881 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.285714 | false | 0 | 0 | 0 | 0.428571 | 0.142857 | 0 | 0 | 0 | null | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
83e047444793f7e0c02754f221c13cf66c3776bc | 28 | py | Python | data/studio21_generated/introductory/4208/starter_code.py | vijaykumawat256/Prompt-Summarization | 614f5911e2acd2933440d909de2b4f86653dc214 | [
"Apache-2.0"
] | null | null | null | data/studio21_generated/introductory/4208/starter_code.py | vijaykumawat256/Prompt-Summarization | 614f5911e2acd2933440d909de2b4f86653dc214 | [
"Apache-2.0"
] | null | null | null | data/studio21_generated/introductory/4208/starter_code.py | vijaykumawat256/Prompt-Summarization | 614f5911e2acd2933440d909de2b4f86653dc214 | [
"Apache-2.0"
] | null | null | null | def ipsubnet2list(subnet):
| 14 | 26 | 0.785714 | 3 | 28 | 7.333333 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.04 | 0.107143 | 28 | 2 | 27 | 14 | 0.84 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0 | null | null | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.