hexsha
string | size
int64 | ext
string | lang
string | max_stars_repo_path
string | max_stars_repo_name
string | max_stars_repo_head_hexsha
string | max_stars_repo_licenses
list | max_stars_count
int64 | max_stars_repo_stars_event_min_datetime
string | max_stars_repo_stars_event_max_datetime
string | max_issues_repo_path
string | max_issues_repo_name
string | max_issues_repo_head_hexsha
string | max_issues_repo_licenses
list | max_issues_count
int64 | max_issues_repo_issues_event_min_datetime
string | max_issues_repo_issues_event_max_datetime
string | max_forks_repo_path
string | max_forks_repo_name
string | max_forks_repo_head_hexsha
string | max_forks_repo_licenses
list | max_forks_count
int64 | max_forks_repo_forks_event_min_datetime
string | max_forks_repo_forks_event_max_datetime
string | content
string | avg_line_length
float64 | max_line_length
int64 | alphanum_fraction
float64 | qsc_code_num_words_quality_signal
int64 | qsc_code_num_chars_quality_signal
float64 | qsc_code_mean_word_length_quality_signal
float64 | qsc_code_frac_words_unique_quality_signal
float64 | qsc_code_frac_chars_top_2grams_quality_signal
float64 | qsc_code_frac_chars_top_3grams_quality_signal
float64 | qsc_code_frac_chars_top_4grams_quality_signal
float64 | qsc_code_frac_chars_dupe_5grams_quality_signal
float64 | qsc_code_frac_chars_dupe_6grams_quality_signal
float64 | qsc_code_frac_chars_dupe_7grams_quality_signal
float64 | qsc_code_frac_chars_dupe_8grams_quality_signal
float64 | qsc_code_frac_chars_dupe_9grams_quality_signal
float64 | qsc_code_frac_chars_dupe_10grams_quality_signal
float64 | qsc_code_frac_chars_replacement_symbols_quality_signal
float64 | qsc_code_frac_chars_digital_quality_signal
float64 | qsc_code_frac_chars_whitespace_quality_signal
float64 | qsc_code_size_file_byte_quality_signal
float64 | qsc_code_num_lines_quality_signal
float64 | qsc_code_num_chars_line_max_quality_signal
float64 | qsc_code_num_chars_line_mean_quality_signal
float64 | qsc_code_frac_chars_alphabet_quality_signal
float64 | qsc_code_frac_chars_comments_quality_signal
float64 | qsc_code_cate_xml_start_quality_signal
float64 | qsc_code_frac_lines_dupe_lines_quality_signal
float64 | qsc_code_cate_autogen_quality_signal
float64 | qsc_code_frac_lines_long_string_quality_signal
float64 | qsc_code_frac_chars_string_length_quality_signal
float64 | qsc_code_frac_chars_long_word_length_quality_signal
float64 | qsc_code_frac_lines_string_concat_quality_signal
float64 | qsc_code_cate_encoded_data_quality_signal
float64 | qsc_code_frac_chars_hex_words_quality_signal
float64 | qsc_code_frac_lines_prompt_comments_quality_signal
float64 | qsc_code_frac_lines_assert_quality_signal
float64 | qsc_codepython_cate_ast_quality_signal
float64 | qsc_codepython_frac_lines_func_ratio_quality_signal
float64 | qsc_codepython_cate_var_zero_quality_signal
bool | qsc_codepython_frac_lines_pass_quality_signal
float64 | qsc_codepython_frac_lines_import_quality_signal
float64 | qsc_codepython_frac_lines_simplefunc_quality_signal
float64 | qsc_codepython_score_lines_no_logic_quality_signal
float64 | qsc_codepython_frac_lines_print_quality_signal
float64 | qsc_code_num_words
int64 | qsc_code_num_chars
int64 | qsc_code_mean_word_length
int64 | qsc_code_frac_words_unique
null | qsc_code_frac_chars_top_2grams
int64 | qsc_code_frac_chars_top_3grams
int64 | qsc_code_frac_chars_top_4grams
int64 | qsc_code_frac_chars_dupe_5grams
int64 | qsc_code_frac_chars_dupe_6grams
int64 | qsc_code_frac_chars_dupe_7grams
int64 | qsc_code_frac_chars_dupe_8grams
int64 | qsc_code_frac_chars_dupe_9grams
int64 | qsc_code_frac_chars_dupe_10grams
int64 | qsc_code_frac_chars_replacement_symbols
int64 | qsc_code_frac_chars_digital
int64 | qsc_code_frac_chars_whitespace
int64 | qsc_code_size_file_byte
int64 | qsc_code_num_lines
int64 | qsc_code_num_chars_line_max
int64 | qsc_code_num_chars_line_mean
int64 | qsc_code_frac_chars_alphabet
int64 | qsc_code_frac_chars_comments
int64 | qsc_code_cate_xml_start
int64 | qsc_code_frac_lines_dupe_lines
int64 | qsc_code_cate_autogen
int64 | qsc_code_frac_lines_long_string
int64 | qsc_code_frac_chars_string_length
int64 | qsc_code_frac_chars_long_word_length
int64 | qsc_code_frac_lines_string_concat
null | qsc_code_cate_encoded_data
int64 | qsc_code_frac_chars_hex_words
int64 | qsc_code_frac_lines_prompt_comments
int64 | qsc_code_frac_lines_assert
int64 | qsc_codepython_cate_ast
int64 | qsc_codepython_frac_lines_func_ratio
int64 | qsc_codepython_cate_var_zero
int64 | qsc_codepython_frac_lines_pass
int64 | qsc_codepython_frac_lines_import
int64 | qsc_codepython_frac_lines_simplefunc
int64 | qsc_codepython_score_lines_no_logic
int64 | qsc_codepython_frac_lines_print
int64 | effective
string | hits
int64 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
75ce330482b516819b6603b846322818a54943c9
| 732
|
py
|
Python
|
GlobalDataset/bin/calculateAllThetaCombinations.py
|
gehilley/GlobalSteepness
|
62a1a5b66adb230d5bbbc004aa5d2c5b618a2fdd
|
[
"MIT"
] | 3
|
2019-09-19T00:04:27.000Z
|
2020-02-17T16:17:55.000Z
|
GlobalDataset/bin/calculateAllThetaCombinations.py
|
gehilley/GlobalSteepness
|
62a1a5b66adb230d5bbbc004aa5d2c5b618a2fdd
|
[
"MIT"
] | null | null | null |
GlobalDataset/bin/calculateAllThetaCombinations.py
|
gehilley/GlobalSteepness
|
62a1a5b66adb230d5bbbc004aa5d2c5b618a2fdd
|
[
"MIT"
] | 1
|
2020-12-17T07:35:23.000Z
|
2020-12-17T07:35:23.000Z
|
#!/usr/bin/env python
import demMethods as d
Ao = 2000000
theta = 0.4
d.processForTheta('af', Ao, theta)
d.processForTheta('au', Ao, theta)
d.processForTheta('ca', Ao, theta)
d.processForTheta('eu', Ao, theta)
d.processForTheta('na', Ao, theta)
d.processForTheta('sa', Ao, theta)
theta = 0.5
d.processForTheta('af', Ao, theta)
d.processForTheta('au', Ao, theta)
d.processForTheta('ca', Ao, theta)
d.processForTheta('eu', Ao, theta)
d.processForTheta('na', Ao, theta)
d.processForTheta('sa', Ao, theta)
theta = 0.6
d.processForTheta('af', Ao, theta)
d.processForTheta('au', Ao, theta)
d.processForTheta('ca', Ao, theta)
d.processForTheta('eu', Ao, theta)
d.processForTheta('na', Ao, theta)
d.processForTheta('sa', Ao, theta)
| 22.181818
| 34
| 0.702186
| 109
| 732
| 4.715596
| 0.201835
| 0.560311
| 0.233463
| 0.671206
| 0.898833
| 0.898833
| 0.898833
| 0.898833
| 0.898833
| 0.898833
| 0
| 0.019939
| 0.10929
| 732
| 32
| 35
| 22.875
| 0.768405
| 0.027322
| 0
| 0.782609
| 0
| 0
| 0.050704
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.043478
| 0
| 0.043478
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 10
|
f94200cb4431cc5675840609928a3541d0d6be51
| 150
|
py
|
Python
|
Helpers/metrics.py
|
mtimbs/AFLData
|
a598defb3a540bf4d82fce6b568c25b29851c2a6
|
[
"CC0-1.0"
] | 1
|
2019-09-09T00:14:15.000Z
|
2019-09-09T00:14:15.000Z
|
Helpers/metrics.py
|
mtimbs/AFLData
|
a598defb3a540bf4d82fce6b568c25b29851c2a6
|
[
"CC0-1.0"
] | null | null | null |
Helpers/metrics.py
|
mtimbs/AFLData
|
a598defb3a540bf4d82fce6b568c25b29851c2a6
|
[
"CC0-1.0"
] | null | null | null |
from sklearn.metrics import confusion_matrix, classification_report
def metrics(true, predicted):
return classification_report(true, predicted)
| 25
| 67
| 0.826667
| 17
| 150
| 7.117647
| 0.705882
| 0.330579
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.113333
| 150
| 5
| 68
| 30
| 0.909774
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.333333
| false
| 0
| 0.333333
| 0.333333
| 1
| 0
| 1
| 0
| 0
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 1
| 1
| 0
|
0
| 7
|
f95101e787fbb75a0a13f53bf3203cb216bc80bd
| 793
|
py
|
Python
|
MotionControl/scripts/utilities/testCalibration.py
|
RobotSoccerCollaboration/RobotSoccer
|
6bd2ac6cf780e959f1d1659319502b9d0349e685
|
[
"MIT"
] | null | null | null |
MotionControl/scripts/utilities/testCalibration.py
|
RobotSoccerCollaboration/RobotSoccer
|
6bd2ac6cf780e959f1d1659319502b9d0349e685
|
[
"MIT"
] | null | null | null |
MotionControl/scripts/utilities/testCalibration.py
|
RobotSoccerCollaboration/RobotSoccer
|
6bd2ac6cf780e959f1d1659319502b9d0349e685
|
[
"MIT"
] | null | null | null |
#!/usr/bin/python
from motor_control import velchange
import math
import time
scale = .3
velchange.goXYOmega(scale,0,0)
time.sleep(1)
velchange.goXYOmega(0,0,0)
time.sleep(1)
velchange.goXYOmega(-scale,0,0)
time.sleep(1)
velchange.goXYOmega(0,0,0)
time.sleep(1)
velchange.goXYOmega(scale*math.cos(2*math.pi/3),scale*math.sin(2*math.pi/3),0)
time.sleep(1)
velchange.goXYOmega(0,0,0)
time.sleep(1)
velchange.goXYOmega(-math.cos(2*math.pi/3)*scale,-math.sin(2*math.pi/3)*scale,0)
time.sleep(1)
velchange.goXYOmega(0,0,0)
time.sleep(1)
velchange.goXYOmega(math.cos(-2*math.pi/3)*scale,math.sin(-2*math.pi/3)*scale,0)
time.sleep(1)
velchange.goXYOmega(0,0,0)
time.sleep(1)
velchange.goXYOmega(-math.cos(-2*math.pi/3)*scale,-math.sin(-2*math.pi/3)*scale,0)
time.sleep(1)
velchange.goXYOmega(0,0,0)
| 26.433333
| 82
| 0.746532
| 155
| 793
| 3.812903
| 0.129032
| 0.047377
| 0.186125
| 0.204738
| 0.883249
| 0.883249
| 0.883249
| 0.883249
| 0.883249
| 0.883249
| 0
| 0.071334
| 0.045397
| 793
| 29
| 83
| 27.344828
| 0.709379
| 0.020177
| 0
| 0.62963
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.111111
| 0
| 0.111111
| 0
| 0
| 0
| 0
| null | 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
f95746724b107b20be39680d45114ccd8067ded6
| 21,873
|
py
|
Python
|
Fonts/freesans20.py
|
adegenaar/MP730026
|
c9e29bf496fab6fd763b36c5c86b2c4d1354d230
|
[
"MIT"
] | 1
|
2020-11-09T09:24:54.000Z
|
2020-11-09T09:24:54.000Z
|
Fonts/freesans20.py
|
adegenaar/MP730026
|
c9e29bf496fab6fd763b36c5c86b2c4d1354d230
|
[
"MIT"
] | null | null | null |
Fonts/freesans20.py
|
adegenaar/MP730026
|
c9e29bf496fab6fd763b36c5c86b2c4d1354d230
|
[
"MIT"
] | null | null | null |
# Code generated by font_to_py.py.
# Font: FreeSans-LrmZ.ttf Char set: !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~£¬°Ωαβγδθλμπωϕ
# Cmd: .\font_to_py.py C:\Users\albert.w.degenaar\Downloads\freesans-font\FreeSans-LrmZ.ttf 20 freesans20.py -x -k extended
version = '0.33'
def height():
return 21
def baseline():
return 16
def max_width():
return 21
def hmap():
return True
def reverse():
return False
def monospaced():
return False
def min_ch():
return 32
def max_ch():
return 981
_font =\
b'\x0c\x00\x06\x00\x1f\x80\x30\xc0\x30\x60\x20\x60\x00\x60\x00\xc0'\
b'\x01\x80\x03\x00\x06\x00\x06\x00\x06\x00\x00\x00\x00\x00\x06\x00'\
b'\x06\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x06\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x06\x00\x00\x10\x10\x10\x10\x10\x10\x10\x10\x10\x10'\
b'\x10\x00\x00\x10\x10\x00\x00\x00\x00\x00\x07\x00\x00\x6c\x6c\x6c'\
b'\x64\x24\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x0c\x00\x00\x00\x0c\x40\x0c\xc0\x0c\xc0\x08\xc0\x7f\xe0\x7f'\
b'\xe0\x19\x80\x19\x80\x11\x80\x11\x80\xff\xe0\x31\x00\x33\x00\x33'\
b'\x00\x23\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0c\x00\x04'\
b'\x00\x1f\x00\x3d\xc0\x64\xc0\x64\x40\x64\x00\x64\x00\x3c\x00\x1f'\
b'\x80\x07\xc0\x04\xe0\x04\x60\x44\x60\x64\x60\x74\xc0\x3f\x80\x04'\
b'\x00\x04\x00\x04\x00\x00\x00\x00\x00\x13\x00\x00\x00\x00\x00\x04'\
b'\x00\x3e\x08\x00\x66\x18\x00\x43\x10\x00\x43\x30\x00\x63\x20\x00'\
b'\x7e\x60\x00\x1c\x40\x00\x00\xc7\x00\x00\x8f\x80\x01\x98\xc0\x01'\
b'\x10\x40\x02\x10\xc0\x02\x18\xc0\x04\x0f\x80\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0e\x00\x00\x00\x07\x00'\
b'\x1f\x80\x18\xc0\x18\xc0\x18\xc0\x0d\x80\x0f\x00\x1e\x00\x3b\x30'\
b'\x61\xb0\x61\xf0\x60\xe0\x60\xe0\x31\xf0\x3f\x18\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x04\x00\x00\x60\x60\x60\x60\x60\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x07\x00\x00'\
b'\x0c\x08\x18\x10\x30\x30\x20\x20\x20\x20\x20\x20\x20\x30\x30\x10'\
b'\x18\x08\x0c\x00\x07\x00\x00\x60\x20\x30\x10\x10\x18\x18\x08\x08'\
b'\x08\x08\x08\x18\x18\x18\x10\x30\x20\x60\x00\x08\x00\x00\x18\x5a'\
b'\x7e\x18\x34\x24\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x0c\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x06\x00\x06\x00\x06\x00\x06\x00\x7f\xe0\x7f\xe0\x06\x00\x06\x00'\
b'\x06\x00\x06\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x06\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x30\x30'\
b'\x10\x10\x20\x00\x00\x07\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x7c\x7c\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x06\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x30\x30\x00\x00'\
b'\x00\x00\x00\x06\x00\x00\x04\x08\x08\x08\x10\x10\x10\x20\x20\x20'\
b'\x60\x40\x40\xc0\x80\x00\x00\x00\x00\x00\x0c\x00\x00\x00\x0f\x00'\
b'\x1f\x80\x30\xc0\x60\xc0\x60\xc0\x60\x60\x60\x60\x60\x60\x60\x60'\
b'\x60\x60\x60\x40\x60\xc0\x30\xc0\x31\x80\x1f\x80\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x0c\x00\x00\x00\x02\x00\x02\x00\x06\x00'\
b'\x3e\x00\x06\x00\x06\x00\x06\x00\x06\x00\x06\x00\x06\x00\x06\x00'\
b'\x06\x00\x06\x00\x06\x00\x06\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x0c\x00\x00\x00\x0f\x00\x3f\xc0\x30\xc0\x60\x60\x60\x60'\
b'\x00\x60\x00\xc0\x01\xc0\x07\x00\x1e\x00\x38\x00\x30\x00\x60\x00'\
b'\x7f\xe0\x7f\xe0\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0c\x00'\
b'\x00\x00\x1f\x00\x3f\x80\x70\xc0\x60\xc0\x60\xc0\x00\xc0\x03\x80'\
b'\x07\x80\x01\xc0\x00\xc0\x00\x60\x60\x60\x60\xc0\x71\xc0\x3f\x80'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0c\x00\x00\x00\x01\x80'\
b'\x03\x80\x03\x80\x07\x80\x0d\x80\x19\x80\x19\x80\x31\x80\x61\x80'\
b'\x41\x80\x7f\xe0\x01\x80\x01\x80\x01\x80\x01\x80\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x0c\x00\x00\x00\x3f\xc0\x3f\xc0\x30\x00'\
b'\x30\x00\x20\x00\x2f\x00\x7f\x80\x70\xc0\x00\xe0\x00\x60\x00\x60'\
b'\x60\x60\x60\xc0\x31\xc0\x3f\x80\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x0c\x00\x00\x00\x0f\x00\x1f\x80\x30\xc0\x30\xc0\x60\x00'\
b'\x60\x00\x6f\x80\x79\xc0\x70\xc0\x60\x60\x60\x60\x60\x60\x20\xc0'\
b'\x39\xc0\x1f\x80\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0c\x00'\
b'\x00\x00\x7f\xe0\x7f\xe0\x00\x40\x00\xc0\x01\x80\x01\x00\x03\x00'\
b'\x02\x00\x06\x00\x04\x00\x0c\x00\x0c\x00\x08\x00\x18\x00\x18\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0c\x00\x00\x00\x0f\x00'\
b'\x3f\x80\x30\xc0\x60\xc0\x60\xc0\x30\xc0\x3f\x80\x1f\x80\x30\xc0'\
b'\x60\x60\x60\x60\x60\x60\x60\xe0\x31\xc0\x1f\x80\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x0c\x00\x00\x00\x0f\x00\x3f\x80\x70\xc0'\
b'\x60\xc0\x60\x40\x60\x60\x60\xe0\x70\xe0\x3f\xe0\x1e\x60\x00\x40'\
b'\x00\xc0\x60\xc0\x31\x80\x1f\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x06\x00\x00\x00\x00\x00\x00\x38\x38\x00\x00\x00\x00\x00'\
b'\x00\x00\x38\x38\x00\x00\x00\x00\x00\x06\x00\x00\x00\x00\x00\x00'\
b'\x38\x38\x00\x00\x00\x00\x00\x00\x00\x38\x38\x08\x10\x30\x00\x00'\
b'\x0c\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x20'\
b'\x00\xe0\x07\x80\x1e\x00\x70\x00\x70\x00\x3c\x00\x07\x80\x01\xe0'\
b'\x00\x20\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0c\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x7f\xe0\x00\x00\x00\x00\x7f\xe0\x7f\xe0\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x0c\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x40\x00\x70\x00\x1e\x00\x07\x80\x00\xe0'\
b'\x00\xe0\x03\xc0\x0e\x00\x78\x00\x60\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x0c\x00\x06\x00\x1f\x80\x30\xc0\x30\x60\x20\x60'\
b'\x00\x60\x00\xc0\x01\x80\x03\x00\x06\x00\x06\x00\x06\x00\x00\x00'\
b'\x00\x00\x06\x00\x06\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x15\x00\x00\x30\x00\x01\xff\x00\x07\x07\x80\x0c\x01\xc0\x18\x00'\
b'\x60\x30\x73\x60\x21\xca\x30\x61\x86\x30\x63\x06\x30\x63\x04\x30'\
b'\x62\x0c\x30\x62\x0c\x60\x63\x1c\xe0\x63\xff\xc0\x30\xc7\x00\x38'\
b'\x00\x00\x1c\x00\x00\x07\xfe\x00\x01\xfc\x00\x00\x00\x00\x00\x00'\
b'\x00\x0e\x00\x00\x00\x03\x80\x07\x80\x07\x80\x0c\xc0\x0c\xc0\x0c'\
b'\xc0\x18\x60\x18\x60\x18\x60\x3f\xf0\x30\x30\x30\x30\x60\x18\x60'\
b'\x18\x60\x1c\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0e\x00\x00'\
b'\x00\x3f\xe0\x30\xf0\x30\x30\x30\x30\x30\x30\x30\x30\x3f\xe0\x3f'\
b'\xe0\x30\x38\x30\x18\x30\x18\x30\x18\x30\x38\x3f\xf0\x3f\xe0\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0f\x00\x01\x80\x0f\xf0\x1c'\
b'\x38\x38\x18\x30\x0c\x60\x00\x60\x00\x60\x00\x60\x00\x60\x00\x60'\
b'\x0c\x60\x0c\x30\x0c\x38\x18\x1c\x38\x0f\xf0\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x0f\x00\x00\x00\x3f\xe0\x30\xf0\x30\x38\x30'\
b'\x18\x30\x0c\x30\x0c\x30\x0c\x30\x0c\x30\x0c\x30\x0c\x30\x0c\x30'\
b'\x18\x30\x38\x3f\xf0\x3f\xc0\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x0e\x00\x00\x00\x3f\xf8\x30\x00\x30\x00\x30\x00\x30\x00\x30'\
b'\x00\x3f\xf0\x3f\xf0\x30\x00\x30\x00\x30\x00\x30\x00\x30\x00\x3f'\
b'\xf8\x3f\xf8\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0d\x00\x00'\
b'\x00\x3f\xf0\x30\x00\x30\x00\x30\x00\x30\x00\x30\x00\x3f\xe0\x3f'\
b'\xe0\x30\x00\x30\x00\x30\x00\x30\x00\x30\x00\x30\x00\x30\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x10\x00\x01\x80\x0f\xf0\x1c'\
b'\x38\x38\x0c\x30\x0c\x60\x00\x60\x00\x60\x00\x60\xfe\x60\xfe\x60'\
b'\x06\x60\x06\x30\x06\x38\x0e\x1e\x3e\x0f\xe2\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x0f\x00\x00\x00\x30\x0c\x30\x0c\x30\x0c\x30'\
b'\x0c\x30\x0c\x30\x0c\x3f\xfc\x3f\xfc\x30\x0c\x30\x0c\x30\x0c\x30'\
b'\x0c\x30\x0c\x30\x0c\x30\x0c\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x06\x00\x00\x30\x30\x30\x30\x30\x30\x30\x30\x30\x30\x30\x30'\
b'\x30\x30\x30\x00\x00\x00\x00\x00\x0b\x00\x00\x00\x01\x80\x01\x80'\
b'\x01\x80\x01\x80\x01\x80\x01\x80\x01\x80\x01\x80\x01\x80\x01\x80'\
b'\xc1\x80\xc1\x80\xe1\x80\x63\x00\x3f\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x0e\x00\x00\x00\x30\x38\x30\x70\x30\xe0\x31\xc0'\
b'\x33\x80\x33\x00\x37\x00\x3f\x80\x39\x80\x30\xc0\x30\xe0\x30\x60'\
b'\x30\x30\x30\x38\x30\x18\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x0c\x00\x00\x00\x30\x00\x30\x00\x30\x00\x30\x00\x30\x00\x30\x00'\
b'\x30\x00\x30\x00\x30\x00\x30\x00\x30\x00\x30\x00\x30\x00\x3f\xe0'\
b'\x3f\xe0\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x12\x00\x00\x00'\
b'\x00\x38\x07\x00\x38\x07\x00\x28\x0f\x00\x2c\x0f\x00\x2c\x0b\x00'\
b'\x24\x1b\x00\x26\x1b\x00\x26\x13\x00\x22\x33\x00\x23\x33\x00\x23'\
b'\x23\x00\x21\x63\x00\x21\xe3\x00\x21\xc3\x00\x20\xc3\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0f\x00\x00'\
b'\x00\x30\x0c\x38\x0c\x3c\x0c\x2c\x0c\x26\x0c\x26\x0c\x23\x0c\x21'\
b'\x8c\x21\x8c\x20\xcc\x20\xec\x20\x6c\x20\x3c\x20\x3c\x20\x1c\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x10\x00\x01\x80\x0f\xf0\x1c'\
b'\x38\x38\x0c\x30\x06\x60\x06\x60\x06\x60\x03\x60\x03\x60\x03\x60'\
b'\x06\x60\x06\x30\x06\x38\x0c\x1c\x38\x0f\xf0\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x0e\x00\x00\x00\x3f\xe0\x30\x70\x30\x38\x30'\
b'\x18\x30\x18\x30\x18\x30\x70\x3f\xf0\x3f\x80\x30\x00\x30\x00\x30'\
b'\x00\x30\x00\x30\x00\x30\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x10\x00\x01\x80\x0f\xf0\x1c\x38\x38\x0c\x30\x06\x60\x06\x60'\
b'\x06\x60\x03\x60\x03\x60\x03\x60\x06\x60\x06\x30\x66\x38\x3c\x1c'\
b'\x3c\x0f\xfe\x00\x02\x00\x00\x00\x00\x00\x00\x00\x00\x0f\x00\x00'\
b'\x00\x3f\xf0\x30\x38\x30\x1c\x30\x0c\x30\x0c\x30\x18\x30\x38\x3f'\
b'\xe0\x30\x38\x30\x18\x30\x18\x30\x18\x30\x18\x30\x0c\x30\x0c\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0e\x00\x03\x00\x1f\xe0\x38'\
b'\x70\x30\x30\x60\x10\x30\x00\x38\x00\x3f\x00\x0f\xe0\x00\xf0\x00'\
b'\x38\x60\x18\x60\x18\x70\x18\x38\x70\x1f\xe0\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x0d\x00\x00\x00\xff\xf0\x06\x00\x06\x00\x06'\
b'\x00\x06\x00\x06\x00\x06\x00\x06\x00\x06\x00\x06\x00\x06\x00\x06'\
b'\x00\x06\x00\x06\x00\x06\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x0f\x00\x00\x00\x30\x0c\x30\x0c\x30\x0c\x30\x0c\x30\x0c\x30'\
b'\x0c\x30\x0c\x30\x0c\x30\x0c\x30\x0c\x30\x0c\x30\x18\x30\x18\x1c'\
b'\x78\x0f\xe0\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0e\x00\x00'\
b'\x00\x60\x18\x60\x18\x30\x18\x30\x30\x30\x30\x18\x30\x18\x60\x18'\
b'\x60\x0c\x40\x0c\xc0\x04\xc0\x06\x80\x07\x80\x03\x80\x03\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x14\x00\x00\x00\x00\x60\x60'\
b'\x60\x60\xf0\x60\x60\xf0\x60\x70\xf0\xe0\x30\x90\xc0\x31\x98\xc0'\
b'\x31\x98\xc0\x31\x98\xc0\x19\x09\x80\x1b\x0d\x80\x1b\x0d\x80\x1a'\
b'\x05\x80\x0e\x07\x00\x0e\x07\x00\x0e\x07\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0e\x00\x00\x00\x70\x18'\
b'\x30\x30\x18\x60\x1c\x60\x0c\xc0\x07\x80\x07\x80\x03\x00\x07\x80'\
b'\x0c\xc0\x0c\xe0\x18\x60\x30\x30\x30\x38\x60\x18\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x0e\x00\x00\x00\x60\x18\x70\x38\x30\x30'\
b'\x18\x70\x1c\x60\x0c\xc0\x06\xc0\x07\x80\x03\x00\x03\x00\x03\x00'\
b'\x03\x00\x03\x00\x03\x00\x03\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x0d\x00\x00\x00\x7f\xf0\x00\x30\x00\x60\x00\xe0\x01\xc0'\
b'\x01\x80\x03\x00\x07\x00\x0e\x00\x0c\x00\x18\x00\x30\x00\x70\x00'\
b'\x7f\xf0\x7f\xf0\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x06\x00'\
b'\x00\x78\x60\x60\x60\x60\x60\x60\x60\x60\x60\x60\x60\x60\x60\x60'\
b'\x60\x60\x60\x78\x00\x06\x00\x00\x80\xc0\x40\x40\x60\x20\x20\x20'\
b'\x10\x10\x10\x08\x08\x08\x04\x00\x00\x00\x00\x00\x06\x00\x00\xf0'\
b'\x10\x10\x10\x10\x10\x10\x10\x10\x10\x10\x10\x10\x10\x10\x10\x10'\
b'\x10\xf0\x00\x0a\x00\x00\x00\x0c\x00\x0c\x00\x1e\x00\x12\x00\x32'\
b'\x00\x23\x00\x21\x00\x61\x80\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0c'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\xff\xf0\x00\x00\x00\x00\x00\x00\x00\x00\x07\x00\x60\x30\x10'\
b'\x08\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x0c\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x1f\x80'\
b'\x31\xc0\x60\xc0\x00\xc0\x01\xc0\x3f\xc0\x70\xc0\x60\xc0\x60\xc0'\
b'\x61\xc0\x3e\xe0\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0c\x00'\
b'\x00\x00\x60\x00\x60\x00\x60\x00\x60\x00\x6f\x80\x79\xc0\x70\xc0'\
b'\x60\x60\x60\x60\x60\x60\x60\x60\x60\x60\x70\xc0\x79\xc0\x7f\x80'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0b\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x1f\x00\x31\x80\x60\xc0\x60\xc0\x60\x00'\
b'\x40\x00\x60\x00\x60\xc0\x60\xc0\x31\x80\x1f\x80\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x0c\x00\x00\x00\x00\x40\x00\x40\x00\x40'\
b'\x00\x40\x1f\x40\x39\xc0\x60\xc0\x60\xc0\x40\x40\x40\x40\x40\x40'\
b'\x60\xc0\x60\xc0\x31\xc0\x3f\x40\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x0c\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x1f\x80'\
b'\x39\xc0\x60\xc0\x60\x60\x60\x60\x7f\xe0\x60\x00\x60\x00\x60\xc0'\
b'\x31\xc0\x1f\x80\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x06\x00'\
b'\x00\x38\x30\x30\x30\xf8\x30\x30\x30\x30\x30\x30\x30\x30\x30\x30'\
b'\x00\x00\x00\x00\x00\x0c\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x1f\x40\x31\xc0\x60\xc0\x60\xc0\x60\xc0\x40\xc0\x40\xc0\x60'\
b'\xc0\x60\xc0\x31\xc0\x3f\xc0\x00\xc0\x60\xc0\x61\xc0\x3f\x80\x0e'\
b'\x00\x0c\x00\x00\x00\x60\x00\x60\x00\x60\x00\x60\x00\x6f\x80\x79'\
b'\xc0\x70\xc0\x60\xc0\x60\xc0\x60\xc0\x60\xc0\x60\xc0\x60\xc0\x60'\
b'\xc0\x60\xc0\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x05\x00\x00'\
b'\x60\x60\x00\x00\x60\x60\x60\x60\x60\x60\x60\x60\x60\x60\x60\x00'\
b'\x00\x00\x00\x00\x05\x00\x00\x60\x60\x00\x00\x60\x60\x60\x60\x60'\
b'\x60\x60\x60\x60\x60\x60\x60\x60\x60\xe0\x80\x0b\x00\x00\x00\x60'\
b'\x00\x60\x00\x60\x00\x60\x00\x61\x80\x63\x00\x66\x00\x6c\x00\x7c'\
b'\x00\x76\x00\x63\x00\x63\x00\x61\x80\x61\xc0\x60\xc0\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x05\x00\x00\x60\x60\x60\x60\x60\x60'\
b'\x60\x60\x60\x60\x60\x60\x60\x60\x60\x00\x00\x00\x00\x00\x12\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x6f'\
b'\xbe\x00\x79\xe7\x00\x70\xc3\x00\x60\xc3\x00\x60\xc3\x00\x60\xc3'\
b'\x00\x60\xc3\x00\x60\xc3\x00\x60\xc3\x00\x60\xc3\x00\x60\xc3\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0c'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x6f\x80\x79\xc0\x70'\
b'\xc0\x60\xc0\x60\xc0\x60\xc0\x60\xc0\x60\xc0\x60\xc0\x60\xc0\x60'\
b'\xc0\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0c\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x1f\x80\x39\xc0\x60\xc0\x60\x40\x60'\
b'\x60\x60\x60\x60\x60\x60\x60\x60\xc0\x31\xc0\x1f\x80\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x0c\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x6f\x80\x79\xc0\x70\xc0\x60\x60\x60\x60\x60\x60\x60'\
b'\x60\x60\x60\x70\xe0\x79\xc0\x6f\x80\x60\x00\x60\x00\x60\x00\x60'\
b'\x00\x60\x00\x0c\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x1f'\
b'\x40\x39\xc0\x60\xc0\x60\xc0\x40\x40\x40\x40\x40\x40\x60\xc0\x60'\
b'\xc0\x71\xc0\x3f\x40\x00\x40\x00\x40\x00\x40\x00\x40\x00\x40\x07'\
b'\x00\x00\x00\x00\x00\x00\x6e\x7e\x70\x60\x60\x60\x60\x60\x60\x60'\
b'\x60\x00\x00\x00\x00\x00\x0b\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x3f\x00\x73\x80\x61\x80\x60\x00\x78\x00\x3f\x00\x03\x80'\
b'\x00\xc0\x60\xc0\x71\x80\x3f\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x06\x00\x00\x00\x30\x30\x30\xf8\x30\x30\x30\x30\x30\x30'\
b'\x30\x30\x30\x38\x00\x00\x00\x00\x00\x0c\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x60\xc0\x60\xc0\x60\xc0\x60\xc0\x60\xc0\x60'\
b'\xc0\x60\xc0\x60\xc0\x60\xc0\x31\xc0\x3f\x40\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x0b\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\xc0\xc0\x60\xc0\x61\x80\x61\x80\x31\x00\x33\x00\x33\x00\x1a'\
b'\x00\x1e\x00\x0e\x00\x0c\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x0f\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\xc3\x86\x43'\
b'\x84\x63\x8c\x62\x8c\x66\xcc\x36\xd8\x34\xd8\x34\x58\x1c\x70\x1c'\
b'\x70\x18\x30\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0b\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x60\x80\x31\x80\x33\x00\x1a'\
b'\x00\x0e\x00\x0c\x00\x1e\x00\x1b\x00\x33\x00\x61\x80\x60\xc0\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0b\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x40\xc0\x60\x80\x61\x80\x21\x80\x31\x00\x33'\
b'\x00\x13\x00\x1e\x00\x1e\x00\x0e\x00\x0c\x00\x0c\x00\x08\x00\x18'\
b'\x00\x78\x00\x20\x00\x0b\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x7f\x80\x7f\x80\x03\x80\x03\x00\x06\x00\x0c\x00\x18\x00\x30'\
b'\x00\x70\x00\x7f\xc0\x7f\xc0\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x07\x00\x00\x1c\x10\x10\x10\x10\x10\x10\x30\x30\x60\x30\x30'\
b'\x10\x10\x10\x10\x10\x10\x1c\x00\x05\x00\x00\x20\x20\x20\x20\x20'\
b'\x20\x20\x20\x20\x20\x20\x20\x20\x20\x20\x20\x20\x20\x20\x00\x07'\
b'\x00\x00\x60\x30\x30\x30\x30\x30\x30\x30\x18\x0c\x18\x30\x30\x30'\
b'\x30\x30\x30\x30\x60\x00\x0c\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x3c\x20\x26\x60\x23\xc0\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x0c\x00\x00\x00\x1f\x80\x39\xc0\x70\xc0\x60\x60\x60\x60'\
b'\x60\x00\x30\x00\x7f\x00\x18\x00\x18\x00\x18\x00\x18\x00\x30\x00'\
b'\x7f\x60\x7f\xe0\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0c\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x7f\xe0\x7f\xe0\x00\x20\x00\x20\x00\x20\x00\x20\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0d\x00\x00\x00\x00\x00'\
b'\x0f\x80\x18\x80\x10\xc0\x18\x80\x09\x80\x07\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x10\x00\x00\x00\x07\xf0\x1c\x38\x38\x0c'\
b'\x30\x0e\x60\x06\x60\x06\x60\x06\x60\x06\x60\x06\x20\x06\x30\x0c'\
b'\x10\x0c\x18\x18\x7e\x7e\x7e\x7e\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x0d\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x1f\x60'\
b'\x3b\xe0\x30\xe0\x60\x60\x60\x60\x60\x60\x60\x60\x60\x60\x60\xe0'\
b'\x39\xe0\x1f\x70\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0b\x00'\
b'\x00\x00\x3f\x00\x31\x80\x60\x80\x60\x80\x60\x80\x61\x80\x6f\x00'\
b'\x6f\x80\x60\xc0\x60\xc0\x60\x60\x60\x60\x60\xc0\x71\xc0\x7f\x80'\
b'\x60\x00\x60\x00\x60\x00\x60\x00\x00\x00\x0b\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x60\x60\x30\x40\x30\xc0\x30\xc0\x19\x80'\
b'\x19\x80\x0d\x00\x0f\x00\x07\x00\x06\x00\x06\x00\x06\x00\x06\x00'\
b'\x06\x00\x06\x00\x00\x00\x0c\x00\x00\x00\x3f\xc0\x38\x00\x1c\x00'\
b'\x0e\x00\x03\x00\x3f\xc0\x30\xc0\x60\x60\x60\x60\x60\x60\x60\x60'\
b'\x60\x60\x60\x60\x39\xc0\x1f\x80\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x0b\x00\x00\x00\x1f\x00\x31\x80\x20\x80\x60\xc0\x60\xc0'\
b'\x60\xc0\x60\xc0\x7f\xc0\x60\xc0\x60\xc0\x60\xc0\x60\xc0\x20\xc0'\
b'\x31\x80\x1f\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0c\x00'\
b'\x00\x00\x70\x00\x58\x00\x0c\x00\x0c\x00\x0c\x00\x0e\x00\x0e\x00'\
b'\x1b\x00\x1b\x00\x31\x00\x31\x80\x31\x80\x60\x80\x60\xe0\x60\xe0'\
b'\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x0b\x00\x00\x00\x00\x00'\
b'\x00\x00\x00\x00\x00\x00\x60\xc0\x60\xc0\x60\xc0\x60\xc0\x60\xc0'\
b'\x60\xc0\x60\xc0\x60\xc0\x70\xc0\x7b\xc0\x6f\xc0\x60\x00\x60\x00'\
b'\x60\x00\x60\x00\x00\x00\x0d\x00\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x7f\xf0\x30\x60\x30\x60\x30\x60\x30\x60\x30\x60\x30\x60'\
b'\x30\x60\x30\x60\x30\x60\x30\x70\x00\x00\x00\x00\x00\x00\x00\x00'\
b'\x00\x00\x10\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x18\x18'\
b'\x30\x0c\x60\x0c\x61\x84\x61\x86\x61\x86\x61\x86\x61\x86\x61\x84'\
b'\x33\xcc\x1e\x78\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x10\x00'\
b'\x00\x00\x01\x80\x01\x80\x01\x80\x01\x80\x0f\xf0\x1f\xf8\x31\x8c'\
b'\x61\x8c\x61\x86\x61\x86\x61\x86\x21\x8c\x31\x8c\x1f\xf8\x0f\xf0'\
b'\x01\x80\x01\x80\x01\x80\x01\x80\x00\x00'
_sparse =\
b'\x20\x00\x2c\x00\x21\x00\x43\x00\x22\x00\x5a\x00\x23\x00\x71\x00'\
b'\x24\x00\x9d\x00\x25\x00\xc9\x00\x26\x00\x0a\x01\x27\x00\x36\x01'\
b'\x28\x00\x4d\x01\x29\x00\x64\x01\x2a\x00\x7b\x01\x2b\x00\x92\x01'\
b'\x2c\x00\xbe\x01\x2d\x00\xd5\x01\x2e\x00\xec\x01\x2f\x00\x03\x02'\
b'\x30\x00\x1a\x02\x31\x00\x46\x02\x32\x00\x72\x02\x33\x00\x9e\x02'\
b'\x34\x00\xca\x02\x35\x00\xf6\x02\x36\x00\x22\x03\x37\x00\x4e\x03'\
b'\x38\x00\x7a\x03\x39\x00\xa6\x03\x3a\x00\xd2\x03\x3b\x00\xe9\x03'\
b'\x3c\x00\x00\x04\x3d\x00\x2c\x04\x3e\x00\x58\x04\x3f\x00\x84\x04'\
b'\x40\x00\xb0\x04\x41\x00\xf1\x04\x42\x00\x1d\x05\x43\x00\x49\x05'\
b'\x44\x00\x75\x05\x45\x00\xa1\x05\x46\x00\xcd\x05\x47\x00\xf9\x05'\
b'\x48\x00\x25\x06\x49\x00\x51\x06\x4a\x00\x68\x06\x4b\x00\x94\x06'\
b'\x4c\x00\xc0\x06\x4d\x00\xec\x06\x4e\x00\x2d\x07\x4f\x00\x59\x07'\
b'\x50\x00\x85\x07\x51\x00\xb1\x07\x52\x00\xdd\x07\x53\x00\x09\x08'\
b'\x54\x00\x35\x08\x55\x00\x61\x08\x56\x00\x8d\x08\x57\x00\xb9\x08'\
b'\x58\x00\xfa\x08\x59\x00\x26\x09\x5a\x00\x52\x09\x5b\x00\x7e\x09'\
b'\x5c\x00\x95\x09\x5d\x00\xac\x09\x5e\x00\xc3\x09\x5f\x00\xef\x09'\
b'\x60\x00\x1b\x0a\x61\x00\x32\x0a\x62\x00\x5e\x0a\x63\x00\x8a\x0a'\
b'\x64\x00\xb6\x0a\x65\x00\xe2\x0a\x66\x00\x0e\x0b\x67\x00\x25\x0b'\
b'\x68\x00\x51\x0b\x69\x00\x7d\x0b\x6a\x00\x94\x0b\x6b\x00\xab\x0b'\
b'\x6c\x00\xd7\x0b\x6d\x00\xee\x0b\x6e\x00\x2f\x0c\x6f\x00\x5b\x0c'\
b'\x70\x00\x87\x0c\x71\x00\xb3\x0c\x72\x00\xdf\x0c\x73\x00\xf6\x0c'\
b'\x74\x00\x22\x0d\x75\x00\x39\x0d\x76\x00\x65\x0d\x77\x00\x91\x0d'\
b'\x78\x00\xbd\x0d\x79\x00\xe9\x0d\x7a\x00\x15\x0e\x7b\x00\x41\x0e'\
b'\x7c\x00\x58\x0e\x7d\x00\x6f\x0e\x7e\x00\x86\x0e\xa3\x00\xb2\x0e'\
b'\xac\x00\xde\x0e\xb0\x00\x0a\x0f\xa9\x03\x36\x0f\xb1\x03\x62\x0f'\
b'\xb2\x03\x8e\x0f\xb3\x03\xba\x0f\xb4\x03\xe6\x0f\xb8\x03\x12\x10'\
b'\xbb\x03\x3e\x10\xbc\x03\x6a\x10\xc0\x03\x96\x10\xc9\x03\xc2\x10'\
b'\xd5\x03\xee\x10'
_mvfont = memoryview(_font)
_mvsp = memoryview(_sparse)
ifb = lambda l : l[0] | (l[1] << 8)
def bs(lst, val):
while True:
m = (len(lst) & ~ 7) >> 1
v = ifb(lst[m:])
if v == val:
return ifb(lst[m + 2:])
if not m:
return 0
lst = lst[m:] if v < val else lst[:m]
def get_ch(ch):
doff = bs(_mvsp, ord(ch))
width = ifb(_mvfont[doff : ])
next_offs = doff + 2 + ((width - 1)//8 + 1) * 21
return _mvfont[doff + 2:next_offs], 21, width
| 61.268908
| 145
| 0.703881
| 5,277
| 21,873
| 2.914345
| 0.051734
| 0.52045
| 0.623838
| 0.669484
| 0.659926
| 0.620587
| 0.580597
| 0.537421
| 0.50647
| 0.467326
| 0
| 0.409298
| 0.026425
| 21,873
| 356
| 146
| 61.441011
| 0.312749
| 0.013578
| 0
| 0.056213
| 1
| 0.887574
| 0.892865
| 0.891938
| 0
| 1
| 0
| 0
| 0
| 1
| 0.029586
| false
| 0
| 0
| 0.023669
| 0.06213
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 1
| 1
| 1
| 1
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 10
|
f9bee0df9082d0cdfe4c2f1d0580dc9ec3dcdfb8
| 141,891
|
py
|
Python
|
python/onshape_client/oas/api/part_studios_api.py
|
toebes/onshape-clients
|
a26cf6a77cfc7901321e603d5a097e23eb51e35c
|
[
"MIT"
] | 14
|
2019-06-23T08:47:41.000Z
|
2021-11-29T16:28:45.000Z
|
python/onshape_client/oas/api/part_studios_api.py
|
toebes/onshape-clients
|
a26cf6a77cfc7901321e603d5a097e23eb51e35c
|
[
"MIT"
] | 40
|
2019-05-22T14:39:46.000Z
|
2022-03-10T10:36:17.000Z
|
python/onshape_client/oas/api/part_studios_api.py
|
toebes/onshape-clients
|
a26cf6a77cfc7901321e603d5a097e23eb51e35c
|
[
"MIT"
] | 24
|
2019-06-02T01:03:41.000Z
|
2022-03-29T13:25:36.000Z
|
# coding: utf-8
"""
Onshape REST API
The Onshape REST API consumed by all clients. # noqa: E501
The version of the OpenAPI document: 1.113
Contact: api-support@onshape.zendesk.com
Generated by: https://openapi-generator.tech
"""
from __future__ import absolute_import
import re # noqa: F401
import sys # noqa: F401
# python 2 and python 3 compatibility library
import six
from onshape_client.oas.api_client import ApiClient
from onshape_client.oas.exceptions import ApiTypeError, ApiValueError
from onshape_client.oas.model_utils import ( # noqa: F401
check_allowed_values,
check_validations,
date,
datetime,
file_type,
int,
none_type,
str,
validate_and_convert_types,
)
from onshape_client.oas.models import bt_feature_definition_response1617
from onshape_client.oas.models import bt_feature_definition_call1406
from onshape_client.oas.models import bt_root_diff_info
from onshape_client.oas.models import bt_model_element_params
from onshape_client.oas.models import bt_document_element_info
from onshape_client.oas.models import bt_translation_request_info
from onshape_client.oas.models import bt_translate_format_params
from onshape_client.oas.models import bt_feature_api_base1430
from onshape_client.oas.models import bt_feature_script_eval_response1859
from onshape_client.oas.models import bt_feature_script_eval_call2377
from onshape_client.oas.models import bt_export_model_bodies_response734
from onshape_client.oas.models import bt_bounding_box_info
from onshape_client.oas.models import bt_feature_specs_response664
from onshape_client.oas.models import bt_feature_list_response2457
from onshape_client.oas.models import bt_mass_properties_bulk_info
from onshape_client.oas.models import bt_named_views_info
from onshape_client.oas.models import bt_shaded_views_info
from onshape_client.oas.models import bt_export_tessellated_edges_response327
from onshape_client.oas.models import bt_export_tessellated_faces_response898
from onshape_client.oas.models import bt_id_translation_params
from onshape_client.oas.models import bt_id_translation_info
from onshape_client.oas.models import bt_update_features_response1333
from onshape_client.oas.models import bt_configuration_response2019
from onshape_client.oas.models import bt_set_feature_rollback_response1042
class PartStudiosApi(object):
"""NOTE: This class is auto generated by OpenAPI Generator
Ref: https://openapi-generator.tech
Do not edit the class manually.
"""
def __init__(self, api_client=None):
if api_client is None:
api_client = ApiClient()
self.api_client = api_client
def __add_part_studio_feature(self, did, wvm, wvmid, eid, **kwargs):
"""Add Feature # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.add_part_studio_feature(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str):
wvm (str):
wvmid (str):
eid (str):
Keyword Args:
bt_feature_definition_call_1406 (bt_feature_definition_call1406.BTFeatureDefinitionCall1406): feature The serialized feature definition. [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_feature_definition_response1617.BTFeatureDefinitionResponse1617
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.add_part_studio_feature = Endpoint(
settings={
"response_type": (
bt_feature_definition_response1617.BTFeatureDefinitionResponse1617,
),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/features",
"operation_id": "add_part_studio_feature",
"http_method": "POST",
"servers": [],
},
params_map={
"all": [
"did",
"wvm",
"wvmid",
"eid",
"bt_feature_definition_call_1406",
],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"bt_feature_definition_call_1406": (
bt_feature_definition_call1406.BTFeatureDefinitionCall1406,
),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"bt_feature_definition_call_1406": "body",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/vnd.onshape.v2+json;charset=UTF-8;qs=0.2"],
"content_type": [
"application/vnd.onshape.v2+json;charset=UTF-8;qs=0.2"
],
},
api_client=api_client,
callable=__add_part_studio_feature,
)
def __compare_part_studios(self, did, wvm, wvmid, eid, **kwargs):
"""Compare Part Studios # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.compare_part_studios(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wvm (str): One of w or v or m corresponding to whether a workspace or version or microversion was entered.
wvmid (str): Workspace (w), Version (v) or Microversion (m) ID.
eid (str): Element ID.
Keyword Args:
workspace_id (str): [optional]
version_id (str): [optional]
microversion_id (str): [optional]
source_configuration (str): [optional]
target_configuration (str): [optional]
link_document_id (str): [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_root_diff_info.BTRootDiffInfo
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.compare_part_studios = Endpoint(
settings={
"response_type": (bt_root_diff_info.BTRootDiffInfo,),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/compare",
"operation_id": "compare_part_studios",
"http_method": "GET",
"servers": [],
},
params_map={
"all": [
"did",
"wvm",
"wvmid",
"eid",
"workspace_id",
"version_id",
"microversion_id",
"source_configuration",
"target_configuration",
"link_document_id",
],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"workspace_id": (str,),
"version_id": (str,),
"microversion_id": (str,),
"source_configuration": (str,),
"target_configuration": (str,),
"link_document_id": (str,),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
"workspace_id": "workspaceId",
"version_id": "versionId",
"microversion_id": "microversionId",
"source_configuration": "sourceConfiguration",
"target_configuration": "targetConfiguration",
"link_document_id": "linkDocumentId",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"workspace_id": "query",
"version_id": "query",
"microversion_id": "query",
"source_configuration": "query",
"target_configuration": "query",
"link_document_id": "query",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": [],
},
api_client=api_client,
callable=__compare_part_studios,
)
def __create_part_studio(self, did, wid, bt_model_element_params, **kwargs):
"""Create Part Studio # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.create_part_studio(did, wid, bt_model_element_params, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wid (str): Workspace ID.
bt_model_element_params (bt_model_element_params.BTModelElementParams):
Keyword Args:
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_document_element_info.BTDocumentElementInfo
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wid"] = wid
kwargs["bt_model_element_params"] = bt_model_element_params
return self.call_with_http_info(**kwargs)
self.create_part_studio = Endpoint(
settings={
"response_type": (bt_document_element_info.BTDocumentElementInfo,),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/w/{wid}",
"operation_id": "create_part_studio",
"http_method": "POST",
"servers": [],
},
params_map={
"all": ["did", "wid", "bt_model_element_params",],
"required": ["did", "wid", "bt_model_element_params",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wid": (str,),
"bt_model_element_params": (
bt_model_element_params.BTModelElementParams,
),
},
"attribute_map": {"did": "did", "wid": "wid",},
"location_map": {
"did": "path",
"wid": "path",
"bt_model_element_params": "body",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": ["application/json;charset=UTF-8; qs=0.09"],
},
api_client=api_client,
callable=__create_part_studio,
)
def __create_part_studio_translation(
self, did, wv, wvid, eid, bt_translate_format_params, **kwargs
):
"""Create Part Studio translation # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.create_part_studio_translation(did, wv, wvid, eid, bt_translate_format_params, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wv (str): One of w or v corresponding to whether a workspace or version was specified.
wvid (str): Workspace (w) or Version (v) ID.
eid (str): Element ID.
bt_translate_format_params (bt_translate_format_params.BTTranslateFormatParams):
Keyword Args:
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_translation_request_info.BTTranslationRequestInfo
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wv"] = wv
kwargs["wvid"] = wvid
kwargs["eid"] = eid
kwargs["bt_translate_format_params"] = bt_translate_format_params
return self.call_with_http_info(**kwargs)
self.create_part_studio_translation = Endpoint(
settings={
"response_type": (
bt_translation_request_info.BTTranslationRequestInfo,
),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wv}/{wvid}/e/{eid}/translations",
"operation_id": "create_part_studio_translation",
"http_method": "POST",
"servers": [],
},
params_map={
"all": ["did", "wv", "wvid", "eid", "bt_translate_format_params",],
"required": ["did", "wv", "wvid", "eid", "bt_translate_format_params",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wv": (str,),
"wvid": (str,),
"eid": (str,),
"bt_translate_format_params": (
bt_translate_format_params.BTTranslateFormatParams,
),
},
"attribute_map": {
"did": "did",
"wv": "wv",
"wvid": "wvid",
"eid": "eid",
},
"location_map": {
"did": "path",
"wv": "path",
"wvid": "path",
"eid": "path",
"bt_translate_format_params": "body",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": ["application/json;charset=UTF-8; qs=0.09"],
},
api_client=api_client,
callable=__create_part_studio_translation,
)
def __delete_part_studio_feature(self, did, wid, eid, fid, **kwargs):
"""Delete Feature # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.delete_part_studio_feature(did, wid, eid, fid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wid (str): Workspace ID.
eid (str): Element ID.
fid (str): The id of the feature being updated. This id should be URL encoded and must match the featureId found in the serialized structure
Keyword Args:
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_feature_api_base1430.BTFeatureApiBase1430
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wid"] = wid
kwargs["eid"] = eid
kwargs["fid"] = fid
return self.call_with_http_info(**kwargs)
self.delete_part_studio_feature = Endpoint(
settings={
"response_type": (bt_feature_api_base1430.BTFeatureApiBase1430,),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/w/{wid}/e/{eid}/features/featureid/{fid}",
"operation_id": "delete_part_studio_feature",
"http_method": "DELETE",
"servers": [],
},
params_map={
"all": ["did", "wid", "eid", "fid",],
"required": ["did", "wid", "eid", "fid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wid": (str,),
"eid": (str,),
"fid": (str,),
},
"attribute_map": {
"did": "did",
"wid": "wid",
"eid": "eid",
"fid": "fid",
},
"location_map": {
"did": "path",
"wid": "path",
"eid": "path",
"fid": "path",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": [],
},
api_client=api_client,
callable=__delete_part_studio_feature,
)
def __eval_feature_script(self, did, wvm, wvmid, eid, **kwargs):
"""Evaluate FeatureScript # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.eval_feature_script(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wvm (str): One of w or v or m corresponding to whether a workspace or version or microversion was entered.
wvmid (str): Workspace (w), Version (v) or Microversion (m) ID.
eid (str): Element ID.
Keyword Args:
configuration (str): Configuration string.. [optional]
bt_feature_script_eval_call_2377 (bt_feature_script_eval_call2377.BTFeatureScriptEvalCall2377): [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_feature_script_eval_response1859.BTFeatureScriptEvalResponse1859
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.eval_feature_script = Endpoint(
settings={
"response_type": (
bt_feature_script_eval_response1859.BTFeatureScriptEvalResponse1859,
),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/featurescript",
"operation_id": "eval_feature_script",
"http_method": "POST",
"servers": [],
},
params_map={
"all": [
"did",
"wvm",
"wvmid",
"eid",
"configuration",
"bt_feature_script_eval_call_2377",
],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"configuration": (str,),
"bt_feature_script_eval_call_2377": (
bt_feature_script_eval_call2377.BTFeatureScriptEvalCall2377,
),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
"configuration": "configuration",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"configuration": "query",
"bt_feature_script_eval_call_2377": "body",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": ["application/json;charset=UTF-8; qs=0.09"],
},
api_client=api_client,
callable=__eval_feature_script,
)
def __export_ps1(self, did, wvm, wvmid, eid, **kwargs):
"""Export Part Studio to Parasolid # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.export_ps1(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wvm (str): One of w or v or m corresponding to whether a workspace or version or microversion was entered.
wvmid (str): Workspace (w), Version (v) or Microversion (m) ID.
eid (str): Element ID.
Keyword Args:
part_ids (str): IDs of the parts to retrieve. Repeat query param to add more than one (i.e. partId=JHK&partId=JHD). May not be combined with other ID filters. [optional]
version (str): Parasolid version. [optional] if omitted the server will use the default value of '0'
include_export_ids (bool): Whether topolgy ids should be exported as parasolid attributes. [optional] if omitted the server will use the default value of False
configuration (str): Configuration string.. [optional]
link_document_id (str): Id of document that links to the document being accessed. This may provide additional access rights to the document. Allowed only with version (v) path parameter.. [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
None
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.export_ps1 = Endpoint(
settings={
"response_type": None,
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/parasolid",
"operation_id": "export_ps1",
"http_method": "GET",
"servers": [],
},
params_map={
"all": [
"did",
"wvm",
"wvmid",
"eid",
"part_ids",
"version",
"include_export_ids",
"configuration",
"link_document_id",
],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"part_ids": (str,),
"version": (str,),
"include_export_ids": (bool,),
"configuration": (str,),
"link_document_id": (str,),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
"part_ids": "partIds",
"version": "version",
"include_export_ids": "includeExportIds",
"configuration": "configuration",
"link_document_id": "linkDocumentId",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"part_ids": "query",
"version": "query",
"include_export_ids": "query",
"configuration": "query",
"link_document_id": "query",
},
"collection_format_map": {},
},
headers_map={"accept": [], "content_type": [],},
api_client=api_client,
callable=__export_ps1,
)
def __export_stl1(self, did, wvm, wvmid, eid, **kwargs):
"""Export Part Studio to STL # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.export_stl1(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wvm (str): One of w or v or m corresponding to whether a workspace or version or microversion was entered.
wvmid (str): Workspace (w), Version (v) or Microversion (m) ID.
eid (str): Element ID.
Keyword Args:
part_ids (str): IDs of the parts to retrieve. Repeat query param to add more than one (i.e. partId=JHK&partId=JHD). May not be combined with other ID filters. [optional]
mode (str): Type of file: text, binary. [optional] if omitted the server will use the default value of 'text'
grouping (bool): Whether parts should be exported as a group or individually in a .zip file. [optional] if omitted the server will use the default value of True
scale (float): Scale for measurements.. [optional] if omitted the server will use the default value of 1.0
units (str): Name of base unit (meter, centimeter, millimeter, inch, foot, or yard). [optional] if omitted the server will use the default value of 'inch'
angle_tolerance (float): Angle tolerance (in radians). This specifies the limit on the sum of the angular deviations of a tessellation chord from the tangent vectors at two chord endpoints. The specified value must be less than PI/2. This parameter currently has a default value chosen based on the complexity of the parts being tessellated.. [optional]
chord_tolerance (float): Chord tolerance (in meters). This specifies the limit on the maximum deviation of a tessellation chord from the true surface/edge. This parameter currently has a default value chosen based on the size and complexity of the parts being tessellated.. [optional]
max_facet_width (float): Max facet width. This specifies the limit on the size of any side of a tessellation facet.. [optional]
min_facet_width (float): Max facet width. This specifies the limit on the size of any side of a tessellation facet.. [optional]
configuration (str): Configuration string.. [optional]
link_document_id (str): Id of document that links to the document being accessed. This may provide additional access rights to the document. Allowed only with version (v) path parameter.. [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
None
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.export_stl1 = Endpoint(
settings={
"response_type": None,
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/stl",
"operation_id": "export_stl1",
"http_method": "GET",
"servers": [],
},
params_map={
"all": [
"did",
"wvm",
"wvmid",
"eid",
"part_ids",
"mode",
"grouping",
"scale",
"units",
"angle_tolerance",
"chord_tolerance",
"max_facet_width",
"min_facet_width",
"configuration",
"link_document_id",
],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"part_ids": (str,),
"mode": (str,),
"grouping": (bool,),
"scale": (float,),
"units": (str,),
"angle_tolerance": (float,),
"chord_tolerance": (float,),
"max_facet_width": (float,),
"min_facet_width": (float,),
"configuration": (str,),
"link_document_id": (str,),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
"part_ids": "partIds",
"mode": "mode",
"grouping": "grouping",
"scale": "scale",
"units": "units",
"angle_tolerance": "angleTolerance",
"chord_tolerance": "chordTolerance",
"max_facet_width": "maxFacetWidth",
"min_facet_width": "minFacetWidth",
"configuration": "configuration",
"link_document_id": "linkDocumentId",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"part_ids": "query",
"mode": "query",
"grouping": "query",
"scale": "query",
"units": "query",
"angle_tolerance": "query",
"chord_tolerance": "query",
"max_facet_width": "query",
"min_facet_width": "query",
"configuration": "query",
"link_document_id": "query",
},
"collection_format_map": {},
},
headers_map={"accept": [], "content_type": [],},
api_client=api_client,
callable=__export_stl1,
)
def __get_part_studio_body_details(self, did, wvm, wvmid, eid, **kwargs):
"""Array of body information # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.get_part_studio_body_details(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str):
wvm (str):
wvmid (str):
eid (str):
Keyword Args:
configuration (str): [optional]
link_document_id (str): [optional]
rollback_bar_index (int): [optional] if omitted the server will use the default value of -1
body (str): [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_export_model_bodies_response734.BTExportModelBodiesResponse734
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.get_part_studio_body_details = Endpoint(
settings={
"response_type": (
bt_export_model_bodies_response734.BTExportModelBodiesResponse734,
),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/bodydetails",
"operation_id": "get_part_studio_body_details",
"http_method": "GET",
"servers": [],
},
params_map={
"all": [
"did",
"wvm",
"wvmid",
"eid",
"configuration",
"link_document_id",
"rollback_bar_index",
"body",
],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"configuration": (str,),
"link_document_id": (str,),
"rollback_bar_index": (int,),
"body": (str,),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
"configuration": "configuration",
"link_document_id": "linkDocumentId",
"rollback_bar_index": "rollbackBarIndex",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"configuration": "query",
"link_document_id": "query",
"rollback_bar_index": "query",
"body": "body",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": ["application/json;charset=UTF-8; qs=0.09"],
},
api_client=api_client,
callable=__get_part_studio_body_details,
)
def __get_part_studio_bounding_boxes(self, did, wvm, wvmid, eid, **kwargs):
"""Mass properties of parts or a PartStudio. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.get_part_studio_bounding_boxes(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wvm (str): One of w or v or m corresponding to whether a workspace or version or microversion was entered.
wvmid (str): Workspace (w), Version (v) or Microversion (m) ID.
eid (str): Element ID.
Keyword Args:
include_hidden (bool): Whether or not to include bounding boxes for hidden parts.. [optional] if omitted the server will use the default value of False
include_wire_bodies (bool): Whether to include wire bodies in the bounding box.. [optional] if omitted the server will use the default value of True
configuration (str): Configuration string.. [optional]
link_document_id (str): Id of document that links to the document being accessed. This may provide additional access rights to the document. Allowed only with version (v) path parameter.. [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_bounding_box_info.BTBoundingBoxInfo
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.get_part_studio_bounding_boxes = Endpoint(
settings={
"response_type": (bt_bounding_box_info.BTBoundingBoxInfo,),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/boundingboxes",
"operation_id": "get_part_studio_bounding_boxes",
"http_method": "GET",
"servers": [],
},
params_map={
"all": [
"did",
"wvm",
"wvmid",
"eid",
"include_hidden",
"include_wire_bodies",
"configuration",
"link_document_id",
],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"include_hidden": (bool,),
"include_wire_bodies": (bool,),
"configuration": (str,),
"link_document_id": (str,),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
"include_hidden": "includeHidden",
"include_wire_bodies": "includeWireBodies",
"configuration": "configuration",
"link_document_id": "linkDocumentId",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"include_hidden": "query",
"include_wire_bodies": "query",
"configuration": "query",
"link_document_id": "query",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": [],
},
api_client=api_client,
callable=__get_part_studio_bounding_boxes,
)
def __get_part_studio_configuration(self, did, wvm, wvmid, eid, **kwargs):
"""Get Configuration # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.get_part_studio_configuration(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str):
wvm (str):
wvmid (str):
eid (str):
Keyword Args:
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
None
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.get_part_studio_configuration = Endpoint(
settings={
"response_type": None,
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/configuration",
"operation_id": "get_part_studio_configuration",
"http_method": "GET",
"servers": [],
},
params_map={
"all": ["did", "wvm", "wvmid", "eid",],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
},
"collection_format_map": {},
},
headers_map={"accept": [], "content_type": [],},
api_client=api_client,
callable=__get_part_studio_configuration,
)
def __get_part_studio_feature_specs(self, did, wvm, wvmid, eid, **kwargs):
"""Get Feature Specs # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.get_part_studio_feature_specs(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wvm (str): One of w or v or m corresponding to whether a workspace or version or microversion was entered.
wvmid (str): Workspace (w), Version (v) or Microversion (m) ID.
eid (str): Element ID.
Keyword Args:
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_feature_specs_response664.BTFeatureSpecsResponse664
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.get_part_studio_feature_specs = Endpoint(
settings={
"response_type": (
bt_feature_specs_response664.BTFeatureSpecsResponse664,
),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/featurespecs",
"operation_id": "get_part_studio_feature_specs",
"http_method": "GET",
"servers": [],
},
params_map={
"all": ["did", "wvm", "wvmid", "eid",],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": [],
},
api_client=api_client,
callable=__get_part_studio_feature_specs,
)
def __get_part_studio_features(self, did, wvm, wvmid, eid, **kwargs):
"""Get Feature List # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.get_part_studio_features(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wvm (str): One of w or v or m corresponding to whether a workspace or version or microversion was entered.
wvmid (str): Workspace (w), Version (v) or Microversion (m) ID.
eid (str): Element ID.
Keyword Args:
feature_id ([str]): ID of a feature; repeat query param to add more than one. [optional]
link_document_id (str): Id of document that links to the document being accessed. This may provide additional access rights to the document. Allowed only with version (v) path parameter.. [optional]
no_sketch_geometry (bool): Whether or not to output simple sketch info without geometry. [optional] if omitted the server will use the default value of False
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_feature_list_response2457.BTFeatureListResponse2457
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.get_part_studio_features = Endpoint(
settings={
"response_type": (
bt_feature_list_response2457.BTFeatureListResponse2457,
),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/features",
"operation_id": "get_part_studio_features",
"http_method": "GET",
"servers": [],
},
params_map={
"all": [
"did",
"wvm",
"wvmid",
"eid",
"feature_id",
"link_document_id",
"no_sketch_geometry",
],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"feature_id": ([str],),
"link_document_id": (str,),
"no_sketch_geometry": (bool,),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
"feature_id": "featureId",
"link_document_id": "linkDocumentId",
"no_sketch_geometry": "noSketchGeometry",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"feature_id": "query",
"link_document_id": "query",
"no_sketch_geometry": "query",
},
"collection_format_map": {"feature_id": "multi",},
},
headers_map={
"accept": ["application/vnd.onshape.v2+json;charset=UTF-8;qs=0.2"],
"content_type": [],
},
api_client=api_client,
callable=__get_part_studio_features,
)
def __get_part_studio_mass_properties(self, did, wvm, wvmid, eid, **kwargs):
"""Mass properties of parts or a PartStudio. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.get_part_studio_mass_properties(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wvm (str): One of w or v or m corresponding to whether a workspace or version or microversion was entered.
wvmid (str): Workspace (w), Version (v) or Microversion (m) ID.
eid (str): Element ID.
Keyword Args:
part_id ([str]): IDs of the parts to retrieve. Repeat query param to add more than one (i.e. partId=JHK&partId=JHD). May not be combined with other ID filters. [optional]
mass_as_group (bool): If true, specified parts will be evaluated as a single object instead of individually. [optional] if omitted the server will use the default value of True
configuration (str): Configuration string.. [optional]
link_document_id (str): Id of document that links to the document being accessed. This may provide additional access rights to the document. Allowed only with version (v) path parameter.. [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_mass_properties_bulk_info.BTMassPropertiesBulkInfo
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.get_part_studio_mass_properties = Endpoint(
settings={
"response_type": (
bt_mass_properties_bulk_info.BTMassPropertiesBulkInfo,
),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/massproperties",
"operation_id": "get_part_studio_mass_properties",
"http_method": "GET",
"servers": [],
},
params_map={
"all": [
"did",
"wvm",
"wvmid",
"eid",
"part_id",
"mass_as_group",
"configuration",
"link_document_id",
],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"part_id": ([str],),
"mass_as_group": (bool,),
"configuration": (str,),
"link_document_id": (str,),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
"part_id": "partId",
"mass_as_group": "massAsGroup",
"configuration": "configuration",
"link_document_id": "linkDocumentId",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"part_id": "query",
"mass_as_group": "query",
"configuration": "query",
"link_document_id": "query",
},
"collection_format_map": {"part_id": "multi",},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": [],
},
api_client=api_client,
callable=__get_part_studio_mass_properties,
)
def __get_part_studio_named_views(self, did, eid, **kwargs):
"""Get Named Views # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.get_part_studio_named_views(did, eid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
eid (str): Element ID.
Keyword Args:
skip_perspective (bool): Whether views with a perspective projection should be omitted.. [optional] if omitted the server will use the default value of True
include_section_cut_views (bool): [optional] if omitted the server will use the default value of False
link_document_id (str): [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_named_views_info.BTNamedViewsInfo
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.get_part_studio_named_views = Endpoint(
settings={
"response_type": (bt_named_views_info.BTNamedViewsInfo,),
"auth": [],
"endpoint_path": "/api/partstudios/d/{did}/e/{eid}/namedViews",
"operation_id": "get_part_studio_named_views",
"http_method": "GET",
"servers": [],
},
params_map={
"all": [
"did",
"eid",
"skip_perspective",
"include_section_cut_views",
"link_document_id",
],
"required": ["did", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"eid": (str,),
"skip_perspective": (bool,),
"include_section_cut_views": (bool,),
"link_document_id": (str,),
},
"attribute_map": {
"did": "did",
"eid": "eid",
"skip_perspective": "skipPerspective",
"include_section_cut_views": "includeSectionCutViews",
"link_document_id": "linkDocumentId",
},
"location_map": {
"did": "path",
"eid": "path",
"skip_perspective": "query",
"include_section_cut_views": "query",
"link_document_id": "query",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": [],
},
api_client=api_client,
callable=__get_part_studio_named_views,
)
def __get_part_studio_shaded_views(self, did, wvm, wvmid, eid, **kwargs):
"""Get Shaded Views # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.get_part_studio_shaded_views(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wvm (str): One of w or v or m corresponding to whether a workspace or version or microversion was entered.
wvmid (str): Workspace (w), Version (v) or Microversion (m) ID.
eid (str): Element ID.
Keyword Args:
view_matrix (str): 12-number view matrix (comma-separated), or one of the following named views: top, bottom, front, back, left, right The 12 entries in the view matrix form three rows and four columns, which is a linear transformation applied to the model itself. The matrix's first three columns maps the coordinate axes of the model to the coordinate axes of the view, and the fourth column translates the origin (in meters). The view coordinates have x pointing right, y pointing up, and z pointing towards the viewer, while a front view of the model has x pointing right, y pointing away from the viewer, and z pointing up. For example, the identity matrix viewMatrix=1,0,0,0,0,1,0,0,0,0,1,0 corresponds to the top view, and viewMatrix=0.612,0.612,0,0,-0.354,0.354,0.707,0,0.707,-0.707,0.707,0 corresponds (approximately) to the isometric view. The first three columns of the view matrix should be orthonormal and have a positive determinant. If this is not the case, view behavior may be undefined.. [optional] if omitted the server will use the default value of 'front'
output_height (int): Output image height (in pixels). [optional] if omitted the server will use the default value of 500
output_width (int): Output image width (in pixels). [optional] if omitted the server will use the default value of 500
pixel_size (float): Height and width represented by each pixel (in meters). If the value is 0, the display will be sized to fit the output image dimensions.. [optional] if omitted the server will use the default value of 0.003
edges (str): The treatment to be applied to edges in the display. Options are show: show visible edges, hide: hide visible edges.. [optional] if omitted the server will use the default value of 'show'
show_all_parts (bool): Whether or not all parts should be shown in the element, regardless of user setting. If false, the visibility setting made by the user will be reflected in the image. If true, all parts will be shown.. [optional] if omitted the server will use the default value of False
include_surfaces (bool): Whether or not surfaces should be shown in the element. It is applicable only when showAllParts is true. If false, surfaces will be excluded. If true, all surfaces will be shown.. [optional] if omitted the server will use the default value of False
use_anti_aliasing (bool): If true, an anti-aliasing factor will be used to smooth model boundaries in the final image result. If false, the image will be rasterized at the given resolution. Setting to true can have negative performance implications with respect to rendering time and memory usage. If a high-resolution image is requested and anti-aliasing is turned on, the server may not be able to fulfill the request.. [optional] if omitted the server will use the default value of False
configuration (str): Configuration string.. [optional]
link_document_id (str): Id of document that links to the document being accessed. This may provide additional access rights to the document. Allowed only with version (v) path parameter.. [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_shaded_views_info.BTShadedViewsInfo
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.get_part_studio_shaded_views = Endpoint(
settings={
"response_type": (bt_shaded_views_info.BTShadedViewsInfo,),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/shadedviews",
"operation_id": "get_part_studio_shaded_views",
"http_method": "GET",
"servers": [],
},
params_map={
"all": [
"did",
"wvm",
"wvmid",
"eid",
"view_matrix",
"output_height",
"output_width",
"pixel_size",
"edges",
"show_all_parts",
"include_surfaces",
"use_anti_aliasing",
"configuration",
"link_document_id",
],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"view_matrix": (str,),
"output_height": (int,),
"output_width": (int,),
"pixel_size": (float,),
"edges": (str,),
"show_all_parts": (bool,),
"include_surfaces": (bool,),
"use_anti_aliasing": (bool,),
"configuration": (str,),
"link_document_id": (str,),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
"view_matrix": "viewMatrix",
"output_height": "outputHeight",
"output_width": "outputWidth",
"pixel_size": "pixelSize",
"edges": "edges",
"show_all_parts": "showAllParts",
"include_surfaces": "includeSurfaces",
"use_anti_aliasing": "useAntiAliasing",
"configuration": "configuration",
"link_document_id": "linkDocumentId",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"view_matrix": "query",
"output_height": "query",
"output_width": "query",
"pixel_size": "query",
"edges": "query",
"show_all_parts": "query",
"include_surfaces": "query",
"use_anti_aliasing": "query",
"configuration": "query",
"link_document_id": "query",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": [],
},
api_client=api_client,
callable=__get_part_studio_shaded_views,
)
def __get_part_studio_tessellated_edges(self, did, wvm, wvmid, eid, **kwargs):
"""Tesselated edges from a PartStudio. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.get_part_studio_tessellated_edges(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str):
wvm (str):
wvmid (str):
eid (str):
Keyword Args:
angle_tolerance (float): [optional]
chord_tolerance (float): [optional]
part_id ([str]): [optional]
edge_id ([str]): [optional]
configuration (str): [optional]
link_document_id (str): [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_export_tessellated_edges_response327.BTExportTessellatedEdgesResponse327
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.get_part_studio_tessellated_edges = Endpoint(
settings={
"response_type": (
bt_export_tessellated_edges_response327.BTExportTessellatedEdgesResponse327,
),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/tessellatededges",
"operation_id": "get_part_studio_tessellated_edges",
"http_method": "GET",
"servers": [],
},
params_map={
"all": [
"did",
"wvm",
"wvmid",
"eid",
"angle_tolerance",
"chord_tolerance",
"part_id",
"edge_id",
"configuration",
"link_document_id",
],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"angle_tolerance": (float,),
"chord_tolerance": (float,),
"part_id": ([str],),
"edge_id": ([str],),
"configuration": (str,),
"link_document_id": (str,),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
"angle_tolerance": "angleTolerance",
"chord_tolerance": "chordTolerance",
"part_id": "partId",
"edge_id": "edgeId",
"configuration": "configuration",
"link_document_id": "linkDocumentId",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"angle_tolerance": "query",
"chord_tolerance": "query",
"part_id": "query",
"edge_id": "query",
"configuration": "query",
"link_document_id": "query",
},
"collection_format_map": {"part_id": "multi", "edge_id": "multi",},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": [],
},
api_client=api_client,
callable=__get_part_studio_tessellated_edges,
)
def __get_part_studio_tessellated_faces(self, did, wvm, wvmid, eid, **kwargs):
"""Tesselated faces of the parts in the Part Studio. # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.get_part_studio_tessellated_faces(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str):
wvm (str):
wvmid (str):
eid (str):
Keyword Args:
angle_tolerance (float): [optional]
chord_tolerance (float): [optional]
max_facet_width (float): [optional]
output_vertex_normals (bool): [optional] if omitted the server will use the default value of False
output_facet_normals (bool): [optional] if omitted the server will use the default value of True
output_texture_coordinates (bool): [optional] if omitted the server will use the default value of False
output_face_appearances (bool): [optional] if omitted the server will use the default value of False
output_index_table (bool): [optional] if omitted the server will use the default value of False
part_id ([str]): [optional]
face_id ([str]): [optional]
output_error_faces (bool): [optional] if omitted the server will use the default value of False
configuration (str): [optional]
link_document_id (str): [optional]
body (str): [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_export_tessellated_faces_response898.BTExportTessellatedFacesResponse898
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.get_part_studio_tessellated_faces = Endpoint(
settings={
"response_type": (
bt_export_tessellated_faces_response898.BTExportTessellatedFacesResponse898,
),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/tessellatedfaces",
"operation_id": "get_part_studio_tessellated_faces",
"http_method": "GET",
"servers": [],
},
params_map={
"all": [
"did",
"wvm",
"wvmid",
"eid",
"angle_tolerance",
"chord_tolerance",
"max_facet_width",
"output_vertex_normals",
"output_facet_normals",
"output_texture_coordinates",
"output_face_appearances",
"output_index_table",
"part_id",
"face_id",
"output_error_faces",
"configuration",
"link_document_id",
"body",
],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"angle_tolerance": (float,),
"chord_tolerance": (float,),
"max_facet_width": (float,),
"output_vertex_normals": (bool,),
"output_facet_normals": (bool,),
"output_texture_coordinates": (bool,),
"output_face_appearances": (bool,),
"output_index_table": (bool,),
"part_id": ([str],),
"face_id": ([str],),
"output_error_faces": (bool,),
"configuration": (str,),
"link_document_id": (str,),
"body": (str,),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
"angle_tolerance": "angleTolerance",
"chord_tolerance": "chordTolerance",
"max_facet_width": "maxFacetWidth",
"output_vertex_normals": "outputVertexNormals",
"output_facet_normals": "outputFacetNormals",
"output_texture_coordinates": "outputTextureCoordinates",
"output_face_appearances": "outputFaceAppearances",
"output_index_table": "outputIndexTable",
"part_id": "partId",
"face_id": "faceId",
"output_error_faces": "outputErrorFaces",
"configuration": "configuration",
"link_document_id": "linkDocumentId",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"angle_tolerance": "query",
"chord_tolerance": "query",
"max_facet_width": "query",
"output_vertex_normals": "query",
"output_facet_normals": "query",
"output_texture_coordinates": "query",
"output_face_appearances": "query",
"output_index_table": "query",
"part_id": "query",
"face_id": "query",
"output_error_faces": "query",
"configuration": "query",
"link_document_id": "query",
"body": "body",
},
"collection_format_map": {"part_id": "multi", "face_id": "multi",},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": ["application/json;charset=UTF-8; qs=0.09"],
},
api_client=api_client,
callable=__get_part_studio_tessellated_faces,
)
def __translate_ids(
self, did, wvm, wvmid, eid, bt_id_translation_params, **kwargs
):
"""Id Translations # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.translate_ids(did, wvm, wvmid, eid, bt_id_translation_params, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wvm (str): One of w or v or m corresponding to whether a workspace or version or microversion was entered.
wvmid (str): Workspace (w), Version (v) or Microversion (m) ID.
eid (str): Element ID.
bt_id_translation_params (bt_id_translation_params.BTIdTranslationParams):
Keyword Args:
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_id_translation_info.BTIdTranslationInfo
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
kwargs["bt_id_translation_params"] = bt_id_translation_params
return self.call_with_http_info(**kwargs)
self.translate_ids = Endpoint(
settings={
"response_type": (bt_id_translation_info.BTIdTranslationInfo,),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/idtranslations",
"operation_id": "translate_ids",
"http_method": "POST",
"servers": [],
},
params_map={
"all": ["did", "wvm", "wvmid", "eid", "bt_id_translation_params",],
"required": ["did", "wvm", "wvmid", "eid", "bt_id_translation_params",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"bt_id_translation_params": (
bt_id_translation_params.BTIdTranslationParams,
),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"bt_id_translation_params": "body",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": ["application/json;charset=UTF-8; qs=0.09"],
},
api_client=api_client,
callable=__translate_ids,
)
def __update_features(self, did, wid, eid, **kwargs):
"""Update Features # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.update_features(did, wid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wid (str): Workspace ID.
eid (str): Element ID.
Keyword Args:
body (str): feature The serialized feature definition. [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_update_features_response1333.BTUpdateFeaturesResponse1333
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wid"] = wid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.update_features = Endpoint(
settings={
"response_type": (
bt_update_features_response1333.BTUpdateFeaturesResponse1333,
),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/w/{wid}/e/{eid}/features/updates",
"operation_id": "update_features",
"http_method": "POST",
"servers": [],
},
params_map={
"all": ["did", "wid", "eid", "body",],
"required": ["did", "wid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wid": (str,),
"eid": (str,),
"body": (str,),
},
"attribute_map": {"did": "did", "wid": "wid", "eid": "eid",},
"location_map": {
"did": "path",
"wid": "path",
"eid": "path",
"body": "body",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": ["application/json;charset=UTF-8; qs=0.09"],
},
api_client=api_client,
callable=__update_features,
)
def __update_part_studio_configuration(self, did, wvm, wvmid, eid, **kwargs):
"""Update Configuration # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.update_part_studio_configuration(did, wvm, wvmid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str):
wvm (str):
wvmid (str):
eid (str):
Keyword Args:
body (str): [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_configuration_response2019.BTConfigurationResponse2019
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wvm"] = wvm
kwargs["wvmid"] = wvmid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.update_part_studio_configuration = Endpoint(
settings={
"response_type": (
bt_configuration_response2019.BTConfigurationResponse2019,
),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/{wvm}/{wvmid}/e/{eid}/configuration",
"operation_id": "update_part_studio_configuration",
"http_method": "POST",
"servers": [],
},
params_map={
"all": ["did", "wvm", "wvmid", "eid", "body",],
"required": ["did", "wvm", "wvmid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wvm": (str,),
"wvmid": (str,),
"eid": (str,),
"body": (str,),
},
"attribute_map": {
"did": "did",
"wvm": "wvm",
"wvmid": "wvmid",
"eid": "eid",
},
"location_map": {
"did": "path",
"wvm": "path",
"wvmid": "path",
"eid": "path",
"body": "body",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": ["application/json;charset=UTF-8; qs=0.09"],
},
api_client=api_client,
callable=__update_part_studio_configuration,
)
def __update_part_studio_feature(self, did, wid, eid, fid, **kwargs):
"""Update Feature # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.update_part_studio_feature(did, wid, eid, fid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wid (str): Workspace ID.
eid (str): Element ID.
fid (str): The id of the feature being updated. This id should be URL encoded and must match the featureId found in the serialized structure
Keyword Args:
body (str): feature The serialized feature definition. [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_feature_definition_response1617.BTFeatureDefinitionResponse1617
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wid"] = wid
kwargs["eid"] = eid
kwargs["fid"] = fid
return self.call_with_http_info(**kwargs)
self.update_part_studio_feature = Endpoint(
settings={
"response_type": (
bt_feature_definition_response1617.BTFeatureDefinitionResponse1617,
),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/w/{wid}/e/{eid}/features/featureid/{fid}",
"operation_id": "update_part_studio_feature",
"http_method": "POST",
"servers": [],
},
params_map={
"all": ["did", "wid", "eid", "fid", "body",],
"required": ["did", "wid", "eid", "fid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wid": (str,),
"eid": (str,),
"fid": (str,),
"body": (str,),
},
"attribute_map": {
"did": "did",
"wid": "wid",
"eid": "eid",
"fid": "fid",
},
"location_map": {
"did": "path",
"wid": "path",
"eid": "path",
"fid": "path",
"body": "body",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": ["application/json;charset=UTF-8; qs=0.09"],
},
api_client=api_client,
callable=__update_part_studio_feature,
)
def __update_rollback(self, did, wid, eid, **kwargs):
"""Update Feature Rollback # noqa: E501
This method makes a synchronous HTTP request by default. To make an
asynchronous HTTP request, please pass async_req=True
>>> thread = api.update_rollback(did, wid, eid, async_req=True)
>>> result = thread.get()
Args:
did (str): Document ID.
wid (str): Workspace ID.
eid (str): Element ID.
Keyword Args:
body (str): The index at which the rollback index should be placed. Features with entry index (0-based) higher than or equal to the value are rolled back. Value of -1 is treated as an alias for \"end of feature list\". Otherwise the value must be in the range 0 to the number of entries in the feature list. [optional]
_return_http_data_only (bool): response data without head status
code and headers. Default is True.
_preload_content (bool): if False, the urllib3.HTTPResponse object
will be returned without reading/decoding response data.
Default is True.
_request_timeout (float/tuple): timeout setting for this request. If one
number provided, it will be total request timeout. It can also
be a pair (tuple) of (connection, read) timeouts.
Default is None.
_check_input_type (bool): specifies if type checking
should be done one the data sent to the server.
Default is True.
_check_return_type (bool): specifies if type checking
should be done one the data received from the server.
Default is True.
_host_index (int): specifies the index of the server
that we want to use.
Default is 0.
async_req (bool): execute request asynchronously
Returns:
bt_set_feature_rollback_response1042.BTSetFeatureRollbackResponse1042
If the method is called asynchronously, returns the request
thread.
"""
kwargs["async_req"] = kwargs.get("async_req", False)
kwargs["_return_http_data_only"] = kwargs.get(
"_return_http_data_only", True
)
kwargs["_preload_content"] = kwargs.get("_preload_content", True)
kwargs["_request_timeout"] = kwargs.get("_request_timeout", None)
kwargs["_check_input_type"] = kwargs.get("_check_input_type", True)
kwargs["_check_return_type"] = kwargs.get("_check_return_type", True)
kwargs["_host_index"] = kwargs.get("_host_index", 0)
kwargs["did"] = did
kwargs["wid"] = wid
kwargs["eid"] = eid
return self.call_with_http_info(**kwargs)
self.update_rollback = Endpoint(
settings={
"response_type": (
bt_set_feature_rollback_response1042.BTSetFeatureRollbackResponse1042,
),
"auth": ["OAuth2"],
"endpoint_path": "/api/partstudios/d/{did}/w/{wid}/e/{eid}/features/rollback",
"operation_id": "update_rollback",
"http_method": "POST",
"servers": [],
},
params_map={
"all": ["did", "wid", "eid", "body",],
"required": ["did", "wid", "eid",],
"nullable": [],
"enum": [],
"validation": [],
},
root_map={
"validations": {},
"allowed_values": {},
"openapi_types": {
"did": (str,),
"wid": (str,),
"eid": (str,),
"body": (str,),
},
"attribute_map": {"did": "did", "wid": "wid", "eid": "eid",},
"location_map": {
"did": "path",
"wid": "path",
"eid": "path",
"body": "body",
},
"collection_format_map": {},
},
headers_map={
"accept": ["application/json;charset=UTF-8; qs=0.09"],
"content_type": ["application/json;charset=UTF-8; qs=0.09"],
},
api_client=api_client,
callable=__update_rollback,
)
class Endpoint(object):
def __init__(
self,
settings=None,
params_map=None,
root_map=None,
headers_map=None,
api_client=None,
callable=None,
):
"""Creates an endpoint
Args:
settings (dict): see below key value pairs
'response_type' (tuple/None): response type
'auth' (list): a list of auth type keys
'endpoint_path' (str): the endpoint path
'operation_id' (str): endpoint string identifier
'http_method' (str): POST/PUT/PATCH/GET etc
'servers' (list): list of str servers that this endpoint is at
params_map (dict): see below key value pairs
'all' (list): list of str endpoint parameter names
'required' (list): list of required parameter names
'nullable' (list): list of nullable parameter names
'enum' (list): list of parameters with enum values
'validation' (list): list of parameters with validations
root_map
'validations' (dict): the dict mapping endpoint parameter tuple
paths to their validation dictionaries
'allowed_values' (dict): the dict mapping endpoint parameter
tuple paths to their allowed_values (enum) dictionaries
'openapi_types' (dict): param_name to openapi type
'attribute_map' (dict): param_name to camelCase name
'location_map' (dict): param_name to 'body', 'file', 'form',
'header', 'path', 'query'
collection_format_map (dict): param_name to `csv` etc.
headers_map (dict): see below key value pairs
'accept' (list): list of Accept header strings
'content_type' (list): list of Content-Type header strings
api_client (ApiClient) api client instance
callable (function): the function which is invoked when the
Endpoint is called
"""
self.settings = settings
self.params_map = params_map
self.params_map["all"].extend(
[
"async_req",
"_host_index",
"_preload_content",
"_request_timeout",
"_return_http_data_only",
"_check_input_type",
"_check_return_type",
]
)
self.params_map["nullable"].extend(["_request_timeout"])
self.validations = root_map["validations"]
self.allowed_values = root_map["allowed_values"]
self.openapi_types = root_map["openapi_types"]
extra_types = {
"async_req": (bool,),
"_host_index": (int,),
"_preload_content": (bool,),
"_request_timeout": (none_type, int, (int,), [int]),
"_return_http_data_only": (bool,),
"_check_input_type": (bool,),
"_check_return_type": (bool,),
}
self.openapi_types.update(extra_types)
self.attribute_map = root_map["attribute_map"]
self.location_map = root_map["location_map"]
self.collection_format_map = root_map["collection_format_map"]
self.headers_map = headers_map
self.api_client = api_client
self.callable = callable
def __validate_inputs(self, kwargs):
for param in self.params_map["enum"]:
if param in kwargs:
check_allowed_values(self.allowed_values, (param,), kwargs[param])
for param in self.params_map["validation"]:
if param in kwargs:
check_validations(self.validations, (param,), kwargs[param])
if kwargs["_check_input_type"] is False:
return
for key, value in six.iteritems(kwargs):
fixed_val = validate_and_convert_types(
value,
self.openapi_types[key],
[key],
False,
kwargs["_check_input_type"],
configuration=self.api_client.configuration,
)
kwargs[key] = fixed_val
def __gather_params(self, kwargs):
params = {
"body": None,
"collection_format": {},
"file": {},
"form": [],
"header": {},
"path": {},
"query": [],
}
for param_name, param_value in six.iteritems(kwargs):
param_location = self.location_map.get(param_name)
if param_location is None:
continue
if param_location:
if param_location == "body":
params["body"] = param_value
continue
base_name = self.attribute_map[param_name]
if param_location == "form" and self.openapi_types[param_name] == (
file_type,
):
params["file"][param_name] = [param_value]
elif param_location == "form" and self.openapi_types[param_name] == (
[file_type],
):
# param_value is already a list
params["file"][param_name] = param_value
elif param_location in {"form", "query"}:
param_value_full = (base_name, param_value)
params[param_location].append(param_value_full)
if param_location not in {"form", "query"}:
params[param_location][base_name] = param_value
collection_format = self.collection_format_map.get(param_name)
if collection_format:
params["collection_format"][base_name] = collection_format
return params
def __call__(self, *args, **kwargs):
""" This method is invoked when endpoints are called
Example:
pet_api = PetApi()
pet_api.add_pet # this is an instance of the class Endpoint
pet_api.add_pet() # this invokes pet_api.add_pet.__call__()
which then invokes the callable functions stored in that endpoint at
pet_api.add_pet.callable or self.callable in this class
"""
return self.callable(self, *args, **kwargs)
def call_with_http_info(self, **kwargs):
try:
_host = self.settings["servers"][kwargs["_host_index"]]
except IndexError:
if self.settings["servers"]:
raise ApiValueError(
"Invalid host index. Must be 0 <= index < %s"
% len(self.settings["servers"])
)
_host = None
for key, value in six.iteritems(kwargs):
if key not in self.params_map["all"]:
raise ApiTypeError(
"Got an unexpected parameter '%s'"
" to method `%s`" % (key, self.settings["operation_id"])
)
# only throw this nullable ApiValueError if _check_input_type
# is False, if _check_input_type==True we catch this case
# in self.__validate_inputs
if (
key not in self.params_map["nullable"]
and value is None
and kwargs["_check_input_type"] is False
):
raise ApiValueError(
"Value may not be None for non-nullable parameter `%s`"
" when calling `%s`" % (key, self.settings["operation_id"])
)
for key in self.params_map["required"]:
if key not in kwargs.keys():
raise ApiValueError(
"Missing the required parameter `%s` when calling "
"`%s`" % (key, self.settings["operation_id"])
)
self.__validate_inputs(kwargs)
params = self.__gather_params(kwargs)
accept_headers_list = self.headers_map["accept"]
if accept_headers_list:
params["header"]["Accept"] = self.api_client.select_header_accept(
accept_headers_list
)
content_type_headers_list = self.headers_map["content_type"]
if content_type_headers_list:
header_list = self.api_client.select_header_content_type(
content_type_headers_list
)
params["header"]["Content-Type"] = header_list
return self.api_client.call_api(
self.settings["endpoint_path"],
self.settings["http_method"],
params["path"],
params["query"],
params["header"],
body=params["body"],
post_params=params["form"],
files=params["file"],
response_type=self.settings["response_type"],
auth_settings=self.settings["auth"],
async_req=kwargs["async_req"],
_check_type=kwargs["_check_return_type"],
_return_http_data_only=kwargs["_return_http_data_only"],
_preload_content=kwargs["_preload_content"],
_request_timeout=kwargs["_request_timeout"],
_host=_host,
collection_formats=params["collection_format"],
)
| 45.993841
| 1,107
| 0.503323
| 13,736
| 141,891
| 4.968331
| 0.047103
| 0.021892
| 0.017525
| 0.019254
| 0.828544
| 0.78479
| 0.758561
| 0.745417
| 0.728537
| 0.710792
| 0
| 0.007964
| 0.395571
| 141,891
| 3,084
| 1,108
| 46.008755
| 0.787776
| 0.340987
| 0
| 0.639535
| 0
| 0.002528
| 0.266092
| 0.064622
| 0
| 0
| 0
| 0
| 0
| 1
| 0.014661
| false
| 0
| 0.015672
| 0
| 0.044995
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
f9d7a4a1b8a4d2f3636f68390314eaa6de516c2c
| 22,086
|
py
|
Python
|
lib_bgp_data/simulations/simulator/tests/system_tests/test_figure_3.py
|
jfuruness/lib_bgp_data
|
25f7d57b9e2101c7aefb325e8d728bd91f47d557
|
[
"BSD-3-Clause"
] | 16
|
2018-09-24T05:10:03.000Z
|
2021-11-29T19:18:59.000Z
|
lib_bgp_data/simulations/simulator/tests/system_tests/test_figure_3.py
|
jfuruness/lib_bgp_data
|
25f7d57b9e2101c7aefb325e8d728bd91f47d557
|
[
"BSD-3-Clause"
] | 4
|
2019-10-09T18:54:17.000Z
|
2021-03-05T14:02:50.000Z
|
lib_bgp_data/simulations/simulator/tests/system_tests/test_figure_3.py
|
jfuruness/lib_bgp_data
|
25f7d57b9e2101c7aefb325e8d728bd91f47d557
|
[
"BSD-3-Clause"
] | 3
|
2018-09-17T17:35:18.000Z
|
2020-03-24T16:03:31.000Z
|
#!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""This file contains system tests for the extrapolator.
For speciifics on each test, see the docstrings under each function.
"""
import pytest
from .graph_tester import Graph_Tester
#from ..tables import Hijack
from ....enums import Non_Default_Policies, Policies, Data_Plane_Conditions as Conds
from ...attacks.attack_classes import Subprefix_Hijack
from ...attacks.attack import Attack
__author__ = "Justin Furuness"
__credits__ = ["Justin Furuness"]
__Lisence__ = "BSD"
__maintainer__ = "Justin Furuness"
__email__ = "jfuruness@gmail.com"
__status__ = "Development"
class Test_Figure_3(Graph_Tester):
"""Tests all example graphs within our paper.
