hexsha string | size int64 | ext string | lang string | max_stars_repo_path string | max_stars_repo_name string | max_stars_repo_head_hexsha string | max_stars_repo_licenses list | max_stars_count int64 | max_stars_repo_stars_event_min_datetime string | max_stars_repo_stars_event_max_datetime string | max_issues_repo_path string | max_issues_repo_name string | max_issues_repo_head_hexsha string | max_issues_repo_licenses list | max_issues_count int64 | max_issues_repo_issues_event_min_datetime string | max_issues_repo_issues_event_max_datetime string | max_forks_repo_path string | max_forks_repo_name string | max_forks_repo_head_hexsha string | max_forks_repo_licenses list | max_forks_count int64 | max_forks_repo_forks_event_min_datetime string | max_forks_repo_forks_event_max_datetime string | content string | avg_line_length float64 | max_line_length int64 | alphanum_fraction float64 | qsc_code_num_words_quality_signal int64 | qsc_code_num_chars_quality_signal float64 | qsc_code_mean_word_length_quality_signal float64 | qsc_code_frac_words_unique_quality_signal float64 | qsc_code_frac_chars_top_2grams_quality_signal float64 | qsc_code_frac_chars_top_3grams_quality_signal float64 | qsc_code_frac_chars_top_4grams_quality_signal float64 | qsc_code_frac_chars_dupe_5grams_quality_signal float64 | qsc_code_frac_chars_dupe_6grams_quality_signal float64 | qsc_code_frac_chars_dupe_7grams_quality_signal float64 | qsc_code_frac_chars_dupe_8grams_quality_signal float64 | qsc_code_frac_chars_dupe_9grams_quality_signal float64 | qsc_code_frac_chars_dupe_10grams_quality_signal float64 | qsc_code_frac_chars_replacement_symbols_quality_signal float64 | qsc_code_frac_chars_digital_quality_signal float64 | qsc_code_frac_chars_whitespace_quality_signal float64 | qsc_code_size_file_byte_quality_signal float64 | qsc_code_num_lines_quality_signal float64 | qsc_code_num_chars_line_max_quality_signal float64 | qsc_code_num_chars_line_mean_quality_signal float64 | qsc_code_frac_chars_alphabet_quality_signal float64 | qsc_code_frac_chars_comments_quality_signal float64 | qsc_code_cate_xml_start_quality_signal float64 | qsc_code_frac_lines_dupe_lines_quality_signal float64 | qsc_code_cate_autogen_quality_signal float64 | qsc_code_frac_lines_long_string_quality_signal float64 | qsc_code_frac_chars_string_length_quality_signal float64 | qsc_code_frac_chars_long_word_length_quality_signal float64 | qsc_code_frac_lines_string_concat_quality_signal float64 | qsc_code_cate_encoded_data_quality_signal float64 | qsc_code_frac_chars_hex_words_quality_signal float64 | qsc_code_frac_lines_prompt_comments_quality_signal float64 | qsc_code_frac_lines_assert_quality_signal float64 | qsc_codepython_cate_ast_quality_signal float64 | qsc_codepython_frac_lines_func_ratio_quality_signal float64 | qsc_codepython_cate_var_zero_quality_signal bool | qsc_codepython_frac_lines_pass_quality_signal float64 | qsc_codepython_frac_lines_import_quality_signal float64 | qsc_codepython_frac_lines_simplefunc_quality_signal float64 | qsc_codepython_score_lines_no_logic_quality_signal float64 | qsc_codepython_frac_lines_print_quality_signal float64 | qsc_code_num_words int64 | qsc_code_num_chars int64 | qsc_code_mean_word_length int64 | qsc_code_frac_words_unique null | qsc_code_frac_chars_top_2grams int64 | qsc_code_frac_chars_top_3grams int64 | qsc_code_frac_chars_top_4grams int64 | qsc_code_frac_chars_dupe_5grams int64 | qsc_code_frac_chars_dupe_6grams int64 | qsc_code_frac_chars_dupe_7grams int64 | qsc_code_frac_chars_dupe_8grams int64 | qsc_code_frac_chars_dupe_9grams int64 | qsc_code_frac_chars_dupe_10grams int64 | qsc_code_frac_chars_replacement_symbols int64 | qsc_code_frac_chars_digital int64 | qsc_code_frac_chars_whitespace int64 | qsc_code_size_file_byte int64 | qsc_code_num_lines int64 | qsc_code_num_chars_line_max int64 | qsc_code_num_chars_line_mean int64 | qsc_code_frac_chars_alphabet int64 | qsc_code_frac_chars_comments int64 | qsc_code_cate_xml_start int64 | qsc_code_frac_lines_dupe_lines int64 | qsc_code_cate_autogen int64 | qsc_code_frac_lines_long_string int64 | qsc_code_frac_chars_string_length int64 | qsc_code_frac_chars_long_word_length int64 | qsc_code_frac_lines_string_concat null | qsc_code_cate_encoded_data int64 | qsc_code_frac_chars_hex_words int64 | qsc_code_frac_lines_prompt_comments int64 | qsc_code_frac_lines_assert int64 | qsc_codepython_cate_ast int64 | qsc_codepython_frac_lines_func_ratio int64 | qsc_codepython_cate_var_zero int64 | qsc_codepython_frac_lines_pass int64 | qsc_codepython_frac_lines_import int64 | qsc_codepython_frac_lines_simplefunc int64 | qsc_codepython_score_lines_no_logic int64 | qsc_codepython_frac_lines_print int64 | effective string | hits int64 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
bf14ce2e4fb18cad227c9c5560c6adb24cf2a870 | 9,279 | py | Python | uncertainty_baselines/models/resnet50.py | gmum/uncertainty-baselines | 1118f7d9c084282e12eb0959dfe0ca12eb3d2388 | [
"Apache-2.0"
] | 2 | 2022-02-22T10:22:46.000Z | 2022-03-09T09:22:41.000Z | uncertainty_baselines/models/resnet50.py | PGM-Lab/2022-AISTATS-diversity | 63df2e5f29cdaefe49626439bbe13289f37eed36 | [
"Apache-2.0"
] | null | null | null | uncertainty_baselines/models/resnet50.py | PGM-Lab/2022-AISTATS-diversity | 63df2e5f29cdaefe49626439bbe13289f37eed36 | [
"Apache-2.0"
] | null | null | null | # coding=utf-8
# Copyright 2020 The Uncertainty Baselines Authors.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
# Lint as: python3
"""ResNet50 Keras model for ImageNet."""
from typing import Any, Dict, Tuple
import tensorflow as tf
def _identity_block(
input_tensor: tf.Tensor,
kernel_size: int,
filters: Tuple[int, int, int],
stage: int,
block: str,
batch_norm_momentum: float,
batch_norm_epsilon: float) -> tf.Tensor:
"""The identity block is the block that has no conv layer at shortcut.
Args:
input_tensor: input tensor
kernel_size: default 3, the kernel size of middle conv layer at main path.
filters: list of integers, the filters of 3 conv layer at main path.
stage: integer, current stage label, used for generating layer names.
block: 'a','b'..., current block label, used for generating layer names.
batch_norm_momentum: the batch normalization EMA momentum.
batch_norm_epsilon: the batch normalization epsilon.
Returns:
Output tensor for the block.
"""
filters1, filters2, filters3 = filters
# TODO(znado): support NCHW data_format.
bn_axis = 3
conv_name_base = 'res' + str(stage) + block + '_branch'
bn_name_base = 'bn' + str(stage) + block + '_branch'
x = tf.keras.layers.Conv2D(
filters1,
(1, 1),
use_bias=False,
kernel_initializer='he_normal',
name=conv_name_base + '2a')(input_tensor)
x = tf.keras.layers.BatchNormalization(
axis=bn_axis,
name=bn_name_base + '2a',
momentum=batch_norm_momentum,
epsilon=batch_norm_epsilon)(x)
x = tf.keras.layers.Activation('relu')(x)
x = tf.keras.layers.Conv2D(
filters2,
kernel_size,
use_bias=False,
padding='same',
kernel_initializer='he_normal',
name=conv_name_base + '2b')(x)
x = tf.keras.layers.BatchNormalization(
axis=bn_axis,
name=bn_name_base + '2b',
momentum=batch_norm_momentum,
epsilon=batch_norm_epsilon)(x)
x = tf.keras.layers.Activation('relu')(x)
x = tf.keras.layers.Conv2D(
filters3,
(1, 1),
use_bias=False,
kernel_initializer='he_normal',
name=conv_name_base + '2c')(x)
x = tf.keras.layers.BatchNormalization(
axis=bn_axis,
name=bn_name_base + '2c',
momentum=batch_norm_momentum,
epsilon=batch_norm_epsilon)(x)
x = tf.keras.layers.add([x, input_tensor])
x = tf.keras.layers.Activation('relu')(x)
return x
def _conv_block(
input_tensor: tf.Tensor,
kernel_size: int,
filters: Tuple[int, int, int],
stage: int,
block: str,
strides: Tuple[int, int] = (2, 2),
batch_norm_momentum: float = 0.9,
batch_norm_epsilon: float = 1e-5) -> tf.Tensor:
"""A block that has a conv layer at shortcut.
Note that from stage 3, the second conv layer at main path is with
strides=(2, 2) and the shortcut should have strides=(2, 2) as well.
Args:
input_tensor: input tensor
kernel_size: the kernel size of middle conv layer at main path
filters: list of integers, the filters of 3 conv layer at main path
stage: integer, current stage label, used for generating layer names
block: 'a','b'..., current block label, used for generating layer names
strides: Strides for the second conv layer in the block.
batch_norm_momentum: the batch normalization EMA momentum.
batch_norm_epsilon: the batch normalization epsilon.
Returns:
Output tensor for the block.
"""
filters1, filters2, filters3 = filters
# TODO(znado): support NCHW data_format.
bn_axis = 3
conv_name_base = 'res' + str(stage) + block + '_branch'
bn_name_base = 'bn' + str(stage) + block + '_branch'
x = tf.keras.layers.Conv2D(
filters1,
(1, 1),
use_bias=False,
kernel_initializer='he_normal',
name=conv_name_base + '2a')(input_tensor)
x = tf.keras.layers.BatchNormalization(
axis=bn_axis,
name=bn_name_base + '2a',
momentum=batch_norm_momentum,
epsilon=batch_norm_epsilon)(x)
x = tf.keras.layers.Activation('relu')(x)
x = tf.keras.layers.Conv2D(
filters2,
kernel_size,
strides=strides,
padding='same',
use_bias=False,
kernel_initializer='he_normal',
name=conv_name_base + '2b')(x)
x = tf.keras.layers.BatchNormalization(
axis=bn_axis,
name=bn_name_base + '2b',
momentum=batch_norm_momentum,
epsilon=batch_norm_epsilon)(x)
x = tf.keras.layers.Activation('relu')(x)
x = tf.keras.layers.Conv2D(
filters3,
(1, 1),
use_bias=False,
kernel_initializer='he_normal',
name=conv_name_base + '2c')(x)
x = tf.keras.layers.BatchNormalization(
axis=bn_axis,
name=bn_name_base + '2c',
momentum=batch_norm_momentum,
epsilon=batch_norm_epsilon)(x)
shortcut = tf.keras.layers.Conv2D(
filters3,
(1, 1),
use_bias=False,
strides=strides,
kernel_initializer='he_normal',
name=conv_name_base + '1')(input_tensor)
shortcut = tf.keras.layers.BatchNormalization(
axis=bn_axis,
name=bn_name_base + '1',
momentum=batch_norm_momentum,
epsilon=batch_norm_epsilon)(shortcut)
x = tf.keras.layers.add([x, shortcut])
x = tf.keras.layers.Activation('relu')(x)
return x
def create_model(
batch_size: int,
batch_norm_momentum: float = 0.9,
batch_norm_epsilon: float = 1e-5,
**unused_kwargs: Dict[str, Any]) -> tf.keras.Model:
"""Instantiates the ResNet50 architecture.
Args:
batch_size: int value of the static per_replica batch size.
batch_norm_momentum: the batch normalization EMA momentum.
batch_norm_epsilon: the batch normalization epsilon.
Returns:
A Keras model instance that returns the logits for the model.
"""
# TODO(znado): support NCHW data format.
bn_axis = 3
input_layer = tf.keras.layers.Input(
shape=(224, 224, 3), batch_size=batch_size)
x = tf.keras.layers.ZeroPadding2D(
padding=(3, 3),
name='conv1_pad')(input_layer)
x = tf.keras.layers.Conv2D(
64,
(7, 7),
use_bias=False,
strides=(2, 2),
padding='valid',
kernel_initializer='he_normal',
name='conv1')(x)
x = tf.keras.layers.BatchNormalization(
axis=bn_axis,
name='bn_conv1',
momentum=batch_norm_momentum,
epsilon=batch_norm_epsilon)(x)
x = tf.keras.layers.Activation('relu')(x)
x = tf.keras.layers.MaxPooling2D((3, 3), strides=(2, 2), padding='same')(x)
x = _conv_block(
x,
kernel_size=3,
filters=(64, 64, 256),
stage=2,
block='a',
strides=(1, 1),
batch_norm_momentum=batch_norm_momentum,
batch_norm_epsilon=batch_norm_epsilon)
x = _identity_block(
x, 3, (64, 64, 256), 2, 'b', batch_norm_momentum, batch_norm_epsilon)
x = _identity_block(
x, 3, (64, 64, 256), 2, 'c', batch_norm_momentum, batch_norm_epsilon)
x = _conv_block(
x,
kernel_size=3,
filters=(128, 128, 512),
stage=3,
block='a',
batch_norm_momentum=batch_norm_momentum,
batch_norm_epsilon=batch_norm_epsilon)
x = _identity_block(
x, 3, (128, 128, 512), 3, 'b', batch_norm_momentum, batch_norm_epsilon)
x = _identity_block(
x, 3, (128, 128, 512), 3, 'c', batch_norm_momentum, batch_norm_epsilon)
x = _identity_block(
x, 3, (128, 128, 512), 3, 'd', batch_norm_momentum, batch_norm_epsilon)
x = _conv_block(
x,
kernel_size=3,
filters=(256, 256, 1024),
stage=4,
block='a',
batch_norm_momentum=batch_norm_momentum,
batch_norm_epsilon=batch_norm_epsilon)
x = _identity_block(
x, 3, (256, 256, 1024), 4, 'b', batch_norm_momentum, batch_norm_epsilon)
x = _identity_block(
x, 3, (256, 256, 1024), 4, 'c', batch_norm_momentum, batch_norm_epsilon)
x = _identity_block(
x, 3, (256, 256, 1024), 4, 'd', batch_norm_momentum, batch_norm_epsilon)
x = _identity_block(
x, 3, (256, 256, 1024), 4, 'e', batch_norm_momentum, batch_norm_epsilon)
x = _identity_block(
x, 3, (256, 256, 1024), 4, 'f', batch_norm_momentum, batch_norm_epsilon)
x = _conv_block(
x,
kernel_size=3,
filters=(512, 512, 2048),
stage=5,
block='a',
batch_norm_momentum=batch_norm_momentum,
batch_norm_epsilon=batch_norm_epsilon)
x = _identity_block(
x, 3, (512, 512, 2048), 5, 'b', batch_norm_momentum, batch_norm_epsilon)
x = _identity_block(
x, 3, (512, 512, 2048), 5, 'c', batch_norm_momentum, batch_norm_epsilon)
x = tf.keras.layers.GlobalAveragePooling2D(name='avg_pool')(x)
x = tf.keras.layers.Dense(
1000,
kernel_initializer=tf.keras.initializers.RandomNormal(stddev=0.01))(x)
return tf.keras.Model(input_layer, x, name='resnet50')
| 31.886598 | 78 | 0.668283 | 1,322 | 9,279 | 4.478064 | 0.153555 | 0.103378 | 0.097635 | 0.063851 | 0.731926 | 0.715203 | 0.709628 | 0.697466 | 0.671115 | 0.664865 | 0 | 0.040511 | 0.215217 | 9,279 | 290 | 79 | 31.996552 | 0.772453 | 0.250458 | 0 | 0.723301 | 0 | 0 | 0.034307 | 0 | 0 | 0 | 0 | 0.010345 | 0 | 1 | 0.014563 | false | 0 | 0.009709 | 0 | 0.038835 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
172cc61c85cd36c5accddbd4ef6f43a2ab9c2d59 | 36 | py | Python | multifunctional/handlers/equal_allocation.py | bsteubing/multifunctional | 92c6e427374b151a8ea57c9be9e9245c717b9d46 | [
"BSD-3-Clause"
] | 1 | 2021-02-03T22:01:08.000Z | 2021-02-03T22:01:08.000Z | multifunctional/handlers/equal_allocation.py | bsteubing/multifunctional | 92c6e427374b151a8ea57c9be9e9245c717b9d46 | [
"BSD-3-Clause"
] | null | null | null | multifunctional/handlers/equal_allocation.py | bsteubing/multifunctional | 92c6e427374b151a8ea57c9be9e9245c717b9d46 | [
"BSD-3-Clause"
] | null | null | null | def equal_allocation(act):
pass
| 12 | 26 | 0.722222 | 5 | 36 | 5 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.194444 | 36 | 2 | 27 | 18 | 0.862069 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.5 | false | 0.5 | 0 | 0 | 0.5 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 5 |
1744d10a0498cb486a350483ab7d84bdd7e4eea7 | 445 | py | Python | src/HERMES_1-concept_map_generation.py | delavet/SOworkspace | 74bbcfa62c7e293b2b02f23249ac408aa22b44af | [
"MIT"
] | 6 | 2020-12-31T06:13:56.000Z | 2022-03-27T16:26:12.000Z | src/HERMES_1-concept_map_generation.py | delavet/SOworkspace | 74bbcfa62c7e293b2b02f23249ac408aa22b44af | [
"MIT"
] | null | null | null | src/HERMES_1-concept_map_generation.py | delavet/SOworkspace | 74bbcfa62c7e293b2b02f23249ac408aa22b44af | [
"MIT"
] | null | null | null | from util.concept_map import apidoc_concept_map_generator
import networkx as nx
from util.config import *
import os
'''
generate concept map for javadoc
'''
def generate_concept_map_for_javadoc():
concept_map = apidoc_concept_map_generator.generate_concept_map('javadoc')
print('generate complete!')
nx.write_gexf(concept_map, LATEST_CONCEPT_MAP_PATH['javadoc'])
if __name__ == "__main__":
generate_concept_map_for_javadoc()
| 24.722222 | 78 | 0.791011 | 61 | 445 | 5.262295 | 0.409836 | 0.311526 | 0.224299 | 0.196262 | 0.261682 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.123596 | 445 | 17 | 79 | 26.176471 | 0.823077 | 0 | 0 | 0 | 1 | 0 | 0.098765 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.1 | false | 0 | 0.4 | 0 | 0.5 | 0.1 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
1745b03b4f4b2345becbbd451b022c50655e6dca | 134 | py | Python | shapenet/modeling/__init__.py | MAYURGAIKWAD/meshrcnn | b47ecd47ca7de7055b7d141e63ddab286c5245f3 | [
"BSD-3-Clause"
] | 1,028 | 2020-01-23T23:30:54.000Z | 2022-03-27T22:33:50.000Z | shapenet/modeling/__init__.py | MAYURGAIKWAD/meshrcnn | b47ecd47ca7de7055b7d141e63ddab286c5245f3 | [
"BSD-3-Clause"
] | 103 | 2020-01-24T05:29:48.000Z | 2022-03-08T13:04:24.000Z | shapenet/modeling/__init__.py | MAYURGAIKWAD/meshrcnn | b47ecd47ca7de7055b7d141e63ddab286c5245f3 | [
"BSD-3-Clause"
] | 179 | 2020-01-24T08:14:30.000Z | 2022-03-19T00:34:05.000Z | # Copyright (c) Facebook, Inc. and its affiliates. All Rights Reserved
from .heads import MeshLoss
from .mesh_arch import build_model
| 33.5 | 70 | 0.798507 | 20 | 134 | 5.25 | 0.9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.141791 | 134 | 3 | 71 | 44.666667 | 0.913043 | 0.507463 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
176622d3c9d2e541893e236e96aeb90c83b90904 | 468 | py | Python | company/InfyTQ/Fundamentals/07SET/removeDuplicates.py | vikkastiwari/cpp-coding-questions | 020790e1a3b26c7b24991427004730b3f0785c71 | [
"MIT"
] | null | null | null | company/InfyTQ/Fundamentals/07SET/removeDuplicates.py | vikkastiwari/cpp-coding-questions | 020790e1a3b26c7b24991427004730b3f0785c71 | [
"MIT"
] | null | null | null | company/InfyTQ/Fundamentals/07SET/removeDuplicates.py | vikkastiwari/cpp-coding-questions | 020790e1a3b26c7b24991427004730b3f0785c71 | [
"MIT"
] | null | null | null | # def remove_duplicates(value):
# # start writing your code here
# distinct_val = []
# for i in set(value):
# distinct_val.append(i)
# return ("".join(distinct_val))
# print(remove_duplicates("11223445566666ababzzz@@@123#*#*"))
from collections import OrderedDict
def remove_duplicates(value):
# start writing your code here
return "".join(OrderedDict.fromkeys(value))
print(remove_duplicates("11223445566666ababzzz@@@123#*#*"))
| 23.4 | 61 | 0.690171 | 52 | 468 | 6.076923 | 0.5 | 0.202532 | 0.120253 | 0.151899 | 0.588608 | 0.303797 | 0.303797 | 0.303797 | 0.303797 | 0 | 0 | 0.087629 | 0.17094 | 468 | 19 | 62 | 24.631579 | 0.726804 | 0.561966 | 0 | 0 | 0 | 0 | 0.160622 | 0.160622 | 0 | 0 | 0 | 0.052632 | 0 | 1 | 0.25 | false | 0 | 0.25 | 0.25 | 0.75 | 0.25 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 5 |
17905202f34ac4c7129cc448e0325235c2111f93 | 184 | py | Python | tests/end-to-end/test_visualization.py | yzR1991/Copulas | 72c0d9c398f7fe3eb075b56591911fea377cdc33 | [
"MIT"
] | 235 | 2020-01-12T14:36:45.000Z | 2022-03-26T16:53:44.000Z | tests/end-to-end/test_visualization.py | yzR1991/Copulas | 72c0d9c398f7fe3eb075b56591911fea377cdc33 | [
"MIT"
] | 165 | 2020-01-09T16:28:25.000Z | 2022-03-01T08:13:22.000Z | tests/end-to-end/test_visualization.py | yzR1991/Copulas | 72c0d9c398f7fe3eb075b56591911fea377cdc33 | [
"MIT"
] | 60 | 2020-02-01T13:47:26.000Z | 2022-03-15T06:18:24.000Z | from copulas.datasets import sample_trivariate_xyz
from copulas.visualization import compare_3d
def test_compare_3d():
data = sample_trivariate_xyz()
compare_3d(data, data)
| 20.444444 | 50 | 0.798913 | 25 | 184 | 5.56 | 0.52 | 0.194245 | 0.273381 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.018987 | 0.141304 | 184 | 8 | 51 | 23 | 0.860759 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | false | 0 | 0.4 | 0 | 0.6 | 0 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
1792cd954d50eeb49fb74232bf49846d7e41b294 | 97 | py | Python | PARTE_1/EX026/cores_terminal.py | 0Fernando0/CursoPython | 1dcfdb6556e41c6dedcba2857aa4382b2f81aa59 | [
"MIT"
] | null | null | null | PARTE_1/EX026/cores_terminal.py | 0Fernando0/CursoPython | 1dcfdb6556e41c6dedcba2857aa4382b2f81aa59 | [
"MIT"
] | null | null | null | PARTE_1/EX026/cores_terminal.py | 0Fernando0/CursoPython | 1dcfdb6556e41c6dedcba2857aa4382b2f81aa59 | [
"MIT"
] | null | null | null | print('\033[4;34molá, mundo!\033[m')
a = 7
print(f'o número \033[31m{a}\033[m e sinal de sorte!') | 32.333333 | 54 | 0.649485 | 22 | 97 | 2.863636 | 0.727273 | 0.126984 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.209302 | 0.113402 | 97 | 3 | 54 | 32.333333 | 0.523256 | 0 | 0 | 0 | 0 | 0 | 0.72449 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.666667 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
17963930d50b768c34f3ce27c2817063d85a550e | 65 | py | Python | daft_builder/__init__.py | macks22/daft-builder | 54e946d07ba730d29373d4448a5278569248d87e | [
"MIT"
] | 1 | 2019-12-06T09:53:26.000Z | 2019-12-06T09:53:26.000Z | daft_builder/__init__.py | macks22/daft-builder | 54e946d07ba730d29373d4448a5278569248d87e | [
"MIT"
] | 3 | 2019-08-02T11:48:05.000Z | 2019-08-08T19:11:32.000Z | daft_builder/__init__.py | macks22/daft-builder | 54e946d07ba730d29373d4448a5278569248d87e | [
"MIT"
] | null | null | null | from .pgm import PGM, Plate, Node, Data, Param, HyperParam, Text
| 32.5 | 64 | 0.738462 | 10 | 65 | 4.8 | 0.9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.153846 | 65 | 1 | 65 | 65 | 0.872727 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
17a47cce1a66fd5ce59bc2e3d3c36a91c9631a68 | 102 | py | Python | leetcode/python/551_student_attendance_record_i.py | VVKot/leetcode-solutions | 7d6e599b223d89a7861929190be715d3b3604fa4 | [
"MIT"
] | 4 | 2019-04-22T11:57:36.000Z | 2019-10-29T09:12:56.000Z | leetcode/python/551_student_attendance_record_i.py | VVKot/coding-competitions | 7d6e599b223d89a7861929190be715d3b3604fa4 | [
"MIT"
] | null | null | null | leetcode/python/551_student_attendance_record_i.py | VVKot/coding-competitions | 7d6e599b223d89a7861929190be715d3b3604fa4 | [
"MIT"
] | null | null | null | import re
class Solution:
def checkRecord(self, s):
return not re.search('A.*A|LLL', s)
| 14.571429 | 43 | 0.617647 | 16 | 102 | 3.9375 | 0.8125 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.245098 | 102 | 6 | 44 | 17 | 0.818182 | 0 | 0 | 0 | 0 | 0 | 0.078431 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0.25 | 0.25 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 5 |
bd96144237e6fa420de87dbc865db3e4318200d5 | 1,627 | py | Python | tests/unit/test_puton.py | GzuPark/put_sunglasses_on_your_face | 4d3eb85ca82b83bf80129f37a0170fce92b5c322 | [
"MIT"
] | 7 | 2020-01-10T09:53:29.000Z | 2022-03-25T05:56:12.000Z | tests/unit/test_puton.py | GzuPark/put_sunglasses_on_your_face | 4d3eb85ca82b83bf80129f37a0170fce92b5c322 | [
"MIT"
] | 3 | 2019-09-05T06:33:27.000Z | 2019-09-06T04:17:01.000Z | tests/unit/test_puton.py | GzuPark/put_sunglasses_on_your_face | 4d3eb85ca82b83bf80129f37a0170fce92b5c322 | [
"MIT"
] | 3 | 2020-01-10T14:08:11.000Z | 2021-11-29T19:03:08.000Z | import os
from main import PutOn
def test_puton_saved_images(get_args):
args = get_args
puton = PutOn(args)
puton.images()
realpath = os.path.dirname(os.path.realpath(__file__))
src_path = os.path.abspath(os.path.join(realpath, "..", "..", "results"))
dst_path = os.path.abspath(os.path.join(realpath, "..", "data"))
sources = []
sources.append(os.path.join(src_path, "landmarks_center.jpg"))
sources.append(os.path.join(src_path, "puton_center.jpg"))
targets = []
targets.append(os.path.join(dst_path, "landmarks_center.jpg"))
targets.append(os.path.join(dst_path, "puton_center.jpg"))
for src, tar in zip(sources, targets):
with open(src, "rb") as img:
src_img = img.read()
with open(tar, "rb") as img:
tar_img = img.read()
assert src_img == tar_img
def test_puton_saved_quaternion_images(get_args):
args = get_args
args.landmarks = False
args.quaternion = True
puton = PutOn(args)
puton.images()
realpath = os.path.dirname(os.path.realpath(__file__))
src_path = os.path.abspath(os.path.join(realpath, "..", "..", "results"))
dst_path = os.path.abspath(os.path.join(realpath, "..", "data"))
sources = []
sources.append(os.path.join(src_path, "puton_soft_right.jpg"))
targets = []
targets.append(os.path.join(dst_path, "puton_soft_right.jpg"))
for src, tar in zip(sources, targets):
with open(src, "rb") as img:
src_img = img.read()
with open(tar, "rb") as img:
tar_img = img.read()
assert src_img == tar_img
| 28.051724 | 77 | 0.629379 | 229 | 1,627 | 4.275109 | 0.187773 | 0.110317 | 0.102145 | 0.098059 | 0.841675 | 0.823289 | 0.774259 | 0.774259 | 0.692543 | 0.610827 | 0 | 0 | 0.215734 | 1,627 | 57 | 78 | 28.54386 | 0.767241 | 0 | 0 | 0.7 | 0 | 0 | 0.094653 | 0 | 0 | 0 | 0 | 0 | 0.05 | 1 | 0.05 | false | 0 | 0.05 | 0 | 0.1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
bd9efed202ab1cdf57a9e99cb4e094ef6f38d0c0 | 70 | py | Python | venv/Lib/site-packages/attrs/exceptions.py | gilbertekalea/booking.com_crawler | 71e52c87cd72a77f80a3e5fc0af0e1a68a5712ae | [
"MIT"
] | 16 | 2020-03-13T15:54:20.000Z | 2020-06-04T08:10:03.000Z | venv/Lib/site-packages/attrs/exceptions.py | gilbertekalea/booking.com_crawler | 71e52c87cd72a77f80a3e5fc0af0e1a68a5712ae | [
"MIT"
] | 112 | 2021-09-27T14:39:02.000Z | 2022-03-30T14:26:35.000Z | venv/Lib/site-packages/attrs/exceptions.py | gilbertekalea/booking.com_crawler | 71e52c87cd72a77f80a3e5fc0af0e1a68a5712ae | [
"MIT"
] | 15 | 2020-03-22T23:00:38.000Z | 2020-06-11T17:01:33.000Z | # SPDX-License-Identifier: MIT
from attr.exceptions import * # noqa
| 17.5 | 37 | 0.742857 | 9 | 70 | 5.777778 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.157143 | 70 | 3 | 38 | 23.333333 | 0.881356 | 0.471429 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
da3f9bc806e5431d9d71619859a78e79d7c4f698 | 164 | py | Python | Codes/madlibgame.py | JojiJohnson/Python-Basics | 0107cbf3b85cd73c57fa6474a5febb91cdae216c | [
"MIT"
] | null | null | null | Codes/madlibgame.py | JojiJohnson/Python-Basics | 0107cbf3b85cd73c57fa6474a5febb91cdae216c | [
"MIT"
] | null | null | null | Codes/madlibgame.py | JojiJohnson/Python-Basics | 0107cbf3b85cd73c57fa6474a5febb91cdae216c | [
"MIT"
] | null | null | null |
name = input ("Enter your name: ")
prof = input ("Enter your Profession: ")
print ("God bless you " + name + ".")
