hexsha string | size int64 | ext string | lang string | max_stars_repo_path string | max_stars_repo_name string | max_stars_repo_head_hexsha string | max_stars_repo_licenses list | max_stars_count int64 | max_stars_repo_stars_event_min_datetime string | max_stars_repo_stars_event_max_datetime string | max_issues_repo_path string | max_issues_repo_name string | max_issues_repo_head_hexsha string | max_issues_repo_licenses list | max_issues_count int64 | max_issues_repo_issues_event_min_datetime string | max_issues_repo_issues_event_max_datetime string | max_forks_repo_path string | max_forks_repo_name string | max_forks_repo_head_hexsha string | max_forks_repo_licenses list | max_forks_count int64 | max_forks_repo_forks_event_min_datetime string | max_forks_repo_forks_event_max_datetime string | content string | avg_line_length float64 | max_line_length int64 | alphanum_fraction float64 | qsc_code_num_words_quality_signal int64 | qsc_code_num_chars_quality_signal float64 | qsc_code_mean_word_length_quality_signal float64 | qsc_code_frac_words_unique_quality_signal float64 | qsc_code_frac_chars_top_2grams_quality_signal float64 | qsc_code_frac_chars_top_3grams_quality_signal float64 | qsc_code_frac_chars_top_4grams_quality_signal float64 | qsc_code_frac_chars_dupe_5grams_quality_signal float64 | qsc_code_frac_chars_dupe_6grams_quality_signal float64 | qsc_code_frac_chars_dupe_7grams_quality_signal float64 | qsc_code_frac_chars_dupe_8grams_quality_signal float64 | qsc_code_frac_chars_dupe_9grams_quality_signal float64 | qsc_code_frac_chars_dupe_10grams_quality_signal float64 | qsc_code_frac_chars_replacement_symbols_quality_signal float64 | qsc_code_frac_chars_digital_quality_signal float64 | qsc_code_frac_chars_whitespace_quality_signal float64 | qsc_code_size_file_byte_quality_signal float64 | qsc_code_num_lines_quality_signal float64 | qsc_code_num_chars_line_max_quality_signal float64 | qsc_code_num_chars_line_mean_quality_signal float64 | qsc_code_frac_chars_alphabet_quality_signal float64 | qsc_code_frac_chars_comments_quality_signal float64 | qsc_code_cate_xml_start_quality_signal float64 | qsc_code_frac_lines_dupe_lines_quality_signal float64 | qsc_code_cate_autogen_quality_signal float64 | qsc_code_frac_lines_long_string_quality_signal float64 | qsc_code_frac_chars_string_length_quality_signal float64 | qsc_code_frac_chars_long_word_length_quality_signal float64 | qsc_code_frac_lines_string_concat_quality_signal float64 | qsc_code_cate_encoded_data_quality_signal float64 | qsc_code_frac_chars_hex_words_quality_signal float64 | qsc_code_frac_lines_prompt_comments_quality_signal float64 | qsc_code_frac_lines_assert_quality_signal float64 | qsc_codepython_cate_ast_quality_signal float64 | qsc_codepython_frac_lines_func_ratio_quality_signal float64 | qsc_codepython_cate_var_zero_quality_signal bool | qsc_codepython_frac_lines_pass_quality_signal float64 | qsc_codepython_frac_lines_import_quality_signal float64 | qsc_codepython_frac_lines_simplefunc_quality_signal float64 | qsc_codepython_score_lines_no_logic_quality_signal float64 | qsc_codepython_frac_lines_print_quality_signal float64 | qsc_code_num_words int64 | qsc_code_num_chars int64 | qsc_code_mean_word_length int64 | qsc_code_frac_words_unique null | qsc_code_frac_chars_top_2grams int64 | qsc_code_frac_chars_top_3grams int64 | qsc_code_frac_chars_top_4grams int64 | qsc_code_frac_chars_dupe_5grams int64 | qsc_code_frac_chars_dupe_6grams int64 | qsc_code_frac_chars_dupe_7grams int64 | qsc_code_frac_chars_dupe_8grams int64 | qsc_code_frac_chars_dupe_9grams int64 | qsc_code_frac_chars_dupe_10grams int64 | qsc_code_frac_chars_replacement_symbols int64 | qsc_code_frac_chars_digital int64 | qsc_code_frac_chars_whitespace int64 | qsc_code_size_file_byte int64 | qsc_code_num_lines int64 | qsc_code_num_chars_line_max int64 | qsc_code_num_chars_line_mean int64 | qsc_code_frac_chars_alphabet int64 | qsc_code_frac_chars_comments int64 | qsc_code_cate_xml_start int64 | qsc_code_frac_lines_dupe_lines int64 | qsc_code_cate_autogen int64 | qsc_code_frac_lines_long_string int64 | qsc_code_frac_chars_string_length int64 | qsc_code_frac_chars_long_word_length int64 | qsc_code_frac_lines_string_concat null | qsc_code_cate_encoded_data int64 | qsc_code_frac_chars_hex_words int64 | qsc_code_frac_lines_prompt_comments int64 | qsc_code_frac_lines_assert int64 | qsc_codepython_cate_ast int64 | qsc_codepython_frac_lines_func_ratio int64 | qsc_codepython_cate_var_zero int64 | qsc_codepython_frac_lines_pass int64 | qsc_codepython_frac_lines_import int64 | qsc_codepython_frac_lines_simplefunc int64 | qsc_codepython_score_lines_no_logic int64 | qsc_codepython_frac_lines_print int64 | effective string | hits int64 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
b631edba215b7694e62a8a6a02571a3439680191 | 100 | py | Python | products/admin.py | Walachul/milestone4 | ce3be4d39b5d28141f41d4783d3e7211480ce64d | [
"MIT"
] | null | null | null | products/admin.py | Walachul/milestone4 | ce3be4d39b5d28141f41d4783d3e7211480ce64d | [
"MIT"
] | 7 | 2020-02-12T03:15:31.000Z | 2022-03-12T00:01:18.000Z | products/admin.py | Code-Institute-Submissions/Walachul-milestone4 | ce3be4d39b5d28141f41d4783d3e7211480ce64d | [
"MIT"
] | 1 | 2020-01-12T12:49:10.000Z | 2020-01-12T12:49:10.000Z | from django.contrib import admin
from .models import Merchandise
admin.site.register(Merchandise)
| 16.666667 | 32 | 0.83 | 13 | 100 | 6.384615 | 0.692308 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.11 | 100 | 5 | 33 | 20 | 0.932584 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.666667 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
b63e74ae43183a84046cec7a2a02b85530f63c8d | 25 | py | Python | src/masonite/events/Listener.py | cercos/masonite | f7f220efa7fae833683e9f07ce13c3795a87d3b8 | [
"MIT"
] | 1,816 | 2018-02-14T01:59:51.000Z | 2022-03-31T17:09:20.000Z | src/masonite/events/Listener.py | cercos/masonite | f7f220efa7fae833683e9f07ce13c3795a87d3b8 | [
"MIT"
] | 340 | 2018-02-11T00:27:26.000Z | 2022-03-21T12:00:24.000Z | src/masonite/events/Listener.py | cercos/masonite | f7f220efa7fae833683e9f07ce13c3795a87d3b8 | [
"MIT"
] | 144 | 2018-03-18T00:08:16.000Z | 2022-02-26T01:51:58.000Z | class Listener:
pass
| 8.333333 | 15 | 0.68 | 3 | 25 | 5.666667 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.28 | 25 | 2 | 16 | 12.5 | 0.944444 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0.5 | 0 | 0 | 0.5 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 5 |
fcccbb128da0eb77727a1ba6cfada08101242877 | 7,724 | py | Python | tests/test_typology.py | tristan0x/hub-dispatch | e6870f73797cbea8798052d2780be924710df2de | [
"Apache-2.0"
] | null | null | null | tests/test_typology.py | tristan0x/hub-dispatch | e6870f73797cbea8798052d2780be924710df2de | [
"Apache-2.0"
] | null | null | null | tests/test_typology.py | tristan0x/hub-dispatch | e6870f73797cbea8798052d2780be924710df2de | [
"Apache-2.0"
] | null | null | null | import unittest
from hub_dispatch import HubDispatch
class TestTopology(unittest.TestCase):
def test_empty_graph(self):
h = HubDispatch()
with self.assertRaises(Exception) as exc:
h.remove_hub('foo')
self.assertEqual(
exc.exception.message,
"Hub 'foo' does not exist"
)
with self.assertRaises(Exception) as exc:
h.link('foo', 'bar')
self.assertEqual(
exc.exception.message,
"Hub 'foo' does not exist"
)
with self.assertRaises(Exception) as exc:
h.unlink('foo', 'bar')
self.assertEqual(
exc.exception.message,
"Hub 'foo' does not exist"
)
def test_add_hub_linked_to_node(self):
h = HubDispatch()
h.add_hub('foo')
self.assertEqual(h._changes.assignments, [('foo', 'foo')])
h.link('foo', 'bar')
self.assertEqual(
h._topology.nodes,
{'bar': 'foo', 'foo': 'foo'},
)
self.assertEqual(
h._topology.hubs,
{'foo': 2},
)
self.assertEqual(h._changes.assignments, [
('foo', 'foo'),
('foo', 'bar')
])
h._changes._clear()
def test_unlink_hub_with_lonely_node(self):
h = HubDispatch().add_hub('foo').link('foo', 'bar')
h._changes._clear()
with self.assertRaises(Exception) as exc:
h.unlink('foo', 'unknown-node')
self.assertEqual(
exc.exception.message,
"Hub 'foo' is not connected to node 'unknown-node'"
)
h.unlink('foo', 'bar')
self.assertEqual(h._topology.nodes, {'foo': 'foo'})
self.assertEqual(h._topology.hubs, {'foo': 1})
self.assertEqual(h._changes.assignments, [])
self.assertEqual(h._changes.unassignments, [('foo', 'bar')])
def test_unlink_hub_with_lonely_nodes(self):
h = HubDispatch().add_hub('foo').link('foo', 'n1').link('foo', 'n2')
h._changes._clear()
h.unlink('foo', 'n1')
self.assertEqual(h._topology.nodes, {'n2': 'foo', 'foo': 'foo'})
self.assertEqual(h._topology.hubs, {'foo': 2})
self.assertEqual(h._changes.assignments, [])
self.assertEqual(h._changes.unassignments, [('foo', 'n1')])
def test_remove_hub_with_lonely_links(self):
h = HubDispatch().add_hub('foo').link('foo', 'bar')
h._changes._clear()
h.remove_hub('foo')
self.assertEqual(h._topology.nodes, {})
self.assertEqual(h._topology.hubs, {})
self.assertEqual(h._changes.assignments, [])
self.assertEqual(h._changes.unassignments, [
('foo', 'foo'),
('foo', 'bar')
])
def test_remove_hub_following_hub(self):
h = HubDispatch().add_hub('foo', 'bar').link('foo', 'bar')
self.assertEqual(h._topology.nodes, {'bar': 'bar', 'foo': 'foo'})
self.assertEqual(h._topology.hubs, {'foo': 1, 'bar': 1})
self.assertEqual(h._changes.assignments, [
('foo', 'foo'), ('bar', 'bar')
])
self.assertEqual(h._changes.unassignments, [])
h._changes._clear()
h.remove_hub('foo')
self.assertEqual(h._topology.nodes, {'bar': 'bar'})
self.assertEqual(h._topology.hubs, {'bar': 1})
self.assertEqual(h._changes.assignments, [])
self.assertEqual(h._changes.unassignments, [('foo', 'foo')])
def test_hub_follows_followee(self):
h = HubDispatch().add_hub('foo', 'bar')\
.link('foo', 'bar').link('bar', 'foo')
self.assertEqual(h._topology.nodes, {'foo': 'foo', 'bar': 'bar'})
self.assertEqual(h._topology.hubs, {'foo': 1, 'bar': 1})
self.assertEqual(h._changes.assignments, [
('foo', 'foo'),
('bar', 'bar'),
])
self.assertEqual(h._changes.unassignments, [])
def test_remove_hub_with_shared_link(self):
h = HubDispatch()\
.add_hub('h1', 'h2')\
.link('h1', 'node').link('h2', 'node')
self.assertEqual(h._topology.nodes,
{'node': 'h1', 'h1': 'h1', 'h2': 'h2'})
self.assertEqual(h._topology.hubs, {'h1': 2, 'h2': 1})
self.assertEqual(h._changes.assignments,
[('h1', 'h1'), ('h2', 'h2'), ('h1', 'node')])
self.assertEqual(h._changes.unassignments, [])
h._changes._clear()
# remove assigned hub
h.unlink('h1', 'node')
self.assertEqual(h._topology.nodes,
{'h1': 'h1', 'h2': 'h2', 'node': 'h2'})
self.assertEqual(h._topology.hubs, {'h2': 2, 'h1': 1})
self.assertEqual(h._changes.assignments, [('h2', 'node')])
self.assertEqual(h._changes.unassignments, [('h1', 'node')])
def test_remove_unassigned_hub(self):
h = HubDispatch()\
.add_hub('h1', 'h2')\
.link('h1', 'node').link('h2', 'node')
h._changes._clear()
h.unlink('h2', 'node')
self.assertEqual(h._topology.nodes, {
'node': 'h1',
'h1': 'h1',
'h2': 'h2',
})
self.assertEqual(h._topology.hubs, {'h1': 2, 'h2': 1})
def test_assign_to_least_loaded(self):
h = HubDispatch()\
.add_hub('h1', 'h2', 'h3', 'h4')\
.link('h1', 'node')\
.link('h4', 'node', 'foo', 'plop', 'pika')\
.link('h2', 'node', 'foo', 'bar')\
.link('h3', 'node')
h._changes._clear()
h.unlink('h1', 'node')
self.assertEqual(
h._topology.nodes,
{'h1': 'h1', 'h2': 'h2', 'h3': 'h3', 'h4': 'h4', 'foo': 'h4',
'bar': 'h2', 'node': 'h3', 'plop': 'h4', 'pika': 'h4'}
)
self.assertEqual(h._topology.hubs,
{'h2': 2, 'h3': 2, 'h4': 4, 'h1': 1})
self.assertEqual(h._changes.assignments, [('h3', 'node')])
self.assertEqual(h._changes.unassignments, [('h1', 'node')])
def test_reassign_node_on_hub_removal(self):
h = HubDispatch().add_hub('A', 'C').link('A', 'B').link('C', 'B')
self.assertEqual(h._topology.nodes, {
'A': 'A', 'B': 'A', 'C': 'C'
})
h._changes._clear()
h.remove_hub('A')
self.assertEqual(h._topology.nodes, {
'B': 'C', 'C': 'C'
})
self.assertEqual(h._changes.unassignments, [('A', 'A'), ('A', 'B')])
self.assertEqual(h._changes.assignments, [('C', 'B')])
def test_promote_hub_a_followed_node(self):
h = HubDispatch().add_hub('A').link('A', 'B')
h._changes._clear()
h.add_hub('B')
self.assertEqual(h._topology.nodes, {
'A': 'A', 'B': 'A'
})
self.assertEqual(h._topology.hubs, {'A': 2})
def test_reassignment_when_hub_have_multiple_assignees(self):
h = HubDispatch()\
.add_hub('h1', 'h2')\
.link('h1', 'n1', 'n2')\
.link('h2', 'n1')
h._changes._clear()
h.unlink('h1', 'n1')
self.assertEqual(h._topology.nodes, {
'h1': 'h1', 'h2': 'h2',
'n1': 'h2', 'n2': 'h1',
})
self.assertEqual(h._topology.hubs, {'h1': 2, 'h2': 2})
self.assertEqual(h._changes.assignments, [('h2', 'n1')])
self.assertEqual(h._changes.unassignments, [('h1', 'n1')])
def test_least_loaded_func(self):
h = HubDispatch()
h._topology.hubs['foo'] = 0
h._topology.hubs['bar'] = 42
self.assertEqual('foo', h._least_loaded('foo', 'bar'))
self.assertEqual('foo', h._least_loaded('bar', 'foo'))
if __name__ == '__main__':
unittest.main()
| 37.31401 | 76 | 0.522398 | 877 | 7,724 | 4.411631 | 0.096921 | 0.224864 | 0.215043 | 0.173688 | 0.803308 | 0.740501 | 0.629103 | 0.525976 | 0.496511 | 0.435513 | 0 | 0.021265 | 0.28159 | 7,724 | 206 | 77 | 37.495146 | 0.675978 | 0.00246 | 0 | 0.486631 | 0 | 0 | 0.096716 | 0 | 0 | 0 | 0 | 0 | 0.331551 | 1 | 0.074866 | false | 0 | 0.010695 | 0 | 0.090909 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
fce6d0c487391734e8cdd6c6b47ccc6419b8acee | 44 | py | Python | hello_pynetclass.py | ericchou-python/pynet_class | 26ac816a2cdc1671d62c6fd0773e142dc2e49d54 | [
"Apache-2.0"
] | null | null | null | hello_pynetclass.py | ericchou-python/pynet_class | 26ac816a2cdc1671d62c6fd0773e142dc2e49d54 | [
"Apache-2.0"
] | null | null | null | hello_pynetclass.py | ericchou-python/pynet_class | 26ac816a2cdc1671d62c6fd0773e142dc2e49d54 | [
"Apache-2.0"
] | null | null | null | #!/usr/env/bin python
print "hello pynet"
| 8.8 | 21 | 0.681818 | 7 | 44 | 4.285714 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.159091 | 44 | 4 | 22 | 11 | 0.810811 | 0.454545 | 0 | 0 | 0 | 0 | 0.5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0 | null | null | 1 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
fcf009e35eeb86fd428a9649a82f42e6bc1e7a7c | 285 | py | Python | tic-tac-toe.py | NageshJ2014/TestRepor | bea3c5feca4fda196f43797d12bf752d7c97959a | [
"MIT"
] | null | null | null | tic-tac-toe.py | NageshJ2014/TestRepor | bea3c5feca4fda196f43797d12bf752d7c97959a | [
"MIT"
] | null | null | null | tic-tac-toe.py | NageshJ2014/TestRepor | bea3c5feca4fda196f43797d12bf752d7c97959a | [
"MIT"
] | null | null | null | def display(array):
print ("\n__________________________\n|\t" + array[0] + "|\tarray[1]|\tarray[2]|")
print ("_\t_\t_\t_\n|\t|\t|\t|")
print ("_\t_\t_\t_\n|\t|\t|\t|")
print ("__________________________\n")
array =["1","2","3","4","5","6","7","8","9"]
display(array)
| 31.666667 | 86 | 0.557895 | 43 | 285 | 2.302326 | 0.395349 | 0.161616 | 0.121212 | 0.161616 | 0.292929 | 0.292929 | 0.292929 | 0.292929 | 0.292929 | 0 | 0 | 0.047809 | 0.119298 | 285 | 8 | 87 | 35.625 | 0.346614 | 0 | 0 | 0.285714 | 0 | 0 | 0.480702 | 0.449123 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0 | 0 | 0 | 0.142857 | 0.571429 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
1e0fcfacc14cf4319f50523a27c81fe3750533fa | 297 | py | Python | arepo/templatetags/arepo_extras.py | Vargdalf/Restaurant-App | 7a8f983061351e8e4e87f7909ecb1829980a5941 | [
"MIT"
] | 2 | 2019-11-27T18:05:19.000Z | 2019-11-29T16:16:59.000Z | arepo/templatetags/arepo_extras.py | Vargdalf/Restaurant-App | 7a8f983061351e8e4e87f7909ecb1829980a5941 | [
"MIT"
] | 3 | 2020-01-04T17:10:58.000Z | 2022-01-13T01:50:30.000Z | arepo/templatetags/arepo_extras.py | Vargdalf/Restaurant-App | 7a8f983061351e8e4e87f7909ecb1829980a5941 | [
"MIT"
] | 1 | 2019-11-27T18:05:21.000Z | 2019-11-27T18:05:21.000Z | from django.template.defaulttags import register
@register.filter
def get_item(dictionary, key):
return dictionary[key][0]
@register.filter
def get_item_int(dictionary, key):
return int(dictionary[key][1])
@register.simple_tag()
def multiply(a, b, *args, **kwargs):
return a * b
| 17.470588 | 48 | 0.723906 | 42 | 297 | 5.02381 | 0.547619 | 0.246446 | 0.161137 | 0.189573 | 0.227488 | 0 | 0 | 0 | 0 | 0 | 0 | 0.007905 | 0.148148 | 297 | 16 | 49 | 18.5625 | 0.826087 | 0 | 0 | 0.2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.3 | false | 0 | 0.1 | 0.3 | 0.7 | 0 | 0 | 0 | 0 | null | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 5 |
1e7d4a02282c1eef2ca88222ac1d800351f62866 | 259 | py | Python | simple/{{cookiecutter.repo_name}}/{{cookiecutter.model_name}}/generators/__init__.py | modelyst/dbgen-model-template | 39c3b84527bc4f01ea3f810d7873e6edf8f056c3 | [
"Apache-2.0"
] | null | null | null | simple/{{cookiecutter.repo_name}}/{{cookiecutter.model_name}}/generators/__init__.py | modelyst/dbgen-model-template | 39c3b84527bc4f01ea3f810d7873e6edf8f056c3 | [
"Apache-2.0"
] | null | null | null | simple/{{cookiecutter.repo_name}}/{{cookiecutter.model_name}}/generators/__init__.py | modelyst/dbgen-model-template | 39c3b84527bc4f01ea3f810d7873e6edf8f056c3 | [
"Apache-2.0"
] | null | null | null | from dbgen import Model
{% if cookiecutter.clean=="false" %}# Add generators here
from .io import add_io_gens
def add_generators(model: Model):
add_io_gens(model)
{% else %}def add_generators(model: Model):
# Add generators here
pass
{% endif %}
| 23.545455 | 57 | 0.710425 | 37 | 259 | 4.810811 | 0.459459 | 0.292135 | 0.191011 | 0.235955 | 0.325843 | 0.325843 | 0 | 0 | 0 | 0 | 0 | 0 | 0.173745 | 259 | 10 | 58 | 25.9 | 0.831776 | 0.150579 | 0 | 0 | 0 | 0 | 0.023041 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0.125 | 0.25 | null | null | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 5 |
1e83baad13db2f2aa9cf2e43bf9787fca52cd9fc | 153 | py | Python | console.py | durovda/tdd_training | 47a154a9f546e2b854a48c17acc817d751d22f17 | [
"Apache-2.0"
] | null | null | null | console.py | durovda/tdd_training | 47a154a9f546e2b854a48c17acc817d751d22f17 | [
"Apache-2.0"
] | null | null | null | console.py | durovda/tdd_training | 47a154a9f546e2b854a48c17acc817d751d22f17 | [
"Apache-2.0"
] | null | null | null | class Console:
@staticmethod
def input(request):
return input(request)
@staticmethod
def print(message):
print(message)
| 17 | 29 | 0.627451 | 15 | 153 | 6.4 | 0.6 | 0.3125 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.287582 | 153 | 8 | 30 | 19.125 | 0.880734 | 0 | 0 | 0.285714 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.285714 | false | 0 | 0 | 0.142857 | 0.571429 | 0.285714 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 5 |
1e8f8bc603e1cb301e8a80716d15a034629e7ca5 | 211 | py | Python | deconvolution/utils/__init__.py | JustinLin610/DeconvDec | e3835e140ab52d86d1045f2fd5a685cac123d0cc | [
"MIT"
] | 26 | 2018-06-10T15:31:55.000Z | 2021-02-26T18:00:55.000Z | deconvolution/utils/__init__.py | JustinLin610/DeconvDec | e3835e140ab52d86d1045f2fd5a685cac123d0cc | [
"MIT"
] | 1 | 2019-10-24T07:44:45.000Z | 2019-10-26T10:03:05.000Z | deconvolution/utils/__init__.py | JustinLin610/DeconvDec | e3835e140ab52d86d1045f2fd5a685cac123d0cc | [
"MIT"
] | 2 | 2019-03-12T20:58:04.000Z | 2021-11-01T13:31:23.000Z | '''
@Date : 2017/12/18
@Author: Shuming Ma
@mail : shumingma@pku.edu.cn
@homepage: shumingma.com
'''
from .data_helper import *
from .dict_helper import *
from .misc_utils import *
from .metrics import *
| 19.181818 | 31 | 0.696682 | 30 | 211 | 4.8 | 0.733333 | 0.208333 | 0.222222 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.045714 | 0.170616 | 211 | 10 | 32 | 21.1 | 0.777143 | 0.450237 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
1ec8c3a6650082e2bd9d10437eeac34d9deb4201 | 822 | py | Python | sparkdq/suggestions/SuggestionSuite.py | PasaLab/SparkDQ | 16d50210747ef7de03cf36d689ce26ff7445f63a | [
"Apache-2.0"
] | 1 | 2021-02-08T07:49:54.000Z | 2021-02-08T07:49:54.000Z | sparkdq/suggestions/SuggestionSuite.py | PasaLab/SparkDQ | 16d50210747ef7de03cf36d689ce26ff7445f63a | [
"Apache-2.0"
] | null | null | null | sparkdq/suggestions/SuggestionSuite.py | PasaLab/SparkDQ | 16d50210747ef7de03cf36d689ce26ff7445f63a | [
"Apache-2.0"
] | null | null | null | from sparkdq.suggestions.SuggestionRunBuilder import SuggestionRunBuilder
from sparkdq.suggestions.rules.ApproximatelyUniqueRule import ApproximatelyUniqueRule
from sparkdq.suggestions.rules.CategoricalRangeRule import CategoricalRangeRule
from sparkdq.suggestions.rules.CompleteRule import CompleteRule
from sparkdq.suggestions.rules.NonNegativeNumbersRule import NonNegativeNumbersRule
from sparkdq.suggestions.rules.RetainCompletenessRule import RetainCompletenessRule
from sparkdq.suggestions.rules.RetainTypeRule import RetainTypeRule
DEFAULT_RULES = [CompleteRule(), RetainCompletenessRule(), RetainTypeRule(), CategoricalRangeRule(),
NonNegativeNumbersRule(), ApproximatelyUniqueRule()]
class SuggestionSuite:
@staticmethod
def on_data(data):
return SuggestionRunBuilder(data)
| 43.263158 | 100 | 0.844282 | 66 | 822 | 10.484848 | 0.30303 | 0.111272 | 0.222543 | 0.234104 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.09854 | 822 | 18 | 101 | 45.666667 | 0.933873 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.076923 | false | 0 | 0.538462 | 0.076923 | 0.769231 | 0 | 0 | 0 | 1 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
94d5c15c2dc12349bb8e3c03e757d0694f0ca9f5 | 42 | py | Python | gaiavision/label_space/matchers/__init__.py | NickChang97/GAIA-cv | b691af89813ffa6a1d1e1719c6dd0ec4c253d2bf | [
"Apache-2.0"
] | 49 | 2021-06-21T06:20:40.000Z | 2022-01-03T14:01:01.000Z | gaiavision/label_space/matchers/__init__.py | NickChang97/GAIA-cv | b691af89813ffa6a1d1e1719c6dd0ec4c253d2bf | [
"Apache-2.0"
] | null | null | null | gaiavision/label_space/matchers/__init__.py | NickChang97/GAIA-cv | b691af89813ffa6a1d1e1719c6dd0ec4c253d2bf | [
"Apache-2.0"
] | 5 | 2021-07-13T09:52:34.000Z | 2022-03-21T04:18:39.000Z | # add visual/language/manual_matcher here
| 21 | 41 | 0.833333 | 6 | 42 | 5.666667 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.095238 | 42 | 1 | 42 | 42 | 0.894737 | 0.928571 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
a2172227daeb7aa8a7ec501736bed20d71ecada6 | 10,931 | py | Python | tests/unit/test_api_tasks_unit.py | sh8121att/airship-drydock | def51688e49c40d398c6adff7c4ff9cec9a38a3b | [
"Apache-2.0"
] | 14 | 2017-03-07T17:00:22.000Z | 2021-04-02T14:15:04.000Z | tests/unit/test_api_tasks_unit.py | sh8121att/airship-drydock | def51688e49c40d398c6adff7c4ff9cec9a38a3b | [
"Apache-2.0"
] | 82 | 2017-02-16T16:54:18.000Z | 2018-06-04T13:40:32.000Z | tests/unit/test_api_tasks_unit.py | att-comdev/drydock | 506e06623a5f1c11c0d34f2089851cc8381f06ae | [
"Apache-2.0"
] | 16 | 2017-02-14T19:47:00.000Z | 2018-04-26T10:13:05.000Z | # Copyright 2018 AT&T Intellectual Property. All other rights reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
"""Test Tasks API"""
from falcon import testing
from unittest.mock import Mock
import pytest
import json
import logging
from drydock_provisioner import policy
from drydock_provisioner.control.api import start_api
import drydock_provisioner.objects as objects
import drydock_provisioner.objects.fields as hd_fields
import falcon
LOG = logging.getLogger(__name__)
class TestTasksApiUnit(object):
def test_get_tasks_id_resp(self, falcontest):
url = '/api/v1.0/tasks/11111111-1111-1111-1111-111111111111'
hdr = self.get_standard_header()
result = falcontest.simulate_get(url, headers=hdr)
assert result.status == falcon.HTTP_200
response_json = json.loads(result.text)
assert response_json['task_id'] == '11111111-1111-1111-1111-111111111111'
try:
response_json['build_data']
key_error = False
except KeyError as ex:
key_error = True
assert key_error
try:
response_json['subtask_errors']
key_error = False
except KeyError as ex:
key_error = True
assert key_error
def test_get_tasks_id_subtaskerror_noerrors_resp(self, falcontest):
url = '/api/v1.0/tasks/11111111-1111-1111-1111-111111111111'
hdr = self.get_standard_header()
result = falcontest.simulate_get(url, headers=hdr, query_string='subtaskerrors=true')
assert result.status == falcon.HTTP_200
response_json = json.loads(result.text)
assert response_json['task_id'] == '11111111-1111-1111-1111-111111111111'
assert response_json['subtask_errors'] == {}
def test_get_tasks_id_subtaskerror_errors_resp(self, falcontest):
url = '/api/v1.0/tasks/11111111-1111-1111-1111-111111111113'
hdr = self.get_standard_header()
result = falcontest.simulate_get(url, headers=hdr, query_string='subtaskerrors=true')
assert result.status == falcon.HTTP_200
response_json = json.loads(result.text)
assert response_json['task_id'] == '11111111-1111-1111-1111-111111111113'
assert response_json['subtask_errors']['11111111-1111-1111-1111-111111111116']['details']['errorCount'] == 1
def test_get_tasks_id_builddata_resp(self, falcontest):
url = '/api/v1.0/tasks/11111111-1111-1111-1111-111111111111'
hdr = self.get_standard_header()
result = falcontest.simulate_get(url, headers=hdr, query_string='builddata=true')
LOG.debug(result.text)
assert result.status == falcon.HTTP_200
response_json = json.loads(result.text)
assert response_json['build_data']
try:
response_json['subtask_errors']
key_error = False
except KeyError as ex:
key_error = True
assert key_error
def test_get_tasks_id_builddata_subtaskerrors_resp(self, falcontest):
url = '/api/v1.0/tasks/11111111-1111-1111-1111-111111111111'
hdr = self.get_standard_header()
result = falcontest.simulate_get(url, headers=hdr, query_string='builddata=true&subtaskerrors=true')
LOG.debug(result.text)
assert result.status == falcon.HTTP_200
response_json = json.loads(result.text)
assert response_json['build_data']
assert response_json['subtask_errors'] == {}
def test_get_tasks_id_layers_resp(self, falcontest):
url = '/api/v1.0/tasks/11111111-1111-1111-1111-111111111113'
hdr = self.get_standard_header()
result = falcontest.simulate_get(url, headers=hdr, query_string='layers=2')
LOG.debug(result.text)
assert result.status == falcon.HTTP_200
response_json = json.loads(result.text)
init_task_id = '11111111-1111-1111-1111-111111111113'
sub_task_id_1 = '11111111-1111-1111-1111-111111111114'
sub_task_id_2 = '11111111-1111-1111-1111-111111111115'
assert response_json['init_task_id'] == init_task_id
assert response_json[init_task_id]['task_id'] == init_task_id
assert response_json[sub_task_id_1]['task_id'] == sub_task_id_1
assert response_json[sub_task_id_2]['task_id'] == sub_task_id_2
try:
response_json['11111111-1111-1111-1111-111111111116']
key_error = False
except KeyError as ex:
key_error = True
assert key_error
def test_get_tasks_id_layers_all_noerrors_resp(self, falcontest):
url = '/api/v1.0/tasks/11111111-1111-1111-1111-111111111113'
hdr = self.get_standard_header()
result = falcontest.simulate_get(url, headers=hdr, query_string='layers=-1')
LOG.debug(result.text)
assert result.status == falcon.HTTP_200
response_json = json.loads(result.text)
init_task_id = '11111111-1111-1111-1111-111111111113'
sub_task_id_1 = '11111111-1111-1111-1111-111111111114'
sub_task_id_2 = '11111111-1111-1111-1111-111111111115'
assert response_json['init_task_id'] == init_task_id
assert response_json[init_task_id]['task_id'] == init_task_id
assert response_json[sub_task_id_1]['task_id'] == sub_task_id_1
assert response_json[sub_task_id_2]['task_id'] == sub_task_id_2
try:
response_json['11111111-1111-1111-1111-111111111116']
key_error = False
except KeyError as ex:
key_error = True
assert key_error is False
try:
response_json['subtask_errors']
key_error = False
except KeyError as ex:
key_error = True
assert key_error
def test_get_tasks_id_layers_all_errors_resp(self, falcontest):
url = '/api/v1.0/tasks/11111111-1111-1111-1111-111111111113'
hdr = self.get_standard_header()
result = falcontest.simulate_get(url, headers=hdr, query_string='layers=-1&subtaskerrors=true')
LOG.debug(result.text)
assert result.status == falcon.HTTP_200
response_json = json.loads(result.text)
init_task_id = '11111111-1111-1111-1111-111111111113'
sub_task_id_1 = '11111111-1111-1111-1111-111111111114'
sub_task_id_2 = '11111111-1111-1111-1111-111111111115'
assert response_json['init_task_id'] == init_task_id
assert response_json[init_task_id]['task_id'] == init_task_id
assert response_json[sub_task_id_1]['task_id'] == sub_task_id_1
assert response_json[sub_task_id_2]['task_id'] == sub_task_id_2
try:
response_json['11111111-1111-1111-1111-111111111116']
key_error = False
except KeyError as ex:
key_error = True
assert key_error is False
assert response_json['subtask_errors']['11111111-1111-1111-1111-111111111116']['details']['errorCount'] == 1
def test_input_not_found(self, falcontest):
url = '/api/v1.0/tasks/11111111-1111-1111-1111-111111111112'
hdr = self.get_standard_header()
result = falcontest.simulate_get(url, headers=hdr)
LOG.debug(result.text)
assert result.status == falcon.HTTP_404
@pytest.fixture()
def falcontest(self, drydock_state, deckhand_ingester,
deckhand_orchestrator, mock_get_build_data, mock_get_task):
"""Create a test harness for the the Falcon API framework."""