NOTE: This is the same as test figure 3 EXCEPT we make sure that blackholes
for subprefixes do not prevent prefix announcements from being accepted
"""
def test_figure_3a(self):
r"""v2 example with ROV++V1 and ROV
/44\
/ / \\666
/ 54 \
/ / 56
77 55 \
| / 99
11
/ \
32 33
"""
attack_types = [Subprefix_Hijack]
adopt_policies = [Non_Default_Policies.ROVPP_V1]
peer_rows = []
provider_customer_rows = [[44, 77],
[44, 54],
[44, 56],
[44, 666],
[77, 11],
[11, 32],
[11, 33],
[54, 55],
[55, 11],
[56, 99]]
# Set adopting rows
bgp_ases = [11, 54, 55, 44, 666, 56, 99]
rov_adopting_ases = [32, 33]
rovpp_adopting_ases = [77]
adopting_rows = []
for bgp_as in bgp_ases:
adopting_rows.append([bgp_as, Policies.DEFAULT.value, False])
for adopting_as in rov_adopting_ases:
adopting_rows.append([adopting_as, Policies.ROV.value, True])
for adopting_as in rovpp_adopting_ases:
adopting_rows.append([adopting_as, Policies.ROVPP_V1.value, True])
attacker = 666
victim = 99
exr_output = [{"asn": 32,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 11},
{"asn": 33,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 11},
{"asn": 99,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": Conds.NOTHIJACKED.value},
{"asn": 11,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 77},
{"asn": 77,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 44},
{"asn": 55,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 54},
{"asn": 56,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 99},
{"asn": 54,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 44},
{"asn": 44,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 56},
{"asn": 666,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 44},
{"asn": 99,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": Conds.NOTHIJACKED.value},
{"asn": 11,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 55},
{"asn": 55,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 54},
{"asn": 56,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 44},
{"asn": 54,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 44},
{"asn": 44,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 666},
{"asn": 666,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": Conds.HIJACKED.value},
{"asn": 77,
"prefix": Attack.default_subprefix,
"origin": 64512,
"received_from_asn": 64512},
]
self._test_graph(attack_types=attack_types,
adopt_policies=adopt_policies,
peer_rows=peer_rows,
provider_customer_rows=provider_customer_rows,
adopting_rows=adopting_rows,
attacker=attacker,
victim=victim,
exr_output=exr_output)
def test_figure_3b(self):
r"""v2 example with ROV++V2 and ROV
/44\
/ / \\666
/ 54 \
/ / 56
77 55 \
| / 99
11
/ \
32 33
"""
attack_types = [Subprefix_Hijack]
adopt_policies = [Non_Default_Policies.ROVPP_V2]
peer_rows = []
provider_customer_rows = [[44, 77],
[44, 54],
[44, 56],
[44, 666],
[77, 11],
[11, 32],
[11, 33],
[54, 55],
[55, 11],
[56, 99]]
# Set adopting rows
bgp_ases = [11, 54, 55, 44, 666, 56, 99]
rov_adopting_ases = [32]
rovpp_v2_adopting_ases = [77, 33]
adopting_rows = []
for bgp_as in bgp_ases:
adopting_rows.append([bgp_as, Policies.DEFAULT.value, False])
for adopting_as in rov_adopting_ases:
adopting_rows.append([adopting_as, Policies.ROV.value, True])
for adopting_as in rovpp_v2_adopting_ases:
adopting_rows.append([adopting_as, Policies.ROVPP_V2.value, True])
attacker = 666
victim = 99
exr_output = [{"asn": 32,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 11},
{"asn": 33,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 11},
{"asn": 99,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": Conds.NOTHIJACKED.value},
{"asn": 11,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 77},
{"asn": 77,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 44},
{"asn": 55,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 54},
{"asn": 56,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 99},
{"asn": 54,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 44},
{"asn": 44,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 56},
{"asn": 666,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 44},
{"asn": 99,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": Conds.NOTHIJACKED.value},
{"asn": 11,
"prefix": Attack.default_subprefix,
"origin": 64512,
"received_from_asn": 77},
{"asn": 55,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 54},
{"asn": 56,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 44},
{"asn": 54,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 44},
{"asn": 44,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 666},
{"asn": 666,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": Conds.HIJACKED.value},
{"asn": 77,
"prefix": Attack.default_subprefix,
"origin": 64512,
"received_from_asn": 64512},
# 32 rejects the blackhole announcement as invalid
{"asn": 33,
"prefix": Attack.default_subprefix,
"origin": 64512,
"received_from_asn": 64512},
]
self._test_graph(attack_types=attack_types,
adopt_policies=adopt_policies,
peer_rows=peer_rows,
provider_customer_rows=provider_customer_rows,
adopting_rows=adopting_rows,
attacker=attacker,
victim=victim,
exr_output=exr_output)
def test_figure_3b_v2_lite(self):
r"""v2 example with ROV++V2 Lite and ROV
/44\
/ / \\666
/ 54 \
/ / 56
77 55 \
| / 99
11
/ \
32 33
"""
attack_types = [Subprefix_Hijack]
adopt_policies = [Non_Default_Policies.ROVPP_V2_LITE]
peer_rows = []
provider_customer_rows = [[44, 77],
[44, 54],
[44, 56],
[44, 666],
[77, 11],
[11, 32],
[11, 33],
[54, 55],
[55, 11],
[56, 99]]
# Set adopting rows
bgp_ases = [11, 54, 55, 44, 666, 56, 99]
rov_adopting_ases = [32]
rovpp_v2_adopting_ases = [77, 33]
adopting_rows = []
for bgp_as in bgp_ases:
adopting_rows.append([bgp_as, Policies.DEFAULT.value, False])
for adopting_as in rov_adopting_ases:
adopting_rows.append([adopting_as, Policies.ROV.value, True])
for adopting_as in rovpp_v2_adopting_ases:
adopting_rows.append([adopting_as, Policies.ROVPP_V2_LITE.value, True])
attacker = 666
victim = 99
exr_output = [{"asn": 32,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 11},
{"asn": 33,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 11},
{"asn": 99,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": Conds.NOTHIJACKED.value},
{"asn": 11,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 77},
{"asn": 77,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 44},
{"asn": 55,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 54},
{"asn": 56,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 99},
{"asn": 54,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 44},
{"asn": 44,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 56},
{"asn": 666,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 44},
{"asn": 99,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": Conds.NOTHIJACKED.value},
{"asn": 11,
"prefix": Attack.default_subprefix,
"origin": 64512,
"received_from_asn": 77},
{"asn": 55,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 54},
{"asn": 56,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 44},
{"asn": 54,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 44},
{"asn": 44,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 666},
{"asn": 666,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": Conds.HIJACKED.value},
{"asn": 77,
"prefix": Attack.default_subprefix,
"origin": 64512,
"received_from_asn": 64512},
# 32 rejects the blackhole announcement as invalid
{"asn": 33,
"prefix": Attack.default_subprefix,
"origin": 64512,
"received_from_asn": 64512},
]
self._test_graph(attack_types=attack_types,
adopt_policies=adopt_policies,
peer_rows=peer_rows,
provider_customer_rows=provider_customer_rows,
adopting_rows=adopting_rows,
attacker=attacker,
victim=victim,
exr_output=exr_output)
def test_figure_3b_v2a_lite(self):
r"""v2 example with ROV++V2 Lite and ROV
/44\
/ / \\666
/ 54 \
/ / 56
77 55 \
| / 99
11
/ \
32 33
"""
attack_types = [Subprefix_Hijack]
adopt_policies = [Non_Default_Policies.ROVPP_V2_AGGRESSIVE_LITE]
peer_rows = []
provider_customer_rows = [[44, 77],
[44, 54],
[44, 56],
[44, 666],
[77, 11],
[11, 32],
[11, 33],
[54, 55],
[55, 11],
[56, 99]]
# Set adopting rows
bgp_ases = [11, 54, 55, 44, 666, 56, 99]
rov_adopting_ases = [32]
rovpp_v2_adopting_ases = [77, 33]
adopting_rows = []
for bgp_as in bgp_ases:
adopting_rows.append([bgp_as, Policies.DEFAULT.value, False])
for adopting_as in rov_adopting_ases:
adopting_rows.append([adopting_as, Policies.ROV.value, True])
for adopting_as in rovpp_v2_adopting_ases:
adopting_rows.append([adopting_as, Policies.ROVPP_V2_AGGRESSIVE_LITE.value, True])
attacker = 666
victim = 99
exr_output = [{"asn": 32,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 11},
{"asn": 33,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 11},
{"asn": 99,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": Conds.NOTHIJACKED.value},
{"asn": 11,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 77},
{"asn": 77,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 44},
{"asn": 55,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 54},
{"asn": 56,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 99},
{"asn": 54,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 44},
{"asn": 44,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 56},
{"asn": 666,
"prefix": Attack.default_prefix,
"origin": 99,
"received_from_asn": 44},
{"asn": 99,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": Conds.NOTHIJACKED.value},
{"asn": 11,
"prefix": Attack.default_subprefix,
"origin": 64512,
"received_from_asn": 77},
{"asn": 55,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 54},
{"asn": 56,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 44},
{"asn": 54,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 44},
{"asn": 44,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": 666},
{"asn": 666,
"prefix": Attack.default_subprefix,
"origin": 666,
"received_from_asn": Conds.HIJACKED.value},
{"asn": 77,
"prefix": Attack.default_subprefix,
"origin": 64512,
"received_from_asn": 64512},
# 32 rejects the blackhole announcement as invalid
{"asn": 33,
"prefix": Attack.default_subprefix,
"origin": 64512,
"received_from_asn": 64512},
]
self._test_graph(attack_types=attack_types,
adopt_policies=adopt_policies,
peer_rows=peer_rows,
provider_customer_rows=provider_customer_rows,
adopting_rows=adopting_rows,
attacker=attacker,
victim=victim,
exr_output=exr_output)
| 39.938517
| 94
| 0.395771
| 1,756
| 22,086
| 4.708998
| 0.076879
| 0.10884
| 0.17233
| 0.120934
| 0.917644
| 0.915226
| 0.912686
| 0.909904
| 0.909904
| 0.901318
| 0
| 0.083157
| 0.507788
| 22,086
| 552
| 95
| 40.01087
| 0.677491
| 0.051571
| 0
| 0.921053
| 0
| 0
| 0.120684
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.008772
| false
| 0
| 0.010965
| 0
| 0.02193
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
ddf0df5ee73c05db2ecdcbd788c0a8ee23ab4095
| 187
|
py
|
Python
|
temboo/core/Library/FedEx/Availability/__init__.py
|
jordanemedlock/psychtruths
|
52e09033ade9608bd5143129f8a1bfac22d634dd
|
[
"Apache-2.0"
] | 7
|
2016-03-07T02:07:21.000Z
|
2022-01-21T02:22:41.000Z
|
temboo/core/Library/FedEx/Availability/__init__.py
|
jordanemedlock/psychtruths
|
52e09033ade9608bd5143129f8a1bfac22d634dd
|
[
"Apache-2.0"
] | null | null | null |
temboo/core/Library/FedEx/Availability/__init__.py
|
jordanemedlock/psychtruths
|
52e09033ade9608bd5143129f8a1bfac22d634dd
|
[
"Apache-2.0"
] | 8
|
2016-06-14T06:01:11.000Z
|
2020-04-22T09:21:44.000Z
|
from temboo.Library.FedEx.Availability.ServiceAvailability import ServiceAvailability, ServiceAvailabilityInputSet, ServiceAvailabilityResultSet, ServiceAvailabilityChoreographyExecution
| 93.5
| 186
| 0.925134
| 11
| 187
| 15.727273
| 0.909091
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.037433
| 187
| 1
| 187
| 187
| 0.961111
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
348aac411d67f92e9a12b748d13904f4cdabd862
| 22,088
|
py
|
Python
|
TrekBot2_WS/build/octomap_server/catkin_generated/pkg.develspace.context.pc.py
|
Rafcin/RescueRoboticsLHMV
|
d3dc63e6c16a040b16170f143556ef358018b7da
|
[
"Unlicense"
] | 1
|
2018-10-04T14:37:00.000Z
|
2018-10-04T14:37:00.000Z
|
TrekBot2_WS/build/octomap_server/catkin_generated/pkg.develspace.context.pc.py
|
Rafcin/TrekBot
|
d3dc63e6c16a040b16170f143556ef358018b7da
|
[
"Unlicense"
] | null | null | null |
TrekBot2_WS/build/octomap_server/catkin_generated/pkg.develspace.context.pc.py
|
Rafcin/TrekBot
|
d3dc63e6c16a040b16170f143556ef358018b7da
|
[
"Unlicense"
] | null | null | null |
# generated from catkin/cmake/template/pkg.context.pc.in
CATKIN_PACKAGE_PREFIX = ""
PROJECT_PKG_CONFIG_INCLUDE_DIRS = "/xavier_ssd/TrekBot/TrekBot2_WS/devel/.private/octomap_server/include;/xavier_ssd/TrekBot/TrekBot2_WS/src/octomap_mapping/octomap_server/include;/usr/include/pcl-1.8;/usr/include/eigen3;/usr/include;/usr/include/ni;/usr/include/openni2;/usr/include/vtk-6.3;/usr/include/freetype2;/usr/lib/aarch64-linux-gnu/openmpi/include/openmpi;/usr/lib/aarch64-linux-gnu/openmpi/include/openmpi/opal/mca/event/libevent2022/libevent;/usr/lib/aarch64-linux-gnu/openmpi/include/openmpi/opal/mca/event/libevent2022/libevent/include;/usr/lib/aarch64-linux-gnu/openmpi/include;/usr/include/python2.7;/usr/include/aarch64-linux-gnu;/usr/include/hdf5/openmpi;/usr/include/libxml2;/usr/include/jsoncpp;/usr/include/tcl".split(';') if "/xavier_ssd/TrekBot/TrekBot2_WS/devel/.private/octomap_server/include;/xavier_ssd/TrekBot/TrekBot2_WS/src/octomap_mapping/octomap_server/include;/usr/include/pcl-1.8;/usr/include/eigen3;/usr/include;/usr/include/ni;/usr/include/openni2;/usr/include/vtk-6.3;/usr/include/freetype2;/usr/lib/aarch64-linux-gnu/openmpi/include/openmpi;/usr/lib/aarch64-linux-gnu/openmpi/include/openmpi/opal/mca/event/libevent2022/libevent;/usr/lib/aarch64-linux-gnu/openmpi/include/openmpi/opal/mca/event/libevent2022/libevent/include;/usr/lib/aarch64-linux-gnu/openmpi/include;/usr/include/python2.7;/usr/include/aarch64-linux-gnu;/usr/include/hdf5/openmpi;/usr/include/libxml2;/usr/include/jsoncpp;/usr/include/tcl" != "" else []
PROJECT_CATKIN_DEPENDS = "roscpp;visualization_msgs;sensor_msgs;pcl_ros;pcl_conversions;nav_msgs;std_msgs;std_srvs;octomap_ros;octomap_msgs;dynamic_reconfigure;nodelet".replace(';', ' ')
PKG_CONFIG_LIBRARIES_WITH_PREFIX = "-loctomap_server;/usr/lib/aarch64-linux-gnu/libpcl_common.so;/usr/lib/aarch64-linux-gnu/libpcl_kdtree.so;/usr/lib/aarch64-linux-gnu/libpcl_octree.so;/usr/lib/aarch64-linux-gnu/libpcl_search.so;/usr/lib/aarch64-linux-gnu/libpcl_sample_consensus.so;/usr/lib/aarch64-linux-gnu/libpcl_io.so;/usr/lib/aarch64-linux-gnu/libpcl_features.so;/usr/lib/aarch64-linux-gnu/libpcl_ml.so;/usr/lib/aarch64-linux-gnu/libpcl_segmentation.so;/usr/lib/aarch64-linux-gnu/libpcl_filters.so;/usr/lib/aarch64-linux-gnu/libboost_system.so;/usr/lib/aarch64-linux-gnu/libboost_filesystem.so;/usr/lib/aarch64-linux-gnu/libboost_thread.so;/usr/lib/aarch64-linux-gnu/libboost_date_time.so;/usr/lib/aarch64-linux-gnu/libboost_iostreams.so;/usr/lib/aarch64-linux-gnu/libboost_serialization.so;/usr/lib/aarch64-linux-gnu/libboost_chrono.so;/usr/lib/aarch64-linux-gnu/libboost_atomic.so;/usr/lib/aarch64-linux-gnu/libboost_regex.so;/usr/lib/aarch64-linux-gnu/libpthread.so;/usr/lib/libOpenNI.so;/usr/lib/libOpenNI2.so;/usr/lib/aarch64-linux-gnu/libflann_cpp_s.a;/usr/lib/aarch64-linux-gnu/libvtkChartsCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonColor-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonDataModel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonMath-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtksys-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonMisc-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonSystem-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonTransforms-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkInfovisCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersExtraction-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonExecutionModel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersGeneral-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonComputationalGeometry-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersStatistics-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingFourier-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkalglib-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingContext2D-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersGeometry-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersSources-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingFreeType-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libfreetype.so;/usr/lib/aarch64-linux-gnu/libz.so;/usr/lib/aarch64-linux-gnu/libvtkftgl-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkDICOMParser-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkDomainsChemistry-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOXML-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOGeometry-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOXMLParser-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libexpat.so;/usr/lib/aarch64-linux-gnu/libvtkFiltersAMR-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkParallelCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOLegacy-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersFlowPaths-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersGeneric-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersHybrid-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingSources-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersHyperTree-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersImaging-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingGeneral-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersModeling-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersParallel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersParallelFlowPaths-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkParallelMPI-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersParallelGeometry-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersParallelImaging-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersParallelMPI-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersParallelStatistics-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersProgrammable-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersPython-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libpython2.7.so;/usr/lib/aarch64-linux-gnu/libvtkWrappingPython27Core-6.3.so.6.3.0;/usr/lib/libvtkWrappingTools-6.3.a;/usr/lib/aarch64-linux-gnu/libvtkFiltersReebGraph-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersSMP-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersSelection-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersTexture-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersVerdict-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkverdict-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkGUISupportQt-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkInteractionStyle-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingOpenGL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingHybrid-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOImage-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkmetaio-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libjpeg.so;/usr/lib/aarch64-linux-gnu/libpng.so;/usr/lib/aarch64-linux-gnu/libtiff.so;/usr/lib/aarch64-linux-gnu/libvtkGUISupportQtOpenGL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkGUISupportQtSQL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOSQL-6.3.so.6.3.0;-lsqlite3;/usr/lib/aarch64-linux-gnu/libvtkGUISupportQtWebkit-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkViewsQt-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkViewsInfovis-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkInfovisLayout-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkInfovisBoostGraphAlgorithms-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingLabel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkViewsCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkInteractionWidgets-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingAnnotation-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingColor-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingVolume-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkGeovisCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libproj.so;/usr/lib/aarch64-linux-gnu/libvtkIOAMR-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/hdf5/openmpi/libhdf5.so;/usr/lib/aarch64-linux-gnu/libsz.so;/usr/lib/aarch64-linux-gnu/libdl.so;/usr/lib/aarch64-linux-gnu/libm.so;/usr/lib/aarch64-linux-gnu/openmpi/lib/libmpi.so;/usr/lib/aarch64-linux-gnu/libvtkIOEnSight-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOExodus-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkexoIIc-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libnetcdf_c++.so;/usr/lib/aarch64-linux-gnu/libnetcdf.so;/usr/lib/aarch64-linux-gnu/libvtkIOExport-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingGL2PS-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingContextOpenGL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libgl2ps.so;/usr/lib/aarch64-linux-gnu/libvtkIOFFMPEG-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOMovie-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libtheoraenc.so;/usr/lib/aarch64-linux-gnu/libtheoradec.so;/usr/lib/aarch64-linux-gnu/libogg.so;/usr/lib/aarch64-linux-gnu/libvtkIOGDAL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOGeoJSON-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOImport-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOInfovis-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libxml2.so;/usr/lib/aarch64-linux-gnu/libvtkIOLSDyna-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOMINC-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOMPIImage-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOMPIParallel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOParallel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIONetCDF-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libjsoncpp.so;/usr/lib/aarch64-linux-gnu/libvtkIOMySQL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOODBC-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOPLY-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOParallelExodus-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOParallelLSDyna-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOParallelNetCDF-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOParallelXML-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOPostgreSQL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOVPIC-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkVPIC-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOVideo-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOXdmf2-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkxdmf2-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingMath-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingMorphological-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingStatistics-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingStencil-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkInteractionImage-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkLocalExample-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkParallelMPI4Py-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkPythonInterpreter-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingExternal-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingFreeTypeFontConfig-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingImage-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingLIC-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingLOD-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingMatplotlib-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingParallel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingParallelLIC-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingQt-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingVolumeAMR-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingVolumeOpenGL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkTestingGenericBridge-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkTestingIOSQL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkTestingRendering-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkViewsContext2D-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkViewsGeovis-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkWrappingJava-6.3.so.6.3.0".split(';') if "-loctomap_server;/usr/lib/aarch64-linux-gnu/libpcl_common.so;/usr/lib/aarch64-linux-gnu/libpcl_kdtree.so;/usr/lib/aarch64-linux-gnu/libpcl_octree.so;/usr/lib/aarch64-linux-gnu/libpcl_search.so;/usr/lib/aarch64-linux-gnu/libpcl_sample_consensus.so;/usr/lib/aarch64-linux-gnu/libpcl_io.so;/usr/lib/aarch64-linux-gnu/libpcl_features.so;/usr/lib/aarch64-linux-gnu/libpcl_ml.so;/usr/lib/aarch64-linux-gnu/libpcl_segmentation.so;/usr/lib/aarch64-linux-gnu/libpcl_filters.so;/usr/lib/aarch64-linux-gnu/libboost_system.so;/usr/lib/aarch64-linux-gnu/libboost_filesystem.so;/usr/lib/aarch64-linux-gnu/libboost_thread.so;/usr/lib/aarch64-linux-gnu/libboost_date_time.so;/usr/lib/aarch64-linux-gnu/libboost_iostreams.so;/usr/lib/aarch64-linux-gnu/libboost_serialization.so;/usr/lib/aarch64-linux-gnu/libboost_chrono.so;/usr/lib/aarch64-linux-gnu/libboost_atomic.so;/usr/lib/aarch64-linux-gnu/libboost_regex.so;/usr/lib/aarch64-linux-gnu/libpthread.so;/usr/lib/libOpenNI.so;/usr/lib/libOpenNI2.so;/usr/lib/aarch64-linux-gnu/libflann_cpp_s.a;/usr/lib/aarch64-linux-gnu/libvtkChartsCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonColor-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonDataModel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonMath-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtksys-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonMisc-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonSystem-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonTransforms-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkInfovisCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersExtraction-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonExecutionModel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersGeneral-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkCommonComputationalGeometry-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersStatistics-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingFourier-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkalglib-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingContext2D-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersGeometry-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersSources-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingFreeType-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libfreetype.so;/usr/lib/aarch64-linux-gnu/libz.so;/usr/lib/aarch64-linux-gnu/libvtkftgl-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkDICOMParser-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkDomainsChemistry-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOXML-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOGeometry-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOXMLParser-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libexpat.so;/usr/lib/aarch64-linux-gnu/libvtkFiltersAMR-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkParallelCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOLegacy-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersFlowPaths-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersGeneric-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersHybrid-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingSources-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersHyperTree-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersImaging-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingGeneral-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersModeling-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersParallel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersParallelFlowPaths-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkParallelMPI-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersParallelGeometry-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersParallelImaging-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersParallelMPI-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersParallelStatistics-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersProgrammable-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersPython-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libpython2.7.so;/usr/lib/aarch64-linux-gnu/libvtkWrappingPython27Core-6.3.so.6.3.0;/usr/lib/libvtkWrappingTools-6.3.a;/usr/lib/aarch64-linux-gnu/libvtkFiltersReebGraph-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersSMP-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersSelection-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersTexture-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkFiltersVerdict-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkverdict-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkGUISupportQt-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkInteractionStyle-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingOpenGL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingHybrid-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOImage-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkmetaio-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libjpeg.so;/usr/lib/aarch64-linux-gnu/libpng.so;/usr/lib/aarch64-linux-gnu/libtiff.so;/usr/lib/aarch64-linux-gnu/libvtkGUISupportQtOpenGL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkGUISupportQtSQL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOSQL-6.3.so.6.3.0;-lsqlite3;/usr/lib/aarch64-linux-gnu/libvtkGUISupportQtWebkit-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkViewsQt-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkViewsInfovis-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkInfovisLayout-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkInfovisBoostGraphAlgorithms-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingLabel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkViewsCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkInteractionWidgets-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingAnnotation-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingColor-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingVolume-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkGeovisCore-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libproj.so;/usr/lib/aarch64-linux-gnu/libvtkIOAMR-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/hdf5/openmpi/libhdf5.so;/usr/lib/aarch64-linux-gnu/libsz.so;/usr/lib/aarch64-linux-gnu/libdl.so;/usr/lib/aarch64-linux-gnu/libm.so;/usr/lib/aarch64-linux-gnu/openmpi/lib/libmpi.so;/usr/lib/aarch64-linux-gnu/libvtkIOEnSight-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOExodus-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkexoIIc-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libnetcdf_c++.so;/usr/lib/aarch64-linux-gnu/libnetcdf.so;/usr/lib/aarch64-linux-gnu/libvtkIOExport-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingGL2PS-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingContextOpenGL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libgl2ps.so;/usr/lib/aarch64-linux-gnu/libvtkIOFFMPEG-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOMovie-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libtheoraenc.so;/usr/lib/aarch64-linux-gnu/libtheoradec.so;/usr/lib/aarch64-linux-gnu/libogg.so;/usr/lib/aarch64-linux-gnu/libvtkIOGDAL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOGeoJSON-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOImport-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOInfovis-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libxml2.so;/usr/lib/aarch64-linux-gnu/libvtkIOLSDyna-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOMINC-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOMPIImage-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOMPIParallel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOParallel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIONetCDF-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libjsoncpp.so;/usr/lib/aarch64-linux-gnu/libvtkIOMySQL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOODBC-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOPLY-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOParallelExodus-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOParallelLSDyna-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOParallelNetCDF-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOParallelXML-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOPostgreSQL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOVPIC-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkVPIC-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOVideo-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkIOXdmf2-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkxdmf2-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingMath-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingMorphological-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingStatistics-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkImagingStencil-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkInteractionImage-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkLocalExample-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkParallelMPI4Py-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkPythonInterpreter-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingExternal-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingFreeTypeFontConfig-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingImage-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingLIC-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingLOD-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingMatplotlib-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingParallel-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingParallelLIC-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingQt-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingVolumeAMR-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkRenderingVolumeOpenGL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkTestingGenericBridge-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkTestingIOSQL-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkTestingRendering-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkViewsContext2D-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkViewsGeovis-6.3.so.6.3.0;/usr/lib/aarch64-linux-gnu/libvtkWrappingJava-6.3.so.6.3.0" != "" else []
PROJECT_NAME = "octomap_server"
PROJECT_SPACE_DIR = "/xavier_ssd/TrekBot/TrekBot2_WS/devel/.private/octomap_server"
PROJECT_VERSION = "0.6.1"
| 2,454.222222
| 20,214
| 0.790474
| 4,237
| 22,088
| 4.098655
| 0.063016
| 0.063112
| 0.316135
| 0.377289
| 0.980134
| 0.980134
| 0.980134
| 0.980134
| 0.980134
| 0.977197
| 0
| 0.098599
| 0.001766
| 22,088
| 8
| 20,215
| 2,761
| 0.689011
| 0.002445
| 0
| 0
| 1
| 0.714286
| 0.98779
| 0.986747
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.142857
| 0
| 0.142857
| 0
| 0
| 0
| 0
| null | 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 1
| 1
| 1
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 15
|
34e63583990bf6578b8c244dbe8752927d478f66
| 18,909
|
py
|
Python
|
test/convert_tests.py
|
lifeomic/foundation-xml-cnv
|
d8d0a96da4a3d1de80f4c7dfc34bc4536c6d227c
|
[
"MIT"
] | null | null | null |
test/convert_tests.py
|
lifeomic/foundation-xml-cnv
|
d8d0a96da4a3d1de80f4c7dfc34bc4536c6d227c
|
[
"MIT"
] | null | null | null |
test/convert_tests.py
|
lifeomic/foundation-xml-cnv
|
d8d0a96da4a3d1de80f4c7dfc34bc4536c6d227c
|
[
"MIT"
] | null | null | null |
from unittest import TestCase
from src.convert import extract_copy_numbers
from src.convert import calculate_status
from src.convert import gather_attributes
from src.convert import calculate_interpretation
from src.convert import extract_sample
expected_results = {
'CopyNumbers': [{
'status': 'amplification',
'sample_id': 'SA-1612348',
'start_position': '58093932',
'end_position': '58188144',
'copy_number': 44.0,
'gene': 'CDK4',
'chromosome': 'chr12',
'interpretation': 'Pathogenic',
'attributes': {'number-of-exons': '7 of 7', 'ratio': 11.63, 'interpretation': 'known',
'status': 'amplification'}
}, {
'status': 'gain',
'sample_id': 'SA-1612348',
'start_position': '41853880',
'end_position': '41956362',
'copy_number': 6.0,
'gene': 'CCND3',
'chromosome': 'chr6',
'interpretation': 'Likely pathogenic',
'attributes': {'number-of-exons': '5 of 5', 'ratio': 2.17, 'interpretation': 'likely',
'status': 'amplification'}
}, {
'status': 'loss',
'sample_id': 'SA-1612348',
'start_position': '128706589',
'end_position': '128801451',
'copy_number': 41.0,
'gene': 'MYC',
'chromosome': 'chr8',
'interpretation': 'Uncertain significance',
'attributes': {'number-of-exons': '5 of 5', 'ratio': 10.34, 'interpretation': 'unknown',
'status': 'loss'}
}, {
'status': 'partial_loss',
'sample_id': 'SA-1612348',
'start_position': '37138078',
'end_position': '37141867',
'copy_number': 6.0,
'gene': 'PIM1',
'chromosome': 'chr6',
'interpretation': 'other',
'attributes': {'number-of-exons': '7 of 7', 'ratio': 2.14, 'interpretation': 'ambiguous',
'status': 'loss'}
}, {
'status': 'gain',
'sample_id': 'SA-1612348',
'start_position': '117859738',
'end_position': '117878968',
'copy_number': 7.0,
'gene': 'RAD21',
'chromosome': 'chr8',
'interpretation': 'Pathogenic',
'attributes': {'number-of-exons': '13 of 13', 'ratio': 2.69,
'interpretation': 'known', 'status': 'partial amplification'}
}]
}
expected_results_multiple_samples = {
'CopyNumbers': [{
'status': 'amplification',
'sample_id': 'SA-1612348',
'start_position': '58093932',
'end_position': '58188144',
'copy_number': 44.0,
'gene': 'CDK4',
'chromosome': 'chr12',
'interpretation': 'Pathogenic',
'attributes': {'number-of-exons': '7 of 7', 'ratio': 11.63, 'interpretation': 'known',
'status': 'amplification'}
}, {
'status': 'gain',
'sample_id': 'SA-1612348',
'start_position': '41853880',
'end_position': '41956362',
'copy_number': 6.0,
'gene': 'CCND3',
'chromosome': 'chr6',
'interpretation': 'Likely pathogenic',
'attributes': {'number-of-exons': '5 of 5', 'ratio': 2.17, 'interpretation': 'likely',
'status': 'amplification'}
}, {
'status': 'loss',
'sample_id': 'SA-1612348',
'start_position': '128706589',
'end_position': '128801451',
'copy_number': 41.0,
'gene': 'MYC',
'chromosome': 'chr8',
'interpretation': 'Uncertain significance',
'attributes': {'number-of-exons': '5 of 5', 'ratio': 10.34, 'interpretation': 'unknown',
'status': 'loss'}
}, {
'status': 'partial_loss',
'sample_id': 'SA-1612348',
'start_position': '37138078',
'end_position': '37141867',
'copy_number': 6.0,
'gene': 'PIM1',
'chromosome': 'chr6',
'interpretation': 'other',
'attributes': {'number-of-exons': '7 of 7', 'ratio': 2.14, 'interpretation': 'ambiguous',
'status': 'loss'}
}, {
'status': 'gain',
'sample_id': 'sample1',
'start_position': '117859738',
'end_position': '117878968',
'copy_number': 7.0,
'gene': 'RAD21',
'chromosome': 'chr8',
'interpretation': 'Pathogenic',
'attributes': {'number-of-exons': '13 of 13', 'ratio': 2.69,
'interpretation': 'known', 'status': 'partial amplification'}
}]
}
foundation_source_dict = {
'FinalReport': {
'PMI': {
'LastName': 'doe',
'FirstName': 'jane',
'MRN': '1234',
'Gender': 'Female',
'DOB': '1970-01-01',
'CollDate': '2000-01-01',
'SubmittedDiagnosis': 'Cancer'
},
'Sample': {
'TestType': 'Test 1'
}
},
'variant-report': {
'samples': {
'sample': {
'@name': 'SA-1612348'
}
},
'short-variants': {
'short-variant': [
{
'@gene': 'gene1',
'@cds-effect': '229C>A',
'@functional-effect': 'missense',
'@allele-fraction': 0.488,
'@position': 'chr1:100',
'@depth': 200,
'@transcript': 'NM_001',
'@status': 'known',
'@protein-effect': 'R77S'
}
]
},
'copy-number-alterations': {
'copy-number-alteration': [
{
'@gene': 'CDK4',
'@position': 'chr12:58093932-58188144',
'@copy-number': '44',
'@equivocal': 'false',
'@ratio': 11.63,
'@status': 'known',
'@type': 'amplification',
'@number-of-exons': '7 of 7',
'dna-evidence': {
'@sample': 'SA-1612348'
}
},
{
'@gene': 'CCND3',
'@position': 'chr6:41853880-41956362',
'@copy-number': '6',
'@equivocal': 'true',
'@ratio': 2.17,
'@status': 'likely',
'@type': 'amplification',
'@number-of-exons': '5 of 5',
'dna-evidence': {
'@sample': 'SA-1612348'
}
},
{
'@gene': 'MYC',
'@position': 'chr8:128706589-128801451',
'@copy-number': '41',
'@equivocal': 'false',
'@ratio': 10.34,
'@status': 'unknown',
'@type': 'loss',
'@number-of-exons': '5 of 5',
'dna-evidence': {
'@sample': 'SA-1612348'
}
},
{
'@gene': 'PIM1',
'@position': 'chr6:37138078-37141867',
'@copy-number': '6',
'@equivocal': 'true',
'@ratio': 2.14,
'@status': 'ambiguous',
'@type': 'loss',
'@number-of-exons': '7 of 7',
'dna-evidence': {
'@sample': 'SA-1612348'
}
},
{
'@gene': 'RAD21',
'@position': 'chr8:117859738-117878968',
'@copy-number': '7',
'@equivocal': 'true',
'@ratio': 2.69,
'@status': 'known',
'@type': 'partial amplification',
'@number-of-exons': '13 of 13'
}
]
},
'rearrangements': {
'rearrangement': [
{
'@status': 'known',
'@targeted-gene': 'CDK4',
'@type': 'truncation',
'@pos1': 'ch17:29557687-29887856',
'@pos2': 'ch6:66426718-66427149'
}
]
},
'biomarkers': {
'microsatellite-instability': {
'@status': 'MSS'
},
'tumor-mutation-burden': {
'@status': 'low'
}
}
}
}
foundation_source_dict_multiple_samples = {
'FinalReport': {
'PMI': {
'LastName': 'doe',
'FirstName': 'jane',
'MRN': '1234',
'Gender': 'Female',
'DOB': '1970-01-01',
'CollDate': '2000-01-01',
'SubmittedDiagnosis': 'Cancer'
},
'Sample': {
'TestType': 'Test 1'
}
},
'variant-report': {
'samples': {
'sample': [
{
'@bait-set': 'D2',
'@mean-exon-depth': '811.98',
'@name': 'sample1',
'@nucleic-acid-type': 'DNA'
},
{
'@bait-set': 'R2',
'@mean-exon-depth': '413.25',
'@name': 'sample2',
'@nucleic-acid-type': 'RNA'
}
]
},
'short-variants': {
'short-variant': [
{
'@gene': 'gene1',
'@cds-effect': '229C>A',
'@functional-effect': 'missense',
'@allele-fraction': 0.488,
'@position': 'chr1:100',
'@depth': 200,
'@transcript': 'NM_001',
'@status': 'known',
'@protein-effect': 'R77S'
}
]
},
'copy-number-alterations': {
'copy-number-alteration': [
{
'@gene': 'CDK4',
'@position': 'chr12:58093932-58188144',
'@copy-number': '44',
'@equivocal': 'false',
'@ratio': 11.63,
'@status': 'known',
'@type': 'amplification',
'@number-of-exons': '7 of 7',
'dna-evidence': {
'@sample': 'SA-1612348'
}
},
{
'@gene': 'CCND3',
'@position': 'chr6:41853880-41956362',
'@copy-number': '6',
'@equivocal': 'true',
'@ratio': 2.17,
'@status': 'likely',
'@type': 'amplification',
'@number-of-exons': '5 of 5',
'dna-evidence': {
'@sample': 'SA-1612348'
}
},
{
'@gene': 'MYC',
'@position': 'chr8:128706589-128801451',
'@copy-number': '41',
'@equivocal': 'false',
'@ratio': 10.34,
'@status': 'unknown',
'@type': 'loss',
'@number-of-exons': '5 of 5',
'dna-evidence': {
'@sample': 'SA-1612348'
}
},
{
'@gene': 'PIM1',
'@position': 'chr6:37138078-37141867',
'@copy-number': '6',
'@equivocal': 'true',
'@ratio': 2.14,
'@status': 'ambiguous',
'@type': 'loss',
'@number-of-exons': '7 of 7',
'dna-evidence': {
'@sample': 'SA-1612348'
}
},
{
'@gene': 'RAD21',
'@position': 'chr8:117859738-117878968',
'@copy-number': '7',
'@equivocal': 'true',
'@ratio': 2.69,
'@status': 'known',
'@type': 'partial amplification',
'@number-of-exons': '13 of 13'
}
]
},
'rearrangements': {
'rearrangement': [
{
'@status': 'known',
'@targeted-gene': 'CDK4',
'@type': 'truncation',
'@pos1': 'ch17:29557687-29887856',
'@pos2': 'ch6:66426718-66427149'
}
]
},
'biomarkers': {
'microsatellite-instability': {
'@status': 'MSS'
},
'tumor-mutation-burden': {
'@status': 'low'
}
}
}
}
class ConvertTest(TestCase):
def test_convert(self):
cnv_resources = extract_copy_numbers(foundation_source_dict)
self.maxDiff = None
self.assertDictEqual(expected_results, cnv_resources)
def test_convert_with_multiple_samples(self):
cnv_resources = extract_copy_numbers(foundation_source_dict_multiple_samples)
self.maxDiff = None
self.assertDictEqual(expected_results_multiple_samples, cnv_resources)
def test_calculate_status(self):
self.assertEqual('gain', calculate_status('true', 'amplification'))
self.assertEqual('amplification', calculate_status('false', 'amplification'))
self.assertEqual('partial_loss', calculate_status('true', 'loss'))
self.assertEqual('loss', calculate_status('false', 'loss'))
self.assertEqual('gain', calculate_status('false', 'partial amplification'))
self.assertEqual('gain', calculate_status('true', 'partial amplification'))
self.assertEqual('', calculate_status('true', 'fred'))
def test_calculate_interpretation(self):
self.assertEqual('Pathogenic', calculate_interpretation('known'))
self.assertEqual('Likely pathogenic', calculate_interpretation('likely'))
self.assertEqual('Uncertain significance', calculate_interpretation('unknown'))
self.assertEqual('other', calculate_interpretation('ambiguous'))
self.assertEqual('', calculate_interpretation('fred'))
def test_gather_attributes_with_partial_amplification(self):
copy_number = {
'@gene': 'RAD21',
'@position': 'chr8:117859738-117878968',
'@copy-number': '7',
'@equivocal': 'true',
'@ratio': 2.69,
'@status': 'known',
'@type': 'partial amplification',
'@number-of-exons': '13 of 13',
'dna-evidence': {
'@sample': 'SA-1612348'
}
}
self.assertEqual(
{'number-of-exons': '13 of 13', 'status': 'partial amplification', 'ratio': 2.69,
'interpretation': 'known'}, gather_attributes(copy_number))
def test_gather_attributes_with_no_exons(self):
copy_number = {
'@gene': 'RAD21',
'@position': 'chr8:117859738-117878968',
'@copy-number': '7',
'@equivocal': 'true',
'@ratio': 2.69,
'@status': 'known',
'@type': 'loss',
'dna-evidence': {
'@sample': 'SA-1612348'
}
}
self.assertEqual({'ratio': 2.69, 'interpretation': 'known', 'status': 'loss'}, gather_attributes(copy_number))
def test_gather_attributes_with_no_ratio(self):
copy_number = {
'@gene': 'RAD21',
'@position': 'chr8:117859738-117878968',
'@copy-number': '7',
'@equivocal': 'true',
'@status': 'known',
'@type': 'loss',
'dna-evidence': {
'@sample': 'SA-1612348'
}
}
self.assertEqual({'interpretation': 'known', 'status': 'loss'}, gather_attributes(copy_number))
def test_gather_attributes_with_no_status(self):
copy_number = {
'@gene': 'RAD21',
'@position': 'chr8:117859738-117878968',
'@copy-number': '7',
'@equivocal': 'true',
'@type': 'loss',
'dna-evidence': {
'@sample': 'SA-1612348'
}
}
self.assertEqual({'status': 'loss'}, gather_attributes(copy_number))
def test_gather_attributes_with_no_type(self):
copy_number = {
'@gene': 'RAD21',
'@position': 'chr8:117859738-117878968',
'@copy-number': '7',
'@equivocal': 'true',
'dna-evidence': {
'@sample': 'SA-1612348'
}
}
self.assertEqual({}, gather_attributes(copy_number))
def test_extract_samples_empty_sample(self):
samples = {
'samples': {
'sample': [
]
}
}
self.assertIsNone(extract_sample(samples))
def test_extract_samples_missing_dna_sample(self):
samples = {
'samples': {
'sample': [
{
'@bait-set': 'D2',
'@mean-exon-depth': '811.98',
'@name': 'sample1',
'@nucleic-acid-type': 'NOT-DNA'
},
{
'@bait-set': 'R2',
'@mean-exon-depth': '413.25',
'@name': 'sample2',
}
]
}
}
self.assertIsNone(extract_sample(samples))
def test_extract_samples_multiple(self):
samples = {
'samples': {
'sample': [
{
'@bait-set': 'D2',
'@mean-exon-depth': '811.98',
'@name': 'sample1',
'@nucleic-acid-type': 'DNA'
},
{
'@bait-set': 'R2',
'@mean-exon-depth': '413.25',
'@name': 'sample2',
'@nucleic-acid-type': 'RNA'
}
]
}
}
self.assertEquals('sample1', extract_sample(samples))
def test_extract_samples(self):
samples = {
'samples': {
'sample': {
'@name': 'SA-1612348'
}
}
}
self.assertEquals('SA-1612348', extract_sample(samples))
| 34.695413
| 118
| 0.417209
| 1,390
| 18,909
| 5.561871
| 0.133813
| 0.050446
| 0.036994
| 0.031949
| 0.864442
| 0.822403
| 0.804812
| 0.776226
| 0.775061
| 0.740008
| 0
| 0.095768
| 0.425141
| 18,909
| 544
| 119
| 34.759191
| 0.615455
| 0
| 0
| 0.702857
| 0
| 0
| 0.330266
| 0.032789
| 0
| 0
| 0
| 0
| 0.04381
| 1
| 0.024762
| false
| 0
| 0.011429
| 0
| 0.038095
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
9b3ec6077056ae20fc81b4b41c84c1875fd3fe4f
| 110
|
py
|
Python
|
doctable/legacy/__init__.py
|
devincornell/sqlitedocuments
|
16923bb3b91af5104140e49045efdc612afbc310
|
[
"MIT"
] | 1
|
2019-06-19T20:27:55.000Z
|
2019-06-19T20:27:55.000Z
|
doctable/legacy/__init__.py
|
devincornell/sqlitedocuments
|
16923bb3b91af5104140e49045efdc612afbc310
|
[
"MIT"
] | 21
|
2019-04-12T01:08:20.000Z
|
2020-11-09T18:28:41.000Z
|
doctable/legacy/__init__.py
|
devincornell/sqlitedocuments
|
16923bb3b91af5104140e49045efdc612afbc310
|
[
"MIT"
] | null | null | null |
#from .docparser import DocParser
from .doctablelegacy import DocTableLegacy
from .docparser import DocParser
| 27.5
| 42
| 0.854545
| 12
| 110
| 7.833333
| 0.333333
| 0.276596
| 0.404255
| 0.595745
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.109091
| 110
| 3
| 43
| 36.666667
| 0.959184
| 0.290909
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 0
| 0
|
0
| 7
|
9b43e6f6b7338045e9872812f074d22d942ec840
| 68,613
|
py
|
Python
|
benchmarks/SimResults/combinations_spec_locality/oldstuff/cmp_bwavesgccmcfhmmer/power.py
|
TugberkArkose/MLScheduler
|
e493b6cbf7b9d29a2c9300d7dd6f0c2f102e4061
|
[
"Unlicense"
] | null | null | null |
benchmarks/SimResults/combinations_spec_locality/oldstuff/cmp_bwavesgccmcfhmmer/power.py
|
TugberkArkose/MLScheduler
|
e493b6cbf7b9d29a2c9300d7dd6f0c2f102e4061
|
[
"Unlicense"
] | null | null | null |
benchmarks/SimResults/combinations_spec_locality/oldstuff/cmp_bwavesgccmcfhmmer/power.py
|
TugberkArkose/MLScheduler
|
e493b6cbf7b9d29a2c9300d7dd6f0c2f102e4061
|
[
"Unlicense"
] | null | null | null |
power = {'BUSES': {'Area': 1.33155,
'Bus/Area': 1.33155,
'Bus/Gate Leakage': 0.00662954,
'Bus/Peak Dynamic': 0.0,
'Bus/Runtime Dynamic': 0.0,
'Bus/Subthreshold Leakage': 0.0691322,
'Bus/Subthreshold Leakage with power gating': 0.0259246,
'Gate Leakage': 0.00662954,
'Peak Dynamic': 0.0,
'Runtime Dynamic': 0.0,
'Subthreshold Leakage': 0.0691322,
'Subthreshold Leakage with power gating': 0.0259246},
'Core': [{'Area': 32.6082,
'Execution Unit/Area': 8.2042,
'Execution Unit/Complex ALUs/Area': 0.235435,
'Execution Unit/Complex ALUs/Gate Leakage': 0.0132646,
'Execution Unit/Complex ALUs/Peak Dynamic': 4.72345e-06,
'Execution Unit/Complex ALUs/Runtime Dynamic': 0.202693,
'Execution Unit/Complex ALUs/Subthreshold Leakage': 0.20111,
'Execution Unit/Complex ALUs/Subthreshold Leakage with power gating': 0.0754163,
'Execution Unit/Floating Point Units/Area': 4.6585,
'Execution Unit/Floating Point Units/Gate Leakage': 0.0656156,
'Execution Unit/Floating Point Units/Peak Dynamic': 2.02403e-05,
'Execution Unit/Floating Point Units/Runtime Dynamic': 0.304033,
'Execution Unit/Floating Point Units/Subthreshold Leakage': 0.994829,
'Execution Unit/Floating Point Units/Subthreshold Leakage with power gating': 0.373061,
'Execution Unit/Gate Leakage': 0.122718,
'Execution Unit/Instruction Scheduler/Area': 2.17927,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Area': 0.328073,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Gate Leakage': 0.00115349,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Peak Dynamic': 1.20978,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Runtime Dynamic': 0.353269,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Subthreshold Leakage': 0.017004,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Subthreshold Leakage with power gating': 0.00962066,
'Execution Unit/Instruction Scheduler/Gate Leakage': 0.00730101,
'Execution Unit/Instruction Scheduler/Instruction Window/Area': 1.00996,
'Execution Unit/Instruction Scheduler/Instruction Window/Gate Leakage': 0.00529112,
'Execution Unit/Instruction Scheduler/Instruction Window/Peak Dynamic': 2.07911,
'Execution Unit/Instruction Scheduler/Instruction Window/Runtime Dynamic': 0.611735,
'Execution Unit/Instruction Scheduler/Instruction Window/Subthreshold Leakage': 0.0800117,
'Execution Unit/Instruction Scheduler/Instruction Window/Subthreshold Leakage with power gating': 0.0455351,
'Execution Unit/Instruction Scheduler/Peak Dynamic': 4.84781,
'Execution Unit/Instruction Scheduler/ROB/Area': 0.841232,
'Execution Unit/Instruction Scheduler/ROB/Gate Leakage': 0.000856399,
'Execution Unit/Instruction Scheduler/ROB/Peak Dynamic': 1.55892,
'Execution Unit/Instruction Scheduler/ROB/Runtime Dynamic': 0.350847,
'Execution Unit/Instruction Scheduler/ROB/Subthreshold Leakage': 0.0178624,
'Execution Unit/Instruction Scheduler/ROB/Subthreshold Leakage with power gating': 0.00897339,
'Execution Unit/Instruction Scheduler/Runtime Dynamic': 1.31585,
'Execution Unit/Instruction Scheduler/Subthreshold Leakage': 0.114878,
'Execution Unit/Instruction Scheduler/Subthreshold Leakage with power gating': 0.0641291,
'Execution Unit/Integer ALUs/Area': 0.47087,
'Execution Unit/Integer ALUs/Gate Leakage': 0.0265291,
'Execution Unit/Integer ALUs/Peak Dynamic': 0.349188,
'Execution Unit/Integer ALUs/Runtime Dynamic': 0.101344,
'Execution Unit/Integer ALUs/Subthreshold Leakage': 0.40222,
'Execution Unit/Integer ALUs/Subthreshold Leakage with power gating': 0.150833,
'Execution Unit/Peak Dynamic': 5.56097,
'Execution Unit/Register Files/Area': 0.570804,
'Execution Unit/Register Files/Floating Point RF/Area': 0.208131,
'Execution Unit/Register Files/Floating Point RF/Gate Leakage': 0.000232788,
'Execution Unit/Register Files/Floating Point RF/Peak Dynamic': 3.82383e-06,
'Execution Unit/Register Files/Floating Point RF/Runtime Dynamic': 0.0128063,
'Execution Unit/Register Files/Floating Point RF/Subthreshold Leakage': 0.00399698,
'Execution Unit/Register Files/Floating Point RF/Subthreshold Leakage with power gating': 0.00176968,
'Execution Unit/Register Files/Gate Leakage': 0.000622708,
'Execution Unit/Register Files/Integer RF/Area': 0.362673,
'Execution Unit/Register Files/Integer RF/Gate Leakage': 0.00038992,
'Execution Unit/Register Files/Integer RF/Peak Dynamic': 0.0926074,
'Execution Unit/Register Files/Integer RF/Runtime Dynamic': 0.0947103,
'Execution Unit/Register Files/Integer RF/Subthreshold Leakage': 0.00614175,
'Execution Unit/Register Files/Integer RF/Subthreshold Leakage with power gating': 0.00246675,
'Execution Unit/Register Files/Peak Dynamic': 0.0926113,
'Execution Unit/Register Files/Runtime Dynamic': 0.107517,
'Execution Unit/Register Files/Subthreshold Leakage': 0.0101387,
'Execution Unit/Register Files/Subthreshold Leakage with power gating': 0.00423643,
'Execution Unit/Results Broadcast Bus/Area Overhead': 0.0442632,
'Execution Unit/Results Broadcast Bus/Gate Leakage': 0.00607074,
'Execution Unit/Results Broadcast Bus/Peak Dynamic': 0.223779,
'Execution Unit/Results Broadcast Bus/Runtime Dynamic': 0.574938,
'Execution Unit/Results Broadcast Bus/Subthreshold Leakage': 0.0920413,
'Execution Unit/Results Broadcast Bus/Subthreshold Leakage with power gating': 0.0345155,
'Execution Unit/Runtime Dynamic': 2.60638,
'Execution Unit/Subthreshold Leakage': 1.83518,
'Execution Unit/Subthreshold Leakage with power gating': 0.709678,
'Gate Leakage': 0.372997,
'Instruction Fetch Unit/Area': 5.86007,
'Instruction Fetch Unit/Branch Predictor/Area': 0.138516,
'Instruction Fetch Unit/Branch Predictor/Chooser/Area': 0.0435221,
'Instruction Fetch Unit/Branch Predictor/Chooser/Gate Leakage': 0.000278362,
'Instruction Fetch Unit/Branch Predictor/Chooser/Peak Dynamic': 0.0168831,
'Instruction Fetch Unit/Branch Predictor/Chooser/Runtime Dynamic': 0.00399087,
'Instruction Fetch Unit/Branch Predictor/Chooser/Subthreshold Leakage': 0.00759719,
'Instruction Fetch Unit/Branch Predictor/Chooser/Subthreshold Leakage with power gating': 0.0039236,
'Instruction Fetch Unit/Branch Predictor/Gate Leakage': 0.000757657,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Area': 0.0435221,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Gate Leakage': 0.000278362,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Peak Dynamic': 0.0168831,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Runtime Dynamic': 0.00399087,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Subthreshold Leakage': 0.00759719,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Subthreshold Leakage with power gating': 0.0039236,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Area': 0.0257064,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Gate Leakage': 0.000154548,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Peak Dynamic': 0.0142575,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Runtime Dynamic': 0.00349451,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Subthreshold Leakage': 0.00384344,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Subthreshold Leakage with power gating': 0.00198631,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Area': 0.0151917,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Gate Leakage': 8.00196e-05,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Peak Dynamic': 0.00527447,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Runtime Dynamic': 0.00136288,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Subthreshold Leakage': 0.00181347,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Subthreshold Leakage with power gating': 0.000957045,
'Instruction Fetch Unit/Branch Predictor/Peak Dynamic': 0.0597838,
'Instruction Fetch Unit/Branch Predictor/RAS/Area': 0.0105732,
'Instruction Fetch Unit/Branch Predictor/RAS/Gate Leakage': 4.63858e-05,
'Instruction Fetch Unit/Branch Predictor/RAS/Peak Dynamic': 0.0117602,
'Instruction Fetch Unit/Branch Predictor/RAS/Runtime Dynamic': 0.00136052,
'Instruction Fetch Unit/Branch Predictor/RAS/Subthreshold Leakage': 0.000932505,
'Instruction Fetch Unit/Branch Predictor/RAS/Subthreshold Leakage with power gating': 0.000494733,
'Instruction Fetch Unit/Branch Predictor/Runtime Dynamic': 0.0128368,
'Instruction Fetch Unit/Branch Predictor/Subthreshold Leakage': 0.0199703,
'Instruction Fetch Unit/Branch Predictor/Subthreshold Leakage with power gating': 0.0103282,
'Instruction Fetch Unit/Branch Target Buffer/Area': 0.64954,
'Instruction Fetch Unit/Branch Target Buffer/Gate Leakage': 0.00272758,
'Instruction Fetch Unit/Branch Target Buffer/Peak Dynamic': 0.177867,
'Instruction Fetch Unit/Branch Target Buffer/Runtime Dynamic': 0.0376042,
'Instruction Fetch Unit/Branch Target Buffer/Subthreshold Leakage': 0.0811682,
'Instruction Fetch Unit/Branch Target Buffer/Subthreshold Leakage with power gating': 0.0435357,
'Instruction Fetch Unit/Gate Leakage': 0.0590479,
'Instruction Fetch Unit/Instruction Buffer/Area': 0.0226323,
'Instruction Fetch Unit/Instruction Buffer/Gate Leakage': 6.83558e-05,
'Instruction Fetch Unit/Instruction Buffer/Peak Dynamic': 0.606827,
'Instruction Fetch Unit/Instruction Buffer/Runtime Dynamic': 0.0910475,
'Instruction Fetch Unit/Instruction Buffer/Subthreshold Leakage': 0.00151885,
'Instruction Fetch Unit/Instruction Buffer/Subthreshold Leakage with power gating': 0.000701682,
'Instruction Fetch Unit/Instruction Cache/Area': 3.14635,
'Instruction Fetch Unit/Instruction Cache/Gate Leakage': 0.029931,
'Instruction Fetch Unit/Instruction Cache/Peak Dynamic': 5.7914,
'Instruction Fetch Unit/Instruction Cache/Runtime Dynamic': 0.343514,
'Instruction Fetch Unit/Instruction Cache/Subthreshold Leakage': 0.367022,
'Instruction Fetch Unit/Instruction Cache/Subthreshold Leakage with power gating': 0.180386,
'Instruction Fetch Unit/Instruction Decoder/Area': 1.85799,
'Instruction Fetch Unit/Instruction Decoder/Gate Leakage': 0.0222493,
'Instruction Fetch Unit/Instruction Decoder/Peak Dynamic': 1.37404,
'Instruction Fetch Unit/Instruction Decoder/Runtime Dynamic': 0.309238,
'Instruction Fetch Unit/Instruction Decoder/Subthreshold Leakage': 0.442943,
'Instruction Fetch Unit/Instruction Decoder/Subthreshold Leakage with power gating': 0.166104,
'Instruction Fetch Unit/Peak Dynamic': 8.29529,
'Instruction Fetch Unit/Runtime Dynamic': 0.79424,
'Instruction Fetch Unit/Subthreshold Leakage': 0.932587,
'Instruction Fetch Unit/Subthreshold Leakage with power gating': 0.408542,
'L2/Area': 4.53318,
'L2/Gate Leakage': 0.015464,
'L2/Peak Dynamic': 0.070497,
'L2/Runtime Dynamic': 0.0157942,
'L2/Subthreshold Leakage': 0.834142,
'L2/Subthreshold Leakage with power gating': 0.401066,
'Load Store Unit/Area': 8.80969,
'Load Store Unit/Data Cache/Area': 6.84535,
'Load Store Unit/Data Cache/Gate Leakage': 0.0279261,
'Load Store Unit/Data Cache/Peak Dynamic': 3.99402,
'Load Store Unit/Data Cache/Runtime Dynamic': 1.34832,
'Load Store Unit/Data Cache/Subthreshold Leakage': 0.527675,
'Load Store Unit/Data Cache/Subthreshold Leakage with power gating': 0.25085,
'Load Store Unit/Gate Leakage': 0.0351387,
'Load Store Unit/LoadQ/Area': 0.0836782,
'Load Store Unit/LoadQ/Gate Leakage': 0.00059896,
'Load Store Unit/LoadQ/Peak Dynamic': 0.0891923,
'Load Store Unit/LoadQ/Runtime Dynamic': 0.0891924,
'Load Store Unit/LoadQ/Subthreshold Leakage': 0.00941961,
'Load Store Unit/LoadQ/Subthreshold Leakage with power gating': 0.00536918,
'Load Store Unit/Peak Dynamic': 4.41692,
'Load Store Unit/Runtime Dynamic': 1.87738,
'Load Store Unit/StoreQ/Area': 0.322079,
'Load Store Unit/StoreQ/Gate Leakage': 0.00329971,
'Load Store Unit/StoreQ/Peak Dynamic': 0.219933,
'Load Store Unit/StoreQ/Runtime Dynamic': 0.439866,
'Load Store Unit/StoreQ/Subthreshold Leakage': 0.0345621,
'Load Store Unit/StoreQ/Subthreshold Leakage with power gating': 0.0197004,
'Load Store Unit/Subthreshold Leakage': 0.591622,
'Load Store Unit/Subthreshold Leakage with power gating': 0.283406,
'Memory Management Unit/Area': 0.434579,
'Memory Management Unit/Dtlb/Area': 0.0879726,
'Memory Management Unit/Dtlb/Gate Leakage': 0.00088729,
'Memory Management Unit/Dtlb/Peak Dynamic': 0.0780549,
'Memory Management Unit/Dtlb/Runtime Dynamic': 0.0788296,
'Memory Management Unit/Dtlb/Subthreshold Leakage': 0.0155699,
'Memory Management Unit/Dtlb/Subthreshold Leakage with power gating': 0.00887485,
'Memory Management Unit/Gate Leakage': 0.00813591,
'Memory Management Unit/Itlb/Area': 0.301552,
'Memory Management Unit/Itlb/Gate Leakage': 0.00393464,
'Memory Management Unit/Itlb/Peak Dynamic': 0.360088,
'Memory Management Unit/Itlb/Runtime Dynamic': 0.0571558,
'Memory Management Unit/Itlb/Subthreshold Leakage': 0.0413758,
'Memory Management Unit/Itlb/Subthreshold Leakage with power gating': 0.0235842,
'Memory Management Unit/Peak Dynamic': 0.653529,
'Memory Management Unit/Runtime Dynamic': 0.135985,
'Memory Management Unit/Subthreshold Leakage': 0.0769113,
'Memory Management Unit/Subthreshold Leakage with power gating': 0.0399462,
'Peak Dynamic': 23.5589,
'Renaming Unit/Area': 0.369768,
'Renaming Unit/FP Front End RAT/Area': 0.168486,
'Renaming Unit/FP Front End RAT/Gate Leakage': 0.00489731,
'Renaming Unit/FP Front End RAT/Peak Dynamic': 3.33511,
'Renaming Unit/FP Front End RAT/Runtime Dynamic': 1.3095e-05,
'Renaming Unit/FP Front End RAT/Subthreshold Leakage': 0.0437281,
'Renaming Unit/FP Front End RAT/Subthreshold Leakage with power gating': 0.024925,
'Renaming Unit/Free List/Area': 0.0414755,
'Renaming Unit/Free List/Gate Leakage': 4.15911e-05,
'Renaming Unit/Free List/Peak Dynamic': 0.0401324,
'Renaming Unit/Free List/Runtime Dynamic': 0.0180644,
'Renaming Unit/Free List/Subthreshold Leakage': 0.000670426,
'Renaming Unit/Free List/Subthreshold Leakage with power gating': 0.000377987,
'Renaming Unit/Gate Leakage': 0.00863632,
'Renaming Unit/Int Front End RAT/Area': 0.114751,
'Renaming Unit/Int Front End RAT/Gate Leakage': 0.00038343,
'Renaming Unit/Int Front End RAT/Peak Dynamic': 0.86945,
'Renaming Unit/Int Front End RAT/Runtime Dynamic': 0.182904,
'Renaming Unit/Int Front End RAT/Subthreshold Leakage': 0.00611897,
'Renaming Unit/Int Front End RAT/Subthreshold Leakage with power gating': 0.00348781,
'Renaming Unit/Peak Dynamic': 4.56169,
'Renaming Unit/Runtime Dynamic': 0.200982,
'Renaming Unit/Subthreshold Leakage': 0.070483,
'Renaming Unit/Subthreshold Leakage with power gating': 0.0362779,
'Runtime Dynamic': 5.63075,
'Subthreshold Leakage': 6.21877,
'Subthreshold Leakage with power gating': 2.58311},
{'Area': 32.0201,
'Execution Unit/Area': 7.68434,
'Execution Unit/Complex ALUs/Area': 0.235435,
'Execution Unit/Complex ALUs/Gate Leakage': 0.0132646,
'Execution Unit/Complex ALUs/Peak Dynamic': 2.83407e-06,
'Execution Unit/Complex ALUs/Runtime Dynamic': 0.202691,
'Execution Unit/Complex ALUs/Subthreshold Leakage': 0.20111,
'Execution Unit/Complex ALUs/Subthreshold Leakage with power gating': 0.0754163,
'Execution Unit/Floating Point Units/Area': 4.6585,
'Execution Unit/Floating Point Units/Gate Leakage': 0.0656156,
'Execution Unit/Floating Point Units/Peak Dynamic': 1.77103e-05,
'Execution Unit/Floating Point Units/Runtime Dynamic': 0.304033,
'Execution Unit/Floating Point Units/Subthreshold Leakage': 0.994829,
'Execution Unit/Floating Point Units/Subthreshold Leakage with power gating': 0.373061,
'Execution Unit/Gate Leakage': 0.120359,
'Execution Unit/Instruction Scheduler/Area': 1.66526,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Area': 0.275653,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Gate Leakage': 0.000977433,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Peak Dynamic': 1.04181,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Runtime Dynamic': 0.532994,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Subthreshold Leakage': 0.0143453,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Subthreshold Leakage with power gating': 0.00810519,
'Execution Unit/Instruction Scheduler/Gate Leakage': 0.00568913,
'Execution Unit/Instruction Scheduler/Instruction Window/Area': 0.805223,
'Execution Unit/Instruction Scheduler/Instruction Window/Gate Leakage': 0.00414562,
'Execution Unit/Instruction Scheduler/Instruction Window/Peak Dynamic': 1.6763,
'Execution Unit/Instruction Scheduler/Instruction Window/Runtime Dynamic': 0.8597,
'Execution Unit/Instruction Scheduler/Instruction Window/Subthreshold Leakage': 0.0625755,
'Execution Unit/Instruction Scheduler/Instruction Window/Subthreshold Leakage with power gating': 0.0355964,
'Execution Unit/Instruction Scheduler/Peak Dynamic': 3.82262,
'Execution Unit/Instruction Scheduler/ROB/Area': 0.584388,
'Execution Unit/Instruction Scheduler/ROB/Gate Leakage': 0.00056608,
'Execution Unit/Instruction Scheduler/ROB/Peak Dynamic': 1.10451,
'Execution Unit/Instruction Scheduler/ROB/Runtime Dynamic': 0.433948,
'Execution Unit/Instruction Scheduler/ROB/Subthreshold Leakage': 0.00906853,
'Execution Unit/Instruction Scheduler/ROB/Subthreshold Leakage with power gating': 0.00364446,
'Execution Unit/Instruction Scheduler/Runtime Dynamic': 1.82664,
'Execution Unit/Instruction Scheduler/Subthreshold Leakage': 0.0859892,
'Execution Unit/Instruction Scheduler/Subthreshold Leakage with power gating': 0.047346,
'Execution Unit/Integer ALUs/Area': 0.47087,
'Execution Unit/Integer ALUs/Gate Leakage': 0.0265291,
'Execution Unit/Integer ALUs/Peak Dynamic': 0.609588,
'Execution Unit/Integer ALUs/Runtime Dynamic': 0.101344,
'Execution Unit/Integer ALUs/Subthreshold Leakage': 0.40222,
'Execution Unit/Integer ALUs/Subthreshold Leakage with power gating': 0.150833,
'Execution Unit/Peak Dynamic': 5.01626,
'Execution Unit/Register Files/Area': 0.570804,
'Execution Unit/Register Files/Floating Point RF/Area': 0.208131,
'Execution Unit/Register Files/Floating Point RF/Gate Leakage': 0.000232788,
'Execution Unit/Register Files/Floating Point RF/Peak Dynamic': 3.34585e-06,
'Execution Unit/Register Files/Floating Point RF/Runtime Dynamic': 0.0223562,
'Execution Unit/Register Files/Floating Point RF/Subthreshold Leakage': 0.00399698,
'Execution Unit/Register Files/Floating Point RF/Subthreshold Leakage with power gating': 0.00176968,
'Execution Unit/Register Files/Gate Leakage': 0.000622708,
'Execution Unit/Register Files/Integer RF/Area': 0.362673,
'Execution Unit/Register Files/Integer RF/Gate Leakage': 0.00038992,
'Execution Unit/Register Files/Integer RF/Peak Dynamic': 0.161664,
'Execution Unit/Register Files/Integer RF/Runtime Dynamic': 0.165338,
'Execution Unit/Register Files/Integer RF/Subthreshold Leakage': 0.00614175,
'Execution Unit/Register Files/Integer RF/Subthreshold Leakage with power gating': 0.00246675,
'Execution Unit/Register Files/Peak Dynamic': 0.161668,
'Execution Unit/Register Files/Runtime Dynamic': 0.187694,
'Execution Unit/Register Files/Subthreshold Leakage': 0.0101387,
'Execution Unit/Register Files/Subthreshold Leakage with power gating': 0.00423643,
'Execution Unit/Results Broadcast Bus/Area Overhead': 0.0390912,
'Execution Unit/Results Broadcast Bus/Gate Leakage': 0.00537402,
'Execution Unit/Results Broadcast Bus/Peak Dynamic': 0.340582,
'Execution Unit/Results Broadcast Bus/Runtime Dynamic': 1.16849,
'Execution Unit/Results Broadcast Bus/Subthreshold Leakage': 0.081478,
'Execution Unit/Results Broadcast Bus/Subthreshold Leakage with power gating': 0.0305543,
'Execution Unit/Runtime Dynamic': 3.79089,
'Execution Unit/Subthreshold Leakage': 1.79543,
'Execution Unit/Subthreshold Leakage with power gating': 0.688821,
'Gate Leakage': 0.368936,
'Instruction Fetch Unit/Area': 5.85939,
'Instruction Fetch Unit/Branch Predictor/Area': 0.138516,
'Instruction Fetch Unit/Branch Predictor/Chooser/Area': 0.0435221,
'Instruction Fetch Unit/Branch Predictor/Chooser/Gate Leakage': 0.000278362,
'Instruction Fetch Unit/Branch Predictor/Chooser/Peak Dynamic': 0.0168831,
'Instruction Fetch Unit/Branch Predictor/Chooser/Runtime Dynamic': 0.00110511,
'Instruction Fetch Unit/Branch Predictor/Chooser/Subthreshold Leakage': 0.00759719,
'Instruction Fetch Unit/Branch Predictor/Chooser/Subthreshold Leakage with power gating': 0.0039236,
'Instruction Fetch Unit/Branch Predictor/Gate Leakage': 0.000757657,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Area': 0.0435221,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Gate Leakage': 0.000278362,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Peak Dynamic': 0.0168831,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Runtime Dynamic': 0.00110511,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Subthreshold Leakage': 0.00759719,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Subthreshold Leakage with power gating': 0.0039236,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Area': 0.0257064,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Gate Leakage': 0.000154548,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Peak Dynamic': 0.0142575,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Runtime Dynamic': 0.000958673,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Subthreshold Leakage': 0.00384344,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Subthreshold Leakage with power gating': 0.00198631,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Area': 0.0151917,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Gate Leakage': 8.00196e-05,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Peak Dynamic': 0.00527447,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Runtime Dynamic': 0.000368998,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Subthreshold Leakage': 0.00181347,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Subthreshold Leakage with power gating': 0.000957045,
'Instruction Fetch Unit/Branch Predictor/Peak Dynamic': 0.0597838,
'Instruction Fetch Unit/Branch Predictor/RAS/Area': 0.0105732,
'Instruction Fetch Unit/Branch Predictor/RAS/Gate Leakage': 4.63858e-05,
'Instruction Fetch Unit/Branch Predictor/RAS/Peak Dynamic': 0.0117602,
'Instruction Fetch Unit/Branch Predictor/RAS/Runtime Dynamic': 0.00237509,
'Instruction Fetch Unit/Branch Predictor/RAS/Subthreshold Leakage': 0.000932505,
'Instruction Fetch Unit/Branch Predictor/RAS/Subthreshold Leakage with power gating': 0.000494733,
'Instruction Fetch Unit/Branch Predictor/Runtime Dynamic': 0.00554398,
'Instruction Fetch Unit/Branch Predictor/Subthreshold Leakage': 0.0199703,
'Instruction Fetch Unit/Branch Predictor/Subthreshold Leakage with power gating': 0.0103282,
'Instruction Fetch Unit/Branch Target Buffer/Area': 0.64954,
'Instruction Fetch Unit/Branch Target Buffer/Gate Leakage': 0.00272758,
'Instruction Fetch Unit/Branch Target Buffer/Peak Dynamic': 0.177867,
'Instruction Fetch Unit/Branch Target Buffer/Runtime Dynamic': 0.0107341,
'Instruction Fetch Unit/Branch Target Buffer/Subthreshold Leakage': 0.0811682,
'Instruction Fetch Unit/Branch Target Buffer/Subthreshold Leakage with power gating': 0.0435357,
'Instruction Fetch Unit/Gate Leakage': 0.0589979,
'Instruction Fetch Unit/Instruction Buffer/Area': 0.0226323,
'Instruction Fetch Unit/Instruction Buffer/Gate Leakage': 6.83558e-05,
'Instruction Fetch Unit/Instruction Buffer/Peak Dynamic': 0.606827,
'Instruction Fetch Unit/Instruction Buffer/Runtime Dynamic': 0.158943,
'Instruction Fetch Unit/Instruction Buffer/Subthreshold Leakage': 0.00151885,
'Instruction Fetch Unit/Instruction Buffer/Subthreshold Leakage with power gating': 0.000701682,
'Instruction Fetch Unit/Instruction Cache/Area': 3.14635,
'Instruction Fetch Unit/Instruction Cache/Gate Leakage': 0.029931,
'Instruction Fetch Unit/Instruction Cache/Peak Dynamic': 6.43323,
'Instruction Fetch Unit/Instruction Cache/Runtime Dynamic': 0.345953,
'Instruction Fetch Unit/Instruction Cache/Subthreshold Leakage': 0.367022,
'Instruction Fetch Unit/Instruction Cache/Subthreshold Leakage with power gating': 0.180386,
'Instruction Fetch Unit/Instruction Decoder/Area': 1.85799,
'Instruction Fetch Unit/Instruction Decoder/Gate Leakage': 0.0222493,
'Instruction Fetch Unit/Instruction Decoder/Peak Dynamic': 1.37404,
'Instruction Fetch Unit/Instruction Decoder/Runtime Dynamic': 0.539843,
'Instruction Fetch Unit/Instruction Decoder/Subthreshold Leakage': 0.442943,
'Instruction Fetch Unit/Instruction Decoder/Subthreshold Leakage with power gating': 0.166104,
'Instruction Fetch Unit/Peak Dynamic': 8.96396,
'Instruction Fetch Unit/Runtime Dynamic': 1.06102,
'Instruction Fetch Unit/Subthreshold Leakage': 0.932286,
'Instruction Fetch Unit/Subthreshold Leakage with power gating': 0.40843,
'L2/Area': 4.53318,
'L2/Gate Leakage': 0.015464,
'L2/Peak Dynamic': 0.0445212,
'L2/Runtime Dynamic': 0.0304461,
'L2/Subthreshold Leakage': 0.834142,
'L2/Subthreshold Leakage with power gating': 0.401066,
'Load Store Unit/Area': 8.80901,
'Load Store Unit/Data Cache/Area': 6.84535,
'Load Store Unit/Data Cache/Gate Leakage': 0.0279261,
'Load Store Unit/Data Cache/Peak Dynamic': 8.41374,
'Load Store Unit/Data Cache/Runtime Dynamic': 3.48941,
'Load Store Unit/Data Cache/Subthreshold Leakage': 0.527675,
'Load Store Unit/Data Cache/Subthreshold Leakage with power gating': 0.25085,
'Load Store Unit/Gate Leakage': 0.0350888,
'Load Store Unit/LoadQ/Area': 0.0836782,
'Load Store Unit/LoadQ/Gate Leakage': 0.00059896,
'Load Store Unit/LoadQ/Peak Dynamic': 0.232181,
'Load Store Unit/LoadQ/Runtime Dynamic': 0.232181,
'Load Store Unit/LoadQ/Subthreshold Leakage': 0.00941961,
'Load Store Unit/LoadQ/Subthreshold Leakage with power gating': 0.00536918,
'Load Store Unit/Peak Dynamic': 9.51015,
'Load Store Unit/Runtime Dynamic': 4.86663,
'Load Store Unit/StoreQ/Area': 0.322079,
'Load Store Unit/StoreQ/Gate Leakage': 0.00329971,
'Load Store Unit/StoreQ/Peak Dynamic': 0.572518,
'Load Store Unit/StoreQ/Runtime Dynamic': 1.14504,
'Load Store Unit/StoreQ/Subthreshold Leakage': 0.0345621,
'Load Store Unit/StoreQ/Subthreshold Leakage with power gating': 0.0197004,
'Load Store Unit/Subthreshold Leakage': 0.591321,
'Load Store Unit/Subthreshold Leakage with power gating': 0.283293,
'Memory Management Unit/Area': 0.4339,
'Memory Management Unit/Dtlb/Area': 0.0879726,
'Memory Management Unit/Dtlb/Gate Leakage': 0.00088729,
'Memory Management Unit/Dtlb/Peak Dynamic': 0.203189,
'Memory Management Unit/Dtlb/Runtime Dynamic': 0.203854,
'Memory Management Unit/Dtlb/Subthreshold Leakage': 0.0155699,
'Memory Management Unit/Dtlb/Subthreshold Leakage with power gating': 0.00887485,
'Memory Management Unit/Gate Leakage': 0.00808595,
'Memory Management Unit/Itlb/Area': 0.301552,
'Memory Management Unit/Itlb/Gate Leakage': 0.00393464,
'Memory Management Unit/Itlb/Peak Dynamic': 0.399995,
'Memory Management Unit/Itlb/Runtime Dynamic': 0.0567237,
'Memory Management Unit/Itlb/Subthreshold Leakage': 0.0413758,
'Memory Management Unit/Itlb/Subthreshold Leakage with power gating': 0.0235842,
'Memory Management Unit/Peak Dynamic': 0.905146,
'Memory Management Unit/Runtime Dynamic': 0.260577,
'Memory Management Unit/Subthreshold Leakage': 0.0766103,
'Memory Management Unit/Subthreshold Leakage with power gating': 0.0398333,
'Peak Dynamic': 28.0295,
'Renaming Unit/Area': 0.303608,
'Renaming Unit/FP Front End RAT/Area': 0.131045,
'Renaming Unit/FP Front End RAT/Gate Leakage': 0.00351123,
'Renaming Unit/FP Front End RAT/Peak Dynamic': 2.51468,
'Renaming Unit/FP Front End RAT/Runtime Dynamic': 8.25667e-06,
'Renaming Unit/FP Front End RAT/Subthreshold Leakage': 0.0308571,
'Renaming Unit/FP Front End RAT/Subthreshold Leakage with power gating': 0.0175885,
'Renaming Unit/Free List/Area': 0.0340654,
'Renaming Unit/Free List/Gate Leakage': 2.5481e-05,
'Renaming Unit/Free List/Peak Dynamic': 0.0306032,
'Renaming Unit/Free List/Runtime Dynamic': 0.0240473,
'Renaming Unit/Free List/Subthreshold Leakage': 0.000370144,
'Renaming Unit/Free List/Subthreshold Leakage with power gating': 0.000201064,
'Renaming Unit/Gate Leakage': 0.00708398,
'Renaming Unit/Int Front End RAT/Area': 0.0941223,
'Renaming Unit/Int Front End RAT/Gate Leakage': 0.000283242,
'Renaming Unit/Int Front End RAT/Peak Dynamic': 0.731965,
'Renaming Unit/Int Front End RAT/Runtime Dynamic': 0.284773,
'Renaming Unit/Int Front End RAT/Subthreshold Leakage': 0.00435488,
'Renaming Unit/Int Front End RAT/Subthreshold Leakage with power gating': 0.00248228,
'Renaming Unit/Peak Dynamic': 3.58947,
'Renaming Unit/Runtime Dynamic': 0.308829,
'Renaming Unit/Subthreshold Leakage': 0.0552466,
'Renaming Unit/Subthreshold Leakage with power gating': 0.0276461,
'Runtime Dynamic': 10.3184,
'Subthreshold Leakage': 6.16288,
'Subthreshold Leakage with power gating': 2.55328},
{'Area': 32.0201,
'Execution Unit/Area': 7.68434,
'Execution Unit/Complex ALUs/Area': 0.235435,
'Execution Unit/Complex ALUs/Gate Leakage': 0.0132646,
'Execution Unit/Complex ALUs/Peak Dynamic': 0.0,
'Execution Unit/Complex ALUs/Runtime Dynamic': 0.202689,
'Execution Unit/Complex ALUs/Subthreshold Leakage': 0.20111,
'Execution Unit/Complex ALUs/Subthreshold Leakage with power gating': 0.0754163,
'Execution Unit/Floating Point Units/Area': 4.6585,
'Execution Unit/Floating Point Units/Gate Leakage': 0.0656156,
'Execution Unit/Floating Point Units/Peak Dynamic': 0.0,
'Execution Unit/Floating Point Units/Runtime Dynamic': 0.304033,
'Execution Unit/Floating Point Units/Subthreshold Leakage': 0.994829,
'Execution Unit/Floating Point Units/Subthreshold Leakage with power gating': 0.373061,
'Execution Unit/Gate Leakage': 0.120359,
'Execution Unit/Instruction Scheduler/Area': 1.66526,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Area': 0.275653,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Gate Leakage': 0.000977433,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Peak Dynamic': 1.04181,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Runtime Dynamic': 0.0908893,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Subthreshold Leakage': 0.0143453,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Subthreshold Leakage with power gating': 0.00810519,
'Execution Unit/Instruction Scheduler/Gate Leakage': 0.00568913,
'Execution Unit/Instruction Scheduler/Instruction Window/Area': 0.805223,
'Execution Unit/Instruction Scheduler/Instruction Window/Gate Leakage': 0.00414562,
'Execution Unit/Instruction Scheduler/Instruction Window/Peak Dynamic': 1.6763,
'Execution Unit/Instruction Scheduler/Instruction Window/Runtime Dynamic': 0.146601,
'Execution Unit/Instruction Scheduler/Instruction Window/Subthreshold Leakage': 0.0625755,
'Execution Unit/Instruction Scheduler/Instruction Window/Subthreshold Leakage with power gating': 0.0355964,
'Execution Unit/Instruction Scheduler/Peak Dynamic': 3.82262,
'Execution Unit/Instruction Scheduler/ROB/Area': 0.584388,
'Execution Unit/Instruction Scheduler/ROB/Gate Leakage': 0.00056608,
'Execution Unit/Instruction Scheduler/ROB/Peak Dynamic': 1.10451,
'Execution Unit/Instruction Scheduler/ROB/Runtime Dynamic': 0.0739993,
'Execution Unit/Instruction Scheduler/ROB/Subthreshold Leakage': 0.00906853,
'Execution Unit/Instruction Scheduler/ROB/Subthreshold Leakage with power gating': 0.00364446,
'Execution Unit/Instruction Scheduler/Runtime Dynamic': 0.31149,
'Execution Unit/Instruction Scheduler/Subthreshold Leakage': 0.0859892,
'Execution Unit/Instruction Scheduler/Subthreshold Leakage with power gating': 0.047346,
'Execution Unit/Integer ALUs/Area': 0.47087,
'Execution Unit/Integer ALUs/Gate Leakage': 0.0265291,
'Execution Unit/Integer ALUs/Peak Dynamic': 0.103951,
'Execution Unit/Integer ALUs/Runtime Dynamic': 0.101344,
'Execution Unit/Integer ALUs/Subthreshold Leakage': 0.40222,
'Execution Unit/Integer ALUs/Subthreshold Leakage with power gating': 0.150833,
'Execution Unit/Peak Dynamic': 4.02616,
'Execution Unit/Register Files/Area': 0.570804,
'Execution Unit/Register Files/Floating Point RF/Area': 0.208131,
'Execution Unit/Register Files/Floating Point RF/Gate Leakage': 0.000232788,
'Execution Unit/Register Files/Floating Point RF/Peak Dynamic': 0.0,
'Execution Unit/Register Files/Floating Point RF/Runtime Dynamic': 0.00381231,
'Execution Unit/Register Files/Floating Point RF/Subthreshold Leakage': 0.00399698,
'Execution Unit/Register Files/Floating Point RF/Subthreshold Leakage with power gating': 0.00176968,
'Execution Unit/Register Files/Gate Leakage': 0.000622708,
'Execution Unit/Register Files/Integer RF/Area': 0.362673,
'Execution Unit/Register Files/Integer RF/Gate Leakage': 0.00038992,
'Execution Unit/Register Files/Integer RF/Peak Dynamic': 0.0275678,
'Execution Unit/Register Files/Integer RF/Runtime Dynamic': 0.0281943,
'Execution Unit/Register Files/Integer RF/Subthreshold Leakage': 0.00614175,
'Execution Unit/Register Files/Integer RF/Subthreshold Leakage with power gating': 0.00246675,
'Execution Unit/Register Files/Peak Dynamic': 0.0275678,
'Execution Unit/Register Files/Runtime Dynamic': 0.0320066,
'Execution Unit/Register Files/Subthreshold Leakage': 0.0101387,
'Execution Unit/Register Files/Subthreshold Leakage with power gating': 0.00423643,
'Execution Unit/Results Broadcast Bus/Area Overhead': 0.0390912,
'Execution Unit/Results Broadcast Bus/Gate Leakage': 0.00537402,
'Execution Unit/Results Broadcast Bus/Peak Dynamic': 0.0580776,
'Execution Unit/Results Broadcast Bus/Runtime Dynamic': 0.169303,
'Execution Unit/Results Broadcast Bus/Subthreshold Leakage': 0.081478,
'Execution Unit/Results Broadcast Bus/Subthreshold Leakage with power gating': 0.0305543,
'Execution Unit/Runtime Dynamic': 1.12087,
'Execution Unit/Subthreshold Leakage': 1.79543,
'Execution Unit/Subthreshold Leakage with power gating': 0.688821,
'Gate Leakage': 0.368936,
'Instruction Fetch Unit/Area': 5.85939,
'Instruction Fetch Unit/Branch Predictor/Area': 0.138516,
'Instruction Fetch Unit/Branch Predictor/Chooser/Area': 0.0435221,
'Instruction Fetch Unit/Branch Predictor/Chooser/Gate Leakage': 0.000278362,
'Instruction Fetch Unit/Branch Predictor/Chooser/Peak Dynamic': 0.0168831,
'Instruction Fetch Unit/Branch Predictor/Chooser/Runtime Dynamic': 0.00047886,
'Instruction Fetch Unit/Branch Predictor/Chooser/Subthreshold Leakage': 0.00759719,
'Instruction Fetch Unit/Branch Predictor/Chooser/Subthreshold Leakage with power gating': 0.0039236,
'Instruction Fetch Unit/Branch Predictor/Gate Leakage': 0.000757657,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Area': 0.0435221,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Gate Leakage': 0.000278362,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Peak Dynamic': 0.0168831,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Runtime Dynamic': 0.00047886,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Subthreshold Leakage': 0.00759719,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Subthreshold Leakage with power gating': 0.0039236,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Area': 0.0257064,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Gate Leakage': 0.000154548,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Peak Dynamic': 0.0142575,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Runtime Dynamic': 0.000420961,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Subthreshold Leakage': 0.00384344,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Subthreshold Leakage with power gating': 0.00198631,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Area': 0.0151917,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Gate Leakage': 8.00196e-05,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Peak Dynamic': 0.00527447,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Runtime Dynamic': 0.00016508,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Subthreshold Leakage': 0.00181347,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Subthreshold Leakage with power gating': 0.000957045,
'Instruction Fetch Unit/Branch Predictor/Peak Dynamic': 0.0597838,
'Instruction Fetch Unit/Branch Predictor/RAS/Area': 0.0105732,
'Instruction Fetch Unit/Branch Predictor/RAS/Gate Leakage': 4.63858e-05,
'Instruction Fetch Unit/Branch Predictor/RAS/Peak Dynamic': 0.0117602,
'Instruction Fetch Unit/Branch Predictor/RAS/Runtime Dynamic': 0.000405014,
'Instruction Fetch Unit/Branch Predictor/RAS/Subthreshold Leakage': 0.000932505,
'Instruction Fetch Unit/Branch Predictor/RAS/Subthreshold Leakage with power gating': 0.000494733,
'Instruction Fetch Unit/Branch Predictor/Runtime Dynamic': 0.0017837,
'Instruction Fetch Unit/Branch Predictor/Subthreshold Leakage': 0.0199703,
'Instruction Fetch Unit/Branch Predictor/Subthreshold Leakage with power gating': 0.0103282,
'Instruction Fetch Unit/Branch Target Buffer/Area': 0.64954,
'Instruction Fetch Unit/Branch Target Buffer/Gate Leakage': 0.00272758,
'Instruction Fetch Unit/Branch Target Buffer/Peak Dynamic': 0.177867,
'Instruction Fetch Unit/Branch Target Buffer/Runtime Dynamic': 0.00445283,
'Instruction Fetch Unit/Branch Target Buffer/Subthreshold Leakage': 0.0811682,
'Instruction Fetch Unit/Branch Target Buffer/Subthreshold Leakage with power gating': 0.0435357,
'Instruction Fetch Unit/Gate Leakage': 0.0589979,
'Instruction Fetch Unit/Instruction Buffer/Area': 0.0226323,
'Instruction Fetch Unit/Instruction Buffer/Gate Leakage': 6.83558e-05,
'Instruction Fetch Unit/Instruction Buffer/Peak Dynamic': 0.606827,
'Instruction Fetch Unit/Instruction Buffer/Runtime Dynamic': 0.0271039,
'Instruction Fetch Unit/Instruction Buffer/Subthreshold Leakage': 0.00151885,
'Instruction Fetch Unit/Instruction Buffer/Subthreshold Leakage with power gating': 0.000701682,
'Instruction Fetch Unit/Instruction Cache/Area': 3.14635,
'Instruction Fetch Unit/Instruction Cache/Gate Leakage': 0.029931,
'Instruction Fetch Unit/Instruction Cache/Peak Dynamic': 1.72404,
'Instruction Fetch Unit/Instruction Cache/Runtime Dynamic': 0.0530174,
'Instruction Fetch Unit/Instruction Cache/Subthreshold Leakage': 0.367022,
'Instruction Fetch Unit/Instruction Cache/Subthreshold Leakage with power gating': 0.180386,
'Instruction Fetch Unit/Instruction Decoder/Area': 1.85799,
'Instruction Fetch Unit/Instruction Decoder/Gate Leakage': 0.0222493,
'Instruction Fetch Unit/Instruction Decoder/Peak Dynamic': 1.37404,
'Instruction Fetch Unit/Instruction Decoder/Runtime Dynamic': 0.0920572,
'Instruction Fetch Unit/Instruction Decoder/Subthreshold Leakage': 0.442943,
'Instruction Fetch Unit/Instruction Decoder/Subthreshold Leakage with power gating': 0.166104,
'Instruction Fetch Unit/Peak Dynamic': 4.02623,
'Instruction Fetch Unit/Runtime Dynamic': 0.178415,
'Instruction Fetch Unit/Subthreshold Leakage': 0.932286,
'Instruction Fetch Unit/Subthreshold Leakage with power gating': 0.40843,
'L2/Area': 4.53318,
'L2/Gate Leakage': 0.015464,
'L2/Peak Dynamic': 0.0335792,
'L2/Runtime Dynamic': 0.00789606,
'L2/Subthreshold Leakage': 0.834142,
'L2/Subthreshold Leakage with power gating': 0.401066,
'Load Store Unit/Area': 8.80901,
'Load Store Unit/Data Cache/Area': 6.84535,
'Load Store Unit/Data Cache/Gate Leakage': 0.0279261,
'Load Store Unit/Data Cache/Peak Dynamic': 2.29498,
'Load Store Unit/Data Cache/Runtime Dynamic': 0.519848,
'Load Store Unit/Data Cache/Subthreshold Leakage': 0.527675,
'Load Store Unit/Data Cache/Subthreshold Leakage with power gating': 0.25085,
'Load Store Unit/Gate Leakage': 0.0350888,
'Load Store Unit/LoadQ/Area': 0.0836782,
'Load Store Unit/LoadQ/Gate Leakage': 0.00059896,
'Load Store Unit/LoadQ/Peak Dynamic': 0.0342244,
'Load Store Unit/LoadQ/Runtime Dynamic': 0.0342243,
'Load Store Unit/LoadQ/Subthreshold Leakage': 0.00941961,
'Load Store Unit/LoadQ/Subthreshold Leakage with power gating': 0.00536918,
'Load Store Unit/Peak Dynamic': 2.4566,
'Load Store Unit/Runtime Dynamic': 0.722856,
'Load Store Unit/StoreQ/Area': 0.322079,
'Load Store Unit/StoreQ/Gate Leakage': 0.00329971,
'Load Store Unit/StoreQ/Peak Dynamic': 0.0843915,
'Load Store Unit/StoreQ/Runtime Dynamic': 0.168783,
'Load Store Unit/StoreQ/Subthreshold Leakage': 0.0345621,
'Load Store Unit/StoreQ/Subthreshold Leakage with power gating': 0.0197004,
'Load Store Unit/Subthreshold Leakage': 0.591321,
'Load Store Unit/Subthreshold Leakage with power gating': 0.283293,
'Memory Management Unit/Area': 0.4339,
'Memory Management Unit/Dtlb/Area': 0.0879726,
'Memory Management Unit/Dtlb/Gate Leakage': 0.00088729,
'Memory Management Unit/Dtlb/Peak Dynamic': 0.0299508,
'Memory Management Unit/Dtlb/Runtime Dynamic': 0.0304546,
'Memory Management Unit/Dtlb/Subthreshold Leakage': 0.0155699,
'Memory Management Unit/Dtlb/Subthreshold Leakage with power gating': 0.00887485,
'Memory Management Unit/Gate Leakage': 0.00808595,
'Memory Management Unit/Itlb/Area': 0.301552,
'Memory Management Unit/Itlb/Gate Leakage': 0.00393464,
'Memory Management Unit/Itlb/Peak Dynamic': 0.107195,
'Memory Management Unit/Itlb/Runtime Dynamic': 0.00869295,
'Memory Management Unit/Itlb/Subthreshold Leakage': 0.0413758,
'Memory Management Unit/Itlb/Subthreshold Leakage with power gating': 0.0235842,
'Memory Management Unit/Peak Dynamic': 0.314754,
'Memory Management Unit/Runtime Dynamic': 0.0391476,
'Memory Management Unit/Subthreshold Leakage': 0.0766103,
'Memory Management Unit/Subthreshold Leakage with power gating': 0.0398333,
'Peak Dynamic': 14.4468,
'Renaming Unit/Area': 0.303608,
'Renaming Unit/FP Front End RAT/Area': 0.131045,
'Renaming Unit/FP Front End RAT/Gate Leakage': 0.00351123,
'Renaming Unit/FP Front End RAT/Peak Dynamic': 2.51468,
'Renaming Unit/FP Front End RAT/Runtime Dynamic': 0.0,
'Renaming Unit/FP Front End RAT/Subthreshold Leakage': 0.0308571,
'Renaming Unit/FP Front End RAT/Subthreshold Leakage with power gating': 0.0175885,
'Renaming Unit/Free List/Area': 0.0340654,
'Renaming Unit/Free List/Gate Leakage': 2.5481e-05,
'Renaming Unit/Free List/Peak Dynamic': 0.0306032,
'Renaming Unit/Free List/Runtime Dynamic': 0.00410068,
'Renaming Unit/Free List/Subthreshold Leakage': 0.000370144,
'Renaming Unit/Free List/Subthreshold Leakage with power gating': 0.000201064,
'Renaming Unit/Gate Leakage': 0.00708398,
'Renaming Unit/Int Front End RAT/Area': 0.0941223,
'Renaming Unit/Int Front End RAT/Gate Leakage': 0.000283242,
'Renaming Unit/Int Front End RAT/Peak Dynamic': 0.731965,
'Renaming Unit/Int Front End RAT/Runtime Dynamic': 0.0478755,
'Renaming Unit/Int Front End RAT/Subthreshold Leakage': 0.00435488,
'Renaming Unit/Int Front End RAT/Subthreshold Leakage with power gating': 0.00248228,
'Renaming Unit/Peak Dynamic': 3.58947,
'Renaming Unit/Runtime Dynamic': 0.0519762,
'Renaming Unit/Subthreshold Leakage': 0.0552466,
'Renaming Unit/Subthreshold Leakage with power gating': 0.0276461,
'Runtime Dynamic': 2.12116,
'Subthreshold Leakage': 6.16288,
'Subthreshold Leakage with power gating': 2.55328},
{'Area': 32.0201,
'Execution Unit/Area': 7.68434,
'Execution Unit/Complex ALUs/Area': 0.235435,
'Execution Unit/Complex ALUs/Gate Leakage': 0.0132646,
'Execution Unit/Complex ALUs/Peak Dynamic': 0.0493846,
'Execution Unit/Complex ALUs/Runtime Dynamic': 0.241477,
'Execution Unit/Complex ALUs/Subthreshold Leakage': 0.20111,
'Execution Unit/Complex ALUs/Subthreshold Leakage with power gating': 0.0754163,
'Execution Unit/Floating Point Units/Area': 4.6585,
'Execution Unit/Floating Point Units/Gate Leakage': 0.0656156,
'Execution Unit/Floating Point Units/Peak Dynamic': 0.26452,
'Execution Unit/Floating Point Units/Runtime Dynamic': 0.304033,
'Execution Unit/Floating Point Units/Subthreshold Leakage': 0.994829,
'Execution Unit/Floating Point Units/Subthreshold Leakage with power gating': 0.373061,
'Execution Unit/Gate Leakage': 0.120359,
'Execution Unit/Instruction Scheduler/Area': 1.66526,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Area': 0.275653,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Gate Leakage': 0.000977433,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Peak Dynamic': 1.04181,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Runtime Dynamic': 0.113665,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Subthreshold Leakage': 0.0143453,
'Execution Unit/Instruction Scheduler/FP Instruction Window/Subthreshold Leakage with power gating': 0.00810519,
'Execution Unit/Instruction Scheduler/Gate Leakage': 0.00568913,
'Execution Unit/Instruction Scheduler/Instruction Window/Area': 0.805223,
'Execution Unit/Instruction Scheduler/Instruction Window/Gate Leakage': 0.00414562,
'Execution Unit/Instruction Scheduler/Instruction Window/Peak Dynamic': 1.6763,
'Execution Unit/Instruction Scheduler/Instruction Window/Runtime Dynamic': 0.183337,
'Execution Unit/Instruction Scheduler/Instruction Window/Subthreshold Leakage': 0.0625755,
'Execution Unit/Instruction Scheduler/Instruction Window/Subthreshold Leakage with power gating': 0.0355964,
'Execution Unit/Instruction Scheduler/Peak Dynamic': 3.82262,
'Execution Unit/Instruction Scheduler/ROB/Area': 0.584388,
'Execution Unit/Instruction Scheduler/ROB/Gate Leakage': 0.00056608,
'Execution Unit/Instruction Scheduler/ROB/Peak Dynamic': 1.10451,
'Execution Unit/Instruction Scheduler/ROB/Runtime Dynamic': 0.0925425,
'Execution Unit/Instruction Scheduler/ROB/Subthreshold Leakage': 0.00906853,
'Execution Unit/Instruction Scheduler/ROB/Subthreshold Leakage with power gating': 0.00364446,
'Execution Unit/Instruction Scheduler/Runtime Dynamic': 0.389545,
'Execution Unit/Instruction Scheduler/Subthreshold Leakage': 0.0859892,
'Execution Unit/Instruction Scheduler/Subthreshold Leakage with power gating': 0.047346,
'Execution Unit/Integer ALUs/Area': 0.47087,
'Execution Unit/Integer ALUs/Gate Leakage': 0.0265291,
'Execution Unit/Integer ALUs/Peak Dynamic': 0.0894446,
'Execution Unit/Integer ALUs/Runtime Dynamic': 0.101344,
'Execution Unit/Integer ALUs/Subthreshold Leakage': 0.40222,
'Execution Unit/Integer ALUs/Subthreshold Leakage with power gating': 0.150833,
'Execution Unit/Peak Dynamic': 4.46511,
'Execution Unit/Register Files/Area': 0.570804,
'Execution Unit/Register Files/Floating Point RF/Area': 0.208131,
'Execution Unit/Register Files/Floating Point RF/Gate Leakage': 0.000232788,
'Execution Unit/Register Files/Floating Point RF/Peak Dynamic': 0.0499736,
'Execution Unit/Register Files/Floating Point RF/Runtime Dynamic': 0.00476762,
'Execution Unit/Register Files/Floating Point RF/Subthreshold Leakage': 0.00399698,
'Execution Unit/Register Files/Floating Point RF/Subthreshold Leakage with power gating': 0.00176968,
'Execution Unit/Register Files/Gate Leakage': 0.000622708,
'Execution Unit/Register Files/Integer RF/Area': 0.362673,
'Execution Unit/Register Files/Integer RF/Gate Leakage': 0.00038992,
'Execution Unit/Register Files/Integer RF/Peak Dynamic': 0.0530528,
'Execution Unit/Register Files/Integer RF/Runtime Dynamic': 0.0352595,
'Execution Unit/Register Files/Integer RF/Subthreshold Leakage': 0.00614175,
'Execution Unit/Register Files/Integer RF/Subthreshold Leakage with power gating': 0.00246675,
'Execution Unit/Register Files/Peak Dynamic': 0.103026,
'Execution Unit/Register Files/Runtime Dynamic': 0.0400271,
'Execution Unit/Register Files/Subthreshold Leakage': 0.0101387,
'Execution Unit/Register Files/Subthreshold Leakage with power gating': 0.00423643,
'Execution Unit/Results Broadcast Bus/Area Overhead': 0.0390912,
'Execution Unit/Results Broadcast Bus/Gate Leakage': 0.00537402,
'Execution Unit/Results Broadcast Bus/Peak Dynamic': 0.124116,
'Execution Unit/Results Broadcast Bus/Runtime Dynamic': 0.309147,
'Execution Unit/Results Broadcast Bus/Subthreshold Leakage': 0.081478,
'Execution Unit/Results Broadcast Bus/Subthreshold Leakage with power gating': 0.0305543,
'Execution Unit/Runtime Dynamic': 1.38557,
'Execution Unit/Subthreshold Leakage': 1.79543,
'Execution Unit/Subthreshold Leakage with power gating': 0.688821,
'Gate Leakage': 0.368936,
'Instruction Fetch Unit/Area': 5.85939,
'Instruction Fetch Unit/Branch Predictor/Area': 0.138516,
'Instruction Fetch Unit/Branch Predictor/Chooser/Area': 0.0435221,
'Instruction Fetch Unit/Branch Predictor/Chooser/Gate Leakage': 0.000278362,
'Instruction Fetch Unit/Branch Predictor/Chooser/Peak Dynamic': 0.0168831,
'Instruction Fetch Unit/Branch Predictor/Chooser/Runtime Dynamic': 0.000321572,
'Instruction Fetch Unit/Branch Predictor/Chooser/Subthreshold Leakage': 0.00759719,
'Instruction Fetch Unit/Branch Predictor/Chooser/Subthreshold Leakage with power gating': 0.0039236,
'Instruction Fetch Unit/Branch Predictor/Gate Leakage': 0.000757657,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Area': 0.0435221,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Gate Leakage': 0.000278362,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Peak Dynamic': 0.0168831,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Runtime Dynamic': 0.000321572,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Subthreshold Leakage': 0.00759719,
'Instruction Fetch Unit/Branch Predictor/Global Predictor/Subthreshold Leakage with power gating': 0.0039236,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Area': 0.0257064,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Gate Leakage': 0.000154548,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Peak Dynamic': 0.0142575,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Runtime Dynamic': 0.000295187,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Subthreshold Leakage': 0.00384344,
'Instruction Fetch Unit/Branch Predictor/L1_Local Predictor/Subthreshold Leakage with power gating': 0.00198631,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Area': 0.0151917,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Gate Leakage': 8.00196e-05,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Peak Dynamic': 0.00527447,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Runtime Dynamic': 0.000122529,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Subthreshold Leakage': 0.00181347,
'Instruction Fetch Unit/Branch Predictor/L2_Local Predictor/Subthreshold Leakage with power gating': 0.000957045,
'Instruction Fetch Unit/Branch Predictor/Peak Dynamic': 0.0597838,
'Instruction Fetch Unit/Branch Predictor/RAS/Area': 0.0105732,
'Instruction Fetch Unit/Branch Predictor/RAS/Gate Leakage': 4.63858e-05,
'Instruction Fetch Unit/Branch Predictor/RAS/Peak Dynamic': 0.0117602,
'Instruction Fetch Unit/Branch Predictor/RAS/Runtime Dynamic': 0.000506505,
'Instruction Fetch Unit/Branch Predictor/RAS/Subthreshold Leakage': 0.000932505,
'Instruction Fetch Unit/Branch Predictor/RAS/Subthreshold Leakage with power gating': 0.000494733,
'Instruction Fetch Unit/Branch Predictor/Runtime Dynamic': 0.00144484,
'Instruction Fetch Unit/Branch Predictor/Subthreshold Leakage': 0.0199703,
'Instruction Fetch Unit/Branch Predictor/Subthreshold Leakage with power gating': 0.0103282,
'Instruction Fetch Unit/Branch Target Buffer/Area': 0.64954,
'Instruction Fetch Unit/Branch Target Buffer/Gate Leakage': 0.00272758,
'Instruction Fetch Unit/Branch Target Buffer/Peak Dynamic': 0.177867,
'Instruction Fetch Unit/Branch Target Buffer/Runtime Dynamic': 0.0025438,
'Instruction Fetch Unit/Branch Target Buffer/Subthreshold Leakage': 0.0811682,
'Instruction Fetch Unit/Branch Target Buffer/Subthreshold Leakage with power gating': 0.0435357,
'Instruction Fetch Unit/Gate Leakage': 0.0589979,
'Instruction Fetch Unit/Instruction Buffer/Area': 0.0226323,
'Instruction Fetch Unit/Instruction Buffer/Gate Leakage': 6.83558e-05,
'Instruction Fetch Unit/Instruction Buffer/Peak Dynamic': 0.606827,
'Instruction Fetch Unit/Instruction Buffer/Runtime Dynamic': 0.0338958,
'Instruction Fetch Unit/Instruction Buffer/Subthreshold Leakage': 0.00151885,
'Instruction Fetch Unit/Instruction Buffer/Subthreshold Leakage with power gating': 0.000701682,
'Instruction Fetch Unit/Instruction Cache/Area': 3.14635,
'Instruction Fetch Unit/Instruction Cache/Gate Leakage': 0.029931,
'Instruction Fetch Unit/Instruction Cache/Peak Dynamic': 2.15607,
'Instruction Fetch Unit/Instruction Cache/Runtime Dynamic': 0.0774554,
'Instruction Fetch Unit/Instruction Cache/Subthreshold Leakage': 0.367022,
'Instruction Fetch Unit/Instruction Cache/Subthreshold Leakage with power gating': 0.180386,
'Instruction Fetch Unit/Instruction Decoder/Area': 1.85799,
'Instruction Fetch Unit/Instruction Decoder/Gate Leakage': 0.0222493,
'Instruction Fetch Unit/Instruction Decoder/Peak Dynamic': 1.37404,
'Instruction Fetch Unit/Instruction Decoder/Runtime Dynamic': 0.115125,
'Instruction Fetch Unit/Instruction Decoder/Subthreshold Leakage': 0.442943,
'Instruction Fetch Unit/Instruction Decoder/Subthreshold Leakage with power gating': 0.166104,
'Instruction Fetch Unit/Peak Dynamic': 4.47922,
'Instruction Fetch Unit/Runtime Dynamic': 0.230465,
'Instruction Fetch Unit/Subthreshold Leakage': 0.932286,
'Instruction Fetch Unit/Subthreshold Leakage with power gating': 0.40843,
'L2/Area': 4.53318,
'L2/Gate Leakage': 0.015464,
'L2/Peak Dynamic': 0.0456561,
'L2/Runtime Dynamic': 0.00372954,
'L2/Subthreshold Leakage': 0.834142,
'L2/Subthreshold Leakage with power gating': 0.401066,
'Load Store Unit/Area': 8.80901,
'Load Store Unit/Data Cache/Area': 6.84535,
'Load Store Unit/Data Cache/Gate Leakage': 0.0279261,
'Load Store Unit/Data Cache/Peak Dynamic': 2.59334,
'Load Store Unit/Data Cache/Runtime Dynamic': 0.655769,
'Load Store Unit/Data Cache/Subthreshold Leakage': 0.527675,
'Load Store Unit/Data Cache/Subthreshold Leakage with power gating': 0.25085,
'Load Store Unit/Gate Leakage': 0.0350888,
'Load Store Unit/LoadQ/Area': 0.0836782,
'Load Store Unit/LoadQ/Gate Leakage': 0.00059896,
'Load Store Unit/LoadQ/Peak Dynamic': 0.0438771,
'Load Store Unit/LoadQ/Runtime Dynamic': 0.0438771,
'Load Store Unit/LoadQ/Subthreshold Leakage': 0.00941961,
'Load Store Unit/LoadQ/Subthreshold Leakage with power gating': 0.00536918,
'Load Store Unit/Peak Dynamic': 2.80054,
'Load Store Unit/Runtime Dynamic': 0.916033,
'Load Store Unit/StoreQ/Area': 0.322079,
'Load Store Unit/StoreQ/Gate Leakage': 0.00329971,
'Load Store Unit/StoreQ/Peak Dynamic': 0.108193,
'Load Store Unit/StoreQ/Runtime Dynamic': 0.216387,
'Load Store Unit/StoreQ/Subthreshold Leakage': 0.0345621,
'Load Store Unit/StoreQ/Subthreshold Leakage with power gating': 0.0197004,
'Load Store Unit/Subthreshold Leakage': 0.591321,
'Load Store Unit/Subthreshold Leakage with power gating': 0.283293,
'Memory Management Unit/Area': 0.4339,
'Memory Management Unit/Dtlb/Area': 0.0879726,
'Memory Management Unit/Dtlb/Gate Leakage': 0.00088729,
'Memory Management Unit/Dtlb/Peak Dynamic': 0.0383982,
'Memory Management Unit/Dtlb/Runtime Dynamic': 0.039082,
'Memory Management Unit/Dtlb/Subthreshold Leakage': 0.0155699,
'Memory Management Unit/Dtlb/Subthreshold Leakage with power gating': 0.00887485,
'Memory Management Unit/Gate Leakage': 0.00808595,
'Memory Management Unit/Itlb/Area': 0.301552,
'Memory Management Unit/Itlb/Gate Leakage': 0.00393464,
'Memory Management Unit/Itlb/Peak Dynamic': 0.134056,
'Memory Management Unit/Itlb/Runtime Dynamic': 0.0127033,
'Memory Management Unit/Itlb/Subthreshold Leakage': 0.0413758,
'Memory Management Unit/Itlb/Subthreshold Leakage with power gating': 0.0235842,
'Memory Management Unit/Peak Dynamic': 0.356126,
'Memory Management Unit/Runtime Dynamic': 0.0517853,
'Memory Management Unit/Subthreshold Leakage': 0.0766103,
'Memory Management Unit/Subthreshold Leakage with power gating': 0.0398333,
'Peak Dynamic': 15.7361,
'Renaming Unit/Area': 0.303608,
'Renaming Unit/FP Front End RAT/Area': 0.131045,
'Renaming Unit/FP Front End RAT/Gate Leakage': 0.00351123,
'Renaming Unit/FP Front End RAT/Peak Dynamic': 2.51468,
'Renaming Unit/FP Front End RAT/Runtime Dynamic': 0.131457,
'Renaming Unit/FP Front End RAT/Subthreshold Leakage': 0.0308571,
'Renaming Unit/FP Front End RAT/Subthreshold Leakage with power gating': 0.0175885,
'Renaming Unit/Free List/Area': 0.0340654,
'Renaming Unit/Free List/Gate Leakage': 2.5481e-05,
'Renaming Unit/Free List/Peak Dynamic': 0.0306032,
'Renaming Unit/Free List/Runtime Dynamic': 0.00672806,
'Renaming Unit/Free List/Subthreshold Leakage': 0.000370144,
'Renaming Unit/Free List/Subthreshold Leakage with power gating': 0.000201064,
'Renaming Unit/Gate Leakage': 0.00708398,
'Renaming Unit/Int Front End RAT/Area': 0.0941223,
'Renaming Unit/Int Front End RAT/Gate Leakage': 0.000283242,
'Renaming Unit/Int Front End RAT/Peak Dynamic': 0.731965,
'Renaming Unit/Int Front End RAT/Runtime Dynamic': 0.0558006,
'Renaming Unit/Int Front End RAT/Subthreshold Leakage': 0.00435488,
'Renaming Unit/Int Front End RAT/Subthreshold Leakage with power gating': 0.00248228,
'Renaming Unit/Peak Dynamic': 3.58947,
'Renaming Unit/Runtime Dynamic': 0.193986,
'Renaming Unit/Subthreshold Leakage': 0.0552466,
'Renaming Unit/Subthreshold Leakage with power gating': 0.0276461,
'Runtime Dynamic': 2.78157,
'Subthreshold Leakage': 6.16288,
'Subthreshold Leakage with power gating': 2.55328}],
'DRAM': {'Area': 0,
'Gate Leakage': 0,
'Peak Dynamic': 5.9696860816869,
'Runtime Dynamic': 5.9696860816869,
'Subthreshold Leakage': 4.252,
'Subthreshold Leakage with power gating': 4.252},
'L3': [{'Area': 61.9075,
'Gate Leakage': 0.0484137,
'Peak Dynamic': 0.261418,
'Runtime Dynamic': 0.114176,
'Subthreshold Leakage': 6.80085,
'Subthreshold Leakage with power gating': 3.32364}],
'Processor': {'Area': 191.908,
'Gate Leakage': 1.53485,
'Peak Dynamic': 82.0327,
'Peak Power': 115.145,
'Runtime Dynamic': 20.966,
'Subthreshold Leakage': 31.5774,
'Subthreshold Leakage with power gating': 13.9484,
'Total Cores/Area': 128.669,
'Total Cores/Gate Leakage': 1.4798,
'Total Cores/Peak Dynamic': 81.7713,
'Total Cores/Runtime Dynamic': 20.8519,
'Total Cores/Subthreshold Leakage': 24.7074,
'Total Cores/Subthreshold Leakage with power gating': 10.2429,
'Total L3s/Area': 61.9075,
'Total L3s/Gate Leakage': 0.0484137,
'Total L3s/Peak Dynamic': 0.261418,
'Total L3s/Runtime Dynamic': 0.114176,
'Total L3s/Subthreshold Leakage': 6.80085,
'Total L3s/Subthreshold Leakage with power gating': 3.32364,
'Total Leakage': 33.1122,
'Total NoCs/Area': 1.33155,
'Total NoCs/Gate Leakage': 0.00662954,
'Total NoCs/Peak Dynamic': 0.0,
'Total NoCs/Runtime Dynamic': 0.0,
'Total NoCs/Subthreshold Leakage': 0.0691322,
'Total NoCs/Subthreshold Leakage with power gating': 0.0259246}}
| 75.068928
| 124
| 0.681984
| 8,090
| 68,613
| 5.778121
| 0.067491
| 0.123564
| 0.112953
| 0.093443
| 0.93963
| 0.930452
| 0.918644
| 0.888009
| 0.862124
| 0.842379
| 0
| 0.131712
| 0.224316
| 68,613
| 914
| 125
| 75.068928
| 0.74659
| 0
| 0
| 0.642232
| 0
| 0
| 0.657373
| 0.048095
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
9b9a785a101741de7835ad565b2906790a1b859c
| 75
|
py
|
Python
|
openproblems/tasks/label_projection/metrics/__init__.py
|
bendemeo/SingleCellOpenProblems
|
e4c009f8c232bdae4c9e20b8e435d0fe474b3daf
|
[
"MIT"
] | 134
|
2020-08-19T07:35:56.000Z
|
2021-05-19T11:37:50.000Z
|
openproblems/tasks/label_projection/metrics/__init__.py
|
bendemeo/SingleCellOpenProblems
|
e4c009f8c232bdae4c9e20b8e435d0fe474b3daf
|
[
"MIT"
] | 175
|
2020-08-17T15:26:06.000Z
|
2021-05-14T11:03:46.000Z
|
openproblems/tasks/label_projection/metrics/__init__.py
|
LuckyMD/SingleCellOpenProblems
|
0ae39db494557e1dd9f28e59dda765527191eee1
|
[
"MIT"
] | 46
|
2020-10-08T21:11:37.000Z
|
2021-04-25T07:05:28.000Z
|
from .accuracy import accuracy
from .f1 import f1
from .f1 import f1_micro
| 18.75
| 30
| 0.8
| 13
| 75
| 4.538462
| 0.384615
| 0.20339
| 0.40678
| 0.474576
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.063492
| 0.16
| 75
| 3
| 31
| 25
| 0.873016
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 0
| 0
|
0
| 7
|
9b9d20d991c60affd95b0075a747ea468ac4961f
| 38
|
py
|
Python
|
volby/__init__.py
|
schubertjan/volby_sim
|
3f62db1135e3fe756c3ca812084f42a66f0e1735
|
[
"MIT"
] | null | null | null |
volby/__init__.py
|
schubertjan/volby_sim
|
3f62db1135e3fe756c3ca812084f42a66f0e1735
|
[
"MIT"
] | null | null | null |
volby/__init__.py
|
schubertjan/volby_sim
|
3f62db1135e3fe756c3ca812084f42a66f0e1735
|
[
"MIT"
] | null | null | null |
from . import calc
from . import utils
| 19
| 19
| 0.763158
| 6
| 38
| 4.833333
| 0.666667
| 0.689655
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.184211
| 38
| 2
| 19
| 19
| 0.935484
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 1
| 0
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
32d99d592c4eae770240fd479730e79607f63fe8
| 304
|
bzl
|
Python
|
third_party/clang/revision.bzl
|
EdSchouten/bazel-toolchains
|
82f7462fea3630d702d73ccf2f3e38e34941977d
|
[
"Apache-2.0"
] | null | null | null |
third_party/clang/revision.bzl
|
EdSchouten/bazel-toolchains
|
82f7462fea3630d702d73ccf2f3e38e34941977d
|
[
"Apache-2.0"
] | null | null | null |
third_party/clang/revision.bzl
|
EdSchouten/bazel-toolchains
|
82f7462fea3630d702d73ccf2f3e38e34941977d
|
[
"Apache-2.0"
] | null | null | null |
CLANG_REVISION = "r342117"
DEBIAN8_CLANG_SHA256 = "96ae880a99c7dd3a20b5eaa202cb713e8cb9820a8e99b06aed6b1f5024a884d9"
DEBIAN9_CLANG_SHA256 = "8def099f798f03c014d7e4c21547cf69e92ca26c01812cb33bf90c5d3f9b4204"
UBUNTU16_04_CLANG_SHA256 = "ee84daf8acffc4a702205a378e8dbdd0e580c58b53ef1381bb35694cae935963"
| 38
| 93
| 0.911184
| 16
| 304
| 16.8125
| 0.6875
| 0.122677
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.474048
| 0.049342
| 304
| 7
| 94
| 43.428571
| 0.456747
| 0
| 0
| 0
| 0
| 0
| 0.654605
| 0.631579
| 0
| 1
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
fd30b78b33a58e478f8b3dede29ab17f7c8ef607
| 586,627
|
py
|
Python
|
boto3_type_annotations_with_docs/boto3_type_annotations/iam/client.py
|
cowboygneox/boto3_type_annotations
|
450dce1de4e066b939de7eac2ec560ed1a7ddaa2
|
[
"MIT"
] | 119
|
2018-12-01T18:20:57.000Z
|
2022-02-02T10:31:29.000Z
|
boto3_type_annotations_with_docs/boto3_type_annotations/iam/client.py
|
cowboygneox/boto3_type_annotations
|
450dce1de4e066b939de7eac2ec560ed1a7ddaa2
|
[
"MIT"
] | 15
|
2018-11-16T00:16:44.000Z
|
2021-11-13T03:44:18.000Z
|
boto3_type_annotations_with_docs/boto3_type_annotations/iam/client.py
|
cowboygneox/boto3_type_annotations
|
450dce1de4e066b939de7eac2ec560ed1a7ddaa2
|
[
"MIT"
] | 11
|
2019-05-06T05:26:51.000Z
|
2021-09-28T15:27:59.000Z
|
from typing import Optional
from botocore.client import BaseClient
from typing import Dict
from botocore.paginate import Paginator
from botocore.waiter import Waiter
from typing import Union
from typing import List
class Client(BaseClient):
def add_client_id_to_open_id_connect_provider(self, OpenIDConnectProviderArn: str, ClientID: str):
"""
Adds a new client ID (also known as audience) to the list of client IDs already registered for the specified IAM OpenID Connect (OIDC) provider resource.
This operation is idempotent; it does not fail or return an error if you add an existing client ID to the provider.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/AddClientIDToOpenIDConnectProvider>`_
**Request Syntax**
::
response = client.add_client_id_to_open_id_connect_provider(
OpenIDConnectProviderArn='string',
ClientID='string'
)
:type OpenIDConnectProviderArn: string
:param OpenIDConnectProviderArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM OpenID Connect (OIDC) provider resource to add the client ID to. You can get a list of OIDC provider ARNs by using the ListOpenIDConnectProviders operation.
:type ClientID: string
:param ClientID: **[REQUIRED]**
The client ID (also known as audience) to add to the IAM OpenID Connect provider resource.
:returns: None
"""
pass
def add_role_to_instance_profile(self, InstanceProfileName: str, RoleName: str):
"""
Adds the specified IAM role to the specified instance profile. An instance profile can contain only one role, and this limit cannot be increased. You can remove the existing role and then add a different role to an instance profile. You must then wait for the change to appear across all of AWS because of `eventual consistency <https://en.wikipedia.org/wiki/Eventual_consistency>`__ . To force the change, you must `disassociate the instance profile <https://docs.aws.amazon.com/AWSEC2/latest/APIReference/API_DisassociateIamInstanceProfile.html>`__ and then `associate the instance profile <https://docs.aws.amazon.com/AWSEC2/latest/APIReference/API_AssociateIamInstanceProfile.html>`__ , or you can stop your instance and then restart it.
.. note::
The caller of this API must be granted the ``PassRole`` permission on the IAM role by a permissions policy.
For more information about roles, go to `Working with Roles <https://docs.aws.amazon.com/IAM/latest/UserGuide/WorkingWithRoles.html>`__ . For more information about instance profiles, go to `About Instance Profiles <https://docs.aws.amazon.com/IAM/latest/UserGuide/AboutInstanceProfiles.html>`__ .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/AddRoleToInstanceProfile>`_
**Request Syntax**
::
response = client.add_role_to_instance_profile(
InstanceProfileName='string',
RoleName='string'
)
:type InstanceProfileName: string
:param InstanceProfileName: **[REQUIRED]**
The name of the instance profile to update.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the role to add.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def add_user_to_group(self, GroupName: str, UserName: str):
"""
Adds the specified user to the specified group.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/AddUserToGroup>`_
**Request Syntax**
::
response = client.add_user_to_group(
GroupName='string',
UserName='string'
)
:type GroupName: string
:param GroupName: **[REQUIRED]**
The name of the group to update.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user to add.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def attach_group_policy(self, GroupName: str, PolicyArn: str):
"""
Attaches the specified managed policy to the specified IAM group.
You use this API to attach a managed policy to a group. To embed an inline policy in a group, use PutGroupPolicy .
For more information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/AttachGroupPolicy>`_
**Request Syntax**
::
response = client.attach_group_policy(
GroupName='string',
PolicyArn='string'
)
:type GroupName: string
:param GroupName: **[REQUIRED]**
The name (friendly name, not ARN) of the group to attach the policy to.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM policy you want to attach.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:returns: None
"""
pass
def attach_role_policy(self, RoleName: str, PolicyArn: str):
"""
Attaches the specified managed policy to the specified IAM role. When you attach a managed policy to a role, the managed policy becomes part of the role's permission (access) policy.
.. note::
You cannot use a managed policy as the role's trust policy. The role's trust policy is created at the same time as the role, using CreateRole . You can update a role's trust policy using UpdateAssumeRolePolicy .
Use this API to attach a *managed* policy to a role. To embed an inline policy in a role, use PutRolePolicy . For more information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/AttachRolePolicy>`_
**Request Syntax**
::
response = client.attach_role_policy(
RoleName='string',
PolicyArn='string'
)
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name (friendly name, not ARN) of the role to attach the policy to.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM policy you want to attach.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:returns: None
"""
pass
def attach_user_policy(self, UserName: str, PolicyArn: str):
"""
Attaches the specified managed policy to the specified user.
You use this API to attach a *managed* policy to a user. To embed an inline policy in a user, use PutUserPolicy .
For more information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/AttachUserPolicy>`_
**Request Syntax**
::
response = client.attach_user_policy(
UserName='string',
PolicyArn='string'
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name (friendly name, not ARN) of the IAM user to attach the policy to.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM policy you want to attach.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:returns: None
"""
pass
def can_paginate(self, operation_name: str = None):
"""
Check if an operation can be paginated.
:type operation_name: string
:param operation_name: The operation name. This is the same name
as the method name on the client. For example, if the
method name is ``create_foo``, and you\'d normally invoke the
operation as ``client.create_foo(**kwargs)``, if the
``create_foo`` operation can be paginated, you can use the
call ``client.get_paginator(\"create_foo\")``.
:return: ``True`` if the operation can be paginated,
``False`` otherwise.
"""
pass
def change_password(self, OldPassword: str, NewPassword: str):
"""
Changes the password of the IAM user who is calling this operation. The AWS account root user password is not affected by this operation.
To change the password for a different user, see UpdateLoginProfile . For more information about modifying passwords, see `Managing Passwords <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_ManagingLogins.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ChangePassword>`_
**Request Syntax**
::
response = client.change_password(
OldPassword='string',
NewPassword='string'
)
:type OldPassword: string
:param OldPassword: **[REQUIRED]**
The IAM user\'s current password.
:type NewPassword: string
:param NewPassword: **[REQUIRED]**
The new password. The new password must conform to the AWS account\'s password policy, if one exists.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ that is used to validate this parameter is a string of characters. That string can include almost any printable ASCII character from the space (\u0020) through the end of the ASCII character range (\u00FF). You can also include the tab (\u0009), line feed (\u000A), and carriage return (\u000D) characters. Any of these characters are valid in a password. However, many tools, such as the AWS Management Console, might restrict the ability to type certain characters because they have special meaning within that tool.
:returns: None
"""
pass
def create_access_key(self, UserName: str = None) -> Dict:
"""
Creates a new AWS secret access key and corresponding AWS access key ID for the specified user. The default status for new keys is ``Active`` .
If you do not specify a user name, IAM determines the user name implicitly based on the AWS access key ID signing the request. This operation works for access keys under the AWS account. Consequently, you can use this operation to manage AWS account root user credentials. This is true even if the AWS account has no associated users.
For information about limits on the number of keys you can create, see `Limitations on IAM Entities <https://docs.aws.amazon.com/IAM/latest/UserGuide/LimitationsOnEntities.html>`__ in the *IAM User Guide* .
.. warning::
To ensure the security of your AWS account, the secret access key is accessible only during key and user creation. You must save the key (for example, in a text file) if you want to be able to access it again. If a secret key is lost, you can delete the access keys for the associated user and then create new keys.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreateAccessKey>`_
**Request Syntax**
::
response = client.create_access_key(
UserName='string'
)
**Response Syntax**
::
{
'AccessKey': {
'UserName': 'string',
'AccessKeyId': 'string',
'Status': 'Active'|'Inactive',
'SecretAccessKey': 'string',
'CreateDate': datetime(2015, 1, 1)
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful CreateAccessKey request.
- **AccessKey** *(dict) --*
A structure with details about the access key.
- **UserName** *(string) --*
The name of the IAM user that the access key is associated with.
- **AccessKeyId** *(string) --*
The ID for this access key.
- **Status** *(string) --*
The status of the access key. ``Active`` means that the key is valid for API calls, while ``Inactive`` means it is not.
- **SecretAccessKey** *(string) --*
The secret key used to sign requests.
- **CreateDate** *(datetime) --*
The date when the access key was created.
:type UserName: string
:param UserName:
The name of the IAM user that the new key will belong to.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:rtype: dict
:returns:
"""
pass
def create_account_alias(self, AccountAlias: str):
"""
Creates an alias for your AWS account. For information about using an AWS account alias, see `Using an Alias for Your AWS Account ID <https://docs.aws.amazon.com/IAM/latest/UserGuide/AccountAlias.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreateAccountAlias>`_
**Request Syntax**
::
response = client.create_account_alias(
AccountAlias='string'
)
:type AccountAlias: string
:param AccountAlias: **[REQUIRED]**
The account alias to create.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of lowercase letters, digits, and dashes. You cannot start or finish with a dash, nor can you have two dashes in a row.
:returns: None
"""
pass
def create_group(self, GroupName: str, Path: str = None) -> Dict:
"""
Creates a new group.
For information about the number of groups you can create, see `Limitations on IAM Entities <https://docs.aws.amazon.com/IAM/latest/UserGuide/LimitationsOnEntities.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreateGroup>`_
**Request Syntax**
::
response = client.create_group(
Path='string',
GroupName='string'
)
**Response Syntax**
::
{
'Group': {
'Path': 'string',
'GroupName': 'string',
'GroupId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1)
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful CreateGroup request.
- **Group** *(dict) --*
A structure containing details about the new group.
- **Path** *(string) --*
The path to the group. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **GroupName** *(string) --*
The friendly name that identifies the group.
- **GroupId** *(string) --*
The stable and unique string identifying the group. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the group. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the group was created.
:type Path: string
:param Path:
The path to the group. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* .
This parameter is optional. If it is not included, it defaults to a slash (/).
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type GroupName: string
:param GroupName: **[REQUIRED]**
The name of the group to create. Do not include the path in this value.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-. The group name must be unique within the account. Group names are not distinguished by case. For example, you cannot create groups named both \"ADMINS\" and \"admins\".
:rtype: dict
:returns:
"""
pass
def create_instance_profile(self, InstanceProfileName: str, Path: str = None) -> Dict:
"""
Creates a new instance profile. For information about instance profiles, go to `About Instance Profiles <https://docs.aws.amazon.com/IAM/latest/UserGuide/AboutInstanceProfiles.html>`__ .
For information about the number of instance profiles you can create, see `Limitations on IAM Entities <https://docs.aws.amazon.com/IAM/latest/UserGuide/LimitationsOnEntities.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreateInstanceProfile>`_
**Request Syntax**
::
response = client.create_instance_profile(
InstanceProfileName='string',
Path='string'
)
**Response Syntax**
::
{
'InstanceProfile': {
'Path': 'string',
'InstanceProfileName': 'string',
'InstanceProfileId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'Roles': [
{
'Path': 'string',
'RoleName': 'string',
'RoleId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'AssumeRolePolicyDocument': 'string',
'Description': 'string',
'MaxSessionDuration': 123,
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
},
]
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful CreateInstanceProfile request.
- **InstanceProfile** *(dict) --*
A structure containing details about the new instance profile.
- **Path** *(string) --*
The path to the instance profile. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **InstanceProfileName** *(string) --*
The name identifying the instance profile.
- **InstanceProfileId** *(string) --*
The stable and unique string identifying the instance profile. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the instance profile. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date when the instance profile was created.
- **Roles** *(list) --*
The role associated with the instance profile.
- *(dict) --*
Contains information about an IAM role. This structure is returned as a response element in several API operations that interact with roles.
- **Path** *(string) --*
The path to the role. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **RoleName** *(string) --*
The friendly name that identifies the role.
- **RoleId** *(string) --*
The stable and unique string identifying the role. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the role. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the role was created.
- **AssumeRolePolicyDocument** *(string) --*
The policy that grants an entity permission to assume the role.
- **Description** *(string) --*
A description of the role that you provide.
- **MaxSessionDuration** *(integer) --*
The maximum session duration (in seconds) for the specified role. Anyone who uses the AWS CLI, or API to assume the role can specify the duration using the optional ``DurationSeconds`` API parameter or ``duration-seconds`` CLI parameter.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the role.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are attached to the specified role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
:type InstanceProfileName: string
:param InstanceProfileName: **[REQUIRED]**
The name of the instance profile to create.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Path: string
:param Path:
The path to the instance profile. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* .
This parameter is optional. If it is not included, it defaults to a slash (/).
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:rtype: dict
:returns:
"""
pass
def create_login_profile(self, UserName: str, Password: str, PasswordResetRequired: bool = None) -> Dict:
"""
Creates a password for the specified user, giving the user the ability to access AWS services through the AWS Management Console. For more information about managing passwords, see `Managing Passwords <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_ManagingLogins.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreateLoginProfile>`_
**Request Syntax**
::
response = client.create_login_profile(
UserName='string',
Password='string',
PasswordResetRequired=True|False
)
**Response Syntax**
::
{
'LoginProfile': {
'UserName': 'string',
'CreateDate': datetime(2015, 1, 1),
'PasswordResetRequired': True|False
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful CreateLoginProfile request.
- **LoginProfile** *(dict) --*
A structure containing the user name and password create date.
- **UserName** *(string) --*
The name of the user, which can be used for signing in to the AWS Management Console.
- **CreateDate** *(datetime) --*
The date when the password for the user was created.
- **PasswordResetRequired** *(boolean) --*
Specifies whether the user is required to set a new password on next sign-in.
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the IAM user to create a password for. The user must already exist.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Password: string
:param Password: **[REQUIRED]**
The new password for the user.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ that is used to validate this parameter is a string of characters. That string can include almost any printable ASCII character from the space (\u0020) through the end of the ASCII character range (\u00FF). You can also include the tab (\u0009), line feed (\u000A), and carriage return (\u000D) characters. Any of these characters are valid in a password. However, many tools, such as the AWS Management Console, might restrict the ability to type certain characters because they have special meaning within that tool.
:type PasswordResetRequired: boolean
:param PasswordResetRequired:
Specifies whether the user is required to set a new password on next sign-in.
:rtype: dict
:returns:
"""
pass
def create_open_id_connect_provider(self, Url: str, ThumbprintList: List, ClientIDList: List = None) -> Dict:
"""
Creates an IAM entity to describe an identity provider (IdP) that supports `OpenID Connect (OIDC) <http://openid.net/connect/>`__ .
The OIDC provider that you create with this operation can be used as a principal in a role's trust policy. Such a policy establishes a trust relationship between AWS and the OIDC provider.
When you create the IAM OIDC provider, you specify the following:
* The URL of the OIDC identity provider (IdP) to trust
* A list of client IDs (also known as audiences) that identify the application or applications that are allowed to authenticate using the OIDC provider
* A list of thumbprints of the server certificate(s) that the IdP uses
You get all of this information from the OIDC IdP that you want to use to access AWS.
.. note::
The trust for the OIDC provider is derived from the IAM provider that this operation creates. Therefore, it is best to limit access to the CreateOpenIDConnectProvider operation to highly privileged users.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreateOpenIDConnectProvider>`_
**Request Syntax**
::
response = client.create_open_id_connect_provider(
Url='string',
ClientIDList=[
'string',
],
ThumbprintList=[
'string',
]
)
**Response Syntax**
::
{
'OpenIDConnectProviderArn': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful CreateOpenIDConnectProvider request.
- **OpenIDConnectProviderArn** *(string) --*
The Amazon Resource Name (ARN) of the new IAM OpenID Connect provider that is created. For more information, see OpenIDConnectProviderListEntry .
:type Url: string
:param Url: **[REQUIRED]**
The URL of the identity provider. The URL must begin with ``https://`` and should correspond to the ``iss`` claim in the provider\'s OpenID Connect ID tokens. Per the OIDC standard, path components are allowed but query parameters are not. Typically the URL consists of only a hostname, like ``https://server.example.org`` or ``https://example.com`` .
You cannot register the same provider multiple times in a single AWS account. If you try to submit a URL that has already been used for an OpenID Connect provider in the AWS account, you will get an error.
:type ClientIDList: list
:param ClientIDList:
A list of client IDs (also known as audiences). When a mobile or web app registers with an OpenID Connect provider, they establish a value that identifies the application. (This is the value that\'s sent as the ``client_id`` parameter on OAuth requests.)
You can register multiple client IDs with the same provider. For example, you might have multiple applications that use the same OIDC provider. You cannot register more than 100 client IDs with a single IAM OIDC provider.
There is no defined format for a client ID. The ``CreateOpenIDConnectProviderRequest`` operation accepts client IDs up to 255 characters long.
- *(string) --*
:type ThumbprintList: list
:param ThumbprintList: **[REQUIRED]**
A list of server certificate thumbprints for the OpenID Connect (OIDC) identity provider\'s server certificates. Typically this list includes only one entry. However, IAM lets you have up to five thumbprints for an OIDC provider. This lets you maintain multiple thumbprints if the identity provider is rotating certificates.
The server certificate thumbprint is the hex-encoded SHA-1 hash value of the X.509 certificate used by the domain where the OpenID Connect provider makes its keys available. It is always a 40-character string.
You must provide at least one thumbprint when creating an IAM OIDC provider. For example, assume that the OIDC provider is ``server.example.com`` and the provider stores its keys at https://keys.server.example.com/openid-connect. In that case, the thumbprint string would be the hex-encoded SHA-1 hash value of the certificate used by https://keys.server.example.com.
For more information about obtaining the OIDC provider\'s thumbprint, see `Obtaining the Thumbprint for an OpenID Connect Provider <https://docs.aws.amazon.com/IAM/latest/UserGuide/identity-providers-oidc-obtain-thumbprint.html>`__ in the *IAM User Guide* .
- *(string) --*
Contains a thumbprint for an identity provider\'s server certificate.
The identity provider\'s server certificate thumbprint is the hex-encoded SHA-1 hash value of the self-signed X.509 certificate used by the domain where the OpenID Connect provider makes its keys available. It is always a 40-character string.
:rtype: dict
:returns:
"""
pass
def create_policy(self, PolicyName: str, PolicyDocument: str, Path: str = None, Description: str = None) -> Dict:
"""
Creates a new managed policy for your AWS account.
This operation creates a policy version with a version identifier of ``v1`` and sets v1 as the policy's default version. For more information about policy versions, see `Versioning for Managed Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-versions.html>`__ in the *IAM User Guide* .
For more information about managed policies in general, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreatePolicy>`_
**Request Syntax**
::
response = client.create_policy(
PolicyName='string',
Path='string',
PolicyDocument='string',
Description='string'
)
**Response Syntax**
::
{
'Policy': {
'PolicyName': 'string',
'PolicyId': 'string',
'Arn': 'string',
'Path': 'string',
'DefaultVersionId': 'string',
'AttachmentCount': 123,
'PermissionsBoundaryUsageCount': 123,
'IsAttachable': True|False,
'Description': 'string',
'CreateDate': datetime(2015, 1, 1),
'UpdateDate': datetime(2015, 1, 1)
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful CreatePolicy request.
- **Policy** *(dict) --*
A structure containing details about the new policy.
- **PolicyName** *(string) --*
The friendly name (not ARN) identifying the policy.
- **PolicyId** *(string) --*
The stable and unique string identifying the policy.
For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **Path** *(string) --*
The path to the policy.
For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **DefaultVersionId** *(string) --*
The identifier for the version of the policy that is set as the default version.
- **AttachmentCount** *(integer) --*
The number of entities (users, groups, and roles) that the policy is attached to.
- **PermissionsBoundaryUsageCount** *(integer) --*
The number of entities (users and roles) for which the policy is used to set the permissions boundary.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **IsAttachable** *(boolean) --*
Specifies whether the policy can be attached to an IAM user, group, or role.
- **Description** *(string) --*
A friendly description of the policy.
This element is included in the response to the GetPolicy operation. It is not included in the response to the ListPolicies operation.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the policy was created.
- **UpdateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the policy was last updated.
When a policy has only one version, this field contains the date and time when the policy was created. When a policy has more than one version, this field contains the date and time when the most recent policy version was created.
:type PolicyName: string
:param PolicyName: **[REQUIRED]**
The friendly name of the policy.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Path: string
:param Path:
The path for the policy.
For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* .
This parameter is optional. If it is not included, it defaults to a slash (/).
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type PolicyDocument: string
:param PolicyDocument: **[REQUIRED]**
The JSON policy document that you want to use as the content for the new policy.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:type Description: string
:param Description:
A friendly description of the policy.
Typically used to store information about the permissions defined in the policy. For example, \"Grants access to production DynamoDB tables.\"
The policy description is immutable. After a value is assigned, it cannot be changed.
:rtype: dict
:returns:
"""
pass
def create_policy_version(self, PolicyArn: str, PolicyDocument: str, SetAsDefault: bool = None) -> Dict:
"""
Creates a new version of the specified managed policy. To update a managed policy, you create a new policy version. A managed policy can have up to five versions. If the policy has five versions, you must delete an existing version using DeletePolicyVersion before you create a new version.
Optionally, you can set the new version as the policy's default version. The default version is the version that is in effect for the IAM users, groups, and roles to which the policy is attached.
For more information about managed policy versions, see `Versioning for Managed Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-versions.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreatePolicyVersion>`_
**Request Syntax**
::
response = client.create_policy_version(
PolicyArn='string',
PolicyDocument='string',
SetAsDefault=True|False
)
**Response Syntax**
::
{
'PolicyVersion': {
'Document': 'string',
'VersionId': 'string',
'IsDefaultVersion': True|False,
'CreateDate': datetime(2015, 1, 1)
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful CreatePolicyVersion request.
- **PolicyVersion** *(dict) --*
A structure containing details about the new policy version.
- **Document** *(string) --*
The policy document.
The policy document is returned in the response to the GetPolicyVersion and GetAccountAuthorizationDetails operations. It is not returned in the response to the CreatePolicyVersion or ListPolicyVersions operations.
The policy document returned in this structure is URL-encoded compliant with `RFC 3986 <https://tools.ietf.org/html/rfc3986>`__ . You can use a URL decoding method to convert the policy back to plain JSON text. For example, if you use Java, you can use the ``decode`` method of the ``java.net.URLDecoder`` utility class in the Java SDK. Other languages and SDKs provide similar functionality.
- **VersionId** *(string) --*
The identifier for the policy version.
Policy version identifiers always begin with ``v`` (always lowercase). When a policy is created, the first policy version is ``v1`` .
- **IsDefaultVersion** *(boolean) --*
Specifies whether the policy version is set as the policy's default version.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the policy version was created.
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM policy to which you want to add a new version.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:type PolicyDocument: string
:param PolicyDocument: **[REQUIRED]**
The JSON policy document that you want to use as the content for this new version of the policy.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:type SetAsDefault: boolean
:param SetAsDefault:
Specifies whether to set this version as the policy\'s default version.
When this parameter is ``true`` , the new policy version becomes the operative version. That is, it becomes the version that is in effect for the IAM users, groups, and roles that the policy is attached to.
For more information about managed policy versions, see `Versioning for Managed Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-versions.html>`__ in the *IAM User Guide* .
:rtype: dict
:returns:
"""
pass
def create_role(self, RoleName: str, AssumeRolePolicyDocument: str, Path: str = None, Description: str = None, MaxSessionDuration: int = None, PermissionsBoundary: str = None, Tags: List = None) -> Dict:
"""
Creates a new role for your AWS account. For more information about roles, go to `IAM Roles <https://docs.aws.amazon.com/IAM/latest/UserGuide/WorkingWithRoles.html>`__ . For information about limitations on role names and the number of roles you can create, go to `Limitations on IAM Entities <https://docs.aws.amazon.com/IAM/latest/UserGuide/LimitationsOnEntities.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreateRole>`_
**Request Syntax**
::
response = client.create_role(
Path='string',
RoleName='string',
AssumeRolePolicyDocument='string',
Description='string',
MaxSessionDuration=123,
PermissionsBoundary='string',
Tags=[
{
'Key': 'string',
'Value': 'string'
},
]
)
**Response Syntax**
::
{
'Role': {
'Path': 'string',
'RoleName': 'string',
'RoleId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'AssumeRolePolicyDocument': 'string',
'Description': 'string',
'MaxSessionDuration': 123,
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful CreateRole request.
- **Role** *(dict) --*
A structure containing details about the new role.
- **Path** *(string) --*
The path to the role. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **RoleName** *(string) --*
The friendly name that identifies the role.
- **RoleId** *(string) --*
The stable and unique string identifying the role. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the role. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the role was created.
- **AssumeRolePolicyDocument** *(string) --*
The policy that grants an entity permission to assume the role.
- **Description** *(string) --*
A description of the role that you provide.
- **MaxSessionDuration** *(integer) --*
The maximum session duration (in seconds) for the specified role. Anyone who uses the AWS CLI, or API to assume the role can specify the duration using the optional ``DurationSeconds`` API parameter or ``duration-seconds`` CLI parameter.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the role.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are attached to the specified role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
:type Path: string
:param Path:
The path to the role. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* .
This parameter is optional. If it is not included, it defaults to a slash (/).
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the role to create.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
Role names are not distinguished by case. For example, you cannot create roles named both \"PRODROLE\" and \"prodrole\".
:type AssumeRolePolicyDocument: string
:param AssumeRolePolicyDocument: **[REQUIRED]**
The trust relationship policy document that grants an entity permission to assume the role.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:type Description: string
:param Description:
A description of the role.
:type MaxSessionDuration: integer
:param MaxSessionDuration:
The maximum session duration (in seconds) that you want to set for the specified role. If you do not specify a value for this setting, the default maximum of one hour is applied. This setting can have a value from 1 hour to 12 hours.
Anyone who assumes the role from the AWS CLI or API can use the ``DurationSeconds`` API parameter or the ``duration-seconds`` CLI parameter to request a longer session. The ``MaxSessionDuration`` setting determines the maximum duration that can be requested using the ``DurationSeconds`` parameter. If users don\'t specify a value for the ``DurationSeconds`` parameter, their security credentials are valid for one hour by default. This applies when you use the ``AssumeRole*`` API operations or the ``assume-role*`` CLI operations but does not apply when you use those operations to create a console URL. For more information, see `Using IAM Roles <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_roles_use.html>`__ in the *IAM User Guide* .
:type PermissionsBoundary: string
:param PermissionsBoundary:
The ARN of the policy that is used to set the permissions boundary for the role.
:type Tags: list
:param Tags:
A list of tags that you want to attach to the newly created role. Each tag consists of a key name and an associated value. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
.. note::
If any one of the tags is invalid or if you exceed the allowed number of tags per role, then the entire request fails and the role is not created.
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --* **[REQUIRED]**
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --* **[REQUIRED]**
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
:rtype: dict
:returns:
"""
pass
def create_saml_provider(self, SAMLMetadataDocument: str, Name: str) -> Dict:
"""
Creates an IAM resource that describes an identity provider (IdP) that supports SAML 2.0.
The SAML provider resource that you create with this operation can be used as a principal in an IAM role's trust policy. Such a policy can enable federated users who sign in using the SAML IdP to assume the role. You can create an IAM role that supports Web-based single sign-on (SSO) to the AWS Management Console or one that supports API access to AWS.
When you create the SAML provider resource, you upload a SAML metadata document that you get from your IdP. That document includes the issuer's name, expiration information, and keys that can be used to validate the SAML authentication response (assertions) that the IdP sends. You must generate the metadata document using the identity management software that is used as your organization's IdP.
.. note::
This operation requires `Signature Version 4 <https://docs.aws.amazon.com/general/latest/gr/signature-version-4.html>`__ .
For more information, see `Enabling SAML 2.0 Federated Users to Access the AWS Management Console <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_roles_providers_enable-console-saml.html>`__ and `About SAML 2.0-based Federation <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_roles_providers_saml.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreateSAMLProvider>`_
**Request Syntax**
::
response = client.create_saml_provider(
SAMLMetadataDocument='string',
Name='string'
)
**Response Syntax**
::
{
'SAMLProviderArn': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful CreateSAMLProvider request.
- **SAMLProviderArn** *(string) --*
The Amazon Resource Name (ARN) of the new SAML provider resource in IAM.
:type SAMLMetadataDocument: string
:param SAMLMetadataDocument: **[REQUIRED]**
An XML document generated by an identity provider (IdP) that supports SAML 2.0. The document includes the issuer\'s name, expiration information, and keys that can be used to validate the SAML authentication response (assertions) that are received from the IdP. You must generate the metadata document using the identity management software that is used as your organization\'s IdP.
For more information, see `About SAML 2.0-based Federation <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_roles_providers_saml.html>`__ in the *IAM User Guide*
:type Name: string
:param Name: **[REQUIRED]**
The name of the provider to create.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:rtype: dict
:returns:
"""
pass
def create_service_linked_role(self, AWSServiceName: str, Description: str = None, CustomSuffix: str = None) -> Dict:
"""
Creates an IAM role that is linked to a specific AWS service. The service controls the attached policies and when the role can be deleted. This helps ensure that the service is not broken by an unexpectedly changed or deleted role, which could put your AWS resources into an unknown state. Allowing the service to control the role helps improve service stability and proper cleanup when a service and its role are no longer needed. For more information, see `Using Service-Linked Roles <https://docs.aws.amazon.com/IAM/latest/UserGuide/using-service-linked-roles.html>`__ in the *IAM User Guide* .
To attach a policy to this service-linked role, you must make the request using the AWS service that depends on this role.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreateServiceLinkedRole>`_
**Request Syntax**
::
response = client.create_service_linked_role(
AWSServiceName='string',
Description='string',
CustomSuffix='string'
)
**Response Syntax**
::
{
'Role': {
'Path': 'string',
'RoleName': 'string',
'RoleId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'AssumeRolePolicyDocument': 'string',
'Description': 'string',
'MaxSessionDuration': 123,
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
}
}
**Response Structure**
- *(dict) --*
- **Role** *(dict) --*
A Role object that contains details about the newly created role.
- **Path** *(string) --*
The path to the role. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **RoleName** *(string) --*
The friendly name that identifies the role.
- **RoleId** *(string) --*
The stable and unique string identifying the role. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the role. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the role was created.
- **AssumeRolePolicyDocument** *(string) --*
The policy that grants an entity permission to assume the role.
- **Description** *(string) --*
A description of the role that you provide.
- **MaxSessionDuration** *(integer) --*
The maximum session duration (in seconds) for the specified role. Anyone who uses the AWS CLI, or API to assume the role can specify the duration using the optional ``DurationSeconds`` API parameter or ``duration-seconds`` CLI parameter.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the role.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are attached to the specified role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
:type AWSServiceName: string
:param AWSServiceName: **[REQUIRED]**
The service principal for the AWS service to which this role is attached. You use a string similar to a URL but without the http:// in front. For example: ``elasticbeanstalk.amazonaws.com`` .
Service principals are unique and case-sensitive. To find the exact service principal for your service-linked role, see `AWS Services That Work with IAM <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_aws-services-that-work-with-iam.html>`__ in the *IAM User Guide* . Look for the services that have **Yes** in the **Service-Linked Role** column. Choose the **Yes** link to view the service-linked role documentation for that service.
:type Description: string
:param Description:
The description of the role.
:type CustomSuffix: string
:param CustomSuffix:
A string that you provide, which is combined with the service-provided prefix to form the complete role name. If you make multiple requests for the same service, then you must supply a different ``CustomSuffix`` for each request. Otherwise the request fails with a duplicate role name error. For example, you could add ``-1`` or ``-debug`` to the suffix.
Some services do not support the ``CustomSuffix`` parameter. If you provide an optional suffix and the operation fails, try the operation again without the suffix.
:rtype: dict
:returns:
"""
pass
def create_service_specific_credential(self, UserName: str, ServiceName: str) -> Dict:
"""
Generates a set of credentials consisting of a user name and password that can be used to access the service specified in the request. These credentials are generated by IAM, and can be used only for the specified service.
You can have a maximum of two sets of service-specific credentials for each supported service per user.
The only supported service at this time is AWS CodeCommit.
You can reset the password to a new service-generated value by calling ResetServiceSpecificCredential .
For more information about service-specific credentials, see `Using IAM with AWS CodeCommit\: Git Credentials, SSH Keys, and AWS Access Keys <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_credentials_ssh-keys.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreateServiceSpecificCredential>`_
**Request Syntax**
::
response = client.create_service_specific_credential(
UserName='string',
ServiceName='string'
)
**Response Syntax**
::
{
'ServiceSpecificCredential': {
'CreateDate': datetime(2015, 1, 1),
'ServiceName': 'string',
'ServiceUserName': 'string',
'ServicePassword': 'string',
'ServiceSpecificCredentialId': 'string',
'UserName': 'string',
'Status': 'Active'|'Inactive'
}
}
**Response Structure**
- *(dict) --*
- **ServiceSpecificCredential** *(dict) --*
A structure that contains information about the newly created service-specific credential.
.. warning::
This is the only time that the password for this credential set is available. It cannot be recovered later. Instead, you must reset the password with ResetServiceSpecificCredential .
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the service-specific credential were created.
- **ServiceName** *(string) --*
The name of the service associated with the service-specific credential.
- **ServiceUserName** *(string) --*
The generated user name for the service-specific credential. This value is generated by combining the IAM user's name combined with the ID number of the AWS account, as in ``jane-at-123456789012`` , for example. This value cannot be configured by the user.
- **ServicePassword** *(string) --*
The generated password for the service-specific credential.
