Split (1)

train · 253k rows

hexsha string	size int64	ext string	lang string	max_stars_repo_path string	max_stars_repo_name string	max_stars_repo_head_hexsha string	max_stars_repo_licenses list	max_stars_count int64	max_stars_repo_stars_event_min_datetime string	max_stars_repo_stars_event_max_datetime string	max_issues_repo_path string	max_issues_repo_name string	max_issues_repo_head_hexsha string	max_issues_repo_licenses list	max_issues_count int64	max_issues_repo_issues_event_min_datetime string	max_issues_repo_issues_event_max_datetime string	max_forks_repo_path string	max_forks_repo_name string	max_forks_repo_head_hexsha string	max_forks_repo_licenses list	max_forks_count int64	max_forks_repo_forks_event_min_datetime string	max_forks_repo_forks_event_max_datetime string	content string	avg_line_length float64	max_line_length int64	alphanum_fraction float64	qsc_code_num_words_quality_signal int64	qsc_code_num_chars_quality_signal float64	qsc_code_mean_word_length_quality_signal float64	qsc_code_frac_words_unique_quality_signal float64	qsc_code_frac_chars_top_2grams_quality_signal float64	qsc_code_frac_chars_top_3grams_quality_signal float64	qsc_code_frac_chars_top_4grams_quality_signal float64	qsc_code_frac_chars_dupe_5grams_quality_signal float64	qsc_code_frac_chars_dupe_6grams_quality_signal float64	qsc_code_frac_chars_dupe_7grams_quality_signal float64	qsc_code_frac_chars_dupe_8grams_quality_signal float64	qsc_code_frac_chars_dupe_9grams_quality_signal float64	qsc_code_frac_chars_dupe_10grams_quality_signal float64	qsc_code_frac_chars_digital_quality_signal float64	qsc_code_frac_chars_whitespace_quality_signal float64	qsc_code_size_file_byte_quality_signal float64	qsc_code_num_lines_quality_signal float64	qsc_code_num_chars_line_max_quality_signal float64	qsc_code_num_chars_line_mean_quality_signal float64	qsc_code_frac_chars_alphabet_quality_signal float64	qsc_code_frac_chars_comments_quality_signal float64	qsc_code_frac_lines_dupe_lines_quality_signal float64	qsc_code_cate_autogen_quality_signal float64	qsc_code_frac_lines_long_string_quality_signal float64	qsc_code_frac_chars_string_length_quality_signal float64	qsc_code_frac_chars_long_word_length_quality_signal float64	qsc_code_frac_lines_string_concat_quality_signal float64	qsc_code_cate_encoded_data_quality_signal float64	qsc_code_frac_lines_prompt_comments_quality_signal float64	qsc_code_frac_lines_assert_quality_signal float64	qsc_codepython_cate_ast_quality_signal float64	qsc_codepython_frac_lines_func_ratio_quality_signal float64	qsc_codepython_cate_var_zero_quality_signal bool	qsc_codepython_frac_lines_pass_quality_signal float64	qsc_codepython_frac_lines_import_quality_signal float64	qsc_codepython_frac_lines_simplefunc_quality_signal float64	qsc_codepython_score_lines_no_logic_quality_signal float64	qsc_codepython_frac_lines_print_quality_signal float64	qsc_code_num_words int64	qsc_code_num_chars int64	qsc_code_mean_word_length int64	qsc_code_frac_words_unique null	qsc_code_frac_chars_top_2grams int64	qsc_code_frac_chars_top_3grams int64	qsc_code_frac_chars_top_4grams int64	qsc_code_frac_chars_dupe_5grams int64	qsc_code_frac_chars_dupe_6grams int64	qsc_code_frac_chars_dupe_7grams int64	qsc_code_frac_chars_dupe_8grams int64	qsc_code_frac_chars_dupe_9grams int64	qsc_code_frac_chars_dupe_10grams int64	qsc_code_frac_chars_digital int64	qsc_code_frac_chars_whitespace int64	qsc_code_num_lines int64	qsc_code_num_chars_line_max int64	qsc_code_num_chars_line_mean int64	qsc_code_frac_chars_alphabet int64	qsc_code_frac_chars_comments int64	qsc_code_frac_lines_dupe_lines int64	qsc_code_cate_autogen int64	qsc_code_frac_lines_long_string int64	qsc_code_frac_chars_string_length int64	qsc_code_frac_chars_long_word_length int64	qsc_code_frac_lines_string_concat null	qsc_code_cate_encoded_data int64	qsc_code_frac_lines_assert int64	qsc_codepython_cate_ast int64	qsc_codepython_frac_lines_func_ratio int64	qsc_codepython_cate_var_zero int64	qsc_codepython_frac_lines_pass int64	qsc_codepython_frac_lines_import int64	qsc_codepython_frac_lines_simplefunc int64	qsc_codepython_score_lines_no_logic int64	qsc_codepython_frac_lines_print int64	hits int64
96dd9c755d4c5f91e863cf0aac41fe735ea830c6	303	py	Python	tests/cases/issues/test_issue_230.py	broglep-work/python-pytest-cases	4976c0073a2fad5fbe5de34a5d1199efda0b7da9	[ "BSD-3-Clause" ]	213	2018-07-05T21:21:21.000Z	2022-03-22T04:54:53.000Z	tests/cases/issues/test_issue_230.py	broglep-work/python-pytest-cases	4976c0073a2fad5fbe5de34a5d1199efda0b7da9	[ "BSD-3-Clause" ]	259	2018-06-22T16:46:33.000Z	2022-03-23T19:39:15.000Z	tests/cases/issues/test_issue_230.py	broglep-work/python-pytest-cases	4976c0073a2fad5fbe5de34a5d1199efda0b7da9	[ "BSD-3-Clause" ]	27	2019-03-26T12:46:49.000Z	2022-02-21T16:56:23.000Z	from pytest_cases import parametrize_with_cases class FooCases: def case_None(self, tmpdir): return 1 def case_True(self, tmpdir): return 1 def case_False(self, tmpdir): return 1 @parametrize_with_cases("foo", cases=FooCases) def test_issue_230(foo): pass	15.947368	47	0.683168	42	303	4.690476	0.52381	0.106599	0.243655	0.258883	0.243655	0.243655	0	0	0	0	0.026087	0.240924	303	18	48	16.833333	0.830435	0	0.272727	0	0	0.009901	0	0	0	0	0	1	0.363636	false	0.090909	0.090909	0.272727	0.818182	0	0	0	0	null	0	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	1	0	1	0	1	1	0	6
8c37f6879587bc3ccbe5c36f97d4dcc1f53509b1	14,099	py	Python	gputools/convolve/filters.py	VolkerH/gputools	b8732c3cf82b96c6960497e6d82ce6b2bac463aa	[ "BSD-3-Clause" ]	null	null	null	gputools/convolve/filters.py	VolkerH/gputools	b8732c3cf82b96c6960497e6d82ce6b2bac463aa	[ "BSD-3-Clause" ]	null	null	null	gputools/convolve/filters.py	VolkerH/gputools	b8732c3cf82b96c6960497e6d82ce6b2bac463aa	[ "BSD-3-Clause" ]	null	null	null	from __future__ import print_function, unicode_literals, absolute_import, division import logging logger = logging.getLogger(__name__) import os import numpy as np from mako.template import Template from gputools import OCLArray, OCLProgram, get_device from gputools.core.ocltypes import assert_bufs_type from gputoo...	33.489311	103	0.591815	2,045	14,099	3.826406	0.085086	0.037316	0.026837	0.021086	0.908626	0.892652	0.884217	0.872204	0.865048	0.86262	0.023013	0.272643	14,099	421	104	33.489311	0.740029	0.515072	0.466102	0	0	0.066247	0.015106	0	0	0	0.033898	1	0.118644	false	0	0.076271	0	0.330508	0.008475	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
8b20da576f61109dc5280c51c4f954fa4fc59644	4,486	py	Python	slavdict/dictionary/migrations/0022_auto_20180504_1201.py	slavdict/slavdict	893886b80de413cb2bb6c0af5adba9c55aa6a7af	[ "CC0-1.0" ]	1	2022-01-17T17:26:25.000Z	2022-01-17T17:26:25.000Z	slavdict/dictionary/migrations/0022_auto_20180504_1201.py	slavdict/slavdict	893886b80de413cb2bb6c0af5adba9c55aa6a7af	[ "CC0-1.0" ]	8	2020-02-12T13:26:05.000Z	2022-02-10T19:28:07.000Z	slavdict/dictionary/migrations/0022_auto_20180504_1201.py	slavdict/slavdict	893886b80de413cb2bb6c0af5adba9c55aa6a7af	[ "CC0-1.0" ]	null	null	null	# -- coding: utf-8 -- # Generated by Django 1.11.11 on 2018-05-04 12:01 from django.db import migrations, models def forwards_func(apps, schema_editor): Entry = apps.get_model('dictionary', 'Entry') db_alias = schema_editor.connection.alias for e in Entry.objects.using(db_alias).all(): if e.que...	77.344828	1,404	0.67967	607	4,486	4.968699	0.209226	0.033157	0.039788	0.05305	0.409151	0.373011	0.275199	0.221485	0.132626	0.105438	0.353941	0.134641	4,486	57	1,405	78.701754	0.422978	0.015381	0.404255	1	0.297872	0.575442	0.454463	0	0	0	0	1	0.042553	false	0.021277	0.021277	0	0.12766	0	0	0	0	null	0	0	0	0	0	0	0	0	0	1	0	0	1	0	1	0	0	1	1	0	1	null	0	0	0	0	0	0	0	0	0	0	6
8b4912c9a69f8f19d8732e9687815b2122e64871	8,488	py	Python	src/micro_cleaning/clean_2009-2014.py	darylkang/capstone-goldman-sachs	74f3616499b61e90b87f38652c6188e16b982a55	[ "MIT" ]	1	2019-01-07T08:57:14.000Z	2019-01-07T08:57:14.000Z	src/micro_cleaning/clean_2009-2014.py	darylkang/capstone-goldman-sachs	74f3616499b61e90b87f38652c6188e16b982a55	[ "MIT" ]	null	null	null	src/micro_cleaning/clean_2009-2014.py	darylkang/capstone-goldman-sachs	74f3616499b61e90b87f38652c6188e16b982a55	[ "MIT" ]	null	null	null	import pandas as pd import numpy as np import os import utils #File in current directory files = [('yr2009_new', 'Icert_%20LCA_%20FY2009.xlsx'), ('yr2011', 'H-1B_iCert_LCA_FY2011_Q4.xlsx'), ('yr2012', 'LCA_FY2012_Q4.xlsx'), ('yr2013', 'LCA_FY2013.xlsx'), ('yr2014', 'H-1B_FY14_Q...	51.13253	153	0.727144	1,297	8,488	4.346184	0.12953	0.052333	0.06209	0.080717	0.812312	0.801313	0.777364	0.715984	0.707646	0.6821	0.02146	0.083176	8,488	165	154	51.442424	0.702904	0.035226	0.440678	0	0	0.574853	0.067759	0	0	0	0	1	0	false	0	0.033898	0	0.033898	0.050847	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
8ca0d4953c97741c2c1f3bc5fbda51e46981e001	330	py	Python	pyCaricare/m.py	pwais/CassieVede	e9d6b0e33cb7fa67bfa675e768b01881d10d40da	[ "Apache-2.0" ]	null	null	null	pyCaricare/m.py	pwais/CassieVede	e9d6b0e33cb7fa67bfa675e768b01881d10d40da	[ "Apache-2.0" ]	null	null	null	pyCaricare/m.py	pwais/CassieVede	e9d6b0e33cb7fa67bfa675e768b01881d10d40da	[ "Apache-2.0" ]	null	null	null	#!/usr/bin/env python import capnp capnp.remove_import_hook() import sys print sys.path meow = capnp.load('/Users/pwais/Documents/CassieVede/src/main/resources/CVImage.capnp')#imports=['/Users/pwais/Documents/CassieVede/deps/capnproto/include/', '/Users/pwais/Documents/CassieVede/deps/capnproto-java/compiler/src/main/s...	47.142857	241	0.79697	46	330	5.673913	0.608696	0.114943	0.218391	0.333333	0.321839	0.321839	0	0	0	0	0	0.039394	330	6	242	55	0.823344	0.524242	0	0	0	0.425806	0.425806	0	0	0	0	0	null	null	0	0.6	null	null	0.2	0	0	0	null	0	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	1	null	0	0	1	0	0	0	1	0	0	0	6
8cb3d7c66c599008b56e66ca35e8f7af978b984c	10,464	py	Python	gewittergefahr/deep_learning/model_activation_test.py	dopplerchase/GewitterGefahr	4415b08dd64f37eba5b1b9e8cc5aa9af24f96593	[ "MIT" ]	26	2018-10-04T01:07:35.000Z	2022-01-29T08:49:32.000Z	gewittergefahr/deep_learning/model_activation_test.py	liuximarcus/GewitterGefahr	d819874d616f98a25187bfd3091073a2e6d5279e	[ "MIT" ]	4	2017-12-25T02:01:08.000Z	2018-12-19T01:54:21.000Z	gewittergefahr/deep_learning/model_activation_test.py	liuximarcus/GewitterGefahr	d819874d616f98a25187bfd3091073a2e6d5279e	[ "MIT" ]	11	2017-12-10T23:05:29.000Z	2022-01-29T08:49:33.000Z	"""Unit tests for model_activation.py.""" import unittest import numpy from gewittergefahr.deep_learning import model_activation # The following constants are used to test get_hilo_activation_examples. STORM_ACTIVATIONS = numpy.array([ 3.0, -0.2, 0.6, -2.3, 4.3, -0.2, -1.3, -2.1, 0.0, 0.3, 1.1, -1.2, 2.5, -1.2, ...	38.612546	80	0.691609	1,405	10,464	4.720996	0.068327	0.075381	0.068747	0.086839	0.918137	0.883914	0.786673	0.761948	0.74054	0.731796	0.026568	0.22305	10,464	270	81	38.755556	0.789299	0.110474	0.502618	0	0	0.002522	0	0	0	0	0.125654	1	0.041885	false	0	0.015707	0	0.062827	0	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
8cb6d24a5b3d053a7dbe19aca6e3249cff72b3eb	106	py	Python	train_and_compute_corr.py	PythonNut/backdoor_data_poisoning	39a2afb35ca2b4ea0df1806cc69c438f9e3780e0	[ "MIT" ]	21	2019-05-29T07:49:18.000Z	2022-01-22T21:03:32.000Z	train_and_compute_corr.py	PythonNut/backdoor_data_poisoning	39a2afb35ca2b4ea0df1806cc69c438f9e3780e0	[ "MIT" ]	null	null	null	train_and_compute_corr.py	PythonNut/backdoor_data_poisoning	39a2afb35ca2b4ea0df1806cc69c438f9e3780e0	[ "MIT" ]	8	2019-06-21T19:24:24.000Z	2021-04-17T07:12:34.000Z	import subprocess subprocess.call(['python', 'train.py']) subprocess.call(['python', 'compute_corr.py'])	21.2	46	0.726415	13	106	5.846154	0.615385	0.368421	0.526316	0	0	0	0	0	0	0	0	0.066038	106	4	47	26.5	0.767677	0	0	0	0	0.330189	0	0	0	0	0	1	0	true	0	0.333333	0	0.333333	0	1	0	0	null	1	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	0	0	6