policy.policy_engine = policy.DrydockPolicy()
policy.policy_engine.register_policy()
return testing.TestClient(
start_api(
state_manager=drydock_state,
ingester=deckhand_ingester,
orchestrator=deckhand_orchestrator))
def get_standard_header(self):
hdr = {
'Content-Type': 'application/json',
'X-IDENTITY-STATUS': 'Confirmed',
'X-USER-NAME': 'Test',
'X-ROLES': 'admin'
}
return hdr
@pytest.fixture()
def mock_get_task(drydock_state):
def side_effect(*args):
task_id = str(args[0])
LOG.debug(task_id)
# Basic task
if task_id == '11111111-1111-1111-1111-111111111111':
new_task = objects.Task()
new_task.task_id = '11111111-1111-1111-1111-111111111111'
new_task.result = objects.TaskStatus()
new_task.result.set_status(hd_fields.ActionResult.Failure)
new_task.result.add_status_msg(msg='Test', error=True, ctx_type='N/A', ctx='N/A')
return new_task
# Task not found
if task_id == '11111111-1111-1111-1111-111111111112':
return None
# Task layers
if task_id == '11111111-1111-1111-1111-111111111113':
new_task = objects.Task()
new_task.task_id = '11111111-1111-1111-1111-111111111113'
new_task.subtask_id_list = ['11111111-1111-1111-1111-111111111114',
'11111111-1111-1111-1111-111111111115']
return new_task
if task_id == '11111111-1111-1111-1111-111111111114':
new_task = objects.Task()
new_task.task_id = '11111111-1111-1111-1111-111111111114'
return new_task
if task_id == '11111111-1111-1111-1111-111111111115':
new_task = objects.Task()
new_task.task_id = '11111111-1111-1111-1111-111111111115'
new_task.subtask_id_list = ['11111111-1111-1111-1111-111111111116',
'11111111-1111-1111-1111-111111111117']
return new_task
if task_id == '11111111-1111-1111-1111-111111111116':
new_task = objects.Task()
new_task.task_id = '11111111-1111-1111-1111-111111111116'
new_task.result = objects.TaskStatus()
new_task.result.set_status(hd_fields.ActionResult.Failure)
new_task.result.add_status_msg(msg='Test', error=True, ctx_type='N/A', ctx='N/A')
LOG.debug('error_count')
LOG.debug(new_task.result.error_count)
return new_task
LOG.debug('returning None')
return None
drydock_state.real_get_task = drydock_state.get_task
drydock_state.get_task = Mock(side_effect=side_effect)
yield
drydock_state.get_task = Mock(wraps=None, side_effect=None)
drydock_state.get_task = drydock_state.real_get_task
| 41.405303 | 116 | 0.664989 | 1,403 | 10,931 | 4.926586 | 0.139701 | 0.094907 | 0.094907 | 0.118634 | 0.768519 | 0.746672 | 0.727286 | 0.717737 | 0.716869 | 0.677228 | 0 | 0.166049 | 0.234745 | 10,931 | 263 | 117 | 41.562738 | 0.660251 | 0.064221 | 0 | 0.642512 | 0 | 0 | 0.21131 | 0.164755 | 0 | 0 | 0 | 0 | 0.178744 | 1 | 0.062802 | false | 0 | 0.048309 | 0 | 0.15942 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
a21ac58aa7cde96c022982c685f57ff35c3f534d | 39 | py | Python | models/cells/DummyTest/__init__.py | HarshKhilawala/cerebmodels | d2a2f2ef947ef9dc23ddce6e55159240cd3233cb | [
"BSD-3-Clause"
] | null | null | null | models/cells/DummyTest/__init__.py | HarshKhilawala/cerebmodels | d2a2f2ef947ef9dc23ddce6e55159240cd3233cb | [
"BSD-3-Clause"
] | 9 | 2020-03-24T17:09:03.000Z | 2021-05-17T16:11:17.000Z | models/cells/DummyTest/__init__.py | myHBPwork/cerebmodels | 371ea7f1bbe388f1acade17c7128b8ca6ab8fb7a | [
"BSD-3-Clause"
] | 1 | 2021-05-21T03:08:41.000Z | 2021-05-21T03:08:41.000Z | # ~/models/cells/DummyTest/__init__.py
| 19.5 | 38 | 0.769231 | 5 | 39 | 5.2 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.051282 | 39 | 1 | 39 | 39 | 0.702703 | 0.923077 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
bf716f21cae6e7398c62c80ff1921c835f26e173 | 20 | py | Python | examples/tuple/ex1.py | mcorne/python-by-example | 15339c0909c84b51075587a6a66391100971c033 | [
"MIT"
] | null | null | null | examples/tuple/ex1.py | mcorne/python-by-example | 15339c0909c84b51075587a6a66391100971c033 | [
"MIT"
] | null | null | null | examples/tuple/ex1.py | mcorne/python-by-example | 15339c0909c84b51075587a6a66391100971c033 | [
"MIT"
] | null | null | null | print(tuple('abc'))
| 10 | 19 | 0.65 | 3 | 20 | 4.333333 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.05 | 20 | 1 | 20 | 20 | 0.684211 | 0 | 0 | 0 | 0 | 0 | 0.15 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
bf7caf580b55a96b998792695efa69fe5538c151 | 200 | py | Python | models_manager.py | pdefromont/test_panda3d | c8db5e0aa979ebece91bfa754cee145293e87e3e | [
"MIT"
] | null | null | null | models_manager.py | pdefromont/test_panda3d | c8db5e0aa979ebece91bfa754cee145293e87e3e | [
"MIT"
] | null | null | null | models_manager.py | pdefromont/test_panda3d | c8db5e0aa979ebece91bfa754cee145293e87e3e | [
"MIT"
] | null | null | null |
class ModelManager:
def __init__(self, main_engine):
self.engine = main_engine
self.loader = self.engine.loader
def spawn(self, model_path, snap_to_grid=True):
pass
| 20 | 51 | 0.66 | 26 | 200 | 4.730769 | 0.615385 | 0.162602 | 0.227642 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.255 | 200 | 9 | 52 | 22.222222 | 0.825503 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.333333 | false | 0.166667 | 0 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 5 |
bf7f58415e46693852f05e6ce87d221d446f6dd6 | 192 | py | Python | _modules/utils/cache/patch_response_headers/views.py | looking-for-a-job/django-examples | dfafa450668cac5c0351f6c7238b8886511229bf | [
"Unlicense"
] | null | null | null | _modules/utils/cache/patch_response_headers/views.py | looking-for-a-job/django-examples | dfafa450668cac5c0351f6c7238b8886511229bf | [
"Unlicense"
] | null | null | null | _modules/utils/cache/patch_response_headers/views.py | looking-for-a-job/django-examples | dfafa450668cac5c0351f6c7238b8886511229bf | [
"Unlicense"
] | null | null | null | from django.http import HttpResponse
from django.views.decorators.cache import cache_control
@cache_control(max_age=3600)
def my_view(request):
return HttpResponse("return this string")
| 24 | 55 | 0.8125 | 27 | 192 | 5.62963 | 0.703704 | 0.131579 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.023392 | 0.109375 | 192 | 7 | 56 | 27.428571 | 0.865497 | 0 | 0 | 0 | 0 | 0 | 0.09375 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | false | 0 | 0.4 | 0.2 | 0.8 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 5 |
bf9b0b859e68203def453978ebfb186974461160 | 944 | py | Python | tests/unit/test_message.py | EclipseTrading/ksnap | d882cfe47cdfd3e9594ed0396dbaa3cbf8efd057 | [
"MIT"
] | 2 | 2020-06-26T06:59:32.000Z | 2021-06-03T17:28:17.000Z | tests/unit/test_message.py | EclipseTrading/ksnap | d882cfe47cdfd3e9594ed0396dbaa3cbf8efd057 | [
"MIT"
] | 9 | 2020-07-03T08:42:38.000Z | 2021-10-05T08:04:40.000Z | tests/unit/test_message.py | EclipseTrading/ksnap | d882cfe47cdfd3e9594ed0396dbaa3cbf8efd057 | [
"MIT"
] | 2 | 2020-11-02T18:26:08.000Z | 2021-03-23T06:44:58.000Z | from ksnap.message import Message
def test_message_to_row():
msg = Message(100, 'key_1', 'val_1', 123456789, [('key_1', b'val_1'), ('key_2', None)])
row = msg.to_row()
assert len(row) == 5
assert row == (100, 'key_1', 'val_1', 123456789, '[{"key": "key_1", "val": "dmFsXzE="}, {"key": "key_2", "val": null}]')
def test_message_from_row():
msg = Message.from_row(100, 'key_1', 'val_1', 123456789, None)
assert msg
assert msg.offset == 100
assert msg.key == 'key_1'
assert msg.value == 'val_1'
assert msg.timestamp == 123456789
assert msg.headers is None
msg = Message.from_row(100, 'key_1', 'val_1', 123456789, '[{"key": "key_1", "val": "dmFsXzE="}, {"key": "key_2", "val": null}]')
assert msg
assert msg.offset == 100
assert msg.key == 'key_1'
assert msg.value == 'val_1'
assert msg.timestamp == 123456789
assert msg.headers == [('key_1', b'val_1'), ('key_2', None)]
| 34.962963 | 132 | 0.604873 | 144 | 944 | 3.75 | 0.1875 | 0.2 | 0.077778 | 0.074074 | 0.77963 | 0.77963 | 0.77963 | 0.742593 | 0.67963 | 0.67963 | 0 | 0.125165 | 0.195975 | 944 | 26 | 133 | 36.307692 | 0.586298 | 0 | 0 | 0.47619 | 0 | 0.095238 | 0.239407 | 0 | 0 | 0 | 0 | 0 | 0.666667 | 1 | 0.095238 | false | 0 | 0.047619 | 0 | 0.142857 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
bfa0c015545d5847022dc4554e43ebdf29294e0e | 184 | py | Python | website/admin.py | p-koskey/awwards | 9738a7260c3fd401707990124edf2e321b3d2a43 | [
"MIT",
"Unlicense"
] | null | null | null | website/admin.py | p-koskey/awwards | 9738a7260c3fd401707990124edf2e321b3d2a43 | [
"MIT",
"Unlicense"
] | null | null | null | website/admin.py | p-koskey/awwards | 9738a7260c3fd401707990124edf2e321b3d2a43 | [
"MIT",
"Unlicense"
] | null | null | null | from django.contrib import admin
from .models import Profile, Post, Rate
# Register your models here.
admin.site.register(Profile)
admin.site.register(Post)
admin.site.register(Rate)
| 23 | 39 | 0.798913 | 27 | 184 | 5.444444 | 0.481481 | 0.183673 | 0.346939 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.103261 | 184 | 7 | 40 | 26.285714 | 0.890909 | 0.141304 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.4 | 0 | 0.4 | 0 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
781de6dc9a04fb60e9e6964b7130044f07e99b90 | 363 | py | Python | capstone/capapi/__init__.py | rachelaus/capstone | 2affa02706f9b1a99d032c66f258a7421c40a35e | [
"MIT"
] | 134 | 2017-07-12T17:03:06.000Z | 2022-03-27T06:38:29.000Z | capstone/capapi/__init__.py | rachelaus/capstone | 2affa02706f9b1a99d032c66f258a7421c40a35e | [
"MIT"
] | 1,362 | 2017-06-22T17:42:49.000Z | 2022-03-31T15:28:00.000Z | capstone/capapi/__init__.py | rachelaus/capstone | 2affa02706f9b1a99d032c66f258a7421c40a35e | [
"MIT"
] | 38 | 2017-06-22T14:46:23.000Z | 2022-03-16T05:32:54.000Z | import django.shortcuts
import rest_framework.reverse
from capapi.resources import api_reverse
from capweb.helpers import reverse
# Monkeypatch rest_framework.reverse._reverse to use our api_reverse function
rest_framework.reverse._reverse = api_reverse
# Monkeypatch django.shortcuts.resolve_url to use our reverse function
django.shortcuts.reverse = reverse
| 30.25 | 77 | 0.853994 | 49 | 363 | 6.142857 | 0.387755 | 0.149502 | 0.199336 | 0.179402 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.101928 | 363 | 11 | 78 | 33 | 0.923313 | 0.396694 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.666667 | 0 | 0.666667 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
783a180895c2fae0a05bfc5543adf8b9681dd03b | 221 | py | Python | itbit.py | Tulip-HFT/market-crawler | a6572459a1b6dd1609d61e01c01f197911c8b144 | [
"MIT"
] | null | null | null | itbit.py | Tulip-HFT/market-crawler | a6572459a1b6dd1609d61e01c01f197911c8b144 | [
"MIT"
] | null | null | null | itbit.py | Tulip-HFT/market-crawler | a6572459a1b6dd1609d61e01c01f197911c8b144 | [
"MIT"
] | null | null | null | import interface
class Itbit(interface.MarketExplorer):
def __init__(self):
pass
def exchange_name(self):
return 'itbit'
def markets(self):
return ['btc/usd', 'btc/sgd', 'btc/eur']
| 17 | 48 | 0.615385 | 26 | 221 | 5.038462 | 0.653846 | 0.152672 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.257919 | 221 | 12 | 49 | 18.416667 | 0.79878 | 0 | 0 | 0 | 0 | 0 | 0.118182 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.375 | false | 0.125 | 0.125 | 0.25 | 0.875 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 0 | 0 | 5 |
7858b3e7858d94546c44d41a270082613f001d35 | 39 | py | Python | __main__.py | sebastianschramm/calendar_api | 88e2f59ed23b48d7b270bba50c0cdc6ea3b1f412 | [
"Apache-2.0"
] | null | null | null | __main__.py | sebastianschramm/calendar_api | 88e2f59ed23b48d7b270bba50c0cdc6ea3b1f412 | [
"Apache-2.0"
] | null | null | null | __main__.py | sebastianschramm/calendar_api | 88e2f59ed23b48d7b270bba50c0cdc6ea3b1f412 | [
"Apache-2.0"
] | null | null | null | from app.webserver import main
main()
| 9.75 | 30 | 0.769231 | 6 | 39 | 5 | 0.833333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.153846 | 39 | 3 | 31 | 13 | 0.909091 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
786ba1f00ebd1a017c1c70ca0fc063ff47f6fd53 | 12,899 | py | Python | tests/conftest.py | emcek/pyerge | f89924ca7091f262869cedfcbb8c982145cfa3a3 | [
"MIT"
] | null | null | null | tests/conftest.py | emcek/pyerge | f89924ca7091f262869cedfcbb8c982145cfa3a3 | [
"MIT"
] | 30 | 2021-11-29T13:47:26.000Z | 2022-01-15T07:51:24.000Z | tests/conftest.py | emcek/pyerge | f89924ca7091f262869cedfcbb8c982145cfa3a3 | [
"MIT"
] | 2 | 2019-04-27T19:27:11.000Z | 2019-08-23T14:57:04.000Z | from pytest import fixture
@fixture
def str_no_sync():
return """1548194358: === sync
1548194358: >>> Syncing repository 'gentoo' into '/usr/portage'...
1548194361: >>> Starting rsync with rsync://[2a01:90:200:10::1a]/gentoo-portage"""
@fixture
def str_sync():
return """1548194361: >>> Starting rsync with rsync://[2a01:90:200:10::1a]/gentoo-portage
1548194466: === Sync completed for gentoo
1548194466: *** terminating."""
@fixture
def str_curr():
return """1571086865: *** emerge --nospinner --oneshot sys-kernel/linux-firmware
1571086944: >>> emerge (1 of 1) sys-kernel/linux-firmware-20191008 to /
1571086944: === (1 of 1) Cleaning (sys-kernel/linux-firmware-20191008::/usr/portage/sys-kernel/linux-firmware/linux-firmware-20191008.ebuild)
1571086985: === (1 of 1) Compiling/Merging (sys-kernel/linux-firmware-20191008::/usr/portage/sys-kernel/linux-firmware/linux-firmware-20191008.ebuild)
1571086996: === (1 of 1) Merging (sys-kernel/linux-firmware-20191008::/usr/portage/sys-kernel/linux-firmware/linux-firmware-20191008.ebuild)
1571087012: >>> AUTOCLEAN: sys-kernel/linux-firmware:0
1571087012: === Unmerging... (sys-kernel/linux-firmware-20191004)"""
@fixture
def str_curr_empty():
return """1571086865: *** emerge --nospinner --oneshot sys-kernel/linux-firmware
1571086944: >>> emerge (1 of 1) sys-kernel/linux-firmware-20191008 to /
1571086944: === (1 of 1) Cleaning (sys-kernel/linux-firmware-20191008::/usr/portage/sys-kernel/linux-firmware/linux-firmware-20191008.ebuild)
1571086996: === (1 of 1) Merging (sys-kernel/linux-firmware-20191008::/usr/portage/sys-kernel/linux-firmware/linux-firmware-20191008.ebuild)
1571087012: >>> AUTOCLEAN: sys-kernel/linux-firmware:0
1571087012: === Unmerging... (sys-kernel/linux-firmware-20191004)"""
@fixture
def str_dl_gt_0():
return """[ebuild U ] xfce-extra/thunar-archive-plugin-0.4.0::gentoo [0.3.1-r3::gentoo] 342 KiB
[ebuild U ] xfce-extra/thunar-shares-plugin-0.3.0::gentoo [0.2.0_p20101105-r1::gentoo] 333 KiB
[ebuild U ] xfce-base/xfce4-meta-4.14-r1::gentoo [4.12-r1::gentoo] USE="svg upower%* -minimal" 0 KiB
Total: 44 packages (42 upgrades, 2 new), Size of downloads: 283,699 KiB
"""
@fixture
def str_dl_eq_0():
return "Total: 0 packages, Size of downloads: 0 KiB"
@fixture
def str_dl_unknown():
return ""
@fixture
def str_eut():
return """[ebuild U ] xfce-base/xfdesktop-4.14.1::gentoo [4.12.4::gentoo] USE="libnotify thunar -debug" 1,498 KiB
[ebuild U ] xfce-extra/thunar-archive-plugin-0.4.0::gentoo [0.3.1-r3::gentoo] 342 KiB
[ebuild U ] xfce-extra/thunar-shares-plugin-0.3.0::gentoo [0.2.0_p20101105-r1::gentoo] 333 KiB
[ebuild U ] xfce-base/xfce4-meta-4.14-r1::gentoo [4.12-r1::gentoo] USE="svg upower%* -minimal" 0 KiB
!!! Error: couldn't get previous merge of libXpresent; skipping...
Estimated update time: 1 hour, 9 minutes.
"""
@fixture
def str_eut_unknown():
return """[ebuild U ] xfce-base/xfdesktop-4.14.1::gentoo [4.12.4::gentoo] USE="libnotify thunar -debug" 1,498 KiB
[ebuild U ] xfce-extra/thunar-archive-plugin-0.4.0::gentoo [0.3.1-r3::gentoo] 342 KiB
[ebuild U ] xfce-extra/thunar-shares-plugin-0.3.0::gentoo [0.2.0_p20101105-r1::gentoo] 333 KiB
[ebuild U ] xfce-base/xfce4-meta-4.14-r1::gentoo [4.12-r1::gentoo] USE="svg upower%* -minimal" 0 KiB
!!! Error: couldn't get previous merge of libXpresent; skipping...