- **ServiceSpecificCredentialId** *(string) --*
The unique identifier for the service-specific credential.
- **UserName** *(string) --*
The name of the IAM user associated with the service-specific credential.
- **Status** *(string) --*
The status of the service-specific credential. ``Active`` means that the key is valid for API calls, while ``Inactive`` means it is not.
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the IAM user that is to be associated with the credentials. The new service-specific credentials have the same permissions as the associated user except that they can be used only to access the specified service.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type ServiceName: string
:param ServiceName: **[REQUIRED]**
The name of the AWS service that is to be associated with the credentials. The service you specify here is the only service that can be accessed using these credentials.
:rtype: dict
:returns:
"""
pass
def create_user(self, UserName: str, Path: str = None, PermissionsBoundary: str = None, Tags: List = None) -> Dict:
"""
Creates a new IAM user for your AWS account.
For information about limitations on the number of IAM users you can create, see `Limitations on IAM Entities <https://docs.aws.amazon.com/IAM/latest/UserGuide/LimitationsOnEntities.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreateUser>`_
**Request Syntax**
::
response = client.create_user(
Path='string',
UserName='string',
PermissionsBoundary='string',
Tags=[
{
'Key': 'string',
'Value': 'string'
},
]
)
**Response Syntax**
::
{
'User': {
'Path': 'string',
'UserName': 'string',
'UserId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'PasswordLastUsed': datetime(2015, 1, 1),
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful CreateUser request.
- **User** *(dict) --*
A structure with details about the new IAM user.
- **Path** *(string) --*
The path to the user. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **UserName** *(string) --*
The friendly name identifying the user.
- **UserId** *(string) --*
The stable and unique string identifying the user. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) that identifies the user. For more information about ARNs and how to use ARNs in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the user was created.
- **PasswordLastUsed** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the user's password was last used to sign in to an AWS website. For a list of AWS websites that capture a user's last sign-in time, see the `Credential Reports <https://docs.aws.amazon.com/IAM/latest/UserGuide/credential-reports.html>`__ topic in the *Using IAM* guide. If a password is used more than once in a five-minute span, only the first use is returned in this field. If the field is null (no value), then it indicates that they never signed in with a password. This can be because:
* The user never had a password.
* A password exists but has not been used since IAM started tracking this information on October 20, 2014.
A null valuedoes not mean that the user *never* had a password. Also, if the user does not currently have a password, but had one in the past, then this field contains the date and time the most recent password was used.
This value is returned only in the GetUser and ListUsers operations.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the user.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are associated with the specified user. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
:type Path: string
:param Path:
The path for the user name. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* .
This parameter is optional. If it is not included, it defaults to a slash (/).
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user to create.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-. User names are not distinguished by case. For example, you cannot create users named both \"TESTUSER\" and \"testuser\".
:type PermissionsBoundary: string
:param PermissionsBoundary:
The ARN of the policy that is used to set the permissions boundary for the user.
:type Tags: list
:param Tags:
A list of tags that you want to attach to the newly created user. Each tag consists of a key name and an associated value. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
.. note::
If any one of the tags is invalid or if you exceed the allowed number of tags per user, then the entire request fails and the user is not created.
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --* **[REQUIRED]**
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --* **[REQUIRED]**
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
:rtype: dict
:returns:
"""
pass
def create_virtual_mfa_device(self, VirtualMFADeviceName: str, Path: str = None) -> Dict:
"""
Creates a new virtual MFA device for the AWS account. After creating the virtual MFA, use EnableMFADevice to attach the MFA device to an IAM user. For more information about creating and working with virtual MFA devices, go to `Using a Virtual MFA Device <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_VirtualMFA.html>`__ in the *IAM User Guide* .
For information about limits on the number of MFA devices you can create, see `Limitations on Entities <https://docs.aws.amazon.com/IAM/latest/UserGuide/LimitationsOnEntities.html>`__ in the *IAM User Guide* .
.. warning::
The seed information contained in the QR code and the Base32 string should be treated like any other secret access information. In other words, protect the seed information as you would your AWS access keys or your passwords. After you provision your virtual device, you should ensure that the information is destroyed following secure procedures.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/CreateVirtualMFADevice>`_
**Request Syntax**
::
response = client.create_virtual_mfa_device(
Path='string',
VirtualMFADeviceName='string'
)
**Response Syntax**
::
{
'VirtualMFADevice': {
'SerialNumber': 'string',
'Base32StringSeed': b'bytes',
'QRCodePNG': b'bytes',
'User': {
'Path': 'string',
'UserName': 'string',
'UserId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'PasswordLastUsed': datetime(2015, 1, 1),
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
},
'EnableDate': datetime(2015, 1, 1)
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful CreateVirtualMFADevice request.
- **VirtualMFADevice** *(dict) --*
A structure containing details about the new virtual MFA device.
- **SerialNumber** *(string) --*
The serial number associated with ``VirtualMFADevice`` .
- **Base32StringSeed** *(bytes) --*
The base32 seed defined as specified in `RFC3548 <https://tools.ietf.org/html/rfc3548.txt>`__ . The ``Base32StringSeed`` is base64-encoded.
- **QRCodePNG** *(bytes) --*
A QR code PNG image that encodes ``otpauth://totp/$virtualMFADeviceName@$AccountName?secret=$Base32String`` where ``$virtualMFADeviceName`` is one of the create call arguments. ``AccountName`` is the user name if set (otherwise, the account ID otherwise), and ``Base32String`` is the seed in base32 format. The ``Base32String`` value is base64-encoded.
- **User** *(dict) --*
The IAM user associated with this virtual MFA device.
- **Path** *(string) --*
The path to the user. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **UserName** *(string) --*
The friendly name identifying the user.
- **UserId** *(string) --*
The stable and unique string identifying the user. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) that identifies the user. For more information about ARNs and how to use ARNs in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the user was created.
- **PasswordLastUsed** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the user's password was last used to sign in to an AWS website. For a list of AWS websites that capture a user's last sign-in time, see the `Credential Reports <https://docs.aws.amazon.com/IAM/latest/UserGuide/credential-reports.html>`__ topic in the *Using IAM* guide. If a password is used more than once in a five-minute span, only the first use is returned in this field. If the field is null (no value), then it indicates that they never signed in with a password. This can be because:
* The user never had a password.
* A password exists but has not been used since IAM started tracking this information on October 20, 2014.
A null valuedoes not mean that the user *never* had a password. Also, if the user does not currently have a password, but had one in the past, then this field contains the date and time the most recent password was used.
This value is returned only in the GetUser and ListUsers operations.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the user.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are associated with the specified user. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
- **EnableDate** *(datetime) --*
The date and time on which the virtual MFA device was enabled.
:type Path: string
:param Path:
The path for the virtual MFA device. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* .
This parameter is optional. If it is not included, it defaults to a slash (/).
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type VirtualMFADeviceName: string
:param VirtualMFADeviceName: **[REQUIRED]**
The name of the virtual MFA device. Use with path to uniquely identify a virtual MFA device.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:rtype: dict
:returns:
"""
pass
def deactivate_mfa_device(self, UserName: str, SerialNumber: str):
"""
Deactivates the specified MFA device and removes it from association with the user name for which it was originally enabled.
For more information about creating and working with virtual MFA devices, go to `Enabling a Virtual Multi-factor Authentication (MFA) Device <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_VirtualMFA.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeactivateMFADevice>`_
**Request Syntax**
::
response = client.deactivate_mfa_device(
UserName='string',
SerialNumber='string'
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user whose MFA device you want to deactivate.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type SerialNumber: string
:param SerialNumber: **[REQUIRED]**
The serial number that uniquely identifies the MFA device. For virtual MFA devices, the serial number is the device ARN.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: =,.@:/-
:returns: None
"""
pass
def delete_access_key(self, AccessKeyId: str, UserName: str = None):
"""
Deletes the access key pair associated with the specified IAM user.
If you do not specify a user name, IAM determines the user name implicitly based on the AWS access key ID signing the request. This operation works for access keys under the AWS account. Consequently, you can use this operation to manage AWS account root user credentials even if the AWS account has no associated users.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteAccessKey>`_
**Request Syntax**
::
response = client.delete_access_key(
UserName='string',
AccessKeyId='string'
)
:type UserName: string
:param UserName:
The name of the user whose access key pair you want to delete.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type AccessKeyId: string
:param AccessKeyId: **[REQUIRED]**
The access key ID for the access key ID and secret access key you want to delete.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that can consist of any upper or lowercased letter or digit.
:returns: None
"""
pass
def delete_account_alias(self, AccountAlias: str):
"""
Deletes the specified AWS account alias. For information about using an AWS account alias, see `Using an Alias for Your AWS Account ID <https://docs.aws.amazon.com/IAM/latest/UserGuide/AccountAlias.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteAccountAlias>`_
**Request Syntax**
::
response = client.delete_account_alias(
AccountAlias='string'
)
:type AccountAlias: string
:param AccountAlias: **[REQUIRED]**
The name of the account alias to delete.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of lowercase letters, digits, and dashes. You cannot start or finish with a dash, nor can you have two dashes in a row.
:returns: None
"""
pass
def delete_account_password_policy(self):
"""
Deletes the password policy for the AWS account. There are no parameters.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteAccountPasswordPolicy>`_
**Request Syntax**
::
response = client.delete_account_password_policy()
:returns: None
"""
pass
def delete_group(self, GroupName: str):
"""
Deletes the specified IAM group. The group must not contain any users or have any attached policies.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteGroup>`_
**Request Syntax**
::
response = client.delete_group(
GroupName='string'
)
:type GroupName: string
:param GroupName: **[REQUIRED]**
The name of the IAM group to delete.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def delete_group_policy(self, GroupName: str, PolicyName: str):
"""
Deletes the specified inline policy that is embedded in the specified IAM group.
A group can also have managed policies attached to it. To detach a managed policy from a group, use DetachGroupPolicy . For more information about policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteGroupPolicy>`_
**Request Syntax**
::
response = client.delete_group_policy(
GroupName='string',
PolicyName='string'
)
:type GroupName: string
:param GroupName: **[REQUIRED]**
The name (friendly name, not ARN) identifying the group that the policy is embedded in.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyName: string
:param PolicyName: **[REQUIRED]**
The name identifying the policy document to delete.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def delete_instance_profile(self, InstanceProfileName: str):
"""
Deletes the specified instance profile. The instance profile must not have an associated role.
.. warning::
Make sure that you do not have any Amazon EC2 instances running with the instance profile you are about to delete. Deleting a role or instance profile that is associated with a running instance will break any applications running on the instance.
For more information about instance profiles, go to `About Instance Profiles <https://docs.aws.amazon.com/IAM/latest/UserGuide/AboutInstanceProfiles.html>`__ .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteInstanceProfile>`_
**Request Syntax**
::
response = client.delete_instance_profile(
InstanceProfileName='string'
)
:type InstanceProfileName: string
:param InstanceProfileName: **[REQUIRED]**
The name of the instance profile to delete.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def delete_login_profile(self, UserName: str):
"""
Deletes the password for the specified IAM user, which terminates the user's ability to access AWS services through the AWS Management Console.
.. warning::
Deleting a user's password does not prevent a user from accessing AWS through the command line interface or the API. To prevent all user access, you must also either make any access keys inactive or delete them. For more information about making keys inactive or deleting them, see UpdateAccessKey and DeleteAccessKey .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteLoginProfile>`_
**Request Syntax**
::
response = client.delete_login_profile(
UserName='string'
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user whose password you want to delete.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def delete_open_id_connect_provider(self, OpenIDConnectProviderArn: str):
"""
Deletes an OpenID Connect identity provider (IdP) resource object in IAM.
Deleting an IAM OIDC provider resource does not update any roles that reference the provider as a principal in their trust policies. Any attempt to assume a role that references a deleted provider fails.
This operation is idempotent; it does not fail or return an error if you call the operation for a provider that does not exist.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteOpenIDConnectProvider>`_
**Request Syntax**
::
response = client.delete_open_id_connect_provider(
OpenIDConnectProviderArn='string'
)
:type OpenIDConnectProviderArn: string
:param OpenIDConnectProviderArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM OpenID Connect provider resource object to delete. You can get a list of OpenID Connect provider resource ARNs by using the ListOpenIDConnectProviders operation.
:returns: None
"""
pass
def delete_policy(self, PolicyArn: str):
"""
Deletes the specified managed policy.
Before you can delete a managed policy, you must first detach the policy from all users, groups, and roles that it is attached to. In addition, you must delete all the policy's versions. The following steps describe the process for deleting a managed policy:
* Detach the policy from all users, groups, and roles that the policy is attached to, using the DetachUserPolicy , DetachGroupPolicy , or DetachRolePolicy API operations. To list all the users, groups, and roles that a policy is attached to, use ListEntitiesForPolicy .
* Delete all versions of the policy using DeletePolicyVersion . To list the policy's versions, use ListPolicyVersions . You cannot use DeletePolicyVersion to delete the version that is marked as the default version. You delete the policy's default version in the next step of the process.
* Delete the policy (this automatically deletes the policy's default version) using this API.
For information about managed policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeletePolicy>`_
**Request Syntax**
::
response = client.delete_policy(
PolicyArn='string'
)
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM policy you want to delete.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:returns: None
"""
pass
def delete_policy_version(self, PolicyArn: str, VersionId: str):
"""
Deletes the specified version from the specified managed policy.
You cannot delete the default version from a policy using this API. To delete the default version from a policy, use DeletePolicy . To find out which version of a policy is marked as the default version, use ListPolicyVersions .
For information about versions for managed policies, see `Versioning for Managed Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-versions.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeletePolicyVersion>`_
**Request Syntax**
::
response = client.delete_policy_version(
PolicyArn='string',
VersionId='string'
)
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM policy from which you want to delete a version.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:type VersionId: string
:param VersionId: **[REQUIRED]**
The policy version to delete.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that consists of the lowercase letter \'v\' followed by one or two digits, and optionally followed by a period \'.\' and a string of letters and digits.
For more information about managed policy versions, see `Versioning for Managed Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-versions.html>`__ in the *IAM User Guide* .
:returns: None
"""
pass
def delete_role(self, RoleName: str):
"""
Deletes the specified role. The role must not have any policies attached. For more information about roles, go to `Working with Roles <https://docs.aws.amazon.com/IAM/latest/UserGuide/WorkingWithRoles.html>`__ .
.. warning::
Make sure that you do not have any Amazon EC2 instances running with the role you are about to delete. Deleting a role or instance profile that is associated with a running instance will break any applications running on the instance.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteRole>`_
**Request Syntax**
::
response = client.delete_role(
RoleName='string'
)
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the role to delete.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def delete_role_permissions_boundary(self, RoleName: str):
"""
Deletes the permissions boundary for the specified IAM role.
.. warning::
Deleting the permissions boundary for a role might increase its permissions. For example, it might allow anyone who assumes the role to perform all the actions granted in its permissions policies.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteRolePermissionsBoundary>`_
**Request Syntax**
::
response = client.delete_role_permissions_boundary(
RoleName='string'
)
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name (friendly name, not ARN) of the IAM role from which you want to remove the permissions boundary.
:returns: None
"""
pass
def delete_role_policy(self, RoleName: str, PolicyName: str):
"""
Deletes the specified inline policy that is embedded in the specified IAM role.
A role can also have managed policies attached to it. To detach a managed policy from a role, use DetachRolePolicy . For more information about policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteRolePolicy>`_
**Request Syntax**
::
response = client.delete_role_policy(
RoleName='string',
PolicyName='string'
)
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name (friendly name, not ARN) identifying the role that the policy is embedded in.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyName: string
:param PolicyName: **[REQUIRED]**
The name of the inline policy to delete from the specified IAM role.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def delete_saml_provider(self, SAMLProviderArn: str):
"""
Deletes a SAML provider resource in IAM.
Deleting the provider resource from IAM does not update any roles that reference the SAML provider resource's ARN as a principal in their trust policies. Any attempt to assume a role that references a non-existent provider resource ARN fails.
.. note::
This operation requires `Signature Version 4 <https://docs.aws.amazon.com/general/latest/gr/signature-version-4.html>`__ .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteSAMLProvider>`_
**Request Syntax**
::
response = client.delete_saml_provider(
SAMLProviderArn='string'
)
:type SAMLProviderArn: string
:param SAMLProviderArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the SAML provider to delete.
:returns: None
"""
pass
def delete_server_certificate(self, ServerCertificateName: str):
"""
Deletes the specified server certificate.
For more information about working with server certificates, see `Working with Server Certificates <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_credentials_server-certs.html>`__ in the *IAM User Guide* . This topic also includes a list of AWS services that can use the server certificates that you manage with IAM.
.. warning::
If you are using a server certificate with Elastic Load Balancing, deleting the certificate could have implications for your application. If Elastic Load Balancing doesn't detect the deletion of bound certificates, it may continue to use the certificates. This could cause Elastic Load Balancing to stop accepting traffic. We recommend that you remove the reference to the certificate from Elastic Load Balancing before using this command to delete the certificate. For more information, go to `DeleteLoadBalancerListeners <https://docs.aws.amazon.com/ElasticLoadBalancing/latest/APIReference/API_DeleteLoadBalancerListeners.html>`__ in the *Elastic Load Balancing API Reference* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteServerCertificate>`_
**Request Syntax**
::
response = client.delete_server_certificate(
ServerCertificateName='string'
)
:type ServerCertificateName: string
:param ServerCertificateName: **[REQUIRED]**
The name of the server certificate you want to delete.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def delete_service_linked_role(self, RoleName: str) -> Dict:
"""
Submits a service-linked role deletion request and returns a ``DeletionTaskId`` , which you can use to check the status of the deletion. Before you call this operation, confirm that the role has no active sessions and that any resources used by the role in the linked service are deleted. If you call this operation more than once for the same service-linked role and an earlier deletion task is not complete, then the ``DeletionTaskId`` of the earlier request is returned.
If you submit a deletion request for a service-linked role whose linked service is still accessing a resource, then the deletion task fails. If it fails, the GetServiceLinkedRoleDeletionStatus API operation returns the reason for the failure, usually including the resources that must be deleted. To delete the service-linked role, you must first remove those resources from the linked service and then submit the deletion request again. Resources are specific to the service that is linked to the role. For more information about removing resources from a service, see the `AWS documentation <http://docs.aws.amazon.com/>`__ for your service.
For more information about service-linked roles, see `Roles Terms and Concepts\: AWS Service-Linked Role <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_roles_terms-and-concepts.html#iam-term-service-linked-role>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteServiceLinkedRole>`_
**Request Syntax**
::
response = client.delete_service_linked_role(
RoleName='string'
)
**Response Syntax**
::
{
'DeletionTaskId': 'string'
}
**Response Structure**
- *(dict) --*
- **DeletionTaskId** *(string) --*
The deletion task identifier that you can use to check the status of the deletion. This identifier is returned in the format ``task/aws-service-role/<service-principal-name>/<role-name>/<task-uuid>`` .
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the service-linked role to be deleted.
:rtype: dict
:returns:
"""
pass
def delete_service_specific_credential(self, ServiceSpecificCredentialId: str, UserName: str = None):
"""
Deletes the specified service-specific credential.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteServiceSpecificCredential>`_
**Request Syntax**
::
response = client.delete_service_specific_credential(
UserName='string',
ServiceSpecificCredentialId='string'
)
:type UserName: string
:param UserName:
The name of the IAM user associated with the service-specific credential. If this value is not specified, then the operation assumes the user whose credentials are used to call the operation.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type ServiceSpecificCredentialId: string
:param ServiceSpecificCredentialId: **[REQUIRED]**
The unique identifier of the service-specific credential. You can get this value by calling ListServiceSpecificCredentials .
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that can consist of any upper or lowercased letter or digit.
:returns: None
"""
pass
def delete_signing_certificate(self, CertificateId: str, UserName: str = None):
"""
Deletes a signing certificate associated with the specified IAM user.
If you do not specify a user name, IAM determines the user name implicitly based on the AWS access key ID signing the request. This operation works for access keys under the AWS account. Consequently, you can use this operation to manage AWS account root user credentials even if the AWS account has no associated IAM users.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteSigningCertificate>`_
**Request Syntax**
::
response = client.delete_signing_certificate(
UserName='string',
CertificateId='string'
)
:type UserName: string
:param UserName:
The name of the user the signing certificate belongs to.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type CertificateId: string
:param CertificateId: **[REQUIRED]**
The ID of the signing certificate to delete.
The format of this parameter, as described by its `regex <http://wikipedia.org/wiki/regex>`__ pattern, is a string of characters that can be upper- or lower-cased letters or digits.
:returns: None
"""
pass
def delete_ssh_public_key(self, UserName: str, SSHPublicKeyId: str):
"""
Deletes the specified SSH public key.
The SSH public key deleted by this operation is used only for authenticating the associated IAM user to an AWS CodeCommit repository. For more information about using SSH keys to authenticate to an AWS CodeCommit repository, see `Set up AWS CodeCommit for SSH Connections <https://docs.aws.amazon.com/codecommit/latest/userguide/setting-up-credentials-ssh.html>`__ in the *AWS CodeCommit User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteSSHPublicKey>`_
**Request Syntax**
::
response = client.delete_ssh_public_key(
UserName='string',
SSHPublicKeyId='string'
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the IAM user associated with the SSH public key.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type SSHPublicKeyId: string
:param SSHPublicKeyId: **[REQUIRED]**
The unique identifier for the SSH public key.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that can consist of any upper or lowercased letter or digit.
:returns: None
"""
pass
def delete_user(self, UserName: str):
"""
Deletes the specified IAM user. Unlike the AWS Management Console, when you delete a user programmatically, you must delete the items attached to the user manually, or the deletion fails. For more information, see `Deleting an IAM User <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_users_manage.html#id_users_deleting_cli>`__ . Before attempting to delete a user, remove the following items:
* Password ( DeleteLoginProfile )
* Access keys ( DeleteAccessKey )
* Signing certificate ( DeleteSigningCertificate )
* SSH public key ( DeleteSSHPublicKey )
* Git credentials ( DeleteServiceSpecificCredential )
* Multi-factor authentication (MFA) device ( DeactivateMFADevice , DeleteVirtualMFADevice )
* Inline policies ( DeleteUserPolicy )
* Attached managed policies ( DetachUserPolicy )
* Group memberships ( RemoveUserFromGroup )
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteUser>`_
**Request Syntax**
::
response = client.delete_user(
UserName='string'
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user to delete.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def delete_user_permissions_boundary(self, UserName: str):
"""
Deletes the permissions boundary for the specified IAM user.
.. warning::
Deleting the permissions boundary for a user might increase its permissions by allowing the user to perform all the actions granted in its permissions policies.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteUserPermissionsBoundary>`_
**Request Syntax**
::
response = client.delete_user_permissions_boundary(
UserName='string'
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name (friendly name, not ARN) of the IAM user from which you want to remove the permissions boundary.
:returns: None
"""
pass
def delete_user_policy(self, UserName: str, PolicyName: str):
"""
Deletes the specified inline policy that is embedded in the specified IAM user.
A user can also have managed policies attached to it. To detach a managed policy from a user, use DetachUserPolicy . For more information about policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteUserPolicy>`_
**Request Syntax**
::
response = client.delete_user_policy(
UserName='string',
PolicyName='string'
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name (friendly name, not ARN) identifying the user that the policy is embedded in.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyName: string
:param PolicyName: **[REQUIRED]**
The name identifying the policy document to delete.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def delete_virtual_mfa_device(self, SerialNumber: str):
"""
Deletes a virtual MFA device.
.. note::
You must deactivate a user's virtual MFA device before you can delete it. For information about deactivating MFA devices, see DeactivateMFADevice .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DeleteVirtualMFADevice>`_
**Request Syntax**
::
response = client.delete_virtual_mfa_device(
SerialNumber='string'
)
:type SerialNumber: string
:param SerialNumber: **[REQUIRED]**
The serial number that uniquely identifies the MFA device. For virtual MFA devices, the serial number is the same as the ARN.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: =,.@:/-
:returns: None
"""
pass
def detach_group_policy(self, GroupName: str, PolicyArn: str):
"""
Removes the specified managed policy from the specified IAM group.
A group can also have inline policies embedded with it. To delete an inline policy, use the DeleteGroupPolicy API. For information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DetachGroupPolicy>`_
**Request Syntax**
::
response = client.detach_group_policy(
GroupName='string',
PolicyArn='string'
)
:type GroupName: string
:param GroupName: **[REQUIRED]**
The name (friendly name, not ARN) of the IAM group to detach the policy from.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM policy you want to detach.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:returns: None
"""
pass
def detach_role_policy(self, RoleName: str, PolicyArn: str):
"""
Removes the specified managed policy from the specified role.
A role can also have inline policies embedded with it. To delete an inline policy, use the DeleteRolePolicy API. For information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DetachRolePolicy>`_
**Request Syntax**
::
response = client.detach_role_policy(
RoleName='string',
PolicyArn='string'
)
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name (friendly name, not ARN) of the IAM role to detach the policy from.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM policy you want to detach.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:returns: None
"""
pass
def detach_user_policy(self, UserName: str, PolicyArn: str):
"""
Removes the specified managed policy from the specified user.
A user can also have inline policies embedded with it. To delete an inline policy, use the DeleteUserPolicy API. For information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/DetachUserPolicy>`_
**Request Syntax**
::
response = client.detach_user_policy(
UserName='string',
PolicyArn='string'
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name (friendly name, not ARN) of the IAM user to detach the policy from.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM policy you want to detach.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:returns: None
"""
pass
def enable_mfa_device(self, UserName: str, SerialNumber: str, AuthenticationCode1: str, AuthenticationCode2: str):
"""
Enables the specified MFA device and associates it with the specified IAM user. When enabled, the MFA device is required for every subsequent login by the IAM user associated with the device.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/EnableMFADevice>`_
**Request Syntax**
::
response = client.enable_mfa_device(
UserName='string',
SerialNumber='string',
AuthenticationCode1='string',
AuthenticationCode2='string'
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the IAM user for whom you want to enable the MFA device.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type SerialNumber: string
:param SerialNumber: **[REQUIRED]**
The serial number that uniquely identifies the MFA device. For virtual MFA devices, the serial number is the device ARN.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: =,.@:/-
:type AuthenticationCode1: string
:param AuthenticationCode1: **[REQUIRED]**
An authentication code emitted by the device.
The format for this parameter is a string of six digits.
.. warning::
Submit your request immediately after generating the authentication codes. If you generate the codes and then wait too long to submit the request, the MFA device successfully associates with the user but the MFA device becomes out of sync. This happens because time-based one-time passwords (TOTP) expire after a short period of time. If this happens, you can `resync the device <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_credentials_mfa_sync.html>`__ .
:type AuthenticationCode2: string
:param AuthenticationCode2: **[REQUIRED]**
A subsequent authentication code emitted by the device.
The format for this parameter is a string of six digits.
.. warning::
Submit your request immediately after generating the authentication codes. If you generate the codes and then wait too long to submit the request, the MFA device successfully associates with the user but the MFA device becomes out of sync. This happens because time-based one-time passwords (TOTP) expire after a short period of time. If this happens, you can `resync the device <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_credentials_mfa_sync.html>`__ .
:returns: None
"""
pass
def generate_credential_report(self) -> Dict:
"""
Generates a credential report for the AWS account. For more information about the credential report, see `Getting Credential Reports <https://docs.aws.amazon.com/IAM/latest/UserGuide/credential-reports.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GenerateCredentialReport>`_
**Request Syntax**
::
response = client.generate_credential_report()
**Response Syntax**
::
{
'State': 'STARTED'|'INPROGRESS'|'COMPLETE',
'Description': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GenerateCredentialReport request.
- **State** *(string) --*
Information about the state of the credential report.
- **Description** *(string) --*
Information about the credential report.
:rtype: dict
:returns:
"""
pass
def generate_presigned_url(self, ClientMethod: str = None, Params: Dict = None, ExpiresIn: int = None, HttpMethod: str = None):
"""
Generate a presigned url given a client, its method, and arguments
:type ClientMethod: string
:param ClientMethod: The client method to presign for
:type Params: dict
:param Params: The parameters normally passed to
``ClientMethod``.
:type ExpiresIn: int
:param ExpiresIn: The number of seconds the presigned url is valid
for. By default it expires in an hour (3600 seconds)
:type HttpMethod: string
:param HttpMethod: The http method to use on the generated url. By
default, the http method is whatever is used in the method\'s model.
:returns: The presigned url
"""
pass
def generate_service_last_accessed_details(self, Arn: str) -> Dict:
"""
Generates a request for a report that includes details about when an IAM resource (user, group, role, or policy) was last used in an attempt to access AWS services. Recent activity usually appears within four hours. IAM reports activity for the last 365 days, or less if your Region began supporting this feature within the last year. For more information, see `Regions Where Data Is Tracked <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_access-advisor.html#access-advisor_tracking-period>`__ .
.. warning::
The service last accessed data includes all attempts to access an AWS API, not just the successful ones. This includes all attempts that were made using the AWS Management Console, the AWS API through any of the SDKs, or any of the command line tools. An unexpected entry in the service last accessed data does not mean that your account has been compromised, because the request might have been denied. Refer to your CloudTrail logs as the authoritative source for information about all API calls and whether they were successful or denied access. For more information, see `Logging IAM Events with CloudTrail <https://docs.aws.amazon.com/IAM/latest/UserGuide/cloudtrail-integration.html>`__ in the *IAM User Guide* .
The ``GenerateServiceLastAccessedDetails`` operation returns a ``JobId`` . Use this parameter in the following operations to retrieve the following details from your report:
* GetServiceLastAccessedDetails – Use this operation for users, groups, roles, or policies to list every AWS service that the resource could access using permissions policies. For each service, the response includes information about the most recent access attempt.
* GetServiceLastAccessedDetailsWithEntities – Use this operation for groups and policies to list information about the associated entities (users or roles) that attempted to access a specific AWS service.
To check the status of the ``GenerateServiceLastAccessedDetails`` request, use the ``JobId`` parameter in the same operations and test the ``JobStatus`` response parameter.
For additional information about the permissions policies that allow an identity (user, group, or role) to access specific services, use the ListPoliciesGrantingServiceAccess operation.
.. note::
Service last accessed data does not use other policy types when determining whether a resource could access a service. These other policy types include resource-based policies, access control lists, AWS Organizations policies, IAM permissions boundaries, and AWS STS assume role policies. It only applies permissions policy logic. For more about the evaluation of policy types, see `Evaluating Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_policies_evaluation-logic.html#policy-eval-basics>`__ in the *IAM User Guide* .
For more information about service last accessed data, see `Reducing Policy Scope by Viewing User Activity <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_access-advisor.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GenerateServiceLastAccessedDetails>`_
**Request Syntax**
::
response = client.generate_service_last_accessed_details(
Arn='string'
)
**Response Syntax**
::
{
'JobId': 'string'
}
**Response Structure**
- *(dict) --*
- **JobId** *(string) --*
The job ID that you can use in the GetServiceLastAccessedDetails or GetServiceLastAccessedDetailsWithEntities operations.
:type Arn: string
:param Arn: **[REQUIRED]**
The ARN of the IAM resource (user, group, role, or managed policy) used to generate information about when the resource was last used in an attempt to access an AWS service.
:rtype: dict
:returns:
"""
pass
def get_access_key_last_used(self, AccessKeyId: str) -> Dict:
"""
Retrieves information about when the specified access key was last used. The information includes the date and time of last use, along with the AWS service and Region that were specified in the last request made with that key.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetAccessKeyLastUsed>`_
**Request Syntax**
::
response = client.get_access_key_last_used(
AccessKeyId='string'
)
**Response Syntax**
::
{
'UserName': 'string',
'AccessKeyLastUsed': {
'LastUsedDate': datetime(2015, 1, 1),
'ServiceName': 'string',
'Region': 'string'
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetAccessKeyLastUsed request. It is also returned as a member of the AccessKeyMetaData structure returned by the ListAccessKeys action.
- **UserName** *(string) --*
The name of the AWS IAM user that owns this access key.
- **AccessKeyLastUsed** *(dict) --*
Contains information about the last time the access key was used.
- **LastUsedDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the access key was most recently used. This field is null in the following situations:
* The user does not have an access key.
* An access key exists but has not been used since IAM began tracking this information.
* There is no sign-in data associated with the user
- **ServiceName** *(string) --*
The name of the AWS service with which this access key was most recently used. The value of this field is "N/A" in the following situations:
* The user does not have an access key.
* An access key exists but has not been used since IAM started tracking this information.
* There is no sign-in data associated with the user
- **Region** *(string) --*
The AWS region where this access key was most recently used. The value for this field is "N/A" in the following situations:
* The user does not have an access key.
* An access key exists but has not been used since IAM began tracking this information.
* There is no sign-in data associated with the user
For more information about AWS regions, see `Regions and Endpoints <https://docs.aws.amazon.com/general/latest/gr/rande.html>`__ in the Amazon Web Services General Reference.
:type AccessKeyId: string
:param AccessKeyId: **[REQUIRED]**
The identifier of an access key.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that can consist of any upper or lowercased letter or digit.
:rtype: dict
:returns:
"""
pass
def get_account_authorization_details(self, Filter: List = None, MaxItems: int = None, Marker: str = None) -> Dict:
"""
Retrieves information about all IAM users, groups, roles, and policies in your AWS account, including their relationships to one another. Use this API to obtain a snapshot of the configuration of IAM permissions (users, groups, roles, and policies) in your account.
.. note::
Policies returned by this API are URL-encoded compliant with `RFC 3986 <https://tools.ietf.org/html/rfc3986>`__ . You can use a URL decoding method to convert the policy back to plain JSON text. For example, if you use Java, you can use the ``decode`` method of the ``java.net.URLDecoder`` utility class in the Java SDK. Other languages and SDKs provide similar functionality.
You can optionally filter the results using the ``Filter`` parameter. You can paginate the results using the ``MaxItems`` and ``Marker`` parameters.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetAccountAuthorizationDetails>`_
**Request Syntax**
::
response = client.get_account_authorization_details(
Filter=[
'User'|'Role'|'Group'|'LocalManagedPolicy'|'AWSManagedPolicy',
],
MaxItems=123,
Marker='string'
)
**Response Syntax**
::
{
'UserDetailList': [
{
'Path': 'string',
'UserName': 'string',
'UserId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'UserPolicyList': [
{
'PolicyName': 'string',
'PolicyDocument': 'string'
},
],
'GroupList': [
'string',
],
'AttachedManagedPolicies': [
{
'PolicyName': 'string',
'PolicyArn': 'string'
},
],
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
},
],
'GroupDetailList': [
{
'Path': 'string',
'GroupName': 'string',
'GroupId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'GroupPolicyList': [
{
'PolicyName': 'string',
'PolicyDocument': 'string'
},
],
'AttachedManagedPolicies': [
{
'PolicyName': 'string',
'PolicyArn': 'string'
},
]
},
],
'RoleDetailList': [
{
'Path': 'string',
'RoleName': 'string',
'RoleId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'AssumeRolePolicyDocument': 'string',
'InstanceProfileList': [
{
'Path': 'string',
'InstanceProfileName': 'string',
'InstanceProfileId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'Roles': [
{
'Path': 'string',
'RoleName': 'string',
'RoleId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'AssumeRolePolicyDocument': 'string',
'Description': 'string',
'MaxSessionDuration': 123,
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
},
]
},
],
'RolePolicyList': [
{
'PolicyName': 'string',
'PolicyDocument': 'string'
},
],
'AttachedManagedPolicies': [
{
'PolicyName': 'string',
'PolicyArn': 'string'
},
],
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
},
],
'Policies': [
{
'PolicyName': 'string',
'PolicyId': 'string',
'Arn': 'string',
'Path': 'string',
'DefaultVersionId': 'string',
'AttachmentCount': 123,
'PermissionsBoundaryUsageCount': 123,
'IsAttachable': True|False,
'Description': 'string',
'CreateDate': datetime(2015, 1, 1),
'UpdateDate': datetime(2015, 1, 1),
'PolicyVersionList': [
{
'Document': 'string',
'VersionId': 'string',
'IsDefaultVersion': True|False,
'CreateDate': datetime(2015, 1, 1)
},
]
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetAccountAuthorizationDetails request.
- **UserDetailList** *(list) --*
A list containing information about IAM users.
- *(dict) --*
Contains information about an IAM user, including all the user's policies and all the IAM groups the user is in.
This data type is used as a response element in the GetAccountAuthorizationDetails operation.
- **Path** *(string) --*
The path to the user. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **UserName** *(string) --*
The friendly name identifying the user.
- **UserId** *(string) --*
The stable and unique string identifying the user. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the user was created.
- **UserPolicyList** *(list) --*
A list of the inline policies embedded in the user.
- *(dict) --*
Contains information about an IAM policy, including the policy document.
This data type is used as a response element in the GetAccountAuthorizationDetails operation.
- **PolicyName** *(string) --*
The name of the policy.
- **PolicyDocument** *(string) --*
The policy document.
- **GroupList** *(list) --*
A list of IAM groups that the user is in.
- *(string) --*
- **AttachedManagedPolicies** *(list) --*
A list of the managed policies attached to the user.
- *(dict) --*
Contains information about an attached policy.
An attached policy is a managed policy that has been attached to a user, group, or role. This data type is used as a response element in the ListAttachedGroupPolicies , ListAttachedRolePolicies , ListAttachedUserPolicies , and GetAccountAuthorizationDetails operations.
For more information about managed policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *Using IAM* guide.
- **PolicyName** *(string) --*
The friendly name of the attached policy.
- **PolicyArn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the user.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are associated with the specified user. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
- **GroupDetailList** *(list) --*
A list containing information about IAM groups.
- *(dict) --*
Contains information about an IAM group, including all of the group's policies.
This data type is used as a response element in the GetAccountAuthorizationDetails operation.
- **Path** *(string) --*
The path to the group. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **GroupName** *(string) --*
The friendly name that identifies the group.
- **GroupId** *(string) --*
The stable and unique string identifying the group. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the group was created.
- **GroupPolicyList** *(list) --*
A list of the inline policies embedded in the group.
- *(dict) --*
Contains information about an IAM policy, including the policy document.
This data type is used as a response element in the GetAccountAuthorizationDetails operation.
- **PolicyName** *(string) --*
The name of the policy.
- **PolicyDocument** *(string) --*
The policy document.
- **AttachedManagedPolicies** *(list) --*
A list of the managed policies attached to the group.
- *(dict) --*
Contains information about an attached policy.
An attached policy is a managed policy that has been attached to a user, group, or role. This data type is used as a response element in the ListAttachedGroupPolicies , ListAttachedRolePolicies , ListAttachedUserPolicies , and GetAccountAuthorizationDetails operations.
For more information about managed policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *Using IAM* guide.
- **PolicyName** *(string) --*
The friendly name of the attached policy.
- **PolicyArn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **RoleDetailList** *(list) --*
A list containing information about IAM roles.
- *(dict) --*
Contains information about an IAM role, including all of the role's policies.
This data type is used as a response element in the GetAccountAuthorizationDetails operation.
- **Path** *(string) --*
The path to the role. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **RoleName** *(string) --*
The friendly name that identifies the role.
- **RoleId** *(string) --*
The stable and unique string identifying the role. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the role was created.
- **AssumeRolePolicyDocument** *(string) --*
The trust policy that grants permission to assume the role.
- **InstanceProfileList** *(list) --*
A list of instance profiles that contain this role.
- *(dict) --*
Contains information about an instance profile.
This data type is used as a response element in the following operations:
* CreateInstanceProfile
* GetInstanceProfile
* ListInstanceProfiles
* ListInstanceProfilesForRole
- **Path** *(string) --*
The path to the instance profile. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **InstanceProfileName** *(string) --*
The name identifying the instance profile.
- **InstanceProfileId** *(string) --*
The stable and unique string identifying the instance profile. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the instance profile. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date when the instance profile was created.
- **Roles** *(list) --*
The role associated with the instance profile.
- *(dict) --*
Contains information about an IAM role. This structure is returned as a response element in several API operations that interact with roles.
- **Path** *(string) --*
The path to the role. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **RoleName** *(string) --*
The friendly name that identifies the role.
- **RoleId** *(string) --*
The stable and unique string identifying the role. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the role. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the role was created.
- **AssumeRolePolicyDocument** *(string) --*
The policy that grants an entity permission to assume the role.
- **Description** *(string) --*
A description of the role that you provide.
- **MaxSessionDuration** *(integer) --*
The maximum session duration (in seconds) for the specified role. Anyone who uses the AWS CLI, or API to assume the role can specify the duration using the optional ``DurationSeconds`` API parameter or ``duration-seconds`` CLI parameter.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the role.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are attached to the specified role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
- **RolePolicyList** *(list) --*
A list of inline policies embedded in the role. These policies are the role's access (permissions) policies.
- *(dict) --*
Contains information about an IAM policy, including the policy document.
This data type is used as a response element in the GetAccountAuthorizationDetails operation.
- **PolicyName** *(string) --*
The name of the policy.
- **PolicyDocument** *(string) --*
The policy document.
- **AttachedManagedPolicies** *(list) --*
A list of managed policies attached to the role. These policies are the role's access (permissions) policies.
- *(dict) --*
Contains information about an attached policy.
An attached policy is a managed policy that has been attached to a user, group, or role. This data type is used as a response element in the ListAttachedGroupPolicies , ListAttachedRolePolicies , ListAttachedUserPolicies , and GetAccountAuthorizationDetails operations.
For more information about managed policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *Using IAM* guide.
- **PolicyName** *(string) --*
The friendly name of the attached policy.
- **PolicyArn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the role.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are attached to the specified role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
- **Policies** *(list) --*
A list containing information about managed policies.
- *(dict) --*
Contains information about a managed policy, including the policy's ARN, versions, and the number of principal entities (users, groups, and roles) that the policy is attached to.
This data type is used as a response element in the GetAccountAuthorizationDetails operation.
For more information about managed policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *Using IAM* guide.
- **PolicyName** *(string) --*
The friendly name (not ARN) identifying the policy.
- **PolicyId** *(string) --*
The stable and unique string identifying the policy.
For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **Path** *(string) --*
The path to the policy.
For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **DefaultVersionId** *(string) --*
The identifier for the version of the policy that is set as the default (operative) version.
For more information about policy versions, see `Versioning for Managed Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-versions.html>`__ in the *Using IAM* guide.
- **AttachmentCount** *(integer) --*
The number of principal entities (users, groups, and roles) that the policy is attached to.
- **PermissionsBoundaryUsageCount** *(integer) --*
The number of entities (users and roles) for which the policy is used as the permissions boundary.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **IsAttachable** *(boolean) --*
Specifies whether the policy can be attached to an IAM user, group, or role.
- **Description** *(string) --*
A friendly description of the policy.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the policy was created.
- **UpdateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the policy was last updated.
When a policy has only one version, this field contains the date and time when the policy was created. When a policy has more than one version, this field contains the date and time when the most recent policy version was created.
- **PolicyVersionList** *(list) --*
A list containing information about the versions of the policy.
- *(dict) --*
Contains information about a version of a managed policy.
This data type is used as a response element in the CreatePolicyVersion , GetPolicyVersion , ListPolicyVersions , and GetAccountAuthorizationDetails operations.
For more information about managed policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *Using IAM* guide.
- **Document** *(string) --*
The policy document.
The policy document is returned in the response to the GetPolicyVersion and GetAccountAuthorizationDetails operations. It is not returned in the response to the CreatePolicyVersion or ListPolicyVersions operations.
The policy document returned in this structure is URL-encoded compliant with `RFC 3986 <https://tools.ietf.org/html/rfc3986>`__ . You can use a URL decoding method to convert the policy back to plain JSON text. For example, if you use Java, you can use the ``decode`` method of the ``java.net.URLDecoder`` utility class in the Java SDK. Other languages and SDKs provide similar functionality.
- **VersionId** *(string) --*
The identifier for the policy version.
Policy version identifiers always begin with ``v`` (always lowercase). When a policy is created, the first policy version is ``v1`` .
- **IsDefaultVersion** *(boolean) --*
Specifies whether the policy version is set as the policy's default version.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the policy version was created.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type Filter: list
:param Filter:
A list of entity types used to filter the results. Only the entities that match the types you specify are included in the output. Use the value ``LocalManagedPolicy`` to include customer managed policies.
The format for this parameter is a comma-separated (if more than one) list of strings. Each string value in the list must be one of the valid values listed below.
- *(string) --*
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:rtype: dict
:returns:
"""
pass
def get_account_password_policy(self) -> Dict:
"""
Retrieves the password policy for the AWS account. For more information about using a password policy, go to `Managing an IAM Password Policy <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_ManagingPasswordPolicies.html>`__ .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetAccountPasswordPolicy>`_
**Request Syntax**
::
response = client.get_account_password_policy()
**Response Syntax**
::
{
'PasswordPolicy': {
'MinimumPasswordLength': 123,
'RequireSymbols': True|False,
'RequireNumbers': True|False,
'RequireUppercaseCharacters': True|False,
'RequireLowercaseCharacters': True|False,
'AllowUsersToChangePassword': True|False,
'ExpirePasswords': True|False,
'MaxPasswordAge': 123,
'PasswordReusePrevention': 123,
'HardExpiry': True|False
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetAccountPasswordPolicy request.
- **PasswordPolicy** *(dict) --*
A structure that contains details about the account's password policy.
- **MinimumPasswordLength** *(integer) --*
Minimum length to require for IAM user passwords.
- **RequireSymbols** *(boolean) --*
Specifies whether to require symbols for IAM user passwords.
- **RequireNumbers** *(boolean) --*
Specifies whether to require numbers for IAM user passwords.
- **RequireUppercaseCharacters** *(boolean) --*
Specifies whether to require uppercase characters for IAM user passwords.
- **RequireLowercaseCharacters** *(boolean) --*
Specifies whether to require lowercase characters for IAM user passwords.
- **AllowUsersToChangePassword** *(boolean) --*
Specifies whether IAM users are allowed to change their own password.
- **ExpirePasswords** *(boolean) --*
Indicates whether passwords in the account expire. Returns true if ``MaxPasswordAge`` contains a value greater than 0. Returns false if MaxPasswordAge is 0 or not present.
- **MaxPasswordAge** *(integer) --*
The number of days that an IAM user password is valid.
- **PasswordReusePrevention** *(integer) --*
Specifies the number of previous passwords that IAM users are prevented from reusing.
- **HardExpiry** *(boolean) --*
Specifies whether IAM users are prevented from setting a new password after their password has expired.
:rtype: dict
:returns:
"""
pass
def get_account_summary(self) -> Dict:
"""
Retrieves information about IAM entity usage and IAM quotas in the AWS account.
For information about limitations on IAM entities, see `Limitations on IAM Entities <https://docs.aws.amazon.com/IAM/latest/UserGuide/LimitationsOnEntities.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetAccountSummary>`_
**Request Syntax**
::
response = client.get_account_summary()
**Response Syntax**
::
{
'SummaryMap': {
'string': 123
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetAccountSummary request.
- **SummaryMap** *(dict) --*
A set of key–value pairs containing information about IAM entity usage and IAM quotas.
- *(string) --*
- *(integer) --*
:rtype: dict
:returns:
"""
pass
def get_context_keys_for_custom_policy(self, PolicyInputList: List) -> Dict:
"""
Gets a list of all of the context keys referenced in the input policies. The policies are supplied as a list of one or more strings. To get the context keys from policies associated with an IAM user, group, or role, use GetContextKeysForPrincipalPolicy .
Context keys are variables maintained by AWS and its services that provide details about the context of an API query request. Context keys can be evaluated by testing against a value specified in an IAM policy. Use ``GetContextKeysForCustomPolicy`` to understand what key names and values you must supply when you call SimulateCustomPolicy . Note that all parameters are shown in unencoded form here for clarity but must be URL encoded to be included as a part of a real HTML request.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetContextKeysForCustomPolicy>`_
**Request Syntax**
::
response = client.get_context_keys_for_custom_policy(
PolicyInputList=[
'string',
]
)
**Response Syntax**
::
{
'ContextKeyNames': [
'string',
]
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetContextKeysForPrincipalPolicy or GetContextKeysForCustomPolicy request.
- **ContextKeyNames** *(list) --*
The list of context keys that are referenced in the input policies.
- *(string) --*
:type PolicyInputList: list
:param PolicyInputList: **[REQUIRED]**
A list of policies for which you want the list of context keys referenced in those policies. Each document is specified as a string containing the complete, valid JSON text of an IAM policy.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
- *(string) --*
:rtype: dict
:returns:
"""
pass
def get_context_keys_for_principal_policy(self, PolicySourceArn: str, PolicyInputList: List = None) -> Dict:
"""
Gets a list of all of the context keys referenced in all the IAM policies that are attached to the specified IAM entity. The entity can be an IAM user, group, or role. If you specify a user, then the request also includes all of the policies attached to groups that the user is a member of.
You can optionally include a list of one or more additional policies, specified as strings. If you want to include *only* a list of policies by string, use GetContextKeysForCustomPolicy instead.
**Note:** This API discloses information about the permissions granted to other users. If you do not want users to see other user's permissions, then consider allowing them to use GetContextKeysForCustomPolicy instead.
Context keys are variables maintained by AWS and its services that provide details about the context of an API query request. Context keys can be evaluated by testing against a value in an IAM policy. Use GetContextKeysForPrincipalPolicy to understand what key names and values you must supply when you call SimulatePrincipalPolicy .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetContextKeysForPrincipalPolicy>`_
**Request Syntax**
::
response = client.get_context_keys_for_principal_policy(
PolicySourceArn='string',
PolicyInputList=[
'string',
]
)
**Response Syntax**
::
{
'ContextKeyNames': [
'string',
]
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetContextKeysForPrincipalPolicy or GetContextKeysForCustomPolicy request.
- **ContextKeyNames** *(list) --*
The list of context keys that are referenced in the input policies.
- *(string) --*
:type PolicySourceArn: string
:param PolicySourceArn: **[REQUIRED]**
The ARN of a user, group, or role whose policies contain the context keys that you want listed. If you specify a user, the list includes context keys that are found in all policies that are attached to the user. The list also includes all groups that the user is a member of. If you pick a group or a role, then it includes only those context keys that are found in policies attached to that entity. Note that all parameters are shown in unencoded form here for clarity, but must be URL encoded to be included as a part of a real HTML request.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:type PolicyInputList: list
:param PolicyInputList:
An optional list of additional policies for which you want the list of context keys that are referenced.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
- *(string) --*
:rtype: dict
:returns:
"""
pass
def get_credential_report(self) -> Dict:
"""
Retrieves a credential report for the AWS account. For more information about the credential report, see `Getting Credential Reports <https://docs.aws.amazon.com/IAM/latest/UserGuide/credential-reports.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetCredentialReport>`_
**Request Syntax**
::
response = client.get_credential_report()
**Response Syntax**
::
{
'Content': b'bytes',
'ReportFormat': 'text/csv',
'GeneratedTime': datetime(2015, 1, 1)
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetCredentialReport request.
- **Content** *(bytes) --*
Contains the credential report. The report is Base64-encoded.
- **ReportFormat** *(string) --*
The format (MIME type) of the credential report.
- **GeneratedTime** *(datetime) --*
The date and time when the credential report was created, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ .
:rtype: dict
:returns:
"""
pass
def get_group(self, GroupName: str, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Returns a list of IAM users that are in the specified IAM group. You can paginate the results using the ``MaxItems`` and ``Marker`` parameters.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetGroup>`_
**Request Syntax**
::
response = client.get_group(
GroupName='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'Group': {
'Path': 'string',
'GroupName': 'string',
'GroupId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1)
},
'Users': [
{
'Path': 'string',
'UserName': 'string',
'UserId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'PasswordLastUsed': datetime(2015, 1, 1),
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetGroup request.
- **Group** *(dict) --*
A structure that contains details about the group.
- **Path** *(string) --*
The path to the group. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **GroupName** *(string) --*
The friendly name that identifies the group.
- **GroupId** *(string) --*
The stable and unique string identifying the group. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the group. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the group was created.
- **Users** *(list) --*
A list of users in the group.
- *(dict) --*
Contains information about an IAM user entity.
This data type is used as a response element in the following operations:
* CreateUser
* GetUser
* ListUsers
- **Path** *(string) --*
The path to the user. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **UserName** *(string) --*
The friendly name identifying the user.
- **UserId** *(string) --*
The stable and unique string identifying the user. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) that identifies the user. For more information about ARNs and how to use ARNs in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the user was created.
- **PasswordLastUsed** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the user's password was last used to sign in to an AWS website. For a list of AWS websites that capture a user's last sign-in time, see the `Credential Reports <https://docs.aws.amazon.com/IAM/latest/UserGuide/credential-reports.html>`__ topic in the *Using IAM* guide. If a password is used more than once in a five-minute span, only the first use is returned in this field. If the field is null (no value), then it indicates that they never signed in with a password. This can be because:
* The user never had a password.
* A password exists but has not been used since IAM started tracking this information on October 20, 2014.
A null valuedoes not mean that the user *never* had a password. Also, if the user does not currently have a password, but had one in the past, then this field contains the date and time the most recent password was used.
This value is returned only in the GetUser and ListUsers operations.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the user.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are associated with the specified user. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type GroupName: string
:param GroupName: **[REQUIRED]**
The name of the group.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def get_group_policy(self, GroupName: str, PolicyName: str) -> Dict:
"""
Retrieves the specified inline policy document that is embedded in the specified IAM group.
.. note::
Policies returned by this API are URL-encoded compliant with `RFC 3986 <https://tools.ietf.org/html/rfc3986>`__ . You can use a URL decoding method to convert the policy back to plain JSON text. For example, if you use Java, you can use the ``decode`` method of the ``java.net.URLDecoder`` utility class in the Java SDK. Other languages and SDKs provide similar functionality.
An IAM group can also have managed policies attached to it. To retrieve a managed policy document that is attached to a group, use GetPolicy to determine the policy's default version, then use GetPolicyVersion to retrieve the policy document.
For more information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetGroupPolicy>`_
**Request Syntax**
::
response = client.get_group_policy(
GroupName='string',
PolicyName='string'
)
**Response Syntax**
::
{
'GroupName': 'string',
'PolicyName': 'string',
'PolicyDocument': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetGroupPolicy request.
- **GroupName** *(string) --*
The group the policy is associated with.
- **PolicyName** *(string) --*
The name of the policy.
- **PolicyDocument** *(string) --*
The policy document.
:type GroupName: string
:param GroupName: **[REQUIRED]**
The name of the group the policy is associated with.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyName: string
:param PolicyName: **[REQUIRED]**
The name of the policy document to get.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:rtype: dict
:returns:
"""
pass
def get_instance_profile(self, InstanceProfileName: str) -> Dict:
"""
Retrieves information about the specified instance profile, including the instance profile's path, GUID, ARN, and role. For more information about instance profiles, see `About Instance Profiles <https://docs.aws.amazon.com/IAM/latest/UserGuide/AboutInstanceProfiles.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetInstanceProfile>`_
**Request Syntax**
::
response = client.get_instance_profile(
InstanceProfileName='string'
)
**Response Syntax**
::
{
'InstanceProfile': {
'Path': 'string',
'InstanceProfileName': 'string',
'InstanceProfileId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'Roles': [
{
'Path': 'string',
'RoleName': 'string',
'RoleId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'AssumeRolePolicyDocument': 'string',
'Description': 'string',
'MaxSessionDuration': 123,
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
},
]
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetInstanceProfile request.
- **InstanceProfile** *(dict) --*
A structure containing details about the instance profile.
- **Path** *(string) --*
The path to the instance profile. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **InstanceProfileName** *(string) --*
The name identifying the instance profile.
- **InstanceProfileId** *(string) --*
The stable and unique string identifying the instance profile. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the instance profile. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date when the instance profile was created.
- **Roles** *(list) --*
The role associated with the instance profile.
- *(dict) --*
Contains information about an IAM role. This structure is returned as a response element in several API operations that interact with roles.
- **Path** *(string) --*
The path to the role. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **RoleName** *(string) --*
The friendly name that identifies the role.
- **RoleId** *(string) --*
The stable and unique string identifying the role. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the role. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the role was created.
- **AssumeRolePolicyDocument** *(string) --*
The policy that grants an entity permission to assume the role.
- **Description** *(string) --*
A description of the role that you provide.
- **MaxSessionDuration** *(integer) --*
The maximum session duration (in seconds) for the specified role. Anyone who uses the AWS CLI, or API to assume the role can specify the duration using the optional ``DurationSeconds`` API parameter or ``duration-seconds`` CLI parameter.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the role.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are attached to the specified role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
:type InstanceProfileName: string
:param InstanceProfileName: **[REQUIRED]**
The name of the instance profile to get information about.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:rtype: dict
:returns:
"""
pass
def get_login_profile(self, UserName: str) -> Dict:
"""
Retrieves the user name and password-creation date for the specified IAM user. If the user has not been assigned a password, the operation returns a 404 (``NoSuchEntity`` ) error.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetLoginProfile>`_
**Request Syntax**
::
response = client.get_login_profile(
UserName='string'
)
**Response Syntax**
::
{
'LoginProfile': {
'UserName': 'string',
'CreateDate': datetime(2015, 1, 1),
'PasswordResetRequired': True|False
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetLoginProfile request.
- **LoginProfile** *(dict) --*
A structure containing the user name and password create date for the user.
- **UserName** *(string) --*
The name of the user, which can be used for signing in to the AWS Management Console.
- **CreateDate** *(datetime) --*
The date when the password for the user was created.
- **PasswordResetRequired** *(boolean) --*
Specifies whether the user is required to set a new password on next sign-in.
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user whose login profile you want to retrieve.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:rtype: dict
:returns:
"""
pass
def get_open_id_connect_provider(self, OpenIDConnectProviderArn: str) -> Dict:
"""
Returns information about the specified OpenID Connect (OIDC) provider resource object in IAM.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetOpenIDConnectProvider>`_
**Request Syntax**
::
response = client.get_open_id_connect_provider(
OpenIDConnectProviderArn='string'
)
**Response Syntax**
::
{
'Url': 'string',
'ClientIDList': [
'string',
],
'ThumbprintList': [
'string',
],
'CreateDate': datetime(2015, 1, 1)
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetOpenIDConnectProvider request.
- **Url** *(string) --*
The URL that the IAM OIDC provider resource object is associated with. For more information, see CreateOpenIDConnectProvider .
- **ClientIDList** *(list) --*
A list of client IDs (also known as audiences) that are associated with the specified IAM OIDC provider resource object. For more information, see CreateOpenIDConnectProvider .
- *(string) --*
- **ThumbprintList** *(list) --*
A list of certificate thumbprints that are associated with the specified IAM OIDC provider resource object. For more information, see CreateOpenIDConnectProvider .
- *(string) --*
Contains a thumbprint for an identity provider's server certificate.
The identity provider's server certificate thumbprint is the hex-encoded SHA-1 hash value of the self-signed X.509 certificate used by the domain where the OpenID Connect provider makes its keys available. It is always a 40-character string.
- **CreateDate** *(datetime) --*
The date and time when the IAM OIDC provider resource object was created in the AWS account.
:type OpenIDConnectProviderArn: string
:param OpenIDConnectProviderArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the OIDC provider resource object in IAM to get information for. You can get a list of OIDC provider resource ARNs by using the ListOpenIDConnectProviders operation.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:rtype: dict
:returns:
"""
pass
def get_paginator(self, operation_name: str = None) -> Paginator:
"""
Create a paginator for an operation.
:type operation_name: string
:param operation_name: The operation name. This is the same name
as the method name on the client. For example, if the
method name is ``create_foo``, and you\'d normally invoke the
operation as ``client.create_foo(**kwargs)``, if the
``create_foo`` operation can be paginated, you can use the
call ``client.get_paginator(\"create_foo\")``.
:raise OperationNotPageableError: Raised if the operation is not
pageable. You can use the ``client.can_paginate`` method to
check if an operation is pageable.
:rtype: L{botocore.paginate.Paginator}
:return: A paginator object.
"""
pass
def get_policy(self, PolicyArn: str) -> Dict:
"""
Retrieves information about the specified managed policy, including the policy's default version and the total number of IAM users, groups, and roles to which the policy is attached. To retrieve the list of the specific users, groups, and roles that the policy is attached to, use the ListEntitiesForPolicy API. This API returns metadata about the policy. To retrieve the actual policy document for a specific version of the policy, use GetPolicyVersion .
This API retrieves information about managed policies. To retrieve information about an inline policy that is embedded with an IAM user, group, or role, use the GetUserPolicy , GetGroupPolicy , or GetRolePolicy API.
For more information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetPolicy>`_
**Request Syntax**
::
response = client.get_policy(
PolicyArn='string'
)
**Response Syntax**
::
{
'Policy': {
'PolicyName': 'string',
'PolicyId': 'string',
'Arn': 'string',
'Path': 'string',
'DefaultVersionId': 'string',
'AttachmentCount': 123,
'PermissionsBoundaryUsageCount': 123,
'IsAttachable': True|False,
'Description': 'string',
'CreateDate': datetime(2015, 1, 1),
'UpdateDate': datetime(2015, 1, 1)
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetPolicy request.
- **Policy** *(dict) --*
A structure containing details about the policy.
- **PolicyName** *(string) --*
The friendly name (not ARN) identifying the policy.
- **PolicyId** *(string) --*
The stable and unique string identifying the policy.
For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **Path** *(string) --*
The path to the policy.
For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **DefaultVersionId** *(string) --*
The identifier for the version of the policy that is set as the default version.
- **AttachmentCount** *(integer) --*
The number of entities (users, groups, and roles) that the policy is attached to.
- **PermissionsBoundaryUsageCount** *(integer) --*
The number of entities (users and roles) for which the policy is used to set the permissions boundary.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **IsAttachable** *(boolean) --*
Specifies whether the policy can be attached to an IAM user, group, or role.
- **Description** *(string) --*
A friendly description of the policy.
This element is included in the response to the GetPolicy operation. It is not included in the response to the ListPolicies operation.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the policy was created.
- **UpdateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the policy was last updated.
When a policy has only one version, this field contains the date and time when the policy was created. When a policy has more than one version, this field contains the date and time when the most recent policy version was created.
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the managed policy that you want information about.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:rtype: dict
:returns:
"""
pass
def get_policy_version(self, PolicyArn: str, VersionId: str) -> Dict:
"""
Retrieves information about the specified version of the specified managed policy, including the policy document.
.. note::
Policies returned by this API are URL-encoded compliant with `RFC 3986 <https://tools.ietf.org/html/rfc3986>`__ . You can use a URL decoding method to convert the policy back to plain JSON text. For example, if you use Java, you can use the ``decode`` method of the ``java.net.URLDecoder`` utility class in the Java SDK. Other languages and SDKs provide similar functionality.
To list the available versions for a policy, use ListPolicyVersions .
This API retrieves information about managed policies. To retrieve information about an inline policy that is embedded in a user, group, or role, use the GetUserPolicy , GetGroupPolicy , or GetRolePolicy API.
For more information about the types of policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
For more information about managed policy versions, see `Versioning for Managed Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-versions.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetPolicyVersion>`_
**Request Syntax**
::
response = client.get_policy_version(
PolicyArn='string',
VersionId='string'
)
**Response Syntax**
::
{
'PolicyVersion': {
'Document': 'string',
'VersionId': 'string',
'IsDefaultVersion': True|False,
'CreateDate': datetime(2015, 1, 1)
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetPolicyVersion request.
- **PolicyVersion** *(dict) --*
A structure containing details about the policy version.
- **Document** *(string) --*
The policy document.
The policy document is returned in the response to the GetPolicyVersion and GetAccountAuthorizationDetails operations. It is not returned in the response to the CreatePolicyVersion or ListPolicyVersions operations.
The policy document returned in this structure is URL-encoded compliant with `RFC 3986 <https://tools.ietf.org/html/rfc3986>`__ . You can use a URL decoding method to convert the policy back to plain JSON text. For example, if you use Java, you can use the ``decode`` method of the ``java.net.URLDecoder`` utility class in the Java SDK. Other languages and SDKs provide similar functionality.
- **VersionId** *(string) --*
The identifier for the policy version.
Policy version identifiers always begin with ``v`` (always lowercase). When a policy is created, the first policy version is ``v1`` .
- **IsDefaultVersion** *(boolean) --*
Specifies whether the policy version is set as the policy's default version.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the policy version was created.
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the managed policy that you want information about.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:type VersionId: string
:param VersionId: **[REQUIRED]**
Identifies the policy version to retrieve.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that consists of the lowercase letter \'v\' followed by one or two digits, and optionally followed by a period \'.\' and a string of letters and digits.
:rtype: dict
:returns:
"""
pass
def get_role(self, RoleName: str) -> Dict:
"""
Retrieves information about the specified role, including the role's path, GUID, ARN, and the role's trust policy that grants permission to assume the role. For more information about roles, see `Working with Roles <https://docs.aws.amazon.com/IAM/latest/UserGuide/WorkingWithRoles.html>`__ .
.. note::
Policies returned by this API are URL-encoded compliant with `RFC 3986 <https://tools.ietf.org/html/rfc3986>`__ . You can use a URL decoding method to convert the policy back to plain JSON text. For example, if you use Java, you can use the ``decode`` method of the ``java.net.URLDecoder`` utility class in the Java SDK. Other languages and SDKs provide similar functionality.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetRole>`_
**Request Syntax**
::
response = client.get_role(
RoleName='string'
)
**Response Syntax**
::
{
'Role': {
'Path': 'string',
'RoleName': 'string',
'RoleId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'AssumeRolePolicyDocument': 'string',
'Description': 'string',
'MaxSessionDuration': 123,
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetRole request.
- **Role** *(dict) --*
A structure containing details about the IAM role.
- **Path** *(string) --*
The path to the role. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **RoleName** *(string) --*
The friendly name that identifies the role.
- **RoleId** *(string) --*
The stable and unique string identifying the role. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the role. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the role was created.
- **AssumeRolePolicyDocument** *(string) --*
The policy that grants an entity permission to assume the role.
- **Description** *(string) --*
A description of the role that you provide.
- **MaxSessionDuration** *(integer) --*
The maximum session duration (in seconds) for the specified role. Anyone who uses the AWS CLI, or API to assume the role can specify the duration using the optional ``DurationSeconds`` API parameter or ``duration-seconds`` CLI parameter.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the role.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are attached to the specified role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the IAM role to get information about.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:rtype: dict
:returns:
"""
pass
def get_role_policy(self, RoleName: str, PolicyName: str) -> Dict:
"""
Retrieves the specified inline policy document that is embedded with the specified IAM role.
.. note::
Policies returned by this API are URL-encoded compliant with `RFC 3986 <https://tools.ietf.org/html/rfc3986>`__ . You can use a URL decoding method to convert the policy back to plain JSON text. For example, if you use Java, you can use the ``decode`` method of the ``java.net.URLDecoder`` utility class in the Java SDK. Other languages and SDKs provide similar functionality.
An IAM role can also have managed policies attached to it. To retrieve a managed policy document that is attached to a role, use GetPolicy to determine the policy's default version, then use GetPolicyVersion to retrieve the policy document.
For more information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
For more information about roles, see `Using Roles to Delegate Permissions and Federate Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/roles-toplevel.html>`__ .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetRolePolicy>`_
**Request Syntax**
::
response = client.get_role_policy(
RoleName='string',
PolicyName='string'
)
**Response Syntax**
::
{
'RoleName': 'string',
'PolicyName': 'string',
'PolicyDocument': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetRolePolicy request.
- **RoleName** *(string) --*
The role the policy is associated with.
- **PolicyName** *(string) --*
The name of the policy.
- **PolicyDocument** *(string) --*
The policy document.
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the role associated with the policy.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyName: string
:param PolicyName: **[REQUIRED]**
The name of the policy document to get.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:rtype: dict
:returns:
"""
pass
def get_saml_provider(self, SAMLProviderArn: str) -> Dict:
"""
Returns the SAML provider metadocument that was uploaded when the IAM SAML provider resource object was created or updated.
.. note::
This operation requires `Signature Version 4 <https://docs.aws.amazon.com/general/latest/gr/signature-version-4.html>`__ .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetSAMLProvider>`_
**Request Syntax**
::
response = client.get_saml_provider(
SAMLProviderArn='string'
)
**Response Syntax**
::
{
'SAMLMetadataDocument': 'string',
'CreateDate': datetime(2015, 1, 1),
'ValidUntil': datetime(2015, 1, 1)
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetSAMLProvider request.
- **SAMLMetadataDocument** *(string) --*
The XML metadata document that includes information about an identity provider.
- **CreateDate** *(datetime) --*
The date and time when the SAML provider was created.
- **ValidUntil** *(datetime) --*
The expiration date and time for the SAML provider.
:type SAMLProviderArn: string
:param SAMLProviderArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the SAML provider resource object in IAM to get information about.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:rtype: dict
:returns:
"""
pass
def get_server_certificate(self, ServerCertificateName: str) -> Dict:
"""
Retrieves information about the specified server certificate stored in IAM.
For more information about working with server certificates, see `Working with Server Certificates <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_credentials_server-certs.html>`__ in the *IAM User Guide* . This topic includes a list of AWS services that can use the server certificates that you manage with IAM.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetServerCertificate>`_
**Request Syntax**
::
response = client.get_server_certificate(
ServerCertificateName='string'
)
**Response Syntax**
::
{
'ServerCertificate': {
'ServerCertificateMetadata': {
'Path': 'string',
'ServerCertificateName': 'string',
'ServerCertificateId': 'string',
'Arn': 'string',
'UploadDate': datetime(2015, 1, 1),
'Expiration': datetime(2015, 1, 1)
},
'CertificateBody': 'string',
'CertificateChain': 'string'
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetServerCertificate request.
- **ServerCertificate** *(dict) --*
A structure containing details about the server certificate.
- **ServerCertificateMetadata** *(dict) --*
The meta information of the server certificate, such as its name, path, ID, and ARN.
- **Path** *(string) --*
The path to the server certificate. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **ServerCertificateName** *(string) --*
The name that identifies the server certificate.
- **ServerCertificateId** *(string) --*
The stable and unique string identifying the server certificate. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the server certificate. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **UploadDate** *(datetime) --*
The date when the server certificate was uploaded.
- **Expiration** *(datetime) --*
The date on which the certificate is set to expire.
- **CertificateBody** *(string) --*
The contents of the public key certificate.
- **CertificateChain** *(string) --*
The contents of the public key certificate chain.
:type ServerCertificateName: string
:param ServerCertificateName: **[REQUIRED]**
The name of the server certificate you want to retrieve information about.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:rtype: dict
:returns:
"""
pass
def get_service_last_accessed_details(self, JobId: str, MaxItems: int = None, Marker: str = None) -> Dict:
"""
After you generate a user, group, role, or policy report using the ``GenerateServiceLastAccessedDetails`` operation, you can use the ``JobId`` parameter in ``GetServiceLastAccessedDetails`` . This operation retrieves the status of your report job and a list of AWS services that the resource (user, group, role, or managed policy) can access.
.. note::
Service last accessed data does not use other policy types when determining whether a resource could access a service. These other policy types include resource-based policies, access control lists, AWS Organizations policies, IAM permissions boundaries, and AWS STS assume role policies. It only applies permissions policy logic. For more about the evaluation of policy types, see `Evaluating Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_policies_evaluation-logic.html#policy-eval-basics>`__ in the *IAM User Guide* .
For each service that the resource could access using permissions policies, the operation returns details about the most recent access attempt. If there was no attempt, the service is listed without details about the most recent attempt to access the service. If the operation fails, the ``GetServiceLastAccessedDetails`` operation returns the reason that it failed.
The ``GetServiceLastAccessedDetails`` operation returns a list of services. This list includes the number of entities that have attempted to access the service and the date and time of the last attempt. It also returns the ARN of the following entity, depending on the resource ARN that you used to generate the report:
* **User** – Returns the user ARN that you used to generate the report
* **Group** – Returns the ARN of the group member (user) that last attempted to access the service
* **Role** – Returns the role ARN that you used to generate the report
* **Policy** – Returns the ARN of the user or role that last used the policy to attempt to access the service
By default, the list is sorted by service namespace.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetServiceLastAccessedDetails>`_
**Request Syntax**
::
response = client.get_service_last_accessed_details(
JobId='string',
MaxItems=123,
Marker='string'
)
**Response Syntax**
::
{
'JobStatus': 'IN_PROGRESS'|'COMPLETED'|'FAILED',
'JobCreationDate': datetime(2015, 1, 1),
'ServicesLastAccessed': [
{
'ServiceName': 'string',
'LastAuthenticated': datetime(2015, 1, 1),
'ServiceNamespace': 'string',
'LastAuthenticatedEntity': 'string',
'TotalAuthenticatedEntities': 123
},
],
'JobCompletionDate': datetime(2015, 1, 1),
'IsTruncated': True|False,
'Marker': 'string',
'Error': {
'Message': 'string',
'Code': 'string'
}
}
**Response Structure**
- *(dict) --*
- **JobStatus** *(string) --*
The status of the job.
- **JobCreationDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the report job was created.
- **ServicesLastAccessed** *(list) --*
A ``ServiceLastAccessed`` object that contains details about the most recent attempt to access the service.
- *(dict) --*
Contains details about the most recent attempt to access the service.
This data type is used as a response element in the GetServiceLastAccessedDetails operation.
- **ServiceName** *(string) --*
The name of the service in which access was attempted.
- **LastAuthenticated** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when an authenticated entity most recently attempted to access the service. AWS does not report unauthenticated requests.
This field is null if no IAM entities attempted to access the service within the `reporting period <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_access-advisor.html#service-last-accessed-reporting-period>`__ .
- **ServiceNamespace** *(string) --*
The namespace of the service in which access was attempted.
To learn the service namespace of a service, go to `Actions, Resources, and Condition Keys for AWS Services <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_policies_actions-resources-contextkeys.html>`__ in the *IAM User Guide* . Choose the name of the service to view details for that service. In the first paragraph, find the service prefix. For example, ``(service prefix: a4b)`` . For more information about service namespaces, see `AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html#genref-aws-service-namespaces>`__ in the *AWS General Reference* .
- **LastAuthenticatedEntity** *(string) --*
The ARN of the authenticated entity (user or role) that last attempted to access the service. AWS does not report unauthenticated requests.
This field is null if no IAM entities attempted to access the service within the `reporting period <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_access-advisor.html#service-last-accessed-reporting-period>`__ .
- **TotalAuthenticatedEntities** *(integer) --*
The total number of authenticated entities that have attempted to access the service.
This field is null if no IAM entities attempted to access the service within the `reporting period <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_access-advisor.html#service-last-accessed-reporting-period>`__ .
- **JobCompletionDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the generated report job was completed or failed.
This field is null if the job is still in progress, as indicated by a ``JobStatus`` value of ``IN_PROGRESS`` .
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
- **Error** *(dict) --*
An object that contains details about the reason the operation failed.
- **Message** *(string) --*
Detailed information about the reason that the operation failed.
- **Code** *(string) --*
The error code associated with the operation failure.
:type JobId: string
:param JobId: **[REQUIRED]**
The ID of the request generated by the GenerateServiceLastAccessedDetails operation.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:rtype: dict
:returns:
"""
pass
def get_service_last_accessed_details_with_entities(self, JobId: str, ServiceNamespace: str, MaxItems: int = None, Marker: str = None) -> Dict:
"""
After you generate a group or policy report using the ``GenerateServiceLastAccessedDetails`` operation, you can use the ``JobId`` parameter in ``GetServiceLastAccessedDetailsWithEntities`` . This operation retrieves the status of your report job and a list of entities that could have used group or policy permissions to access the specified service.
* **Group** – For a group report, this operation returns a list of users in the group that could have used the group’s policies in an attempt to access the service.
* **Policy** – For a policy report, this operation returns a list of entities (users or roles) that could have used the policy in an attempt to access the service.
You can also use this operation for user or role reports to retrieve details about those entities.
If the operation fails, the ``GetServiceLastAccessedDetailsWithEntities`` operation returns the reason that it failed.
By default, the list of associated entities is sorted by date, with the most recent access listed first.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetServiceLastAccessedDetailsWithEntities>`_
**Request Syntax**
::
response = client.get_service_last_accessed_details_with_entities(
JobId='string',
ServiceNamespace='string',
MaxItems=123,
Marker='string'
)
**Response Syntax**
::
{
'JobStatus': 'IN_PROGRESS'|'COMPLETED'|'FAILED',
'JobCreationDate': datetime(2015, 1, 1),
'JobCompletionDate': datetime(2015, 1, 1),
'EntityDetailsList': [
{
'EntityInfo': {
'Arn': 'string',
'Name': 'string',
'Type': 'USER'|'ROLE'|'GROUP',
'Id': 'string',
'Path': 'string'
},
'LastAuthenticated': datetime(2015, 1, 1)
},
],
'IsTruncated': True|False,
'Marker': 'string',
'Error': {
'Message': 'string',
'Code': 'string'
}
}
**Response Structure**
- *(dict) --*
- **JobStatus** *(string) --*
The status of the job.
- **JobCreationDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the report job was created.
- **JobCompletionDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the generated report job was completed or failed.
- **EntityDetailsList** *(list) --*
An ``EntityDetailsList`` object that contains details about when an IAM entity (user or role) used group or policy permissions in an attempt to access the specified AWS service.
- *(dict) --*
An object that contains details about when the IAM entities (users or roles) were last used in an attempt to access the specified AWS service.
This data type is a response element in the GetServiceLastAccessedDetailsWithEntities operation.
- **EntityInfo** *(dict) --*
The ``EntityInfo`` object that contains details about the entity (user or role).
- **Arn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **Name** *(string) --*
The name of the entity (user or role).
- **Type** *(string) --*
The type of entity (user or role).
- **Id** *(string) --*
The identifier of the entity (user or role).
- **Path** *(string) --*
The path to the entity (user or role). For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **LastAuthenticated** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the authenticated entity last attempted to access AWS. AWS does not report unauthenticated requests.
This field is null if no IAM entities attempted to access the service within the `reporting period <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_access-advisor.html#service-last-accessed-reporting-period>`__ .
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
- **Error** *(dict) --*
An object that contains details about the reason the operation failed.
- **Message** *(string) --*
Detailed information about the reason that the operation failed.
- **Code** *(string) --*
The error code associated with the operation failure.
:type JobId: string
:param JobId: **[REQUIRED]**
The ID of the request generated by the ``GenerateServiceLastAccessedDetails`` operation.
:type ServiceNamespace: string
:param ServiceNamespace: **[REQUIRED]**
The service namespace for an AWS service. Provide the service namespace to learn when the IAM entity last attempted to access the specified service.
To learn the service namespace for a service, go to `Actions, Resources, and Condition Keys for AWS Services <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_policies_actions-resources-contextkeys.html>`__ in the *IAM User Guide* . Choose the name of the service to view details for that service. In the first paragraph, find the service prefix. For example, ``(service prefix: a4b)`` . For more information about service namespaces, see `AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html#genref-aws-service-namespaces>`__ in the *AWS General Reference* .
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:rtype: dict
:returns:
"""
pass
def get_service_linked_role_deletion_status(self, DeletionTaskId: str) -> Dict:
"""
Retrieves the status of your service-linked role deletion. After you use the DeleteServiceLinkedRole API operation to submit a service-linked role for deletion, you can use the ``DeletionTaskId`` parameter in ``GetServiceLinkedRoleDeletionStatus`` to check the status of the deletion. If the deletion fails, this operation returns the reason that it failed, if that information is returned by the service.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetServiceLinkedRoleDeletionStatus>`_
**Request Syntax**
::
response = client.get_service_linked_role_deletion_status(
DeletionTaskId='string'
)
**Response Syntax**
::
{
'Status': 'SUCCEEDED'|'IN_PROGRESS'|'FAILED'|'NOT_STARTED',
'Reason': {
'Reason': 'string',
'RoleUsageList': [
{
'Region': 'string',
'Resources': [
'string',
]
},
]
}
}
**Response Structure**
- *(dict) --*
- **Status** *(string) --*
The status of the deletion.
- **Reason** *(dict) --*
An object that contains details about the reason the deletion failed.
- **Reason** *(string) --*
A short description of the reason that the service-linked role deletion failed.
- **RoleUsageList** *(list) --*
A list of objects that contains details about the service-linked role deletion failure, if that information is returned by the service. If the service-linked role has active sessions or if any resources that were used by the role have not been deleted from the linked service, the role can't be deleted. This parameter includes a list of the resources that are associated with the role and the region in which the resources are being used.
- *(dict) --*
An object that contains details about how a service-linked role is used, if that information is returned by the service.
This data type is used as a response element in the GetServiceLinkedRoleDeletionStatus operation.
- **Region** *(string) --*
The name of the region where the service-linked role is being used.
- **Resources** *(list) --*
The name of the resource that is using the service-linked role.
- *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:type DeletionTaskId: string
:param DeletionTaskId: **[REQUIRED]**
The deletion task identifier. This identifier is returned by the DeleteServiceLinkedRole operation in the format ``task/aws-service-role/<service-principal-name>/<role-name>/<task-uuid>`` .
:rtype: dict
:returns:
"""
pass
def get_ssh_public_key(self, UserName: str, SSHPublicKeyId: str, Encoding: str) -> Dict:
"""
Retrieves the specified SSH public key, including metadata about the key.
The SSH public key retrieved by this operation is used only for authenticating the associated IAM user to an AWS CodeCommit repository. For more information about using SSH keys to authenticate to an AWS CodeCommit repository, see `Set up AWS CodeCommit for SSH Connections <https://docs.aws.amazon.com/codecommit/latest/userguide/setting-up-credentials-ssh.html>`__ in the *AWS CodeCommit User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetSSHPublicKey>`_
**Request Syntax**
::
response = client.get_ssh_public_key(
UserName='string',
SSHPublicKeyId='string',
Encoding='SSH'|'PEM'
)
**Response Syntax**
::
{
'SSHPublicKey': {
'UserName': 'string',
'SSHPublicKeyId': 'string',
'Fingerprint': 'string',
'SSHPublicKeyBody': 'string',
'Status': 'Active'|'Inactive',
'UploadDate': datetime(2015, 1, 1)
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetSSHPublicKey request.
- **SSHPublicKey** *(dict) --*
A structure containing details about the SSH public key.
- **UserName** *(string) --*
The name of the IAM user associated with the SSH public key.
- **SSHPublicKeyId** *(string) --*
The unique identifier for the SSH public key.
- **Fingerprint** *(string) --*
The MD5 message digest of the SSH public key.
- **SSHPublicKeyBody** *(string) --*
The SSH public key.
- **Status** *(string) --*
The status of the SSH public key. ``Active`` means that the key can be used for authentication with an AWS CodeCommit repository. ``Inactive`` means that the key cannot be used.
- **UploadDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the SSH public key was uploaded.
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the IAM user associated with the SSH public key.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type SSHPublicKeyId: string
:param SSHPublicKeyId: **[REQUIRED]**
The unique identifier for the SSH public key.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that can consist of any upper or lowercased letter or digit.
:type Encoding: string
:param Encoding: **[REQUIRED]**
Specifies the public key encoding format to use in the response. To retrieve the public key in ssh-rsa format, use ``SSH`` . To retrieve the public key in PEM format, use ``PEM`` .
:rtype: dict
:returns:
"""
pass
def get_user(self, UserName: str = None) -> Dict:
"""
Retrieves information about the specified IAM user, including the user's creation date, path, unique ID, and ARN.
If you do not specify a user name, IAM determines the user name implicitly based on the AWS access key ID used to sign the request to this API.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetUser>`_
**Request Syntax**
::
response = client.get_user(
UserName='string'
)
**Response Syntax**
::
{
'User': {
'Path': 'string',
'UserName': 'string',
'UserId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'PasswordLastUsed': datetime(2015, 1, 1),
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetUser request.
- **User** *(dict) --*
A structure containing details about the IAM user.
.. warning::
Due to a service issue, password last used data does not include password use from May 3, 2018 22:50 PDT to May 23, 2018 14:08 PDT. This affects `last sign-in <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_credentials_finding-unused.html>`__ dates shown in the IAM console and password last used dates in the `IAM credential report <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_credentials_getting-report.html>`__ , and returned by this GetUser API. If users signed in during the affected time, the password last used date that is returned is the date the user last signed in before May 3, 2018. For users that signed in after May 23, 2018 14:08 PDT, the returned password last used date is accurate.
You can use password last used information to identify unused credentials for deletion. For example, you might delete users who did not sign in to AWS in the last 90 days. In cases like this, we recommend that you adjust your evaluation window to include dates after May 23, 2018. Alternatively, if your users use access keys to access AWS programmatically you can refer to access key last used information because it is accurate for all dates.
- **Path** *(string) --*
The path to the user. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **UserName** *(string) --*
The friendly name identifying the user.
- **UserId** *(string) --*
The stable and unique string identifying the user. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) that identifies the user. For more information about ARNs and how to use ARNs in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the user was created.
- **PasswordLastUsed** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the user's password was last used to sign in to an AWS website. For a list of AWS websites that capture a user's last sign-in time, see the `Credential Reports <https://docs.aws.amazon.com/IAM/latest/UserGuide/credential-reports.html>`__ topic in the *Using IAM* guide. If a password is used more than once in a five-minute span, only the first use is returned in this field. If the field is null (no value), then it indicates that they never signed in with a password. This can be because:
* The user never had a password.
* A password exists but has not been used since IAM started tracking this information on October 20, 2014.
A null valuedoes not mean that the user *never* had a password. Also, if the user does not currently have a password, but had one in the past, then this field contains the date and time the most recent password was used.
This value is returned only in the GetUser and ListUsers operations.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the user.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are associated with the specified user. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
:type UserName: string
:param UserName:
The name of the user to get information about.
This parameter is optional. If it is not included, it defaults to the user making the request. This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:rtype: dict
:returns:
"""
pass
def get_user_policy(self, UserName: str, PolicyName: str) -> Dict:
"""
Retrieves the specified inline policy document that is embedded in the specified IAM user.
.. note::
Policies returned by this API are URL-encoded compliant with `RFC 3986 <https://tools.ietf.org/html/rfc3986>`__ . You can use a URL decoding method to convert the policy back to plain JSON text. For example, if you use Java, you can use the ``decode`` method of the ``java.net.URLDecoder`` utility class in the Java SDK. Other languages and SDKs provide similar functionality.
An IAM user can also have managed policies attached to it. To retrieve a managed policy document that is attached to a user, use GetPolicy to determine the policy's default version. Then use GetPolicyVersion to retrieve the policy document.
For more information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/GetUserPolicy>`_
**Request Syntax**
::
response = client.get_user_policy(
UserName='string',
PolicyName='string'
)
**Response Syntax**
::
{
'UserName': 'string',
'PolicyName': 'string',
'PolicyDocument': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful GetUserPolicy request.
- **UserName** *(string) --*
The user the policy is associated with.
- **PolicyName** *(string) --*
The name of the policy.
- **PolicyDocument** *(string) --*
The policy document.
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user who the policy is associated with.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyName: string
:param PolicyName: **[REQUIRED]**
The name of the policy document to get.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:rtype: dict
:returns:
"""
pass
def get_waiter(self, waiter_name: str = None) -> Waiter:
"""
Returns an object that can wait for some condition.
:type waiter_name: str
:param waiter_name: The name of the waiter to get. See the waiters
section of the service docs for a list of available waiters.
:returns: The specified waiter object.
:rtype: botocore.waiter.Waiter
"""
pass
def list_access_keys(self, UserName: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Returns information about the access key IDs associated with the specified IAM user. If there is none, the operation returns an empty list.
Although each user is limited to a small number of keys, you can still paginate the results using the ``MaxItems`` and ``Marker`` parameters.
If the ``UserName`` field is not specified, the user name is determined implicitly based on the AWS access key ID used to sign the request. This operation works for access keys under the AWS account. Consequently, you can use this operation to manage AWS account root user credentials even if the AWS account has no associated users.
.. note::
To ensure the security of your AWS account, the secret access key is accessible only during key and user creation.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListAccessKeys>`_
**Request Syntax**
::
response = client.list_access_keys(
UserName='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'AccessKeyMetadata': [
{
'UserName': 'string',
'AccessKeyId': 'string',
'Status': 'Active'|'Inactive',
'CreateDate': datetime(2015, 1, 1)
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListAccessKeys request.
- **AccessKeyMetadata** *(list) --*
A list of objects containing metadata about the access keys.
- *(dict) --*
Contains information about an AWS access key, without its secret key.
This data type is used as a response element in the ListAccessKeys operation.
- **UserName** *(string) --*
The name of the IAM user that the key is associated with.
- **AccessKeyId** *(string) --*
The ID for this access key.
- **Status** *(string) --*
The status of the access key. ``Active`` means that the key is valid for API calls; ``Inactive`` means it is not.
- **CreateDate** *(datetime) --*
The date when the access key was created.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type UserName: string
:param UserName:
The name of the user.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_account_aliases(self, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the account alias associated with the AWS account (Note: you can have only one). For information about using an AWS account alias, see `Using an Alias for Your AWS Account ID <https://docs.aws.amazon.com/IAM/latest/UserGuide/AccountAlias.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListAccountAliases>`_
**Request Syntax**
::
response = client.list_account_aliases(
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'AccountAliases': [
'string',
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListAccountAliases request.
- **AccountAliases** *(list) --*
A list of aliases associated with the account. AWS supports only one alias per account.
- *(string) --*
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_attached_group_policies(self, GroupName: str, PathPrefix: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists all managed policies that are attached to the specified IAM group.
An IAM group can also have inline policies embedded with it. To list the inline policies for a group, use the ListGroupPolicies API. For information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters. You can use the ``PathPrefix`` parameter to limit the list of policies to only those matching the specified path prefix. If there are no policies attached to the specified group (or none that match the specified path prefix), the operation returns an empty list.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListAttachedGroupPolicies>`_
**Request Syntax**
::
response = client.list_attached_group_policies(
GroupName='string',
PathPrefix='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'AttachedPolicies': [
{
'PolicyName': 'string',
'PolicyArn': 'string'
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListAttachedGroupPolicies request.
- **AttachedPolicies** *(list) --*
A list of the attached policies.
- *(dict) --*
Contains information about an attached policy.
An attached policy is a managed policy that has been attached to a user, group, or role. This data type is used as a response element in the ListAttachedGroupPolicies , ListAttachedRolePolicies , ListAttachedUserPolicies , and GetAccountAuthorizationDetails operations.
For more information about managed policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *Using IAM* guide.
- **PolicyName** *(string) --*
The friendly name of the attached policy.
- **PolicyArn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type GroupName: string
:param GroupName: **[REQUIRED]**
The name (friendly name, not ARN) of the group to list attached policies for.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PathPrefix: string
:param PathPrefix:
The path prefix for filtering the results. This parameter is optional. If it is not included, it defaults to a slash (/), listing all policies.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_attached_role_policies(self, RoleName: str, PathPrefix: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists all managed policies that are attached to the specified IAM role.
An IAM role can also have inline policies embedded with it. To list the inline policies for a role, use the ListRolePolicies API. For information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters. You can use the ``PathPrefix`` parameter to limit the list of policies to only those matching the specified path prefix. If there are no policies attached to the specified role (or none that match the specified path prefix), the operation returns an empty list.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListAttachedRolePolicies>`_
**Request Syntax**
::
response = client.list_attached_role_policies(
RoleName='string',
PathPrefix='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'AttachedPolicies': [
{
'PolicyName': 'string',
'PolicyArn': 'string'
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListAttachedRolePolicies request.
- **AttachedPolicies** *(list) --*
A list of the attached policies.
- *(dict) --*
Contains information about an attached policy.
An attached policy is a managed policy that has been attached to a user, group, or role. This data type is used as a response element in the ListAttachedGroupPolicies , ListAttachedRolePolicies , ListAttachedUserPolicies , and GetAccountAuthorizationDetails operations.
For more information about managed policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *Using IAM* guide.
- **PolicyName** *(string) --*
The friendly name of the attached policy.
- **PolicyArn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name (friendly name, not ARN) of the role to list attached policies for.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PathPrefix: string
:param PathPrefix:
The path prefix for filtering the results. This parameter is optional. If it is not included, it defaults to a slash (/), listing all policies.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_attached_user_policies(self, UserName: str, PathPrefix: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists all managed policies that are attached to the specified IAM user.
An IAM user can also have inline policies embedded with it. To list the inline policies for a user, use the ListUserPolicies API. For information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters. You can use the ``PathPrefix`` parameter to limit the list of policies to only those matching the specified path prefix. If there are no policies attached to the specified group (or none that match the specified path prefix), the operation returns an empty list.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListAttachedUserPolicies>`_
**Request Syntax**
::
response = client.list_attached_user_policies(
UserName='string',
PathPrefix='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'AttachedPolicies': [
{
'PolicyName': 'string',
'PolicyArn': 'string'
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListAttachedUserPolicies request.
- **AttachedPolicies** *(list) --*
A list of the attached policies.
- *(dict) --*
Contains information about an attached policy.
An attached policy is a managed policy that has been attached to a user, group, or role. This data type is used as a response element in the ListAttachedGroupPolicies , ListAttachedRolePolicies , ListAttachedUserPolicies , and GetAccountAuthorizationDetails operations.
For more information about managed policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *Using IAM* guide.
- **PolicyName** *(string) --*
The friendly name of the attached policy.
- **PolicyArn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type UserName: string
:param UserName: **[REQUIRED]**
The name (friendly name, not ARN) of the user to list attached policies for.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PathPrefix: string
:param PathPrefix:
The path prefix for filtering the results. This parameter is optional. If it is not included, it defaults to a slash (/), listing all policies.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_entities_for_policy(self, PolicyArn: str, EntityFilter: str = None, PathPrefix: str = None, PolicyUsageFilter: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists all IAM users, groups, and roles that the specified managed policy is attached to.
You can use the optional ``EntityFilter`` parameter to limit the results to a particular type of entity (users, groups, or roles). For example, to list only the roles that are attached to the specified policy, set ``EntityFilter`` to ``Role`` .
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListEntitiesForPolicy>`_
**Request Syntax**
::
response = client.list_entities_for_policy(
PolicyArn='string',
EntityFilter='User'|'Role'|'Group'|'LocalManagedPolicy'|'AWSManagedPolicy',
PathPrefix='string',
PolicyUsageFilter='PermissionsPolicy'|'PermissionsBoundary',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'PolicyGroups': [
{
'GroupName': 'string',
'GroupId': 'string'
},
],
'PolicyUsers': [
{
'UserName': 'string',
'UserId': 'string'
},
],
'PolicyRoles': [
{
'RoleName': 'string',
'RoleId': 'string'
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListEntitiesForPolicy request.
- **PolicyGroups** *(list) --*
A list of IAM groups that the policy is attached to.
- *(dict) --*
Contains information about a group that a managed policy is attached to.
This data type is used as a response element in the ListEntitiesForPolicy operation.
For more information about managed policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *Using IAM* guide.
- **GroupName** *(string) --*
The name (friendly name, not ARN) identifying the group.
- **GroupId** *(string) --*
The stable and unique string identifying the group. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_identifiers.html>`__ in the *IAM User Guide* .
- **PolicyUsers** *(list) --*
A list of IAM users that the policy is attached to.
- *(dict) --*
Contains information about a user that a managed policy is attached to.
This data type is used as a response element in the ListEntitiesForPolicy operation.
For more information about managed policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *Using IAM* guide.
- **UserName** *(string) --*
The name (friendly name, not ARN) identifying the user.
- **UserId** *(string) --*
The stable and unique string identifying the user. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_identifiers.html>`__ in the *IAM User Guide* .
- **PolicyRoles** *(list) --*
A list of IAM roles that the policy is attached to.
- *(dict) --*
Contains information about a role that a managed policy is attached to.
This data type is used as a response element in the ListEntitiesForPolicy operation.
For more information about managed policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *Using IAM* guide.
- **RoleName** *(string) --*
The name (friendly name, not ARN) identifying the role.
- **RoleId** *(string) --*
The stable and unique string identifying the role. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_identifiers.html>`__ in the *IAM User Guide* .
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM policy for which you want the versions.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:type EntityFilter: string
:param EntityFilter:
The entity type to use for filtering the results.
For example, when ``EntityFilter`` is ``Role`` , only the roles that are attached to the specified policy are returned. This parameter is optional. If it is not included, all attached entities (users, groups, and roles) are returned. The argument for this parameter must be one of the valid values listed below.
:type PathPrefix: string
:param PathPrefix:
The path prefix for filtering the results. This parameter is optional. If it is not included, it defaults to a slash (/), listing all entities.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type PolicyUsageFilter: string
:param PolicyUsageFilter:
The policy usage method to use for filtering the results.
To list only permissions policies, set ``PolicyUsageFilter`` to ``PermissionsPolicy`` . To list only the policies used to set permissions boundaries, set the value to ``PermissionsBoundary`` .
This parameter is optional. If it is not included, all policies are returned.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_group_policies(self, GroupName: str, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the names of the inline policies that are embedded in the specified IAM group.
An IAM group can also have managed policies attached to it. To list the managed policies that are attached to a group, use ListAttachedGroupPolicies . For more information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters. If there are no inline policies embedded with the specified group, the operation returns an empty list.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListGroupPolicies>`_
**Request Syntax**
::
response = client.list_group_policies(
GroupName='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'PolicyNames': [
'string',
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListGroupPolicies request.
- **PolicyNames** *(list) --*
A list of policy names.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
- *(string) --*
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type GroupName: string
:param GroupName: **[REQUIRED]**
The name of the group to list policies for.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_groups(self, PathPrefix: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the IAM groups that have the specified path prefix.
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListGroups>`_
**Request Syntax**
::
response = client.list_groups(
PathPrefix='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'Groups': [
{
'Path': 'string',
'GroupName': 'string',
'GroupId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1)
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListGroups request.
- **Groups** *(list) --*
A list of groups.
- *(dict) --*
Contains information about an IAM group entity.
This data type is used as a response element in the following operations:
* CreateGroup
* GetGroup
* ListGroups
- **Path** *(string) --*
The path to the group. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **GroupName** *(string) --*
The friendly name that identifies the group.
- **GroupId** *(string) --*
The stable and unique string identifying the group. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the group. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the group was created.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type PathPrefix: string
:param PathPrefix:
The path prefix for filtering the results. For example, the prefix ``/division_abc/subdivision_xyz/`` gets all groups whose path starts with ``/division_abc/subdivision_xyz/`` .
This parameter is optional. If it is not included, it defaults to a slash (/), listing all groups. This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_groups_for_user(self, UserName: str, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the IAM groups that the specified IAM user belongs to.
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListGroupsForUser>`_
**Request Syntax**
::
response = client.list_groups_for_user(
UserName='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'Groups': [
{
'Path': 'string',
'GroupName': 'string',
'GroupId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1)
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListGroupsForUser request.
- **Groups** *(list) --*
A list of groups.
- *(dict) --*
Contains information about an IAM group entity.
This data type is used as a response element in the following operations:
* CreateGroup
* GetGroup
* ListGroups
- **Path** *(string) --*
The path to the group. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **GroupName** *(string) --*
The friendly name that identifies the group.
- **GroupId** *(string) --*
The stable and unique string identifying the group. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the group. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the group was created.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user to list groups for.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_instance_profiles(self, PathPrefix: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the instance profiles that have the specified path prefix. If there are none, the operation returns an empty list. For more information about instance profiles, go to `About Instance Profiles <https://docs.aws.amazon.com/IAM/latest/UserGuide/AboutInstanceProfiles.html>`__ .
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListInstanceProfiles>`_
**Request Syntax**
::
response = client.list_instance_profiles(
PathPrefix='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'InstanceProfiles': [
{
'Path': 'string',
'InstanceProfileName': 'string',
'InstanceProfileId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'Roles': [
{
'Path': 'string',
'RoleName': 'string',
'RoleId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'AssumeRolePolicyDocument': 'string',
'Description': 'string',
'MaxSessionDuration': 123,
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
},
]
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListInstanceProfiles request.
- **InstanceProfiles** *(list) --*
A list of instance profiles.
- *(dict) --*
Contains information about an instance profile.
This data type is used as a response element in the following operations:
* CreateInstanceProfile
* GetInstanceProfile
* ListInstanceProfiles
* ListInstanceProfilesForRole
- **Path** *(string) --*
The path to the instance profile. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **InstanceProfileName** *(string) --*
The name identifying the instance profile.
- **InstanceProfileId** *(string) --*
The stable and unique string identifying the instance profile. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the instance profile. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date when the instance profile was created.
- **Roles** *(list) --*
The role associated with the instance profile.
- *(dict) --*
Contains information about an IAM role. This structure is returned as a response element in several API operations that interact with roles.
- **Path** *(string) --*
The path to the role. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **RoleName** *(string) --*
The friendly name that identifies the role.
- **RoleId** *(string) --*
The stable and unique string identifying the role. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the role. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the role was created.
- **AssumeRolePolicyDocument** *(string) --*
The policy that grants an entity permission to assume the role.
- **Description** *(string) --*
A description of the role that you provide.
- **MaxSessionDuration** *(integer) --*
The maximum session duration (in seconds) for the specified role. Anyone who uses the AWS CLI, or API to assume the role can specify the duration using the optional ``DurationSeconds`` API parameter or ``duration-seconds`` CLI parameter.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the role.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are attached to the specified role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type PathPrefix: string
:param PathPrefix:
The path prefix for filtering the results. For example, the prefix ``/application_abc/component_xyz/`` gets all instance profiles whose path starts with ``/application_abc/component_xyz/`` .
This parameter is optional. If it is not included, it defaults to a slash (/), listing all instance profiles. This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_instance_profiles_for_role(self, RoleName: str, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the instance profiles that have the specified associated IAM role. If there are none, the operation returns an empty list. For more information about instance profiles, go to `About Instance Profiles <https://docs.aws.amazon.com/IAM/latest/UserGuide/AboutInstanceProfiles.html>`__ .
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListInstanceProfilesForRole>`_
**Request Syntax**
::
response = client.list_instance_profiles_for_role(
RoleName='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'InstanceProfiles': [
{
'Path': 'string',
'InstanceProfileName': 'string',
'InstanceProfileId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'Roles': [
{
'Path': 'string',
'RoleName': 'string',
'RoleId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'AssumeRolePolicyDocument': 'string',
'Description': 'string',
'MaxSessionDuration': 123,
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
},
]
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListInstanceProfilesForRole request.
- **InstanceProfiles** *(list) --*
A list of instance profiles.
- *(dict) --*
Contains information about an instance profile.
This data type is used as a response element in the following operations:
* CreateInstanceProfile
* GetInstanceProfile
* ListInstanceProfiles
* ListInstanceProfilesForRole
- **Path** *(string) --*
The path to the instance profile. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **InstanceProfileName** *(string) --*
The name identifying the instance profile.
- **InstanceProfileId** *(string) --*
The stable and unique string identifying the instance profile. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the instance profile. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date when the instance profile was created.
- **Roles** *(list) --*
The role associated with the instance profile.
- *(dict) --*
Contains information about an IAM role. This structure is returned as a response element in several API operations that interact with roles.
- **Path** *(string) --*
The path to the role. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **RoleName** *(string) --*
The friendly name that identifies the role.
- **RoleId** *(string) --*
The stable and unique string identifying the role. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the role. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the role was created.
- **AssumeRolePolicyDocument** *(string) --*
The policy that grants an entity permission to assume the role.
- **Description** *(string) --*
A description of the role that you provide.
- **MaxSessionDuration** *(integer) --*
The maximum session duration (in seconds) for the specified role. Anyone who uses the AWS CLI, or API to assume the role can specify the duration using the optional ``DurationSeconds`` API parameter or ``duration-seconds`` CLI parameter.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the role.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are attached to the specified role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the role to list instance profiles for.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_mfa_devices(self, UserName: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the MFA devices for an IAM user. If the request includes a IAM user name, then this operation lists all the MFA devices associated with the specified user. If you do not specify a user name, IAM determines the user name implicitly based on the AWS access key ID signing the request for this API.
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListMFADevices>`_
**Request Syntax**
::
response = client.list_mfa_devices(
UserName='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'MFADevices': [
{
'UserName': 'string',
'SerialNumber': 'string',
'EnableDate': datetime(2015, 1, 1)
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListMFADevices request.
- **MFADevices** *(list) --*
A list of MFA devices.
- *(dict) --*
Contains information about an MFA device.
This data type is used as a response element in the ListMFADevices operation.
- **UserName** *(string) --*
The user with whom the MFA device is associated.
- **SerialNumber** *(string) --*
The serial number that uniquely identifies the MFA device. For virtual MFA devices, the serial number is the device ARN.
- **EnableDate** *(datetime) --*
The date when the MFA device was enabled for the user.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type UserName: string
:param UserName:
The name of the user whose MFA devices you want to list.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_open_id_connect_providers(self) -> Dict:
"""
Lists information about the IAM OpenID Connect (OIDC) provider resource objects defined in the AWS account.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListOpenIDConnectProviders>`_
**Request Syntax**
::
response = client.list_open_id_connect_providers()
**Response Syntax**
::
{
'OpenIDConnectProviderList': [
{
'Arn': 'string'
},
]
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListOpenIDConnectProviders request.
- **OpenIDConnectProviderList** *(list) --*
The list of IAM OIDC provider resource objects defined in the AWS account.
- *(dict) --*
Contains the Amazon Resource Name (ARN) for an IAM OpenID Connect provider.
- **Arn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:rtype: dict
:returns:
"""
pass
def list_policies(self, Scope: str = None, OnlyAttached: bool = None, PathPrefix: str = None, PolicyUsageFilter: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists all the managed policies that are available in your AWS account, including your own customer-defined managed policies and all AWS managed policies.
You can filter the list of policies that is returned using the optional ``OnlyAttached`` , ``Scope`` , and ``PathPrefix`` parameters. For example, to list only the customer managed policies in your AWS account, set ``Scope`` to ``Local`` . To list only AWS managed policies, set ``Scope`` to ``AWS`` .
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters.
For more information about managed policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListPolicies>`_
**Request Syntax**
::
response = client.list_policies(
Scope='All'|'AWS'|'Local',
OnlyAttached=True|False,
PathPrefix='string',
PolicyUsageFilter='PermissionsPolicy'|'PermissionsBoundary',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'Policies': [
{
'PolicyName': 'string',
'PolicyId': 'string',
'Arn': 'string',
'Path': 'string',
'DefaultVersionId': 'string',
'AttachmentCount': 123,
'PermissionsBoundaryUsageCount': 123,
'IsAttachable': True|False,
'Description': 'string',
'CreateDate': datetime(2015, 1, 1),
'UpdateDate': datetime(2015, 1, 1)
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListPolicies request.
- **Policies** *(list) --*
A list of policies.
- *(dict) --*
Contains information about a managed policy.
This data type is used as a response element in the CreatePolicy , GetPolicy , and ListPolicies operations.
For more information about managed policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *Using IAM* guide.
- **PolicyName** *(string) --*
The friendly name (not ARN) identifying the policy.
- **PolicyId** *(string) --*
The stable and unique string identifying the policy.
For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **Path** *(string) --*
The path to the policy.
For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **DefaultVersionId** *(string) --*
The identifier for the version of the policy that is set as the default version.
- **AttachmentCount** *(integer) --*
The number of entities (users, groups, and roles) that the policy is attached to.
- **PermissionsBoundaryUsageCount** *(integer) --*
The number of entities (users and roles) for which the policy is used to set the permissions boundary.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **IsAttachable** *(boolean) --*
Specifies whether the policy can be attached to an IAM user, group, or role.
- **Description** *(string) --*
A friendly description of the policy.
This element is included in the response to the GetPolicy operation. It is not included in the response to the ListPolicies operation.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the policy was created.
- **UpdateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the policy was last updated.
When a policy has only one version, this field contains the date and time when the policy was created. When a policy has more than one version, this field contains the date and time when the most recent policy version was created.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type Scope: string
:param Scope:
The scope to use for filtering the results.
To list only AWS managed policies, set ``Scope`` to ``AWS`` . To list only the customer managed policies in your AWS account, set ``Scope`` to ``Local`` .
This parameter is optional. If it is not included, or if it is set to ``All`` , all policies are returned.
:type OnlyAttached: boolean
:param OnlyAttached:
A flag to filter the results to only the attached policies.
When ``OnlyAttached`` is ``true`` , the returned list contains only the policies that are attached to an IAM user, group, or role. When ``OnlyAttached`` is ``false`` , or when the parameter is not included, all policies are returned.
:type PathPrefix: string
:param PathPrefix:
The path prefix for filtering the results. This parameter is optional. If it is not included, it defaults to a slash (/), listing all policies. This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type PolicyUsageFilter: string
:param PolicyUsageFilter:
The policy usage method to use for filtering the results.
To list only permissions policies, set ``PolicyUsageFilter`` to ``PermissionsPolicy`` . To list only the policies used to set permissions boundaries, set the value to ``PermissionsBoundary`` .
This parameter is optional. If it is not included, all policies are returned.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_policies_granting_service_access(self, Arn: str, ServiceNamespaces: List, Marker: str = None) -> Dict:
"""
Retrieves a list of policies that the IAM identity (user, group, or role) can use to access each specified service.
.. note::
This operation does not use other policy types when determining whether a resource could access a service. These other policy types include resource-based policies, access control lists, AWS Organizations policies, IAM permissions boundaries, and AWS STS assume role policies. It only applies permissions policy logic. For more about the evaluation of policy types, see `Evaluating Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_policies_evaluation-logic.html#policy-eval-basics>`__ in the *IAM User Guide* .
The list of policies returned by the operation depends on the ARN of the identity that you provide.
* **User** – The list of policies includes the managed and inline policies that are attached to the user directly. The list also includes any additional managed and inline policies that are attached to the group to which the user belongs.
* **Group** – The list of policies includes only the managed and inline policies that are attached to the group directly. Policies that are attached to the group’s user are not included.
* **Role** – The list of policies includes only the managed and inline policies that are attached to the role.
For each managed policy, this operation returns the ARN and policy name. For each inline policy, it returns the policy name and the entity to which it is attached. Inline policies do not have an ARN. For more information about these policy types, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_managed-vs-inline.html>`__ in the *IAM User Guide* .
Policies that are attached to users and roles as permissions boundaries are not returned. To view which managed policy is currently used to set the permissions boundary for a user or role, use the GetUser or GetRole operations.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListPoliciesGrantingServiceAccess>`_
**Request Syntax**
::
response = client.list_policies_granting_service_access(
Marker='string',
Arn='string',
ServiceNamespaces=[
'string',
]
)
**Response Syntax**
::
{
'PoliciesGrantingServiceAccess': [
{
'ServiceNamespace': 'string',
'Policies': [
{
'PolicyName': 'string',
'PolicyType': 'INLINE'|'MANAGED',
'PolicyArn': 'string',
'EntityType': 'USER'|'ROLE'|'GROUP',
'EntityName': 'string'
},
]
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
- **PoliciesGrantingServiceAccess** *(list) --*
A ``ListPoliciesGrantingServiceAccess`` object that contains details about the permissions policies attached to the specified identity (user, group, or role).
- *(dict) --*
Contains details about the permissions policies that are attached to the specified identity (user, group, or role).
This data type is used as a response element in the ListPoliciesGrantingServiceAccess operation.
- **ServiceNamespace** *(string) --*
The namespace of the service that was accessed.
To learn the service namespace of a service, go to `Actions, Resources, and Condition Keys for AWS Services <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_policies_actions-resources-contextkeys.html>`__ in the *IAM User Guide* . Choose the name of the service to view details for that service. In the first paragraph, find the service prefix. For example, ``(service prefix: a4b)`` . For more information about service namespaces, see `AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html#genref-aws-service-namespaces>`__ in the *AWS General Reference* .
- **Policies** *(list) --*
The ``PoliciesGrantingServiceAccess`` object that contains details about the policy.
- *(dict) --*
Contains details about the permissions policies that are attached to the specified identity (user, group, or role).
This data type is an element of the ListPoliciesGrantingServiceAccessEntry object.
- **PolicyName** *(string) --*
The policy name.
- **PolicyType** *(string) --*
The policy type. For more information about these policy types, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_managed-vs-inline.html>`__ in the *IAM User Guide* .
- **PolicyArn** *(string) --*
The Amazon Resource Name (ARN). ARNs are unique identifiers for AWS resources.
For more information about ARNs, go to `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- **EntityType** *(string) --*
The type of entity (user or role) that used the policy to access the service to which the inline policy is attached.
This field is null for managed policies. For more information about these policy types, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_managed-vs-inline.html>`__ in the *IAM User Guide* .
- **EntityName** *(string) --*
The name of the entity (user or role) to which the inline policy is attached.
This field is null for managed policies. For more information about these policy types, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_managed-vs-inline.html>`__ in the *IAM User Guide* .
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type Arn: string
:param Arn: **[REQUIRED]**
The ARN of the IAM identity (user, group, or role) whose policies you want to list.
:type ServiceNamespaces: list
:param ServiceNamespaces: **[REQUIRED]**
The service namespace for the AWS services whose policies you want to list.
To learn the service namespace for a service, go to `Actions, Resources, and Condition Keys for AWS Services <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_policies_actions-resources-contextkeys.html>`__ in the *IAM User Guide* . Choose the name of the service to view details for that service. In the first paragraph, find the service prefix. For example, ``(service prefix: a4b)`` . For more information about service namespaces, see `AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html#genref-aws-service-namespaces>`__ in the *AWS General Reference* .
- *(string) --*
:rtype: dict
:returns:
"""
pass
def list_policy_versions(self, PolicyArn: str, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists information about the versions of the specified managed policy, including the version that is currently set as the policy's default version.
For more information about managed policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListPolicyVersions>`_
**Request Syntax**
::
response = client.list_policy_versions(
PolicyArn='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'Versions': [
{
'Document': 'string',
'VersionId': 'string',
'IsDefaultVersion': True|False,
'CreateDate': datetime(2015, 1, 1)
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListPolicyVersions request.
- **Versions** *(list) --*
A list of policy versions.
For more information about managed policy versions, see `Versioning for Managed Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-versions.html>`__ in the *IAM User Guide* .
- *(dict) --*
Contains information about a version of a managed policy.
This data type is used as a response element in the CreatePolicyVersion , GetPolicyVersion , ListPolicyVersions , and GetAccountAuthorizationDetails operations.
For more information about managed policies, refer to `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *Using IAM* guide.
- **Document** *(string) --*
The policy document.
The policy document is returned in the response to the GetPolicyVersion and GetAccountAuthorizationDetails operations. It is not returned in the response to the CreatePolicyVersion or ListPolicyVersions operations.
The policy document returned in this structure is URL-encoded compliant with `RFC 3986 <https://tools.ietf.org/html/rfc3986>`__ . You can use a URL decoding method to convert the policy back to plain JSON text. For example, if you use Java, you can use the ``decode`` method of the ``java.net.URLDecoder`` utility class in the Java SDK. Other languages and SDKs provide similar functionality.
- **VersionId** *(string) --*
The identifier for the policy version.
Policy version identifiers always begin with ``v`` (always lowercase). When a policy is created, the first policy version is ``v1`` .
- **IsDefaultVersion** *(boolean) --*
Specifies whether the policy version is set as the policy's default version.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the policy version was created.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM policy for which you want the versions.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_role_policies(self, RoleName: str, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the names of the inline policies that are embedded in the specified IAM role.
An IAM role can also have managed policies attached to it. To list the managed policies that are attached to a role, use ListAttachedRolePolicies . For more information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters. If there are no inline policies embedded with the specified role, the operation returns an empty list.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListRolePolicies>`_
**Request Syntax**
::
response = client.list_role_policies(
RoleName='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'PolicyNames': [
'string',
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListRolePolicies request.
- **PolicyNames** *(list) --*
A list of policy names.
- *(string) --*
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the role to list policies for.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_role_tags(self, RoleName: str, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the tags that are attached to the specified role. The returned list of tags is sorted by tag key. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListRoleTags>`_
**Request Syntax**
::
response = client.list_role_tags(
RoleName='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
- **Tags** *(list) --*
The list of tags currently that is attached to the role. Each tag consists of a key name and an associated value. If no tags are attached to the specified role, the response contains an empty list.
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can use the ``Marker`` request parameter to make a subsequent pagination request that retrieves more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when more results are available. Check ``IsTruncated`` after every call to ensure that you receive all of your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the IAM role for which you want to see the list of tags.
This parameter accepts (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that consist of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
(Optional) Use this only when paginating results to indicate the maximum number of items that you want in the response. If additional items exist beyond the maximum that you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, it defaults to 100. Note that IAM might return fewer results, even when more results are available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_roles(self, PathPrefix: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the IAM roles that have the specified path prefix. If there are none, the operation returns an empty list. For more information about roles, go to `Working with Roles <https://docs.aws.amazon.com/IAM/latest/UserGuide/WorkingWithRoles.html>`__ .
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListRoles>`_
**Request Syntax**
::
response = client.list_roles(
PathPrefix='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'Roles': [
{
'Path': 'string',
'RoleName': 'string',
'RoleId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'AssumeRolePolicyDocument': 'string',
'Description': 'string',
'MaxSessionDuration': 123,
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListRoles request.
- **Roles** *(list) --*
A list of roles.
- *(dict) --*
Contains information about an IAM role. This structure is returned as a response element in several API operations that interact with roles.
- **Path** *(string) --*
The path to the role. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **RoleName** *(string) --*
The friendly name that identifies the role.
- **RoleId** *(string) --*
The stable and unique string identifying the role. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the role. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the role was created.
- **AssumeRolePolicyDocument** *(string) --*
The policy that grants an entity permission to assume the role.
- **Description** *(string) --*
A description of the role that you provide.
- **MaxSessionDuration** *(integer) --*
The maximum session duration (in seconds) for the specified role. Anyone who uses the AWS CLI, or API to assume the role can specify the duration using the optional ``DurationSeconds`` API parameter or ``duration-seconds`` CLI parameter.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the role.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are attached to the specified role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type PathPrefix: string
:param PathPrefix:
The path prefix for filtering the results. For example, the prefix ``/application_abc/component_xyz/`` gets all roles whose path starts with ``/application_abc/component_xyz/`` .
This parameter is optional. If it is not included, it defaults to a slash (/), listing all roles. This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_saml_providers(self) -> Dict:
"""
Lists the SAML provider resource objects defined in IAM in the account.
.. note::
This operation requires `Signature Version 4 <https://docs.aws.amazon.com/general/latest/gr/signature-version-4.html>`__ .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListSAMLProviders>`_
**Request Syntax**
::
response = client.list_saml_providers()
**Response Syntax**
::
{
'SAMLProviderList': [
{
'Arn': 'string',
'ValidUntil': datetime(2015, 1, 1),
'CreateDate': datetime(2015, 1, 1)
},
]
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListSAMLProviders request.
- **SAMLProviderList** *(list) --*
The list of SAML provider resource objects defined in IAM for this AWS account.
- *(dict) --*
Contains the list of SAML providers for this account.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) of the SAML provider.
- **ValidUntil** *(datetime) --*
The expiration date and time for the SAML provider.
- **CreateDate** *(datetime) --*
The date and time when the SAML provider was created.
:rtype: dict
:returns:
"""
pass
def list_server_certificates(self, PathPrefix: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the server certificates stored in IAM that have the specified path prefix. If none exist, the operation returns an empty list.
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters.
For more information about working with server certificates, see `Working with Server Certificates <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_credentials_server-certs.html>`__ in the *IAM User Guide* . This topic also includes a list of AWS services that can use the server certificates that you manage with IAM.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListServerCertificates>`_
**Request Syntax**
::
response = client.list_server_certificates(
PathPrefix='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'ServerCertificateMetadataList': [
{
'Path': 'string',
'ServerCertificateName': 'string',
'ServerCertificateId': 'string',
'Arn': 'string',
'UploadDate': datetime(2015, 1, 1),
'Expiration': datetime(2015, 1, 1)
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListServerCertificates request.
- **ServerCertificateMetadataList** *(list) --*
A list of server certificates.
- *(dict) --*
Contains information about a server certificate without its certificate body, certificate chain, and private key.
This data type is used as a response element in the UploadServerCertificate and ListServerCertificates operations.
- **Path** *(string) --*
The path to the server certificate. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **ServerCertificateName** *(string) --*
The name that identifies the server certificate.
- **ServerCertificateId** *(string) --*
The stable and unique string identifying the server certificate. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the server certificate. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **UploadDate** *(datetime) --*
The date when the server certificate was uploaded.
- **Expiration** *(datetime) --*
The date on which the certificate is set to expire.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type PathPrefix: string
:param PathPrefix:
The path prefix for filtering the results. For example: ``/company/servercerts`` would get all server certificates for which the path starts with ``/company/servercerts`` .
This parameter is optional. If it is not included, it defaults to a slash (/), listing all server certificates. This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_service_specific_credentials(self, UserName: str = None, ServiceName: str = None) -> Dict:
"""
Returns information about the service-specific credentials associated with the specified IAM user. If none exists, the operation returns an empty list. The service-specific credentials returned by this operation are used only for authenticating the IAM user to a specific service. For more information about using service-specific credentials to authenticate to an AWS service, see `Set Up service-specific credentials <https://docs.aws.amazon.com/codecommit/latest/userguide/setting-up-gc.html>`__ in the AWS CodeCommit User Guide.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListServiceSpecificCredentials>`_
**Request Syntax**
::
response = client.list_service_specific_credentials(
UserName='string',
ServiceName='string'
)
**Response Syntax**
::
{
'ServiceSpecificCredentials': [
{
'UserName': 'string',
'Status': 'Active'|'Inactive',
'ServiceUserName': 'string',
'CreateDate': datetime(2015, 1, 1),
'ServiceSpecificCredentialId': 'string',
'ServiceName': 'string'
},
]
}
**Response Structure**
- *(dict) --*
- **ServiceSpecificCredentials** *(list) --*
A list of structures that each contain details about a service-specific credential.
- *(dict) --*
Contains additional details about a service-specific credential.
- **UserName** *(string) --*
The name of the IAM user associated with the service-specific credential.
- **Status** *(string) --*
The status of the service-specific credential. ``Active`` means that the key is valid for API calls, while ``Inactive`` means it is not.
- **ServiceUserName** *(string) --*
The generated user name for the service-specific credential.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the service-specific credential were created.
- **ServiceSpecificCredentialId** *(string) --*
The unique identifier for the service-specific credential.
- **ServiceName** *(string) --*
The name of the service associated with the service-specific credential.
:type UserName: string
:param UserName:
The name of the user whose service-specific credentials you want information about. If this value is not specified, then the operation assumes the user whose credentials are used to call the operation.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type ServiceName: string
:param ServiceName:
Filters the returned results to only those for the specified AWS service. If not specified, then AWS returns service-specific credentials for all services.
:rtype: dict
:returns:
"""
pass
def list_signing_certificates(self, UserName: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Returns information about the signing certificates associated with the specified IAM user. If none exists, the operation returns an empty list.
Although each user is limited to a small number of signing certificates, you can still paginate the results using the ``MaxItems`` and ``Marker`` parameters.
If the ``UserName`` field is not specified, the user name is determined implicitly based on the AWS access key ID used to sign the request for this API. This operation works for access keys under the AWS account. Consequently, you can use this operation to manage AWS account root user credentials even if the AWS account has no associated users.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListSigningCertificates>`_
**Request Syntax**
::
response = client.list_signing_certificates(
UserName='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'Certificates': [
{
'UserName': 'string',
'CertificateId': 'string',
'CertificateBody': 'string',
'Status': 'Active'|'Inactive',
'UploadDate': datetime(2015, 1, 1)
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListSigningCertificates request.
- **Certificates** *(list) --*
A list of the user's signing certificate information.
- *(dict) --*
Contains information about an X.509 signing certificate.
This data type is used as a response element in the UploadSigningCertificate and ListSigningCertificates operations.
- **UserName** *(string) --*
The name of the user the signing certificate is associated with.
- **CertificateId** *(string) --*
The ID for the signing certificate.
- **CertificateBody** *(string) --*
The contents of the signing certificate.
- **Status** *(string) --*
The status of the signing certificate. ``Active`` means that the key is valid for API calls, while ``Inactive`` means it is not.
- **UploadDate** *(datetime) --*
The date when the signing certificate was uploaded.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type UserName: string
:param UserName:
The name of the IAM user whose signing certificates you want to examine.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_ssh_public_keys(self, UserName: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Returns information about the SSH public keys associated with the specified IAM user. If none exists, the operation returns an empty list.
The SSH public keys returned by this operation are used only for authenticating the IAM user to an AWS CodeCommit repository. For more information about using SSH keys to authenticate to an AWS CodeCommit repository, see `Set up AWS CodeCommit for SSH Connections <https://docs.aws.amazon.com/codecommit/latest/userguide/setting-up-credentials-ssh.html>`__ in the *AWS CodeCommit User Guide* .