8ce983522284a5e6fcac118504e4ee26e058630b	45,561	py	Python	kvasir/tests/blast_results.py	DuttonLab/kvasir	55706b01814dd1592f96b828c56be047ab4c2782	[ "MIT" ]	1	2020-11-03T03:38:45.000Z	2020-11-03T03:38:45.000Z	kvasir/tests/blast_results.py	DuttonLab/kvasir	55706b01814dd1592f96b828c56be047ab4c2782	[ "MIT" ]	null	null	null	kvasir/tests/blast_results.py	DuttonLab/kvasir	55706b01814dd1592f96b828c56be047ab4c2782	[ "MIT" ]	1	2020-03-23T17:56:04.000Z	2020-03-23T17:56:04.000Z	from bson.objectid import ObjectId genes = [ {'_id': ObjectId('5939bbad00947043daa06288'), 'type': 'CDS', 'dna_seq': 'ATGTCAGAACATCTTCTCCCTACCCTCAGAATCCCTGAAACGTTCACCGAGGTCACGACTCGGCAAGAACACCAAGGCACAACCCCGGTCACCGTAACCCGCCACCATCCAGGCACTGACCCGAAGTACGGGGGCGAACACGTAACCACCGTCTTTGGAGACGACCGCATCCTCTACGGCTACACCCGCCAAATCAGCGG...	969.382979	2,475	0.914708	1,375	45,561	30.142545	0.196364	0.009169	0.015056	0.016938	0.475052	0.473387	0.448487	0.418062	0.401124	0.394899	0.050255	0.026492	45,561	46	2,476	990.456522	0.884182	0	0	0	0	0.903185	0.765194	0	1	0	0	1	0	false	0	0.023256	0	0.023256	0	0	0	1	null	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	1	1	null	1	0	0	0	0	0	0	0	0	0	6
507f5e2f33b7e050cfedbccc07b83b0a8f8a74ba	27	py	Python	handclas/__init__.py	geoyee/GBI-map	fc1ed2e0fe0a0cc5603e5b196a34336517282ee2	[ "Apache-2.0" ]	8	2021-08-17T02:32:26.000Z	2022-02-10T04:39:45.000Z	handclas/__init__.py	geoyee/GBIM	fc1ed2e0fe0a0cc5603e5b196a34336517282ee2	[ "Apache-2.0" ]	2	2021-08-18T06:29:09.000Z	2021-08-22T15:29:11.000Z	handclas/__init__.py	geoyee/GBIM	fc1ed2e0fe0a0cc5603e5b196a34336517282ee2	[ "Apache-2.0" ]	4	2021-08-17T02:32:32.000Z	2021-11-03T12:16:26.000Z	from .infer import HandClas	27	27	0.851852	4	27	5.75	1	0	0	0	0	0	0	0	0	0	0	0.111111	27	1	27	27	0.958333	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
50a7938ab6fb271394bc6a0c97ad676f10c2758d	26	py	Python	colour/__init__.py	adambonneruk/watch	7ff593ea9c56284da83c41c5ab0100fd9336183d	[ "MIT" ]	null	null	null	colour/__init__.py	adambonneruk/watch	7ff593ea9c56284da83c41c5ab0100fd9336183d	[ "MIT" ]	22	2021-09-24T18:47:13.000Z	2021-10-01T16:56:14.000Z	colour/__init__.py	adambonneruk/watch	7ff593ea9c56284da83c41c5ab0100fd9336183d	[ "MIT" ]	null	null	null	from .colour import Colour	26	26	0.846154	4	26	5.5	0.75	0	0	0	0	0	0	0	0	0	0	0.115385	26	1	26	26	0.956522	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
50a9fcc708c3af3d68e18c4bdc9fdd2f203d1f5a	31	py	Python	eod/tasks/det/models/heads/__init__.py	scott-mao/EOD	f10e64de86c0f356ebf5c7e923f4042eec4207b1	[ "Apache-2.0" ]	1	2022-01-12T01:51:39.000Z	2022-01-12T01:51:39.000Z	eod/tasks/det/models/heads/__init__.py	YZW-explorer/EOD	f10e64de86c0f356ebf5c7e923f4042eec4207b1	[ "Apache-2.0" ]	null	null	null	eod/tasks/det/models/heads/__init__.py	YZW-explorer/EOD	f10e64de86c0f356ebf5c7e923f4042eec4207b1	[ "Apache-2.0" ]	null	null	null	from .roi_head import * # noqa	15.5	30	0.709677	5	31	4.2	1	0	0	0	0	0	0	0	0	0	0	0.193548	31	1	31	31	0.84	0.129032	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
50d989ec759041686f1da09cc84eca433b7dd093	427	py	Python	lib/metrics.py	dongkwonjin/GleNet	18b51377b7e752b49478820625ac3202367c85c6	[ "MIT" ]	20	2020-08-19T04:19:07.000Z	2021-12-13T11:39:33.000Z	lib/metrics.py	dongkwonjin/GleNet	18b51377b7e752b49478820625ac3202367c85c6	[ "MIT" ]	null	null	null	lib/metrics.py	dongkwonjin/GleNet	18b51377b7e752b49478820625ac3202367c85c6	[ "MIT" ]	1	2020-12-14T10:39:47.000Z	2020-12-14T10:39:47.000Z	import tensorflow as tf def compute_psnr(image1, image2): image1 = tf.clip_by_value(image1, 0.0, 1.0) image2 = tf.clip_by_value(image2, 0.0, 1.0) return tf.reduce_mean(tf.image.psnr(image1, image2, max_val=1.0)) def compute_ssim(image1, image2): image1 = tf.clip_by_value(image1, 0.0, 1.0) image2 ...	32.846154	69	0.702576	80	427	3.575	0.2625	0.041958	0.111888	0.181818	0.804196	0.804196	0.664336	0.664336	0.664336	0.664336	0.099448	0.152225	427	12	70	35.583333	0.690608	0	0.444444	0	0	0	0	0	0	0	0	1	0.222222	false	0	0.111111	0	0.555556	0	0	0	0	null	0	0	1	1	1	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	1	0	0	0	0	1	0	6
0f974bc8e17988ad57244287269d96604e4dea95	173	py	Python	python/test_file.py	chenkl1995/help	323b0e0e76ea982fdb081e7272c7823295c5a392	[ "MIT" ]	1	2019-06-08T13:02:38.000Z	2019-06-08T13:02:38.000Z	python/test_file.py	chenkl1995/help	323b0e0e76ea982fdb081e7272c7823295c5a392	[ "MIT" ]	null	null	null	python/test_file.py	chenkl1995/help	323b0e0e76ea982fdb081e7272c7823295c5a392	[ "MIT" ]	null	null	null	import os.path as osp import sys # current file absolute path && filename print(sys.argv[0]) print(osp.basename(sys.argv[0])) print(__file__) print(osp.basename(__file__))	19.222222	40	0.757225	28	173	4.392857	0.5	0.113821	0.130081	0.211382	0	0	0	0	0	0	0.012903	0.104046	173	9	41	19.222222	0.780645	0.219653	0	0	0	0	0	0	0	0	0	1	0	true	0	0.333333	0	0.333333	0.666667	1	0	0	null	0	0	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	0	1	6
0f978c0a4e585c39accfdae8bbb01493f300dd9c	244	py	Python	eutl_scraper/items/__init__.py	jabrell/eutl_scraper	ba1a9717ce3ea506bed8869af195b30b139a9980	[ "MIT" ]	null	null	null	eutl_scraper/items/__init__.py	jabrell/eutl_scraper	ba1a9717ce3ea506bed8869af195b30b139a9980	[ "MIT" ]	2	2022-02-11T19:01:25.000Z	2022-02-17T13:03:00.000Z	eutl_scraper/items/__init__.py	jabrell/eutl_scraper	ba1a9717ce3ea506bed8869af195b30b139a9980	[ "MIT" ]	1	2021-12-05T19:06:38.000Z	2021-12-05T19:06:38.000Z	from .accountItems import AccountItem, ContactItem, AccountIDMapItem from .installationItems import (InstallationItem, ComplianceItem, SurrenderingDetailsItem, EntitlementItem) from .transactionItems import TransactionItem, TransactionBlockItem	81.333333	107	0.885246	18	244	12	0.777778	0	0	0	0	0	0	0	0	0	0	0.069672	244	3	108	81.333333	0.951542	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	0	1	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
e866fef0ff0759b389078a30a90296d51ce33877	51,050	py	Python	magnum/tests/unit/api/controllers/v1/test_cluster.py	piersharding/magnum	451358a57c4bd8fd93bab8121cfb5698d5471568	[ "Apache-2.0" ]	null	null	null	magnum/tests/unit/api/controllers/v1/test_cluster.py	piersharding/magnum	451358a57c4bd8fd93bab8121cfb5698d5471568	[ "Apache-2.0" ]	2	2019-06-14T12:13:53.000Z	2020-07-10T00:30:53.000Z	magnum/tests/unit/api/controllers/v1/test_cluster.py	zonca/magnum	3217e75b63fb9ebeb37b462677cdb72315ca1067	[ "Apache-2.0" ]	null	null	null	# Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distr...	47.137581	79	0.644349	5,853	51,050	5.335554	0.064924	0.08982	0.054116	0.062442	0.832111	0.8088	0.78331	0.747222	0.717314	0.676294	0.010255	0.247424	51,050	1,082	80	47.181146	0.802598	0.026072	0.629834	0	0	0.11127	0.015939	0	0	0	0.259669	1	0.119337	false	0	0.01768	0	0.150276	0	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
e87863b1df450bac2c77068316a94c6a213e72fb	490	py	Python	pyinaturalist_convert/__init__.py	FelipeSBarros/pyinaturalist-convert	470d5103a3901d789ada4507b55abf5159faa46a	[ "MIT" ]	6	2021-05-24T02:23:12.000Z	2022-01-14T05:24:54.000Z	pyinaturalist_convert/__init__.py	FelipeSBarros/pyinaturalist-convert	470d5103a3901d789ada4507b55abf5159faa46a	[ "MIT" ]	17	2021-05-24T22:27:08.000Z	2022-03-01T16:06:29.000Z	pyinaturalist_convert/__init__.py	JWCook/pyinaturalist-export	470d5103a3901d789ada4507b55abf5159faa46a	[ "MIT" ]	1	2021-05-28T13:21:00.000Z	2021-05-28T13:21:00.000Z	# flake8: noqa: F401, F403 # Ignore ImportErrors if invoked outside a virtualenv try: from pyinaturalist_convert.converters import * from pyinaturalist_convert.csv import load_csv_exports from pyinaturalist_convert.dwc import to_dwc from pyinaturalist_convert.geojson import to_geojson except ImportError...	30.625	65	0.797959	64	490	5.953125	0.5625	0.223097	0.314961	0.141732	0	0	0	0	0	0	0.017115	0.165306	490	15	66	32.666667	0.914425	0.285714	0.181818	0	0	0	0	0	0	0	0	1	0	true	0.090909	0.636364	0	0.636364	0.090909	0	0	0	null	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	1	1	0	1	0	6
e884687116000d0f0bba2e8bad6c0c95ffdd0439	1,075	py	Python	apps/habitss/migrations/0002_auto_20190130_1556.py	KolevDarko/lifehq	88d92f5fe76f2fb6511f2a892e096d95a69985d8	[ "MIT" ]	null	null	null	apps/habitss/migrations/0002_auto_20190130_1556.py	KolevDarko/lifehq	88d92f5fe76f2fb6511f2a892e096d95a69985d8	[ "MIT" ]	null	null	null	apps/habitss/migrations/0002_auto_20190130_1556.py	KolevDarko/lifehq	88d92f5fe76f2fb6511f2a892e096d95a69985d8	[ "MIT" ]	null	null	null	# Generated by Django 2.0 on 2019-01-30 15:56 from django.db import migrations import hashid_field.field class Migration(migrations.Migration): dependencies = [ ('habitss', '0001_initial'), ] operations = [ migrations.AlterField( model_name='habit', name='id', ...	35.833333	177	0.682791	95	1,075	7.578947	0.442105	0.061111	0.088889	0.120833	0.705556	0.705556	0.705556	0.705556	0.705556	0.705556	0.060714	0.218605	1,075	29	178	37.068966	0.796429	0.04	0.521739	1	0	0.231068	0.180583	0	0	0	0	1	0	false	0	0.086957	0	0.217391	0	0	0	0	null	0	0	0	0	1	1	1	1	1	0	0	0	0	0	0	0	0	1	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
e8c1283522a3a20f16704578e48f5fac965cf83d	863	py	Python	kaivy/video/__init__.py	team-kaivy/kaivy	e27b53e8e9eedc48abc99151f3adbb76f0a9b331	[ "MIT" ]	null	null	null	kaivy/video/__init__.py	team-kaivy/kaivy	e27b53e8e9eedc48abc99151f3adbb76f0a9b331	[ "MIT" ]	null	null	null	kaivy/video/__init__.py	team-kaivy/kaivy	e27b53e8e9eedc48abc99151f3adbb76f0a9b331	[ "MIT" ]	null	null	null	######################################################################################################################## # # # This file is part of kAIvy ...	107.875	136	0.078795	16	863	4.25	0.9375	0	0	0	0	0	0	0	0	0	0.024922	0.628042	863	7	137	123.285714	0.186916	0.332561	null	0	null	0	0	null	0	0	null	1	null	true	0	0	null	null	null	1	0	0	null	0	0	0	0	0	0	0	0	0	0	1	1	0	1	1	0	0	0	0	0	0	null	0	0	0	0	1	0	0	0	0	0	6
2cdc0b2e33bfc2a6bfda1718ed95be82b3a22ea4	10,939	py	Python	aoc2021/day15part1.py	sagasu/python-algorithms	d630777a3f17823165e4d72ab780ede7b10df752	[ "MIT" ]	null	null	null	aoc2021/day15part1.py	sagasu/python-algorithms	d630777a3f17823165e4d72ab780ede7b10df752	[ "MIT" ]	null	null	null	aoc2021/day15part1.py	sagasu/python-algorithms	d630777a3f17823165e4d72ab780ede7b10df752	[ "MIT" ]	null	null	null	lines = ["9165985876154699219988192797299938946759548993842382179897895847959995468789384779887969965834298757", "9998264799399739852669159899969915752881369928979589425659869512849898348591988899941938989958981368", "8899439372928798295981284899995498957198997822776999766989269673341115866632499916582179985999797178",...	90.404959	112	0.938386	196	10,939	52.372449	0.663265	0.001169	0.000877	0.000779	0	0	0	0	0	0	0.937465	0.023494	10,939	121	113	90.404959	0.023497	0	0	0	0	0.914077	0.914077	0	1	0	0	1	0	false	0	0.008621	0	0.008621	0.008621	0	0	1	null	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	0	1	1	null	1	0	0	0	0	0	0	0	0	0	6
fa389372020ad94becd22353e444468af6f16465	199	py	Python	src/icemac/addressbook/generations/evolve30.py	icemac/icemac.addressbook	6197e6e01da922feb100dd0943576523050cd703	[ "BSD-2-Clause" ]	1	2020-03-26T20:16:44.000Z	2020-03-26T20:16:44.000Z	src/icemac/addressbook/generations/evolve30.py	icemac/icemac.addressbook	6197e6e01da922feb100dd0943576523050cd703	[ "BSD-2-Clause" ]	2	2020-02-21T13:04:23.000Z	2020-02-21T13:06:10.000Z	src/icemac/addressbook/generations/evolve30.py	icemac/icemac.addressbook	6197e6e01da922feb100dd0943576523050cd703	[ "BSD-2-Clause" ]	null	null	null	import icemac.addressbook.generations.utils def evolve(context): """Install the person archive.""" icemac.addressbook.generations.utils.update_address_book_infrastructure( context)	24.875	76	0.763819	21	199	7.095238	0.761905	0.228188	0.375839	0.442953	0	0	0	0	0	0	0	0.140704	199	7	77	28.428571	0.871345	0.135678	0	0	0	0	0	0	0	0	0	1	0.25	false	0	0.25	0	0.5	0	1	0	0	null	1	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	1	0	0	0	0	0	0	6
fa5a2028565aa9f9f29fb778d83b2effa1dfee52	5,804	py	Python	Image-Detection/Image_Detection/predict.py	nhatpk/Image-Detection	8a806066d570b5725b46c00e0c4105868077b283	[ "MIT" ]	null	null	null	Image-Detection/Image_Detection/predict.py	nhatpk/Image-Detection	8a806066d570b5725b46c00e0c4105868077b283	[ "MIT" ]	11	2020-01-28T22:47:49.000Z	2022-01-13T01:19:43.000Z	Image-Detection/Image_Detection/predict.py	nhatpk/Image-Detection	8a806066d570b5725b46c00e0c4105868077b283	[ "MIT" ]	null	null	null	# USAGE # python predict.py --image images/dog.jpg --model output/simple_nn.model --label-bin output/simple_nn_lb.pickle --width 32 --height 32 --flatten 1 # python predict.py --image images/dog.jpg --model output/smallvggnet.model --label-bin output/smallvggnet_lb.pickle --width 64 --height 64 # python predict.py --i...	44.646154	162	0.669538	845	5,804	4.544379	0.182249	0.041667	0.040625	0.0375	0.908854	0.908854	0.897396	0.879688	0.879688	0.857292	0.02847	0.176947	5,804	130	163	44.646154	0.775382	0.708649	0.5	0	0	0.135034	0.126322	0	0	0	0	1	0.0625	false	0	0.15625	0	0.28125	0	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