print ("You will be a great " + prof + "!")
| 27.333333 | 44 | 0.573171 | 22 | 164 | 4.272727 | 0.636364 | 0.212766 | 0.297872 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.243902 | 164 | 5 | 45 | 32.8 | 0.758065 | 0 | 0 | 0 | 0 | 0 | 0.481013 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.5 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
da4ec629288a7004e99e5234f7a71c8014a5ab0e | 57 | py | Python | jcfg/__init__.py | chkap/jcfg | 4577e7aa87f45408ed14375f415d68ef3a05bc66 | [
"MIT"
] | 1 | 2020-04-04T07:35:44.000Z | 2020-04-04T07:35:44.000Z | jcfg/__init__.py | chkap/jcfg | 4577e7aa87f45408ed14375f415d68ef3a05bc66 | [
"MIT"
] | null | null | null | jcfg/__init__.py | chkap/jcfg | 4577e7aa87f45408ed14375f415d68ef3a05bc66 | [
"MIT"
] | null | null | null | from .json_config import JsonCfg
from .error import *
| 9.5 | 32 | 0.754386 | 8 | 57 | 5.25 | 0.75 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.192982 | 57 | 5 | 33 | 11.4 | 0.913043 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
e5111ae3c2929e02e98d8c6dedfe9e79fa8a5b72 | 69 | py | Python | src/python/run.py | jakkaj/SSHFS_CheatSheet | a9d3a8eb8b03e86d4b275649c41fc7534f2ac810 | [
"MIT"
] | null | null | null | src/python/run.py | jakkaj/SSHFS_CheatSheet | a9d3a8eb8b03e86d4b275649c41fc7534f2ac810 | [
"MIT"
] | null | null | null | src/python/run.py | jakkaj/SSHFS_CheatSheet | a9d3a8eb8b03e86d4b275649c41fc7534f2ac810 | [
"MIT"
] | null | null | null | #!/usr/bin/python3
import cv2
print (cv2.__version__)
print ("Hello") | 17.25 | 23 | 0.73913 | 10 | 69 | 4.7 | 0.8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.047619 | 0.086957 | 69 | 4 | 24 | 17.25 | 0.698413 | 0.246377 | 0 | 0 | 0 | 0 | 0.096154 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.333333 | 0 | 0.333333 | 0.666667 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 0 | 5 |
e55d6b660f96d3eafefc34e847bb8b2717f680b7 | 65 | py | Python | pmanagement/projects/models/__init__.py | Ferald89/projectmanagemen | 88d96f2f59daca0029b69a60e69c0118dacc30ea | [
"MIT"
] | null | null | null | pmanagement/projects/models/__init__.py | Ferald89/projectmanagemen | 88d96f2f59daca0029b69a60e69c0118dacc30ea | [
"MIT"
] | 2 | 2020-06-15T17:13:04.000Z | 2020-06-15T17:13:05.000Z | pmanagement/projects/models/__init__.py | Ferald89/projectmanagemen | 88d96f2f59daca0029b69a60e69c0118dacc30ea | [
"MIT"
] | null | null | null | from .projects import Project
from .memberships import Membership | 32.5 | 35 | 0.861538 | 8 | 65 | 7 | 0.75 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.107692 | 65 | 2 | 35 | 32.5 | 0.965517 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
e565a3426a37d3d174f41c41c4d17591e6a614a0 | 89 | py | Python | nrgmodbus/spidar/__init__.py | nrgpy/nrgmodbus | 8932c527c30113933bba71c2f0f99e81966865ad | [
"MIT"
] | null | null | null | nrgmodbus/spidar/__init__.py | nrgpy/nrgmodbus | 8932c527c30113933bba71c2f0f99e81966865ad | [
"MIT"
] | null | null | null | nrgmodbus/spidar/__init__.py | nrgpy/nrgmodbus | 8932c527c30113933bba71c2f0f99e81966865ad | [
"MIT"
] | null | null | null | __name__ = "spidar"
from .spidar import spidar_v1
from .registers import spidar_registers | 29.666667 | 39 | 0.831461 | 12 | 89 | 5.666667 | 0.5 | 0.352941 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.012658 | 0.11236 | 89 | 3 | 39 | 29.666667 | 0.848101 | 0 | 0 | 0 | 0 | 0 | 0.066667 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.666667 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
e5d8429cf773f4622496b9d46057f2adb32f167d | 2,014 | py | Python | tests/test_vector3d_class.py | furushei/vector3d-python | 72d007da2bd3d4300232479d4ad2f5371278d357 | [
"Unlicense"
] | null | null | null | tests/test_vector3d_class.py | furushei/vector3d-python | 72d007da2bd3d4300232479d4ad2f5371278d357 | [
"Unlicense"
] | null | null | null | tests/test_vector3d_class.py | furushei/vector3d-python | 72d007da2bd3d4300232479d4ad2f5371278d357 | [
"Unlicense"
] | null | null | null | import unittest
from vector3d import Vector3D
import math
class TestVector3DClass(unittest.TestCase):
def test_add(self):
self.assertEqual(Vector3D(1, 2, 3) + Vector3D(4, 5, 6), Vector3D(5, 7, 9))
def test_sub(self):
self.assertEqual(Vector3D(1, 2, 3) - Vector3D(4, 5, 6), Vector3D(-3, -3, -3))
def test_mul(self):
self.assertEqual(Vector3D(1, 2, 3) * 1, Vector3D(1, 2, 3))
self.assertEqual(Vector3D(1, 2, 3) * 1.5, Vector3D(1.5, 3.0, 4.5))
def test_rmul(self):
self.assertEqual(1 * Vector3D(1, 2, 3), Vector3D(1, 2, 3))
self.assertEqual(1.5 * Vector3D(1, 2, 3), Vector3D(1.5, 3.0, 4.5))
def test_mul_and_rmul(self):
self.assertEqual(2 * Vector3D(1, 2, 3) * 3, Vector3D(6, 12, 18))
def test_truediv(self):
self.assertEqual(Vector3D(1, 2, 3) / 2, Vector3D(0.5, 1.0, 1.5))
def test_floordiv(self):
self.assertEqual(Vector3D(1, 2, 3) // 2, Vector3D(0, 1, 1))
def test_eq(self):
self.assertTrue(Vector3D(1, 2, 3) == Vector3D(1, 2, 3))
self.assertFalse(Vector3D(1, 2, 3) == Vector3D(1, 2, 0))
self.assertFalse(Vector3D(1, 2, 3) == Vector3D(1, 0, 3))
self.assertFalse(Vector3D(1, 2, 3) == Vector3D(0, 2, 3))
def test_ne(self):
self.assertTrue(Vector3D(1, 2, 3) != Vector3D(1, 2, 0))
self.assertTrue(Vector3D(1, 2, 3) != Vector3D(1, 0, 3))
self.assertTrue(Vector3D(1, 2, 3) != Vector3D(0, 2, 3))
self.assertFalse(Vector3D(1, 2, 3) != Vector3D(1, 2, 3))
def test_abs(self):
self.assertAlmostEqual(abs(Vector3D(1, 2, 3)), 3.7416573867739413)
self.assertEqual(abs(Vector3D(3, 4, 0)), 5)
test_cases = [
(-4.5, 4, 3),
(math.pi, math.e, -1),
]
for x, y, z in test_cases:
actual = abs(Vector3D(x, y, z))
excepted = math.sqrt(x * x + y * y + z * z)
self.assertAlmostEqual(actual, excepted)
if __name__ == '__main__':
unittest.main()
| 33.566667 | 85 | 0.573982 | 310 | 2,014 | 3.658065 | 0.164516 | 0.222222 | 0.21164 | 0.213404 | 0.583774 | 0.561728 | 0.532628 | 0.472663 | 0.406526 | 0.291887 | 0 | 0.13289 | 0.252731 | 2,014 | 59 | 86 | 34.135593 | 0.620598 | 0 | 0 | 0 | 0 | 0 | 0.003974 | 0 | 0 | 0 | 0 | 0 | 0.465116 | 1 | 0.232558 | false | 0 | 0.069767 | 0 | 0.325581 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
e5f35b351c2ff79b4938b8198249e87c8ce82455 | 512 | py | Python | password/db/database.py | cedricfarinazzo/password | a9dd52383519438cc38baf4653beeec8f9e45a2c | [
"MIT"
] | null | null | null | password/db/database.py | cedricfarinazzo/password | a9dd52383519438cc38baf4653beeec8f9e45a2c | [
"MIT"
] | null | null | null | password/db/database.py | cedricfarinazzo/password | a9dd52383519438cc38baf4653beeec8f9e45a2c | [
"MIT"
] | null | null | null | from .config import Config
from .entry import Entry
class Database:
def __init__(self, conf):
self.conf = conf
self.__data = []
def register(self, account, master_key):
pass
def retrieve(self, account_id, master_key):
pass
def delete(self, account_id, master_key):
pass
def update(self, account_id, data, master_key):
pass
def list(self):
pass
def load(self, master_key):
pass
def save(self):
pass
| 16.516129 | 51 | 0.59375 | 65 | 512 | 4.461538 | 0.353846 | 0.144828 | 0.224138 | 0.275862 | 0.2 | 0.2 | 0.2 | 0 | 0 | 0 | 0 | 0 | 0.320313 | 512 | 30 | 52 | 17.066667 | 0.833333 | 0 | 0 | 0.35 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.4 | false | 0.35 | 0.1 | 0 | 0.55 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 5 |
f92641c0a44bd6d7004c4cd5280a05da731cae94 | 7,677 | py | Python | cogs/images.py | Nirlep5252/SynTech | 955cf600800f0cf0f03e6b1932ac2923d6beb2bf | [
"MIT"
] | 2 | 2021-12-12T03:17:10.000Z | 2022-03-28T08:04:07.000Z | cogs/images.py | Nirlep5252/SynTech | 955cf600800f0cf0f03e6b1932ac2923d6beb2bf | [
"MIT"
] | null | null | null | cogs/images.py | Nirlep5252/SynTech | 955cf600800f0cf0f03e6b1932ac2923d6beb2bf | [
"MIT"
] | null | null | null | import logging
import discord
from discord.ext import commands
from config import MAIN_COLOR
import aiohttp
import io
class images(commands.Cog, description="This is where you can get images"):
def __init__(self, bot):
self.bot = bot
@commands.Cog.listener()
async def on_ready(self):
logging.info('Images is ready')
@commands.command()
async def horny(self, ctx, member: discord.Member = None):
member = member or ctx.author
await ctx.trigger_typing()
async with aiohttp.ClientSession() as session:
async with session.get(f'https://some-random-api.ml/canvas/horny?avatar={member.avatar.replace(format="png")}') as af:
if 300 > af.status >= 200:
fp = io.BytesIO(await af.read())
file = discord.File(fp, "horny.png")
em = discord.Embed(
title="bonk",
color=MAIN_COLOR,
)
em.set_image(url="attachment://horny.png")
await ctx.send(embed=em, file=file)
else:
await ctx.send('No horny :(')
await session.close()
@commands.command()
async def gay(self, ctx, member: discord.Member = None):
member = member or ctx.author
await ctx.trigger_typing()
async with aiohttp.ClientSession() as session:
async with session.get(f'https://some-random-api.ml/canvas/gay?avatar={member.avatar.replace(format="png")}') as af:
if 300 > af.status >= 200:
fp = io.BytesIO(await af.read())
file = discord.File(fp, "gay.png")
em = discord.Embed(
title="He has came out",
color=MAIN_COLOR,
)
em.set_image(url="attachment://gay.png")
await ctx.send(embed=em, file=file)
else:
await ctx.send('No gay :(')
await session.close()
@commands.command()
async def jail(self, ctx, member: discord.Member = None):
member = member or ctx.author
await ctx.trigger_typing()
async with aiohttp.ClientSession() as session:
async with session.get(f'https://some-random-api.ml/canvas/jail?avatar={member.avatar.replace(format="png")}') as af:
if 300 > af.status >= 200:
fp = io.BytesIO(await af.read())
file = discord.File(fp, "jail.png")
em = discord.Embed(
title="He be in jail",
color=MAIN_COLOR,
)
em.set_image(url="attachment://jail.png")
await ctx.send(embed=em, file=file)
else:
await ctx.send('No jial :(')
await session.close()
@commands.command()
async def gun(self, ctx, member: discord.Member = None):
member = member or ctx.author
await ctx.trigger_typing()
async with aiohttp.ClientSession() as session:
async with session.get(f'https://api.monkedev.com/canvas/gun?imgUrl={member.avatar.replace(format="png")}') as af:
if 300 > af.status >= 200:
fp = io.BytesIO(await af.read())
file = discord.File(fp, "gun.png")
em = discord.Embed(
title="Get down he has a gun",
color=MAIN_COLOR,
)
em.set_image(url="attachment://gun.png")
await ctx.send(embed=em, file=file)
else:
await ctx.send('No gun :(')
await session.close()
@commands.command()
async def comment(self, ctx, *, text=None):
if text is None:
await ctx.send("You need to add text to this")
else:
async with aiohttp.ClientSession() as session:
async with session.get(f'https://some-random-api.ml/canvas/youtube-comment?avatar={ctx.author.avatar.url}&username={ctx.author.name}&comment={text}') as af:
if 300 > af.status >= 200:
fp = io.BytesIO(await af.read())
file = discord.File(fp, "comment.png")
em = discord.Embed(
title="Comment",
color=MAIN_COLOR,
)
em.set_image(url="attachment://comment.png")
await ctx.send(embed=em, file=file)
@commands.command()
async def message(self, ctx, member: discord.Member = None, *, text=None):
member = member or ctx.author
if text is None:
await ctx.send("You need to add text to this")
else:
async with aiohttp.ClientSession() as session:
async with session.get(f'https://api.monkedev.com/canvas/fakequote?imgUrl={member.avatar.url}&text={text}&username={member.name}') as af:
if 300 > af.status >= 200:
fp = io.BytesIO(await af.read())
file = discord.File(fp, "comment.png")
em = discord.Embed(
title="Comment",
color=MAIN_COLOR,
)
em.set_image(url="attachment://comment.png")
await ctx.send(embed=em, file=file)
@commands.command(aliases=['av'])
async def avatar(self, ctx, member: discord.Member = None):
member = member or ctx.author
embed = discord.Embed(title=f"Avatar of {member.name}", color=MAIN_COLOR)
embed.set_image(url=member.avatar.url)
await ctx.send(embed=embed)
@commands.command()
async def pikachu(self, ctx):
async with aiohttp.ClientSession() as session:
request = await session.get('https://some-random-api.ml/img/pikachu')
json = await request.json()
embed = discord.Embed(title="Pika Pika!", color=MAIN_COLOR)
embed.set_image(url=json['link'])
await ctx.send(embed=embed)
@commands.command()
async def dog(self, ctx):
async with aiohttp.ClientSession() as session:
request = await session.get('https://some-random-api.ml/img/dog')
json = await request.json()
embed = discord.Embed(title="Woof Woof!", color=MAIN_COLOR)
embed.set_image(url=json['link'])
await ctx.send(embed=embed)
@commands.command()
async def cat(self, ctx):
async with aiohttp.ClientSession() as session:
request = await session.get('https://some-random-api.ml/img/cat')
json = await request.json()
embed = discord.Embed(title="Meow!", color=MAIN_COLOR)
embed.set_image(url=json['link'])
await ctx.send(embed=embed)
@commands.command()
async def panda(self, ctx):
async with aiohttp.ClientSession() as session:
request = await session.get('https://some-random-api.ml/img/panda')
json = await request.json()
embed = discord.Embed(title="Panda!", color=MAIN_COLOR)
embed.set_image(url=json['link'])
await ctx.send(embed=embed)
def setup(bot):
bot.add_cog(images(bot=bot))
| 43.619318 | 173 | 0.521688 | 872 | 7,677 | 4.555046 | 0.133028 | 0.042296 | 0.05136 | 0.04708 | 0.817221 | 0.806143 | 0.779708 | 0.731873 | 0.652316 | 0.640987 | 0 | 0.007338 | 0.360948 | 7,677 | 175 | 174 | 43.868571 | 0.802283 | 0 | 0 | 0.592357 | 0 | 0.038217 | 0.154759 | 0.01213 | 0 | 0 | 0 | 0 | 0 | 1 | 0.012739 | false | 0 | 0.038217 | 0 | 0.057325 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
0060e7e1b4a20eb5fb0f956634689508e774c769 | 105 | py | Python | test.py | imurchie/python_extension | 5284e6f82a496410287012ac21d00b0c27a2bb2d | [
"Apache-2.0"
] | 1 | 2020-05-02T00:13:12.000Z | 2020-05-02T00:13:12.000Z | test.py | imurchie/python_extension | 5284e6f82a496410287012ac21d00b0c27a2bb2d | [
"Apache-2.0"
] | null | null | null | test.py | imurchie/python_extension | 5284e6f82a496410287012ac21d00b0c27a2bb2d | [
"Apache-2.0"
] | null | null | null | import spam
p1 = spam.Point(2, 3)
p2 = spam.Point(4, 5)
print p1
print p2
print spam.distance(p1, p2)
| 10.5 | 27 | 0.67619 | 21 | 105 | 3.380952 | 0.52381 | 0.253521 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.117647 | 0.190476 | 105 | 9 | 28 | 11.666667 | 0.717647 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.166667 | null | null | 0.5 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
0075cc799c503af5517806a811527936193f25cc | 335 | py | Python | book/tlpi_zhiye/utlib/ut_util.py | deevarvar/myLab | 7a5019f5f7fc11e173d350e6e2a7d2c80504782d | [
"MIT"
] | null | null | null | book/tlpi_zhiye/utlib/ut_util.py | deevarvar/myLab | 7a5019f5f7fc11e173d350e6e2a7d2c80504782d | [
"MIT"
] | null | null | null | book/tlpi_zhiye/utlib/ut_util.py | deevarvar/myLab | 7a5019f5f7fc11e173d350e6e2a7d2c80504782d | [
"MIT"
] | 3 | 2016-10-08T15:01:49.000Z | 2018-05-24T03:14:24.000Z | __author__ = 'deevarvar'
import string
import random
import os
#generate a random string
def string_generator(size=6, chars=string.ascii_letters+string.digits):
return ''.join(random.choice(chars) for _ in range(size))
#emulate touch cmd
def touchFile(fname, time=None):
with open(fname, 'a'):
os.utime(fname,time)
| 20.9375 | 71 | 0.728358 | 48 | 335 | 4.9375 | 0.666667 | 0.075949 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.003534 | 0.155224 | 335 | 15 | 72 | 22.333333 | 0.833922 | 0.122388 | 0 | 0 | 1 | 0 | 0.034247 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.222222 | false | 0 | 0.333333 | 0.111111 | 0.666667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 5 |
00c23b88bd1163522f9c14e781734fce25e720b2 | 225 | py | Python | tests/cache/test_memory_backend.py | SandySalvatore/dogpile_cache_release | 863b35becbf741bba89ddbf2700b7667298bf3d3 | [
"BSD-3-Clause"
] | null | null | null | tests/cache/test_memory_backend.py | SandySalvatore/dogpile_cache_release | 863b35becbf741bba89ddbf2700b7667298bf3d3 | [
"BSD-3-Clause"
] | null | null | null | tests/cache/test_memory_backend.py | SandySalvatore/dogpile_cache_release | 863b35becbf741bba89ddbf2700b7667298bf3d3 | [
"BSD-3-Clause"
] | null | null | null | from ._fixtures import _GenericBackendTest
class MemoryBackendTest(_GenericBackendTest):
backend = "dogpile.cache.memory"
class MemoryPickleBackendTest(_GenericBackendTest):
backend = "dogpile.cache.memory_pickle"
| 25 | 51 | 0.813333 | 19 | 225 | 9.368421 | 0.631579 | 0.280899 | 0.359551 | 0.41573 | 0.483146 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.111111 | 225 | 8 | 52 | 28.125 | 0.89 | 0 | 0 | 0 | 0 | 0 | 0.208889 | 0.12 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.2 | 0 | 1 | 0 | 1 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
daab7dc81582642a67941023cf754d96752bbc19 | 484 | py | Python | pystratis/core/tests/test_extpubkey.py | TjadenFroyda/pyStratis | 9cc7620d7506637f8a2b84003d931eceb36ac5f2 | [
"MIT"
] | 8 | 2021-06-30T20:44:22.000Z | 2021-12-07T14:42:22.000Z | pystratis/core/tests/test_extpubkey.py | TjadenFroyda/pyStratis | 9cc7620d7506637f8a2b84003d931eceb36ac5f2 | [
"MIT"
] | 2 | 2021-07-01T11:50:18.000Z | 2022-01-25T18:39:49.000Z | pystratis/core/tests/test_extpubkey.py | TjadenFroyda/pyStratis | 9cc7620d7506637f8a2b84003d931eceb36ac5f2 | [
"MIT"
] | 4 | 2021-07-01T04:36:42.000Z | 2021-09-17T10:54:19.000Z | from pystratis.core import ExtPubKey
def test_extpubkey(generate_extpubkey):
extpubkey = ExtPubKey(generate_extpubkey)
assert str(extpubkey) == generate_extpubkey
def test_bad_extpubkey_raises_error(generate_extpubkey):
extpubkey = generate_extpubkey
# Change part of the key so that it fails the checksum
extpubkey = extpubkey[:10] + 'abcd' + extpubkey[14:]
assert len(extpubkey) == len(generate_extpubkey)
assert str(extpubkey) != generate_extpubkey
| 32.266667 | 58 | 0.764463 | 58 | 484 | 6.172414 | 0.465517 | 0.332402 | 0.363128 | 0.195531 | 0.290503 | 0.290503 | 0.290503 | 0 | 0 | 0 | 0 | 0.009828 | 0.159091 | 484 | 14 | 59 | 34.571429 | 0.869779 | 0.107438 | 0 | 0 | 1 | 0 | 0.009302 | 0 | 0 | 0 | 0 | 0 | 0.333333 | 1 | 0.222222 | false | 0 | 0.111111 | 0 | 0.333333 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
dabd7479210d76b2d359d5f228ca53204fff3e4f | 327 | py | Python | modules/hashing/sha.py | Zami3l/cryptotools | 8ed16f32ad528ed1826efffe61522d591e5e5941 | [
"MIT"
] | null | null | null | modules/hashing/sha.py | Zami3l/cryptotools | 8ed16f32ad528ed1826efffe61522d591e5e5941 | [
"MIT"
] | null | null | null | modules/hashing/sha.py | Zami3l/cryptotools | 8ed16f32ad528ed1826efffe61522d591e5e5941 | [
"MIT"
] | null | null | null | #!/usr/bin/python3
# coding : utf-8
import hashlib
def sha1(plainText):
return hashlib.sha1(plainText).hexdigest().encode('utf8')
def sha256(plainText):
return hashlib.sha256(plainText).hexdigest().encode('utf8')
def sha512(plainText):