"""
@fixture
def orginal_html_xml():
html = b'<?xml version="1.0" encoding="UTF-8"?>\n<rdf:RDF xmlns="http://purl.org/rss/1.0/"\n ' \
b'xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"\n ' \
b'xmlns:content="http://purl.org/rss/1.0/modules/content/"\n ' \
b'xmlns:dc="http://purl.org/dc/elements/1.1/"\n ' \
b'xmlns:image="http://purl.org/rss/1.0/modules/image/"\n ' \
b'xmlns:slash="http://purl.org/rss/1.0/modules/slash/"\n ' \
b'xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"\n ' \
b'xmlns:taxo="http://purl.org/rss/1.0/modules/taxonomy/"\n ' \
b'xmlns:trackback="http://madskills.com/public/xml/rss/module/trackback/">\n' \
b'<channel rdf:about="https://security.gentoo.org/glsa">\n ' \
b'<title>Gentoo Linux security advisories</title>\n ' \
b'<link>https://security.gentoo.org/glsa</link>\n ' \
b'<description>This feed contains new Gentoo Linux security advisories. ' \
b'Contact security@gentoo.org with questions.</description>\n' \
b'<items>\n <rdf:Seq>\n' \
b'<rdf:li resource="https://security.gentoo.org/glsa/201904-25"/>\n' \
b'<rdf:li resource="https://security.gentoo.org/glsa/201904-24"/>\n' \
b'<rdf:li resource="https://security.gentoo.org/glsa/201904-23"/>\n' \
b'</items>\n <dc:date>2019-04-24T00:00:00+00:00</dc:date>\n </channel>\n' \
b'<item rdf:about="https://security.gentoo.org/glsa/201904-25">\n ' \
b'<title>GLSA 201904-25: QEMU: Multiple vulnerabilities</title>\n ' \
b'<link>https://security.gentoo.org/glsa/201904-25</link>\n ' \
b'<dc:date>2019-04-24T00:00:00+00:00</dc:date>\n </item>\n' \
b'<item rdf:about="https://security.gentoo.org/glsa/201904-24">\n ' \
b'<title>GLSA 201904-24: Ming: Multiple vulnerabilities</title>\n ' \
b'<link>https://security.gentoo.org/glsa/201904-24</link>\n ' \
b'<dc:date>2019-04-24T00:00:00+00:00</dc:date>\n </item>\n' \
b'<item rdf:about="https://security.gentoo.org/glsa/201904-23">\n ' \
b'<title>GLSA 201904-23: GLib: Multiple vulnerabilities</title>\n ' \
b'<link>https://security.gentoo.org/glsa/201904-23</link>\n ' \
b'<dc:date>2019-04-22T00:00:00+00:00</dc:date>\n </item>\n' \
b'</rdf:RDF>'
return html
@fixture()
def html_xlm_as_str():
return """
<?xml version="1.0" encoding="UTF-8"?>
<rdf:RDF xmlns="http://purl.org/rss/1.0/"
xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"
xmlns:content="http://purl.org/rss/1.0/modules/content/"
xmlns:dc="http://purl.org/dc/elements/1.1/"
xmlns:image="http://purl.org/rss/1.0/modules/image/"
xmlns:slash="http://purl.org/rss/1.0/modules/slash/"
xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
xmlns:taxo="http://purl.org/rss/1.0/modules/taxonomy/"
xmlns:trackback="http://madskills.com/public/xml/rss/module/trackback/">
<channel rdf:about="https://security.gentoo.org/glsa">
<title>Gentoo Linux security advisories</title>
<link>https://security.gentoo.org/glsa</link>
<description>This feed contains new Gentoo Linux security advisories. Contact security@gentoo.org with questions.</description>
<items>
<rdf:Seq>
<rdf:li resource="https://security.gentoo.org/glsa/201904-23"/>
<rdf:li resource="https://security.gentoo.org/glsa/201904-22"/>
</rdf:Seq>
</items>
<dc:date>2019-04-24T00:00:00+00:00</dc:date>
</channel>
<item rdf:about="https://security.gentoo.org/glsa/201904-23">
<title>GLSA 201904-23: GLib: Multiple vulnerabilities</title>
<link>https://security.gentoo.org/glsa/201904-23</link>
<dc:date>2019-04-22T00:00:00+00:00</dc:date>
</item>
<item rdf:about="https://security.gentoo.org/glsa/201904-22">
<title>GLSA 201904-22: OpenDKIM: Root privilege escalation</title>
<link>https://security.gentoo.org/glsa/201904-22</link>
<dc:date>2019-04-22T00:00:00+00:00</dc:date>
</item>
</rdf:RDF>
"""
@fixture()
def opt_emerge_nonlocal_with_1g():
from argparse import Namespace
return Namespace(action='emerge', local=False, size='1G', verbose=2)
@fixture
def str_e_upd_calc():
return """"""
@fixture
def str_e_upd_none():
return "'Total: 0 packages, Size of downloads: 0 KiB'"
@fixture
def str_e_upd_total():
return """[blocks b ] kde-apps/kcalcore:5 ("kde-apps/kcalcore:5" is blocking kde-frameworks/kcalendarcore-5.64.0)
[ebuild U ] kde-apps/libkgapi-19.08.3:5::gentoo [19.04.3:5::gentoo] USE="nls -debug -test" 229 KiB
[ebuild U ] kde-misc/kio-gdrive-1.2.7:5::gentoo [1.2.6:5::gentoo] USE="handbook kaccounts -debug -test" 46 KiB
Total: 347 packages (327 upgrades, 10 new, 1 in new slot, 9 reinstalls, 2 uninstalls), Size of downloads: 642,505 KiB
"""
@fixture
def str_e_upd_conflict():
return """[blocks b ] kde-apps/kcalcore:5 ("kde-apps/kcalcore:5" is blocking kde-frameworks/kcalendarcore-5.64.0)
[ebuild U ] kde-apps/libkgapi-19.08.3:5::gentoo [19.04.3:5::gentoo] USE="nls -debug -test" 229 KiB
[ebuild U ] kde-misc/kio-gdrive-1.2.7:5::gentoo [1.2.6:5::gentoo] USE="handbook kaccounts -debug -test" 46 KiB
Total: 347 packages (327 upgrades, 10 new, 2 in new slots, 9 reinstalls, 2 uninstalls), Size of downloads: 642,505 KiB
Conflict: 2 blocks
"""
@fixture
def str_e_prog_5_6():
return """1637618618: >>> emerge (5 of 6) www-client/vivaldi-4.3.2439.71-r1 to /
1637618618: === (5 of 6) Cleaning (www-client/vivaldi-4.3.2439.71-r1::/usr/portage/www-client/vivaldi/vivaldi-4.3.2439.71-r1.ebuild)
1637618619: === (5 of 6) Compiling/Merging (www-client/vivaldi-4.3.2439.71-r1::/usr/portage/www-client/vivaldi/vivaldi-4.3.2439.71-r1.ebuild)
1637618637: === (5 of 6) Merging (www-client/vivaldi-4.3.2439.71-r1::/usr/portage/www-client/vivaldi/vivaldi-4.3.2439.71-r1.ebuild)
1637618646: >>> AUTOCLEAN: www-client/vivaldi:0
1637618646: === Unmerging... (www-client/vivaldi-4.3.2439.63)
1637618651: >>> unmerge success: www-client/vivaldi-4.3.2439.63
1637618659: === (5 of 6) Post-Build Cleaning (www-client/vivaldi-4.3.2439.71-r1::/usr/portage/www-client/vivaldi/vivaldi-4.3.2439.71-r1.ebuild)
1637618659: ::: completed emerge (5 of 6) www-client/vivaldi-4.3.2439.71-r1 to /"""
@fixture
def str_e_prog_1_1():
return """1637631921: *** emerge --regex-search-auto=y dev-python/pyerge
1637631930: >>> emerge (1 of 1) dev-python/pyerge-0.4.0 to /
1637631930: === (1 of 1) Cleaning (dev-python/pyerge-0.4.0::/usr/local/portage/dev-python/pyerge/pyerge-0.4.0.ebuild)
1637631930: === (1 of 1) Compiling/Merging (dev-python/pyerge-0.4.0::/usr/local/portage/dev-python/pyerge/pyerge-0.4.0.ebuild)
1637631937: === (1 of 1) Merging (dev-python/pyerge-0.4.0::/usr/local/portage/dev-python/pyerge/pyerge-0.4.0.ebuild)
1637631941: >>> AUTOCLEAN: dev-python/pyerge:0"""
@fixture
def str_e_sta_compiling():
return """sr/portage/dev-perl/Mozilla-CA/Mozilla-CA-20999999-r1.ebuild)
1637618600: === (4 of 6) Compiling/Merging (dev-perl/Mozilla-CA-20999999-r1::/usr/portage/dev-perl/Mozilla-CA/Mozilla-CA-20999999-r1.ebuild)
1637618606: === (4 of """
@fixture
def str_e_sta_cleaning():
return """Compat-0.130.0-r1 to /
1637618599: === (4 of 6) Cleaning (dev-perl/Mozilla-CA-20999999-r1::/usr/portage/dev-perl/Mozilla-CA/Mozilla-CA-20999999-r1.ebuild)
1637618600: === (4 of 6)"""
@fixture
def str_e_sta_autoclean():
return """hesis-6.25.0::/usr/portage/dev-python/hypothesis/hypothesis-6.25.0.ebuild)
1637618672: >>> AUTOCLEAN: dev-python/hypothesis:0
1637618672: === """
@fixture
def str_e_sta_completed_emerge():
return """v-perl/Mozilla-CA/Mozilla-CA-20999999-r1.ebuild)
1637618618: ::: completed emerge (4 of 6) dev-perl/Mozilla-CA-20999999-r1 to /
1637618618: === (5 of 6"""
@fixture
def str_e_sta_finished():
return """othesis-6.25.0 to /
1637618682: *** Finished. Cleaning up...
1637618686: *** terminating.
1637631776: *** em"""
@fixture
def str_e_sta_starting_rsync():
return """pository 'gentoo' into '/usr/portage'...
1548195587: >>> Starting rsync with rsync://[2a00:1828:a00d:ffff::6]/gentoo-portage
1548195642: === Sync com"""
@fixture
def str_e_sta_sync_completed():
return """1604197444: >>> Syncing repository 'gentoo' into '/usr/portage'...
1604197446: >>> Starting rsync with rsync://[2001:470:1f14:104f::2]/gentoo-portage
1604197788: === Sync completed for gentoo
1604197788: >>> Syncing repository 'tor"""
@fixture
def str_e_sta_unmerging():
return """perl/Mozilla-CA:0
1637618610: === Unmerging... (dev-perl/Mozilla-CA-20999999)
1637618618: === (4 of 6"""
@fixture
def str_e_sta_merging():
return """zilla-CA-20999999-r1::/usr/portage/dev-perl/Mozilla-CA/Mozilla-CA-20999999-r1.ebuild)
1637618606: === (4 of 6) Merging (dev-perl/Mozilla-CA-20999999-r1::/usr/portage/dev-perl/Mozilla-CA/Mozilla-CA-20999999-r1.ebuild)
1637618610: >>>"""
@fixture
def str_e_sta_unmerge():
return """erging... (dev-perl/Tie-IxHash-1.230.0)
1604167130: >>> unmerge success: dev-perl/Tie-IxHash-1.230.0
1604167130: *** exiting successfully.
1604167131: *** terminating."""
@fixture
def str_e_sta_unknown():
return """portage/eix:0
1548195548: === (3 of 3) Updating world file (app-portage/eix-0.33.5)
1548195548: === (3 of 3) Post-Build Cle"""
| 43.430976 | 151 | 0.672843 | 2,006 | 12,899 | 4.284148 | 0.159023 | 0.006982 | 0.03933 | 0.048639 | 0.775076 | 0.739469 | 0.712241 | 0.681173 | 0.642658 | 0.594019 | 0 | 0.151172 | 0.13691 | 12,899 | 296 | 152 | 43.577703 | 0.620767 | 0 | 0 | 0.306034 | 0 | 0.297414 | 0.83115 | 0.292658 | 0 | 0 | 0 | 0 | 0 | 1 | 0.125 | false | 0 | 0.008621 | 0.116379 | 0.258621 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 5 |
7873702395dfc58ec1d7fe7e2c0672cda7e5b394 | 464 | py | Python | pysol/io/Output.py | lotfio/pysol | 34fac6d1ec246a7a037d8237e00974a9a9548faa | [
"MIT"
] | 2 | 2019-10-09T21:58:20.000Z | 2020-01-08T07:29:28.000Z | pysol/io/Output.py | lotfio/pysol | 34fac6d1ec246a7a037d8237e00974a9a9548faa | [
"MIT"
] | null | null | null | pysol/io/Output.py | lotfio/pysol | 34fac6d1ec246a7a037d8237e00974a9a9548faa | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
#| This file is part of cony
#|
#| @package pysol python cli application
#| @author <lotfio lakehal>
#| @license MIT
#| @version 0.1.0
#| @copyright 2019 lotfio lakehal
import sys
class Output:
def __init__(self):
pass
# writeLine method
# this method writes to the output
# TODO::adding colors support
def writeLn(self, line = '', color = 'white'):
return sys.stdout.write(line) | 21.090909 | 50 | 0.609914 | 58 | 464 | 4.810345 | 0.827586 | 0.09319 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.023599 | 0.269397 | 464 | 22 | 51 | 21.090909 | 0.79941 | 0.588362 | 0 | 0 | 0 | 0 | 0.027933 | 0 | 0 | 0 | 0 | 0.045455 | 0 | 1 | 0.333333 | false | 0.166667 | 0.166667 | 0.166667 | 0.833333 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 0 | 0 | 5 |
15ae9f0ce903032fc57703270b8695e08efff1c2 | 102 | py | Python | monitoring-center-backend/monitoring_center/views/__init__.py | Heimdall-monitoring/monitoring-center | acf56a796c25fb6804fd16b1ff8c93645bc77ff3 | [
"MIT"
] | null | null | null | monitoring-center-backend/monitoring_center/views/__init__.py | Heimdall-monitoring/monitoring-center | acf56a796c25fb6804fd16b1ff8c93645bc77ff3 | [
"MIT"
] | 10 | 2020-09-09T14:37:05.000Z | 2020-11-26T13:14:09.000Z | monitoring-center-backend/monitoring_center/views/__init__.py | Heimdall-monitoring/monitoring-center | acf56a796c25fb6804fd16b1ff8c93645bc77ff3 | [
"MIT"
] | null | null | null | """
Handle all views for the application
"""
from .api import API_VIEWS
from .main import MAIN_VIEWS
| 14.571429 | 36 | 0.754902 | 16 | 102 | 4.6875 | 0.625 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.166667 | 102 | 6 | 37 | 17 | 0.882353 | 0.352941 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
ec59846e9803688bdecbaf1a7723610f0e230b5e | 7,652 | py | Python | thorpy/painting/mousecursor.py | YannThorimbert/PyMap2D | c4ddb6bb4651f19b6ad1b4149f38e64de2daf120 | [
"MIT"
] | 27 | 2018-04-05T13:06:22.000Z | 2022-01-24T08:14:47.000Z | thorpy/painting/mousecursor.py | YannThorimbert/PyMap2D | c4ddb6bb4651f19b6ad1b4149f38e64de2daf120 | [
"MIT"
] | 6 | 2019-11-23T07:02:53.000Z | 2021-04-12T19:08:35.000Z | thorpy/painting/mousecursor.py | YannThorimbert/PyMap2D | c4ddb6bb4651f19b6ad1b4149f38e64de2daf120 | [
"MIT"
] | 7 | 2018-11-20T01:01:41.000Z | 2022-01-24T08:14:50.000Z | import pygame
from thorpy.miscgui import constants
# default pygame black arrow
arrow = (
(16,
16),
(0,
0),
(0x00,
0x00,
0x40,
0x00,
0x60,
0x00,
0x70,
0x00,
0x78,
0x00,
0x7C,
0x00,
0x7E,
0x00,
0x7F,
0x00,
0x7F,
0x80,
0x7C,
0x00,
0x6C,
0x00,
0x46,
0x00,
0x06,
0x00,
0x03,
0x00,
0x03,
0x00,
0x00,
0x00),
(0x40,
0x00,
0xE0,
0x00,
0xF0,
0x00,
0xF8,
0x00,
0xFC,
0x00,
0xFE,
0x00,
0xFF,
0x00,
0xFF,
0x80,
0xFF,
0xC0,
0xFF,
0x80,
0xFE,
0x00,
0xEF,
0x00,
0x4F,
0x00,
0x07,
0x80,
0x07,
0x80,
0x03,
0x00))
diamond = ((16, 16), (7, 7),
(0, 0, 1, 0, 3, 128, 7, 192, 14, 224, 28, 112, 56, 56, 112, 28, 56,
56, 28, 112, 14, 224, 7, 192, 3, 128, 1, 0, 0, 0, 0, 0),
(1, 0, 3, 128, 7, 192, 15, 224, 31, 240, 62, 248, 124, 124, 248, 62,
124, 124, 62, 248, 31, 240, 15, 224, 7, 192, 3, 128, 1, 0, 0, 0))
ball = ((16, 16), (7, 7),
(0, 0, 3, 192, 15, 240, 24, 248, 51, 252, 55, 252, 127, 254, 127, 254,
127, 254, 127, 254, 63, 252, 63, 252, 31, 248, 15, 240, 3, 192, 0, 0),
(3, 192, 15, 240, 31, 248, 63, 252, 127, 254, 127, 254, 255, 255, 255,
255, 255, 255, 255, 255, 127, 254, 127, 254, 63, 252, 31, 248, 15, 240,
3, 192))
broken_x = ((16, 16), (7, 7),
(0, 0, 96, 6, 112, 14, 56, 28, 28, 56, 12, 48, 0, 0, 0, 0, 0, 0, 0, 0,
12, 48, 28, 56, 56, 28, 112, 14, 96, 6, 0, 0),
(224, 7, 240, 15, 248, 31, 124, 62, 62, 124, 30, 120, 14, 112, 0, 0, 0,
0, 14, 112, 30, 120, 62, 124, 124, 62, 248, 31, 240, 15, 224, 7))
tri_left = (
(16,
16),
(1,
1),
(0,
0,
96,
0,
120,
0,
62,
0,
63,
128,
31,
224,
31,
248,
15,
254,
15,
254,
7,
128,
7,
128,
3,
128,
3,
128,
1,
128,
1,
128,
0,
0),
(224,
0,
248,
0,
254,
0,
127,
128,
127,
224,
63,
248,
63,
254,
31,
255,
31,
255,
15,
254,
15,
192,
7,
192,
7,
192,
3,
192,
3,
192,
1,
128))
tri_right = (
(16,
16),
(14,
1),
(0,
0,
0,
6,
0,
30,
0,
124,
1,
252,
7,
248,
31,
248,
127,
240,
127,
240,
1,
224,
1,
224,
1,
192,
1,
192,
1,
128,
1,
128,
0,
0),
(0,
7,
0,
31,
0,
127,
1,
254,
7,
254,
31,
252,
127,
252,
255,
248,
255,
248,
127,
240,
3,
240,
3,
224,
3,
224,
3,
192,
3,
192,
1,
128))
tower = ( # sized 24x24
"XXXXXXXXXXXXXXXXXXXXXXXX",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"X X",
"XXXXXXXXXXXXXXXXXXXXXXXX",
)
strings_chablon = ( # sized 24x24
"XX ",
"XXX ",
"XXXX ",
"XX.XX ",
"XX..XX ",
"XX...XX ",
"XX....XX ",
"XX.....XX ",
"XX......XX ",
"XX.......XX ",
"XX........XX ",
"XX........XXX ",
"XX......XXXXX ",
"XX.XXX..XX ",
"XXXX XX..XX ",
"XX XX..XX ",
" XX..XX ",
" XX..XX ",
" XX..XX ",
" XXXX ",
" XX ",
" ",
" ",
" ",
)
strings_sizerX = ( # sized 24x16
" X X ",
" XX XX ",
" X.X X.X ",
" X..X X..X ",
" X...XXXXXXXX...X ",
"X................X ",
" X...XXXXXXXX...X ",
" X..X X..X ",
" X.X X.X ",
" XX XX ",
" X X ",
" ",
" ",
" ",
" ",
" ",
)
strings_sizerY = ( # sized 16x24
" X ",
" X.X ",
" X...X ",
" X.....X ",
" X.......X ",
"XXXXX.XXXXX ",
" X.X ",
" X.X ",
" X.X ",
" X.X ",
" X.X ",
" X.X ",
" X.X ",
"XXXXX.XXXXX ",
" X.......X ",
" X.....X ",
" X...X ",
" X.X ",
" X ",
" ",
" ",
" ",
" ",
" ",
)
strings_sizerXY = ( # sized 24x16
"XXXXXXXX ",
"X.....X ",
"X....X ",
"X...X ",
"X..X.X ",
"X.X X.X ",
"XX X.X X ",
"X X.X XX ",
" X.XX.X ",
" X...X ",
" X...X ",
" X....X ",
" X.....X ",
" XXXXXXXX ",
" ",
" ",
)
strings_txt = ( # sized 8x16
"ooo ooo ",
" o ",
" o ",
" o ",
" o ",
" o ",
" o ",
" o ",
" o ",
" o ",
" o ",
" o ",
" o ",
"ooo ooo ",
" ",
" ",
)
class MouseCursor:
"""Object defining a cursor that can be used in place of the standard mouse
cursor, through the function mousecursor.change_cursor(cursor).