Although each user is limited to a small number of keys, you can still paginate the results using the ``MaxItems`` and ``Marker`` parameters.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListSSHPublicKeys>`_
**Request Syntax**
::
response = client.list_ssh_public_keys(
UserName='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'SSHPublicKeys': [
{
'UserName': 'string',
'SSHPublicKeyId': 'string',
'Status': 'Active'|'Inactive',
'UploadDate': datetime(2015, 1, 1)
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListSSHPublicKeys request.
- **SSHPublicKeys** *(list) --*
A list of the SSH public keys assigned to IAM user.
- *(dict) --*
Contains information about an SSH public key, without the key's body or fingerprint.
This data type is used as a response element in the ListSSHPublicKeys operation.
- **UserName** *(string) --*
The name of the IAM user associated with the SSH public key.
- **SSHPublicKeyId** *(string) --*
The unique identifier for the SSH public key.
- **Status** *(string) --*
The status of the SSH public key. ``Active`` means that the key can be used for authentication with an AWS CodeCommit repository. ``Inactive`` means that the key cannot be used.
- **UploadDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the SSH public key was uploaded.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type UserName: string
:param UserName:
The name of the IAM user to list SSH public keys for. If none is specified, the ``UserName`` field is determined implicitly based on the AWS access key used to sign the request.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_user_policies(self, UserName: str, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the names of the inline policies embedded in the specified IAM user.
An IAM user can also have managed policies attached to it. To list the managed policies that are attached to a user, use ListAttachedUserPolicies . For more information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters. If there are no inline policies embedded with the specified user, the operation returns an empty list.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListUserPolicies>`_
**Request Syntax**
::
response = client.list_user_policies(
UserName='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'PolicyNames': [
'string',
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListUserPolicies request.
- **PolicyNames** *(list) --*
A list of policy names.
- *(string) --*
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user to list policies for.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_user_tags(self, UserName: str, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the tags that are attached to the specified user. The returned list of tags is sorted by tag key. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListUserTags>`_
**Request Syntax**
::
response = client.list_user_tags(
UserName='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
- **Tags** *(list) --*
The list of tags that are currently attached to the user. Each tag consists of a key name and an associated value. If no tags are attached to the specified user, the response contains an empty list.
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can use the ``Marker`` request parameter to make a subsequent pagination request that retrieves more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when more results are available. Check ``IsTruncated`` after every call to ensure that you receive all of your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the IAM user whose tags you want to see.
This parameter accepts (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that consist of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: =,.@-
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
(Optional) Use this only when paginating results to indicate the maximum number of items that you want in the response. If additional items exist beyond the maximum that you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, it defaults to 100. Note that IAM might return fewer results, even when more results are available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_users(self, PathPrefix: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the IAM users that have the specified path prefix. If no path prefix is specified, the operation returns all users in the AWS account. If there are none, the operation returns an empty list.
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListUsers>`_
**Request Syntax**
::
response = client.list_users(
PathPrefix='string',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'Users': [
{
'Path': 'string',
'UserName': 'string',
'UserId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'PasswordLastUsed': datetime(2015, 1, 1),
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListUsers request.
- **Users** *(list) --*
A list of users.
- *(dict) --*
Contains information about an IAM user entity.
This data type is used as a response element in the following operations:
* CreateUser
* GetUser
* ListUsers
- **Path** *(string) --*
The path to the user. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **UserName** *(string) --*
The friendly name identifying the user.
- **UserId** *(string) --*
The stable and unique string identifying the user. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) that identifies the user. For more information about ARNs and how to use ARNs in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the user was created.
- **PasswordLastUsed** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the user's password was last used to sign in to an AWS website. For a list of AWS websites that capture a user's last sign-in time, see the `Credential Reports <https://docs.aws.amazon.com/IAM/latest/UserGuide/credential-reports.html>`__ topic in the *Using IAM* guide. If a password is used more than once in a five-minute span, only the first use is returned in this field. If the field is null (no value), then it indicates that they never signed in with a password. This can be because:
* The user never had a password.
* A password exists but has not been used since IAM started tracking this information on October 20, 2014.
A null valuedoes not mean that the user *never* had a password. Also, if the user does not currently have a password, but had one in the past, then this field contains the date and time the most recent password was used.
This value is returned only in the GetUser and ListUsers operations.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the user.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are associated with the specified user. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type PathPrefix: string
:param PathPrefix:
The path prefix for filtering the results. For example: ``/division_abc/subdivision_xyz/`` , which would get all user names whose path starts with ``/division_abc/subdivision_xyz/`` .
This parameter is optional. If it is not included, it defaults to a slash (/), listing all user names. This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def list_virtual_mfa_devices(self, AssignmentStatus: str = None, Marker: str = None, MaxItems: int = None) -> Dict:
"""
Lists the virtual MFA devices defined in the AWS account by assignment status. If you do not specify an assignment status, the operation returns a list of all virtual MFA devices. Assignment status can be ``Assigned`` , ``Unassigned`` , or ``Any`` .
You can paginate the results using the ``MaxItems`` and ``Marker`` parameters.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ListVirtualMFADevices>`_
**Request Syntax**
::
response = client.list_virtual_mfa_devices(
AssignmentStatus='Assigned'|'Unassigned'|'Any',
Marker='string',
MaxItems=123
)
**Response Syntax**
::
{
'VirtualMFADevices': [
{
'SerialNumber': 'string',
'Base32StringSeed': b'bytes',
'QRCodePNG': b'bytes',
'User': {
'Path': 'string',
'UserName': 'string',
'UserId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'PasswordLastUsed': datetime(2015, 1, 1),
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
},
'EnableDate': datetime(2015, 1, 1)
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful ListVirtualMFADevices request.
- **VirtualMFADevices** *(list) --*
The list of virtual MFA devices in the current account that match the ``AssignmentStatus`` value that was passed in the request.
- *(dict) --*
Contains information about a virtual MFA device.
- **SerialNumber** *(string) --*
The serial number associated with ``VirtualMFADevice`` .
- **Base32StringSeed** *(bytes) --*
The base32 seed defined as specified in `RFC3548 <https://tools.ietf.org/html/rfc3548.txt>`__ . The ``Base32StringSeed`` is base64-encoded.
- **QRCodePNG** *(bytes) --*
A QR code PNG image that encodes ``otpauth://totp/$virtualMFADeviceName@$AccountName?secret=$Base32String`` where ``$virtualMFADeviceName`` is one of the create call arguments. ``AccountName`` is the user name if set (otherwise, the account ID otherwise), and ``Base32String`` is the seed in base32 format. The ``Base32String`` value is base64-encoded.
- **User** *(dict) --*
The IAM user associated with this virtual MFA device.
- **Path** *(string) --*
The path to the user. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **UserName** *(string) --*
The friendly name identifying the user.
- **UserId** *(string) --*
The stable and unique string identifying the user. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) that identifies the user. For more information about ARNs and how to use ARNs in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the user was created.
- **PasswordLastUsed** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the user's password was last used to sign in to an AWS website. For a list of AWS websites that capture a user's last sign-in time, see the `Credential Reports <https://docs.aws.amazon.com/IAM/latest/UserGuide/credential-reports.html>`__ topic in the *Using IAM* guide. If a password is used more than once in a five-minute span, only the first use is returned in this field. If the field is null (no value), then it indicates that they never signed in with a password. This can be because:
* The user never had a password.
* A password exists but has not been used since IAM started tracking this information on October 20, 2014.
A null valuedoes not mean that the user *never* had a password. Also, if the user does not currently have a password, but had one in the past, then this field contains the date and time the most recent password was used.
This value is returned only in the GetUser and ListUsers operations.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the user.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are associated with the specified user. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
- **EnableDate** *(datetime) --*
The date and time on which the virtual MFA device was enabled.
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type AssignmentStatus: string
:param AssignmentStatus:
The status (``Unassigned`` or ``Assigned`` ) of the devices to list. If you do not specify an ``AssignmentStatus`` , the operation defaults to ``Any`` , which lists both assigned and unassigned virtual MFA devices.,
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:rtype: dict
:returns:
"""
pass
def put_group_policy(self, GroupName: str, PolicyName: str, PolicyDocument: str):
"""
Adds or updates an inline policy document that is embedded in the specified IAM group.
A user can also have managed policies attached to it. To attach a managed policy to a group, use AttachGroupPolicy . To create a new managed policy, use CreatePolicy . For information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
For information about limits on the number of inline policies that you can embed in a group, see `Limitations on IAM Entities <https://docs.aws.amazon.com/IAM/latest/UserGuide/LimitationsOnEntities.html>`__ in the *IAM User Guide* .
.. note::
Because policy documents can be large, you should use POST rather than GET when calling ``PutGroupPolicy`` . For general information about using the Query API with IAM, go to `Making Query Requests <https://docs.aws.amazon.com/IAM/latest/UserGuide/IAM_UsingQueryAPI.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/PutGroupPolicy>`_
**Request Syntax**
::
response = client.put_group_policy(
GroupName='string',
PolicyName='string',
PolicyDocument='string'
)
:type GroupName: string
:param GroupName: **[REQUIRED]**
The name of the group to associate the policy with.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyName: string
:param PolicyName: **[REQUIRED]**
The name of the policy document.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyDocument: string
:param PolicyDocument: **[REQUIRED]**
The policy document.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:returns: None
"""
pass
def put_role_permissions_boundary(self, RoleName: str, PermissionsBoundary: str):
"""
Adds or updates the policy that is specified as the IAM role's permissions boundary. You can use an AWS managed policy or a customer managed policy to set the boundary for a role. Use the boundary to control the maximum permissions that the role can have. Setting a permissions boundary is an advanced feature that can affect the permissions for the role.
You cannot set the boundary for a service-linked role.
.. warning::
Policies used as permissions boundaries do not provide permissions. You must also attach a permissions policy to the role. To learn how the effective permissions for a role are evaluated, see `IAM JSON Policy Evaluation Logic <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_policies_evaluation-logic.html>`__ in the IAM User Guide.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/PutRolePermissionsBoundary>`_
**Request Syntax**
::
response = client.put_role_permissions_boundary(
RoleName='string',
PermissionsBoundary='string'
)
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name (friendly name, not ARN) of the IAM role for which you want to set the permissions boundary.
:type PermissionsBoundary: string
:param PermissionsBoundary: **[REQUIRED]**
The ARN of the policy that is used to set the permissions boundary for the role.
:returns: None
"""
pass
def put_role_policy(self, RoleName: str, PolicyName: str, PolicyDocument: str):
"""
Adds or updates an inline policy document that is embedded in the specified IAM role.
When you embed an inline policy in a role, the inline policy is used as part of the role's access (permissions) policy. The role's trust policy is created at the same time as the role, using CreateRole . You can update a role's trust policy using UpdateAssumeRolePolicy . For more information about IAM roles, go to `Using Roles to Delegate Permissions and Federate Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/roles-toplevel.html>`__ .
A role can also have a managed policy attached to it. To attach a managed policy to a role, use AttachRolePolicy . To create a new managed policy, use CreatePolicy . For information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
For information about limits on the number of inline policies that you can embed with a role, see `Limitations on IAM Entities <https://docs.aws.amazon.com/IAM/latest/UserGuide/LimitationsOnEntities.html>`__ in the *IAM User Guide* .
.. note::
Because policy documents can be large, you should use POST rather than GET when calling ``PutRolePolicy`` . For general information about using the Query API with IAM, go to `Making Query Requests <https://docs.aws.amazon.com/IAM/latest/UserGuide/IAM_UsingQueryAPI.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/PutRolePolicy>`_
**Request Syntax**
::
response = client.put_role_policy(
RoleName='string',
PolicyName='string',
PolicyDocument='string'
)
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the role to associate the policy with.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyName: string
:param PolicyName: **[REQUIRED]**
The name of the policy document.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyDocument: string
:param PolicyDocument: **[REQUIRED]**
The policy document.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:returns: None
"""
pass
def put_user_permissions_boundary(self, UserName: str, PermissionsBoundary: str):
"""
Adds or updates the policy that is specified as the IAM user's permissions boundary. You can use an AWS managed policy or a customer managed policy to set the boundary for a user. Use the boundary to control the maximum permissions that the user can have. Setting a permissions boundary is an advanced feature that can affect the permissions for the user.
.. warning::
Policies that are used as permissions boundaries do not provide permissions. You must also attach a permissions policy to the user. To learn how the effective permissions for a user are evaluated, see `IAM JSON Policy Evaluation Logic <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_policies_evaluation-logic.html>`__ in the IAM User Guide.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/PutUserPermissionsBoundary>`_
**Request Syntax**
::
response = client.put_user_permissions_boundary(
UserName='string',
PermissionsBoundary='string'
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name (friendly name, not ARN) of the IAM user for which you want to set the permissions boundary.
:type PermissionsBoundary: string
:param PermissionsBoundary: **[REQUIRED]**
The ARN of the policy that is used to set the permissions boundary for the user.
:returns: None
"""
pass
def put_user_policy(self, UserName: str, PolicyName: str, PolicyDocument: str):
"""
Adds or updates an inline policy document that is embedded in the specified IAM user.
An IAM user can also have a managed policy attached to it. To attach a managed policy to a user, use AttachUserPolicy . To create a new managed policy, use CreatePolicy . For information about policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
For information about limits on the number of inline policies that you can embed in a user, see `Limitations on IAM Entities <https://docs.aws.amazon.com/IAM/latest/UserGuide/LimitationsOnEntities.html>`__ in the *IAM User Guide* .
.. note::
Because policy documents can be large, you should use POST rather than GET when calling ``PutUserPolicy`` . For general information about using the Query API with IAM, go to `Making Query Requests <https://docs.aws.amazon.com/IAM/latest/UserGuide/IAM_UsingQueryAPI.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/PutUserPolicy>`_
**Request Syntax**
::
response = client.put_user_policy(
UserName='string',
PolicyName='string',
PolicyDocument='string'
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user to associate the policy with.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyName: string
:param PolicyName: **[REQUIRED]**
The name of the policy document.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyDocument: string
:param PolicyDocument: **[REQUIRED]**
The policy document.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:returns: None
"""
pass
def remove_client_id_from_open_id_connect_provider(self, OpenIDConnectProviderArn: str, ClientID: str):
"""
Removes the specified client ID (also known as audience) from the list of client IDs registered for the specified IAM OpenID Connect (OIDC) provider resource object.
This operation is idempotent; it does not fail or return an error if you try to remove a client ID that does not exist.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/RemoveClientIDFromOpenIDConnectProvider>`_
**Request Syntax**
::
response = client.remove_client_id_from_open_id_connect_provider(
OpenIDConnectProviderArn='string',
ClientID='string'
)
:type OpenIDConnectProviderArn: string
:param OpenIDConnectProviderArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM OIDC provider resource to remove the client ID from. You can get a list of OIDC provider ARNs by using the ListOpenIDConnectProviders operation.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:type ClientID: string
:param ClientID: **[REQUIRED]**
The client ID (also known as audience) to remove from the IAM OIDC provider resource. For more information about client IDs, see CreateOpenIDConnectProvider .
:returns: None
"""
pass
def remove_role_from_instance_profile(self, InstanceProfileName: str, RoleName: str):
"""
Removes the specified IAM role from the specified EC2 instance profile.
.. warning::
Make sure that you do not have any Amazon EC2 instances running with the role you are about to remove from the instance profile. Removing a role from an instance profile that is associated with a running instance might break any applications running on the instance.
For more information about IAM roles, go to `Working with Roles <https://docs.aws.amazon.com/IAM/latest/UserGuide/WorkingWithRoles.html>`__ . For more information about instance profiles, go to `About Instance Profiles <https://docs.aws.amazon.com/IAM/latest/UserGuide/AboutInstanceProfiles.html>`__ .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/RemoveRoleFromInstanceProfile>`_
**Request Syntax**
::
response = client.remove_role_from_instance_profile(
InstanceProfileName='string',
RoleName='string'
)
:type InstanceProfileName: string
:param InstanceProfileName: **[REQUIRED]**
The name of the instance profile to update.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the role to remove.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def remove_user_from_group(self, GroupName: str, UserName: str):
"""
Removes the specified user from the specified group.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/RemoveUserFromGroup>`_
**Request Syntax**
::
response = client.remove_user_from_group(
GroupName='string',
UserName='string'
)
:type GroupName: string
:param GroupName: **[REQUIRED]**
The name of the group to update.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user to remove.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def reset_service_specific_credential(self, ServiceSpecificCredentialId: str, UserName: str = None) -> Dict:
"""
Resets the password for a service-specific credential. The new password is AWS generated and cryptographically strong. It cannot be configured by the user. Resetting the password immediately invalidates the previous password associated with this user.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ResetServiceSpecificCredential>`_
**Request Syntax**
::
response = client.reset_service_specific_credential(
UserName='string',
ServiceSpecificCredentialId='string'
)
**Response Syntax**
::
{
'ServiceSpecificCredential': {
'CreateDate': datetime(2015, 1, 1),
'ServiceName': 'string',
'ServiceUserName': 'string',
'ServicePassword': 'string',
'ServiceSpecificCredentialId': 'string',
'UserName': 'string',
'Status': 'Active'|'Inactive'
}
}
**Response Structure**
- *(dict) --*
- **ServiceSpecificCredential** *(dict) --*
A structure with details about the updated service-specific credential, including the new password.
.. warning::
This is the **only** time that you can access the password. You cannot recover the password later, but you can reset it again.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the service-specific credential were created.
- **ServiceName** *(string) --*
The name of the service associated with the service-specific credential.
- **ServiceUserName** *(string) --*
The generated user name for the service-specific credential. This value is generated by combining the IAM user's name combined with the ID number of the AWS account, as in ``jane-at-123456789012`` , for example. This value cannot be configured by the user.
- **ServicePassword** *(string) --*
The generated password for the service-specific credential.
- **ServiceSpecificCredentialId** *(string) --*
The unique identifier for the service-specific credential.
- **UserName** *(string) --*
The name of the IAM user associated with the service-specific credential.
- **Status** *(string) --*
The status of the service-specific credential. ``Active`` means that the key is valid for API calls, while ``Inactive`` means it is not.
:type UserName: string
:param UserName:
The name of the IAM user associated with the service-specific credential. If this value is not specified, then the operation assumes the user whose credentials are used to call the operation.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type ServiceSpecificCredentialId: string
:param ServiceSpecificCredentialId: **[REQUIRED]**
The unique identifier of the service-specific credential.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that can consist of any upper or lowercased letter or digit.
:rtype: dict
:returns:
"""
pass
def resync_mfa_device(self, UserName: str, SerialNumber: str, AuthenticationCode1: str, AuthenticationCode2: str):
"""
Synchronizes the specified MFA device with its IAM resource object on the AWS servers.
For more information about creating and working with virtual MFA devices, go to `Using a Virtual MFA Device <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_VirtualMFA.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/ResyncMFADevice>`_
**Request Syntax**
::
response = client.resync_mfa_device(
UserName='string',
SerialNumber='string',
AuthenticationCode1='string',
AuthenticationCode2='string'
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user whose MFA device you want to resynchronize.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type SerialNumber: string
:param SerialNumber: **[REQUIRED]**
Serial number that uniquely identifies the MFA device.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type AuthenticationCode1: string
:param AuthenticationCode1: **[REQUIRED]**
An authentication code emitted by the device.
The format for this parameter is a sequence of six digits.
:type AuthenticationCode2: string
:param AuthenticationCode2: **[REQUIRED]**
A subsequent authentication code emitted by the device.
The format for this parameter is a sequence of six digits.
:returns: None
"""
pass
def set_default_policy_version(self, PolicyArn: str, VersionId: str):
"""
Sets the specified version of the specified policy as the policy's default (operative) version.
This operation affects all users, groups, and roles that the policy is attached to. To list the users, groups, and roles that the policy is attached to, use the ListEntitiesForPolicy API.
For information about managed policies, see `Managed Policies and Inline Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-vs-inline.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/SetDefaultPolicyVersion>`_
**Request Syntax**
::
response = client.set_default_policy_version(
PolicyArn='string',
VersionId='string'
)
:type PolicyArn: string
:param PolicyArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM policy whose default version you want to set.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:type VersionId: string
:param VersionId: **[REQUIRED]**
The version of the policy to set as the default (operative) version.
For more information about managed policy versions, see `Versioning for Managed Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/policies-managed-versions.html>`__ in the *IAM User Guide* .
:returns: None
"""
pass
def set_security_token_service_preferences(self, GlobalEndpointTokenVersion: str):
"""
Sets the specified version of the global endpoint token as the token version used for the AWS account.
By default, AWS Security Token Service (STS) is available as a global service, and all STS requests go to a single endpoint at ``https://sts.amazonaws.com`` . AWS recommends using Regional STS endpoints to reduce latency, build in redundancy, and increase session token availability. For information about Regional endpoints for STS, see `AWS Regions and Endpoints <https://docs.aws.amazon.com/general/latest/gr/rande.html#sts_region>`__ in the *AWS General Reference* .
If you make an STS call to the global endpoint, the resulting session tokens might be valid in some Regions but not others. It depends on the version that is set in this operation. Version 1 tokens are valid only in AWS Regions that are available by default. These tokens do not work in manually enabled Regions, such as Asia Pacific (Hong Kong). Version 2 tokens are valid in all Regions. However, version 2 tokens are longer and might affect systems where you temporarily store tokens. For information, see `Activating and Deactivating STS in an AWS Region <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_credentials_temp_enable-regions.html>`__ in the *IAM User Guide* .
To view the current session token version, see the ``GlobalEndpointTokenVersion`` entry in the response of the GetAccountSummary operation.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/SetSecurityTokenServicePreferences>`_
**Request Syntax**
::
response = client.set_security_token_service_preferences(
GlobalEndpointTokenVersion='v1Token'|'v2Token'
)
:type GlobalEndpointTokenVersion: string
:param GlobalEndpointTokenVersion: **[REQUIRED]**
The version of the global endpoint token. Version 1 tokens are valid only in AWS Regions that are available by default. These tokens do not work in manually enabled Regions, such as Asia Pacific (Hong Kong). Version 2 tokens are valid in all Regions. However, version 2 tokens are longer and might affect systems where you temporarily store tokens.
For information, see `Activating and Deactivating STS in an AWS Region <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_credentials_temp_enable-regions.html>`__ in the *IAM User Guide* .
:returns: None
"""
pass
def simulate_custom_policy(self, PolicyInputList: List, ActionNames: List, ResourceArns: List = None, ResourcePolicy: str = None, ResourceOwner: str = None, CallerArn: str = None, ContextEntries: List = None, ResourceHandlingOption: str = None, MaxItems: int = None, Marker: str = None) -> Dict:
"""
Simulate how a set of IAM policies and optionally a resource-based policy works with a list of API operations and AWS resources to determine the policies' effective permissions. The policies are provided as strings.
The simulation does not perform the API operations; it only checks the authorization to determine if the simulated policies allow or deny the operations.
If you want to simulate existing policies attached to an IAM user, group, or role, use SimulatePrincipalPolicy instead.
Context keys are variables maintained by AWS and its services that provide details about the context of an API query request. You can use the ``Condition`` element of an IAM policy to evaluate context keys. To get the list of context keys that the policies require for correct simulation, use GetContextKeysForCustomPolicy .
If the output is long, you can use ``MaxItems`` and ``Marker`` parameters to paginate the results.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/SimulateCustomPolicy>`_
**Request Syntax**
::
response = client.simulate_custom_policy(
PolicyInputList=[
'string',
],
ActionNames=[
'string',
],
ResourceArns=[
'string',
],
ResourcePolicy='string',
ResourceOwner='string',
CallerArn='string',
ContextEntries=[
{
'ContextKeyName': 'string',
'ContextKeyValues': [
'string',
],
'ContextKeyType': 'string'|'stringList'|'numeric'|'numericList'|'boolean'|'booleanList'|'ip'|'ipList'|'binary'|'binaryList'|'date'|'dateList'
},
],
ResourceHandlingOption='string',
MaxItems=123,
Marker='string'
)
**Response Syntax**
::
{
'EvaluationResults': [
{
'EvalActionName': 'string',
'EvalResourceName': 'string',
'EvalDecision': 'allowed'|'explicitDeny'|'implicitDeny',
'MatchedStatements': [
{
'SourcePolicyId': 'string',
'SourcePolicyType': 'user'|'group'|'role'|'aws-managed'|'user-managed'|'resource'|'none',
'StartPosition': {
'Line': 123,
'Column': 123
},
'EndPosition': {
'Line': 123,
'Column': 123
}
},
],
'MissingContextValues': [
'string',
],
'OrganizationsDecisionDetail': {
'AllowedByOrganizations': True|False
},
'EvalDecisionDetails': {
'string': 'allowed'|'explicitDeny'|'implicitDeny'
},
'ResourceSpecificResults': [
{
'EvalResourceName': 'string',
'EvalResourceDecision': 'allowed'|'explicitDeny'|'implicitDeny',
'MatchedStatements': [
{
'SourcePolicyId': 'string',
'SourcePolicyType': 'user'|'group'|'role'|'aws-managed'|'user-managed'|'resource'|'none',
'StartPosition': {
'Line': 123,
'Column': 123
},
'EndPosition': {
'Line': 123,
'Column': 123
}
},
],
'MissingContextValues': [
'string',
],
'EvalDecisionDetails': {
'string': 'allowed'|'explicitDeny'|'implicitDeny'
}
},
]
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful SimulatePrincipalPolicy or SimulateCustomPolicy request.
- **EvaluationResults** *(list) --*
The results of the simulation.
- *(dict) --*
Contains the results of a simulation.
This data type is used by the return parameter of `` SimulateCustomPolicy `` and `` SimulatePrincipalPolicy `` .
- **EvalActionName** *(string) --*
The name of the API operation tested on the indicated resource.
- **EvalResourceName** *(string) --*
The ARN of the resource that the indicated API operation was tested on.
- **EvalDecision** *(string) --*
The result of the simulation.
- **MatchedStatements** *(list) --*
A list of the statements in the input policies that determine the result for this scenario. Remember that even if multiple statements allow the operation on the resource, if only one statement denies that operation, then the explicit deny overrides any allow. Inaddition, the deny statement is the only entry included in the result.
- *(dict) --*
Contains a reference to a ``Statement`` element in a policy document that determines the result of the simulation.
This data type is used by the ``MatchedStatements`` member of the `` EvaluationResult `` type.
- **SourcePolicyId** *(string) --*
The identifier of the policy that was provided as an input.
- **SourcePolicyType** *(string) --*
The type of the policy.
- **StartPosition** *(dict) --*
The row and column of the beginning of the ``Statement`` in an IAM policy.
- **Line** *(integer) --*
The line containing the specified position in the document.
- **Column** *(integer) --*
The column in the line containing the specified position in the document.
- **EndPosition** *(dict) --*
The row and column of the end of a ``Statement`` in an IAM policy.
- **Line** *(integer) --*
The line containing the specified position in the document.
- **Column** *(integer) --*
The column in the line containing the specified position in the document.
- **MissingContextValues** *(list) --*
A list of context keys that are required by the included input policies but that were not provided by one of the input parameters. This list is used when the resource in a simulation is "*", either explicitly, or when the ``ResourceArns`` parameter blank. If you include a list of resources, then any missing context values are instead included under the ``ResourceSpecificResults`` section. To discover the context keys used by a set of policies, you can call GetContextKeysForCustomPolicy or GetContextKeysForPrincipalPolicy .
- *(string) --*
- **OrganizationsDecisionDetail** *(dict) --*
A structure that details how AWS Organizations and its service control policies affect the results of the simulation. Only applies if the simulated user's account is part of an organization.
- **AllowedByOrganizations** *(boolean) --*
Specifies whether the simulated operation is allowed by the AWS Organizations service control policies that impact the simulated user's account.
- **EvalDecisionDetails** *(dict) --*
Additional details about the results of the evaluation decision. When there are both IAM policies and resource policies, this parameter explains how each set of policies contributes to the final evaluation decision. When simulating cross-account access to a resource, both the resource-based policy and the caller's IAM policy must grant access. See `How IAM Roles Differ from Resource-based Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_roles_compare-resource-policies.html>`__
- *(string) --*
- *(string) --*
- **ResourceSpecificResults** *(list) --*
The individual results of the simulation of the API operation specified in EvalActionName on each resource.
- *(dict) --*
Contains the result of the simulation of a single API operation call on a single resource.
This data type is used by a member of the EvaluationResult data type.
- **EvalResourceName** *(string) --*
The name of the simulated resource, in Amazon Resource Name (ARN) format.
- **EvalResourceDecision** *(string) --*
The result of the simulation of the simulated API operation on the resource specified in ``EvalResourceName`` .
- **MatchedStatements** *(list) --*
A list of the statements in the input policies that determine the result for this part of the simulation. Remember that even if multiple statements allow the operation on the resource, if *any* statement denies that operation, then the explicit deny overrides any allow. In addition, the deny statement is the only entry included in the result.
- *(dict) --*
Contains a reference to a ``Statement`` element in a policy document that determines the result of the simulation.
This data type is used by the ``MatchedStatements`` member of the `` EvaluationResult `` type.
- **SourcePolicyId** *(string) --*
The identifier of the policy that was provided as an input.
- **SourcePolicyType** *(string) --*
The type of the policy.
- **StartPosition** *(dict) --*
The row and column of the beginning of the ``Statement`` in an IAM policy.
- **Line** *(integer) --*
The line containing the specified position in the document.
- **Column** *(integer) --*
The column in the line containing the specified position in the document.
- **EndPosition** *(dict) --*
The row and column of the end of a ``Statement`` in an IAM policy.
- **Line** *(integer) --*
The line containing the specified position in the document.
- **Column** *(integer) --*
The column in the line containing the specified position in the document.
- **MissingContextValues** *(list) --*
A list of context keys that are required by the included input policies but that were not provided by one of the input parameters. This list is used when a list of ARNs is included in the ``ResourceArns`` parameter instead of "*". If you do not specify individual resources, by setting ``ResourceArns`` to "*" or by not including the ``ResourceArns`` parameter, then any missing context values are instead included under the ``EvaluationResults`` section. To discover the context keys used by a set of policies, you can call GetContextKeysForCustomPolicy or GetContextKeysForPrincipalPolicy .
- *(string) --*
- **EvalDecisionDetails** *(dict) --*
Additional details about the results of the evaluation decision. When there are both IAM policies and resource policies, this parameter explains how each set of policies contributes to the final evaluation decision. When simulating cross-account access to a resource, both the resource-based policy and the caller's IAM policy must grant access.
- *(string) --*
- *(string) --*
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type PolicyInputList: list
:param PolicyInputList: **[REQUIRED]**
A list of policy documents to include in the simulation. Each document is specified as a string containing the complete, valid JSON text of an IAM policy. Do not include any resource-based policies in this parameter. Any resource-based policy must be submitted with the ``ResourcePolicy`` parameter. The policies cannot be \"scope-down\" policies, such as you could include in a call to `GetFederationToken <https://docs.aws.amazon.com/IAM/latest/APIReference/API_GetFederationToken.html>`__ or one of the `AssumeRole <https://docs.aws.amazon.com/IAM/latest/APIReference/API_AssumeRole.html>`__ API operations. In other words, do not use policies designed to restrict what a user can do while using the temporary credentials.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
- *(string) --*
:type ActionNames: list
:param ActionNames: **[REQUIRED]**
A list of names of API operations to evaluate in the simulation. Each operation is evaluated against each resource. Each operation must include the service identifier, such as ``iam:CreateUser`` . This operation does not support using wildcards (*) in an action name.
- *(string) --*
:type ResourceArns: list
:param ResourceArns:
A list of ARNs of AWS resources to include in the simulation. If this parameter is not provided, then the value defaults to ``*`` (all resources). Each API in the ``ActionNames`` parameter is evaluated for each resource in this list. The simulation determines the access result (allowed or denied) of each combination and reports it in the response.
The simulation does not automatically retrieve policies for the specified resources. If you want to include a resource policy in the simulation, then you must include the policy as a string in the ``ResourcePolicy`` parameter.
If you include a ``ResourcePolicy`` , then it must be applicable to all of the resources included in the simulation or you receive an invalid input error.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- *(string) --*
:type ResourcePolicy: string
:param ResourcePolicy:
A resource-based policy to include in the simulation provided as a string. Each resource in the simulation is treated as if it had this policy attached. You can include only one resource-based policy in a simulation.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:type ResourceOwner: string
:param ResourceOwner:
An ARN representing the AWS account ID that specifies the owner of any simulated resource that does not identify its owner in the resource ARN. Examples of resource ARNs include an S3 bucket or object. If ``ResourceOwner`` is specified, it is also used as the account owner of any ``ResourcePolicy`` included in the simulation. If the ``ResourceOwner`` parameter is not specified, then the owner of the resources and the resource policy defaults to the account of the identity provided in ``CallerArn`` . This parameter is required only if you specify a resource-based policy and account that owns the resource is different from the account that owns the simulated calling user ``CallerArn`` .
The ARN for an account uses the following syntax: ``arn:aws:iam::*AWS-account-ID* :root`` . For example, to represent the account with the 112233445566 ID, use the following ARN: ``arn:aws:iam::112233445566-ID:root`` .
:type CallerArn: string
:param CallerArn:
The ARN of the IAM user that you want to use as the simulated caller of the API operations. ``CallerArn`` is required if you include a ``ResourcePolicy`` so that the policy\'s ``Principal`` element has a value to use in evaluating the policy.
You can specify only the ARN of an IAM user. You cannot specify the ARN of an assumed role, federated user, or a service principal.
:type ContextEntries: list
:param ContextEntries:
A list of context keys and corresponding values for the simulation to use. Whenever a context key is evaluated in one of the simulated IAM permissions policies, the corresponding value is supplied.
- *(dict) --*
Contains information about a condition context key. It includes the name of the key and specifies the value (or values, if the context key supports multiple values) to use in the simulation. This information is used when evaluating the ``Condition`` elements of the input policies.
This data type is used as an input parameter to `` SimulateCustomPolicy `` and `` SimulateCustomPolicy `` .
- **ContextKeyName** *(string) --*
The full name of a condition context key, including the service prefix. For example, ``aws:SourceIp`` or ``s3:VersionId`` .
- **ContextKeyValues** *(list) --*
The value (or values, if the condition context key supports multiple values) to provide to the simulation when the key is referenced by a ``Condition`` element in an input policy.
- *(string) --*
- **ContextKeyType** *(string) --*
The data type of the value (or values) specified in the ``ContextKeyValues`` parameter.
:type ResourceHandlingOption: string
:param ResourceHandlingOption:
Specifies the type of simulation to run. Different API operations that support resource-based policies require different combinations of resources. By specifying the type of simulation to run, you enable the policy simulator to enforce the presence of the required resources to ensure reliable simulation results. If your simulation does not match one of the following scenarios, then you can omit this parameter. The following list shows each of the supported scenario values and the resources that you must define to run the simulation.
Each of the EC2 scenarios requires that you specify instance, image, and security-group resources. If your scenario includes an EBS volume, then you must specify that volume as a resource. If the EC2 scenario includes VPC, then you must supply the network-interface resource. If it includes an IP subnet, then you must specify the subnet resource. For more information on the EC2 scenario options, see `Supported Platforms <https://docs.aws.amazon.com/AWSEC2/latest/UserGuide/ec2-supported-platforms.html>`__ in the *Amazon EC2 User Guide* .
* **EC2-Classic-InstanceStore** instance, image, security-group
* **EC2-Classic-EBS** instance, image, security-group, volume
* **EC2-VPC-InstanceStore** instance, image, security-group, network-interface
* **EC2-VPC-InstanceStore-Subnet** instance, image, security-group, network-interface, subnet
* **EC2-VPC-EBS** instance, image, security-group, network-interface, volume
* **EC2-VPC-EBS-Subnet** instance, image, security-group, network-interface, subnet, volume
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:rtype: dict
:returns:
"""
pass
def simulate_principal_policy(self, PolicySourceArn: str, ActionNames: List, PolicyInputList: List = None, ResourceArns: List = None, ResourcePolicy: str = None, ResourceOwner: str = None, CallerArn: str = None, ContextEntries: List = None, ResourceHandlingOption: str = None, MaxItems: int = None, Marker: str = None) -> Dict:
"""
Simulate how a set of IAM policies attached to an IAM entity works with a list of API operations and AWS resources to determine the policies' effective permissions. The entity can be an IAM user, group, or role. If you specify a user, then the simulation also includes all of the policies that are attached to groups that the user belongs to.
You can optionally include a list of one or more additional policies specified as strings to include in the simulation. If you want to simulate only policies specified as strings, use SimulateCustomPolicy instead.
You can also optionally include one resource-based policy to be evaluated with each of the resources included in the simulation.
The simulation does not perform the API operations; it only checks the authorization to determine if the simulated policies allow or deny the operations.
**Note:** This API discloses information about the permissions granted to other users. If you do not want users to see other user's permissions, then consider allowing them to use SimulateCustomPolicy instead.
Context keys are variables maintained by AWS and its services that provide details about the context of an API query request. You can use the ``Condition`` element of an IAM policy to evaluate context keys. To get the list of context keys that the policies require for correct simulation, use GetContextKeysForPrincipalPolicy .
If the output is long, you can use the ``MaxItems`` and ``Marker`` parameters to paginate the results.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/SimulatePrincipalPolicy>`_
**Request Syntax**
::
response = client.simulate_principal_policy(
PolicySourceArn='string',
PolicyInputList=[
'string',
],
ActionNames=[
'string',
],
ResourceArns=[
'string',
],
ResourcePolicy='string',
ResourceOwner='string',
CallerArn='string',
ContextEntries=[
{
'ContextKeyName': 'string',
'ContextKeyValues': [
'string',
],
'ContextKeyType': 'string'|'stringList'|'numeric'|'numericList'|'boolean'|'booleanList'|'ip'|'ipList'|'binary'|'binaryList'|'date'|'dateList'
},
],
ResourceHandlingOption='string',
MaxItems=123,
Marker='string'
)
**Response Syntax**
::
{
'EvaluationResults': [
{
'EvalActionName': 'string',
'EvalResourceName': 'string',
'EvalDecision': 'allowed'|'explicitDeny'|'implicitDeny',
'MatchedStatements': [
{
'SourcePolicyId': 'string',
'SourcePolicyType': 'user'|'group'|'role'|'aws-managed'|'user-managed'|'resource'|'none',
'StartPosition': {
'Line': 123,
'Column': 123
},
'EndPosition': {
'Line': 123,
'Column': 123
}
},
],
'MissingContextValues': [
'string',
],
'OrganizationsDecisionDetail': {
'AllowedByOrganizations': True|False
},
'EvalDecisionDetails': {
'string': 'allowed'|'explicitDeny'|'implicitDeny'
},
'ResourceSpecificResults': [
{
'EvalResourceName': 'string',
'EvalResourceDecision': 'allowed'|'explicitDeny'|'implicitDeny',
'MatchedStatements': [
{
'SourcePolicyId': 'string',
'SourcePolicyType': 'user'|'group'|'role'|'aws-managed'|'user-managed'|'resource'|'none',
'StartPosition': {
'Line': 123,
'Column': 123
},
'EndPosition': {
'Line': 123,
'Column': 123
}
},
],
'MissingContextValues': [
'string',
],
'EvalDecisionDetails': {
'string': 'allowed'|'explicitDeny'|'implicitDeny'
}
},
]
},
],
'IsTruncated': True|False,
'Marker': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful SimulatePrincipalPolicy or SimulateCustomPolicy request.
- **EvaluationResults** *(list) --*
The results of the simulation.
- *(dict) --*
Contains the results of a simulation.
This data type is used by the return parameter of `` SimulateCustomPolicy `` and `` SimulatePrincipalPolicy `` .
- **EvalActionName** *(string) --*
The name of the API operation tested on the indicated resource.
- **EvalResourceName** *(string) --*
The ARN of the resource that the indicated API operation was tested on.
- **EvalDecision** *(string) --*
The result of the simulation.
- **MatchedStatements** *(list) --*
A list of the statements in the input policies that determine the result for this scenario. Remember that even if multiple statements allow the operation on the resource, if only one statement denies that operation, then the explicit deny overrides any allow. Inaddition, the deny statement is the only entry included in the result.
- *(dict) --*
Contains a reference to a ``Statement`` element in a policy document that determines the result of the simulation.
This data type is used by the ``MatchedStatements`` member of the `` EvaluationResult `` type.
- **SourcePolicyId** *(string) --*
The identifier of the policy that was provided as an input.
- **SourcePolicyType** *(string) --*
The type of the policy.
- **StartPosition** *(dict) --*
The row and column of the beginning of the ``Statement`` in an IAM policy.
- **Line** *(integer) --*
The line containing the specified position in the document.
- **Column** *(integer) --*
The column in the line containing the specified position in the document.
- **EndPosition** *(dict) --*
The row and column of the end of a ``Statement`` in an IAM policy.
- **Line** *(integer) --*
The line containing the specified position in the document.
- **Column** *(integer) --*
The column in the line containing the specified position in the document.
- **MissingContextValues** *(list) --*
A list of context keys that are required by the included input policies but that were not provided by one of the input parameters. This list is used when the resource in a simulation is "*", either explicitly, or when the ``ResourceArns`` parameter blank. If you include a list of resources, then any missing context values are instead included under the ``ResourceSpecificResults`` section. To discover the context keys used by a set of policies, you can call GetContextKeysForCustomPolicy or GetContextKeysForPrincipalPolicy .
- *(string) --*
- **OrganizationsDecisionDetail** *(dict) --*
A structure that details how AWS Organizations and its service control policies affect the results of the simulation. Only applies if the simulated user's account is part of an organization.
- **AllowedByOrganizations** *(boolean) --*
Specifies whether the simulated operation is allowed by the AWS Organizations service control policies that impact the simulated user's account.
- **EvalDecisionDetails** *(dict) --*
Additional details about the results of the evaluation decision. When there are both IAM policies and resource policies, this parameter explains how each set of policies contributes to the final evaluation decision. When simulating cross-account access to a resource, both the resource-based policy and the caller's IAM policy must grant access. See `How IAM Roles Differ from Resource-based Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_roles_compare-resource-policies.html>`__
- *(string) --*
- *(string) --*
- **ResourceSpecificResults** *(list) --*
The individual results of the simulation of the API operation specified in EvalActionName on each resource.
- *(dict) --*
Contains the result of the simulation of a single API operation call on a single resource.
This data type is used by a member of the EvaluationResult data type.
- **EvalResourceName** *(string) --*
The name of the simulated resource, in Amazon Resource Name (ARN) format.
- **EvalResourceDecision** *(string) --*
The result of the simulation of the simulated API operation on the resource specified in ``EvalResourceName`` .
- **MatchedStatements** *(list) --*
A list of the statements in the input policies that determine the result for this part of the simulation. Remember that even if multiple statements allow the operation on the resource, if *any* statement denies that operation, then the explicit deny overrides any allow. In addition, the deny statement is the only entry included in the result.
- *(dict) --*
Contains a reference to a ``Statement`` element in a policy document that determines the result of the simulation.
This data type is used by the ``MatchedStatements`` member of the `` EvaluationResult `` type.
- **SourcePolicyId** *(string) --*
The identifier of the policy that was provided as an input.
- **SourcePolicyType** *(string) --*
The type of the policy.
- **StartPosition** *(dict) --*
The row and column of the beginning of the ``Statement`` in an IAM policy.
- **Line** *(integer) --*
The line containing the specified position in the document.
- **Column** *(integer) --*
The column in the line containing the specified position in the document.
- **EndPosition** *(dict) --*
The row and column of the end of a ``Statement`` in an IAM policy.
- **Line** *(integer) --*
The line containing the specified position in the document.
- **Column** *(integer) --*
The column in the line containing the specified position in the document.
- **MissingContextValues** *(list) --*
A list of context keys that are required by the included input policies but that were not provided by one of the input parameters. This list is used when a list of ARNs is included in the ``ResourceArns`` parameter instead of "*". If you do not specify individual resources, by setting ``ResourceArns`` to "*" or by not including the ``ResourceArns`` parameter, then any missing context values are instead included under the ``EvaluationResults`` section. To discover the context keys used by a set of policies, you can call GetContextKeysForCustomPolicy or GetContextKeysForPrincipalPolicy .
- *(string) --*
- **EvalDecisionDetails** *(dict) --*
Additional details about the results of the evaluation decision. When there are both IAM policies and resource policies, this parameter explains how each set of policies contributes to the final evaluation decision. When simulating cross-account access to a resource, both the resource-based policy and the caller's IAM policy must grant access.
- *(string) --*
- *(string) --*
- **IsTruncated** *(boolean) --*
A flag that indicates whether there are more items to return. If your results were truncated, you can make a subsequent pagination request using the ``Marker`` request parameter to retrieve more items. Note that IAM might return fewer than the ``MaxItems`` number of results even when there are more results available. We recommend that you check ``IsTruncated`` after every call to ensure that you receive all your results.
- **Marker** *(string) --*
When ``IsTruncated`` is ``true`` , this element is present and contains the value to use for the ``Marker`` parameter in a subsequent pagination request.
:type PolicySourceArn: string
:param PolicySourceArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of a user, group, or role whose policies you want to include in the simulation. If you specify a user, group, or role, the simulation includes all policies that are associated with that entity. If you specify a user, the simulation also includes all policies that are attached to any groups the user belongs to.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:type PolicyInputList: list
:param PolicyInputList:
An optional list of additional policy documents to include in the simulation. Each document is specified as a string containing the complete, valid JSON text of an IAM policy.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
- *(string) --*
:type ActionNames: list
:param ActionNames: **[REQUIRED]**
A list of names of API operations to evaluate in the simulation. Each operation is evaluated for each resource. Each operation must include the service identifier, such as ``iam:CreateUser`` .
- *(string) --*
:type ResourceArns: list
:param ResourceArns:
A list of ARNs of AWS resources to include in the simulation. If this parameter is not provided, then the value defaults to ``*`` (all resources). Each API in the ``ActionNames`` parameter is evaluated for each resource in this list. The simulation determines the access result (allowed or denied) of each combination and reports it in the response.
The simulation does not automatically retrieve policies for the specified resources. If you want to include a resource policy in the simulation, then you must include the policy as a string in the ``ResourcePolicy`` parameter.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
- *(string) --*
:type ResourcePolicy: string
:param ResourcePolicy:
A resource-based policy to include in the simulation provided as a string. Each resource in the simulation is treated as if it had this policy attached. You can include only one resource-based policy in a simulation.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:type ResourceOwner: string
:param ResourceOwner:
An AWS account ID that specifies the owner of any simulated resource that does not identify its owner in the resource ARN. Examples of resource ARNs include an S3 bucket or object. If ``ResourceOwner`` is specified, it is also used as the account owner of any ``ResourcePolicy`` included in the simulation. If the ``ResourceOwner`` parameter is not specified, then the owner of the resources and the resource policy defaults to the account of the identity provided in ``CallerArn`` . This parameter is required only if you specify a resource-based policy and account that owns the resource is different from the account that owns the simulated calling user ``CallerArn`` .
:type CallerArn: string
:param CallerArn:
The ARN of the IAM user that you want to specify as the simulated caller of the API operations. If you do not specify a ``CallerArn`` , it defaults to the ARN of the user that you specify in ``PolicySourceArn`` , if you specified a user. If you include both a ``PolicySourceArn`` (for example, ``arn:aws:iam::123456789012:user/David`` ) and a ``CallerArn`` (for example, ``arn:aws:iam::123456789012:user/Bob`` ), the result is that you simulate calling the API operations as Bob, as if Bob had David\'s policies.
You can specify only the ARN of an IAM user. You cannot specify the ARN of an assumed role, federated user, or a service principal.
``CallerArn`` is required if you include a ``ResourcePolicy`` and the ``PolicySourceArn`` is not the ARN for an IAM user. This is required so that the resource-based policy\'s ``Principal`` element has a value to use in evaluating the policy.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:type ContextEntries: list
:param ContextEntries:
A list of context keys and corresponding values for the simulation to use. Whenever a context key is evaluated in one of the simulated IAM permission policies, the corresponding value is supplied.
- *(dict) --*
Contains information about a condition context key. It includes the name of the key and specifies the value (or values, if the context key supports multiple values) to use in the simulation. This information is used when evaluating the ``Condition`` elements of the input policies.
This data type is used as an input parameter to `` SimulateCustomPolicy `` and `` SimulateCustomPolicy `` .
- **ContextKeyName** *(string) --*
The full name of a condition context key, including the service prefix. For example, ``aws:SourceIp`` or ``s3:VersionId`` .
- **ContextKeyValues** *(list) --*
The value (or values, if the condition context key supports multiple values) to provide to the simulation when the key is referenced by a ``Condition`` element in an input policy.
- *(string) --*
- **ContextKeyType** *(string) --*
The data type of the value (or values) specified in the ``ContextKeyValues`` parameter.
:type ResourceHandlingOption: string
:param ResourceHandlingOption:
Specifies the type of simulation to run. Different API operations that support resource-based policies require different combinations of resources. By specifying the type of simulation to run, you enable the policy simulator to enforce the presence of the required resources to ensure reliable simulation results. If your simulation does not match one of the following scenarios, then you can omit this parameter. The following list shows each of the supported scenario values and the resources that you must define to run the simulation.
Each of the EC2 scenarios requires that you specify instance, image, and security group resources. If your scenario includes an EBS volume, then you must specify that volume as a resource. If the EC2 scenario includes VPC, then you must supply the network interface resource. If it includes an IP subnet, then you must specify the subnet resource. For more information on the EC2 scenario options, see `Supported Platforms <https://docs.aws.amazon.com/AWSEC2/latest/UserGuide/ec2-supported-platforms.html>`__ in the *Amazon EC2 User Guide* .
* **EC2-Classic-InstanceStore** instance, image, security group
* **EC2-Classic-EBS** instance, image, security group, volume
* **EC2-VPC-InstanceStore** instance, image, security group, network interface
* **EC2-VPC-InstanceStore-Subnet** instance, image, security group, network interface, subnet
* **EC2-VPC-EBS** instance, image, security group, network interface, volume
* **EC2-VPC-EBS-Subnet** instance, image, security group, network interface, subnet, volume
:type MaxItems: integer
:param MaxItems:
Use this only when paginating results to indicate the maximum number of items you want in the response. If additional items exist beyond the maximum you specify, the ``IsTruncated`` response element is ``true`` .
If you do not include this parameter, the number of items defaults to 100. Note that IAM might return fewer results, even when there are more results available. In that case, the ``IsTruncated`` response element returns ``true`` , and ``Marker`` contains a value to include in the subsequent call that tells the service where to continue from.
:type Marker: string
:param Marker:
Use this parameter only when paginating results and only after you receive a response indicating that the results are truncated. Set it to the value of the ``Marker`` element in the response that you received to indicate where the next call should start.
:rtype: dict
:returns:
"""
pass
def tag_role(self, RoleName: str, Tags: List):
"""
Adds one or more tags to an IAM role. The role can be a regular role or a service-linked role. If a tag with the same key name already exists, then that tag is overwritten with the new value.
A tag consists of a key name and an associated value. By assigning tags to your resources, you can do the following:
* **Administrative grouping and discovery** - Attach tags to resources to aid in organization and search. For example, you could search for all resources with the key name *Project* and the value *MyImportantProject* . Or search for all resources with the key name *Cost Center* and the value *41200* .
* **Access control** - Reference tags in IAM user-based and resource-based policies. You can use tags to restrict access to only an IAM user or role that has a specified tag attached. You can also restrict access to only those resources that have a certain tag attached. For examples of policies that show how to use tags to control access, see `Control Access Using IAM Tags <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_tags.html>`__ in the *IAM User Guide* .
* **Cost allocation** - Use tags to help track which individuals and teams are using which AWS resources.
.. note::
* Make sure that you have no invalid tags and that you do not exceed the allowed number of tags per role. In either case, the entire request fails and *no* tags are added to the role.
* AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/TagRole>`_
**Request Syntax**
::
response = client.tag_role(
RoleName='string',
Tags=[
{
'Key': 'string',
'Value': 'string'
},
]
)
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the role that you want to add tags to.
This parameter accepts (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that consist of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Tags: list
:param Tags: **[REQUIRED]**
The list of tags that you want to attach to the role. Each tag consists of a key name and an associated value. You can specify this with a JSON string.
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --* **[REQUIRED]**
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --* **[REQUIRED]**
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
:returns: None
"""
pass
def tag_user(self, UserName: str, Tags: List):
"""
Adds one or more tags to an IAM user. If a tag with the same key name already exists, then that tag is overwritten with the new value.
A tag consists of a key name and an associated value. By assigning tags to your resources, you can do the following:
* **Administrative grouping and discovery** - Attach tags to resources to aid in organization and search. For example, you could search for all resources with the key name *Project* and the value *MyImportantProject* . Or search for all resources with the key name *Cost Center* and the value *41200* .
* **Access control** - Reference tags in IAM user-based and resource-based policies. You can use tags to restrict access to only an IAM requesting user or to a role that has a specified tag attached. You can also restrict access to only those resources that have a certain tag attached. For examples of policies that show how to use tags to control access, see `Control Access Using IAM Tags <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_tags.html>`__ in the *IAM User Guide* .
* **Cost allocation** - Use tags to help track which individuals and teams are using which AWS resources.
.. note::
* Make sure that you have no invalid tags and that you do not exceed the allowed number of tags per role. In either case, the entire request fails and *no* tags are added to the role.
* AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/TagUser>`_
**Request Syntax**
::
response = client.tag_user(
UserName='string',
Tags=[
{
'Key': 'string',
'Value': 'string'
},
]
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user that you want to add tags to.
This parameter accepts (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that consist of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: =,.@-
:type Tags: list
:param Tags: **[REQUIRED]**
The list of tags that you want to attach to the user. Each tag consists of a key name and an associated value.
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --* **[REQUIRED]**
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --* **[REQUIRED]**
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
:returns: None
"""
pass
def untag_role(self, RoleName: str, TagKeys: List):
"""
Removes the specified tags from the role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UntagRole>`_
**Request Syntax**
::
response = client.untag_role(
RoleName='string',
TagKeys=[
'string',
]
)
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the IAM role from which you want to remove tags.
This parameter accepts (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that consist of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type TagKeys: list
:param TagKeys: **[REQUIRED]**
A list of key names as a simple array of strings. The tags with matching keys are removed from the specified role.
- *(string) --*
:returns: None
"""
pass
def untag_user(self, UserName: str, TagKeys: List):
"""
Removes the specified tags from the user. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UntagUser>`_
**Request Syntax**
::
response = client.untag_user(
UserName='string',
TagKeys=[
'string',
]
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the IAM user from which you want to remove tags.
This parameter accepts (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that consist of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: =,.@-
:type TagKeys: list
:param TagKeys: **[REQUIRED]**
A list of key names as a simple array of strings. The tags with matching keys are removed from the specified user.
- *(string) --*
:returns: None
"""
pass
def update_access_key(self, AccessKeyId: str, Status: str, UserName: str = None):
"""
Changes the status of the specified access key from Active to Inactive, or vice versa. This operation can be used to disable a user's key as part of a key rotation workflow.
If the ``UserName`` is not specified, the user name is determined implicitly based on the AWS access key ID used to sign the request. This operation works for access keys under the AWS account. Consequently, you can use this operation to manage AWS account root user credentials even if the AWS account has no associated users.
For information about rotating keys, see `Managing Keys and Certificates <https://docs.aws.amazon.com/IAM/latest/UserGuide/ManagingCredentials.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateAccessKey>`_
**Request Syntax**
::
response = client.update_access_key(
UserName='string',
AccessKeyId='string',
Status='Active'|'Inactive'
)
:type UserName: string
:param UserName:
The name of the user whose key you want to update.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type AccessKeyId: string
:param AccessKeyId: **[REQUIRED]**
The access key ID of the secret access key you want to update.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that can consist of any upper or lowercased letter or digit.
:type Status: string
:param Status: **[REQUIRED]**
The status you want to assign to the secret access key. ``Active`` means that the key can be used for API calls to AWS, while ``Inactive`` means that the key cannot be used.
:returns: None
"""
pass
def update_account_password_policy(self, MinimumPasswordLength: int = None, RequireSymbols: bool = None, RequireNumbers: bool = None, RequireUppercaseCharacters: bool = None, RequireLowercaseCharacters: bool = None, AllowUsersToChangePassword: bool = None, MaxPasswordAge: int = None, PasswordReusePrevention: int = None, HardExpiry: bool = None):
"""
Updates the password policy settings for the AWS account.
.. note::
* This operation does not support partial updates. No parameters are required, but if you do not specify a parameter, that parameter's value reverts to its default value. See the **Request Parameters** section for each parameter's default value. Also note that some parameters do not allow the default parameter to be explicitly set. Instead, to invoke the default value, do not include that parameter when you invoke the operation.
For more information about using a password policy, see `Managing an IAM Password Policy <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_ManagingPasswordPolicies.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateAccountPasswordPolicy>`_
**Request Syntax**
::
response = client.update_account_password_policy(
MinimumPasswordLength=123,
RequireSymbols=True|False,
RequireNumbers=True|False,
RequireUppercaseCharacters=True|False,
RequireLowercaseCharacters=True|False,
AllowUsersToChangePassword=True|False,
MaxPasswordAge=123,
PasswordReusePrevention=123,
HardExpiry=True|False
)
:type MinimumPasswordLength: integer
:param MinimumPasswordLength:
The minimum number of characters allowed in an IAM user password.
If you do not specify a value for this parameter, then the operation uses the default value of ``6`` .
:type RequireSymbols: boolean
:param RequireSymbols:
Specifies whether IAM user passwords must contain at least one of the following non-alphanumeric characters:
! @ # $ % ^ & * ( ) _ + - = [ ] { } | \'
If you do not specify a value for this parameter, then the operation uses the default value of ``false`` . The result is that passwords do not require at least one symbol character.
:type RequireNumbers: boolean
:param RequireNumbers:
Specifies whether IAM user passwords must contain at least one numeric character (0 to 9).
If you do not specify a value for this parameter, then the operation uses the default value of ``false`` . The result is that passwords do not require at least one numeric character.
:type RequireUppercaseCharacters: boolean
:param RequireUppercaseCharacters:
Specifies whether IAM user passwords must contain at least one uppercase character from the ISO basic Latin alphabet (A to Z).
If you do not specify a value for this parameter, then the operation uses the default value of ``false`` . The result is that passwords do not require at least one uppercase character.
:type RequireLowercaseCharacters: boolean
:param RequireLowercaseCharacters:
Specifies whether IAM user passwords must contain at least one lowercase character from the ISO basic Latin alphabet (a to z).
If you do not specify a value for this parameter, then the operation uses the default value of ``false`` . The result is that passwords do not require at least one lowercase character.
:type AllowUsersToChangePassword: boolean
:param AllowUsersToChangePassword:
Allows all IAM users in your account to use the AWS Management Console to change their own passwords. For more information, see `Letting IAM Users Change Their Own Passwords <https://docs.aws.amazon.com/IAM/latest/UserGuide/HowToPwdIAMUser.html>`__ in the *IAM User Guide* .
If you do not specify a value for this parameter, then the operation uses the default value of ``false`` . The result is that IAM users in the account do not automatically have permissions to change their own password.
:type MaxPasswordAge: integer
:param MaxPasswordAge:
The number of days that an IAM user password is valid.
If you do not specify a value for this parameter, then the operation uses the default value of ``0`` . The result is that IAM user passwords never expire.
:type PasswordReusePrevention: integer
:param PasswordReusePrevention:
Specifies the number of previous passwords that IAM users are prevented from reusing.
If you do not specify a value for this parameter, then the operation uses the default value of ``0`` . The result is that IAM users are not prevented from reusing previous passwords.
:type HardExpiry: boolean
:param HardExpiry:
Prevents IAM users from setting a new password after their password has expired. The IAM user cannot be accessed until an administrator resets the password.
If you do not specify a value for this parameter, then the operation uses the default value of ``false`` . The result is that IAM users can change their passwords after they expire and continue to sign in as the user.
:returns: None
"""
pass
def update_assume_role_policy(self, RoleName: str, PolicyDocument: str):
"""
Updates the policy that grants an IAM entity permission to assume a role. This is typically referred to as the "role trust policy". For more information about roles, go to `Using Roles to Delegate Permissions and Federate Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/roles-toplevel.html>`__ .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateAssumeRolePolicy>`_
**Request Syntax**
::
response = client.update_assume_role_policy(
RoleName='string',
PolicyDocument='string'
)
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the role to update with the new policy.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type PolicyDocument: string
:param PolicyDocument: **[REQUIRED]**
The policy that grants an entity permission to assume the role.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:returns: None
"""
pass
def update_group(self, GroupName: str, NewPath: str = None, NewGroupName: str = None):
"""
Updates the name and/or the path of the specified IAM group.
.. warning::
You should understand the implications of changing a group's path or name. For more information, see `Renaming Users and Groups <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_WorkingWithGroupsAndUsers.html>`__ in the *IAM User Guide* .
.. note::
The person making the request (the principal), must have permission to change the role group with the old name and the new name. For example, to change the group named ``Managers`` to ``MGRs`` , the principal must have a policy that allows them to update both groups. If the principal has permission to update the ``Managers`` group, but not the ``MGRs`` group, then the update fails. For more information about permissions, see `Access Management <https://docs.aws.amazon.com/IAM/latest/UserGuide/access.html>`__ .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateGroup>`_
**Request Syntax**
::
response = client.update_group(
GroupName='string',
NewPath='string',
NewGroupName='string'
)
:type GroupName: string
:param GroupName: **[REQUIRED]**
Name of the IAM group to update. If you\'re changing the name of the group, this is the original name.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type NewPath: string
:param NewPath:
New path for the IAM group. Only include this if changing the group\'s path.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type NewGroupName: string
:param NewGroupName:
New name for the IAM group. Only include this if changing the group\'s name.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def update_login_profile(self, UserName: str, Password: str = None, PasswordResetRequired: bool = None):
"""
Changes the password for the specified IAM user.
IAM users can change their own passwords by calling ChangePassword . For more information about modifying passwords, see `Managing Passwords <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_ManagingLogins.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateLoginProfile>`_
**Request Syntax**
::
response = client.update_login_profile(
UserName='string',
Password='string',
PasswordResetRequired=True|False
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the user whose password you want to update.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type Password: string
:param Password:
The new password for the specified IAM user.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
However, the format can be further restricted by the account administrator by setting a password policy on the AWS account. For more information, see UpdateAccountPasswordPolicy .
:type PasswordResetRequired: boolean
:param PasswordResetRequired:
Allows this new password to be used only once by requiring the specified IAM user to set a new password on next sign-in.
:returns: None
"""
pass
def update_open_id_connect_provider_thumbprint(self, OpenIDConnectProviderArn: str, ThumbprintList: List):
"""
Replaces the existing list of server certificate thumbprints associated with an OpenID Connect (OIDC) provider resource object with a new list of thumbprints.
The list that you pass with this operation completely replaces the existing list of thumbprints. (The lists are not merged.)
Typically, you need to update a thumbprint only when the identity provider's certificate changes, which occurs rarely. However, if the provider's certificate *does* change, any attempt to assume an IAM role that specifies the OIDC provider as a principal fails until the certificate thumbprint is updated.
.. note::
Trust for the OIDC provider is derived from the provider's certificate and is validated by the thumbprint. Therefore, it is best to limit access to the ``UpdateOpenIDConnectProviderThumbprint`` operation to highly privileged users.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateOpenIDConnectProviderThumbprint>`_
**Request Syntax**
::
response = client.update_open_id_connect_provider_thumbprint(
OpenIDConnectProviderArn='string',
ThumbprintList=[
'string',
]
)
:type OpenIDConnectProviderArn: string
:param OpenIDConnectProviderArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the IAM OIDC provider resource object for which you want to update the thumbprint. You can get a list of OIDC provider ARNs by using the ListOpenIDConnectProviders operation.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:type ThumbprintList: list
:param ThumbprintList: **[REQUIRED]**
A list of certificate thumbprints that are associated with the specified IAM OpenID Connect provider. For more information, see CreateOpenIDConnectProvider .
- *(string) --*
Contains a thumbprint for an identity provider\'s server certificate.
The identity provider\'s server certificate thumbprint is the hex-encoded SHA-1 hash value of the self-signed X.509 certificate used by the domain where the OpenID Connect provider makes its keys available. It is always a 40-character string.
:returns: None
"""
pass
def update_role(self, RoleName: str, Description: str = None, MaxSessionDuration: int = None) -> Dict:
"""
Updates the description or maximum session duration setting of a role.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateRole>`_
**Request Syntax**
::
response = client.update_role(
RoleName='string',
Description='string',
MaxSessionDuration=123
)
**Response Syntax**
::
{}
**Response Structure**
- *(dict) --*
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the role that you want to modify.
:type Description: string
:param Description:
The new description that you want to apply to the specified role.
:type MaxSessionDuration: integer
:param MaxSessionDuration:
The maximum session duration (in seconds) that you want to set for the specified role. If you do not specify a value for this setting, the default maximum of one hour is applied. This setting can have a value from 1 hour to 12 hours.
Anyone who assumes the role from the AWS CLI or API can use the ``DurationSeconds`` API parameter or the ``duration-seconds`` CLI parameter to request a longer session. The ``MaxSessionDuration`` setting determines the maximum duration that can be requested using the ``DurationSeconds`` parameter. If users don\'t specify a value for the ``DurationSeconds`` parameter, their security credentials are valid for one hour by default. This applies when you use the ``AssumeRole*`` API operations or the ``assume-role*`` CLI operations but does not apply when you use those operations to create a console URL. For more information, see `Using IAM Roles <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_roles_use.html>`__ in the *IAM User Guide* .
:rtype: dict
:returns:
"""
pass
def update_role_description(self, RoleName: str, Description: str) -> Dict:
"""
Use UpdateRole instead.
Modifies only the description of a role. This operation performs the same function as the ``Description`` parameter in the ``UpdateRole`` operation.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateRoleDescription>`_
**Request Syntax**
::
response = client.update_role_description(
RoleName='string',
Description='string'
)
**Response Syntax**
::
{
'Role': {
'Path': 'string',
'RoleName': 'string',
'RoleId': 'string',
'Arn': 'string',
'CreateDate': datetime(2015, 1, 1),
'AssumeRolePolicyDocument': 'string',
'Description': 'string',
'MaxSessionDuration': 123,
'PermissionsBoundary': {
'PermissionsBoundaryType': 'PermissionsBoundaryPolicy',
'PermissionsBoundaryArn': 'string'
},
'Tags': [
{
'Key': 'string',
'Value': 'string'
},
]
}
}
**Response Structure**
- *(dict) --*
- **Role** *(dict) --*
A structure that contains details about the modified role.
- **Path** *(string) --*
The path to the role. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **RoleName** *(string) --*
The friendly name that identifies the role.
- **RoleId** *(string) --*
The stable and unique string identifying the role. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the role. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* guide.
- **CreateDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the role was created.
- **AssumeRolePolicyDocument** *(string) --*
The policy that grants an entity permission to assume the role.
- **Description** *(string) --*
A description of the role that you provide.
- **MaxSessionDuration** *(integer) --*
The maximum session duration (in seconds) for the specified role. Anyone who uses the AWS CLI, or API to assume the role can specify the duration using the optional ``DurationSeconds`` API parameter or ``duration-seconds`` CLI parameter.
- **PermissionsBoundary** *(dict) --*
The ARN of the policy used to set the permissions boundary for the role.
For more information about permissions boundaries, see `Permissions Boundaries for IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/access_policies_boundaries.html>`__ in the *IAM User Guide* .
- **PermissionsBoundaryType** *(string) --*
The permissions boundary usage type that indicates what type of IAM resource is used as the permissions boundary for an entity. This data type can only have a value of ``Policy`` .
- **PermissionsBoundaryArn** *(string) --*
The ARN of the policy used to set the permissions boundary for the user or role.
- **Tags** *(list) --*
A list of tags that are attached to the specified role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- *(dict) --*
A structure that represents user-provided metadata that can be associated with a resource such as an IAM user or role. For more information about tagging, see `Tagging IAM Identities <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_tags.html>`__ in the *IAM User Guide* .
- **Key** *(string) --*
The key name that can be used to look up or retrieve the associated value. For example, ``Department`` or ``Cost Center`` are common choices.
- **Value** *(string) --*
The value associated with this tag. For example, tags with a key name of ``Department`` could have values such as ``Human Resources`` , ``Accounting`` , and ``Support`` . Tags with a key name of ``Cost Center`` might have values that consist of the number associated with the different cost centers in your company. Typically, many resources have tags with the same key name but with different values.
.. note::
AWS always interprets the tag ``Value`` as a single string. If you need to store an array, you can store comma-separated values in the string. However, you must interpret the value in your code.
:type RoleName: string
:param RoleName: **[REQUIRED]**
The name of the role that you want to modify.
:type Description: string
:param Description: **[REQUIRED]**
The new description that you want to apply to the specified role.
:rtype: dict
:returns:
"""
pass
def update_saml_provider(self, SAMLMetadataDocument: str, SAMLProviderArn: str) -> Dict:
"""
Updates the metadata document for an existing SAML provider resource object.
.. note::
This operation requires `Signature Version 4 <https://docs.aws.amazon.com/general/latest/gr/signature-version-4.html>`__ .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateSAMLProvider>`_
**Request Syntax**
::
response = client.update_saml_provider(
SAMLMetadataDocument='string',
SAMLProviderArn='string'
)
**Response Syntax**
::
{
'SAMLProviderArn': 'string'
}
**Response Structure**
- *(dict) --*
Contains the response to a successful UpdateSAMLProvider request.
- **SAMLProviderArn** *(string) --*
The Amazon Resource Name (ARN) of the SAML provider that was updated.
:type SAMLMetadataDocument: string
:param SAMLMetadataDocument: **[REQUIRED]**
An XML document generated by an identity provider (IdP) that supports SAML 2.0. The document includes the issuer\'s name, expiration information, and keys that can be used to validate the SAML authentication response (assertions) that are received from the IdP. You must generate the metadata document using the identity management software that is used as your organization\'s IdP.
:type SAMLProviderArn: string
:param SAMLProviderArn: **[REQUIRED]**
The Amazon Resource Name (ARN) of the SAML provider to update.
For more information about ARNs, see `Amazon Resource Names (ARNs) and AWS Service Namespaces <https://docs.aws.amazon.com/general/latest/gr/aws-arns-and-namespaces.html>`__ in the *AWS General Reference* .
:rtype: dict
:returns:
"""
pass
def update_server_certificate(self, ServerCertificateName: str, NewPath: str = None, NewServerCertificateName: str = None):
"""
Updates the name and/or the path of the specified server certificate stored in IAM.
For more information about working with server certificates, see `Working with Server Certificates <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_credentials_server-certs.html>`__ in the *IAM User Guide* . This topic also includes a list of AWS services that can use the server certificates that you manage with IAM.
.. warning::
You should understand the implications of changing a server certificate's path or name. For more information, see `Renaming a Server Certificate <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_credentials_server-certs_manage.html#RenamingServerCerts>`__ in the *IAM User Guide* .
.. note::
The person making the request (the principal), must have permission to change the server certificate with the old name and the new name. For example, to change the certificate named ``ProductionCert`` to ``ProdCert`` , the principal must have a policy that allows them to update both certificates. If the principal has permission to update the ``ProductionCert`` group, but not the ``ProdCert`` certificate, then the update fails. For more information about permissions, see `Access Management <https://docs.aws.amazon.com/IAM/latest/UserGuide/access.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateServerCertificate>`_
**Request Syntax**
::
response = client.update_server_certificate(
ServerCertificateName='string',
NewPath='string',
NewServerCertificateName='string'
)
:type ServerCertificateName: string
:param ServerCertificateName: **[REQUIRED]**
The name of the server certificate that you want to update.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type NewPath: string
:param NewPath:
The new path for the server certificate. Include this only if you are updating the server certificate\'s path.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type NewServerCertificateName: string
:param NewServerCertificateName:
The new name for the server certificate. Include this only if you are updating the server certificate\'s name. The name of the certificate cannot contain any spaces.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def update_service_specific_credential(self, ServiceSpecificCredentialId: str, Status: str, UserName: str = None):
"""
Sets the status of a service-specific credential to ``Active`` or ``Inactive`` . Service-specific credentials that are inactive cannot be used for authentication to the service. This operation can be used to disable a user's service-specific credential as part of a credential rotation work flow.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateServiceSpecificCredential>`_
**Request Syntax**
::
response = client.update_service_specific_credential(
UserName='string',
ServiceSpecificCredentialId='string',
Status='Active'|'Inactive'
)
:type UserName: string
:param UserName:
The name of the IAM user associated with the service-specific credential. If you do not specify this value, then the operation assumes the user whose credentials are used to call the operation.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type ServiceSpecificCredentialId: string
:param ServiceSpecificCredentialId: **[REQUIRED]**
The unique identifier of the service-specific credential.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that can consist of any upper or lowercased letter or digit.
:type Status: string
:param Status: **[REQUIRED]**
The status to be assigned to the service-specific credential.
:returns: None
"""
pass
def update_signing_certificate(self, CertificateId: str, Status: str, UserName: str = None):
"""
Changes the status of the specified user signing certificate from active to disabled, or vice versa. This operation can be used to disable an IAM user's signing certificate as part of a certificate rotation work flow.
If the ``UserName`` field is not specified, the user name is determined implicitly based on the AWS access key ID used to sign the request. This operation works for access keys under the AWS account. Consequently, you can use this operation to manage AWS account root user credentials even if the AWS account has no associated users.
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateSigningCertificate>`_
**Request Syntax**
::
response = client.update_signing_certificate(
UserName='string',
CertificateId='string',
Status='Active'|'Inactive'
)
:type UserName: string
:param UserName:
The name of the IAM user the signing certificate belongs to.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type CertificateId: string
:param CertificateId: **[REQUIRED]**
The ID of the signing certificate you want to update.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that can consist of any upper or lowercased letter or digit.
:type Status: string
:param Status: **[REQUIRED]**
The status you want to assign to the certificate. ``Active`` means that the certificate can be used for API calls to AWS ``Inactive`` means that the certificate cannot be used.
:returns: None
"""
pass
def update_ssh_public_key(self, UserName: str, SSHPublicKeyId: str, Status: str):
"""
Sets the status of an IAM user's SSH public key to active or inactive. SSH public keys that are inactive cannot be used for authentication. This operation can be used to disable a user's SSH public key as part of a key rotation work flow.
The SSH public key affected by this operation is used only for authenticating the associated IAM user to an AWS CodeCommit repository. For more information about using SSH keys to authenticate to an AWS CodeCommit repository, see `Set up AWS CodeCommit for SSH Connections <https://docs.aws.amazon.com/codecommit/latest/userguide/setting-up-credentials-ssh.html>`__ in the *AWS CodeCommit User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateSSHPublicKey>`_
**Request Syntax**
::
response = client.update_ssh_public_key(
UserName='string',
SSHPublicKeyId='string',
Status='Active'|'Inactive'
)
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the IAM user associated with the SSH public key.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type SSHPublicKeyId: string
:param SSHPublicKeyId: **[REQUIRED]**
The unique identifier for the SSH public key.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters that can consist of any upper or lowercased letter or digit.
:type Status: string
:param Status: **[REQUIRED]**
The status to assign to the SSH public key. ``Active`` means that the key can be used for authentication with an AWS CodeCommit repository. ``Inactive`` means that the key cannot be used.
:returns: None
"""
pass
def update_user(self, UserName: str, NewPath: str = None, NewUserName: str = None):
"""
Updates the name and/or the path of the specified IAM user.
.. warning::
You should understand the implications of changing an IAM user's path or name. For more information, see `Renaming an IAM User <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_users_manage.html#id_users_renaming>`__ and `Renaming an IAM Group <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_groups_manage_rename.html>`__ in the *IAM User Guide* .
.. note::
To change a user name, the requester must have appropriate permissions on both the source object and the target object. For example, to change Bob to Robert, the entity making the request must have permission on Bob and Robert, or must have permission on all (*). For more information about permissions, see `Permissions and Policies <https://docs.aws.amazon.com/IAM/latest/UserGuide/PermissionsAndPolicies.html>`__ .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UpdateUser>`_
**Request Syntax**
::
response = client.update_user(
UserName='string',
NewPath='string',
NewUserName='string'
)
:type UserName: string
:param UserName: **[REQUIRED]**
Name of the user to update. If you\'re changing the name of the user, this is the original user name.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type NewPath: string
:param NewPath:
New path for the IAM user. Include this parameter only if you\'re changing the user\'s path.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
:type NewUserName: string
:param NewUserName:
New name for the user. Include this parameter only if you\'re changing the user\'s name.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:returns: None
"""
pass
def upload_server_certificate(self, ServerCertificateName: str, CertificateBody: str, PrivateKey: str, Path: str = None, CertificateChain: str = None) -> Dict:
"""
Uploads a server certificate entity for the AWS account. The server certificate entity includes a public key certificate, a private key, and an optional certificate chain, which should all be PEM-encoded.
We recommend that you use `AWS Certificate Manager <https://docs.aws.amazon.com/acm/>`__ to provision, manage, and deploy your server certificates. With ACM you can request a certificate, deploy it to AWS resources, and let ACM handle certificate renewals for you. Certificates provided by ACM are free. For more information about using ACM, see the `AWS Certificate Manager User Guide <https://docs.aws.amazon.com/acm/latest/userguide/>`__ .
For more information about working with server certificates, see `Working with Server Certificates <https://docs.aws.amazon.com/IAM/latest/UserGuide/id_credentials_server-certs.html>`__ in the *IAM User Guide* . This topic includes a list of AWS services that can use the server certificates that you manage with IAM.
For information about the number of server certificates you can upload, see `Limitations on IAM Entities and Objects <https://docs.aws.amazon.com/IAM/latest/UserGuide/reference_iam-limits.html>`__ in the *IAM User Guide* .
.. note::
Because the body of the public key certificate, private key, and the certificate chain can be large, you should use POST rather than GET when calling ``UploadServerCertificate`` . For information about setting up signatures and authorization through the API, go to `Signing AWS API Requests <https://docs.aws.amazon.com/general/latest/gr/signing_aws_api_requests.html>`__ in the *AWS General Reference* . For general information about using the Query API with IAM, go to `Calling the API by Making HTTP Query Requests <https://docs.aws.amazon.com/IAM/latest/UserGuide/programming.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UploadServerCertificate>`_
**Request Syntax**
::
response = client.upload_server_certificate(
Path='string',
ServerCertificateName='string',
CertificateBody='string',
PrivateKey='string',
CertificateChain='string'
)
**Response Syntax**
::
{
'ServerCertificateMetadata': {
'Path': 'string',
'ServerCertificateName': 'string',
'ServerCertificateId': 'string',
'Arn': 'string',
'UploadDate': datetime(2015, 1, 1),
'Expiration': datetime(2015, 1, 1)
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful UploadServerCertificate request.
- **ServerCertificateMetadata** *(dict) --*
The meta information of the uploaded server certificate without its certificate body, certificate chain, and private key.
- **Path** *(string) --*
The path to the server certificate. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **ServerCertificateName** *(string) --*
The name that identifies the server certificate.
- **ServerCertificateId** *(string) --*
The stable and unique string identifying the server certificate. For more information about IDs, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **Arn** *(string) --*
The Amazon Resource Name (ARN) specifying the server certificate. For more information about ARNs and how to use them in policies, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *Using IAM* guide.
- **UploadDate** *(datetime) --*
The date when the server certificate was uploaded.
- **Expiration** *(datetime) --*
The date on which the certificate is set to expire.
:type Path: string
:param Path:
The path for the server certificate. For more information about paths, see `IAM Identifiers <https://docs.aws.amazon.com/IAM/latest/UserGuide/Using_Identifiers.html>`__ in the *IAM User Guide* .
This parameter is optional. If it is not included, it defaults to a slash (/). This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of either a forward slash (/) by itself or a string that must begin and end with forward slashes. In addition, it can contain any ASCII character from the ! (\u0021) through the DEL character (\u007F), including most punctuation characters, digits, and upper and lowercased letters.
.. note::
If you are uploading a server certificate specifically for use with Amazon CloudFront distributions, you must specify a path using the ``path`` parameter. The path must begin with ``/cloudfront`` and must include a trailing slash (for example, ``/cloudfront/test/`` ).
:type ServerCertificateName: string
:param ServerCertificateName: **[REQUIRED]**
The name for the server certificate. Do not include the path in this value. The name of the certificate cannot contain any spaces.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type CertificateBody: string
:param CertificateBody: **[REQUIRED]**
The contents of the public key certificate in PEM-encoded format.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:type PrivateKey: string
:param PrivateKey: **[REQUIRED]**
The contents of the private key in PEM-encoded format.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:type CertificateChain: string
:param CertificateChain:
The contents of the certificate chain. This is typically a concatenation of the PEM-encoded public key certificates of the chain.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:rtype: dict
:returns:
"""
pass
def upload_signing_certificate(self, CertificateBody: str, UserName: str = None) -> Dict:
"""
Uploads an X.509 signing certificate and associates it with the specified IAM user. Some AWS services use X.509 signing certificates to validate requests that are signed with a corresponding private key. When you upload the certificate, its default status is ``Active`` .
If the ``UserName`` is not specified, the IAM user name is determined implicitly based on the AWS access key ID used to sign the request. This operation works for access keys under the AWS account. Consequently, you can use this operation to manage AWS account root user credentials even if the AWS account has no associated users.
.. note::
Because the body of an X.509 certificate can be large, you should use POST rather than GET when calling ``UploadSigningCertificate`` . For information about setting up signatures and authorization through the API, go to `Signing AWS API Requests <https://docs.aws.amazon.com/general/latest/gr/signing_aws_api_requests.html>`__ in the *AWS General Reference* . For general information about using the Query API with IAM, go to `Making Query Requests <https://docs.aws.amazon.com/IAM/latest/UserGuide/IAM_UsingQueryAPI.html>`__ in the *IAM User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UploadSigningCertificate>`_
**Request Syntax**
::
response = client.upload_signing_certificate(
UserName='string',
CertificateBody='string'
)
**Response Syntax**
::
{
'Certificate': {
'UserName': 'string',
'CertificateId': 'string',
'CertificateBody': 'string',
'Status': 'Active'|'Inactive',
'UploadDate': datetime(2015, 1, 1)
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful UploadSigningCertificate request.
- **Certificate** *(dict) --*
Information about the certificate.
- **UserName** *(string) --*
The name of the user the signing certificate is associated with.
- **CertificateId** *(string) --*
The ID for the signing certificate.
- **CertificateBody** *(string) --*
The contents of the signing certificate.
- **Status** *(string) --*
The status of the signing certificate. ``Active`` means that the key is valid for API calls, while ``Inactive`` means it is not.
- **UploadDate** *(datetime) --*
The date when the signing certificate was uploaded.
:type UserName: string
:param UserName:
The name of the user the signing certificate is for.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type CertificateBody: string
:param CertificateBody: **[REQUIRED]**
The contents of the signing certificate.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:rtype: dict
:returns:
"""
pass
def upload_ssh_public_key(self, UserName: str, SSHPublicKeyBody: str) -> Dict:
"""
Uploads an SSH public key and associates it with the specified IAM user.
The SSH public key uploaded by this operation can be used only for authenticating the associated IAM user to an AWS CodeCommit repository. For more information about using SSH keys to authenticate to an AWS CodeCommit repository, see `Set up AWS CodeCommit for SSH Connections <https://docs.aws.amazon.com/codecommit/latest/userguide/setting-up-credentials-ssh.html>`__ in the *AWS CodeCommit User Guide* .
See also: `AWS API Documentation <https://docs.aws.amazon.com/goto/WebAPI/iam-2010-05-08/UploadSSHPublicKey>`_
**Request Syntax**
::
response = client.upload_ssh_public_key(
UserName='string',
SSHPublicKeyBody='string'
)
**Response Syntax**
::
{
'SSHPublicKey': {
'UserName': 'string',
'SSHPublicKeyId': 'string',
'Fingerprint': 'string',
'SSHPublicKeyBody': 'string',
'Status': 'Active'|'Inactive',
'UploadDate': datetime(2015, 1, 1)
}
}
**Response Structure**
- *(dict) --*
Contains the response to a successful UploadSSHPublicKey request.
- **SSHPublicKey** *(dict) --*
Contains information about the SSH public key.
- **UserName** *(string) --*
The name of the IAM user associated with the SSH public key.
- **SSHPublicKeyId** *(string) --*
The unique identifier for the SSH public key.
- **Fingerprint** *(string) --*
The MD5 message digest of the SSH public key.
- **SSHPublicKeyBody** *(string) --*
The SSH public key.
- **Status** *(string) --*
The status of the SSH public key. ``Active`` means that the key can be used for authentication with an AWS CodeCommit repository. ``Inactive`` means that the key cannot be used.
- **UploadDate** *(datetime) --*
The date and time, in `ISO 8601 date-time format <http://www.iso.org/iso/iso8601>`__ , when the SSH public key was uploaded.
:type UserName: string
:param UserName: **[REQUIRED]**
The name of the IAM user to associate the SSH public key with.
This parameter allows (through its `regex pattern <http://wikipedia.org/wiki/regex>`__ ) a string of characters consisting of upper and lowercase alphanumeric characters with no spaces. You can also include any of the following characters: _+=,.@-
:type SSHPublicKeyBody: string
:param SSHPublicKeyBody: **[REQUIRED]**
The SSH public key. The public key must be encoded in ssh-rsa format or PEM format. The minimum bit-length of the public key is 2048 bits. For example, you can generate a 2048-bit key, and the resulting PEM file is 1679 bytes long.
The `regex pattern <http://wikipedia.org/wiki/regex>`__ used to validate this parameter is a string of characters consisting of the following:
* Any printable ASCII character ranging from the space character (\u0020) through the end of the ASCII character range
* The printable characters in the Basic Latin and Latin-1 Supplement character set (through \u00FF)
* The special characters tab (\u0009), line feed (\u000A), and carriage return (\u000D)
:rtype: dict
:returns:
"""
pass
| 76.165541
| 756
| 0.631325
| 70,187
| 586,627
| 5.240458
| 0.023095
| 0.009461
| 0.019263
| 0.023708
| 0.879218
| 0.851693
| 0.832792
| 0.818255
| 0.808089
| 0.795975
| 0
| 0.007884
| 0.286061
| 586,627
| 7,701
| 757
| 76.175432
| 0.870306
| 0.88919
| 0
| 0.486301
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.486301
| false
| 0.506849
| 0.023973
| 0
| 0.513699
| 0.006849
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 0
| 1
| 0
|
0
| 10
|
bd32f69d0751dbce7224f32437a713bf086fb418
| 7,872
|
py
|
Python
|
tests/MLE/mle.py
|
dbekaert/fringe
|
c696c3651777d8007406fbce4470a16a39948f74
|
[
"Apache-2.0"
] | 52
|
2020-03-29T18:57:45.000Z
|
2022-03-24T00:35:53.000Z
|
tests/MLE/mle.py
|
dbekaert/fringe
|
c696c3651777d8007406fbce4470a16a39948f74
|
[
"Apache-2.0"
] | 48
|
2020-04-12T12:11:48.000Z
|
2022-03-23T06:00:21.000Z
|
tests/MLE/mle.py
|
dbekaert/fringe
|
c696c3651777d8007406fbce4470a16a39948f74
|
[
"Apache-2.0"
] | 39
|
2020-03-29T14:39:51.000Z
|
2022-03-17T02:04:27.000Z
|
import numpy as np
import matplotlib.pyplot as plt
def wrap_phase(ph):
ph = ph - np.round(ph/(2*np.pi)) * 2*np.pi
return ph
def estimate_MLE_5(cor_matrix):
###Correlation matrix
###This matrix needs to be positive semi-definite
nsar = cor_matrix.shape[0]
w, v = np.linalg.eigh(cor_matrix)
msk = (w < 1e-6)
w[msk] = 0.
cor_matrix = np.dot(v, np.dot(np.diag(w), np.matrix.getH(v)))
print('Eigen value properties of COV')
print('Range: ', np.min(w), np.max(w))
print('Number used: {0} out of {1}'.format(nsar - np.sum(msk), nsar))
###Absolute value of the correlation matrix
###This matrix needs to be positive semi-definite
coh = np.abs(cor_matrix)
coh = 0.5 * (coh + coh.T)
w1, v1 = np.linalg.eigh(coh)
msk = (w1 > 1e-6)
wdiag1 = np.zeros(w1.size)
wdiag1[msk] = 1 / w1[msk]
coh_inv = np.dot(v1, np.dot(np.diag(wdiag1), np.matrix.getH(v1)))
print('Eigen value properties of COH')
print('Range: ', np.min(w1), np.max(w1))
print('Range inv: ', np.min(wdiag1), np.max(wdiag1))
print('Number used: {0} out of {1}'.format(np.sum(msk), nsar))
### Generating the Hadamard product
### This is the matrix used for the MLE iterations
Gmat = coh_inv * cor_matrix
Gmat = 0.5 * (Gmat + np.matrix.getH(Gmat))
w, v = np.linalg.eigh(Gmat)
#w, v = np.linalg.eigh(cor_matrix)
###Init with zeros
#ph0 = np.zeros(nsar)
###Init with random
#ph0 = np.random.randn(nsar)
###Init with cor_matrix
#ph0 = -np.angle(cor_matrix[:,0])
###Init with eigen
ph0 = np.angle(v[:,0])
print('Eigen value properties of Hadamard')
print('Hadamard: ' ,np.min(w), np.max(w))
N = coh.shape[0]
ind = range(N)
ph = np.zeros(ph0.shape)
ph0 = wrap_phase(ph0 - ph0[0])
iteration = 0
plt.figure()
niter = 25
while iteration < niter:
print('iteration: ', iteration)
for p in range(N):
psum = 0.0+1.j*0.0
for n in range(N):
if (n != p):
psum += (coh_inv[p,n]*cor_matrix[p,n]*np.exp(1j*ph0[n]))
ph[p] = np.angle(psum)*(np.abs(psum)>1e-5)
ph = np.angle(np.exp(1j*ph)*np.exp(-1j*ph[0]))
#ph = ph - ph[0]
residual = (np.angle(np.exp(1j*ph)*np.exp(-1j*ph0)))
#print(residual)
if (iteration==0):
plt.subplot(niter+1,1,1)
plt.plot(ph0)
ph0 = ph.copy()
iteration+=1
plt.subplot(niter+1, 1, iteration+1)
plt.plot(ph)
if np.max(np.abs(residual)) < 1.0*np.pi/180. :
iteration = niter
return ph, Gmat
def estimate_MLE_4(cor_matrix):
###Correlation matrix
###This matrix needs to be positive semi-definite
nsar = cor_matrix.shape[0]
w, v = np.linalg.eigh(cor_matrix)
msk = (w < 1e-3)
w[msk] = 0.
cor_matrix = np.dot(v, np.dot(np.diag(w), np.matrix.getH(v)))
print('Eigen value properties of COV')
print('Range: ', np.min(w), np.max(w))
print('Number used: {0} out of {1}'.format(nsar - np.sum(msk), nsar))
###Absolute value of the correlation matrix
###This matrix needs to be positive semi-definite
coh = np.abs(cor_matrix)
coh = 0.5 * (coh + coh.T)
w1, v1 = np.linalg.eigh(coh)
msk = (w1 > 1e-3)
wdiag1 = np.zeros(w1.size)
wdiag1[msk] = 1 / w1[msk]
coh_inv = np.dot(v1, np.dot(np.diag(wdiag1), np.matrix.getH(v1)))
print('Eigen value properties of COH')
print('Range: ', np.min(w1), np.max(w1))
print('Range inv: ', np.min(wdiag1), np.max(wdiag1))
print('Number used: {0} out of {1}'.format(np.sum(msk), nsar))
### Generating the Hadamard product
### This is the matrix used for the MLE iterations
Gmat = coh_inv * cor_matrix
Gmat = 0.5 * (Gmat + np.matrix.getH(Gmat))
w, v = np.linalg.eigh(Gmat)
###Init with zeros
#ph0 = np.zeros(nsar)
###Init with random
#ph0 = np.random.randn(nsar)
###Init with cor_matrix
#ph0 = -np.angle(cor_matrix[:,0])
###Init with eigen
ph0 = np.angle(v[:,0])
print('Eigen value properties of Hadamard')
print('Hadamard: ' ,np.min(w), np.max(w))
N = coh.shape[0]
ind = range(N)
ph = np.zeros(ph0.shape)
ph0 = wrap_phase(ph0 - ph0[0])
iteration = 0
plt.figure()
niter = 25
while iteration < niter:
print('iteration: ', iteration)
for p in range(N):
psum = 0.0+1.j*0.0
for n in range(N):
if (n != p):
psum += (coh_inv[p,n]*cor_matrix[p,n]*np.exp(1j*ph0[n]))
ph[p] = np.angle(psum)*(np.abs(psum)>1e-5)
ph = np.angle(np.exp(1j*ph)*np.exp(-1j*ph[0]))
#ph = ph - ph[0]
residual = (np.angle(np.exp(1j*ph)*np.exp(-1j*ph0)))
#print(residual)
if (iteration==0):
plt.subplot(niter+1,1,1)
plt.plot(ph0)
ph0 = ph.copy()
iteration+=1
plt.subplot(niter+1, 1, iteration+1)
plt.plot(ph)
if np.max(np.abs(residual)) < 10.0*np.pi/180. :
iteration = niter
return ph, Gmat
def estimate_MLE_3(cor_matrix):
###Correlation matrix
###This matrix needs to be positive semi-definite
nsar = cor_matrix.shape[0]
w, v = np.linalg.eigh(cor_matrix)
msk = (w < 1e-3)
w[msk] = 0.
cor_matrix = np.dot(v, np.dot(np.diag(w), np.matrix.getH(v)))
print('Eigen value properties of COV')
print('Range: ', np.min(w), np.max(w))
print('Number used: {0} out of {1}'.format(nsar - np.sum(msk), nsar))
###Absolute value of the correlation matrix
###This matrix needs to be positive semi-definite
coh = np.abs(cor_matrix)
coh = 0.5 * (coh + coh.T)
w1, v1 = np.linalg.eigh(coh)
msk = (w1 > 1e-3)
wdiag1 = np.zeros(w1.size)
wdiag1[msk] = 1 / w1[msk]
coh_inv = np.dot(v1, np.dot(np.diag(wdiag1), np.matrix.getH(v1)))
print('Eigen value properties of COH')
print('Range: ', np.min(w1), np.max(w1))
print('Range inv: ', np.min(wdiag1), np.max(wdiag1))
print('Number used: {0} out of {1}'.format(np.sum(msk), nsar))
### Generating the Hadamard product
### This is the matrix used for the MLE iterations
Gmat = coh_inv * cor_matrix
Gmat = 0.5 * (Gmat + np.matrix.getH(Gmat))
w, v = np.linalg.eigh(Gmat)
###Init with zeros
#ph0 = np.zeros(nsar)
###Init with random
#ph0 = np.random.randn(nsar)
###Init with cor_matrix
#ph0 = -np.angle(cor_matrix[:,0])
###Init with eigen
ph0 = np.angle(v[:,0])
print('Eigen value properties of Hadamard')
print('Hadamard: ' ,np.min(w), np.max(w))
N = coh.shape[0]
ind = range(N)
ph = np.zeros(ph0.shape)
ph0 = wrap_phase(ph0 - ph0[0])
iteration = 0
plt.figure()
niter = 25
while iteration < niter:
print('iteration: ', iteration)
for p in range(N):
psum = 0.0+1.j*0.0
for n in range(N):
if (n != p):
psum += (coh_inv[p,n]*cor_matrix[p,n]*np.exp(1j*ph0[n]))
ph[p] = np.angle(psum)
ph = np.angle(np.exp(1j*ph)*np.exp(-1j*ph[0]))
#ph = ph - ph[0]
residual = (np.angle(np.exp(1j*ph)*np.exp(-1j*ph0)))
#print(residual)
if (iteration==0):
plt.subplot(niter+1,1,1)
plt.plot(ph0)
ph0 = ph.copy()
iteration+=1
plt.subplot(niter+1, 1, iteration+1)
plt.plot(ph)
return ph, Gmat
| 26.152824
| 77
| 0.53595
| 1,200
| 7,872
| 3.476667
| 0.085
| 0.060403
| 0.025168
| 0.053931
| 0.970997
| 0.970997
| 0.970997
| 0.965484
| 0.965484
| 0.965484
| 0
| 0.04069
| 0.300686
| 7,872
| 300
| 78
| 26.24
| 0.717166
| 0.158155
| 0
| 0.919753
| 0
| 0
| 0.092694
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.024691
| false
| 0
| 0.012346
| 0
| 0.061728
| 0.185185
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
951eaec8fc7cc9c10fcfea18f2283776cb549b8f
| 7,292
|
py
|
Python
|
pscheduler-archiver-esmond/tests/data_is_valid_test.py
|
igarny/pscheduler
|
0ab6e68bb3adb808e1116bab0eb7438bf4c31e2c
|
[
"Apache-2.0"
] | 47
|
2016-09-28T14:19:10.000Z
|
2022-03-21T13:26:47.000Z
|
pscheduler-archiver-esmond/tests/data_is_valid_test.py
|
igarny/pscheduler
|
0ab6e68bb3adb808e1116bab0eb7438bf4c31e2c
|
[
"Apache-2.0"
] | 993
|
2016-07-07T19:30:32.000Z
|
2022-03-21T10:25:52.000Z
|
pscheduler-archiver-esmond/tests/data_is_valid_test.py
|
mfeit-internet2/pscheduler-dev
|
d2cd4065a6fce88628b0ca63edc7a69f2672dad2
|
[
"Apache-2.0"
] | 36
|
2016-09-15T09:39:45.000Z
|
2021-06-23T15:05:13.000Z
|
"""
tests for the data-is-valid command
"""
import pscheduler
import unittest
class DataIsValidTest(pscheduler.ArchiverDataIsValidUnitTest):
name = 'esmond'
def _test_host(self, field_name):
self.assert_cmd('{{"{0}": "127.0.0.1", "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}}'.format(field_name))
self.assert_cmd('{{"{0}": "fe80::a00:27ff:fe04:4faa", "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}}'.format(field_name))
self.assert_cmd('{{"{0}": "::1", "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}}'.format(field_name))
self.assert_cmd('{{"{0}": "example.perfsonar.net", "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}}'.format(field_name))
self.assert_cmd('{{"{0}": "bad address", "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}}'.format(field_name), expected_valid=False)
"""
Data validation tests.
"""
def test_url(self):
#test URL
##valid url
self.assert_cmd('{"url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
##invalid url
self.assert_cmd('{"url": 1}', expected_valid=False)
#missing URL
self.assert_cmd('{"url2": "https/example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
#invalid json
self.assert_cmd('{"url: "https/example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
def test_schema(self):
#test schema version
self.assert_cmd('{"schema": 1, "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"schema": 2, "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False, expected_errors=["Schema version 2 is not supported (highest is 1)"])
def test_bind(self):
#test bind
self._test_host("bind")
def test_auth_token(self):
#test _auth_token
self.assert_cmd('{"_auth-token": "2bc72c85c507f4c79825640ed640ce3cf24e2768", "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"_auth-token": 1, "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
def test_measurement_agent(self):
#test measurement-agent
self._test_host("measurement-agent")
def test_verify_ssl(self):
#test verify-ssl
self.assert_cmd('{"verify-ssl": true, "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"verify-ssl": false, "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"verify-ssl": 0, "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
self.assert_cmd('{"verify-ssl": 1, "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
self.assert_cmd('{"verify-ssl": maybe, "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
def test_data_formatting_policy(self):
#test data-formatting-policy
self.assert_cmd('{"data-formatting-policy": "prefer-mapped", "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"data-formatting-policy": "mapped-and-raw", "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"data-formatting-policy": "mapped-only", "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"data-formatting-policy": "raw-only", "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"data-formatting-policy": "bad-input", "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
def test_retry_policy(self):
#test retry-policy
self.assert_cmd('{"retry-policy": [], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"retry-policy": [{"attempts": 2, "wait": "PT60S"}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"retry-policy": [{"attempts": 2, "wait": "PT60S"}, {"attempts": 3, "wait": "PT120S"}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"retry-policy": [{"attempts": 2, "wait": "PT60S"}, {"attempts": 3, "wait": "PT120S"}, {"attempts": 1, "wait": "P1D"}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"retry-policy": "", "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
self.assert_cmd('{"retry-policy": [{}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
self.assert_cmd('{"retry-policy": [{"attempts": 2], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
self.assert_cmd('{"retry-policy": [{"attempts": 0, "wait": "PT60S"}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
self.assert_cmd('{"retry-policy": [{"wait": "PT60S"}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
self.assert_cmd('{"retry-policy": [{"attempts": 2, "wait": 60}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
self.assert_cmd('{"retry-policy": [{"attempts": 2, "wait": "PU60S"}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
def test_summaries(self):
#test summaries
self.assert_cmd('{"summaries": [], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"summaries": [{"event-type": "throughput", "summary-type": "average", "summary-window": 86400}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"summaries": [{"event-type": "throughput", "summary-type": "average", "summary-window": 86400}, {"event-type": "histogram-owdelay", "summary-type": "statistics", "summary-window": 0}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}')
self.assert_cmd('{"summaries": "", "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
self.assert_cmd('{"summaries": [{}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
self.assert_cmd('{"summaries": [{"event-type": "throughput"}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
self.assert_cmd('{"summaries": [{"summary-type": "average"}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
self.assert_cmd('{"summaries": [{"summary-window": 86400}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
self.assert_cmd('{"summaries": [{"event-type": "throughput", "summary-type": "average", "summary-window": "86400"}], "url": "https://example.perfsonar.net/esmond/perfsonar/archive"}', expected_valid=False)
if __name__ == '__main__':
unittest.main()
| 75.175258
| 277
| 0.666621
| 865
| 7,292
| 5.49711
| 0.107514
| 0.090431
| 0.11756
| 0.211987
| 0.830915
| 0.794953
| 0.783176
| 0.783176
| 0.783176
| 0.782545
| 0
| 0.017106
| 0.126166
| 7,292
| 96
| 278
| 75.958333
| 0.729127
| 0.030993
| 0
| 0
| 0
| 0.639344
| 0.637207
| 0.047687
| 0
| 0
| 0
| 0
| 0.704918
| 1
| 0.163934
| false
| 0
| 0.032787
| 0
| 0.229508
| 0
| 0
| 0
| 0
| null | 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| null | 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 10
|
9533e66b42059684689485194b7e33e5efabc4d0
| 12
|
py
|
Python
|
test/__init__.py
|
cuichuan123456/transform-culane
|
5e1de763100ae53b1c5c66cf168c09999cf75139
|
[
"BSD-3-Clause"
] | 540
|
2020-11-10T11:09:00.000Z
|
2022-03-30T01:49:33.000Z
|
test/__init__.py
|
cuichuan123456/transform-culane
|
5e1de763100ae53b1c5c66cf168c09999cf75139
|
[
"BSD-3-Clause"
] | 83
|
2020-11-14T17:43:34.000Z
|
2022-03-22T08:49:23.000Z
|
test/__init__.py
|
cuichuan123456/transform-culane
|
5e1de763100ae53b1c5c66cf168c09999cf75139
|
[
"BSD-3-Clause"
] | 122
|
2020-11-12T01:29:12.000Z
|
2022-03-23T09:50:50.000Z
|
# 2020 06 15
| 12
| 12
| 0.666667
| 3
| 12
| 2.666667
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.888889
| 0.25
| 12
| 1
| 12
| 12
| 0
| 0.833333
| 0
| null | 0
| null | 0
| 0
| null | 0
| 0
| 0
| null | 1
| null | true
| 0
| 0
| null | null | null | 1
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
2f44cc5c0d6b471bbfacd1c1cc465b4b62cc2e50
| 6,512
|
py
|
Python
|
tests/test_view_user.py
|
SproutProject/sptoj-server
|
9590c9f2308e4ad7447e60740372ed6a8f32e7b8
|
[
"MIT"
] | null | null | null |
tests/test_view_user.py
|
SproutProject/sptoj-server
|
9590c9f2308e4ad7447e60740372ed6a8f32e7b8
|
[
"MIT"
] | null | null | null |
tests/test_view_user.py
|
SproutProject/sptoj-server
|
9590c9f2308e4ad7447e60740372ed6a8f32e7b8
|
[
"MIT"
] | null | null | null |
'''User API unittest'''
import tests
import model.user
from unittest import TestCase
class TestRegister(TestCase):
'''Register unittest.'''
@tests.async_test
async def test_register(self):
'''Test register.'''
response = await tests.request('/user/register', {
'mail': 'text@example.com',
'password': '1234',
'name': 'Foo',
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/register', {
'mail': 'test@example.com',
'password': '1234',
'name': 'Foo',
})
self.assertEqual(response, 'Success')
@tests.async_test
async def test_exist(self):
'''Test duplicated register.'''
response = await tests.request('/user/register', {
'mail': 'test@example.com',
'password': '1234',
'name': 'Foo',
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/register', {
'mail': 'test@example.com',
'password': '1234',
'name': 'Foo',
})
self.assertEqual(response, 'Eexist')
class TestLogin(TestCase):
'''Login unittest.'''
@tests.async_test
async def test_login(self):
'''Test login.'''
response = await tests.request('/user/register', {
'mail': 'foo@example.com',
'password': '1234',
'name': 'Foo',
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/register', {
'mail': 'bar@example.com',
'password': '1234',
'name': 'Foo',
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/login', {
'mail': 'foo@example.com',
'password': '1234',
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/login', {
'mail': 'bar@example.com',
'password': '1234',
})
self.assertEqual(response, 'Success')
@tests.async_test
async def test_failed(self):
'''Test login failed.'''
response = await tests.request('/user/register', {
'mail': 'foo@example.com',
'password': '1234',
'name': 'Foo',
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/login', {
'mail': 'foo@example.com',
'password': '12345'
})
self.assertEqual(response, 'Error')
response = await tests.request('/user/login', {
'mail': 'bar@example.com',
'password': '1234'
})
self.assertEqual(response, 'Error')
class TestGet(TestCase):
'''Get unittest.'''
@tests.async_test
async def test_get(self):
'''Test get information.'''
response = await tests.request('/user/get', {})
self.assertEqual(response, 'Error')
response = await tests.request('/user/register', {
'mail': 'foo@example.com',
'password': '1234',
'name': 'Foo',
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/get', {})
self.assertEqual(response, 'Error')
response = await tests.request('/user/login', {
'mail': 'foo@example.com',
'password': '1234'
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/get', {})
self.assertEqual(response, { 'uid': 1, 'name': 'Foo', 'level': 3 })
response = await tests.request('/user/1/get', {})
self.assertEqual(response, { 'uid': 1, 'name': 'Foo', 'level': 3 })
response = await tests.request('/user/100/get', {})
self.assertEqual(response, 'Error')
response = await tests.request('/user/register', {
'mail': 'bar@example.com',
'password': '1234',
'name': 'Foo',
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/2/get', {})
self.assertEqual(response, 'Error')
class TestSet(TestCase):
'''Set unittest.'''
@tests.async_test
async def test_get(self):
'''Test set information.'''
response = await tests.request('/user/register', {
'mail': 'foo@example.com',
'password': '1234',
'name': 'Foo',
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/login', {
'mail': 'foo@example.com',
'password': '1234',
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/get', {})
self.assertNotEqual(response, 'Error')
uid = response['uid']
response = await tests.request('/user/{}/set'.format(uid), {
'name': 'Foo',
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/{}/set'.format(uid), {
'name': 'Foo',
'password': '5678',
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/get', {})
self.assertEqual(response, 'Error')
response = await tests.request('/user/login', {
'mail': 'foo@example.com',
'password': '1234',
})
self.assertEqual(response, 'Error')
response = await tests.request('/user/login', {
'mail': 'foo@example.com',
'password': '5678',
})
self.assertEqual(response, 'Success')
class TestList(TestCase):
'''List unittest.'''
@tests.async_test
async def test_list(self):
'''Test get self information.'''
response = await tests.request('/user/register', {
'mail': 'foo@example.com',
'password': '1234',
'name': 'Foo',
})
self.assertEqual(response, 'Success')
await model.user.create('admin', '1234', 'Foo',
level=model.user.UserLevel.kernel)
response = await tests.request('/user/login', {
'mail': 'admin',
'password': '1234'
})
self.assertEqual(response, 'Success')
response = await tests.request('/user/list', {})
self.assertNotEqual(response, 'Error')
self.assertEqual(len(response), 2)
| 29.201794
| 75
| 0.524877
| 606
| 6,512
| 5.617162
| 0.09571
| 0.11839
| 0.163925
| 0.227673
| 0.857814
| 0.84577
| 0.829025
| 0.787897
| 0.769683
| 0.769683
| 0
| 0.021937
| 0.306972
| 6,512
| 222
| 76
| 29.333333
| 0.732329
| 0.014588
| 0
| 0.847561
| 0
| 0
| 0.21134
| 0
| 0
| 0
| 0
| 0
| 0.195122
| 1
| 0
| false
| 0.128049
| 0.018293
| 0
| 0.04878
| 0
| 0
| 0
| 0
| null | 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
|
0
| 9
|
2f66d0e62e08e0f227fb6084ee21d3fe2262ccde
| 82
|
py
|
Python
|
Activities/S1600733.py
|
Hushamhere/dadsa
|
ba5a25b0039e042935061aef038047c7be701373
|
[
"Unlicense"
] | null | null | null |
Activities/S1600733.py
|
Hushamhere/dadsa
|
ba5a25b0039e042935061aef038047c7be701373
|
[
"Unlicense"
] | null | null | null |
Activities/S1600733.py
|
Hushamhere/dadsa
|
ba5a25b0039e042935061aef038047c7be701373
|
[
"Unlicense"
] | null | null | null |
print ('hello world')
print ('ok making a change')
print ("making a change again")
| 27.333333
| 31
| 0.707317
| 13
| 82
| 4.461538
| 0.615385
| 0.241379
| 0.448276
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.146341
| 82
| 3
| 31
| 27.333333
| 0.828571
| 0
| 0
| 0
| 0
| 0
| 0.60241
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 1
|
0
| 7
|
c81e4ec01c32819b7c23273e77bf52d2db563b86
| 50,852
|
py
|
Python
|
tests/test_cellartracker.py
|
Mccall85/cellartracker
|
02935ea91c9ec91bbb58773009f705e3bee78196
|
[
"MIT"
] | 3
|
2020-05-26T00:47:42.000Z
|
2022-02-08T08:09:23.000Z
|
tests/test_cellartracker.py
|
Mccall85/cellartracker
|
02935ea91c9ec91bbb58773009f705e3bee78196
|
[
"MIT"
] | 8
|
2020-08-14T20:55:02.000Z
|
2022-01-31T03:16:38.000Z
|
tests/test_cellartracker.py
|
mathroule/cellartracker
|
b3dd9b4be58e72528cc86b02efac692b8d76295e
|
[
"MIT"
] | 1
|
2022-02-04T09:16:41.000Z
|
2022-02-04T09:16:41.000Z
|
#!/usr/bin/env python
"""Tests for `cellartracker` package."""
import unittest
import requests
import requests_mock
from cellartracker.cellartracker import CellarTracker
from cellartracker.errors import AuthenticationError, CannotConnect
class TestCellartracker(unittest.TestCase):
"""Tests for `cellartracker` package."""
def setUp(self):
"""Set up test fixtures, if any."""
def tearDown(self):
"""Tear down test fixtures, if any."""