return hashlib.sha512(plainText).hexdigest().encode('utf8')
| 19.235294 | 63 | 0.69419 | 38 | 327 | 5.973684 | 0.447368 | 0.198238 | 0.290749 | 0.370044 | 0.273128 | 0 | 0 | 0 | 0 | 0 | 0 | 0.068592 | 0.152905 | 327 | 16 | 64 | 20.4375 | 0.750903 | 0.097859 | 0 | 0 | 0 | 0 | 0.040956 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.428571 | false | 0 | 0.142857 | 0.428571 | 1 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 5 |
daccfd9582abdccbd7aabd7be19b5ea05a78a6f7 | 24 | py | Python | Python/DrChuck/Introduction/py003.py | paddygit/hands-on | 170a415aa03b22e18aa2e1b4dacdd091a7765867 | [
"MIT"
] | null | null | null | Python/DrChuck/Introduction/py003.py | paddygit/hands-on | 170a415aa03b22e18aa2e1b4dacdd091a7765867 | [
"MIT"
] | null | null | null | Python/DrChuck/Introduction/py003.py | paddygit/hands-on | 170a415aa03b22e18aa2e1b4dacdd091a7765867 | [
"MIT"
] | 1 | 2020-05-17T06:53:38.000Z | 2020-05-17T06:53:38.000Z | x = 2
x = x+2
print(x)
| 4.8 | 8 | 0.458333 | 7 | 24 | 1.571429 | 0.428571 | 0.363636 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.125 | 0.333333 | 24 | 4 | 9 | 6 | 0.5625 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.333333 | 1 | 1 | 1 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
970817da5ddb1e99adb4f0cbe3d83bb7cf66c1fb | 74 | py | Python | py_tdlib/constructors/get_authorization_state.py | Mr-TelegramBot/python-tdlib | 2e2d21a742ebcd439971a32357f2d0abd0ce61eb | [
"MIT"
] | 24 | 2018-10-05T13:04:30.000Z | 2020-05-12T08:45:34.000Z | py_tdlib/constructors/get_authorization_state.py | MrMahdi313/python-tdlib | 2e2d21a742ebcd439971a32357f2d0abd0ce61eb | [
"MIT"
] | 3 | 2019-06-26T07:20:20.000Z | 2021-05-24T13:06:56.000Z | py_tdlib/constructors/get_authorization_state.py | MrMahdi313/python-tdlib | 2e2d21a742ebcd439971a32357f2d0abd0ce61eb | [
"MIT"
] | 5 | 2018-10-05T14:29:28.000Z | 2020-08-11T15:04:10.000Z | from ..factory import Method
class getAuthorizationState(Method):
pass
| 12.333333 | 36 | 0.797297 | 8 | 74 | 7.375 | 0.875 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.135135 | 74 | 5 | 37 | 14.8 | 0.921875 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0.333333 | 0.333333 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 5 |
9730397cd176e3d9b0269e4f81198e757dceef13 | 144 | py | Python | models/__init__.py | 2KangHo/PyTorch-ImageClassification-TestBench | f8a974a30374879951a93840cba6caacc11430fd | [
"MIT"
] | 1 | 2020-02-12T05:10:15.000Z | 2020-02-12T05:10:15.000Z | models/__init__.py | 2KangHo/PyTorch-ImageClassification-TestBench | f8a974a30374879951a93840cba6caacc11430fd | [
"MIT"
] | null | null | null | models/__init__.py | 2KangHo/PyTorch-ImageClassification-TestBench | f8a974a30374879951a93840cba6caacc11430fd | [
"MIT"
] | null | null | null | from .mobilenet import mobilenet
from .mobilenetv2 import mobilenetv2
from .shufflenet import shufflenet
from .shufflenetv2 import shufflenetv2
| 28.8 | 38 | 0.861111 | 16 | 144 | 7.75 | 0.375 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.03125 | 0.111111 | 144 | 4 | 39 | 36 | 0.9375 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
977bbaeeb40b251b25fea35fac410cd996e7250c | 165 | py | Python | test.py | nielsmadan/venom | 87dee312fe8dbaa64fe29fba7a2ccd5f41a55b4a | [
"0BSD"
] | 1 | 2022-01-26T04:57:28.000Z | 2022-01-26T04:57:28.000Z | test.py | nielsmadan/venom | 87dee312fe8dbaa64fe29fba7a2ccd5f41a55b4a | [
"0BSD"
] | null | null | null | test.py | nielsmadan/venom | 87dee312fe8dbaa64fe29fba7a2ccd5f41a55b4a | [
"0BSD"
] | 1 | 2021-08-19T08:11:58.000Z | 2021-08-19T08:11:58.000Z | import sys
import os
import nose
sys.path.append(os.path.join(os.path.dirname(os.path.abspath(__file__)), "autoload"))
nose.main(argv=sys.argv + ["-w", "./test"])
| 20.625 | 85 | 0.70303 | 27 | 165 | 4.148148 | 0.555556 | 0.160714 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.084848 | 165 | 7 | 86 | 23.571429 | 0.741722 | 0 | 0 | 0 | 0 | 0 | 0.09697 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.6 | 0 | 0.6 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
97ca566e9b7dbff573501fd4ff2e5a5130bfb5ba | 170 | py | Python | App/apis.py | kogwang/Emails | 6e54f2e03c107611fec986a672b47001086e1c7d | [
"Apache-2.0"
] | null | null | null | App/apis.py | kogwang/Emails | 6e54f2e03c107611fec986a672b47001086e1c7d | [
"Apache-2.0"
] | null | null | null | App/apis.py | kogwang/Emails | 6e54f2e03c107611fec986a672b47001086e1c7d | [
"Apache-2.0"
] | null | null | null | from flask_restful import Resource
# 例:
class Cat(Resource):
def get(self):
return {'message':'get'}
def put(self):
return {'message':'put'}
| 13.076923 | 34 | 0.588235 | 21 | 170 | 4.714286 | 0.666667 | 0.20202 | 0.343434 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.264706 | 170 | 12 | 35 | 14.166667 | 0.792 | 0.011765 | 0 | 0 | 0 | 0 | 0.122699 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.333333 | false | 0 | 0.166667 | 0.333333 | 1 | 0 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 5 |
8af579a8b162dbc1a1011dd5abb9f1ba1af38b93 | 1,391 | py | Python | maggport/exports.py | ccavales3/maggport | a68e27f7c2beea06bd8209146f342d06ae3a4893 | [
"MIT"
] | null | null | null | maggport/exports.py | ccavales3/maggport | a68e27f7c2beea06bd8209146f342d06ae3a4893 | [
"MIT"
] | null | null | null | maggport/exports.py | ccavales3/maggport | a68e27f7c2beea06bd8209146f342d06ae3a4893 | [
"MIT"
] | null | null | null | """
Contains all parameter validations
"""
import json
import pandas
def export_csv(docs_list: list, out: str, header: bool) -> None: # type: ignore
"""
Export file to csv
Args:
docs (list): Queried docs from mongodb
out (str): Output file
"""
# create empty DataFrame to store docs
df_doc = pandas.DataFrame(columns=[])
# prepare result to be exported
for doc in docs_list:
series_obj = pandas.Series(doc)
df_doc = df_doc.append(series_obj, ignore_index=True)
df_doc.to_csv(out, sep=',', index=False, header=header)
def export_json(**kwargs) -> None: # type: ignore
"""
Export file to json
Args:
docs (list): Queried docs from mongodb
out (str): Output file
"""
with open(kwargs['out'], 'w') as outfile:
json.dump(kwargs['docs_list'], outfile, indent=2)
def export_txt(docs_list: list, out: str, header: bool) -> None: # type: ignore
"""
Export file to txt
Args:
docs (list): Queried docs from mongodb
out (str): Output file
"""
# create empty DataFrame to store docs
df_doc = pandas.DataFrame(columns=[])
# prepare result to be exported
for doc in docs_list:
series_obj = pandas.Series(doc)
df_doc = df_doc.append(series_obj, ignore_index=True)
df_doc.to_csv(out, index=False, header=header)
| 24.403509 | 80 | 0.629763 | 192 | 1,391 | 4.4375 | 0.291667 | 0.075117 | 0.037559 | 0.070423 | 0.746479 | 0.746479 | 0.715962 | 0.715962 | 0.715962 | 0.715962 | 0 | 0.000968 | 0.257369 | 1,391 | 56 | 81 | 24.839286 | 0.823814 | 0.357297 | 0 | 0.470588 | 0 | 0 | 0.017522 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.176471 | false | 0 | 0.117647 | 0 | 0.294118 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
c188e7121128fca0f92698c3eec5dfb167512885 | 277 | py | Python | Python/array.py | AbdulConsole/Hacktoberfest2019-2 | b9619361b6cecf9b3e734972af3b0a03dba98d2e | [
"MIT"
] | 1 | 2019-10-28T20:12:23.000Z | 2019-10-28T20:12:23.000Z | Python/array.py | AbdulConsole/Hacktoberfest2019-2 | b9619361b6cecf9b3e734972af3b0a03dba98d2e | [
"MIT"
] | null | null | null | Python/array.py | AbdulConsole/Hacktoberfest2019-2 | b9619361b6cecf9b3e734972af3b0a03dba98d2e | [
"MIT"
] | 1 | 2020-10-16T14:10:12.000Z | 2020-10-16T14:10:12.000Z | import array as arr
numbers_list = [2, 5, 62, 5, 42, 52, 48, 5]
numbers_array = arr.array('i', numbers_list)
print(numbers_array[2:5]) # 3rd to 5th
print(numbers_array[:-5]) # beginning to 4th
print(numbers_array[5:]) # 6th to end
print(numbers_array[:]) # beginning to end
| 34.625 | 44 | 0.700361 | 49 | 277 | 3.816327 | 0.428571 | 0.320856 | 0.363636 | 0.192513 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.084746 | 0.148014 | 277 | 7 | 45 | 39.571429 | 0.707627 | 0.198556 | 0 | 0 | 0 | 0 | 0.004608 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.142857 | 0 | 0.142857 | 0.571429 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
c1a1ef8fe5c0691ee38a3b1ca0b6f35531868b03 | 40 | py | Python | WSGIServer/exceptions.py | CakeBrewery/WSGIServer | 574b8f2a13ab7d11cfd59c6486c34315abe3afa1 | [
"MIT"
] | null | null | null | WSGIServer/exceptions.py | CakeBrewery/WSGIServer | 574b8f2a13ab7d11cfd59c6486c34315abe3afa1 | [
"MIT"
] | null | null | null | WSGIServer/exceptions.py | CakeBrewery/WSGIServer | 574b8f2a13ab7d11cfd59c6486c34315abe3afa1 | [
"MIT"
] | null | null | null | class CannotKeepUp(Exception):
pass
| 13.333333 | 30 | 0.75 | 4 | 40 | 7.5 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.175 | 40 | 2 | 31 | 20 | 0.909091 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0.5 | 0 | 0 | 0.5 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 5 |
c1bda62d454c26cae5bcc8b130797c65c3023d88 | 47 | py | Python | python_use_module.py | alamedra/astr-119-session-2 | d8e92723a085b124ebfe4c311efb98ccee751387 | [
"MIT"
] | null | null | null | python_use_module.py | alamedra/astr-119-session-2 | d8e92723a085b124ebfe4c311efb98ccee751387 | [
"MIT"
] | null | null | null | python_use_module.py | alamedra/astr-119-session-2 | d8e92723a085b124ebfe4c311efb98ccee751387 | [
"MIT"
] | null | null | null | import test_module as tm
tm.hello_world()
| 11.75 | 26 | 0.723404 | 8 | 47 | 4 | 0.875 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.212766 | 47 | 3 | 27 | 15.666667 | 0.864865 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
c1bec24785d1f381501b826243a8fe53601ff955 | 42 | py | Python | garageofcode/main.py | tpi12jwe/garageofcode | 3cfaf01f6d77130bb354887e6ed9921c791db849 | [
"MIT"
] | 2 | 2020-02-11T10:32:06.000Z | 2020-02-11T17:00:47.000Z | garageofcode/main.py | tpi12jwe/garageofcode | 3cfaf01f6d77130bb354887e6ed9921c791db849 | [
"MIT"
] | null | null | null | garageofcode/main.py | tpi12jwe/garageofcode | 3cfaf01f6d77130bb354887e6ed9921c791db849 | [
"MIT"
] | null | null | null |
from labyrinth.main import main
main()
| 8.4 | 31 | 0.738095 | 6 | 42 | 5.166667 | 0.666667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.190476 | 42 | 4 | 32 | 10.5 | 0.911765 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
de0237b8666c35180ca29fa84fd0b0f152a79ec3 | 270 | py | Python | problems/c4subgraphiso/generator/main.py | Benezivas/algobattle-problems | b00b85413893bd1618001a4cdaa0dd7442f4e481 | [
"MIT"
] | null | null | null | problems/c4subgraphiso/generator/main.py | Benezivas/algobattle-problems | b00b85413893bd1618001a4cdaa0dd7442f4e481 | [
"MIT"
] | null | null | null | problems/c4subgraphiso/generator/main.py | Benezivas/algobattle-problems | b00b85413893bd1618001a4cdaa0dd7442f4e481 | [
"MIT"
] | null | null | null | """Simple dummy generator for the C4SubGraphIso problem, outputting a static instance."""
with open("output", "w") as output:
output.write("s 1 2 3 4\n")
output.write("e 4 1\n")
output.write("e 1 2\n")
output.write("e 2 3\n")
output.write("e 3 4\n")
| 33.75 | 89 | 0.633333 | 49 | 270 | 3.489796 | 0.489796 | 0.321637 | 0.280702 | 0.304094 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.059908 | 0.196296 | 270 | 7 | 90 | 38.571429 | 0.728111 | 0.307407 | 0 | 0 | 0 | 0 | 0.254144 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
de0af6fefdcbd005523b9e45d8d172230ef68b61 | 6,564 | py | Python | tests/sentry/api/endpoints/test_issues_resolved_in_release.py | AlexWayfer/sentry | ef935cda2b2e960bd602fda590540882d1b0712d | [
"BSD-3-Clause"
] | 1 | 2018-03-05T15:40:12.000Z | 2018-03-05T15:40:12.000Z | tests/sentry/api/endpoints/test_issues_resolved_in_release.py | AlexWayfer/sentry | ef935cda2b2e960bd602fda590540882d1b0712d | [
"BSD-3-Clause"
] | 6 | 2018-10-19T10:04:23.000Z | 2019-12-09T20:29:12.000Z | tests/sentry/api/endpoints/test_issues_resolved_in_release.py | AlexWayfer/sentry | ef935cda2b2e960bd602fda590540882d1b0712d | [
"BSD-3-Clause"
] | 1 | 2018-07-02T09:46:44.000Z | 2018-07-02T09:46:44.000Z | from __future__ import absolute_import
from django.core.urlresolvers import reverse
import six
from sentry.models import (
Commit,
GroupLink,
GroupResolution,
ReleaseCommit,
Repository,
)
from sentry.testutils import APITestCase
class IssuesResolvedInReleaseEndpointTest(APITestCase):
def setUp(self):
super(IssuesResolvedInReleaseEndpointTest, self).setUp()
self.user = self.create_user()
self.org = self.create_organization()
self.team = self.create_team(organization=self.org)
self.create_member(organization=self.org, user=self.user, teams=[self.team])
self.project = self.create_project(
teams=[self.team],
)
self.release = self.create_release(
project=self.project,
)
self.group = self.create_group(project=self.project)
self.login_as(self.user)
self.path = reverse(
'sentry-api-0-release-resolved',
kwargs={
'organization_slug': self.project.organization.slug,
'project_slug': self.project.slug,
'version': self.release.version,
}
)
def test_shows_issues_from_groupresolution(self):
"""
tests that the endpoint will correctly retrieve issues resolved
in a release from the GroupResolution model
"""
GroupResolution.objects.create(
group=self.group,
release=self.release,
type=GroupResolution.Type.in_release,
)
response = self.client.get(self.path)
assert response.status_code == 200, response.content
assert len(response.data) == 1
assert response.data[0]['id'] == six.text_type(self.group.id)
def test_shows_issues_from_grouplink(self):
"""
tests that the endpoint will correctly retrieve issues resolved
in a release from the GroupLink model
"""
repo = Repository.objects.create(
organization_id=self.org.id,
name=self.project.name,
)
commit = Commit.objects.create(
organization_id=self.org.id,
repository_id=repo.id,
key='a' * 40,
)
commit2 = Commit.objects.create(
organization_id=self.org.id,
repository_id=repo.id,
key='b' * 40,
)
ReleaseCommit.objects.create(
organization_id=self.org.id,
release=self.release,
commit=commit,
order=1,
)
ReleaseCommit.objects.create(
organization_id=self.org.id,
release=self.release,
commit=commit2,
order=0,
)
GroupLink.objects.create(
group_id=self.group.id,
project_id=self.group.project_id,
linked_type=GroupLink.LinkedType.commit,
relationship=GroupLink.Relationship.resolves,
linked_id=commit.id,
)
response = self.client.get(self.path)
assert response.status_code == 200, response.content
assert len(response.data) == 1
assert response.data[0]['id'] == six.text_type(self.group.id)
def test_does_not_return_duplicate_groups(self):
"""
tests that the endpoint will correctly retrieve issues resolved
in a release from the GroupLink and GroupResolution model
but will not return the groups twice if they appear in both
"""
repo = Repository.objects.create(
organization_id=self.org.id,
name=self.project.name,
)
commit = Commit.objects.create(
organization_id=self.org.id,
repository_id=repo.id,
key='a' * 40,
)
commit2 = Commit.objects.create(
organization_id=self.org.id,
repository_id=repo.id,
key='b' * 40,
)
ReleaseCommit.objects.create(
organization_id=self.org.id,
release=self.release,
commit=commit,
order=1,
)
ReleaseCommit.objects.create(
organization_id=self.org.id,
release=self.release,
commit=commit2,
order=0,
)
GroupLink.objects.create(
group_id=self.group.id,
project_id=self.group.project_id,
linked_type=GroupLink.LinkedType.commit,
relationship=GroupLink.Relationship.resolves,
linked_id=commit.id,
)
GroupResolution.objects.create(
group=self.group,
release=self.release,
type=GroupResolution.Type.in_release,
)
response = self.client.get(self.path)
assert response.status_code == 200, response.content
assert len(response.data) == 1
assert response.data[0]['id'] == six.text_type(self.group.id)
def test_return_groups_from_both_types(self):
"""
tests that the endpoint will correctly retrieve issues resolved
in a release from both the GroupLink and GroupResolution model
"""
group2 = self.create_group(project=self.project)
repo = Repository.objects.create(
organization_id=self.org.id,
name=self.project.name,
)
commit = Commit.objects.create(
organization_id=self.org.id,
repository_id=repo.id,
key='a' * 40,
)
commit2 = Commit.objects.create(
organization_id=self.org.id,
repository_id=repo.id,
key='b' * 40,
)
ReleaseCommit.objects.create(
organization_id=self.org.id,
release=self.release,
commit=commit,
order=1,
)
ReleaseCommit.objects.create(
organization_id=self.org.id,
release=self.release,
commit=commit2,
order=0,
)
GroupLink.objects.create(
group_id=self.group.id,
project_id=self.group.project_id,
linked_type=GroupLink.LinkedType.commit,
relationship=GroupLink.Relationship.resolves,
linked_id=commit.id,
)
GroupResolution.objects.create(
group=group2,
release=self.release,
type=GroupResolution.Type.in_release,
)
response = self.client.get(self.path)
assert response.status_code == 200, response.content
assert len(response.data) == 2
| 32.49505 | 84 | 0.587294 | 690 | 6,564 | 5.471014 | 0.14058 | 0.072318 | 0.099338 | 0.107285 | 0.768212 | 0.743046 | 0.725563 | 0.725563 | 0.725563 | 0.725563 | 0 | 0.010316 | 0.320689 | 6,564 | 201 | 85 | 32.656716 | 0.836286 | 0.078915 | 0 | 0.630952 | 0 | 0 | 0.013022 | 0.004904 | 0 | 0 | 0 | 0 | 0.065476 | 1 | 0.029762 | false | 0 | 0.029762 | 0 | 0.065476 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
a9b6540f8af3e9d5d6004e0d9127a26184b29fa6 | 302 | py | Python | server/src/labelFunctions/index.py | leonard-thong/dlwlrat | 2b4b669a3b2f348d1b05125afd6b8a1907b6b212 | [
"CC-BY-3.0"
] | 2 | 2020-10-08T06:01:22.000Z | 2020-12-15T16:28:27.000Z | server/src/labelFunctions/index.py | dreamyang-liu/SciAnnotate | dfa41ec5c2c4b6665b5d9b059895be20e9e0cfe2 | [
"CC-BY-3.0"
] | 8 | 2020-12-09T02:55:20.000Z | 2020-12-23T23:31:42.000Z | server/src/labelFunctions/index.py | dreamyang-liu/SciAnnotate | dfa41ec5c2c4b6665b5d9b059895be20e9e0cfe2 | [
"CC-BY-3.0"
] | 4 | 2021-02-02T04:51:53.000Z | 2021-07-18T17:00:04.000Z | # -*- coding:utf-8 -*-
"""
===========================================
@author: lmy, leonard
@time: 2020/8/19 11:03 PM
@project: brat
@file: index.py
===========================================
"""
from .contactLabeler import *
from .executor1 import *
from .x import *
from .xx import * | 23.230769 | 43 | 0.433775 | 30 | 302 | 4.366667 | 0.766667 | 0.229008 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.051383 | 0.162252 | 302 | 13 | 44 | 23.230769 | 0.466403 | 0.672185 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
e70e297f0693cbe0942f362178dce263c911d064 | 37 | py | Python | data/System/Herunterfahren.py | Fadope1/mp3Controller | 1b5381adf5322e37409d4ae56f59ef064da2a3c6 | [
"MIT"
] | null | null | null | data/System/Herunterfahren.py | Fadope1/mp3Controller | 1b5381adf5322e37409d4ae56f59ef064da2a3c6 | [
"MIT"
] | null | null | null | data/System/Herunterfahren.py | Fadope1/mp3Controller | 1b5381adf5322e37409d4ae56f59ef064da2a3c6 | [