"""
def __init__(self, strings, size, hotspot):
self.strings = strings
self.size = size
self.hotspot = hotspot
def get_cursor(self):
curs, mask = pygame.cursors.compile(self.strings, 'X', '.', 'o')
return (self.size, self.hotspot, curs, mask)
text_cursor = MouseCursor(strings_txt, (8, 16), (0, 0)).get_cursor()
tower_cursor = MouseCursor(tower, (24,24), (0,0)).get_cursor()
cursors = {constants.CURSOR_NORMAL: arrow,
constants.CURSOR_TEXT: text_cursor,
constants.CURSOR_BROKEN: broken_x,
constants.CURSOR_BALL: ball}
def change_cursor(cursor):
if isinstance(cursor, int):
cursor = cursors[cursor]
pygame.mouse.set_cursor(*cursor)
| 19.082294 | 83 | 0.284762 | 770 | 7,652 | 2.794805 | 0.166234 | 0.109665 | 0.14777 | 0.178439 | 0.284387 | 0.276022 | 0.201208 | 0.186338 | 0.153346 | 0.139405 | 0 | 0.276724 | 0.565996 | 7,652 | 400 | 84 | 19.13 | 0.371274 | 0.030711 | 0 | 0.744 | 0 | 0 | 0.329232 | 0.00649 | 0 | 0 | 0.034613 | 0 | 0 | 1 | 0.008 | false | 0 | 0.005333 | 0 | 0.018667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
ec6d16c8255c712a415e8d48321e6e8731775c92 | 125 | py | Python | kloppy/infra/serializers/event/__init__.py | dmallory42/kloppy | 418aae2a7a4e67499cfb74177b830daa38b065b6 | [
"BSD-3-Clause"
] | null | null | null | kloppy/infra/serializers/event/__init__.py | dmallory42/kloppy | 418aae2a7a4e67499cfb74177b830daa38b065b6 | [
"BSD-3-Clause"
] | null | null | null | kloppy/infra/serializers/event/__init__.py | dmallory42/kloppy | 418aae2a7a4e67499cfb74177b830daa38b065b6 | [
"BSD-3-Clause"
] | null | null | null | from .base import EventDataSerializer
#from .metrica import MetricaEventSerializer
from .statsbomb import StatsBombSerializer | 41.666667 | 44 | 0.88 | 12 | 125 | 9.166667 | 0.666667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.088 | 125 | 3 | 45 | 41.666667 | 0.964912 | 0.344 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
ece1f62705f6b8961a679dd0f7b4c4a13dce5f27 | 35 | py | Python | main.py | TheD3vel0per/CoviDonate | 33e85d090bcdae9e317cb1d8a92f286e0874e2e4 | [
"MIT"
] | 3 | 2020-06-14T04:54:38.000Z | 2021-01-24T06:40:46.000Z | main.py | TheD3vel0per/CoviDonate | 33e85d090bcdae9e317cb1d8a92f286e0874e2e4 | [
"MIT"
] | null | null | null | main.py | TheD3vel0per/CoviDonate | 33e85d090bcdae9e317cb1d8a92f286e0874e2e4 | [
"MIT"
] | null | null | null | import server
server.App.app.run() | 11.666667 | 20 | 0.771429 | 6 | 35 | 4.5 | 0.666667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.085714 | 35 | 3 | 20 | 11.666667 | 0.84375 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
ecef896937249c86482ffe819342e20f03a27b3a | 81 | py | Python | terminal-print-codes/clear.py | whitmans-max/python-examples | 881a8f23f0eebc76816a0078e19951893f0daaaa | [
"MIT"
] | 140 | 2017-02-21T22:49:04.000Z | 2022-03-22T17:51:58.000Z | terminal-print-codes/clear.py | whitmans-max/python-examples | 881a8f23f0eebc76816a0078e19951893f0daaaa | [
"MIT"
] | 5 | 2017-12-02T19:55:00.000Z | 2021-09-22T23:18:39.000Z | terminal-print-codes/clear.py | whitmans-max/python-examples | 881a8f23f0eebc76816a0078e19951893f0daaaa | [
"MIT"
] | 79 | 2017-01-25T10:53:33.000Z | 2022-03-11T16:13:57.000Z |
# clear screen
print("\033[2J")
# move to (10,0) (row,col)
print("\033[10;0H")
| 11.571429 | 26 | 0.592593 | 15 | 81 | 3.2 | 0.8 | 0.333333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.188406 | 0.148148 | 81 | 6 | 27 | 13.5 | 0.507246 | 0.45679 | 0 | 0 | 0 | 0 | 0.425 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
01cabd77181128eeef9a62b37165f8b9fd4b2e8f | 57 | py | Python | aft/vesselregistration/models.py | InDeepShip/InDeepShip | 856f868a6c20223a6b0f221158813059a4479264 | [
"MIT"
] | 1 | 2021-01-03T18:59:29.000Z | 2021-01-03T18:59:29.000Z | aft/vesselregistration/models.py | InDeepShip/InDeepShip | 856f868a6c20223a6b0f221158813059a4479264 | [
"MIT"
] | null | null | null | aft/vesselregistration/models.py | InDeepShip/InDeepShip | 856f868a6c20223a6b0f221158813059a4479264 | [
"MIT"
] | null | null | null | from djongo import models
from api.models import Vessel
| 14.25 | 29 | 0.824561 | 9 | 57 | 5.222222 | 0.666667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.157895 | 57 | 3 | 30 | 19 | 0.979167 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
bf00bca317edfb3c693efd56879e24adad2e4eb1 | 13 | py | Python | test/integration/ListLength/list length.py | HighSchoolHacking/GLS-Draft | 9e418b6290e7c8e3f2da87668784bdba1cde5a76 | [
"MIT"
] | 30 | 2019-10-29T12:47:50.000Z | 2022-02-12T06:41:39.000Z | test/integration/ListLength/list length.py | HighSchoolHacking/GLS-Draft | 9e418b6290e7c8e3f2da87668784bdba1cde5a76 | [
"MIT"
] | 247 | 2017-09-21T17:11:18.000Z | 2019-10-08T12:59:07.000Z | test/integration/ListLength/list length.py | HighSchoolHacking/GLS-Draft | 9e418b6290e7c8e3f2da87668784bdba1cde5a76 | [
"MIT"
] | 17 | 2017-10-01T16:53:20.000Z | 2018-11-28T07:20:35.000Z | #
len(foo)
#
| 3.25 | 8 | 0.461538 | 2 | 13 | 3 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.230769 | 13 | 3 | 9 | 4.333333 | 0.6 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
bf2ce50204085878978eb5cf5c145ae96b7731cd | 245 | py | Python | certsign/__init__.py | nilsfr/certsign | 496dedc391a6a417ae16ce0b27b14103418466bc | [
"BSD-3-Clause"
] | 11 | 2018-10-04T10:13:28.000Z | 2021-11-15T10:09:57.000Z | certsign/__init__.py | nilsfr/certsign | 496dedc391a6a417ae16ce0b27b14103418466bc | [
"BSD-3-Clause"
] | null | null | null | certsign/__init__.py | nilsfr/certsign | 496dedc391a6a417ae16ce0b27b14103418466bc | [
"BSD-3-Clause"
] | 1 | 2021-04-30T07:28:36.000Z | 2021-04-30T07:28:36.000Z | try:
import __builtin__
if not hasattr(__builtin__, 'FileExistsError'):
class FileExistsError(OSError):
""" File already exists. """
__builtin__.FileExistsError = FileExistsError
except ImportError:
pass
| 24.5 | 53 | 0.669388 | 20 | 245 | 7.6 | 0.75 | 0.289474 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.24898 | 245 | 9 | 54 | 27.222222 | 0.826087 | 0.081633 | 0 | 0 | 0 | 0 | 0.069124 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0.142857 | 0.285714 | 0 | 0.428571 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 5 |
170fc5ae06cc4d7536cdffafd85e597dac258912 | 435 | py | Python | core/test/__init__.py | OctopusRice/LineNet | a03ce3bf741dc497ae6bc680cd779128bda1a34b | [
"BSD-3-Clause"
] | 1 | 2020-12-03T03:07:15.000Z | 2020-12-03T03:07:15.000Z | core/test/__init__.py | OctopusRice/LineNet | a03ce3bf741dc497ae6bc680cd779128bda1a34b | [
"BSD-3-Clause"
] | 1 | 2019-08-23T09:27:33.000Z | 2019-08-29T01:46:12.000Z | core/test/__init__.py | OctopusRice/LineNet | a03ce3bf741dc497ae6bc680cd779128bda1a34b | [
"BSD-3-Clause"
] | null | null | null | from .cornernet import cornernet
from .linenet import linenet
from .cornernet_saccade import cornernet_saccade
from .cornernet_ifp_saccade import cornernet_ifp_saccade
from .cornernet_ifp_squeeze3 import cornernet_ifp_squeeze3
from .cornernet_ifp_squeeze2 import cornernet_ifp_squeeze2
def test_func(sys_config, db, nnet, result_dir, debug=False):
return globals()[sys_config.sampling_function](db, nnet, result_dir, debug=debug)
| 43.5 | 85 | 0.850575 | 61 | 435 | 5.737705 | 0.377049 | 0.205714 | 0.137143 | 0.131429 | 0.114286 | 0 | 0 | 0 | 0 | 0 | 0 | 0.010127 | 0.091954 | 435 | 9 | 86 | 48.333333 | 0.875949 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.125 | false | 0 | 0.75 | 0.125 | 1 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 5 |
17342bce93f053c4c85553d6042a3d75831239ac | 93 | py | Python | asistance/classrooms/models/__init__.py | Daniel1404/Registration-program | 42dbe8871915b7b6f5be8ce173870f75ef0d79bf | [
"MIT"
] | null | null | null | asistance/classrooms/models/__init__.py | Daniel1404/Registration-program | 42dbe8871915b7b6f5be8ce173870f75ef0d79bf | [
"MIT"
] | null | null | null | asistance/classrooms/models/__init__.py | Daniel1404/Registration-program | 42dbe8871915b7b6f5be8ce173870f75ef0d79bf | [
"MIT"
] | null | null | null | """classrooms/Import models"""
from .classroom import Classroom
from .students import Student | 31 | 32 | 0.806452 | 11 | 93 | 6.818182 | 0.636364 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.096774 | 93 | 3 | 33 | 31 | 0.892857 | 0.258065 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
17458cd32ffe843fe44f13b20ce51d1f402445ff | 67 | py | Python | env/lib64/python3.8/site-packages/openpyxl/comments/__init__.py | albixhafa/balance-sheet-integrity | bc7edef8ac7d7e57375a26f9edf9c7235722a2ac | [
"MIT"
] | 11 | 2020-06-28T04:30:26.000Z | 2022-03-26T08:40:47.000Z | env/lib64/python3.8/site-packages/openpyxl/comments/__init__.py | albixhafa/balance-sheet-integrity | bc7edef8ac7d7e57375a26f9edf9c7235722a2ac | [
"MIT"
] | 10 | 2020-09-30T12:49:45.000Z | 2020-10-04T10:26:33.000Z | venv/Lib/site-packages/openpyxl/comments/__init__.py | aklauritzen/bilago | 276b1c11e259dd77260c74fc013f59eb1eb42d2f | [
"MIT"
] | 1 | 2021-11-16T19:06:53.000Z | 2021-11-16T19:06:53.000Z | # Copyright (c) 2010-2020 openpyxl
from .comments import Comment
| 13.4 | 34 | 0.761194 | 9 | 67 | 5.666667 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.142857 | 0.164179 | 67 | 4 | 35 | 16.75 | 0.767857 | 0.477612 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
17655ddac3571e4456e5f8f9202f2d5622269657 | 4,174 | py | Python | New/Robot/Function.py | qs2042/-gocqhttp- | 9de8495b3af0ebfde166a3e8cb98cee7dfe87665 | [
"MIT"
] | 1 | 2022-03-31T02:53:47.000Z | 2022-03-31T02:53:47.000Z | New/Robot/Function.py | qs2042/handle-gocqhttp-Event-service | 9de8495b3af0ebfde166a3e8cb98cee7dfe87665 | [
"MIT"
] | null | null | null | New/Robot/Function.py | qs2042/handle-gocqhttp-Event-service | 9de8495b3af0ebfde166a3e8cb98cee7dfe87665 | [
"MIT"
] | null | null | null | import random,requests,json,time,re
# 工具类
class CQCode:
# 未被go-cqhttp支持的CQcode
def __init__(self) -> None:
# [CQ:rps] 猜拳魔法表情
# [CQ:dice] 掷骰子魔法表情
# [CQ:shake] 窗口抖动(戳一戳)
# [CQ:anonymous] 匿名发消息
# [CQ:contact,type=qqID,id=10001000] 推荐好友
# [CQ:contact,type=groupID,id=100100] 推荐群
# [CQ:location,lat=39.8969426,lon=116.3109099] 位置
pass
# 表情
@staticmethod
def face(id:str):
# https://github.com/kyubotics/coolq-http-api/wiki/%E8%A1%A8%E6%83%85-CQ-%E7%A0%81-ID-%E8%A1%A8
if not id.isdigit():
id = random.randint(0, 221)
id = int(id)
if id < 0 or id > 221:
id = random.randint(0, 221)
return "[CQ:face,id=%d]" % id
# 语音
@staticmethod
def record(file="http://baidu.com/1.mp3"):
# magic 0=正常(Default), 1=变声
# url 语音URL
# cache 只在通过网络 URL 发送时有效, 表示是否使用已缓存的文件, 0=不使用, 1=使用(Default)
# Proxy 只在通过网络 URL 发送时有效, 表示是否通过代理下载文件(需通过环境变量或配置文件配置代理), 0=不使用, 1=使用(Default)
# timeout 只在通过网络 URL 发送时有效, 单位秒, 表示下载网络文件的超时时间 , 默认不超时
return "[CQ:record,file=%s]" % file
# 短视频
@staticmethod
def video(file="http://baidu.com/1.mp4", cover="http://baidu.com/1.jpg"):
# c 通过网络下载视频时的线程数, 默认单线程. (在资源不支持并发时会自动处理), params=2or3
return "[CQ:video,file=%s,cover=%s]" % (file, cover)
# @
@staticmethod
def at(qq=2042136767, name="at的群友不在当前群里"):
return "[CQ:at,qq=%s,name=%s]" % (qq, name)
# 链接分享
@staticmethod
def share(url, title, content=None, image=None):
# content 内容描述
# image 图片URL
return "[CQ:share,url=%s,title=%s]" % (url, title)
# 音乐分享
@staticmethod
def music(type="163", id=28949129):
# qq, 163, xm
return "[CQ:music,type=%s,id=%s]" % (type, id)
def musicCustom(self, url="http://baidu.com", audio="http://baidu.com/1.mp3", title="音乐标题", content=None, image=None):
return "[CQ:music,type=custom,url=%s,audio=%s,title=%s]" % (url, audio, title)
# 图片
@staticmethod
def image(file="http://baidu.com/1.jpg", type="show", id="40004"):
# value = 图片文件名
# flash = 闪照, show = 秀图 (默认普通图片)
# value = 发送秀图时的特效id, 默认为40000
return "[CQ:image,file=%s,type=%s,id=%s]" % (file,type,id)
# [CQ:reply,id=123456] 回复
# [CQ:reply,text=Hello World,qq=10086,time=3376656000,seq=5123] 自定义回复
# [CQ:redbag,title=恭喜发财] 红包
# 戳一戳
@staticmethod
def poke(qq):
return "[CQ:poke,qq=%s]" % qq
# [CQ:gift,qq=123456,id=8] 发送礼物
# [CQ:forward,id=xxxx] 合并转发
# ... 合并转发消息节点
# [CQ:xml,data=xxxx] XML消息
# [CQ:json,data={"app":"com.tencent.miniapp","desc":"","view":"notification","ver":"0.0.0.1","prompt":"[应用]","appID":"","sourceName":"","actionData":"","actionData_A":"","sourceUrl":"","meta":{"notification":{"appInfo":{"appName":"全国疫情数据统计","appType":4,"appid":1109659848,"iconUrl":"http:\/\/gchat.qpic.cn\/gchatpic_new\/719328335\/-2010394141-6383A777BEB79B70B31CE250142D740F\/0"},"data":[{"title":"确诊","value":"80932"},{"title":"今日确诊","value":"28"},{"title":"疑似","value":"72"},{"title":"今日疑似","value":"5"},{"title":"治愈","value":"60197"},{"title":"今日治愈","value":"1513"},{"title":"死亡","value":"3140"},{"title":"今**亡","value":"17"}],"title":"中国加油, 武汉加油","button":[{"name":"病毒 : SARS-CoV-2, 其导致疾病命名 COVID-19","action":""},{"name":"传染源 : 新冠肺炎的患者。无症状感染者也可能成为传染源。","action":""}],"emphasis_keyword":""}},"text":"","sourceAd":""}] JSON消息
# [CQ:cardimage,file=https://i.pixiv.cat/img-master/img/2020/03/25/00/00/08/80334602_p0_master1200.jpg] cardimage
# 文本转语音
@staticmethod
def tts(text="大家好我是萌新"):
return "[CQ:tts,text=%s]" % text
class Function:pass | 44.88172 | 1,008 | 0.546239 | 550 | 4,174 | 4.129091 | 0.461818 | 0.035227 | 0.031704 | 0.028622 | 0.068252 | 0 | 0 | 0 | 0 | 0 | 0 | 0.106952 | 0.23838 | 4,174 | 93 | 1,009 | 44.88172 | 0.607424 | 0.520604 | 0 | 0.282051 | 0 | 0.025641 | 0.220153 | 0.096933 | 0 | 0 | 0 | 0 | 0 | 1 | 0.282051 | false | 0.051282 | 0.025641 | 0.230769 | 0.615385 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 0 | 0 | 5 |
17865694e6526b8ffbed6b1bf0d3dd28eb28a5cf | 6,750 | py | Python | tests/flow/test_Richards_empirical.py | kimjaed/simpeg | b8d716f86a4ea07ba3085fabb24c2bc974788040 | [
"MIT"
] | 3 | 2020-11-27T03:18:28.000Z | 2022-03-18T01:29:58.000Z | tests/flow/test_Richards_empirical.py | kimjaed/simpeg | b8d716f86a4ea07ba3085fabb24c2bc974788040 | [
"MIT"
] | null | null | null | tests/flow/test_Richards_empirical.py | kimjaed/simpeg | b8d716f86a4ea07ba3085fabb24c2bc974788040 | [
"MIT"
] | 1 | 2020-05-26T17:00:53.000Z | 2020-05-26T17:00:53.000Z | from __future__ import print_function
import unittest
import numpy as np
from discretize.Tests import checkDerivative
from SimPEG import Mesh
from SimPEG import Maps
from SimPEG.FLOW import Richards
TOL = 1E-8
np.random.seed(2)
class TestModels(unittest.TestCase):
def test_haverkamp_theta_u(self):
mesh = Mesh.TensorMesh([50])
hav = Richards.Empirical.Haverkamp_theta(mesh)
passed = checkDerivative(
lambda u: (hav(u), hav.derivU(u)),
np.random.randn(50),
plotIt=False
)
self.assertTrue(passed, True)
def test_haverkamp_theta_m(self):
mesh = Mesh.TensorMesh([50])
idnmap = Maps.IdentityMap(nP=mesh.nC)
seeds = {
'theta_r': np.random.rand(mesh.nC),
'theta_s': np.random.rand(mesh.nC),
'alpha': np.random.rand(mesh.nC),
'beta': np.random.rand(mesh.nC),
}
opts = [
('theta_r',
dict(theta_rMap=idnmap), 1),
('theta_s',
dict(theta_sMap=idnmap), 1),
('alpha',
dict(alphaMap=idnmap), 1),
('beta',
dict(betaMap=idnmap), 1),
]
u = np.random.randn(mesh.nC)
for name, opt, nM in opts:
van = Richards.Empirical.Haverkamp_theta(mesh, **opt)
x0 = np.concatenate([seeds[n] for n in name.split('-')])
def fun(m):
van.model = m
return van(u), van.derivM(u)
print('Haverkamp_theta test m deriv: ', name)
passed = checkDerivative(
fun,
x0,
plotIt=False
)
self.assertTrue(passed, True)
def test_vangenuchten_theta_u(self):
mesh = Mesh.TensorMesh([50])
van = Richards.Empirical.Vangenuchten_theta(mesh)
passed = checkDerivative(
lambda u: (van(u), van.derivU(u)),
np.random.randn(50),
plotIt=False
)
self.assertTrue(passed, True)
def test_vangenuchten_theta_m(self):
mesh = Mesh.TensorMesh([50])
idnmap = Maps.IdentityMap(nP=mesh.nC)
seeds = {
'theta_r': np.random.rand(mesh.nC),
'theta_s': np.random.rand(mesh.nC),
'n': np.random.rand(mesh.nC) + 1,
'alpha': np.random.rand(mesh.nC),
}
opts = [
('theta_r',
dict(theta_rMap=idnmap), 1),
('theta_s',
dict(theta_sMap=idnmap), 1),
('n',
dict(nMap=idnmap), 1),
('alpha',
dict(alphaMap=idnmap), 1),
]
u = np.random.randn(mesh.nC)
for name, opt, nM in opts:
van = Richards.Empirical.Vangenuchten_theta(mesh, **opt)
x0 = np.concatenate([seeds[n] for n in name.split('-')])
def fun(m):
van.model = m
return van(u), van.derivM(u)
print('Vangenuchten_theta test m deriv: ', name)
passed = checkDerivative(
fun,
x0,
plotIt=False
)
self.assertTrue(passed, True)
def test_haverkamp_k_u(self):
mesh = Mesh.TensorMesh([5])
hav = Richards.Empirical.Haverkamp_k(mesh)
print('Haverkamp_k test u deriv')
passed = checkDerivative(
lambda u: (hav(u), hav.derivU(u)),
np.random.randn(mesh.nC),
plotIt=False
)
self.assertTrue(passed, True)
def test_haverkamp_k_m(self):
mesh = Mesh.TensorMesh([5])
expmap = Maps.IdentityMap(nP=mesh.nC)
wires2 = Maps.Wires(('one', mesh.nC), ('two', mesh.nC))
wires3 = Maps.Wires(
('one', mesh.nC), ('two', mesh.nC), ('three', mesh.nC)
)
opts = [
('Ks',
dict(KsMap=expmap), 1),
('A',
dict(AMap=expmap), 1),
('gamma',
dict(gammaMap=expmap), 1),
('Ks-A',
dict(KsMap=expmap*wires2.one, AMap=expmap*wires2.two), 2),
('Ks-gamma',
dict(KsMap=expmap*wires2.one, gammaMap=expmap*wires2.two), 2),
('A-gamma',
dict(AMap=expmap*wires2.one, gammaMap=expmap*wires2.two), 2),
('Ks-A-gamma', dict(
KsMap=expmap*wires3.one,
AMap=expmap*wires3.two,
gammaMap=expmap*wires3.three), 3),
]
u = np.random.randn(mesh.nC)
for name, opt, nM in opts:
np.random.seed(2)
hav = Richards.Empirical.Haverkamp_k(mesh, **opt)
def fun(m):
hav.model = m
return hav(u), hav.derivM(u)
print('Haverkamp_k test m deriv: ', name)
passed = checkDerivative(
fun,
np.random.randn(mesh.nC * nM),
plotIt=False
)
self.assertTrue(passed, True)
def test_vangenuchten_k_u(self):
mesh = Mesh.TensorMesh([50])
van = Richards.Empirical.Vangenuchten_k(mesh)
print('Vangenuchten_k test u deriv')
passed = checkDerivative(
lambda u: (van(u), van.derivU(u)),
np.random.randn(mesh.nC),
plotIt=False
)
self.assertTrue(passed, True)
def test_vangenuchten_k_m(self):
mesh = Mesh.TensorMesh([50])
expmap = Maps.ExpMap(nP=mesh.nC)
idnmap = Maps.IdentityMap(nP=mesh.nC)
seeds = {
'Ks': np.random.triangular(
np.log(1e-7), np.log(1e-6), np.log(1e-5), mesh.nC
),
'I': np.random.rand(mesh.nC),
'n': np.random.rand(mesh.nC) + 1,
'alpha': np.random.rand(mesh.nC),
}
opts = [
('Ks',
dict(KsMap=expmap), 1),
('I',
dict(IMap=idnmap), 1),
('n',
dict(nMap=idnmap), 1),
('alpha',
dict(alphaMap=idnmap), 1),
]
u = np.random.randn(mesh.nC)
for name, opt, nM in opts:
van = Richards.Empirical.Vangenuchten_k(mesh, **opt)
x0 = np.concatenate([seeds[n] for n in name.split('-')])
def fun(m):
van.model = m
return van(u), van.derivM(u)
print('Vangenuchten_k test m deriv: ', name)
passed = checkDerivative(
fun,
x0,
plotIt=False
)
self.assertTrue(passed, True)
if __name__ == '__main__':
unittest.main()
| 27.663934 | 78 | 0.490667 | 754 | 6,750 | 4.309019 | 0.135279 | 0.053555 | 0.040628 | 0.054171 | 0.805479 | 0.764851 | 0.707602 | 0.680517 | 0.606648 | 0.603878 | 0 | 0.015737 | 0.378667 | 6,750 | 243 | 79 | 27.777778 | 0.758941 | 0 | 0 | 0.581152 | 0 | 0 | 0.050667 | 0 | 0 | 0 | 0 | 0 | 0.041885 | 1 | 0.062827 | false | 0.08377 | 0.036649 | 0 | 0.125654 | 0.036649 | 0 | 0 | 0 | null | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 5 |
17a52e94c8e6800b3676f1a239c0da6d1c3d394c | 163 | py | Python | somework/mainapp/admin.py | XtremeGood/somework | 52fa01d48538e32a8afb85f4ddbaadac3e3cd154 | [
"Apache-2.0"
] | null | null | null | somework/mainapp/admin.py | XtremeGood/somework | 52fa01d48538e32a8afb85f4ddbaadac3e3cd154 | [
"Apache-2.0"
] | null | null | null | somework/mainapp/admin.py | XtremeGood/somework | 52fa01d48538e32a8afb85f4ddbaadac3e3cd154 | [
"Apache-2.0"
] | null | null | null | from django.contrib import admin
from .models import Dematad , Demathol
# Register your models here.
admin.site.register(Dematad)
admin.site.register(Demathol) | 20.375 | 39 | 0.797546 | 22 | 163 | 5.909091 | 0.545455 | 0.138462 | 0.261538 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.122699 | 163 | 8 | 40 | 20.375 | 0.909091 | 0.159509 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
bd88a63df6aa5bbbb9977a5a3b802cd56934d7c0 | 130 | py | Python | Code/YOLO/darkflow/darkflow/utils/process.py | kalvin-osoro/ml_project | bf0bdc5719f2712682dd070045a5f1edf933a0c4 | [
"Apache-2.0"
] | null | null | null | Code/YOLO/darkflow/darkflow/utils/process.py | kalvin-osoro/ml_project | bf0bdc5719f2712682dd070045a5f1edf933a0c4 | [
"Apache-2.0"
] | null | null | null | Code/YOLO/darkflow/darkflow/utils/process.py | kalvin-osoro/ml_project | bf0bdc5719f2712682dd070045a5f1edf933a0c4 | [
"Apache-2.0"
] | null | null | null | version https://git-lfs.github.com/spec/v1
oid sha256:b7e8d585076c795bbcb5be78241001de3ba37c934f920b343400ff698eecaadd
size 10049
| 32.5 | 75 | 0.884615 | 13 | 130 | 8.846154 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.379032 | 0.046154 | 130 | 3 | 76 | 43.333333 | 0.548387 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | null | null | 0 | 0 | null | null | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
bdbb40bbf8449770703931f37f387af247ea123f | 237 | py | Python | t/test_sample.py | texttheater/produce | 202e3196daf7ac53c1998ac2ee9b0f8cbb1c6615 | [
"MIT"
] | 14 | 2015-03-04T12:40:25.000Z | 2021-07-07T04:06:09.000Z | t/test_sample.py | texttheater/produce | 202e3196daf7ac53c1998ac2ee9b0f8cbb1c6615 | [
"MIT"
] | 43 | 2015-01-27T13:52:39.000Z | 2020-10-17T19:51:20.000Z | t/test_sample.py | texttheater/produce | 202e3196daf7ac53c1998ac2ee9b0f8cbb1c6615 | [
"MIT"
] | 2 | 2015-11-23T08:59:07.000Z | 2019-04-17T13:04:49.000Z | import prodtest
class SampleTest(prodtest.ProduceTestCase):
def test(self):
self.assertDirectoryContents(['produce.ini'])
self.produce('hello.txt')
self.assertDirectoryContents(['produce.ini', 'hello.txt'])
| 26.333333 | 66 | 0.691983 | 23 | 237 | 7.130435 | 0.565217 | 0.329268 | 0.414634 | 0.45122 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.168776 | 237 | 8 | 67 | 29.625 | 0.832487 | 0 | 0 | 0 | 0 | 0 | 0.168776 | 0 | 0 | 0 | 0 | 0 | 0.333333 | 1 | 0.166667 | false | 0 | 0.166667 | 0 | 0.5 | 0 | 1 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
bdc1dbe4d021a56b569d6de452e28b8ea6e8107a | 49 | py | Python | dfetch/commands/__init__.py | Rohitth007/dfetch | 947ba95e79451c8c7dc82eeb4e5b4b117addf7bd | [
"MIT"
] | 11 | 2020-10-14T14:51:02.000Z | 2022-02-07T18:40:43.000Z | dfetch/commands/__init__.py | Rohitth007/dfetch | 947ba95e79451c8c7dc82eeb4e5b4b117addf7bd | [
"MIT"
] | 138 | 2020-11-02T21:18:40.000Z | 2022-03-31T20:44:08.000Z | dfetch/commands/__init__.py | Rohitth007/dfetch | 947ba95e79451c8c7dc82eeb4e5b4b117addf7bd | [
"MIT"
] | 5 | 2020-10-31T12:35:04.000Z | 2022-01-27T12:51:55.000Z | """Contains all commandline-related commands."""
| 24.5 | 48 | 0.755102 | 5 | 49 | 7.4 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.081633 | 49 | 1 | 49 | 49 | 0.822222 | 0.857143 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
da64f88e9e0d5e6369b2e3b6988ed606853a60ae | 127 | py | Python | backend/home/admin.py | crowdbotics-apps/nextwavecovidnews-28441 | e05429721b6026b82c93e4c7df6c41d30e481d51 | [
"FTL",
"AML",
"RSA-MD"
] | null | null | null | backend/home/admin.py | crowdbotics-apps/nextwavecovidnews-28441 | e05429721b6026b82c93e4c7df6c41d30e481d51 | [
"FTL",
"AML",
"RSA-MD"
] | 2 | 2021-07-04T22:30:11.000Z | 2021-07-04T22:31:01.000Z | backend/home/admin.py | crowdbotics-apps/nextwavecovidnews-28441 | e05429721b6026b82c93e4c7df6c41d30e481d51 | [
"FTL",
"AML",
"RSA-MD"
] | null | null | null | from django.contrib import admin
from .models import CustomText
admin.site.register(CustomText)