d70b2ec98ae151a9c49683058bd7a4b7e7adaf95	18,657	py	Python	test/test_nmt_master.py	EiffL/NaMaster	41cc7839083511fe6be2eb20e93b8916c5c1f1f3	[ "BSD-3-Clause" ]	null	null	null	test/test_nmt_master.py	EiffL/NaMaster	41cc7839083511fe6be2eb20e93b8916c5c1f1f3	[ "BSD-3-Clause" ]	null	null	null	test/test_nmt_master.py	EiffL/NaMaster	41cc7839083511fe6be2eb20e93b8916c5c1f1f3	[ "BSD-3-Clause" ]	null	null	null	import unittest import numpy as np import pymaster as nmt import healpy as hp import warnings import sys from .testutils import normdiff, read_flat_map #Unit tests associated with the NmtField and NmtFieldFlat classes class TestWorkspaceSph(unittest.TestCase) : def setUp(self) : #This is to avoid showing...	47.716113	104	0.629576	2,763	18,657	4.091929	0.079262	0.051477	0.066336	0.043517	0.853883	0.826729	0.794003	0.763312	0.720768	0.686273	0.020573	0.231441	18,657	390	105	47.838462	0.767906	0.063033	0.521212	0	0	0.026678	0.016007	0	0	0	0.215152	1	0.069697	false	0	0.021212	0	0.09697	0	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
d72c54c8e6ec232076e2166e20192cef76577a8c	217	bzl	Python	hugo/repositories.bzl	dwtj/dwtj_rules_hugo	02eaf9946058c2a286c79d49da14a35caf574bea	[ "MIT" ]	1	2021-05-28T15:42:00.000Z	2021-05-28T15:42:00.000Z	hugo/repositories.bzl	dwtj/dwtj_rules_hugo	02eaf9946058c2a286c79d49da14a35caf574bea	[ "MIT" ]	null	null	null	hugo/repositories.bzl	dwtj/dwtj_rules_hugo	02eaf9946058c2a286c79d49da14a35caf574bea	[ "MIT" ]	null	null	null	'''This exports all public repository rules in this project. ''' load("//hugo:private/local_hugo_repository/defs.bzl", _local_hugo_repository = "local_hugo_repository") local_hugo_repository = _local_hugo_repository	36.166667	103	0.815668	29	217	5.689655	0.482759	0.272727	0.575758	0.436364	0.460606	0.460606	0.460606	0.460606	0.460606	0	0	0.082949	217	6	104	36.166667	0.829146	0.262673	0	0	0	0.428571	0.428571	0	0	0	0	1	0	false	0	0	0	0	0	1	0	0	null	1	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	1	null	0	0	0	0	0	0	0	0	0	0	6
ad2ca874cccf966e203439f67d29bef0f070c81e	276	py	Python	alarmageddon/validations/utilities.py	professor0x/Alarmageddon	2aa0493b78e8ea8ae7870651dc7ff1d8c58b309c	[ "Apache-2.0" ]	10	2015-01-22T14:11:31.000Z	2020-08-07T11:41:29.000Z	alarmageddon/validations/utilities.py	professor0x/Alarmageddon	2aa0493b78e8ea8ae7870651dc7ff1d8c58b309c	[ "Apache-2.0" ]	31	2015-01-07T20:38:16.000Z	2019-04-12T14:06:42.000Z	alarmageddon/validations/utilities.py	professor0x/Alarmageddon	2aa0493b78e8ea8ae7870651dc7ff1d8c58b309c	[ "Apache-2.0" ]	11	2015-01-07T01:42:01.000Z	2019-03-19T06:32:20.000Z	def format_node(cluster_name, node): """Formats a string representation of a node.""" return '<{0}[{1}]>'.format(cluster_name, node) def format_cluster(cluster_name): """Formats a string representation of a cluster.""" return format_node(cluster_name, '*')	27.6	55	0.692029	37	276	4.972973	0.351351	0.23913	0.184783	0.228261	0.336957	0.336957	0	0	0	0	0.008621	0.15942	276	9	56	30.666667	0.784483	0.318841	0	0	0	0.0625	0	0	0	0	0	1	0.5	false	0	0	0	1	0	0	0	0	null	1	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	1	0	0	0	0	1	0	6
ada01f49d0c5c1bfbcf5a1fcb562f49ec657e2cf	6,091	py	Python	blog/posts/tests/test_views.py	kosior/blog	90c6634fd75393bc26d1c3750ff8d96e5c13b867	[ "MIT" ]	null	null	null	blog/posts/tests/test_views.py	kosior/blog	90c6634fd75393bc26d1c3750ff8d96e5c13b867	[ "MIT" ]	null	null	null	blog/posts/tests/test_views.py	kosior/blog	90c6634fd75393bc26d1c3750ff8d96e5c13b867	[ "MIT" ]	null	null	null	from django.test import TestCase from django.shortcuts import reverse from posts.models import Post from posts.forms import BlogPostForm class PostListViewTest(TestCase): def test_view_url_exists_at_desired_location(self): response = self.client.get('/') self.assertEqual(response.status_code, 20...	43.198582	107	0.691184	759	6,091	5.370224	0.121212	0.073602	0.105986	0.113346	0.791217	0.782139	0.76104	0.73209	0.720069	0.663641	0.01668	0.183057	6,091	140	108	43.507143	0.802452	0	0.601852	0	0	0.125103	0.011985	0	0	0	0.342593	1	0.240741	false	0	0.037037	0	0.314815	0	0	0	0	null	0	0	0	0	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	1	0	0	0	0	0	0	6
a8ee40db81045f3be28dad81e274002fcd9b1b8b	2,954	py	Python	validation_tests/analytical_exact/river_at_rest_varying_topo_width/plot_results.py	samcom12/anuga_core	f4378114dbf02d666fe6423de45798add5c42806	[ "Python-2.0", "OLDAP-2.7" ]	136	2015-05-07T05:47:43.000Z	2022-02-16T03:07:40.000Z	validation_tests/analytical_exact/river_at_rest_varying_topo_width/plot_results.py	samcom12/anuga_core	f4378114dbf02d666fe6423de45798add5c42806	[ "Python-2.0", "OLDAP-2.7" ]	184	2015-05-03T09:27:54.000Z	2021-12-20T04:22:48.000Z	validation_tests/analytical_exact/river_at_rest_varying_topo_width/plot_results.py	samcom12/anuga_core	f4378114dbf02d666fe6423de45798add5c42806	[ "Python-2.0", "OLDAP-2.7" ]	70	2015-03-18T07:35:22.000Z	2021-11-01T07:07:29.000Z	""" Quick plot of the dam break outputs """ import anuga.utilities.plot_utils as util import matplotlib matplotlib.use('Agg') from matplotlib import pyplot as pyplot from numpy import ones, zeros, ones_like p_st = util.get_output('varying_width.sww') p2_st=util.get_centroids(p_st) v = p2_st.y[116] v2=(p2_st.y==v...	27.867925	84	0.719025	516	2,954	3.99031	0.164729	0.064109	0.036425	0.095192	0.823215	0.780962	0.727538	0.726566	0.725595	0.693541	0.04464	0.074814	2,954	105	85	28.133333	0.708745	0.119499	0.57971	0	0	0.235066	0	0	0	0	0	1	0	false	0	0.057971	0	0.057971	0	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
d123f95e30ec500d3b3dbb95104f256b4b3ac566	747	py	Python	Level2/Lessons12911/12911_njy.py	StudyForCoding/ProgrammersLevel	dc957b1c02cc4383a93b8cbf3d739e6c4d88aa25	[ "MIT" ]	null	null	null	Level2/Lessons12911/12911_njy.py	StudyForCoding/ProgrammersLevel	dc957b1c02cc4383a93b8cbf3d739e6c4d88aa25	[ "MIT" ]	null	null	null	Level2/Lessons12911/12911_njy.py	StudyForCoding/ProgrammersLevel	dc957b1c02cc4383a93b8cbf3d739e6c4d88aa25	[ "MIT" ]	1	2021-04-05T07:35:59.000Z	2021-04-05T07:35:59.000Z	#다음 큰 숫자 # 탐욕법 씀 def solution(n): c = bin(n).count('1') for num in range(n+1,1000001): if bin(num).count('1') == c: return num """ 정확성 테스트 테스트 1 〉 통과 (0.01ms, 10.2MB) 테스트 2 〉 통과 (0.01ms, 10.2MB) 테스트 3 〉 통과 (0.01ms, 10.2MB) 테스트 4 〉 통과 (0.01ms, 10.3MB) 테스트 5 〉 통과 (0.01ms, 10.2MB) 테스트 6 〉 통과...	22.636364	36	0.555556	192	747	2.265625	0.21875	0.137931	0.183908	0.367816	0.777011	0.777011	0.747126	0.390805	0.312644	0.312644	0.272408	0.238286	747	33	37	22.636364	0.456942	0.017403	0	0	0	0.013986	0	0	0	0	0	1	0.2	false	0	0	0	0.4	0	0	0	0	null	0	1	1	0	1	1	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
d15de77498188f1b6c3dfc208c4c8f72d5e14834	16	py	Python	code/sample_2-1-16.py	KoyanagiHitoshi/AtCoder-Python-Introduction	6d014e333a873f545b4d32d438e57cf428b10b96	[ "MIT" ]	1	2022-03-29T13:50:12.000Z	2022-03-29T13:50:12.000Z	code/sample_2-1-16.py	KoyanagiHitoshi/AtCoder-Python-Introduction	6d014e333a873f545b4d32d438e57cf428b10b96	[ "MIT" ]	null	null	null	code/sample_2-1-16.py	KoyanagiHitoshi/AtCoder-Python-Introduction	6d014e333a873f545b4d32d438e57cf428b10b96	[ "MIT" ]	null	null	null	print(9**(1/2))	8	15	0.5	4	16	2	1	0	0	0	0	0	0	0	0	0	0.2	0.0625	16	1	16	16	0.333333	0	0	0	0	0	0	0	0	0	0	1	0	true	0	0	0	0	1	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	1	0	0	0	0	0	0	null	0	0	0	0	1	0	0	0	0	1	6
0f0b772dadcaa93a7a09d54fb2c6d1f7126a96ae	96	py	Python	venv/lib/python3.8/site-packages/libpasteurize/fixes/fix_imports2.py	Retraces/UkraineBot	3d5d7f8aaa58fa0cb8b98733b8808e5dfbdb8b71	[ "MIT" ]	2	2022-03-13T01:58:52.000Z	2022-03-31T06:07:54.000Z	venv/lib/python3.8/site-packages/libpasteurize/fixes/fix_imports2.py	DesmoSearch/Desmobot	b70b45df3485351f471080deb5c785c4bc5c4beb	[ "MIT" ]	19	2021-11-20T04:09:18.000Z	2022-03-23T15:05:55.000Z	venv/lib/python3.8/site-packages/libpasteurize/fixes/fix_imports2.py	DesmoSearch/Desmobot	b70b45df3485351f471080deb5c785c4bc5c4beb	[ "MIT" ]	null	null	null	/home/runner/.cache/pip/pool/6e/cd/95/e58bf4bfff312f1fa5363f6434400ad9d2d85d45e4676871102834d425	96	96	0.895833	9	96	9.555556	1	0	0	0	0	0	0	0	0	0	0.447917	0	96	1	96	96	0.447917	0	0	0	0	0	0	0	1	0	0	0	null	null	0	0	null	null	0	1	0	0	null	0	0	0	0	0	0	0	0	0	1	0	1	0	0	1	0	0	0	0	0	0	null	1	0	1	0	0	0	0	0	0	0	6
0f5859eb3a7849f57f89449971d6fe7c64f38339	141	py	Python	src/pycalphad_xml/__init__.py	bocklund/pycalphad-xml	891ebd9993861780267a92743c549630a7eef31d	[ "MIT" ]	null	null	null	src/pycalphad_xml/__init__.py	bocklund/pycalphad-xml	891ebd9993861780267a92743c549630a7eef31d	[ "MIT" ]	null	null	null	src/pycalphad_xml/__init__.py	bocklund/pycalphad-xml	891ebd9993861780267a92743c549630a7eef31d	[ "MIT" ]	1	2022-03-31T21:18:47.000Z	2022-03-31T21:18:47.000Z	from pycalphad import Database from pycalphad_xml import parser Database.register_format("xml", read=parser.read_xml, write=parser.write_xml)	47	77	0.851064	21	141	5.52381	0.47619	0.224138	0	0	0	0	0	0	0	0	0	0.070922	141	3	77	47	0.885496	0	0	0	0	0.021127	0	0	0	0	0	1	0	true	0	0.666667	0	0.666667	0	1	0	0	null	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
0f7a55679b229a4c28346df87c90c5274dc452c5	515	py	Python	trainer/callbacks/__init__.py	Ouwen/MimickNet	2b255f37af3cd18a47dac08de2c0c98bf9a3280a	[ "Apache-2.0" ]	34	2019-10-02T18:31:43.000Z	2022-03-07T08:33:49.000Z	trainer/callbacks/__init__.py	Ouwen/MimickNet	2b255f37af3cd18a47dac08de2c0c98bf9a3280a	[ "Apache-2.0" ]	3	2019-10-03T01:54:03.000Z	2021-02-25T16:53:40.000Z	trainer/callbacks/__init__.py	Ouwen/MimickNet	2b255f37af3cd18a47dac08de2c0c98bf9a3280a	[ "Apache-2.0" ]	10	2019-11-05T02:08:42.000Z	2020-07-07T19:28:23.000Z	from trainer.callbacks.copy_keras_models import CopyKerasModel from trainer.callbacks.log_code import LogCode from trainer.callbacks.get_csv_metrics import GetCsvMetrics from trainer.callbacks.generate_images import GenerateImages from trainer.callbacks.start_tensorboard import StartTensorBoard from trainer.callbacks.m...	57.222222	76	0.906796	58	515	7.87931	0.482759	0.19256	0.350109	0.164114	0	0	0	0	0	0	0	0.062136	515	8	77	64.375	0.94617	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	0	0	0	null	0	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
7e1494fab5db9ead9dac0bcc190f7d4577edfce7	12,784	py	Python	aql/tests/tools/aql_test_tool_gcc.py	menify/sandbox	32166c71044f0d5b414335b2b6559adc571f568c	[ "MIT" ]	null	null	null	aql/tests/tools/aql_test_tool_gcc.py	menify/sandbox	32166c71044f0d5b414335b2b6559adc571f568c	[ "MIT" ]	null	null	null	aql/tests/tools/aql_test_tool_gcc.py	menify/sandbox	32166c71044f0d5b414335b2b6559adc571f568c	[ "MIT" ]	null	null	null	import os import sys sys.path.insert( 0, os.path.normpath(os.path.join( os.path.dirname( __file__ ), '..') )) from aql_tests import skip, AqlTestCase, runLocalTests from aql.utils import Tempfile, Tempdir, whereProgram, \ removeUserHandler, addUserHandler, disableDefaultHandlers, enableDefaultHandlers from aql....	28.792793	96	0.539503	1,385	12,784	4.755957	0.1213	0.060726	0.031729	0.034006	0.769091	0.761348	0.759678	0.751025	0.734325	0.719599	0.005116	0.296699	12,784	443	97	28.857788	0.727505	0.071809	0.767273	0	0	0.030802	0	0	0	0	0.036364	1	0.043636	false	0	0.036364	0	0.090909	0.010909	0	0	0	null	0	0	0	0	1	1	1	1	1	0	0	0	0	0	0	0	1	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
7e342f831e135a353c4b8c9fb8c953ebdfcb1245	34	py	Python	conda.recipe/run_test.py	lex-c/mapshader	321246b3011e36abe580d0beff4f07ec5ee38d95	[ "MIT" ]	1	2021-02-01T18:03:49.000Z	2021-02-01T18:03:49.000Z	conda.recipe/run_test.py	lex-c/mapshader	321246b3011e36abe580d0beff4f07ec5ee38d95	[ "MIT" ]	null	null	null	conda.recipe/run_test.py	lex-c/mapshader	321246b3011e36abe580d0beff4f07ec5ee38d95	[ "MIT" ]	null	null	null	import mapshader;mapshader.test()	17	33	0.823529	4	34	7	0.75	0	0	0	0	0	0	0	0	0	0	0.058824	34	1	34	34	0.875	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