"MIT"
] | null | null | null | import os
os.system("shutdown now")
| 9.25 | 25 | 0.72973 | 6 | 37 | 4.5 | 0.833333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.135135 | 37 | 3 | 26 | 12.333333 | 0.84375 | 0 | 0 | 0 | 0 | 0 | 0.324324 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
e72bfbcf6f9ddcc93a5a61ea7e9e401494c5faa8 | 237 | py | Python | openjij/sampler/__init__.py | Atsushi-Machida/OpenJij | e4bddebb13536eb26ff0b7b9fc6b1c75659fe934 | [
"Apache-2.0"
] | null | null | null | openjij/sampler/__init__.py | Atsushi-Machida/OpenJij | e4bddebb13536eb26ff0b7b9fc6b1c75659fe934 | [
"Apache-2.0"
] | null | null | null | openjij/sampler/__init__.py | Atsushi-Machida/OpenJij | e4bddebb13536eb26ff0b7b9fc6b1c75659fe934 | [
"Apache-2.0"
] | null | null | null | from .response import Response
from .sampler import *
from .sa_sampler import SASampler
from .sqa_sampler import SQASampler
from .gpu_sqa_sampler import GPUSQASampler
from .gpu_sa_sampler import GPUSASampler
from .cmos_annealer import *
| 29.625 | 42 | 0.843882 | 33 | 237 | 5.848485 | 0.393939 | 0.336788 | 0.15544 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.118143 | 237 | 7 | 43 | 33.857143 | 0.923445 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
e7446cadb184775a3927f9dc5f35a6885d79a46b | 181 | py | Python | src/test/pythonFiles/testFiles/standard/tests/external.py | ChaseKnowlden/vscode-jupyter | 9bdaf87f0b6dcd717c508e9023350499a6093f97 | [
"MIT"
] | 615 | 2020-11-11T22:55:28.000Z | 2022-03-30T21:48:08.000Z | src/test/pythonFiles/testFiles/standard/tests/external.py | ChaseKnowlden/vscode-jupyter | 9bdaf87f0b6dcd717c508e9023350499a6093f97 | [
"MIT"
] | 8,428 | 2020-11-11T22:06:43.000Z | 2022-03-31T23:42:34.000Z | src/test/pythonFiles/testFiles/standard/tests/external.py | vasili8m/vscode-python | 846eee870e8b7bab38172600836faedb5fb80166 | [
"MIT"
] | 158 | 2020-11-12T07:49:02.000Z | 2022-03-27T20:50:20.000Z | class ForeignTests:
class TestExtraNestedForeignTests:
def test_super_deep_foreign(self):
assert False
def test_foreign_test(self):
assert False
| 25.857143 | 42 | 0.690608 | 19 | 181 | 6.315789 | 0.578947 | 0.116667 | 0.25 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.265193 | 181 | 6 | 43 | 30.166667 | 0.902256 | 0 | 0 | 0.333333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.333333 | 1 | 0.333333 | false | 0 | 0 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 5 |
e7974eb3db1511a1249f05c1ed94cf20e57e7104 | 42 | py | Python | src/main/resources/docs/tests/W0301.py | h314to/codacy-pylint | 9d31567db6188e1b31ce0e1567998f64946502df | [
"Apache-2.0"
] | null | null | null | src/main/resources/docs/tests/W0301.py | h314to/codacy-pylint | 9d31567db6188e1b31ce0e1567998f64946502df | [
"Apache-2.0"
] | null | null | null | src/main/resources/docs/tests/W0301.py | h314to/codacy-pylint | 9d31567db6188e1b31ce0e1567998f64946502df | [
"Apache-2.0"
] | null | null | null | ##Patterns: W0301
##Info: W0301
a = 1;
| 10.5 | 18 | 0.571429 | 6 | 42 | 4 | 0.833333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.28125 | 0.238095 | 42 | 3 | 19 | 14 | 0.46875 | 0.619048 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
99be151f8d4a94bc2cffbab98edbfd933cacf8b5 | 1,487 | py | Python | Complementing_Strand_of_DNA.py | sujitmandal/Boinformatics | 56f4116fd5281bf04b694152b1ea9cf219a6d757 | [
"MIT"
] | null | null | null | Complementing_Strand_of_DNA.py | sujitmandal/Boinformatics | 56f4116fd5281bf04b694152b1ea9cf219a6d757 | [
"MIT"
] | null | null | null | Complementing_Strand_of_DNA.py | sujitmandal/Boinformatics | 56f4116fd5281bf04b694152b1ea9cf219a6d757 | [
"MIT"
] | null | null | null | string = "TCAGGTCTTAAAAGGCTAGACGGATGATCCGTCATGTGCTTATAACCTCATACCGCGTGCGCTCCCTAGTTCTTGTGGGAAGAACCTCCGATCACTTCCGTACTTCAGGTCATTTTCTGTGATAACCTCTTCACCATTAGGTATGCTGTTACGGCTCACTATGTCTTAAGGGTATACAGGGATGGGCCCACTATATACCACTAGCGTGGAACGTCGTTCCACCTAGATACATACACCCTTCAAATTGTGGTCATTCTAAAAAAGGCTTCTTCTGAGACGGTAACTGGCTATGGGTGATCGCTCGTACAGGTATCTCGAAAAGGAGATGGGGCTCATCGTTTGTCAATCCCCCCATCTGAGGCTTTGGGTCACATTGCAGTTTCAGATCCCATCTTCTGTAACCAACCTGCGAACTGCTTCAACGTGCAACTTAGTACTAAGTACGATTGAGCGTAGCCCTAAGGGGTTAACTGTACGCTATGAGTTCATTTCATGTTTGTCTGGGAAATTCGACGTACATACTCCATGTGATGGCTTATAGTCCTCAGCATGGCAAAAACTCGTTACAGAAATAAATTGGCGGGACTACGCCATACTGTTGCCCAGTTATACGCATGGGTAAGCACGCCCAGTTATGTTCCTCACGGTTGATTGCGCGATCCGTTTCGGCCGAATGCCGCGACGGTGGTTGACCCTGTTGACATTTTGTCGTCTGTCTCTAGGCCACTTCGCAAAGACCAGCTCCCCTAAAGACTACATTGCCGTCGGTATCCATCATTCCTGAGAGACGTGAGGCCCCCTTTCGTAACCCAGCCCGGCTGAAATCTCAATTCCTTAACCTCGGCCCTTTCTATATTTATCTAGTCACTCGGTATATGTTAGCTAGGTTATCCACCATAGAAATTGTCAACTTGATGCCAGCCGGCAGGATATAGTAAGGATATCGAAGTCCCAGTATTGACATCAAGACGTCATCCCTTCCGTGGGGGATCTAAAAAC"
'''
Author : Sujit Mandal
Github: https://github.com/sujitmandal
Package : https://pypi.org/project/images-into-array/
LinkedIn : https://www.linkedin.com/in/sujit-mandal-91215013a/
Facebook : https://www.facebook.com/sujit.mandal.33671748
Twitter : https://twitter.com/mandalsujit37
'''
def DNA(temp):
st_temp = temp.replace('A', 't').replace('T', 'a').replace('C', 'g').replace('G', 'c').upper()[::-1]
print(st_temp)
if __name__ == "__main__":
DNA(string)
| 78.263158 | 1,010 | 0.891728 | 68 | 1,487 | 19.352941 | 0.573529 | 0.025076 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.013277 | 0.03766 | 1,487 | 18 | 1,011 | 82.611111 | 0.906359 | 0 | 0 | 0 | 0 | 0 | 0.847245 | 0.83389 | 0 | 1 | 0 | 0 | 0 | 1 | 0.166667 | false | 0 | 0 | 0 | 0.166667 | 0.166667 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
99ec93579d92280a83c5edd71ef71c89f21f8a81 | 203 | py | Python | bobstack/sipmessaging/concretesipmessages/inviteSIPRequest.py | bobjects/BobStack | c177b286075044832f44baf9ace201780c8b4320 | [
"Apache-2.0"
] | null | null | null | bobstack/sipmessaging/concretesipmessages/inviteSIPRequest.py | bobjects/BobStack | c177b286075044832f44baf9ace201780c8b4320 | [
"Apache-2.0"
] | null | null | null | bobstack/sipmessaging/concretesipmessages/inviteSIPRequest.py | bobjects/BobStack | c177b286075044832f44baf9ace201780c8b4320 | [
"Apache-2.0"
] | null | null | null | from ...sipmessaging import SIPRequest
class INVITESIPRequest(SIPRequest):
@property
def is_invite_request(self):
return True
@property
def is_known(self):
return True
| 16.916667 | 38 | 0.679803 | 22 | 203 | 6.136364 | 0.681818 | 0.162963 | 0.192593 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.251232 | 203 | 11 | 39 | 18.454545 | 0.888158 | 0 | 0 | 0.5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0.125 | 0.25 | 0.75 | 0 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 5 |
820a3b29c7139c4175fb31dbf43be353c1b73f18 | 142 | py | Python | src/react_ssr/exceptions.py | urantialife/react-ssr-backend | f4d094fbd15ff1eb2178aeac0bf9bec8c70414f7 | [
"BSD-2-Clause"
] | 1 | 2019-06-23T21:00:16.000Z | 2019-06-23T21:00:16.000Z | src/react_ssr/exceptions.py | urantialife/react-ssr-backend | f4d094fbd15ff1eb2178aeac0bf9bec8c70414f7 | [
"BSD-2-Clause"
] | null | null | null | src/react_ssr/exceptions.py | urantialife/react-ssr-backend | f4d094fbd15ff1eb2178aeac0bf9bec8c70414f7 | [
"BSD-2-Clause"
] | null | null | null | class RenderFrontendError(Exception):
pass
class GetContextError(Exception):
pass
class GetDefaultStateError(Exception):
pass
| 12.909091 | 38 | 0.760563 | 12 | 142 | 9 | 0.5 | 0.361111 | 0.333333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.176056 | 142 | 10 | 39 | 14.2 | 0.923077 | 0 | 0 | 0.5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0.5 | 0 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 5 |
8246dc79492b3bf557a76db49ba1825839531379 | 47 | py | Python | lang/py/cookbook/v2/source/cb2_19_9_sol_2.py | ch1huizong/learning | 632267634a9fd84a5f5116de09ff1e2681a6cc85 | [
"MIT"
] | null | null | null | lang/py/cookbook/v2/source/cb2_19_9_sol_2.py | ch1huizong/learning | 632267634a9fd84a5f5116de09ff1e2681a6cc85 | [
"MIT"
] | null | null | null | lang/py/cookbook/v2/source/cb2_19_9_sol_2.py | ch1huizong/learning | 632267634a9fd84a5f5116de09ff1e2681a6cc85 | [
"MIT"
] | null | null | null | for x in a:
for y in b:
print x, y
| 11.75 | 18 | 0.446809 | 11 | 47 | 1.909091 | 0.636364 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.489362 | 47 | 3 | 19 | 15.666667 | 0.875 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0 | null | null | 0.333333 | 1 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
4132ee58a226e2fa529d29c9d666bb398283f978 | 34 | py | Python | whilesonusuz.py | sahintuter/Basic-Python-Examples | 97e8e1d5e918c154ebac88b850200c1d461c128f | [
"Apache-2.0"
] | null | null | null | whilesonusuz.py | sahintuter/Basic-Python-Examples | 97e8e1d5e918c154ebac88b850200c1d461c128f | [
"Apache-2.0"
] | null | null | null | whilesonusuz.py | sahintuter/Basic-Python-Examples | 97e8e1d5e918c154ebac88b850200c1d461c128f | [
"Apache-2.0"
] | null | null | null | while True:
print("sonsuz")
| 11.333333 | 20 | 0.588235 | 4 | 34 | 5 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.264706 | 34 | 2 | 21 | 17 | 0.8 | 0 | 0 | 0 | 0 | 0 | 0.1875 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0 | 0 | 0 | 0.5 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
4135ac2116210c5d0db399a173a75c9372c88bcd | 297 | py | Python | poo_exercise/models/__init__.py | thiagosalvatore/poo-exercise | ab897d9b17b3aa63252c4fa7334f624f6d380d9a | [
"Apache-2.0"
] | null | null | null | poo_exercise/models/__init__.py | thiagosalvatore/poo-exercise | ab897d9b17b3aa63252c4fa7334f624f6d380d9a | [
"Apache-2.0"
] | null | null | null | poo_exercise/models/__init__.py | thiagosalvatore/poo-exercise | ab897d9b17b3aa63252c4fa7334f624f6d380d9a | [
"Apache-2.0"
] | null | null | null | from poo_exercise.models.classroom import Classroom
from poo_exercise.models.question import Question
from poo_exercise.models.quiz import Quiz
from poo_exercise.models.student import Student
from poo_exercise.models.student_quiz import StudentQuiz
from poo_exercise.models.teacher import Teacher
| 42.428571 | 56 | 0.878788 | 43 | 297 | 5.906977 | 0.255814 | 0.165354 | 0.354331 | 0.496063 | 0.220472 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.080808 | 297 | 6 | 57 | 49.5 | 0.930403 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
413f2103569be24e3d6f0a05ec48b83503156bfb | 77 | py | Python | acq4/devices/PatchPipette/__init__.py | aleonlein/acq4 | 4b1fcb9ad2c5e8d4595a2b9cf99d50ece0c0f555 | [
"MIT"
] | 47 | 2015-01-05T16:18:10.000Z | 2022-03-16T13:09:30.000Z | acq4/devices/PatchPipette/__init__.py | aleonlein/acq4 | 4b1fcb9ad2c5e8d4595a2b9cf99d50ece0c0f555 | [
"MIT"
] | 48 | 2015-04-19T16:51:41.000Z | 2022-03-31T14:48:16.000Z | acq4/devices/PatchPipette/__init__.py | sensapex/acq4 | 9561ba73caff42c609bd02270527858433862ad8 | [
"MIT"
] | 32 | 2015-01-15T14:11:49.000Z | 2021-07-15T13:44:52.000Z | from __future__ import print_function
from .patchpipette import PatchPipette
| 25.666667 | 38 | 0.883117 | 9 | 77 | 7 | 0.666667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.103896 | 77 | 2 | 39 | 38.5 | 0.913043 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0.5 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 0 | 5 |
4184757a21af3c941bc4568b5152bb621805b3ef | 214 | py | Python | tests/fixtures/auth.py | jmwri/pyrunehistory | a9384cb86d706857158c2ac74d4bef30de99ae31 | [
"MIT"
] | null | null | null | tests/fixtures/auth.py | jmwri/pyrunehistory | a9384cb86d706857158c2ac74d4bef30de99ae31 | [
"MIT"
] | null | null | null | tests/fixtures/auth.py | jmwri/pyrunehistory | a9384cb86d706857158c2ac74d4bef30de99ae31 | [
"MIT"
] | null | null | null | from pytest import fixture
from pyrunehistory.client import Client
from pyrunehistory.auth import Auth
@fixture
def auth() -> Auth:
c = Client('user', 'password', 'secret', 'http://tests')
return c.auth
| 19.454545 | 60 | 0.71028 | 28 | 214 | 5.428571 | 0.535714 | 0.223684 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.168224 | 214 | 10 | 61 | 21.4 | 0.853933 | 0 | 0 | 0 | 0 | 0 | 0.140187 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0.142857 | 0.428571 | 0 | 0.714286 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | 5 |
41b7c2c8b55507db402f8c007943df6e2831904c | 157 | py | Python | hocrox/layer/preprocessing/transformation/__init__.py | imdeepmind/hocrox | 271f7ee8f7b9c0fb5466f5b8d9acbc0a703b570f | [
"MIT"
] | 2 | 2021-12-09T19:20:23.000Z | 2021-12-26T13:22:50.000Z | hocrox/layer/preprocessing/transformation/__init__.py | imdeepmind/hocrox | 271f7ee8f7b9c0fb5466f5b8d9acbc0a703b570f | [
"MIT"
] | 29 | 2021-04-28T14:37:36.000Z | 2022-03-17T18:37:52.000Z | hocrox/layer/preprocessing/transformation/__init__.py | imdeepmind/hocrox | 271f7ee8f7b9c0fb5466f5b8d9acbc0a703b570f | [
"MIT"
] | 1 | 2022-03-07T10:55:36.000Z | 2022-03-07T10:55:36.000Z | """Preprocessing layers that transforms images."""
from .crop import Crop
from .pading import Padding
from .resize import Resize
from .rotate import Rotate
| 22.428571 | 50 | 0.789809 | 21 | 157 | 5.904762 | 0.571429 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.140127 | 157 | 6 | 51 | 26.166667 | 0.918519 | 0.280255 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
41b8ad039382a81095801040b7e287eed0d4318b | 150 | py | Python | rl4rs/env/__init__.py | fuxiAIlab/RL4RS | e26ee5d068eaffd0f04779067614e34e313b1200 | [
"Apache-2.0"
] | 77 | 2022-02-17T01:51:29.000Z | 2022-03-23T23:34:01.000Z | rl4rs/env/__init__.py | fuxiAIlab/RL4RS | e26ee5d068eaffd0f04779067614e34e313b1200 | [
"Apache-2.0"
] | 2 | 2022-03-15T11:38:50.000Z | 2022-03-29T08:12:46.000Z | rl4rs/env/__init__.py | fuxiAIlab/RL4RS | e26ee5d068eaffd0f04779067614e34e313b1200 | [
"Apache-2.0"
] | 11 | 2022-02-26T18:14:35.000Z | 2022-03-29T21:29:10.000Z | from .base import RecDataBase, RecSimBase, RecEnvBase, RecState
__all__ = [
"RecDataBase",
"RecSimBase",
"RecEnvBase",
"RecState",
]
| 16.666667 | 63 | 0.66 | 12 | 150 | 7.916667 | 0.666667 | 0.442105 | 0.652632 | 0.821053 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.213333 | 150 | 8 | 64 | 18.75 | 0.805085 | 0 | 0 | 0 | 0 | 0 | 0.26 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.142857 | 0 | 0.142857 | 0 | 1 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
41c5de797ef7699d54bc170c40d2ce0440ca6549 | 231 | py | Python | prism/__init__.py | CurtLH/prism-python | 82cf5ef75509550741c73ccf62c4541ff881e469 | [
"Apache-2.0"
] | 14 | 2020-04-02T00:41:46.000Z | 2022-01-06T03:58:53.000Z | prism/__init__.py | CurtLH/prism-python | 82cf5ef75509550741c73ccf62c4541ff881e469 | [
"Apache-2.0"
] | 15 | 2019-12-05T22:51:04.000Z | 2021-06-25T20:56:42.000Z | prism/__init__.py | CurtLH/prism-python | 82cf5ef75509550741c73ccf62c4541ff881e469 | [
"Apache-2.0"
] | 5 | 2019-12-05T22:55:49.000Z | 2020-11-18T18:31:59.000Z | from prism.prism import Prism, load_schema, create_table, upload_file
from ._version import get_versions
__version__ = get_versions()["version"]
del get_versions
__all__ = ["load_schema", "Prism", "create_table", "upload_file"]
| 25.666667 | 69 | 0.779221 | 31 | 231 | 5.225806 | 0.451613 | 0.203704 | 0.209877 | 0.259259 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.108225 | 231 | 8 | 70 | 28.875 | 0.786408 | 0 | 0 | 0 | 0 | 0 | 0.199134 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.4 | 0 | 0.4 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
68d533f537b1bea1308c50afd462dd5d709014c6 | 168 | py | Python | uliweb/contrib/staticfiles/conf.py | timgates42/uliweb | 80c0459c5e5d257b665eb2e1d0b5f68ad55c42f1 | [
"BSD-2-Clause"
] | 202 | 2015-01-12T08:10:48.000Z | 2021-11-08T09:04:32.000Z | uliweb/contrib/staticfiles/conf.py | timgates42/uliweb | 80c0459c5e5d257b665eb2e1d0b5f68ad55c42f1 | [
"BSD-2-Clause"
] | 30 | 2015-01-01T09:07:17.000Z | 2021-06-03T12:58:45.000Z | uliweb/contrib/staticfiles/conf.py | timgates42/uliweb | 80c0459c5e5d257b665eb2e1d0b5f68ad55c42f1 | [
"BSD-2-Clause"
] | 58 | 2015-01-12T03:28:54.000Z | 2022-01-14T01:58:08.000Z | from uliweb.form import *
class ManageForm(Form):
static_url = StringField(label='Static URL prefix:', required=True, key='wsgi_middleware_staticfiles/STATIC_URL') | 42 | 117 | 0.785714 | 22 | 168 | 5.818182 | 0.772727 | 0.210938 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.10119 | 168 | 4 | 117 | 42 | 0.847682 | 0 | 0 | 0 | 0 | 0 | 0.331361 | 0.224852 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 1 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
ec176572f6f3e86a7252760d80c4d4ea64a7dca5 | 139 | py | Python | test/com/facebook/buck/features/python/testdata/python_test/test_spinning.py | lakshmi2005/buck | 012a59d5d2e5a45b483e85fb190d2b67ea0c56ab | [
"Apache-2.0"
] | 1 | 2022-01-25T13:13:09.000Z | 2022-01-25T13:13:09.000Z | test/com/facebook/buck/python/testdata/python_test/test_spinning.py | monaka/buck | 5bf0591e649158237fe7d8523f11380e4f54bdf4 | [
"Apache-2.0"
] | 1 | 2018-12-10T15:54:22.000Z | 2018-12-10T19:30:37.000Z | test/com/facebook/buck/python/testdata/python_test/test_spinning.py | monaka/buck | 5bf0591e649158237fe7d8523f11380e4f54bdf4 | [
"Apache-2.0"
] | 1 | 2022-01-25T13:14:45.000Z | 2022-01-25T13:14:45.000Z | import unittest
import time
class Test(unittest.TestCase):
def test_that_passes(self):
while True:
time.sleep(1)
| 15.444444 | 31 | 0.654676 | 18 | 139 | 4.944444 | 0.777778 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.009804 | 0.266187 | 139 | 8 | 32 | 17.375 | 0.862745 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.166667 | false | 0.166667 | 0.333333 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | 5 |
ec2313367ba597f9b98d1ea92500b0d058501b87 | 52 | py | Python | mkpy/__main__.py | phipus/mkpy | 8d5da1ea868e85ea6a7b20fa250989af0d1ee0c8 | [
"MIT"
] | null | null | null | mkpy/__main__.py | phipus/mkpy | 8d5da1ea868e85ea6a7b20fa250989af0d1ee0c8 | [
"MIT"
] | null | null | null | mkpy/__main__.py | phipus/mkpy | 8d5da1ea868e85ea6a7b20fa250989af0d1ee0c8 | [
"MIT"
] | null | null | null | import os
import sys
from .make import main
main()
| 8.666667 | 22 | 0.75 | 9 | 52 | 4.333333 | 0.666667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.192308 | 52 | 5 | 23 | 10.4 | 0.928571 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.75 | 0 | 0.75 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
ec26cf264ef74b054d7286a7bf2f3efd084f6e76 | 38 | py | Python | tests/components/twitch/__init__.py | domwillcode/home-assistant | f170c80bea70c939c098b5c88320a1c789858958 | [
"Apache-2.0"
] | 30,023 | 2016-04-13T10:17:53.000Z | 2020-03-02T12:56:31.000Z | tests/components/twitch/__init__.py | jagadeeshvenkatesh/core | 1bd982668449815fee2105478569f8e4b5670add | [
"Apache-2.0"
] | 31,101 | 2020-03-02T13:00:16.000Z | 2022-03-31T23:57:36.000Z | tests/components/twitch/__init__.py | jagadeeshvenkatesh/core | 1bd982668449815fee2105478569f8e4b5670add | [
"Apache-2.0"
] | 11,956 | 2016-04-13T18:42:31.000Z | 2020-03-02T09:32:12.000Z | """Tests for the Twitch component."""