# Register your models here.
| 18.142857 | 32 | 0.811024 | 17 | 127 | 6.058824 | 0.647059 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.125984 | 127 | 6 | 33 | 21.166667 | 0.927928 | 0.204724 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.666667 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
da861a020456d77788ee9757867f9b5acbe72d6b | 48 | py | Python | experiments/sql2nl/__init__.py | chenyangh/tensor2struct-public | d3257cba6d76d3c658a58a78f687d986bdc755cf | [
"MIT"
] | 69 | 2021-04-14T06:35:07.000Z | 2022-03-31T18:35:05.000Z | experiments/sql2nl/__init__.py | chenyangh/tensor2struct-public | d3257cba6d76d3c658a58a78f687d986bdc755cf | [
"MIT"
] | 11 | 2021-04-16T11:16:04.000Z | 2022-03-22T21:21:29.000Z | experiments/sql2nl/__init__.py | chenyangh/tensor2struct-public | d3257cba6d76d3c658a58a78f687d986bdc755cf | [
"MIT"
] | 18 | 2021-04-14T07:19:56.000Z | 2022-03-23T19:26:18.000Z | # from experiments.sql2nl import data_scheduler
| 24 | 47 | 0.854167 | 6 | 48 | 6.666667 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.023256 | 0.104167 | 48 | 1 | 48 | 48 | 0.906977 | 0.9375 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
e5aeb3d28c03746c6d0e3ecc201c9c2b64aaf2e9 | 3,200 | py | Python | pirates/leveleditor/worldData/VolcanoSmallIsland.py | itsyaboyrocket/pirates | 6ca1e7d571c670b0d976f65e608235707b5737e3 | [
"BSD-3-Clause"
] | 3 | 2021-02-25T06:38:13.000Z | 2022-03-22T07:00:15.000Z | pirates/leveleditor/worldData/VolcanoSmallIsland.py | itsyaboyrocket/pirates | 6ca1e7d571c670b0d976f65e608235707b5737e3 | [
"BSD-3-Clause"
] | null | null | null | pirates/leveleditor/worldData/VolcanoSmallIsland.py | itsyaboyrocket/pirates | 6ca1e7d571c670b0d976f65e608235707b5737e3 | [
"BSD-3-Clause"
] | 1 | 2021-02-25T06:38:17.000Z | 2021-02-25T06:38:17.000Z | # uncompyle6 version 3.2.0
# Python bytecode 2.4 (62061)
# Decompiled from: Python 2.7.14 (v2.7.14:84471935ed, Sep 16 2017, 20:19:30) [MSC v.1500 32 bit (Intel)]
# Embedded file name: pirates.leveleditor.worldData.VolcanoSmallIsland
from pandac.PandaModules import Point3, VBase3
objectStruct = {'Objects': {'1141153785.89sdnaik': {'Type': 'Island', 'Name': 'VolcanoSmallIsland', 'Objects': {'1141154634.53sdnaik': {'Type': 'Rock', 'Hpr': Point3(0.0, 0.0, 0.0), 'Pos': Point3(-1048.453, 118.341, 38.314), 'Scale': VBase3(1.0, 1.0, 1.0), 'Visual': {'Model': 'models/props/zz_dont_use_rocks_LT_group_1F'}}, '1141154639.13sdnaik': {'Type': 'Rock', 'Hpr': Point3(0.0, 0.0, 0.0), 'Pos': Point3(-1053.665, 151.9, 37.458), 'Scale': VBase3(1.0, 1.0, 1.0), 'Visual': {'Model': 'models/props/zz_dont_use_rock_Dk_1F'}}, '1141154653.08sdnaik': {'Type': 'Rock', 'Hpr': Point3(0.0, 0.0, 0.0), 'Pos': Point3(-1127.113, 128.661, 34.376), 'Scale': VBase3(1.0, 1.0, 1.0), 'Visual': {'Model': 'models/props/zz_dont_use_rock_Dk_1F'}}, '1141154674.09sdnaik': {'Type': 'Tree - Animated', 'Hpr': Point3(0.0, 0.0, 0.0), 'Pos': Point3(-1085.864, 144.671, 36.053), 'Scale': VBase3(1.0, 1.0, 1.0), 'SubObjs': [{'Visual': {'Animate': 'models/vegetation/palm_leaf_a_idle', 'Attach': ['trunk', 'def_trunk_attach'], 'Model': 'models/vegetation/palm_leaf_a_hi', 'PartName': 'leaf'}}], 'Visual': {'Animate': 'models/vegetation/palm_trunk_a_idle', 'Model': 'models/vegetation/palm_trunk_a_hi', 'PartName': 'trunk'}}, '1141154679.2sdnaik': {'Type': 'Tree - Animated', 'Animate': 'models/vegetation/palm_trunk_a_idle', 'Hpr': VBase3(-40.642, 0.0, 0.0), 'Pos': Point3(-1093.491, 148.268, 35.624), 'Scale': VBase3(1.0, 1.0, 1.0), 'SubObjs': [{'Visual': {'Animate': 'models/vegetation/palm_leaf_a_idle', 'Attach': ['trunk', 'def_trunk_attach'], 'Model': 'models/vegetation/palm_leaf_a_hi', 'PartName': 'leaf'}}], 'Visual': {'Animate': 'models/vegetation/palm_trunk_a_idle', 'Model': 'models/vegetation/palm_trunk_a_hi', 'PartName': 'trunk'}}, '1141154683.27sdnaik': {'Type': 'Tree - Animated', 'Animate': 'models/vegetation/palm_trunk_a_idle', 'Hpr': Point3(0.0, 0.0, 0.0), 'Pos': Point3(-1086.865, 135.491, 36.172), 'Scale': VBase3(1.0, 1.0, 1.0), 'SubObjs': [{'Visual': {'Animate': 'models/vegetation/palm_leaf_a_idle', 'Attach': ['trunk', 'def_trunk_attach'], 'Model': 'models/vegetation/palm_leaf_a_hi', 'PartName': 'leaf'}}], 'Visual': {'Animate': 'models/vegetation/palm_trunk_a_idle', 'Model': 'models/vegetation/palm_trunk_b_hi', 'PartName': 'trunk'}}}}}, 'Node Links': [], 'Layers': {}, 'ObjectIds': {'1141153785.89sdnaik': '["Objects"]["1141153785.89sdnaik"]', '1141154634.53sdnaik': '["Objects"]["1141153785.89sdnaik"]["Objects"]["1141154634.53sdnaik"]', '1141154639.13sdnaik': '["Objects"]["1141153785.89sdnaik"]["Objects"]["1141154639.13sdnaik"]', '1141154653.08sdnaik': '["Objects"]["1141153785.89sdnaik"]["Objects"]["1141154653.08sdnaik"]', '1141154674.09sdnaik': '["Objects"]["1141153785.89sdnaik"]["Objects"]["1141154674.09sdnaik"]', '1141154679.2sdnaik': '["Objects"]["1141153785.89sdnaik"]["Objects"]["1141154679.2sdnaik"]', '1141154683.27sdnaik': '["Objects"]["1141153785.89sdnaik"]["Objects"]["1141154683.27sdnaik"]'}} | 533.333333 | 2,920 | 0.680938 | 447 | 3,200 | 4.731544 | 0.288591 | 0.026478 | 0.031206 | 0.03026 | 0.511584 | 0.511584 | 0.505437 | 0.505437 | 0.505437 | 0.505437 | 0 | 0.191597 | 0.070313 | 3,200 | 6 | 2,920 | 533.333333 | 0.519328 | 0.07 | 0 | 0 | 0 | 0 | 0.618775 | 0.344886 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.5 | 0 | 0.5 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
e5f035049beb0fdfb0917f12457b94e6615d1661 | 1,501 | py | Python | rvpvp/isa/rvv/vwxxx_wv.py | ultrafive/riscv-pvp | 843e38422c3d545352b955764927d5e7847e5453 | [
"Unlicense"
] | 5 | 2021-05-10T09:57:00.000Z | 2021-10-05T14:39:20.000Z | rvpvp/isa/rvv/vwxxx_wv.py | ultrafive/riscv-pvp | 843e38422c3d545352b955764927d5e7847e5453 | [
"Unlicense"
] | null | null | null | rvpvp/isa/rvv/vwxxx_wv.py | ultrafive/riscv-pvp | 843e38422c3d545352b955764927d5e7847e5453 | [
"Unlicense"
] | 1 | 2021-05-14T20:24:11.000Z | 2021-05-14T20:24:11.000Z | from ...isa.inst import *
import numpy as np
class Vwadd_wv(Inst):
name = 'vwadd.wv'
# vwadd.wv vd, vs2, vs1, vm
def golden(self):
if self['vl']==0:
return self['ori']
result = self['ori'].copy()
maskflag = 1 if 'mask' in self else 0
vstart = self['vstart'] if 'vstart' in self else 0
if self['vs2'].dtype == self['vs1'].dtype:
self['vs1'].dtype = self.intdtype()
for ii in range(vstart, self['vl']):
if (maskflag == 0) or (maskflag == 1 and np.unpackbits(self['mask'], bitorder='little')[ii] ):
result[ii] = self['vs2'][ii].astype(object) + self['vs1'][ii]#.astype(intdtype(self['sew']))
return result
class Vwaddu_wv(Vwadd_wv):
name = 'vwaddu.wv'
class Vwsub_wv(Inst):
name = 'vwsub.wv'
# vwsub.wv vd, vs2, vs1, vm
def golden(self):
if self['vl']==0:
return self['ori']
result = self['ori'].copy()
maskflag = 1 if 'mask' in self else 0
vstart = self['vstart'] if 'vstart' in self else 0
if self['vs2'].dtype == self['vs1'].dtype:
self['vs1'].dtype = self.uintdtype()
for ii in range(vstart, self['vl']):
if (maskflag == 0) or (maskflag == 1 and np.unpackbits(self['mask'], bitorder='little')[ii] ):
result[ii] = self['vs2'][ii].astype(object) - self['vs1'][ii]
return result
class Vwsubu_wv(Vwsub_wv):
name = 'vwsubu.wv'
| 35.738095 | 109 | 0.538308 | 206 | 1,501 | 3.893204 | 0.23301 | 0.067332 | 0.049875 | 0.054863 | 0.723192 | 0.723192 | 0.723192 | 0.723192 | 0.723192 | 0.723192 | 0 | 0.024367 | 0.289141 | 1,501 | 41 | 110 | 36.609756 | 0.727273 | 0.055296 | 0 | 0.588235 | 0 | 0 | 0.096249 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.058824 | false | 0 | 0.058824 | 0 | 0.470588 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
006649073e8f0e0fe171e207cb3f6bf627350050 | 36 | py | Python | brigadier/exceptions/command_expection.py | NickNackGus/brigadier.py | 43b315446711af3e313bdbb4b0b13a75f6f3a19e | [
"MIT"
] | null | null | null | brigadier/exceptions/command_expection.py | NickNackGus/brigadier.py | 43b315446711af3e313bdbb4b0b13a75f6f3a19e | [
"MIT"
] | 1 | 2020-11-03T00:20:41.000Z | 2020-11-04T06:16:16.000Z | brigadier/exceptions/command_expection.py | NickNackGus/brigadier.py | 43b315446711af3e313bdbb4b0b13a75f6f3a19e | [
"MIT"
] | 1 | 2020-11-02T23:55:34.000Z | 2020-11-02T23:55:34.000Z | class CommandExceptionType:
pass | 18 | 27 | 0.805556 | 3 | 36 | 9.666667 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.166667 | 36 | 2 | 28 | 18 | 0.966667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0.5 | 0 | 0 | 0.5 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 5 |
0094fea6d8745b7596d268d4df581034d2d69e46 | 4,145 | py | Python | tests/test_postgres.py | CalgaryMichael/branchdb-python | 77b467105cdcaa7346c19c3882f05d85bc238268 | [
"MIT"
] | null | null | null | tests/test_postgres.py | CalgaryMichael/branchdb-python | 77b467105cdcaa7346c19c3882f05d85bc238268 | [
"MIT"
] | null | null | null | tests/test_postgres.py | CalgaryMichael/branchdb-python | 77b467105cdcaa7346c19c3882f05d85bc238268 | [
"MIT"
] | null | null | null | # coding=utf-8
from __future__ import absolute_import
from __future__ import division
from __future__ import print_function
from __future__ import unicode_literals
import pytest
import mock
from psycopg2.sql import Composed, Identifier, SQL
from branchdb.errors import DatabaseError
from branchdb.engines.postgres import postgres_engine, PostgresEngine
from .mocking import mock_postgres_cursor, MockConnection
def test_all_databases():
engine = PostgresEngine()
with mock.patch.object(engine, "get_cursor") as mock_cursor:
mock_cursor.return_value.__enter__ = mock_postgres_cursor([["db1"], ["db2"]])
result = engine.all_databases()
assert result == ["db1", "db2"]
@mock.patch("branchdb.engines.postgres.postgres_engine.PostgresEngine._execute")
@mock.patch("branchdb.engines.postgres.postgres_engine.PostgresEngine.database_exists")
def test_create_database(mock_exists, mock_execute):
mock_exists.return_value = False
engine = PostgresEngine()
engine.connection = MockConnection()
with mock.patch.object(engine, "get_cursor") as mock_cursor:
cursor = mock_postgres_cursor()
mock_cursor.return_value.__enter__ = cursor
result = engine.create_database("jazz", template=None)
composed_create = Composed([
SQL("CREATE DATABASE "),
Identifier("jazz"),
SQL("\n")])
mock_execute.assert_any_call(mock.ANY, composed_create)
composed_grant = Composed([
SQL("GRANT ALL PRIVILEGES ON DATABASE "),
Identifier("jazz"),
SQL(" TO "),
Identifier("user"),
SQL("\n")])
mock_execute.assert_any_call(mock.ANY, composed_grant)
assert result is True
@mock.patch("branchdb.engines.postgres.postgres_engine.PostgresEngine._execute")
@mock.patch("branchdb.engines.postgres.postgres_engine.PostgresEngine.database_exists")
def test_create_database__with_template(mock_exists, mock_execute):
mock_exists.return_value = False
engine = PostgresEngine()
engine.connection = MockConnection()
with mock.patch.object(engine, "get_cursor") as mock_cursor:
cursor = mock_postgres_cursor()
mock_cursor.return_value.__enter__ = cursor
result = engine.create_database("jazz2", template="jazz1")
composed_create = Composed([
SQL("CREATE DATABASE "),
Identifier("jazz2"),
SQL(" TEMPLATE "),
Identifier("jazz1"),
SQL("\n")])
mock_execute.assert_any_call(mock.ANY, composed_create)
composed_grant = Composed([
SQL("GRANT ALL PRIVILEGES ON DATABASE "),
Identifier("jazz2"),
SQL(" TO "),
Identifier("user"),
SQL("\n")])
mock_execute.assert_any_call(mock.ANY, composed_grant)
assert result is True
@mock.patch("branchdb.engines.postgres.postgres_engine.PostgresEngine.database_exists")
def test_create_database__existing(mock_exists):
mock_exists.return_value = True
engine = PostgresEngine()
with pytest.raises(DatabaseError, match="Database 'jazz' already exists."):
engine.create_database("jazz")
@mock.patch("branchdb.engines.postgres.postgres_engine.PostgresEngine._execute")
@mock.patch("branchdb.engines.postgres.postgres_engine.PostgresEngine.database_exists")
def test_delete_database(mock_exists, mock_execute):
mock_exists.return_value = True
engine = PostgresEngine()
engine.connection = MockConnection()
with mock.patch.object(engine, "get_cursor") as mock_cursor:
cursor = mock_postgres_cursor()
mock_cursor.return_value.__enter__ = cursor
result = engine.delete_database("jazz")
composed_delete = Composed([
SQL("DROP DATABASE "),
Identifier("jazz"),
SQL("\n")])
mock_execute.assert_any_call(mock.ANY, composed_delete)
assert result is True
@mock.patch("branchdb.engines.postgres.postgres_engine.PostgresEngine.database_exists")
def test_delete_database__existing(mock_exists):
mock_exists.return_value = False
engine = PostgresEngine()
with pytest.raises(DatabaseError, match="Database 'jazz' does not exist."):
engine.delete_database("jazz")
| 36.043478 | 87 | 0.724246 | 479 | 4,145 | 5.962422 | 0.154489 | 0.105042 | 0.072479 | 0.067227 | 0.771709 | 0.771709 | 0.762605 | 0.730042 | 0.702731 | 0.641807 | 0 | 0.003186 | 0.166948 | 4,145 | 114 | 88 | 36.359649 | 0.823921 | 0.002895 | 0 | 0.663043 | 0 | 0 | 0.210603 | 0.13435 | 0 | 0 | 0 | 0 | 0.097826 | 1 | 0.065217 | false | 0 | 0.108696 | 0 | 0.173913 | 0.01087 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
00b533a9f58a56f599ac3b416131477a9574518e | 213 | py | Python | pypga/core/__init__.py | lneuhaus/pypga | 836932e4a5abbc9d52eb824b446f176af65485c0 | [
"MIT"
] | 1 | 2021-04-25T08:06:09.000Z | 2021-04-25T08:06:09.000Z | pypga/core/__init__.py | lneuhaus/pypga | 836932e4a5abbc9d52eb824b446f176af65485c0 | [
"MIT"
] | null | null | null | pypga/core/__init__.py | lneuhaus/pypga | 836932e4a5abbc9d52eb824b446f176af65485c0 | [
"MIT"
] | null | null | null | from .logic_function import logic, is_logic
from .register import Register
from .module import Module, TopModule
from .migen import MigenModule
from .common import CustomizableMixin
from .settings import settings
| 30.428571 | 43 | 0.840376 | 28 | 213 | 6.321429 | 0.464286 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.122066 | 213 | 6 | 44 | 35.5 | 0.946524 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
00d1a9a1a0914723472eccb299025eb1d851a2b3 | 239 | py | Python | ml/knn/run.py | maxis1314/pyutils | 7e0666c650209155b3da186d09c54cf14825df1e | [
"Apache-2.0"
] | 2 | 2017-06-12T07:58:51.000Z | 2018-03-08T09:43:35.000Z | ml/knn/run.py | maxis1314/pyutils | 7e0666c650209155b3da186d09c54cf14825df1e | [
"Apache-2.0"
] | 1 | 2017-06-10T02:05:52.000Z | 2017-07-04T03:57:28.000Z | ml/knn/run.py | maxis1314/pyutils | 7e0666c650209155b3da186d09c54cf14825df1e | [
"Apache-2.0"
] | null | null | null | #encoding=utf-8
import sys
from numpy import *
import kNN
#datingDataMat,datingLabels = kNN.file2matrix('thefile.csv','\t')
#print datingDataMat
#bayes.testingNB2(datingDataMat,datingLabels)
kNN.commonClassTest('input.csv','\t',0.2);
| 17.071429 | 65 | 0.761506 | 30 | 239 | 6.066667 | 0.7 | 0.274725 | 0.307692 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.022936 | 0.087866 | 239 | 13 | 66 | 18.384615 | 0.811927 | 0.589958 | 0 | 0 | 0 | 0 | 0.117021 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.75 | 0 | 0.75 | 0 | 0 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
dadac72e7a58cd6e599ea8dadbb766a9021c30a9 | 44 | py | Python | src/mixt/scripts/__init__.py | adrienbrunet/mixt | d725ec752ce430d135e993bc988bfdf2b8457c4b | [
"MIT"
] | 27 | 2018-06-04T19:11:42.000Z | 2022-02-23T22:46:39.000Z | src/mixt/scripts/__init__.py | adrienbrunet/mixt | d725ec752ce430d135e993bc988bfdf2b8457c4b | [
"MIT"
] | 7 | 2018-06-09T15:27:51.000Z | 2021-03-11T20:00:35.000Z | src/mixt/scripts/__init__.py | adrienbrunet/mixt | d725ec752ce430d135e993bc988bfdf2b8457c4b | [
"MIT"
] | 3 | 2018-07-29T10:20:02.000Z | 2021-11-18T19:55:07.000Z | """Home for scripts of the mixt project."""
| 22 | 43 | 0.681818 | 7 | 44 | 4.285714 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.159091 | 44 | 1 | 44 | 44 | 0.810811 | 0.840909 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
daf3b659ba59d5d6db45266d2aa72aa4d6b41182 | 1,093 | py | Python | test/test_change_requests_page.py | CiscoDevNet/python-msx-sdk | d7e0a08c656504b4f4551d263e67c671a2a04b3f | [
"MIT"
] | null | null | null | test/test_change_requests_page.py | CiscoDevNet/python-msx-sdk | d7e0a08c656504b4f4551d263e67c671a2a04b3f | [
"MIT"
] | null | null | null | test/test_change_requests_page.py | CiscoDevNet/python-msx-sdk | d7e0a08c656504b4f4551d263e67c671a2a04b3f | [
"MIT"
] | null | null | null | """
MSX SDK
MSX SDK client. # noqa: E501
The version of the OpenAPI document: 1.0.9
Generated by: https://openapi-generator.tech
"""
import sys
import unittest
import python_msx_sdk
from python_msx_sdk.model.change_request_summary import ChangeRequestSummary
from python_msx_sdk.model.change_requests_page_all_of import ChangeRequestsPageAllOf
from python_msx_sdk.model.page_header import PageHeader
globals()['ChangeRequestSummary'] = ChangeRequestSummary
globals()['ChangeRequestsPageAllOf'] = ChangeRequestsPageAllOf
globals()['PageHeader'] = PageHeader
from python_msx_sdk.model.change_requests_page import ChangeRequestsPage
class TestChangeRequestsPage(unittest.TestCase):
"""ChangeRequestsPage unit test stubs"""
def setUp(self):
pass
def tearDown(self):
pass
def testChangeRequestsPage(self):
"""Test ChangeRequestsPage"""
# FIXME: construct object with mandatory attributes with example values
# model = ChangeRequestsPage() # noqa: E501
pass
if __name__ == '__main__':
unittest.main()
| 26.02381 | 84 | 0.747484 | 120 | 1,093 | 6.583333 | 0.483333 | 0.053165 | 0.075949 | 0.081013 | 0.159494 | 0.132911 | 0.098734 | 0.098734 | 0 | 0 | 0 | 0.009945 | 0.172004 | 1,093 | 41 | 85 | 26.658537 | 0.862983 | 0.273559 | 0 | 0.157895 | 1 | 0 | 0.080475 | 0.030343 | 0 | 0 | 0 | 0.02439 | 0 | 1 | 0.157895 | false | 0.157895 | 0.368421 | 0 | 0.578947 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | 5 |
daf43177d133abda2451ec532e44d048c554ca90 | 305 | py | Python | src/config.py | bgalde-dev/dinism | a8c5c85b446c38f5146766be09e7d4d939c9cf29 | [
"MIT"
] | null | null | null | src/config.py | bgalde-dev/dinism | a8c5c85b446c38f5146766be09e7d4d939c9cf29 | [
"MIT"
] | null | null | null | src/config.py | bgalde-dev/dinism | a8c5c85b446c38f5146766be09e7d4d939c9cf29 | [
"MIT"
] | null | null | null | sql_conn="Driver={SQL Server};Server=nhl-db.chuct8n1xntr.us-west-1.rds.amazonaws.com;Database=nhl_db;uid=admin;pwd=hd##WWWWRY77"
# IF USING LOCAL HOST THE CONNECTION STRING WILL BE AS FOLLOWS
pg_username="admin"
pg_password="hd##WWWWRY77"
# The name of the database you are connecting to
db_name="nhl_db"
| 43.571429 | 128 | 0.790164 | 54 | 305 | 4.351852 | 0.722222 | 0.06383 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.02518 | 0.088525 | 305 | 6 | 129 | 50.833333 | 0.820144 | 0.35082 | 0 | 0 | 0 | 0.25 | 0.717949 | 0.538462 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.25 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 5 |
97010aec1a2a1aa487a12637dda6e0a08d9f18c3 | 24 | py | Python | archive/tkgl.py | HackerDaGreat57/mcpy | 959c3180c724ab2039d4bd98d0a8f0fae30b6b3c | [
"MIT"
] | 1 | 2021-06-09T02:53:33.000Z | 2021-06-09T02:53:33.000Z | archive/tkgl.py | HackerDaGreat57/mcpy | 959c3180c724ab2039d4bd98d0a8f0fae30b6b3c | [
"MIT"
] | 1 | 2021-06-09T03:02:42.000Z | 2022-01-03T02:15:11.000Z | archive/tkgl.py | HackerDaGreat57/mcpy | 959c3180c724ab2039d4bd98d0a8f0fae30b6b3c | [
"MIT"
] | null | null | null | from OpenGL.Tk import *
| 12 | 23 | 0.75 | 4 | 24 | 4.5 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.166667 | 24 | 1 | 24 | 24 | 0.9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
9709a66bdede4ace286bd4a888ae8f6a77e86d08 | 511 | py | Python | Teacher/DigitalHistory/Assignments_To_Be_Graded/016993270/Week_Two/Now_Try_This/1.py | ShayanRiyaz/BitUGrading | ecc069de292d371cf6805df70be94408d5c7894b | [
"MIT"
] | null | null | null | Teacher/DigitalHistory/Assignments_To_Be_Graded/016993270/Week_Two/Now_Try_This/1.py | ShayanRiyaz/BitUGrading | ecc069de292d371cf6805df70be94408d5c7894b | [
"MIT"
] | null | null | null | Teacher/DigitalHistory/Assignments_To_Be_Graded/016993270/Week_Two/Now_Try_This/1.py | ShayanRiyaz/BitUGrading | ecc069de292d371cf6805df70be94408d5c7894b | [
"MIT"
] | null | null | null | # Please note that if you uncomment and press multiple times, the program will keep appending to the file.
s = 'Amsterdam'
# Print out 'e' using indexing
answer1 = s[2]
print(answer1)# Please note that if you uncomment and press multiple times, the program will keep appending to the file.
s ='Amsterdam'
# Reverse the string using slicing
answer2 = s[1]
print(answer2)# Please note that if you uncomment and press multiple times, the program will keep appending to the file.
answer3 = s[::-1]
print(answer3) | 36.5 | 120 | 0.759295 | 83 | 511 | 4.674699 | 0.385542 | 0.07732 | 0.108247 | 0.123711 | 0.708763 | 0.708763 | 0.708763 | 0.708763 | 0.708763 | 0.708763 | 0 | 0.021176 | 0.168297 | 511 | 14 | 121 | 36.5 | 0.891765 | 0.735812 | 0 | 0.25 | 0 | 0 | 0.138462 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.375 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
970a28ba60acad15c1a4daf73644b07d7d7c5bc4 | 6,195 | py | Python | search/tests.py | kimyou7/ParkGoGreen | a0b21210823d711af56d76226919950aa01a2b92 | [
"MIT"
] | null | null | null | search/tests.py | kimyou7/ParkGoGreen | a0b21210823d711af56d76226919950aa01a2b92 | [
"MIT"
] | null | null | null | search/tests.py | kimyou7/ParkGoGreen | a0b21210823d711af56d76226919950aa01a2b92 | [
"MIT"
] | null | null | null | """
tests.py
Automated tests that are written here are run with the manage.py test command.
Included is an automated Selenium test written by Jaimes Subroto.
"""