@requests_mock.Mocker()
def test_get_list(self, m):
"""Test get list."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=List&Format=tab&Location=1"
file = open("./tests/fixtures/list.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_list()
self.assertEqual([
{'iWine': '684674', 'WineBarcode': 'W0684674_750ml', 'Quantity': '0', 'Pending': '3', 'Location': '', 'Bin': '', 'Size': '750ml', 'Price': '0', 'Valuation': '', 'MyValue': '0', 'WBValue': '', 'CTValue': '', 'MenuPrice': '0', 'Currency': 'EUR', 'Vintage': '2008', 'Wine': 'Pétrus', 'Locale': 'France, Bordeaux, Libournais, Pomerol', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Libournais', 'Appellation': 'Pomerol', 'Producer': 'Pétrus', 'SortProducer': 'Pétrus', 'Type': 'Red', 'Varietal': 'Red Bordeaux Blend', 'MasterVarietal': 'Red Bordeaux Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'WA': '', 'WS': '', 'IWC': '', 'BH': '', 'AG': '', 'WE': '', 'JR': '', 'RH': '', 'JG': '', 'GV': '', 'JK': '', 'LD': '', 'CW': '', 'WFW': '', 'PR': '', 'SJ': '', 'WD': '18-19+', 'RR': '', 'JH': '', 'MFW': '', 'WWR': '', 'IWR': '', 'CHG': '', 'TT': '', 'TWF': '', 'DR': '', 'FP': '', 'JM': '', 'PG': '', 'WAL': '', 'CT': '96.625', 'MY': '', 'BeginConsume': '2018', 'EndConsume': '2046', 'UPC': ''},
{'iWine': '118542', 'WineBarcode': 'W0118542_750ml', 'Quantity': '1', 'Pending': '0', 'Location': 'Cellar', 'Bin': '', 'Size': '750ml', 'Price': '3500', 'Valuation': '3500', 'MyValue': '0', 'WBValue': '', 'CTValue': '', 'MenuPrice': '0', 'Currency': 'EUR', 'Vintage': '2003', 'Wine': 'Domaine de la Romanée-Conti La Tâche', 'Locale': 'France, Burgundy, Côte de Nuits, La Tâche Grand Cru', 'Country': 'France', 'Region': 'Burgundy', 'SubRegion': 'Côte de Nuits', 'Appellation': 'La Tâche Grand Cru', 'Producer': 'Domaine de la Romanée-Conti', 'SortProducer': 'Romanée-Conti, Domaine de la ', 'Type': 'Red', 'Varietal': 'Pinot Noir', 'MasterVarietal': 'Pinot Noir', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'WA': '', 'WS': '', 'IWC': '', 'BH': '', 'AG': '', 'WE': '', 'JR': '', 'RH': '', 'JG': '', 'GV': '', 'JK': '', 'LD': '', 'CW': '', 'WFW': '', 'PR': '', 'SJ': '', 'WD': '', 'RR': '', 'JH': '', 'MFW': '', 'WWR': '', 'IWR': '', 'CHG': '', 'TT': '', 'TWF': '', 'DR': '', 'FP': '', 'JM': '', 'PG': '', 'WAL': '', 'CT': '94.4117647058823', 'MY': '', 'BeginConsume': '2013', 'EndConsume': '2029', 'UPC': ''},
{'iWine': '1367113', 'WineBarcode': 'W1367113_750ml', 'Quantity': '5', 'Pending': '0', 'Location': 'Cellar', 'Bin': '', 'Size': '750ml', 'Price': '230', 'Valuation': '230', 'MyValue': '0', 'WBValue': '', 'CTValue': '', 'MenuPrice': '0', 'Currency': 'EUR', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Sauternais', 'Appellation': 'Sauternes', 'Producer': "Château d'Yquem", 'SortProducer': "Yquem, Château d'", 'Type': 'White - Sweet/Dessert', 'Varietal': 'Sémillon-Sauvignon Blanc Blend', 'MasterVarietal': 'Sémillon-Sauvignon Blanc Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'WA': '', 'WS': '', 'IWC': '', 'BH': '', 'AG': '', 'WE': '', 'JR': '', 'RH': '', 'JG': '', 'GV': '', 'JK': '', 'LD': '', 'CW': '', 'WFW': '', 'PR': '', 'SJ': '', 'WD': '19-20', 'RR': '', 'JH': '', 'MFW': '', 'WWR': '', 'IWR': '', 'CHG': '', 'TT': '', 'TWF': '', 'DR': '', 'FP': '', 'JM': '', 'PG': '', 'WAL': '', 'CT': '95.9782608695652', 'MY': '', 'BeginConsume': '2019', 'EndConsume': '2054', 'UPC': '810910020858'}
], data)
@requests_mock.Mocker()
def test_get_list_with_empty_result(self, m):
"""Test get list with empty result."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=List&Format=tab&Location=1"
file = open("./tests/fixtures/list_empty.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_list()
self.assertEqual([], data)
@requests_mock.Mocker()
def test_get_list_with_invalid_credentials(self, m):
"""Test get list with invalid credentials."""
url = "https://www.cellartracker.com/xlquery.asp?User=invalid-username&Password=invalid-password&Table=List&Format=tab&Location=1"
file = open("./tests/fixtures/not_logged.html", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="invalid-username", password="invalid-password")
with self.assertRaises(AuthenticationError):
cellartracker.get_list()
@requests_mock.Mocker()
def test_get_list_with_error(self, m):
"""Test get list with error."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=List&Format=tab&Location=1"
m.register_uri("GET", url, exc=requests.exceptions.ConnectTimeout)
cellartracker = CellarTracker(username="test-username", password="test-password")
with self.assertRaises(CannotConnect):
cellartracker.get_list()
@requests_mock.Mocker()
def test_get_inventory(self, m):
"""Test get inventory."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Inventory&Format=tab&Location=1"
file = open("./tests/fixtures/inventory.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_inventory()
self.assertEqual([
{'iWine': '684674', 'Barcode': '0129197314', 'Location': '(pending)', 'Bin': '', 'Size': '750ml', 'Currency': 'EUR', 'ExchangeRate': '1', 'Valuation': '0', 'Price': '0', 'NativePrice': '0', 'NativePriceCurrency': 'EUR', 'StoreName': 'Unknown', 'PurchaseDate': '5/25/2020', 'BottleNote': '', 'Vintage': '2008', 'Wine': 'Pétrus', 'Locale': 'France, Bordeaux, Libournais, Pomerol', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Libournais', 'Appellation': 'Pomerol', 'Producer': 'Pétrus', 'SortProducer': 'Pétrus', 'Type': 'Red', 'Color': 'Red', 'Category': 'Dry', 'Varietal': 'Red Bordeaux Blend', 'MasterVarietal': 'Red Bordeaux Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'WA': '', 'WS': '', 'IWC': '', 'BH': '', 'AG': '', 'WE': '', 'JR': '', 'RH': '', 'JG': '', 'GV': '', 'JK': '', 'LD': '', 'CW': '', 'WFW': '', 'PR': '', 'SJ': '', 'WD': '18-19+', 'RR': '', 'JH': '', 'MFW': '', 'WWR': '', 'IWR': '', 'CHG': '', 'TT': '', 'TWF': '', 'DR': '', 'FP': '', 'JM': '', 'PG': '', 'WAL': '', 'CT': '96.625', 'CNotes': '9', 'MY': '', 'PNotes': '', 'BeginConsume': '2018', 'EndConsume': '2046'},
{'iWine': '684674', 'Barcode': '0129197315', 'Location': '(pending)', 'Bin': '', 'Size': '750ml', 'Currency': 'EUR', 'ExchangeRate': '1', 'Valuation': '0', 'Price': '0', 'NativePrice': '0', 'NativePriceCurrency': 'EUR', 'StoreName': 'Unknown', 'PurchaseDate': '5/25/2020', 'BottleNote': '', 'Vintage': '2008', 'Wine': 'Pétrus', 'Locale': 'France, Bordeaux, Libournais, Pomerol', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Libournais', 'Appellation': 'Pomerol', 'Producer': 'Pétrus', 'SortProducer': 'Pétrus', 'Type': 'Red', 'Color': 'Red', 'Category': 'Dry', 'Varietal': 'Red Bordeaux Blend', 'MasterVarietal': 'Red Bordeaux Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'WA': '', 'WS': '', 'IWC': '', 'BH': '', 'AG': '', 'WE': '', 'JR': '', 'RH': '', 'JG': '', 'GV': '', 'JK': '', 'LD': '', 'CW': '', 'WFW': '', 'PR': '', 'SJ': '', 'WD': '18-19+', 'RR': '', 'JH': '', 'MFW': '', 'WWR': '', 'IWR': '', 'CHG': '', 'TT': '', 'TWF': '', 'DR': '', 'FP': '', 'JM': '', 'PG': '', 'WAL': '', 'CT': '96.625', 'CNotes': '9', 'MY': '', 'PNotes': '', 'BeginConsume': '2018', 'EndConsume': '2046'},
{'iWine': '684674', 'Barcode': '0129197316', 'Location': '(pending)', 'Bin': '', 'Size': '750ml', 'Currency': 'EUR', 'ExchangeRate': '1', 'Valuation': '0', 'Price': '0', 'NativePrice': '0', 'NativePriceCurrency': 'EUR', 'StoreName': 'Unknown', 'PurchaseDate': '5/25/2020', 'BottleNote': '', 'Vintage': '2008', 'Wine': 'Pétrus', 'Locale': 'France, Bordeaux, Libournais, Pomerol', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Libournais', 'Appellation': 'Pomerol', 'Producer': 'Pétrus', 'SortProducer': 'Pétrus', 'Type': 'Red', 'Color': 'Red', 'Category': 'Dry', 'Varietal': 'Red Bordeaux Blend', 'MasterVarietal': 'Red Bordeaux Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'WA': '', 'WS': '', 'IWC': '', 'BH': '', 'AG': '', 'WE': '', 'JR': '', 'RH': '', 'JG': '', 'GV': '', 'JK': '', 'LD': '', 'CW': '', 'WFW': '', 'PR': '', 'SJ': '', 'WD': '18-19+', 'RR': '', 'JH': '', 'MFW': '', 'WWR': '', 'IWR': '', 'CHG': '', 'TT': '', 'TWF': '', 'DR': '', 'FP': '', 'JM': '', 'PG': '', 'WAL': '', 'CT': '96.625', 'CNotes': '9', 'MY': '', 'PNotes': '', 'BeginConsume': '2018', 'EndConsume': '2046'},
{'iWine': '118542', 'Barcode': '0129196204', 'Location': 'Cellar', 'Bin': '', 'Size': '750ml', 'Currency': 'EUR', 'ExchangeRate': '1', 'Valuation': '3500', 'Price': '3500', 'NativePrice': '3500', 'NativePriceCurrency': 'EUR', 'StoreName': 'Unknown', 'PurchaseDate': '4/8/2020', 'BottleNote': '', 'Vintage': '2003', 'Wine': 'Domaine de la Romanée-Conti La Tâche', 'Locale': 'France, Burgundy, Côte de Nuits, La Tâche Grand Cru', 'Country': 'France', 'Region': 'Burgundy', 'SubRegion': 'Côte de Nuits', 'Appellation': 'La Tâche Grand Cru', 'Producer': 'Domaine de la Romanée-Conti', 'SortProducer': 'Romanée-Conti, Domaine de la ', 'Type': 'Red', 'Color': 'Red', 'Category': 'Dry', 'Varietal': 'Pinot Noir', 'MasterVarietal': 'Pinot Noir', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'WA': '', 'WS': '', 'IWC': '', 'BH': '', 'AG': '', 'WE': '', 'JR': '', 'RH': '', 'JG': '', 'GV': '', 'JK': '', 'LD': '', 'CW': '', 'WFW': '', 'PR': '', 'SJ': '', 'WD': '', 'RR': '', 'JH': '', 'MFW': '', 'WWR': '', 'IWR': '', 'CHG': '', 'TT': '', 'TWF': '', 'DR': '', 'FP': '', 'JM': '', 'PG': '', 'WAL': '', 'CT': '94.4117647058823', 'CNotes': '20', 'MY': '', 'PNotes': '', 'BeginConsume': '2013', 'EndConsume': '2029'},
{'iWine': '1367113', 'Barcode': '0129197436', 'Location': 'Cellar', 'Bin': '', 'Size': '750ml', 'Currency': 'EUR', 'ExchangeRate': '1', 'Valuation': '230', 'Price': '230', 'NativePrice': '230', 'NativePriceCurrency': 'EUR', 'StoreName': 'Unknown', 'PurchaseDate': '11/6/2019', 'BottleNote': '', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Sauternais', 'Appellation': 'Sauternes', 'Producer': "Château d'Yquem", 'SortProducer': "Yquem, Château d'", 'Type': 'White - Sweet/Dessert', 'Color': 'White', 'Category': 'Sweet/Dessert', 'Varietal': 'Sémillon-Sauvignon Blanc Blend', 'MasterVarietal': 'Sémillon-Sauvignon Blanc Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'WA': '', 'WS': '', 'IWC': '', 'BH': '', 'AG': '', 'WE': '', 'JR': '', 'RH': '', 'JG': '', 'GV': '', 'JK': '', 'LD': '', 'CW': '', 'WFW': '', 'PR': '', 'SJ': '', 'WD': '19-20', 'RR': '', 'JH': '', 'MFW': '', 'WWR': '', 'IWR': '', 'CHG': '', 'TT': '', 'TWF': '', 'DR': '', 'FP': '', 'JM': '', 'PG': '', 'WAL': '', 'CT': '95.9782608695652', 'CNotes': '55', 'MY': '', 'PNotes': '', 'BeginConsume': '2019', 'EndConsume': '2054'},
{'iWine': '1367113', 'Barcode': '0129197437', 'Location': 'Cellar', 'Bin': '', 'Size': '750ml', 'Currency': 'EUR', 'ExchangeRate': '1', 'Valuation': '230', 'Price': '230', 'NativePrice': '230', 'NativePriceCurrency': 'EUR', 'StoreName': 'Unknown', 'PurchaseDate': '11/6/2019', 'BottleNote': '', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Sauternais', 'Appellation': 'Sauternes', 'Producer': "Château d'Yquem", 'SortProducer': "Yquem, Château d'", 'Type': 'White - Sweet/Dessert', 'Color': 'White', 'Category': 'Sweet/Dessert', 'Varietal': 'Sémillon-Sauvignon Blanc Blend', 'MasterVarietal': 'Sémillon-Sauvignon Blanc Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'WA': '', 'WS': '', 'IWC': '', 'BH': '', 'AG': '', 'WE': '', 'JR': '', 'RH': '', 'JG': '', 'GV': '', 'JK': '', 'LD': '', 'CW': '', 'WFW': '', 'PR': '', 'SJ': '', 'WD': '19-20', 'RR': '', 'JH': '', 'MFW': '', 'WWR': '', 'IWR': '', 'CHG': '', 'TT': '', 'TWF': '', 'DR': '', 'FP': '', 'JM': '', 'PG': '', 'WAL': '', 'CT': '95.9782608695652', 'CNotes': '55', 'MY': '', 'PNotes': '', 'BeginConsume': '2019', 'EndConsume': '2054'},
{'iWine': '1367113', 'Barcode': '0129197438', 'Location': 'Cellar', 'Bin': '', 'Size': '750ml', 'Currency': 'EUR', 'ExchangeRate': '1', 'Valuation': '230', 'Price': '230', 'NativePrice': '230', 'NativePriceCurrency': 'EUR', 'StoreName': 'Unknown', 'PurchaseDate': '11/6/2019', 'BottleNote': '', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Sauternais', 'Appellation': 'Sauternes', 'Producer': "Château d'Yquem", 'SortProducer': "Yquem, Château d'", 'Type': 'White - Sweet/Dessert', 'Color': 'White', 'Category': 'Sweet/Dessert', 'Varietal': 'Sémillon-Sauvignon Blanc Blend', 'MasterVarietal': 'Sémillon-Sauvignon Blanc Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'WA': '', 'WS': '', 'IWC': '', 'BH': '', 'AG': '', 'WE': '', 'JR': '', 'RH': '', 'JG': '', 'GV': '', 'JK': '', 'LD': '', 'CW': '', 'WFW': '', 'PR': '', 'SJ': '', 'WD': '19-20', 'RR': '', 'JH': '', 'MFW': '', 'WWR': '', 'IWR': '', 'CHG': '', 'TT': '', 'TWF': '', 'DR': '', 'FP': '', 'JM': '', 'PG': '', 'WAL': '', 'CT': '95.9782608695652', 'CNotes': '55', 'MY': '', 'PNotes': '', 'BeginConsume': '2019', 'EndConsume': '2054'},
{'iWine': '1367113', 'Barcode': '0129197439', 'Location': 'Cellar', 'Bin': '', 'Size': '750ml', 'Currency': 'EUR', 'ExchangeRate': '1', 'Valuation': '230', 'Price': '230', 'NativePrice': '230', 'NativePriceCurrency': 'EUR', 'StoreName': 'Unknown', 'PurchaseDate': '11/6/2019', 'BottleNote': '', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Sauternais', 'Appellation': 'Sauternes', 'Producer': "Château d'Yquem", 'SortProducer': "Yquem, Château d'", 'Type': 'White - Sweet/Dessert', 'Color': 'White', 'Category': 'Sweet/Dessert', 'Varietal': 'Sémillon-Sauvignon Blanc Blend', 'MasterVarietal': 'Sémillon-Sauvignon Blanc Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'WA': '', 'WS': '', 'IWC': '', 'BH': '', 'AG': '', 'WE': '', 'JR': '', 'RH': '', 'JG': '', 'GV': '', 'JK': '', 'LD': '', 'CW': '', 'WFW': '', 'PR': '', 'SJ': '', 'WD': '19-20', 'RR': '', 'JH': '', 'MFW': '', 'WWR': '', 'IWR': '', 'CHG': '', 'TT': '', 'TWF': '', 'DR': '', 'FP': '', 'JM': '', 'PG': '', 'WAL': '', 'CT': '95.9782608695652', 'CNotes': '55', 'MY': '', 'PNotes': '', 'BeginConsume': '2019', 'EndConsume': '2054'},
{'iWine': '1367113', 'Barcode': '0129197440', 'Location': 'Cellar', 'Bin': '', 'Size': '750ml', 'Currency': 'EUR', 'ExchangeRate': '1', 'Valuation': '230', 'Price': '230', 'NativePrice': '230', 'NativePriceCurrency': 'EUR', 'StoreName': 'Unknown', 'PurchaseDate': '11/6/2019', 'BottleNote': '', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Sauternais', 'Appellation': 'Sauternes', 'Producer': "Château d'Yquem", 'SortProducer': "Yquem, Château d'", 'Type': 'White - Sweet/Dessert', 'Color': 'White', 'Category': 'Sweet/Dessert', 'Varietal': 'Sémillon-Sauvignon Blanc Blend', 'MasterVarietal': 'Sémillon-Sauvignon Blanc Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'WA': '', 'WS': '', 'IWC': '', 'BH': '', 'AG': '', 'WE': '', 'JR': '', 'RH': '', 'JG': '', 'GV': '', 'JK': '', 'LD': '', 'CW': '', 'WFW': '', 'PR': '', 'SJ': '', 'WD': '19-20', 'RR': '', 'JH': '', 'MFW': '', 'WWR': '', 'IWR': '', 'CHG': '', 'TT': '', 'TWF': '', 'DR': '', 'FP': '', 'JM': '', 'PG': '', 'WAL': '', 'CT': '95.9782608695652', 'CNotes': '55', 'MY': '', 'PNotes': '', 'BeginConsume': '2019', 'EndConsume': '2054'}
], data)
@requests_mock.Mocker()
def test_get_inventory_with_empty_result(self, m):
"""Test get inventory with empty result."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Inventory&Format=tab&Location=1"
file = open("./tests/fixtures/inventory_empty.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_inventory()
self.assertEqual([], data)
@requests_mock.Mocker()
def test_get_inventory_with_invalid_credentials(self, m):
"""Test get inventory with invalid credentials."""
url = "https://www.cellartracker.com/xlquery.asp?User=invalid-username&Password=invalid-password&Table=Inventory&Format=tab&Location=1"
file = open("./tests/fixtures/not_logged.html", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="invalid-username", password="invalid-password")
with self.assertRaises(AuthenticationError):
cellartracker.get_inventory()
@requests_mock.Mocker()
def test_get_inventory_with_error(self, m):
"""Test get inventory with error."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Inventory&Format=tab&Location=1"
m.register_uri("GET", url, exc=requests.exceptions.ConnectTimeout)
cellartracker = CellarTracker(username="test-username", password="test-password")
with self.assertRaises(CannotConnect):
cellartracker.get_inventory()
@requests_mock.Mocker()
def test_get_purchase(self, m):
"""Test get purchase."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Purchase&Format=tab&Location=1"
file = open("./tests/fixtures/purchase.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_purchase()
self.assertEqual([
{'iWine': '684674', 'iPurchase': '123799475', 'PurchaseDate': '5/25/2020', 'DeliveryDate': '5/25/2020', 'StoreName': 'Unknown', 'Currency': 'EUR', 'ExchangeRate': '1', 'Price': '0', 'NativePrice': '0', 'NativePriceCurrency': 'EUR', 'Quantity': '3', 'Remaining': '3', 'OrderNumber': '', 'Delivered': 'False', 'Size': '750ml', 'SortSize': '12', 'Vintage': '2008', 'Wine': 'Pétrus', 'SortWine': 'Pétrus', 'Locale': 'France, Bordeaux, Libournais, Pomerol', 'Type': 'Red', 'Color': 'Red', 'Category': 'Dry', 'Producer': 'Pétrus', 'Varietal': 'Red Bordeaux Blend', 'MasterVarietal': 'Red Bordeaux Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Libournais', 'Appellation': 'Pomerol', 'cLabels': '788'},
{'iWine': '118542', 'iPurchase': '123864434', 'PurchaseDate': '4/8/2020', 'DeliveryDate': '4/8/2020', 'StoreName': 'Unknown', 'Currency': 'EUR', 'ExchangeRate': '1', 'Price': '3500', 'NativePrice': '3500', 'NativePriceCurrency': 'EUR', 'Quantity': '2', 'Remaining': '1', 'OrderNumber': '', 'Delivered': 'True', 'Size': '750ml', 'SortSize': '12', 'Vintage': '2003', 'Wine': 'Domaine de la Romanée-Conti La Tâche', 'SortWine': 'Romanée-Conti, Domaine de la La Tâche', 'Locale': 'France, Burgundy, Côte de Nuits, La Tâche Grand Cru', 'Type': 'Red', 'Color': 'Red', 'Category': 'Dry', 'Producer': 'Domaine de la Romanée-Conti', 'Varietal': 'Pinot Noir', 'MasterVarietal': 'Pinot Noir', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'Country': 'France', 'Region': 'Burgundy', 'SubRegion': 'Côte de Nuits', 'Appellation': 'La Tâche Grand Cru', 'cLabels': '484'},
{'iWine': '1367113', 'iPurchase': '123864410', 'PurchaseDate': '11/6/2019', 'DeliveryDate': '11/6/2019', 'StoreName': 'Unknown', 'Currency': 'EUR', 'ExchangeRate': '1', 'Price': '230', 'NativePrice': '230', 'NativePriceCurrency': 'EUR', 'Quantity': '6', 'Remaining': '5', 'OrderNumber': '', 'Delivered': 'True', 'Size': '750ml', 'SortSize': '12', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'SortWine': "Yquem, Château d'", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Type': 'White - Sweet/Dessert', 'Color': 'White', 'Category': 'Sweet/Dessert', 'Producer': "Château d'Yquem", 'Varietal': 'Sémillon-Sauvignon Blanc Blend', 'MasterVarietal': 'Sémillon-Sauvignon Blanc Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Sauternais', 'Appellation': 'Sauternes', 'cLabels': '2199'}
], data)
@requests_mock.Mocker()
def test_get_purchase_with_empty_result(self, m):
"""Test get purchase with empty result."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Purchase&Format=tab&Location=1"
file = open("./tests/fixtures/purchase_empty.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_purchase()
self.assertEqual([], data)
@requests_mock.Mocker()
def test_get_purchase_with_invalid_credentials(self, m):
"""Test get purchase with invalid credentials."""
url = "https://www.cellartracker.com/xlquery.asp?User=invalid-username&Password=invalid-password&Table=Purchase&Format=tab&Location=1"
file = open("./tests/fixtures/not_logged.html", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="invalid-username", password="invalid-password")
with self.assertRaises(AuthenticationError):
cellartracker.get_purchase()
@requests_mock.Mocker()
def test_get_purchase_with_error(self, m):
"""Test get purchase with error."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Purchase&Format=tab&Location=1"
m.register_uri("GET", url, exc=requests.exceptions.ConnectTimeout)
cellartracker = CellarTracker(username="test-username", password="test-password")
with self.assertRaises(CannotConnect):
cellartracker.get_purchase()
@requests_mock.Mocker()
def test_get_pending(self, m):
"""Test get pending."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Pending&Format=tab&Location=1"
file = open("./tests/fixtures/pending.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_pending()
self.assertEqual([
{'iWine': '684674', 'iPurchase': '123799475', 'PurchaseDate': '5/25/2020', 'DeliveryDate': '5/25/2020', 'StoreName': 'Unknown', 'Currency': 'EUR', 'ExchangeRate': '1', 'Price': '0', 'NativePrice': '0', 'NativePriceCurrency': 'EUR', 'Quantity': '3', 'Remaining': '3', 'OrderNumber': '', 'Delivered': 'False', 'Size': '750ml', 'SortSize': '12', 'Vintage': '2008', 'Wine': 'Pétrus', 'SortWine': 'Pétrus', 'Locale': 'France, Bordeaux, Libournais, Pomerol', 'Type': 'Red', 'Color': 'Red', 'Category': 'Dry', 'Producer': 'Pétrus', 'Varietal': 'Red Bordeaux Blend', 'MasterVarietal': 'Red Bordeaux Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Libournais', 'Appellation': 'Pomerol', 'cLabels': '788'}
], data)
@requests_mock.Mocker()
def test_get_pending_with_empty_result(self, m):
"""Test get pending with empty result."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Pending&Format=tab&Location=1"
file = open("./tests/fixtures/pending_empty.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_pending()
self.assertEqual([], data)
@requests_mock.Mocker()
def test_get_pending_with_invalid_credentials(self, m):
"""Test get pending with invalid credentials."""
url = "https://www.cellartracker.com/xlquery.asp?User=invalid-username&Password=invalid-password&Table=Pending&Format=tab&Location=1"
file = open("./tests/fixtures/not_logged.html", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="invalid-username", password="invalid-password")
with self.assertRaises(AuthenticationError):
cellartracker.get_pending()
@requests_mock.Mocker()
def test_get_pending_with_error(self, m):
"""Test get pending with error."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Pending&Format=tab&Location=1"
m.register_uri("GET", url, exc=requests.exceptions.ConnectTimeout)
cellartracker = CellarTracker(username="test-username", password="test-password")
with self.assertRaises(CannotConnect):
cellartracker.get_pending()
@requests_mock.Mocker()
def test_get_consumed(self, m):
"""Test get consumed."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Consumed&Format=tab&Location=1"
file = open("./tests/fixtures/consumed.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_consumed()
self.assertEqual([
{'iConsumed': '129197435', 'iWine': '1367113', 'Type': 'White - Sweet/Dessert', 'Consumed': '5/21/2020', 'ConsumedYear': '2020', 'ConsumedQuarter': 'Q2', 'ConsumedMonth': '5', 'ConsumedDay': '21', 'ConsumedWeekday': '5', 'Size': '750ml', 'SortSize': '12', 'ShortType': 'Drank', 'Currency': 'EUR', 'ExchangeRate': '1', 'Value': '230', 'Price': '230', 'NativePrice': '230', 'NativePriceCurrency': 'EUR', 'MenuPrice': '0', 'cNotes': '0', 'iNote': '', 'cLabels': '2199', 'NativeRevenue': '0', 'NativeRevenueCurrency': 'EUR', 'Revenue': '0', 'RevenueCurrency': 'EUR', 'RevenueExchangeRate': '1', 'ConsumptionNote': 'Excellent!', 'PurchaseNote': '', 'BottleNote': '', 'Location': 'Cellar', 'Bin': '', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'SortWine': "Yquem, Château d'", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Color': 'White', 'Category': 'Sweet/Dessert', 'Varietal': 'Sémillon-Sauvignon Blanc Blend', 'MasterVarietal': 'Sémillon-Sauvignon Blanc Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Sauternais', 'Appellation': 'Sauternes'},
{'iConsumed': '129196205', 'iWine': '118542', 'Type': 'Red', 'Consumed': '5/1/2020', 'ConsumedYear': '2020', 'ConsumedQuarter': 'Q2', 'ConsumedMonth': '5', 'ConsumedDay': '1', 'ConsumedWeekday': '6', 'Size': '750ml', 'SortSize': '12', 'ShortType': 'Drank', 'Currency': 'EUR', 'ExchangeRate': '1', 'Value': '3500', 'Price': '3500', 'NativePrice': '3500', 'NativePriceCurrency': 'EUR', 'MenuPrice': '0', 'cNotes': '0', 'iNote': '', 'cLabels': '484', 'NativeRevenue': '0', 'NativeRevenueCurrency': 'EUR', 'Revenue': '0', 'RevenueCurrency': 'EUR', 'RevenueExchangeRate': '1', 'ConsumptionNote': 'Absolutely fantastic wine!', 'PurchaseNote': '', 'BottleNote': '', 'Location': 'Cellar', 'Bin': '', 'Vintage': '2003', 'Wine': 'Domaine de la Romanée-Conti La Tâche', 'SortWine': 'Romanée-Conti, Domaine de la La Tâche', 'Locale': 'France, Burgundy, Côte de Nuits, La Tâche Grand Cru', 'Color': 'Red', 'Category': 'Dry', 'Varietal': 'Pinot Noir', 'MasterVarietal': 'Pinot Noir', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'Country': 'France', 'Region': 'Burgundy', 'SubRegion': 'Côte de Nuits', 'Appellation': 'La Tâche Grand Cru'}
], data)
@requests_mock.Mocker()
def test_get_consumed_with_empty_result(self, m):
"""Test get consumed with empty result."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Consumed&Format=tab&Location=1"
file = open("./tests/fixtures/consumed_empty.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_consumed()
self.assertEqual([], data)
@requests_mock.Mocker()
def test_get_consumed_with_invalid_credentials(self, m):
"""Test get consumed with invalid credentials."""
url = "https://www.cellartracker.com/xlquery.asp?User=invalid-username&Password=invalid-password&Table=Consumed&Format=tab&Location=1"
file = open("./tests/fixtures/not_logged.html", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="invalid-username", password="invalid-password")
with self.assertRaises(AuthenticationError):
cellartracker.get_consumed()
@requests_mock.Mocker()
def test_get_consumed_with_error(self, m):
"""Test get consumed with error."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Consumed&Format=tab&Location=1"
m.register_uri("GET", url, exc=requests.exceptions.ConnectTimeout)
cellartracker = CellarTracker(username="test-username", password="test-password")
with self.assertRaises(CannotConnect):
cellartracker.get_consumed()
@requests_mock.Mocker()
def test_get_availability(self, m):
"""Test get availability."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Availability&Format=tab&Location=1"
file = open("./tests/fixtures/availability.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_availability()
self.assertEqual([
{'iWine': '684674', 'Type': 'Red', 'Color': 'Red', 'Category': 'Dry', 'Available': '8.93877551020408E-02', 'Linear': '0.248135209139836', 'Bell': '0.119183673469388', 'Early': '0.119183673469388', 'Late': '8.93877551020408E-02', 'Fast': '0.744897959183674', 'TwinPeak': '0.446938775510204', 'Simple': '0.111111111111111', 'Purchases': '0', 'ActualPurchases': '0', 'Pending': '3', 'ActualPending': '3', 'LocalQuantityActual': '0', 'LocalQuantity': '0', 'Consumed': '0', 'ActualConsumed': '0', 'Inventory': '3', 'ActualInventory': '3', 'Vintage': '2008', 'Wine': 'Pétrus', 'SortWine': 'Pétrus', 'Locale': 'France, Bordeaux, Libournais, Pomerol', 'Producer': 'Pétrus', 'Varietal': 'Red Bordeaux Blend', 'MasterVarietal': 'Red Bordeaux Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Libournais', 'Appellation': 'Pomerol', 'PersonalBegin': '', 'PersonalEnd': '', 'WABegin': '', 'WAEnd': '', 'WSBegin': '', 'WSEnd': '', 'IWCBegin': '', 'IWCEnd': '', 'AGBegin': '', 'AGEnd': '', 'TWFBegin': '', 'TWFEnd': '', 'BGBegin': '', 'BGEnd': '', 'WEBegin': '', 'WEEnd': '', 'JRBegin': '', 'JREnd': '', 'DRBegin': '', 'DREnd': '', 'PGBegin': '', 'PGEnd': '', 'WALBegin': '', 'WALEnd': '', 'FTLOPBegin': '', 'FTLOPEnd': '', 'JGBegin': '', 'JGEnd': '', 'ComBegin': '2018', 'ComEnd': '2046', 'BeginConsume': '1/1/2018', 'EndConsume': '12/31/2046', 'Source': 'Community', 'WA': '', 'WAWeb': '', 'WASort': '', 'WS': '', 'WSWeb': '', 'WSSort': '', 'BG': '', 'BGWeb': '', 'BGSort': '', 'IWC': '', 'IWCWeb': '', 'IWCSort': '', 'AG': '', 'AGWeb': '', 'AGSort': '', 'FTLOP': '', 'FTLOPWeb': '', 'FTLOPSort': '', 'BR': '', 'BRWeb': '', 'BRSort': '', 'GV': '', 'GVWeb': '', 'GVSort': '', 'LF': '', 'LFWeb': '', 'LFSort': '', 'JK': '', 'JKWeb': '', 'JKSort': '', 'JG': '', 'JGWeb': '', 'JGSort': '', 'LD': '', 'LDWeb': '', 'LDSort': '', 'CW': '', 'CWWeb': '', 'CWSort': '', 'WE': '', 'WEWeb': '', 'WESort': '', 'JR': '', 'JRWeb': '', 'JRSort': '', 'WFW': '', 'WFWWeb': '', 'WFWSort': '', 'PR': '', 'PRWeb': '', 'PRSort': '', 'SJ': '', 'SJWeb': '', 'SJSort': '', 'WD': '18-19+', 'WDWeb': 'http://www.thewinedoctor.com/bordeaux/petrus.shtml', 'WDSort': '94', 'GA': '', 'GAWeb': '', 'GASort': '', 'RR': '', 'RRWeb': '', 'RRSort': '', 'JH': '', 'JHWeb': '', 'JHSort': '', 'MFW': '', 'MFWWeb': '', 'MFWSort': '', 'WWR': '', 'WWRWeb': '', 'WWRSort': '', 'IWR': '', 'IWRWeb': '', 'IWRSort': '', 'CHG': '', 'CHGWeb': '', 'CHGSort': '', 'TT': '', 'TTWeb': '', 'TTSort': '', 'TWF': '', 'TWFWeb': '', 'TWFSort': '', 'DR': '', 'DRWeb': '', 'DRSort': '', 'FP': '', 'FPWeb': '', 'FPSort': '', 'JM': '', 'JMWeb': '', 'JMSort': '', 'PG': '', 'PGWeb': '', 'PGSort': '', 'WAL': '', 'WALWeb': '', 'WALSort': '', 'PNotes': '', 'PScore': '', 'PScoreSort': '', 'CNotes': '9', 'CScore': '96.625', 'CScoreSort': '96.625'},
{'iWine': '118542', 'Type': 'Red', 'Color': 'Red', 'Category': 'Dry', 'Available': '-0.186046511627907', 'Linear': '-0.12951030927835', 'Bell': '-0.186046511627907', 'Early': '0.247209302325581', 'Late': '-0.541782945736434', 'Fast': '0.571472868217054', 'TwinPeak': '-0.202790697674418', 'Simple': '0.1', 'Purchases': '2', 'ActualPurchases': '2', 'Pending': '0', 'ActualPending': '0', 'LocalQuantityActual': '1', 'LocalQuantity': '1', 'Consumed': '1', 'ActualConsumed': '1', 'Inventory': '1', 'ActualInventory': '1', 'Vintage': '2003', 'Wine': 'Domaine de la Romanée-Conti La Tâche', 'SortWine': 'Romanée-Conti, Domaine de la La Tâche', 'Locale': 'France, Burgundy, Côte de Nuits, La Tâche Grand Cru', 'Producer': 'Domaine de la Romanée-Conti', 'Varietal': 'Pinot Noir', 'MasterVarietal': 'Pinot Noir', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'Country': 'France', 'Region': 'Burgundy', 'SubRegion': 'Côte de Nuits', 'Appellation': 'La Tâche Grand Cru', 'PersonalBegin': '', 'PersonalEnd': '', 'WABegin': '', 'WAEnd': '', 'WSBegin': '', 'WSEnd': '', 'IWCBegin': '', 'IWCEnd': '', 'AGBegin': '', 'AGEnd': '', 'TWFBegin': '', 'TWFEnd': '', 'BGBegin': '', 'BGEnd': '', 'WEBegin': '', 'WEEnd': '', 'JRBegin': '', 'JREnd': '', 'DRBegin': '', 'DREnd': '', 'PGBegin': '', 'PGEnd': '', 'WALBegin': '', 'WALEnd': '', 'FTLOPBegin': '', 'FTLOPEnd': '', 'JGBegin': '', 'JGEnd': '', 'ComBegin': '2013', 'ComEnd': '2029', 'BeginConsume': '1/1/2013', 'EndConsume': '12/31/2029', 'Source': 'Community', 'WA': '', 'WAWeb': '', 'WASort': '', 'WS': '', 'WSWeb': '', 'WSSort': '', 'BG': '', 'BGWeb': '', 'BGSort': '', 'IWC': '', 'IWCWeb': '', 'IWCSort': '', 'AG': '', 'AGWeb': '', 'AGSort': '', 'FTLOP': '', 'FTLOPWeb': '', 'FTLOPSort': '', 'BR': '', 'BRWeb': 'http://www.wine-searcher.com/find/conti+tache/2003/ANY/USD?referring_site=BRP', 'BRSort': '0', 'GV': '', 'GVWeb': '', 'GVSort': '', 'LF': '', 'LFWeb': '', 'LFSort': '', 'JK': '', 'JKWeb': '', 'JKSort': '', 'JG': '', 'JGWeb': '', 'JGSort': '', 'LD': '', 'LDWeb': '', 'LDSort': '', 'CW': '', 'CWWeb': '', 'CWSort': '', 'WE': '', 'WEWeb': '', 'WESort': '', 'JR': '', 'JRWeb': '', 'JRSort': '', 'WFW': '', 'WFWWeb': '', 'WFWSort': '', 'PR': '', 'PRWeb': '', 'PRSort': '', 'SJ': '', 'SJWeb': '', 'SJSort': '', 'WD': '', 'WDWeb': '', 'WDSort': '', 'GA': '', 'GAWeb': '', 'GASort': '', 'RR': '', 'RRWeb': '', 'RRSort': '', 'JH': '', 'JHWeb': '', 'JHSort': '', 'MFW': '', 'MFWWeb': '', 'MFWSort': '', 'WWR': '', 'WWRWeb': '', 'WWRSort': '', 'IWR': '', 'IWRWeb': '', 'IWRSort': '', 'CHG': '', 'CHGWeb': '', 'CHGSort': '', 'TT': '', 'TTWeb': '', 'TTSort': '', 'TWF': '', 'TWFWeb': '', 'TWFSort': '', 'DR': '', 'DRWeb': '', 'DRSort': '', 'FP': '', 'FPWeb': '', 'FPSort': '', 'JM': '', 'JMWeb': '', 'JMSort': '', 'PG': '', 'PGWeb': '', 'PGSort': '', 'WAL': '', 'WALWeb': '', 'WALSort': '', 'PNotes': '', 'PScore': '', 'PScoreSort': '', 'CNotes': '20', 'CScore': '94.4117647058823', 'CScoreSort': '94.4117647058823'},
{'iWine': '1367113', 'Type': 'White - Sweet/Dessert', 'Color': 'White', 'Category': 'Sweet/Dessert', 'Available': '-0.766808640097353', 'Linear': '-0.766808640097353', 'Bell': '-0.888', 'Early': '-0.888', 'Late': '-0.916', 'Fast': '-0.3', 'TwinPeak': '-0.58', 'Simple': '0.142857142857143', 'Purchases': '6', 'ActualPurchases': '6', 'Pending': '0', 'ActualPending': '0', 'LocalQuantityActual': '5', 'LocalQuantity': '5', 'Consumed': '1', 'ActualConsumed': '1', 'Inventory': '5', 'ActualInventory': '5', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'SortWine': "Yquem, Château d'", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Producer': "Château d'Yquem", 'Varietal': 'Sémillon-Sauvignon Blanc Blend', 'MasterVarietal': 'Sémillon-Sauvignon Blanc Blend', 'Designation': 'Unknown', 'Vineyard': 'Unknown', 'Country': 'France', 'Region': 'Bordeaux', 'SubRegion': 'Sauternais', 'Appellation': 'Sauternes', 'PersonalBegin': '', 'PersonalEnd': '', 'WABegin': '', 'WAEnd': '', 'WSBegin': '', 'WSEnd': '', 'IWCBegin': '', 'IWCEnd': '', 'AGBegin': '', 'AGEnd': '', 'TWFBegin': '', 'TWFEnd': '', 'BGBegin': '', 'BGEnd': '', 'WEBegin': '', 'WEEnd': '', 'JRBegin': '', 'JREnd': '', 'DRBegin': '', 'DREnd': '', 'PGBegin': '', 'PGEnd': '', 'WALBegin': '', 'WALEnd': '', 'FTLOPBegin': '', 'FTLOPEnd': '', 'JGBegin': '', 'JGEnd': '', 'ComBegin': '2019', 'ComEnd': '2054', 'BeginConsume': '1/1/2019', 'EndConsume': '12/31/2054', 'Source': 'Community', 'WA': '', 'WAWeb': '', 'WASort': '', 'WS': '', 'WSWeb': '', 'WSSort': '', 'BG': '', 'BGWeb': '', 'BGSort': '', 'IWC': '', 'IWCWeb': '', 'IWCSort': '', 'AG': '', 'AGWeb': '', 'AGSort': '', 'FTLOP': '', 'FTLOPWeb': '', 'FTLOPSort': '', 'BR': '', 'BRWeb': '', 'BRSort': '', 'GV': '', 'GVWeb': '', 'GVSort': '', 'LF': '', 'LFWeb': '', 'LFSort': '', 'JK': '', 'JKWeb': '', 'JKSort': '', 'JG': '', 'JGWeb': '', 'JGSort': '', 'LD': '', 'LDWeb': '', 'LDSort': '', 'CW': '', 'CWWeb': '', 'CWSort': '', 'WE': '', 'WEWeb': '', 'WESort': '', 'JR': '', 'JRWeb': '', 'JRSort': '', 'WFW': '', 'WFWWeb': '', 'WFWSort': '', 'PR': '', 'PRWeb': '', 'PRSort': '', 'SJ': '', 'SJWeb': '', 'SJSort': '', 'WD': '19-20', 'WDWeb': 'http://www.thewinedoctor.com/bordeaux/yquem.shtml', 'WDSort': '96', 'GA': '', 'GAWeb': '', 'GASort': '', 'RR': '', 'RRWeb': '', 'RRSort': '', 'JH': '', 'JHWeb': '', 'JHSort': '', 'MFW': '', 'MFWWeb': '', 'MFWSort': '', 'WWR': '', 'WWRWeb': '', 'WWRSort': '', 'IWR': '', 'IWRWeb': '', 'IWRSort': '', 'CHG': '', 'CHGWeb': '', 'CHGSort': '', 'TT': '', 'TTWeb': '', 'TTSort': '', 'TWF': '', 'TWFWeb': '', 'TWFSort': '', 'DR': '', 'DRWeb': '', 'DRSort': '', 'FP': '', 'FPWeb': '', 'FPSort': '', 'JM': '', 'JMWeb': '', 'JMSort': '', 'PG': '', 'PGWeb': '', 'PGSort': '', 'WAL': '', 'WALWeb': '', 'WALSort': '', 'PNotes': '', 'PScore': '', 'PScoreSort': '', 'CNotes': '55', 'CScore': '95.9782608695652', 'CScoreSort': '95.9782608695652'}
], data)
@requests_mock.Mocker()
def test_get_availability_with_empty_result(self, m):
"""Test get availability with empty result."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Availability&Format=tab&Location=1"
file = open("./tests/fixtures/availability_empty.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_availability()
self.assertEqual([], data)
@requests_mock.Mocker()
def test_get_availability_with_invalid_credentials(self, m):
"""Test get availability with invalid credentials."""
url = "https://www.cellartracker.com/xlquery.asp?User=invalid-username&Password=invalid-password&Table=Availability&Format=tab&Location=1"
file = open("./tests/fixtures/not_logged.html", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="invalid-username", password="invalid-password")
with self.assertRaises(AuthenticationError):
cellartracker.get_availability()
@requests_mock.Mocker()
def test_get_availability_with_error(self, m):
"""Test get availability with error."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Availability&Format=tab&Location=1"
m.register_uri("GET", url, exc=requests.exceptions.ConnectTimeout)
cellartracker = CellarTracker(username="test-username", password="test-password")
with self.assertRaises(CannotConnect):
cellartracker.get_availability()
@requests_mock.Mocker()
def test_get_bottles(self, m):
"""Test get bottles."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Bottles&Format=tab&Location=1"
file = open("./tests/fixtures/bottles.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_bottles()
self.assertEqual([
{'BottleState': '-1', 'iWine': '684674', 'Vintage': '2008', 'Wine': 'Pétrus', 'Locale': 'France, Bordeaux, Libournais, Pomerol', 'Quantity': '1', 'BottleSize': '750ml', 'Location': '(n/a)', 'Bin': '', 'Store': 'Unknown', 'PurchaseDate': '5/25/2020', 'DeliveryDate': '5/25/2020', 'BottleCost': '0', 'BottleCostCurrency': 'EUR', 'BottleNote': '', 'PurchaseNote': '', 'ConsumptionDate': '', 'ConsumptionType': '', 'ShortType': '', 'ConsumptionNote': '', 'ConsumptionRevenue': '', 'ConsumptionRevenueCurrency': ''},
{'BottleState': '-1', 'iWine': '684674', 'Vintage': '2008', 'Wine': 'Pétrus', 'Locale': 'France, Bordeaux, Libournais, Pomerol', 'Quantity': '1', 'BottleSize': '750ml', 'Location': '(n/a)', 'Bin': '', 'Store': 'Unknown', 'PurchaseDate': '5/25/2020', 'DeliveryDate': '5/25/2020', 'BottleCost': '0', 'BottleCostCurrency': 'EUR', 'BottleNote': '', 'PurchaseNote': '', 'ConsumptionDate': '', 'ConsumptionType': '', 'ShortType': '', 'ConsumptionNote': '', 'ConsumptionRevenue': '', 'ConsumptionRevenueCurrency': ''},
{'BottleState': '-1', 'iWine': '684674', 'Vintage': '2008', 'Wine': 'Pétrus', 'Locale': 'France, Bordeaux, Libournais, Pomerol', 'Quantity': '1', 'BottleSize': '750ml', 'Location': '(n/a)', 'Bin': '', 'Store': 'Unknown', 'PurchaseDate': '5/25/2020', 'DeliveryDate': '5/25/2020', 'BottleCost': '0', 'BottleCostCurrency': 'EUR', 'BottleNote': '', 'PurchaseNote': '', 'ConsumptionDate': '', 'ConsumptionType': '', 'ShortType': '', 'ConsumptionNote': '', 'ConsumptionRevenue': '', 'ConsumptionRevenueCurrency': ''},
{'BottleState': '0', 'iWine': '118542', 'Vintage': '2003', 'Wine': 'Domaine de la Romanée-Conti La Tâche', 'Locale': 'France, Burgundy, Côte de Nuits, La Tâche Grand Cru', 'Quantity': '1', 'BottleSize': '750ml', 'Location': 'Cellar', 'Bin': '', 'Store': 'Unknown', 'PurchaseDate': '4/8/2020', 'DeliveryDate': '4/8/2020', 'BottleCost': '3500', 'BottleCostCurrency': 'EUR', 'BottleNote': '', 'PurchaseNote': '', 'ConsumptionDate': '5/1/2020', 'ConsumptionType': 'Drank from my cellar', 'ShortType': 'Drank', 'ConsumptionNote': 'Absolutely fantastic wine!', 'ConsumptionRevenue': '', 'ConsumptionRevenueCurrency': ''},
{'BottleState': '0', 'iWine': '1367113', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Quantity': '1', 'BottleSize': '750ml', 'Location': 'Cellar', 'Bin': '', 'Store': 'Unknown', 'PurchaseDate': '11/6/2019', 'DeliveryDate': '11/6/2019', 'BottleCost': '230', 'BottleCostCurrency': 'EUR', 'BottleNote': '', 'PurchaseNote': '', 'ConsumptionDate': '5/21/2020', 'ConsumptionType': 'Drank from my cellar', 'ShortType': 'Drank', 'ConsumptionNote': 'Excellent!', 'ConsumptionRevenue': '', 'ConsumptionRevenueCurrency': ''},
{'BottleState': '1', 'iWine': '118542', 'Vintage': '2003', 'Wine': 'Domaine de la Romanée-Conti La Tâche', 'Locale': 'France, Burgundy, Côte de Nuits, La Tâche Grand Cru', 'Quantity': '1', 'BottleSize': '750ml', 'Location': 'Cellar', 'Bin': '', 'Store': 'Unknown', 'PurchaseDate': '4/8/2020', 'DeliveryDate': '4/8/2020', 'BottleCost': '3500', 'BottleCostCurrency': 'EUR', 'BottleNote': '', 'PurchaseNote': '', 'ConsumptionDate': '', 'ConsumptionType': '', 'ShortType': '', 'ConsumptionNote': '', 'ConsumptionRevenue': '', 'ConsumptionRevenueCurrency': ''},
{'BottleState': '1', 'iWine': '1367113', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Quantity': '1', 'BottleSize': '750ml', 'Location': 'Cellar', 'Bin': '', 'Store': 'Unknown', 'PurchaseDate': '11/6/2019', 'DeliveryDate': '11/6/2019', 'BottleCost': '230', 'BottleCostCurrency': 'EUR', 'BottleNote': '', 'PurchaseNote': '', 'ConsumptionDate': '', 'ConsumptionType': '', 'ShortType': '', 'ConsumptionNote': '', 'ConsumptionRevenue': '', 'ConsumptionRevenueCurrency': ''},
{'BottleState': '1', 'iWine': '1367113', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Quantity': '1', 'BottleSize': '750ml', 'Location': 'Cellar', 'Bin': '', 'Store': 'Unknown', 'PurchaseDate': '11/6/2019', 'DeliveryDate': '11/6/2019', 'BottleCost': '230', 'BottleCostCurrency': 'EUR', 'BottleNote': '', 'PurchaseNote': '', 'ConsumptionDate': '', 'ConsumptionType': '', 'ShortType': '', 'ConsumptionNote': '', 'ConsumptionRevenue': '', 'ConsumptionRevenueCurrency': ''},
{'BottleState': '1', 'iWine': '1367113', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Quantity': '1', 'BottleSize': '750ml', 'Location': 'Cellar', 'Bin': '', 'Store': 'Unknown', 'PurchaseDate': '11/6/2019', 'DeliveryDate': '11/6/2019', 'BottleCost': '230', 'BottleCostCurrency': 'EUR', 'BottleNote': '', 'PurchaseNote': '', 'ConsumptionDate': '', 'ConsumptionType': '', 'ShortType': '', 'ConsumptionNote': '', 'ConsumptionRevenue': '', 'ConsumptionRevenueCurrency': ''},
{'BottleState': '1', 'iWine': '1367113', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Quantity': '1', 'BottleSize': '750ml', 'Location': 'Cellar', 'Bin': '', 'Store': 'Unknown', 'PurchaseDate': '11/6/2019', 'DeliveryDate': '11/6/2019', 'BottleCost': '230', 'BottleCostCurrency': 'EUR', 'BottleNote': '', 'PurchaseNote': '', 'ConsumptionDate': '', 'ConsumptionType': '', 'ShortType': '', 'ConsumptionNote': '', 'ConsumptionRevenue': '', 'ConsumptionRevenueCurrency': ''},
{'BottleState': '1', 'iWine': '1367113', 'Vintage': '2011', 'Wine': "Château d'Yquem", 'Locale': 'France, Bordeaux, Sauternais, Sauternes', 'Quantity': '1', 'BottleSize': '750ml', 'Location': 'Cellar', 'Bin': '', 'Store': 'Unknown', 'PurchaseDate': '11/6/2019', 'DeliveryDate': '11/6/2019', 'BottleCost': '230', 'BottleCostCurrency': 'EUR', 'BottleNote': '', 'PurchaseNote': '', 'ConsumptionDate': '', 'ConsumptionType': '', 'ShortType': '', 'ConsumptionNote': '', 'ConsumptionRevenue': '', 'ConsumptionRevenueCurrency': ''}
], data)
@requests_mock.Mocker()
def test_get_bottles_with_empty_result(self, m):
"""Test get bottles with empty result."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Bottles&Format=tab&Location=1"
file = open("./tests/fixtures/bottles_empty.tsv", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="test-username", password="test-password")
data = cellartracker.get_bottles()
self.assertEqual([], data)
@requests_mock.Mocker()
def test_get_bottles_with_invalid_credentials(self, m):
"""Test get bottles with invalid credentials."""
url = "https://www.cellartracker.com/xlquery.asp?User=invalid-username&Password=invalid-password&Table=Bottles&Format=tab&Location=1"
file = open("./tests/fixtures/not_logged.html", "r")
m.register_uri("GET", url, status_code=200, text=file.read())
file.close
cellartracker = CellarTracker(username="invalid-username", password="invalid-password")
with self.assertRaises(AuthenticationError):
cellartracker.get_bottles()
@requests_mock.Mocker()
def test_get_bottles_with_error(self, m):
"""Test get bottles with error."""
url = "https://www.cellartracker.com/xlquery.asp?User=test-username&Password=test-password&Table=Bottles&Format=tab&Location=1"
m.register_uri("GET", url, exc=requests.exceptions.ConnectTimeout)
cellartracker = CellarTracker(username="test-username", password="test-password")
with self.assertRaises(CannotConnect):
cellartracker.get_bottles()
| 132.772846
| 2,966
| 0.594628
| 5,215
| 50,852
| 5.75302
| 0.084564
| 0.013066
| 0.027998
| 0.033598
| 0.924205
| 0.909739
| 0.891041
| 0.867775
| 0.84711
| 0.800213
| 0
| 0.046829
| 0.142079
| 50,852
| 382
| 2,967
| 133.120419
| 0.640865
| 0.020825
| 0
| 0.712281
| 0
| 0.101754
| 0.496917
| 0.020108
| 0
| 0
| 0
| 0
| 0.098246
| 1
| 0.105263
| false
| 0.196491
| 0.017544
| 0
| 0.126316
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
|
0
| 10
|
c0d72b5f07a5c138e3d70c780e97b2203070c0c8
| 20,806
|
py
|
Python
|
story7/grammarparser.py
|
bfoz/pegen
|
b397b789157a8ea4912d89c0b3835b698de53e87
|
[
"CNRI-Python-GPL-Compatible"
] | 169
|
2019-06-22T17:22:33.000Z
|
2020-05-04T18:36:55.000Z
|
story7/grammarparser.py
|
bfoz/pegen
|
b397b789157a8ea4912d89c0b3835b698de53e87
|
[
"CNRI-Python-GPL-Compatible"
] | 168
|
2019-06-25T01:26:09.000Z
|
2020-05-07T23:00:54.000Z
|
story7/grammarparser.py
|
bfoz/pegen
|
b397b789157a8ea4912d89c0b3835b698de53e87
|
[
"CNRI-Python-GPL-Compatible"
] | 20
|
2019-07-05T06:39:52.000Z
|
2020-02-24T05:38:41.000Z
|
# This is @generated code; do not edit!
from token import ENDMARKER, NAME, NEWLINE, NUMBER, STRING
from story7.memo import memoize, memoize_left_rec
from story7.node import Node
from story7.parser import Parser
from ast import literal_eval
from token import DEDENT, INDENT, OP
from story7.grammar import Grammar, Rule, Alt, NamedItem, Lookahead, Maybe, Loop, Cut
BaseParser = Parser
class Parser(BaseParser):
def __init__(self, tokenizer):
super().__init__(tokenizer)
self.extra_rules = []
def synthetic_rule(self, alts):
if len(alts) == 1 and len(alts[0].items) == 1:
return alts[0].items[0]
name = f"_synthetic_rule_{len(self.extra_rules)}"
rule = Rule(name, alts)
self.extra_rules.append(rule)
return rule.name
class GrammarParser(Parser):
@memoize
def start(self):
self.show_rule('start', [['grammar', 'ENDMARKER']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and (grammar := self.grammar()) is not None
and self.show_index(0, 1)
and (endmarker := self.expect(ENDMARKER)) is not None
):
self.show_index(0, 0, 2)
retval = grammar
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def grammar(self):
self.show_rule('grammar', [['metas', 'rules'], ['rules']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and (metas := self.metas()) is not None
and self.show_index(0, 1)
and (rules := self.rules()) is not None
):
self.show_index(0, 0, 2)
retval = Grammar ( rules + self . extra_rules , metas )
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and (rules := self.rules()) is not None
):
self.show_index(1, 0, 1)
retval = Grammar ( rules + self . extra_rules , [ ] )
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def metas(self):
self.show_rule('metas', [['meta', 'metas'], ['meta']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and (meta := self.meta()) is not None
and self.show_index(0, 1)
and (metas := self.metas()) is not None
):
self.show_index(0, 0, 2)
retval = [ meta ] + metas
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and (meta := self.meta()) is not None
):
self.show_index(1, 0, 1)
retval = [ meta ]
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def meta(self):
self.show_rule('meta', [['"@"', 'NAME', 'NEWLINE'], ['"@"', 'NAME', 'NAME', 'NEWLINE'], ['"@"', 'NAME', 'STRING', 'NEWLINE']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and self.expect("@") is not None
and self.show_index(0, 1)
and (name := self.expect(NAME)) is not None
and self.show_index(0, 2)
and (newline := self.expect(NEWLINE)) is not None
):
self.show_index(0, 0, 3)
retval = ( name . string , None )
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and self.expect("@") is not None
and self.show_index(1, 1)
and (name := self.expect(NAME)) is not None
and self.show_index(1, 2)
and (name1 := self.expect(NAME)) is not None
and self.show_index(1, 3)
and (newline := self.expect(NEWLINE)) is not None
):
self.show_index(1, 0, 4)
retval = ( name . string , name1 . string )
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(2, 0)
and self.expect("@") is not None
and self.show_index(2, 1)
and (name := self.expect(NAME)) is not None
and self.show_index(2, 2)
and (string := self.expect(STRING)) is not None
and self.show_index(2, 3)
and (newline := self.expect(NEWLINE)) is not None
):
self.show_index(2, 0, 4)
retval = ( name . string , literal_eval ( string . string ) )
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def rules(self):
self.show_rule('rules', [['rule', 'rules'], ['rule']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and (rule := self.rule()) is not None
and self.show_index(0, 1)
and (rules := self.rules()) is not None
):
self.show_index(0, 0, 2)
retval = [ rule ] + rules
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and (rule := self.rule()) is not None
):
self.show_index(1, 0, 1)
retval = [ rule ]
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def rule(self):
self.show_rule('rule', [['NAME', '":"', 'alts', 'NEWLINE', 'INDENT', 'more_alts', 'DEDENT'], ['NAME', '":"', 'NEWLINE', 'INDENT', 'more_alts', 'DEDENT'], ['NAME', '":"', 'alts', 'NEWLINE']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and (name := self.expect(NAME)) is not None
and self.show_index(0, 1)
and self.expect(":") is not None
and self.show_index(0, 2)
and (alts := self.alts()) is not None
and self.show_index(0, 3)
and (newline := self.expect(NEWLINE)) is not None
and self.show_index(0, 4)
and (indent := self.expect(INDENT)) is not None
and self.show_index(0, 5)
and (more_alts := self.more_alts()) is not None
and self.show_index(0, 6)
and (dedent := self.expect(DEDENT)) is not None
):
self.show_index(0, 0, 7)
retval = Rule ( name . string , alts + more_alts )
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and (name := self.expect(NAME)) is not None
and self.show_index(1, 1)
and self.expect(":") is not None
and self.show_index(1, 2)
and (newline := self.expect(NEWLINE)) is not None
and self.show_index(1, 3)
and (indent := self.expect(INDENT)) is not None
and self.show_index(1, 4)
and (more_alts := self.more_alts()) is not None
and self.show_index(1, 5)
and (dedent := self.expect(DEDENT)) is not None
):
self.show_index(1, 0, 6)
retval = Rule ( name . string , more_alts )
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(2, 0)
and (name := self.expect(NAME)) is not None
and self.show_index(2, 1)
and self.expect(":") is not None
and self.show_index(2, 2)
and (alts := self.alts()) is not None
and self.show_index(2, 3)
and (newline := self.expect(NEWLINE)) is not None
):
self.show_index(2, 0, 4)
retval = Rule ( name . string , alts )
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def more_alts(self):
self.show_rule('more_alts', [['"|"', 'alts', 'NEWLINE', 'more_alts'], ['"|"', 'alts', 'NEWLINE']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and self.expect("|") is not None
and self.show_index(0, 1)
and (alts := self.alts()) is not None
and self.show_index(0, 2)
and (newline := self.expect(NEWLINE)) is not None
and self.show_index(0, 3)
and (more_alts := self.more_alts()) is not None
):
self.show_index(0, 0, 4)
retval = alts + more_alts
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and self.expect("|") is not None
and self.show_index(1, 1)
and (alts := self.alts()) is not None
and self.show_index(1, 2)
and (newline := self.expect(NEWLINE)) is not None
):
self.show_index(1, 0, 3)
retval = alts
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def alts(self):
self.show_rule('alts', [['alt', '"|"', 'alts'], ['alt']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and (alt := self.alt()) is not None
and self.show_index(0, 1)
and self.expect("|") is not None
and self.show_index(0, 2)
and (alts := self.alts()) is not None
):
self.show_index(0, 0, 3)
retval = [ alt ] + alts
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and (alt := self.alt()) is not None
):
self.show_index(1, 0, 1)
retval = [ alt ]
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def alt(self):
self.show_rule('alt', [['items', 'action'], ['items']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and (items := self.items()) is not None
and self.show_index(0, 1)
and (action := self.action()) is not None
):
self.show_index(0, 0, 2)
retval = Alt ( items , action )
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and (items := self.items()) is not None
):
self.show_index(1, 0, 1)
retval = Alt ( items , None )
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def items(self):
self.show_rule('items', [['item', 'items'], ['item']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and (item := self.item()) is not None
and self.show_index(0, 1)
and (items := self.items()) is not None
):
self.show_index(0, 0, 2)
retval = [ item ] + items
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and (item := self.item()) is not None
):
self.show_index(1, 0, 1)
retval = [ item ]
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def item(self):
self.show_rule('item', [['NAME', "'='", 'molecule'], ['"&"', 'atom'], ['"!"', 'atom'], ['"~"'], ['molecule']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and (name := self.expect(NAME)) is not None
and self.show_index(0, 1)
and self.expect('=') is not None
and self.show_index(0, 2)
and (molecule := self.molecule()) is not None
):
self.show_index(0, 0, 3)
retval = NamedItem ( name . string , molecule )
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and self.expect("&") is not None
and self.show_index(1, 1)
and (atom := self.atom()) is not None
):
self.show_index(1, 0, 2)
retval = Lookahead ( atom )
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(2, 0)
and self.expect("!") is not None
and self.show_index(2, 1)
and (atom := self.atom()) is not None
):
self.show_index(2, 0, 2)
retval = Lookahead ( atom , False )
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(3, 0)
and self.expect("~") is not None
):
self.show_index(3, 0, 1)
retval = Cut ( )
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(4, 0)
and (molecule := self.molecule()) is not None
):
self.show_index(4, 0, 1)
retval = molecule
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def molecule(self):
self.show_rule('molecule', [['atom', '"?"'], ['atom', '"*"'], ['atom', '"+"'], ['atom'], ['"["', 'alts', '"]"']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and (atom := self.atom()) is not None
and self.show_index(0, 1)
and self.expect("?") is not None
):
self.show_index(0, 0, 2)
retval = Maybe ( atom )
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and (atom := self.atom()) is not None
and self.show_index(1, 1)
and self.expect("*") is not None
):
self.show_index(1, 0, 2)
retval = Loop ( atom )
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(2, 0)
and (atom := self.atom()) is not None
and self.show_index(2, 1)
and self.expect("+") is not None
):
self.show_index(2, 0, 2)
retval = Loop ( atom , True )
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(3, 0)
and (atom := self.atom()) is not None
):
self.show_index(3, 0, 1)
retval = atom
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(4, 0)
and self.expect("[") is not None
and self.show_index(4, 1)
and (alts := self.alts()) is not None
and self.show_index(4, 2)
and self.expect("]") is not None
):
self.show_index(4, 0, 3)
retval = Maybe ( self . synthetic_rule ( alts ) )
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def atom(self):
self.show_rule('atom', [['NAME'], ['STRING'], ['"("', 'alts', '")"']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and (name := self.expect(NAME)) is not None
):
self.show_index(0, 0, 1)
retval = name . string
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and (string := self.expect(STRING)) is not None
):
self.show_index(1, 0, 1)
retval = string . string
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(2, 0)
and self.expect("(") is not None
and self.show_index(2, 1)
and (alts := self.alts()) is not None
and self.show_index(2, 2)
and self.expect(")") is not None
):
self.show_index(2, 0, 3)
retval = self . synthetic_rule ( alts )
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def action(self):
self.show_rule('action', [['"{"', 'stuffs', '"}"']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and self.expect("{") is not None
and self.show_index(0, 1)
and (stuffs := self.stuffs()) is not None
and self.show_index(0, 2)
and self.expect("}") is not None
):
self.show_index(0, 0, 3)
retval = stuffs
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def stuffs(self):
self.show_rule('stuffs', [['stuff', 'stuffs'], ['stuff']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and (stuff := self.stuff()) is not None
and self.show_index(0, 1)
and (stuffs := self.stuffs()) is not None
):
self.show_index(0, 0, 2)
retval = stuff + " " + stuffs
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and (stuff := self.stuff()) is not None
):
self.show_index(1, 0, 1)
retval = stuff
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
@memoize
def stuff(self):
self.show_rule('stuff', [['"{"', 'stuffs', '"}"'], ['NAME'], ['NUMBER'], ['STRING'], ['!"}"', 'OP']])
pos = self.mark()
if (True
and self.show_index(0, 0)
and self.expect("{") is not None
and self.show_index(0, 1)
and (stuffs := self.stuffs()) is not None
and self.show_index(0, 2)
and self.expect("}") is not None
):
self.show_index(0, 0, 3)
retval = "{" + stuffs + "}"
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(1, 0)
and (name := self.expect(NAME)) is not None
):
self.show_index(1, 0, 1)
retval = name . string
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(2, 0)
and (number := self.expect(NUMBER)) is not None
):
self.show_index(2, 0, 1)
retval = number . string
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(3, 0)
and (string := self.expect(STRING)) is not None
):
self.show_index(3, 0, 1)
retval = string . string
if retval is not None:
return retval
self.reset(pos)
if (True
and self.show_index(4, 0)
and self.lookahead(False, self.expect, "}")
and self.show_index(4, 1)
and (op := self.expect(OP)) is not None
):
self.show_index(4, 0, 2)
retval = op . string
if retval is not None:
return retval
self.reset(pos)
self.show_index(0, 0, 0)
return None
| 33.236422
| 198
| 0.478852
| 2,628
| 20,806
| 3.71309
| 0.031963
| 0.137733
| 0.202501
| 0.15413
| 0.841361
| 0.827526
| 0.817073
| 0.812052
| 0.789813
| 0.784075
| 0
| 0.0299
| 0.400413
| 20,806
| 625
| 199
| 33.2896
| 0.752305
| 0.001778
| 0
| 0.79097
| 1
| 0
| 0.028314
| 0.001878
| 0
| 0
| 0
| 0
| 0
| 1
| 0.0301
| false
| 0
| 0.011706
| 0
| 0.145485
| 0
| 0
| 0
| 0
| null | 0
| 1
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 9
|
c0ed1fb2a35d1c358fc2f4f91c208795650a1cb7
| 180
|
py
|
Python
|
end-2-end/ProphetNet/prophetnet/__init__.py
|
13540148299/MUHACU
|
ae8f5e21f1e13ed9c6e79bd5dc9abaa1f1f82345
|
[
"MIT"
] | null | null | null |
end-2-end/ProphetNet/prophetnet/__init__.py
|
13540148299/MUHACU
|
ae8f5e21f1e13ed9c6e79bd5dc9abaa1f1f82345
|
[
"MIT"
] | null | null | null |
end-2-end/ProphetNet/prophetnet/__init__.py
|
13540148299/MUHACU
|
ae8f5e21f1e13ed9c6e79bd5dc9abaa1f1f82345
|
[
"MIT"
] | null | null | null |
import os
import sys
sys.path.insert(0, os.path.dirname(os.path.realpath(__file__)))
from . import translation
from . import ngram_s2s_model
from . import ngram_criterions
| 22.5
| 64
| 0.766667
| 27
| 180
| 4.851852
| 0.555556
| 0.229008
| 0.229008
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.012987
| 0.144444
| 180
| 7
| 65
| 25.714286
| 0.837662
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 0.833333
| 0
| 0.833333
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
f19bd96e124da957974860264ec11979cdcd67f3
| 11,971
|
py
|
Python
|
httprunner/testcasedb.py
|
zhaochencheng/httprunner_pro
|
aaa33d4b0214f94bd7a891f79f582601e58fed28
|
[
"Apache-2.0"
] | 4
|
2021-12-26T11:48:06.000Z
|
2022-03-21T03:35:54.000Z
|
httprunner/testcasedb.py
|
zhaochencheng/httprunner_pro
|
aaa33d4b0214f94bd7a891f79f582601e58fed28
|
[
"Apache-2.0"
] | null | null | null |
httprunner/testcasedb.py
|
zhaochencheng/httprunner_pro
|
aaa33d4b0214f94bd7a891f79f582601e58fed28
|
[
"Apache-2.0"
] | 1
|
2022-03-04T04:53:59.000Z
|
2022-03-04T04:53:59.000Z
|
from typing import Text, Any, Union
from httprunner.models import (
DataBase,
DataBaseConfig,
DataBaseValidate,
)
# =================================
# 数据库初始化
# =================================
class DBDeal(object):
def __init__(self):
self.__step_database = DataBase()
def mongo(self, host=None, port=None, user=None, password=None, database=None, **kwargs) -> "databaseDeal":
self.__step_database.dbconfig = DataBaseConfig(dbtype="mongo")
return databaseDeal(step_database=self.__step_database, host=host, port=port, user=user
, password=password, database=database, **kwargs)
def mysql(self, host=None, port=None, user=None, password=None, database=None, **kwargs) -> "databaseDeal":
self.__step_database.dbconfig = DataBaseConfig(dbtype="mysql")
return databaseDeal(step_database=self.__step_database, host=host, port=port, user=user
, password=password, database=database, **kwargs)
def redis_signle(self, host=None, port=None, database=None, **kwargs):
self.__step_database.dbconfig = DataBaseConfig(dbtype="redis_signle")
return databaseDeal(step_database=self.__step_database, host=host, port=port, database=database, **kwargs)
def redis_cluster(self, host=None, port=None, **kwargs):
self.__step_database.dbconfig = DataBaseConfig(dbtype="redis_cluster")
return databaseDeal(step_database=self.__step_database, host=host, port=port, **kwargs)
def redis_sentinel(self, host=None, port=None, database=None, **kwargs):
self.__step_database.dbconfig = DataBaseConfig(dbtype="redis_sentinel")
return databaseDeal(step_database=self.__step_database, host=host, port=port, database=database, **kwargs)
def perform(self) -> "DataBase":
return self.__step_database
class databaseDeal(object):
def __init__(self, step_database: "DataBase", host: Text = None, port: Text = None, user: Text = None,
password: Text = None, database: Text = None,
**kwargs):
self.__step_database = step_database
self.__step_database.dbconfig.host = host
self.__step_database.dbconfig.port = port
self.__step_database.dbconfig.user = user
self.__step_database.dbconfig.password = password
self.__step_database.dbconfig.database = database
self.__step_database.dbconfig.kwargs = kwargs
def with_variables(self, **variables) -> "databaseDeal":
self.__step_database.variables.update(variables)
return self
def exec(self, content: str, alias: str = "") -> "databaseDeal":
operate = {"content": content, "alias": alias}
self.__step_database.operate.append(operate)
return self
def extract(self) -> "DataBaseExtraction":
return DataBaseExtraction(self.__step_database)
def perform(self) -> "DataBase":
return self.__step_database
class DataBaseExtraction(object):
def __init__(self, step_database: "DataBase"):
self.__step_database = step_database
def with_jmespath(self, jmes_path: Text, var_name: Text) -> "DataBaseExtraction":
self.__step_database.extract[var_name] = jmes_path
return self
def perform(self) -> "DataBase":
return self.__step_database
# =================================
# 数据库校验
# =================================
class DBValidate(object):
def __init__(self):
self.__databaseconfig = DataBaseConfig()
self.__database = DataBase(dbconfig=self.__databaseconfig)
self.__db_validate = DataBaseValidate(**{"database": self.__database})
# self.__db_validate.database = self.__database
def mysql(self, host: Text = None, port: Text = None, user: Text = None,
password: Text = None, database: Text = None,
**kwargs) -> "databaseValidate":
self.__db_validate.database.dbconfig.dbtype = "mysql"
return databaseValidate(db_validate=self.__db_validate, host=host, port=port, user=user,
password=password,
database=database, **kwargs)
def mongo(self, host: Text = None, port: Text = None, user: Text = None,
password: Text = None, database: Text = None,
**kwargs) -> "databaseValidate":
self.__db_validate.database.dbconfig.dbtype = "mongo"
return databaseValidate(db_validate=self.__db_validate, host=host, port=port, user=user,
password=password,
database=database, **kwargs)
def redis_signle(self, host: Text = None, port: Text = None, database: Text = None,
**kwargs) -> "databaseValidate":
self.__db_validate.database.dbconfig.dbtype = "redis_signle"
return databaseValidate(db_validate=self.__db_validate, host=host, port=port,
database=database, **kwargs)
def redis_cluster(self, host: Text = None, port: Text = None, **kwargs) -> "databaseValidate":
self.__db_validate.database.dbconfig.dbtype = "redis_cluster"
return databaseValidate(db_validate=self.__db_validate, host=host, port=port, **kwargs)
def redis_sentinel(self, host: Text = None, port: Text = None, database: Text = None,
**kwargs) -> "databaseValidate":
self.__db_validate.database.dbconfig.dbtype = "redis_sentinel"
return databaseValidate(db_validate=self.__db_validate, host=host, port=port,
database=database, **kwargs)
def perform(self) -> "DataBaseValidate":
return self.__db_validate
class databaseValidate(databaseDeal):
def __init__(self, db_validate: "DataBaseValidate", **kwargs):
self.__db_validate = db_validate
super().__init__(step_database=self.__db_validate.database, **kwargs)
def extract(self) -> "ValidateExtraction":
return ValidateExtraction(self.__db_validate)
def validate(self) -> "DataBaseValidation":
return DataBaseValidation(db_validate=self.__db_validate)
def perform(self) -> "DataBaseValidate":
return self.__db_validate
class ValidateExtraction(DataBaseExtraction):
def __init__(self, db_validate: "DataBaseValidate"):
self.__db_validate = db_validate
super().__init__(step_database=self.__db_validate.database)
def validate(self) -> "DataBaseValidation":
return DataBaseValidation(db_validate=self.__db_validate)
def perform(self) -> "DataBaseValidate":
return self.__db_validate
class DataBaseValidation(object):
def __init__(self, db_validate: "DataBaseValidate"):
self.__db_validate = db_validate
def assert_equal(
self, jmes_path: Text, expected_value: Any, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"equal": [jmes_path, expected_value, message]}
)
return self
def assert_not_equal(
self, jmes_path: Text, expected_value: Any, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"not_equal": [jmes_path, expected_value, message]}
)
return self
def assert_greater_than(
self, jmes_path: Text, expected_value: Union[int, float], message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"greater_than": [jmes_path, expected_value, message]}
)
return self
def assert_less_than(
self, jmes_path: Text, expected_value: Union[int, float], message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"less_than": [jmes_path, expected_value, message]}
)
return self
def assert_greater_or_equals(
self, jmes_path: Text, expected_value: Union[int, float], message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"greater_or_equals": [jmes_path, expected_value, message]}
)
return self
def assert_less_or_equals(
self, jmes_path: Text, expected_value: Union[int, float], message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"less_or_equals": [jmes_path, expected_value, message]}
)
return self
def assert_length_equal(
self, jmes_path: Text, expected_value: int, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"length_equal": [jmes_path, expected_value, message]}
)
return self
def assert_length_greater_than(
self, jmes_path: Text, expected_value: int, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"length_greater_than": [jmes_path, expected_value, message]}
)
return self
def assert_length_less_than(
self, jmes_path: Text, expected_value: int, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"length_less_than": [jmes_path, expected_value, message]}
)
return self
def assert_length_greater_or_equals(
self, jmes_path: Text, expected_value: int, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"length_greater_or_equals": [jmes_path, expected_value, message]}
)
return self
def assert_length_less_or_equals(
self, jmes_path: Text, expected_value: int, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"length_less_or_equals": [jmes_path, expected_value, message]}
)
return self
def assert_string_equals(
self, jmes_path: Text, expected_value: Any, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"string_equals": [jmes_path, expected_value, message]}
)
return self
def assert_startswith(
self, jmes_path: Text, expected_value: Text, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"startswith": [jmes_path, expected_value, message]}
)
return self
def assert_endswith(
self, jmes_path: Text, expected_value: Text, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"endswith": [jmes_path, expected_value, message]}
)
return self
def assert_regex_match(
self, jmes_path: Text, expected_value: Text, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"regex_match": [jmes_path, expected_value, message]}
)
return self
def assert_contains(
self, jmes_path: Text, expected_value: Any, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"contains": [jmes_path, expected_value, message]}
)
return self
def assert_contained_by(
self, jmes_path: Text, expected_value: Any, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"contained_by": [jmes_path, expected_value, message]}
)
return self
def assert_type_match(
self, jmes_path: Text, expected_value: Any, message: Text = ""
) -> "DataBaseValidation":
self.__db_validate.validators.append(
{"type_match": [jmes_path, expected_value, message]}
)
return self
def perform(self) -> "DataBaseValidate":
return self.__db_validate
| 38.616129
| 114
| 0.638293
| 1,236
| 11,971
| 5.837379
| 0.067152
| 0.07623
| 0.087318
| 0.042134
| 0.832155
| 0.803049
| 0.797921
| 0.783091
| 0.770478
| 0.705336
| 0
| 0
| 0.243255
| 11,971
| 309
| 115
| 38.7411
| 0.796446
| 0.016206
| 0
| 0.518672
| 0
| 0
| 0.088538
| 0.003824
| 0
| 0
| 0
| 0
| 0.074689
| 1
| 0.20332
| false
| 0.041494
| 0.008299
| 0.045643
| 0.414938
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
9e3cc3621febcdcd95f195e3f2410d63b19b3789
| 18,594
|
py
|
Python
|
test/test_alerts.py
|
volfpeter/markyp-bootstrap4
|
1af5a1f9dc861a14323706ace28882ef6555739a
|
[
"MIT"
] | 21
|
2019-07-16T15:03:43.000Z
|
2021-11-16T10:51:58.000Z
|
test/test_alerts.py
|
volfpeter/markyp-bootstrap4
|
1af5a1f9dc861a14323706ace28882ef6555739a
|
[
"MIT"
] | null | null | null |
test/test_alerts.py
|
volfpeter/markyp-bootstrap4
|
1af5a1f9dc861a14323706ace28882ef6555739a
|
[
"MIT"
] | null | null | null |
from markyp_bootstrap4.alerts import alert, dismissable
def test_alert():
assert alert("Message", "Description", context="primary").markup ==\
'<div role="alert" class="alert alert-primary">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="primary", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-primary my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.primary("Message", "Description").markup ==\
'<div role="alert" class="alert alert-primary">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.primary("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-primary my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="secondary").markup ==\
'<div role="alert" class="alert alert-secondary">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="secondary", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-secondary my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.secondary("Message", "Description").markup ==\
'<div role="alert" class="alert alert-secondary">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.secondary("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-secondary my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="success").markup ==\
'<div role="alert" class="alert alert-success">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="success", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-success my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.success("Message", "Description").markup ==\
'<div role="alert" class="alert alert-success">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.success("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-success my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="danger").markup ==\
'<div role="alert" class="alert alert-danger">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="danger", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-danger my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.danger("Message", "Description").markup ==\
'<div role="alert" class="alert alert-danger">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.danger("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-danger my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="warning").markup ==\
'<div role="alert" class="alert alert-warning">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="warning", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-warning my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.warning("Message", "Description").markup ==\
'<div role="alert" class="alert alert-warning">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.warning("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-warning my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="info").markup ==\
'<div role="alert" class="alert alert-info">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="info", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-info my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.info("Message", "Description").markup ==\
'<div role="alert" class="alert alert-info">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.info("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-info my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="light").markup ==\
'<div role="alert" class="alert alert-light">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="light", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-light my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.light("Message", "Description").markup ==\
'<div role="alert" class="alert alert-light">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.light("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-light my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="dark").markup ==\
'<div role="alert" class="alert alert-dark">\n'\
'Message\nDescription\n'\
'</div>'
assert alert("Message", "Description", context="dark", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-dark my-alert">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.dark("Message", "Description").markup ==\
'<div role="alert" class="alert alert-dark">\n'\
'Message\nDescription\n'\
'</div>'
assert alert.dark("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-dark my-alert">\n'\
'Message\nDescription\n'\
'</div>'
def test_dismissable():
assert dismissable("Message", "Description", context="primary").markup ==\
'<div role="alert" class="alert alert-primary alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="primary", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-primary alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.primary("Message", "Description").markup ==\
'<div role="alert" class="alert alert-primary alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.primary("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-primary alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="secondary").markup ==\
'<div role="alert" class="alert alert-secondary alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="secondary", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-secondary alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.secondary("Message", "Description").markup ==\
'<div role="alert" class="alert alert-secondary alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.secondary("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-secondary alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="success").markup ==\
'<div role="alert" class="alert alert-success alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="success", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-success alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.success("Message", "Description").markup ==\
'<div role="alert" class="alert alert-success alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.success("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-success alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="danger").markup ==\
'<div role="alert" class="alert alert-danger alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="danger", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-danger alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.danger("Message", "Description").markup ==\
'<div role="alert" class="alert alert-danger alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.danger("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-danger alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="warning").markup ==\
'<div role="alert" class="alert alert-warning alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="warning", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-warning alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.warning("Message", "Description").markup ==\
'<div role="alert" class="alert alert-warning alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.warning("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-warning alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="info").markup ==\
'<div role="alert" class="alert alert-info alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="info", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-info alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.info("Message", "Description").markup ==\
'<div role="alert" class="alert alert-info alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.info("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-info alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="light").markup ==\
'<div role="alert" class="alert alert-light alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="light", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-light alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.light("Message", "Description").markup ==\
'<div role="alert" class="alert alert-light alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.light("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-light alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="dark").markup ==\
'<div role="alert" class="alert alert-dark alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable("Message", "Description", context="dark", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-dark alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.dark("Message", "Description").markup ==\
'<div role="alert" class="alert alert-dark alert-dismissible fade show">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
assert dismissable.dark("Message", "Description", class_="my-alert").markup ==\
'<div role="alert" class="alert alert-dark alert-dismissible fade show my-alert">\n'\
'Message\nDescription\n'\
'<button data-dismiss="alert" type="button" aria-label="Close" class="close">'\
'<span aria-hidden="true">×</span>'\
'</button>\n'\
'</div>'
| 49.983871
| 99
| 0.595515
| 2,093
| 18,594
| 5.27377
| 0.020067
| 0.104367
| 0.075376
| 0.104367
| 0.992934
| 0.992934
| 0.990397
| 0.990397
| 0.990397
| 0.990397
| 0
| 0.000067
| 0.197537
| 18,594
| 371
| 100
| 50.118598
| 0.739696
| 0
| 0
| 0.811268
| 0
| 0.135211
| 0.625363
| 0.132516
| 0
| 0
| 0
| 0
| 0.180282
| 1
| 0.005634
| true
| 0
| 0.002817
| 0
| 0.008451
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
|
0
| 9
|
9e76bce22db39d2069912e1c890cdd4ae2791ad7
| 418
|
py
|
Python
|
counter/models.py
|
markgardie/WebApp
|
f640c6416fa660e32f01f6a320e7eb5f606fe742
|
[
"MIT"
] | null | null | null |
counter/models.py
|
markgardie/WebApp
|
f640c6416fa660e32f01f6a320e7eb5f606fe742
|
[
"MIT"
] | null | null | null |
counter/models.py
|
markgardie/WebApp
|
f640c6416fa660e32f01f6a320e7eb5f606fe742
|
[
"MIT"
] | null | null | null |
from django.db import models
class Breakfast(models.Model):
product_name = models.CharField(max_length=30)
def __srt__(self):
return self.name
class Lunch(models.Model):
product_name = models.CharField(max_length=30)
def __srt__(self):
return self.name
class Dinner(models.Model):
product_name = models.CharField(max_length=30)
def __srt__(self):
return self.name
| 20.9
| 50
| 0.700957
| 56
| 418
| 4.910714
| 0.357143
| 0.12
| 0.196364
| 0.24
| 0.821818
| 0.821818
| 0.821818
| 0.821818
| 0.821818
| 0.821818
| 0
| 0.018018
| 0.203349
| 418
| 19
| 51
| 22
| 0.807808
| 0
| 0
| 0.692308
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.230769
| false
| 0
| 0.076923
| 0.230769
| 1
| 0
| 0
| 0
| 0
| null | 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 1
| 1
| 0
|
0
| 11
|
9e88e4f85cc6f7357a59417cca969a48da2ffc0e
| 148
|
py
|
Python
|
cowin/utils.py
|
its-K/cowin-api
|
6be685f9e66a257ecdc1e0014d6ecd8f5e0c93b0
|
[
"MIT"
] | 2
|
2021-05-25T10:47:07.000Z
|
2021-05-29T04:17:51.000Z
|
cowin/utils.py
|
its-K/cowin-api
|
6be685f9e66a257ecdc1e0014d6ecd8f5e0c93b0
|
[
"MIT"
] | null | null | null |
cowin/utils.py
|
its-K/cowin-api
|
6be685f9e66a257ecdc1e0014d6ecd8f5e0c93b0
|
[
"MIT"
] | null | null | null |
from datetime import datetime
from cowin.constants import Constants
def today() -> str:
return datetime.now().strftime(Constants.DD_MM_YYYY)
| 18.5
| 56
| 0.77027
| 20
| 148
| 5.6
| 0.7
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.141892
| 148
| 7
| 57
| 21.142857
| 0.88189
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.25
| true
| 0
| 0.5
| 0.25
| 1
| 0
| 1
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 1
| 1
| 1
| 0
|
0
| 7
|
7b7389bc53fe9888b2aacbd4d93431a18f9ff4f2
| 5,814
|
py
|
Python
|
scikitplot/tests/test_plotters.py
|
leozhoujf/scikit-plot
|
2dd3e6a76df77edcbd724c4db25575f70abb57cb
|
[
"MIT"
] | 2,360
|
2017-02-12T01:43:09.000Z
|
2022-03-31T10:06:31.000Z
|
scikitplot/tests/test_plotters.py
|
leozhoujf/scikit-plot
|
2dd3e6a76df77edcbd724c4db25575f70abb57cb
|
[
"MIT"
] | 79
|
2017-02-12T21:42:08.000Z
|
2022-02-28T03:00:44.000Z
|
scikitplot/tests/test_plotters.py
|
leozhoujf/scikit-plot
|
2dd3e6a76df77edcbd724c4db25575f70abb57cb
|
[
"MIT"
] | 302
|
2017-02-17T19:36:33.000Z
|
2022-01-28T16:22:06.000Z
|
from __future__ import absolute_import
import unittest
import scikitplot.plotters as skplt
from sklearn.datasets import load_iris as load_data
from sklearn.decomposition import PCA
import numpy as np
import matplotlib.pyplot as plt
class TestPlotPCAComponentVariance(unittest.TestCase):
def setUp(self):
np.random.seed(0)
self.X, self.y = load_data(return_X_y=True)
p = np.random.permutation(len(self.X))
self.X, self.y = self.X[p], self.y[p]
def tearDown(self):
plt.close("all")
def test_target_explained_variance(self):
np.random.seed(0)
clf = PCA()
clf.fit(self.X)
ax = skplt.plot_pca_component_variance(clf, target_explained_variance=0)
ax = skplt.plot_pca_component_variance(clf, target_explained_variance=0.5)
ax = skplt.plot_pca_component_variance(clf, target_explained_variance=1)
ax = skplt.plot_pca_component_variance(clf, target_explained_variance=1.5)
def test_fitted(self):
np.random.seed(0)
clf = PCA()
self.assertRaises(TypeError, skplt.plot_pca_component_variance, clf)
def test_ax(self):
np.random.seed(0)
clf = PCA()
clf.fit(self.X)
fig, ax = plt.subplots(1, 1)
out_ax = skplt.plot_pca_component_variance(clf)
assert ax is not out_ax
out_ax = skplt.plot_pca_component_variance(clf, ax=ax)
assert ax is out_ax
class TestPlotPCA2DProjection(unittest.TestCase):
def setUp(self):
np.random.seed(0)
self.X, self.y = load_data(return_X_y=True)
p = np.random.permutation(len(self.X))
self.X, self.y = self.X[p], self.y[p]
def tearDown(self):
plt.close("all")
def test_ax(self):
np.random.seed(0)
clf = PCA()
clf.fit(self.X)
fig, ax = plt.subplots(1, 1)
out_ax = skplt.plot_pca_2d_projection(clf, self.X, self.y)
assert ax is not out_ax
out_ax =skplt.plot_pca_2d_projection(clf, self.X, self.y, ax=ax)
assert ax is out_ax
def test_cmap(self):
np.random.seed(0)
clf = PCA()
clf.fit(self.X)
fig, ax = plt.subplots(1, 1)
ax = skplt.plot_pca_2d_projection(clf, self.X, self.y, cmap='Spectral')
ax = skplt.plot_pca_2d_projection(clf, self.X, self.y, cmap=plt.cm.Spectral)
class TestValidateLabels(unittest.TestCase):
def test_valid_equal(self):
known_labels = ["A", "B", "C"]
passed_labels = ["A", "B", "C"]
arg_name = "true_labels"
actual = skplt.validate_labels(known_labels, passed_labels, arg_name)
self.assertEqual(actual, None)
def test_valid_subset(self):
known_labels = ["A", "B", "C"]
passed_labels = ["A", "B"]
arg_name = "true_labels"
actual = skplt.validate_labels(known_labels, passed_labels, arg_name)
self.assertEqual(actual, None)
def test_invalid_one_duplicate(self):
known_labels = ["A", "B", "C"]
passed_labels = ["A", "B", "B"]
arg_name = "true_labels"
with self.assertRaises(ValueError) as context:
skplt.validate_labels(known_labels, passed_labels, arg_name)
msg = "The following duplicate labels were passed into true_labels: B"
self.assertEqual(msg, str(context.exception))
def test_invalid_two_duplicates(self):
known_labels = ["A", "B", "C"]
passed_labels = ["A", "B", "A", "B"]
arg_name = "true_labels"
with self.assertRaises(ValueError) as context:
skplt.validate_labels(known_labels, passed_labels, arg_name)
msg = "The following duplicate labels were passed into true_labels: A, B"
self.assertEqual(msg, str(context.exception))
def test_invalid_one_missing(self):
known_labels = ["A", "B", "C"]
passed_labels = ["A", "B", "D"]
arg_name = "true_labels"
with self.assertRaises(ValueError) as context:
skplt.validate_labels(known_labels, passed_labels, arg_name)
msg = "The following labels were passed into true_labels, but were not found in labels: D"
self.assertEqual(msg, str(context.exception))
def test_invalid_two_missing(self):
known_labels = ["A", "B", "C"]
passed_labels = ["A", "E", "B", "D"]
arg_name = "true_labels"
with self.assertRaises(ValueError) as context:
skplt.validate_labels(known_labels, passed_labels, arg_name)
msg = "The following labels were passed into true_labels, but were not found in labels: E, D"
self.assertEqual(msg, str(context.exception))
def test_numerical_labels(self):
known_labels = [0, 1, 2]
passed_labels = [0, 2]
arg_name = "true_labels"
actual = skplt.validate_labels(known_labels, passed_labels, arg_name)
self.assertEqual(actual, None)
def test_invalid_duplicate_numerical_labels(self):
known_labels = [0, 1, 2]
passed_labels = [0, 2, 2]
arg_name = "true_labels"
with self.assertRaises(ValueError) as context:
skplt.validate_labels(known_labels, passed_labels, arg_name)
msg = "The following duplicate labels were passed into true_labels: 2"
self.assertEqual(msg, str(context.exception))
def test_invalid_missing_numerical_labels(self):
known_labels = [0, 1, 2]
passed_labels = [0, 2, 3]
arg_name = "true_labels"
with self.assertRaises(ValueError) as context:
skplt.validate_labels(known_labels, passed_labels, arg_name)
msg = "The following labels were passed into true_labels, but were not found in labels: 3"
self.assertEqual(msg, str(context.exception))
if __name__ == '__main__':
unittest.main()
| 34
| 101
| 0.645167
| 797
| 5,814
| 4.479297
| 0.135508
| 0.055462
| 0.026891
| 0.039216
| 0.863866
| 0.863585
| 0.843978
| 0.826891
| 0.815686
| 0.788515
| 0
| 0.009777
| 0.24355
| 5,814
| 170
| 102
| 34.2
| 0.801955
| 0
| 0
| 0.612403
| 0
| 0
| 0.102511
| 0
| 0
| 0
| 0
| 0
| 0.155039
| 1
| 0.139535
| false
| 0.186047
| 0.054264
| 0
| 0.217054
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
|
0
| 7
|
7b7cd1b7ff2975e3688175ed16f24ba63c162035
| 2,593
|
py
|
Python
|
update_latest_signal_to40.py
|
orxg/patpred
|
0f092d54bd4b1ab8b9368bb4aad951ca4da5e529
|
[
"Apache-2.0"
] | null | null | null |
update_latest_signal_to40.py
|
orxg/patpred
|
0f092d54bd4b1ab8b9368bb4aad951ca4da5e529
|
[
"Apache-2.0"
] | null | null | null |
update_latest_signal_to40.py
|
orxg/patpred
|
0f092d54bd4b1ab8b9368bb4aad951ca4da5e529
|
[
"Apache-2.0"
] | null | null | null |
# -*- coding: utf-8 -*-
"""
Created on Mon Sep 17 15:33:45 2018
@author: ldh
该脚本将最新数据刷入40.
"""
# update_latest_signal_to40.py
from sqlalchemy.types import VARCHAR,DATETIME,INT,DECIMAL
from podaci.guosen.data import get_data,save_into_db,execute_session
#%% 日内
SQL_GET_LAST_SIGNAL_MINUTE = '''
SELECT
a.[stock_code]
,a.[target_date]
,[pred_dt]
,[signal_type]
,[signal_prob]
FROM LDH_pattern_pred_minute a
RIGHT JOIN (
SELECT
max(target_date) as target_date,
stock_code
FROM LDH_pattern_pred_minute
GROUP BY stock_code) b
ON a.target_date = b.target_date AND a.stock_code = b.stock_code
'''
intra_last_signal = get_data(SQL_GET_LAST_SIGNAL_MINUTE,'gb')
dtype_dict = {'stock_code':VARCHAR(10),
'target_date':VARCHAR(16),
'pred_dt':DATETIME,
'signal_type':INT, # (0为震荡,1为趋势)
'signal_prob':DECIMAL(10,6)}
save_into_db(intra_last_signal,'Yi_mgt_pattern_pred_minute_source',dtype_dict,'xiaoyi40',
'replace')
SQL_MERGE_SIGNAL_MINUTE = '''
MERGE INTO Yi_mgt_pattern_pred_minute as T
USING Yi_mgt_pattern_pred_minute_source as S
ON (T.target_date = S.target_date AND T.stock_code = S.stock_code)
WHEN NOT MATCHED BY TARGET
THEN INSERT
(stock_code,target_date,pred_dt,signal_type,signal_prob)
VALUES
(S.stock_code,S.target_date,S.pred_dt,S.signal_type,S.signal_prob)
WHEN NOT MATCHED BY SOURCE
THEN DELETE;
'''
execute_session(SQL_MERGE_SIGNAL_MINUTE,'xiaoyi40')
#%% 日间
SQL_GET_LAST_SIGNAL_DAILY = '''
SELECT
a.[stock_code]
,a.[target_date]
,[pred_dt]
,[signal_type]
,[signal_prob]
FROM LDH_pattern_pred_daily a
RIGHT JOIN (
SELECT
max(target_date) as target_date,
stock_code
FROM LDH_pattern_pred_daily
GROUP BY stock_code) b
ON a.target_date = b.target_date AND a.stock_code = b.stock_code
'''
daily_last_signal = get_data(SQL_GET_LAST_SIGNAL_DAILY,'gb')
dtype_dict = {'stock_code':VARCHAR(10),
'target_date':VARCHAR(16),
'pred_dt':DATETIME,
'signal_type':INT, # (0为震荡,1为趋势)
'signal_prob':DECIMAL(10,6)}
save_into_db(daily_last_signal,'Yi_mgt_pattern_pred_daily_source',dtype_dict,'xiaoyi40',
'replace')
SQL_MERGE_SIGNAL_DAILY = '''
MERGE INTO Yi_mgt_pattern_pred_daily as T
USING Yi_mgt_pattern_pred_daily_source as S
ON (T.target_date = S.target_date AND T.stock_code = S.stock_code)
WHEN NOT MATCHED BY TARGET
THEN INSERT
(stock_code,target_date,pred_dt,signal_type,signal_prob)
VALUES
(S.stock_code,S.target_date,S.pred_dt,S.signal_type,S.signal_prob)
WHEN NOT MATCHED BY SOURCE
THEN DELETE;
'''
execute_session(SQL_MERGE_SIGNAL_DAILY,'xiaoyi40')
| 28.494505
| 89
| 0.753182
| 426
| 2,593
| 4.211268
| 0.204225
| 0.100334
| 0.040134
| 0.053512
| 0.860089
| 0.811594
| 0.742475
| 0.715719
| 0.629877
| 0.629877
| 0
| 0.019239
| 0.138064
| 2,593
| 90
| 90
| 28.811111
| 0.783445
| 0.057462
| 0
| 0.736842
| 0
| 0.026316
| 0.63225
| 0.211847
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.026316
| 0
| 0.026316
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
c872c49c60747b0e07a750cdd22c813a62dc4237
| 3,969
|
py
|
Python
|
tests/test_repository_list.py
|
itcrab/contributions-graph
|
902b5cf081100577030654b2e7a20a6b4899651b
|
[
"MIT"
] | 2
|
2018-07-01T13:34:00.000Z
|
2019-05-16T20:41:33.000Z
|
tests/test_repository_list.py
|
itcrab/contributions-graph
|
902b5cf081100577030654b2e7a20a6b4899651b
|
[
"MIT"
] | 14
|
2018-07-02T12:12:07.000Z
|
2021-11-13T13:40:48.000Z
|
tests/test_repository_list.py
|
itcrab/contributions-graph
|
902b5cf081100577030654b2e7a20a6b4899651b
|
[
"MIT"
] | null | null | null |
import pytest
from contributions_graph.repository_list import RepositoryList
class TestRepositoryList:
def test_repository_list_case_1(self, repository_dicts):
repository_list = RepositoryList()
assert repository_list._repositories == []
assert repository_list._position == 0
assert repository_list._max_position == 0
repository_list.add(**repository_dicts[0])
assert repository_list._repositories == [repository_dicts[0]]
assert repository_list._position == 0
assert repository_list._max_position == 1
repository_list.add(**repository_dicts[1])
assert repository_list._repositories == [
repository_dicts[0],
repository_dicts[1],
]
assert repository_list._position == 0
assert repository_list._max_position == 2
repository_list.add(**repository_dicts[2])
assert repository_list._repositories == [
repository_dicts[0],
repository_dicts[1],
repository_dicts[2],
]
assert repository_list._position == 0
assert repository_list._max_position == 3
def test_repository_list_case_2(self, repository_dicts):
repository_list = RepositoryList()
assert repository_list._repositories == []
assert repository_list._position == 0
assert repository_list._max_position == 0
repository_list.add(**repository_dicts[0])
repository_list.add(**repository_dicts[1])
repository_list.add(**repository_dicts[2])
assert repository_list._repositories == [
repository_dicts[0],
repository_dicts[1],
repository_dicts[2],
]
assert repository_list._position == 0
assert repository_list._max_position == 3
next(repository_list)
assert repository_list._repositories == [
repository_dicts[0],
repository_dicts[1],
repository_dicts[2],
]
assert repository_list._position == 1
assert repository_list._max_position == 3
next(repository_list)
assert repository_list._repositories == [
repository_dicts[0],
repository_dicts[1],
repository_dicts[2],
]
assert repository_list._position == 2
assert repository_list._max_position == 3
next(repository_list)
assert repository_list._repositories == [
repository_dicts[0],
repository_dicts[1],
repository_dicts[2],
]
assert repository_list._position == 3
assert repository_list._max_position == 3
with pytest.raises(StopIteration):
next(repository_list)
def test_repository_list_case_3(self, repository_dicts):
repository_list = RepositoryList()
assert repository_list._repositories == []
assert repository_list._position == 0
assert repository_list._max_position == 0
repository_list.add(**repository_dicts[0])
repository_list.add(**repository_dicts[1])
repository_list.add(**repository_dicts[2])
assert repository_list._repositories == [
repository_dicts[0],
repository_dicts[1],
repository_dicts[2],
]
assert repository_list._position == 0
assert repository_list._max_position == 3
repository_list_values = [repo for repo in repository_list]
assert repository_list_values == [
repository_dicts[0],
repository_dicts[1],
repository_dicts[2],
]
assert repository_list._repositories == [
repository_dicts[0],
repository_dicts[1],
repository_dicts[2],
]
assert repository_list._position == 3
assert repository_list._max_position == 3
with pytest.raises(StopIteration):
next(repository_list)
| 34.215517
| 69
| 0.6387
| 398
| 3,969
| 5.969849
| 0.080402
| 0.353535
| 0.311448
| 0.161616
| 0.942761
| 0.896886
| 0.882576
| 0.862374
| 0.862374
| 0.862374
| 0
| 0.022043
| 0.279919
| 3,969
| 115
| 70
| 34.513043
| 0.809307
| 0
| 0
| 0.77551
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.377551
| 1
| 0.030612
| false
| 0
| 0.020408
| 0
| 0.061224
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 10
|
c8db2bc0e47da138d2b373a7ee1a22127490e3bd
| 37
|
py
|
Python
|
petrophys/vshale/__init__.py
|
smiles21/petrophys
|
03ccf2c65cd472013596b293cb2daaa95a1a05a6
|
[
"MIT"
] | null | null | null |
petrophys/vshale/__init__.py
|
smiles21/petrophys
|
03ccf2c65cd472013596b293cb2daaa95a1a05a6
|
[
"MIT"
] | null | null | null |
petrophys/vshale/__init__.py
|
smiles21/petrophys
|
03ccf2c65cd472013596b293cb2daaa95a1a05a6
|
[
"MIT"
] | null | null | null |
from .calc_vshale import calc_vshale
| 18.5
| 36
| 0.864865
| 6
| 37
| 5
| 0.666667
| 0.666667
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.108108
| 37
| 1
| 37
| 37
| 0.909091
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 1
| 0
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
c8f492e2f4b7c2064a89a1bfa19c08e0c5f11d2d
| 294
|
py
|
Python
|
examples/example.py
|
mozkzki/moz-youtube
|
e74cb17a618d5e73af5cf83d50ec349ac75e5113
|
[
"MIT"
] | null | null | null |
examples/example.py
|
mozkzki/moz-youtube
|
e74cb17a618d5e73af5cf83d50ec349ac75e5113
|
[
"MIT"
] | 1
|
2021-09-18T20:08:07.000Z
|
2021-09-18T20:08:07.000Z
|
examples/example.py
|
mozkzki/moz-youtube
|
e74cb17a618d5e73af5cf83d50ec349ac75e5113
|
[
"MIT"
] | null | null | null |
from moz_youtube import (
random_get_video,
get_video_match_today,
get_videos_within_x_day,
get_play_list,
)
def main() -> None:
random_get_video()
# get_video_match_today()
# get_videos_within_x_day()
# get_play_list()
if __name__ == "__main__":
main()
| 16.333333
| 31
| 0.680272
| 41
| 294
| 4.121951
| 0.487805
| 0.189349
| 0.16568
| 0.201183
| 0.733728
| 0.733728
| 0.733728
| 0.733728
| 0.733728
| 0.733728
| 0
| 0
| 0.221088
| 294
| 17
| 32
| 17.294118
| 0.737991
| 0.221088
| 0
| 0
| 0
| 0
| 0.035556
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.1
| true
| 0
| 0.1
| 0
| 0.2
| 0
| 0
| 0
| 0
| null | 0
| 0
| 1
| 0
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
cdb209c8da620dd38faadf817ab43c8d2efeba05
| 15,756
|
py
|
Python
|
src/project poker/mainmenus.py
|
acc-cosc-1336/cosc-1336-spring-2018-EricScotty
|
80c0249a583dc178cfc7bb95b851d7f3240dc3e9
|
[
"MIT"
] | null | null | null |
src/project poker/mainmenus.py
|
acc-cosc-1336/cosc-1336-spring-2018-EricScotty
|
80c0249a583dc178cfc7bb95b851d7f3240dc3e9
|
[
"MIT"
] | null | null | null |
src/project poker/mainmenus.py
|
acc-cosc-1336/cosc-1336-spring-2018-EricScotty
|
80c0249a583dc178cfc7bb95b851d7f3240dc3e9
|
[
"MIT"
] | null | null | null |
#partially written by Arturo Gonzalez one of the best teachers in the WORLD!! lolz
from customer_repository import CustomerRepository
from main_menu_actions import MainMenuActions
from atm import ATM
class MainMenu:
def __init__(self):
self.atm = ATM()
def __account_menu(self):
print("Select account: ")
print("1) Dealer")
print("2) Player")
print("3) Pot")
def __display_menu(self):
print("Dealer Menu")
print("1) Deposit")
print("2) Withdraw")
print("3) Distribute")
print("4) Back")
print("5) Next")
print("6) exit")
def __display_menu1(self):
print("Player Menu")
print("1) Bet")
print("2) Raise")
print("3) Call")
print("4) Fold")
print("5) player exit")
def __display_menu2(self):
print("Player Select")
print("1) Player 1")
print("2) Player 2")
print("3) Player 3")
print("4) Player 4")
print("5) Player 5")
print("6) Player 6")
print("7) Player 7")
print("8) Player 8")
print("9) Player 9")
print("10) Player 10")
print("11) Exit to Account Menu")
def __display_menu3(self):
print(bank_account.get_balance())
print(turn_log[-1])
print(betlog_log[-1])
print("4) Exit to Account Menu")
def run_atm(self):
choice = -1
self.__account_menu()
self.atm.account = int(input("Enter choice: "))
while self.atm.account = 1:
self.__display_menu()
choice = int(input("What do you want to do?"))
while choice != 6:
self.__display_menu()
choice = int(input("What do you want to do?"))
if choice == 1:
self.__display_menu2()
choice = int(input("What do you want to do?"))
if choice = 1:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[1]
elif choice = 2:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[2]
elif choice = 3:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[3]
elif choice = 4:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[4]
elif choice = 5:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[5]
elif choice = 6:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[6]
elif choice = 7:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[7]
elif choice = 8:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[8]
elif choice = 9:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[9]
elif choice = 10:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[10]
while choice !=11:
self.main_menu_actions.__handle_deposit()
elif choice == 2:
self.__display_menu2()
choice = int(input("What do you want to do?"))
if choice = 1:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[1]
elif choice = 2:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[2]
elif choice = 3:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[3]
elif choice = 4:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[4]
elif choice = 5:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[5]
elif choice = 6:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[6]
elif choice = 7:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[7]
elif choice = 8:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[8]
elif choice = 9:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[9]
elif choice = 10:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.
while choice !=11:
self.main_menu_actions.__handle_withdraw()
elif choice == 3:
self.__display_menu2()
choice = int(input("What do you want to do?"))
if choice = 1:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[1]
elif choice = 2:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[2]
elif choice = 3:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[3]
elif choice = 4:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[4]
elif choice = 5:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[5]
elif choice = 6:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[6]
elif choice = 7:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[7]
elif choice = 8:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[8]
elif choice = 9:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[9]
elif choice = 10:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[10]
while choice !=11:
self.main_menu_actions.__handle_distribute()
elif choice == 4:
self.__display_menu2()
choice = int(input("What do you want to do?"))
if choice = 1:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[1]
elif choice = 2:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[2]
elif choice = 3:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[3]
elif choice = 4:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[4]
elif choice = 5:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[5]
elif choice = 6:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[6]
elif choice = 7:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[7]
elif choice = 8:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[8]
elif choice = 9:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[9]
elif choice = 10:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[10]
while choice != 11:
self.main_menu_actions.__undo_last_action()
elif choice == 5:
self.__display_menu2()
choice = int(input("What do you want to do?"))
if choice = 1:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[1]
elif choice = 2:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[2]
elif choice = 3:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[3]
elif choice = 4:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[4]
elif choice = 5:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[5]
elif choice = 6:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[6]
elif choice = 7:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[7]
elif choice = 8:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[8]
elif choice = 9:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[9]
elif choice = 10:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[10]
while choice != 11:
self.main_menu_actions.__skip_action()
choice = -1
self.__display_menu()
self.main_menu_actions.atm.account = int(input("Enter choice: "))
while self.atm.account = 2:
self.__display_menu2()
choice = int(input("What do you want to do?"))
if choice = 1:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[1]
elif choice = 2:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[2]
elif choice = 3:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[3]
elif choice = 4:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[4]
elif choice = 5:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[5]
elif choice = 6:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[6]
elif choice = 7:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[7]
elif choice = 8:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[8]
elif choice = 9:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[9]
elif choice = 10:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[10]
while choice != 11:
self.__display_menu1()
choice = int(input("What do you want to do?"))
if choice == 1:
self.main_menu_actions.__bet()
elif choice == 2:
self.main_menu_actions.__raise()
elif choice == 3:
self.main_menu_actions.__call()
elif choice == 4:
self.main_menu_actions.__fold()
else choice = -1
self.__display_menu2()
self.main_menu_actions.atm.account = int(input("Enter choice: "))
while self.atm.account = 3:
self.__display_menu()
choice = int(input("What do you want to do?"))
while choice != 4:
self.main_menu_actions.atm.customer = self.main_menu_actions.atm.customer_repository.customers[12]
self.__display_menu3()
choice = int(input("What do you want to do?"))
if choice == 4:
choice = -1
self.__account_menu()
self.main_menu_actions.atm.account = int(input("Enter choice: "))
| 47.032836
| 135
| 0.508251
| 1,582
| 15,756
| 4.793932
| 0.054362
| 0.142405
| 0.267009
| 0.335707
| 0.882384
| 0.874077
| 0.868275
| 0.856408
| 0.851398
| 0.851398
| 0
| 0.023448
| 0.415334
| 15,756
| 334
| 136
| 47.173653
| 0.799826
| 0
| 0
| 0.708696
| 0
| 0
| 0.041724
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | null | 0
| 0.013043
| null | null | 0.143478
| 0
| 0
| 0
| null | 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 10
|
a817d4b8f7702dfd3a55b19cd2e4d31218abb3c2
| 240
|
py
|
Python
|
blender_plugin/Blueprint3DJSBPY/bp3dpy/core/utils.py
|
Yurii-Baluk/three.js
|
dac4518e57d6f5e5d5c55b9c51a0150afcc1abf6
|
[
"MIT"
] | null | null | null |
blender_plugin/Blueprint3DJSBPY/bp3dpy/core/utils.py
|
Yurii-Baluk/three.js
|
dac4518e57d6f5e5d5c55b9c51a0150afcc1abf6
|
[
"MIT"
] | null | null | null |
blender_plugin/Blueprint3DJSBPY/bp3dpy/core/utils.py
|
Yurii-Baluk/three.js
|
dac4518e57d6f5e5d5c55b9c51a0150afcc1abf6
|
[
"MIT"
] | null | null | null |
import math;
import random;
def uid():
def tS4():
return hex(math.floor((1.0 + random.uniform(0.0, 1.0)) * 0x10000))[2:];
return tS4() + tS4() + '-' + tS4() + '-' + tS4() + '-' + tS4() + '-' + tS4() + tS4() + tS4();
| 34.285714
| 97
| 0.454167
| 31
| 240
| 3.516129
| 0.451613
| 0.385321
| 0.495413
| 0.550459
| 0.220183
| 0.220183
| 0.220183
| 0
| 0
| 0
| 0
| 0.124294
| 0.2625
| 240
| 7
| 97
| 34.285714
| 0.491525
| 0
| 0
| 0
| 0
| 0
| 0.016598
| 0
| 0
| 0
| 0.029046
| 0
| 0
| 1
| 0.333333
| true
| 0
| 0.333333
| 0.166667
| 1
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 1
| 1
| 1
| 0
|
0
| 10
|
a82f9328853b8fe56ca731f061fc9923d06ac0b7
| 79
|
py
|
Python
|
pablo/agents/__init__.py
|
trstruth/pablo
|
ad56d6becc6e86e3c9ff723d8db8129160f06c13
|
[
"MIT"
] | null | null | null |
pablo/agents/__init__.py
|
trstruth/pablo
|
ad56d6becc6e86e3c9ff723d8db8129160f06c13
|
[
"MIT"
] | null | null | null |
pablo/agents/__init__.py
|
trstruth/pablo
|
ad56d6becc6e86e3c9ff723d8db8129160f06c13
|
[
"MIT"
] | null | null | null |
from pablo.agents.agent import Agent
from pablo.agents.naive import NaiveAgent
| 26.333333
| 41
| 0.848101
| 12
| 79
| 5.583333
| 0.583333
| 0.268657
| 0.447761
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.101266
| 79
| 2
| 42
| 39.5
| 0.943662
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
b51b9939e34bed1b63e403c1079c8288a088ef6d
| 20,586
|
py
|
Python
|
tests/test_rules_manager.py
|
pombredanne/PyRepScan
|
4de426681d5d6417bb9b6b2d8efa139bdcbcc794
|
[
"MIT"
] | 35
|
2020-03-13T13:47:26.000Z
|
2022-02-27T02:23:38.000Z
|
tests/test_rules_manager.py
|
pombredanne/PyRepScan
|
4de426681d5d6417bb9b6b2d8efa139bdcbcc794
|
[
"MIT"
] | 3
|
2020-03-17T07:54:25.000Z
|
2021-04-08T09:37:36.000Z
|
tests/test_rules_manager.py
|
pombredanne/PyRepScan
|
4de426681d5d6417bb9b6b2d8efa139bdcbcc794
|
[
"MIT"
] | 4
|
2021-05-16T15:25:55.000Z
|
2021-11-14T21:07:38.000Z
|
import unittest
import pyrepscan
class RulesManagerTestCase(
unittest.TestCase,
):
def test_should_scan_file_ignored_extensions(
self,
):
rules_manager = pyrepscan.RulesManager()
self.assertTrue(
expr=rules_manager.should_scan_file_path('file.txt'),
)
rules_manager.add_file_extension_to_skip('txt')
self.assertFalse(
expr=rules_manager.should_scan_file_path('file.txt'),
)
rules_manager.add_file_extension_to_skip('pdf')
self.assertFalse(
expr=rules_manager.should_scan_file_path('file.txt'),
)
self.assertFalse(
expr=rules_manager.should_scan_file_path('file.pdf'),
)
self.assertFalse(
expr=rules_manager.should_scan_file_path('file.other.pdf'),
)
self.assertTrue(
expr=rules_manager.should_scan_file_path('file.pdf.other'),
)
self.assertTrue(
expr=rules_manager.should_scan_file_path('file.doc'),
)
def test_should_scan_file_ignored_file_paths(
self,
):
rules_manager = pyrepscan.RulesManager()
self.assertTrue(
expr=rules_manager.should_scan_file_path('/site-packages/file.txt'),
)
rules_manager.add_file_path_to_skip('site-packages')
self.assertFalse(
expr=rules_manager.should_scan_file_path('/site-packages/file.txt'),
)
self.assertTrue(
expr=rules_manager.should_scan_file_path('/folder_one/subfolder/file.txt'),
)
rules_manager.add_file_path_to_skip('folder_one/subfolder')
self.assertFalse(
expr=rules_manager.should_scan_file_path('/folder_one/subfolder/file.txt'),
)
self.assertTrue(
expr=rules_manager.should_scan_file_path('/folder_one/sub/file.txt'),
)
rules_manager.add_file_path_to_skip('part/name')
self.assertFalse(
expr=rules_manager.should_scan_file_path('some_part/name_some'),
)
def test_add_content_rule_one(
self,
):
rules_manager = pyrepscan.RulesManager()
rules_manager.add_content_rule(
name='rule_one',
pattern=r'([a-z]+)',
whitelist_patterns=[],
blacklist_patterns=[],
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='',
content='first line\nsecond line\nthird line',
),
second=[
{
'match_text': 'first',
'rule_name': 'rule_one',
},
{
'match_text': 'line',
'rule_name': 'rule_one',
},
{
'match_text': 'second',
'rule_name': 'rule_one',
},
{
'match_text': 'line',
'rule_name': 'rule_one',
},
{
'match_text': 'third',
'rule_name': 'rule_one',
},
{
'match_text': 'line',
'rule_name': 'rule_one',
},
],
)
def test_add_content_rule_two(
self,
):
rules_manager = pyrepscan.RulesManager()
rules_manager.add_content_rule(
name='rule_one',
pattern=r'([a-z]+)',
whitelist_patterns=[],
blacklist_patterns=[
r'line',
],
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='',
content='first line\nsecond line\nthird line',
),
second=[
{
'match_text': 'first',
'rule_name': 'rule_one',
},
{
'match_text': 'second',
'rule_name': 'rule_one',
},
{
'match_text': 'third',
'rule_name': 'rule_one',
},
],
)
def test_add_content_rule_three(
self,
):
rules_manager = pyrepscan.RulesManager()
rules_manager.add_content_rule(
name='rule_one',
pattern=r'([a-z]+)',
whitelist_patterns=[
'second',
'third',
],
blacklist_patterns=[],
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='',
content='first line\nsecond line\nthird line',
),
second=[
{
'match_text': 'second',
'rule_name': 'rule_one',
},
{
'match_text': 'third',
'rule_name': 'rule_one',
},
],
)
def test_add_content_rule_four(
self,
):
rules_manager = pyrepscan.RulesManager()
rules_manager.add_content_rule(
name='rule_one',
pattern=r'([a-z]+)',
whitelist_patterns=[
'second',
'third',
],
blacklist_patterns=[
r'nd$',
],
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='',
content='first line\nsecond line\nthird line',
),
second=[
{
'match_text': 'third',
'rule_name': 'rule_one',
},
],
)
def test_add_content_rule_five(
self,
):
rules_manager = pyrepscan.RulesManager()
rules_manager.add_content_rule(
name='rule_one',
pattern=r'(nothing)',
whitelist_patterns=[],
blacklist_patterns=[],
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='',
content='first line\nsecond line\nthird line',
),
)
def test_add_content_rule_exceptions(
self,
):
rules_manager = pyrepscan.RulesManager()
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.add_content_rule(
name='',
pattern=r'regex',
whitelist_patterns=[],
blacklist_patterns=[],
)
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.add_content_rule(
name='rule_one',
pattern=r'',
whitelist_patterns=[],
blacklist_patterns=[],
)
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.add_content_rule(
name='rule_one',
pattern=r'(',
whitelist_patterns=[],
blacklist_patterns=[],
)
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.add_content_rule(
name='rule_one',
pattern=r'regex_pattern_without_capturing_group',
whitelist_patterns=[],
blacklist_patterns=[],
)
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.add_content_rule(
name='rule_two',
pattern=r'(content)',
whitelist_patterns=[],
blacklist_patterns=[
'(',
],
)
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.add_content_rule(
name='rule_two',
pattern=r'(content)',
whitelist_patterns=[],
blacklist_patterns=[
'(blacklist_regex_with_capturing_group)',
],
)
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.add_content_rule(
name='rule_two',
pattern=r'(content)',
whitelist_patterns=[
'(',
],
blacklist_patterns=[],
)
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.add_content_rule(
name='rule_two',
pattern=r'(content)',
whitelist_patterns=[
'(whitelist_regex_with_capturing_group)',
],
blacklist_patterns=[],
)
def test_add_file_path_rule_one(
self,
):
rules_manager = pyrepscan.RulesManager()
rules_manager.add_file_path_rule(
name='rule_one',
pattern=r'(prod|dev|stage).+key',
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='workdir/prod/some_file',
content=None,
),
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='workdir/prod/some_file.key',
content=None,
),
second=[
{
'match_text': 'workdir/prod/some_file.key',
'rule_name': 'rule_one',
},
],
)
rules_manager.add_file_path_rule(
name='rule_two',
pattern=r'prod.+key',
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='workdir/prod/some_file',
content=None,
),
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='workdir/prod/some_file.key',
content=None,
),
second=[
{
'match_text': 'workdir/prod/some_file.key',
'rule_name': 'rule_one',
},
{
'match_text': 'workdir/prod/some_file.key',
'rule_name': 'rule_two',
},
],
)
def test_add_file_path_rule_exceptions(
self,
):
rules_manager = pyrepscan.RulesManager()
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.add_file_path_rule(
name='',
pattern=r'regex',
)
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.add_file_path_rule(
name='rule_one',
pattern=r'',
)
def test_add_file_extension_to_skip_exceptions(
self,
):
rules_manager = pyrepscan.RulesManager()
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.add_file_extension_to_skip(
file_extension='',
)
def test_add_file_path_to_skip_exceptions(
self,
):
rules_manager = pyrepscan.RulesManager()
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.add_file_path_to_skip(
file_path='',
)
def test_scan_file_one(
self,
):
rules_manager = pyrepscan.RulesManager()
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='/path/to/file.txt',
content=None,
),
)
def test_scan_file_two(
self,
):
rules_manager = pyrepscan.RulesManager()
rules_manager.add_content_rule(
name='rule_one',
pattern=r'(some_text)',
whitelist_patterns=[],
blacklist_patterns=[],
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='/path/to/file.txt',
content=None,
),
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='',
),
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='other_text',
),
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='some_text',
),
second=[
{
'rule_name': 'rule_one',
'match_text': 'some_text',
},
],
)
rules_manager.add_content_rule(
name='rule_two',
pattern=r'(some)',
whitelist_patterns=[],
blacklist_patterns=[],
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='some_text',
),
second=[
{
'rule_name': 'rule_one',
'match_text': 'some_text',
},
{
'rule_name': 'rule_two',
'match_text': 'some',
},
],
)
def test_scan_file_three(
self,
):
rules_manager = pyrepscan.RulesManager()
rules_manager.add_content_rule(
name='rule_one',
pattern=r'(some_.+)',
whitelist_patterns=[],
blacklist_patterns=[
r'text',
],
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='some_text',
),
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='some_other',
),
second=[
{
'rule_name': 'rule_one',
'match_text': 'some_other',
},
],
)
def test_scan_file_four(
self,
):
rules_manager = pyrepscan.RulesManager()
rules_manager.add_content_rule(
name='rule_one',
pattern=r'(some_.+)',
whitelist_patterns=[],
blacklist_patterns=[
r'text',
r'other',
],
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='some_text',
),
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='some_other',
),
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='some_diff',
),
second=[
{
'rule_name': 'rule_one',
'match_text': 'some_diff',
},
],
)
def test_scan_file_five(
self,
):
rules_manager = pyrepscan.RulesManager()
rules_manager.add_content_rule(
name='rule_one',
pattern=r'(some_.+)',
whitelist_patterns=[
'diff',
],
blacklist_patterns=[],
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='some_text',
),
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='some_other',
),
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='some_diff',
),
second=[
{
'rule_name': 'rule_one',
'match_text': 'some_diff',
},
],
)
def test_scan_file_six(
self,
):
rules_manager = pyrepscan.RulesManager()
rules_manager.add_content_rule(
name='rule_one',
pattern=r'(some_.+)',
whitelist_patterns=[
'diff',
'other',
],
blacklist_patterns=[],
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='some_text',
),
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='some_other',
),
second=[
{
'rule_name': 'rule_one',
'match_text': 'some_other',
},
],
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='some_diff',
),
second=[
{
'rule_name': 'rule_one',
'match_text': 'some_diff',
},
],
)
def test_scan_file_seven(
self,
):
rules_manager = pyrepscan.RulesManager()
rules_manager.add_file_path_rule(
name='rule_one',
pattern=r'dev\.txt',
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='/path/to/file.txt',
content=None,
),
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='',
),
)
self.assertIsNone(
obj=rules_manager.scan_file(
file_path='/path/to/file.txt',
content='other_text',
),
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='/path/to/dev.txt',
content='',
),
second=[
{
'rule_name': 'rule_one',
'match_text': '/path/to/dev.txt',
},
],
)
rules_manager.add_file_path_rule(
name='rule_two',
pattern=r'(\.txt)',
)
self.assertEqual(
first=rules_manager.scan_file(
file_path='/path/to/dev.txt',
content='some_text',
),
second=[
{
'rule_name': 'rule_one',
'match_text': '/path/to/dev.txt',
},
{
'rule_name': 'rule_two',
'match_text': '/path/to/dev.txt',
},
],
)
def test_check_pattern(
self,
):
rules_manager = pyrepscan.RulesManager()
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.check_pattern(
content='',
pattern=r'(',
)
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.check_pattern(
content='',
pattern=r'no_capturing_group',
)
with self.assertRaises(
expected_exception=RuntimeError,
):
rules_manager.check_pattern(
content='',
pattern=r'(?:\:)',
)
self.assertEqual(
first=rules_manager.check_pattern(
content='some sentence',
pattern=r'([^ ]+)',
),
second=[
'some',
'sentence',
]
)
| 27.448
| 87
| 0.451278
| 1,680
| 20,586
| 5.184524
| 0.051786
| 0.137773
| 0.067509
| 0.067164
| 0.945121
| 0.928358
| 0.906315
| 0.903444
| 0.903444
| 0.880827
| 0
| 0
| 0.444768
| 20,586
| 749
| 88
| 27.484646
| 0.76203
| 0
| 0
| 0.726744
| 0
| 0
| 0.126882
| 0.021277
| 0
| 0
| 0
| 0
| 0.087209
| 1
| 0.02907
| false
| 0
| 0.002907
| 0
| 0.03343
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
b5b14c28240dfae809d0682523bde18975fddead
| 2,752
|
py
|
Python
|
goldsberry/sportvu/_SportVu2.py
|
motraor3/py-Goldsberry
|
fe238b07142cff64eda37e402bb003251af13f9b
|
[
"MIT"
] | 268
|
2015-07-28T18:49:06.000Z
|
2022-03-06T03:08:18.000Z
|
goldsberry/sportvu/_SportVu2.py
|
motraor3/py-Goldsberry
|
fe238b07142cff64eda37e402bb003251af13f9b
|
[
"MIT"
] | 24
|
2015-07-06T22:50:59.000Z
|
2021-07-05T05:10:26.000Z
|
goldsberry/sportvu/_SportVu2.py
|
motraor3/py-Goldsberry
|
fe238b07142cff64eda37e402bb003251af13f9b
|
[
"MIT"
] | 85
|
2015-08-08T17:45:28.000Z
|
2021-11-10T09:35:26.000Z
|
import goldsberry
class catch_and_shoot(goldsberry.masterclass.NbaDataProviderSportVu):
def __init__(self, season=goldsberry.apiparams.default_season, team=False):
url_modifier = 'catchShoot'
goldsberry.masterclass.NbaDataProviderSportVu.__init__(self, url_modifier, year=season, team=team)
class defense(goldsberry.masterclass.NbaDataProviderSportVu):
def __init__(self, season=goldsberry.apiparams.default_season, team=False):
url_modifier = 'defense'
goldsberry.masterclass.NbaDataProviderSportVu.__init__(self, url_modifier, year=season, team=team)
class drives(goldsberry.masterclass.NbaDataProviderSportVu):
def __init__(self, season=goldsberry.apiparams.default_season, team=False):
url_modifier = 'drives'
goldsberry.masterclass.NbaDataProviderSportVu.__init__(self, url_modifier, year=season, team=team)
class passing(goldsberry.masterclass.NbaDataProviderSportVu):
def __init__(self, season=goldsberry.apiparams.default_season, team=False):
url_modifier = 'passing'
goldsberry.masterclass.NbaDataProviderSportVu.__init__(self, url_modifier, year=season, team=team)
class touches(goldsberry.masterclass.NbaDataProviderSportVu):
def __init__(self, season=goldsberry.apiparams.default_season, team=False):
url_modifier = 'touches'
goldsberry.masterclass.NbaDataProviderSportVu.__init__(self, url_modifier, year=season, team=team)
class pull_up_shooting(goldsberry.masterclass.NbaDataProviderSportVu):
def __init__(self, season=goldsberry.apiparams.default_season, team=False):
url_modifier = 'pullUpShoot'
goldsberry.masterclass.NbaDataProviderSportVu.__init__(self, url_modifier, year=season, team=team)
class rebounding(goldsberry.masterclass.NbaDataProviderSportVu):
def __init__(self, season=goldsberry.apiparams.default_season, team=False):
url_modifier = 'rebounding'
goldsberry.masterclass.NbaDataProviderSportVu.__init__(self, url_modifier, year=season, team=team)
class shooting(goldsberry.masterclass.NbaDataProviderSportVu):
def __init__(self, season=goldsberry.apiparams.default_season, team=False):
url_modifier = 'shooting'
goldsberry.masterclass.NbaDataProviderSportVu.__init__(self, url_modifier, year=season, team=team)
class speed(goldsberry.masterclass.NbaDataProviderSportVu):
def __init__(self, season=goldsberry.apiparams.default_season, team=False):
url_modifier = 'speed'
goldsberry.masterclass.NbaDataProviderSportVu.__init__(self, url_modifier, year=season, team=team)
__all__ = ['catch_and_shoot', 'defense', 'drives', 'passing',
'touches', 'pull_up_shooting', 'rebounding', 'shooting',
'speed']
| 45.114754
| 106
| 0.773256
| 281
| 2,752
| 7.177936
| 0.11032
| 0.187407
| 0.383738
| 0.205255
| 0.884482
| 0.884482
| 0.884482
| 0.884482
| 0.884482
| 0.884482
| 0
| 0
| 0.127907
| 2,752
| 60
| 107
| 45.866667
| 0.840417
| 0
| 0
| 0.45
| 0
| 0
| 0.055233
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.225
| false
| 0.075
| 0.025
| 0
| 0.475
| 0
| 0
| 0
| 0
| null | 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 0
| 0
| 0
|
0
| 10
|
a98b1ff13113ec49cd618d43556df15c40fc5f9a
| 13,286
|
py
|
Python
|
tests/test_adjacency_matrix.py
|
lantunes/netomaton
|
fef60a787d031c9c7b1eb4ff990f7c12145579ef
|
[
"Apache-2.0"
] | 35
|
2018-12-07T14:11:29.000Z
|
2022-03-17T23:47:21.000Z
|
tests/test_adjacency_matrix.py
|
lantunes/netomaton
|
fef60a787d031c9c7b1eb4ff990f7c12145579ef
|
[
"Apache-2.0"
] | 2
|
2020-03-15T06:45:39.000Z
|
2020-04-15T23:50:13.000Z
|
tests/test_adjacency_matrix.py
|
lantunes/netomaton
|
fef60a787d031c9c7b1eb4ff990f7c12145579ef
|
[
"Apache-2.0"
] | 6
|
2019-10-18T08:47:32.000Z
|
2022-03-02T10:17:12.000Z
|
import os
import unittest
from netomaton.topology import adjacency
THIS_DIR = os.path.dirname(os.path.abspath(__file__))
class TestAdjacencyMatrix(unittest.TestCase):
def test_n3_r0_ca(self):
matrix = adjacency.cellular_automaton(n=3, r=0)
expected = [[1., 0., 0.],
[0., 1., 0.],
[0., 0., 1.]]
self.assertEqual(expected, matrix)
def test_n3_r1_ca(self):
matrix = adjacency.cellular_automaton(n=3)
expected = [[1., 1., 1.],
[1., 1., 1.],
[1., 1., 1.]]
self.assertEqual(expected, matrix)
def test_n5_r1_ca(self):
matrix = adjacency.cellular_automaton(n=5)
expected = [[1., 1., 0., 0., 1.],
[1., 1., 1., 0., 0.],
[0., 1., 1., 1., 0.],
[0., 0., 1., 1., 1.],
[1., 0., 0., 1., 1.]]
self.assertEqual(expected, matrix)
def test_n5_r2_ca(self):
matrix = adjacency.cellular_automaton(n=5, r=2)
expected = [[1., 1., 1., 1., 1.],
[1., 1., 1., 1., 1.],
[1., 1., 1., 1., 1.],
[1., 1., 1., 1., 1.],
[1., 1., 1., 1., 1.]]
self.assertEqual(expected, matrix)
def test_n7_r2_ca(self):
matrix = adjacency.cellular_automaton(n=7, r=2)
expected = [[1., 1., 1., 0., 0., 1., 1.],
[1., 1., 1., 1., 0., 0., 1.],
[1., 1., 1., 1., 1., 0., 0.],
[0., 1., 1., 1., 1., 1., 0.],
[0., 0., 1., 1., 1., 1., 1.],
[1., 0., 0., 1., 1., 1., 1.],
[1., 1., 0., 0., 1., 1., 1.]]
self.assertEqual(expected, matrix)
def test_3x3_r0_vonNeumann_ca2d(self):
matrix = adjacency.cellular_automaton2d(rows=3, cols=3, r=0, neighbourhood='von Neumann')
expected = [[1., 0., 0., 0., 0., 0., 0., 0., 0.],
[0., 1., 0., 0., 0., 0., 0., 0., 0.],
[0., 0., 1., 0., 0., 0., 0., 0., 0.],
[0., 0., 0., 1., 0., 0., 0., 0., 0.],
[0., 0., 0., 0., 1., 0., 0., 0., 0.],
[0., 0., 0., 0., 0., 1., 0., 0., 0.],
[0., 0., 0., 0., 0., 0., 1., 0., 0.],
[0., 0., 0., 0., 0., 0., 0., 1., 0.],
[0., 0., 0., 0., 0., 0., 0., 0., 1.]]
self.assertEqual(expected, matrix)
def test_3x3_r1_vonNeumann_ca2d(self):
matrix = adjacency.cellular_automaton2d(rows=3, cols=3, r=1, neighbourhood='von Neumann')
expected = [[1., 1., 1., 1., 0., 0., 1., 0., 0.],
[1., 1., 1., 0., 1., 0., 0., 1., 0.],
[1., 1., 1., 0., 0., 1., 0., 0., 1.],
[1., 0., 0., 1., 1., 1., 1., 0., 0.],
[0., 1., 0., 1., 1., 1., 0., 1., 0.],
[0., 0., 1., 1., 1., 1., 0., 0., 1.],
[1., 0., 0., 1., 0., 0., 1., 1., 1.],
[0., 1., 0., 0., 1., 0., 1., 1., 1.],
[0., 0., 1., 0., 0., 1., 1., 1., 1.]]