| 19 | 37 | 0.684211 | 5 | 38 | 5.2 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.131579 | 38 | 1 | 38 | 38 | 0.787879 | 0.815789 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
ec37df794d8476676e294d834ad65ee0269a31a8 | 267 | py | Python | app/routes.py | davidtso1219/timer_app | d0d8fc07a139e9d8932e569ea3bc9b1c595db2ac | [
"MIT"
] | null | null | null | app/routes.py | davidtso1219/timer_app | d0d8fc07a139e9d8932e569ea3bc9b1c595db2ac | [
"MIT"
] | null | null | null | app/routes.py | davidtso1219/timer_app | d0d8fc07a139e9d8932e569ea3bc9b1c595db2ac | [
"MIT"
] | null | null | null | from flask import render_template, request, flash
from app import app
@app.route('/')
def welcome():
return render_template('index.html')
@app.route('/timer')
@app.route('/timer/<name>')
def next(name=None):
return render_template('timer.html', name=name) | 20.538462 | 51 | 0.707865 | 38 | 267 | 4.894737 | 0.473684 | 0.225806 | 0.215054 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.123596 | 267 | 13 | 51 | 20.538462 | 0.794872 | 0 | 0 | 0 | 0 | 0 | 0.149254 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.222222 | false | 0 | 0.222222 | 0.222222 | 0.666667 | 0 | 0 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 5 |
ec391762e00a207f2d6f00a1964e9e042c2df23d | 148 | py | Python | apps/cars/api/serializers/__init__.py | agorsk1/car-rating-app | 354c5933f4cbad69c9a57d1839f9086cd5cf9a1d | [
"MIT"
] | 1 | 2022-03-03T11:15:25.000Z | 2022-03-03T11:15:25.000Z | apps/cars/api/serializers/__init__.py | agorsk1/car-rating-app | 354c5933f4cbad69c9a57d1839f9086cd5cf9a1d | [
"MIT"
] | null | null | null | apps/cars/api/serializers/__init__.py | agorsk1/car-rating-app | 354c5933f4cbad69c9a57d1839f9086cd5cf9a1d | [
"MIT"
] | null | null | null | from .car_serializers import (
CarSerializer,
CarPopularitySerializer,
CarSerializer
)
from .rating_serializers import RatingSerializer
| 21.142857 | 48 | 0.797297 | 12 | 148 | 9.666667 | 0.666667 | 0.293103 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.162162 | 148 | 6 | 49 | 24.666667 | 0.935484 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.333333 | 0 | 0.333333 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
6b5dc5b9587c35e35b8217d498e47fd608bf481f | 19 | py | Python | braintree/version.py | maneeshd/braintree_python | 4aa3f4b8a376ea81bf16a053d840efe55ae13675 | [
"MIT"
] | null | null | null | braintree/version.py | maneeshd/braintree_python | 4aa3f4b8a376ea81bf16a053d840efe55ae13675 | [
"MIT"
] | null | null | null | braintree/version.py | maneeshd/braintree_python | 4aa3f4b8a376ea81bf16a053d840efe55ae13675 | [
"MIT"
] | null | null | null | Version = "3.59.0"
| 9.5 | 18 | 0.578947 | 4 | 19 | 2.75 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.25 | 0.157895 | 19 | 1 | 19 | 19 | 0.4375 | 0 | 0 | 0 | 0 | 0 | 0.315789 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
6b6b6f12404fdd729d8e23c7f7606a0e10ae3f7f | 116 | py | Python | roslibpy/math/__init__.py | mortenmj/roslibpy | e492ab89af283346939aed747506d84423cf194d | [
"BSD-3-Clause"
] | null | null | null | roslibpy/math/__init__.py | mortenmj/roslibpy | e492ab89af283346939aed747506d84423cf194d | [
"BSD-3-Clause"
] | null | null | null | roslibpy/math/__init__.py | mortenmj/roslibpy | e492ab89af283346939aed747506d84423cf194d | [
"BSD-3-Clause"
] | null | null | null | from .point import Point
from .quaternion import Quaternion
from .pose import Pose
from .transform import Transform
| 23.2 | 34 | 0.827586 | 16 | 116 | 6 | 0.375 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.137931 | 116 | 4 | 35 | 29 | 0.96 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
6b85f115a69697a1af1760645d8462feaa202a77 | 22 | py | Python | raft/__init__.py | ibaiGorordo/ONNX-RAFT-Optical-Flow-Estimation | 38ce7b76846397df53631ab05e3dfa1e495ae0f4 | [
"MIT"
] | 4 | 2022-02-20T14:08:21.000Z | 2022-03-26T10:48:52.000Z | raft/__init__.py | ibaiGorordo/ONNX-RAFT-Optical-Flow-Estimation | 38ce7b76846397df53631ab05e3dfa1e495ae0f4 | [
"MIT"
] | null | null | null | raft/__init__.py | ibaiGorordo/ONNX-RAFT-Optical-Flow-Estimation | 38ce7b76846397df53631ab05e3dfa1e495ae0f4 | [
"MIT"
] | null | null | null | from .raft import Raft | 22 | 22 | 0.818182 | 4 | 22 | 4.5 | 0.75 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.136364 | 22 | 1 | 22 | 22 | 0.947368 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
6bb0f6eaa788938b013b19783e1dabd8ba83894c | 63 | py | Python | py001.py | vandebettio/desenvolvimentopython-exercicios | 7d2ee8feaf809f4d4c31015cae8bedab4d26e792 | [
"MIT"
] | null | null | null | py001.py | vandebettio/desenvolvimentopython-exercicios | 7d2ee8feaf809f4d4c31015cae8bedab4d26e792 | [
"MIT"
] | null | null | null | py001.py | vandebettio/desenvolvimentopython-exercicios | 7d2ee8feaf809f4d4c31015cae8bedab4d26e792 | [
"MIT"
] | null | null | null | # O começo de tudo, mostrar 'Olá, mundo!'
print('Olá, mundo!')
| 21 | 41 | 0.650794 | 10 | 63 | 4.1 | 0.8 | 0.390244 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.15873 | 63 | 2 | 42 | 31.5 | 0.773585 | 0.619048 | 0 | 0 | 0 | 0 | 0.5 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
6bb4ec20c496aa4bfd8883c79529f77f39fc9399 | 84 | py | Python | run_server.py | kdurril/mvp_app | dfe7ef75e4a49d9bce3cb50c29f1a6d25a15361d | [
"MIT"
] | null | null | null | run_server.py | kdurril/mvp_app | dfe7ef75e4a49d9bce3cb50c29f1a6d25a15361d | [
"MIT"
] | null | null | null | run_server.py | kdurril/mvp_app | dfe7ef75e4a49d9bce3cb50c29f1a6d25a15361d | [
"MIT"
] | null | null | null | #!/usr/bin/env
# -*- encoding: utf-8 -*-
import gunicorn
from mvp_app import app
| 12 | 25 | 0.654762 | 13 | 84 | 4.153846 | 0.846154 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.014493 | 0.178571 | 84 | 6 | 26 | 14 | 0.768116 | 0.452381 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
6bbfcdd7ab9c272bc18a3bb8310792b62e674260 | 249 | py | Python | python_files/similarity/Distances.py | albertoursino/ComparisonBetweenNetworks | e6e3612b47cf10ec4e284a66044dad0ddf412b85 | [
"MIT"
] | 1 | 2021-11-26T17:33:15.000Z | 2021-11-26T17:33:15.000Z | python_files/similarity/Distances.py | albertoursino/GraphsComparison | e6e3612b47cf10ec4e284a66044dad0ddf412b85 | [
"MIT"
] | null | null | null | python_files/similarity/Distances.py | albertoursino/GraphsComparison | e6e3612b47cf10ec4e284a66044dad0ddf412b85 | [
"MIT"
] | null | null | null | import numpy as np
# Given two graphs by their adjacency matrices,
# return the number of edges in common (in case all entries are 0's and 1's).
def num_edges_in_common(mat1: np.matrix, mat2: np.matrix):
return np.sum(np.multiply(mat1, mat2))
| 31.125 | 77 | 0.738956 | 46 | 249 | 3.934783 | 0.717391 | 0.077348 | 0.143646 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.028986 | 0.168675 | 249 | 7 | 78 | 35.571429 | 0.845411 | 0.485944 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.333333 | false | 0 | 0.333333 | 0.333333 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 5 |
6bdcbed91c2aed9d91abf539c0008a316c3415eb | 1,157 | py | Python | src/fp_artificial.py | yusif-ifraimo/FlapPy_Bird_SWT | a5af3f26f651c58b724a2161114b6ff5584d22fe | [
"MIT"
] | 1 | 2020-09-18T09:00:43.000Z | 2020-09-18T09:00:43.000Z | src/fp_artificial.py | yusif-ifraimo/FlapPy_Bird_SWT | a5af3f26f651c58b724a2161114b6ff5584d22fe | [
"MIT"
] | null | null | null | src/fp_artificial.py | yusif-ifraimo/FlapPy_Bird_SWT | a5af3f26f651c58b724a2161114b6ff5584d22fe | [
"MIT"
] | null | null | null | def number(the_number, arg):
return arg[0](the_number, arg[1]) if arg else the_number
def zero (arg = None): return number(0, arg)
def one (arg = None): return number(1, arg)
def two (arg = None): return number(2, arg)
def three(arg = None): return number(3, arg)
def four (arg = None): return number(4, arg)
def five (arg = None): return number(5, arg)
def six (arg = None): return number(6, arg)
def seven(arg = None): return number(7, arg)
def eight(arg = None): return number(8, arg)
def nine (arg = None): return number(9, arg)
def plus (value): return int.__add__, value
def minus (value): return int.__sub__, value
def times (value): return int.__mul__, value
def divided_by(value): return int.__floordiv__, value
assert seven(times(five())) == 35
assert four(plus(nine())) == 13
assert eight(minus(three())) == 5
assert six(divided_by(two())) == 3
def quad(a, b, c):
return lambda x: (a(x) if callable(a) else a)*(x ** 2) + \
(b(x) if callable(b) else b) * x + \
(a(x) if callable(c) else c)
assert quad(0, 0, 3)(0) == 3
assert quad(quad(1, 0, 0), quad(0, 2, 0), 3)(0) == 3 | 32.138889 | 62 | 0.621435 | 199 | 1,157 | 3.507538 | 0.246231 | 0.100287 | 0.186246 | 0.272206 | 0.037249 | 0 | 0 | 0 | 0 | 0 | 0 | 0.036264 | 0.213483 | 1,157 | 36 | 63 | 32.138889 | 0.730769 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.230769 | 1 | 0.615385 | false | 0 | 0 | 0.615385 | 0.692308 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 5 |
d401349e3655283a9449bbf73ea81ceb301926fb | 247 | py | Python | repo/__init__.py | GudniNatan/GSKI-PA6 | a0f9a38bc0d2f6710f803a77276e6a76cd6f4471 | [
"MIT"
] | null | null | null | repo/__init__.py | GudniNatan/GSKI-PA6 | a0f9a38bc0d2f6710f803a77276e6a76cd6f4471 | [
"MIT"
] | null | null | null | repo/__init__.py | GudniNatan/GSKI-PA6 | a0f9a38bc0d2f6710f803a77276e6a76cd6f4471 | [
"MIT"
] | null | null | null | from repo.member_repo import MemberRepo
from repo.plays_repo import PlaysRepo
from repo.repo import Repo, RelationError
from repo.sport_repo import SportRepo
from repo.group_repo import GroupRepo
from repo.group_member_repo import GroupMemberRepo
| 35.285714 | 50 | 0.870445 | 37 | 247 | 5.648649 | 0.351351 | 0.229665 | 0.15311 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.101215 | 247 | 6 | 51 | 41.166667 | 0.941441 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
d4077586394075db09833fbccc12fdfd0c984e21 | 51 | py | Python | Online-Judges/CodingBat/Python/String-01/07-first_half.py | shihab4t/Competitive-Programming | e8eec7d4f7d86bfa1c00b7fbbedfd6a1518f19be | [
"Unlicense"
] | 3 | 2021-06-15T01:19:23.000Z | 2022-03-16T18:23:53.000Z | Online-Judges/CodingBat/Python/String-01/07-first_half.py | shihab4t/Competitive-Programming | e8eec7d4f7d86bfa1c00b7fbbedfd6a1518f19be | [
"Unlicense"
] | null | null | null | Online-Judges/CodingBat/Python/String-01/07-first_half.py | shihab4t/Competitive-Programming | e8eec7d4f7d86bfa1c00b7fbbedfd6a1518f19be | [
"Unlicense"
] | null | null | null | def first_half(str):
return str[:(len(str)/2)]
| 17 | 29 | 0.627451 | 9 | 51 | 3.444444 | 0.777778 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.023256 | 0.156863 | 51 | 2 | 30 | 25.5 | 0.697674 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.5 | false | 0 | 0 | 0.5 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 5 |
d40ed7311dfd6a9b6121a5ef4da4987f47689faf | 12,225 | py | Python | homework6/mybehaviors.py | markriedl/gaige | e4984571ae368195b6bc296e69ed707a86b88da3 | [
"MIT"
] | 100 | 2018-11-26T17:04:50.000Z | 2022-03-26T10:16:23.000Z | homework6/mybehaviors.py | markriedl/gaige | e4984571ae368195b6bc296e69ed707a86b88da3 | [
"MIT"
] | null | null | null | homework6/mybehaviors.py | markriedl/gaige | e4984571ae368195b6bc296e69ed707a86b88da3 | [
"MIT"
] | 9 | 2018-12-12T01:10:41.000Z | 2020-07-04T18:20:04.000Z | '''
* Copyright (c) 2014, 2015 Entertainment Intelligence Lab, Georgia Institute of Technology.
* Originally developed by Mark Riedl.
* Last edited by Mark Riedl 05/2015
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
'''
import sys, pygame, math, numpy, random, time, copy
from pygame.locals import *
from constants import *
from utils import *
from core import *
from moba2 import *
from btnode import *
###########################
### SET UP BEHAVIOR TREE
def treeSpec(agent):
myid = str(agent.getTeam())
spec = None
### YOUR CODE GOES BELOW HERE ###
### YOUR CODE GOES ABOVE HERE ###
return spec
def myBuildTree(agent):
myid = str(agent.getTeam())
root = None
### YOUR CODE GOES BELOW HERE ###
### YOUR CODE GOES ABOVE HERE ###
return root
### Helper function for making BTNodes (and sub-classes of BTNodes).
### type: class type (BTNode or a sub-class)
### agent: reference to the agent to be controlled
### This function takes any number of additional arguments that will be passed to the BTNode and parsed using BTNode.parseArgs()
def makeNode(type, agent, *args):
node = type(agent, args)
return node
###############################
### BEHAVIOR CLASSES:
##################
### Taunt
###
### Print disparaging comment, addressed to a given NPC
### Parameters:
### 0: reference to an NPC
### 1: node ID string (optional)
class Taunt(BTNode):
### target: the enemy agent to taunt
def parseArgs(self, args):
BTNode.parseArgs(self, args)
self.target = None
# First argument is the target
if len(args) > 0:
self.target = args[0]
# Second argument is the node ID
if len(args) > 1:
self.id = args[1]
def execute(self, delta = 0):
ret = BTNode.execute(self, delta)
if self.target is not None:
print "Hey", self.target, "I don't like you!"
return ret
##################
### MoveToTarget
###
### Move the agent to a given (x, y)
### Parameters:
### 0: a point (x, y)
### 1: node ID string (optional)
class MoveToTarget(BTNode):
### target: a point (x, y)
def parseArgs(self, args):
BTNode.parseArgs(self, args)
self.target = None
# First argument is the target
if len(args) > 0:
self.target = args[0]
# Second argument is the node ID
if len(args) > 1:
self.id = args[1]
def enter(self):
BTNode.enter(self)
self.agent.navigateTo(self.target)
def execute(self, delta = 0):
ret = BTNode.execute(self, delta)
if self.target == None:
# failed executability conditions
print "exec", self.id, "false"
return False
elif distance(self.agent.getLocation(), self.target) < self.agent.getRadius():
# Execution succeeds
print "exec", self.id, "true"
return True
else:
# executing
return None
return ret
##################
### Retreat
###
### Move the agent back to the base to be healed
### Parameters:
### 0: percentage of hitpoints that must have been lost to retreat
### 1: node ID string (optional)
class Retreat(BTNode):
### percentage: Percentage of hitpoints that must have been lost
def parseArgs(self, args):
BTNode.parseArgs(self, args)
self.percentage = 0.5
# First argument is the factor
if len(args) > 0:
self.percentage = args[0]
# Second argument is the node ID
if len(args) > 1:
self.id = args[1]
def enter(self):
BTNode.enter(self)
base = self.agent.world.getBaseForTeam(self.agent.getTeam())
if base:
self.agent.navigateTo(base.getLocation())
def execute(self, delta = 0):
ret = BTNode.execute(self, delta)
if self.agent.getHitpoints() > self.agent.getMaxHitpoints() * self.percentage:
# fail executability conditions
print "exec", self.id, "false"
return False
elif self.agent.getHitpoints() == self.agent.getMaxHitpoints():
# Exection succeeds
print "exec", self.id, "true"
return True
else:
# executing
return None
return ret
##################
### ChaseMinion
###
### Find the closest minion and move to intercept it.
### Parameters:
### 0: node ID string (optional)
class ChaseMinion(BTNode):
### target: the minion to chase
### timer: how often to replan
def parseArgs(self, args):
BTNode.parseArgs(self, args)
self.target = None
self.timer = 50
# First argument is the node ID
if len(args) > 0:
self.id = args[0]
def enter(self):
BTNode.enter(self)
self.timer = 50
enemies = self.agent.world.getEnemyNPCs(self.agent.getTeam())
if len(enemies) > 0:
best = None
dist = 0
for e in enemies:
if isinstance(e, Minion):
d = distance(self.agent.getLocation(), e.getLocation())
if best == None or d < dist:
best = e
dist = d
self.target = best
if self.target is not None:
navTarget = self.chooseNavigationTarget()
if navTarget is not None:
self.agent.navigateTo(navTarget)
def execute(self, delta = 0):
ret = BTNode.execute(self, delta)
if self.target == None or self.target.isAlive() == False:
# failed execution conditions
print "exec", self.id, "false"
return False
elif self.target is not None and distance(self.agent.getLocation(), self.target.getLocation()) < BIGBULLETRANGE:
# succeeded
print "exec", self.id, "true"
return True
else:
# executing
self.timer = self.timer - 1
if self.timer <= 0:
self.timer = 50
navTarget = self.chooseNavigationTarget()
if navTarget is not None:
self.agent.navigateTo(navTarget)
return None
return ret
def chooseNavigationTarget(self):
if self.target is not None:
return self.target.getLocation()
else:
return None
##################
### KillMinion
###
### Kill the closest minion. Assumes it is already in range.
### Parameters:
### 0: node ID string (optional)
class KillMinion(BTNode):
### target: the minion to shoot
def parseArgs(self, args):
BTNode.parseArgs(self, args)
self.target = None
# First argument is the node ID
if len(args) > 0:
self.id = args[0]
def enter(self):
BTNode.enter(self)
self.agent.stopMoving()
enemies = self.agent.world.getEnemyNPCs(self.agent.getTeam())
if len(enemies) > 0:
best = None
dist = 0
for e in enemies:
if isinstance(e, Minion):
d = distance(self.agent.getLocation(), e.getLocation())
if best == None or d < dist:
best = e
dist = d
self.target = best
def execute(self, delta = 0):
ret = BTNode.execute(self, delta)
if self.target == None or distance(self.agent.getLocation(), self.target.getLocation()) > BIGBULLETRANGE:
# failed executability conditions
print "exec", self.id, "false"
return False
elif self.target.isAlive() == False:
# succeeded
print "exec", self.id, "true"
return True
else:
# executing
self.shootAtTarget()
return None
return ret
def shootAtTarget(self):
if self.agent is not None and self.target is not None:
self.agent.turnToFace(self.target.getLocation())
self.agent.shoot()
##################
### ChaseHero
###
### Move to intercept the enemy Hero.
### Parameters:
### 0: node ID string (optional)
class ChaseHero(BTNode):
### target: the hero to chase
### timer: how often to replan
def ParseArgs(self, args):
BTNode.parseArgs(self, args)
self.target = None
self.timer = 50
# First argument is the node ID
if len(args) > 0:
self.id = args[0]
def enter(self):
BTNode.enter(self)
self.timer = 50
enemies = self.agent.world.getEnemyNPCs(self.agent.getTeam())
for e in enemies:
if isinstance(e, Hero):
self.target = e
navTarget = self.chooseNavigationTarget()
if navTarget is not None:
self.agent.navigateTo(navTarget)
return None
def execute(self, delta = 0):
ret = BTNode.execute(self, delta)
if self.target == None or self.target.isAlive() == False:
# fails executability conditions
print "exec", self.id, "false"
return False
elif distance(self.agent.getLocation(), self.target.getLocation()) < BIGBULLETRANGE:
# succeeded
print "exec", self.id, "true"
return True
else:
# executing
self.timer = self.timer - 1
if self.timer <= 0:
navTarget = self.chooseNavigationTarget()
if navTarget is not None:
self.agent.navigateTo(navTarget)
return None
return ret
def chooseNavigationTarget(self):
if self.target is not None:
return self.target.getLocation()
else:
return None
##################
### KillHero
###
### Kill the enemy hero. Assumes it is already in range.
### Parameters:
### 0: node ID string (optional)
class KillHero(BTNode):
### target: the minion to shoot
def ParseArgs(self, args):
BTNode.parseArgs(self, args)
self.target = None
# First argument is the node ID
if len(args) > 0:
self.id = args[0]
def enter(self):
BTNode.enter(self)
self.agent.stopMoving()
enemies = self.agent.world.getEnemyNPCs(self.agent.getTeam())
for e in enemies:
if isinstance(e, Hero):
self.target = e
return None
def execute(self, delta = 0):
ret = BTNode.execute(self, delta)
if self.target == None or distance(self.agent.getLocation(), self.target.getLocation()) > BIGBULLETRANGE:
# failed executability conditions
if self.target == None:
print "foo none"
else:
print "foo dist", distance(self.agent.getLocation(), self.target.getLocation())
print "exec", self.id, "false"
return False
elif self.target.isAlive() == False:
# succeeded
print "exec", self.id, "true"
return True
else:
#executing
self.shootAtTarget()
return None
return ret
def shootAtTarget(self):
if self.agent is not None and self.target is not None:
self.agent.turnToFace(self.target.getLocation())
self.agent.shoot()
##################
### HitpointDaemon
###
### Only execute children if hitpoints are above a certain threshold.
### Parameters:
### 0: percentage of hitpoints that must be remaining to pass the daemon check
### 1: node ID string (optional)
class HitpointDaemon(BTNode):
### percentage: percentage of hitpoints that must be remaining to pass the daemon check
def parseArgs(self, args):
BTNode.parseArgs(self, args)
self.percentage = 0.5
# First argument is the factor
if len(args) > 0:
self.percentage = args[0]
# Second argument is the node ID
if len(args) > 1:
self.id = args[1]
def execute(self, delta = 0):
ret = BTNode.execute(self, delta)
if self.agent.getHitpoints() < self.agent.getMaxHitpoints() * self.percentage:
# Check failed
print "exec", self.id, "fail"
return False
else:
# Check didn't fail, return child's status
return self.getChild(0).execute(delta)