from django.test import TestCase
# Create your tests here.
# -*- coding: utf-8 -*-
from selenium import webdriver
from selenium.webdriver.common.by import By
from selenium.webdriver.common.keys import Keys
from selenium.webdriver.support.ui import Select
from selenium.common.exceptions import NoSuchElementException
from selenium.common.exceptions import NoAlertPresentException
import unittest, time, re
chromedriver_path = '<C:/YOUR/chromedriver.exe_path>'
class ChromePark(unittest.TestCase):
def setUp(self):
# self.driver = webdriver.Firefox()
self.driver = webdriver.Chrome(chromedriver_path)
self.driver.implicitly_wait(30)
self.base_url = "https://www.katalon.com/"
self.verificationErrors = []
self.accept_next_alert = True
def test_chrome_park(self):
driver = self.driver
driver.get("http://35.230.88.48/")
driver.find_element_by_name("q").clear()
driver.find_element_by_name("q").send_keys("head")
driver.find_element_by_name("q").send_keys(Keys.ENTER)
self.assertEqual("Heron's Head Park", driver.find_element_by_xpath("//div/div[2]/p/strong").text)
self.assertEqual("April 24, 2018, 9:52 a.m.", driver.find_element_by_xpath("//div/div[2]/p[2]/strong").text)
self.assertEqual("Bathroom", driver.find_element_by_xpath("//p[3]/strong").text)
self.assertEqual("Weird toilet signs", driver.find_element_by_xpath("//p[4]/strong").text)
self.assertEqual("Park: Heron's Head Park", driver.find_element_by_xpath("//div[2]/div[2]/p").text)
self.assertEqual("Date: April 24, 2018, 9:56 a.m.", driver.find_element_by_xpath("//div[2]/div[2]/p[2]").text)
self.assertEqual("Category: Medical Waste", driver.find_element_by_xpath("//div[2]/div[2]/p[3]").text)
self.assertEqual("Issue: Park is entirely giant pills", driver.find_element_by_xpath("//div[2]/div[2]/p[4]").text)
def is_element_present(self, how, what):
try: self.driver.find_element(by=how, value=what)
except NoSuchElementException as e: return False
return True
def is_alert_present(self):
try: self.driver.switch_to_alert()
except NoAlertPresentException as e: return False
return True
def close_alert_and_get_its_text(self):
try:
alert = self.driver.switch_to_alert()
alert_text = alert.text
if self.accept_next_alert:
alert.accept()
else:
alert.dismiss()
return alert_text
finally: self.accept_next_alert = True
def tearDown(self):
self.driver.quit()
self.assertEqual([], self.verificationErrors)
if __name__ == "__main__":
unittest.main()
class ChromeInvalid(unittest.TestCase):
def setUp(self):
self.driver = webdriver.Chrome(chromedriver_path)
self.driver.implicitly_wait(30)
self.base_url = "https://www.katalon.com/"
self.verificationErrors = []
self.accept_next_alert = True
def test_chrome_invalid(self):
driver = self.driver
driver.get("http://35.230.88.48/")
driver.find_element_by_name("q").clear()
driver.find_element_by_name("q").send_keys("-1234")
driver.find_element_by_name("q").send_keys(Keys.ENTER)
self.assertEqual("Please enter alphanumeric characters only. Search either by zip code or park name.", driver.find_element_by_xpath("//p[3]").text)
def is_element_present(self, how, what):
try: self.driver.find_element(by=how, value=what)
except NoSuchElementException as e: return False
return True
def is_alert_present(self):
try: self.driver.switch_to_alert()
except NoAlertPresentException as e: return False
return True
def close_alert_and_get_its_text(self):
try:
alert = self.driver.switch_to_alert()
alert_text = alert.text
if self.accept_next_alert:
alert.accept()
else:
alert.dismiss()
return alert_text
finally: self.accept_next_alert = True
def tearDown(self):
self.driver.quit()
self.assertEqual([], self.verificationErrors)
if __name__ == "__main__":
unittest.main()
class ChromeSimilar(unittest.TestCase):
def setUp(self):
self.driver = webdriver.Chrome(chromedriver_path)
self.driver.implicitly_wait(30)
self.base_url = "https://www.katalon.com/"
self.verificationErrors = []
self.accept_next_alert = True
def test_chrome_similar(self):
driver = self.driver
driver.get("http://35.230.88.48/")
Select(driver.find_element_by_name("dropdown")).select_by_visible_text("Bathroom")
driver.find_element_by_name("q").clear()
driver.find_element_by_name("q").send_keys("94110")
driver.find_element_by_name("q").send_keys(Keys.ENTER)
self.assertEqual("No parks matched your zip code, here are reports that share the bathroom category.", driver.find_element_by_xpath("//div[1]/p[2]").text)
def is_element_present(self, how, what):
try: self.driver.find_element(by=how, value=what)
except NoSuchElementException as e: return False
return True
def is_alert_present(self):
try: self.driver.switch_to_alert()
except NoAlertPresentException as e: return False
return True
def close_alert_and_get_its_text(self):
try:
alert = self.driver.switch_to_alert()
alert_text = alert.text
if self.accept_next_alert:
alert.accept()
else:
alert.dismiss()
return alert_text
finally: self.accept_next_alert = True
def tearDown(self):
self.driver.quit()
self.assertEqual([], self.verificationErrors)
if __name__ == "__main__":
unittest.main()
| 37.77439 | 162 | 0.656497 | 799 | 6,195 | 4.869837 | 0.197747 | 0.064251 | 0.100488 | 0.11231 | 0.756361 | 0.728861 | 0.715497 | 0.702133 | 0.689026 | 0.679517 | 0 | 0.01674 | 0.228571 | 6,195 | 163 | 163 | 38.006135 | 0.797447 | 0.038095 | 0 | 0.773438 | 0 | 0 | 0.123886 | 0.012775 | 0 | 0 | 0 | 0 | 0.101563 | 1 | 0.140625 | false | 0 | 0.0625 | 0 | 0.296875 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
9731da18e66cff2d06671b3b61678d8c2be506fc | 46 | py | Python | pretrained-model/fastformer/fast_transformer/__init__.py | AetherPrior/malaya | 45d37b171dff9e92c5d30bd7260b282cd0912a7d | [
"MIT"
] | 88 | 2021-01-06T10:01:31.000Z | 2022-03-30T17:34:09.000Z | pretrained-model/fastformer/fast_transformer/__init__.py | AetherPrior/malaya | 45d37b171dff9e92c5d30bd7260b282cd0912a7d | [
"MIT"
] | 43 | 2021-01-14T02:44:41.000Z | 2022-03-31T19:47:42.000Z | pretrained-model/fastformer/fast_transformer/__init__.py | AetherPrior/malaya | 45d37b171dff9e92c5d30bd7260b282cd0912a7d | [
"MIT"
] | 38 | 2021-01-06T07:15:03.000Z | 2022-03-19T05:07:50.000Z | from .fast_transformer import FastTransformer
| 23 | 45 | 0.891304 | 5 | 46 | 8 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.086957 | 46 | 1 | 46 | 46 | 0.952381 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
97326bd9cf004152e2b90dbd7493f8fe7913a577 | 94 | py | Python | fun.py | henrik2706/cli | 5a21278eb323a9fe54fd48dbba827e7a923fc443 | [
"MIT"
] | null | null | null | fun.py | henrik2706/cli | 5a21278eb323a9fe54fd48dbba827e7a923fc443 | [
"MIT"
] | null | null | null | fun.py | henrik2706/cli | 5a21278eb323a9fe54fd48dbba827e7a923fc443 | [
"MIT"
] | null | null | null |
print("Her kommer en vits")
print("Katta med slips")
print("Det var en vits")
print("hei")
| 11.75 | 27 | 0.670213 | 16 | 94 | 3.9375 | 0.6875 | 0.190476 | 0.349206 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.159574 | 94 | 7 | 28 | 13.428571 | 0.797468 | 0 | 0 | 0 | 0 | 0 | 0.548387 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | null | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
9739e144ab1182beb89d2e994758e697a485090a | 60 | py | Python | dragonfire/sr/__init__.py | Pavan77750/Dragonfire | 902240dff586ce38a8ca779b5e587959206b83f9 | [
"MIT"
] | 1 | 2018-08-27T11:49:35.000Z | 2018-08-27T11:49:35.000Z | dragonfire/sr/__init__.py | Pavan77750/Dragonfire | 902240dff586ce38a8ca779b5e587959206b83f9 | [
"MIT"
] | null | null | null | dragonfire/sr/__init__.py | Pavan77750/Dragonfire | 902240dff586ce38a8ca779b5e587959206b83f9 | [
"MIT"
] | null | null | null | from __future__ import absolute_import
from .kaldi import *
| 20 | 38 | 0.833333 | 8 | 60 | 5.625 | 0.625 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.133333 | 60 | 2 | 39 | 30 | 0.865385 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
9740c967b2c69d58e0b5caae3b1f1f7522810c13 | 80 | py | Python | session_server/services/ai_service.py | w359405949/browserquest_py | 20c2569431db9dca74a986efa9bc0ce69ed5a8fc | [
"WTFPL"
] | 1 | 2019-03-27T07:46:15.000Z | 2019-03-27T07:46:15.000Z | session_server/services/ai_service.py | w359405949/browserquest_py | 20c2569431db9dca74a986efa9bc0ce69ed5a8fc | [
"WTFPL"
] | null | null | null | session_server/services/ai_service.py | w359405949/browserquest_py | 20c2569431db9dca74a986efa9bc0ce69ed5a8fc | [
"WTFPL"
] | null | null | null |
from ai_service_pb2 import AIService
class AIServiceImpl(AIService):
pass
| 13.333333 | 36 | 0.8 | 10 | 80 | 6.2 | 0.9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.014925 | 0.1625 | 80 | 5 | 37 | 16 | 0.910448 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0.333333 | 0.333333 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 5 |
9750027f2189b052a5f13caa8a7762774b3d563b | 112 | py | Python | dataprocessing/__init__.py | swip3798/TankDB | 78646d476dde86bfc9e70f6860d40f83652d7501 | [
"MIT"
] | null | null | null | dataprocessing/__init__.py | swip3798/TankDB | 78646d476dde86bfc9e70f6860d40f83652d7501 | [
"MIT"
] | null | null | null | dataprocessing/__init__.py | swip3798/TankDB | 78646d476dde86bfc9e70f6860d40f83652d7501 | [
"MIT"
] | null | null | null | from .csv_import import get_prices_by_date, get_stations_by_date
from .data_manager import DataManager, FuelType | 56 | 64 | 0.883929 | 18 | 112 | 5.055556 | 0.666667 | 0.131868 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.080357 | 112 | 2 | 65 | 56 | 0.883495 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
97b0a01bd72483b73c4f27f94b36711edc3e5b08 | 164 | py | Python | tests/marker.py | nryotaro/han | ed78f6772f4bf6923d9a3f52dbcc8a55e757631b | [
"MIT"
] | null | null | null | tests/marker.py | nryotaro/han | ed78f6772f4bf6923d9a3f52dbcc8a55e757631b | [
"MIT"
] | null | null | null | tests/marker.py | nryotaro/han | ed78f6772f4bf6923d9a3f52dbcc8a55e757631b | [
"MIT"
] | null | null | null | """Provide the flag that run integration tests."""
import os
run_integration_tests: bool = os.getenv("HAN_TEST_ALL") is not None
skip_reason = "Take much time."
| 20.5 | 67 | 0.743902 | 26 | 164 | 4.5 | 0.846154 | 0.239316 | 0.324786 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.146341 | 164 | 7 | 68 | 23.428571 | 0.835714 | 0.268293 | 0 | 0 | 0 | 0 | 0.236842 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.333333 | 0 | 0.333333 | 0 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
8adb2702d684089a281eb32326caf55f8382f954 | 1,079 | py | Python | models/__init__.py | rmarcacini/LC-ABSA | 90ae7f41b3766761005caf015292926127fe3949 | [
"MIT"
] | 1 | 2021-08-12T07:20:41.000Z | 2021-08-12T07:20:41.000Z | models/__init__.py | rmarcacini/LC-ABSA | 90ae7f41b3766761005caf015292926127fe3949 | [
"MIT"
] | null | null | null | models/__init__.py | rmarcacini/LC-ABSA | 90ae7f41b3766761005caf015292926127fe3949 | [
"MIT"
] | null | null | null | # -*- coding: utf-8 -*-
# file: __init__.py
# author: yangheng <yangheng@m.scnu.edu.cn>
# Copyright (C) 2019. All Rights Reserved.
# LC-APC
# Most of the following models are easy to adapted to target-level tasks.
from models.lc_apc.bert_spc import BERT_SPC
from models.lc_apc.bert_base import BERT_BASE
from models.lc_apc.lcf_glove import LCF_GLOVE
from models.lc_apc.lcf_bert import LCF_BERT
from models.lc_apc.lca_lstm import LCA_LSTM
from models.lc_apc.lca_glove import LCA_GLOVE
from models.lc_apc.lca_bert import LCA_BERT
from models.lc_apc.hlcf_glove import HLCF_GLOVE
from models.lc_apc.hlcf_bert import HLCF_BERT
# APC
from models.apc.lstm import LSTM
from models.apc.ian import IAN
from models.apc.memnet import MemNet
from models.apc.ram import RAM
from models.apc.td_lstm import TD_LSTM
from models.apc.tc_lstm import TC_LSTM
from models.apc.cabasc import Cabasc
from models.apc.atae_lstm import ATAE_LSTM
from models.apc.tnet_lf import TNet_LF
from models.apc.aoa import AOA
from models.apc.mgan import MGAN
# ATEPC
from models.lc_atepc.lcf_atepc import LCF_ATEPC | 33.71875 | 73 | 0.816497 | 200 | 1,079 | 4.195 | 0.27 | 0.250298 | 0.170441 | 0.160906 | 0.225268 | 0 | 0 | 0 | 0 | 0 | 0 | 0.005236 | 0.114921 | 1,079 | 32 | 74 | 33.71875 | 0.873298 | 0.195551 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | null | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
c10345721da2973eb56c76eaa510bf4b78ce0cab | 116 | py | Python | Assignments/Modules/Lab/02. ASCII Art.py | KaloyankerR/python-advanced-repository | 711672d0f033a5adffc3ca689d02d2a7a9a26bfb | [
"MIT"
] | null | null | null | Assignments/Modules/Lab/02. ASCII Art.py | KaloyankerR/python-advanced-repository | 711672d0f033a5adffc3ca689d02d2a7a9a26bfb | [
"MIT"
] | null | null | null | Assignments/Modules/Lab/02. ASCII Art.py | KaloyankerR/python-advanced-repository | 711672d0f033a5adffc3ca689d02d2a7a9a26bfb | [
"MIT"
] | null | null | null | from pyfiglet import figlet_format
def draw_figure(txt):
print(figlet_format(txt))
draw_figure(txt=input())
| 12.888889 | 34 | 0.758621 | 17 | 116 | 4.941176 | 0.647059 | 0.285714 | 0.309524 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.137931 | 116 | 8 | 35 | 14.5 | 0.84 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0.25 | 0 | 0.5 | 0.25 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
c12038fdb8fbd9ad873f4d44a6cffb0125e6af8a | 305 | py | Python | health/health_app/views.py | oxhagolli/k8s-health | 1e855672c2ef8760ef61fbcc746ffdbd91362ab7 | [
"MIT"
] | null | null | null | health/health_app/views.py | oxhagolli/k8s-health | 1e855672c2ef8760ef61fbcc746ffdbd91362ab7 | [
"MIT"
] | null | null | null | health/health_app/views.py | oxhagolli/k8s-health | 1e855672c2ef8760ef61fbcc746ffdbd91362ab7 | [
"MIT"
] | null | null | null | from .main import app
from .constants import HOME_TEMPLATE, StatusCode
from flask import render_template
@app.route("/")
def home():
try:
return render_template(HOME_TEMPLATE, status_code=StatusCode.OK)
except:
return render_template(HOME_TEMPLATE, status_code=StatusCode.ERROR)
| 25.416667 | 75 | 0.754098 | 39 | 305 | 5.692308 | 0.487179 | 0.162162 | 0.18018 | 0.216216 | 0.468468 | 0.468468 | 0.468468 | 0.468468 | 0 | 0 | 0 | 0 | 0.163934 | 305 | 11 | 76 | 27.727273 | 0.870588 | 0 | 0 | 0 | 0 | 0 | 0.003279 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.111111 | true | 0 | 0.333333 | 0 | 0.666667 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
c1335954c95f7cef5f08fd4b63576801bd7fe88d | 159 | py | Python | Assignments/2.2/D2.py | cRohda/Comp-Sci | 07e36fdcca242f5aa4f3e11440e9c77616973031 | [
"Apache-2.0"
] | null | null | null | Assignments/2.2/D2.py | cRohda/Comp-Sci | 07e36fdcca242f5aa4f3e11440e9c77616973031 | [
"Apache-2.0"
] | null | null | null | Assignments/2.2/D2.py | cRohda/Comp-Sci | 07e36fdcca242f5aa4f3e11440e9c77616973031 | [
"Apache-2.0"
] | null | null | null | my_string = "incredible" # Create string variable
print(my_string[-6]) # Prints the first e (index -6)
print(my_string[-1]) # Prints the second e (index -1) | 53 | 54 | 0.704403 | 26 | 159 | 4.192308 | 0.538462 | 0.220183 | 0.238532 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.029851 | 0.157233 | 159 | 3 | 54 | 53 | 0.783582 | 0.522013 | 0 | 0 | 0 | 0 | 0.136986 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0 | 0 | 0 | 0.666667 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
c13f034cda554fd93845980c4d5b83aa5be50b20 | 72 | py | Python | sdl2/test/__init__.py | papagiannakis/py-sdl2 | c8ff267761ce19d7714e72a4a3eb97a375c06fc6 | [
"CC0-1.0"
] | 222 | 2017-08-19T00:51:59.000Z | 2022-02-05T19:39:33.000Z | sdl2/test/__init__.py | Sahil-pixel/py-sdl2 | e5c8cbaccfda4f20f35f58bc8d00e0f533b30c3b | [
"CC0-1.0"
] | 103 | 2017-08-20T17:13:05.000Z | 2022-02-05T20:20:01.000Z | sdl2/test/__init__.py | Sahil-pixel/py-sdl2 | e5c8cbaccfda4f20f35f58bc8d00e0f533b30c3b | [
"CC0-1.0"
] | 54 | 2017-08-20T17:13:00.000Z | 2022-01-14T23:51:13.000Z | """Unit tests SDL2.
This package contains the unit tests for SDL2.
"""
| 14.4 | 46 | 0.708333 | 11 | 72 | 4.636364 | 0.727273 | 0.352941 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.033898 | 0.180556 | 72 | 4 | 47 | 18 | 0.830508 | 0.888889 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
c1619cde51ed2bce4071408f2d57af7212511620 | 255 | py | Python | postmark_inbound/signals.py | skulegirl/django-postmark-inbound | e60e88ca4adbf733cf60b5ebee1183904cdd3054 | [
"MIT"
] | null | null | null | postmark_inbound/signals.py | skulegirl/django-postmark-inbound | e60e88ca4adbf733cf60b5ebee1183904cdd3054 | [
"MIT"
] | null | null | null | postmark_inbound/signals.py | skulegirl/django-postmark-inbound | e60e88ca4adbf733cf60b5ebee1183904cdd3054 | [
"MIT"
] | null | null | null | import django.dispatch
inbound_mail_received = django.dispatch.Signal(providing_args=["mail_data",
"mail_object"])
inbound_mail_filtered = django.dispatch.Signal(providing_args=["mail_data"]) | 51 | 78 | 0.623529 | 25 | 255 | 6 | 0.48 | 0.28 | 0.266667 | 0.386667 | 0.546667 | 0.546667 | 0.546667 | 0 | 0 | 0 | 0 | 0 | 0.282353 | 255 | 5 | 79 | 51 | 0.819672 | 0 | 0 | 0 | 0 | 0 | 0.113281 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.25 | 0 | 0.25 | 0 | 1 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
c169b4155c7300335b641d9a8956927563c1324c | 179 | py | Python | bin/cubes/solid-pentominoes-three-walls.py | tiwo/puzzler | 7ad3d9a792f0635f7ec59ffa85fb46b54fd77a7e | [
"Intel"
] | null | null | null | bin/cubes/solid-pentominoes-three-walls.py | tiwo/puzzler | 7ad3d9a792f0635f7ec59ffa85fb46b54fd77a7e | [
"Intel"
] | null | null | null | bin/cubes/solid-pentominoes-three-walls.py | tiwo/puzzler | 7ad3d9a792f0635f7ec59ffa85fb46b54fd77a7e | [
"Intel"
] | 1 | 2022-01-02T16:54:14.000Z | 2022-01-02T16:54:14.000Z | #!/usr/bin/env python
# $Id$
"""90 solutions"""
import puzzler
from puzzler.puzzles.solid_pentominoes import SolidPentominoesThreeWalls
puzzler.run(SolidPentominoesThreeWalls)
| 17.9 | 72 | 0.804469 | 19 | 179 | 7.526316 | 0.789474 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.01227 | 0.089385 | 179 | 9 | 73 | 19.888889 | 0.865031 | 0.212291 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.666667 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
c1a34bbb88733a228cdde0d8893e099536f7b1b3 | 148 | py | Python | aml_utils.py | MeilinaR/aml | 769d0946c9a25ebc02304b7bd4ac21def453ef87 | [
"Apache-2.0"
] | null | null | null | aml_utils.py | MeilinaR/aml | 769d0946c9a25ebc02304b7bd4ac21def453ef87 | [
"Apache-2.0"
] | null | null | null | aml_utils.py | MeilinaR/aml | 769d0946c9a25ebc02304b7bd4ac21def453ef87 | [
"Apache-2.0"
] | null | null | null | LAMBDA: float = None
def set_lambda(value: float = None):
global LAMBDA
LAMBDA = float(value)
def get_lambda() -> float:
return LAMBDA | 18.5 | 36 | 0.675676 | 20 | 148 | 4.9 | 0.45 | 0.336735 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.222973 | 148 | 8 | 37 | 18.5 | 0.852174 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.333333 | false | 0 | 0 | 0.166667 | 0.5 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 5 |
c1ae54244b79bab725a74ed186583a7617051cde | 4,485 | py | Python | tests/trainer/test_dynamic_values.py | 897615138/tfsnippet-jill | 2fc898a4def866c8d3c685168df1fa22083bb143 | [
"MIT"
] | 63 | 2018-06-06T11:56:40.000Z | 2022-03-22T08:00:59.000Z | tests/trainer/test_dynamic_values.py | 897615138/tfsnippet-jill | 2fc898a4def866c8d3c685168df1fa22083bb143 | [
"MIT"
] | 39 | 2018-07-04T12:40:53.000Z | 2022-02-09T23:48:44.000Z | tests/trainer/test_dynamic_values.py | 897615138/tfsnippet-jill | 2fc898a4def866c8d3c685168df1fa22083bb143 | [
"MIT"
] | 34 | 2018-06-25T09:59:22.000Z | 2022-02-23T12:46:33.000Z | import unittest
import pytest
from mock import Mock
from tfsnippet.trainer import *
class DynamicValuesTestCase(unittest.TestCase):
def test_DynamicValue(self):
x = [1]
class MyValue(DynamicValue):
def get(self):
return x[0]
v = MyValue()
self.assertEqual(v.get(), 1)
x[0] = 123
self.assertEqual(v.get(), 123)
class AnnealingScalarTestCase(unittest.TestCase):
def test_freq_1(self):
loop = Mock(steps=100)
v = AnnealingScalar(loop, initial_value=1., ratio=.5, epochs=1)
loop.epoch = 0
self.assertEqual(v.get(), 1.)
loop.epoch = 1
self.assertEqual(v.get(), 1.)
loop.epoch = 2
self.assertEqual(v.get(), .5)
loop.epoch = 3
self.assertEqual(v.get(), .25)
# test cache
self.assertEqual(v.get(), .25)
def test_freq_3(self):
loop = Mock(epochs=100)
v = AnnealingScalar(loop, initial_value=1., ratio=.5, steps=3)
loop.step = 0
self.assertEqual(v.get(), 1.)
loop.step = 1
self.assertEqual(v.get(), 1.)
loop.step = 2
self.assertEqual(v.get(), 1.)
loop.step = 3
self.assertEqual(v.get(), 1.)
loop.step = 4
self.assertEqual(v.get(), .5)
loop.step = 5
self.assertEqual(v.get(), .5)
loop.step = 6
self.assertEqual(v.get(), .5)
loop.step = 7
self.assertEqual(v.get(), .25)
# test cache
self.assertEqual(v.get(), .25)
def test_min_value(self):
loop = Mock(steps=100)
v = AnnealingScalar(loop, initial_value=1., ratio=.5, epochs=1,
min_value=.1)
loop.epoch = 0
self.assertEqual(v.get(), 1.)
loop.epoch = 1
self.assertEqual(v.get(), 1.)
loop.epoch = 2
self.assertEqual(v.get(), .5)
loop.epoch = 3
self.assertEqual(v.get(), .25)
loop.epoch = 4
self.assertEqual(v.get(), .125)
loop.epoch = 5
self.assertEqual(v.get(), .1)
# test cache
self.assertEqual(v.get(), .1)
def test_max_value(self):
loop = Mock(epochs=100)
v = AnnealingScalar(loop, initial_value=1., ratio=1.5, steps=1,
max_value=3.)
loop.step = 0
self.assertEqual(v.get(), 1.)
loop.step = 1
self.assertEqual(v.get(), 1.)
loop.step = 2
self.assertEqual(v.get(), 1.5)
loop.step = 3
self.assertEqual(v.get(), 2.25)
loop.step = 4
self.assertEqual(v.get(), 3.)
# test cache
self.assertEqual(v.get(), 3.)
def test_errors(self):
loop = Mock()
with pytest.raises(ValueError,
match='`initial_value` must >= `min_value`: '
'initial_value 1.0 vs min_value 2.0'):
_ = AnnealingScalar(loop, initial_value=1., ratio=.5, min_value=2.)