7e39e8a95ad199eb63ff11391bb69f694e80055a	40	py	Python	test/TestPrint.py	ngocbien/ngocbienml	dcaa4707f5b513153e7be20538923e741894b2a2	[ "MIT" ]	1	2021-06-04T06:50:38.000Z	2021-06-04T06:50:38.000Z	test/TestPrint.py	ngocbien/ngocbienml	dcaa4707f5b513153e7be20538923e741894b2a2	[ "MIT" ]	null	null	null	test/TestPrint.py	ngocbien/ngocbienml	dcaa4707f5b513153e7be20538923e741894b2a2	[ "MIT" ]	null	null	null	print('This is not Helloworld command!')	40	40	0.775	6	40	5.166667	1	0	0	0	0	0	0	0	0	0	0	0.1	40	1	40	40	0.861111	0	0	0	0	0.756098	0	0	0	0	0	1	0	true	0	0	0	0	1	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	1	0	null	0	0	0	0	1	0	0	0	0	1	6
7e521a7122ae5d02132a34f2cab4c1f44f8064d2	13,140	py	Python	NeoML/Python/neoml/Dnn/Solver.py	reisei/neoml	2b397a410d220272e97c8d9393d92035f32d63d8	[ "ECL-2.0", "Apache-2.0" ]	1	2021-05-30T09:19:35.000Z	2021-05-30T09:19:35.000Z	NeoML/Python/neoml/Dnn/Solver.py	reisei/neoml	2b397a410d220272e97c8d9393d92035f32d63d8	[ "ECL-2.0", "Apache-2.0" ]	null	null	null	NeoML/Python/neoml/Dnn/Solver.py	reisei/neoml	2b397a410d220272e97c8d9393d92035f32d63d8	[ "ECL-2.0", "Apache-2.0" ]	null	null	null	""" Copyright (c) 2017-2020 ABBYY Production LLC Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in wr...	38.991098	116	0.643151	1,657	13,140	4.922752	0.128546	0.066201	0.099301	0.046341	0.79772	0.776266	0.758612	0.741694	0.741694	0.741694	0.014632	0.245814	13,140	336	117	39.107143	0.808476	0.536682	0.646552	0	0	0.008162	0	0	0	0	0	1	0.275862	false	0	0.008621	0	0.456897	0	0	0	0	null	0	0	0	0	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	1	0	0	0	0	0	0	6
0e3e2c5e06704b2c095e8abd355ce9c3a989de75	200	py	Python	word2vec/__init__.py	erjihaoshi/word2vec	f355c99d86f05f00b17325e6b5955494f2d71b3f	[ "Apache-2.0" ]	2	2019-03-31T04:31:55.000Z	2019-04-14T13:28:38.000Z	word2vec/__init__.py	poryfly/word2vec	762200acec2941a030abed69e946838af35eb2ae	[ "Apache-2.0" ]	null	null	null	word2vec/__init__.py	poryfly/word2vec	762200acec2941a030abed69e946838af35eb2ae	[ "Apache-2.0" ]	null	null	null	from .io import * from .wordvectors import * from .wordclusters import * from .scripts_interface import * from ._version import get_versions __version__ = get_versions()["version"] del get_versions	20	39	0.785	25	200	5.92	0.44	0.27027	0.243243	0	0	0	0	0	0	0	0	0.135	200	9	40	22.222222	0.855491	0	0	0	0	0.035	0	0	0	0	0	1	0	false	0	0.714286	0	0.714286	0	1	0	0	null	1	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	1	0	1	0	6
0e47c099803482ab6c24e07383219073349168f0	96	py	Python	venv/lib/python3.8/site-packages/clikit/ui/components/paragraph.py	Retraces/UkraineBot	3d5d7f8aaa58fa0cb8b98733b8808e5dfbdb8b71	[ "MIT" ]	2	2022-03-13T01:58:52.000Z	2022-03-31T06:07:54.000Z	venv/lib/python3.8/site-packages/clikit/ui/components/paragraph.py	DesmoSearch/Desmobot	b70b45df3485351f471080deb5c785c4bc5c4beb	[ "MIT" ]	19	2021-11-20T04:09:18.000Z	2022-03-23T15:05:55.000Z	venv/lib/python3.8/site-packages/clikit/ui/components/paragraph.py	DesmoSearch/Desmobot	b70b45df3485351f471080deb5c785c4bc5c4beb	[ "MIT" ]	null	null	null	/home/runner/.cache/pip/pool/5c/3e/02/155595b62b115108a5f01ae049cbc9e9ba2abc3c47f399b40074d4b19b	96	96	0.895833	9	96	9.555556	1	0	0	0	0	0	0	0	0	0	0.427083	0	96	1	96	96	0.46875	0	0	0	0	0	0	0	1	0	0	0	null	null	0	0	null	null	0	1	0	0	null	0	0	0	0	0	0	0	0	0	1	0	1	0	0	1	0	0	0	0	0	0	null	1	0	1	0	0	0	0	0	0	0	6
7edb02704f3e30a587ad143c6364687da3ba3039	32,931	py	Python	tests/test_comments.py	alexschiller/osf.io	4122d4be152c6189142c2ebb19cfdee09c77035d	[ "Apache-2.0" ]	null	null	null	tests/test_comments.py	alexschiller/osf.io	4122d4be152c6189142c2ebb19cfdee09c77035d	[ "Apache-2.0" ]	null	null	null	tests/test_comments.py	alexschiller/osf.io	4122d4be152c6189142c2ebb19cfdee09c77035d	[ "Apache-2.0" ]	null	null	null	from __future__ import absolute_import from collections import OrderedDict import unittest from framework.auth import Auth from framework.exceptions import PermissionsError from framework.guid.model import Guid from modularodm import Q from modularodm.exceptions import ValidationError, ValidationValueError from nose....	46.578501	196	0.633992	3,665	32,931	5.424011	0.056207	0.021128	0.025504	0.037024	0.799135	0.780774	0.776649	0.770562	0.758489	0.745309	0.006032	0.229814	32,931	706	197	46.644476	0.777747	0.004525	0.703884	0	0	0.10324	0.003478	0	0	0.001416	0.067961	1	0.055016	false	0	0.040453	0.004854	0.140777	0	0	0	0	null	0	0	0	0	1	1	1	1	1	0	0	0	0	0	0	0	1	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
7d4034c47793bb87e26dc8a323cc397126cf1d90	66,107	py	Python	genomebrowser/browser/views.py	aekazakov/CGCMS	d604811dfddc4a4d2cbdda9076aca6868dda87ae	[ "MIT" ]	null	null	null	genomebrowser/browser/views.py	aekazakov/CGCMS	d604811dfddc4a4d2cbdda9076aca6868dda87ae	[ "MIT" ]	null	null	null	genomebrowser/browser/views.py	aekazakov/CGCMS	d604811dfddc4a4d2cbdda9076aca6868dda87ae	[ "MIT" ]	null	null	null	import csv from django.shortcuts import render from django.http import HttpResponse from django.template import loader from django.http import Http404 from .models import * from django.views import generic from django.db.models import Q from django.core.files.storage import default_storage from browser.seqsearch import...	51.889325	309	0.657933	8,178	66,107	5.003791	0.035706	0.061949	0.055277	0.047775	0.832531	0.795679	0.740182	0.726033	0.704357	0.678063	0.00362	0.218494	66,107	1,273	310	51.930086	0.788456	0.012434	0.695347	0	0.000878	0.141255	0.00616	0	0	0	0	1	0.046532	false	0	0.009658	0.00439	0.172959	0.006146	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
adadc3aeacab774b5daa404320e931fddd44dc51	3,701	py	Python	api_testing/api_request/request.py	harshita-sharma011/oep-e2e	f7badfb6061535fa63d49113d92bdc937ee3cfd9	[ "Apache-2.0" ]	null	null	null	api_testing/api_request/request.py	harshita-sharma011/oep-e2e	f7badfb6061535fa63d49113d92bdc937ee3cfd9	[ "Apache-2.0" ]	371	2020-03-10T10:48:11.000Z	2022-02-27T09:19:13.000Z	api_testing/api_request/request.py	harshita-sharma011/oep-e2e	f7badfb6061535fa63d49113d92bdc937ee3cfd9	[ "Apache-2.0" ]	14	2020-03-11T06:13:54.000Z	2021-12-03T06:53:56.000Z	#!/usr/bin/env python """ This module contains api requests methods """ import os import sys import requests import json from http import HTTPStatus class Data(): def __init__(self, username, password): auth_api_key = username auth_password = password auth = (auth_api_key, auth_passwor...	35.247619	142	0.587949	396	3,701	5.434343	0.171717	0.091078	0.1171	0.104089	0.815056	0.786245	0.769052	0.746283	0.723978	0.709108	0.006682	0.312618	3,701	105	143	35.247619	0.83923	0.071872	0.697674	0	0	0.016181	0	0	0	0	0	1	0.081395	false	0.034884	0.05814	0	0.162791	0.162791	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
add1acf18ceae672025340745d781ba6a966894a	26	py	Python	pychatworkAPI/__init__.py	dc-aichara/pyChatwork	5d32568ce3d9b16c38fe494ba66d03af15513392	[ "MIT" ]	6	2019-07-01T01:02:36.000Z	2020-10-06T21:49:09.000Z	pychatworkAPI/__init__.py	dc-aichara/pychatworkAPI	5d32568ce3d9b16c38fe494ba66d03af15513392	[ "MIT" ]	null	null	null	pychatworkAPI/__init__.py	dc-aichara/pychatworkAPI	5d32568ce3d9b16c38fe494ba66d03af15513392	[ "MIT" ]	null	null	null	from .api import Chatwork	13	25	0.807692	4	26	5.25	1	0	0	0	0	0	0	0	0	0	0	0.153846	26	1	26	26	0.954545	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
bc2faed5f1e0733d3b375fb57d98b48fbd081494	1,410	py	Python	save_proxy.py	hegman12/stocksandcharts	5b6022f3b41d8160d4f95947afba2202b86e13ca	[ "BSD-3-Clause" ]	null	null	null	save_proxy.py	hegman12/stocksandcharts	5b6022f3b41d8160d4f95947afba2202b86e13ca	[ "BSD-3-Clause" ]	null	null	null	save_proxy.py	hegman12/stocksandcharts	5b6022f3b41d8160d4f95947afba2202b86e13ca	[ "BSD-3-Clause" ]	null	null	null	import requests import mysql.connector as db import re def next_proxy(): con=db.connect(host="localhost",user="<your user>",password="<your pwd>",auth_plugin='mysql_native_password',database="<your DB>") try: cursor = con.cursor() results=cursor.callproc('next_proxy',(0,)) finally: ...	27.115385	134	0.587943	177	1,410	4.581921	0.327684	0.049322	0.036991	0.062885	0.702836	0.702836	0.702836	0.702836	0.702836	0.702836	0.005618	0.242553	1,410	51	135	27.647059	0.753745	0.024113	0.589744	0	0	0.185455	0.045818	0	0	0	0	1	0.076923	false	0.076923	0.076923	0	0.230769	0.025641	0	0	0	null	0	0	0	0	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	1	0	0	0	0	6
70ed4cbfd052d4f6799fd9ef295ab717d8522432	87	py	Python	twitter/twitter_apis/views.py	bantiagrawal/twitter	b489a9c65a5257d58e3f71f7d6bf329cf6ce5aee	[ "BSD-2-Clause" ]	null	null	null	twitter/twitter_apis/views.py	bantiagrawal/twitter	b489a9c65a5257d58e3f71f7d6bf329cf6ce5aee	[ "BSD-2-Clause" ]	null	null	null	twitter/twitter_apis/views.py	bantiagrawal/twitter	b489a9c65a5257d58e3f71f7d6bf329cf6ce5aee	[ "BSD-2-Clause" ]	null	null	null	from rest_framework import viewsets class TwitterViewSet(viewsets.ViewSet): pass	14.5	39	0.804598	10	87	6.9	0.9	0	0	0	0	0	0	0	0	0	0	0.149425	87	5	40	17.4	0.932432	0	0	0	0	0	0	0	0	0	0	1	0	true	0.333333	0.333333	0	0.666667	0	1	0	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	1	1	0	1	0	6
70f17fed3dc4ce1c47ed276b9df98a88757c6912	42	py	Python	coveralls.py	czfshine/NSTL-1	5395a2bb4a4ecbfd6929c1f05bfa8f7fe2ab848e	[ "MIT" ]	1	2017-10-20T16:46:47.000Z	2017-10-20T16:46:47.000Z	coveralls.py	czfshine/NSTL-1	5395a2bb4a4ecbfd6929c1f05bfa8f7fe2ab848e	[ "MIT" ]	null	null	null	coveralls.py	czfshine/NSTL-1	5395a2bb4a4ecbfd6929c1f05bfa8f7fe2ab848e	[ "MIT" ]	1	2018-04-08T12:41:45.000Z	2018-04-08T12:41:45.000Z	import cpp_coveralls cpp_coveralls.run()	10.5	20	0.833333	6	42	5.5	0.666667	0.727273	0	0	0	0	0	0	0	0	0	0.095238	42	3	21	14	0.868421	0	0	0	0	0	0	0	0	0	0	1	0	true	0	0.5	0	0.5	0	1	1	0	null	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	0	0	6
cb0e8a548a92e220294480c980fd8c087abcd901	12,778	py	Python	optimlib/optimlib.py	deaflurryth/optimlib	217b97f479d06ecc39d476b47450e27bfc5a835e	[ "MIT" ]	null	null	null	optimlib/optimlib.py	deaflurryth/optimlib	217b97f479d06ecc39d476b47450e27bfc5a835e	[ "MIT" ]	null	null	null	optimlib/optimlib.py	deaflurryth/optimlib	217b97f479d06ecc39d476b47450e27bfc5a835e	[ "MIT" ]	null	null	null	import numpy as np from numpy import array, zeros, diag, diagflat, dot import random import math import time from datetime import datetime def CompactAnn(): def Simulated(): print('ИМИТАЦИЯ ОТЖИГА') print('_______________') v= int(input('Введите кол-во вершин: ')) iteraa...	46.805861	154	0.50313	1,315	12,778	4.777186	0.154373	0.028972	0.02547	0.037886	0.797835	0.769819	0.756129	0.74021	0.74021	0.729386	0.021575	0.379715	12,778	272	155	46.977941	0.771007	0.074034	0.732558	0	0	0.082148	0.008501	0	0	0	0	1	0.062016	false	0	0.027132	0.007752	0.143411	0.139535	0	0	0	null	0	0	0	0	1	1	1	1	1	0	0	0	0	0	0	0	1	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
cb21dd7ac5546077b8373819d6a57755d05b8e60	60	py	Python	tests/test-bot.py	lucasfr/weatherFeelings	9ea7694ca1acb6e6002afc0a59e98e6d032039ae	[ "MIT" ]	null	null	null	tests/test-bot.py	lucasfr/weatherFeelings	9ea7694ca1acb6e6002afc0a59e98e6d032039ae	[ "MIT" ]	7	2017-08-20T22:56:14.000Z	2017-09-07T22:26:12.000Z	tests/test-bot.py	lucasfr/weatherFeelings	9ea7694ca1acb6e6002afc0a59e98e6d032039ae	[ "MIT" ]	null	null	null	import unittest def test_hello(): print("Hello World")	12	24	0.7	8	60	5.125	0.875	0	0	0	0	0	0	0	0	0	0	0.183333	60	5	24	12	0.836735	0	0	0	0	0.180328	0	0	0	0	0	1	0.333333	true	0	0.333333	0	0.666667	0.333333	1	0	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	1	1	0	1	0	1	0	6
cb4e504f2a5171d87733806d0bbe5f13202a97af	221	py	Python	bip_utils/utils/__init__.py	djmuratb/bip_utils	18de9a7067ca2cc3bc4727dc9e39e75db0456e1b	[ "MIT" ]	1	2021-06-13T11:45:23.000Z	2021-06-13T11:45:23.000Z	bip_utils/utils/__init__.py	djmuratb/bip_utils	18de9a7067ca2cc3bc4727dc9e39e75db0456e1b	[ "MIT" ]	null	null	null	bip_utils/utils/__init__.py	djmuratb/bip_utils	18de9a7067ca2cc3bc4727dc9e39e75db0456e1b	[ "MIT" ]	null	null	null	from bip_utils.utils.algo import AlgoUtils from bip_utils.utils.bit import BitUtils from bip_utils.utils.conversion import ConvUtils from bip_utils.utils.crypto import CryptoUtils from bip_utils.utils.key import KeyUtils	36.833333	48	0.864253	35	221	5.314286	0.4	0.188172	0.322581	0.456989	0	0	0	0	0	0	0	0.090498	221	5	49	44.2	0.925373	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	0	0	0	null	0	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