return ret
##################
### BuffDaemon
###
### Only execute children if agent's level is significantly above enemy hero's level.
### Parameters:
### 0: Number of levels above enemy level necessary to not fail the check
### 1: node ID string (optional)
class BuffDaemon(BTNode):
### advantage: Number of levels above enemy level necessary to not fail the check
def parseArgs(self, args):
BTNode.parseArgs(self, args)
self.advantage = 0
# First argument is the advantage
if len(args) > 0:
self.advantage = args[0]
# Second argument is the node ID
if len(args) > 1:
self.id = args[1]
def execute(self, delta = 0):
ret = BTNode.execute(self, delta)
hero = None
# Get a reference to the enemy hero
enemies = self.agent.world.getEnemyNPCs(self.agent.getTeam())
for e in enemies:
if isinstance(e, Hero):
hero = e
break
if hero == None or self.agent.level <= hero.level + self.advantage:
# fail check
print "exec", self.id, "fail"
return False
else:
# Check didn't fail, return child's status
return self.getChild(0).execute(delta)
return ret
#################################
### MY CUSTOM BEHAVIOR CLASSES
| 24.847561 | 128 | 0.664703 | 1,677 | 12,225 | 4.845558 | 0.157424 | 0.046517 | 0.037657 | 0.025843 | 0.738125 | 0.726803 | 0.708467 | 0.680532 | 0.669333 | 0.669333 | 0 | 0.009713 | 0.199918 | 12,225 | 491 | 129 | 24.898167 | 0.821082 | 0.244663 | 0 | 0.837638 | 0 | 0 | 0.019298 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0.02583 | null | null | 0.062731 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
d435f4a9ddd857a2b12240748a5222bad0e3b32a | 82 | py | Python | pykodi/__init__.py | cgtobi/PyKodi | 626e3d0ec0b0ad960d25a6f0bfb6c7fcfa3ea4bf | [
"MIT"
] | 6 | 2020-09-05T07:26:44.000Z | 2022-01-02T03:01:36.000Z | pykodi/__init__.py | cgtobi/PyKodi | 626e3d0ec0b0ad960d25a6f0bfb6c7fcfa3ea4bf | [
"MIT"
] | 7 | 2020-08-29T02:54:35.000Z | 2021-09-12T18:23:08.000Z | pykodi/__init__.py | cgtobi/PyKodi | 626e3d0ec0b0ad960d25a6f0bfb6c7fcfa3ea4bf | [
"MIT"
] | 5 | 2020-08-28T09:56:28.000Z | 2021-10-02T19:13:50.000Z | from .kodi import get_kodi_connection, Kodi, CannotConnectError, InvalidAuthError
| 41 | 81 | 0.865854 | 9 | 82 | 7.666667 | 0.777778 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.085366 | 82 | 1 | 82 | 82 | 0.92 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
d45b37e02cf02a1791f26a0d796667f668461705 | 5,157 | py | Python | query_builder.py | MattWellie/PAGE_MPO | 55296a55c8606e877673d6398ec31db472ec8a04 | [
"Apache-2.0"
] | 1 | 2016-04-12T08:18:22.000Z | 2016-04-12T08:18:22.000Z | query_builder.py | MattWellie/PAGE_MPO | 55296a55c8606e877673d6398ec31db472ec8a04 | [
"Apache-2.0"
] | null | null | null | query_builder.py | MattWellie/PAGE_MPO | 55296a55c8606e877673d6398ec31db472ec8a04 | [
"Apache-2.0"
] | null | null | null | # Script to build queries based on results from variants passing filters
in_file = 'summary.txt'
template = 'zgrep {} /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/{}/{}/{}/vcf/{}.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep {}'
with open(in_file, 'r') as handle:
for line in handle:
list = line.split('\t')
if list[0] = 'proband': continue
else:
PP = list[0]
pp1 = PP[:2]
pp2 = PP[2:]
pos = list[4]
gene = list[5]
print template.format(gene, pp1, pp2, PP, PP, pos)
"""
Results are:
zgrep LAMA5 /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/00/04/PP0004/vcf/PP0004.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 60886088
zgrep LAMA5 /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/00/04/PP0004/vcf/PP0004.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 60892813
zgrep ATP6V1B2 /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/00/25/PP0025/vcf/PP0025.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 20069263
zgrep AGAP1 /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/00/65/PP0065/vcf/PP0065.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 236839424
zgrep DNAJC16 /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/02/67/PP0267/vcf/PP0267.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 15894604
zgrep CLSPN /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/02/67/PP0267/vcf/PP0267.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 36216977
zgrep DHX33 /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/02/67/PP0267/vcf/PP0267.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 5365725
zgrep SCN4A /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/03/15/PP0315/vcf/PP0315.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 62022122
zgrep KIF26B /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/02/73/PP0273/vcf/PP0273.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 245766015
zgrep KIF26B /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/02/73/PP0273/vcf/PP0273.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 245851740
zgrep RP11-445F12.2,RNA5SP439,SYNRG,C17orf78,CTC-268N12.3,RP11-445F12.1,CTD-3194G12.1,CTD-3194G12.2,LHX1,DDX52,TADA2A,RP11-378E13.4,HNF1B,HMGB1P24,RP11-697E22.1,RP11-697E22.3,RP11-697E22.2,CTC-421K24.1,CTB-75G16.1,ZNHIT3,MRM1,ACACA,CTB-75G16.3,MIR2909,DHRS11,YWHAEP7,RP11-378E13.3,CTC-268N12.2,PIGW,DUSP14,RP11-333J10.2,RP11-333J10.3,RP11-19G24.2,RP11-19G24.1,AATF,MYO19,AC091199.1,RP11-115K3.1,GGNBP2 /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/02/70/PP0270/vcf/PP0270.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 34842342
zgrep RP11-445F12.2,RNA5SP439,SYNRG,C17orf78,CTC-268N12.3,RP11-445F12.1,CTD-3194G12.1,CTD-3194G12.2,LHX1,DDX52,TADA2A,RP11-378E13.4,HNF1B,HMGB1P24,RP11-697E22.1,RP11-697E22.3,RP11-697E22.2,CTC-421K24.1,CTB-75G16.1,ZNHIT3,MRM1,ACACA,CTB-75G16.3,MIR2909,DHRS11,YWHAEP7,RP11-378E13.3,CTC-268N12.2,PIGW,DUSP14,RP11-333J10.2,RP11-333J10.3,RP11-19G24.2,RP11-19G24.1,AATF,MYO19,AC091199.1,RP11-115K3.1,GGNBP2 /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/02/70/PP0270/vcf/PP0270.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 34842342
zgrep TSSK1A,LINC00896,CRKL,KRT18P62,DGCR9,DGCR8,SLC9A3P2,BCRP5,RNU6-225P,XXbac-B444P24.14,TMEM191A,DGCR5,XXbac-B444P24.13,XXbac-B444P24.10,DGCR6,XXbac-B135H6.18,AC000067.1,RTN4R,XXbac-B135H6.15,GSC2,Y_RNA,SLC25A1,AC007731.1,MIR1286,SNAP29,AC006547.13,SMPD4P1,MRPL40,LZTR1,SLC7A4,MIR3618,AC000078.5,TANGO2,AC000081.2,SEPT5,CA15P1,CA15P2,AC002472.1,RNY1P9,POM121L4P,AC007050.18,USP41,AC000095.9,XXbac-B33L19.10,DGCR6L,ZNF74,AC007050.1,AC006547.14,AC006547.15,TXNRD2,CLDN5,GGTLC3,AC004471.10,AC000068.10,MIR4761,CDC45,RN7SL168P,SNORA77,MIR1306,SERPIND1,ZDHHC8,PRODH,C22orf29,TUBA3FP,AIFM3,ABHD17AP4,DGCR2,PI4KA,AC007326.9,KRT18P5,TBX1,FAM230A,P2RX6P,AC000077.2,RN7SL812P,XXbac-B33L19.4,XXbac-B33L19.6,XXbac-B33L19.3,GP1BB,AC007308.6,AC007308.7,C22orf39,RANBP1,PI4KAP1,TSSK2,ARVCF,MIR185,AC007050.17,COMT,AC004461.4,AC011718.2,AC011718.3,AC011718.1,SCARF2,HIRA,AC023490.1,AC023490.2,SCARNA17,AC002472.11,AC006547.8,AC002472.13,SCARNA18,RN7SL389P,GNB1L,AC000068.9,TRMT2A,RN7SKP131,AC000068.5,KLHL22,RIMBP3,SNORA15,AC004463.6,MED15,P2RX6,AC004471.9,snoU13,MIR649,CLTCL1,XXbac-B444P24.8,THAP7-AS1,XXbac-B562F10.11,THAP7,AC000089.3,DGCR11,DGCR10,DGCR14,PPP1R26P2,PPP1R26P3,UFD1L /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/02/25/PP0225/vcf/PP0225.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 18893860
zgrep CHRNA1 /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/03/03/PP0303/vcf/PP0303.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 175614789
zgrep CHRNA1 /lustre/scratch115/realdata/mdt3/projects/pagedata/data_freezes/2015-09-03/PP/03/03/PP0303/vcf/PP0303.uber_vep_tabix_qc.2015-11-11.vcf.gz | grep 175619069
"""
| 135.710526 | 1,329 | 0.780299 | 876 | 5,157 | 4.517123 | 0.295662 | 0.064695 | 0.097043 | 0.113217 | 0.627748 | 0.627748 | 0.627748 | 0.627748 | 0.627748 | 0.627748 | 0 | 0.305226 | 0.068645 | 5,157 | 38 | 1,330 | 135.710526 | 0.518634 | 0.013574 | 0 | 0 | 0 | 0.076923 | 0.305054 | 0.232852 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0 | null | null | 0.076923 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
d4607c90fb8ba57aec697a1345e7065e545e7f18 | 550 | py | Python | src/raw/hm_generation/test_level_curves.py | Leikt/map_generator | 86c6359ed84056f32642cb7e23db855beba62923 | [
"MIT"
] | 1 | 2021-06-09T10:02:04.000Z | 2021-06-09T10:02:04.000Z | src/raw/hm_generation/test_level_curves.py | Leikt/map_generator | 86c6359ed84056f32642cb7e23db855beba62923 | [
"MIT"
] | null | null | null | src/raw/hm_generation/test_level_curves.py | Leikt/map_generator | 86c6359ed84056f32642cb7e23db855beba62923 | [
"MIT"
] | null | null | null | #! /usr/bin/env python3
# coding: utf-8
import logging
import random
import numpy as np
from src.helpers.chrono import chrono
DATA = [
[3,1,1,1,1,1,1,1,1,1],
[1,1,1,1,1,1,1,1,1,1],
[1,1,1,1,1,1,1,1,1,1],
[1,1,1,1,1,1,1,1,1,1],
[1,1,1,1,1,1,1,1,1,1],
[1,1,1,1,1,1,1,1,1,1],
[1,1,1,1,1,3,1,1,1,1],
[1,1,1,1,1,1,1,1,1,1],
[1,1,1,1,1,1,1,1,1,1],
[1,1,1,1,1,1,1,1,1,4],
]
@chrono
def generate(parameters: object, width: int, height: int, seed: int) -> object:
heightmap = np.array(DATA)
return heightmap | 21.153846 | 79 | 0.545455 | 140 | 550 | 2.142857 | 0.228571 | 0.633333 | 0.93 | 1.213333 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0.33 | 0 | 0.226667 | 0.181818 | 550 | 26 | 80 | 21.153846 | 0.44 | 0.065455 | 0 | 0.35 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.05 | false | 0 | 0.2 | 0 | 0.3 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
d4658050abdee14c93f40b2c001c101d467a8da9 | 80 | py | Python | MHD/FEniCS/MyPackage/PackageName/Assemble/__init__.py | wathen/PhD | 35524f40028541a4d611d8c78574e4cf9ddc3278 | [
"MIT"
] | 3 | 2020-10-25T13:30:20.000Z | 2021-08-10T21:27:30.000Z | MHD/FEniCS/MyPackage/PackageName/Assemble/__init__.py | wathen/PhD | 35524f40028541a4d611d8c78574e4cf9ddc3278 | [
"MIT"
] | null | null | null | MHD/FEniCS/MyPackage/PackageName/Assemble/__init__.py | wathen/PhD | 35524f40028541a4d611d8c78574e4cf9ddc3278 | [
"MIT"
] | 3 | 2019-10-28T16:12:13.000Z | 2020-01-13T13:59:44.000Z | from SystemAssemble import *
from InitialGuess import *
from NonLinTol import *
| 20 | 28 | 0.8125 | 9 | 80 | 7.222222 | 0.555556 | 0.307692 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.15 | 80 | 3 | 29 | 26.666667 | 0.955882 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
d4796ffbe1ec1b769e170295a176fd57dadaa4e4 | 57 | py | Python | intro/a-hello.py | jwrr/python-stuff | 7be2a408b751fe6636537d478296350256e2f133 | [
"MIT"
] | null | null | null | intro/a-hello.py | jwrr/python-stuff | 7be2a408b751fe6636537d478296350256e2f133 | [
"MIT"
] | null | null | null | intro/a-hello.py | jwrr/python-stuff | 7be2a408b751fe6636537d478296350256e2f133 | [
"MIT"
] | null | null | null | #!/usr/bin/python3
import sys
print('Hello, World!')
| 7.125 | 22 | 0.649123 | 8 | 57 | 4.625 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.020833 | 0.157895 | 57 | 7 | 23 | 8.142857 | 0.75 | 0.298246 | 0 | 0 | 0 | 0 | 0.351351 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 0.5 | 0.5 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 0 | 5 |
2e0557b2f3ec02f66e7f5b1df03aae704994c4b9 | 158 | py | Python | 503-Triggering-Lambda-Functions-on-a-Schedule/lambda_function.py | AWSCookbook/Serverless | ad39607b2901774b99056505e0ed03386c10ef7e | [
"MIT"
] | 5 | 2021-12-16T19:21:12.000Z | 2022-02-10T02:23:16.000Z | 503-Triggering-Lambda-Functions-on-a-Schedule/lambda_function.py | AWSCookbook/Serverless | ad39607b2901774b99056505e0ed03386c10ef7e | [
"MIT"
] | null | null | null | 503-Triggering-Lambda-Functions-on-a-Schedule/lambda_function.py | AWSCookbook/Serverless | ad39607b2901774b99056505e0ed03386c10ef7e | [
"MIT"
] | 4 | 2021-11-25T13:42:24.000Z | 2022-02-25T06:53:11.000Z | import os
from datetime import datetime
def lambda_handler(event, context):
print('AWS Cookbook Lambda function run at {}'.format(str(datetime.now())))
| 22.571429 | 79 | 0.746835 | 22 | 158 | 5.318182 | 0.818182 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.139241 | 158 | 6 | 80 | 26.333333 | 0.860294 | 0 | 0 | 0 | 0 | 0 | 0.240506 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0.5 | 0 | 0.75 | 0.25 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
2e5499770c3dccc0537f2ea2f2a637787686ec42 | 271 | py | Python | tests/roots/test-ext-autodoc/target/docstring_signature.py | hatchermarie2/sphinx | 204564549cae0d2fc88ea270df8dde0535277a70 | [
"BSD-2-Clause"
] | 1 | 2020-12-03T18:37:30.000Z | 2020-12-03T18:37:30.000Z | tests/roots/test-ext-autodoc/target/docstring_signature.py | hatchermarie2/sphinx | 204564549cae0d2fc88ea270df8dde0535277a70 | [
"BSD-2-Clause"
] | 4 | 2019-11-05T16:18:23.000Z | 2022-03-02T11:13:20.000Z | tests/roots/test-ext-autodoc/target/docstring_signature.py | hatchermarie2/sphinx | 204564549cae0d2fc88ea270df8dde0535277a70 | [
"BSD-2-Clause"
] | 1 | 2019-11-05T15:21:55.000Z | 2019-11-05T15:21:55.000Z | class A:
"""A(foo, bar)"""
class B:
"""B(foo, bar)"""
def __init__(self):
"""B(foo, bar, baz)"""
class C:
"""C(foo, bar)"""
def __new__(cls):
"""C(foo, bar, baz)"""
class D:
def __init__(self):
"""D(foo, bar, baz)"""
| 13.55 | 30 | 0.435424 | 38 | 271 | 2.789474 | 0.342105 | 0.339623 | 0.254717 | 0.264151 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.306273 | 271 | 19 | 31 | 14.263158 | 0.56383 | 0.317343 | 0 | 0.285714 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.428571 | false | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 5 |
2e6370380e1bc57baba6d277f231ee16c4dc7578 | 101 | py | Python | ufora/FORA/python/PurePython/testModules/import_example/B.py | ufora/ufora | 04db96ab049b8499d6d6526445f4f9857f1b6c7e | [
"Apache-2.0",
"CC0-1.0",
"MIT",
"BSL-1.0",
"BSD-3-Clause"
] | 571 | 2015-11-05T20:07:07.000Z | 2022-01-24T22:31:09.000Z | ufora/FORA/python/PurePython/testModules/import_example/B.py | timgates42/ufora | 04db96ab049b8499d6d6526445f4f9857f1b6c7e | [
"Apache-2.0",
"CC0-1.0",
"MIT",
"BSL-1.0",
"BSD-3-Clause"
] | 218 | 2015-11-05T20:37:55.000Z | 2021-05-30T03:53:50.000Z | ufora/FORA/python/PurePython/testModules/import_example/B.py | timgates42/ufora | 04db96ab049b8499d6d6526445f4f9857f1b6c7e | [
"Apache-2.0",
"CC0-1.0",
"MIT",
"BSL-1.0",
"BSD-3-Clause"
] | 40 | 2015-11-07T21:42:19.000Z | 2021-05-23T03:48:19.000Z | import ufora.FORA.python.PurePython.testModules.import_example.A as A
def f(x):
return A.C.g(x)
| 20.2 | 69 | 0.742574 | 19 | 101 | 3.894737 | 0.789474 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.128713 | 101 | 4 | 70 | 25.25 | 0.840909 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.333333 | false | 0 | 0.333333 | 0.333333 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 5 |
5cf53c5f1d898d236ac6edb281000a1a27e35aa8 | 80 | py | Python | tf_label.py | yashpatel5400/dl-playground | acf71dab5bb29b253bb28b966115d72d18b76a8e | [
"MIT"
] | null | null | null | tf_label.py | yashpatel5400/dl-playground | acf71dab5bb29b253bb28b966115d72d18b76a8e | [
"MIT"
] | null | null | null | tf_label.py | yashpatel5400/dl-playground | acf71dab5bb29b253bb28b966115d72d18b76a8e | [
"MIT"
] | 1 | 2018-01-15T03:56:22.000Z | 2018-01-15T03:56:22.000Z | """
classic labelling of images done in Tensorflow
"""
import tensorflow as tf
| 13.333333 | 46 | 0.75 | 11 | 80 | 5.454545 | 0.909091 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.175 | 80 | 5 | 47 | 16 | 0.909091 | 0.575 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
5cfc17aba7028bfa1f434dc21ee1e679bee882bb | 36 | py | Python | tests/__init__.py | robotics-4-all/goalee | a50185b51ccc28caf1f5dd3ba8603a35b8f0eebb | [
"MIT"
] | null | null | null | tests/__init__.py | robotics-4-all/goalee | a50185b51ccc28caf1f5dd3ba8603a35b8f0eebb | [
"MIT"
] | null | null | null | tests/__init__.py | robotics-4-all/goalee | a50185b51ccc28caf1f5dd3ba8603a35b8f0eebb | [
"MIT"
] | null | null | null | """Unit test package for goalee."""
| 18 | 35 | 0.666667 | 5 | 36 | 4.8 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.138889 | 36 | 1 | 36 | 36 | 0.774194 | 0.805556 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
cf108751f2e11fe6a71c4313621abdabe48c7803 | 1,096 | py | Python | Lib/graph/AxisDisplay.py | jeamick/ares-visual | 3cf5068f874b3f6fe898968b2a7efa86fadca99d | [
"MIT"
] | null | null | null | Lib/graph/AxisDisplay.py | jeamick/ares-visual | 3cf5068f874b3f6fe898968b2a7efa86fadca99d | [
"MIT"
] | 2 | 2019-03-27T00:36:09.000Z | 2019-04-09T00:39:12.000Z | Lib/graph/AxisDisplay.py | jeamick/ares-visual | 3cf5068f874b3f6fe898968b2a7efa86fadca99d | [
"MIT"
] | null | null | null | #!/usr/bin/env python
# -*- coding: utf-8 -*-
# author: Olivier Noguès
DISPLAYS = {'TIMESTAMP': {'tickFormat': "function(d) { return d3.time.format('%%x')(new Date(d)) }"},
'FLOAT': {'tickFormat': "function(d) { return d3.format(',.%(digits)sf')(d) }"},
'K': {'tickFormat': "function(d) { return d3.format(',.%(digits)sf')(d / 1000) + 'K' }", 'labelString': '1K = 1000'},
'M': {'tickFormat': "function(d) { return d3.format(',.%(digits)sf')(d / 1000000) + 'Mio'}", 'labelString': '1Mio = 1000000'},
'G': {'tickFormat': "function(d) { return d3.format(',.%(digits)sf')(d / 1000000000) + 'G'}", 'labelString': '1G = 1000000000'},
'%': {'tickFormat': "function(d) { return d3.format(',.%(digits)s%')(d) }"},
'INT': {'tickFormat': "function(d) { return d3.format(',')(d) }"},
'MONTH': {'tickValues': "[0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12]",
'tickFormat': 'function(d){ return months[d] }'},
'DAYS': {'tickValues': "[0, 1, 2, 3, 4, 5, 6]",
'tickFormat': 'function(d){ return months[d] }'},
} | 68.5 | 136 | 0.515511 | 131 | 1,096 | 4.312977 | 0.412214 | 0.286726 | 0.302655 | 0.39823 | 0.646018 | 0.59823 | 0.426549 | 0.357522 | 0.297345 | 0 | 0 | 0.087156 | 0.20438 | 1,096 | 16 | 137 | 68.5 | 0.56078 | 0.059307 | 0 | 0.166667 | 0 | 0.333333 | 0.730769 | 0.164694 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
cf15a5a884a752757087e12b7d4a7552aa38a5be | 98 | py | Python | modules/__init__.py | sungyihsun/meta-transfer-learning | b96dfdfcdcdbdc553139b5abe42cf045e33e1f57 | [
"MIT"
] | null | null | null | modules/__init__.py | sungyihsun/meta-transfer-learning | b96dfdfcdcdbdc553139b5abe42cf045e33e1f57 | [
"MIT"
] | null | null | null | modules/__init__.py | sungyihsun/meta-transfer-learning | b96dfdfcdcdbdc553139b5abe42cf045e33e1f57 | [
"MIT"
] | null | null | null | from .encoder import Encoder
from .decoder import Decoder
from .discriminator import Discriminator | 32.666667 | 40 | 0.857143 | 12 | 98 | 7 | 0.416667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.112245 | 98 | 3 | 40 | 32.666667 | 0.965517 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
cf5044ba0032e131c908b1d912fc172c3e766fe1 | 3,225 | py | Python | python/printcolors.py | liweitianux/atoolbox | 88d85c80d025e0fd6b7c8fad155dc3a1cdc8b992 | [
"MIT"
] | 4 | 2016-05-28T02:14:39.000Z | 2019-07-10T06:58:33.000Z | python/printcolors.py | liweitianux/atoolbox | 88d85c80d025e0fd6b7c8fad155dc3a1cdc8b992 | [
"MIT"
] | 1 | 2020-06-15T04:06:40.000Z | 2020-06-15T04:06:40.000Z | python/printcolors.py | liweitianux/atoolbox | 88d85c80d025e0fd6b7c8fad155dc3a1cdc8b992 | [
"MIT"
] | 3 | 2018-11-27T12:34:35.000Z | 2020-08-20T01:03:48.000Z | #!/usr/bin/env python3
# Credit: https://www.geeksforgeeks.org/print-colors-python-terminal/
class colors:
reset = '\033[0m'
bold = '\033[01m'
disable = '\033[02m'
underline = '\033[04m'
reverse = '\033[07m'
strikethrough = '\033[09m'
invisible = '\033[08m'
class fg:
black = '\033[30m'
red = '\033[31m'
green = '\033[32m'
orange = '\033[33m'
blue = '\033[34m'
purple = '\033[35m'
cyan = '\033[36m'
lightgray = '\033[37m'
darkgray = '\033[90m'
lightred = '\033[91m'
lightgreen = '\033[92m'
yellow = '\033[93m'
lightblue = '\033[94m'
pink = '\033[95m'
lightcyan = '\033[96m'
class bg:
black = '\033[40m'
red = '\033[41m'
green = '\033[42m'
orange = '\033[43m'
blue = '\033[44m'
purple = '\033[45m'
cyan = '\033[46m'
lightgray = '\033[47m'
if __name__ == '__main__':
C = colors
text = 'hello world'
print(f'{text}')
print(f'{C.fg.red}{text}{C.reset}')
print(f'{C.fg.green}{text}{C.reset}')
print(f'{C.fg.orange}{text}{C.reset}')
print(f'{C.fg.blue}{text}{C.reset}')
print(f'{C.fg.purple}{text}{C.reset}')
print(f'{C.fg.cyan}{text}{C.reset}')
print(f'{C.fg.lightgray}{text}{C.reset}')
print(f'{C.fg.darkgray}{text}{C.reset}')
print(f'{C.fg.lightred}{text}{C.reset}')
print(f'{C.fg.lightgreen}{text}{C.reset}')
print(f'{C.fg.yellow}{text}{C.reset}')
print(f'{C.fg.lightblue}{text}{C.reset}')
print(f'{C.fg.pink}{text}{C.reset}')
print(f'{C.fg.lightcyan}{text}{C.reset}')
print(f'{C.bold}{text}{C.reset}')
print(f'{C.bold}{C.fg.red}{text}{C.reset}')
print(f'{C.bold}{C.fg.green}{text}{C.reset}')
print(f'{C.bold}{C.fg.orange}{text}{C.reset}')
print(f'{C.bold}{C.fg.blue}{text}{C.reset}')
print(f'{C.bold}{C.fg.purple}{text}{C.reset}')
print(f'{C.bold}{C.fg.cyan}{text}{C.reset}')
print(f'{C.bold}{C.fg.lightgray}{text}{C.reset}')
print(f'{C.bold}{C.fg.darkgray}{text}{C.reset}')
print(f'{C.bold}{C.fg.lightred}{text}{C.reset}')
print(f'{C.bold}{C.fg.lightgreen}{text}{C.reset}')
print(f'{C.bold}{C.fg.yellow}{text}{C.reset}')
print(f'{C.bold}{C.fg.lightblue}{text}{C.reset}')
print(f'{C.bold}{C.fg.pink}{text}{C.reset}')
print(f'{C.bold}{C.fg.lightcyan}{text}{C.reset}')
print(f'{C.reverse}{text}{C.reset}')
print(f'{C.reverse}{C.fg.red}{text}{C.reset}')
print(f'{C.reverse}{C.fg.green}{text}{C.reset}')
print(f'{C.reverse}{C.fg.orange}{text}{C.reset}')
print(f'{C.reverse}{C.fg.blue}{text}{C.reset}')
print(f'{C.reverse}{C.fg.purple}{text}{C.reset}')
print(f'{C.reverse}{C.fg.cyan}{text}{C.reset}')
print(f'{C.reverse}{C.fg.lightgray}{text}{C.reset}')
print(f'{C.reverse}{C.fg.darkgray}{text}{C.reset}')
print(f'{C.reverse}{C.fg.lightred}{text}{C.reset}')
print(f'{C.reverse}{C.fg.lightgreen}{text}{C.reset}')
print(f'{C.reverse}{C.fg.yellow}{text}{C.reset}')
print(f'{C.reverse}{C.fg.lightblue}{text}{C.reset}')
print(f'{C.reverse}{C.fg.pink}{text}{C.reset}')
print(f'{C.reverse}{C.fg.lightcyan}{text}{C.reset}')
| 35.43956 | 69 | 0.562481 | 526 | 3,225 | 3.43346 | 0.146388 | 0.149502 | 0.170543 | 0.357143 | 0.715393 | 0.715393 | 0.704873 | 0.698782 | 0.698782 | 0 | 0 | 0.05654 | 0.177364 | 3,225 | 90 | 70 | 35.833333 | 0.624199 | 0.027597 | 0 | 0 | 0 | 0 | 0.566688 | 0.482451 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0.123457 | 0.555556 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
d8a3a74fad16fec47235a9d823f25cc5971f4c22 | 151 | py | Python | E2_6/MoreAsciiiArt.py | AidaNajafi/AidaNajafi.github.io | a5d86dc67a1d272794586e0a5c612a3893b75e69 | [
"Apache-2.0"
] | null | null | null | E2_6/MoreAsciiiArt.py | AidaNajafi/AidaNajafi.github.io | a5d86dc67a1d272794586e0a5c612a3893b75e69 | [
"Apache-2.0"
] | null | null | null | E2_6/MoreAsciiiArt.py | AidaNajafi/AidaNajafi.github.io | a5d86dc67a1d272794586e0a5c612a3893b75e69 | [
"Apache-2.0"
] | null | null | null | def print_left_triangle(n):
for i in range(n):
print("%"*i)
for j in range(i+1):
print("*"*j)
print_left_triangle(4)
| 16.777778 | 28 | 0.529801 | 24 | 151 | 3.166667 | 0.5 | 0.236842 | 0.447368 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.019231 | 0.311258 | 151 | 8 | 29 | 18.875 | 0.711538 | 0 | 0 | 0 | 0 | 0 | 0.013245 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.166667 | false | 0 | 0 | 0 | 0.166667 | 0.666667 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
d8c58bfa7fdd8b3334e66d386359e8af67f5a8ee | 27,479 | py | Python | spark_fhir_schemas/stu3/complex_types/plandefinition_action.py | icanbwell/SparkFhirSchemas | 8c828313c39850b65f8676e67f526ee92b7d624e | [
"Apache-2.0"
] | 2 | 2020-10-31T23:25:01.000Z | 2021-06-09T14:12:42.000Z | spark_fhir_schemas/stu3/complex_types/plandefinition_action.py | icanbwell/SparkFhirSchemas | 8c828313c39850b65f8676e67f526ee92b7d624e | [
"Apache-2.0"
] | null | null | null | spark_fhir_schemas/stu3/complex_types/plandefinition_action.py | icanbwell/SparkFhirSchemas | 8c828313c39850b65f8676e67f526ee92b7d624e | [
"Apache-2.0"
] | null | null | null | from typing import Union, List, Optional
from pyspark.sql.types import (
StructType,
StructField,
StringType,
ArrayType,
DataType,
TimestampType,
)
# This file is auto-generated by generate_schema so do not edit manually
# noinspection PyPep8Naming
class PlanDefinition_ActionSchema:
"""
This resource allows for the definition of various types of plans as a
sharable, consumable, and executable artifact. The resource is general enough
to support the description of a broad range of clinical artifacts such as
clinical decision support rules, order sets and protocols.