self.assertEqual(expected, matrix)
def test_5x5_r2_vonNeumann_ca2d(self):
matrix = adjacency.cellular_automaton2d(rows=5, cols=5, r=2, neighbourhood='von Neumann')
expected = [[1., 1., 1., 1., 1., 1., 1., 0., 0., 1., 1., 0., 0., 0., 0., 1., 0., 0., 0., 0., 1., 1., 0., 0., 1.],
[1., 1., 1., 1., 1., 1., 1., 1., 0., 0., 0., 1., 0., 0., 0., 0., 1., 0., 0., 0., 1., 1., 1., 0., 0.],
[1., 1., 1., 1., 1., 0., 1., 1., 1., 0., 0., 0., 1., 0., 0., 0., 0., 1., 0., 0., 0., 1., 1., 1., 0.],
[1., 1., 1., 1., 1., 0., 0., 1., 1., 1., 0., 0., 0., 1., 0., 0., 0., 0., 1., 0., 0., 0., 1., 1., 1.],
[1., 1., 1., 1., 1., 1., 0., 0., 1., 1., 0., 0., 0., 0., 1., 0., 0., 0., 0., 1., 1., 0., 0., 1., 1.],
[1., 1., 0., 0., 1., 1., 1., 1., 1., 1., 1., 1., 0., 0., 1., 1., 0., 0., 0., 0., 1., 0., 0., 0., 0.],
[1., 1., 1., 0., 0., 1., 1., 1., 1., 1., 1., 1., 1., 0., 0., 0., 1., 0., 0., 0., 0., 1., 0., 0., 0.],
[0., 1., 1., 1., 0., 1., 1., 1., 1., 1., 0., 1., 1., 1., 0., 0., 0., 1., 0., 0., 0., 0., 1., 0., 0.],
[0., 0., 1., 1., 1., 1., 1., 1., 1., 1., 0., 0., 1., 1., 1., 0., 0., 0., 1., 0., 0., 0., 0., 1., 0.],
[1., 0., 0., 1., 1., 1., 1., 1., 1., 1., 1., 0., 0., 1., 1., 0., 0., 0., 0., 1., 0., 0., 0., 0., 1.],
[1., 0., 0., 0., 0., 1., 1., 0., 0., 1., 1., 1., 1., 1., 1., 1., 1., 0., 0., 1., 1., 0., 0., 0., 0.],
[0., 1., 0., 0., 0., 1., 1., 1., 0., 0., 1., 1., 1., 1., 1., 1., 1., 1., 0., 0., 0., 1., 0., 0., 0.],
[0., 0., 1., 0., 0., 0., 1., 1., 1., 0., 1., 1., 1., 1., 1., 0., 1., 1., 1., 0., 0., 0., 1., 0., 0.],
[0., 0., 0., 1., 0., 0., 0., 1., 1., 1., 1., 1., 1., 1., 1., 0., 0., 1., 1., 1., 0., 0., 0., 1., 0.],
[0., 0., 0., 0., 1., 1., 0., 0., 1., 1., 1., 1., 1., 1., 1., 1., 0., 0., 1., 1., 0., 0., 0., 0., 1.],
[1., 0., 0., 0., 0., 1., 0., 0., 0., 0., 1., 1., 0., 0., 1., 1., 1., 1., 1., 1., 1., 1., 0., 0., 1.],
[0., 1., 0., 0., 0., 0., 1., 0., 0., 0., 1., 1., 1., 0., 0., 1., 1., 1., 1., 1., 1., 1., 1., 0., 0.],
[0., 0., 1., 0., 0., 0., 0., 1., 0., 0., 0., 1., 1., 1., 0., 1., 1., 1., 1., 1., 0., 1., 1., 1., 0.],
[0., 0., 0., 1., 0., 0., 0., 0., 1., 0., 0., 0., 1., 1., 1., 1., 1., 1., 1., 1., 0., 0., 1., 1., 1.],
[0., 0., 0., 0., 1., 0., 0., 0., 0., 1., 1., 0., 0., 1., 1., 1., 1., 1., 1., 1., 1., 0., 0., 1., 1.],
[1., 1., 0., 0., 1., 1., 0., 0., 0., 0., 1., 0., 0., 0., 0., 1., 1., 0., 0., 1., 1., 1., 1., 1., 1.],
[1., 1., 1., 0., 0., 0., 1., 0., 0., 0., 0., 1., 0., 0., 0., 1., 1., 1., 0., 0., 1., 1., 1., 1., 1.],
[0., 1., 1., 1., 0., 0., 0., 1., 0., 0., 0., 0., 1., 0., 0., 0., 1., 1., 1., 0., 1., 1., 1., 1., 1.],
[0., 0., 1., 1., 1., 0., 0., 0., 1., 0., 0., 0., 0., 1., 0., 0., 0., 1., 1., 1., 1., 1., 1., 1., 1.],
[1., 0., 0., 1., 1., 0., 0., 0., 0., 1., 0., 0., 0., 0., 1., 1., 0., 0., 1., 1., 1., 1., 1., 1., 1.]]
self.assertEqual(expected, matrix)
def test_3x3_r0_Moore_ca2d(self):
matrix = adjacency.cellular_automaton2d(rows=3, cols=3, r=0, neighbourhood='Moore')
expected = [[1., 0., 0., 0., 0., 0., 0., 0., 0.],
[0., 1., 0., 0., 0., 0., 0., 0., 0.],
[0., 0., 1., 0., 0., 0., 0., 0., 0.],
[0., 0., 0., 1., 0., 0., 0., 0., 0.],
[0., 0., 0., 0., 1., 0., 0., 0., 0.],
[0., 0., 0., 0., 0., 1., 0., 0., 0.],
[0., 0., 0., 0., 0., 0., 1., 0., 0.],
[0., 0., 0., 0., 0., 0., 0., 1., 0.],
[0., 0., 0., 0., 0., 0., 0., 0., 1.]]
self.assertEqual(expected, matrix)
def test_3x3_r1_Moore_ca2d(self):
matrix = adjacency.cellular_automaton2d(rows=3, cols=3, r=1, neighbourhood='Moore')
expected = [[1., 1., 1., 1., 1., 1., 1., 1., 1.],
[1., 1., 1., 1., 1., 1., 1., 1., 1.],
[1., 1., 1., 1., 1., 1., 1., 1., 1.],
[1., 1., 1., 1., 1., 1., 1., 1., 1.],
[1., 1., 1., 1., 1., 1., 1., 1., 1.],
[1., 1., 1., 1., 1., 1., 1., 1., 1.],
[1., 1., 1., 1., 1., 1., 1., 1., 1.],
[1., 1., 1., 1., 1., 1., 1., 1., 1.],
[1., 1., 1., 1., 1., 1., 1., 1., 1.]]
self.assertEqual(expected, matrix)
def test_7x7_r2_Moore_ca2d(self):
matrix = adjacency.cellular_automaton2d(rows=7, cols=7, r=2, neighbourhood='Moore')
with open(os.path.join(THIS_DIR, 'resources', 'adjacency_7x7_r2_Moore_ca2d.txt'), 'r') as content_file:
content = content_file.read()
expected = eval(content)
self.assertEqual(expected, matrix)
def test_4x3_r0_vonNeumann_ca2d(self):
matrix = adjacency.cellular_automaton2d(rows=4, cols=3, r=0, neighbourhood='von Neumann')
expected = [[1., 0., 0., 0., 0., 0., 0., 0., 0., 0., 0., 0.],
[0., 1., 0., 0., 0., 0., 0., 0., 0., 0., 0., 0.],
[0., 0., 1., 0., 0., 0., 0., 0., 0., 0., 0., 0.],
[0., 0., 0., 1., 0., 0., 0., 0., 0., 0., 0., 0.],
[0., 0., 0., 0., 1., 0., 0., 0., 0., 0., 0., 0.],
[0., 0., 0., 0., 0., 1., 0., 0., 0., 0., 0., 0.],
[0., 0., 0., 0., 0., 0., 1., 0., 0., 0., 0., 0.],
[0., 0., 0., 0., 0., 0., 0., 1., 0., 0., 0., 0.],
[0., 0., 0., 0., 0., 0., 0., 0., 1., 0., 0., 0.],
[0., 0., 0., 0., 0., 0., 0., 0., 0., 1., 0., 0.],
[0., 0., 0., 0., 0., 0., 0., 0., 0., 0., 1., 0.],
[0., 0., 0., 0., 0., 0., 0., 0., 0., 0., 0., 1.]]
self.assertEqual(expected, matrix)
def test_4x3_r0_Moore_ca2d(self):
matrix = adjacency.cellular_automaton2d(rows=4, cols=3, r=0, neighbourhood='Moore')
expected = [[1., 0., 0., 0., 0., 0., 0., 0., 0., 0., 0., 0.],
[0., 1., 0., 0., 0., 0., 0., 0., 0., 0., 0., 0.],
[0., 0., 1., 0., 0., 0., 0., 0., 0., 0., 0., 0.],
[0., 0., 0., 1., 0., 0., 0., 0., 0., 0., 0., 0.],
[0., 0., 0., 0., 1., 0., 0., 0., 0., 0., 0., 0.],
[0., 0., 0., 0., 0., 1., 0., 0., 0., 0., 0., 0.],
[0., 0., 0., 0., 0., 0., 1., 0., 0., 0., 0., 0.],
[0., 0., 0., 0., 0., 0., 0., 1., 0., 0., 0., 0.],
[0., 0., 0., 0., 0., 0., 0., 0., 1., 0., 0., 0.],
[0., 0., 0., 0., 0., 0., 0., 0., 0., 1., 0., 0.],
[0., 0., 0., 0., 0., 0., 0., 0., 0., 0., 1., 0.],
[0., 0., 0., 0., 0., 0., 0., 0., 0., 0., 0., 1.]]
self.assertEqual(expected, matrix)
def test_4x3_r1_vonNeumann_ca2d(self):
matrix = adjacency.cellular_automaton2d(rows=4, cols=3, r=1, neighbourhood='von Neumann')
expected = [[1.0, 1.0, 1.0, 1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0, 0.0, 0.0],
[1.0, 1.0, 1.0, 0.0, 1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0, 0.0],
[1.0, 1.0, 1.0, 0.0, 0.0, 1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0],
[1.0, 0.0, 0.0, 1.0, 1.0, 1.0, 1.0, 0.0, 0.0, 0.0, 0.0, 0.0],
[0.0, 1.0, 0.0, 1.0, 1.0, 1.0, 0.0, 1.0, 0.0, 0.0, 0.0, 0.0],
[0.0, 0.0, 1.0, 1.0, 1.0, 1.0, 0.0, 0.0, 1.0, 0.0, 0.0, 0.0],
[0.0, 0.0, 0.0, 1.0, 0.0, 0.0, 1.0, 1.0, 1.0, 1.0, 0.0, 0.0],
[0.0, 0.0, 0.0, 0.0, 1.0, 0.0, 1.0, 1.0, 1.0, 0.0, 1.0, 0.0],
[0.0, 0.0, 0.0, 0.0, 0.0, 1.0, 1.0, 1.0, 1.0, 0.0, 0.0, 1.0],
[1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0, 0.0, 0.0, 1.0, 1.0, 1.0],
[0.0, 1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0, 0.0, 1.0, 1.0, 1.0],
[0.0, 0.0, 1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0, 1.0, 1.0, 1.0]]
self.assertEqual(expected, matrix)
def test_4x3_r1_Moore_ca2d(self):
matrix = adjacency.cellular_automaton2d(rows=4, cols=3, r=1, neighbourhood='Moore')
expected = [[1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 0.0, 0.0, 0.0, 1.0, 1.0, 1.0],
[1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 0.0, 0.0, 0.0, 1.0, 1.0, 1.0],
[1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 0.0, 0.0, 0.0, 1.0, 1.0, 1.0],
[1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 0.0, 0.0, 0.0],
[1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 0.0, 0.0, 0.0],
[1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 0.0, 0.0, 0.0],
[0.0, 0.0, 0.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0],
[0.0, 0.0, 0.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0],
[0.0, 0.0, 0.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0],
[1.0, 1.0, 1.0, 0.0, 0.0, 0.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0],
[1.0, 1.0, 1.0, 0.0, 0.0, 0.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0],
[1.0, 1.0, 1.0, 0.0, 0.0, 0.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0]]
self.assertEqual(expected, matrix)
def test_6x8_r2_Moore_ca2d(self):
matrix = adjacency.cellular_automaton2d(rows=6, cols=8, r=2, neighbourhood='Moore')
with open(os.path.join(THIS_DIR, 'resources', 'adjacency_6x8_r2_Moore_ca2d.txt'), 'r') as content_file:
content = content_file.read()
expected = eval(content)
self.assertEqual(expected, matrix)
def test_6x8_r2_vonNeumann_ca2d(self):
matrix = adjacency.cellular_automaton2d(rows=6, cols=8, r=2, neighbourhood='von Neumann')
with open(os.path.join(THIS_DIR, 'resources', 'adjacency_6x8_r2_vonNeumann_ca2d.txt'), 'r') as content_file:
content = content_file.read()
expected = eval(content)
self.assertEqual(expected, matrix)
| 60.666667
| 121
| 0.339831
| 2,409
| 13,286
| 1.83022
| 0.026982
| 0.381039
| 0.439555
| 0.453618
| 0.956453
| 0.951917
| 0.949195
| 0.949195
| 0.88841
| 0.837378
| 0
| 0.242367
| 0.361508
| 13,286
| 218
| 122
| 60.944954
| 0.277378
| 0
| 0
| 0.431472
| 0
| 0
| 0.01686
| 0.007376
| 0
| 0
| 0
| 0
| 0.086294
| 1
| 0.086294
| false
| 0
| 0.015228
| 0
| 0.106599
| 0
| 0
| 0
| 1
| null | 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 12
|
a9a00ad52890f3b391c1ba48e5bdf786f0436bc3
| 11,565
|
py
|
Python
|
tests/unit/html_elements_test_io/html_elements_2_functions_io.py
|
MickyHCorbett/MorfLess
|
9761197d7767c250cc27262e1ab41adf21c59333
|
[
"MIT"
] | null | null | null |
tests/unit/html_elements_test_io/html_elements_2_functions_io.py
|
MickyHCorbett/MorfLess
|
9761197d7767c250cc27262e1ab41adf21c59333
|
[
"MIT"
] | null | null | null |
tests/unit/html_elements_test_io/html_elements_2_functions_io.py
|
MickyHCorbett/MorfLess
|
9761197d7767c250cc27262e1ab41adf21c59333
|
[
"MIT"
] | null | null | null |
#
import libraries.constants as ct
import libraries.globals as gb
import libraries.schematics as sch
from collections import OrderedDict
#
test_values_1 = [\
{ 'remark': 'Test Case 1:pcom_add_content_command - empty syntax',
'syntax': '',
'custom_class': '',
'placement': '',
'type': '',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': ''
},
{ 'remark': 'Test Case 2:pcom_add_content_command - syntax NONE',
'syntax': ct.PCOM_NO_ENTRY,
'custom_class': '',
'placement': '',
'type': 'that',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': ''
},
{ 'remark': 'Test Case 4:pcom_add_content_command - syntax but no TEXT command',
'syntax': 'FONT=[ Something here ]:',
'custom_class': '',
'placement': '',
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': ''
},
{ 'remark': 'Test Case 5:pcom_add_content_command - syntax TEXT command',
'syntax': 'TEXT=[ Something here ]:',
'custom_class': '',
'placement': '',
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': """
<div class="post">
Something here
</div><!-- end of .post -->
"""
},
{ 'remark': 'Test Case 6:pcom_add_content_command - MAIN placement - syntax TEXT command',
'syntax': 'TEXT=[ Something here ]:',
'custom_class': '',
'placement': ct.PCOM_MAIN_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': """
<div class="main-outer clearfix-small">
<div class="main-inner clearfix-small">
<div class="post">
Something here
</div><!-- end of .post -->
</div><!-- end of .main-inner -->
</div><!-- end of .main-outer -->
"""
},
{ 'remark': 'Test Case 7:pcom_add_content_command - MAIN placement - syntax TEXT command - custom class',
'syntax': 'TEXT=[ Something here ]:',
'custom_class': 'my-class',
'placement': ct.PCOM_MAIN_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': """
<div class="main-outer clearfix-small my-class">
<div class="main-inner clearfix-small my-class">
<div class="post my-class">
Something here
</div><!-- end of .post -->
</div><!-- end of .main-inner -->
</div><!-- end of .main-outer -->
"""
},
{ 'remark': 'Test Case 8:pcom_add_content_command - MAIN placement - syntax TEXT command - custom class - replacements',
'syntax': 'TEXT=[ [p][b]Something here[/b][/p] ]:',
'custom_class': 'my-class',
'placement': ct.PCOM_MAIN_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': """
<div class="main-outer clearfix-small my-class">
<div class="main-inner clearfix-small my-class">
<div class="post my-class">
<p><strong>Something here</strong></p>
</div><!-- end of .post -->
</div><!-- end of .main-inner -->
</div><!-- end of .main-outer -->
"""
},
{ 'remark': 'Test Case 9:pcom_add_content_command - HEADER placement - syntax TEXT command - custom class - replacements',
'syntax': 'TEXT=[ [p][b]Something here[/b][/p] ]:',
'custom_class': 'my-class',
'placement': ct.PCOM_HEADER_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': """
<div class="post my-class">
<p><strong>Something here</strong></p>
</div><!-- end of .post -->
"""
},
{ 'remark': 'Test Case 10:pcom_add_cosntent_command - FOOTER placement - syntax TEXT command - custom class - replacements',
'syntax': 'TEXT=[ [p][b]Something here[/b][/p] ]:',
'custom_class': 'my-class',
'placement': ct.PCOM_FOOTER_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': """
<div class="post my-class">
<p><strong>Something here</strong></p>
</div><!-- end of .post -->
"""
},
]
test_values_2 = [\
{ 'remark': 'Test Case 1:pcom_insert_searchbar_command - no placement',
'syntax': 'TEXT=[ [p][b]Something here[/b][/p] ]:',
'custom_class': 'my-class',
'placement': '',
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': """
<div id="pm-searchbar-general" class="clearfix-small">
<div class="pm-searchbar clearfix-small">
<form action="/$$SEARCH$$/" autocomplete="on">
<input id="search" type="text" name="s" />
</form>
<span id="search-submit" class="pm-search-button" name="search-submit"></span>
</div><!-- end of #pm-searchbar -->
</div><!-- end of #pm-searchbar-general -->
"""
},
{ 'remark': 'Test Case 2:pcom_insert_searchbar_command - header placement',
'syntax': 'TEXT=[ [p][b]Something here[/b][/p] ]:',
'custom_class': 'my-class',
'placement': ct.PCOM_HEADER_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': """
<div id="pm-nav-searchbar" class="clearfix-small">
<div class="pm-searchbar clearfix-small">
<form action="/$$SEARCH$$/" autocomplete="on">
<input id="search" type="text" name="s" />
</form>
<span id="search-submit" class="pm-search-button" name="search-submit"></span>
</div><!-- end of #pm-searchbar -->
</div><!-- end of #pm-nav-searchbar-->
"""
},
{ 'remark': 'Test Case 3:pcom_insert_searchbar_command - main placement',
'syntax': 'TEXT=[ [p][b]Something here[/b][/p] ]:',
'custom_class': 'my-class',
'placement': ct.PCOM_MAIN_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': """
<div class="main-outer clearfix-small my-class">
<div class="main-inner clearfix-small my-class">
<div class="post">
<div id="pm-searchbar-general" class="clearfix-small">
<div class="pm-searchbar clearfix-small">
<form action="/$$SEARCH$$/" autocomplete="on">
<input id="search" type="text" name="s" />
</form>
<span id="search-submit" class="pm-search-button" name="search-submit"></span>
</div><!-- end of #pm-searchbar -->
</div><!-- end of #pm-searchbar-general -->
</div><!-- end of .post -->
</div><!-- end of .main-inner -->
</div><!-- end of .main-outer -->
"""
},
]
test_values_3 = [\
{ 'remark': 'Test Case 1:pcom_process_insert_command - main placement syntax not with ref keyword',
'syntax': 'TEXT=[ [p][b]Something here[/b][/p] ]:',
'custom_class': 'my-class',
'placement': ct.PCOM_MAIN_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': """
"""
},
{ 'remark': 'Test Case 2:pcom_process_insert_command - main placement syntax with subschematic command and ref keyword',
'syntax': 'TEXT=[ some name ]: ref={ this_insert.txt }:',
'custom_class': 'my-class',
'placement': ct.PCOM_MAIN_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': """
"""
},
{ 'remark': 'Test Case 3:pcom_process_insert_command - main placement syntax with ref keyword',
'syntax': 'ref={ this_insert.txt }:',
'custom_class': 'my-class',
'placement': ct.PCOM_MAIN_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': 'INSERT=[MAIN:this_insert.txt]:'
},
{ 'remark': 'Test Case 4:pcom_process_insert_command - header placement syntax with ref keyword',
'syntax': 'ref={ this_insert2.txt }:',
'custom_class': 'my-class',
'placement': ct.PCOM_HEADER_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': 'INSERT=[HEADER:this_insert2.txt]:'
},
]
# test_values_4 = [\
# { 'remark': 'Test Case 1:pcom_process_insert_addiitons_command - main placement syntax not with ref keyword',
# 'syntax': 'TEXT=[ [p][b]Something here[/b][/p] ]:',
# 'custom_class': 'my-class',
# 'placement': ct.PCOM_MAIN_PLACEMENT,
# 'type': 'this',
# 'settings': gb.DEFAULT_SETTINGS,
# 'assertEqual': """
#
# """
# },
#
# { 'remark': 'Test Case 2:pcom_process_insert_addiitons_command - main placement syntax with subschematic command and ref keyword',
# 'syntax': 'TEXT=[ some name ]: ref={ this_insert.txt }:',
# 'custom_class': 'my-class',
# 'placement': ct.PCOM_MAIN_PLACEMENT,
# 'type': 'this',
# 'settings': gb.DEFAULT_SETTINGS,
# 'assertEqual': """
#
# """
# },
#
# { 'remark': 'Test Case 3:pcom_process_insert_addiitons_command - main placement syntax with ref keyword',
# 'syntax': 'ref={ this_insert.txt }:',
# 'custom_class': 'my-class',
# 'placement': ct.PCOM_MAIN_PLACEMENT,
# 'type': 'this',
# 'settings': gb.DEFAULT_SETTINGS,
# 'assertEqual': 'INSERT=[MAIN:this_insert.txt]:'
# },
#
# { 'remark': 'Test Case 4:pcom_process_insert_addiitons_command - header placement syntax with ref keyword',
# 'syntax': 'ref={ this_insert2.txt }:',
# 'custom_class': 'my-class',
# 'placement': ct.PCOM_HEADER_PLACEMENT,
# 'type': 'this',
# 'settings': gb.DEFAULT_SETTINGS,
# 'assertEqual': 'INSERT=[HEADER:this_insert2.txt]:'
# },
# ]
test_values_5 = [\
{ 'remark': 'Test Case 1:pcom_insert_pagination_command - main placement syntax with subschematic command and ref keyword',
'syntax': 'TEXT=[ some name ]: ref={ this_insert.txt }:',
'custom_class': '',
'placement': ct.PCOM_MAIN_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': 'PAGINATION=[MAIN::,]:'
},
{ 'remark': 'Test Case 2:pcom_insert_pagination_command - main placement syntax with subschematic command and ref keyword, class',
'syntax': '',
'custom_class': 'my-class',
'placement': ct.PCOM_HEADER_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': 'PAGINATION=[HEADER:my-class:]:'
},
{ 'remark': 'Test Case 3:pcom_insert_pagination_command - header placement next link',
'syntax': 'next={ this-link.page }:',
'custom_class': 'my-class',
'placement': ct.PCOM_HEADER_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': 'PAGINATION=[HEADER:my-class:this-link.page,]:'
},
{ 'remark': 'Test Case 4:pcom_insert_pagination_command - header placement next and prev link',
'syntax': 'prev={ that-page.post }: next={ this-link.page }: ',
'custom_class': 'my-class',
'placement': ct.PCOM_HEADER_PLACEMENT,
'type': 'this',
'settings': gb.DEFAULT_SETTINGS,
'assertEqual': 'PAGINATION=[HEADER:my-class:this-link.page,that-page.post]:'
},
]
test_values_6 = [\
{ 'remark': 'Test Case 1:pcom_create_pagination_link - empty link data',
'links': {\
'next_url': '',
'prev_url': '',
'next_title': '',
'prev_title': ''
},
'assertEqual': {
'pagination': True
},
'assertIn': [\
'<div id="pm-next-post-link">',
'<span class="pm-post-link-text"><i class="fa fa-arrow-right" aria-hidden="true"></i>',
'<a href=""></a>',
'</span></div><!-- post link -->',
'<div id="pm-prev-post-link">',
'<span class="pm-post-link-text"><i class="fa fa-arrow-left" aria-hidden="true"></i>',
'<a href=""></a>',
'</span></div><!-- post link -->'
]
},
{ 'remark': 'Test Case 2:pcom_create_pagination_link - link data NONE',
'links': {\
'next_url': ct.PCOM_NO_ENTRY,
'prev_url': ct.PCOM_NO_ENTRY,
'next_title': ct.PCOM_NO_ENTRY,
'prev_title': ct.PCOM_NO_ENTRY
},
'assertEqual': {
'pagination': False
},
'assertIn': [\
''
]
},
]
| 30.92246
| 134
| 0.600086
| 1,364
| 11,565
| 4.934751
| 0.085044
| 0.032239
| 0.054078
| 0.08914
| 0.896746
| 0.857228
| 0.831526
| 0.806715
| 0.795424
| 0.780716
| 0
| 0.004015
| 0.203199
| 11,565
| 373
| 135
| 31.005362
| 0.726424
| 0.121487
| 0
| 0.642857
| 0
| 0.017857
| 0.673784
| 0.138197
| 0
| 0
| 0
| 0
| 0.085714
| 1
| 0
| false
| 0
| 0.014286
| 0
| 0.014286
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
8d724a32999aa01d0ea29c504e878e7ab9e4327f
| 3,429
|
py
|
Python
|
metrics.py
|
yzyouzhang/SASV_PR
|
b95fe79f7380a78e6351fcfff01cc2eddf2f6de2
|
[
"MIT"
] | 7
|
2022-03-04T07:35:36.000Z
|
2022-03-30T10:54:51.000Z
|
metrics.py
|
yzyouzhang/SASV_PR
|
b95fe79f7380a78e6351fcfff01cc2eddf2f6de2
|
[
"MIT"
] | null | null | null |
metrics.py
|
yzyouzhang/SASV_PR
|
b95fe79f7380a78e6351fcfff01cc2eddf2f6de2
|
[
"MIT"
] | null | null | null |
from typing import List, Union
import numpy
import torch
from scipy.interpolate import interp1d
from scipy.optimize import brentq
from sklearn.metrics import roc_curve
def get_all_EERs(
preds: Union[torch.Tensor, List, numpy.ndarray], keys: List
) -> List[float]:
"""
Calculate all three EERs used in the SASV Challenge 2022.
preds and keys should be pre-calculated using dev or eval protocol in
either 'protocols/ASVspoof2019.LA.asv.dev.gi.trl.txt' or
'protocols/ASVspoof2019.LA.asv.eval.gi.trl.txt'
:param preds: list of scores in tensor
:param keys: list of keys where each element should be one of
['target', 'nontarget', 'spoof']
"""
sasv_labels, sv_labels, spf_labels = [], [], []
sv_preds, spf_preds = [], []
for pred, key in zip(preds, keys):
if key == "target":
sasv_labels.append(1)
sv_labels.append(1)
spf_labels.append(1)
sv_preds.append(pred)
spf_preds.append(pred)
elif key == "nontarget":
sasv_labels.append(0)
sv_labels.append(0)
sv_preds.append(pred)
elif key == "spoof":
sasv_labels.append(0)
spf_labels.append(0)
spf_preds.append(pred)
else:
raise ValueError(
f"should be one of 'target', 'nontarget', 'spoof', got:{key}"
)
fpr, tpr, _ = roc_curve(sasv_labels, preds, pos_label=1)
sasv_eer = brentq(lambda x: 1.0 - x - interp1d(fpr, tpr)(x), 0.0, 1.0)
fpr, tpr, _ = roc_curve(sv_labels, sv_preds, pos_label=1)
sv_eer = brentq(lambda x: 1.0 - x - interp1d(fpr, tpr)(x), 0.0, 1.0)
fpr, tpr, _ = roc_curve(spf_labels, spf_preds, pos_label=1)
spf_eer = brentq(lambda x: 1.0 - x - interp1d(fpr, tpr)(x), 0.0, 1.0)
return sasv_eer, sv_eer, spf_eer
def get_all_EERs_my(
preds: Union[torch.Tensor, List, numpy.ndarray], keys: List
) -> List[float]:
"""
Calculate all three EERs used in the SASV Challenge 2022.
preds and keys should be pre-calculated using dev or eval protocol in
either 'protocols/ASVspoof2019.LA.asv.dev.gi.trl.txt' or
'protocols/ASVspoof2019.LA.asv.eval.gi.trl.txt'
:param preds: list of scores in tensor
:param keys: list of keys where each element should be one of
['target', 'nontarget', 'spoof']
"""
sasv_labels, sv_labels, spf_labels = [], [], []
sv_preds, spf_preds = [], []
for pred, key in zip(preds, keys):
if key == 0:
sasv_labels.append(1)
sv_labels.append(1)
spf_labels.append(1)
sv_preds.append(pred)
spf_preds.append(pred)
elif key == 1:
sasv_labels.append(0)
sv_labels.append(0)
sv_preds.append(pred)
elif key == 2:
sasv_labels.append(0)
spf_labels.append(0)
spf_preds.append(pred)
else:
raise ValueError
fpr, tpr, _ = roc_curve(sasv_labels, preds, pos_label=1)
sasv_eer = brentq(lambda x: 1.0 - x - interp1d(fpr, tpr)(x), 0.0, 1.0)
fpr, tpr, _ = roc_curve(sv_labels, sv_preds, pos_label=1)
sv_eer = brentq(lambda x: 1.0 - x - interp1d(fpr, tpr)(x), 0.0, 1.0)
fpr, tpr, _ = roc_curve(spf_labels, spf_preds, pos_label=1)
spf_eer = brentq(lambda x: 1.0 - x - interp1d(fpr, tpr)(x), 0.0, 1.0)
return sasv_eer, sv_eer, spf_eer
| 32.657143
| 77
| 0.609216
| 512
| 3,429
| 3.927734
| 0.171875
| 0.083541
| 0.059672
| 0.04177
| 0.900547
| 0.900547
| 0.900547
| 0.884137
| 0.884137
| 0.884137
| 0
| 0.035899
| 0.268883
| 3,429
| 105
| 78
| 32.657143
| 0.766254
| 0.214348
| 0
| 0.727273
| 0
| 0
| 0.029817
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.030303
| false
| 0
| 0.090909
| 0
| 0.151515
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
a5ded7e3c7e3a95fefec625fc299d84345737a6b
| 92
|
py
|
Python
|
parameters_8000.py
|
a-bhimani/techlog
|
6b6b312b85538932b94258d63e4a41ca407dd068
|
[
"BSD-3-Clause"
] | 1
|
2019-01-15T17:37:12.000Z
|
2019-01-15T17:37:12.000Z
|
parameters_8000.py
|
a-bhimani/techlog
|
6b6b312b85538932b94258d63e4a41ca407dd068
|
[
"BSD-3-Clause"
] | null | null | null |
parameters_8000.py
|
a-bhimani/techlog
|
6b6b312b85538932b94258d63e4a41ca407dd068
|
[
"BSD-3-Clause"
] | null | null | null |
password="pbkdf2(1000,20,sha512)$bece9f3681afdc29$6d2ae94a68738e3542159ba80963af71bcdc34be"
| 46
| 91
| 0.891304
| 7
| 92
| 11.714286
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.461538
| 0.01087
| 92
| 1
| 92
| 92
| 0.43956
| 0
| 0
| 0
| 0
| 0
| 0.869565
| 0.869565
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 1
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
|
0
| 8
|
573186095bd925a51167823c4999b18c5cb8b2e8
| 223
|
py
|
Python
|
experiments/__init__.py
|
dingsheng-ong/ipr-gan
|
a9eba23521a071db932a6c49127e55506de55380
|
[
"BSD-3-Clause"
] | 15
|
2021-03-18T17:33:31.000Z
|
2022-03-30T02:37:11.000Z
|
experiments/__init__.py
|
dingsheng-ong/ipr-gan
|
a9eba23521a071db932a6c49127e55506de55380
|
[
"BSD-3-Clause"
] | 4
|
2021-07-19T02:21:53.000Z
|
2021-12-13T10:18:05.000Z
|
experiments/__init__.py
|
dingsheng-ong/ipr-gan
|
a9eba23521a071db932a6c49127e55506de55380
|
[
"BSD-3-Clause"
] | 3
|
2021-03-23T20:26:16.000Z
|
2021-12-13T08:12:04.000Z
|
from experiments.base import Experiment
from experiments.image_generation import ImageGeneration
from experiments.image_super_resolution import ImageSuperResolution
from experiments.image_translation import ImageTranslation
| 55.75
| 67
| 0.914798
| 24
| 223
| 8.333333
| 0.541667
| 0.3
| 0.3
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.067265
| 223
| 4
| 68
| 55.75
| 0.961538
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
5749ee3da7537d01962b7f2667e4ed29ba096e59
| 1,115
|
py
|
Python
|
csvs/migrations/0002_auto_20210613_1659.py
|
Taylor-X01/second-hand-car-scrapper
|
c3acc8b3d86954641ccab0bab8ad6c327ce671f5
|
[
"MIT"
] | null | null | null |
csvs/migrations/0002_auto_20210613_1659.py
|
Taylor-X01/second-hand-car-scrapper
|
c3acc8b3d86954641ccab0bab8ad6c327ce671f5
|
[
"MIT"
] | null | null | null |
csvs/migrations/0002_auto_20210613_1659.py
|
Taylor-X01/second-hand-car-scrapper
|
c3acc8b3d86954641ccab0bab8ad6c327ce671f5
|
[
"MIT"
] | null | null | null |
# Generated by Django 3.2 on 2021-06-13 15:59
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('csvs', '0001_initial'),
]
operations = [
migrations.AlterField(
model_name='carpost_moteur',
name='km',
field=models.IntegerField(),
),
migrations.AlterField(
model_name='carpost_moteur',
name='price',
field=models.IntegerField(),
),
migrations.AlterField(
model_name='carpost_moteur',
name='year',
field=models.IntegerField(),
),
migrations.AlterField(
model_name='carpost_wandaloo',
name='km',
field=models.IntegerField(),
),
migrations.AlterField(
model_name='carpost_wandaloo',
name='price',
field=models.IntegerField(),
),
migrations.AlterField(
model_name='carpost_wandaloo',
name='year',
field=models.IntegerField(),
),
]
| 25.340909
| 45
| 0.530942
| 92
| 1,115
| 6.293478
| 0.369565
| 0.207254
| 0.259067
| 0.300518
| 0.763385
| 0.709845
| 0.709845
| 0.637306
| 0.637306
| 0.637306
| 0
| 0.025035
| 0.355157
| 1,115
| 43
| 46
| 25.930233
| 0.78025
| 0.038565
| 0
| 0.810811
| 1
| 0
| 0.119626
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.027027
| 0
| 0.108108
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 0
| 1
| 1
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
938681614302286ac84ed1b4fcea1fb8d319f30e
| 592
|
py
|
Python
|
catkin_ws_assignments/build/catkin_generated/order_packages.py
|
ritvik506/Robotics-Automation-QSTP-2021
|
2efe058162c2921d87437d9a4f561c3b87cacbc5
|
[
"MIT"
] | null | null | null |
catkin_ws_assignments/build/catkin_generated/order_packages.py
|
ritvik506/Robotics-Automation-QSTP-2021
|
2efe058162c2921d87437d9a4f561c3b87cacbc5
|
[
"MIT"
] | null | null | null |
catkin_ws_assignments/build/catkin_generated/order_packages.py
|
ritvik506/Robotics-Automation-QSTP-2021
|
2efe058162c2921d87437d9a4f561c3b87cacbc5
|
[
"MIT"
] | null | null | null |
# generated from catkin/cmake/template/order_packages.context.py.in
source_root_dir = '/home/ritvik/Desktop/ROS/ROS-Assignments-QSTP/catkin_ws_assignments/src'
whitelisted_packages = ''.split(';') if '' != '' else []
blacklisted_packages = ''.split(';') if '' != '' else []
underlay_workspaces = '/home/ritvik/Desktop/ROS/ROS-Assignments-QSTP/catkin_ws_assignments/devel;/home/ritvik/Desktop/ROS/catkin_ws/devel;/opt/ros/melodic'.split(';') if '/home/ritvik/Desktop/ROS/ROS-Assignments-QSTP/catkin_ws_assignments/devel;/home/ritvik/Desktop/ROS/catkin_ws/devel;/opt/ros/melodic' != '' else []
| 98.666667
| 317
| 0.756757
| 81
| 592
| 5.358025
| 0.382716
| 0.115207
| 0.195853
| 0.230415
| 0.629032
| 0.629032
| 0.629032
| 0.629032
| 0.629032
| 0.629032
| 0
| 0
| 0.057432
| 592
| 5
| 318
| 118.4
| 0.777778
| 0.109797
| 0
| 0
| 1
| 0.5
| 0.64
| 0.634286
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 0
| 0
| 0
| 1
| 1
| 1
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 9
|
9e1d142e0d83bea4f400e6181f114b09d86074b0
| 77,638
|
py
|
Python
|
pyshtools/shclasses/shtensor.py
|
gaojiawei321/SHTOOLS
|
9a115cf83002df2ddec6b7f41aeb6be688e285de
|
[
"BSD-3-Clause"
] | 1
|
2019-04-06T07:42:49.000Z
|
2019-04-06T07:42:49.000Z
|
pyshtools/shclasses/shtensor.py
|
gaojiawei321/SHTOOLS
|
9a115cf83002df2ddec6b7f41aeb6be688e285de
|
[
"BSD-3-Clause"
] | null | null | null |
pyshtools/shclasses/shtensor.py
|
gaojiawei321/SHTOOLS
|
9a115cf83002df2ddec6b7f41aeb6be688e285de
|
[
"BSD-3-Clause"
] | null | null | null |
"""
Class for the gravity and magnetic field 'gradient' tensors.
"""
from __future__ import absolute_import as _absolute_import
from __future__ import division as _division
from __future__ import print_function as _print_function
import numpy as _np
import matplotlib as _mpl
import matplotlib.pyplot as _plt
import copy as _copy
from scipy.linalg import eigvalsh as _eigvalsh
from .shcoeffsgrid import SHGrid as _SHGrid
class Tensor(object):
"""
Generic class for gravity and magnetic field tensors. To initialize the
class, use the method tensor() of an SHGravCoeffs or SHMagCoeffs
class instance.
"""
def __init__(self):
"""Unused constructor of the main class."""
print('Initialize the class using one of the two methods:\n'
'>>> pyshtools.SHGravCoeffs.tensor\n'
'>>> pyshtools.SHMagCoeffs.tensor\n')
def compute_invar(self):
"""
Compute the three invariants (I0, I1, I2) of the tensor, as well as
the quantity I = -(I2/2)**2 / (I1/3)**3.
"""
self.i0 = self.vxx + self.vyy + self.vzz
self.i1 = (self.vxx*self.vyy + self.vyy*self.vzz + self.vxx*self.vzz -
self.vxy**2 - self.vyz**2 - self.vxz**2)
self.i2 = (self.vxx*(self.vyy*self.vzz - self.vyz**2) +
self.vxy*(self.vyz*self.vxz - self.vxy*self.vzz) +
self.vxz*(self.vxy*self.vyz - self.vxz*self.vyy))
self.i = (-1.) * (self.i2 / 2.)**2
self.i.data[1:, :] /= (self.i1.data[1:, :] / 3.)**3
def compute_eig(self):
"""
Compute the three eigenvalues of the tensor: eig1, eig2, ei3.
"""
self.eig1 = _SHGrid.from_array(_np.zeros_like(self.vxx.data),
grid='DH')
self.eig2 = _SHGrid.from_array(_np.zeros_like(self.vxx.data),
grid='DH')
self.eig3 = _SHGrid.from_array(_np.zeros_like(self.vxx.data),
grid='DH')
for i in range(self.nlat):
for j in range(self.nlon):
a = _np.array([[self.vxx.data[i, j],
self.vxy.data[i, j],
self.vxz.data[i, j]],
[self.vyx.data[i, j],
self.vyy.data[i, j],
self.vyz.data[i, j]],
[self.vzx.data[i, j],
self.vzy.data[i, j],
self.vzz.data[i, j]]])
eigs = _eigvalsh(a)
self.eig1.data[i, j] = eigs[2]
self.eig2.data[i, j] = eigs[1]
self.eig3.data[i, j] = eigs[0]
def compute_eigh(self):
"""
Compute the two horizontal eigenvalues of the tensor (eigh1, and
eigh2), as well as the combined maximum absolute value of the two
(eighh).
"""
self.eigh1 = _SHGrid.from_array(_np.zeros_like(self.vxx.data),
grid='DH')
self.eigh2 = _SHGrid.from_array(_np.zeros_like(self.vxx.data),
grid='DH')
self.eighh = _SHGrid.from_array(_np.zeros_like(self.vxx.data),
grid='DH')
for i in range(self.nlat):
for j in range(self.nlon):
a = _np.array([[self.vxx.data[i, j],
self.vxy.data[i, j]],
[self.vyx.data[i, j],
self.vyy.data[i, j]]])
eigs = _eigvalsh(a)
self.eigh1.data[i, j] = eigs[1]
self.eigh2.data[i, j] = eigs[0]
if abs(eigs[0]) >= abs(eigs[1]):
self.eighh.data[i, j] = eigs[0]
else:
self.eighh.data[i, j] = eigs[1]
def copy(self):
"""
Return a deep copy of the class instance.
Usage
-----
copy = x.copy()
"""
return _copy.deepcopy(self)
def info(self):
"""
Print a summary of the data stored in the SHGravTensor class instance.
Usage
-----
x.info()
"""
print(repr(self))
def plot_vxx(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the Vxx component of the tensor.
Usage
-----
x.plot_vxx([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = False
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$V_{xx}$'
Text label for the colorbar..
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._vxx_label
if ax is None:
fig, axes = self.vxx.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False, **kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.vxx.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_vyy(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the Vyy component of the tensor.
Usage
-----
x.plot_vyy([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$V_{yy}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._vyy_label
if ax is None:
fig, axes = self.vyy.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False, **kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.vyy.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_vzz(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the Vzz component of the tensor.
Usage
-----
x.plot_vzz([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$V_{zz}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._vzz_label
if ax is None:
fig, axes = self.vzz.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False, **kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.vzz.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_vxy(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the Vxy component of the tensor.
Usage
-----
x.plot_vxy([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$V_{xy}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._vxy_label
if ax is None:
fig, axes = self.vxy.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False, **kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.vxy.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_vyx(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the Vyx component of the tensor.
Usage
-----
x.plot_vyx([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$V_{yx}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._vyx_label
if ax is None:
fig, axes = self.vyx.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False, **kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.vyx.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_vxz(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the Vxz component of the tensor.
Usage
-----
x.plot_vxz([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$V_{xz}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._vxz_label
if ax is None:
fig, axes = self.vxz.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False, **kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.vxz.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_vzx(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the Vzx component of the tensor.
Usage
-----
x.plot_vzx([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$V_{zx}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._vzx_label
if ax is None:
fig, axes = self.vzx.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False, **kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.vzx.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_vyz(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the Vyz component of the tensor.
Usage
-----
x.plot_vyz([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$V_{yz}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._vyz_label
if ax is None:
fig, axes = self.vyz.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False, **kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.vyz.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_vzy(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the Vzy component of the tensor.
Usage
-----
x.plot_vzy([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$V_{zy}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._vzy_label
if ax is None:
fig, axes = self.vzy.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False, **kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.vzy.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot(self, colorbar=True, cb_orientation='horizontal',
tick_interval=[90, 90], minor_tick_interval=[30, 30],
xlabel='Longitude', ylabel='Latitude',
axes_labelsize=8, tick_labelsize=8, show=True, fname=None,
**kwargs):
"""
Plot the 9 components of the tensor.
Usage
-----
x.plot([tick_interval, minor_tick_interval, xlabel, ylabel,
colorbar, cb_orientation, cb_label, axes_labelsize,
tick_labelsize, show, fname, **kwargs])
Parameters
----------
tick_interval : list or tuple, optional, default = [90, 90]
Intervals to use when plotting the major x and y ticks. If set to
None, major ticks will not be plotted.
minor_tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the minor x and y ticks. If set to
None, minor ticks will not be plotted.
xlabel : str, optional, default = 'Longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'Latitude'
Label for the latitude axis.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = None
Text label for the colorbar.
axes_labelsize : int, optional, default = 8
The font size for the x and y axes labels.
tick_labelsize : int, optional, default = 8
The font size for the x and y tick labels.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if colorbar is True:
if cb_orientation == 'horizontal':
scale = 0.9
else:
scale = 0.45
else:
scale = 0.55
figsize = (_mpl.rcParams['figure.figsize'][0],
_mpl.rcParams['figure.figsize'][0] * scale)
fig, ax = _plt.subplots(3, 3, figsize=figsize)
self.plot_vxx(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[0], tick_interval=tick_interval,
xlabel=xlabel, ylabel=ylabel,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_vxy(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[1], tick_interval=tick_interval,
xlabel=xlabel, ylabel=ylabel,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_vxz(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[2], tick_interval=tick_interval,
xlabel=xlabel, ylabel=ylabel,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_vyx(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[3], tick_interval=tick_interval,
xlabel=xlabel, ylabel=ylabel,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_vyy(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[4], tick_interval=tick_interval,
xlabel=xlabel, ylabel=ylabel,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_vyz(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[5], tick_interval=tick_interval,
xlabel=xlabel, ylabel=ylabel,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_vzx(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[6], tick_interval=tick_interval,
xlabel=xlabel, ylabel=ylabel,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_vzy(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[7], tick_interval=tick_interval,
xlabel=xlabel, ylabel=ylabel,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_vzz(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[8], tick_interval=tick_interval,
xlabel=xlabel, ylabel=ylabel,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
fig.tight_layout(pad=0.5)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, ax
def plot_i0(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the first invariant I0 (the trace) of the tensor
I0 = vxx + vyy + vzz
which should be identically zero.
Usage
-----
x.plot_i0([tick_interval, xlabel, ylabel, ax, colorbar, cb_orientation,
cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = 'Tr $V_{ij}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._i0_label
if self.i0 is None:
self.compute_invar()
if ax is None:
fig, axes = self.i0.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False, **kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.i0.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_i1(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the second invariant I1 of the tensor:
I1 = vxx*vyy + vyy*vzz + vxx*vzz - vxy**2 - vyz**2 - vxz**2
Usage
-----
x.plot_i1([tick_interval, xlabel, ylabel, ax, colorbar, cb_orientation,
cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$I_1$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._i1_label
if self.i1 is None:
self.compute_invar()
if ax is None:
fig, axes = self.i1.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False, **kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.i1.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_i2(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the third invariant I2 (the determinant) of the tensor:
I2 = vxx*(vyy*vzz - vyz**2) + vxy*(vyz*vxz - vxy*vzz)
+ vxz*(vxy*vyz - vxz*vyy)
Usage
-----
x.plot_i2([tick_interval, xlabel, ylabel, ax, colorbar, cb_orientation,
cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = 'det $V_{ij}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._i2_label
if self.i2 is None:
self.compute_invar()
if ax is None:
fig, axes = self.i2.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False, **kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.i2.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_i(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the dimensionless quantity I of Pedersen and Rasmussen (1990)
I = -(I2/2)**2 / (I1/3)**3
that is bounded by 0 and 1.
Usage
-----
x.plot_i([tick_interval, xlabel, ylabel, ax, colorbar, cb_orientation,
cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$-(I_2/2)^{2} / (I_1/3)^{3}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._i_label
if self.i is None:
self.compute_invar()
if ax is None:
fig, axes = self.i.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False, **kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.i.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_invar(self, colorbar=True, cb_orientation='horizontal',
tick_interval=[60, 60], minor_tick_interval=[20, 20],
xlabel='Longitude', ylabel='Latitude',
axes_labelsize=9, tick_labelsize=8, show=True, fname=None,
**kwargs):
"""
Plot the three invariants of the tensor and the derived quantity I.
Usage
-----
x.plot_invar([tick_interval, minor_tick_interval, xlabel, ylabel,
colorbar, cb_orientation, cb_label, axes_labelsize,
tick_labelsize, show, fname, **kwargs])
Parameters
----------
tick_interval : list or tuple, optional, default = [60, 60]
Intervals to use when plotting the major x and y ticks. If set to
None, major ticks will not be plotted.
minor_tick_interval : list or tuple, optional, default = [20, 20]
Intervals to use when plotting the minor x and y ticks. If set to
None, minor ticks will not be plotted.
xlabel : str, optional, default = 'Longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'Latitude'
Label for the latitude axis.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = None
Text label for the colorbar.
axes_labelsize : int, optional, default = 9
The font size for the x and y axes labels.
tick_labelsize : int, optional, default = 8
The font size for the x and y tick labels.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if colorbar is True:
if cb_orientation == 'horizontal':
scale = 0.8
else:
scale = 0.5
else:
scale = 0.6
figsize = (_mpl.rcParams['figure.figsize'][0],
_mpl.rcParams['figure.figsize'][0] * scale)
fig, ax = _plt.subplots(2, 2, figsize=figsize)
self.plot_i0(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[0], tick_interval=tick_interval,
xlabel=xlabel, ylabel=ylabel,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_i1(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[1], tick_interval=tick_interval,
xlabel=xlabel, ylabel=ylabel,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_i2(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[2], tick_interval=tick_interval,
xlabel=xlabel, ylabel=ylabel,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_i(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[3], tick_interval=tick_interval,
xlabel=xlabel, ylabel=ylabel,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
fig.tight_layout(pad=0.5)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, ax
def plot_eig1(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the first eigenvalue of the tensor.
Usage
-----
x.plot_eig1([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$\lambda_1$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._eig1_label
if self.eig1 is None:
self.compute_eig()
if ax is None:
fig, axes = self.eig1.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False,
**kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.eig1.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_eig2(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the second eigenvalue of the tensor.
Usage
-----
x.plot_eig2([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$\lambda_2$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._eig2_label
if self.eig2 is None:
self.compute_eig()
if ax is None:
fig, axes = self.eig2.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False,
**kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.eig2.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_eig3(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the third eigenvalue of the tensor.
Usage
-----
x.plot_eig3([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$\lambda_3$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._eig3_label
if self.eig3 is None:
self.compute_eig()
if ax is None:
fig, axes = self.eig3.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False,
**kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.eig3.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_eigs(self, colorbar=True, cb_orientation='vertical',
tick_interval=[60, 60], minor_tick_interval=[20, 20],
xlabel='Longitude', ylabel='Latitude',
axes_labelsize=9, tick_labelsize=8, show=True, fname=None,
**kwargs):
"""
Plot the three eigenvalues of the tensor.
Usage
-----
x.plot_eigs([tick_interval, minor_tick_interval, xlabel, ylabel,
colorbar, cb_orientation, cb_label, axes_labelsize,
tick_labelsize, show, fname, **kwargs])
Parameters
----------
tick_interval : list or tuple, optional, default = [60, 60]
Intervals to use when plotting the major x and y ticks. If set to
None, major ticks will not be plotted.
minor_tick_interval : list or tuple, optional, default = [20, 20]
Intervals to use when plotting the minor x and y ticks. If set to
None, minor ticks will not be plotted.
xlabel : str, optional, default = 'Longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'Latitude'
Label for the latitude axis.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = None
Text label for the colorbar.
axes_labelsize : int, optional, default = 9
The font size for the x and y axes labels.
tick_labelsize : int, optional, default = 8
The font size for the x and y tick labels.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if colorbar is True:
if cb_orientation == 'horizontal':
scale = 2.3
else:
scale = 1.4
else:
scale = 1.65
figsize = (_mpl.rcParams['figure.figsize'][0],
_mpl.rcParams['figure.figsize'][0] * scale)
fig, ax = _plt.subplots(3, 1, figsize=figsize)
self.plot_eig1(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[0], xlabel=xlabel, ylabel=ylabel,
tick_interval=tick_interval,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_eig2(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[1], xlabel=xlabel, ylabel=ylabel,
tick_interval=tick_interval,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_eig3(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[2], xlabel=xlabel, ylabel=ylabel,
tick_interval=tick_interval,
axes_labelsize=axes_labelsize,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
fig.tight_layout(pad=0.5)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, ax
def plot_eigh1(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the first eigenvalue of the horizontal tensor.
Usage
-----
x.plot_eigh1([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$\lambda_{h1}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._eigh1_label
if self.eigh1 is None:
self.compute_eigh()
if ax is None:
fig, axes = self.eigh1.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False,
**kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.eigh1.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_eigh2(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the second eigenvalue of the horizontal tensor.
Usage
-----
x.plot_eigh2([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$\lambda_{h2}$, Eotvos$^{-1}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._eigh2_label
if self.eigh2 is None:
self.compute_eigh()
if ax is None:
fig, axes = self.eigh2.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False,
**kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.eigh2.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_eighh(self, colorbar=True, cb_orientation='vertical',
cb_label=None, ax=None, show=True, fname=None, **kwargs):
"""
Plot the maximum absolute value eigenvalue of the horizontal tensor.
Usage
-----
x.plot_eighh([tick_interval, xlabel, ylabel, ax, colorbar,
cb_orientation, cb_label, show, fname])
Parameters
----------
tick_interval : list or tuple, optional, default = [30, 30]
Intervals to use when plotting the x and y ticks. If set to None,
ticks will not be plotted.
xlabel : str, optional, default = 'longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'latitude'
Label for the latitude axis.
ax : matplotlib axes object, optional, default = None
A single matplotlib axes object where the plot will appear.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = '$\lambda_{hh}$'
Text label for the colorbar.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if cb_label is None:
cb_label = self._eighh_label
if self.eighh is None:
self.compute_eigh()
if ax is None:
fig, axes = self.eighh.plot(colorbar=colorbar,
cb_orientation=cb_orientation,
cb_label=cb_label, show=False,
**kwargs)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, axes
else:
self.eighh.plot(colorbar=colorbar, cb_orientation=cb_orientation,
cb_label=cb_label, ax=ax, **kwargs)
def plot_eigh(self, colorbar=True, cb_orientation='vertical',
tick_interval=[60, 60], minor_tick_interval=[20, 20],
xlabel='Longitude', ylabel='Latitude',
axes_labelsize=9, tick_labelsize=8, show=True, fname=None,
**kwargs):
"""
Plot the two eigenvalues and maximum absolute value eigenvalue of the
horizontal tensor.
Usage
-----
x.plot_eigh([tick_interval, minor_tick_interval, xlabel, ylabel,
colorbar, cb_orientation, cb_label, axes_labelsize,
tick_labelsize, show, fname, **kwargs])
Parameters
----------
tick_interval : list or tuple, optional, default = [60, 60]
Intervals to use when plotting the major x and y ticks. If set to
None, major ticks will not be plotted.
minor_tick_interval : list or tuple, optional, default = [20, 20]
Intervals to use when plotting the minor x and y ticks. If set to
None, minor ticks will not be plotted.
xlabel : str, optional, default = 'Longitude'
Label for the longitude axis.
ylabel : str, optional, default = 'Latitude'
Label for the latitude axis.
colorbar : bool, optional, default = True
If True, plot a colorbar.
cb_orientation : str, optional, default = 'vertical'
Orientation of the colorbar: either 'vertical' or 'horizontal'.
cb_label : str, optional, default = None
Text label for the colorbar.
axes_labelsize : int, optional, default = 9
The font size for the x and y axes labels.
tick_labelsize : int, optional, default = 8
The font size for the x and y tick labels.
show : bool, optional, default = True
If True, plot the image to the screen.
fname : str, optional, default = None
If present, and if axes is not specified, save the image to the
specified file.
kwargs : optional
Keyword arguements that will be sent to the SHGrid.plot()
and plt.imshow() methods.
"""
if colorbar is True:
if cb_orientation == 'horizontal':
scale = 2.3
else:
scale = 1.4
else:
scale = 1.65
figsize = (_mpl.rcParams['figure.figsize'][0],
_mpl.rcParams['figure.figsize'][0] * scale)
fig, ax = _plt.subplots(3, 1, figsize=figsize)
self.plot_eigh1(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[0], xlabel=xlabel, ylabel=ylabel,
tick_interval=tick_interval,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_eigh2(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[1], xlabel=xlabel, ylabel=ylabel,
tick_interval=tick_interval,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
self.plot_eighh(colorbar=colorbar, cb_orientation=cb_orientation,
ax=ax.flat[2], xlabel=xlabel, ylabel=ylabel,
tick_interval=tick_interval,
tick_labelsize=tick_labelsize,
minor_tick_interval=minor_tick_interval,
**kwargs)
fig.tight_layout(pad=0.5)
if show:
fig.show()
if fname is not None:
fig.savefig(fname)
return fig, ax
class SHGravTensor(Tensor):
"""
Class for the gravity field tensor and eigenvalues. The class is
initialized from a class instance of SHGravCoeffs using the method
tensor().
Attributes:
vxx, vxy, vzz, : The 9 components of the gravity tensor.
vyx, vyy, vyz,
vzx, vzy, vzz
i0, i1, i2, i : The three invariants of the gravity tensor and a
derived quantity that is bounded between 0 and 1.
gm : The gravitational constant times the mass of the body.
a : Semimajor axis of the reference ellipsoid.
f : Flattening of the reference ellipsoid, f=(a-b)/a.
lmax : The maximum spherical harmonic degree resolvable by the
grids.
lmax_calc : The maximum spherical harmonic degree of the
gravitational potential used in creating the grids.
nlat, nlon : The number of latitude and longitude bands in the grids.
sampling : The longitudinal sampling scheme of the grids: either 1
for nlong=nlat or 2 for nlong=2*nlat.
Methods:
plot() : Plot all 9 components of the gravity tensor.
plot_vxx() : Plot the vxx component of the gravity tensor.
plot_vxy() : Plot the vxy component of the gravity tensor.
plot_vxz() : Plot the vxz component of the gravity tensor.
plot_vyx() : Plot the vyx component of the gravity tensor.
plot_vyy() : Plot the vyy component of the gravity tensor.
plot_vyz() : Plot the vyz component of the gravity tensor.
plot_vzx() : Plot the vzx component of the gravity tensor.
plot_vzy() : Plot the vzy component of the gravity tensor.
plot_vzz() : Plot the vzz component of the gravity tensor.
compute_invar() : Compute the invariants of the gravity tensor.
plot_i0() : Plot the first invariant I0 of the gravity tensor.
plot_i1() : Plot the second invariant I1 of the gravity tensor.
plot_i2() : Plot the third invariant I2 of the gravity tensor.
plot_i() : Plot the derived quantity I = -(I2/2)**2 / (I1/3)**3.
compute_eig() : Compute the three eigenvalues of the gravity tensor.
plot_eig() : Plot the three eigenvalues of the gravity tensor.
plot_eig1() : Plot the first eigenvalue of the gravity tensor.
plot_eig2() : Plot the second eigenvalue of the gravity tensor.
plot_eig3() : Plot the third eigenvalue of the gravity tensor.
compute_eigh() : Compute the horizontal eigenvalues of the gravity tensor.
plot_eigh() : Plot the two horizontal eigenvalues and the combined
maximum absolute eigenvalue of the gravity tensor.
plot_eigh1() : Plot the first horizontal eigenvalue of the gravity
tensor.
plot_eigh2() : Plot the second horizontal eigenvalue of the gravity
tensor.
plot_eighh() : Plot the combined maximum absolute eigenvalue of the
gravity tensor.
copy() : Return a copy of the class instance.
info() : Print a summary of the data stored in the SHGravTensor
instance.
"""
def __init__(self, vxx, vyy, vzz, vxy, vxz, vyz, gm, a, f, lmax,
lmax_calc):
"""
Initialize the SHGravTensor class.
"""
self.vxx = _SHGrid.from_array(vxx, grid='DH')
self.vyy = _SHGrid.from_array(vyy, grid='DH')
self.vzz = _SHGrid.from_array(vzz, grid='DH')
self.vxy = _SHGrid.from_array(vxy, grid='DH')
self.vxz = _SHGrid.from_array(vxz, grid='DH')
self.vyz = _SHGrid.from_array(vyz, grid='DH')
self.vyx = self.vxy
self.vzx = self.vxz
self.vzy = self.vyz
self.grid = self.vxx.grid
self.sampling = self.vxx.sampling
self.nlat = self.vxx.nlat
self.nlon = self.vxx.nlon
self.gm = gm
self.a = a
self.f = f
self.lmax = lmax
self.lmax_calc = lmax_calc
self.i0 = None
self.i1 = None
self.i2 = None
self.i = None
self.eig1 = None
self.eig2 = None
self.eig3 = None
self.eigh1 = None
self.eigh2 = None
self.eighh = None
self._vxx_label = '$V_{xx}$, Eotvos'
self._vxy_label = '$V_{xy}$, Eotvos'
self._vxz_label = '$V_{xz}$, Eotvos'
self._vyx_label = '$V_{yx}$, Eotvos'
self._vyy_label = '$V_{yy}$, Eotvos'
self._vyz_label = '$V_{yz}$, Eotvos'
self._vzx_label = '$V_{zx}$, Eotvos'
self._vzy_label = '$V_{zy}$, Eotvos'
self._vzz_label = '$V_{zz}$, Eotvos'
self._i0_label = 'Tr $V_{ii}$, Eotvos'
self._i1_label = '$I_1$, Eotvos$^2$'
self._i2_label = 'det $V_{ij}$, Eotvos$^3$'
self._i_label = '$-(I_2/2)^{2} / (I_1/3)^{3}$'
self._eig1_label = '$\lambda_1$, Eotvos'
self._eig2_label = '$\lambda_2$, Eotvos'
self._eig3_label = '$\lambda_3$, Eotvos'
self._eigh1_label = '$\lambda_{h1}$, Eotvos'
self._eigh2_label = '$\lambda_{h2}$, Eotvos'
self._eighh_label = '$\lambda_{hh}$, Eotvos'
def __repr__(self):
str = ('grid = {:s}\n'.format(repr(self.grid)))
if self.grid == 'DH':
str += 'sampling = {:d}\n'.format(self.sampling)
str += ('nlat = {:d}\n'
'nlon = {:d}\n'
'lmax = {:d}\n'
'lmax_calc = {:d}\n'
'gm (m3 / s2) = {:e}\n'
'a (m)= {:e}\n'
'f = {:e}'
.format(self.nlat, self.nlon, self.lmax, self.lmax_calc,
self.gm, self.a, self.f))
return str
class SHMagTensor(Tensor):
"""
Class for the magnetic field tensor and eigenvalues. The class is
initialized from a class instance of SHMagCoeffs using the method
tensor().
Attributes:
vxx, vxy, vzz, : The 9 components of the magnetic field tensor.
vyx, vyy, vyz,
vzx, vzy, vzz
i0, i1, i2, i : The three invariants of the magnetic field tensor and a
derived quantity that is bounded between 0 and 1.
a : Semimajor axis of the reference ellipsoid.
f : Flattening of the reference ellipsoid, f=(a-b)/a.
lmax : The maximum spherical harmonic degree resolvable by the
grids.
lmax_calc : The maximum spherical harmonic degree of the
magnetic potential used in creating the grids.
nlat, nlon : The number of latitude and longitude bands in the grids.
sampling : The longitudinal sampling scheme of the grids: either 1
for nlong=nlat or 2 for nlong=2*nlat.
Methods:
plot() : Plot all 9 components of the magnetic field tensor.
plot_vxx() : Plot the vxx component of the magnetic field tensor.
plot_vxy() : Plot the vxy component of the magnetic field tensor.
plot_vxz() : Plot the vxz component of the magnetic field tensor.
plot_vyx() : Plot the vyx component of the magnetic field tensor.
plot_vyy() : Plot the vyy component of the magnetic field tensor.
plot_vyz() : Plot the vyz component of the magnetic field tensor.
plot_vzx() : Plot the vzx component of the magnetic field tensor.
plot_vzy() : Plot the vzy component of the magnetic field tensor.
plot_vzz() : Plot the vzz component of the magnetic field tensor.
compute_invar() : Compute the invariants of the magnetic field tensor.
plot_i0() : Plot the first invariant I0 of the magnetic field tensor.
plot_i1() : Plot the second invariant I1 of themagnetic field tensor.
plot_i2() : Plot the third invariant I2 of the magnetic field tensor.
plot_i() : Plot the derived quantity I = -(I2/2)**2 / (I1/3)**3.
compute_eig() : Compute the three eigenvalues of the magnetic field
tensor.
plot_eig() : Plot the three eigenvalues of the magnetic field tensor.
plot_eig1() : Plot the first eigenvalue of the magnetic field tensor.
plot_eig2() : Plot the second eigenvalue of the magnetic field tensor.
plot_eig3() : Plot the third eigenvalue of the magnetic field tensor.
compute_eigh() : Compute the horizontal eigenvalues of the magnetic field
tensor.
plot_eigh() : Plot the two horizontal eigenvalues and the combined
maximum absolute eigenvalue of the magnetic field tensor.
plot_eigh1() : Plot the first horizontal eigenvalue of the magnetic
field tensor.
plot_eigh2() : Plot the second horizontal eigenvalue of the magnetic
field tensor.
plot_eighh() : Plot the combined maximum absolute eigenvalue of the
magnetic field tensor.
copy() : Return a copy of the class instance.
info() : Print a summary of the data stored in the SHMagTensor
instance.
"""
def __init__(self, vxx, vyy, vzz, vxy, vxz, vyz, a, f, lmax,
lmax_calc):
"""
Initialize the SHMagTensor class.
"""
self.vxx = _SHGrid.from_array(vxx, grid='DH')
self.vyy = _SHGrid.from_array(vyy, grid='DH')
self.vzz = _SHGrid.from_array(vzz, grid='DH')
self.vxy = _SHGrid.from_array(vxy, grid='DH')
self.vxz = _SHGrid.from_array(vxz, grid='DH')
self.vyz = _SHGrid.from_array(vyz, grid='DH')
self.vyx = self.vxy
self.vzx = self.vxz
self.vzy = self.vyz
self.grid = self.vxx.grid
self.sampling = self.vxx.sampling
self.nlat = self.vxx.nlat
self.nlon = self.vxx.nlon
self.a = a
self.f = f
self.lmax = lmax
self.lmax_calc = lmax_calc
self.i0 = None
self.i1 = None
self.i2 = None
self.i = None
self.eig1 = None
self.eig2 = None
self.eig3 = None
self.eigh1 = None
self.eigh2 = None
self.eighh = None
self._vxx_label = '$V_{xx}$, nT m$^{-1}$'
self._vxy_label = '$V_{xy}$, nT m$^{-1}$'
self._vxz_label = '$V_{xz}$, nT m$^{-1}$'
self._vyx_label = '$V_{yx}$, nT m$^{-1}$'
self._vyy_label = '$V_{yy}$, nT m$^{-1}$'
self._vyz_label = '$V_{yz}$, nT m$^{-1}$'
self._vzx_label = '$V_{zx}$, nT m$^{-1}$'
self._vzy_label = '$V_{zy}$, nT m$^{-1}$'
self._vzz_label = '$V_{zz}$, nT m$^{-1}$'
self._i0_label = 'Tr $V_{ii}$, nT m$^{-1}$'
self._i1_label = '$I_1$, nT$^2$ m$^{-2}$'
self._i2_label = 'det $V_{ij}$, nT$^3$ m$^{-3}$'
self._i_label = '$-(I_2/2)^{2} / (I_1/3)^{3}$'
self._eig1_label = '$\lambda_1$, nT m$^{-1}$'
self._eig2_label = '$\lambda_2$, nT m$^{-1}$'
self._eig3_label = '$\lambda_3$, nT m$^{-1}$'
self._eigh1_label = '$\lambda_{h1}$, nT m$^{-1}$'
self._eigh2_label = '$\lambda_{h2}$, nT m$^{-1}$'
self._eighh_label = '$\lambda_{hh}$, nT m$^{-1}$'
def __repr__(self):
str = ('grid = {:s}\n'.format(repr(self.grid)))
if self.grid == 'DH':
str += 'sampling = {:d}\n'.format(self.sampling)
str += ('nlat = {:d}\n'
'nlon = {:d}\n'
'lmax = {:d}\n'
'lmax_calc = {:d}\n'
'a (m)= {:e}\n'
'f = {:e}'
.format(self.nlat, self.nlon, self.lmax, self.lmax_calc,
self.a, self.f))
return str
| 41.562099
| 79
| 0.552114
| 9,118
| 77,638
| 4.583571
| 0.031147
| 0.077166
| 0.042352
| 0.044027
| 0.939894
| 0.923671
| 0.912617
| 0.894097
| 0.882397
| 0.847271
| 0
| 0.010123
| 0.361254
| 77,638
| 1,867
| 80
| 41.58436
| 0.832631
| 0.472501
| 0
| 0.7023
| 0
| 0
| 0.047071
| 0.001788
| 0
| 0
| 0
| 0
| 0
| 1
| 0.044655
| false
| 0
| 0.012179
| 0
| 0.096076
| 0.00406
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
9e1e77c9894befe52b92a1f00af8be43e737081c
| 47,788
|
py
|
Python
|
scene2dxf.py
|
shucheng-ai/WDA-cad
|
73eb14841612d9827e0884998db00b436fbb2e0d
|
[
"Apache-2.0"
] | null | null | null |
scene2dxf.py
|
shucheng-ai/WDA-cad
|
73eb14841612d9827e0884998db00b436fbb2e0d
|
[
"Apache-2.0"
] | null | null | null |
scene2dxf.py
|
shucheng-ai/WDA-cad
|
73eb14841612d9827e0884998db00b436fbb2e0d
|
[
"Apache-2.0"
] | null | null | null |
#!/usr/bin/env python3
# coding:utf-8
from dxfwriter import DxfCanvas
import os
import random
def draw_test_fixtures (scene, canvases):
plan = scene['top_view']
wall, column, door = [], [], []
for i in plan:
t = i['color']
p = i['points']
if t == 'wall':
wall.append(p)
elif t == 'door' or t == 'dock' or t == 'exit':
door.append(p)
elif t == 'column' or t == 'misc_column':
column.append(p)
with canvases.layer('WDA_PARSE_WALL'):
with canvases.style(lineColor=random.randint(0, 200)):
for item in wall:
canvases.path(item)
with canvases.layer('WDA_PARSE_COLUMN'):
with canvases.style(lineColor=random.randint(0, 200)):
for item in column:
canvases.path(item)
with canvases.layer('WDA_PARSE_DOOR'):
with canvases.style(lineColor=random.randint(0, 200)):
for item in door:
canvases.path(item)
def scene_to_dxf (scene, outpath = None):
dxf = DxfCanvas()
draw_test_fixtures (scene, dxf)
if outpath == None:
outpath = ""
outpath = os.path.join (outpath, "wda_parse.dxf")
dxf.save(outpath)
pass
if __name__ == '__main__':
scene = {"navigation": [{"bbox": [[509176, 188672], [574497, 222793]], "room": "room1", "image": "data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAABAAAAAJICAIAAABwpAHvAAAgAElEQVR4AezBsY3lZqKt0U2XNkNgEBVB223RuPYXRIegILb9jGOVrQgqCIZA+9gPECDg/NC0rqYHxUtOfWtNkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTJEkSZL0ZUyRJEmS9GVMkSRJkvRlTNFXtS+P/MV6bNGv2pdH/mI9tuhX7csjf7EeW6Qr2ZdH/mI9tuhX7csjf7EeW/Sr9uWRv1iPLfqSpuir2pfHemx5sS+P9diiX7Uvj/XY8mJfHuuxRb9qXx7rseXFvjzWY4t0JfvyWI8tL/blsR5b9Kv25bEeW17sy2M9tuhX7ctjPba82JfHemzRlzRFX9W+PNZjy4t9eazHlj8B0b/jx/u3377/nhc/3r/99v336Ff9eP/22/ff8+LH+7ffvv8e6Up+vH/77fvvefHj/dtv33+PftWP92+/ff89L368f/vt++/Rr/rx/u2377/nxY/3b799/z3/pdpGPzflhoDoP/bj/dtv33/Pix/v3377/nv+1DaXB7TNNezLYz22vNiXx3ps0a/al8d6bHmxL4/12CJdyb481mPLi315rMcW/ap9eazHlhf78liPLfpV+/JYjy0v9uWxHltuDsi/8v94z3/s+Xbkv9SUGwLaZgS0zeUB+UPb/J/al8d6bHmxL4/12HIrQNtcw7481mPLi315rMcW/ap9eazHlhf78liPLdKV7MtjPba82JfHemzRr9qXx3psebEvj/XYol+1L4/12PJiXx7rseW/EfD/eM9/7H/6Pb+kba5tyg0BbTMC2ubygPypbf7v7MtjPba82JfHemy5FaBtrmFfHuux5cW+PNZji37VvjzWY8uLfXmsxxbpSvblsR5bXuzLYz226Ffty2M9trzYl8d6bNGv2pfHemx5sS+P9djy3whom88HtM0IaJtrm3JDQNuMgLa5PCBJWyBJ2/wf2ZfHemx5sS+P9dhyK0DbXMO+PNZjy4t9eazHFv2qfXmsx5YX+/JYjy36D+zLI6P12KL/wL481mPLi315rMcW/ap9eazHlhf78liPLfpV+/JYjy0v9uWxHlv+GwFt8/mAthkBbXNtUy5pXx75W+uxZQS0zeUBSdomAZK0zf+FfXmsx5YX+/JYjy23ArTNNezLYz22vNiXx3ps0a/al8d6bHmxL4/12KL/wL481mPLn/blsR5b9B/Yl8d6bHmxL4/12KJftS+P9djyYl8e67FFv2pfHuux5cW+PNZjy38joG0+H/Dj/Vv+1npsuZ4pl7Qvj/XY8hP78liPLSOgbS4PSNI2fwCStM3p9uWxHlte7MtjPbbcCtA217Avj/XY8mJfHuuxRb9qXx7rseXFvjzWY4v+A/vyWI8tf9qXx3ps0X9gXx7rseXFvjzWY4t+1b481mPLi315rMcW/ap9eazHlhf78liPLf+NgLb5fMCP92/rseUF0DZ/2JfHemy5nimXtC+P9djyE/vyWI8tI6BtLg9I0jb/1/blkb9Yjy1/AqJ/x4/3b/mL377/Hv2qH+/f8he/ff89+g/8eP/22/ff86cf799++/579B/48f4tf/Hb99+jX/Xj/Vv+4rfvv0e/6sf7t/zFb99/z3+ptvl8wI/3b+ux5QXQNn/Yl8d6bLmeKZe0L4/12PIT+/L47fvv0SdrG0n/dfblsR5b/rQvj/XYIkn/LYD8Z9rmHwB+vH9bjy0vgLb5w7481mPL9Uy5pH15rMeWn9iXx3psGQFtI0n6W/vyWI8tf9qXx3pskST9Ccg/8+P922/ff8+obf6wL4/12HI9Uy5pXx7rseUn9uWxHltGQNtIkv7WvjzWY8uf9uWxHlskSf8m4Mf7t/XY8gJomz/sy2M9tlzPlEval0f+1npsGQFtI0n6W/vyWI8tf9qXx3pskST9m4Af79/yt9Zjy/VMuSGgbUZA20iS/ta+PDJajy2SpH8T0DYjoG2ubcoNAW0zAtpGkiRJ+nxA24yAtrm2KTcEtM0IaBtJkiTp8wFtMwLa5tqm3BDQNiOgbSRJkqTPB7TNCGiba5tyQ0DbjIC2kSRJkj4f0DYjoG2ubcoNAW0zAtpGkiRJ+nxA24yAtrm2KTcEtM0IaBtJkiTp8wFtMwLa5tqm3BDQNiOgbSRJkqTPB7TNCGiba5tyQ0DbjIC2kSRJkj4f0DYjoG2ubcoNAW0zAtpGkiRJ+nxA24yAtrm2KTcEtM0IaBtJkiTp8wFtMwLa5tqm3BDQNiOgbSRJkqTPB7TNCGiba5tyQ0DbjIC2kSRJkj4f0DYjoG2ubcoNAW0zAtpGkiRJ+nxA24yAtrm2KTcEtM0IaBtJkiTp8wFtMwLa5tqm3BDQNiOgbSRJkqTPB7TNCGiba5tyQ0DbjIC2kSRJkj4f0DYjoG2ubcoNAW0zAtpGkiRJ+nxA24yAtrm2KXczfyxJnm9HRkDbSJIkSZ8PaJsR0DbXNuVu5o8lyfPtyAhoG0mSJOnzAW0zAtrm2qbczfyxJHm+HRkBbSNJkiR9PqBtRkDbXNuUu5k/liTPtyMjoG0kSZKkzwe0zQhom2ubcjfzx5Lk+XZkBLSNJEmS9PmAthkBbXNtU+5m/liSPN+OjIC2kSRJkj4f0DYjoG2ubcrdzB9LkufbkRHQNpIkSdLnA9pmBLTNtU25m/ljSfJ8OzIC2kaSJEn6fEDbjIC2ubYpdzN/LEn+p9/zF20jSZIkfT6gbUZA21zblLuZP5Yk/9Pv+Yu2kSRJkj4f0DYjoG2ubcrdzB9Lkv/p9yRt8yegbSRJkqTPB7TNCGiba5tyN/PHkuT5dgBJ2uYPQNtIkiRJnw9omxHQNtc25W7mjyXJ8+1IAiRpmwRoG0mSJOnzAW0zAtrm2qbczfyxJHm+HfkDkKQt0DaSJEnS5wPaZgS0zbVNuZv5Y0nyfDvyJ6At0DaSJEnS5wPaZgS0zbVNuZv5Y0nyfDsyAtpGkiRJ+nxA24yAtrm2KXczfyxJnm9HRkDbSJIkSZ8PaJsR0DbXNuVu5o8lyfPtyAhoG0mSJOnzAW0zAtrm2qbczfyxJHm+HRkBbSNJkiR9PqBtRkDbXNuUu5k/liTPtyMjoG0kSZKkzwe0zQhom2ubcjfzx5Lk+XZkBLSNJEmS9PmAthkBbXNtU+5m/liSPN+OjIC2kSRJkj4f0DYjoG2ubcrdzB9LkufbkRHQNpIkSdLnA9pmBLTNtU25m/ljSfJ8OzIC2kaSJEn6fEDbjIC2ubYpdzN/LEmeb0dGQNtIkiRJnw9omxHQNtc25W7mjyXJ8+3ICGgbSZIk6fMBbTMC2ubaptzN/LEkeb4dGQFtI0mSJH0+oG1GQNtc25S7mT+WJM+3IyOgbSRJkqTPB7TNCGiba5tyN/PHkuT5dmQEtI0kSZL0+YC2GQFtc21TbghomxHQNpIkSdLnA9pmBLTNtU25IaBtRkDbSJIkSZ8PaJsR0DbXNuWGgLYZAW0jSZIkfT6gbUZA21zblBsC2mYEtI0kSZL0+YC2GQFtc21TbghomxHQNpIkSdLnA9pmBLTNtU25IaBtRkDbSJIkSZ8PaJsR0DbXNuWGgLYZAW0jSZIkfT6gbUZA21zblBsC2mYEtI0kSZL0+YC2GQFtc21TbghomxHQNpIkSdLnA9pmBLTNtU25IaBtRkDbSJIkSZ8PaJsR0DbXNuWGgLYZAW0jSZIkfT6gbUZA21zblBsC2mYEtI0kSZL0+YC2GQFtc21TbghomxHQNpIkSdLnA9pmBLTNtU25IaBtRkDbSJIkSZ8PaJsR0DbXNuWGgLYZAW0jSZIkfT6gbUZA21zblBsC2mYEtI0kSZL0+YC2GQFtc21TbghomxHQNpIkSdLnA9pmBLTNtU25IaBtRkDbSJIkSZ8PaJsR0DbXNuWGgLYZAW0jSZIkfT6gbUZA21zblBsC2mYEtI0kSZL0+YC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gbIv9I2kiRJ0imAthkBbXNtU+4GaJsR0DaSJEnSKYC2GQFtc21T7gZomxHQNpIkSdIpgLYZAW1zbVPuBmibEdA2kiRJ0imAthkBbXNtUy5pXx75W+ux5QXQNpKkn9iXR/4367FFkvTPAD/ev+VvrceW65lySfvyWI8t/wrw4/3bemx5AbSNJOkn9uWxHlt+bl8e67FFkvTPAD/ev63HlhdA2/xhXx7rseV6plzSvjzWY8u/Avx4/7YeW14AbSNJ+ol9eazHlp/bl8d6bJEk/TPAj/dv67HlBdA2f9iXx3psuZ4pl7Qvj/XY8q8AP96/rceWF0DbSJJ+Yl8e67Hl5/blsR5bJEn/DPDj/dt6bHkBtM0f9uWxHluuZ8ol7ctjPbb8K8CP92/rseUF0DaSpJ/Yl8d6bPm5fXmsxxZJ0j8D/Hj/th5bXgBt84d9eazHluuZckn78liPLf8K8OP923pseQG0jSTpJ/blsR5bfm5fHuuxRZL0zwA/3r+tx5YXQNv8YV8e67HleqZc0r488rfWY8sLoG0kST+xL4/8b9ZjiyTpnwF+vH/L31qPLdcz5W6AthkBbSNJkiSdAmibEdA21zblboC2GQFtI0mSJJ0CaJsR0DbXNuVugLYZAW0jSZIknQJomxHQNtc25W6AthkBbSNJkiSdAmibEdA21zblboC2GQFtI0mSJJ0CaJsR0DbXNuVugLYZAW0jSZIknQJomxHQNtc25W6AthkBbSNJkiSdAmibEdA21zblboC2GQFtI0mSJJ0CaJsR0DbXNuVugLYZAW0jSZIknQJomxHQNtc25W6AthkBbSNJkiSdAmibEdA21zblboC2GQFtI0mSJJ0CaJsR0DbXNuVugLYZAW0jSZIknQJomxHQNtc25W6AthkBbSNJkiSdAmibEdA21zblboC2GQFtI0mSJJ0CaJsR0DbXNuVugLYZAW0jSZIknQJomxHQNtc25W6AthkBbSNJkiSdAmibEdA21zblboC2GQFtI0mSJJ0CaJsR0DbXNuVugLYZAW0jSZIknQJomxHQNtc25W6AthkBbSNJkiSdAmibEdA21zblboC2GQFtI0mSJJ0CaJsR0DbXNuVugLYZAW0jSZIknQJomxHQNtc25W6AthkBbSNJkiSdAmibEdA21zblboC2GQFtI0mSJJ0CaJsR0DbXNuVugLYZAW0jSZIknQJomxHQNtc25W6AthkBbSNJkiSdAmibEdA21zblboC2GQFtI0mSJJ0CaJsR0DbXNuVugLYZAW0jSZIknQJomxHQNtc25W6AthkBbSNJkiSdAmibEdA21zblboC2GQFtI0mSJJ0CaJsR0DbXNuVWgLYZAW0jSZIknQVomxHQNtc25VaAthkBbSNJkiSdBWibEdA21zblVoC2GQFtI0mSJJ0FaJsR0DbXNuVWgLYZAW0jSZIknQVomxHQNtc25VaAthkBbSNJkiSdBWibEdA21zblVoC2GQFtI0mSJJ0FaJsR0DbXNuVWgLYZAW0jSZIknQVomxHQNtc25VaAthkBbSNJkiSdBWibEdA21zblVoC2GQFtI0mSJJ0FaJsR0DbXNuVWgLYZAW0jSZIknQVomxHQNtc25VaAthkBbSNJkiSdBWibEdA21zblVoC2GQFtI0mSJJ0FaJsR0DbXNuVWgLYZAW0jSZIknQVomxHQNtc25VaAthkBbSNJkiSdBWibEdA21zblVoC2GQFtI0mSJJ0FaJsR0DbXNuVWgLYZAW0jSZIknQVomxHQNtc25VbmjyXJ8+3IC6BtJEmSpLMAbTMC2ubaptzK/LEkeb4deQG0jSRJknQWoG1GQNtc25RbmT+WJM+3Iy+AtpEkSZLOArTNCGiba5tyK/PHkuT5duQF0DaSJEnSWYC2GQFtc21TbmX+WJI83468ANpGkiRJOgvQNiOgba5tyq3MH0uS59uRF0DbSJIkSWcB2mYEtM21TbmV+WNJ8nw78gJoG0mSJOksQNuMgLa5tim3Mn8sSZ5vR14AbSNJkiSdBWibEdA21zblVuaPJcnz7cgLoG0kSZKkswBtMwLa5tqm3Mr8sSR5vh15AbSNJEmSdBagbUZA21zblFuZP5Ykz7cjL4C2kSRJks4CtM0IaJtrm3Ir88eS5Pl25AXQNpIkSdJZgLYZAW1zbVNuZf5YkjzfjrwA2kaSJEk6C9A2I6Btrm3KrcwfS5Ln25EXQNtIkiRJZwHaZgS0zbVNuZX5Y0nyfDvyAmgbSZIk6SxA24yAtrm2KbcyfyxJnm9HXgBtI0mSJJ0FaJsR0DbXNuVW5o8lyfPtyAugbSRJkqSzAG0zAtrm2qbcyvyxJHm+HXkBtI0kSZJ0FqBtRkDbXNuUW5k/liTPtyMvgLaRJEmSzgK0zQhom2ubcivzx5Lk+XbkBdA2kiRJ0lmAthkBbXNtU25l/liSPN+OvADaRpIkSToL0DYjoG2ubcqtzB9LkufbkRdA20iSJElnAdpmBLTNtU25lfljSfJ8O/ICaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3AuRfaRtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3ArTNCGgbSZIk6SxA24yAtrm2KbcCtM0IaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3ArTNCGgbSZIk6SxA24yAtrm2KbcCtM0IaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3ArTNCGgbSZIk6SxA24yAtrm2KbcCtM0IaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3ArTNCGgbSZIk6SxA24yAtrm2KbcCtM0IaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3ArTNCGgbSZIk6SxA24yAtrm2KbcCtM0IaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3ArTNCGgbSZIk6SxA24yAtrm2KbcCtM0IaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3ArTNCGgbSZIk6SxA24yAtrm2KbcCtM0IaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3ArTNCGgbSZIk6SxA24yAtrm2KbcCtM0IaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3ArTNCGgbSZIk6SxA24yAtrm2KbcCtM0IaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3ArTNCGgbSZIk6SxA24yAtrm2KbcCtM0IaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3ArTNCGgbSZIk6SxA24yAtrm2KbcCtM0IaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3ArTNCGgbSZIk6SxA24yAtrm2KbcCtM0IaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5tim3ArTNCGgbSZIk6SxA24yAtrm2KbcCtM0IaBtJkiTpLEDbjIC2ubYptwK0zQhoG0mSJOksQNuMgLa5timXtC+P/K312PInoG0kST+3L4/8b9ZjiyTpnwF+vH/L31qPLdcz5ZL25bEeW/4CaLsvj/XY8iegbSRJP7cvj/XY8nP78liPLZKkfwb48f5tPba8ANrmD/vyWI8t1zPlkvblsR5b/gJouy+P9djyJ6BtJEk/ty+P9djyc/vyWI8tkqR/Bvjx/m09trwA2uYP+/JYjy3XM+WS9uWxHlv+Ami7L4/12PInoG0kST+3L4/12PJz+/JYjy2SpH8G+PH+bT22vADa5g/78liPLdcz5ZL25bEeW/5invfnc92Xx3ps+RPQNpKkn9uXx3ps+bl9eazHFknSPwP8eP+2HlteAG3zh315rMeW65lySfvyWI8tfzHP+/O57stjPbb8CWgbSdLP7ctjPbb83L481mOLJOmfAX68f1uPLS+AtvnDvjzWY8v1TLmkfXnkb63Hlj8BbSNJ+rl9eeR/sx5bJEn/DPDj/Vv+1npsuZ4ptzLP+/O5ZgS0jSRJknQWoG1GQNtc25Rbmef9+VwzAtpGkiRJOgvQNiOgba5tyq3M8/58rhkBbSNJkiSdBWibEdA21zblVuZ5fz7XjIC2kSRJks4CtM0IaJtrm3Ir87w/n2tGQNtIkiRJZwHaZgS0zbVNuZV53p/PNSOgbSRJkqSzAG0zAtrm2qbcyjzvz+eaEdA2kiRJ0lmAthkBbXNtU25lnvfnc80IaBtJkiTpLEDbjIC2ubYptzLP+/O5ZgS0jSRJknQWoG1GQNtc25Rbmef9+VwzAtpGkiRJOgvQNiOgba5tyq3M8/58rhkBbSNJkiSdBWibEdA21zblVuZ5fz7XjIC2kSRJks4CtM0IaJtrm3Ir87w/n2tGQNtIkiRJZwHaZgS0zbVNuZV53p/PNSOgbSRJkqSzAG0zAtrm2qbcyjzvz+eaEdA2kiRJ0lmAthkBbXNtU25lnvfnc80IaBtJkiTpLEDbjIC2ubYptzLP+/O5ZgS0jSRJknQWoG1GQNtc25Rbmef9+VwzAtpGkiRJOgvQNiOgba5tyq3M8/58rhkBbSNJkiSdBWibEdA21zblVuZ5fz7XjIC2kSRJks4CtM0IaJtrm3Ir87w/n2tGQNtIkiRJZwHaZgS0zbVNuZV53p/PNSOgbSRJkqSzAG0zAtrm2qbcyjzvz+eaEdA2kiRJ0lmAthkBbXNtU25lnvfnc80IaBtJkiTpLEDbjIC2ubYptzLP+/O5ZgS0jSRJknQWoG1GQNtc25Rbmef9+VwzAtpGkiRJOgvQNiOgba5tyq3M8/58rhkBbSNJkiSdBWibEdA21zblVuZ5fz7XjIC2kSRJks4CtM0IaJtrm3Ir87w/n2tGQNtIkiRJZwHaZgS0zbVNuZV53p/PNSOgbSRJkqSzAG0zAtrm2qbcyjzvz+eaEdA2kiRJ0lmAthkBbXNtU25lnvfnc80IaBtJkiTpLEDbjIC2ubYptzLP+/O5ZgS0jSRJknQWoG1GQNtc25Rbmef9+VwzAtpGkiRJOgvQNiOgba5tyq3M8/58rhkBbSNJkiSdBWibEdA21zblVuZ5fz7XjIC2kSRJks4CtM0IaJtrm3Ir87w/n2tGQNtIkiRJZwHaZgS0zbVNuZV53p/PNSOgbSRJkqSzAG0zAtrm2qbcyjzvz+eaEdA2kiRJ0lmAthkBbXNtU25lnvfnc80IaBtJkiTpLEDbjIC2ubYptzLP+/O5ZgS0jSRJknQWoG1GQNtc25Rbmef9+VwzAtpGkiRJOgvQNiOgba5tyq3M8/58rhkBbSNJkiSdBWibEdA21zblVuZ5fz7XjIC2kSRJks4CtM0IaJtrm3Ir87w/n2tGQNtIkiRJZwHaZgS0zbVNuZV53p/PNSOgbSRJkqSzAG0zAtrm2qbcyjzvz+eaEX4wf4YAABOfSURBVNA2kiRJ0lmAthkBbXNtU25lnvfnc80IaBtJkiTpLEDbjIC2ubYptzLP+/O5ZgS0jSRJknQWoG1GQNtc25Rbmef9+VwzAtpGkiRJOgvQNiOgba5tyq3M8/58rhkBbSNJkiSdBWibEdA21zblVuZ5fz7XjIC2kSRJks4CtM0IaJtrm3Ir87w/n2tGQNtIkiRJZwHaZgS0zbVNuZV53p/PNSOgbSRJkqSzAG0zAtrm2qbcyjzvz+eaEdA2kiRJ0lmAthkBbXNtU25lnvfnc80IaBtJkiTpLEDbjIC2ubYptzLP+/O5ZgS0jSRJknQWoG1GQNtc25Rbmef9+VwzAtpGkiRJOgvQNiOgba5tyq3M8/58rhkBbSNJkiSdBWibEdA21zblVuZ5fz7XjIC2kSRJks4CtM0IaJtrm3Ir87w/n2v+f3twbCO3lmhR9Fz32hUCg1AEsscqY+wdhEKYIE4EZcmeCDoIhlA27Q8IeEBfDKQviyDRe60V0DaSJEnSWYC2WQFtc20jtzLnfhxbVkDbSJIkSWcB2mYFtM21jdzKnPtxbFkBbSNJkiSdBWibFdA21zZyK3Pux7FlBbSNJEmSdBagbVZA21zbyK3MuR/HlhXQNpIkSdJZgLZZAW1zbSO3Mud+HFtWQNtIkiRJZwHaZgW0zbWN3Mqc+3FsWQFtI0mSJJ0FaJsV0DbXNnIrc+7HsWUFtI0kSZJ0FqBtVkDbXNvIrcy5H8eWFdA2kiRJ0lmAtlkBbXNtI7cy534cW1ZA20iSJElnAdpmBbTNtY3cypz7cWxZAW0jSZIknQVomxXQNtc2citz7sexZQW0jSRJknQWoG1WQNtc28itzLkfx5YV0DaSJEnSWYC2WQFtc20jtwK0zQpoG0mSJOksQNusgLa5tpFbAdpmBbSNJEmSdBagbVZA21zbyK0AbbMC2kaSJEk6C9A2K6Btrm3kVoC2WQFtI0mSJJ0FaJsV0DbXNnIrQNusgLaRJEmSzgK0zQpom2sbuRWgbVZA20iSJElnAdpmBbTNtY3cCtA2K6BtJEmSpLMAbbMC2ubaRm4FaJsV0DaSJEnSWYC2WQFtc20jtwK0zQpoG0mSJOksQNusgLa5tpFbAdpmBbSNJEmSdBagbVZA21zbyK0AbbMC2kaSJEk6C9A2K6Btrm3kVoC2WQFtI0mSJJ0FaJsV0DbXNnIrQNusgLaRJEmSzgK0zQpom2sbuRWgbVZA20iSJElnAdpmBbTNtY3cCtA2K6BtJEmSpLMAbbMC2ubaRm4FaJsV0DaSJEnSWYC2WQFtc20jtwK0zQpoG0mSJOksQNusgLa5tpFbAdpmBbSNJEmSdBagbVZA21zbyK0AbbMC2kaSJEk6C9A2K6Btrm3kVoC2WQFtI0mSJJ0FaJsV0DbXNnIrQNusgLaRJEmSzgK0zQpom2sbuRWgbVZA20iSJElnAdpmBbTNtY3cCtA2K6BtJEmSpLMAbbMC2ubaRm4FaJsV0DaSJEnSWYC2WQFtc20jtwK0zQpoG0mSJOksQNusgLa5tpFbAdpmBbSNJEmSdBagbVZA21zbyK0AbbMC2kaSJEk6C9A2K6Btrm3kVoC2WQFtI0mSJJ0FaJsV0DbXNnIrQNusgLaRJEmSzgK0zQpom2sbuRWgbVZA20iSJElnAdpmBbTNtY3cCtA2K6BtJEmSpLMAbbMC2ubaRm4FaJsV0DaSJEnSWYC2WQFtc20jtwK0zQpoG0mSJOksQNusgLa5tpFbAdpmBbSNJEmSdBagbVZA21zbyK0AbbMC2kaSJEk6C9A2K6Btrm3kVoC2WQFtI0mSJJ0FaJsV0DbXNnIrQNusgLaRJEmSzgK0zQpom2sbuRWgbVZA20iSJElnAdpmBbTNtY1c0v545Y+29zP/ANpGkvR7++OV/8/2fkaS9HeAHz+/54+29zPXM3JJ++O1vZ/5H0Db/fHa3s/8A2gbSdLv7Y/X9n7m9/bHa3s/I0n6O8CPn9+39zOfAG3zy/54be9nrmfkkvbHa3s/8z+Atvvjtb2f+QfQNpKk39sfr+39zO/tj9f2fkaS9HeAHz+/b+9nPgHa5pf98drez1zPyCXtj9f2fuZ/AG33x2t7P/MPoG0kSb+3P17b+5nf2x+v7f2MJOnvAD9+ft/ez3wCtM0v++O1vZ+5npFL2h+v7f3M/wDa7o/X9n7mH0DbSJJ+b3+8tvczv7c/Xtv7GUnS3wF+/Py+vZ/5BGibX/bHa3s/cz0jl7Q/Xtv7mf8BtN0fr+39zD+AtpEk/d7+eG3vZ35vf7y29zOSpL8D/Pj5fXs/8wnQNr/sj9f2fuZ6Ri5pf7zyR9v7mX8AbSNJ+r398cr/Z3s/I0n6O8CPn9/zR9v7mesZuRWgbVZA20iSJElnAdpmBbTNtY3cCtA2K6BtJEmSpLMAbbMC2ubaRm4FaJsV0DaSJEnSWYC2WQFtc20jtwK0zQpoG0mSJOksQNusgLa5tpFbAdpmBbSNJEmSdBagbVZA21zbyK0AbbMC2kaSJEk6C9A2K6Btrm3kVoC2WQFtI0mSJJ0FaJsV0DbXNnIrQNusgLaRJEmSzgK0zQpom2sbuRWgbVZA20iSJElnAdpmBbTNtY3cCtA2K6BtJEmSpLMAbbMC2ubaRm4FaJsV0DaSJEnSWYC2WQFtc20jtwK0zQpoG0mSJOksQNusgLa5tpFbAdpmBbSNJEmSdBagbVZA21zbyK0AbbMC2kaSJEk6C9A2K6Btrm3kVoC2WQFtI0mSJJ0FaJsV0DbXNnIrQNusgLaRJEmSzgK0zQpom2sbuRWgbVZA20iSJElnAdpmBbTNtY3cCtA2K6BtJEmSpLMAbbMC2ubaRm4FaJsV0DaSJEnSWYC2WQFtc20jtwK0zQpoG0mSJOksQNusgLa5tpFbAdpmBbSNJEmSdBagbVZA21zbyK0AbbMC2kaSJEk6C9A2K6Btrm3kVoC2WQFtI0mSJJ0FaJsV0DbXNnIrQNusgLaRJEmSzgK0zQpom2sbuRWgbVZA20iSJElnAdpmBbTNtY3cCtA2K6BtJEmSpLMAbbMC2ubaRm4FaJsV0DaSJEnSWYC2WQFtc20jtwK0zQpoG0mSJOksQNusgLa5tpFbAdpmBbSNJEmSdBagbVZA21zbyK0AbbMC2kaSJEk6C9A2K6Btrm3kVoC2WQFtI0mSJJ0FaJsV0DbXNnIrQNusgLaRJEmSzgK0zQpom2sbuRWgbVZA20iSJElnAdpmBbTNtY3cCtA2K6BtJEmSpLMAbbMC2ubaRm4FaJsV0DaSJEnSWYC2WQFtc20jtwK0zQpoG0mSJOksQNusgLa5tpFbAdpmBbSNJEmSdBagbVZA21zbyH3MuSc5ji0roG0kSZKkswBtswLa5tpG7mPOPclxbFkBbSNJkiSdBWibFdA21zZyH3PuSY5jywpoG0mSJOksQNusgLa5tpH7mHNPchxbVkDbSJIkSWcB2mYFtM21jdzHnHuS49iyAtpGkiRJOgvQNiugba5t5D7m3JMcx5YV0DaSJEnSWYC2WQFtc20j9zHnnuQ4tqyAtpEkSZLOArTNCmibaxu5jzn3JMexZQW0jSRJknQWoG1WQNtc28h9zLknOY4tK6BtJEmSpLMAbbMC2ubaRu5jzj3JcWxZAW0jSZIknQVomxXQNtc2ch9z7kmOY8sKaBtJkiTpLEDbrIC2ubaR+5hzT3IcW1ZA20iSJElnAdpmBbTNtY3cx5x7kuPYsgLaRpIkSToL0DYroG2ubeQ+5tyTHMeWFdA2kiRJ0lmAtlkBbXNtI/cx557kOLasgLaRJEmSzgK0zQpom2sbuY859yTHsWUFtI0kSZJ0FqBtVkDbXNvIfcy5JzmOLSugbSRJkqSzAG2zAtrm2kbuY849yXFsWQFtI0mSJJ0FaJsV0DbXNnIfc+5JjmPLCmgbSZIk6SxA26yAtrm2kfuYc09yHFtWQNtIkiRJZwHaZgW0zbWN3Mece5Lj2LIC2kaSJEk6C9A2K6Btrm3kPubckxzHlhXQNpIkSdJZgLZZAW1zbSP3Meee5Di2rIC2kSRJks4CtM0KaJtrG7mPOfckx7FlBbSNJEmSdBagbVZA21zbyH3MuSc5ji0roG0kSZKkswBtswLa5tpG7mPOPclxbFkBbSNJkiSdBWibFdA21zZyH3PuSY5jywpoG0mSJOksQNusgLa5tpH7mHNPchxbVkDbSJIkSWcB2mYFtM21jdzHnHuS49iyAtpGkiRJOgvQNiugba5t5D7m3JMcx5YV0DaSJEnSWYC2WQFtc20j9zHnnuQ4tqyAtpEkSZLOArTNCmibaxu5jzn3JMexZQW0jSRJknQWoG1WQNtc28h9zLknOY4tK6BtJEmSpLMAbbMC2ubaRu5jzj3JcWxZAW0jSZIknQVomxXQNtc2ch9z7kmOY8sKaBtJkiTpLEDbrIC2ubaR+5hzT3IcW1ZA20iSJElnAdpmBbTNtY3cx5x7kuPYsgLaRpIkSToL0DYroG2ubeQ+5tyT/Pvf/8n/aBtJkiTpLEDbrIC2ubaR+5hzT3IcWz4B2kaSJEk6EdA2q/nxOL69c20j9zHnnuQ4tnwCtI0kSZJ0IqBtVvPjcXx759pG7mPOPclxbPkEaBtJkiTpREDbrObH4/j2zrWN3Mece5Lj2PIJ0DaSJEnSiYC2Wc2Px/HtnWsbuY859yTHseUToG0kSZKkEwFts5ofj+PbO9c2ch9z7kmOY8snQNtIkiRJJwLaZjU/Hse3d65t5D7m3JMcx5ZPgLaRJEmSTgS0zWp+PI5v71zbyH3MuSc5ji2fAG0jSZIknQhom9X8eBzf3rm2kfuYc09yHFs+AdpGkiRJOhHQNqv58Ti+vXNtI/cx557kOLZ8ArSNJEmSdCKgbVbz43F8e+faRu5jzj3JcWz5BGgbSZIk6URA26zmx+P49s61jdzHnHuS49jyCdA2kiRJ0omAtlnNj8fx7Z1rG7mPOfckx7HlE6BtJEmSpBMBbbOaH4/j2zvXNnIfc+5JjmPLJ0DbSJIkSScC2mY1Px7Ht3eubeQ+5tyTHMeWT4C2kSRJkk4EtM1qfjyOb+9c28h9zLknOY4tnwBtI0mSJJ0IaJvV/Hgc3965tpH7mHNPchxbPgHaRpIkSToR0Dar+fE4vr1zbSP3Meee5Di2fAK0jSRJknQioG1W8+NxfHvn2kbuY849yXFs+QRoG0mSJOlEQNus5sfj+PbOtY3cx5x7kuPY8gnQNpIkSdKJgLZZzY/H8e2daxu5jzn3JMex5ROgbSRJkqQTAW2zmh+P49s71zZyH3PuSY5jyydA20iSJEknAtpmNT8ex7d3rm3kPubckxzHlk+AtpEkSZJOBLTNan48jm/vXNvIfcy5JzmOLZ8AbSNJkiSdCGibFdA21zZyH3PuSY5jyydA20iSJEknAtpmBbTNtY3cx5x7kuPY8gnQNpIkSdKJgLZZAW1zbSP3Meee5Di2fAK0jSRJknQioG1WQNtc28h9zLknOY4tnwBtI0mSJJ0IaJsV0DbXNnIfc+5JjmPLJ0DbSJIkSScC2mYFtM21jdzHnHuS49jyCdA2kiRJ0omAtlkBbXNtI/cx557kOLZ8ArSNJEmSdCKgbVZA21zbyH3MuSc5ji2fAG0jSZIknQhomxXQNtc2ch9z7kmOY8snQNtIkiRJJwLaZgW0zbWN3Mece5J///s/kSRJki6pba5t5D7m3JMcx5ZPgLaRJEmSTgS0zQpom2sbuaT98cofbe9nfgHaRpL0R/vjlf/P9n5GkvR3gB8/v+ePtvcz1zNySfvjtb2fWc25JzmObX+8tvczvwBtI0n6o/3x2t7P/N7+eG3vZyRJfwf48fP79n7mE6Btftkfr+39zPWMXNL+eG3vZ1Zz7kmOY9sfr+39zC9A20iS/mh/vLb3M7+3P17b+xlJ0t8Bfvz8vr2f+QRom1/2x2t7P3M9I5e0P17b+5nVnHuS49j2x2t7P/ML0DaSpD/aH6/t/czv7Y/X9n5GkvR3gB8/v2/vZz4B2uaX/fHa3s9cz8gl7Y/X9n5mBbRNsj9e2/uZX4C2kST90f54be9nfm9/vLb3M5KkvwP8+Pl9ez/zCdA2v+yP1/Z+5npGLml/vLb3Mysgv/z4+f0///pvJEl/7cfP7//513/zez9+fv/Pv/4bSdJf+/Hz+3/+9d+s2uaX/fHa3s9cz8gl7Y9X/mh7PyNJ+mv745X/z/Z+RpL01/bHK3+0vZ+5nhFJkiRJX8aIJEmSpC9jRJIkSdKXMSJJkiTpyxiRJEmS9GWMSJIkSfoyRiRJkiR9GSOSJEmSvowRSZIkSV/GiCRJkqQvY0SSJEnSlzEiSZIk6csYkSRJkvRljEiSJEn6MkYkSZIkfRkjkiRJkr6MEUmSJElfxogkSZKkL2NEkiRJ0pcxIkmSJOnLGJEkSZL0ZYxIkiRJ+jJGJEmSJH0ZI5IkSZK+jBFJkiRJX8aIJEmSpC9jRJIkSdKXMSJJkiTpyxiRJEmS9GWMSJIkSfoyRiRJkiR9GSOSJEmSvowRSZIkSV/GiCRJkqQvY0SSJEnSlzEiSZIk6csYkSRJkvRljEiSJEn6MkYkSZIkfRkjkiRJkr6MEUmSJElfxogkSZKkL2NEkiRJ0pcxIkmSJOnLGJEkSZL0ZYxIkiRJ+jJGJEmSJH0ZI5IkSZK+jBFJkiRJX8b/AdshfsD5IzLrAAAAAElFTkSuQmCC"}, {"bbox": [[509176, 154972], [574497, 188693]], "room": "room2", "image": "data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAABAAAAAJCCAIAAADRPyKJAAAgAElEQVR4AezBsa0cyYJt0RNqymVC2tIypRJa3kbQBBpx5BZKokxb0oSSU/5AAwRuoIfziPcxVZF991ojkiRJkj6NEUmSJEmfxogkSZKkT2NEkiRJ0qcxIkmSJOnTGJEkSZL0aYxIkiRJ+jRGJEmSJH0aI5IkSZI+jRFJkiRJn8aIJEmSpE9jRJIkSdKnMSJJkiTp0xiRJEmS9GmMSJIkSfo0RiRJkiR9GiOSJEmSPo0RSZIkSZ/GiCRJkqRPY0SSJEnSpzEiSZIk6dMYkSRJkvRpjEiSJEn6NEYkSZIkfRojkiRJkj6NEUmSJEmfxogkSZKkT2NEkiRJ0qcxIkmSJOnTGJEkSZL0aYxIkiRJ+jRGJEmSJH0aI5IkSZI+jRFJkiRJn8aIJEmSpE9jRJIkSdKnMSJJkiTp0xiRJEmS9GmMSJIkSfo0RiRJkiR9GiOSJEmSPo0RSZIkSZ/GiCRJkqRPY0SSJEnSpzEiSZIk6dMYkSRJkvRpjEiSJEn6NEYkSZIkfRojkiRJkj6NEUmSJEmfxogkSZKkT2NEkiRJ0qcx8mkct0f+YX/e8y9y3B75h/15j346bo/8w/68R7923B75h/15j37tuD3yD/vzHv3acXvkH/bnPfq14/bIP+zPe/Rrx+2Rf9if9+in4/bIP+zPe/5Fjtsj/7A/7/kcRj6N4/bYn/d8cNwe+/Oef5Hj9tif93xw3B778x79dNwe+/OeD47bY3/eo187bo/9ec8Hx+2xP+/Rrx23x/6854Pj9tif9ygB8j/5+v2Pb19+5IOv3//49uVH9Gtfv//x7cuPfPD1+x/fvvzI/4e2+Vc7bo/9ec8Hx+2xP+/RT8ftsT/v+eC4PfbnPf8ix+2xP+/54Lg99uc9n8PIp3HcHvvzng+O22N/3vMvctwe+/OeD47bY3/eo5+O22N/3vPBcXvsz3v0a8ftsT/v+eC4PfbnPfq14/bYn/d8cNwe+/OeTw9I0hbIT22THLfH/rzng+P22J/36NeO22N/3vPBcXvsz3t+A5BP6ev3P759+ZEPvn7/49uXH3mrtlnGcXvsz3s+OG6P/XnPv8hxe+zPez44bo/9ec/nMPJpHLfH/rzng+P22J/3vBCQ/0tfv//x7cuPfPD1+x/fvvyIfvr6/Y9vX37kg6/f//j25Uf0a1+///Hty4988PX7H9++/Ih+7ev3P759+ZEPvn7/49uXH9Hf2uYDIMnX73/sz3s+OG6P/XmPfu24PfbnPR8ct8f+vOe/BbTNv9pxe+zPez44bo/9ec9bAVnG1+9/fPvyIx98/f7Hty8/8i/y9fsf3778aJufjttjf97zOYxcB5D/D1+///Hty4988PX7H9++/MjLtc3/jeP22J/3fHDcHvvzHv103B77854Pjttjf96jXztuj/15zwfH7bE/79GvHbfH/rzng+P22J/3fHpAZm2BtsftsT/v+eC4PfbnPfq14/bYn/d8cNwe+/Oe/xbQNv9qx+2xP+/54Lg99uc9+um4PfbnPR8ct8f+vOdf5Lg9vn35kQ++fv/j25cf+W1//fU1v3aeexY2ch1A28yAtvkNx+2Rf9if97wKkKQt0Db/B47bI/+wP+/RT8ftkX/Yn/fo147bI/+wP+/Rrx23R/5hf97z6QFJ2uYnIEnb4/bIP+zPe/Rrx+2Rf9if9/y3gLb5Vztuj/zD/rxHPx23R/5hf97zbwF8/f5H/mF/3vPbtu34889vbTMD/vrr63nuWdjIdQBtMwPa5gqA/K0t0DaS9MkASdpGSwLaRvr3ApK0Bdrmv7Vtx59/fmubGfDXX1/Pc8/CRq4DaJsZ0DZXACRpC7QF2kaSPhMgSdtoSUDbSP9SQJK2SYC2+W9t2/Hnn9/aZgb89dfX89yzsJHrANpmBrTNFQBJ2iYB2gJtI0mfBhCtrW2kfyMgSdv8DWib/9a2HX/++a1tZsBff309zz0LG7kOoG1mQNtcAZCkbf4GtI0kfSZA22hVQPQObaP/Y0Db/AS0zX9r244///zWNjPgr7++nueehY1cB9A2M6BtrgCIJH16bSNpBkQv1zb/rW07/vzzW9vMgL/++nqeexY2ch1ALq5tJEmS9G5A/j/89dfXP//8lv/JX399Pc89Cxu5DqBtZkDbSJIkSa+ybcd57kDb/AQk+euvr+e5Z2Ej1wG0zQxoG0mSJOlVtu04zx1om78BSdpu23GeexY2ch1A28yAtpEkSZJeZduO89yBtkmAJG2TbNtxnnsWNnIdQNvMgLaRJEmSXmXbjvPcgbZAkrb527Yd57lnYSPXAbTNDGgbSZIk6VW27TjPHcjf2uanbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRq4DaJsZ0DaSJEnSq2zbcZ470DazbTvOc8/CRi4CyC+0jSRJkvQq23ac5w60zWzbjvPcs7CRiwDyt7b5CWgbSZIk6YW27TjPHWib2bYd57lnYSMXAbQFkrTN34C2kSRJkl5o247z3IG2mW3bcZ57FjZyEUDbJECStkmAtpEkSZJeaNuO89yBtplt23GeexY2chFA2/wNSNIWaBtJkiTphbbtOM8daJvZth3nuWdhIxcBtM1PQP7WNpIkSdILbdtxnjvQNrNtO85zz8JGLgJomxnQNpIkSdILbdtxnjvQNrNtO85zz8JGLgJomxnQNpIkSdILbdtxnjvQNrNtO85zz8JGLgJomxnQNpIkSdILbduRXzvPPQsbuQigbWZA20iSJEkvB7TNDGibhY1cBNA2M6BtJEmSpJcD2mYGtM3CRi4CaJsZ0DaSJEnSywFtMwPaZmEjFwG0zQxoG0mSJOnlgLaZAW2zsJGLANpmBrSNJEmS9HJA28yAtlnYyEUAbTMD2kaSJEl6OaBtZkDbLGzkIoC2mQFtI0mSJL0ckP9J2yxs5CKAtpkBbSNJkiS9HNA2M6BtFjZyEUDbzIC2kSRJkl4OaJsZ0DYLG7kIoG1mQNtIkiRJLwe0zQxom4WNXATQNjOgbSRJkqSXA9pmBrTNwkYuAmibGdA2kiRJ0ssBbTMD2mZhIxcBtM0MaBtJkiTp5YC2mQFts7CRiwDaZga0jSRJkvRyQNvMgLZZ2MhFAG0zA9pGkiRJejmgbWZA2yxs5CKAtpkBbSNJkiS9HNA2M6BtFjZyEUDbzIC2kSRJkl4OaJsZ0DYLG7kIoG1mQNtIkiRJLwe0zQxom4WNXATQNjOgbSRJkqSXA9pmBrTNwkYuAmibGdA2kiRJ0ssBbTMD2mZhIxcBtM0MaBtJkiTp5YC2mQFts7CRiwDaZga0jSRJkvRyQNvMgLZZ2MhFAG0zA9pGkiRJejmgbWZA2yxs5CKAtpkBbSNJkiS9HNA2M6BtFjZyEUDbzIC2kSRJkl4OaJsZ0DYLG7kIoG1mQNtIkiRJLwe0zQxom4WNXATQNjOgbSRJkqSXA9pmBrTNwkYuAmibGdA2kiRJ0ssBbTMD2mZhIxcBtM0MaBtJkiTp5YC2mQFts7CRiwDaZga0jSRJkvRyQNvMgLZZ2MhFAG0zA9pGkiRJejmgbWZA2yxs5CKAtpkBbSNJkiS9HNA2M6BtFjZyEUDbzIC2kSRJkl4OaJsZ0DYLG7kIoG1mQNtIkiRJLwe0zQxom4WNXATQNjOgbSRJkqSXA9pmBrTNwkYuAmibGdA2kiRJ0ssBbTMD2mZhIxcBtM0MaBtJkiTptYC2mQFts7aRiwDaZga0jSRJkvRaQNvMgLZZ28hFAG0zA9pGkiRJei2gbWZA26xt5CKAtpkBbSNJkiS9FtA2M6Bt1jZyEUDbzIC2kSRJkl4LaJsZ0DZrG7kIoG1mQNtIkiRJrwW0zQxom7WNXATQNjOgbSRJkqTXAtpmBrTN2kYuAmibGdA2kiRJ0msBbTMD2mZtIxcBtM0MaBtJkiTptYC2mQFts7aRiwDaZga0jSRJkvRaQNvMgLZZ28hFAG0zA9pGkiRJei2gbWZA26xt5CKAtpkBbSNJkiS9FtA2M6Bt1jZyEUDbzIC2kSRJkl4LaJsZ0DZrG7kIoG1mQNtIkiRJrwW0zQxom7WNXATQNjOgbSRJkqTXAtpmBrTN2kYuAmibGdA2kiRJ0msBbTMD2mZtIxcBtM0MaBtJkiTptYC2mQFts7aRiwDaZga0jSRJkvRaQNvMgLZZ28hFAG0zA9pGkiRJei2gbWZA26xt5CKAtpkBbSNJkiS9FtA2M6Bt1jZyEUDbzIC2kSRJkl4LaJsZ0DZrG7kIoG1mQNtIkiRJrwW0zQxom7WNXATQNjOgbSRJkqTXAtpmBrTN2kYuAmibGdA2kiRJ0msBbTMD2mZtIxcBtM0MaBtJkiTptYC2mQFts7aRiwDaZga0jSRJkvRaQNvMgLZZ28hFAG0zA9pGkiRJei2gbWZA26xt5CKAtpkBbSNJkiS9FtA2M6Bt1jZyEUDbzIC2kSRJkl4LaJsZ0DZrG1nScXvkf7U/70mAtpEk/SfH7ZH/ZH/eI0n6PcDX73/kf7U/71nPyJKO22N/3vMB0DZ/O26P/XlPArSNJOk/OW6P/XnPrx23x/68R5L0e4Cv3//49uVHZm3zt+P22J/3rGdkScftsT/v+QBom78dt8f+vCcB2kaS9J8ct8f+vOfXjttjf94jSfptx+2xP+9A/tYWaJu/HbfH/rxnPSNLOm6P/XnPB0Db/O24PfbnPQnQNpKk/+S4PfbnPb923B778x5J0m87bo9vX360zQdA2yTH7bE/71nPyJKO22N/3vPTth1JznPP347bY3/ekwBtI0n6T47bY3/e82vH7bE/75Ek/bbj9vj25Uf+oW2S4/bYn/esZ2RJx+2xP+/5aduOJOe552/H7bE/70mAtpEk/SfH7bE/7/m14/bYn/dIkn7bcXt8+/KjLZC/tQXaJjluj/15z3pGlnTcHvlfffvyI39rG0nSf3LcHvlP9uc9kqTfdtwe+V/tz3vWM3IF23YkOc89M6BtJEmSpJcD2mYGtM3CRq5g244k57lnBrSNJEmS9HJA28yAtlnYyBVs25HkPPfMgLaRJEmSXg5omxnQNgsbuYJtO5Kc554Z0DaSJEnSywFtMwPaZmEjV7BtR5Lz3DMD2kaSJEl6OaBtZkDbLGzkCrbtSHKee2ZA20iSJEkvB7TNDGibhY1cwbYdSc5zzwxoG0mSJOnlgLaZAW2zsJEr2LYjyXnumQFtI0mSJL0c0DYzoG0WNnIF23YkOc89M6BtJEmSpJcD2mYGtM3CRq5g244k57lnBrSNJEmS9HJA28yAtlnYyBVs25HkPPfMgLaRJEmSXg5omxnQNgsbuYJtO5Kc554Z0DaSJEnSywFtMwPaZmEjV7BtR5Lz3DMD2kaSJEl6OaBtZkDbLGzkCrbtSHKee2ZA20iSJEkvB7TNDGibhY1cwbYdSc5zzwxoG0mSJOnlgLaZAW2zsJEr2LYjyXnumQFtI0mSJL0c0DYzoG0WNnIF23YkOc89M6BtJEmSpJcD2mYGtM3CRq5g244k57lnBrSNJEmS9HJA28yAtlnYyBVs25HkPPfMgLaRJEmSXg5omxnQNgsbuYJtO5Kc554Z0DaSJEnSywFtMwPaZmEjV7BtR5Lz3DMD2kaSJEl6OaBtZkDbLGzkCrbtSHKee2ZA20iSJEkvB7TNDGibhY1cwbYdSc5zzwxoG0mSJOnlgLaZAW2zsJEr2LYjyXnumQFtI0mSJL0c0DYzoG0WNnIF23YkOc89M6BtJEmSpJcD2mYGtM3CRq5g244k57lnBrSNJEmS9HJA28yAtlnYyBVs25HkPPfMgLaRJEmSXg5omxnQNgsbuYJtO5Kc554Z0DaSJEnSywFtMwPaZmEjV7BtR5Lz3DMD2kaSJEl6OaBtZkDbLGzkCrbtSHKee2ZA20iSJEkvB7TNDGibhY1cwbYdSc5zzwxoG0mSJOnlgLaZAW2zsJEr2LYjyXnumQFtI0mSJL0c0DYzoG0WNnIF23YkOc89M6BtJEmSpJcD2mYGtM3CRq5g244k57lnBrSNJEmS9HJA28yAtlnYyBVs25HkPPfMgLaRJEmSXg5omxnQNgsbuYJtO5Kc554Z0DaSJEnSywFtMwPaZmEjV7BtR5Lz3DMD2kaSJEl6OaBtZkDbLGzkCrbtSHKee2ZA20iSJEkvB7TNDGibhY1cwbYdSc5zzwxoG0mSJOnlgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJEr2LYjyXnu+QBoG0mSJOkdgLaZAW2zsJErANpmBrSNJEmS9A5A28yAtlnYyBUAbTMD2kaSJEl6B6BtZkDbLGzkCoC2mQFtI0mSJL0D0DYzoG0WNnIFQNvMgLaRJEmS3gFomxnQNgsbuQKgbWZA20iSJEnvALTNDGibhY1cAdA2M6BtJEmSpHcA2mYGtM3CRq4AyP+kbSRJkqR3ANpmBrTNwkauAGibGdA2kiRJ0jsAbTMD2mZhI1cAtM0MaBtJkiTpHYC2mQFts7CRKwDaZga0jSRJkvQOQNvMgLZZ2MgVAG0zA9pGkiRJegegbWZA2yxs5AqAtpkBbSNJkiS9A9A2M6BtFjZyBUDbzIC2kSRJkt4BaJsZ0DYLG7kCoG1mQNtIkiRJ7wC0zQxom4WNXAHQNjOgbSRJkqR3ANpmBrTNwkauAGibGdA2kiRJ0jsAbTMD2mZhI1cAtM0MaBtJkiTpHYC2mQFts7CRKwDaZga0jSRJkvQOQNvMgLZZ2MgVAG0zA9pGkiRJegegbWZA2yxs5AqAtpkBbSNJkiS9A9A2M6BtFjZyBUDbzIC2kSRJkt4BaJsZ0DYLG7kCoG1mQNtIkiRJ7wC0zQxom4WNXAHQNjOgbSRJkqR3ANpmBrTNwkauAGibGdA2kiRJ0jsAbTMD2mZhI1cAtM0MaBtJkiTpHYC2mQFts7CRKwDaZga0jSRJkvQOQNvMgLZZ2MgVAG0zA9pGkiRJegegbWZA2yxs5AqAtpkBbSNJkiS9A9A2M6BtFjZyBUDbzIC2kSRJkt4BaJsZ0DYLG7kCoG1mQNtIkiRJ7wC0zQxom4WNXAHQNjOgbSRJkqR3ANpmBrTNwkauAGibGdA2kiRJ0jsAbTMD2mZhI1cAtM0MaBtJkiTpHYC2mQFts7CRKwDaZga0jSRJkvQOQNvMgLZZ2MgVAG0zA9pGkiRJegegbWZA2yxs5AqAtpkBbSNJkiS9A9A2M6BtFjZyBUDbzIC2kSRJkt4BaJsZ0DYLG1nScXvkf7U/70DbSJJ+w3F75D/Zn/dIkn7bcXvkf7U/71nPyJKO22N/3vMT0DY/HbfH/rwDbSNJ+g3H7bE/7/m14/bYn/dIkn7bcXvsz3tmQNskx+2xP+9Zz8iSjttjf97zE9A2Px23x/68A20jSfoNx+2xP+/5teP22J/3SJJ+23F77M97ZkDbJMftsT/vWc/Iko7bY3/e8xPQNj8dt8f+vANtI0n6DcftsT/v+bXj9tif90iSfttxe+zPe2ZA2yTH7bE/71nPyJKO22N/3vMT0DY/HbfH/rwDbSNJ+g3H7bE/7/m14/bYn/dIkn7bcXvsz3tmQNskx+2xP+9Zz8iSjttjf97zE9A2Px23x/68A20jSfoNx+2xP+/5teP22J/3SJJ+23F77M97ZkDbJMftsT/vWc/Iko7bI/+r/XkH2kaS9BuO2yP/yf68R5L0247bI/+r/XnPekauAGibGdA2kiRJ0jsAbTMD2mZhI1cAtM0MaBtJkiTpHYC2mQFts7CRKwDaZga0jSRJkvQOQNvMgLZZ2MgVAG0zA9pGkiRJegegbWZA2yxs5AqAtpkBbSNJkiS9A9A2M6BtFjZyBUDbzIC2kSRJkt4BaJsZ0DYLG7kCoG1mQNtIkiRJ7wC0zQxom4WNXAHQNjOgbSRJkqR3ANpmBrTNwkauAGibGdA2kiRJ0jsAbTMD2mZhI1cAtM0MaBtJkiTpHYC2mQFts7CRKwDaZga0jSRJkvQOQNvMgLZZ2MgVAG0zA9pGkiRJegegbWZA2yxs5AqAtpkBbSNJkiS9A9A2M6BtFjZyBUDbzIC2kSRJkt4BaJsZ0DYLG7kCoG1mQNtIkiRJ7wC0zQxom4WNXAHQNjOgbSRJkqR3ANpmBrTNwkauAGibGdA2kiRJ0jsAbTMD2mZhI1cAtM0MaBtJkiTpHYC2mQFts7CRKwDaZga0jSRJkvQOQNvMgLZZ2MgVAG0zA9pGkiRJegegbWZA2yxs5AqAtpkBbSNJkiS9A9A2M6BtFjZyBUDbzIC2kSRJkt4BaJsZ0DYLG7kCoG1mQNtIkiRJ7wC0zQxom4WNXAHQNjOgbSRJkqR3ANpmBrTNwkauAGibGdA2kiRJ0jsAbTMD2mZhI1cAtM0MaBtJkiTpHYC2mQFts7CRKwDaZga0jSRJkvQOQNvMgLZZ2MgVAG0zA9pGkiRJegegbWZA2yxs5AqAtpkBbSNJkiS9A9A2M6BtFjZyBUDbzIC2kSRJkt4BaJsZ0DYLG7kCoG1mQNtIkiRJ7wC0zQxom4WNXAHQNjOgbSRJkqR3ANpmBrTNwkauAGibGdA2kiRJ0jsAbTMD2mZhI1cAtM0MaBtJkiTpHYC2mQFts7CRKwDaZga0jSRJkvQOQNvMgLZZ2MgVAG0zA9pGkiRJegegbWZA2yxs5AqAtpkBbSNJkiS9A9A2M6BtFjZyBUDbzIC2kSRJkt4BaJsZ0DYLG7kCoG1mQNtIkiRJ7wC0zQxom4WNXAHQNjOgbSRJkqR3ANpmBrTNwkauAGibGdA2kiRJ0jsAbTMD2mZhI1cAtM0MaBtJkiTpHYC2mQFts7CRKwDaZga0jSRJkvQOQNvMgLZZ2MgVAG0zA9pGkiRJegegbWZA2yxs5AqAtpkBbSNJkiS9A9A2M6BtFjZyBUDbzIC2kSRJkt4BaJsZ0DYLG7kCoG1mQNtIkiRJ7wC0zQxom4WNXAHQNjOgbSRJkqR3ANpmBrTNwkauAGibGdA2kiRJ0jsAbTMD2mZhI1cAtM0MaBtJkiTpHYC2mQFts7CRKwDaZga0jSRJkvQOQNvMgLZZ2MgVAG0zA9pGkiRJegegbWZA2yxs5AqAtpkBbSNJkiS9A9A2M6BtFjZyBUDbzIC2kSRJkt4BaJsZ0DYLG7kCoG1mQNtIkiRJ7wC0zQxom4WNXAHQNjOgbSRJkqR3ANpmBrTNwkauAGibGdA2kiRJ0jsAbTMD2mZhI1cAtM0MaBtJkiTpHYC2mQFts7CRKwDaZga0jSRJkvQOQNvMgJMIjv0AABfISURBVLZZ2MgVAG0zA9pGkiRJegegbWZA2yxs5AqAtpkBbSNJkiS9A9A2M6BtFjZyBUDbzIC2kSRJkt4BaJsZ0DYLG7kCoG1mQNtIkiRJ7wC0zQxom4WNXAHQNjOgbSRJkqR3ANpmBrTNwkauAGibGdA2kiRJ0jsAbTMD2mZhI1cAtM0MaBtJkiTpHYC2mQFts7CRKwDaZga0jSRJkvQOQNvMgLZZ2MgVAG0zA9pGkiRJegegbWZA2yxs5AqAtpkBbSNJkiS9A/y/9uDYxo5c4dbopku7QmAQY48hW1YZx95BdAgdxLZllCVbEXQQDKFs2g8YoIEi+s38uj2QioPzreUkmtlOooUV/RfYTqKZ7SQCAAAA7mA7iWa2k2hhRf8FtpNoZjuJAAAAgDvYTqKZ7SRaWNF/ge0kmtlOIgAAAOAOtpNoZjuJFlb0X2A7iWa2kwgAAAC4g+0kmtlOooUV/RfYTqKZ7SQCAAAA7mA7iWa2k2hhRf8FtpNoZjuJAAAAgDvYTqKZ7SRaWNF/ge0kmtlOIgAAAOAOtpNoZjuJFlb0X2A7iWa2kwgAAAC4g+0kmtlOooUV/RfYTqKZ7SQCAAAA7mA7iWa2k2hhRf8FtpNoZjuJAAAAgDvYTqKZ7SRaWNF/ge0kmtlOIgAAAOAOtpNoZjuJFlb0X2A7iWa2kwgAAAC4g+0kmtlOooUV/RfYTqKZ7SQCAAAA7mA7iWa2k2hhRcuznUQz20kEAAAA3MR2Es1sJ9HCipZnO4lmtpMIAAAAuIntJJrZTqKFFS3PdhLNbCcRAAAAcBPbSTSznUQLK1qe7SSa2U4iAAAA4Ca2k2hmO4kWVrQ820k0s51EAAAAwE1sJ9HMdhItrGh5tpNoZjuJAAAAgJvYTqKZ7SRaWNHybCfRzHYSAQAAADexnUQz20m0sKLl2U6ime0kAgAAAG5iO4lmtpNoYUXLs51EM9tJBAAAANzEdhLNbCfRwoqWZzuJZraTCAAAALiJ7SSa2U6ihRUtz3YSzWwnEQAAAHAT20k0s51ECytanu0kmtlOIgAAAOAmtpNoZjuJFla0PNtJNLOdRAAAAMBNbCfRzHYSLaxoebaTaGY7iQAAAICb2E6ime0kWljR8mwn0cx2EgEAAAA3sZ1EM9tJtLCi5dlOopntJAIAAABuYjuJZraTaGFFy7OdRDPbSQQAAADcxHYSzWwn0cKKlmc7iWa2kwgAAAC4ie0kmtlOooUVLc92Es1sJxEAAABwE9tJNLOdRAsrWp7tJJrZTiIAAADgJraTaGY7iRZWtDzbSTSznUQAAADATWwn0cx2Ei2saHm2k2hmO4kAAACAm9hOopntJFpY0fJsJ9HMdhIBAAAAN7GdRDPbSbSwouXZTqKZ7SQCAAAAbmI7iWa2k2hhRcuznUQz20kEAAAA3MR2Es1sJ9HCipZnO4lmtpMIAAAAuIntJJrZTqKFFS3PdhLNbCcRAAAAcBPbSTSznUQLK1qe7SSa2U4iAAAA4Ca2k2hmO4kWVrQ820k0s51EAAAAwE1sJ9HMdhItrGhJfTv0j16//kgiAMDP6duh/0s7dwEAflrfDv2jdu5aT9GS+na0c9dfbCfRRd+O168/kggA8HP6drRz19/r29HOXQCAn9a3o527ZraTSOrb0c5d6ylaUt+Odu76i+0kuujb8fr1RxIBAH5O34527vp7fTvauQsA8NP6drRz18x2Ekl9O9q5az1FS+rb0c5df6m1Sxqj6V3fjtevP5IIAPBz+na0c9ff69vRzl0AgJ/Wt6Odu2a2k0jq29HOXespWlLfjnbu+kutXdIYTe/6drx+/ZFEAICf07ejnbv+Xt+Odu4CAPy0vh3t3DWznURS34527lpP0ZL6drRz119q7ZLGaHrXt+P1648kAgD8nL4d7dz19/p2tHMXAOCn9e1o566Z7SSS+na0c9d6ipbUt0P/6PXrjyQCAPycvh36v7RzFwDgp/Xt0D9q5671FC2v1i5pjKYL20kEAAAA3MR2Es1sJ9HCipZXa5c0RtOF7SQCAAAAbmI7iWa2k2hhRcurtUsao+nCdhIBAAAAN7GdRDPbSbSwouXV2iWN0XRhO4kAAACAm9hOopntJFpY0fJq7ZLGaLqwnUQAAADATWwn0cx2Ei2saHm1dkljNF3YTiIAAADgJraTaGY7iRZWtLxau6Qxmi5sJxEAAABwE9tJNLOdRAsrWl6tXdIYTRe2kwgAAAC4ie0kmtlOooUVLa/WLmmMpgvbSQQAAADcxHYSzWwn0cKKlldrlzRG04XtJAIAAABuYjuJZraTaGFFy6u1Sxqj6cJ2EgEAAAA3sZ1EM9tJtLCi5dXaJY3RdGE7iQAAAICb2E6ime0kWljR8mrtksZourCdRAAAAMBNbCfRzHYSLaxoebV2SWM0XdhOIgAAAOAmtpNoZjuJFla0vFq7pDGaLmwnEQAAAHAT20k0s51ECytaXq1d0hhNF7aTCAAAALiJ7SSa2U6ihRUtr9YuaYymC9tJBAAAANzEdhLNbCfRwoqWV2uXNEbThe0kAgAAAG5iO4lmtpNoYUXLq7VLGqPpwnYSAQAAADexnUQz20m0sKLl1doljdF0YTuJAAAAgJvYTqKZ7SRaWNHyau2Sxmi6sJ1EAAAAwE1sJ9HMdhItrGh5tXZJYzRd2E4iAAAA4Ca2k2hmO4kWVrS8WrukMZoubCcRAAAAcBPbSTSznUQLK1perV3SGE0XtpMIAAAAuIntJJrZTqKFFS2v1i5pjKYL20kEAAAA3MR2Es1sJ9HCipZXa5c0RtOF7SQCAAAAbmI7iWa2k2hhRcurtUsao+nCdhIBAAAAN7GdRDPbSbSwouXV2iWN0XRhO4kAAACAm9hOopntJFpY0fJq7ZLGaLqwnUQAAADATWwn0cx2Ei2saHm1dkljNF3YTiIAAADgJraTaGY7iRZWtLxau6Qxmi5sJxEAAABwE9tJNLOdRAsrWl6tXdIYTRe2kwgAAAC4ie0kmtlOooUVLa/WLmmMpgvbSQQAAADcxHYSzWwn0cKKlldrlzRG04XtJAIAAABuYjuJZraTaGFFy6u1Sxqj6cJ2EgEAAAA3sZ1EM9tJtLCi5dXaJY3RdGE7iQAAAICb2E6ime0kWljR8mrtksZourCdRAAAAMBNbCfRzHYSLaxoebV2SWM0XdhOIgAAAOAmtpNoZjuJFla0vFq7pDGaLmwnEQAAAHAT20k0s51ECytaXq1d0hhNF7aTCAAAALiJ7SSa2U6ihRUtr9YuaYymC9tJBAAAANzEdhLNbCfRwoqWV2uXNEbThe0kAgAAAG5iO4lmtpNoYUXLq7VLGqPpwnYSAQAAADexnUQz20m0sKLl1doljdF0YTuJAAAAgJvYTqKZ7SRaWNHyau2Sxmi6sJ1EAAAAwE1sJ9HMdhItrGh5tXZJYzRd2E4iAAAA4Ca2k2hmO4kWVrS8WrukMZoubCcRAAAAcBPbSTSznUQLK1perV3SGE0XtpMIAAAAuIntJJrZTqKFFS2v1i5pjKYL20kEAAAA3MR2Es1sJ9HCipZXa5c0RtOF7SQCAAAAbmI7iWa2k2hhRcurtUsao+nCdhIBAAAAN7GdRDPbSbSwouXV2iWN0XRhO4kAAACAm9hOopntJFpY0fJq7ZLGaLqwnUQAAADATWwn0cx2Ei2saHm1dkljNF3YTiIAAADgJraTaGY7iRZWtLxau6Qxmi5sJxEAAABwE9tJNLOdRAsrWl6tXdIYTRe2kwgAAAC4ie0kmtlOooUVLa/WLmmMpgvbSQQAAADcxHYSzWwn0cKKlldrlzRG04XtJAIAAABuYjuJZraTaGFFy6u1Sxqj6cJ2EgEAAAA3sZ1EM9tJtLCi5dXaJY3RdGE7iQAAAICb2E6ime0kWljR8mrtksZourCdRAAAAMBNbCfRzHYSLaxoebV2SWM0XdhOIgAAAOAmtpNoZjuJFla0vFq7pDGaLmwnEQAAAHAT20k0s51ECytaXq1d0hhNF7aTCAAAALiJ7SSa2U6ihRUtr9YuaYymC9tJBAAAANzEdhLNbCfRwoqWV2uXNEbThe0kAgAAAH67Wrv+3hhNCytaXq1d0hhNF7aTCAAAAPjtau1jNNtJNKu1j9G0sKLl1doljdF0YTuJAAAAgN+u1j5Gs51Es1r7GE0LK1perV3SGE0XtpMIAAAA+O1q7WM02/rg27eXx+NVUhItqWh5tXZJYzRd2E4iAAAA4LertY/RbCfRrNY+RrOdREsqWl6tXdIYTRe2kwgAAAD47WrtYzTbSTSrtY/RbCfRkoqWV2uXNEbThe0kAgAAAH67WvsYzbY++Pbt5fF4lZRESypaXq1d0hhNF7aTCAAAAPjtau1jNNtJbOvi27eXx+NVUhItqWh5tXZJYzRd2E4iAAAA4LertY/RbCexnUR/sf3t28sYzXYSLaloebV2SWM0XdhOIgAAAOC3q7WP0WwnsZ1Ef7H97dvL4/EqKYmWVLS2+rbpzzdJYzRd2E4iAAAA4NezrXdJau1jNNtJbCfRX2x/+/byeLxKSqIlFa2tvm36803SGE0XtpMIAAAA+PVsJ9FfbH/79vJ4vOr/59u3l8fjVVISLalobfVt059vksZourCdRAAAAMCvZzuJ3tXax2i2k+id7SS19sfjNYlWVbS2+rbpzzdJYzRd2E4iAAAA4NeznUTvau1jNNtJ9M62pG/fXsZoWljR2urbpj/fJI3RdGE7iQAAAIBfz3YSvau1j9FsJ9Gs1j5G08KK1lbfNv35JmmMpgvbSQQAAAD8eraT6F2tfYxmO4lmtfYxmhZWtLb6tunPN0ljNF3YTiIAAADg17OdRO9q7WM020k0q7WP0bSworXVt01/vkkao+nCdhIBAAAAv57tJHpXax+j2U6iWa19jKaFFa2tvm36803SGE0XtpMIAAAA+PVsJ9G7WvsYzXYSzWrtYzQtrGht9W3Tn2+SHo9XzZIIAAAA+PVsJ9G7WvsYzXYSzWrtYzQtrGht9W2TNP44dWE7iQAAAIDfwnYSvau1j9FsJ9Gs1j5G08KK1lbfNknjj1MXtpMIAAAA+C1sJ9G7WvsYzXYSzWrtYzQtrGht9W2TNP44dWE7iQAAAIDfwnYSvau1j9FsJ9Gs1j5G08KK1lbfNknjj1MXtpMIAAAA+C1sJ9G7WvsYzXYSzWrtYzQtrGht9W2TNP44dWE7iQAAAIDfwnYSvau1j9FsJ9Gs1j5G08KK1lbfNknjj1MXtpMIAAAA+C1sJ9G7WvsYzXYSzWrtYzQtrGht9W2TNP44dWE7iQAAAIDfwnYSvau1j9FsJ9Gs1j5G08KK1lbfNknjj1MXtpMIAAAA+C1sJ9G7WvsYzXYSzWrtYzQtrGht9W2TNP44dWE7iQAAAIDfwnYSvau1j9FsJ9Gs1j5G08KK1lbfNknjj1MXtpMIAAAA+C1sJ9G7WvsYzXYSzWrtYzQtrGht9W2TNP44dWE7iQAAAIDfwnYSvau1j9FsJ9Gs1j5G08KK1lbfNknjj1MXtpMIAAAA+C1sJ9G7WvsYzXYSzWrtYzQtrGht9W2TNP44dWE7iQAAAIBfz3YSXdTax2i2k2hWax+jaWFFa7OdRDPbSQQAAAD8eraT6KLW/ni8JtEHtfYxmhZWtDbbSTSznUQAAADAr2c7iS5q7Y/HaxJ9UGsfo2lhRWuznUQz20kEAAAA/Hq2k+ii1v54vCbRB7X2MZoWVrQ220k0s51EAAAAwK9nO4kuau2Px2sSfVBrH6NpYUVrs51EM9tJBAAAAPx6tpPootb+eLwm0Qe19jGaFla0NttJNLOdRAAAAMCvZzuJLmrtj8drEn1Qax+jaWFFa7OdRDPbSQQAAAD8eraT6KLW/ni8JtEHtfYxmhZWtDbbSTSznUQAAADAr2c7iS5q7Y/HaxJ9UGsfo2lhRWuznUQz20kEAAAA/Hq2k+ii1v54vCbRB7X2MZoWVrQ220k0s51EAAAAwK9nO4kuau2Px2sSfVBrH6NpYUVrs51EM9tJBAAAAPx6tpPootb+eLwm0Qe19jGaFla0NttJNLOdRACA/13fDs3auQsA8PdsJ9FFrf3xeE2iD2rtYzQtrGhJfTv0j9q5CwDwv+vb0c5d7/p2tHMXAODv2U6ii1r74/H68v2L/lE7d62naEl9O9q5S7KtD16+f3n9+kMAgP/dy/cvr19/6N3L9y+vX38IAPC/+Pbt5fF4ffn+pZ27ZrX2MZqkvh3t3LWeoiX17WjnLsl2Es36drRzFwDgf9e3o5273vXtaOcuAMDfs51EF7X2x+P15fuXdu6a1drHaJL6drRz13qKltS3o527JNtJNOvb0c5dAID/Xd+Odu5617ejnbsAAH/PdhJd1Nofj9eX71/auWtWax+jSerb0c5d6ylaUt+Odu6SbCfRrG9HO3fh3+nboQ/auQuf1bdDH7RzFz6rb4c+aOcu/At9O9q5613fjnbuwr/Qt0MftHMXPqtvhz5o5y58Vt8OfdDOXfg5tpPootb+eLy+fP/Szl2zWvsYTVLfjnbuWk/Rkvp2tHOXZDuJZn072rkL/07fjnbuuujb0c5d+Ky+He3cddG3o5278Fl9O9q566JvRzt34V/o29HOXe/6drRzF/6Fvh3t3HXRt6Odu/BZfTvaueuib0c7d+Gz+na0c9dF34527sLPsZ1EF7X2x+P15fuXdu6a1drHaJL6drRz13qKltS3Q/+onbvw7/TtaOeui74d7dyFz+rb0c5dF3072rkLn9W3o527Lvp2tHMX/oW+He3c9a5vRzt34V/o29HOXRd9O9q5C5/Vt6Oduy76drRzFz6rb0c7d1307WjnLvwc20l0UWt/PF5fvn/RP2rnrvUUrc12Es1sJxH+nb4d7dx10bejnbvwWX072rnrom9HO3fhs/p2tHPXRd+Odu7Cv9C3Q7N27sK/0Lejnbsu+na0cxc+q29HO3dd9O1o5y58Vt+Odu666NvRzl34ObaT6KLW/ni8JtEHtfYxmhZWtDbbSTSznUT4d/p2tHPXRd+Odu7CZ/XtaOeui74d7dyFz+rb0c5dF3072rkLWEnfjnbuuujb0c5d+Ky+He3cddG3o5278Fl9O9q566JvRzt34efY1rskkmrtj8drEn1Qax+jaWFFa7Mt/Bov37+8fv2hi5fvX16//hA+6+X7l9evP3Tx8v3L69cfwme9fP/y+vWHLl6+f3n9+kPASl6+f3n9+kMXL9+/vH79IXzWy/cvr19/6OLl+5fXrz+Ez3r5/uX16w9dvHz/8vr1h/BZ37696O+N0bSwIjyrvh3t3HXRt6Odu/BZfTvaueuib0c7d+Gz+na0c9dF34527gJW0rejnbsu+na0cxc+q29HO3dd9O1o5y58Vt+Odu666NvRzl14SkV4Vn072rnrom9HO3fhs/p2tHPXRd+Odu7CZ/XtaOeui74d7dwFrKRvRzt3XfTtaOcufFbfjnbuuujb0c5d+Ky+He3cddG3o5278JSK8Kz6drRz10Xfjnbuwmf17Wjnrou+He3chc/q29HOXRd9O9q5C1hJ34527rro29HOXfisvh3t3HXRt6Odu/BZfTvaueuib0c7d+EpFeFZ9e3QB+3chc/q26EP2rkLn9W3Qx+0cxewkr4d+qCdu/BZfTv0QTt34bP6duiDdu7CUyoCAAAA8DSKAAAAADyNIgAAAABPowgAAADA0ygCAAAA8DSKAAAAADyNIgAAAABPowgAAADA0ygCAAAA8DSKAAAAADyNIgAAAABPowgAAADA0ygCAAAA8DSKAAAAADyNIgAAAABPowgAAADA0ygCAAAA8DSKAAAAADyNIgAAAABPowgAAADA0ygCAAAA8DSKAAAAADyNIgAAAABPowgAAADA0ygCAAAA8DSKAAAAADyNIgAAAABPowgAAADA0ygCAAAA8DSKAAAAADyNIgAAAABPowgAAADA0ygCAAAA8DSKAAAAADyNIgAAAABPowgAAADA0ygCAAAA8DSKAAAAADyNIgAAAABPowgAAADA0ygCAAAA8DSKAAAAADyNIgAAAABPowgAAADA0ygCAAAA8DSKAAAAADyNIgAAAABPowgAAADA0ygCAAAA8DT+HwHgqNh6nn6vAAAAAElFTkSuQmCC"}], "top_view": [{"points": [[522277, 222631], [514379, 222590], [514338, 222549], [509895, 222549], [509895, 219957], [509854, 219916], [509813, 214280], [509771, 208603], [509730, 191654], [509648, 191654], [509648, 188734], [574235, 188734], [574235, 222508], [571273, 222549], [571273, 222631], [522277, 222631]], "color": "wall", "color_code": []}, {"points": [[509844, 218547], [509896, 218547], [509896, 220519], [509844, 220519], [509844, 218547]], "color": "exit", "color_code": []}, {"points": [[574235, 190022], [574236, 190022], [574236, 191544], [574235, 191544], [574235, 190022]], "color": "exit", "color_code": []}, {"points": [[571326, 222527], [572848, 222527], [572848, 222549], [571326, 222549], [571326, 222527]], "color": "exit", "color_code": []}, {"points": [[509772, 208772], [509785, 208772], [509785, 210294], [509772, 210294], [509772, 208772]], "color": "exit", "color_code": []}, {"points": [[509750, 200112], [509764, 200112], [509764, 205454], [509750, 205454], [509750, 200112]], "color": "dock", "color_code": []}, {"points": [[509648, 188912], [509737, 188912], [509737, 194254], [509648, 194254], [509648, 188912]], "color": "dock", "color_code": []}, {"points": [[517626, 222172], [518047, 222172], [518047, 222793], [517626, 222793], [517626, 222172]], "color": "column", "color_code": []}, {"points": [[525626, 222172], [526047, 222172], [526047, 222793], [525626, 222793], [525626, 222172]], "color": "column", "color_code": []}, {"points": [[533626, 222172], [534047, 222172], [534047, 222793], [533626, 222793], [533626, 222172]], "color": "column", "color_code": []}, {"points": [[549626, 222172], [550047, 222172], [550047, 222793], [549626, 222793], [549626, 222172]], "color": "column", "color_code": []}, {"points": [[557626, 222172], [558047, 222172], [558047, 222793], [557626, 222793], [557626, 222172]], "color": "column", "color_code": []}, {"points": [[565626, 222172], [566047, 222172], [566047, 222793], [565626, 222793], [565626, 222172]], "color": "column", "color_code": []}, {"points": [[509176, 221872], [509897, 221872], [509897, 222293], [509176, 222293], [509176, 221872]], "color": "column", "color_code": []}, {"points": [[509176, 213572], [509897, 213572], [509897, 213993], [509176, 213993], [509176, 213572]], "color": "column", "color_code": []}, {"points": [[509176, 205272], [509897, 205272], [509897, 205693], [509176, 205693], [509176, 205272]], "color": "column", "color_code": []}, {"points": [[509176, 196972], [509897, 196972], [509897, 197393], [509176, 197393], [509176, 196972]], "color": "column", "color_code": []}, {"points": [[509176, 188672], [509897, 188672], [509897, 189093], [509176, 189093], [509176, 188672]], "color": "column", "color_code": []}, {"points": [[541626, 221772], [542047, 221772], [542047, 222393], [541626, 222393], [541626, 221772]], "color": "column", "color_code": []}, {"points": [[541476, 213572], [542197, 213572], [542197, 213993], [541476, 213993], [541476, 213572]], "color": "column", "color_code": []}, {"points": [[541476, 205272], [542197, 205272], [542197, 205693], [541476, 205693], [541476, 205272]], "color": "column", "color_code": []}, {"points": [[541476, 196972], [542197, 196972], [542197, 197393], [541476, 197393], [541476, 196972]], "color": "column", "color_code": []}, {"points": [[541476, 188672], [542197, 188672], [542197, 189093], [541476, 189093], [541476, 188672]], "color": "column", "color_code": []}, {"points": [[573776, 221872], [574497, 221872], [574497, 222293], [573776, 222293], [573776, 221872]], "color": "column", "color_code": []}, {"points": [[573776, 213572], [574497, 213572], [574497, 213993], [573776, 213993], [573776, 213572]], "color": "column", "color_code": []}, {"points": [[573776, 205272], [574497, 205272], [574497, 205693], [573776, 205693], [573776, 205272]], "color": "column", "color_code": []}, {"points": [[573776, 196972], [574497, 196972], [574497, 197393], [573776, 197393], [573776, 196972]], "color": "column", "color_code": []}, {"points": [[573776, 188672], [574497, 188672], [574497, 189093], [573776, 189093], [573776, 188672]], "color": "column", "color_code": []}, {"points": [[544698, 188569], [544657, 188446], [514256, 188446], [514214, 188404], [509648, 188404], [509648, 186060], [509607, 186018], [509566, 180382], [509525, 174705], [509484, 157757], [509401, 157757], [509401, 155288], [573741, 155288], [573782, 158333], [574440, 158333], [574440, 158579], [574317, 158620], [574317, 180547], [574235, 180753], [574276, 184990], [574276, 187870], [574235, 187911], [574235, 188404], [572178, 188404], [572137, 188446], [554447, 188487], [554447, 188569], [544698, 188569]], "color": "wall", "color_code": []}, {"points": [[509401, 156822], [509486, 156822], [509486, 158344], [509401, 158344], [509401, 156822]], "color": "exit", "color_code": []}, {"points": [[573645, 185509], [574277, 185509], [574277, 188405], [573645, 188405], [573645, 185509]], "color": "dock", "color_code": []}, {"points": [[509529, 175212], [509568, 175212], [509568, 180554], [509529, 180554], [509529, 175212]], "color": "dock", "color_code": []}, {"points": [[573645, 155288], [574318, 155288], [574318, 159056], [573645, 159056], [573645, 155288]], "color": "dock", "color_code": []}, {"points": [[509477, 157757], [509500, 157757], [509500, 163954], [509477, 163954], [509477, 157757]], "color": "dock", "color_code": []}, {"points": [[509176, 180372], [509897, 180372], [509897, 180793], [509176, 180793], [509176, 180372]], "color": "column", "color_code": []}, {"points": [[509176, 172072], [509897, 172072], [509897, 172493], [509176, 172493], [509176, 172072]], "color": "column", "color_code": []}, {"points": [[509176, 163772], [509897, 163772], [509897, 164193], [509176, 164193], [509176, 163772]], "color": "column", "color_code": []}, {"points": [[509176, 155472], [509897, 155472], [509897, 155893], [509176, 155893], [509176, 155472]], "color": "column", "color_code": []}, {"points": [[541476, 180372], [542197, 180372], [542197, 180793], [541476, 180793], [541476, 180372]], "color": "column", "color_code": []}, {"points": [[541476, 172072], [542197, 172072], [542197, 172493], [541476, 172493], [541476, 172072]], "color": "column", "color_code": []}, {"points": [[541476, 163772], [542197, 163772], [542197, 164193], [541476, 164193], [541476, 163772]], "color": "column", "color_code": []}, {"points": [[541626, 155372], [542047, 155372], [542047, 155993], [541626, 155993], [541626, 155372]], "color": "column", "color_code": []}, {"points": [[573776, 180372], [574497, 180372], [574497, 180793], [573776, 180793], [573776, 180372]], "color": "column", "color_code": []}, {"points": [[573776, 172072], [574497, 172072], [574497, 172493], [573776, 172493], [573776, 172072]], "color": "column", "color_code": []}, {"points": [[573776, 163772], [574497, 163772], [574497, 164193], [573776, 164193], [573776, 163772]], "color": "column", "color_code": []}, {"points": [[573776, 155472], [574497, 155472], [574497, 155893], [573776, 155893], [573776, 155472]], "color": "column", "color_code": []}, {"points": [[517626, 154972], [518047, 154972], [518047, 155593], [517626, 155593], [517626, 154972]], "color": "column", "color_code": []}, {"points": [[525626, 154972], [526047, 154972], [526047, 155593], [525626, 155593], [525626, 154972]], "color": "column", "color_code": []}, {"points": [[533626, 154972], [534047, 154972], [534047, 155593], [533626, 155593], [533626, 154972]], "color": "column", "color_code": []}, {"points": [[549626, 154972], [550047, 154972], [550047, 155593], [549626, 155593], [549626, 154972]], "color": "column", "color_code": []}, {"points": [[557626, 154972], [558047, 154972], [558047, 155593], [557626, 155593], [557626, 154972]], "color": "column", "color_code": []}, {"points": [[565626, 154972], [566047, 154972], [566047, 155593], [565626, 155593], [565626, 154972]], "color": "column", "color_code": []}, {"points": [[516526, 188272], [516947, 188272], [516947, 188693], [516526, 188693], [516526, 188272]], "color": "column", "color_code": []}, {"points": [[572125, 188272], [572546, 188272], [572546, 188693], [572125, 188693], [572125, 188272]], "color": "column", "color_code": []}, {"points": [[511126, 188272], [511547, 188272], [511547, 188693], [511126, 188693], [511126, 188272]], "color": "column", "color_code": []}, {"points": [[566725, 188272], [567146, 188272], [567146, 188693], [566725, 188693], [566725, 188272]], "color": "column", "color_code": []}, {"points": [[523376, 188272], [523797, 188272], [523797, 188693], [523376, 188693], [523376, 188272]], "color": "column", "color_code": []}, {"points": [[530676, 188272], [531097, 188272], [531097, 188693], [530676, 188693], [530676, 188272]], "color": "column", "color_code": []}, {"points": [[537976, 188272], [538397, 188272], [538397, 188693], [537976, 188693], [537976, 188272]], "color": "column", "color_code": []}, {"points": [[559875, 188272], [560296, 188272], [560296, 188693], [559875, 188693], [559875, 188272]], "color": "column", "color_code": []}, {"points": [[552575, 188272], [552996, 188272], [552996, 188693], [552575, 188693], [552575, 188272]], "color": "column", "color_code": []}, {"points": [[545275, 188272], [545696, 188272], [545696, 188693], [545275, 188693], [545275, 188272]], "color": "column", "color_code": []}], "top_view_bbox": [[509176, 154972], [574497, 222793]]}