cb60fe84761594d517e7c4f9bc3a4f7aebd731d5	207	py	Python	Analytics/resources/attributes/__init__.py	thanosbnt/SharingCitiesDashboard	5d123691d1f25d0b85e20e4e8293266bf23c9f8a	[ "Apache-2.0" ]	4	2018-11-21T14:42:18.000Z	2020-05-11T10:52:59.000Z	Analytics/resources/attributes/__init__.py	thanosbnt/SharingCitiesDashboard	5d123691d1f25d0b85e20e4e8293266bf23c9f8a	[ "Apache-2.0" ]	60	2018-11-21T15:11:59.000Z	2019-12-02T10:46:44.000Z	Analytics/resources/attributes/__init__.py	thanosbnt/SharingCitiesDashboard	5d123691d1f25d0b85e20e4e8293266bf23c9f8a	[ "Apache-2.0" ]	7	2018-11-21T14:42:44.000Z	2019-11-28T16:24:14.000Z	from .attribute_alias import AttributeAlias from .delete_attribute_alias import DeleteAttributeAlias from .get_attributes import GetAttributes from .update_attribute_sub_theme import UpdateAttributeSubTheme	41.4	63	0.903382	23	207	7.826087	0.608696	0.155556	0.222222	0	0	0	0	0	0	0	0	0.077295	207	4	64	51.75	0.942408	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	0	0	null	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
cb72753daf37e92c96f0f834557a9f74ff5da397	203	py	Python	tccli/services/tiw/__init__.py	hapsyou/tencentcloud-cli-intl-en	fa8ba71164484f9a2be4b983080a1de08606c0b0	[ "Apache-2.0" ]	null	null	null	tccli/services/tiw/__init__.py	hapsyou/tencentcloud-cli-intl-en	fa8ba71164484f9a2be4b983080a1de08606c0b0	[ "Apache-2.0" ]	null	null	null	tccli/services/tiw/__init__.py	hapsyou/tencentcloud-cli-intl-en	fa8ba71164484f9a2be4b983080a1de08606c0b0	[ "Apache-2.0" ]	null	null	null	# -- coding: utf-8 -- from tccli.services.tiw.tiw_client import register_arg from tccli.services.tiw.tiw_client import get_actions_info from tccli.services.tiw.tiw_client import AVAILABLE_VERSION_LIST	40.6	64	0.827586	32	203	5	0.53125	0.16875	0.31875	0.375	0.65625	0.65625	0.65625	0	0	0	0.005376	0.083744	203	4	65	50.75	0.854839	0.103448	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	0	0	0	null	0	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
cbc0166c412b36bded83c8b0ab63347e6cd2aca2	184	py	Python	mqbench/nn/intrinsic/qat/modules/__init__.py	a1trl9/MQBench	279c5a9e6e48778fe2913ba708b53ab9c2b0520c	[ "Apache-2.0" ]	51	2021-08-20T01:28:50.000Z	2021-09-22T05:34:39.000Z	mqbench/nn/intrinsic/qat/modules/__init__.py	a1trl9/MQBench	279c5a9e6e48778fe2913ba708b53ab9c2b0520c	[ "Apache-2.0" ]	7	2021-08-24T09:46:31.000Z	2021-09-22T05:43:06.000Z	mqbench/nn/intrinsic/qat/modules/__init__.py	a1trl9/MQBench	279c5a9e6e48778fe2913ba708b53ab9c2b0520c	[ "Apache-2.0" ]	6	2021-08-20T09:18:48.000Z	2021-09-19T04:35:13.000Z	from .linear_fused import LinearBn1d from .deconv_fused import ConvTransposeBnReLU2d, ConvTransposeBn2d, ConvTransposeReLU2d from .conv_fused import ConvBnReLU2d, ConvBn2d, ConvReLU2d	46	87	0.875	19	184	8.315789	0.684211	0.208861	0	0	0	0	0	0	0	0	0.041667	0.086957	184	3	88	61.333333	0.89881	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	0	0	null	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
cbc158a56809a1f8bb5d980bb8309f6376449a0c	385	py	Python	home/views.py	denis254/interior	a02019f58db0857c79f38917991b7a70b62f2939	[ "MIT" ]	null	null	null	home/views.py	denis254/interior	a02019f58db0857c79f38917991b7a70b62f2939	[ "MIT" ]	9	2020-03-24T16:25:40.000Z	2022-03-11T23:34:16.000Z	home/views.py	denis254/interior	a02019f58db0857c79f38917991b7a70b62f2939	[ "MIT" ]	null	null	null	from django.shortcuts import render, redirect def home(request): return render(request, "home.html") def about(request): return render(request, "about.html") def contact(request): return render(request, "contact.html") def test(request): return render(request, "test.html") def facebook(request): ...	22.647059	66	0.727273	48	385	5.833333	0.395833	0.232143	0.271429	0.371429	0	0	0	0	0	0	0	0.14026	385	16	67	24.0625	0.845921	0	0	0	0	0.215584	0	0	0	0	0	1	0.454545	false	0	0.090909	0.454545	1	0	0	0	0	null	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	1	0	0	0	1	1	0	6
cbc67f470b3ed15dd42297b665d4045b6b6f6e91	16,044	py	Python	dfirtrack_main/tests/task/test_task_is_abandoned.py	cclauss/dfirtrack	2a307c5fe82e927b3c229a20a02bc0c7a5d66d9a	[ "Apache-2.0" ]	null	null	null	dfirtrack_main/tests/task/test_task_is_abandoned.py	cclauss/dfirtrack	2a307c5fe82e927b3c229a20a02bc0c7a5d66d9a	[ "Apache-2.0" ]	null	null	null	dfirtrack_main/tests/task/test_task_is_abandoned.py	cclauss/dfirtrack	2a307c5fe82e927b3c229a20a02bc0c7a5d66d9a	[ "Apache-2.0" ]	null	null	null	from django.contrib.auth.models import User from django.test import TestCase from dfirtrack_artifacts.models import ( Artifact, Artifactpriority, Artifactstatus, Artifacttype, ) from dfirtrack_main.models import ( Case, System, Systemstatus, Task, Taskname, Taskpriority, Tas...	40.210526	116	0.655572	1,779	16,044	5.554244	0.038786	0.033397	0.057686	0.037648	0.862868	0.84283	0.801943	0.767331	0.737375	0.713187	0.007456	0.255984	16,044	398	117	40.311558	0.820307	0.085141	0.610039	0	0	0.149342	0.076875	0	0	0	0.069498	1	0.046332	false	0.046332	0.015444	0	0.065637	0	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
1dcc4552f5545c124e3bf2dcd95043e0446c7a18	3,343	py	Python	test/core/gen2/local/test_rechunker.py	bcdev/xcube	9d275ef3baef8fbcea5c1fbbfb84c3d0164aecd3	[ "MIT" ]	97	2018-06-26T13:02:55.000Z	2022-03-26T21:03:13.000Z	test/core/gen2/local/test_rechunker.py	bcdev/xcube	9d275ef3baef8fbcea5c1fbbfb84c3d0164aecd3	[ "MIT" ]	524	2018-11-09T12:00:08.000Z	2022-03-31T17:00:13.000Z	test/core/gen2/local/test_rechunker.py	bcdev/xcube	9d275ef3baef8fbcea5c1fbbfb84c3d0164aecd3	[ "MIT" ]	15	2019-07-09T08:46:03.000Z	2022-02-07T18:47:34.000Z	import unittest import xarray as xr from xcube.core.gen2 import CubeConfig from xcube.core.gen2.local.rechunker import CubeRechunker from xcube.core.gridmapping import GridMapping from xcube.core.new import new_cube class CubeRechunkerTest(unittest.TestCase): def test_chunks_are_smaller_than_sizes(self): ...	45.175676	75	0.546216	382	3,343	4.719895	0.225131	0.091514	0.049917	0.051026	0.798114	0.798114	0.781475	0.757072	0.757072	0.757072	0.041108	0.330541	3,343	73	76	45.794521	0.764522	0.063117	0.678571	0	0	0.024952	0	0	0	0	0.446429	1	0.035714	false	0	0.107143	0	0.160714	0	0	0	0	null	0	0	0	0	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	1	0	0	0	0	0	0	0	0	6
1debfe8a6fa830d234f7f38c115435fcb60ed88d	154	py	Python	torchlib/__init__.py	CarlosPena00/pytorch-unet	8365bace23e4b04b9c5b75cd6720807ea8cac5ab	[ "MIT" ]	null	null	null	torchlib/__init__.py	CarlosPena00/pytorch-unet	8365bace23e4b04b9c5b75cd6720807ea8cac5ab	[ "MIT" ]	null	null	null	torchlib/__init__.py	CarlosPena00/pytorch-unet	8365bace23e4b04b9c5b75cd6720807ea8cac5ab	[ "MIT" ]	null	null	null	__version__ = "0.0" from torchlib import models from torchlib import datasets from torchlib import transforms from torchlib import post_processing_func	19.25	41	0.837662	21	154	5.857143	0.52381	0.390244	0.585366	0	0	0	0	0	0	0	0.015038	0.136364	154	7	42	22	0.909774	0	0	0	0	0.019608	0	0	0	0	0	1	0	false	0	0.8	0	0.8	0	1	0	0	null	1	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	1	0	1	0	6
1dffd7739dd56d7b25060c2f0fc7db8634d538de	35	py	Python	Spiders/__init__.py	PeterChenFisher/Pi	6875a45f8ec6cbad98167fb8a51015e63de0da7f	[ "MIT" ]	1	2019-08-18T13:43:14.000Z	2019-08-18T13:43:14.000Z	Spiders/__init__.py	PeterChenFisher/Pi	6875a45f8ec6cbad98167fb8a51015e63de0da7f	[ "MIT" ]	null	null	null	Spiders/__init__.py	PeterChenFisher/Pi	6875a45f8ec6cbad98167fb8a51015e63de0da7f	[ "MIT" ]	null	null	null	from .SoulBread import jdjzww_daily	35	35	0.885714	5	35	6	1	0	0	0	0	0	0	0	0	0	0	0.085714	35	1	35	35	0.9375	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
381a778c76762b96814151888e06bae43c594d59	1,778	py	Python	src/contracts/contractSprite.py	stonecoldpat/sprites-python	398abb86f27dcbd5a91b6aad648a06529c029d26	[ "MIT" ]	null	null	null	src/contracts/contractSprite.py	stonecoldpat/sprites-python	398abb86f27dcbd5a91b6aad648a06529c029d26	[ "MIT" ]	null	null	null	src/contracts/contractSprite.py	stonecoldpat/sprites-python	398abb86f27dcbd5a91b6aad648a06529c029d26	[ "MIT" ]	1	2019-07-19T17:29:45.000Z	2019-07-19T17:29:45.000Z	class PreimageManager: def __init__(self, contract): self._contract = contract def revealedBefore(self, h, T): return self._contract.functions.revealedBefore(h, T) def submitPreimage(self, x): return self._contract.functions.submitPreimage(x) class SpriteChannel: def __init...	26.939394	78	0.671541	204	1,778	5.666667	0.176471	0.228374	0.280277	0.420415	0.512111	0.285467	0.138408	0.072664	0	0	0.001445	0.221597	1,778	65	79	27.353846	0.833815	0	0.093023	0	0	0	0	0	0	0	0	1	0.465116	false	0	0	0.418605	0.930233	0	0	0	0	null	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	1	0	0	0	1	1	0	6
69b82e3e1dffff017a762d25702b4d6a2e46cbcc	134	py	Python	python/testData/formatter/inGenerator.py	jnthn/intellij-community	8fa7c8a3ace62400c838e0d5926a7be106aa8557	[ "Apache-2.0" ]	2	2019-04-28T07:48:50.000Z	2020-12-11T14:18:08.000Z	python/testData/formatter/inGenerator.py	Cyril-lamirand/intellij-community	60ab6c61b82fc761dd68363eca7d9d69663cfa39	[ "Apache-2.0" ]	173	2018-07-05T13:59:39.000Z	2018-08-09T01:12:03.000Z	python/testData/formatter/inGenerator.py	Cyril-lamirand/intellij-community	60ab6c61b82fc761dd68363eca7d9d69663cfa39	[ "Apache-2.0" ]	2	2020-03-15T08:57:37.000Z	2020-04-07T04:48:14.000Z	personnes = [p for p in Personne.objects.filter(Q(administrateur__societe__notation_ok=True)\|Q(dirigeant__societe__notation_ok=True))]	134	134	0.850746	20	134	5.2	0.7	0.288462	0.326923	0.403846	0	0	0	0	0	0	0	0.044776	134	1	134	134	0.8125	0	0	0	0	0	0	0	0	0	0	1	0	false	0	0	0	0	0	1	0	0	null	1	1	1	0	0	0	0	0	0	0	0	1	0	1	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
69ba3e61e8ce7933a091185d6d4d7083546529ee	38	py	Python	naive_rllib/models/__init__.py	mikuh/naive-rllib	674bfbe894ebb4d5d402964731b280cbca1db602	[ "MIT" ]	null	null	null	naive_rllib/models/__init__.py	mikuh/naive-rllib	674bfbe894ebb4d5d402964731b280cbca1db602	[ "MIT" ]	null	null	null	naive_rllib/models/__init__.py	mikuh/naive-rllib	674bfbe894ebb4d5d402964731b280cbca1db602	[ "MIT" ]	null	null	null	from naive_rllib.models.ppo import PPO	38	38	0.868421	7	38	4.571429	0.857143	0	0	0	0	0	0	0	0	0	0	0.078947	38	1	38	38	0.914286	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
69be4a8d14dd8ed3f23b76c831ef6081a141f671	6,354	py	Python	tests/test_transformations.py	katsuya0719/geomeppy	0012371d5df7c31f99e5f7403f57eab9ba6a16d0	[ "MIT" ]	29	2016-10-01T01:23:48.000Z	2021-11-08T11:47:00.000Z	tests/test_transformations.py	katsuya0719/geomeppy	0012371d5df7c31f99e5f7403f57eab9ba6a16d0	[ "MIT" ]	142	2016-09-13T10:13:17.000Z	2022-02-10T09:07:11.000Z	tests/test_transformations.py	katsuya0719/geomeppy	0012371d5df7c31f99e5f7403f57eab9ba6a16d0	[ "MIT" ]	19	2017-01-04T23:15:19.000Z	2022-02-11T18:19:43.000Z	"""Tests for transformations""" import numpy as np from transforms3d._gohlketransforms import translation_matrix from geomeppy.geom.polygons import Polygon3D from geomeppy.geom.transformations import Transformation from geomeppy.geom.vectors import Vector3D from geomeppy.utilities import almostequal class TestTransf...	39.465839	86	0.599937	815	6,354	4.530061	0.08589	0.032503	0.020314	0.013001	0.826111	0.782232	0.76273	0.742145	0.727519	0.722644	0.064355	0.273686	6,354	160	87	39.7125	0.735645	0.063897	0.564103	0	0	0	0	0	0	0	0.350427	1	0.034188	false	0	0.051282	0	0.094017	0	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