with pytest.raises(ValueError,
match='`initial_value` must <= `max_value`: '
'initial_value 1.0 vs max_value 0.5'):
_ = AnnealingScalar(loop, initial_value=1., ratio=.5, max_value=.5)
with pytest.raises(ValueError,
match='`min_value` must <= `max_value`: '
'min_value 1.0 vs max_value 0.5'):
_ = AnnealingScalar(loop, initial_value=1., ratio=.5, min_value=1.0,
max_value=.5)
with pytest.raises(ValueError,
match='One and only one of `epochs` and `steps` '
'should be specified'):
_ = AnnealingScalar(loop, initial_value=1., ratio=.5)
with pytest.raises(ValueError,
match='One and only one of `epochs` and `steps` '
'should be specified'):
_ = AnnealingScalar(loop, initial_value=1., ratio=.5, epochs=1,
steps=1)
with pytest.raises(ValueError,
match='`epochs` must be positive: -1'):
_ = AnnealingScalar(loop, initial_value=1., ratio=.5, epochs=-1)
with pytest.raises(ValueError,
match='`steps` must be positive: -1'):
_ = AnnealingScalar(loop, initial_value=1., ratio=.5, steps=-1)
| 32.266187 | 80 | 0.51505 | 532 | 4,485 | 4.255639 | 0.114662 | 0.192138 | 0.204947 | 0.243375 | 0.808746 | 0.780035 | 0.712898 | 0.634276 | 0.567138 | 0.536661 | 0 | 0.046929 | 0.353846 | 4,485 | 138 | 81 | 32.5 | 0.7343 | 0.009588 | 0 | 0.522936 | 0 | 0 | 0.086094 | 0 | 0 | 0 | 0 | 0 | 0.266055 | 1 | 0.06422 | false | 0 | 0.036697 | 0.009174 | 0.137615 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
c1c29d3450fa9de663b26e83c6457e281b767ab7 | 133 | py | Python | beluga/symbolic/special_functions/__init__.py | doublefloyd/beluga | 740bda376634945ef51bf1cf946fcbe002e9bc7f | [
"MIT"
] | 20 | 2017-10-02T13:09:58.000Z | 2022-03-28T20:50:35.000Z | beluga/symbolic/special_functions/__init__.py | doublefloyd/beluga | 740bda376634945ef51bf1cf946fcbe002e9bc7f | [
"MIT"
] | 187 | 2018-02-04T20:35:03.000Z | 2021-01-27T15:04:18.000Z | beluga/symbolic/special_functions/__init__.py | doublefloyd/beluga | 740bda376634945ef51bf1cf946fcbe002e9bc7f | [
"MIT"
] | 12 | 2018-01-19T04:00:09.000Z | 2022-03-28T16:44:17.000Z | from .tables import SymTable, SymTableGenerator, TableSpline1D
from .custom_functions import CustomFunction, CustomFunctionGenerator
| 44.333333 | 69 | 0.879699 | 12 | 133 | 9.666667 | 0.833333 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.008197 | 0.082707 | 133 | 2 | 70 | 66.5 | 0.942623 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
c1e687937aa586dac1ecee0c22b3d0883c0a7caa | 145 | py | Python | dupdetectorML/__init__.py | vamas/DupDetectorML | a0db6f24519f19a72f9bc7ac226d6a37734564ae | [
"CC0-1.0"
] | null | null | null | dupdetectorML/__init__.py | vamas/DupDetectorML | a0db6f24519f19a72f9bc7ac226d6a37734564ae | [
"CC0-1.0"
] | null | null | null | dupdetectorML/__init__.py | vamas/DupDetectorML | a0db6f24519f19a72f9bc7ac226d6a37734564ae | [
"CC0-1.0"
] | null | null | null | from datasetbuilder import DatasetBuilder
from trainer import Trainer
from predictor import Predictor
from helpers import SaveModel, RestoreModel | 36.25 | 43 | 0.882759 | 17 | 145 | 7.529412 | 0.470588 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.110345 | 145 | 4 | 43 | 36.25 | 0.992248 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
a9dbf25d80e23673f5e4882640d323bb6f084ec8 | 49 | py | Python | clueless/client/errors.py | arthurtucker/Clue-Less | cf082f5c3b1baf2e93a94984100b6ca58e761383 | [
"Apache-2.0"
] | 4 | 2016-09-21T04:59:05.000Z | 2020-09-23T03:12:52.000Z | clueless/client/errors.py | arthurtucker/Clue-Less | cf082f5c3b1baf2e93a94984100b6ca58e761383 | [
"Apache-2.0"
] | null | null | null | clueless/client/errors.py | arthurtucker/Clue-Less | cf082f5c3b1baf2e93a94984100b6ca58e761383 | [
"Apache-2.0"
] | 1 | 2020-04-01T23:27:44.000Z | 2020-04-01T23:27:44.000Z |
class GameClientException(Exception):
pass
| 9.8 | 37 | 0.755102 | 4 | 49 | 9.25 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.183673 | 49 | 4 | 38 | 12.25 | 0.925 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0.5 | 0 | 0 | 0.5 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 5 |
e73efb33172240fc00479521177caae1e86d2adb | 593 | py | Python | app/errorhandlers.py | PAPA-allen/econline | 1ed90f4d082f12d6a1419b02b392ae71da1c751a | [
"FTL",
"CNRI-Python"
] | null | null | null | app/errorhandlers.py | PAPA-allen/econline | 1ed90f4d082f12d6a1419b02b392ae71da1c751a | [
"FTL",
"CNRI-Python"
] | null | null | null | app/errorhandlers.py | PAPA-allen/econline | 1ed90f4d082f12d6a1419b02b392ae71da1c751a | [
"FTL",
"CNRI-Python"
] | null | null | null | from flask import render_template
from enum import Enum
def page_not_found(e):
return render_template('404.html'), 404
def method_not_allowed(e):
return render_template('405.html'), 405
def internal_server_error(e):
return render_template('500.html'), 500
def forbidden(e):
return render_template('403.html'), 403
#Proxy design pattern
AppErrors = {
"PAGE_NOT_FOUND":404,
"METHOD_NOT_ALLOWED":405,
"INTERNAL_SERVER_ERROR":500,
"FORBIDDEN":403
}
def handle_error(e):
return render_template(f'{AppErrors[e]}.html'),AppErrors[e]
| 17.441176 | 64 | 0.696459 | 82 | 593 | 4.804878 | 0.353659 | 0.213198 | 0.164975 | 0.266497 | 0.13198 | 0 | 0 | 0 | 0 | 0 | 0 | 0.074534 | 0.185497 | 593 | 33 | 65 | 17.969697 | 0.741201 | 0.033727 | 0 | 0 | 0 | 0 | 0.210821 | 0.039179 | 0 | 0 | 0 | 0 | 0 | 1 | 0.277778 | false | 0 | 0.111111 | 0.277778 | 0.666667 | 0 | 0 | 0 | 0 | null | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 5 |
e746e3e882a13039821b69df85fd494747ee113b | 161 | py | Python | test/conftest.py | makci97/hangman | 1f7fd84951dd10129b075bfa2a33fc295407a210 | [
"MIT"
] | null | null | null | test/conftest.py | makci97/hangman | 1f7fd84951dd10129b075bfa2a33fc295407a210 | [
"MIT"
] | null | null | null | test/conftest.py | makci97/hangman | 1f7fd84951dd10129b075bfa2a33fc295407a210 | [
"MIT"
] | null | null | null | import pytest
from hangman.hangman import Hangman
@pytest.fixture
def prepare_hangman():
hangman = Hangman()
hangman.word = 'hello'
return hangman
| 16.1 | 35 | 0.726708 | 19 | 161 | 6.105263 | 0.526316 | 0.482759 | 0.362069 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.192547 | 161 | 9 | 36 | 17.888889 | 0.892308 | 0 | 0 | 0 | 0 | 0 | 0.031056 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.142857 | false | 0 | 0.285714 | 0 | 0.571429 | 0 | 1 | 0 | 0 | null | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 5 |
e79cdd1eedba1f427929757f7acd452e8761bfb9 | 1,312 | py | Python | src/bioinformatics-stronghold/revc-complementing-a-strand-of-dna.py | spencerking/rosalind | 66c50378813abf7b9cc535a963aeb9249d8a3ed7 | [
"BSD-3-Clause"
] | null | null | null | src/bioinformatics-stronghold/revc-complementing-a-strand-of-dna.py | spencerking/rosalind | 66c50378813abf7b9cc535a963aeb9249d8a3ed7 | [
"BSD-3-Clause"
] | null | null | null | src/bioinformatics-stronghold/revc-complementing-a-strand-of-dna.py | spencerking/rosalind | 66c50378813abf7b9cc535a963aeb9249d8a3ed7 | [
"BSD-3-Clause"
] | null | null | null | def reverseComplement(s):
result = ""
for base in s[::-1]:
if base == "A":
result += "T"
elif base == "T":
result += "A"
elif base == "C":
result += "G"
elif base == "G":
result += "C"
return result
print(reverseComplement("AGGATAGCCGTCTGTCTTTCTCACTTGAGTACTGATGAAAAGGCAAGTGAGAAGGACAGGATTATCCTGAACCGCCTAGCTTCGTTTTGAGCCGGCATATCGCCTGCCTGATGTCGTGTTTACTTACGCGCCCGCAAAGTTTCCAGGAAAAGCCATCGGTTTTAATGGAGATCGTCCGTGTCGGCGTATGCAGCATACTCCTAGTGAGTGGTCGGCCGCGGTATGGCTGATACCTAGCACCCGCTACGGCCTGAGAGCTCAGACAACTGAGGCAATATTATAAAACTCATAAAAGTGCCTCTTTGTCTCCGAGCGGAGTGTTCCGCATTTCGCATTCCAGTATGGGCTGCACCCGGGCAACTGGGGCGCGGCCGATCTTTCGAATAGCATATGGGTGAGTATGGTGGAATTTCTGGAGACTCACACCTGCATTAGAAGACAAAGTGAAACTGATTCATCAGCTGTACCCGTACCAAAGGCGTAAGCTGCCTGCTCCTGTCCGGGGAGTGGAGTCTGATGGGATTAGTTACTATGATTGAGTGCGACCACCCCCAAGCAACGCGCTCTAGACTAGATTACCGAGTCCAACGACTTGCCCTCTGTACTCGTAGGTGCCTCCCTTCGCACAGACGTGGCGCTCTTTTGTCCAACTTTGTGTTAAGTAAGCGTTTTTACGTACTATATACGCACGCAAACGCGGCTCTGTTTATGTATCGGGGTCATTGGCTCCCACAAAAACGTCTTACATTACTTGGCCAGGTAATTGGAGAATCGATTACAAGCGCCTAGTAACGACAAGATCTTGCCACGTCCCAAGCTCCCAACGTTACTGGGACTACCATGCGGTGGCTTGGGATGAAGTGAGATTCTCAGAAAGAGATAAGGGGTTTCTGGTTTGGCGCATAATGCTAACTTTGCCTCTATACAAGCGAATGCGTGGGATCAATTGTCACGTAATGTCTTACGGCACAGATGCATTCAATACTAAGA"))
| 82 | 1,018 | 0.856707 | 34 | 1,312 | 33.058824 | 0.5 | 0.021352 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.000849 | 0.102134 | 1,312 | 15 | 1,019 | 87.466667 | 0.953311 | 0 | 0 | 0 | 0 | 0 | 0.760671 | 0.754573 | 0 | 1 | 0 | 0 | 0 | 1 | 0.076923 | false | 0 | 0 | 0 | 0.153846 | 0.076923 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
e7ba060ab5f09b67f72cc7cfb8e50ec25509f165 | 86 | py | Python | RobinhoodTrader/session/__init__.py | jaxbulsara/RobinhoodTrader | a22b4056b8786c1405e3cb06519f17e9ef685dac | [
"MIT"
] | 1 | 2021-04-17T16:24:11.000Z | 2021-04-17T16:24:11.000Z | RobinhoodTrader/session/__init__.py | jaxbulsara/RobinhoodTrader | a22b4056b8786c1405e3cb06519f17e9ef685dac | [
"MIT"
] | null | null | null | RobinhoodTrader/session/__init__.py | jaxbulsara/RobinhoodTrader | a22b4056b8786c1405e3cb06519f17e9ef685dac | [
"MIT"
] | 1 | 2021-04-17T16:24:16.000Z | 2021-04-17T16:24:16.000Z | from .RobinhoodSession import RobinhoodSession
from .TokenFactory import TokenFactory
| 28.666667 | 46 | 0.883721 | 8 | 86 | 9.5 | 0.5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.093023 | 86 | 2 | 47 | 43 | 0.974359 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
99de3be8355e722191df6f57dedb558088acaafd | 3,215 | py | Python | textAnalysis.py | Bissenmann/txt_analysis | 9a90cf53ea2020352c889b256f9f0b9692e893ed | [
"MIT"
] | 1 | 2016-10-20T01:46:56.000Z | 2016-10-20T01:46:56.000Z | textAnalysis.py | Bissenmann/txt-analysis | 9a90cf53ea2020352c889b256f9f0b9692e893ed | [
"MIT"
] | null | null | null | textAnalysis.py | Bissenmann/txt-analysis | 9a90cf53ea2020352c889b256f9f0b9692e893ed | [
"MIT"
] | null | null | null | import nltk
from nltk.tokenize import word_tokenize
from nltk.corpus import stopwords
# Necessary if you haven't downloaded nltk packages
# nltk.download()
# Put your own text file to analyze below
##text = open("sampleText.txt", "r")
##text.read()
sampleText = "“Dreams don't work unless you do.” Personal statement stil' underway, 2800 extra letters I need to get rid of. Here’s what it looks like at the moment: I launched my own graphic design business the day I turned up 16, the minimum legal age to be paid. Needless to say I was eager to start. My unyielding passion for design began at a young age but has developed and honed over the last few years. I used this personal strength as an opportunity to start something I would be proud of. So, for over a year and a half, I sold logos, animations and websites to companies and individuals online. I just created visual identities that enabled organisations to put their best face forward to their audience. But unlike most small online agencies, I tailored my designs exclusively to my client’s needs. I achieved this by examining thoroughly their business and industry in order to best visually interpret their company, thus to better communicate their values, and most importantly, to distinguish them from their competitors. This actually means that before designing and selling my products I figured out, along with my clients, what was the target audience we had to appeal to. Working with wide sets of data was not only incredibly exciting, it has also given me key informations about the markets I had to understand; and by deciphering these datas I strengthened my analysing skills. I have really enjoyed this marketing process of my job because it relied on my ability to interpret data in a meaningful way. Nonetheless, early this september I decided to put a stop to this thrilling and profitable business to better focus on my studies. I believe that having such an early approach to the business world is a priceless bonus for my career. Through prototyping websites for my clients, I also merged my appeal for programing to my business. With the magic of HTML and CSS, I could combine design, maths and interaction altogether. I see programing as a fantastic form of expression and I firmly believe it should be taught at school early on, like any other languages. I was born in the US, I have traveled in 21 countries and I have lived in Canada, Belgium and France. I am bilingual in French and English and fluent in Spanish. Moving in different countries in my youth has enabled me to discover a variety of cultures. I love to be internationally surrounded, it’s the way I’ve been growing. My current school offers me a broad cultural experience with the ability to connect with students from all around the world, and I would love to find this multicultural experience at University."
# Importing stop words ('useless' words) from the nltk corpus
stop_words = set(stopwords.words("english"))
words = word_tokenize(sampleText)
filteredText = [w for w in words if w not in stop_words]
print(filteredText)
# print(word_tokenize(sampleText))
# To print the most common words use
print("Most common words", sampleText.most_common(15))
| 114.821429 | 2,610 | 0.796267 | 545 | 3,215 | 4.686239 | 0.522936 | 0.014096 | 0.017228 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.003736 | 0.167341 | 3,215 | 27 | 2,611 | 119.074074 | 0.950318 | 0.08647 | 0 | 0 | 0 | 0.111111 | 0.895079 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | false | 0.111111 | 0.444444 | 0 | 0.444444 | 0.222222 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 5 |
99deed7ca1f1e471be9f0114c1768a173c86970e | 335 | py | Python | tap_udemy_for_business/schemas/__init__.py | immuta/tap-udemy-for-business | d331651154341960aa7aa7376ffc466f10cb42e2 | [
"MIT"
] | 1 | 2021-06-28T05:01:51.000Z | 2021-06-28T05:01:51.000Z | tap_udemy_for_business/schemas/__init__.py | immuta/tap-udemy-for-business | d331651154341960aa7aa7376ffc466f10cb42e2 | [
"MIT"
] | 1 | 2021-05-18T10:47:26.000Z | 2021-05-19T06:03:27.000Z | tap_udemy_for_business/schemas/__init__.py | immuta/tap-udemy-for-business | d331651154341960aa7aa7376ffc466f10cb42e2 | [
"MIT"
] | 1 | 2021-09-20T15:43:54.000Z | 2021-09-20T15:43:54.000Z | from tap_udemy_for_business.schemas.courses import schema as courses
from tap_udemy_for_business.schemas.user_activity import schema as user_activity
from tap_udemy_for_business.schemas.user_course_activity import (
schema as user_course_activity,
)
from tap_udemy_for_business.schemas.user_progress import schema as user_progress
| 47.857143 | 80 | 0.877612 | 52 | 335 | 5.269231 | 0.269231 | 0.10219 | 0.175182 | 0.218978 | 0.729927 | 0.540146 | 0.430657 | 0.306569 | 0 | 0 | 0 | 0 | 0.089552 | 335 | 6 | 81 | 55.833333 | 0.898361 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.666667 | 0 | 0.666667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
99ecf42f5ebcc1ac814725bf88f5f89ba3461d12 | 991 | py | Python | tests/test_lager.py | jessekrubin/lager | 942d8b158495b5d782a159f36ef801abb972a87f | [
"BSD-2-Clause"
] | 1 | 2020-05-14T03:51:40.000Z | 2020-05-14T03:51:40.000Z | tests/test_lager.py | dynamic-graphics-inc/lager | 942d8b158495b5d782a159f36ef801abb972a87f | [
"MIT"
] | 6 | 2020-05-02T18:20:18.000Z | 2020-06-16T23:31:25.000Z | tests/test_lager.py | jessekrubin/lager | 942d8b158495b5d782a159f36ef801abb972a87f | [
"BSD-2-Clause"
] | null | null | null | # -*- coding: utf-8 -*-
"""
test_lager
----------------------------------
Tests for `lager` module.
"""
# from lager import pour_lager
# from os import remove, chdir, path
# def test_write_to_logfile(tmpdir):
# """
# Should log to a file.
# """
# chdir(tmpdir)
# temp_file = 'sometempfile.log'
# logger = pour_lager(filepath=temp_file)
# logger.info('yeah yeah yeah')
# logger.info('no no no')
# logger.warning('yeah yeah yeah')
# logger.warning('no no no')
# logger.error('yeah yeah yeah')
# logger.error('no no no')
# logger.debug('yeah yeah yeah')
# logger.debug('no no no')
# assert path.exists('sometempfile.log')
# with open('sometempfile.log') as f:
# a = f.read()
# print(a)
# assert len(a.splitlines()) == 8
# def test_write_stdthing():
# logger = pour_lager()
# logger.info('yeah yeah yeah')
def test_lager_port():
from lager import const
assert const.LAGER_PORT == 52437
| 20.645833 | 45 | 0.586276 | 129 | 991 | 4.395349 | 0.372093 | 0.141093 | 0.10582 | 0.126984 | 0.077601 | 0 | 0 | 0 | 0 | 0 | 0 | 0.009186 | 0.23108 | 991 | 47 | 46 | 21.085106 | 0.734908 | 0.838547 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.333333 | 1 | 0.333333 | true | 0 | 0.333333 | 0 | 0.666667 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
412f901d72bf26e63834524eb934233171179c6f | 375 | py | Python | tests/list/pop.py | chrivers/pyjaco | 8ad793dce34ab7aed3b973aae729d6a943a2381c | [
"MIT"
] | 38 | 2015-01-01T18:08:59.000Z | 2022-02-18T08:57:27.000Z | tests/list/pop.py | chrivers/pyjaco | 8ad793dce34ab7aed3b973aae729d6a943a2381c | [
"MIT"
] | 1 | 2020-01-08T04:32:52.000Z | 2020-01-08T04:32:52.000Z | tests/list/pop.py | chrivers/pyjaco | 8ad793dce34ab7aed3b973aae729d6a943a2381c | [
"MIT"
] | 12 | 2016-03-07T09:30:49.000Z | 2021-09-05T20:38:47.000Z | x = [1, True, "foo", "bar"]
print x.pop() == "bar"
print x.pop() == "foo"
print x.pop() == True
print x.pop() == 1
x = [1, True, "foo", "bar"]
print x.pop(0) == 1
print x.pop(0) == True
print x.pop(0) == "foo"
print x.pop(0) == "bar"
try:
x.pop()
except IndexError, E:
print "Done:", E
x = [1, 2, 3]
try:
x.pop(4)
except IndexError, E:
print "Done:", E
| 14.423077 | 27 | 0.52 | 69 | 375 | 2.826087 | 0.231884 | 0.205128 | 0.369231 | 0.205128 | 0.492308 | 0.492308 | 0.215385 | 0.215385 | 0 | 0 | 0 | 0.041667 | 0.232 | 375 | 25 | 28 | 15 | 0.635417 | 0 | 0 | 0.421053 | 0 | 0 | 0.090667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | null | 0 | 0 | null | null | 0.526316 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 5 |
412fc891adb40a4035829fa1547f15b44503ad7b | 3,312 | py | Python | stubs/micropython-v1_18-rp2/rp2.py | mattytrentini/micropython-stubs | 4d596273823b69e9e5bcf5fa67f249c374ee0bbc | [
"MIT"
] | null | null | null | stubs/micropython-v1_18-rp2/rp2.py | mattytrentini/micropython-stubs | 4d596273823b69e9e5bcf5fa67f249c374ee0bbc | [
"MIT"
] | null | null | null | stubs/micropython-v1_18-rp2/rp2.py | mattytrentini/micropython-stubs | 4d596273823b69e9e5bcf5fa67f249c374ee0bbc | [
"MIT"
] | null | null | null | """
Module: 'rp2' on micropython-v1.18-rp2
"""
# MCU: {'family': 'micropython', 'sysname': 'rp2', 'version': '1.18.0', 'build': '', 'mpy': 5637, 'port': 'rp2', 'platform': 'rp2', 'name': 'micropython', 'arch': 'armv7m', 'machine': 'Arduino Nano RP2040 Connect with RP2040', 'nodename': 'rp2', 'ver': 'v1.18', 'release': '1.18.0'}
# Stubber: 1.5.3
from typing import Any
def const(*args, **kwargs) -> Any:
...
class Flash():
''
def __init__(self, *argv, **kwargs) -> None:
''
...
def ioctl(self, *args, **kwargs) -> Any:
...
def readblocks(self, *args, **kwargs) -> Any:
...
def writeblocks(self, *args, **kwargs) -> Any:
...
class PIO():
''
def __init__(self, *argv, **kwargs) -> None:
''
...
IN_HIGH = 1 # type: int
IN_LOW = 0 # type: int
IRQ_SM0 = 256 # type: int
IRQ_SM1 = 512 # type: int
IRQ_SM2 = 1024 # type: int
IRQ_SM3 = 2048 # type: int
JOIN_NONE = 0 # type: int
JOIN_RX = 2 # type: int
JOIN_TX = 1 # type: int
OUT_HIGH = 3 # type: int
OUT_LOW = 2 # type: int
SHIFT_LEFT = 0 # type: int
SHIFT_RIGHT = 1 # type: int
def add_program(self, *args, **kwargs) -> Any:
...
def irq(self, *args, **kwargs) -> Any:
...
def remove_program(self, *args, **kwargs) -> Any:
...
def state_machine(self, *args, **kwargs) -> Any:
...
class StateMachine():
''
def __init__(self, *argv, **kwargs) -> None:
''
...
def exec(self, *args, **kwargs) -> Any:
...
def get(self, *args, **kwargs) -> Any:
...
def active(self, *args, **kwargs) -> Any:
...
def init(self, *args, **kwargs) -> Any:
...
def irq(self, *args, **kwargs) -> Any:
...
def put(self, *args, **kwargs) -> Any:
...
def restart(self, *args, **kwargs) -> Any:
...
def rx_fifo(self, *args, **kwargs) -> Any:
...
def tx_fifo(self, *args, **kwargs) -> Any:
...
def asm_pio_encode(*args, **kwargs) -> Any:
...
def dht_readinto(*args, **kwargs) -> Any:
...
class PIOASMError(Exception):
''
class PIOASMEmit():
''
def __init__(self, *argv, **kwargs) -> None:
''
...
def set(self, *args, **kwargs) -> Any:
...
def irq(self, *args, **kwargs) -> Any:
...
def label(self, *args, **kwargs) -> Any:
...
def mov(self, *args, **kwargs) -> Any:
...
def nop(self, *args, **kwargs) -> Any:
...
def pull(self, *args, **kwargs) -> Any:
...
def push(self, *args, **kwargs) -> Any:
...
def wrap_target(self, *args, **kwargs) -> Any:
...
def wrap(self, *args, **kwargs) -> Any:
...
def word(self, *args, **kwargs) -> Any:
...
def jmp(self, *args, **kwargs) -> Any:
...
def wait(self, *args, **kwargs) -> Any:
...
def in_(self, *args, **kwargs) -> Any:
...
def out(self, *args, **kwargs) -> Any:
...
def start_pass(self, *args, **kwargs) -> Any:
...
def delay(self, *args, **kwargs) -> Any:
...
def side(self, *args, **kwargs) -> Any:
...
def asm_pio(*args, **kwargs) -> Any:
...
| 20.830189 | 282 | 0.476449 | 380 | 3,312 | 4.044737 | 0.276316 | 0.240729 | 0.312947 | 0.364997 | 0.536109 | 0.260247 | 0.172414 | 0.08393 | 0.08393 | 0.08393 | 0 | 0.027644 | 0.311896 | 3,312 | 158 | 283 | 20.962025 | 0.646775 | 0.140399 | 0 | 0.518182 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.372727 | false | 0.009091 | 0.009091 | 0 | 0.545455 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 5 |
4168810f720968b69bd374253adf77b32ab34ee1 | 3,308 | py | Python | customsepomex/seeder/curlSepomex.py | edgarhurtado27/custom-sepomex | 0a9d9c52f27619e028e3c56f05e2343912935061 | [
"MIT"
] | null | null | null | customsepomex/seeder/curlSepomex.py | edgarhurtado27/custom-sepomex | 0a9d9c52f27619e028e3c56f05e2343912935061 | [
"MIT"
] | null | null | null | customsepomex/seeder/curlSepomex.py | edgarhurtado27/custom-sepomex | 0a9d9c52f27619e028e3c56f05e2343912935061 | [
"MIT"
] | null | null | null | import requests
import logging
from zipfile import ZipFile
import sys, os
sys.path.append(os.path.join(sys.path[0], '..'))
from mongoclient import CustomMongoClient
logging.basicConfig(level=logging.INFO)
HEADERS = {'Content-Type': 'application/x-www-form-urlencoded'}
API_ENDPOINT = "https://www.correosdemexico.gob.mx/SSLServicios/ConsultaCP/CodigoPostal_Exportar.aspx"
DATA = "__EVENTTARGET=&__EVENTARGUMENT=&__LASTFOCUS=&__VIEWSTATE=%2FwEPDwUINzcwOTQyOTgPZBYCAgEPZBYCAgEPZBYGAgMPDxYCHgRUZXh0BTnDmmx0aW1hIEFjdHVhbGl6YWNpw7NuIGRlIEluZm9ybWFjacOzbjogQWdvc3RvIDE1IGRlIDIwMjFkZAIHDxAPFgYeDURhdGFUZXh0RmllbGQFA0Vkbx4ORGF0YVZhbHVlRmllbGQFBUlkRWRvHgtfIURhdGFCb3VuZGdkEBUhIy0tLS0tLS0tLS0gVCAgbyAgZCAgbyAgcyAtLS0tLS0tLS0tDkFndWFzY2FsaWVudGVzD0JhamEgQ2FsaWZvcm5pYRNCYWphIENhbGlmb3JuaWEgU3VyCENhbXBlY2hlFENvYWh1aWxhIGRlIFphcmFnb3phBkNvbGltYQdDaGlhcGFzCUNoaWh1YWh1YRFDaXVkYWQgZGUgTcOpeGljbwdEdXJhbmdvCkd1YW5hanVhdG8IR3VlcnJlcm8HSGlkYWxnbwdKYWxpc2NvB03DqXhpY28UTWljaG9hY8OhbiBkZSBPY2FtcG8HTW9yZWxvcwdOYXlhcml0C051ZXZvIExlw7NuBk9heGFjYQZQdWVibGEKUXVlcsOpdGFybwxRdWludGFuYSBSb28QU2FuIEx1aXMgUG90b3PDrQdTaW5hbG9hBlNvbm9yYQdUYWJhc2NvClRhbWF1bGlwYXMIVGxheGNhbGEfVmVyYWNydXogZGUgSWduYWNpbyBkZSBsYSBMbGF2ZQhZdWNhdMOhbglaYWNhdGVjYXMVIQIwMAIwMQIwMgIwMwIwNAIwNQIwNgIwNwIwOAIwOQIxMAIxMQIxMgIxMwIxNAIxNQIxNgIxNwIxOAIxOQIyMAIyMQIyMgIyMwIyNAIyNQIyNgIyNwIyOAIyOQIzMAIzMQIzMhQrAyFnZ2dnZ2dnZ2dnZ2dnZ2dnZ2dnZ2dnZ2dnZ2dnZ2dnZ2dkZAIdDzwrAAsAZBgBBR5fX0NvbnRyb2xzUmVxdWlyZVBvc3RCYWNrS2V5X18WAQULYnRuRGVzY2FyZ2G2iMbH35u3WADeV8JN3PTuofYbzw%3D%3D&__VIEWSTATEGENERATOR=BE1A6D2E&__EVENTVALIDATION=%2FwEWKAKe5L2iBwLG%2FOLvBgLWk4iCCgLWk4SCCgLWk4CCCgLWk7yCCgLWk7iCCgLWk7SCCgLWk7CCCgLWk6yCCgLWk%2BiBCgLWk%2BSBCgLJk4iCCgLJk4SCCgLJk4CCCgLJk7yCCgLJk7iCCgLJk7SCCgLJk7CCCgLJk6yCCgLJk%2BiBCgLJk%2BSBCgLIk4iCCgLIk4SCCgLIk4CCCgLIk7yCCgLIk7iCCgLIk7SCCgLIk7CCCgLIk6yCCgLIk%2BiBCgLIk%2BSBCgLLk4iCCgLLk4SCCgLLk4CCCgLL%2BuTWBALa4Za4AgK%2BqOyRAQLI56b6CwL1%2FKjtBYL74Dewt%2F4T3RA0oKJjVZ0%2FcjO2&cboEdo=00&rblTipo=txt&btnDescarga.x=18&btnDescarga.y=14"
# Getting data from SEPOMEX
r = requests.post(url = API_ENDPOINT, data = DATA, headers = HEADERS)
# Saving zip file
with open(r'/tmp/salida.zip','wb') as f:
f.write(r.content)
# Extract data
with ZipFile('/tmp/salida.zip', 'r') as myzip:
myzip.extractall('/tmp/')
logging.info('Reading file')
zipCodesFile = open('/tmp/CPdescarga.txt', encoding='latin-1')
zipCodesMap = {}
count = 0
while True:
count += 1
line = zipCodesFile.readline()
# if line is empty end of file is reached
if not line: break
if count > 2:
register = {}
data = line.strip().split('|')
cp = data[0]
if zipCodesMap.get(cp) is not None :
register = zipCodesMap.get(cp)
register.get('colonias').append(data[1])
else :
register = {
"codigoPostal": cp,
"estado": data[4],
"municipio": data[3],
"colonias": [data[1]]
}
zipCodesMap[cp] = register
logging.info('Closing file')
zipCodesFile.close()
logging.info('Begin import')
for key in zipCodesMap:
CustomMongoClient.insertOne('zipCodes', zipCodesMap[key])
logging.info('Deleting files')
os.remove('/tmp/salida.zip')
os.remove('/tmp/CPdescarga.txt')
logging.info('Import finished')
| 46.591549 | 1,623 | 0.804716 | 242 | 3,308 | 10.938017 | 0.53719 | 0.024934 | 0.0136 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.057483 | 0.111245 | 3,308 | 70 | 1,624 | 47.257143 | 0.842857 | 0.028416 | 0 | 0 | 0 | 0.021277 | 0.611094 | 0.513244 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | false | 0 | 0.148936 | 0 | 0.148936 | 0 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
417e3d959e5506bedaaf6b18f46365ee8fa486de | 42 | py | Python | opsdroid/testing/mockmodules/skills/__init__.py | JiahnChoi/opsdroid.kr | 0893456b0f9f6c70edf7c330a7593d87450538cc | [
"Apache-2.0"
] | 712 | 2016-08-09T21:30:07.000Z | 2022-03-24T09:38:21.000Z | opsdroid/testing/mockmodules/skills/__init__.py | JiahnChoi/opsdroid.kr | 0893456b0f9f6c70edf7c330a7593d87450538cc | [
"Apache-2.0"
] | 1,767 | 2016-07-27T13:01:25.000Z | 2022-03-29T04:25:10.000Z | opsdroid/testing/mockmodules/skills/__init__.py | JiahnChoi/opsdroid.kr | 0893456b0f9f6c70edf7c330a7593d87450538cc | [
"Apache-2.0"
] | 536 | 2016-07-31T14:23:41.000Z | 2022-03-22T17:35:15.000Z | """Mocked skills for testing opsdroid."""