scene_to_dxf(scene)
| 783.409836
| 46,469
| 0.888173
| 2,213
| 47,788
| 19.138726
| 0.447808
| 0.013175
| 0.021604
| 0.023138
| 0.195991
| 0.177457
| 0.12837
| 0.12837
| 0.113637
| 0.105232
| 0
| 0.213358
| 0.030008
| 47,788
| 61
| 46,470
| 783.409836
| 0.700349
| 0.000711
| 0
| 0.157895
| 0
| 0.052632
| 0.810839
| 0.772475
| 0
| 1
| 0
| 0
| 0
| 1
| 0.052632
| false
| 0.026316
| 0.078947
| 0
| 0.131579
| 0
| 0
| 0
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
f5224f91f4ef3d2ad29ce63c8864cbf0add25dc7
| 9,807
|
py
|
Python
|
Start.py
|
BetikSonu/BotInstagram
|
beb757e54a69faa6df83f454914aa6516c7c299f
|
[
"MIT"
] | 4
|
2020-07-05T09:24:51.000Z
|
2021-03-31T06:04:30.000Z
|
Start.py
|
BetikSonu/BotInstagram
|
beb757e54a69faa6df83f454914aa6516c7c299f
|
[
"MIT"
] | null | null | null |
Start.py
|
BetikSonu/BotInstagram
|
beb757e54a69faa6df83f454914aa6516c7c299f
|
[
"MIT"
] | 2
|
2020-05-14T11:29:35.000Z
|
2021-02-23T08:57:20.000Z
|
from selenium import webdriver
import time
import random
import string
import sys
def start():
while True:
try:
text = str(input("Please put Special(s) or Unlimited(u)"))
if text == "s":
number = int(input("Please put a above number"))
special(number)
elif text == "u":
unlimited()
else:
print("Please put Special(s) or Unlimited(u)")
except Exception:
sys.exit(1)
def special(number: int):
if number == 0:
print("Please put a someone value")
sys.exit(1)
for i in range(number):
browser = webdriver.Chrome()
browser.get("https://www.instagram.com")
time.sleep(1)
try:
def mail(stringLength=8):
letters = string.ascii_lowercase
return ''.join(random.choice(letters) for i in range(stringLength))
def password(stringLength=8):
lettersAndDigits = string.ascii_letters + string.digits
return ''.join((random.choice(lettersAndDigits) for i in range(stringLength)))
def clickKaydol():
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/article/div[2]/div[2]/div/p/a/span').click()
clickKaydol()
time.sleep(1)
newemail = mail() + "@gmail.com" # Mail
newname = mail() + " " + mail() # Full Name
newuser = mail() # Username
newpass = password() # Password
email = browser.find_element_by_name("emailOrPhone")
name = browser.find_element_by_name("fullName")
user = browser.find_element_by_name("username")
passwordd = browser.find_element_by_name("password")
email.send_keys(newemail)
name.send_keys(newname)
user.send_keys(newuser)
passwordd.send_keys(newpass)
time.sleep(1)
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/form/div[7]/div/button').click()
time.sleep(2)
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[4]/div/div/span/span[1]/select/option[2]').click()
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[4]/div/div/span/span[2]/select/option[1]').click()
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[4]/div/div/span/span[3]/select/option[31]').click()
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[5]/div[2]/button').click()
print(newemail)
print(newname)
print(newpass)
print(newuser)
print("------------")
f = open("accounts.txt", "a+")
f.write("\nMail: " + newemail + "\n")
f.write("Name: " + newname + "\n")
f.write("Username: " + newuser + "\n")
f.write("Password: " + newpass + "\n")
f.write("------------------")
f.close()
except Exception:
browser.close()
browser = webdriver.Chrome()
browser.get("https://www.instagram.com")
time.sleep(1)
def mail(stringLength=8):
letters = string.ascii_lowercase
return ''.join(random.choice(letters) for i in range(stringLength))
def password(stringLength=8):
lettersAndDigits = string.ascii_letters + string.digits
return ''.join((random.choice(lettersAndDigits) for i in range(stringLength)))
def clickKaydol():
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/article/div[2]/div[2]/div/p/a/span').click()
clickKaydol()
time.sleep(1)
newemail = mail() + "@gmail.com" # Mail
newname = mail() + " " + mail() # Full Name
newuser = mail() # Username
newpass = password() # Password
email = browser.find_element_by_name("emailOrPhone")
name = browser.find_element_by_name("fullName")
user = browser.find_element_by_name("username")
passwordd = browser.find_element_by_name("password")
email.send_keys(newemail)
name.send_keys(newname)
user.send_keys(newuser)
passwordd.send_keys(newpass)
time.sleep(3)
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/article/div[2]/div[1]/div/form/div[7]/div/button').click()
time.sleep(2)
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[4]/div/div/span/span[1]/select/option[2]').click()
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[4]/div/div/span/span[2]/select/option[1]').click()
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[4]/div/div/span/span[3]/select/option[31]').click()
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[5]/div[2]/button').click()
print(newemail)
print(newname)
print(newpass)
print(newuser)
print("------------")
f = open("accounts.txt", "a+")
f.write("\nMail: " + newemail + "\n")
f.write("Name: " + newname + "\n")
f.write("Username: " + newuser + "\n")
f.write("Password: " + newpass + "\n")
f.write("------------------\n")
f.close()
def unlimited():
while True:
browser = webdriver.Chrome()
browser.get("https://www.instagram.com")
time.sleep(1)
try:
def mail(stringLength=8):
letters = string.ascii_lowercase
return ''.join(random.choice(letters) for i in range(stringLength))
def password(stringLength=8):
lettersAndDigits = string.ascii_letters + string.digits
return ''.join((random.choice(lettersAndDigits) for i in range(stringLength)))
def clickKaydol():
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/article/div[2]/div[2]/div/p/a/span').click()
clickKaydol()
time.sleep(1)
newemail = mail() + "@gmail.com" # Mail
newname = mail() + " " + mail() # Full Name
newuser = mail() # Username
newpass = password() # Password
email = browser.find_element_by_name("emailOrPhone")
name = browser.find_element_by_name("fullName")
user = browser.find_element_by_name("username")
passwordd = browser.find_element_by_name("password")
email.send_keys(newemail)
name.send_keys(newname)
user.send_keys(newuser)
passwordd.send_keys(newpass)
time.sleep(1)
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/form/div[7]/div/button').click()
time.sleep(2)
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[4]/div/div/span/span[1]/select/option[2]').click()
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[4]/div/div/span/span[2]/select/option[1]').click()
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[4]/div/div/span/span[3]/select/option[31]').click()
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[5]/div[2]/button').click()
print(newemail)
print(newname)
print(newpass)
print(newuser)
print("------------")
f = open("accounts.txt", "a+")
f.write("\nMail: " + newemail + "\n")
f.write("Name: " + newname + "\n")
f.write("Username: " + newuser + "\n")
f.write("Password: " + newpass + "\n")
f.write("------------------")
f.close()
except Exception:
browser.close()
browser = webdriver.Chrome()
browser.get("https://www.instagram.com")
time.sleep(1)
def mail(stringLength=8):
letters = string.ascii_lowercase
return ''.join(random.choice(letters) for i in range(stringLength))
def password(stringLength=8):
lettersAndDigits = string.ascii_letters + string.digits
return ''.join((random.choice(lettersAndDigits) for i in range(stringLength)))
def clickKaydol():
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/article/div[2]/div[2]/div/p/a/span').click()
clickKaydol()
time.sleep(1)
newemail = mail() + "@gmail.com" # Mail
newname = mail() + " " + mail() # Full Name
newuser = mail() # Username
newpass = password() # Password
email = browser.find_element_by_name("emailOrPhone")
name = browser.find_element_by_name("fullName")
user = browser.find_element_by_name("username")
passwordd = browser.find_element_by_name("password")
email.send_keys(newemail)
name.send_keys(newname)
user.send_keys(newuser)
passwordd.send_keys(newpass)
time.sleep(3)
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/article/div[2]/div[1]/div/form/div[7]/div/button').click()
time.sleep(2)
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[4]/div/div/span/span[1]/select/option[2]').click()
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[4]/div/div/span/span[2]/select/option[1]').click()
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[4]/div/div/span/span[3]/select/option[31]').click()
browser.find_element_by_xpath(
'//*[@id="react-root"]/section/main/div/article/div/div[1]/div/div[5]/div[2]/button').click()
print(newemail)
print(newname)
print(newpass)
print(newuser)
print("------------")
f = open("accounts.txt", "a+")
f.write("\nMail: " + newemail + "\n")
f.write("Name: " + newname + "\n")
f.write("Username: " + newuser + "\n")
f.write("Password: " + newpass + "\n")
f.write("------------------\n")
f.close()
start()
| 35.404332
| 123
| 0.630264
| 1,316
| 9,807
| 4.587386
| 0.083587
| 0.045718
| 0.119265
| 0.132516
| 0.948153
| 0.948153
| 0.948153
| 0.938546
| 0.938546
| 0.938546
| 0
| 0.01349
| 0.176099
| 9,807
| 276
| 124
| 35.532609
| 0.733663
| 0.013358
| 0
| 0.913793
| 0
| 0.103448
| 0.317276
| 0.235959
| 0
| 0
| 0
| 0
| 0
| 1
| 0.064655
| false
| 0.103448
| 0.021552
| 0
| 0.12069
| 0.094828
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
|
0
| 8
|
f580ed01e0bce7cd7f18be396bef947e347e332a
| 4,241
|
py
|
Python
|
venv/Lib/site-packages/docutils/parsers/rst/include/isocyr1.txt.py
|
roshanba/mangal
|
f7b428811dc07214009cc33f0beb665ead402038
|
[
"bzip2-1.0.6",
"MIT"
] | null | null | null |
venv/Lib/site-packages/docutils/parsers/rst/include/isocyr1.txt.py
|
roshanba/mangal
|
f7b428811dc07214009cc33f0beb665ead402038
|
[
"bzip2-1.0.6",
"MIT"
] | null | null | null |
venv/Lib/site-packages/docutils/parsers/rst/include/isocyr1.txt.py
|
roshanba/mangal
|
f7b428811dc07214009cc33f0beb665ead402038
|
[
"bzip2-1.0.6",
"MIT"
] | null | null | null |
XX XXXX XXXX XXXX XXX XXXX XXXXXX XX XXX XXXXXX XXXXXXX
XX XXXXXXX XXXX XXX XXXXXXX XXXXXXXXX XXXXXXXX XXXXXXXXX XXXX
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
XXXXXXXXX XX XXXXXXXXXXXXXXXXXXX XXXX XX XXXXXXXXX
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX X
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX X
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XXX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XXX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX X
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX X
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XXX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XXX
XX XXXXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XXXX XXXX
XX XXXXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XXXX XXXX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX X
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX X
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XXXXX X
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XXXXX X
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXXXXX XXXXXXXXX XXXXXXX XX XXXXXX XXXX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX X
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX X
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XXXXX
XX XXXXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XXXXX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XXX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XXX
XX XXXXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XXXX XXXX
XX XXXXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XXXX XXXX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XXX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XXX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX X
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX X
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XXXX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XXXX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XX
XX XXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXXXX XXXXXX XXX
XX XXXXXX XXXXXXXXX XXXXXXX XX XXXXXXXX XXXXX XXXXXX XXX
| 57.310811
| 66
| 0.809715
| 635
| 4,241
| 5.407874
| 0.018898
| 0.21258
| 0.351194
| 0.499709
| 0.9371
| 0.9371
| 0.9371
| 0.933023
| 0.894584
| 0.878567
| 0
| 0
| 0.190285
| 4,241
| 73
| 67
| 58.09589
| 1
| 0
| 0
| 0.930556
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | null | 0
| 0
| null | null | 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 11
|
195f0791206d9d2a61c6cb9bf16b1de2903167b4
| 12,409
|
py
|
Python
|
angr/procedures/definitions/win32_mgmtapi.py
|
r4b3rt/angr
|
c133cfd4f83ffea2a1d9e064241e9459eaabc55f
|
[
"BSD-2-Clause"
] | null | null | null |
angr/procedures/definitions/win32_mgmtapi.py
|
r4b3rt/angr
|
c133cfd4f83ffea2a1d9e064241e9459eaabc55f
|
[
"BSD-2-Clause"
] | null | null | null |
angr/procedures/definitions/win32_mgmtapi.py
|
r4b3rt/angr
|
c133cfd4f83ffea2a1d9e064241e9459eaabc55f
|
[
"BSD-2-Clause"
] | null | null | null |
# pylint:disable=line-too-long
import logging
from ...sim_type import SimTypeFunction, SimTypeShort, SimTypeInt, SimTypeLong, SimTypeLongLong, SimTypeDouble, SimTypeFloat, SimTypePointer, SimTypeChar, SimStruct, SimTypeFixedSizeArray, SimTypeBottom, SimUnion, SimTypeBool
from ...calling_conventions import SimCCStdcall, SimCCMicrosoftAMD64
from .. import SIM_PROCEDURES as P
from . import SimLibrary
_l = logging.getLogger(name=__name__)
lib = SimLibrary()
lib.set_default_cc('X86', SimCCStdcall)
lib.set_default_cc('AMD64', SimCCMicrosoftAMD64)
lib.set_library_names("mgmtapi.dll")
prototypes = \
{
#
'SnmpMgrOpen': SimTypeFunction([SimTypePointer(SimTypeChar(label="Byte"), offset=0), SimTypePointer(SimTypeChar(label="Byte"), offset=0), SimTypeInt(signed=True, label="Int32"), SimTypeInt(signed=True, label="Int32")], SimTypePointer(SimTypeBottom(label="Void"), offset=0), arg_names=["lpAgentAddress", "lpAgentCommunity", "nTimeOut", "nRetries"]),
#
'SnmpMgrCtl': SimTypeFunction([SimTypePointer(SimTypeBottom(label="Void"), offset=0), SimTypeInt(signed=False, label="UInt32"), SimTypePointer(SimTypeBottom(label="Void"), offset=0), SimTypeInt(signed=False, label="UInt32"), SimTypePointer(SimTypeBottom(label="Void"), offset=0), SimTypeInt(signed=False, label="UInt32"), SimTypePointer(SimTypeInt(signed=False, label="UInt32"), offset=0)], SimTypeInt(signed=True, label="Int32"), arg_names=["session", "dwCtlCode", "lpvInBuffer", "cbInBuffer", "lpvOUTBuffer", "cbOUTBuffer", "lpcbBytesReturned"]),
#
'SnmpMgrClose': SimTypeFunction([SimTypePointer(SimTypeBottom(label="Void"), offset=0)], SimTypeInt(signed=True, label="Int32"), arg_names=["session"]),
#
'SnmpMgrRequest': SimTypeFunction([SimTypePointer(SimTypeBottom(label="Void"), offset=0), SimTypeChar(label="Byte"), SimTypePointer(SimStruct({"list": SimTypePointer(SimStruct({"name": SimStruct({"idLength": SimTypeInt(signed=False, label="UInt32"), "ids": SimTypePointer(SimTypeInt(signed=False, label="UInt32"), offset=0)}, name="AsnObjectIdentifier", pack=False, align=None), "value": SimStruct({"asnType": SimTypeChar(label="Byte"), "asnValue": SimUnion({"number": SimTypeInt(signed=True, label="Int32"), "unsigned32": SimTypeInt(signed=False, label="UInt32"), "counter64": SimTypeBottom(label="ULARGE_INTEGER"), "string": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), "bits": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), "object": SimStruct({"idLength": SimTypeInt(signed=False, label="UInt32"), "ids": SimTypePointer(SimTypeInt(signed=False, label="UInt32"), offset=0)}, name="AsnObjectIdentifier", pack=False, align=None), "sequence": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), "address": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), "counter": SimTypeInt(signed=False, label="UInt32"), "gauge": SimTypeInt(signed=False, label="UInt32"), "ticks": SimTypeInt(signed=False, label="UInt32"), "arbitrary": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None)}, name="<anon>", label="None")}, name="AsnAny", pack=False, align=None)}, name="SnmpVarBind", pack=False, align=None), offset=0), "len": SimTypeInt(signed=False, label="UInt32")}, name="SnmpVarBindList", pack=False, align=None), offset=0), SimTypePointer(SimTypeInt(signed=False, label="SNMP_ERROR_STATUS"), offset=0), SimTypePointer(SimTypeInt(signed=True, label="Int32"), offset=0)], SimTypeInt(signed=True, label="Int32"), arg_names=["session", "requestType", "variableBindings", "errorStatus", "errorIndex"]),
#
'SnmpMgrStrToOid': SimTypeFunction([SimTypePointer(SimTypeChar(label="Byte"), offset=0), SimTypePointer(SimStruct({"idLength": SimTypeInt(signed=False, label="UInt32"), "ids": SimTypePointer(SimTypeInt(signed=False, label="UInt32"), offset=0)}, name="AsnObjectIdentifier", pack=False, align=None), offset=0)], SimTypeInt(signed=True, label="Int32"), arg_names=["string", "oid"]),
#
'SnmpMgrOidToStr': SimTypeFunction([SimTypePointer(SimStruct({"idLength": SimTypeInt(signed=False, label="UInt32"), "ids": SimTypePointer(SimTypeInt(signed=False, label="UInt32"), offset=0)}, name="AsnObjectIdentifier", pack=False, align=None), offset=0), SimTypePointer(SimTypePointer(SimTypeChar(label="Byte"), offset=0), offset=0)], SimTypeInt(signed=True, label="Int32"), arg_names=["oid", "string"]),
#
'SnmpMgrTrapListen': SimTypeFunction([SimTypePointer(SimTypePointer(SimTypeInt(signed=True, label="Int"), label="IntPtr", offset=0), offset=0)], SimTypeInt(signed=True, label="Int32"), arg_names=["phTrapAvailable"]),
#
'SnmpMgrGetTrap': SimTypeFunction([SimTypePointer(SimStruct({"idLength": SimTypeInt(signed=False, label="UInt32"), "ids": SimTypePointer(SimTypeInt(signed=False, label="UInt32"), offset=0)}, name="AsnObjectIdentifier", pack=False, align=None), offset=0), SimTypePointer(SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), offset=0), SimTypePointer(SimTypeInt(signed=False, label="SNMP_GENERICTRAP"), offset=0), SimTypePointer(SimTypeInt(signed=True, label="Int32"), offset=0), SimTypePointer(SimTypeInt(signed=False, label="UInt32"), offset=0), SimTypePointer(SimStruct({"list": SimTypePointer(SimStruct({"name": SimStruct({"idLength": SimTypeInt(signed=False, label="UInt32"), "ids": SimTypePointer(SimTypeInt(signed=False, label="UInt32"), offset=0)}, name="AsnObjectIdentifier", pack=False, align=None), "value": SimStruct({"asnType": SimTypeChar(label="Byte"), "asnValue": SimUnion({"number": SimTypeInt(signed=True, label="Int32"), "unsigned32": SimTypeInt(signed=False, label="UInt32"), "counter64": SimTypeBottom(label="ULARGE_INTEGER"), "string": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), "bits": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), "object": SimStruct({"idLength": SimTypeInt(signed=False, label="UInt32"), "ids": SimTypePointer(SimTypeInt(signed=False, label="UInt32"), offset=0)}, name="AsnObjectIdentifier", pack=False, align=None), "sequence": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), "address": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), "counter": SimTypeInt(signed=False, label="UInt32"), "gauge": SimTypeInt(signed=False, label="UInt32"), "ticks": SimTypeInt(signed=False, label="UInt32"), "arbitrary": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None)}, name="<anon>", label="None")}, name="AsnAny", pack=False, align=None)}, name="SnmpVarBind", pack=False, align=None), offset=0), "len": SimTypeInt(signed=False, label="UInt32")}, name="SnmpVarBindList", pack=False, align=None), offset=0)], SimTypeInt(signed=True, label="Int32"), arg_names=["enterprise", "IPAddress", "genericTrap", "specificTrap", "timeStamp", "variableBindings"]),
#
'SnmpMgrGetTrapEx': SimTypeFunction([SimTypePointer(SimStruct({"idLength": SimTypeInt(signed=False, label="UInt32"), "ids": SimTypePointer(SimTypeInt(signed=False, label="UInt32"), offset=0)}, name="AsnObjectIdentifier", pack=False, align=None), offset=0), SimTypePointer(SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), offset=0), SimTypePointer(SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), offset=0), SimTypePointer(SimTypeInt(signed=False, label="SNMP_GENERICTRAP"), offset=0), SimTypePointer(SimTypeInt(signed=True, label="Int32"), offset=0), SimTypePointer(SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), offset=0), SimTypePointer(SimTypeInt(signed=False, label="UInt32"), offset=0), SimTypePointer(SimStruct({"list": SimTypePointer(SimStruct({"name": SimStruct({"idLength": SimTypeInt(signed=False, label="UInt32"), "ids": SimTypePointer(SimTypeInt(signed=False, label="UInt32"), offset=0)}, name="AsnObjectIdentifier", pack=False, align=None), "value": SimStruct({"asnType": SimTypeChar(label="Byte"), "asnValue": SimUnion({"number": SimTypeInt(signed=True, label="Int32"), "unsigned32": SimTypeInt(signed=False, label="UInt32"), "counter64": SimTypeBottom(label="ULARGE_INTEGER"), "string": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), "bits": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), "object": SimStruct({"idLength": SimTypeInt(signed=False, label="UInt32"), "ids": SimTypePointer(SimTypeInt(signed=False, label="UInt32"), offset=0)}, name="AsnObjectIdentifier", pack=False, align=None), "sequence": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), "address": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None), "counter": SimTypeInt(signed=False, label="UInt32"), "gauge": SimTypeInt(signed=False, label="UInt32"), "ticks": SimTypeInt(signed=False, label="UInt32"), "arbitrary": SimStruct({"stream": SimTypePointer(SimTypeChar(label="Byte"), offset=0), "length": SimTypeInt(signed=False, label="UInt32"), "dynamic": SimTypeInt(signed=True, label="Int32")}, name="AsnOctetString", pack=False, align=None)}, name="<anon>", label="None")}, name="AsnAny", pack=False, align=None)}, name="SnmpVarBind", pack=False, align=None), offset=0), "len": SimTypeInt(signed=False, label="UInt32")}, name="SnmpVarBindList", pack=False, align=None), offset=0)], SimTypeInt(signed=True, label="Int32"), arg_names=["enterprise", "agentAddress", "sourceAddress", "genericTrap", "specificTrap", "community", "timeStamp", "variableBindings"]),
}
lib.set_prototypes(prototypes)
| 310.225
| 3,692
| 0.735031
| 1,361
| 12,409
| 6.678913
| 0.094783
| 0.174257
| 0.145545
| 0.180198
| 0.884818
| 0.877228
| 0.866557
| 0.856106
| 0.838724
| 0.831463
| 0
| 0.023805
| 0.069063
| 12,409
| 39
| 3,693
| 318.179487
| 0.763071
| 0.002256
| 0
| 0
| 0
| 0
| 0.21673
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.217391
| 0
| 0.217391
| 0
| 0
| 0
| 0
| null | 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 9
|
19a1e82bcdf1ae7daf0b30bf044c598f61b49a17
| 175
|
py
|
Python
|
third_party/baselines/bench/__init__.py
|
cclauss/episodic-curiosity
|
3c406964473d98fb977b1617a170a447b3c548fd
|
[
"Apache-2.0"
] | 195
|
2019-02-21T18:47:39.000Z
|
2022-03-29T14:09:36.000Z
|
third_party/baselines/bench/__init__.py
|
cclauss/episodic-curiosity
|
3c406964473d98fb977b1617a170a447b3c548fd
|
[
"Apache-2.0"
] | 12
|
2019-03-24T03:26:35.000Z
|
2021-09-28T05:50:35.000Z
|
third_party/baselines/bench/__init__.py
|
cclauss/episodic-curiosity
|
3c406964473d98fb977b1617a170a447b3c548fd
|
[
"Apache-2.0"
] | 43
|
2019-02-25T14:48:08.000Z
|
2022-01-16T11:36:49.000Z
|
# coding=utf-8
from __future__ import absolute_import
from __future__ import division
from __future__ import print_function
from third_party.baselines.bench.monitor import *
| 25
| 49
| 0.851429
| 24
| 175
| 5.583333
| 0.625
| 0.223881
| 0.358209
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.00641
| 0.108571
| 175
| 6
| 50
| 29.166667
| 0.852564
| 0.068571
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0.25
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
5fe2563c0d44cd6c1451c6a0c90920d01811b19b
| 76,489
|
py
|
Python
|
scripts/python/labview_processing/specific_data_scripts/PureFuels_data_processing.py
|
coelectrolyzer/cats
|
21f8e6f5f176767ec403ad2738c80a5a71fba959
|
[
"MIT"
] | 1
|
2022-02-17T16:37:12.000Z
|
2022-02-17T16:37:12.000Z
|
scripts/python/labview_processing/specific_data_scripts/PureFuels_data_processing.py
|
coelectrolyzer/cats
|
21f8e6f5f176767ec403ad2738c80a5a71fba959
|
[
"MIT"
] | 5
|
2021-10-30T00:06:31.000Z
|
2022-03-09T13:34:07.000Z
|
scripts/python/labview_processing/specific_data_scripts/PureFuels_data_processing.py
|
coelectrolyzer/cats
|
21f8e6f5f176767ec403ad2738c80a5a71fba959
|
[
"MIT"
] | 3
|
2021-05-08T02:26:08.000Z
|
2022-03-01T22:27:40.000Z
|
## @package PureFuels_data_processing
#
# @brief Script to read in all folders of Co-Optima Pure Fuels Data
#
# @details Python script to read in Co-Optima transient data for
# for all sets of folders of the Pure Fuels transient
# data and perform a series of analyses, compress the data,
# output the data into a new compressed format, and prepare
# a series of plots to visualize all data. This script works
# in conjunction with the transient_data.py script.
#
# @author Austin Ladshaw
#
# @date 08/10/2020
#
# @copyright This software was designed and built at the Oak Ridge National
# Laboratory (ORNL) National Transportation Research Center
# (NTRC) by Austin Ladshaw for research in the catalytic
# reduction of NOx. Copyright (c) 2020, all rights reserved.
import sys
sys.path.append('../..')
from labview_processing.transient_data import TransientData
import os, getopt
import time
## Function to read in a single file, do basic data pre-processing, and return transient object for post-processing
def readCoOptimaFile(run_name, bypass_name):
# NOTE: The 5 index of the file name (after split on '-') is the name of the pure fuel
# HOWEVER, in the case of 1-octene, we need both the 5th and 6th index
# The last index is always the run number
# The first index is the date (which needs to be combined with the run #)
# Use the fuel name as the folder to store processed data
# Sub-directory in that folder will be named after date and run #
print("Reading file: " + run_name + "...")
base_folder = run_name.split("/")[1].split("-")[5]
if base_folder == "1":
base_folder += run_name.split("/")[1].split("-")[6]
sub_folder = run_name.split("/")[0] + "/" + run_name.split("/")[1].split("-")[0] + "_run" + run_name.split("/")[1].split("-")[-1]
print(sub_folder)
sub_folder = sub_folder.split("/")[1]
bypass = TransientData(bypass_name)
run = TransientData(run_name)
# Next, the Ethanol and CO columns have different tolerances, but with different units.
# To deal with this, we need to first do some column manipulation to create new columns based
# on the ppm tolerances.
bypass.mathOperation('CO% (1)',"*",10000,True,'CO (10000)')
run.mathOperation('CO% (1)',"*",10000,True,'CO (10000)')
bypass.mathOperation('Ethanol% (1)',"*",10000,True,'Ethanol (10000)')
run.mathOperation('Ethanol% (1)',"*",10000,True,'Ethanol (10000)')
bypass.deleteColumns(['CO% (1)','Ethanol% (1)'])
run.deleteColumns(['CO% (1)','Ethanol% (1)'])
# Now we can compress the columns for each AND delete columns we don't need...
bypass.compressColumns()
run.compressColumns()
# NOTE: Many of these items to retain may change from file to file, which is why we have to do this manually
# 1-hexene
if base_folder == "1Hexene":
list = ['Elapsed Time (min)','NH3 (300,3000)', 'H2O% (20)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'CO2% (20)', 'CO (500,10000)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Ethanol (1000,10000)', 'Toluene (1000)', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Propylene (200,1000)', 'Ethane (1000)', '2-Pentanone 150c', 'Isobutylene (500)', 'Isopentane (500)', 'CH4 (250,3000)', 'AI 2', 'AI 41', 'AI 43', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)']
# 1-octene
if base_folder == "1Octene":
list = ['Elapsed Time (min)','NH3 (3000,300)', 'H2O% (20)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'CO2% (20)', 'CO (500,10000)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Ethanol (1000,10000)', 'Toluene (1000)', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Propylene (200,1000)', 'Ethane (1000)', '2-Pentanone 150c', 'Isobutylene (500)', 'Isopentane (500)', 'CH4 (250,3000)', 'AI 2', 'AI 55', 'AI 56', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)']
# 1-propanol
if base_folder == "1Propanol":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Anisole 150c', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 31', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# 2-Butanone
if base_folder == "2Butanone":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Toluene (1000)', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Propylene (200,1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Isopentane (500)', 'Methyl ethyl ketone', 'AI 2', 'AI 43', 'AI 96', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# 2-methylpentane
if base_folder == "2MethylPentane":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Toluene (1000)', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Propylene (200,1000)', 'Ethane (1000)', '2-Pentanone 150c', 'Isobutylene (500)', 'Isopentane (500)', 'AI 2', 'AI 41', 'AI 42', 'AI 43', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (300,3000)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# 2-pentanone
if base_folder == "2Pentaone":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Toluene (1000)', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Propylene (200,1000)', 'Ethane (1000)', '2-Pentanone 150c', 'Isobutylene (500)', 'Isopentane (500)', 'AI 2', 'AI 42', 'AI 43', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (300,3000)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
## ------- WARNING -------- This data set has an incorrectly labeled MS column for AI 2 --> 'AI 2)'
## ------------------------------------- see below -----------------------------------------------
# 2-propanol
if base_folder == "2Propanol":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', '2-Pentanone 150c', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2)', 'AI 45', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# anisole
if base_folder == "Anisole":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Anisole 150c', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 65', 'AI 78', 'AI 93', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# butylacetate
if base_folder == "ButylAcetate":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Ethyl Acetate 150c', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Propylene (200,1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Toluene (1000)', 'Isopentane (500)', 'AI 2', 'AI 43', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (300,3000)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# cyclopentanone
if base_folder == "Cyclopentanone":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', '2-Pentanone 150c', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 43', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# diisobutylene
if base_folder == "Diisobutylene":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Methyl ethyl ketone', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 97', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# E10
if base_folder == "CH3CH2OH+iC8H18+C6H5CH3":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Methyl ethyl ketone', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 31', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# ethanol
if base_folder == "CH3CH2OH":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Methyl ethyl ketone', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 31', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# ethene
if base_folder == "C2H4ONLY":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Toluene (1000)', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Propylene (200,1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propane', 'Anisole 150c', 'AI 2', 'AI 26', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (300,3000)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# ethyl acetate
if base_folder == "EthylAcetate":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Ethyl Acetate 150c', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 43', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# furan mix
if base_folder == "FuranMix":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Methyl ethyl ketone', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 82', 'AI 96', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# iso-butanol
if base_folder == "iBuOH":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Toluene (1000)', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Propylene (200,1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Isopentane (500)', 'Methyl ethyl ketone', 'AI 2', 'AI 43', 'AI 96', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# iso-butylacetate (and repeat)
if base_folder == "isoButylAcetate":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Ethyl Acetate 150c', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Propylene (200,1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Toluene (1000)', 'Isopentane (500)', 'AI 2', 'AI 43', 'AI 56', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (300,3000)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# iso-octane
if base_folder == "isooctane":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', '2-Pentanone 150c', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 31', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# m-xylene
if base_folder == "mXylene":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', '2-Pentanone 150c', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 31', 'AI 77', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# mesitylene
if base_folder == "mesitylene":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Methyl ethyl ketone', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 77', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# methane
if base_folder == "CH4ONLY":
list = ['Elapsed Time (min)', 'NO (350,3000)', 'NO2 (150)', 'Propylene (200,1000)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Propane', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Anisole 150c', 'Isobutylene (500)', 'Ethane (1000)', 'Toluene (1000)', 'N2O (100,200,300)', 'AI 2', 'AI 15', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# methylcyclohexane
if base_folder == "MCH":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', '2-Pentanone 150c', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 41', 'AI 55', 'AI 83', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# methylcyclopentane
if base_folder == "MCP":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', '2-Pentanone 150c', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 56', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# methylisobutylketone
if base_folder == "MIBK":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', '2-Pentanone 150c', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Propylene (200,1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Toluene (1000)', 'Isopentane (500)', 'AI 2', 'AI 43', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (300,3000)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# n-butanol
if base_folder == "nButanol":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Toluene (1000)', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Propylene (200,1000)', 'Ethane (1000)', 'Isopentane (500)', 'Isobutylene (500)', 'Anisole 150c', 'AI 2', 'AI 42', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (300,3000)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# n-heptane
if base_folder == "nHeptane":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Toluene (1000)', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Propylene (200,1000)', 'Ethane (1000)', '2-Pentanone 150c', 'Isobutylene (500)', 'Isopentane (500)', 'AI 2', 'AI 43', 'AI 57', 'AI 71', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (300,3000)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# n-octane
if base_folder == "nOctane":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', '2-Pentanone 150c', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 43', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# propane
if base_folder == "C3H8ONLY":
list = ['Elapsed Time (min)', 'NO (350,3000)', 'NO2 (150)', 'Propylene (200,1000)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Propane', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Anisole 150c', 'Isobutylene (500)', 'Ethane (1000)', 'Toluene (1000)', 'N2O (100,200,300)', 'AI 2', 'AI 15', 'AI 30', 'AI 43', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# propene
if base_folder == "C3H6ONLY":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Toluene (1000)', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Propylene (200,1000)', 'Ethane (1000)', 'Propane', 'Isobutylene (500)', 'Anisole 150c', 'AI 2', 'AI 39', 'AI 41', 'AI 42', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (300,3000)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
# toluene
if base_folder == "Toluene":
list = ['Elapsed Time (min)', 'N2O (100,200,300)', 'NO (350,3000)', 'NO2 (150)', 'H2O% (20)', 'CO2% (20)', 'Formaldehyde (70)', 'Acetaldehyde (1000)', 'Methyl ethyl ketone', 'Cyclohexane (100) 150C', 'Acetylene (1000)', 'Ethylene (100,3000)', 'Toluene (1000)', 'Isobutylene (500)', 'Ethane (1000)', 'Propylene (200,1000)', 'Isopentane (500)', 'AI 2', 'AI 31', 'AI 57', 'AI 91', 'FID THC (ppm C1)', 'TC top sample in (C)', 'TC top sample mid 2 (C)', 'TC top sample out (C)', 'P tup in (bar)', 'P top out (bar)', 'NH3 (3000,300)', 'CO (500,10000)', 'Ethanol (1000,10000)', 'CH4 (250,3000)']
bypass.retainOnlyColumns(list)
run.retainOnlyColumns(list)
# If not errors are reported, then both the bypass and the run will have the same columns/names at this point
# Next, remove any negative values from observations since they are not physically relavent
bypass.removeNegatives(list)
run.removeNegatives(list)
# Now, we need to use the bypass data to find the average input values for each column
avg = {}
for item in list:
avg[item] = bypass.getAverage(item)
# Next, append columns to the run using the average inlet values just calculated from the bypass
# Have to use appendColumnByFrame even though each frame will have same values
frame_list = [0.]*len(run.getTimeFrames())
for item in avg:
if item != 'Elapsed Time (min)' and item != 'TC top sample in (C)' and item != 'TC top sample mid 2 (C)' and item != 'TC top sample out (C)' and item != 'P tup in (bar)' and item != 'P top out (bar)':
i=0
for v in frame_list:
frame_list[i] = avg[item]
i+=1
run.appendColumnByFrame(item+'[bypass]', frame_list)
# Now, we can apply some additional pre-processing, such as normalization or scaling of data based on the bypass
AI_list = []
for item in list:
if "AI" in item and "bypass" not in item:
AI_list.append(item)
for item in AI_list:
# This line will automatically override the existing AI columns and normalize them to the bypass AI columns
# Then, for specific AI columns, we can multiply through by the ppm specific value
# NOTE: Since the AI columns change from folder to folder, we can't really automate more than AI 2 for H2
if item == 'AI 2' or item == 'AI 2)':
run.mathOperation(item,"/",item+'[bypass]')
run.mathOperation(item,"*",1670, True, 'H2 (ppm)')
frame_list = [1670]*len(run.getTimeFrames())
run.appendColumnByFrame('H2 (ppm)[bypass]', frame_list)
else:
run.mathOperation(item+'[bypass]',"-",run.getMinimum(item))
run.mathOperation(item,"-",run.getMinimum(item))
run.mathOperation(item,"/",item+'[bypass]')
#Special case for E10 mixture
if base_folder == "CH3CH2OH+iC8H18+C6H5CH3":
for item in AI_list:
if item == 'AI 31':
run.mathOperation(item,"*",0.10, True, 'ethanol (ppm C1)')
run.mathOperation('ethanol (ppm C1)',"*",3000)
frame_list = [300]*len(run.getTimeFrames())
run.appendColumnByFrame('ethanol (ppm C1)[bypass]', frame_list)
if item == 'AI 57':
run.mathOperation(item,"*",0.65, True, 'iso-octane (ppm C1)')
run.mathOperation('iso-octane (ppm C1)',"*",3000)
frame_list = [1950]*len(run.getTimeFrames())
run.appendColumnByFrame('iso-octane (ppm C1)[bypass]', frame_list)
if item == 'AI 91':
run.mathOperation(item,"*",0.25, True, 'toluene (ppm C1)')
run.mathOperation('toluene (ppm C1)',"*",3000)
frame_list = [750]*len(run.getTimeFrames())
run.appendColumnByFrame('toluene (ppm C1)[bypass]', frame_list)
# AI values...
# 2 = H2
# 57 = iso-octane
# 31 = ethanol
# 91 = toluene
# 43 = n-octane
# E10 (blend)
# 65% iso-octane
# 25% toluene
# 10% ethanol
# Next, scale the 'FID THC (ppm C1)' column by dividing by the corresponding bypass, then multiplying by 3000
run.mathOperation('FID THC (ppm C1)',"/",'FID THC (ppm C1)[bypass]')
run.mathOperation('FID THC (ppm C1)',"*",3000)
run.mathOperation('FID THC (ppm C1)[bypass]',"/",'FID THC (ppm C1)[bypass]')
run.mathOperation('FID THC (ppm C1)[bypass]',"*",3000)
# Next, create columns for the appropriate O2 concentrations based on Sreshtha's paper (table 4)
# Fuel O2 %
# --------- -----
# ethanol 0.71
# n-propanol 0.71
# iso-propanol 0.71
# n-butanol 0.71
# iso-butanol 0.71
# 2-butanone 0.68
# 2-pentanone 0.68
# cyclopentanone 0.65
# methylisobutylketone 0.69
# ethyl acetate 0.64
# butyl acetate 0.66
# iso-butyl acetate 0.66
# anisole 0.63
# 2,5-dimethylfuran
# (+) 2-methylfuran 0.63
# toluene 0.65
# m-xylene 0.66
# mesitylene 0.66
# ethene 0.71
# propene 0.71
# 1-hexene 0.71
# 1-octene 0.71
# diisobutylene 0.71
# methane 0.86
# propane 0.76
# n-heptane 0.74
# n-octane 0.73
# 2-methylpentane 0.74
# iso-octane 0.73
# methylcyclohexane 0.71
# methylcyclopentane 0.71
# E10 (blend)
# 65% iso-octane
# 25% toluene
# 10% ethanol 0.708
# 1-hexene
if base_folder == "1Hexene":
frame_list = [0.71]*len(run.getTimeFrames())
# 1-octene
if base_folder == "1Octene":
frame_list = [0.71]*len(run.getTimeFrames())
# 1-propanol
if base_folder == "1Propanol":
frame_list = [0.71]*len(run.getTimeFrames())
# 2-Butanone
if base_folder == "2Butanone":
frame_list = [0.68]*len(run.getTimeFrames())
# 2-methylpentane
if base_folder == "2MethylPentane":
frame_list = [0.74]*len(run.getTimeFrames())
# 2-pentanone
if base_folder == "2Pentaone":
frame_list = [0.68]*len(run.getTimeFrames())
# 2-propanol
if base_folder == "2Propanol":
frame_list = [0.71]*len(run.getTimeFrames())
# anisole
if base_folder == "Anisole":
frame_list = [0.63]*len(run.getTimeFrames())
# butylacetate
if base_folder == "ButylAcetate":
frame_list = [0.66]*len(run.getTimeFrames())
# cyclopentanone
if base_folder == "Cyclopentanone":
frame_list = [0.65]*len(run.getTimeFrames())
# diisobutylene
if base_folder == "Diisobutylene":
frame_list = [0.71]*len(run.getTimeFrames())
# E10
if base_folder == "CH3CH2OH+iC8H18+C6H5CH3":
frame_list = [0.708]*len(run.getTimeFrames())
# ethanol
if base_folder == "CH3CH2OH":
frame_list = [0.71]*len(run.getTimeFrames())
# ethene
if base_folder == "C2H4ONLY":
frame_list = [0.71]*len(run.getTimeFrames())
# ethyl acetate
if base_folder == "EthylAcetate":
frame_list = [0.64]*len(run.getTimeFrames())
# furan mix
if base_folder == "FuranMix":
frame_list = [0.63]*len(run.getTimeFrames())
# iso-butanol
if base_folder == "iBuOH":
frame_list = [0.71]*len(run.getTimeFrames())
# iso-butylacetate (and repeat)
if base_folder == "isoButylAcetate":
frame_list = [0.66]*len(run.getTimeFrames())
# iso-octane
if base_folder == "isooctane":
frame_list = [0.73]*len(run.getTimeFrames())
# m-xylene
if base_folder == "mXylene":
frame_list = [0.66]*len(run.getTimeFrames())
# mesitylene
if base_folder == "mesitylene":
frame_list = [0.66]*len(run.getTimeFrames())
# methane
if base_folder == "CH4ONLY":
frame_list = [0.86]*len(run.getTimeFrames())
# methylcyclohexane
if base_folder == "MCH":
frame_list = [0.71]*len(run.getTimeFrames())
# methylcyclopentane
if base_folder == "MCP":
frame_list = [0.71]*len(run.getTimeFrames())
# methylisobutylketone
if base_folder == "MIBK":
frame_list = [0.69]*len(run.getTimeFrames())
# n-butanol
if base_folder == "nButanol":
frame_list = [0.71]*len(run.getTimeFrames())
# n-heptane
if base_folder == "nHeptane":
frame_list = [0.74]*len(run.getTimeFrames())
# n-octane
if base_folder == "nOctane":
frame_list = [0.73]*len(run.getTimeFrames())
# propane
if base_folder == "C3H8ONLY":
frame_list = [0.76]*len(run.getTimeFrames())
# propene
if base_folder == "C3H6ONLY":
frame_list = [0.71]*len(run.getTimeFrames())
# toluene
if base_folder == "Toluene":
frame_list = [0.65]*len(run.getTimeFrames())
run.appendColumnByFrame('O2%', frame_list)
# Now, create column for FID Conversion %, CO conversion %, and NOx conversion %
run.mathOperation('FID THC (ppm C1)[bypass]',"-",'FID THC (ppm C1)', True, 'THC Conversion %')
run.mathOperation('THC Conversion %',"/",'FID THC (ppm C1)[bypass]')
run.mathOperation('THC Conversion %',"*",100)
run.mathOperation('CO (500,10000)[bypass]',"-",'CO (500,10000)', True, 'CO Conversion %')
run.mathOperation('CO Conversion %',"/",'CO (500,10000)[bypass]')
run.mathOperation('CO Conversion %',"*",100)
frame_list = [0.]*len(run.getTimeFrames())
run.appendColumnByFrame('NOx (ppm)', frame_list)
run.appendColumnByFrame('NOx (ppm)[bypass]', frame_list)
run.mathOperation('NOx (ppm)',"+",'NO (350,3000)')
run.mathOperation('NOx (ppm)',"+",'NO2 (150)')
run.mathOperation('NOx (ppm)[bypass]',"+",'NO (350,3000)[bypass]')
run.mathOperation('NOx (ppm)[bypass]',"+",'NO2 (150)[bypass]')
run.mathOperation('NOx (ppm)[bypass]',"-",'NOx (ppm)', True, 'NOx Conversion %')
run.mathOperation('NOx Conversion %',"/",'NOx (ppm)[bypass]')
run.mathOperation('NOx Conversion %',"*",100)
# Next, we will create a column for the average internal temperature. This temperature will
# be just a simple average since each zone of the catalyst is the same length.
run.mathOperation('TC top sample out (C)',"+",'TC top sample mid 2 (C)', True, 'Avg Internal Temp (C)')
run.mathOperation('Avg Internal Temp (C)',"/",2)
return run
## Function to calculate various T-n values and print them to a file
def printTnValues(obj, out_dir):
# For simplification, we will calculate and print out T-10, T-30, T-50, T-70, and T-90
conv_per = [10,20,30,40,50,60,70,80,90] #unit: %
span = 2 # +/- 1%
temp = 'TC top sample in (C)'
chem_name = out_dir.split("/")[0].split("-")[0]
#Iterate through the data map of the obj and record temperatures from +/- 5 conversion % for each category
# Categories: 'THC Conversion %', 'CO Conversion %', and 'NOx Conversion %'
conv_map = {}
conv_map['THC Conversion %'] = [0.]*len(conv_per)
conv_map['CO Conversion %'] = [0.]*len(conv_per)
conv_map['NOx Conversion %'] = [0.]*len(conv_per)
for item in conv_map:
i=0
for per in conv_per:
count = 0
j=0
for value in obj.data_map[item]:
if value >= per - span and value <= per + span:
conv_map[item][i] += obj.data_map[temp][j]
count+=1
j+=1
if count != 0:
conv_map[item][i] = conv_map[item][i]/count
else:
conv_map[item][i] = 100
i+=1
file_name = out_dir + "ConversionTemperatures.dat"
file = open(file_name,'w')
file.write("T-n")
for item in conv_map:
file.write("\t"+item)
file.write("\n")
i=0
for value in conv_per:
file.write(str(value))
for item in conv_map:
file.write("\t"+str(conv_map[item][i]))
i+=1
file.write("\n")
file.close()
return
##Function to print out the rate map
def printRateMap(obj, map, out_dir):
file_name = out_dir + "ApproximateRateData.dat"
file = open(file_name,'w')
i=0
first = ""
for item in obj.data_map:
if "bypass" not in item:
if i==0:
file.write(item)
if item != obj.time_key:
if item+"[bypass]" in obj.data_map.keys():
file.write(item+"[bypass]")
first = item
if item != obj.time_key:
file.write("\t"+"d{"+item+"}/dt")
else:
file.write("\t"+item)
if item != obj.time_key:
if item+"[bypass]" in obj.data_map.keys():
file.write("\t"+item+"[bypass]")
if item != obj.time_key and "bypass" not in item:
file.write("\t"+"d{"+item+"}/dt")
i+=1
file.write("\n")
j=0
for value in map[first]:
i = 0
for item in obj.data_map:
if "bypass" not in item:
if i == 0:
file.write(str(map[item][j]))
if item != obj.time_key:
if item+"[bypass]" in obj.data_map.keys():
file.write(str(map[item+"[bypass]"][j]))
if item != obj.time_key:
file.write("\t"+str(map["d{"+item+"}/dt"][j]))
else:
file.write("\t"+str(map[item][j]))
if item != obj.time_key:
if item+"[bypass]" in obj.data_map.keys():
file.write("\t"+str(map[item+"[bypass]"][j]))
if item != obj.time_key:
file.write("\t"+str(map["d{"+item+"}/dt"][j]))
i+=1
file.write("\n")
j+=1
file.close()
return
## Function to read in a specific folder
def readCoOptimaPureFuelFolder(folder):
# Read in the bypass and run files separately
run = []
# 1-hexene (3)
if folder == "1-hexene":
bypass_name = "20170807-CPTMA-MalibuTWC-SGDI-30k-1Hexene-5Cramp-lambda0_999-bp-1"
run_name = "20170807-CPTMA-MalibuTWC-SGDI-30k-1Hexene-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170807-CPTMA-MalibuTWC-SGDI-30k-1Hexene-5Cramp-lambda0_999-bp-2"
run_name = "20170807-CPTMA-MalibuTWC-SGDI-30k-1Hexene-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170807-CPTMA-MalibuTWC-SGDI-30k-1Hexene-5Cramp-lambda0_999-bp-3"
run_name = "20170807-CPTMA-MalibuTWC-SGDI-30k-1Hexene-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# 1-octene (4)
if folder == "1-octene":
bypass_name = "20170522-CPTMA-MalibuTWC-SGDI-30k-1-Octene-5Cramp-lambda0_999-bp-1"
run_name = "20170522-CPTMA-MalibuTWC-SGDI-30k-1-Octene-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170522-CPTMA-MalibuTWC-SGDI-30k-1-Octene-5Cramp-lambda0_999-bp-2"
run_name = "20170522-CPTMA-MalibuTWC-SGDI-30k-1-Octene-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170522-CPTMA-MalibuTWC-SGDI-30k-1-Octene-5Cramp-lambda0_999-bp-3"
run_name = "20170522-CPTMA-MalibuTWC-SGDI-30k-1-Octene-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170522-CPTMA-MalibuTWC-SGDI-30k-1-Octene-5Cramp-lambda0_999-bp-4"
run_name = "20170522-CPTMA-MalibuTWC-SGDI-30k-1-Octene-5Cramp-lambda0_999-4"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# 1-propanol (3)
if folder == "1-propanol":
bypass_name = "20170706-CPTMA-MalibuTWC-SGDI-30k-1Propanol-5Cramp-REPEAT-lambda0_999-bp-1"
run_name = "20170706-CPTMA-MalibuTWC-SGDI-30k-1Propanol-5Cramp-REPEAT-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170706-CPTMA-MalibuTWC-SGDI-30k-1Propanol-5Cramp-REPEAT-lambda0_999-bp-2"
run_name = "20170706-CPTMA-MalibuTWC-SGDI-30k-1Propanol-5Cramp-REPEAT-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170706-CPTMA-MalibuTWC-SGDI-30k-1Propanol-5Cramp-REPEAT-lambda0_999-bp-3"
run_name = "20170706-CPTMA-MalibuTWC-SGDI-30k-1Propanol-5Cramp-REPEAT-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# 2-Butanone (3)
if folder == "2-Butanone":
bypass_name = "20170411-CPTMA-MalibuTWC-SGDI-30k-2Butanone-5Cramp-lambda0_999-bp-1"
run_name = "20170411-CPTMA-MalibuTWC-SGDI-30k-2Butanone-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170411-CPTMA-MalibuTWC-SGDI-30k-2Butanone-5Cramp-lambda0_999-bp-2"
run_name = "20170411-CPTMA-MalibuTWC-SGDI-30k-2Butanone-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170411-CPTMA-MalibuTWC-SGDI-30k-2Butanone-5Cramp-lambda0_999-bp-3"
run_name = "20170411-CPTMA-MalibuTWC-SGDI-30k-2Butanone-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# 2-methylpentane (3)
if folder == "2-methylpentane":
bypass_name = "20170810-CPTMA-MalibuTWC-SGDI-30k-2MethylPentane-5Cramp-lambda0_999-bp-1"
run_name = "20170810-CPTMA-MalibuTWC-SGDI-30k-2MethylPentane-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170810-CPTMA-MalibuTWC-SGDI-30k-2MethylPentane-5Cramp-lambda0_999-bp-2"
run_name = "20170810-CPTMA-MalibuTWC-SGDI-30k-2MethylPentane-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170810-CPTMA-MalibuTWC-SGDI-30k-2MethylPentane-5Cramp-lambda0_999-bp-3"
run_name = "20170810-CPTMA-MalibuTWC-SGDI-30k-2MethylPentane-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# 2-pentanone (3)
if folder == "2-pentanone":
bypass_name = "20170804-CPTMA-MalibuTWC-SGDI-30k-2Pentaone-5Cramp-lambda0_999-bp-1"
run_name = "20170804-CPTMA-MalibuTWC-SGDI-30k-2Pentaone-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170804-CPTMA-MalibuTWC-SGDI-30k-2Pentaone-5Cramp-lambda0_999-bp-2"
run_name = "20170804-CPTMA-MalibuTWC-SGDI-30k-2Pentaone-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170804-CPTMA-MalibuTWC-SGDI-30k-2Pentaone-5Cramp-lambda0_999-bp-3"
run_name = "20170804-CPTMA-MalibuTWC-SGDI-30k-2Pentaone-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# 2-propanol (3)
if folder == "2-propanol":
bypass_name = "20170614-CPTMA-MalibuTWC-SGDI-30k-2Propanol-5Cramp-REPEAT-lambda0_999-bp-1"
run_name = "20170614-CPTMA-MalibuTWC-SGDI-30k-2Propanol-5Cramp-REPEAT-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170614-CPTMA-MalibuTWC-SGDI-30k-2Propanol-5Cramp-REPEAT-lambda0_999-bp-2"
run_name = "20170614-CPTMA-MalibuTWC-SGDI-30k-2Propanol-5Cramp-REPEAT-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170614-CPTMA-MalibuTWC-SGDI-30k-2Propanol-5Cramp-REPEAT-lambda0_999-bp-3"
run_name = "20170614-CPTMA-MalibuTWC-SGDI-30k-2Propanol-5Cramp-REPEAT-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# anisole (3)
if folder == "anisole":
bypass_name = "20170629-CPTMA-MalibuTWC-SGDI-30k-Anisole-5Cramp-lambda0_999-bp-1"
run_name = "20170629-CPTMA-MalibuTWC-SGDI-30k-Anisole-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170629-CPTMA-MalibuTWC-SGDI-30k-Anisole-5Cramp-lambda0_999-bp-2"
run_name = "20170629-CPTMA-MalibuTWC-SGDI-30k-Anisole-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170629-CPTMA-MalibuTWC-SGDI-30k-Anisole-5Cramp-lambda0_999-bp-3"
run_name = "20170629-CPTMA-MalibuTWC-SGDI-30k-Anisole-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# butylacetate (3)
if folder == "butylacetate":
bypass_name = "20170815-CPTMA-MalibuTWC-SGDI-30k-ButylAcetate-5Cramp-lambda0_999-bp-1"
run_name = "20170815-CPTMA-MalibuTWC-SGDI-30k-ButylAcetate-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170815-CPTMA-MalibuTWC-SGDI-30k-ButylAcetate-5Cramp-lambda0_999-bp-2"
run_name = "20170815-CPTMA-MalibuTWC-SGDI-30k-ButylAcetate-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170815-CPTMA-MalibuTWC-SGDI-30k-ButylAcetate-5Cramp-lambda0_999-bp-3"
run_name = "20170815-CPTMA-MalibuTWC-SGDI-30k-ButylAcetate-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# cyclopentanone (3)
if folder == "cyclopentanone":
bypass_name = "20170511-CPTMA-MalibuTWC-SGDI-30k-Cyclopentanone-5Cramp-lambda0_999-bp-1"
run_name = "20170511-CPTMA-MalibuTWC-SGDI-30k-Cyclopentanone-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170511-CPTMA-MalibuTWC-SGDI-30k-Cyclopentanone-5Cramp-lambda0_999-bp-2"
run_name = "20170511-CPTMA-MalibuTWC-SGDI-30k-Cyclopentanone-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170511-CPTMA-MalibuTWC-SGDI-30k-Cyclopentanone-5Cramp-lambda0_999-bp-3"
run_name = "20170511-CPTMA-MalibuTWC-SGDI-30k-Cyclopentanone-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# diisobutylene (3)
if folder == "diisobutylene":
bypass_name = "20170427-CPTMA-MalibuTWC-SGDI-30k-Diisobutylene-5Cramp-lambda0_999-bp-1"
run_name = "20170427-CPTMA-MalibuTWC-SGDI-30k-Diisobutylene-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170427-CPTMA-MalibuTWC-SGDI-30k-Diisobutylene-5Cramp-lambda0_999-bp-2"
run_name = "20170427-CPTMA-MalibuTWC-SGDI-30k-Diisobutylene-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170427-CPTMA-MalibuTWC-SGDI-30k-Diisobutylene-5Cramp-lambda0_999-bp-3"
run_name = "20170427-CPTMA-MalibuTWC-SGDI-30k-Diisobutylene-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# E10 (3)
if folder == "E10-baseline":
bypass_name = "20170421-CPTMA-MalibuTWC-SGDI-30k-CH3CH2OH+iC8H18+C6H5CH3-5Cramp-lambda0_999-bp-1"
run_name = "20170421-CPTMA-MalibuTWC-SGDI-30k-CH3CH2OH+iC8H18+C6H5CH3-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170421-CPTMA-MalibuTWC-SGDI-30k-CH3CH2OH+iC8H18+C6H5CH3-5Cramp-lambda0_999-bp-2"
run_name = "20170421-CPTMA-MalibuTWC-SGDI-30k-CH3CH2OH+iC8H18+C6H5CH3-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170421-CPTMA-MalibuTWC-SGDI-30k-CH3CH2OH+iC8H18+C6H5CH3-5Cramp-lambda0_999-bp-3"
run_name = "20170421-CPTMA-MalibuTWC-SGDI-30k-CH3CH2OH+iC8H18+C6H5CH3-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# ethanol (3)
if folder == "ethanol":
bypass_name = "20170424-CPTMA-MalibuTWC-SGDI-30k-CH3CH2OH-5Cramp-lambda0_999-bp-1"
run_name = "20170424-CPTMA-MalibuTWC-SGDI-30k-CH3CH2OH-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170424-CPTMA-MalibuTWC-SGDI-30k-CH3CH2OH-5Cramp-lambda0_999-bp-2"
run_name = "20170424-CPTMA-MalibuTWC-SGDI-30k-CH3CH2OH-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170424-CPTMA-MalibuTWC-SGDI-30k-CH3CH2OH-5Cramp-lambda0_999-bp-3"
run_name = "20170424-CPTMA-MalibuTWC-SGDI-30k-CH3CH2OH-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# ethene (3)
if folder == "ethene":
bypass_name = "20170718-CPTMA-MalibuTWC-SGDI-30k-C2H4ONLY-5Cramp-lambda0_999-bp-1"
run_name = "20170718-CPTMA-MalibuTWC-SGDI-30k-C2H4ONLY-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170718-CPTMA-MalibuTWC-SGDI-30k-C2H4ONLY-5Cramp-lambda0_999-bp-2"
run_name = "20170718-CPTMA-MalibuTWC-SGDI-30k-C2H4ONLY-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170718-CPTMA-MalibuTWC-SGDI-30k-C2H4ONLY-5Cramp-lambda0_999-bp-3"
run_name = "20170718-CPTMA-MalibuTWC-SGDI-30k-C2H4ONLY-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# ethyl acetate (3)
if folder == "ethyl-acetate":
bypass_name = "20170510-CPTMA-MalibuTWC-SGDI-30k-EthylAcetate-5Cramp-lambda0_999-bp-1"
run_name = "20170510-CPTMA-MalibuTWC-SGDI-30k-EthylAcetate-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170510-CPTMA-MalibuTWC-SGDI-30k-EthylAcetate-5Cramp-lambda0_999-bp-2"
run_name = "20170510-CPTMA-MalibuTWC-SGDI-30k-EthylAcetate-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170510-CPTMA-MalibuTWC-SGDI-30k-EthylAcetate-5Cramp-lambda0_999-bp-3"
run_name = "20170510-CPTMA-MalibuTWC-SGDI-30k-EthylAcetate-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# furan mix (4)
if folder == "furan-mix":
bypass_name = "20170425-CPTMA-MalibuTWC-SGDI-30k-FuranMix-5Cramp-lambda0_999-bp-1"
run_name = "20170425-CPTMA-MalibuTWC-SGDI-30k-FuranMix-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170425-CPTMA-MalibuTWC-SGDI-30k-FuranMix-5Cramp-lambda0_999-bp-2"
run_name = "20170425-CPTMA-MalibuTWC-SGDI-30k-FuranMix-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170425-CPTMA-MalibuTWC-SGDI-30k-FuranMix-5Cramp-lambda0_999-bp-3"
run_name = "20170425-CPTMA-MalibuTWC-SGDI-30k-FuranMix-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170425-CPTMA-MalibuTWC-SGDI-30k-FuranMix-5Cramp-lambda0_999-bp-4"
run_name = "20170425-CPTMA-MalibuTWC-SGDI-30k-FuranMix-5Cramp-lambda0_999-4"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# iso-butanol (3)
if folder == "iso-butanol":
bypass_name = "20170412-CPTMA-MalibuTWC-SGDI-30k-iBuOH-5Cramp-lambda0_999-bp-1"
run_name = "20170412-CPTMA-MalibuTWC-SGDI-30k-iBuOH-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170412-CPTMA-MalibuTWC-SGDI-30k-iBuOH-5Cramp-lambda0_999-bp-2"
run_name = "20170412-CPTMA-MalibuTWC-SGDI-30k-iBuOH-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170412-CPTMA-MalibuTWC-SGDI-30k-iBuOH-5Cramp-lambda0_999-bp-3"
run_name = "20170412-CPTMA-MalibuTWC-SGDI-30k-iBuOH-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# iso-butylacetate (3+3repeat)
if folder == "iso-butylacetate":
bypass_name = "20170823-CPTMA-MalibuTWC-SGDI-30k-isoButylAcetate-5Cramp-lambda0_999-bp-1"
run_name = "20170823-CPTMA-MalibuTWC-SGDI-30k-isoButylAcetate-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170823-CPTMA-MalibuTWC-SGDI-30k-isoButylAcetate-5Cramp-lambda0_999-bp-2"
run_name = "20170823-CPTMA-MalibuTWC-SGDI-30k-isoButylAcetate-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170823-CPTMA-MalibuTWC-SGDI-30k-isoButylAcetate-5Cramp-lambda0_999-bp-3"
run_name = "20170823-CPTMA-MalibuTWC-SGDI-30k-isoButylAcetate-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170824-CPTMA-MalibuTWC-SGDI-30k-isoButylAcetate-REPEAT-5Cramp-lambda0_999-bp-1"
run_name = "20170824-CPTMA-MalibuTWC-SGDI-30k-isoButylAcetate-REPEAT-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170824-CPTMA-MalibuTWC-SGDI-30k-isoButylAcetate-REPEAT-5Cramp-lambda0_999-bp-2"
run_name = "20170824-CPTMA-MalibuTWC-SGDI-30k-isoButylAcetate-REPEAT-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170824-CPTMA-MalibuTWC-SGDI-30k-isoButylAcetate-REPEAT-5Cramp-lambda0_999-bp-3"
run_name = "20170824-CPTMA-MalibuTWC-SGDI-30k-isoButylAcetate-REPEAT-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# iso-octane (3)
if folder == "iso-octane":
bypass_name = "20170518-CPTMA-MalibuTWC-SGDI-30k-isooctane-5Cramp-lambda0_999-bp-1"
run_name = "20170518-CPTMA-MalibuTWC-SGDI-30k-isooctane-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170518-CPTMA-MalibuTWC-SGDI-30k-isooctane-5Cramp-lambda0_999-bp-2"
run_name = "20170518-CPTMA-MalibuTWC-SGDI-30k-isooctane-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170518-CPTMA-MalibuTWC-SGDI-30k-isooctane-5Cramp-lambda0_999-bp-3"
run_name = "20170518-CPTMA-MalibuTWC-SGDI-30k-isooctane-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# m-xylene (3)
if folder == "m-xylene":
bypass_name = "20170524-CPTMA-MalibuTWC-SGDI-30k-mXylene-5Cramp-lambda0_999-bp-1"
run_name = "20170524-CPTMA-MalibuTWC-SGDI-30k-mXylene-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170524-CPTMA-MalibuTWC-SGDI-30k-mXylene-5Cramp-lambda0_999-bp-2"
run_name = "20170524-CPTMA-MalibuTWC-SGDI-30k-mXylene-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170524-CPTMA-MalibuTWC-SGDI-30k-mXylene-5Cramp-lambda0_999-bp-3"
run_name = "20170524-CPTMA-MalibuTWC-SGDI-30k-mXylene-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# mesitylene (3)
if folder == "mesitylene":
bypass_name = "20170428-CPTMA-MalibuTWC-SGDI-30k-mesitylene-5Cramp-lambda0_999-bp-1"
run_name = "20170428-CPTMA-MalibuTWC-SGDI-30k-mesitylene-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170428-CPTMA-MalibuTWC-SGDI-30k-mesitylene-5Cramp-lambda0_999-bp-2"
run_name = "20170428-CPTMA-MalibuTWC-SGDI-30k-mesitylene-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170428-CPTMA-MalibuTWC-SGDI-30k-mesitylene-5Cramp-lambda0_999-bp-3"
run_name = "20170428-CPTMA-MalibuTWC-SGDI-30k-mesitylene-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# methane (3)
if folder == "methane":
bypass_name = "20170720-CPTMA-MalibuTWC-SGDI-30k-CH4ONLY-5Cramp-lambda0_999-bp-1"
run_name = "20170720-CPTMA-MalibuTWC-SGDI-30k-CH4ONLY-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170720-CPTMA-MalibuTWC-SGDI-30k-CH4ONLY-5Cramp-lambda0_999-bp-2"
run_name = "20170720-CPTMA-MalibuTWC-SGDI-30k-CH4ONLY-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170720-CPTMA-MalibuTWC-SGDI-30k-CH4ONLY-5Cramp-lambda0_999-bp-3"
run_name = "20170720-CPTMA-MalibuTWC-SGDI-30k-CH4ONLY-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# methylcyclohexane (2+2)
if folder == "methylcyclohexane":
bypass_name = "20170622-CPTMA-MalibuTWC-SGDI-30k-MCH-5Cramp-REPEAT-lambda0_999-bp-1"
run_name = "20170622-CPTMA-MalibuTWC-SGDI-30k-MCH-5Cramp-REPEAT-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170622-CPTMA-MalibuTWC-SGDI-30k-MCH-5Cramp-REPEAT-lambda0_999-bp-2"
run_name = "20170622-CPTMA-MalibuTWC-SGDI-30k-MCH-5Cramp-REPEAT-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170627-CPTMA-MalibuTWC-SGDI-30k-MCH-5Cramp-REPEAT-lambda0_999-bp-1"
run_name = "20170627-CPTMA-MalibuTWC-SGDI-30k-MCH-5Cramp-REPEAT-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170627-CPTMA-MalibuTWC-SGDI-30k-MCH-5Cramp-REPEAT-lambda0_999-bp-2"
run_name = "20170627-CPTMA-MalibuTWC-SGDI-30k-MCH-5Cramp-REPEAT-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# methylcyclopentane (3)
if folder == "methylcyclopentane":
bypass_name = "20170621-CPTMA-MalibuTWC-SGDI-30k-MCP-5Cramp-REPEAT-lambda0_999-bp-1"
run_name = "20170621-CPTMA-MalibuTWC-SGDI-30k-MCP-5Cramp-REPEAT-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170621-CPTMA-MalibuTWC-SGDI-30k-MCP-5Cramp-REPEAT-lambda0_999-bp-2"
run_name = "20170621-CPTMA-MalibuTWC-SGDI-30k-MCP-5Cramp-REPEAT-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170621-CPTMA-MalibuTWC-SGDI-30k-MCP-5Cramp-REPEAT-lambda0_999-bp-3"
run_name = "20170621-CPTMA-MalibuTWC-SGDI-30k-MCP-5Cramp-REPEAT-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# methylisobutylketone (3)
if folder == "methylisobutylketone":
bypass_name = "20170822-CPTMA-MalibuTWC-SGDI-30k-MIBK-5Cramp-lambda0_999-bp-1"
run_name = "20170822-CPTMA-MalibuTWC-SGDI-30k-MIBK-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170822-CPTMA-MalibuTWC-SGDI-30k-MIBK-5Cramp-lambda0_999-bp-2"
run_name = "20170822-CPTMA-MalibuTWC-SGDI-30k-MIBK-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170822-CPTMA-MalibuTWC-SGDI-30k-MIBK-5Cramp-lambda0_999-bp-3"
run_name = "20170822-CPTMA-MalibuTWC-SGDI-30k-MIBK-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# n-butanol (3+2+3)
if folder == "n-butanol":
bypass_name = "20170728-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-bp-1"
run_name = "20170728-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170728-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-bp-2"
run_name = "20170728-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170728-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-bp-3"
run_name = "20170728-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170731-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-bp-1"
run_name = "20170731-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170731-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-bp-2"
run_name = "20170731-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170801-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-bp-1"
run_name = "20170801-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170801-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-bp-2"
run_name = "20170801-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170801-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-bp-3"
run_name = "20170801-CPTMA-MalibuTWC-SGDI-30k-nButanol-5Cramp-REPEAT-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# n-heptane (3)
if folder == "n-heptane":
bypass_name = "20170808-CPTMA-MalibuTWC-SGDI-30k-nHeptane-5Cramp-lambda0_999-bp-1"
run_name = "20170808-CPTMA-MalibuTWC-SGDI-30k-nHeptane-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170808-CPTMA-MalibuTWC-SGDI-30k-nHeptane-5Cramp-lambda0_999-bp-2"
run_name = "20170808-CPTMA-MalibuTWC-SGDI-30k-nHeptane-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170808-CPTMA-MalibuTWC-SGDI-30k-nHeptane-5Cramp-lambda0_999-bp-3"
run_name = "20170808-CPTMA-MalibuTWC-SGDI-30k-nHeptane-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# n-octane (3)
if folder == "n-octane":
bypass_name = "20170519-CPTMA-MalibuTWC-SGDI-30k-nOctane-5Cramp-lambda0_999-bp-1"
run_name = "20170519-CPTMA-MalibuTWC-SGDI-30k-nOctane-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170519-CPTMA-MalibuTWC-SGDI-30k-nOctane-5Cramp-lambda0_999-bp-2"
run_name = "20170519-CPTMA-MalibuTWC-SGDI-30k-nOctane-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170519-CPTMA-MalibuTWC-SGDI-30k-nOctane-5Cramp-lambda0_999-bp-3"
run_name = "20170519-CPTMA-MalibuTWC-SGDI-30k-nOctane-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# propane (3)
if folder == "propane":
bypass_name = "20170717-CPTMA-MalibuTWC-SGDI-30k-C3H8ONLY-5Cramp-lambda0_999-bp-1"
run_name = "20170717-CPTMA-MalibuTWC-SGDI-30k-C3H8ONLY-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170717-CPTMA-MalibuTWC-SGDI-30k-C3H8ONLY-5Cramp-lambda0_999-bp-2"
run_name = "20170717-CPTMA-MalibuTWC-SGDI-30k-C3H8ONLY-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170717-CPTMA-MalibuTWC-SGDI-30k-C3H8ONLY-5Cramp-lambda0_999-bp-3"
run_name = "20170717-CPTMA-MalibuTWC-SGDI-30k-C3H8ONLY-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# propene (3+3)
if folder == "propene":
bypass_name = "20170724-CPTMA-MalibuTWC-SGDI-30k-C3H6ONLY-5Cramp-lambda0_999-bp-1"
run_name = "20170724-CPTMA-MalibuTWC-SGDI-30k-C3H6ONLY-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170724-CPTMA-MalibuTWC-SGDI-30k-C3H6ONLY-5Cramp-lambda0_999-bp-2"
run_name = "20170724-CPTMA-MalibuTWC-SGDI-30k-C3H6ONLY-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170724-CPTMA-MalibuTWC-SGDI-30k-C3H6ONLY-5Cramp-lambda0_999-bp-3"
run_name = "20170724-CPTMA-MalibuTWC-SGDI-30k-C3H6ONLY-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170725-CPTMA-MalibuTWC-SGDI-30k-C3H6ONLY-5Cramp-lambda0_999-bp-1"
run_name = "20170725-CPTMA-MalibuTWC-SGDI-30k-C3H6ONLY-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170725-CPTMA-MalibuTWC-SGDI-30k-C3H6ONLY-5Cramp-lambda0_999-bp-2"
run_name = "20170725-CPTMA-MalibuTWC-SGDI-30k-C3H6ONLY-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170725-CPTMA-MalibuTWC-SGDI-30k-C3H6ONLY-5Cramp-lambda0_999-bp-3"
run_name = "20170725-CPTMA-MalibuTWC-SGDI-30k-C3H6ONLY-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
# toluene (3)
if folder == "toluene":
bypass_name = "20170505-CPTMA-MalibuTWC-SGDI-30k-Toluene-5Cramp-lambda0_999-bp-1"
run_name = "20170505-CPTMA-MalibuTWC-SGDI-30k-Toluene-5Cramp-lambda0_999-1"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
avg_run = readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name)
bypass_name = "20170505-CPTMA-MalibuTWC-SGDI-30k-Toluene-5Cramp-lambda0_999-bp-2"
run_name = "20170505-CPTMA-MalibuTWC-SGDI-30k-Toluene-5Cramp-lambda0_999-2"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
bypass_name = "20170505-CPTMA-MalibuTWC-SGDI-30k-Toluene-5Cramp-lambda0_999-bp-3"
run_name = "20170505-CPTMA-MalibuTWC-SGDI-30k-Toluene-5Cramp-lambda0_999-3"
run.append(readCoOptimaFile(folder+"/"+run_name, folder+"/"+bypass_name))
#After the nested if statements, the run list should be holding all pre-processed data
# Loop through this data to produce plots, charts, output, and post-processing
i=0
for obj in run:
#Start aggregating runs to create the average
if i > 0:
for item in avg_run.data_map:
j=0
for value in avg_run.data_map[item]:
try:
avg_run.data_map[item][j] += obj.data_map[item][j]
except:
avg_run.data_map[item][j] += obj.data_map[item][-1]
j+=1
# At this point, we can automatically create and save some plots for visualization
# NOTE: The time frame indexed by 1 represents the temperature ramp
base_name = obj.input_file_name.split(".")[0]
base_folder = base_name.split("-")[5]
if base_folder == "1":
base_folder += base_name.split("-")[6]
sub_folder = base_name.split("-")[0] + "_run" + base_name.split("-")[-1]
obj.createPlot('THC Conversion %', range=obj.getTimeFrames()[1], display=False, save=True, file_name=base_name+"--THC_Conv",file_type=".png",subdir=base_folder+"-output/"+sub_folder+"/",x_col='TC top sample in (C)')
obj.createPlot('CO Conversion %', range=obj.getTimeFrames()[1], display=False, save=True, file_name=base_name+"--CO_Conv",file_type=".png",subdir=base_folder+"-output/"+sub_folder+"/",x_col='TC top sample in (C)')
obj.createPlot('NOx Conversion %', range=obj.getTimeFrames()[1], display=False, save=True, file_name=base_name+"--NOx_Conv",file_type=".png",subdir=base_folder+"-output/"+sub_folder+"/",x_col='TC top sample in (C)')
# At this point, we would attempt to calculate rate information (prior to row compression)
rate_map = obj.createRateMap()
printRateMap(obj, rate_map, out_dir=base_folder+"-output/"+sub_folder+"/")
# May also want to calculate different T-n values and print to another file
printTnValues(obj, out_dir=base_folder+"-output/"+sub_folder+"/")
i+=1
#Output information for the average run
# First, loop to average the sum
for item in avg_run.data_map:
j=0
for value in avg_run.data_map[item]:
avg_run.data_map[item][j] = avg_run.data_map[item][j]/len(run)
j+=1
#Next create the plots and calculate some specific rate info
base_name = avg_run.input_file_name.split(".")[0]
base_folder = base_name.split("-")[5]
if base_folder == "1":
base_folder += base_name.split("-")[6]
sub_folder = base_name.split("-")[0] + "_avg"
avg_run.createPlot('THC Conversion %', range=avg_run.getTimeFrames()[1], display=False, save=True, file_name=base_name+"--THC_Conv_Avg",file_type=".png",subdir=base_folder+"-output/"+sub_folder+"/",x_col='TC top sample in (C)')
avg_run.createPlot('CO Conversion %', range=avg_run.getTimeFrames()[1], display=False, save=True, file_name=base_name+"--CO_Conv_Avg",file_type=".png",subdir=base_folder+"-output/"+sub_folder+"/",x_col='TC top sample in (C)')
avg_run.createPlot('NOx Conversion %', range=avg_run.getTimeFrames()[1], display=False, save=True, file_name=base_name+"--NOx_Conv_Avg",file_type=".png",subdir=base_folder+"-output/"+sub_folder+"/",x_col='TC top sample in (C)')
# At this point, we would attempt to calculate rate information (prior to row compression)
rate_map = avg_run.createRateMap()
printRateMap(avg_run, rate_map, out_dir=base_folder+"-output/"+sub_folder+"/")
# May also want to calculate different T-n values and print to another file
printTnValues(avg_run, out_dir=base_folder+"-output/"+sub_folder+"/")
# Lastly, we will compress the rows and print the data to a file
i=0
for obj in run:
base_name = obj.input_file_name.split(".")[0]
base_folder = base_name.split("-")[5]
if base_folder == "1":
base_folder += base_name.split("-")[6]
sub_folder = base_name.split("-")[0] + "_run" + base_name.split("-")[-1]
obj.compressRows(10)
obj.printAlltoFile(base_folder+"-output/"+sub_folder+"/"+base_name+"_output.dat")
i+=1
#Output for the averaged data
base_name = avg_run.input_file_name.split(".")[0]
base_folder = base_name.split("-")[5]
if base_folder == "1":
base_folder += base_name.split("-")[6]
sub_folder = base_name.split("-")[0] + "_avg"
avg_run.compressRows(10)
avg_run.printAlltoFile(base_folder+"-output/"+sub_folder+"/"+base_name+"_Avg_output.dat")
return
## Main function
def main(argv):
# Co-Optima data cannot be automatically paired with by-pass data since the data frames for
# the runs and by-pass do not match exactly. Instead, we will read in each seperately and
# combine manually.
readCoOptimaPureFuelFolder("1-hexene")
#readCoOptimaPureFuelFolder("1-octene")
#readCoOptimaPureFuelFolder("1-propanol")
#readCoOptimaPureFuelFolder("2-Butanone")
#readCoOptimaPureFuelFolder("2-methylpentane")
#readCoOptimaPureFuelFolder("2-pentanone")
#readCoOptimaPureFuelFolder("2-propanol")
#readCoOptimaPureFuelFolder("anisole")
#readCoOptimaPureFuelFolder("butylacetate")
#readCoOptimaPureFuelFolder("cyclopentanone")
#readCoOptimaPureFuelFolder("diisobutylene")
#readCoOptimaPureFuelFolder("E10-baseline")
#readCoOptimaPureFuelFolder("ethanol")
#readCoOptimaPureFuelFolder("ethene")
#readCoOptimaPureFuelFolder("ethyl-acetate")
#readCoOptimaPureFuelFolder("furan-mix")
#readCoOptimaPureFuelFolder("iso-butanol"
#readCoOptimaPureFuelFolder("iso-butylacetate")
#readCoOptimaPureFuelFolder("iso-octane")
#readCoOptimaPureFuelFolder("m-xylene")
#readCoOptimaPureFuelFolder("mesitylene")
#readCoOptimaPureFuelFolder("methane")
#readCoOptimaPureFuelFolder("methylcyclohexane")
#readCoOptimaPureFuelFolder("methylcyclopentane")
#readCoOptimaPureFuelFolder("methylisobutylketone")
#readCoOptimaPureFuelFolder("n-butanol")
#readCoOptimaPureFuelFolder("n-heptane")
#readCoOptimaPureFuelFolder("n-octane")
#readCoOptimaPureFuelFolder("propane")
#readCoOptimaPureFuelFolder("propene")
#readCoOptimaPureFuelFolder("toluene")
return
##Directs python to call the main function
if __name__ == "__main__":
main(sys.argv[1:])
| 57.038777
| 596
| 0.637098
| 10,147
| 76,489
| 4.696955
| 0.053908
| 0.037159
| 0.080822
| 0.094293
| 0.825052
| 0.79018
| 0.761162
| 0.733886
| 0.723542
| 0.721821
| 0
| 0.126264
| 0.188119
| 76,489
| 1,340
| 597
| 57.081343
| 0.641208
| 0.115049
| 0
| 0.443409
| 0
| 0.045273
| 0.468196
| 0.21467
| 0
| 0
| 0
| 0
| 0
| 1
| 0.006658
| false
| 0.380826
| 0.005326
| 0
| 0.018642
| 0.013316
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
|
0
| 7
|
5ff630de4b4ec822cbbdcf58d75183dbb7e8a352
| 8,954
|
py
|
Python
|
test/test_SM/test_ploshadki/test_ploshadka_absolut.py
|
IrinaSlobodchikova/marker
|
72f981134fb025a94348cd2bc829fa8430a01372
|
[
"Apache-2.0"
] | null | null | null |
test/test_SM/test_ploshadki/test_ploshadka_absolut.py
|
IrinaSlobodchikova/marker
|
72f981134fb025a94348cd2bc829fa8430a01372
|
[
"Apache-2.0"
] | null | null | null |
test/test_SM/test_ploshadki/test_ploshadka_absolut.py
|
IrinaSlobodchikova/marker
|
72f981134fb025a94348cd2bc829fa8430a01372
|
[
"Apache-2.0"
] | null | null | null |
def test_sm_absolut_include_eic_yestoday(app):
app.testhelpersm.refresh_page()
app.session.open_SM_page(app.smPurchases)
app.session.ensure_login_sm(app.username, app.password)
app.session.ensure_login_sm(app.username, app.password)
app.session.open_SM_page(app.smPurchases)
app.testHelperSMSearch.expand_show_hide()
# Искать в контейнере (всего контейнеров + 1, номер контейнера(если 0 - случайный выбор), номер строки
# в контейнере если 0 - случайный выбор)
name = 'АБСОЛЮТ'
app.testHelperSMSearch.select_first_publish_date(3, 0)
app.testHelperSMSearch.find_torgovaya_ploschadka(name)
app.testHelperSMSearch.press_search_button()
assert app.testHelperSMSearch.check_results() != '0'
assert int(app.testHelperSMSearch.check_results()) >= 1
def test_sm_absolut_without_eic_yestoday(app):
app.testhelpersm.refresh_page()
app.session.open_SM_page(app.smPurchases)
app.session.ensure_login_sm(app.username, app.password)
app.session.ensure_login_sm(app.username, app.password)
app.session.open_SM_page(app.smPurchases)
app.testHelperSMSearch.expand_show_hide()
# Искать в контейнере (всего контейнеров + 1, номер контейнера(если 0 - случайный выбор), номер строки
# в контейнере если 0 - случайный выбор)
name = 'АБСОЛЮТ'
app.testHelperSMSearch.select_first_publish_date(3, 0)
app.testHelperSMSearch.find_torgovaya_ploschadka(name)
app.testHelperSMSearch.find_in_container_number(11, 2, 1)
app.testHelperSMSearch.find_in_container_number(11, 6, 3)
app.testHelperSMSearch.find_in_container_number(11, 6, 4)
app.testHelperSMSearch.press_search_button()
assert app.testHelperSMSearch.check_results() != '0'
assert int(app.testHelperSMSearch.check_results()) >= 1
def test_sm_absolut_include_eic_yestoday_today(app):
app.testhelpersm.refresh_page()
app.session.open_SM_page(app.smPurchases)
app.session.ensure_login_sm(app.username, app.password)
app.session.ensure_login_sm(app.username, app.password)
app.session.open_SM_page(app.smPurchases)
app.testHelperSMSearch.expand_show_hide()
# Искать в контейнере (всего контейнеров + 1, номер контейнера(если 0 - случайный выбор), номер строки
# в контейнере если 0 - случайный выбор)
name = 'АБСОЛЮТ'
app.testHelperSMSearch.select_first_publish_date(11, 0)
app.testHelperSMSearch.find_torgovaya_ploschadka(name)
app.testHelperSMSearch.press_search_button()
assert app.testHelperSMSearch.check_results() != '0'
assert int(app.testHelperSMSearch.check_results()) >= 1
def test_sm_absolut_without_eic_yestoday_today(app):
app.testhelpersm.refresh_page()
app.session.open_SM_page(app.smPurchases)
app.session.ensure_login_sm(app.username, app.password)
app.session.ensure_login_sm(app.username, app.password)
app.session.open_SM_page(app.smPurchases)
app.testHelperSMSearch.expand_show_hide()
# Искать в контейнере (всего контейнеров + 1, номер контейнера(если 0 - случайный выбор), номер строки
# в контейнере если 0 - случайный выбор)
name = 'АБСОЛЮТ'
app.testHelperSMSearch.select_first_publish_date(11, 0)
app.testHelperSMSearch.find_torgovaya_ploschadka(name)
app.testHelperSMSearch.find_in_container_number(11, 2, 1)
app.testHelperSMSearch.find_in_container_number(11, 6, 3)
app.testHelperSMSearch.find_in_container_number(11, 6, 4)
app.testHelperSMSearch.press_search_button()
assert app.testHelperSMSearch.check_results() != '0'
assert int(app.testHelperSMSearch.check_results()) >= 1
def test_sm_absolut_include_eic_7_days(app):
app.testhelpersm.refresh_page()
app.session.open_SM_page(app.smPurchases)
app.session.ensure_login_sm(app.username, app.password)
app.session.ensure_login_sm(app.username, app.password)
app.session.open_SM_page(app.smPurchases)
app.testHelperSMSearch.expand_show_hide()
# Искать в контейнере (всего контейнеров + 1, номер контейнера(если 0 - случайный выбор), номер строки
# в контейнере если 0 - случайный выбор)
name = 'АБСОЛЮТ'
app.testHelperSMSearch.select_first_publish_date(4, 0)
app.testHelperSMSearch.find_torgovaya_ploschadka(name)
app.testHelperSMSearch.press_search_button()
assert app.testHelperSMSearch.check_results() != '0'
assert int(app.testHelperSMSearch.check_results()) >= 1
def test_sm_absolut_without_eic_7_days(app):
app.testhelpersm.refresh_page()
app.session.open_SM_page(app.smPurchases)
app.session.ensure_login_sm(app.username, app.password)
app.session.ensure_login_sm(app.username, app.password)
app.session.open_SM_page(app.smPurchases)
app.testHelperSMSearch.expand_show_hide()
# Искать в контейнере (всего контейнеров + 1, номер контейнера(если 0 - случайный выбор), номер строки
# в контейнере если 0 - случайный выбор)
name = 'АБСОЛЮТ'
app.testHelperSMSearch.select_first_publish_date(4, 0)
app.testHelperSMSearch.find_torgovaya_ploschadka(name)
app.testHelperSMSearch.find_in_container_number(11, 2, 1)
app.testHelperSMSearch.find_in_container_number(11, 6, 3)
app.testHelperSMSearch.find_in_container_number(11, 6, 4)
app.testHelperSMSearch.press_search_button()
assert app.testHelperSMSearch.check_results() != '0'
assert int(app.testHelperSMSearch.check_results()) >= 1
def test_sm_absolut_include_eic_current_month(app):
app.testhelpersm.refresh_page()
app.session.open_SM_page(app.smPurchases)
app.session.ensure_login_sm(app.username, app.password)
app.session.ensure_login_sm(app.username, app.password)
app.session.open_SM_page(app.smPurchases)
app.testHelperSMSearch.expand_show_hide()
# Искать в контейнере (всего контейнеров + 1, номер контейнера(если 0 - случайный выбор), номер строки
# в контейнере если 0 - случайный выбор)
name = 'АБСОЛЮТ'
app.testHelperSMSearch.select_first_publish_date(5, 0)
app.testHelperSMSearch.find_torgovaya_ploschadka(name)
app.testHelperSMSearch.press_search_button()
assert app.testHelperSMSearch.check_results() != '0'
assert int(app.testHelperSMSearch.check_results()) >= 1
def test_sm_absolut_without_eic_current_month(app):
app.testhelpersm.refresh_page()
app.session.open_SM_page(app.smPurchases)
app.session.ensure_login_sm(app.username, app.password)
app.session.ensure_login_sm(app.username, app.password)
app.session.open_SM_page(app.smPurchases)
app.testHelperSMSearch.expand_show_hide()
# Искать в контейнере (всего контейнеров + 1, номер контейнера(если 0 - случайный выбор), номер строки
# в контейнере если 0 - случайный выбор)
name = 'АБСОЛЮТ'
app.testHelperSMSearch.select_first_publish_date(5, 0)
app.testHelperSMSearch.find_torgovaya_ploschadka(name)
app.testHelperSMSearch.find_in_container_number(11, 2, 1)
app.testHelperSMSearch.find_in_container_number(11, 6, 3)
app.testHelperSMSearch.find_in_container_number(11, 6, 4)
app.testHelperSMSearch.press_search_button()
assert app.testHelperSMSearch.check_results() != '0'
assert int(app.testHelperSMSearch.check_results()) >= 1
def test_sm_absolut_include_eic_prev_month(app):
app.testhelpersm.refresh_page()
app.session.open_SM_page(app.smPurchases)
app.session.ensure_login_sm(app.username, app.password)
app.session.ensure_login_sm(app.username, app.password)
app.session.open_SM_page(app.smPurchases)
app.testHelperSMSearch.expand_show_hide()
# Искать в контейнере (всего контейнеров + 1, номер контейнера(если 0 - случайный выбор), номер строки
# в контейнере если 0 - случайный выбор)
name = 'АБСОЛЮТ'
app.testHelperSMSearch.select_first_publish_date(6, 0)
app.testHelperSMSearch.find_torgovaya_ploschadka(name)
app.testHelperSMSearch.press_search_button()
assert app.testHelperSMSearch.check_results() != '0'
assert int(app.testHelperSMSearch.check_results()) > 2
def test_sm_absolut_without_eic_prev_month(app):
app.testhelpersm.refresh_page()
app.session.open_SM_page(app.smPurchases)
app.session.ensure_login_sm(app.username, app.password)
app.session.ensure_login_sm(app.username, app.password)
app.session.open_SM_page(app.smPurchases)
app.testHelperSMSearch.expand_show_hide()
# Искать в контейнере (всего контейнеров + 1, номер контейнера(если 0 - случайный выбор), номер строки
# в контейнере если 0 - случайный выбор)
name = 'АБСОЛЮТ'
app.testHelperSMSearch.select_first_publish_date(6, 0)
app.testHelperSMSearch.find_torgovaya_ploschadka(name)
app.testHelperSMSearch.find_in_container_number(11, 2, 1)
app.testHelperSMSearch.find_in_container_number(11, 6, 3)
app.testHelperSMSearch.find_in_container_number(11, 6, 4)
app.testHelperSMSearch.press_search_button()
assert app.testHelperSMSearch.check_results() != '0'
assert int(app.testHelperSMSearch.check_results()) > 2
| 47.62766
| 106
| 0.77161
| 1,173
| 8,954
| 5.631714
| 0.057119
| 0.23842
| 0.094611
| 0.048441
| 1
| 1
| 0.996518
| 0.993037
| 0.993037
| 0.993037
| 0
| 0.01723
| 0.13145
| 8,954
| 188
| 107
| 47.62766
| 0.832198
| 0.156243
| 0
| 0.931034
| 0
| 0
| 0.010621
| 0
| 0
| 0
| 0
| 0
| 0.137931
| 1
| 0.068966
| false
| 0.137931
| 0
| 0
| 0.068966
| 0
| 0
| 0
| 0
| null | 1
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
|
0
| 9
|
5ff699a9f252fe5cba9e13634156442d3817a777
| 27,711
|
py
|
Python
|
titus/test/testSignature.py
|
jmilleralpine/hadrian
|
6a438e0370487bbbac5e64a4d6d7a2728902d153
|
[
"Apache-2.0"
] | 127
|
2015-08-05T17:08:35.000Z
|
2019-10-17T07:07:08.000Z
|
titus/test/testSignature.py
|
jmilleralpine/hadrian
|
6a438e0370487bbbac5e64a4d6d7a2728902d153
|
[
"Apache-2.0"
] | 54
|
2015-11-20T02:21:29.000Z
|
2019-11-23T20:17:23.000Z
|
titus/test/testSignature.py
|
jmilleralpine/hadrian
|
6a438e0370487bbbac5e64a4d6d7a2728902d153
|
[
"Apache-2.0"