69daadc47e80656e7e61187dc72b583a36471947	22,205	py	Python	src/MC.py	shaoyuanxun/Generalized_McCormick_Relaxations_Library	3908b40f06e7f8c801353ce20153ec087898479f	[ "Apache-2.0" ]	1	2021-01-10T00:11:53.000Z	2021-01-10T00:11:53.000Z	src/MC.py	shaoyuanxun/Generalized_McCormick_Relaxations_Library	3908b40f06e7f8c801353ce20153ec087898479f	[ "Apache-2.0" ]	null	null	null	src/MC.py	shaoyuanxun/Generalized_McCormick_Relaxations_Library	3908b40f06e7f8c801353ce20153ec087898479f	[ "Apache-2.0" ]	1	2019-02-27T19:23:17.000Z	2019-02-27T19:23:17.000Z	# Author: Yuanxun Shao (yuanxus@g.clemson.edu) import math import numpy as np import sys from utility import eq_mul class MCPy: ''' MCPy is a python library for automatically calculate convex\concave relaxations and subgradients of factorable nonconvex functions according to McCormick relaxation rules a...	32.654412	135	0.476334	3,087	22,205	3.339488	0.053126	0.123969	0.077408	0.028713	0.85566	0.820545	0.791832	0.750121	0.726453	0.688137	0.045111	0.362081	22,205	679	136	32.702504	0.682669	0.104661	0.671679	0	0	0.010135	0	0	0	0	0	1	0.075188	false	0	0.010025	0.002506	0.230576	0.002506	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
69e873ead168d2f98fcd3ba3a2ed0d0d415dff07	49	py	Python	bmtk/utils/reports/compartment/__init__.py	tjbanks/bmtk	52fee3b230ceb14a666c46f57f2031c38f1ac5b1	[ "BSD-3-Clause" ]	216	2017-10-03T17:02:42.000Z	2022-03-20T03:35:48.000Z	bmtk/utils/reports/compartment/__init__.py	tjbanks/bmtk	52fee3b230ceb14a666c46f57f2031c38f1ac5b1	[ "BSD-3-Clause" ]	92	2018-03-19T10:14:18.000Z	2022-01-29T15:21:47.000Z	bmtk/utils/reports/compartment/__init__.py	tjbanks/bmtk	52fee3b230ceb14a666c46f57f2031c38f1ac5b1	[ "BSD-3-Clause" ]	97	2017-10-03T22:15:06.000Z	2022-03-23T21:03:26.000Z	from .compartment_report import CompartmentReport	49	49	0.918367	5	49	8.8	1	0	0	0	0	0	0	0	0	0	0	0.061224	49	1	49	49	0.956522	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
385dbbc4d8e4e6449ce63960a8054ddfd0c629c0	49	py	Python	documentation_threading/01_threading_functions/example_06.py	software-foundations/learning-distributed-systems	b09f60742a88acf466fcf724e1368b95363682fa	[ "MIT" ]	null	null	null	documentation_threading/01_threading_functions/example_06.py	software-foundations/learning-distributed-systems	b09f60742a88acf466fcf724e1368b95363682fa	[ "MIT" ]	null	null	null	documentation_threading/01_threading_functions/example_06.py	software-foundations/learning-distributed-systems	b09f60742a88acf466fcf724e1368b95363682fa	[ "MIT" ]	null	null	null	import threading print(threading.main_thread())	12.25	30	0.816327	6	49	6.5	0.833333	0	0	0	0	0	0	0	0	0	0	0.081633	49	3	31	16.333333	0.866667	0	0	0	0	0	0	0	0	0	0	1	0	true	0	0.5	0	0.5	0.5	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	0	1	6
38759c4dae1cd9e1e1291bbd52dc0447edfe27d4	41	py	Python	tests/__init__.py	zelo2/EduCDM	d725dc50ec677dfe409d88a3ffea6dce8effad62	[ "Apache-2.0" ]	1	2021-04-12T01:18:40.000Z	2021-04-12T01:18:40.000Z	tests/__init__.py	zelo2/EduCDM	d725dc50ec677dfe409d88a3ffea6dce8effad62	[ "Apache-2.0" ]	null	null	null	tests/__init__.py	zelo2/EduCDM	d725dc50ec677dfe409d88a3ffea6dce8effad62	[ "Apache-2.0" ]	1	2022-02-07T08:34:43.000Z	2022-02-07T08:34:43.000Z	# coding: utf-8 # 2021/3/17 @ tongshiwei	13.666667	24	0.658537	7	41	3.857143	1	0	0	0	0	0	0	0	0	0	0.235294	0.170732	41	2	25	20.5	0.558824	0.878049	null	0	null	0	0	null	0	0	null	1	null	true	0	0	null	null	null	1	1	0	null	0	0	0	0	0	0	0	0	0	1	0	1	0	0	0	1	0	0	0	0	0	null	0	0	0	0	1	0	0	0	0	0	6
3895eff1dfdf6b24c07f2f37a087a5aa29fc7e5a	185	py	Python	automatization_of_data_mining_project/missing_row_creator/classes/missing_row_validator/missing_row_validator.py	Sale1996/automatization_of_data_mining_project	223aec59231586563a3b125bff064f8420630a8f	[ "MIT" ]	null	null	null	automatization_of_data_mining_project/missing_row_creator/classes/missing_row_validator/missing_row_validator.py	Sale1996/automatization_of_data_mining_project	223aec59231586563a3b125bff064f8420630a8f	[ "MIT" ]	null	null	null	automatization_of_data_mining_project/missing_row_creator/classes/missing_row_validator/missing_row_validator.py	Sale1996/automatization_of_data_mining_project	223aec59231586563a3b125bff064f8420630a8f	[ "MIT" ]	null	null	null	class MissingRowValidator(object): def validate(self, data_sets_info, first_column_pair_name, second_column_pair_name, second_column_values_to_match): pass	37	73	0.740541	23	185	5.434783	0.782609	0.16	0.224	0.32	0.368	0	0	0	0	0	0	0.205405	185	4	74	46.25	0.85034	0	0	0	0	0	0	0	0	0	0	1	0.25	false	0.25	0	0	0.5	0	1	0	0	null	0	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	1	0	1	0	0	0	0	6
38d4dd6bc9ebf0478db284cfa84aed2727b4892c	848	py	Python	old/lib/games_puzzles_algorithms/debug.py	feiooo/games-puzzles-algorithms	66d97135d163fb04e820338068d9bd9e12d907e9	[ "MIT" ]	null	null	null	old/lib/games_puzzles_algorithms/debug.py	feiooo/games-puzzles-algorithms	66d97135d163fb04e820338068d9bd9e12d907e9	[ "MIT" ]	null	null	null	old/lib/games_puzzles_algorithms/debug.py	feiooo/games-puzzles-algorithms	66d97135d163fb04e820338068d9bd9e12d907e9	[ "MIT" ]	null	null	null	import sys import traceback import json import logging def log(data, level=logging.INFO, raw=False): if logging.getLogger().getEffectiveLevel() >= level: return sf = traceback.extract_stack()[-2] logger = logging.getLogger(sf[0]) data_to_print = data() if raw else json.dumps(data(), sort_keys=...	32.615385	83	0.639151	124	848	4.266129	0.322581	0.120983	0.083176	0.075614	0.839319	0.839319	0.839319	0.839319	0.839319	0.839319	0.017544	0.193396	848	25	84	33.92	0.755848	0	0.454545	0	0	0.067217	0	0	0	0	0	1	0.090909	false	0	0.181818	0	0.363636	0.181818	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
2a09cb373086dd3386c663d0989e82530df9e0af	488	py	Python	Functions/FEEDLIKER.py	niteappantest/test-follower-insta	bad4a0c2f4ee1e1d70acdc9a9bccbac722152d9f	[ "Apache-2.0" ]	1	2021-05-25T14:49:15.000Z	2021-05-25T14:49:15.000Z	Functions/FEEDLIKER.py	niteappantest/test-follower-insta	bad4a0c2f4ee1e1d70acdc9a9bccbac722152d9f	[ "Apache-2.0" ]	null	null	null	Functions/FEEDLIKER.py	niteappantest/test-follower-insta	bad4a0c2f4ee1e1d70acdc9a9bccbac722152d9f	[ "Apache-2.0" ]	null	null	null	[[yellow]] 8888888 8888888 8888888 8888 88 88 88 88 88 88888 88888 88888 88 88 88 88 88 88 88 88 8888888 8888888 8888 8888888 88 888888 88 88 888888 88 88 88 88 88 88 88 8888888 88 88 8...	34.857143	55	0.405738	58	488	3.413793	0.137931	0.525253	0.545455	0.565657	0.555556	0.555556	0.222222	0.212121	0	0	0.716475	0.465164	488	14	55	34.857143	0.042146	0	0.153846	0	0	0	0	0	0	0	0	0	null	null	0	0	null	null	0	0	0	0	null	1	1	1	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	null	0	0	1	0	0	0	0	0	0	0	6
2a169658504b8c67c6e1e4eea4e0d07a7322eb88	215	py	Python	src/lime_python/protocol/security/__init__.py	mirlarof/lime-python	9961379562bd9d362b16c0ee66f3bde652070b22	[ "Apache-2.0" ]	2	2019-09-10T15:10:11.000Z	2021-02-05T21:44:38.000Z	src/lime_python/protocol/security/__init__.py	mirlarof/lime-python	9961379562bd9d362b16c0ee66f3bde652070b22	[ "Apache-2.0" ]	9	2021-05-19T21:08:15.000Z	2021-05-31T20:43:26.000Z	src/lime_python/protocol/security/__init__.py	mirlarof/lime-python	9961379562bd9d362b16c0ee66f3bde652070b22	[ "Apache-2.0" ]	3	2019-09-10T15:10:32.000Z	2022-01-24T13:36:46.000Z	from .authentication import * from .external_authentication import * from .guest_authentication import * from .key_authentication import * from .plain_authentication import * from .transport_authentication import *	30.714286	39	0.832558	23	215	7.565217	0.347826	0.689655	0.689655	0	0	0	0	0	0	0	0	0.111628	215	6	40	35.833333	0.910995	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	0	0	null	1	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	0	0	6
2a181eddd4b0f9ad5e0f81313d275c09db13c348	128	py	Python	tests/missing_data/test_missing_data_air_passengers_None_Median.py	shaido987/pyaf	b9afd089557bed6b90b246d3712c481ae26a1957	[ "BSD-3-Clause" ]	377	2016-10-13T20:52:44.000Z	2022-03-29T18:04:14.000Z	tests/missing_data/test_missing_data_air_passengers_None_Median.py	ysdede/pyaf	b5541b8249d5a1cfdc01f27fdfd99b6580ed680b	[ "BSD-3-Clause" ]	160	2016-10-13T16:11:53.000Z	2022-03-28T04:21:34.000Z	tests/missing_data/test_missing_data_air_passengers_None_Median.py	ysdede/pyaf	b5541b8249d5a1cfdc01f27fdfd99b6580ed680b	[ "BSD-3-Clause" ]	63	2017-03-09T14:51:18.000Z	2022-03-27T20:52:57.000Z	import tests.missing_data.test_missing_data_air_passengers_generic as gen gen.test_air_passengers_missing_data(None, 'Median')	32	73	0.882813	20	128	5.15	0.6	0.320388	0	0	0	0	0	0	0	0	0	0.054688	128	3	74	42.666667	0.85124	0	0	0	0	0.046875	0	0	0	0	0	1	0	true	1	0.5	0	0.5	0	1	0	0	null	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	1	1	0	0	0	6
2a33abe5e6674cbbfd5767b2ba74e2dbfdee4d38	48	py	Python	dotbot/util/__init__.py	davesteinberg/dotbot	0098c5261036c7299150c75ef3c2d852a127e44a	[ "MIT" ]	null	null	null	dotbot/util/__init__.py	davesteinberg/dotbot	0098c5261036c7299150c75ef3c2d852a127e44a	[ "MIT" ]	null	null	null	dotbot/util/__init__.py	davesteinberg/dotbot	0098c5261036c7299150c75ef3c2d852a127e44a	[ "MIT" ]	null	null	null	from .common import shell_command, test_success	24	47	0.854167	7	48	5.571429	1	0	0	0	0	0	0	0	0	0	0	0.104167	48	1	48	48	0.906977	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
2a5bdb616c8c68570778bfa2ebe5c1d644a860b3	38	py	Python	tests/__init__.py	akcarsten/duplicates	b61b6f4bb562b21b3daf239cb0284b9c131f97c3	[ "MIT" ]	10	2021-01-11T14:53:28.000Z	2022-03-09T00:57:02.000Z	tests/__init__.py	akcarsten/duplicates	b61b6f4bb562b21b3daf239cb0284b9c131f97c3	[ "MIT" ]	1	2021-05-05T05:49:02.000Z	2021-05-10T03:25:41.000Z	tests/__init__.py	akcarsten/duplicates	b61b6f4bb562b21b3daf239cb0284b9c131f97c3	[ "MIT" ]	5	2021-06-05T05:30:17.000Z	2022-03-20T22:38:53.000Z	from .test_detect_duplicates import *	19	37	0.842105	5	38	6	1	0	0	0	0	0	0	0	0	0	0	0.105263	38	1	38	38	0.882353	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
2a8d4f855f8423b8b647180ab440c29211c7d5a3	276	py	Python	eelbrain/_utils/tests/test_parse.py	reddigari/Eelbrain	6c02b99955d4b5dc7e3054042c182e1a4629b13c	[ "BSD-3-Clause" ]	null	null	null	eelbrain/_utils/tests/test_parse.py	reddigari/Eelbrain	6c02b99955d4b5dc7e3054042c182e1a4629b13c	[ "BSD-3-Clause" ]	null	null	null	eelbrain/_utils/tests/test_parse.py	reddigari/Eelbrain	6c02b99955d4b5dc7e3054042c182e1a4629b13c	[ "BSD-3-Clause" ]	null	null	null	# Author: Christian Brodbeck <christianbrodbeck@nyu.edu> from nose.tools import eq_ from eelbrain._utils.parse import find_variables def test_find_variables(): eq_(find_variables("a + b / c.x()"), {'a', 'b', 'c'}) eq_(find_variables("a + 'b' / c.x()"), {'a', 'c'})	27.6	57	0.652174	41	276	4.170732	0.536585	0.304094	0.052632	0.187135	0.233918	0.233918	0.233918	0.233918	0	0	0	0.148551	276	9	58	30.666667	0.72766	0.195652	0	0	0	0.15	0	0	0	0	0	1	0.2	true	0	0.4	0	0.6	0	0	0	0	null	1	0	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
aa850ef91ebb0860a60a49ee11ac66b1c98535f0	98	py	Python	dodocs/tests/test_healthcheck.py	sanskar1991/do-docs-testing	585c7b189006f52cc16f4a6b845ef7610f992ef9	[ "MIT" ]	null	null	null	dodocs/tests/test_healthcheck.py	sanskar1991/do-docs-testing	585c7b189006f52cc16f4a6b845ef7610f992ef9	[ "MIT" ]	null	null	null	dodocs/tests/test_healthcheck.py	sanskar1991/do-docs-testing	585c7b189006f52cc16f4a6b845ef7610f992ef9	[ "MIT" ]	null	null	null	import logging as logger def test_healthcheck_01(): logger.info("Just running healthcheck")	16.333333	43	0.765306	13	98	5.615385	0.846154	0	0	0	0	0	0	0	0	0	0.024096	0.153061	98	5	44	19.6	0.855422	0	0	0	0	0.244898	0	0	0	0	0	1	0.333333	true	0	0.333333	0	0.666667	0	1	0	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	1	1	0	1	0	1	0	6
aabb1a94ea318a422ed3a49a0a57862db1f396f5	3,423	py	Python	gen_heap.py	HalbFettKaese/CMC	b01756bbf1784679287c47efadd1dc9720d3c2e2	[ "MIT" ]	2	2021-05-13T20:52:32.000Z	2021-09-10T06:55:26.000Z	gen_heap.py	HalbFettKaese/CMC	b01756bbf1784679287c47efadd1dc9720d3c2e2	[ "MIT" ]	null	null	null	gen_heap.py	HalbFettKaese/CMC	b01756bbf1784679287c47efadd1dc9720d3c2e2	[ "MIT" ]	1	2021-01-01T18:11:27.000Z	2021-01-01T18:11:27.000Z	import re, random from tree_gen import generate SIZE = 255 def generate_heap(namespace, objective): # return # rval = str(random.randint(10 5, 10 6)) with open('load_heap.mcfunction', 'w') as file: file.write(re.sub(r'namespace', namespace, open('../heap_load').read())) with open('creat...	46.256757	126	0.674554	465	3,423	4.916129	0.156989	0.102362	0.139983	0.07874	0.849519	0.793526	0.755031	0.666229	0.564742	0.536745	0.020292	0.179375	3,423	73	127	46.890411	0.793521	0.121239	0.391304	1	0.217391	0.519186	0.075075	0	0	0	0	1	0.195652	false	0	0.043478	0.173913	0.413043	0	0	0	0	null	0	0	0	1	1	1	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	null	0	0	0	0	0	0	0	1	0	0	6