| 21 | 41 | 0.714286 | 5 | 42 | 6 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.119048 | 42 | 1 | 42 | 42 | 0.810811 | 0.833333 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
41821af2a76b3e22f6f71a6ae8d96831d2ebf10b | 121 | py | Python | restfulpy/messaging/__init__.py | maryayi/restfulpy | df4a88a7cc2740c37fd8d80c310e0372b83cd8e0 | [
"MIT"
] | 1 | 2021-06-11T21:39:44.000Z | 2021-06-11T21:39:44.000Z | restfulpy/messaging/__init__.py | maryayi/restfulpy | df4a88a7cc2740c37fd8d80c310e0372b83cd8e0 | [
"MIT"
] | null | null | null | restfulpy/messaging/__init__.py | maryayi/restfulpy | df4a88a7cc2740c37fd8d80c310e0372b83cd8e0 | [
"MIT"
] | null | null | null |
from .models import Email, BaseEmail
from .providers import Messenger, create_messenger, SmtpProvider, ConsoleMessenger
| 30.25 | 82 | 0.842975 | 13 | 121 | 7.769231 | 0.769231 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.107438 | 121 | 3 | 83 | 40.333333 | 0.935185 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
41b611d41234f90412cdc0880a8765a25d93371b | 172 | py | Python | pytheons/pyunit/suites/test_runner.py | pytheons/pyunit | e8b9104b6c7ff0c6cd3b702262f6fb0f3c2c2d45 | [
"MIT"
] | 1 | 2021-01-14T14:35:31.000Z | 2021-01-14T14:35:31.000Z | pytheons/pyunit/suites/test_runner.py | pytheons/pyunit | e8b9104b6c7ff0c6cd3b702262f6fb0f3c2c2d45 | [
"MIT"
] | null | null | null | pytheons/pyunit/suites/test_runner.py | pytheons/pyunit | e8b9104b6c7ff0c6cd3b702262f6fb0f3c2c2d45 | [
"MIT"
] | 1 | 2021-12-23T07:58:47.000Z | 2021-12-23T07:58:47.000Z | from pytheons.pyunit.user_interface.command_line_interface.command.run import RunCommand
class TestRunner:
@staticmethod
def run():
RunCommand().handle()
| 21.5 | 88 | 0.75 | 19 | 172 | 6.631579 | 0.789474 | 0.253968 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.162791 | 172 | 7 | 89 | 24.571429 | 0.875 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.2 | true | 0 | 0.2 | 0 | 0.6 | 0 | 1 | 0 | 0 | null | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 5 |
41c2f6f1b97b6f932bb63e47727a7102438e598c | 53 | py | Python | source/FnAssetAPI/ui/dialogs/__init__.py | IngenuityEngine/ftrack-connect-foundry | a0d5ba788e3dc5c1536ebe9740bcf4393e3f5e1d | [
"MIT"
] | 1 | 2019-10-22T06:33:08.000Z | 2019-10-22T06:33:08.000Z | source/FnAssetAPI/ui/dialogs/__init__.py | IngenuityEngine/ftrack-connect-foundry | a0d5ba788e3dc5c1536ebe9740bcf4393e3f5e1d | [
"MIT"
] | null | null | null | source/FnAssetAPI/ui/dialogs/__init__.py | IngenuityEngine/ftrack-connect-foundry | a0d5ba788e3dc5c1536ebe9740bcf4393e3f5e1d | [
"MIT"
] | null | null | null | from .TabbedBrowserDialog import TabbedBrowserDialog
| 26.5 | 52 | 0.90566 | 4 | 53 | 12 | 0.75 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.075472 | 53 | 1 | 53 | 53 | 0.979592 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
68bcde70e04c9373c6ff4f2316389feb0e862a5c | 205 | py | Python | analysis/functions/get_names.py | N-Wouda/OR-Analysis | 2070e2dee49f1556fcaa00044d3512e4ba08550f | [
"MIT"
] | 7 | 2020-04-12T14:02:08.000Z | 2021-10-09T07:52:08.000Z | analysis/functions/get_names.py | N-Wouda/OR-Analysis | 2070e2dee49f1556fcaa00044d3512e4ba08550f | [
"MIT"
] | 11 | 2020-02-16T22:15:28.000Z | 2020-03-28T09:35:38.000Z | analysis/functions/get_names.py | N-Wouda/OR-Analysis | 2070e2dee49f1556fcaa00044d3512e4ba08550f | [
"MIT"
] | 2 | 2020-05-21T23:19:44.000Z | 2020-09-04T05:22:45.000Z | from typing import Callable, List
def get_names(operators: List[Callable]):
"""
Gets the operator names from the passed-in function list.
"""
return [func.__name__ for func in operators]
| 22.777778 | 61 | 0.702439 | 28 | 205 | 4.964286 | 0.678571 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.209756 | 205 | 8 | 62 | 25.625 | 0.858025 | 0.278049 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.333333 | false | 0 | 0.333333 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
6b6151e33b4c3e32eba3cf7d817f109e09866ff5 | 330 | py | Python | tests/util/test_suppress_slots_meta.py | LeeeeT/valtypes | 0c5df3cbab296bf9ca34544604fbb9496a41e01a | [
"MIT"
] | 3 | 2022-02-22T12:59:59.000Z | 2022-03-10T14:12:25.000Z | tests/util/test_suppress_slots_meta.py | LeeeeT/valtypes | 0c5df3cbab296bf9ca34544604fbb9496a41e01a | [
"MIT"
] | 3 | 2022-03-08T13:33:38.000Z | 2022-03-25T03:31:56.000Z | tests/util/test_suppress_slots_meta.py | LeeeeT/valtypes | 0c5df3cbab296bf9ca34544604fbb9496a41e01a | [
"MIT"
] | null | null | null | from valtypes.util import SuppressSlotsMeta
def test_multiple_inheritance() -> None:
"""
It allows multiple inheritance from classes with __slots__ defined
"""
class A(int, metaclass=SuppressSlotsMeta):
pass
class B(int, metaclass=SuppressSlotsMeta):
pass
class AB(A, B):
pass
| 19.411765 | 70 | 0.666667 | 36 | 330 | 5.944444 | 0.638889 | 0.17757 | 0.271028 | 0.308411 | 0.35514 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.254545 | 330 | 16 | 71 | 20.625 | 0.869919 | 0.2 | 0 | 0.375 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.125 | true | 0.375 | 0.125 | 0 | 0.625 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 1 | 0 | 0 | 5 |
6b6ac7e1694c82e2879b7fe523e19b9a67b2f05a | 46 | py | Python | script/lib/__init__.py | FRG-UPC-Deliverables/tsk-js | 9dd4fcd1c88cb690361cc2a8429cdd127684acea | [
"MIT"
] | null | null | null | script/lib/__init__.py | FRG-UPC-Deliverables/tsk-js | 9dd4fcd1c88cb690361cc2a8429cdd127684acea | [
"MIT"
] | 5 | 2021-05-08T07:21:28.000Z | 2021-09-21T03:54:39.000Z | script/lib/__init__.py | FRG-UPC-Deliverables/tsk-js | 9dd4fcd1c88cb690361cc2a8429cdd127684acea | [
"MIT"
] | null | null | null | from utils import execute, file_exists, rmdir
| 23 | 45 | 0.826087 | 7 | 46 | 5.285714 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.130435 | 46 | 1 | 46 | 46 | 0.925 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
6b713bb3be403657004cfcabd1f2825af27803d6 | 94 | py | Python | comments/admin.py | daedaldan/hackerthoughts | d6d15b88933b2c8caa76fd3fe5335f3d434353f6 | [
"MIT"
] | null | null | null | comments/admin.py | daedaldan/hackerthoughts | d6d15b88933b2c8caa76fd3fe5335f3d434353f6 | [
"MIT"
] | null | null | null | comments/admin.py | daedaldan/hackerthoughts | d6d15b88933b2c8caa76fd3fe5335f3d434353f6 | [
"MIT"
] | null | null | null | from django.contrib import admin
from .models import Interest
admin.site.register(Interest)
| 15.666667 | 32 | 0.819149 | 13 | 94 | 5.923077 | 0.692308 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.117021 | 94 | 5 | 33 | 18.8 | 0.927711 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.666667 | 0 | 0.666667 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
6b9891a6793c1531a51ee4310da353feaf471a42 | 152 | py | Python | example.py | jenswehnerteaching/code-refinery-bq | ab6a82bd86a03631bcb2b42030538f9e8eb12751 | [
"Apache-2.0"
] | null | null | null | example.py | jenswehnerteaching/code-refinery-bq | ab6a82bd86a03631bcb2b42030538f9e8eb12751 | [
"Apache-2.0"
] | 1 | 2021-06-07T09:26:07.000Z | 2021-06-07T10:14:18.000Z | example.py | jenswehnerteaching/code-refinery-bq | ab6a82bd86a03631bcb2b42030538f9e8eb12751 | [
"Apache-2.0"
] | 2 | 2021-06-07T09:21:56.000Z | 2021-06-07T09:24:00.000Z | import pytest
def add(a,b):
return a + b
def test_add():
assert add(1,2)==3
def subtract(a,b):
return a - b
def product(a,b):
return a * b
| 11.692308 | 20 | 0.605263 | 31 | 152 | 2.935484 | 0.451613 | 0.131868 | 0.263736 | 0.296703 | 0.395604 | 0.285714 | 0 | 0 | 0 | 0 | 0 | 0.026087 | 0.243421 | 152 | 12 | 21 | 12.666667 | 0.765217 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.111111 | 1 | 0.444444 | false | 0 | 0.111111 | 0.333333 | 0.888889 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 5 |
d42c31c2321a20375a7896ec8f469ca50ad02862 | 202 | py | Python | docker_hadoop/conexer/src/space_expl_framework/abs_classes/__init__.py | rahlk/ConEX | 4dd03a394694257dcd29a0f35cea83b656988830 | [
"Apache-2.0"
] | 1 | 2020-07-15T19:42:22.000Z | 2020-07-15T19:42:22.000Z | docker_hadoop/conexer/src/space_expl_framework/abs_classes/__init__.py | rahlk/ConEX | 4dd03a394694257dcd29a0f35cea83b656988830 | [
"Apache-2.0"
] | 1 | 2020-01-31T00:41:17.000Z | 2020-01-31T00:41:17.000Z | docker_hadoop/conexer/src/space_expl_framework/abs_classes/__init__.py | rahlk/ConEX__Replication_Package | 4dd03a394694257dcd29a0f35cea83b656988830 | [
"Apache-2.0"
] | null | null | null | from expl_algo import AbstractAlgo
from profiler import AbstractProfiler
from component import AbsComponents
from conf_space import AbsConfSpace
from sampling_strategies import AbstractSamplingStrategy
| 33.666667 | 56 | 0.90099 | 23 | 202 | 7.782609 | 0.652174 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.09901 | 202 | 5 | 57 | 40.4 | 0.983516 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
d48484be3e2b0001b444a485e546f8aa8b80123b | 42 | py | Python | convolupy/__init__.py | dwf/convolupy | 2cb5ed9f2f86ae6d8f59363bf01278fa8916c968 | [
"BSD-3-Clause"
] | 6 | 2015-02-24T01:06:08.000Z | 2020-04-07T17:22:37.000Z | convolupy/__init__.py | dwf/convolupy | 2cb5ed9f2f86ae6d8f59363bf01278fa8916c968 | [
"BSD-3-Clause"
] | 1 | 2019-10-06T13:50:36.000Z | 2019-10-06T13:50:36.000Z | convolupy/__init__.py | dwf/convolupy | 2cb5ed9f2f86ae6d8f59363bf01278fa8916c968 | [
"BSD-3-Clause"
] | 6 | 2015-11-02T13:21:40.000Z | 2020-04-07T17:22:37.000Z | """Dummy module for namespace package."""
| 21 | 41 | 0.714286 | 5 | 42 | 6 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.119048 | 42 | 1 | 42 | 42 | 0.810811 | 0.833333 | 0 | null | 0 | null | 0 | 0 | null | 0 | 0 | 0 | null | 1 | null | true | 0 | 0 | null | null | null | 1 | 1 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 5 |
d486ca8a832fd710af72b1e4aa176062dbf3e0fb | 89 | py | Python | pokerl/agents/__init__.py | sneppy/pokerl | 2ea8cd6c3dad7531ac5cad79aa0dc8879f771e2c | [
"MIT"
] | 6 | 2020-05-26T23:04:39.000Z | 2022-03-01T18:11:08.000Z | pokerl/agents/__init__.py | sneppy/pokerl | 2ea8cd6c3dad7531ac5cad79aa0dc8879f771e2c | [
"MIT"
] | 14 | 2020-05-26T23:30:13.000Z | 2020-05-28T20:50:32.000Z | pokerl/agents/__init__.py | sneppy/pokerl | 2ea8cd6c3dad7531ac5cad79aa0dc8879f771e2c | [
"MIT"
] | null | null | null | from .agent import PokerAgent
from .human import CLIAgent
from .random import RandomAgent | 29.666667 | 31 | 0.842697 | 12 | 89 | 6.25 | 0.666667 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.123596 | 89 | 3 | 31 | 29.666667 | 0.961538 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
2e15defca9426339f9a639fcdeda7736a72aa315 | 296 | py | Python | allennlp/data/dataset_readers/nlvr.py | YoPatapon/allennlp | d50964b1f5b6887c74855a4fbbd1e948d406d206 | [
"Apache-2.0"
] | 6 | 2019-03-19T02:05:35.000Z | 2019-09-25T07:24:52.000Z | allennlp/data/dataset_readers/nlvr.py | shanesyy/allennlp | 4c99f8e82f7fd70c86652109bfca5282d470e981 | [
"Apache-2.0"
] | 1 | 2019-07-08T15:28:04.000Z | 2019-07-08T15:28:04.000Z | allennlp/data/dataset_readers/nlvr.py | shanesyy/allennlp | 4c99f8e82f7fd70c86652109bfca5282d470e981 | [
"Apache-2.0"
] | 1 | 2020-03-12T06:53:53.000Z | 2020-03-12T06:53:53.000Z | # pylint: disable=unused-import
import warnings
from allennlp.data.dataset_readers.semantic_parsing.nlvr import NlvrDatasetReader
warnings.warn("allennlp.data.dataset_readers.nlvr.* has been moved."
"Please use allennlp.data.dataset_reader.semantic_parsing.nlvr.*", FutureWarning)
| 42.285714 | 95 | 0.797297 | 36 | 296 | 6.416667 | 0.611111 | 0.155844 | 0.246753 | 0.225108 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.108108 | 296 | 6 | 96 | 49.333333 | 0.875 | 0.097973 | 0 | 0 | 0 | 0 | 0.433962 | 0.332075 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 0.5 | 0 | 0.5 | 0 | 0 | 0 | 0 | null | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 5 |
2e2626ffcf2540a325ba557009f028e47b301b9a | 248 | py | Python | tests/utils/with_number_inheritance.py | ontherivt/versionary | f9ae71b5614d42f1f9c587f23259c09670f154b1 | [
"MIT"
] | 6 | 2017-07-03T18:42:13.000Z | 2021-09-22T18:28:44.000Z | tests/utils/with_number_inheritance.py | ontherivt/versionary | f9ae71b5614d42f1f9c587f23259c09670f154b1 | [
"MIT"
] | 1 | 2017-09-22T15:39:41.000Z | 2017-09-22T15:39:41.000Z | tests/utils/with_number_inheritance.py | ontherivt/versionary | f9ae71b5614d42f1f9c587f23259c09670f154b1 | [
"MIT"
] | 1 | 2021-11-13T08:47:10.000Z | 2021-11-13T08:47:10.000Z | from versionary.decorators import versioned
@versioned(1)
class MyClass(object):
pass
@versioned(2)
class MyClass(MyClass.v1):
pass
@versioned(3)
class MyClass(MyClass.v2):
pass
@versioned(4)
class MyClass(MyClass.v1):
pass
| 11.272727 | 43 | 0.709677 | 32 | 248 | 5.5 | 0.46875 | 0.272727 | 0.323864 | 0.238636 | 0.284091 | 0 | 0 | 0 | 0 | 0 | 0 | 0.034314 | 0.177419 | 248 | 21 | 44 | 11.809524 | 0.828431 | 0 | 0 | 0.461538 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0.307692 | 0.076923 | 0 | 0.384615 | 0 | 0 | 0 | 0 | null | 1 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 5 |
5cfbc6fc557123ab32e36c471954c9c7f2e51d6f | 87 | py | Python | dashboard/plot/__init__.py | sorice/flasked-altair | 603047ff9ac8494cd9a4df8bb7d2db4a6eded7e9 | [
"MIT"
] | null | null | null | dashboard/plot/__init__.py | sorice/flasked-altair | 603047ff9ac8494cd9a4df8bb7d2db4a6eded7e9 | [
"MIT"
] | null | null | null | dashboard/plot/__init__.py | sorice/flasked-altair | 603047ff9ac8494cd9a4df8bb7d2db4a6eded7e9 | [
"MIT"
] | null | null | null | from .py2html import Div
from .altair import make_static_chart, make_interactive_chart
| 29 | 61 | 0.862069 | 13 | 87 | 5.461538 | 0.692308 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.012821 | 0.103448 | 87 | 2 | 62 | 43.5 | 0.897436 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | true | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 5 |
cf14fcef3de1f8a3bb920962d79471f5ebceb3cd | 4,250 | py | Python | models.py | nortics/stepik-flask4 | 4d1aaee69edda7a9286a80e3c8ac83e7192f6573 | [
"MIT"
] | null | null | null | models.py | nortics/stepik-flask4 | 4d1aaee69edda7a9286a80e3c8ac83e7192f6573 | [
"MIT"
] | null | null | null | models.py | nortics/stepik-flask4 | 4d1aaee69edda7a9286a80e3c8ac83e7192f6573 | [
"MIT"
] | null | null | null | from sqlalchemy import Column, Integer, String, Numeric, Text, Time, Boolean
from database import Base
class Dows(Base):
__tablename__ = "dows"
dow = Column(String(45), primary_key=True, nullable=False)
dow_name = Column(String(45), nullable=False)
dow_order = Column(Integer, nullable=False)
def __init__(self, **kwargs):
for key, value in kwargs.items():
setattr(self, key, value)
def __repr__(self):
return '<{} {!r}>'.format(type(self).__name__, self.dow)
class Goals(Base):
__tablename__ = "goals"
goal = Column(String(45), primary_key=True, nullable=False)
goal_name = Column(String(45), nullable=False)
def __init__(self, **kwargs):
for key, value in kwargs.items():
setattr(self, key, value)
def __repr__(self):
return '<{} {!r}>'.format(type(self).__name__, self.goal)
class Scheduler(Base):
__tablename__ = "scheduler"
row_id = Column(Integer, primary_key=True, autoincrement=True, nullable=False)
teacher_id = Column(Integer, nullable=False)
dow_id = Column(String(45), nullable=False)
time = Column(Time, nullable=False)
occupied = Column(Boolean, nullable=False)
def __init__(self, **kwargs):
for key, value in kwargs.items():
setattr(self, key, value)
def __repr__(self):
return '<{} {!r}>'.format(type(self).__name__, self.row_id)
class TeacherGoals(Base):
__tablename__ = "teacher_goals"
row_id = Column(Integer, primary_key=True, autoincrement=True, nullable=False)
teacher_id = Column(Integer, nullable=False)
goal_id = Column(String(45), nullable=False)
def __init__(self, **kwargs):
for key, value in kwargs.items():
setattr(self, key, value)
def __repr__(self):
return '<{} {!r}>'.format(type(self).__name__, self.row_id)
class Teachers(Base):
__tablename__ = "teachers"
row_id = Column(Integer, primary_key=True, autoincrement=True, nullable=False)
id = Column(Integer, nullable=False)
name = Column(String(100), nullable=False)
about = Column(Text, nullable=False)
rating = Column(Numeric(4, 1), nullable=False)
picture = Column(String(120), nullable=False)
price = Column(Numeric(6, 2), nullable=False)
def __init__(self, **kwargs):
for key, value in kwargs.items():
setattr(self, key, value)
def __repr__(self):
return '<{} {!r}>'.format(type(self).__name__, self.row_id)
class ViewSchedulerDows(Base):
__tablename__ = "view_scheduler_dows"
row_id = Column(Integer, primary_key=True, autoincrement=True, nullable=False)
teacher_id = Column(Integer, nullable=False)
id = Column(Integer, nullable=False)
dow_id = Column(Integer, nullable=False)
time = Column(Time, nullable=False)
occupied = Column(Boolean, nullable=False)
dow_name = Column(String(45), nullable=False)
dow_order = Column(Integer, nullable=False)
def __init__(self, **kwargs):
for key, value in kwargs.items():
setattr(self, key, value)
def __repr__(self):
return '<{} {!r}>'.format(type(self).__name__, self.row_id)
class ViewTeacherGoals(Base):
__tablename__ = "view_teacher_goals"
row_id = Column(Integer, primary_key=True, autoincrement=True, nullable=False)
teacher_id = Column(Integer, nullable=False)
goal_id = Column(String(45), nullable=False)
goal_name = Column(String(45), nullable=False)
def __init__(self, **kwargs):
for key, value in kwargs.items():
setattr(self, key, value)
def __repr__(self):
return '<{} {!r}>'.format(type(self).__name__, self.row_id)
class TeacherRequests(Base):
__tablename__ = "view_teacher_requests"
request_uid = Column(Integer, primary_key=True, nullable=False)
goal = Column(String(45), nullable=False)
time = Column(String(45), nullable=False)
customer_name = Column(String(45), nullable=False)
customer_phone = Column(String(45), nullable=False)
def __init__(self, **kwargs):
for key, value in kwargs.items():
setattr(self, key, value)
def __repr__(self):
return '<{} {!r}>'.format(type(self).__name__, self.row_id)
| 33.203125 | 82 | 0.662588 | 527 | 4,250 | 5.018975 | 0.127135 | 0.181853 | 0.068809 | 0.091493 | 0.798866 | 0.791304 | 0.753875 | 0.726276 | 0.6862 | 0.6862 | 0 | 0.010598 | 0.200706 | 4,250 | 127 | 83 | 33.464567 | 0.768031 | 0 | 0 | 0.642105 | 0 | 0 | 0.039765 | 0.004941 | 0 | 0 | 0 | 0 | 0 | 1 | 0.168421 | false | 0 | 0.021053 | 0.084211 | 0.831579 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 5 |
d8579b2267c58abccf3dc28e92946181ec45f830 | 85 | py | Python | mist/guuid.py | BBVA/MIST | 3821ccd089e78cefe78282ac7297a6b4882cc53c | [
"Apache-2.0"
] | 13 | 2021-03-09T15:34:37.000Z | 2021-07-27T21:21:24.000Z | mist/guuid.py | JavDomGom/mist | 83ae9f67df61ff2387a7d424cff0f8591a6a645f | [
"Apache-2.0"
] | 12 | 2020-10-16T10:17:22.000Z | 2020-10-20T12:28:17.000Z | mist/guuid.py | JavDomGom/mist | 83ae9f67df61ff2387a7d424cff0f8591a6a645f | [
"Apache-2.0"
] | 3 | 2021-04-23T17:09:27.000Z | 2021-06-23T02:22:56.000Z | import uuid
def guuid() -> str:
return uuid.uuid4().hex
__all__ = ("guuid", )
| 10.625 | 27 | 0.6 | 11 | 85 | 4.272727 | 0.818182 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0.015152 | 0.223529 | 85 | 7 | 28 | 12.142857 | 0.69697 | 0 | 0 | 0 | 0 | 0 | 0.058824 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0.25 | false | 0 | 0.25 | 0.25 | 0.75 | 0 | 1 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 5 |
d88155d8631223b8d781a0c031ed7f2a691d6596 | 2,180 | py | Python | test/test_ezsigntemplatesignature_request_compound.py | ezmaxinc/eZmax-SDK-python | 6794b8001abfb7d9ae18a3b87aba164839b925a0 | [
"MIT"
] | null | null | null | test/test_ezsigntemplatesignature_request_compound.py | ezmaxinc/eZmax-SDK-python | 6794b8001abfb7d9ae18a3b87aba164839b925a0 | [
"MIT"
] | null | null | null | test/test_ezsigntemplatesignature_request_compound.py | ezmaxinc/eZmax-SDK-python | 6794b8001abfb7d9ae18a3b87aba164839b925a0 | [
"MIT"
] | null | null | null | """
eZmax API Definition (Full)
This API expose all the functionnalities for the eZmax and eZsign applications. # noqa: E501
The version of the OpenAPI document: 1.1.7
Contact: support-api@ezmax.ca
Generated by: https://openapi-generator.tech
"""
import sys
import unittest
import eZmaxApi
from eZmaxApi.model.ezsigntemplatesignature_request import EzsigntemplatesignatureRequest
from eZmaxApi.model.ezsigntemplatesignature_request_compound_all_of import EzsigntemplatesignatureRequestCompoundAllOf
from eZmaxApi.model.ezsigntemplatesignaturecustomdate_request_compound import EzsigntemplatesignaturecustomdateRequestCompound
from eZmaxApi.model.field_e_ezsigntemplatesignature_font import FieldEEzsigntemplatesignatureFont
from eZmaxApi.model.field_e_ezsigntemplatesignature_tooltipposition import FieldEEzsigntemplatesignatureTooltipposition
from eZmaxApi.model.field_e_ezsigntemplatesignature_type import FieldEEzsigntemplatesignatureType
globals()['EzsigntemplatesignatureRequest'] = EzsigntemplatesignatureRequest
globals()['EzsigntemplatesignatureRequestCompoundAllOf'] = EzsigntemplatesignatureRequestCompoundAllOf
globals()['EzsigntemplatesignaturecustomdateRequestCompound'] = EzsigntemplatesignaturecustomdateRequestCompound
globals()['FieldEEzsigntemplatesignatureFont'] = FieldEEzsigntemplatesignatureFont
globals()['FieldEEzsigntemplatesignatureTooltipposition'] = FieldEEzsigntemplatesignatureTooltipposition
globals()['FieldEEzsigntemplatesignatureType'] = FieldEEzsigntemplatesignatureType
from eZmaxApi.model.ezsigntemplatesignature_request_compound import EzsigntemplatesignatureRequestCompound
class TestEzsigntemplatesignatureRequestCompound(unittest.TestCase):
"""EzsigntemplatesignatureRequestCompound unit test stubs"""
def setUp(self):
pass
def tearDown(self):
pass
def testEzsigntemplatesignatureRequestCompound(self):
"""Test EzsigntemplatesignatureRequestCompound"""
# FIXME: construct object with mandatory attributes with example values
# model = EzsigntemplatesignatureRequestCompound() # noqa: E501
pass
if __name__ == '__main__':
unittest.main()
| 44.489796 | 126 | 0.840826 | 162 | 2,180 | 11.154321 | 0.45679 | 0.046486 | 0.065855 | 0.066408 | 0.163254 | 0.137244 | 0 | 0 | 0 | 0 | 0 | 0.004606 | 0.10367 | 2,180 | 48 | 127 | 45.416667 | 0.920164 | 0.216972 | 0 | 0.12 | 0 | 0 | 0.143371 | 0.138572 | 0 | 0 | 0 | 0.020833 | 0 | 1 | 0.12 | false | 0.12 | 0.4 | 0 | 0.56 | 0 | 0 | 0 | 1 | null | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | null | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | 5 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.