"""
# noinspection PyDefaultArgument
@staticmethod
def get_schema(
max_nesting_depth: Optional[int] = 6,
nesting_depth: int = 0,
nesting_list: List[str] = [],
max_recursion_limit: Optional[int] = 2,
include_extension: Optional[bool] = False,
extension_fields: Optional[List[str]] = [
"valueBoolean",
"valueCode",
"valueDate",
"valueDateTime",
"valueDecimal",
"valueId",
"valueInteger",
"valuePositiveInt",
"valueString",
"valueTime",
"valueUnsignedInt",
"valueUri",
"valueQuantity",
],
extension_depth: int = 0,
max_extension_depth: Optional[int] = 2,
) -> Union[StructType, DataType]:
"""
This resource allows for the definition of various types of plans as a
sharable, consumable, and executable artifact. The resource is general enough
to support the description of a broad range of clinical artifacts such as
clinical decision support rules, order sets and protocols.
id: unique id for the element within a resource (for internal references). This
may be any string value that does not contain spaces.
extension: May be used to represent additional information that is not part of the basic
definition of the element. In order to make the use of extensions safe and
manageable, there is a strict set of governance applied to the definition and
use of extensions. Though any implementer is allowed to define an extension,
there is a set of requirements that SHALL be met as part of the definition of
the extension.
label: A user-visible label for the action.
title: The title of the action displayed to a user.
description: A short description of the action used to provide a summary to display to the
user.
textEquivalent: A text equivalent of the action to be performed. This provides a human-
interpretable description of the action when the definition is consumed by a
system that may not be capable of interpreting it dynamically.
code: A code that provides meaning for the action or action group. For example, a
section may have a LOINC code for a the section of a documentation template.
reason: A description of why this action is necessary or appropriate.
documentation: Didactic or other informational resources associated with the action that can
be provided to the CDS recipient. Information resources can include inline
text commentary and links to web resources.
goalId: Identifies goals that this action supports. The reference must be to a goal
element defined within this plan definition.
triggerDefinition: A description of when the action should be triggered.
condition: An expression that describes applicability criteria, or start/stop conditions
for the action.
input: Defines input data requirements for the action.
output: Defines the outputs of the action, if any.
relatedAction: A relationship to another action such as "before" or "30-60 minutes after
start of".
timingDateTime: An optional value describing when the action should be performed.
timingPeriod: An optional value describing when the action should be performed.
timingDuration: An optional value describing when the action should be performed.
timingRange: An optional value describing when the action should be performed.
timingTiming: An optional value describing when the action should be performed.
participant: Indicates who should participate in performing the action described.
type: The type of action to perform (create, update, remove).
groupingBehavior: Defines the grouping behavior for the action and its children.
selectionBehavior: Defines the selection behavior for the action and its children.
requiredBehavior: Defines the requiredness behavior for the action.
precheckBehavior: Defines whether the action should usually be preselected.
cardinalityBehavior: Defines whether the action can be selected multiple times.
definition: A reference to an ActivityDefinition that describes the action to be taken in
detail, or a PlanDefinition that describes a series of actions to be taken.
transform: A reference to a StructureMap resource that defines a transform that can be
executed to produce the intent resource using the ActivityDefinition instance
as the input.
dynamicValue: Customizations that should be applied to the statically defined resource. For
example, if the dosage of a medication must be computed based on the patient's
weight, a customization would be used to specify an expression that calculated
the weight, and the path on the resource that would contain the result.
action: Sub actions that are contained within the action. The behavior of this action
determines the functionality of the sub-actions. For example, a selection
behavior of at-most-one indicates that of the sub-actions, at most one may be
chosen as part of realizing the action definition.
"""
from spark_fhir_schemas.stu3.complex_types.extension import ExtensionSchema
from spark_fhir_schemas.stu3.complex_types.codeableconcept import (
CodeableConceptSchema,
)
from spark_fhir_schemas.stu3.complex_types.relatedartifact import (
RelatedArtifactSchema,
)
from spark_fhir_schemas.stu3.complex_types.triggerdefinition import (
TriggerDefinitionSchema,
)
from spark_fhir_schemas.stu3.complex_types.plandefinition_condition import (
PlanDefinition_ConditionSchema,
)
from spark_fhir_schemas.stu3.complex_types.datarequirement import (
DataRequirementSchema,
)
from spark_fhir_schemas.stu3.complex_types.plandefinition_relatedaction import (
PlanDefinition_RelatedActionSchema,
)
from spark_fhir_schemas.stu3.complex_types.period import PeriodSchema
from spark_fhir_schemas.stu3.complex_types.duration import DurationSchema
from spark_fhir_schemas.stu3.complex_types.range import RangeSchema
from spark_fhir_schemas.stu3.complex_types.timing import TimingSchema
from spark_fhir_schemas.stu3.complex_types.plandefinition_participant import (
PlanDefinition_ParticipantSchema,
)
from spark_fhir_schemas.stu3.complex_types.coding import CodingSchema
from spark_fhir_schemas.stu3.complex_types.reference import ReferenceSchema
from spark_fhir_schemas.stu3.complex_types.plandefinition_dynamicvalue import (
PlanDefinition_DynamicValueSchema,
)
if (
max_recursion_limit
and nesting_list.count("PlanDefinition_Action") >= max_recursion_limit
) or (max_nesting_depth and nesting_depth >= max_nesting_depth):
return StructType([StructField("id", StringType(), True)])
# add my name to recursion list for later
my_nesting_list: List[str] = nesting_list + ["PlanDefinition_Action"]
schema = StructType(
[
# unique id for the element within a resource (for internal references). This
# may be any string value that does not contain spaces.
StructField("id", StringType(), True),
# May be used to represent additional information that is not part of the basic
# definition of the element. In order to make the use of extensions safe and
# manageable, there is a strict set of governance applied to the definition and
# use of extensions. Though any implementer is allowed to define an extension,
# there is a set of requirements that SHALL be met as part of the definition of
# the extension.
StructField(
"extension",
ArrayType(
ExtensionSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth,
max_extension_depth=max_extension_depth,
)
),
True,
),
# A user-visible label for the action.
StructField("label", StringType(), True),
# The title of the action displayed to a user.
StructField("title", StringType(), True),
# A short description of the action used to provide a summary to display to the
# user.
StructField("description", StringType(), True),
# A text equivalent of the action to be performed. This provides a human-
# interpretable description of the action when the definition is consumed by a
# system that may not be capable of interpreting it dynamically.
StructField("textEquivalent", StringType(), True),
# A code that provides meaning for the action or action group. For example, a
# section may have a LOINC code for a the section of a documentation template.
StructField(
"code",
ArrayType(
CodeableConceptSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth,
max_extension_depth=max_extension_depth,
)
),
True,
),
# A description of why this action is necessary or appropriate.
StructField(
"reason",
ArrayType(
CodeableConceptSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth,
max_extension_depth=max_extension_depth,
)
),
True,
),
# Didactic or other informational resources associated with the action that can
# be provided to the CDS recipient. Information resources can include inline
# text commentary and links to web resources.
StructField(
"documentation",
ArrayType(
RelatedArtifactSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth,
max_extension_depth=max_extension_depth,
)
),
True,
),
# Identifies goals that this action supports. The reference must be to a goal
# element defined within this plan definition.
StructField("goalId", ArrayType(StringType()), True),
# A description of when the action should be triggered.
StructField(
"triggerDefinition",
ArrayType(
TriggerDefinitionSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth,
max_extension_depth=max_extension_depth,
)
),
True,
),
# An expression that describes applicability criteria, or start/stop conditions
# for the action.
StructField(
"condition",
ArrayType(
PlanDefinition_ConditionSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth,
max_extension_depth=max_extension_depth,
)
),
True,
),
# Defines input data requirements for the action.
StructField(
"input",
ArrayType(
DataRequirementSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth,
max_extension_depth=max_extension_depth,
)
),
True,
),
# Defines the outputs of the action, if any.
StructField(
"output",
ArrayType(
DataRequirementSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth,
max_extension_depth=max_extension_depth,
)
),
True,
),
# A relationship to another action such as "before" or "30-60 minutes after
# start of".
StructField(
"relatedAction",
ArrayType(
PlanDefinition_RelatedActionSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth,
max_extension_depth=max_extension_depth,
)
),
True,
),
# An optional value describing when the action should be performed.
StructField("timingDateTime", TimestampType(), True),
# An optional value describing when the action should be performed.
StructField(
"timingPeriod",
PeriodSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth + 1,
max_extension_depth=max_extension_depth,
),
True,
),
# An optional value describing when the action should be performed.
StructField(
"timingDuration",
DurationSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth + 1,
max_extension_depth=max_extension_depth,
),
True,
),
# An optional value describing when the action should be performed.
StructField(
"timingRange",
RangeSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth + 1,
max_extension_depth=max_extension_depth,
),
True,
),
# An optional value describing when the action should be performed.
StructField(
"timingTiming",
TimingSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth + 1,
max_extension_depth=max_extension_depth,
),
True,
),
# Indicates who should participate in performing the action described.
StructField(
"participant",
ArrayType(
PlanDefinition_ParticipantSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth,
max_extension_depth=max_extension_depth,
)
),
True,
),
# The type of action to perform (create, update, remove).
StructField(
"type",
CodingSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth + 1,
max_extension_depth=max_extension_depth,
),
True,
),
# Defines the grouping behavior for the action and its children.
StructField("groupingBehavior", StringType(), True),
# Defines the selection behavior for the action and its children.
StructField("selectionBehavior", StringType(), True),
# Defines the requiredness behavior for the action.
StructField("requiredBehavior", StringType(), True),
# Defines whether the action should usually be preselected.
StructField("precheckBehavior", StringType(), True),
# Defines whether the action can be selected multiple times.
StructField("cardinalityBehavior", StringType(), True),
# A reference to an ActivityDefinition that describes the action to be taken in
# detail, or a PlanDefinition that describes a series of actions to be taken.
StructField(
"definition",
ReferenceSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth + 1,
max_extension_depth=max_extension_depth,
),
True,
),
# A reference to a StructureMap resource that defines a transform that can be
# executed to produce the intent resource using the ActivityDefinition instance
# as the input.
StructField(
"transform",
ReferenceSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth + 1,
max_extension_depth=max_extension_depth,
),
True,
),
# Customizations that should be applied to the statically defined resource. For
# example, if the dosage of a medication must be computed based on the patient's
# weight, a customization would be used to specify an expression that calculated
# the weight, and the path on the resource that would contain the result.
StructField(
"dynamicValue",
ArrayType(
PlanDefinition_DynamicValueSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth,
max_extension_depth=max_extension_depth,
)
),
True,
),
# Sub actions that are contained within the action. The behavior of this action
# determines the functionality of the sub-actions. For example, a selection
# behavior of at-most-one indicates that of the sub-actions, at most one may be
# chosen as part of realizing the action definition.
StructField(
"action",
ArrayType(
PlanDefinition_ActionSchema.get_schema(
max_nesting_depth=max_nesting_depth,
nesting_depth=nesting_depth + 1,
nesting_list=my_nesting_list,
max_recursion_limit=max_recursion_limit,
include_extension=include_extension,
extension_fields=extension_fields,
extension_depth=extension_depth,
max_extension_depth=max_extension_depth,
)
),
True,
),
]
)
if not include_extension:
schema.fields = [
c
if c.name != "extension"
else StructField("extension", StringType(), True)
for c in schema.fields
]
return schema
| 49.780797 | 100 | 0.553659 | 2,514 | 27,479 | 5.835322 | 0.131663 | 0.066258 | 0.041922 | 0.062168 | 0.799796 | 0.796319 | 0.79441 | 0.752829 | 0.727198 | 0.695774 | 0 | 0.003359 | 0.404163 | 27,479 | 551 | 101 | 49.871143 | 0.892628 | 0.294771 | 0 | 0.637306 | 0 | 0 | 0.028344 | 0.002233 | 0 | 0 | 0 | 0 | 0 | 1 | 0.002591 | false | 0 | 0.044041 | 0 | 0.054404 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
d8d77a9aca9d5ca16392d0a4536f363d1cd5c254 | 2,012 | py | Python | terrascript/resource/selectel/selectel.py | mjuenema/python-terrascript | 6d8bb0273a14bfeb8ff8e950fe36f97f7c6e7b1d | [
"BSD-2-Clause"
] | 507 | 2017-07-26T02:58:38.000Z | 2022-01-21T12:35:13.000Z | terrascript/resource/selectel/selectel.py | mjuenema/python-terrascript | 6d8bb0273a14bfeb8ff8e950fe36f97f7c6e7b1d | [
"BSD-2-Clause"
] | 135 | 2017-07-20T12:01:59.000Z | 2021-10-04T22:25:40.000Z | terrascript/resource/selectel/selectel.py | mjuenema/python-terrascript | 6d8bb0273a14bfeb8ff8e950fe36f97f7c6e7b1d | [
"BSD-2-Clause"
] | 81 | 2018-02-20T17:55:28.000Z | 2022-01-31T07:08:40.000Z | # terrascript/resource/selectel/selectel.py
# Automatically generated by tools/makecode.py (24-Sep-2021 15:26:31 UTC)
import terrascript
class selectel_dbaas_database_v1(terrascript.Resource):
pass
class selectel_dbaas_datastore_v1(terrascript.Resource):
pass
class selectel_dbaas_extension_v1(terrascript.Resource):
pass
class selectel_dbaas_grant_v1(terrascript.Resource):
pass
class selectel_dbaas_user_v1(terrascript.Resource):
pass
class selectel_domains_domain_v1(terrascript.Resource):
pass
class selectel_domains_record_v1(terrascript.Resource):
pass
class selectel_mks_cluster_v1(terrascript.Resource):
pass
class selectel_mks_nodegroup_v1(terrascript.Resource):
pass
class selectel_vpc_crossregion_subnet_v2(terrascript.Resource):
pass
class selectel_vpc_floatingip_v2(terrascript.Resource):
pass
class selectel_vpc_keypair_v2(terrascript.Resource):
pass
class selectel_vpc_license_v2(terrascript.Resource):
pass
class selectel_vpc_project_v2(terrascript.Resource):
pass
class selectel_vpc_role_v2(terrascript.Resource):
pass
class selectel_vpc_subnet_v2(terrascript.Resource):
pass
class selectel_vpc_token_v2(terrascript.Resource):
pass
class selectel_vpc_user_v2(terrascript.Resource):
pass
class selectel_vpc_vrrp_subnet_v2(terrascript.Resource):
pass
__all__ = [
"selectel_dbaas_database_v1",
"selectel_dbaas_datastore_v1",
"selectel_dbaas_extension_v1",
"selectel_dbaas_grant_v1",
"selectel_dbaas_user_v1",
"selectel_domains_domain_v1",
"selectel_domains_record_v1",
"selectel_mks_cluster_v1",
"selectel_mks_nodegroup_v1",
"selectel_vpc_crossregion_subnet_v2",
"selectel_vpc_floatingip_v2",
"selectel_vpc_keypair_v2",
"selectel_vpc_license_v2",
"selectel_vpc_project_v2",
"selectel_vpc_role_v2",
"selectel_vpc_subnet_v2",
"selectel_vpc_token_v2",
"selectel_vpc_user_v2",
"selectel_vpc_vrrp_subnet_v2",
]
| 19.533981 | 73 | 0.784294 | 253 | 2,012 | 5.754941 | 0.173913 | 0.260989 | 0.300137 | 0.346154 | 0.594093 | 0.526099 | 0.49794 | 0.06456 | 0 | 0 | 0 | 0.028935 | 0.141153 | 2,012 | 102 | 74 | 19.72549 | 0.813657 | 0.056163 | 0 | 0.316667 | 1 | 0 | 0.244726 | 0.223629 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.316667 | 0.016667 | 0 | 0.333333 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 5 |
d8e0f1b2fe03d6ce11609874936328987ab1e0a9 | 91 | py | Python | oneshot/ignite/handlers/__init__.py | nganltp/admicro-LaSO | 857d67a40af437ab57068fb0de35e4ada56c6209 | [
"BSD-3-Clause"
] | 83 | 2019-04-14T06:58:15.000Z | 2022-03-01T01:34:03.000Z | oneshot/ignite/handlers/__init__.py | leokarlin/LaSO | 8941bdc9316361ad03dbc2bcabd4bf9922c0ecc7 | [
"BSD-3-Clause"
] | 17 | 2019-04-28T04:26:24.000Z | 2022-01-19T15:37:42.000Z | oneshot/ignite/handlers/__init__.py | nganltp/admicro-LaSO | 857d67a40af437ab57068fb0de35e4ada56c6209 | [
"BSD-3-Clause"
] | 15 | 2019-09-05T04:22:10.000Z | 2022-01-13T15:31:25.000Z | from .param_scheduler import ManualParamScheduler
from .find_learning_rate import LRFinder | 45.5 | 50 | 0.89011 | 11 | 91 | 7.090909 | 0.818182 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.087912 | 91 | 2 | 51 | 45.5 | 0.939759 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
9918b98160d81c07ac3345e699f045ef2411d605 | 17,128 | py | Python | tests/test_map_mods.py | computational-ms/py-unimod-mapper | 58382a78640d88e5753565c8c823fe50ddcfb0be | [
"MIT"
] | null | null | null | tests/test_map_mods.py | computational-ms/py-unimod-mapper | 58382a78640d88e5753565c8c823fe50ddcfb0be | [
"MIT"
] | null | null | null | tests/test_map_mods.py | computational-ms/py-unimod-mapper | 58382a78640d88e5753565c8c823fe50ddcfb0be | [
"MIT"
] | null | null | null | from unimod_mapper import UnimodMapper
import numpy as np
mod_dict = {
"ufiles": "",
"parameters": {
"modifications": [
{
"aa": "M",
"type": "opt",
"position": "any",
"name": "Oxidation",
},
{
"aa": "C",
"type": "fix",
"position": "any",
"name": "Carbamidomethyl",
},
{
"aa": "*",
"type": "opt",
"position": "Prot-N-term",
"name": "Acetyl",
},
]
},
}
mod_dict_not_in_unimod = {
"ufiles": "",
"parameters": {
"modifications": [
{
"aa": "M",
"type": "opt",
"position": "any",
"name": "Yadailation",
},
{
"aa": "C",
"type": "fix",
"position": "any",
"name": "Yadailation",
},
]
},
}
mod_dict_id = {
"ufiles": "",
"parameters": {
"modifications": [
{
"aa": "M",
"type": "opt",
"position": "any",
"id": 35,
},
{
"aa": "C",
"type": "fix",
"position": "any",
"id": 4,
},
{
"aa": "*",
"type": "opt",
"position": "Prot-N-term",
"id": "1",
},
]
},
}
mod_dict_id_not_in_unimod = {
"ufiles": "",
"parameters": {
"modifications": [
{
"aa": "M",
"type": "opt",
"position": "any",
"id": 987654321,
},
{
"aa": "C",
"type": "fix",
"position": "any",
"id": 123456789,
},
]
},
}
mod_dict_nl = {
"ufiles": "",
"parameters": {
"modifications": [
{
"aa": "M",
"type": "opt",
"position": "any",
"name": "Oxidation",
"neutral_loss": 0.0,
},
{
"aa": "C",
"type": "fix",
"position": "any",
"name": "Carbamidomethyl",
"neutral_loss": "unimod",
},
{
"aa": "M",
"type": "fix",
"position": "any",
"name": "Carbamidomethyl",
"neutral_loss": "unimod",
},
]
},
}
mod_dict_name_id = {
"ufiles": "",
"parameters": {
"modifications": [
{
"aa": "M",
"type": "opt",
"position": "any",
"name": "Oxidation",
"id": "35",
},
{
"aa": "C",
"type": "fix",
"position": "any",
"name": "Carbamidomethyl",
"id": "4",
},
{
"aa": "*",
"type": "opt",
"position": "Prot-N-term",
"name": "Acetyl",
"id": "1",
},
]
},
}
mod_dict_name_wrong_id = {
"ufiles": "",
"parameters": {
"modifications": [
{
"aa": "M",
"type": "opt",
"position": "any",
"name": "Oxidation",
"id": "3567",
},
{
"aa": "C",
"type": "fix",
"position": "any",
"name": "Carbamidomethyl",
"id": "4567",
},
{
"aa": "*",
"type": "opt",
"position": "Prot-N-term",
"name": "Acetyl",
"id": "1", # only this one is correct
},
]
},
}
unimod_dict = {
"fix": [
{
"aa": "C",
"position": "any",
"name": "Carbamidomethyl",
"mass": 57.021464,
"composition": {"H": 3, "C": 2, "N": 1, "O": 1},
"id": "4",
"neutral_loss": None,
"_id": 1,
"org": {
"aa": "C",
"type": "fix",
"position": "any",
"name": "Carbamidomethyl",
},
"unimod": True,
}
],
"opt": [
{
"aa": "M",
"position": "any",
"name": "Oxidation",
"mass": 15.994915,
"composition": {"O": 1},
"id": "35",
"neutral_loss": None,
"_id": 0,
"org": {"aa": "M", "type": "opt", "position": "any", "name": "Oxidation"},
"unimod": True,
},
{
"aa": "*",
"position": "Prot-N-term",