aac709edc81810105ace89042d5e7023a46e0373	25	py	Python	indicators/rsi/__init__.py	catalinnega/Cryptocurrencies-TA-on-Dash	498f152e06fe959e2c9672bd4d862820e6155884	[ "MIT" ]	null	null	null	indicators/rsi/__init__.py	catalinnega/Cryptocurrencies-TA-on-Dash	498f152e06fe959e2c9672bd4d862820e6155884	[ "MIT" ]	null	null	null	indicators/rsi/__init__.py	catalinnega/Cryptocurrencies-TA-on-Dash	498f152e06fe959e2c9672bd4d862820e6155884	[ "MIT" ]	null	null	null	from indicators import *	12.5	24	0.8	3	25	6.666667	1	0	0	0	0	0	0	0	0	0	0	0.16	25	1	25	25	0.952381	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
aac8b6444eaa836482839fafcecee344421e57a7	13,321	py	Python	tests/test_battle_planner.py	benneyman/War	622ccc0ae1bba36046c7c6b5e1757773a2e90773	[ "MIT" ]	null	null	null	tests/test_battle_planner.py	benneyman/War	622ccc0ae1bba36046c7c6b5e1757773a2e90773	[ "MIT" ]	null	null	null	tests/test_battle_planner.py	benneyman/War	622ccc0ae1bba36046c7c6b5e1757773a2e90773	[ "MIT" ]	1	2019-09-07T17:56:06.000Z	2019-09-07T17:56:06.000Z	from battalion_processor import BattalionProcessor from battalion_types import BattalionType from battle_planner import BattlePlanner from army import Army from copy import deepcopy class Test_BattlePlanner(object): def test_apply_power_rule(self): bp = BattlePlanner(BattalionProcessor(), Army()) ...	65.945545	121	0.663764	1,420	13,321	5.953521	0.057746	0.107641	0.083274	0.083274	0.939437	0.913059	0.907026	0.888219	0.879465	0.879347	0.033441	0.256963	13,321	202	122	65.945545	0.820671	0	0.67033	0	0	0	0	0	0	0	0.214286	1	0.065934	false	0	0.027473	0	0.098901	0	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
aad4097514f83abc0f64bc2221a44050df1ed94a	9,320	py	Python	src/the_tale/the_tale/linguistics/lexicon/groups/action_event.py	al-arz/the-tale	542770257eb6ebd56a5ac44ea1ef93ff4ab19eb5	[ "BSD-3-Clause" ]	85	2017-11-21T12:22:02.000Z	2022-03-27T23:07:17.000Z	src/the_tale/the_tale/linguistics/lexicon/groups/action_event.py	al-arz/the-tale	542770257eb6ebd56a5ac44ea1ef93ff4ab19eb5	[ "BSD-3-Clause" ]	545	2017-11-04T14:15:04.000Z	2022-03-27T14:19:27.000Z	src/the_tale/the_tale/linguistics/lexicon/groups/action_event.py	al-arz/the-tale	542770257eb6ebd56a5ac44ea1ef93ff4ab19eb5	[ "BSD-3-Clause" ]	45	2017-11-11T12:36:30.000Z	2022-02-25T06:10:44.000Z	import smart_imports smart_imports.all() V = lexicon_relations.VARIABLE KEYS = [('ACTION_EVENT_HABIT_IN_PLACE_AGGRESSIVE_ARTIFACT', 40000, 'Дневник: В городе, черты, агрессивность (артефакт)', relations.LEXICON_GROUP.ACTION_EVENT, 'События при посещении города агрессивным героем (артефакт)', [V....	67.05036	164	0.706545	1,195	9,320	5.293724	0.078661	0.111287	0.080936	0.136579	0.926968	0.851091	0.82153	0.800348	0.800348	0.800348	0.020658	0.168991	9,320	138	165	67.536232	0.796127	0	0.32	0	0	0.543406	0.161391	0	0	0	0	1	0	false	0	0.02	0	0.02	0	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
2ac17125d9ff508e53d98712993154767874cc19	48	py	Python	sunpy/visualization/__init__.py	mridullpandey/sunpy	65bf70731a8147899b8c0fca8b3b1a386e47c010	[ "BSD-2-Clause" ]	2	2020-07-02T13:01:42.000Z	2020-08-27T20:05:31.000Z	sunpy/visualization/__init__.py	mridullpandey/sunpy	65bf70731a8147899b8c0fca8b3b1a386e47c010	[ "BSD-2-Clause" ]	2	2015-06-15T17:16:11.000Z	2016-11-23T17:12:07.000Z	sunpy/visualization/__init__.py	mridullpandey/sunpy	65bf70731a8147899b8c0fca8b3b1a386e47c010	[ "BSD-2-Clause" ]	6	2017-03-15T07:17:05.000Z	2020-09-30T18:36:49.000Z	from sunpy.visualization.visualization import *	24	47	0.854167	5	48	8.2	0.8	0	0	0	0	0	0	0	0	0	0	0.083333	48	1	48	48	0.931818	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
2aeb77cfe3a025472706654c9e1ec39a168df7a2	89	py	Python	observer/__init__.py	zarcen/design_pattern_py	d8c89d0c8545ac0d38404f2864073cef6b143776	[ "MIT" ]	null	null	null	observer/__init__.py	zarcen/design_pattern_py	d8c89d0c8545ac0d38404f2864073cef6b143776	[ "MIT" ]	null	null	null	observer/__init__.py	zarcen/design_pattern_py	d8c89d0c8545ac0d38404f2864073cef6b143776	[ "MIT" ]	null	null	null	from observer.observer_abc import AbsObserver from observer.subject_abc import AbsSubject	44.5	45	0.898876	12	89	6.5	0.583333	0.307692	0	0	0	0	0	0	0	0	0	0.078652	89	2	46	44.5	0.95122	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	0	0	null	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
63219eb1522e1505064069f269fdb142484b1f5f	32	py	Python	PDA/extra_assignments/2.4. Numbers_ Tens digit/solution/main.py	EMbeDS-education/StatsAndComputing20212022	971e418882b206a1b5606d15d222cef1a5a04834	[ "MIT" ]	2	2022-02-24T09:35:15.000Z	2022-03-14T20:34:33.000Z	PDA/extra_assignments/2.4. Numbers_ Tens digit/solution/main.py	GeorgiosArg/StatsAndComputing20212022	798d39af6aa5ef5eef49d5d6f43191351e8a49f3	[ "MIT" ]	null	null	null	PDA/extra_assignments/2.4. Numbers_ Tens digit/solution/main.py	GeorgiosArg/StatsAndComputing20212022	798d39af6aa5ef5eef49d5d6f43191351e8a49f3	[ "MIT" ]	2	2022-03-15T21:40:35.000Z	2022-03-26T14:51:31.000Z	print(int(input()) % 100 // 10)	16	31	0.5625	5	32	3.6	1	0	0	0	0	0	0	0	0	0	0.185185	0.15625	32	1	32	32	0.481481	0	0	0	0	0	0	0	0	0	0	1	0	true	0	0	0	0	1	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	1	0	0	0	0	0	0	null	0	0	0	0	1	0	0	0	0	1	6
2d77192fe5d59606e56c928418f5af626cfbee76	40	py	Python	code/dpp/tails/__init__.py	bsouhaib/qf-tpp	a5adf3f7203b920528c1c397329c4afd9039c3b4	[ "MIT" ]	null	null	null	code/dpp/tails/__init__.py	bsouhaib/qf-tpp	a5adf3f7203b920528c1c397329c4afd9039c3b4	[ "MIT" ]	null	null	null	code/dpp/tails/__init__.py	bsouhaib/qf-tpp	a5adf3f7203b920528c1c397329c4afd9039c3b4	[ "MIT" ]	null	null	null	from .exponential import ExponentialTail	40	40	0.9	4	40	9	1	0	0	0	0	0	0	0	0	0	0	0.075	40	1	40	40	0.972973	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
2d8f91b60f844e994218b28a8aa70eac1cb5b8b0	551	py	Python	super_annotate/convert_to_sa.py	bhupathy-rubicon2/rubicon-helper-scripts	59cfa2503da101d80dcd074ccaa2d0f8922bbdb3	[ "MIT" ]	null	null	null	super_annotate/convert_to_sa.py	bhupathy-rubicon2/rubicon-helper-scripts	59cfa2503da101d80dcd074ccaa2d0f8922bbdb3	[ "MIT" ]	null	null	null	super_annotate/convert_to_sa.py	bhupathy-rubicon2/rubicon-helper-scripts	59cfa2503da101d80dcd074ccaa2d0f8922bbdb3	[ "MIT" ]	null	null	null	## Script to convert pascal voc format annotations to SA import superannotate as sa '''sa.import_annotation( "/home/mcw/ML_NAS/Rubicon/SOW2/pothole-retag-data/check_sa/img", "/home/mcw/ML_NAS/Rubicon/SOW2/pothole-retag-data/check_sa/output/", "VOC", "pothole_voc", "Vector", "object_detection" )''' ...	39.357143	75	0.709619	80	551	4.7	0.375	0.074468	0.095745	0.12766	0.787234	0.787234	0.606383	0.606383	0.606383	0.606383	0.008316	0.127042	551	14	76	39.357143	0.773389	0.096189	0	0	0.166667	0.644531	0.503906	0	0	0	0	1	0	true	0	0.333333	0	0.333333	0	0	0	0	null	0	0	0	0	1	0	0	0	1	0	0	0	0	0	0	0	0	0	0	1	1	null	0	0	0	0	1	0	1	0	0	0	6
2ddaa2bd411c96c17fca8e66a956a17cf48641b1	32	py	Python	Session3-PyTorch/torch_lr_finder/__init__.py	garima-mahato/END2	f138a83f44f0de706225b1232e09001221a68899	[ "Apache-2.0" ]	null	null	null	Session3-PyTorch/torch_lr_finder/__init__.py	garima-mahato/END2	f138a83f44f0de706225b1232e09001221a68899	[ "Apache-2.0" ]	null	null	null	Session3-PyTorch/torch_lr_finder/__init__.py	garima-mahato/END2	f138a83f44f0de706225b1232e09001221a68899	[ "Apache-2.0" ]	null	null	null	from .lr_finder import LRFinder	16	31	0.84375	5	32	5.2	1	0	0	0	0	0	0	0	0	0	0	0.125	32	1	32	32	0.928571	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
2de21e8d03ca7b97a4b140e2502f75744556d77c	224	py	Python	exceptions_ImportError_nomodule.py	lmokto/allexceptions	4cdbda52ea00d8022240530649ea85557c1621b2	[ "MIT" ]	null	null	null	exceptions_ImportError_nomodule.py	lmokto/allexceptions	4cdbda52ea00d8022240530649ea85557c1621b2	[ "MIT" ]	null	null	null	exceptions_ImportError_nomodule.py	lmokto/allexceptions	4cdbda52ea00d8022240530649ea85557c1621b2	[ "MIT" ]	null	null	null	import module_does_not_exist ''' File "/Users/joseuranga/Desktop/exceptions/exceptions_ImportError_nomodule.py", line 1, in <module> import module_does_not_exist ImportError: No module named module_does_not_exist '''	28	101	0.808036	31	224	5.483871	0.580645	0.176471	0.229412	0.317647	0.282353	0	0	0	0	0	0.005	0.107143	224	7	102	32	0.845	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	0	0	0	null	0	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
2dfd71a38ed0bef4374fcabd5fa61e295c4f18f5	166	py	Python	erdantic/examples/__init__.py	drivendataorg/erdantic	80c95bd012cc60499915c7f224a248112b23aeb4	[ "MIT" ]	69	2021-02-05T23:26:47.000Z	2022-03-31T12:02:04.000Z	erdantic/examples/__init__.py	drivendataorg/erdantic	80c95bd012cc60499915c7f224a248112b23aeb4	[ "MIT" ]	45	2021-02-05T23:40:38.000Z	2022-02-09T22:05:38.000Z	erdantic/examples/__init__.py	drivendataorg/erdantic	80c95bd012cc60499915c7f224a248112b23aeb4	[ "MIT" ]	6	2021-02-20T22:28:10.000Z	2022-03-25T18:29:37.000Z	"""Example data model classes.""" from erdantic.examples import dataclasses from erdantic.examples import pydantic __all__ = [ "dataclasses", "pydantic", ]	16.6	41	0.722892	17	166	6.823529	0.647059	0.206897	0.344828	0.448276	0	0	0	0	0	0	0	0.168675	166	9	42	18.444444	0.84058	0.162651	0	0	0	0.142857	0	0	0	0	0	1	0	false	0	0.333333	0	0.333333	0	1	0	0	null	1	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	1	0	0	0	6
930d69e38778f30a7b87bd6b27fddc6041beca38	1,126	py	Python	packages/director-sdk/python/simcore_director_sdk/models/__init__.py	oetiker/osparc-simcore	00918bf8f000840cc70cc49458780a55858d52ea	[ "MIT" ]	null	null	null	packages/director-sdk/python/simcore_director_sdk/models/__init__.py	oetiker/osparc-simcore	00918bf8f000840cc70cc49458780a55858d52ea	[ "MIT" ]	2	2018-05-13T09:10:57.000Z	2019-03-06T08:10:40.000Z	packages/director-sdk/python/simcore_director_sdk/models/__init__.py	oetiker/osparc-simcore	00918bf8f000840cc70cc49458780a55858d52ea	[ "MIT" ]	null	null	null	# coding: utf-8 # flake8: noqa """ Director API This is the oSparc's director API # noqa: E501 OpenAPI spec version: 0.1.0 Contact: support@simcore.com Generated by: https://openapi-generator.tech """ from __future__ import absolute_import # import models into model package from simcore_direc...	40.214286	96	0.865009	138	1,126	6.76087	0.413043	0.117899	0.203644	0.235799	0.463023	0.433012	0.39657	0.105038	0	0	0.052889	0.09325	1,126	27	97	41.703704	0.860921	0.199822	0	1	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	0	0	0	null	0	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
fac404523181cb0a4d2621118511ac2c98b85882	7,547	py	Python	ENIAC/api/loop_stack/loop_indicators/rmi_indicator.py	Ahrli/fast_tools	144d764e4f169d3ab3753dcc6a79db9f9449de59	[ "Apache-2.0" ]	1	2021-12-11T16:33:47.000Z	2021-12-11T16:33:47.000Z	ENIAC/api/loop_stack/loop_indicators/rmi_indicator.py	webclinic017/fast_tools	144d764e4f169d3ab3753dcc6a79db9f9449de59	[ "Apache-2.0" ]	null	null	null	ENIAC/api/loop_stack/loop_indicators/rmi_indicator.py	webclinic017/fast_tools	144d764e4f169d3ab3753dcc6a79db9f9449de59	[ "Apache-2.0" ]	3	2021-11-22T09:46:43.000Z	2022-01-28T22:33:07.000Z	import backtrader.indicators as btind from . import compare_price as compare from .base_indicator import iBaseIndicator class iRmiCompare(iBaseIndicator): ''' 因子：相对强弱指数比较数值传入参数： rule = {"args": ["5"], #rmi周期 "logic":{"compare": "eq","byValue": 1,"byMax": 5,}, # 周期结果比较 } ...	33.393805	118	0.542732	955	7,547	4.175916	0.113089	0.078987	0.069208	0.048897	0.839268	0.790622	0.784102	0.784102	0.724423	0.672267	0.031746	0.298794	7,547	225	119	33.542222	0.721844	0.144826	0.573529	0	0	0.028255	0	0	0	0	0	1	0.139706	false	0	0.022059	0.036765	0.352941	0	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