"name": "Acetyl",
"mass": 42.010565,
"composition": {"H": 2, "C": 2, "O": 1},
"id": "1",
"neutral_loss": None,
"_id": 2,
"org": {
"aa": "*",
"type": "opt",
"position": "Prot-N-term",
"name": "Acetyl",
},
"unimod": True,
},
],
}
unimod_dict_id = {
"fix": [
{
"aa": "C",
"position": "any",
"name": "Carbamidomethyl",
"mass": 57.021464,
"composition": {"H": 3, "C": 2, "N": 1, "O": 1},
"id": "4",
"neutral_loss": None,
"_id": 1,
"org": {"aa": "C", "type": "fix", "position": "any", "id": "4"},
"unimod": True,
}
],
"opt": [
{
"aa": "M",
"position": "any",
"name": "Oxidation",
"mass": 15.994915,
"composition": {"O": 1},
"id": "35",
"neutral_loss": None,
"_id": 0,
"org": {"aa": "M", "type": "opt", "position": "any", "id": "35"},
"unimod": True,
},
{
"aa": "*",
"position": "Prot-N-term",
"name": "Acetyl",
"mass": 42.010565,
"composition": {"H": 2, "C": 2, "O": 1},
"id": "1",
"neutral_loss": None,
"_id": 2,
"org": {"aa": "*", "type": "opt", "position": "Prot-N-term", "id": "1"},
"unimod": True,
},
],
}
unimod_dict_with_nl = {
"fix": [
{
"aa": "C",
"position": "any",
"name": "Carbamidomethyl",
"mass": 57.021464,
"composition": {"H": 3, "C": 2, "N": 1, "O": 1},
"id": "4",
"neutral_loss": 0.0,
"_id": 1,
"org": {
"aa": "C",
"type": "fix",
"position": "any",
"name": "Carbamidomethyl",
"neutral_loss": "unimod",
},
"unimod": True,
},
{
"aa": "M",
"position": "any",
"name": "Carbamidomethyl",
"mass": 57.021464,
"composition": {"H": 3, "C": 2, "N": 1, "O": 1},
"id": "4",
"neutral_loss": 105.024835,
"_id": 2,
"org": {
"aa": "M",
"type": "fix",
"position": "any",
"name": "Carbamidomethyl",
"neutral_loss": "unimod",
},
"unimod": True,
},
],
"opt": [
{
"aa": "M",
"position": "any",
"name": "Oxidation",
"mass": 15.994915,
"composition": {"O": 1},
"id": "35",
"neutral_loss": 0.0,
"_id": 0,
"org": {
"aa": "M",
"type": "opt",
"position": "any",
"name": "Oxidation",
"neutral_loss": 0.0,
},
"unimod": True,
}
],
}
unimod_dict_name_id = {
"fix": [
{
"aa": "C",
"position": "any",
"name": "Carbamidomethyl",
"mass": 57.021464,
"composition": {"H": 3, "C": 2, "N": 1, "O": 1},
"id": "4",
"neutral_loss": None,
"_id": 1,
"org": {
"aa": "C",
"type": "fix",
"position": "any",
"name": "Carbamidomethyl",
"id": "4",
},
"unimod": True,
}
],
"opt": [
{
"aa": "M",
"position": "any",
"name": "Oxidation",
"mass": 15.994915,
"composition": {"O": 1},
"id": "35",
"neutral_loss": None,
"_id": 0,
"org": {
"aa": "M",
"type": "opt",
"position": "any",
"name": "Oxidation",
"id": "35",
},
"unimod": True,
},
{
"aa": "*",
"position": "Prot-N-term",
"name": "Acetyl",
"mass": 42.010565,
"composition": {"H": 2, "C": 2, "O": 1},
"id": "1",
"neutral_loss": None,
"_id": 2,
"org": {
"aa": "*",
"type": "opt",
"position": "Prot-N-term",
"name": "Acetyl",
"id": "1",
},
"unimod": True,
},
],
}
unimod_dict_name_wrong_id = {
"fix": [],
"opt": [
{
"aa": "*",
"position": "Prot-N-term",
"name": "Acetyl",
"mass": 42.010565,
"composition": {"H": 2, "C": 2, "O": 1},
"id": "1",
"neutral_loss": None,
"_id": 2,
"org": {
"aa": "*",
"type": "opt",
"position": "Prot-N-term",
"name": "Acetyl",
"id": "1",
},
"unimod": True,
}
],
}
def test_map_mods_by_name():
_output = UnimodMapper().map_mods(mod_list=mod_dict["parameters"]["modifications"])
assert _output == unimod_dict
def test_map_mods_by_name_mod_not_in_unimod():
_output = UnimodMapper().map_mods(
mod_list=mod_dict_not_in_unimod["parameters"]["modifications"]
)
assert _output == {"fix": [], "opt": []}
def test_map_mods_by_id():
_output = UnimodMapper().map_mods(
mod_list=mod_dict_id["parameters"]["modifications"]
)
assert _output == unimod_dict_id
def test_map_mods_mod_not_in_unimod_by_id():
_output = UnimodMapper().map_mods(
mod_list=mod_dict_id_not_in_unimod["parameters"]["modifications"]
)
assert _output == {"fix": [], "opt": []}
def test_map_mods_neutral_loss():
import pprint
pprint.pprint(mod_dict_nl["parameters"]["modifications"])
_output = UnimodMapper().map_mods(
mod_list=mod_dict_nl["parameters"]["modifications"]
)
print("Output")
pprint.pprint(_output)
print("Expected")
pprint.pprint(unimod_dict_with_nl)
assert _output == unimod_dict_with_nl
def test_map_mods_name_and_id():
_output = UnimodMapper().map_mods(
mod_list=mod_dict_name_id["parameters"]["modifications"]
)
assert _output == unimod_dict_name_id
def test_map_mods_name_and_wrong_id():
_output = UnimodMapper().map_mods(
mod_list=mod_dict_name_wrong_id["parameters"]["modifications"]
)
assert _output == unimod_dict_name_wrong_id
def test_map_TMTpro18():
mapper = UnimodMapper()
mapped = mapper.mass_to_names(304.207146, decimals=4) # starts working from 3 on
assert list(mapped) == ["TMTpro"]
def test_map_composition_to_names():
mapper = UnimodMapper()
mapped = mapper.composition_to_names({"C": 1, "O": 1})
assert list(mapped) == ["Formyl", "Ser->Asp", "Thr->Glu"]
def test_map_composition_to_ids():
mapper = UnimodMapper()
mapped = mapper.composition_to_ids({"C": 1, "O": 1})
assert list(mapped) == ["122", "1196", "1205"]
# def test_map_all_masses():
# mapper = UnimodMapper()
# for mod_dict in mapper.data_list:
# mono_mass = mod_dict["mono_mass"]
# name = mod_dict["unimodname"]
# mapped_name = mapper.mass_to_names(mono_mass, decimals=5)
# assert name in list(mapped_name)
def test_map_mod_chemical_composition():
mapper = UnimodMapper()
mod_list = [
{
"aa": "M", # specify the modified amino acid as a single letter, use '*' if the amino acid is variable
"type": "opt", # specify if it is a fixed (fix) or potential (opt) modification
"position": "any", # specify the position within the protein/peptide (Prot-N-term, Prot-C-term), use 'any' if the positon is variable
"name": "Oxidation", # specify the unimod PSI-MS Name (alternative to id)
"id": None, # specify the unimod Accession (alternative to name)
"composition": None, # For user-defined mods composition needs to be given as a Hill notation
},
{
"aa": "T",
"type": "fix",
"name": "Acetyl",
},
]
rdict = mapper.map_mods(mod_list)
assert rdict["opt"][0]["composition"] == {"O": 1}
assert rdict["fix"][0]["composition"] == {"C": 2, "H": 2, "O": 1}
assert rdict["fix"][0]["id"] == "1"
def test_map_mod_userdefined_compositions():
mapper = UnimodMapper()
mod_list = [
{
"aa": "M", # specify the modified amino acid as a single letter, use '*' if the amino acid is variable
"type": "opt", # specify if it is a fixed (fix) or potential (opt) modification
"position": "any", # specify the position within the protein/peptide (Prot-N-term, Prot-C-term), use 'any' if the positon is variable
"name": "TheOneAndOnly", # specify the unimod PSI-MS Name (alternative to id)
"composition": {
"H": 2,
"O": 1,
}, # For user-defined mods composition needs to be given as a Hill notation
},
]
rdict = mapper.map_mods(mod_list)
assert (
len(rdict["opt"]) == 0
) # cause the name is not a unimod mod, but the composition exists already
mod_list = [
{
"aa": "M", # specify the modified amino acid as a single letter, use '*' if the amino acid is variable
"type": "opt", # specify if it is a fixed (fix) or potential (opt) modification
"position": "any", # specify the position within the protein/peptide (Prot-N-term, Prot-C-term), use 'any' if the positon is variable
"name": "TheOneAndOnly", # specify the unimod PSI-MS Name (alternative to id)
"composition": {
"H": 222,
"O": 111,
}, # For user-defined mods composition needs to be given as a Hill notation
},
]
rdict = mapper.map_mods(mod_list)
assert rdict["opt"][0]["composition"] == {"H": 222, "O": 111}
assert rdict["opt"][0]["name"] == "TheOneAndOnly"
def test_map_mod_chemical_composition_fails():
mapper = UnimodMapper()
# Using PSI-MS name works
mod_list = [
{
"aa": "N",
"type": "opt",
"name": "Ammonia-loss",
},
]
rdict = mapper.map_mods(mod_list)
assert rdict["opt"][0]["name"] == "Ammonia-loss"
# Using Interim name for same ID doesn't work
mod_list = [
{
"aa": "D",
"type": "opt",
"name": "N-oxobutanoic",
},
]
rdict = mapper.map_mods(mod_list)
assert len(rdict["opt"]) == 0
# Using Interim name and ID doesn't work (cause name is checked first)
# But using a wrong ID but correct name works (see test_map_mods_name_and_wrong_id)
# Seems inconsistent
mod_list = [
{
"aa": "D",
"type": "opt",
"name": "N-oxobutanoic",
"id": 385,
},
]
rdict = mapper.map_mods(mod_list)
assert len(rdict["opt"]) == 0
# Using just ID works
mod_list = [
{
"aa": "D",
"type": "opt",
"id": 385,
},
]
rdict = mapper.map_mods(mod_list)
assert rdict["opt"][0]["name"] == "Ammonia-loss"
# Using Interim name if PSI MS name doesn't exist works
mod_list = [
{
"aa": "S",
"type": "opt",
"name": "Galactosyl",
},
]
rdict = mapper.map_mods(mod_list)
assert rdict["opt"][0]["composition"] == {"C": 6, "H": 10, "O": 6}
| 27.144216 | 146 | 0.402616 | 1,576 | 17,128 | 4.218909 | 0.109137 | 0.059558 | 0.060911 | 0.031584 | 0.819221 | 0.784328 | 0.731839 | 0.704617 | 0.662205 | 0.627764 | 0 | 0.030531 | 0.426319 | 17,128 | 630 | 147 | 27.187302 | 0.646143 | 0.112506 | 0 | 0.617021 | 0 | 0 | 0.207094 | 0 | 0 | 0 | 0 | 0 | 0.037234 | 1 | 0.02305 | false | 0 | 0.005319 | 0 | 0.028369 | 0.010638 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
992d70cccac7fb3028dc88ff4a902d8edbaea619 | 74 | py | Python | src/modeling/feature_selection/__init__.py | NovaSBE-DSKC/retention-evaluation | 5b68b9282f0b5479a9dc5238faef68067c76b861 | [
"MIT"
] | null | null | null | src/modeling/feature_selection/__init__.py | NovaSBE-DSKC/retention-evaluation | 5b68b9282f0b5479a9dc5238faef68067c76b861 | [
"MIT"
] | null | null | null | src/modeling/feature_selection/__init__.py | NovaSBE-DSKC/retention-evaluation | 5b68b9282f0b5479a9dc5238faef68067c76b861 | [
"MIT"
] | null | null | null | from . import fs00_drop_pipeline1_columns, fs01_all, fs02_drop_agrupamento | 74 | 74 | 0.891892 | 11 | 74 | 5.454545 | 0.909091 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.101449 | 0.067568 | 74 | 1 | 74 | 74 | 0.768116 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
995b9162b368f2eda0769502cd2a4c334654649a | 94 | py | Python | metric/__init__.py | DeepLearnXMU/WDCNMT | 382db9d376988ff658fff8f99526a5170e95bb91 | [
"MIT"
] | 34 | 2018-12-18T08:54:24.000Z | 2022-02-04T16:16:26.000Z | metric/__init__.py | DeepLearnXMU/H-RNNSearch | a28cb555984e920e317fc9376cec12924f422f69 | [
"MIT"
] | 3 | 2019-03-13T10:38:34.000Z | 2020-03-26T09:38:28.000Z | metric/__init__.py | DeepLearnXMU/H-RNNSearch | a28cb555984e920e317fc9376cec12924f422f69 | [
"MIT"
] | 1 | 2019-03-31T00:39:51.000Z | 2019-03-31T00:39:51.000Z | # metric/__init__.py
# author: Playinf
# email: playinf@stu.xmu.edu.cn
from bleu import bleu
| 15.666667 | 31 | 0.744681 | 15 | 94 | 4.4 | 0.866667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.138298 | 94 | 5 | 32 | 18.8 | 0.814815 | 0.680851 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
9960442d8f1bfa9ead2f1b93a07ce1e20b424f87 | 199 | py | Python | pyjarowinkler/__init__.py | GustavoPeredo/jaro-winkler-distance | 2b97c6fea03e7b469b6065f13c71ce734d1758cf | [
"Apache-2.0"
] | null | null | null | pyjarowinkler/__init__.py | GustavoPeredo/jaro-winkler-distance | 2b97c6fea03e7b469b6065f13c71ce734d1758cf | [
"Apache-2.0"
] | null | null | null | pyjarowinkler/__init__.py | GustavoPeredo/jaro-winkler-distance | 2b97c6fea03e7b469b6065f13c71ce734d1758cf | [
"Apache-2.0"
] | null | null | null | from sys import version_info
from pyjarowinkler import distance
if version_info[:2] > (2, 7):
from pyjarowinkler import cydistance
__author__ = 'Jean-Bernard Ratte - jean.bernard.ratte@unary.ca'
| 33.166667 | 63 | 0.778894 | 28 | 199 | 5.321429 | 0.607143 | 0.147651 | 0.308725 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.017442 | 0.135678 | 199 | 5 | 64 | 39.8 | 0.848837 | 0 | 0 | 0 | 0 | 0 | 0.241206 | 0.135678 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.6 | 0 | 0.6 | 0 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
9972656fd26566a9759c9cae7dd14286d6883272 | 252 | py | Python | scripts/by_county_charts.py | jguzman-tech/tamf | 6f437ba1d8e4520ee13b71b74e04b23b8f8d4964 | [
"Apache-2.0"
] | 1 | 2021-03-15T19:49:03.000Z | 2021-03-15T19:49:03.000Z | scripts/by_county_charts.py | jguzman-tech/tamf | 6f437ba1d8e4520ee13b71b74e04b23b8f8d4964 | [
"Apache-2.0"
] | null | null | null | scripts/by_county_charts.py | jguzman-tech/tamf | 6f437ba1d8e4520ee13b71b74e04b23b8f8d4964 | [
"Apache-2.0"
] | null | null | null | from tamf.utility import *
import os.path
if __name__ == '__main__':
create_aggregate_bar_chart(1,
'./plots/category_subplots_by_county.png',
'./plots/category_subplots_aggregate.png')
| 31.5 | 73 | 0.587302 | 26 | 252 | 5.076923 | 0.769231 | 0.19697 | 0.318182 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.005814 | 0.31746 | 252 | 7 | 74 | 36 | 0.761628 | 0 | 0 | 0 | 0 | 0 | 0.34127 | 0.309524 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.333333 | 0 | 0.333333 | 0 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
51087f116a7bcfbdc002044967db617850c61faf | 189 | py | Python | binreconfiguration/strategy/minfreespace.py | vialette/binreconfiguration | 57cc024fdcf9b083a830270176ade185b65a85d0 | [
"MIT"
] | null | null | null | binreconfiguration/strategy/minfreespace.py | vialette/binreconfiguration | 57cc024fdcf9b083a830270176ade185b65a85d0 | [
"MIT"
] | null | null | null | binreconfiguration/strategy/minfreespace.py | vialette/binreconfiguration | 57cc024fdcf9b083a830270176ade185b65a85d0 | [
"MIT"
] | null | null | null | from .ascendinggaugedstrategy import AscendingGaugedStrategy
from .gauge import FreeSpace
class MinFreeSpace(AscendingGaugedStrategy):
def _gauge(self, item):
return FreeSpace(item)
| 18.9 | 60 | 0.825397 | 18 | 189 | 8.611111 | 0.611111 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.116402 | 189 | 9 | 61 | 21 | 0.928144 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | false | 0 | 0.4 | 0.2 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 5 |
510d374481e956f25bdf0667bbc4f57ce3a253d9 | 40 | py | Python | demo.py | mobai-ch/easyTracking | 148224c0d7278db351710252aef695a2161ba1e1 | [
"Apache-2.0"
] | null | null | null | demo.py | mobai-ch/easyTracking | 148224c0d7278db351710252aef695a2161ba1e1 | [
"Apache-2.0"
] | null | null | null | demo.py | mobai-ch/easyTracking | 148224c0d7278db351710252aef695a2161ba1e1 | [
"Apache-2.0"
] | null | null | null | '''
这个文件是用来看我Tracker的效果的,总之想法子调到能用吧
'''
| 10 | 31 | 0.75 | 2 | 40 | 15 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.075 | 40 | 3 | 32 | 13.333333 | 0.810811 | 0.775 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
512b8a04cf71753d6cc7b24c9d85bb3f6ab56ac3 | 112 | py | Python | image_labelling_tool/admin.py | claytonbrown/image-labelling-tool | 4a8f046d729f68a2fb214104a7522111a88c100a | [
"MIT"
] | 61 | 2017-07-31T00:38:49.000Z | 2022-01-22T02:09:36.000Z | image_labelling_tool/admin.py | JinyongJeong/image-labelling-tool | 4620fcc73d88f8df4261c62267e768595de96ed1 | [
"MIT"
] | 4 | 2017-08-24T21:51:16.000Z | 2020-04-03T09:32:59.000Z | image_labelling_tool/admin.py | JinyongJeong/image-labelling-tool | 4620fcc73d88f8df4261c62267e768595de96ed1 | [
"MIT"
] | 22 | 2017-08-09T14:36:53.000Z | 2022-02-07T01:37:54.000Z | from django.contrib import admin
import models
# Register your models here.
admin.site.register(models.Labels)
| 18.666667 | 34 | 0.8125 | 16 | 112 | 5.6875 | 0.6875 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.116071 | 112 | 5 | 35 | 22.4 | 0.919192 | 0.232143 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.666667 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
512c96da59c008ffa0b94977a45de9c8a4241349 | 175 | py | Python | bootcamp/questions/admin.py | Fadykhallaf/Signet | 2a8edcd85324d24b50d7d14fc980c8e9f88bfd26 | [
"MIT"
] | null | null | null | bootcamp/questions/admin.py | Fadykhallaf/Signet | 2a8edcd85324d24b50d7d14fc980c8e9f88bfd26 | [
"MIT"
] | null | null | null | bootcamp/questions/admin.py | Fadykhallaf/Signet | 2a8edcd85324d24b50d7d14fc980c8e9f88bfd26 | [
"MIT"
] | null | null | null | from django.contrib import admin
from bootcamp.questions.models import Question,Answer,Tag
admin.site.register(Question)
admin.site.register(Answer)
admin.site.register(Tag)
| 25 | 57 | 0.834286 | 25 | 175 | 5.84 | 0.52 | 0.184932 | 0.349315 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.068571 | 175 | 6 | 58 | 29.166667 | 0.895706 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.4 | 0 | 0.4 | 0 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
512ef8e6b88db2a5106ef94cd266be042eef6426 | 77 | py | Python | dycco/__init__.py | rojalator/dycco | 84ace8727aef84bb3d886cdaa3d3aef1089f1935 | [
"MIT"
] | null | null | null | dycco/__init__.py | rojalator/dycco | 84ace8727aef84bb3d886cdaa3d3aef1089f1935 | [
"MIT"
] | 1 | 2022-03-22T07:35:15.000Z | 2022-03-22T09:15:44.000Z | dycco/__init__.py | rojalator/dycco | 84ace8727aef84bb3d886cdaa3d3aef1089f1935 | [
"MIT"
] | null | null | null | from .dycco import document, parse, preprocess_docs, preprocess_code # noqa
| 38.5 | 76 | 0.805195 | 10 | 77 | 6 | 0.9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.12987 | 77 | 1 | 77 | 77 | 0.895522 | 0.051948 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
5139aeb60e15410718d7de8b5640e172ee23d311 | 72 | py | Python | scrapy_github/scrapy_github/items/DataHydroClickItem.py | ljtnono/scrapys | 00c60e60118c35feee598f1bdfa4b994c8fa922a | [
"MIT"
] | null | null | null | scrapy_github/scrapy_github/items/DataHydroClickItem.py | ljtnono/scrapys | 00c60e60118c35feee598f1bdfa4b994c8fa922a | [
"MIT"
] | null | null | null | scrapy_github/scrapy_github/items/DataHydroClickItem.py | ljtnono/scrapys | 00c60e60118c35feee598f1bdfa4b994c8fa922a | [
"MIT"
] | null | null | null | import scrapy
class DataHydroClickItem(scrapy.Item):
"""
"""
| 9 | 38 | 0.625 | 6 | 72 | 7.5 | 0.833333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.236111 | 72 | 7 | 39 | 10.285714 | 0.818182 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
51542ba5a69c0aab71d260c49e3744527c0e5194 | 115 | py | Python | enthought/envisage/developer/ui/view/application_browser.py | enthought/etsproxy | 4aafd628611ebf7fe8311c9d1a0abcf7f7bb5347 | [
"BSD-3-Clause"
] | 3 | 2016-12-09T06:05:18.000Z | 2018-03-01T13:00:29.000Z | enthought/envisage/developer/ui/view/application_browser.py | enthought/etsproxy | 4aafd628611ebf7fe8311c9d1a0abcf7f7bb5347 | [
"BSD-3-Clause"
] | 1 | 2020-12-02T00:51:32.000Z | 2020-12-02T08:48:55.000Z | enthought/envisage/developer/ui/view/application_browser.py | enthought/etsproxy | 4aafd628611ebf7fe8311c9d1a0abcf7f7bb5347 | [
"BSD-3-Clause"
] | null | null | null | # proxy module
from __future__ import absolute_import
from envisage.developer.ui.view.application_browser import *
| 28.75 | 60 | 0.852174 | 15 | 115 | 6.133333 | 0.8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.095652 | 115 | 3 | 61 | 38.333333 | 0.884615 | 0.104348 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
51636b536f2f9a1d136a5b0d2a24a53515b84525 | 91 | py | Python | irv/constants.py | nathanllww/slivka-irv | 6688ac88a34387df476d51f66d291e9f3b6454aa | [
"MIT"
] | null | null | null | irv/constants.py | nathanllww/slivka-irv | 6688ac88a34387df476d51f66d291e9f3b6454aa | [
"MIT"
] | 5 | 2021-10-08T17:44:32.000Z | 2021-12-19T18:47:59.000Z | irv/constants.py | nathanllww/slivka-irv | 6688ac88a34387df476d51f66d291e9f3b6454aa | [
"MIT"
] | null | null | null | NO_CONFIDENCE = "No Confidence"
UNBREAKABLE_TIE_WINNER = "No Confidence (unbreakable tie)"
| 30.333333 | 58 | 0.802198 | 11 | 91 | 6.363636 | 0.454545 | 0.514286 | 0.657143 | 0.742857 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.10989 | 91 | 2 | 59 | 45.5 | 0.864198 | 0 | 0 | 0 | 0 | 0 | 0.483516 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
5aa44c63ba4e1bb26a1adcbb5cd194825abee1f6 | 35 | py | Python | prof/Src/q_learning_stock/indicators/__init__.py | LaoKpa/reinforcement_trader | 1465731269e6d58900a28a040346bf45ffb5cf97 | [
"MIT"
] | 7 | 2020-09-28T23:36:40.000Z | 2022-02-22T02:00:32.000Z | prof/Src/q_learning_stock/indicators/__init__.py | LaoKpa/reinforcement_trader | 1465731269e6d58900a28a040346bf45ffb5cf97 | [
"MIT"
] | 4 | 2020-11-13T18:48:52.000Z | 2022-02-10T01:29:47.000Z | prof/q_learning_stock/indicators/__init__.py | lzcaisg/reinforcement_trader | 1465731269e6d58900a28a040346bf45ffb5cf97 | [
"MIT"
] | 3 | 2020-11-23T17:31:59.000Z | 2021-04-08T10:55:03.000Z | from .technical_indicators import * | 35 | 35 | 0.857143 | 4 | 35 | 7.25 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.085714 | 35 | 1 | 35 | 35 | 0.90625 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
5aecff1573ba4cf263e3b4a2440f9827f0031b9d | 160 | py | Python | knowledge_repo/app/deploy/__init__.py | djarratt/knowledge-repo | 4a95a0c2a74068384536bfa067640dbe34c6405d | [
"Apache-2.0"
] | null | null | null | knowledge_repo/app/deploy/__init__.py | djarratt/knowledge-repo | 4a95a0c2a74068384536bfa067640dbe34c6405d | [
"Apache-2.0"
] | null | null | null | knowledge_repo/app/deploy/__init__.py | djarratt/knowledge-repo | 4a95a0c2a74068384536bfa067640dbe34c6405d | [
"Apache-2.0"
] | 1 | 2021-06-07T14:52:26.000Z | 2021-06-07T14:52:26.000Z | from .common import KnowledgeDeployer, get_app_builder
from .flask import FlaskDeployer
from .gunicorn import GunicornDeployer
from .uwsgi import uWSGIDeployer
| 32 | 54 | 0.8625 | 19 | 160 | 7.157895 | 0.684211 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.10625 | 160 | 4 | 55 | 40 | 0.951049 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.