fac45b7bf57acb82952b82d31b091c24edfcafdd	3,182	py	Python	djangopj/geo/migrations/0001_initial.py	hikarine3/docker-django	ddcb15fa741993c3098a4f6bebbdaa498c27ac20	[ "MIT" ]	25	2019-11-19T07:16:20.000Z	2021-11-09T11:04:15.000Z	djangopj/geo/migrations/0001_initial.py	hikarine3/docker-django	ddcb15fa741993c3098a4f6bebbdaa498c27ac20	[ "MIT" ]	6	2020-05-16T10:51:09.000Z	2021-09-22T19:01:51.000Z	djangopj/geo/migrations/0001_initial.py	hikarine3/docker-django	ddcb15fa741993c3098a4f6bebbdaa498c27ac20	[ "MIT" ]	1	2019-03-26T05:33:01.000Z	2019-03-26T05:33:01.000Z	# Generated by Django 3.0.7 on 2020-06-09 10:11 from django.conf import settings from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): initial = True dependencies = [ migrations.swappable_dependency(settings.AUTH_USER_MODEL), ] ope...	48.953846	126	0.606851	350	3,182	5.325714	0.191429	0.060086	0.094421	0.094421	0.741416	0.741416	0.741416	0.741416	0.741416	0.741416	0.015605	0.254871	3,182	64	127	49.71875	0.770561	0.014142	0.649123	1	0	0.090271	0.006699	0	0	0	0	1	0	false	0	0.052632	0	0.122807	0	0	0	0	null	0	0	0	0	1	1	1	1	1	0	0	0	0	0	0	0	0	1	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
fac7fd4536e86fe7a004855213811336128caca7	134	py	Python	ml_automation/metrics/accuracy.py	ChillBoss/ml_automation	50d42b3cd5a3bb2f7a91e4c53bf3bbfe7a3b1741	[ "MIT" ]	null	null	null	ml_automation/metrics/accuracy.py	ChillBoss/ml_automation	50d42b3cd5a3bb2f7a91e4c53bf3bbfe7a3b1741	[ "MIT" ]	null	null	null	ml_automation/metrics/accuracy.py	ChillBoss/ml_automation	50d42b3cd5a3bb2f7a91e4c53bf3bbfe7a3b1741	[ "MIT" ]	null	null	null	import numpy as np from sklearn.metrics import accuracy_score def accuracy(preds, target): return accuracy_score(target, preds)	19.142857	42	0.791045	19	134	5.473684	0.684211	0.25	0	0	0	0	0	0	0	0	0	0.149254	134	6	43	22.333333	0.912281	0	0	0	0	0	0	0	0	0	0	1	0.25	false	0	0.5	0.25	1	0	1	0	0	null	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	1	0	0	1	1	0	0	6
facba5c0db1bee6658dc2a02164a22a385afbd31	168	py	Python	sc2g/sc2g/env/attack/__init__.py	kiriphorito/COMP3096---MARL	5e05413b0980d60f4a3f2a17123178c93bb0b763	[ "Apache-2.0" ]	1	2018-07-07T09:02:27.000Z	2018-07-07T09:02:27.000Z	sc2g/sc2g/env/attack/__init__.py	kiriphorito/COMP3096---MARL	5e05413b0980d60f4a3f2a17123178c93bb0b763	[ "Apache-2.0" ]	null	null	null	sc2g/sc2g/env/attack/__init__.py	kiriphorito/COMP3096---MARL	5e05413b0980d60f4a3f2a17123178c93bb0b763	[ "Apache-2.0" ]	null	null	null	from sc2g.env.attack.basic_attack import AttackEnv from sc2g.env.attack.directed_attack import DirectedAttackEnv from sc2g.env.attack.multi_attack import MultiAttackEnv	56	61	0.880952	24	168	6.041667	0.458333	0.165517	0.227586	0.351724	0	0	0	0	0	0	0.019108	0.065476	168	3	62	56	0.904459	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	0	0	null	0	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	0	0	6
fae5d58518bfd8abdd23bf2cc3cceea11b667e2c	112	py	Python	RBFN/__init__.py	Anselmoo/RBF_NetworkFitting	db8742934b73b8172be16c277919f210aa8a08df	[ "MIT" ]	1	2019-12-04T18:33:31.000Z	2019-12-04T18:33:31.000Z	RBFN/__init__.py	Anselmoo/RBF_NetworkFitting	db8742934b73b8172be16c277919f210aa8a08df	[ "MIT" ]	1	2020-08-14T17:28:46.000Z	2020-08-14T17:28:46.000Z	RBFN/__init__.py	Anselmoo/RBF_NetworkFitting	db8742934b73b8172be16c277919f210aa8a08df	[ "MIT" ]	1	2022-01-23T06:35:16.000Z	2022-01-23T06:35:16.000Z	import sys from . import RBFNetwork from . import PlotResults from . import GeneticFitter sys.path.append('..')	18.666667	27	0.767857	14	112	6.142857	0.571429	0.348837	0	0	0	0	0	0	0	0	0	0.133929	112	5	28	22.4	0.886598	0	0	0	0	0.017857	0	0	0	0	0	1	0	true	0	0.8	0	0.8	0	1	0	0	null	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
878cc5e22def24957a53a528999cb2da2a810ea0	6,905	py	Python	Testing/PythonTests/reconstructpca.py	ben2k/ShapeWorks	a61d2710c5592db1dc00b4fe11990e512220161f	[ "MIT" ]	1	2022-01-14T19:04:58.000Z	2022-01-14T19:04:58.000Z	Testing/PythonTests/reconstructpca.py	ben2k/ShapeWorks	a61d2710c5592db1dc00b4fe11990e512220161f	[ "MIT" ]	null	null	null	Testing/PythonTests/reconstructpca.py	ben2k/ShapeWorks	a61d2710c5592db1dc00b4fe11990e512220161f	[ "MIT" ]	null	null	null	import os import sys from shapeworks import * success = True def pcamodesTest1(): denseFile = os.environ["DATA"] + "/_dense.vtk" sparseFile = os.environ["DATA"] + "/_sparse.particles" goodPointsFile = os.environ["DATA"] + "/_goodPoints.txt" worldParticles = [] worldParticles.append(os.environ["DATA"] + "/e...	55.685484	122	0.787111	707	6,905	7.540311	0.097595	0.060777	0.126805	0.106922	0.968861	0.968861	0.968861	0.968861	0.968861	0.928531	0.041903	0.080666	6,905	123	123	56.138211	0.797889	0	0.694737	0	0	0.334685	0.291528	0	0	0	0	1	0.021053	false	0	0.031579	0	0.073684	0	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
87db2ef53a8f7566e55b653e14113d0f09a73eeb	45	py	Python	seojeon/models.py	jyh69293/index1	d2fcd1660f32fbf68df5009db1a3fca0cfa549f7	[ "MIT" ]	1	2018-11-11T07:12:50.000Z	2018-11-11T07:12:50.000Z	seojeon/models.py	jyh69293/index1	d2fcd1660f32fbf68df5009db1a3fca0cfa549f7	[ "MIT" ]	null	null	null	seojeon/models.py	jyh69293/index1	d2fcd1660f32fbf68df5009db1a3fca0cfa549f7	[ "MIT" ]	null	null	null	from django.db import models # nothing here	11.25	28	0.777778	7	45	5	1	0	0	0	0	0	0	0	0	0	0	0.177778	45	3	29	15	0.945946	0.266667	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
3559da7440b802a2f65c9d0006158e35d7042f21	86	py	Python	spot_runner/__main__.py	leadhub-code/spot-runner	86e2104a126083b2d265b342e4e1305ec48be4c1	[ "MIT" ]	1	2017-11-23T10:34:58.000Z	2017-11-23T10:34:58.000Z	spot_runner/__main__.py	leadhub-code/spot-runner	86e2104a126083b2d265b342e4e1305ec48be4c1	[ "MIT" ]	1	2017-11-29T12:31:06.000Z	2017-12-11T13:12:49.000Z	spot_runner/__main__.py	leadhub-code/spot-runner	86e2104a126083b2d265b342e4e1305ec48be4c1	[ "MIT" ]	null	null	null	from .main import spot_runner_main if __name__ == '__main__': spot_runner_main()	17.2	34	0.744186	12	86	4.333333	0.583333	0.384615	0.538462	0	0	0	0	0	0	0	0	0.162791	86	4	35	21.5	0.722222	0	0	0	0	0.093023	0	0	0	0	0	1	0	true	0	0.333333	0	0.333333	0	1	0	0	null	1	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	0	0	6
ea26c5d29e58b181375e64330986089fe6661dc6	16,095	py	Python	old/Bezier/Bezier.py	Tony031218/manim-projects	b243dec0f0a007649a92938e90d60eccb4c7dd15	[ "Apache-2.0" ]	45	2019-10-08T23:58:20.000Z	2020-05-20T03:49:15.000Z	old/Bezier/Bezier.py	Tony031218/manim-projects	b243dec0f0a007649a92938e90d60eccb4c7dd15	[ "Apache-2.0" ]	null	null	null	old/Bezier/Bezier.py	Tony031218/manim-projects	b243dec0f0a007649a92938e90d60eccb4c7dd15	[ "Apache-2.0" ]	12	2019-08-15T08:07:22.000Z	2020-05-09T12:34:14.000Z	from manimlib.imports import * from manim_projects.tony_useful.imports import * class LinearBezierCurve(Scene): CONFIG = { "camera_config": { "background_color": WHITE } } def construct(self): P0 = Dot(np.array([-1.5, 1.5, 0])) P1 = Dot(np.array([ 1.5, -1.5, 0]...	45.724432	134	0.596024	2,578	16,095	3.501552	0.070985	0.149551	0.099258	0.105461	0.800377	0.774233	0.764927	0.722499	0.707987	0.694915	0.060822	0.224666	16,095	351	135	45.854701	0.662553	0	0.517361	0	0.006944	0.045356	0.006648	0	0	0	0	1	0.03125	false	0	0.006944	0	0.097222	0	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
ea652a0d78e185e62e5ee4879a56e0c18272ba03	23,433	py	Python	spark_fhir_schemas/stu3/complex_types/allergyintolerance.py	icanbwell/SparkFhirSchemas	8c828313c39850b65f8676e67f526ee92b7d624e	[ "Apache-2.0" ]	2	2020-10-31T23:25:01.000Z	2021-06-09T14:12:42.000Z	spark_fhir_schemas/stu3/complex_types/allergyintolerance.py	icanbwell/SparkFhirSchemas	8c828313c39850b65f8676e67f526ee92b7d624e	[ "Apache-2.0" ]	null	null	null	spark_fhir_schemas/stu3/complex_types/allergyintolerance.py	icanbwell/SparkFhirSchemas	8c828313c39850b65f8676e67f526ee92b7d624e	[ "Apache-2.0" ]	null	null	null	from typing import Union, List, Optional from pyspark.sql.types import ( StructType, StructField, StringType, ArrayType, DateType, DataType, TimestampType, ) # This file is auto-generated by generate_schema so do not edit manually # noinspection PyPep8Naming class AllergyIntoleranceSchema...	50.393548	104	0.567362	2,261	23,433	5.702344	0.143299	0.056775	0.036066	0.052121	0.80819	0.788878	0.788878	0.758163	0.746064	0.739549	0.002853	0.386762	23,433	464	105	50.502155	0.894363	0.357957	0.608997	0	0	0.031012	0	0	0	0	0.00692	1	0.00346	false	0	0.048443	0	0.062284	0	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
ea76dc4be6e539c599bb82f08d5591cdea07d442	35	py	Python	app/models/__init__.py	jonatasoli/sapu	b0b796a53fecd9ab77eb0ece31d2a0113c656fc5	[ "BSD-3-Clause" ]	1	2020-10-29T01:48:36.000Z	2020-10-29T01:48:36.000Z	app/models/__init__.py	jonatasoli/sapu	b0b796a53fecd9ab77eb0ece31d2a0113c656fc5	[ "BSD-3-Clause" ]	10	2020-10-29T23:46:13.000Z	2020-10-29T23:48:00.000Z	app/models/__init__.py	jonatasoli/sapu	b0b796a53fecd9ab77eb0ece31d2a0113c656fc5	[ "BSD-3-Clause" ]	null	null	null	from models.user_model import User	17.5	34	0.857143	6	35	4.833333	0.833333	0	0	0	0	0	0	0	0	0	0	0.114286	35	1	35	35	0.935484	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
ea77994967ef08bfe1047ee4bf881b3dd0c5a2ea	24	py	Python	arubaapi/__init__.py	hAyt3ch/arubaapi	efa08b4172246f768410ecd81f154125345d969c	[ "MIT" ]	null	null	null	arubaapi/__init__.py	hAyt3ch/arubaapi	efa08b4172246f768410ecd81f154125345d969c	[ "MIT" ]	null	null	null	arubaapi/__init__.py	hAyt3ch/arubaapi	efa08b4172246f768410ecd81f154125345d969c	[ "MIT" ]	1	2019-04-23T13:37:16.000Z	2019-04-23T13:37:16.000Z	from .arubaapi import *	12	23	0.75	3	24	6	1	0	0	0	0	0	0	0	0	0	0	0.166667	24	1	24	24	0.9	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	1	0	null	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6
5761e24030745ac2e965c19573c04fb8e727141e	18,281	py	Python	yardstick/tests/unit/benchmark/scenarios/networking/test_pktgen.py	upfront710/yardstick	2c3898f2ca061962cedbfc7435f78b59aa39b097	[ "Apache-2.0" ]	28	2017-02-07T07:46:42.000Z	2021-06-30T08:11:06.000Z	yardstick/tests/unit/benchmark/scenarios/networking/test_pktgen.py	upfront710/yardstick	2c3898f2ca061962cedbfc7435f78b59aa39b097	[ "Apache-2.0" ]	6	2018-01-18T08:00:54.000Z	2019-04-11T04:51:41.000Z	yardstick/tests/unit/benchmark/scenarios/networking/test_pktgen.py	upfront710/yardstick	2c3898f2ca061962cedbfc7435f78b59aa39b097	[ "Apache-2.0" ]	46	2016-12-13T10:05:47.000Z	2021-02-18T07:33:06.000Z	############################################################################## # Copyright (c) 2015 Ericsson AB and others. # # All rights reserved. This program and the accompanying materials # are made available under the terms of the Apache License, Version 2.0 # which accompanies this distribution, and is available...	40.26652	79	0.627427	2,141	18,281	5.018683	0.095283	0.093811	0.055282	0.0698	0.859656	0.817124	0.759144	0.755421	0.731596	0.715309	0.02804	0.258684	18,281	453	80	40.355408	0.764832	0.015152	0.614035	0	0	0.078975	0.006894	0	0	0	0.149123	1	0.119883	false	0	0.020468	0	0.143275	0.008772	0	0	0	null	0	0	0	1	1	1	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	0	6
577f04fbcd11416b57c420fd153d9aa58db65d91	165	py	Python	exercicios/06. estrutura de controle/046.py	augustolimads/Exercicios_Python	2ea33e0a9ee2be1a75335fa1ac169f2654c73c4b	[ "Apache-2.0" ]	null	null	null	exercicios/06. estrutura de controle/046.py	augustolimads/Exercicios_Python	2ea33e0a9ee2be1a75335fa1ac169f2654c73c4b	[ "Apache-2.0" ]	null	null	null	exercicios/06. estrutura de controle/046.py	augustolimads/Exercicios_Python	2ea33e0a9ee2be1a75335fa1ac169f2654c73c4b	[ "Apache-2.0" ]	null	null	null	from time import sleep print('Contagem regressiva para fogos') for c in range(10, -1, -1): print('{}...'.format(c)) sleep(1) print('Pei pei PEI pei pEI!!!!')	27.5	39	0.630303	27	165	3.851852	0.62963	0.230769	0.259615	0.230769	0	0	0	0	0	0	0.036496	0.169697	165	6	40	27.5	0.722628	0	0	0	0	0.349398	0	0	0	0	0	1	0	false	0	0.166667	0	0.166667	0.5	1	0	0	null	1	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	0	0	0	0	0	1	6
57d49af7e159d18b9db7c9de21d894f1538241f7	50	py	Python	CDRTR/dataset/__init__.py	caoyulong/CDRTR	f61cf84c096a124066af90f6536d85be630ecdff	[ "BSD-2-Clause" ]	9	2019-07-05T14:49:25.000Z	2021-05-12T13:37:19.000Z	CDRTR/dataset/__init__.py	caoyulong/CDRTR	f61cf84c096a124066af90f6536d85be630ecdff	[ "BSD-2-Clause" ]	null	null	null	CDRTR/dataset/__init__.py	caoyulong/CDRTR	f61cf84c096a124066af90f6536d85be630ecdff	[ "BSD-2-Clause" ]	1	2021-02-13T14:00:26.000Z	2021-02-13T14:00:26.000Z	from . import Dataset from . import DSNRecDataset	16.666667	27	0.8	6	50	6.666667	0.666667	0.5	0	0	0	0	0	0	0	0	0	0.16	50	2	28	25	0.952381	0	0	0	0	0	0	0	0	0	0	1	0	true	0	1	0	1	0	1	0	0	null	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	null	0	0	0	0	1	0	1	0	1	0	6

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.