] | 58
|
2015-05-27T18:19:29.000Z
|
2019-05-23T12:37:17.000Z
|
#!/usr/bin/env python
# Copyright (C) 2014 Open Data ("Open Data" refers to
# one or more of the following companies: Open Data Partners LLC,
# Open Data Research LLC, or Open Data Capital LLC.)
#
# This file is part of Hadrian.
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
import json
import unittest
from titus.datatype import *
from titus.signature import *
import titus.P as P
class TestSignature(unittest.TestCase):
version = PFAVersion(0, 8, 1)
def typeEquality(self, x, y):
if isinstance(x, AvroType) and isinstance(y, AvroType):
return x.accepts(y) and y.accepts(x)
elif isinstance(x, FcnType) and isinstance(y, FcnType):
return all(xt.accepts(yt) and yt.accepts(xt) for xt, yt in zip(x.params, y.params)) and x.ret.accepts(y.ret) and y.ret.accepts(x.ret)
else:
return False
def matches(self, x, y):
if x is None and y is None:
return True
elif x is None or y is None:
return False
else:
(dummy, xparams, xret) = x
(yparams, yret) = y
return all(self.typeEquality(xp, yp) for xp, yp in zip(xparams, yparams)) and self.typeEquality(xret, yret)
def testPassThroughExactParameterMatches(self):
self.assertTrue(self.matches(Sig([{"x": P.Null()}], P.Null()).accepts([AvroNull()], self.version), ([AvroNull()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Int()}], P.Null()).accepts([AvroInt()], self.version), ([AvroInt()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Long()}], P.Null()).accepts([AvroLong()], self.version), ([AvroLong()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Float()}], P.Null()).accepts([AvroFloat()], self.version), ([AvroFloat()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Double()}], P.Null()).accepts([AvroDouble()], self.version), ([AvroDouble()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Bytes()}], P.Null()).accepts([AvroBytes()], self.version), ([AvroBytes()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.String()}], P.Null()).accepts([AvroString()], self.version), ([AvroString()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Int())}], P.Null()).accepts([AvroArray(AvroInt())], self.version), ([AvroArray(AvroInt())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Int())}], P.Null()).accepts([AvroMap(AvroInt())], self.version), ([AvroMap(AvroInt())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Union([P.Int()])}], P.Null()).accepts([AvroUnion([AvroInt()])], self.version), ([AvroUnion([AvroInt()])], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Fixed(10)}], P.Null()).accepts([AvroFixed(10, "MyFixed")], self.version), ([AvroFixed(10, "MyFixed")], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Fixed(10, "MyFixed")}], P.Null()).accepts([AvroFixed(10, "MyFixed")], self.version), ([AvroFixed(10, "MyFixed")], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Enum(["one", "two", "three"])}], P.Null()).accepts([AvroEnum(["one", "two", "three"], "MyEnum")], self.version), ([AvroEnum(["one", "two", "three"], "MyEnum")], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Enum(["one", "two", "three"], "MyEnum")}], P.Null()).accepts([AvroEnum(["one", "two", "three"], "MyEnum")], self.version), ([AvroEnum(["one", "two", "three"], "MyEnum")], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Record({"one": P.Int()})}], P.Null()).accepts([AvroRecord([AvroField("one", AvroInt())], "MyRecord")], self.version), ([AvroRecord([AvroField("one", AvroInt())], "MyRecord")], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Record({"one": P.Int()}, "MyRecord")}], P.Null()).accepts([AvroRecord([AvroField("one", AvroInt())], "MyRecord")], self.version), ([AvroRecord([AvroField("one", AvroInt())], "MyRecord")], AvroNull())))
def testNotMatchAntiPatterns(self):
self.assertTrue(self.matches(Sig([{"x": P.Null()}], P.Null()).accepts([AvroInt()], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Int()}], P.Null()).accepts([AvroLong()], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Long()}], P.Null()).accepts([AvroFloat()], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Float()}], P.Null()).accepts([AvroDouble()], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Double()}], P.Null()).accepts([AvroBytes()], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Bytes()}], P.Null()).accepts([AvroString()], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.String()}], P.Null()).accepts([AvroArray(AvroInt())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Int())}], P.Null()).accepts([AvroMap(AvroInt())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Int())}], P.Null()).accepts([AvroUnion([AvroInt()])], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Union([P.Int()])}], P.Null()).accepts([AvroFixed(10, "MyFixed")], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Fixed(10, "YourFixed")}], P.Null()).accepts([AvroFixed(10, "MyFixed")], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Fixed(10)}], P.Null()).accepts([AvroEnum(["one", "two", "three"], "MyEnum")], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Enum(["one", "two", "three"], "YourEnum")}], P.Null()).accepts([AvroEnum(["one", "two", "three"], "MyEnum")], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Enum(["one", "two", "three"])}], P.Null()).accepts([AvroRecord([AvroField("one", AvroInt())], "MyRecord")], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Record({"one": P.Int()}, "YourRecord")}], P.Null()).accepts([AvroRecord([AvroField("one", AvroInt())], "MyRecord")], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Record({"one": P.Int()})}], P.Null()).accepts([AvroNull()], self.version), None))
def testPromoteNumbers(self):
self.assertTrue(self.matches(Sig([{"x": P.Int()}], P.Null()).accepts([AvroInt()], self.version), ([AvroInt()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Int()}], P.Null()).accepts([AvroLong()], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Int()}], P.Null()).accepts([AvroFloat()], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Int()}], P.Null()).accepts([AvroDouble()], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Long()}], P.Null()).accepts([AvroInt()], self.version), ([AvroLong()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Long()}], P.Null()).accepts([AvroLong()], self.version), ([AvroLong()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Long()}], P.Null()).accepts([AvroFloat()], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Long()}], P.Null()).accepts([AvroDouble()], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Float()}], P.Null()).accepts([AvroInt()], self.version), ([AvroFloat()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Float()}], P.Null()).accepts([AvroLong()], self.version), ([AvroFloat()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Float()}], P.Null()).accepts([AvroFloat()], self.version), ([AvroFloat()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Float()}], P.Null()).accepts([AvroDouble()], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Double()}], P.Null()).accepts([AvroInt()], self.version), ([AvroDouble()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Double()}], P.Null()).accepts([AvroLong()], self.version), ([AvroDouble()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Double()}], P.Null()).accepts([AvroDouble()], self.version), ([AvroDouble()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Double()}], P.Null()).accepts([AvroDouble()], self.version), ([AvroDouble()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Int())}], P.Null()).accepts([AvroArray(AvroInt())], self.version), ([AvroArray(AvroInt())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Int())}], P.Null()).accepts([AvroArray(AvroLong())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Int())}], P.Null()).accepts([AvroArray(AvroFloat())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Int())}], P.Null()).accepts([AvroArray(AvroDouble())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Long())}], P.Null()).accepts([AvroArray(AvroInt())], self.version), ([AvroArray(AvroLong())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Long())}], P.Null()).accepts([AvroArray(AvroLong())], self.version), ([AvroArray(AvroLong())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Long())}], P.Null()).accepts([AvroArray(AvroFloat())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Long())}], P.Null()).accepts([AvroArray(AvroDouble())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Float())}], P.Null()).accepts([AvroArray(AvroInt())], self.version), ([AvroArray(AvroFloat())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Float())}], P.Null()).accepts([AvroArray(AvroLong())], self.version), ([AvroArray(AvroFloat())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Float())}], P.Null()).accepts([AvroArray(AvroFloat())], self.version), ([AvroArray(AvroFloat())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Float())}], P.Null()).accepts([AvroArray(AvroDouble())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Double())}], P.Null()).accepts([AvroArray(AvroInt())], self.version), ([AvroArray(AvroDouble())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Double())}], P.Null()).accepts([AvroArray(AvroLong())], self.version), ([AvroArray(AvroDouble())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Double())}], P.Null()).accepts([AvroArray(AvroDouble())], self.version), ([AvroArray(AvroDouble())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Double())}], P.Null()).accepts([AvroArray(AvroDouble())], self.version), ([AvroArray(AvroDouble())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Int())}], P.Null()).accepts([AvroMap(AvroInt())], self.version), ([AvroMap(AvroInt())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Int())}], P.Null()).accepts([AvroMap(AvroLong())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Int())}], P.Null()).accepts([AvroMap(AvroFloat())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Int())}], P.Null()).accepts([AvroMap(AvroDouble())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Long())}], P.Null()).accepts([AvroMap(AvroInt())], self.version), ([AvroMap(AvroLong())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Long())}], P.Null()).accepts([AvroMap(AvroLong())], self.version), ([AvroMap(AvroLong())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Long())}], P.Null()).accepts([AvroMap(AvroFloat())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Long())}], P.Null()).accepts([AvroMap(AvroDouble())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Float())}], P.Null()).accepts([AvroMap(AvroInt())], self.version), ([AvroMap(AvroFloat())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Float())}], P.Null()).accepts([AvroMap(AvroLong())], self.version), ([AvroMap(AvroFloat())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Float())}], P.Null()).accepts([AvroMap(AvroFloat())], self.version), ([AvroMap(AvroFloat())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Float())}], P.Null()).accepts([AvroMap(AvroDouble())], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Double())}], P.Null()).accepts([AvroMap(AvroInt())], self.version), ([AvroMap(AvroDouble())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Double())}], P.Null()).accepts([AvroMap(AvroLong())], self.version), ([AvroMap(AvroDouble())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Double())}], P.Null()).accepts([AvroMap(AvroDouble())], self.version), ([AvroMap(AvroDouble())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Map(P.Double())}], P.Null()).accepts([AvroMap(AvroDouble())], self.version), ([AvroMap(AvroDouble())], AvroNull())))
def testLooselyMatchFunctionReferences(self):
self.assertTrue(self.matches(Sig([{"x": P.Fcn([P.Long()], P.Long())}], P.Null()).accepts([FcnType([AvroLong()], AvroLong())], self.version), ([FcnType([AvroLong()], AvroLong())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Fcn([P.Long()], P.Long())}], P.Null()).accepts([FcnType([AvroLong()], AvroInt())], self.version), ([FcnType([AvroLong()], AvroInt())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Fcn([P.Long()], P.Long())}], P.Null()).accepts([FcnType([AvroDouble()], AvroLong())], self.version), ([FcnType([AvroDouble()], AvroLong())], AvroNull())))
def testMatchWildcards(self):
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Wildcard("A")).accepts([AvroNull()], self.version), ([AvroNull()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Wildcard("A")).accepts([AvroInt()], self.version), ([AvroInt()], AvroInt())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Wildcard("A")).accepts([AvroLong()], self.version), ([AvroLong()], AvroLong())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Wildcard("A")).accepts([AvroFloat()], self.version), ([AvroFloat()], AvroFloat())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Wildcard("A")).accepts([AvroDouble()], self.version), ([AvroDouble()], AvroDouble())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Wildcard("A")).accepts([AvroBytes()], self.version), ([AvroBytes()], AvroBytes())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Wildcard("A")).accepts([AvroString()], self.version), ([AvroString()], AvroString())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Wildcard("A")).accepts([AvroArray(AvroInt())], self.version), ([AvroArray(AvroInt())], AvroArray(AvroInt()))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Wildcard("A")).accepts([AvroMap(AvroInt())], self.version), ([AvroMap(AvroInt())], AvroMap(AvroInt()))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Wildcard("A")).accepts([AvroUnion([AvroInt()])], self.version), ([AvroUnion([AvroInt()])], AvroUnion([AvroInt()]))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Wildcard("A")).accepts([AvroFixed(10, "MyFixed")], self.version), ([AvroFixed(10, "MyFixed")], AvroFixed(10, "MyFixed"))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Wildcard("A")).accepts([AvroEnum(["one", "two", "three"], "MyEnum")], self.version), ([AvroEnum(["one", "two", "three"], "MyEnum")], AvroEnum(["one", "two", "three"], "MyEnum"))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Wildcard("A")).accepts([AvroRecord([AvroField("one", AvroInt())], "MyRecord")], self.version), ([AvroRecord([AvroField("one", AvroInt())], "MyRecord")], AvroRecord([AvroField("one", AvroInt())], "MyRecord"))))
def testMatchNestedWildcards(self):
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Wildcard("A"))}], P.Wildcard("A")).accepts([AvroArray(AvroNull())], self.version), ([AvroArray(AvroNull())], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Wildcard("A"))}], P.Wildcard("A")).accepts([AvroArray(AvroInt())], self.version), ([AvroArray(AvroInt())], AvroInt())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Wildcard("A"))}], P.Wildcard("A")).accepts([AvroArray(AvroLong())], self.version), ([AvroArray(AvroLong())], AvroLong())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Wildcard("A"))}], P.Wildcard("A")).accepts([AvroArray(AvroFloat())], self.version), ([AvroArray(AvroFloat())], AvroFloat())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Wildcard("A"))}], P.Wildcard("A")).accepts([AvroArray(AvroDouble())], self.version), ([AvroArray(AvroDouble())], AvroDouble())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Wildcard("A"))}], P.Wildcard("A")).accepts([AvroArray(AvroBytes())], self.version), ([AvroArray(AvroBytes())], AvroBytes())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Wildcard("A"))}], P.Wildcard("A")).accepts([AvroArray(AvroString())], self.version), ([AvroArray(AvroString())], AvroString())))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Wildcard("A"))}], P.Wildcard("A")).accepts([AvroArray(AvroArray(AvroInt()))], self.version), ([AvroArray(AvroArray(AvroInt()))], AvroArray(AvroInt()))))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Wildcard("A"))}], P.Wildcard("A")).accepts([AvroArray(AvroMap(AvroInt()))], self.version), ([AvroArray(AvroMap(AvroInt()))], AvroMap(AvroInt()))))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Wildcard("A"))}], P.Wildcard("A")).accepts([AvroArray(AvroUnion([AvroInt()]))], self.version), ([AvroArray(AvroUnion([AvroInt()]))], AvroUnion([AvroInt()]))))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Wildcard("A"))}], P.Wildcard("A")).accepts([AvroArray(AvroFixed(10, "MyFixed"))], self.version), ([AvroArray(AvroFixed(10, "MyFixed"))], AvroFixed(10, "MyFixed"))))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Wildcard("A"))}], P.Wildcard("A")).accepts([AvroArray(AvroEnum(["one", "two", "three"], "MyEnum"))], self.version), ([AvroArray(AvroEnum(["one", "two", "three"], "MyEnum"))], AvroEnum(["one", "two", "three"], "MyEnum"))))
self.assertTrue(self.matches(Sig([{"x": P.Array(P.Wildcard("A"))}], P.Wildcard("A")).accepts([AvroArray(AvroRecord([AvroField("one", AvroInt())], "MyRecord"))], self.version), ([AvroArray(AvroRecord([AvroField("one", AvroInt())], "MyRecord"))], AvroRecord([AvroField("one", AvroInt())], "MyRecord"))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Array(P.Wildcard("A"))).accepts([AvroNull()], self.version), ([AvroNull()], AvroArray(AvroNull()))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Array(P.Wildcard("A"))).accepts([AvroInt()], self.version), ([AvroInt()], AvroArray(AvroInt()))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Array(P.Wildcard("A"))).accepts([AvroLong()], self.version), ([AvroLong()], AvroArray(AvroLong()))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Array(P.Wildcard("A"))).accepts([AvroFloat()], self.version), ([AvroFloat()], AvroArray(AvroFloat()))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Array(P.Wildcard("A"))).accepts([AvroDouble()], self.version), ([AvroDouble()], AvroArray(AvroDouble()))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Array(P.Wildcard("A"))).accepts([AvroBytes()], self.version), ([AvroBytes()], AvroArray(AvroBytes()))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Array(P.Wildcard("A"))).accepts([AvroString()], self.version), ([AvroString()], AvroArray(AvroString()))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Array(P.Wildcard("A"))).accepts([AvroArray(AvroInt())], self.version), ([AvroArray(AvroInt())], AvroArray(AvroArray(AvroInt())))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Array(P.Wildcard("A"))).accepts([AvroMap(AvroInt())], self.version), ([AvroMap(AvroInt())], AvroArray(AvroMap(AvroInt())))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Array(P.Wildcard("A"))).accepts([AvroUnion([AvroInt()])], self.version), ([AvroUnion([AvroInt()])], AvroArray(AvroUnion([AvroInt()])))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Array(P.Wildcard("A"))).accepts([AvroFixed(10, "MyFixed")], self.version), ([AvroFixed(10, "MyFixed")], AvroArray(AvroFixed(10, "MyFixed")))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Array(P.Wildcard("A"))).accepts([AvroEnum(["one", "two", "three"], "MyEnum")], self.version), ([AvroEnum(["one", "two", "three"], "MyEnum")], AvroArray(AvroEnum(["one", "two", "three"], "MyEnum")))))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A")}], P.Array(P.Wildcard("A"))).accepts([AvroRecord([AvroField("one", AvroInt())], "MyRecord")], self.version), ([AvroRecord([AvroField("one", AvroInt())], "MyRecord")], AvroArray(AvroRecord([AvroField("one", AvroInt())], "MyRecord")))))
def testUseWildcardsToNormalizeNumericalTypes(self):
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroInt(), AvroInt()], self.version), ([AvroInt(), AvroInt()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroInt(), AvroLong()], self.version), ([AvroLong(), AvroLong()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroInt(), AvroFloat()], self.version), ([AvroFloat(), AvroFloat()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroInt(), AvroDouble()], self.version), ([AvroDouble(), AvroDouble()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroLong(), AvroInt()], self.version), ([AvroLong(), AvroLong()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroLong(), AvroLong()], self.version), ([AvroLong(), AvroLong()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroLong(), AvroFloat()], self.version), ([AvroFloat(), AvroFloat()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroLong(), AvroDouble()], self.version), ([AvroDouble(), AvroDouble()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroFloat(), AvroInt()], self.version), ([AvroFloat(), AvroFloat()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroFloat(), AvroLong()], self.version), ([AvroFloat(), AvroFloat()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroFloat(), AvroFloat()], self.version), ([AvroFloat(), AvroFloat()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroFloat(), AvroDouble()], self.version), ([AvroDouble(), AvroDouble()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroDouble(), AvroInt()], self.version), ([AvroDouble(), AvroDouble()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroDouble(), AvroLong()], self.version), ([AvroDouble(), AvroDouble()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroDouble(), AvroFloat()], self.version), ([AvroDouble(), AvroDouble()], AvroNull())))
self.assertTrue(self.matches(Sig([{"x": P.Wildcard("A", set([AvroInt(), AvroLong(), AvroFloat(), AvroDouble()]))}, {"y": P.Wildcard("A")}], P.Null()).accepts([AvroDouble(), AvroDouble()], self.version), ([AvroDouble(), AvroDouble()], AvroNull())))
def testMatchWildRecords(self):
self.assertTrue(self.matches(Sig([{"x": P.WildRecord("A", {"one": P.Int()})}], P.Wildcard("A")).accepts([AvroRecord([AvroField("one", AvroInt())], "MyRecord")], self.version), ([AvroRecord([AvroField("one", AvroInt())], "MyRecord")], AvroRecord([AvroField("one", AvroInt())], "MyRecord"))))
self.assertTrue(self.matches(Sig([{"x": P.WildRecord("A", {"one": P.Int()})}], P.Wildcard("A")).accepts([AvroRecord([AvroField("one", AvroInt()), AvroField("two", AvroString())], "MyRecord")], self.version), ([AvroRecord([AvroField("one", AvroInt()), AvroField("two", AvroString())], "MyRecord")], AvroRecord([AvroField("one", AvroInt()), AvroField("two", AvroString())], "MyRecord"))))
self.assertTrue(self.matches(Sig([{"x": P.WildRecord("A", {"one": P.String()})}], P.Wildcard("A")).accepts([AvroRecord([AvroField("one", AvroInt()), AvroField("two", AvroString())], "MyRecord")], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.WildRecord("A", {"one": P.Double()})}], P.Wildcard("A")).accepts([AvroRecord([AvroField("one", AvroInt()), AvroField("two", AvroString())], "MyRecord")], self.version), None))
self.assertTrue(self.matches(Sig([{"x": P.WildRecord("A", {"one": P.Int()})}], P.Wildcard("A")).accepts([AvroRecord([AvroField("uno", AvroInt()), AvroField("two", AvroString())], "MyRecord")], self.version), None))
if __name__ == "__main__":
unittest.main()
| 123.709821
| 394
| 0.622893
| 3,356
| 27,711
| 5.140942
| 0.052443
| 0.116038
| 0.149191
| 0.20721
| 0.890744
| 0.883904
| 0.870283
| 0.857764
| 0.826697
| 0.811163
| 0
| 0.001963
| 0.09913
| 27,711
| 223
| 395
| 124.264574
| 0.689152
| 0.026704
| 0
| 0.153409
| 0
| 0
| 0.038881
| 0
| 0
| 0
| 0
| 0
| 0.8125
| 1
| 0.056818
| false
| 0.005682
| 0.028409
| 0
| 0.130682
| 0
| 0
| 0
| 0
| null | 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 9
|
27be4c9358f415cdd0843ae839e01f24c78048bc
| 66
|
py
|
Python
|
tests/unit_tests/paradigm_form_class_unit_test.py
|
spraakbanken/paradigmextract
|
12dfda604ff72b5a951a89bd515f893bf01f2860
|
[
"MIT"
] | 2
|
2018-03-01T15:48:16.000Z
|
2019-05-07T11:28:19.000Z
|
tests/unit_tests/paradigm_form_class_unit_test.py
|
spraakbanken/paradigmextract
|
12dfda604ff72b5a951a89bd515f893bf01f2860
|
[
"MIT"
] | 1
|
2017-11-30T07:40:41.000Z
|
2017-11-30T07:40:41.000Z
|
tests/unit_tests/paradigm_form_class_unit_test.py
|
spraakbanken/paradigmextract
|
12dfda604ff72b5a951a89bd515f893bf01f2860
|
[
"MIT"
] | 1
|
2018-03-05T07:45:22.000Z
|
2018-03-05T07:45:22.000Z
|
from paradigmextract.paradigm import Form
def test1():
pass
| 11
| 41
| 0.742424
| 8
| 66
| 6.125
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.018868
| 0.19697
| 66
| 5
| 42
| 13.2
| 0.90566
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.333333
| true
| 0.333333
| 0.333333
| 0
| 0.666667
| 0
| 1
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 1
| 1
| 1
| 0
| 1
| 0
|
0
| 7
|
fd6abf99922c5a5a8aa7521f509f37272fb1eeaf
| 126
|
py
|
Python
|
{{cookiecutter.app_slug}}/backends/backend_flask/app/routes/__init__.py
|
ELC/cookiecutter-python-fullstack
|
0a5c8c2f2fb2f54034c09d3b67dbbe55a943b0ce
|
[
"Apache-2.0"
] | 5
|
2021-06-30T15:06:09.000Z
|
2022-03-12T06:27:36.000Z
|
backend/app/routes/__init__.py
|
leepand/open-mlops
|
73c6a53601ae88e38901e224cf7127f92f7dbae0
|
[
"Apache-2.0"
] | 12
|
2021-06-30T04:16:17.000Z
|
2021-06-30T04:22:45.000Z
|
backend/app/routes/__init__.py
|
leepand/open-mlops
|
73c6a53601ae88e38901e224cf7127f92f7dbae0
|
[
"Apache-2.0"
] | 3
|
2021-11-04T22:22:00.000Z
|
2021-11-25T21:50:40.000Z
|
from .api import blueprint as api_routes
from .ui import blueprint as ui_routes
from .errors import blueprint as error_routes
| 31.5
| 45
| 0.833333
| 21
| 126
| 4.857143
| 0.428571
| 0.441176
| 0.5
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.142857
| 126
| 3
| 46
| 42
| 0.944444
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 1
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 1
|
0
| 8
|
e3034310bcb1ad9ecf80101651c9dc594d1b45d7
| 23,200
|
py
|
Python
|
code/figures/fig2_knowngenes_matrices_logos.py
|
RPGroup-PBoC/sortseq_belliveau
|
ca3b0b8092bbe6deaf1b82b2dab67b4bcca679f2
|
[
"MIT"
] | 4
|
2018-05-07T00:50:08.000Z
|
2021-05-10T12:40:56.000Z
|
code/figures/fig2_knowngenes_matrices_logos.py
|
RPGroup-PBoC/sortseq_belliveau
|
ca3b0b8092bbe6deaf1b82b2dab67b4bcca679f2
|
[
"MIT"
] | null | null | null |
code/figures/fig2_knowngenes_matrices_logos.py
|
RPGroup-PBoC/sortseq_belliveau
|
ca3b0b8092bbe6deaf1b82b2dab67b4bcca679f2
|
[
"MIT"
] | 1
|
2019-07-29T01:40:40.000Z
|
2019-07-29T01:40:40.000Z
|
import os
import glob
import pickle
import re
# Our numerical workhorses
import numpy as np
import pandas as pd
# Import the project utils
import sys
sys.path.insert(0, '../')
# Import matplotlib stuff for plotting
import matplotlib
import matplotlib.pyplot as plt
import matplotlib.cm as cm
from IPython.core.pylabtools import figsize
from mpl_toolkits.axes_grid1 import make_axes_locatable
# Logo-generating module and utils
import anylogo
import NB_sortseq_utils as utils
# set plotting format options
utils.set_plotting_style_emat()
#===============================================================================
# Set output directory
#===============================================================================
output = 'output_figs/'
#===============================================================================
# directory where emat csv files are contained
#===============================================================================
# lac
datadir_lac = '../sortseq/2011_lacZ/'
# mar
datadir_marA = '../sortseq/20150820_marRmut2only/'
datadir_mar_RNAP = '../sortseq/20150513_marRmut1only_marRdeltaRAB_marRdeltaR/'
# rel
datadir_rel = '../sortseq/20150312_relB/'
#===============================================================================
# plot energy matrices with logos on top.
#===============================================================================
# Set color scale - I want the colorbar to be symmetric and will pick values#
# that seem appropriate for all matrices.
emat_min=-0.4
emat_max=0.4
mid_val=0.0
# Create background dict
gc = .508
background_array =pd.DataFrame( [[(1-gc)/2,gc/2,gc/2,(1-gc)/2]])
#------------------------------------------------------------------------------#
# lacZ: LacI
#------------------------------------------------------------------------------#
energy_df = pd.read_csv(datadir_lac + '2011_lacZ_MG1655_M9glucose_na_mut1_4bins_LacI_O1_emat_mean.csv')
energy_df = energy_df[['A','C','G','T']]
# create background nucleotide frequencies dataframe
energy_df_scaled = utils.estimate_scalefactor(np.array(energy_df))*energy_df.copy()
background_df = pd.DataFrame(pd.np.tile(background_array,
(len(energy_df_scaled), 1)), columns=['A','C','G','T'])
seq = 'AATTGTGAGCGGATAACAATT'
plt.figure(figsize=utils.cm2inch((0.18*len(seq) + 0.2,2.5)))
ax = plt.gca()
relative_scale=1.5
relative_spacing=.65
emat_ymin = -2 * (relative_scale + relative_spacing)
emat_ymax = -2 * relative_spacing
yticks = np.linspace(emat_ymin, emat_ymax, 9)[[1, 3, 5, 7]]
yticklabels = list('TGCA')
anylogo.draw(ax, effect_df=energy_df_scaled, logo_type='information',
background = background_df,
use_transparency=False)
L = len(seq)
ax.set_xticks([])
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='none',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max),
extent=(-.5, L - .5, emat_ymin, emat_ymax),
zorder=100,
aspect='auto')
ax.set_ylim([emat_ymin, 2])
ax.set_yticks(yticks)
ax.set_yticklabels(yticklabels, fontsize=5, horizontalalignment='center')
ax.set_ylabel('')
ax.yaxis.set_tick_params(length=0)
# # create an axes on the right side of ax. The width of cax will be 3%
# # of ax and the padding between cax and ax will be fixed at 0.05 inch.
# divider = make_axes_locatable(ax)
# cax = divider.append_axes("right", size="3%", pad=0.05)
#
# cbar = plt.colorbar(im, cax=cax, ticks=[-0.5, 0, 0.5])
# cbar.ax.set_yticklabels(['-0.5', '0', '0.5'], fontsize=6, fontname='Arial')
# cbar.outline.set_visible(False)
# cbar.ax.tick_params(axis=u'both', which=u'both',length=0)
y = .5*emat_ymax
for i in range(L):
ax.text(i, y, seq[i], horizontalalignment='center', verticalalignment='center',
fontsize=6)
ax.tick_params(axis='y', pad=7)
plt.tight_layout()
plt.savefig(output + 'fig2_lacZ_emat_logo_lacI.pdf')
# save energy matrix using nearest interpolation
plt.figure()
ax = plt.gca()
L = len(seq)
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='nearest',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max))
ax.axis('off')
plt.savefig(output + 'fig2_lacZ_emat_logo_lacI_ematonly.pdf')
#------------------------------------------------------------------------------#
# logos for CRP
#------------------------------------------------------------------------------#
energy_df = pd.read_csv(datadir_lac + '2011_lacZ_MG1655_M9glucose_na_mut1_4bins_CRP_emat_mean.csv')
energy_df = energy_df[['A','C','G','T']]
energy_df_scaled = utils.estimate_scalefactor(np.array(energy_df))*energy_df.copy()
energy_df_scaled = energy_df_scaled[['A','C','G','T']]
# create background nucleotide frequencies dataframe
energy_df_scaled = utils.estimate_scalefactor(np.array(energy_df))*energy_df.copy()
background_df = pd.DataFrame(pd.np.tile(background_array,
(len(energy_df_scaled), 1)), columns=['A','C','G','T'])
seq = 'ATTAATGTGAGTTAGCTCACTCATTA'
plt.figure(figsize=utils.cm2inch((0.18*len(seq) + 0.2,2.5)))
ax = plt.gca()
relative_scale=1.5
relative_spacing=.65
emat_ymin = -2 * (relative_scale + relative_spacing)
emat_ymax = -2 * relative_spacing
yticks = np.linspace(emat_ymin, emat_ymax, 9)[[1, 3, 5, 7]]
yticklabels = list('TGCA')
anylogo.draw(ax, effect_df=energy_df_scaled, logo_type='information',
background = background_df,
use_transparency=False)
L = len(seq)
ax.set_xticks([])
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='none',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max),
extent=(-.5, L - .5, emat_ymin, emat_ymax),
zorder=100,
aspect='auto')
ax.set_ylim([emat_ymin, 2])
ax.set_yticks(yticks)
ax.set_yticklabels(yticklabels, fontsize=5, horizontalalignment='center')
ax.set_ylabel('')
ax.yaxis.set_tick_params(length=0)
# # create an axes on the right side of ax. The width of cax will be 3%
# # of ax and the padding between cax and ax will be fixed at 0.05 inch.
# divider = make_axes_locatable(ax)
# cax = divider.append_axes("right", size="3%", pad=0.05)
#
# cbar = plt.colorbar(im, cax=cax, ticks=[-0.5, 0, 0.5])
# cbar.ax.set_yticklabels(['-0.5', '0', '0.5'], fontsize=6, fontname='Arial')
# cbar.outline.set_visible(False)
# cbar.ax.tick_params(axis=u'both', which=u'both',length=0)
y = .5*emat_ymax
for i in range(L):
ax.text(i, y, seq[i], horizontalalignment='center', verticalalignment='center',
fontsize=6)
ax.tick_params(axis='y', pad=7)
plt.tight_layout()
plt.savefig(output + 'fig2_lacZ_emat_logo_CRP.pdf')
# save energy matrix using nearest interpolation
plt.figure()
ax = plt.gca()
L = len(seq)
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='nearest',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max))
ax.axis('off')
plt.savefig(output + 'fig2_lacZ_emat_logo_CRP_ematonly.pdf')
#------------------------------------------------------------------------------#
# lacZ: RNAP
#------------------------------------------------------------------------------#
energy_df = pd.read_csv(datadir_lac + '2011_lacZ_MG1655_M9glucose_na_mut1_4bins_RNAP_emat_mean.csv')
# energy_df['position'] = energy_df['position'] - 63
energy_df = energy_df[energy_df.position != energy_df.position.min()]
energy_df = energy_df[energy_df.position != energy_df.position.max()]
energy_df.reset_index(inplace=True)
energy_df = energy_df[['A','C','G','T']]
energy_df_scaled = utils.estimate_scalefactor(np.array(energy_df))*energy_df.copy()
energy_df_scaled.reset_index(inplace=True)
energy_df_scaled = energy_df_scaled[['A','C','G','T']]
# create background nucleotide frequencies dataframe
energy_df_scaled = utils.estimate_scalefactor(np.array(energy_df))*energy_df.copy()
background_df = pd.DataFrame(pd.np.tile(background_array,
(len(energy_df_scaled), 1)), columns=['A','C','G','T'])
seq = 'TTTACACTTTATGCTTCCGGCTCGTATGTT'
plt.figure(figsize=utils.cm2inch((0.18*len(seq) + 0.2,2.5)))
ax = plt.gca()
relative_scale=1.5
relative_spacing=.65
emat_ymin = -2 * (relative_scale + relative_spacing)
emat_ymax = -2 * relative_spacing
yticks = np.linspace(emat_ymin, emat_ymax, 9)[[1, 3, 5, 7]]
yticklabels = list('TGCA')
anylogo.draw(ax, effect_df=energy_df_scaled, logo_type='information',
background = background_df,
use_transparency=False)
L = len(seq)
ax.set_xticks([])
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='none',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max),
extent=(-.5, L - .5, emat_ymin, emat_ymax),
zorder=100,
aspect='auto')
ax.set_ylim([emat_ymin, 2])
ax.set_yticks(yticks)
ax.set_yticklabels(yticklabels, fontsize=5, horizontalalignment='center')
ax.set_ylabel('')
ax.yaxis.set_tick_params(length=0)
# # create an axes on the right side of ax. The width of cax will be 3%
# # of ax and the padding between cax and ax will be fixed at 0.05 inch.
# divider = make_axes_locatable(ax)
# cax = divider.append_axes("right", size="3%", pad=0.05)
#
# cbar = plt.colorbar(im, cax=cax, ticks=[-0.5, 0, 0.5])
# cbar.ax.set_yticklabels(['-0.5', '0', '0.5'], fontsize=6, fontname='Arial')
# cbar.outline.set_visible(False)
# cbar.ax.tick_params(axis=u'both', which=u'both',length=0)
y = .5*emat_ymax
for i in range(L):
ax.text(i, y, seq[i], horizontalalignment='center', verticalalignment='center',
fontsize=6)
ax.tick_params(axis='y', pad=7)
plt.tight_layout()
plt.savefig(output + 'fig2_lacZ_emat_logo_RNAP.pdf')
# save energy matrix using nearest interpolation
plt.figure()
ax = plt.gca()
L = len(seq)
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='nearest',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max))
ax.axis('off')
plt.savefig(output + 'fig2_lacZ_emat_logo_RNAP_ematonly.pdf')
#------------------------------------------------------------------------------#
# marRAB: MarA
#------------------------------------------------------------------------------#
energy_df = pd.read_csv(datadir_marA + '20150820_marR_MG1655_LB_na_mut2_4bins_MarA_emat_mean.csv')
# energy_df = energy_df[energy_df.position != energy_df.position.max()]
energy_df = energy_df[['A','C','G','T']]
energy_df_scaled = utils.estimate_scalefactor(np.array(energy_df))*energy_df.copy()
energy_df_scaled = energy_df_scaled[['A','C','G','T']]
# create background nucleotide frequencies dataframe
energy_df_scaled = utils.estimate_scalefactor(np.array(energy_df))*energy_df.copy()
background_df = pd.DataFrame(pd.np.tile(background_array,
(len(energy_df_scaled), 1)), columns=['A','C','G','T'])
seq = 'ATTTAGCAAAACGTGGCATC'
plt.figure(figsize=utils.cm2inch((0.18*len(seq) + 0.2,2.5)))
ax = plt.gca()
relative_scale=1.5
relative_spacing=.65
emat_ymin = -2 * (relative_scale + relative_spacing)
emat_ymax = -2 * relative_spacing
yticks = np.linspace(emat_ymin, emat_ymax, 9)[[1, 3, 5, 7]]
yticklabels = list('TGCA')
anylogo.draw(ax, effect_df=energy_df_scaled, logo_type='information',
background = background_df,
use_transparency=False)
L = len(seq)
ax.set_xticks([])
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='none',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max),
extent=(-.5, L - .5, emat_ymin, emat_ymax),
zorder=100,
aspect='auto')
ax.set_ylim([emat_ymin, 2])
ax.set_yticks(yticks)
ax.set_yticklabels(yticklabels, fontsize=5, horizontalalignment='center')
ax.set_ylabel('')
ax.yaxis.set_tick_params(length=0)
# # create an axes on the right side of ax. The width of cax will be 3%
# # of ax and the padding between cax and ax will be fixed at 0.05 inch.
# divider = make_axes_locatable(ax)
# cax = divider.append_axes("right", size="3%", pad=0.05)
#
# cbar = plt.colorbar(im, cax=cax, ticks=[-0.5, 0, 0.5])
# cbar.ax.set_yticklabels(['-0.5', '0', '0.5'], fontsize=6, fontname='Arial')
# cbar.outline.set_visible(False)
# cbar.ax.tick_params(axis=u'both', which=u'both',length=0)
y = .5*emat_ymax
for i in range(L):
ax.text(i, y, seq[i], horizontalalignment='center', verticalalignment='center',
fontsize=6)
ax.tick_params(axis='y', pad=7)
plt.tight_layout()
plt.savefig(output + 'fig2_marRAB_emat_logo_marA.pdf')
# save energy matrix using nearest interpolation
plt.figure()
ax = plt.gca()
L = len(seq)
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='nearest',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max))
ax.axis('off')
plt.savefig(output + 'fig2_marRAB_emat_logo_marA_ematonly.pdf')
#------------------------------------------------------------------------------#
# marRAB: RNAP
#------------------------------------------------------------------------------#
energy_df = pd.read_csv(datadir_mar_RNAP + '20150513_marR_MG1655_LB_na_mut1_4bins_RNAP_emat_mean.csv')
energy_df = energy_df[energy_df.position != energy_df.position.max()]
energy_df = energy_df[energy_df.position != energy_df.position.max()]
energy_df.reset_index(inplace=True)
energy_df = energy_df[['A','C','G','T']]
energy_df_scaled = utils.estimate_scalefactor(np.array(energy_df))*energy_df.copy()
energy_df_scaled.reset_index(inplace=True)
energy_df_scaled = energy_df_scaled[['A','C','G','T']]
# create background nucleotide frequencies dataframe
energy_df_scaled = utils.estimate_scalefactor(np.array(energy_df))*energy_df.copy()
background_df = pd.DataFrame(pd.np.tile(background_array,
(len(energy_df_scaled), 1)), columns=['A','C','G','T'])
seq = 'TTGACTTATACTTGCCTGGGCAATATTAT'
plt.figure(figsize=utils.cm2inch((0.18*len(seq) + 0.2,2.5)))
ax = plt.gca()
relative_scale=1.5
relative_spacing=.65
emat_ymin = -2 * (relative_scale + relative_spacing)
emat_ymax = -2 * relative_spacing
yticks = np.linspace(emat_ymin, emat_ymax, 9)[[1, 3, 5, 7]]
yticklabels = list('TGCA')
anylogo.draw(ax, effect_df=energy_df_scaled, logo_type='information',
background = background_df,
use_transparency=False)
L = len(seq)
ax.set_xticks([])
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='none',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max),
extent=(-.5, L - .5, emat_ymin, emat_ymax),
zorder=100,
aspect='auto')
ax.set_ylim([emat_ymin, 2])
ax.set_yticks(yticks)
ax.set_yticklabels(yticklabels, fontsize=5, horizontalalignment='center')
ax.set_ylabel('')
ax.yaxis.set_tick_params(length=0)
# # create an axes on the right side of ax. The width of cax will be 3%
# # of ax and the padding between cax and ax will be fixed at 0.05 inch.
# divider = make_axes_locatable(ax)
# cax = divider.append_axes("right", size="3%", pad=0.05)
#
# cbar = plt.colorbar(im, cax=cax, ticks=[-0.5, 0, 0.5])
# cbar.ax.set_yticklabels(['-0.5', '0', '0.5'], fontsize=6, fontname='Arial')
# cbar.outline.set_visible(False)
# cbar.ax.tick_params(axis=u'both', which=u'both',length=0)
y = .5*emat_ymax
for i in range(L):
ax.text(i, y, seq[i], horizontalalignment='center', verticalalignment='center',
fontsize=6)
ax.tick_params(axis='y', pad=7)
plt.tight_layout()
plt.savefig(output + 'fig2_marRAB_emat_logo_RNAP.pdf')
# save energy matrix using nearest interpolation
plt.figure()
ax = plt.gca()
L = len(seq)
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='nearest',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max))
ax.axis('off')
plt.savefig(output + 'fig2_marRAB_emat_logo_RNAP_ematonly.pdf')
#------------------------------------------------------------------------------#
# relB promoter: RelBE
#------------------------------------------------------------------------------#
energy_df = pd.read_csv(datadir_rel + '20150513_relB_MG1655_M9glucose_na_mut1_4bins_RelBE_emat_mean.csv')
energy_df = energy_df[['A','C','G','T']]
energy_df_scaled = utils.estimate_scalefactor(np.array(energy_df))*energy_df.copy()
energy_df_scaled = energy_df_scaled[['A','C','G','T']]
# create background nucleotide frequencies dataframe
energy_df_scaled = utils.estimate_scalefactor(np.array(energy_df))*energy_df.copy()
background_df = pd.DataFrame(pd.np.tile(background_array,
(len(energy_df_scaled), 1)), columns=['A','C','G','T'])
seq = 'TGTAATGACATTTGTAATTACAA'
plt.figure(figsize=utils.cm2inch((0.18*len(seq) + 0.2,2.5)))
ax = plt.gca()
relative_scale=1.5
relative_spacing=.65
emat_ymin = -2 * (relative_scale + relative_spacing)
emat_ymax = -2 * relative_spacing
yticks = np.linspace(emat_ymin, emat_ymax, 9)[[1, 3, 5, 7]]
yticklabels = list('TGCA')
anylogo.draw(ax, effect_df=energy_df_scaled, logo_type='information',
background = background_df,
use_transparency=False)
L = len(seq)
ax.set_xticks([])
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='none',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max),
extent=(-.5, L - .5, emat_ymin, emat_ymax),
zorder=100,
aspect='auto')
ax.set_ylim([emat_ymin, 2])
ax.set_yticks(yticks)
ax.set_yticklabels(yticklabels, fontsize=5, horizontalalignment='center')
ax.set_ylabel('')
ax.yaxis.set_tick_params(length=0)
# # create an axes on the right side of ax. The width of cax will be 3%
# # of ax and the padding between cax and ax will be fixed at 0.05 inch.
# divider = make_axes_locatable(ax)
# cax = divider.append_axes("right", size="3%", pad=0.05)
#
# cbar = plt.colorbar(im, cax=cax, ticks=[-0.5, 0, 0.5])
# cbar.ax.set_yticklabels(['-0.5', '0', '0.5'], fontsize=6, fontname='Arial')
# cbar.outline.set_visible(False)
# cbar.ax.tick_params(axis=u'both', which=u'both',length=0)
y = .5*emat_ymax
for i in range(L):
ax.text(i, y, seq[i], horizontalalignment='center', verticalalignment='center',
fontsize=6)
ax.tick_params(axis='y', pad=7)
plt.tight_layout()
plt.savefig(output + 'fig2_relB_emat_logo_RelBE.pdf')
# save energy matrix using nearest interpolation
plt.figure()
ax = plt.gca()
L = len(seq)
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='nearest',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max))
ax.axis('off')
plt.savefig(output + 'fig2_relB_emat_logo_RelBE_ematonly.pdf')
#------------------------------------------------------------------------------#
# relB promoter: RelBE
#------------------------------------------------------------------------------#
energy_df = pd.read_csv(datadir_rel + '20150513_relB_MG1655_M9glucose_na_mut1_4bins_RNAP_emat_mean.csv')
energy_df = energy_df[energy_df.position != energy_df.position.min()]
energy_df = energy_df[energy_df.position != energy_df.position.max()]
energy_df.reset_index(inplace=True)
energy_df = energy_df[['A','C','G','T']]
energy_df_scaled = utils.estimate_scalefactor(np.array(energy_df))*energy_df.copy()
energy_df_scaled.reset_index(inplace=True)
energy_df_scaled = energy_df_scaled[['A','C','G','T']]
# create background nucleotide frequencies dataframe
energy_df_scaled = utils.estimate_scalefactor(np.array(energy_df))*energy_df.copy()
background_df = pd.DataFrame(pd.np.tile(background_array,
(len(energy_df_scaled), 1)), columns=['A','C','G','T'])
seq = 'TTGCCCTAAGCATGTTGTAGTGCGATACT'
plt.figure(figsize=utils.cm2inch((0.18*len(seq) + 0.2,2.5)))
ax = plt.gca()
relative_scale=1.5
relative_spacing=.65
emat_ymin = -2 * (relative_scale + relative_spacing)
emat_ymax = -2 * relative_spacing
yticks = np.linspace(emat_ymin, emat_ymax, 9)[[1, 3, 5, 7]]
yticklabels = list('TGCA')
anylogo.draw(ax, effect_df=energy_df_scaled, logo_type='information',
background = background_df,
use_transparency=False)
L = len(seq)
ax.set_xticks([])
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='none',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max),
extent=(-.5, L - .5, emat_ymin, emat_ymax),
zorder=100,
aspect='auto')
ax.set_ylim([emat_ymin, 2])
ax.set_yticks(yticks)
ax.set_yticklabels(yticklabels, fontsize=5, horizontalalignment='center')
ax.set_ylabel('')
ax.yaxis.set_tick_params(length=0)
# # create an axes on the right side of ax. The width of cax will be 3%
# # of ax and the padding between cax and ax will be fixed at 0.05 inch.
# divider = make_axes_locatable(ax)
# cax = divider.append_axes("right", size="3%", pad=0.05)
#
# cbar = plt.colorbar(im, cax=cax, ticks=[-0.5, 0, 0.5])
# cbar.ax.set_yticklabels(['-0.5', '0', '0.5'], fontsize=6, fontname='Arial')
# cbar.outline.set_visible(False)
# cbar.ax.tick_params(axis=u'both', which=u'both',length=0)
y = .5*emat_ymax
for i in range(L):
ax.text(i, y, seq[i], horizontalalignment='center', verticalalignment='center',
fontsize=6)
ax.tick_params(axis='y', pad=7)
plt.tight_layout()
plt.savefig(output + 'fig2_relB_emat_logo_RNAP.pdf')
# save energy matrix using nearest interpolation
plt.figure()
ax = plt.gca()
L = len(seq)
im = ax.imshow(utils.zero_matrix_WT(np.array(energy_df.T), seq),
interpolation='nearest',
cmap='RdBu_r',
clim=(emat_min, emat_max),
norm = utils.MidpointNormalize(midpoint = mid_val,
vmin = emat_min, vmax = emat_max))
ax.axis('off')
plt.savefig(output + 'fig2_relB_emat_logo_RNAP_ematonly.pdf')
| 36.193448
| 105
| 0.637931
| 3,288
| 23,200
| 4.284063
| 0.077251
| 0.07724
| 0.041744
| 0.03862
| 0.913602
| 0.91204
| 0.908633
| 0.906361
| 0.903237
| 0.903237
| 0
| 0.026079
| 0.15375
| 23,200
| 640
| 106
| 36.25
| 0.691387
| 0.259957
| 0
| 0.867322
| 0
| 0
| 0.102121
| 0.06904
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.034398
| 0
| 0.034398
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
8bde0aa9f65226adb28383d6c80d521f468aa396
| 538
|
py
|
Python
|
Mundo 3/Exercicios/Desafio 109/moeda.py
|
yWolfBR/Python-CursoEmVideo
|
17bab8ad3c4293daf8377c5d49242942845b3577
|
[
"MIT"
] | null | null | null |
Mundo 3/Exercicios/Desafio 109/moeda.py
|
yWolfBR/Python-CursoEmVideo
|
17bab8ad3c4293daf8377c5d49242942845b3577
|
[
"MIT"
] | null | null | null |
Mundo 3/Exercicios/Desafio 109/moeda.py
|
yWolfBR/Python-CursoEmVideo
|
17bab8ad3c4293daf8377c5d49242942845b3577
|
[
"MIT"
] | null | null | null |
def aumentar(v=0, t=0, formatar=False):
vf = v + (v * (t / 100))
if formatar:
vf = moeda(vf)
return vf
def diminuir(v=0, t=0, formatar=False):
vf = v - (v * (t / 100))
if formatar:
vf = moeda(vf)
return vf
def dobro(v=0, formatar=False):
vf = v * 2
if formatar:
vf = moeda(vf)
return vf
def metade(v=0, formatar=False):
vf = v / 2
if formatar:
vf = moeda(vf)
return vf
def moeda(v=0.0, m='R$'):
vf = f'{m}{v:.2f}'.replace('.', ',')
return vf
| 16.8125
| 40
| 0.501859
| 87
| 538
| 3.103448
| 0.241379
| 0.037037
| 0.207407
| 0.237037
| 0.77037
| 0.77037
| 0.77037
| 0.77037
| 0.77037
| 0.77037
| 0
| 0.046832
| 0.325279
| 538
| 31
| 41
| 17.354839
| 0.69697
| 0
| 0
| 0.565217
| 0
| 0
| 0.026022
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.217391
| false
| 0
| 0
| 0
| 0.434783
| 0
| 0
| 0
| 0
| null | 0
| 1
| 1
| 0
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
8be29015a42d07a259b9fbde6cdb16c7311338d6
| 11,160
|
py
|
Python
|
cogs/portal.py
|
BenitzCoding/Utility-Bot
|
a3959f5fc9a13e2e282d68ce6dd3b0266fc2b1b2
|
[
"MIT"
] | null | null | null |
cogs/portal.py
|
BenitzCoding/Utility-Bot
|
a3959f5fc9a13e2e282d68ce6dd3b0266fc2b1b2
|
[
"MIT"
] | null | null | null |
cogs/portal.py
|
BenitzCoding/Utility-Bot
|
a3959f5fc9a13e2e282d68ce6dd3b0266fc2b1b2
|
[
"MIT"
] | null | null | null |
from imports import *
from utilities import utils, default
class Portal(commands.Cog):
def __init__(self, bot):
self.bot = bot
self.config = default.get("./config.json")
async def distribute_message(self, message, server):
if server == "Senarc":
senarc_srv = discord.utils.get(self.bot.guilds, id=886543799843688498)
orion_srv = discord.utils.get(self.bot.guilds, id=881095332434440224)
mta_srv = discord.utils.get(self.bot.guilds, id=849907771871854631)
secure_srv = discord.utils.get(self.bot.guilds, id=864451138514452481)
mittens_srv = discord.utils.get(self.bot.guilds, id=780278916173791232)
for channel in orion_srv.text_channels:
if channel.id == int(891555218939080714):
orion = channel
orion_webhook = discord.utils.get(await orion.webhooks(), name="Senarc Network Integration")
await orion_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in mittens_srv.text_channels:
if channel.id == int(891555957019119626):
mittens = channel
mittens_webhook = discord.utils.get(await mittens.webhooks(), name="Senarc Network Integration")
await mittens_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
for channel in mta_srv.text_channels:
if channel.id == int(891555527866331146):
mta = channel
mta_webhook = discord.utils.get(await mta.webhooks(), name="Senarc Network Integration")
await mta_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in secure_srv.text_channels:
if channel.id == int(891555715406262284):
secure = channel
secure_webhook = discord.utils.get(await secure.webhooks(), name="Senarc Network Integration")
await secure_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in orion_srv.text_channels:
if channel.id == int(891555957019119626):
mittens = channel
mittens_webhook = discord.utils.get(await mittens.webhooks(), name="Senarc Network Integration")
await mittens_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
if server == "Orion":
senarc_srv = discord.utils.get(self.bot.guilds, id=886543799843688498)
mta_srv = discord.utils.get(self.bot.guilds, id=849907771871854631)
secure_srv = discord.utils.get(self.bot.guilds, id=864451138514452481)
mittens_srv = discord.utils.get(self.bot.guilds, id=780278916173791232)
for channel in mta_srv.text_channels:
if channel.id == int(891555527866331146):
mta = channel
mta_webhook = discord.utils.get(await mta.webhooks(), name="Senarc Network Integration")
await mta_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in mittens_srv.text_channels:
if channel.id == int(891555957019119626):
mittens = channel
mittens_webhook = discord.utils.get(await mittens.webhooks(), name="Senarc Network Integration")
await mittens_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
for channel in secure_srv.text_channels:
if channel.id == int(891555715406262284):
secure = channel
secure_webhook = discord.utils.get(await secure.webhooks(), name="Senarc Network Integration")
await secure_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in senarc_srv.text_channels:
if channel.id == int(890089098134585415):
senarc = channel
senarc_webhook = discord.utils.get(await senarc.webhooks(), name="Senarc Network Integration")
await senarc_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
if server == "Mittens":
senarc_srv = discord.utils.get(self.bot.guilds, id=886543799843688498)
orion_srv = discord.utils.get(self.bot.guilds, id=881095332434440224)
mta_srv = discord.utils.get(self.bot.guilds, id=849907771871854631)
secure_srv = discord.utils.get(self.bot.guilds, id=864451138514452481)
mittens_srv = discord.utils.get(self.bot.guilds, id=780278916173791232)
for channel in orion_srv.text_channels:
if channel.id == int(891555218939080714):
orion = channel
orion_webhook = discord.utils.get(await orion.webhooks(), name="Senarc Network Integration")
await orion_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in mta_srv.text_channels:
if channel.id == int(891555527866331146):
mta = channel
mta_webhook = discord.utils.get(await mta.webhooks(), name="Senarc Network Integration")
await mta_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in secure_srv.text_channels:
if channel.id == int(891555715406262284):
secure = channel
secure_webhook = discord.utils.get(await secure.webhooks(), name="Senarc Network Integration")
await secure_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in senarc_srv.text_channels:
if channel.id == int(890089098134585415):
senarc = channel
senarc_webhook = discord.utils.get(await senarc.webhooks(), name="Senarc Network Integration")
await senarc_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
if server == "Secure":
senarc_srv = discord.utils.get(self.bot.guilds, id=886543799843688498)
orion_srv = discord.utils.get(self.bot.guilds, id=881095332434440224)
mta_srv = discord.utils.get(self.bot.guilds, id=849907771871854631)
secure_srv = discord.utils.get(self.bot.guilds, id=864451138514452481)
mittens_srv = discord.utils.get(self.bot.guilds, id=780278916173791232)
for channel in orion_srv.text_channels:
if channel.id == int(891555218939080714):
orion = channel
orion_webhook = discord.utils.get(await orion.webhooks(), name="Senarc Network Integration")
await orion_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in mta_srv.text_channels:
if channel.id == int(891555527866331146):
mta = channel
mta_webhook = discord.utils.get(await mta.webhooks(), name="Senarc Network Integration")
await mta_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in orion_srv.text_channels:
if channel.id == int(891555957019119626):
mittens = channel
mittens_webhook = discord.utils.get(await mittens.webhooks(), name="Senarc Network Integration")
await mittens_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in mittens_srv.text_channels:
if channel.id == int(891555957019119626):
mittens = channel
mittens_webhook = discord.utils.get(await mittens.webhooks(), name="Senarc Network Integration")
await mittens_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
for channel in senarc_srv.text_channels:
if channel.id == int(890089098134585415):
senarc = channel
senarc_webhook = discord.utils.get(await senarc.webhooks(), name="Senarc Network Integration")
await senarc_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
if server == "MTA":
senarc_srv = discord.utils.get(self.bot.guilds, id=886543799843688498)
orion_srv = discord.utils.get(self.bot.guilds, id=881095332434440224)
mta_srv = discord.utils.get(self.bot.guilds, id=849907771871854631)
secure_srv = discord.utils.get(self.bot.guilds, id=864451138514452481)
mittens_srv = discord.utils.get(self.bot.guilds, id=780278916173791232)
for channel in orion_srv.text_channels:
if channel.id == int(891555218939080714):
orion = channel
orion_webhook = discord.utils.get(await orion.webhooks(), name="Senarc Network Integration")
await orion_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in secure_srv.text_channels:
if channel.id == int(891555715406262284):
secure = channel
secure_webhook = discord.utils.get(await secure.webhooks(), name="Senarc Network Integration")
await secure_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in mittens_srv.text_channels:
if channel.id == int(891555957019119626):
mittens = channel
mittens_webhook = discord.utils.get(await mittens.webhooks(), name="Senarc Network Integration")
await mittens_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in orion_srv.text_channels:
if channel.id == int(891555957019119626):
mittens = channel
mittens_webhook = discord.utils.get(await mittens.webhooks(), name="Senarc Network Integration")
await mittens_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
for channel in senarc_srv.text_channels:
if channel.id == int(890089098134585415):
senarc = channel
senarc_webhook = discord.utils.get(await senarc.webhooks(), name="Senarc Network Integration")
await senarc_webhook.send(message.content, username=message.author.name, avatar_url=message.author.display_avatar)
break
else:
continue
@commands.Cog.listener()
async def on_message(self, message):
if message.author.bot:
return
if message.channel.id == int(890089098134585415):
await self.distribute_message(message, "Senarc")
elif message.channel.id == int(891555218939080714):
await self.distribute_message(message, "Orion")
elif message.channel.id == int(891555957019119626):
await self.distribute_message(message, "Mittens")
elif message.channel.id == int(891555715406262284):
await self.distribute_message(message, "Secure")
elif message.channel.id == int(891555527866331146):
await self.distribute_message(message, "MTA")
def setup(bot):
bot.add_cog(Portal(bot))
| 37.959184
| 120
| 0.742563
| 1,398
| 11,160
| 5.80329
| 0.049356
| 0.069518
| 0.086898
| 0.053248
| 0.945889
| 0.914212
| 0.914212
| 0.914212
| 0.914212
| 0.914212
| 0
| 0.099374
| 0.156004
| 11,160
| 293
| 121
| 38.088737
| 0.76197
| 0
| 0
| 0.878261
| 0
| 0
| 0.059588
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.008696
| false
| 0
| 0.008696
| 0
| 0.026087
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
47406ea88df305915506c83483d13f5d1b631a2e
| 3,981
|
py
|
Python
|
Python/train_data_maker.py
|
MuratErdem/FacePass
|
bcc4fd6bad77f71219d917789c887e100e653419
|
[
"MIT"
] | 1
|
2021-01-09T14:39:11.000Z
|
2021-01-09T14:39:11.000Z
|
Python/train_data_maker.py
|
MuratErdem/FacePass
|
bcc4fd6bad77f71219d917789c887e100e653419
|
[
"MIT"
] | null | null | null |
Python/train_data_maker.py
|
MuratErdem/FacePass
|
bcc4fd6bad77f71219d917789c887e100e653419
|
[
"MIT"
] | null | null | null |
import face_recognition
import pickle
import db_opr
from dir import configs
from concurrent.futures import ThreadPoolExecutor
config_obj = configs()
train_face_encode_list = {}
def fast_encode(row_fetch_faces):
person_face_name = str(row_fetch_faces["id"])
train_face_fetch = str(config_obj.str_views_dir) + str("\\assets\\uploads\\files\\") + str(
row_fetch_faces["img_file_path"])
train_image = face_recognition.load_image_file(train_face_fetch)
train_face_encode = face_recognition.face_encodings(train_image)[0]
train_face_encode_list[person_face_name] = train_face_encode
str_query_update = "UPDATE person_details2 set data_set=1 where id='" + person_face_name + "'"
print(str_query_update)
db_opr.execute_insert(str_query_update)
def train():
str_reinit = "UPDATE person_details2 set data_set=0"
db_opr.execute_insert(str_reinit)
global train_face_encode_list
query_fetch_faces = "SELECT * from person_details2 where is_train=1"
result_fetch_faces = db_opr.fetch_result(query_fetch_faces)
for row_fetch_faces in result_fetch_faces:
train_face_fetch = None
train_image = None
train_face_encode = None
print(row_fetch_faces)
# person_face_name,train_face_encode = fast_encode(row_fetch_faces)
with ThreadPoolExecutor(max_workers=3) as executor:
data = executor.submit(fast_encode, row_fetch_faces)
print("ALL ENCODINGS DONE")
with open('DATASET/dataset_faces_full.dat', 'wb') as f:
pickle.dump(train_face_encode_list, f)
def train_stud():
str_reinit = "UPDATE student set data_set=0"
db_opr.execute_insert(str_reinit)
global train_face_encode_list
query_fetch_faces = "SELECT * from student where is_train=1"
result_fetch_faces = db_opr.fetch_result(query_fetch_faces)
print("DB DONE")
for row_fetch_faces in result_fetch_faces:
train_face_fetch = None
train_image = None
train_face_encode = None
print(row_fetch_faces)
person_face_name = str(row_fetch_faces["id"])
train_face_fetch = str(config_obj.str_views_dir) + str("\\assets\\uploads\\files\\") + str(
row_fetch_faces["img_file_path"])
train_image = face_recognition.load_image_file(train_face_fetch)
train_face_encode = face_recognition.face_encodings(train_image)[0]
train_face_encode_list[person_face_name] = train_face_encode
str_query_update = "UPDATE student set data_set=1 where id='" + person_face_name + ""
db_opr.execute_insert(str_query_update)
with open('TRAINDATASET/dataset_faces_full_students.dat', 'wb') as f:
pickle.dump(train_face_encode_list, f)
def train_presence_in_out():
str_reinit = "UPDATE person_details2 set data_set=0"
db_opr.execute_insert(str_reinit)
global train_face_encode_list
query_fetch_faces = "SELECT * from person_details2 where is_train=1"
result_fetch_faces = db_opr.fetch_result(query_fetch_faces)
print("DB DONE")
for row_fetch_faces in result_fetch_faces:
train_face_fetch = None
train_image = None
train_face_encode = None
print(row_fetch_faces)
person_face_name = str(row_fetch_faces["id"])
train_face_fetch = str(config_obj.str_views_dir) + str("\\assets\\uploads\\files\\") + str(
row_fetch_faces["img_file_path"])
train_image = face_recognition.load_image_file(train_face_fetch)
# train_face_encode = face_encd(train_image)
train_face_encode = face_recognition.face_encodings(train_image)[0]
train_face_encode_list[person_face_name] = train_face_encode
str_query_update = "UPDATE person_details2 set data_set=1 where id='" + person_face_name + "'"
print(str_query_update)
db_opr.execute_insert(str_query_update)
with open('TRAINDATASET/dataset_faces_full.dat', 'wb') as f:
pickle.dump(train_face_encode_list, f)
train()
| 42.351064
| 102
| 0.73273
| 573
| 3,981
| 4.640489
| 0.136126
| 0.101542
| 0.118466
| 0.071455
| 0.882663
| 0.85408
| 0.848439
| 0.848439
| 0.848439
| 0.836405
| 0
| 0.005841
| 0.182869
| 3,981
| 93
| 103
| 42.806452
| 0.811559
| 0.027129
| 0
| 0.734177
| 0
| 0
| 0.165633
| 0.04832
| 0
| 0
| 0
| 0
| 0
| 1
| 0.050633
| false
| 0
| 0.063291
| 0
| 0.113924
| 0.101266
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
474e12b4a3549000e2617985967e62d4e6380888
| 4,692
|
py
|
Python
|
test/pyaz/aks/nodepool/__init__.py
|
bigdatamoore/py-az-cli
|
54383a4ee7cc77556f6183e74e992eec95b28e01
|
[
"MIT"
] | null | null | null |
test/pyaz/aks/nodepool/__init__.py
|
bigdatamoore/py-az-cli
|
54383a4ee7cc77556f6183e74e992eec95b28e01
|
[
"MIT"
] | 9
|
2021-09-24T16:37:24.000Z
|
2021-12-24T00:39:19.000Z
|
test/pyaz/aks/nodepool/__init__.py
|
bigdatamoore/py-az-cli
|
54383a4ee7cc77556f6183e74e992eec95b28e01
|
[
"MIT"
] | null | null | null |
import json, subprocess
from ... pyaz_utils import get_cli_name, get_params
def list(resource_group, cluster_name):
params = get_params(locals())
command = "az aks nodepool list " + params
print(command)
output = subprocess.run(command, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE)
stdout = output.stdout.decode("utf-8")
stderr = output.stderr.decode("utf-8")
if stdout:
return json.loads(stdout)
print(stdout)
else:
raise Exception(stderr)
print(stderr)
def show(resource_group, cluster_name, name):
params = get_params(locals())
command = "az aks nodepool show " + params
print(command)
output = subprocess.run(command, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE)
stdout = output.stdout.decode("utf-8")
stderr = output.stderr.decode("utf-8")
if stdout:
return json.loads(stdout)
print(stdout)
else:
raise Exception(stderr)
print(stderr)
def add(resource_group, cluster_name, name, kubernetes_version=None, zones=None, enable_node_public_ip=None, node_public_ip_prefix_id=None, node_vm_size=None, node_osdisk_type=None, node_osdisk_size=None, node_count=None, vnet_subnet_id=None, ppg=None, max_pods=None, os_type=None, os_sku=None, min_count=None, max_count=None, enable_cluster_autoscaler=None, node_taints=None, priority=None, eviction_policy=None, spot_max_price=None, tags=None, labels=None, max_surge=None, mode=None, enable_encryption_at_host=None, enable_ultra_ssd=None, no_wait=None):
params = get_params(locals())
command = "az aks nodepool add " + params
print(command)
output = subprocess.run(command, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE)
stdout = output.stdout.decode("utf-8")
stderr = output.stderr.decode("utf-8")
if stdout:
return json.loads(stdout)
print(stdout)
else:
raise Exception(stderr)
print(stderr)
def scale(resource_group, cluster_name, name, node_count=None, no_wait=None):
params = get_params(locals())
command = "az aks nodepool scale " + params
print(command)
output = subprocess.run(command, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE)
stdout = output.stdout.decode("utf-8")
stderr = output.stderr.decode("utf-8")
if stdout:
return json.loads(stdout)
print(stdout)
else:
raise Exception(stderr)
print(stderr)
def upgrade(resource_group, cluster_name, name, kubernetes_version=None, node_image_only=None, max_surge=None, no_wait=None):
params = get_params(locals())
command = "az aks nodepool upgrade " + params
print(command)
output = subprocess.run(command, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE)
stdout = output.stdout.decode("utf-8")
stderr = output.stderr.decode("utf-8")
if stdout:
return json.loads(stdout)
print(stdout)
else:
raise Exception(stderr)
print(stderr)
def update(resource_group, cluster_name, name, enable_cluster_autoscaler=None, disable_cluster_autoscaler=None, update_cluster_autoscaler=None, min_count=None, max_count=None, tags=None, max_surge=None, mode=None, no_wait=None):
params = get_params(locals())
command = "az aks nodepool update " + params
print(command)
output = subprocess.run(command, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE)
stdout = output.stdout.decode("utf-8")
stderr = output.stderr.decode("utf-8")
if stdout:
return json.loads(stdout)
print(stdout)
else:
raise Exception(stderr)
print(stderr)
def delete(resource_group, cluster_name, name, no_wait=None):
params = get_params(locals())
command = "az aks nodepool delete " + params
print(command)
output = subprocess.run(command, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE)
stdout = output.stdout.decode("utf-8")
stderr = output.stderr.decode("utf-8")
if stdout:
return json.loads(stdout)
print(stdout)
else:
raise Exception(stderr)
print(stderr)
def get_upgrades(resource_group, cluster_name, nodepool_name):
params = get_params(locals())
command = "az aks nodepool get-upgrades " + params
print(command)
output = subprocess.run(command, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE)
stdout = output.stdout.decode("utf-8")
stderr = output.stderr.decode("utf-8")
if stdout:
return json.loads(stdout)
print(stdout)
else:
raise Exception(stderr)
print(stderr)
| 40.448276
| 555
| 0.689898
| 609
| 4,692
| 5.178982
| 0.144499
| 0.071021
| 0.050729
| 0.060875
| 0.800571
| 0.766328
| 0.752378
| 0.734623
| 0.703551
| 0.660748
| 0
| 0.004246
| 0.196931
| 4,692
| 115
| 556
| 40.8
| 0.832803
| 0
| 0
| 0.830189
| 0
| 0
| 0.056053
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.075472
| false
| 0
| 0.018868
| 0
| 0.169811
| 0.226415
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
47b48d0a71c78d49dc47775283106af32a64f673
| 3,908
|
py
|
Python
|
serverless/flask-server/tests/test_utils.py
|
adrianaarcia/YPool
|
054b54495c7daedc8eb88b39d33d5b365a1e63ca
|
[
"MIT"
] | null | null | null |
serverless/flask-server/tests/test_utils.py
|
adrianaarcia/YPool
|
054b54495c7daedc8eb88b39d33d5b365a1e63ca
|
[
"MIT"
] | null | null | null |
serverless/flask-server/tests/test_utils.py
|
adrianaarcia/YPool
|
054b54495c7daedc8eb88b39d33d5b365a1e63ca
|
[
"MIT"
] | null | null | null |
import os
import sys
sys.path.append(os.path.dirname(os.path.dirname(os.path.abspath(__file__))))
from utils import (
generate_pairs,
sort_by_group,
)
def test_get_generate_pairs_many():
location_list = ["JFK", "JFK", "BDL", "BDL", "Yale"]
mappings = generate_pairs(location_list)
assert mappings == [('JFK', 2), ('BDL', 2), ('Yale', 1)]
def test_get_generate_pairs_one():
location_list = ["JFK"]
mappings = generate_pairs(location_list)
assert mappings == [('JFK', 1)]
def test_get_generate_pairs_empty():
location_list = []
mappings = generate_pairs(location_list)
assert mappings == []
def test_sort_by_group_unmatched():
sample_items = [
{'netId': 'abc0', 'date': '2021-04-22', 'origin': 'Yale', 'destination': 'Airport-JFK', 'groupId': '123', 'matched': False, 'preferred_car_type': 'regular',
'preferred_group_size': '3', 'requestId': 'this-is-a-test-req-id-0', 'request_time': '2021-04-19 13:16:33', 'time': '01:32'},
{'netId': 'abc1', 'date': '2021-04-20', 'origin': 'Yale', 'destination': 'Airport-JFK', 'groupId': '321', 'matched': False, 'preferred_car_type': 'XL',
'preferred_group_size': '4', 'requestId': 'this-is-a-test-req-id-1', 'request_time': '2021-04-20 10:59:47', 'time': '08:18'},
{'netId': 'abc2', 'date': '2021-04-23', 'origin': 'Yale', 'destination': 'Airport-JFK', 'groupId': '123', 'matched': False, 'preferred_car_type': 'regular',
'preferred_group_size': '5', 'requestId': 'this-is-a-test-req-id-2', 'request_time': '2021-04-24 07:51:59', 'time': '11:52'},
{'netId': 'abc3', 'date': '2021-04-22', 'origin': 'Yale', 'destination': 'Airport-JFK', 'groupId': '321', 'matched': False, 'preferred_car_type': 'XL',
'preferred_group_size': '3', 'requestId': 'this-is-a-test-req-id-3', 'request_time': '2021-04-18 20:09:56', 'time': '02:19'},
{'netId': 'abc4', 'date': '2021-04-22', 'origin': 'Yale', 'destination': 'Airport-JFK', 'groupId': '123', 'matched': False, 'preferred_car_type': 'regular', 'preferred_group_size': '4', 'requestId': 'this-is-a-test-req-id-4', 'request_time': '2021-04-19 04:22:44', 'time': '09:01'}]
groups = sort_by_group(sample_items)
assert groups == []
def test_sort_by_group_matched():
sample_items = [
{'netId': 'abc0', 'date': '2021-04-22', 'origin': 'Yale', 'destination': 'Airport-JFK', 'groupId': '123', 'matched': True, 'preferred_car_type': 'regular',
'preferred_group_size': '3', 'requestId': 'this-is-a-test-req-id-0', 'request_time': '2021-04-19 13:16:33', 'time': '01:32'},
{'netId': 'abc1', 'date': '2021-04-20', 'origin': 'Yale', 'destination': 'Airport-JFK', 'groupId': '321', 'matched': True, 'preferred_car_type': 'XL',
'preferred_group_size': '4', 'requestId': 'this-is-a-test-req-id-1', 'request_time': '2021-04-20 10:59:47', 'time': '08:18'},
{'netId': 'abc2', 'date': '2021-04-23', 'origin': 'Yale', 'destination': 'Airport-JFK', 'groupId': '123', 'matched': True, 'preferred_car_type': 'regular',
'preferred_group_size': '5', 'requestId': 'this-is-a-test-req-id-2', 'request_time': '2021-04-24 07:51:59', 'time': '11:52'},
{'netId': 'abc3', 'date': '2021-04-22', 'origin': 'Yale', 'destination': 'Airport-JFK', 'groupId': '321', 'matched': True, 'preferred_car_type': 'XL',
'preferred_group_size': '3', 'requestId': 'this-is-a-test-req-id-3', 'request_time': '2021-04-18 20:09:56', 'time': '02:19'},
{'netId': 'abc4', 'date': '2021-04-22', 'origin': 'Yale', 'destination': 'Airport-JFK', 'groupId': '123', 'matched': True, 'preferred_car_type': 'regular', 'preferred_group_size': '4', 'requestId': 'this-is-a-test-req-id-4', 'request_time': '2021-04-19 04:22:44', 'time': '09:01'}]
groups = sort_by_group(sample_items)
assert groups == [['abc0', 'abc2', 'abc4'], ['abc1', 'abc3']]
| 69.785714
| 290
| 0.613869
| 541
| 3,908
| 4.260628
| 0.171904
| 0.052061
| 0.043384
| 0.121475
| 0.916703
| 0.877223
| 0.856399
| 0.836009
| 0.792625
| 0.792625
| 0
| 0.098562
| 0.145855
| 3,908
| 55
| 291
| 71.054545
| 0.591971
| 0
| 0
| 0.333333
| 1
| 0
| 0.494371
| 0.058854
| 0
| 0
| 0
| 0
| 0.111111
| 1
| 0.111111
| false
| 0
| 0.066667
| 0
| 0.177778
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
47ee18b8b03a3713693cbe636e24e0ff71d222d7
| 2,881
|
py
|
Python
|
Boatwright_et_al.,2018/assembly_and_qc_scripts/trago_norm_histogram.py
|
BBarbazukLab/papers
|
fc77bcae17d475da99d758407be3ff7f9b298c3d
|
[
"MIT"
] | 3
|
2018-09-18T15:22:25.000Z
|
2019-07-10T17:57:42.000Z
|
Boatwright_et_al.,2018/assembly_and_qc_scripts/trago_norm_histogram.py
|
BBarbazukLab/papers
|
fc77bcae17d475da99d758407be3ff7f9b298c3d
|
[
"MIT"
] | null | null | null |
Boatwright_et_al.,2018/assembly_and_qc_scripts/trago_norm_histogram.py
|
BBarbazukLab/papers
|
fc77bcae17d475da99d758407be3ff7f9b298c3d
|
[
"MIT"
] | 4
|
2018-12-01T15:05:15.000Z
|
2019-12-17T13:43:55.000Z
|
#!/usr/bin/env python
from Bio import SeqIO
import numpy as np
import matplotlib
matplotlib.use('Agg')
import matplotlib.pyplot as plt
## AMM normalized for Tdu no 10
sizes = [len(rec) for rec in SeqIO.parse("/scratch/lfs/mcintyre/trago/trago_output/trag_normalized_trinity_SC/Tdu_dir_denovTrinityOutput.Trinity.fasta", "fasta")]
len(sizes), min(sizes), max(sizes)
plt.hist(sizes, bins=10000)
plt.ylim([0,1600])
plt.xlim([0,5000])
plt.xlabel('seq length')
plt.ylabel('Tdu_amm_norm')
plt.savefig("/scratch/lfs/mcintyre/trago/trago_output/trag_normalized_trinity_SC/Tdu_amm_norm_plot2")
## AMM normalized for Tdu w/10
sizes = [len(rec) for rec in SeqIO.parse("/scratch/lfs/mcintyre/trago/trago_output/trag_normalized_trinity_SC/Tdu_10_dir_denovTrinityOutput.Trinity.fasta", "fasta")]
len(sizes), min(sizes), max(sizes)
plt.hist(sizes, bins=10000)
plt.ylim([0,1600])
plt.xlim([0,5000])
plt.xlabel('seq length')
plt.ylabel('Tdu_10_amm_norm')
plt.savefig("/scratch/lfs/mcintyre/trago/trago_output/trag_normalized_trinity_SC/Tdu_10_amm_norm_plot2")
## AMM normalized for Tpo no 10
sizes = [len(rec) for rec in SeqIO.parse("/scratch/lfs/mcintyre/trago/trago_output/trag_normalized_trinity_SC/Tpo_dir_denovTrinityOutput.Trinity.fasta", "fasta")]
len(sizes), min(sizes), max(sizes)
plt.hist(sizes, bins=10000)
plt.ylim([0,1600])
plt.xlim([0,5000])
plt.xlabel('seq length')
plt.ylabel('Tpo_amm_norm')
plt.savefig("/scratch/lfs/mcintyre/trago/trago_output/trag_normalized_trinity_SC/Tpo_amm_norm_plot2")
## AMM normalized for Tpo w/10
sizes = [len(rec) for rec in SeqIO.parse("/scratch/lfs/mcintyre/trago/trago_output/trag_normalized_trinity_SC/Tpo_10_dir_denovTrinityOutput.Trinity.fasta", "fasta")]
len(sizes), min(sizes), max(sizes)
plt.hist(sizes, bins=10000)
plt.ylim([0,1600])
plt.xlim([0,5000])
plt.xlabel('seq length')
plt.ylabel('Tpo_10_amm_norm')
plt.savefig("/scratch/lfs/mcintyre/trago/trago_output/trag_normalized_trinity_SC/Tpo_10_amm_norm_plot2")
## AMM normalized for Tpr no 10
sizes = [len(rec) for rec in SeqIO.parse("/scratch/lfs/mcintyre/trago/trago_output/trag_normalized_trinity_SC/Tpr_dir_denovTrinityOutput.Trinity.fasta", "fasta")]
len(sizes), min(sizes), max(sizes)
plt.hist(sizes, bins=10000)
plt.ylim([0,1600])
plt.xlim([0,5000])
plt.xlabel('seq length')
plt.ylabel('Tpr_norm')
plt.savefig("/scratch/lfs/mcintyre/trago/trago_output/trag_normalized_trinity_SC/Tpr_amm_norm_plot2")
## AMM normalized for Tpr w/10
sizes = [len(rec) for rec in SeqIO.parse("/scratch/lfs/mcintyre/trago/trago_output/trag_normalized_trinity_SC/Tpr_10_dir_denovTrinityOutput.Trinity.fasta", "fasta")]
len(sizes), min(sizes), max(sizes)
plt.hist(sizes, bins=10000)
plt.ylim([0,1600])
plt.xlim([0,5000])
plt.xlabel('seq length')
plt.ylabel('Tpr_10_norm')
plt.savefig("/scratch/lfs/mcintyre/trago/trago_output/trag_normalized_trinity_SC/Tpr_10_amm_norm_plot2")
| 40.577465
| 165
| 0.777855
| 473
| 2,881
| 4.53277
| 0.122622
| 0.05597
| 0.100746
| 0.128731
| 0.933302
| 0.933302
| 0.920243
| 0.862407
| 0.862407
| 0.862407
| 0
| 0.046997
| 0.06942
| 2,881
| 70
| 166
| 41.157143
| 0.752704
| 0.073238
| 0
| 0.566038
| 0
| 0
| 0.50753
| 0.44503
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.075472
| 0
| 0.075472
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
9a1e459d2dd5df9d9b07d53c2e4a5bfe72026be8
| 21,788
|
py
|
Python
|
tests/unit/test_executor.py
|
alex-tsukanov/cargopy
|
f73b68e2ea5263dea5e570756d5fbcc4ef8d7b75
|
[
"MIT"
] | 5
|
2019-03-01T16:50:15.000Z
|
2021-05-24T10:58:34.000Z
|
tests/unit/test_executor.py
|
alex-tsukanov/cargopy
|
f73b68e2ea5263dea5e570756d5fbcc4ef8d7b75
|
[
"MIT"
] | 18
|
2019-03-18T12:59:09.000Z
|
2019-05-14T17:36:02.000Z
|
tests/unit/test_executor.py
|
alex-tsukanov/cargopy
|
f73b68e2ea5263dea5e570756d5fbcc4ef8d7b75
|
[
"MIT"
] | 2
|
2019-03-24T22:43:08.000Z
|
2019-06-04T09:45:12.000Z
|
from typing import Any, Mapping
from unittest.mock import patch
import pytest
from happyly.exceptions import FetchedNoResult
from happyly import Deserializer, Serializer, StopPipeline
from happyly.listening import Executor
from happyly.serialization import DUMMY_SERDE
from tests.unit.test_handler import TestHandler
@patch('test_executor.Executor.on_received')
@patch('test_executor.Executor.on_deserialized')
@patch('test_executor.Executor.on_deserialization_failed')
@patch('test_executor.Executor.on_handled')
@patch('test_executor.Executor.on_handling_failed')
@patch('test_executor.Executor.on_serialized')
@patch('test_executor.Executor.on_serialization_failed')
@patch('test_executor.Executor.on_published')
@patch('test_executor.Executor.on_publishing_failed')
@patch('test_executor.Executor.on_finished')
@patch('test_executor.Executor.on_stopped')
@patch(
'test_executor.TestHandler.__call__', return_value={'result': 42} # type: ignore
)
def test_executor_no_input(
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
):
executor = Executor(handler=TestHandler())
assert executor.deserializer is DUMMY_SERDE
assert executor.serializer is DUMMY_SERDE
assert executor.publisher is None
executor.run()
def assert_callbacks():
on_received.assert_called_with(None)
on_deserialized.assert_called_with(
original_message=None, deserialized_message={}
)
on_deserialization_failed.assert_not_called()
handler.assert_called_with({})
on_handled.assert_called_with(
original_message=None, deserialized_message={}, result={'result': 42}
)
on_handling_failed.assert_not_called()
on_serialized.assert_called_with(
original_message=None,
deserialized_message={},
result={'result': 42},
serialized_message={'result': 42},
)
on_serialization_failed.assert_not_called()
on_published.assert_not_called()
on_publishing_failed.assert_not_called()
on_finished.assert_called_with(original_message=None, error=None)
on_stopped.assert_not_called()
for callback in [
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
]:
callback.reset_mock()
assert_callbacks()
result = executor.run_for_result()
assert_callbacks()
assert result == {'result': 42}
@patch('test_executor.Executor.on_received')
@patch('test_executor.Executor.on_deserialized')
@patch('test_executor.Executor.on_deserialization_failed')
@patch('test_executor.Executor.on_handled')
@patch('test_executor.Executor.on_handling_failed')
@patch('test_executor.Executor.on_serialized')
@patch('test_executor.Executor.on_serialization_failed')
@patch('test_executor.Executor.on_published')
@patch('test_executor.Executor.on_publishing_failed')
@patch('test_executor.Executor.on_finished')
@patch('test_executor.Executor.on_stopped')
@patch(
'test_executor.TestHandler.__call__', return_value={'result': 42} # type: ignore
)
def test_executor_with_input(
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
):
class TestDeser(Deserializer):
def deserialize(self, message: Any) -> Mapping[str, Any]:
return {'spam': 'eggs'}
class TestSer(Serializer):
def serialize(self, message_attributes: Mapping[str, Any]) -> Any:
return {'i am': 'serialized'}
des = TestDeser()
ser = TestSer()
executor = Executor(
handler=TestHandler(), deserializer=des, publisher=None, serializer=ser
)
assert executor.deserializer == des
assert executor.serializer == ser
assert executor.publisher is None
executor.run("original message")
def assert_callbacks():
on_received.assert_called_with("original message")
on_deserialized.assert_called_with(
original_message="original message", deserialized_message={'spam': 'eggs'}
)
on_deserialization_failed.assert_not_called()
handler.assert_called_with({'spam': 'eggs'})
on_handled.assert_called_with(
original_message="original message",
deserialized_message={'spam': 'eggs'},
result={'result': 42},
)
on_handling_failed.assert_not_called()
on_serialized.assert_called_with(
original_message="original message",
deserialized_message={'spam': 'eggs'},
result={'result': 42},
serialized_message={'i am': 'serialized'},
)
on_serialization_failed.assert_not_called()
on_published.assert_not_called()
on_publishing_failed.assert_not_called()
on_finished.assert_called_with(original_message='original message', error=None)
on_stopped.assert_not_called()
for callback in [
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
]:
callback.reset_mock()
assert_callbacks()
result = executor.run_for_result("original message")
assert_callbacks()
assert result == {'i am': 'serialized'}
@patch('test_executor.Executor.on_received')
@patch('test_executor.Executor.on_deserialized')
@patch('test_executor.Executor.on_deserialization_failed')
@patch('test_executor.Executor.on_handled')
@patch('test_executor.Executor.on_handling_failed')
@patch('test_executor.Executor.on_serialized')
@patch('test_executor.Executor.on_serialization_failed')
@patch('test_executor.Executor.on_published')
@patch('test_executor.Executor.on_publishing_failed')
@patch('test_executor.Executor.on_finished')
@patch('test_executor.Executor.on_stopped')
@patch(
'test_executor.TestHandler.__call__', return_value={'result': 42} # type: ignore
)
def test_serialization_failure(
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
):
error = KeyError('123')
class TestDeser(Deserializer):
def deserialize(self, message: Any) -> Mapping[str, Any]:
raise error
def build_error_result(
self, message: Any, error: Exception
) -> Mapping[str, Any]:
return {"SPAM": "EGGS"}
des = TestDeser()
executor = Executor(handler=TestHandler(), deserializer=des, publisher=None)
executor.run("orig")
def assert_callbacks():
on_received.assert_called_with("orig")
on_deserialized.assert_not_called()
on_deserialization_failed.assert_called_with(
original_message="orig", error=error
)
handler.assert_not_called()
on_handled.assert_not_called()
on_handling_failed.assert_not_called()
on_serialized.assert_called_with(
original_message="orig",
deserialized_message=None,
result={'SPAM': 'EGGS'},
serialized_message={'SPAM': 'EGGS'},
)
on_serialization_failed.assert_not_called()
on_published.assert_not_called()
on_publishing_failed.assert_not_called()
on_finished.assert_called_with(original_message="orig", error=None)
on_stopped.assert_not_called()
for callback in [
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
]:
callback.reset_mock()
assert_callbacks()
result = executor.run_for_result("orig")
assert_callbacks()
assert result == {'SPAM': 'EGGS'}
@patch('test_executor.Executor.on_received')
@patch('test_executor.Executor.on_deserialized')
@patch('test_executor.Executor.on_deserialization_failed')
@patch('test_executor.Executor.on_handled')
@patch('test_executor.Executor.on_handling_failed')
@patch('test_executor.Executor.on_serialized')
@patch('test_executor.Executor.on_serialization_failed')
@patch('test_executor.Executor.on_published')
@patch('test_executor.Executor.on_publishing_failed')
@patch('test_executor.Executor.on_finished')
@patch('test_executor.Executor.on_stopped')
@patch(
'test_executor.TestHandler.__call__', return_value={'result': 42} # type: ignore
)
def test_serialization_fallback_failure(
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
):
error = KeyError('123')
class TestDeser(Deserializer):
def deserialize(self, message: Any) -> Mapping[str, Any]:
raise error
des = TestDeser()
executor = Executor(handler=TestHandler(), deserializer=des, publisher=None)
executor.run("orig")
def assert_callbacks():
on_received.assert_called_with("orig")
on_deserialized.assert_not_called()
on_deserialization_failed.assert_called_with(
original_message="orig", error=error
)
handler.assert_not_called()
on_handled.assert_not_called()
on_handling_failed.assert_not_called()
on_serialized.assert_not_called()
on_serialization_failed.assert_not_called()
on_published.assert_not_called()
on_publishing_failed.assert_not_called()
on_finished.assert_called_with(original_message="orig", error=error)
on_stopped.assert_not_called()
for callback in [
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
]:
callback.reset_mock()
assert_callbacks()
with pytest.raises(FetchedNoResult):
executor.run_for_result("orig")
assert_callbacks()
@patch('test_executor.Executor.on_received')
@patch('test_executor.Executor.on_deserialized')
@patch('test_executor.Executor.on_deserialization_failed')
@patch('test_executor.Executor.on_handled')
@patch('test_executor.Executor.on_handling_failed')
@patch('test_executor.Executor.on_serialized')
@patch('test_executor.Executor.on_serialization_failed')
@patch('test_executor.Executor.on_published')
@patch('test_executor.Executor.on_publishing_failed')
@patch('test_executor.Executor.on_finished')
@patch('test_executor.Executor.on_stopped')
@patch('test_executor.TestHandler.__call__', return_value={'error': 42}) # type: ignore
def test_handling_status_err(
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
):
executor = Executor(handler=TestHandler())
executor.run({"orig": 'msg'})
def assert_callbacks():
on_received.assert_called_with({"orig": 'msg'})
on_deserialized.assert_called_with(
original_message={"orig": 'msg'}, deserialized_message={"orig": 'msg'}
)
on_deserialization_failed.assert_not_called()
handler.assert_called_with({'orig': 'msg'})
on_handled.assert_called_with(
original_message={'orig': 'msg'},
deserialized_message={'orig': 'msg'},
result={'error': 42},
)
on_handling_failed.assert_not_called()
on_serialized.assert_called_with(
original_message={'orig': 'msg'},
deserialized_message={'orig': 'msg'},
result={'error': 42},
serialized_message={'error': 42},
)
on_serialization_failed.assert_not_called()
on_published.assert_not_called()
on_publishing_failed.assert_not_called()
on_finished.assert_called_with(original_message={"orig": 'msg'}, error=None)
on_stopped.assert_not_called()
for callback in [
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
]:
callback.reset_mock()
assert_callbacks()
result = executor.run_for_result({"orig": 'msg'})
assert_callbacks()
assert result == {'error': 42}
_ERR = KeyError('123')
@patch('test_executor.Executor.on_received')
@patch('test_executor.Executor.on_deserialized')
@patch('test_executor.Executor.on_deserialization_failed')
@patch('test_executor.Executor.on_handled')
@patch('test_executor.Executor.on_handling_failed')
@patch('test_executor.Executor.on_serialized')
@patch('test_executor.Executor.on_serialization_failed')
@patch('test_executor.Executor.on_published')
@patch('test_executor.Executor.on_publishing_failed')
@patch('test_executor.Executor.on_finished')
@patch('test_executor.Executor.on_stopped')
@patch('test_executor.TestHandler.__call__', side_effect=_ERR) # type: ignore
def test_handling_fallback_fails(
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
):
executor = Executor(handler=TestHandler())
executor.run({"orig": 'msg'})
def assert_callbacks():
on_received.assert_called_with({"orig": 'msg'})
on_deserialized.assert_called_with(
original_message={"orig": 'msg'}, deserialized_message={"orig": 'msg'}
)
on_deserialization_failed.assert_not_called()
handler.assert_called_with({'orig': 'msg'})
on_handled.assert_not_called()
on_handling_failed.assert_called_with(
original_message={'orig': 'msg'},
deserialized_message={'orig': 'msg'},
error=_ERR,
)
on_serialized.assert_not_called()
on_serialization_failed.assert_not_called()
on_published.assert_not_called()
on_publishing_failed.assert_not_called()
on_finished.assert_called_with(original_message={"orig": 'msg'}, error=_ERR)
on_stopped.assert_not_called()
for callback in [
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
]:
callback.reset_mock()
assert_callbacks()
with pytest.raises(FetchedNoResult):
executor.run_for_result({"orig": 'msg'})
assert_callbacks()
_STOP = StopPipeline('reason')
@patch('test_executor.Executor.on_received', side_effect=_STOP)
@patch('test_executor.Executor.on_deserialized')
@patch('test_executor.Executor.on_deserialization_failed')
@patch('test_executor.Executor.on_handled')
@patch('test_executor.Executor.on_handling_failed')
@patch('test_executor.Executor.on_serialized')
@patch('test_executor.Executor.on_serialization_failed')
@patch('test_executor.Executor.on_published')
@patch('test_executor.Executor.on_publishing_failed')
@patch('test_executor.Executor.on_finished')
@patch('test_executor.Executor.on_stopped')
@patch(
'test_executor.TestHandler.__call__', return_value={'result': 42} # type: ignore
)
def test_stop_on_received(
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
):
class TestDeser(Deserializer):
def deserialize(self, message: Any) -> Mapping[str, Any]:
return {'spam': 'eggs'}
class TestSer(Serializer):
def serialize(self, message_attributes: Mapping[str, Any]) -> Any:
return {'i am': 'serialized'}
des = TestDeser()
ser = TestSer()
executor = Executor(
handler=TestHandler(), deserializer=des, publisher=None, serializer=ser
)
assert executor.deserializer == des
assert executor.serializer == ser
assert executor.publisher is None
executor.run("original message")
def assert_callbacks():
on_received.assert_called_with("original message")
on_deserialized.assert_not_called()
on_deserialization_failed.assert_not_called()
handler.assert_not_called()
on_handled.assert_not_called()
on_handling_failed.assert_not_called()
on_serialized.assert_not_called()
on_serialization_failed.assert_not_called()
on_published.assert_not_called()
on_publishing_failed.assert_not_called()
on_finished.assert_not_called()
on_stopped.assert_called_with(
original_message="original message", reason='reason'
)
for callback in [
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
]:
callback.reset_mock()
assert_callbacks()
with pytest.raises(FetchedNoResult):
executor.run_for_result("original message")
assert_callbacks()
@patch('test_executor.Executor.on_received')
@patch('test_executor.Executor.on_deserialized', side_effect=_STOP)
@patch('test_executor.Executor.on_deserialization_failed')
@patch('test_executor.Executor.on_handled')
@patch('test_executor.Executor.on_handling_failed')
@patch('test_executor.Executor.on_serialized')
@patch('test_executor.Executor.on_serialization_failed')
@patch('test_executor.Executor.on_published')
@patch('test_executor.Executor.on_publishing_failed')
@patch('test_executor.Executor.on_finished')
@patch('test_executor.Executor.on_stopped')
@patch(
'test_executor.TestHandler.__call__', return_value={'result': 42} # type: ignore
)
def test_stop_on_deserialized(
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
):
class TestDeser(Deserializer):
def deserialize(self, message: Any) -> Mapping[str, Any]:
return {'spam': 'eggs'}
class TestSer(Serializer):
def serialize(self, message_attributes: Mapping[str, Any]) -> Any:
return {'i am': 'serialized'}
des = TestDeser()
ser = TestSer()
executor = Executor(
handler=TestHandler(), deserializer=des, publisher=None, serializer=ser
)
assert executor.deserializer == des
assert executor.serializer == ser
assert executor.publisher is None
executor.run("original message")
def assert_callbacks():
on_received.assert_called_with("original message")
on_deserialized.assert_called_with(
original_message='original message', deserialized_message={'spam': 'eggs'}
)
on_deserialization_failed.assert_not_called()
handler.assert_not_called()
on_handled.assert_not_called()
on_handling_failed.assert_not_called()
on_serialized.assert_not_called()
on_serialization_failed.assert_not_called()
on_published.assert_not_called()
on_publishing_failed.assert_not_called()
on_finished.assert_not_called()
on_stopped.assert_called_with(
original_message="original message", reason='reason'
)
for callback in [
handler,
on_stopped,
on_finished,
on_publishing_failed,
on_published,
on_serialization_failed,
on_serialized,
on_handling_failed,
on_handled,
on_deserialization_failed,
on_deserialized,
on_received,
]:
callback.reset_mock()
assert_callbacks()
with pytest.raises(FetchedNoResult):
executor.run_for_result("original message")
assert_callbacks()
| 32.568012
| 88
| 0.682119
| 2,362
| 21,788
| 5.895428
| 0.039797
| 0.084452
| 0.117199
| 0.157989
| 0.951885
| 0.94298
| 0.936733
| 0.929408
| 0.91526
| 0.912819
| 0
| 0.002525
| 0.218331
| 21,788
| 668
| 89
| 32.616766
| 0.815102
| 0.004727
| 0
| 0.854098
| 0
| 0
| 0.201605
| 0.167928
| 0
| 0
| 0
| 0
| 0.222951
| 1
| 0.040984
| false
| 0
| 0.013115
| 0.011475
| 0.078689
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
d00682ff1d2118a3648b73a64c639307d8f46c39
| 1,658
|
py
|
Python
|
tests/test_publish_parq_stress.py
|
NaessigJ/s3parq
|
21f6fc9fa9d697515ec103b8afd2ecb8df3407d5
|
[
"MIT"
] | 16
|
2019-07-10T19:36:07.000Z
|
2022-03-31T21:37:23.000Z
|
tests/test_publish_parq_stress.py
|
NaessigJ/s3parq
|
21f6fc9fa9d697515ec103b8afd2ecb8df3407d5
|
[
"MIT"
] | 19
|
2019-03-20T13:57:42.000Z
|
2022-01-31T08:50:01.000Z
|
tests/test_publish_parq_stress.py
|
NaessigJ/s3parq
|
21f6fc9fa9d697515ec103b8afd2ecb8df3407d5
|
[
"MIT"
] | 16
|
2019-03-20T18:28:44.000Z
|
2022-03-30T18:40:28.000Z
|
import boto3
from dfmock import DFMock
from moto import mock_s3
import pytest
import s3parq.publish_parq as pub_parq
@pytest.mark.slow
@mock_s3
def test_parquet_sizes():
""" Running two tests - this needs to work with and without partitions """
bucket = "testbucket"
key = "testdataset"
s3_client = boto3.client('s3')
s3_client.create_bucket(Bucket=bucket)
df = DFMock(count=100000)
df.columns = {"int_col": "int", "str_col": "string",
"grouped_col": {"option_count": 2, "option_type": "string"}}
df.generate_dataframe()
df.grow_dataframe_to_size(500)
pub_parq.publish(
dataframe=df.dataframe, key=key, bucket=bucket, partitions=[])
for obj in s3_client.list_objects(Bucket=bucket)['Contents']:
if obj['Key'].endswith(".parquet"):
assert float(obj['Size']) <= 61 * float(1 << 20)
@pytest.mark.slow
@mock_s3
def test_parquet_sizes_with_partition():
""" Running two tests - this needs to work with and without partitions """
bucket = "testbucket"
key = "testdataset"
s3_client = boto3.client('s3')
s3_client.create_bucket(Bucket=bucket)
df = DFMock(count=100000)
df.columns = {"int_col": "int", "str_col": "string",
"grouped_col": {"option_count": 2, "option_type": "string"}}
df.generate_dataframe()
df.grow_dataframe_to_size(500)
pub_parq.publish(
dataframe=df.dataframe, key=key, bucket=bucket, partitions=['grouped_col'])
for obj in s3_client.list_objects(Bucket=bucket)['Contents']:
if obj['Key'].endswith(".parquet"):
assert float(obj['Size']) <= 61 * float(1 << 20)
| 33.836735
| 83
| 0.659831
| 220
| 1,658
| 4.781818
| 0.304545
| 0.091255
| 0.026616
| 0.034221
| 0.885932
| 0.885932
| 0.885932
| 0.885932
| 0.885932
| 0.811787
| 0
| 0.03386
| 0.198432
| 1,658
| 48
| 84
| 34.541667
| 0.757713
| 0.08082
| 0
| 0.769231
| 0
| 0
| 0.151656
| 0
| 0
| 0
| 0
| 0
| 0.051282
| 1
| 0.051282
| false
| 0
| 0.128205
| 0
| 0.179487
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
d099f4524ae6cb713b3b5f57d3e3c18100e60ebe
| 297
|
py
|
Python
|
data/lib/dimensionalEnv/math/__init__.py
|
Synell/PERT-Maker
|
8eac93eaa788ee0a201437e5bd30d55133d7cd38
|
[
"MIT"
] | null | null | null |
data/lib/dimensionalEnv/math/__init__.py
|
Synell/PERT-Maker
|
8eac93eaa788ee0a201437e5bd30d55133d7cd38
|
[
"MIT"
] | null | null | null |
data/lib/dimensionalEnv/math/__init__.py
|
Synell/PERT-Maker
|
8eac93eaa788ee0a201437e5bd30d55133d7cd38
|
[
"MIT"
] | null | null | null |
#----------------------------------------------------------------------
# Libraries
from .deg2Vector2 import *
from .rad2Vector2 import *
from .rad2Deg import *
from .deg2Rad import *
from .absoluteDeg import *
#----------------------------------------------------------------------
| 29.7
| 72
| 0.356902
| 16
| 297
| 6.625
| 0.5
| 0.377358
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.023166
| 0.127946
| 297
| 9
| 73
| 33
| 0.3861
| 0.505051
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
d0abef814066e79e533d6a1676badb6171e65458
| 127
|
py
|
Python
|
problem/10000~19999/14753/14753.py3.py
|
njw1204/BOJ-AC
|
1de41685725ae4657a7ff94e413febd97a888567
|
[
"MIT"
] | 1
|
2019-04-19T16:37:44.000Z
|
2019-04-19T16:37:44.000Z
|
problem/10000~19999/14753/14753.py3.py
|
njw1204/BOJ-AC
|
1de41685725ae4657a7ff94e413febd97a888567
|
[
"MIT"
] | 1
|
2019-04-20T11:42:44.000Z
|
2019-04-20T11:42:44.000Z
|
problem/10000~19999/14753/14753.py3.py
|
njw1204/BOJ-AC
|
1de41685725ae4657a7ff94e413febd97a888567
|
[
"MIT"
] | 3
|
2019-04-19T16:37:47.000Z
|
2021-10-25T00:45:00.000Z
|
input();x=sorted(map(int,input().split()));print(max(x[-1]*x[-2],x[-1]*x[-2]*x[-3],x[0]*x[1],x[0]*x[-1]*x[-2],x[0]*x[1]*x[-1]))
| 127
| 127
| 0.488189
| 35
| 127
| 1.771429
| 0.342857
| 0.193548
| 0.241935
| 0.193548
| 0.387097
| 0
| 0
| 0
| 0
| 0
| 0
| 0.102362
| 0
| 127
| 1
| 127
| 127
| 0.385827
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| null | 0
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
|
0
| 7
|
d0b183de258b9bc6f4806a74f4510a7e331e7877
| 60,798
|
py
|
Python
|
Feature Comparison/Host_based.py
|
icmpnorequest/URL_Reputation_Classification
|
53f8590f761eb874d46ed9c06648bdd6a7172efe
|
[
"MIT"
] | 6
|
2019-01-09T01:14:28.000Z
|
2021-03-04T05:08:29.000Z
|
Feature Comparison/Host_based.py
|
icmpnorequest/URL_Reputation_Classification
|
53f8590f761eb874d46ed9c06648bdd6a7172efe
|
[
"MIT"
] | null | null | null |
Feature Comparison/Host_based.py
|
icmpnorequest/URL_Reputation_Classification
|
53f8590f761eb874d46ed9c06648bdd6a7172efe
|
[
"MIT"
] | 2
|
2020-04-24T17:07:17.000Z
|
2021-03-04T05:08:32.000Z
|
'''
1. IP address properties — Is the IP address in a blacklist? Are the IPs of the A, MX or NS records in the same autonomous systems (ASes) or prefixes as one another? To what ASes or prefixes do they belong?
2. WHOIS properties—What is the date of registration,update, and expiration ? Who is the registrar? Who is the registrant? Is the WHOIS entry locked?
3. Domain name properties — What is the time-to-live (TTL) value
4. Botnet Feature
4. Geographic properties — In which continent/country/ city does the IP address belong? What is the speed of the uplink connection (broadband, dial-up, etc)?
'''
import dns.resolver
from dns import query
from urllib.parse import urlparse
import whois
import tldextract
import pandas as pd
import numpy as np
import concurrent.futures
from requests import get
from Blacklist import is_in_blacklist
pd.set_option('display.max_columns', 10000)
pd.set_option('display.max_rows', 10000)
pd.set_option('display.max_colwidth', 10000)
pd.set_option('display.width',1000)
np.set_printoptions(threshold=np.inf)
All_Known_TLD = ['com', 'at', 'uk', 'pl', 'be', 'biz', 'co', 'jp', 'co_jp', 'cz', 'de', 'eu', 'fr', 'info', 'it', 'ru', 'lv', 'me', 'name', 'net', 'nz', 'org', 'us']
dataset_path = '../Data/train_dataset.csv'
registrar_path = '../Data/registrar.txt'
Host_based_Feature_path = 'Host_based_FeatureSet.npy'
blacklist_path = '../Data/url_blacklists.txt'
blacklist_featureset_path = 'Blacklist_FeatureSet.npy'
whois_featureset_path = 'Whois_FeatureSet.npy'
botnet_featureset_path = 'Botnet_FeatureSet.npy'
# DNS Ips A, MX, NS
def IP_Records(url):
# 1. Get the domain of url
domain = urlparse(url).netloc
# 2. A record
is_res = 0
is_a = 0
is_mx = 0
is_ns = 0
try:
# A record
a = dns.resolver.query(domain,'A')
if len(a) is not 0:
is_a = 1
else:
is_a = 0
# MX record
mx = dns.resolver.query(domain, 'MX')
if len(mx) is not 0:
is_mx = 1
else:
is_mx = 0
# NS record
ns = dns.resolver.query(domain, 'NS')
if len(ns) is not 0:
is_ns = 1
else:
is_ns = 0
# Is_res
if is_a == 1 and is_mx == 1 and is_ns == 1:
return 1
else:
return 0
except dns.resolver.NoAnswer:
return 0
except dns.resolver.NXDOMAIN:
return 0
except dns.name.EmptyLabel:
return 0
except dns.exception.Timeout:
return 0
# Get DNS record TTL
def get_ttl(url):
domain = urlparse(url).netloc
try:
answer = dns.resolver.query(domain)
return answer.rrset.ttl
except dns.resolver.NoAnswer:
return 0
except dns.resolver.NXDOMAIN:
return 0
except dns.name.EmptyLabel:
return 0
except dns.exception.Timeout:
return 0
if __name__ == '__main__':
## 1. Read the training Dataset file and blacklist
df = pd.read_csv(dataset_path, header=0)
# print(df.head())
# Read the blackurls
blacklist = []
with open(blacklist_path, 'r') as f:
for i in f.readlines():
blacklist.append(i)
## 2. Get the Basic Feature set
url = df['URL']
is_blacklist = []
is_record = []
urls_1000 = (url[:1000]).tolist()
urls_3000 = (url[1000:3000]).tolist()
urls_5000 = (url[3000:5000]).tolist()
urls_7000 = (url[5000:]).tolist()
# Get DNS records
'''
with concurrent.futures.ThreadPoolExecutor(max_workers=16) as pool:
# is_record_1000 = list(pool.map(IP_Records, urls_1000))
# is_record_3000 = list(pool.map(IP_Records, urls_3000))
# is_record_5000 = list(pool.map(IP_Records, urls_5000))
# is_record_7000 = list(pool.map(IP_Records, urls_7000))
ttl_7000 = list(pool.map(get_ttl, urls_7000))
'''
is_record_1000 = [0, 1, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 0, 0, 1, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 1, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 0, 0, 1, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 1, 1, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 1, 1, 1, 1, 0, 0, 0, 0, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 0, 0, 0, 1, 1, 1, 0, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 1, 1, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 1, 1, 1, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0]
is_record_3000 = [1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 1, 1, 1, 0, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 1, 1, 0, 1, 0, 1, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 1, 1, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 1, 1, 1, 1, 0, 1, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 1, 1, 1, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 1, 1, 0, 1, 0, 0, 1, 0, 1, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 1, 1, 1, 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 1, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 1, 1, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 1, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 1, 1, 1, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 1, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 1, 0, 1, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 1, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 1, 1, 1, 0, 0, 1, 1, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 0, 1, 1, 0, 1, 0, 0, 1, 1, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0]
is_record_5000 = [1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 1, 1, 0, 1, 1, 1, 0, 0, 0, 1, 0, 1, 1, 0, 0, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 1, 0, 0, 1, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 1, 0, 1, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 1, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 1, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 1, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0, 1, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 1, 1, 0, 0, 1, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 1, 0, 1, 1, 0, 0, 1, 1, 0, 0, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 1, 0, 1, 0, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 1, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 1, 1, 1, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 1, 1, 1, 0, 1, 1, 0, 0, 1, 0, 1, 1, 1, 1, 0, 0, 1, 0, 1, 1, 1, 1, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 0, 0, 1, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 1, 0, 1, 1, 0, 1, 1, 0, 1, 1, 0, 1, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 0, 1, 0, 0, 1, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 1, 1, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0]
is_record_7000 = [0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 1, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 1, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 1, 1, 1, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 1, 1, 0, 1, 1, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 1, 1, 0, 1, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 1, 1, 0, 1, 1, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 1, 1, 1, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 1, 0, 1, 1, 0, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 1, 1, 1, 1, 0, 1, 1, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 1, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 1, 0, 1, 1, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 0, 0, 1, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 0, 0, 1, 0, 1, 1, 0, 0, 1, 1, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 1, 0, 1, 1, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 1, 0, 0, 0, 0, 1, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 1, 0, 1, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 0, 1, 1, 1, 0, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 1, 1, 1, 1, 0, 0, 1, 0, 1, 0, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 1, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 1, 0, 1, 1, 1, 0, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 0, 1, 0, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 1, 1, 0, 1, 0, 1, 0, 1, 1, 0, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 1, 0, 0, 1, 1, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 0, 0, 1, 1, 1, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 0, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 0, 1, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 1, 1]
is_record = is_record_1000 + is_record_3000 + is_record_5000 + is_record_7000
##### DNS records TTL
ttl_1000 = [0, 286, 0, 3108, 0, 0, 3110, 3112, 6886, 3115, 299, 3117, 0, 300, 3122, 586, 0, 3286, 75123, 10486, 300, 300, 0, 355, 3129, 0, 3130, 3354, 0, 655, 0, 60, 3131, 3355, 355, 0, 3133, 0, 3355, 3599, 0, 0, 7200, 300, 1800, 474, 0, 3139, 3140, 3141, 3599, 3600, 0, 3600, 3144, 3599, 0, 3599, 0, 3599, 300, 599, 3154, 3600, 1799, 3158, 10793, 0, 7200, 300, 0, 3197, 99, 0, 3198, 7200, 1800, 0, 10401, 0, 3203, 0, 59, 899, 0, 3284, 3600, 254, 0, 3599, 299, 298, 300, 59, 600, 0, 3300, 600, 300, 0, 3303, 3303, 3600, 600, 16, 3599, 1800, 300, 3308, 75309, 7199, 3311, 900, 0, 30, 3312, 3600, 20, 0, 3600, 28939, 3319, 600, 20, 30, 0, 650, 1800, 4249, 3599, 0, 900, 300, 4249, 76249, 4249, 294, 0, 494, 600, 4250, 3600, 76247, 10, 600, 105, 3600, 900, 11448, 4248, 599, 0, 299, 4249, 0, 7200, 0, 600, 28683, 600, 76247, 4248, 300, 455, 3600, 11446, 76246, 4246, 600, 20, 0, 4246, 3599, 0, 76247, 0, 4246, 0, 3600, 4245, 600, 600, 0, 486, 600, 4244, 76244, 0, 3600, 1800, 0, 0, 1800, 299, 1799, 4243, 448, 600, 0, 1199, 0, 4243, 7200, 1799, 3600, 0, 300, 1799, 1799, 300, 11445, 4242, 33042, 3599, 4250, 3598, 30, 0, 218, 0, 4240, 4240, 299, 3600, 0, 3600, 0, 3600, 0, 0, 300, 4239, 1239, 0, 76238, 0, 0, 4238, 4238, 0, 0, 76237, 7200, 3600, 0, 0, 60, 20, 0, 7200, 11437, 4237, 3560, 7199, 0, 0, 3600, 0, 0, 4236, 0, 0, 0, 11437, 4235, 300, 60, 0, 3600, 300, 4235, 0, 0, 0, 0, 589, 0, 426, 3599, 120, 4238, 20, 0, 3599, 1800, 0, 300, 20, 4235, 300, 0, 900, 421, 59, 4236, 76236, 1800, 4235, 0, 1799, 0, 3600, 3600, 300, 76235, 4235, 3505, 599, 4235, 3600, 3599, 58, 0, 0, 76657, 414, 60, 0, 60, 0, 4656, 600, 4657, 300, 300, 300, 300, 0, 4655, 76655, 4656, 3600, 19055, 900, 851, 59, 600, 4655, 4655, 3599, 4654, 0, 3600, 4206, 0, 6313, 187, 600, 0, 600, 0, 76655, 76654, 4654, 4654, 406, 76655, 300, 4655, 58, 1054, 76654, 0, 1799, 4653, 0, 0, 4654, 3600, 33454, 4654, 600, 0, 0, 76654, 600, 3599, 0, 190, 300, 0, 0, 0, 1800, 0, 300, 19052, 1049, 0, 4653, 300, 3599, 0, 20, 4653, 20, 4652, 1052, 1054, 3600, 0, 3600, 0, 900, 60, 600, 594, 3600, 0, 3600, 0, 4653, 14400, 19, 600, 76652, 4652, 0, 0, 4653, 299, 76652, 8508, 4652, 1052, 9, 1800, 0, 0, 428, 1610, 0, 0, 20, 4652, 0, 600, 0, 4651, 4658, 3599, 299, 4651, 60, 3600, 3587, 3529, 4652, 0, 600, 1, 0, 27, 0, 3600, 1, 1050, 76650, 4650, 0, 1050, 0, 0, 7200, 386, 1800, 145, 299, 3599, 0, 3600, 0, 300, 0, 298, 3599, 76648, 1047, 0, 3600, 1047, 59, 1800, 76647, 300, 0, 5533, 7200, 600, 35, 76647, 3600, 0, 4646, 3600, 1046, 299, 3599, 1199, 0, 0, 0, 1799, 600, 15, 3599, 11845, 3600, 4645, 60, 4644, 0, 4647, 4644, 0, 10, 600, 0, 4622, 600, 4643, 0, 1800, 299, 0, 4644, 600, 0, 3224, 3590, 130, 0, 600, 600, 900, 600, 0, 298, 28642, 28640, 20, 3600, 300, 4640, 4640, 3524, 3600, 76640, 0, 0, 28, 0, 0, 28846, 299, 59, 0, 0, 1200, 3599, 0, 19039, 1038, 3600, 3600, 3600, 3600, 3031, 1799, 0, 3600, 4637, 0, 299, 0, 0, 1, 0, 4636, 300, 0, 4637, 5514, 4636, 2970, 3599, 4635, 76635, 0, 59, 0, 0, 600, 0, 3499, 30, 4635, 0, 7200, 4635, 600, 3600, 0, 3600, 0, 0, 3600, 0, 300, 0, 0, 1033, 0, 3599, 26, 4632, 189, 3599, 76631, 76631, 4631, 489, 3600, 0, 0, 19031, 1800, 298, 76632, 4632, 600, 60, 3600, 300, 300, 4633, 600, 3538, 14400, 4633, 1033, 4633, 0, 180, 3600, 0, 76633, 0, 86400, 3599, 0, 3599, 299, 3599, 3599, 482, 59, 3600, 262, 3191, 300, 300, 60, 48, 0, 4634, 3600, 0, 4635, 3600, 4635, 3600, 4147, 1800, 0, 900, 119, 76636, 0, 300, 3600, 599, 600, 300, 0, 11836, 76637, 0, 0, 0, 1037, 0, 4637, 300, 76637, 592, 0, 3600, 480, 0, 600, 4638, 600, 261, 60, 0, 76639, 76639, 3600, 0, 900, 3508, 599, 4640, 0, 300, 202, 0, 352, 3599, 76640, 300, 4639, 0, 4640, 76638, 1040, 300, 600, 300, 1800, 4640, 300, 20, 0, 76641, 4641, 0, 0, 4643, 4642, 4642, 76642, 4642, 0, 4642, 4642, 4642, 0, 0, 4645, 222, 10800, 0, 1569, 3599, 0, 0, 299, 7199, 0, 76643, 4611, 4643, 1045, 1800, 600, 0, 4643, 0, 0, 4644, 3600, 60, 5723, 0, 300, 4644, 20, 4645, 3599, 0, 3599, 4645, 180, 3595, 3600, 76646, 1, 0, 1046, 0, 30, 4646, 1800, 300, 1800, 0, 300, 0, 599, 299, 3, 29, 76648, 1799, 4, 600, 4648, 0, 300, 18, 20, 0, 4651, 3600, 76649, 76637, 0, 0, 11849, 300, 899, 2, 76650, 3599, 4651, 1799, 3600, 17, 4651, 76651, 7200, 300, 4652, 0, 360, 3600, 60, 600, 3599, 996, 300, 3599, 1180, 7200, 76654, 600, 4629, 0, 3599, 899, 299, 3599, 0, 7200, 33453, 0, 299, 299, 4654, 900, 0, 0, 1199, 52, 381, 3599, 7200, 0, 345, 0, 0, 3600, 0, 0, 358, 4655, 3600, 300, 599, 2702, 7199, 0, 0, 0, 344, 0, 0, 0, 6399, 76656, 3600, 7200, 76656, 4656, 344, 3599, 76657, 4656, 0, 3600, 0, 0, 4622, 231, 20, 4656, 4656, 29263, 76657, 0, 0, 4659, 3600, 1059, 599, 0, 0, 600, 0, 899, 6619, 1060, 299, 0, 3600, 76659, 3600, 4659, 0, 44, 4659, 4659, 290, 4660, 7199, 4658, 3600, 300, 0, 0, 0, 2983, 4660, 76660, 4660, 3600, 257, 300, 5713, 1061, 58, 299, 3600, 0, 0, 19, 0, 0, 4660, 262, 145, 290, 0, 7200, 599, 3599, 0, 4660, 6400, 10, 0, 1061, 0, 76661, 59, 4661, 600, 4662, 26, 4662, 4584, 76662, 3600, 0, 0, 0, 3599, 76666, 300, 4663, 3588, 1799, 3146, 1800, 1799, 3599, 19063, 0]
ttl_3000 = [899, 0, 599, 19, 0, 4455, 76624, 1799, 299, 4624, 4624, 4624, 0, 4622, 59, 3599, 600, 7200, 0, 0, 3600, 76623, 60, 4623, 0, 1024, 600, 76624, 300, 76624, 0, 0, 59, 5578, 7200, 0, 0, 0, 4624, 7200, 4624, 4624, 7200, 171, 0, 7200, 20, 300, 1199, 0, 4625, 0, 0, 0, 300, 3600, 0, 300, 298, 0, 20, 0, 3599, 11826, 0, 0, 19026, 7199, 7199, 0, 0, 600, 11825, 0, 1200, 76626, 0, 1026, 60, 299, 30, 0, 204, 0, 299, 0, 300, 0, 1027, 1800, 4627, 600, 0, 0, 0, 0, 0, 4628, 1199, 76627, 0, 0, 4628, 3600, 76627, 0, 0, 4629, 0, 76482, 3041, 299, 3600, 86400, 3599, 299, 600, 0, 0, 300, 18128, 153, 33431, 3600, 19031, 0, 152, 4632, 4632, 4631, 0, 900, 0, 300, 4632, 0, 300, 3600, 20, 4633, 1366, 4633, 0, 346, 2873, 1800, 7200, 4632, 76634, 0, 4634, 12, 299, 0, 3409, 3600, 0, 3339, 3600, 3600, 60, 600, 1200, 0, 33433, 7200, 0, 59, 599, 300, 20, 4636, 76635, 600, 599, 3599, 3599, 0, 300, 4635, 0, 0, 0, 300, 3599, 30, 59, 4636, 750, 0, 60, 76637, 300, 4637, 76636, 1800, 900, 4637, 0, 600, 4637, 0, 600, 0, 3599, 4638, 60, 0, 0, 0, 60, 3600, 4637, 0, 4637, 0, 0, 3599, 4636, 76638, 600, 76638, 300, 0, 76640, 3598, 53, 600, 4639, 0, 59, 59, 1017, 0, 0, 3600, 200, 3600, 76640, 60, 0, 4452, 3600, 1041, 3599, 300, 4643, 11842, 300, 0, 5, 58, 0, 0, 0, 3984, 300, 0, 76642, 7138, 192, 0, 600, 1042, 192, 186, 3600, 300, 0, 360, 600, 0, 4642, 281, 59, 0, 3599, 3600, 4642, 4642, 3, 0, 444, 3600, 0, 59, 3600, 600, 0, 600, 299, 600, 4642, 600, 7199, 4642, 0, 4642, 4612, 4642, 3447, 0, 3600, 299, 0, 0, 4443, 3599, 76643, 3600, 223, 4647, 188, 0, 4442, 0, 0, 0, 0, 3599, 76643, 599, 3600, 0, 5270, 0, 138, 3599, 4642, 0, 0, 600, 60, 600, 3600, 4644, 3600, 300, 899, 0, 59, 600, 0, 7199, 0, 0, 4638, 3600, 4638, 846, 840, 3600, 60, 3427, 67067, 436, 0, 4640, 7199, 0, 215, 3600, 6456, 1040, 3599, 0, 20, 76635, 0, 68, 4642, 0, 179, 4641, 300, 373, 76640, 3600, 4640, 3600, 7200, 600, 299, 7200, 300, 4642, 4645, 11841, 300, 1041, 0, 299, 128, 0, 12, 4641, 76641, 4600, 58, 600, 0, 33441, 76418, 76641, 76347, 0, 3970, 0, 3598, 176, 0, 0, 0, 3600, 600, 76641, 192, 25, 76641, 30, 7200, 0, 4643, 76642, 0, 3599, 4643, 1799, 299, 4642, 897, 600, 4643, 300, 4427, 282, 76643, 7200, 1799, 1047, 0, 3599, 4644, 0, 4642, 3600, 11845, 4645, 173, 599, 4645, 0, 0, 20, 300, 60, 19, 341, 10000, 4647, 0, 19048, 76648, 59, 4649, 76649, 4649, 1800, 4649, 4424, 3600, 4650, 3599, 30, 4650, 0, 599, 299, 300, 0, 4650, 600, 600, 600, 4651, 4651, 0, 0, 4652, 0, 120, 3599, 1052, 4653, 0, 4653, 1799, 4653, 4657, 0, 1800, 4653, 0, 600, 37, 3600, 600, 76654, 0, 4453, 170, 612, 3599, 0, 4655, 0, 0, 3600, 0, 50, 4656, 19056, 299, 0, 0, 76655, 0, 7200, 0, 3600, 3569, 0, 116, 300, 4656, 0, 300, 0, 14389, 3600, 20, 3, 3961, 299, 0, 600, 1057, 4657, 599, 7200, 5541, 2840, 76658, 0, 0, 208, 4659, 0, 0, 600, 1800, 0, 3966, 180, 1795, 4459, 76661, 76481, 4661, 0, 1800, 598, 0, 0, 33463, 300, 0, 0, 4663, 4430, 4663, 3600, 4664, 0, 4665, 3599, 11320, 4597, 59, 53, 900, 300, 4668, 3600, 3600, 4617, 20, 0, 166, 0, 599, 76670, 85717, 299, 413, 7200, 0, 300, 4671, 0, 300, 1800, 4671, 0, 19071, 76672, 3599, 19072, 300, 20, 60, 0, 0, 0, 0, 0, 0, 76672, 300, 0, 900, 3600, 86399, 14, 0, 0, 0, 1800, 3599, 4673, 599, 0, 300, 0, 3600, 4672, 86400, 7200, 0, 0, 4454, 33470, 3418, 0, 0, 0, 114, 600, 0, 4673, 4675, 1073, 3600, 4673, 4673, 4673, 3600, 3599, 0, 600, 4674, 599, 58, 0, 900, 0, 0, 600, 4673, 3600, 3377, 4641, 48, 300, 4674, 299, 4675, 14400, 4595, 900, 3599, 360, 3599, 0, 0, 3600, 299, 300, 0, 0, 1786, 0, 4675, 0, 0, 4675, 0, 0, 298, 158, 4675, 20, 600, 4675, 3600, 3599, 0, 0, 1800, 76676, 1012, 0, 4676, 20, 193, 29, 300, 360, 1076, 900, 76677, 3599, 59, 0, 0, 0, 0, 4676, 3600, 0, 76676, 285, 4677, 0, 1483, 599, 3599, 2903, 0, 1007, 4677, 59, 1800, 3600, 4677, 300, 47, 33477, 21600, 3600, 3599, 4678, 157, 0, 299, 7199, 599, 4679, 7200, 226, 35, 4662, 3600, 0, 4678, 0, 300, 900, 19, 76678, 4678, 300, 4678, 60, 0, 4679, 76679, 0, 4469, 600, 300, 0, 0, 1080, 600, 0, 14400, 193, 0, 600, 76680, 59, 3600, 0, 0, 4681, 19, 592, 300, 1080, 76681, 0, 0, 0, 3600, 900, 900, 0, 300, 395, 76681, 4681, 4681, 0, 3598, 0, 20, 0, 19082, 0, 1798, 0, 300, 4680, 0, 300, 277, 3951, 0, 7200, 4681, 19081, 900, 300, 4686, 0, 3600, 0, 600, 76683, 4683, 4672, 3599, 30, 0, 3599, 4571, 152, 1799, 0, 143, 3600, 0, 3600, 76409, 7199, 76684, 3599, 599, 3599, 1498, 0, 599, 0, 600, 3600, 3393, 3600, 60, 600, 0, 0, 900, 0, 281, 0, 2959, 4684, 0, 0, 19, 0, 3600, 7200, 0, 300, 600, 0, 185, 3600, 0, 0, 0, 300, 19, 3600, 3599, 0, 76685, 300, 0, 0, 600, 1, 0, 3600, 0, 600, 7199, 1084, 3599, 600, 4, 3600, 299, 4685, 300, 30, 0, 0, 0, 0, 1800, 14400, 299, 14400, 0, 0, 0, 0, 14400, 4684, 96, 4684, 4684, 0, 0, 4685, 120, 4684, 76685, 0, 3600, 600, 0, 0, 0, 285, 3600, 4685, 0, 75943, 899, 0, 4685, 300, 4685, 29, 2992, 4687, 4687, 1088, 0, 586, 0, 0, 3599, 389, 3935, 3383, 58, 300, 0, 4688, 299, 1089, 0, 4689, 3800, 4689, 4409, 0, 300, 0, 58, 3599, 0, 1090, 0, 0, 0, 4419, 3600, 4433, 3600, 0, 0, 59, 0, 789, 10072, 299, 0, 0, 3599, 0, 76397, 90, 30, 4692, 4692, 4693, 3600, 0, 0, 241, 11397, 0, 4694, 833, 600, 298, 28692, 3599, 3599, 138, 600, 300, 31, 0, 1800, 0, 0, 0, 89, 0, 24, 7199, 7200, 4694, 300, 300, 299, 0, 7199, 4694, 300, 600, 0, 0, 119, 3929, 87, 4695, 70, 0, 4695, 0, 4696, 3599, 19097, 3599, 7199, 19, 0, 0, 0, 0, 3261, 76698, 600, 299, 3600, 59, 0, 76698, 2943, 600, 33498, 4699, 600, 0, 60, 0, 3599, 2985, 1799, 0, 4701, 0, 1800, 600, 0, 0, 0, 20, 599, 79, 4700, 0, 4699, 0, 0, 7177, 3595, 4699, 60, 23, 3599, 3599, 3600, 300, 76700, 4700, 1100, 600, 4700, 0, 4700, 600, 9, 300, 30, 3599, 4703, 171, 300, 0, 1800, 1100, 0, 0, 0, 0, 3599, 0, 4700, 11224, 60, 4700, 4700, 300, 3600, 3600, 4699, 3599, 30, 4698, 0, 4698, 4698, 599, 300, 300, 3600, 0, 594, 76698, 0, 143, 299, 14390, 0, 0, 4697, 300, 3600, 0, 59, 0, 4697, 0, 300, 3600, 300, 76698, 0, 4698, 1799, 0, 0, 7200, 300, 299, 4697, 243, 0, 4698, 0, 4698, 60, 599, 0, 299, 3380, 300, 0, 60, 21590, 170, 59, 600, 119, 0, 0, 4642, 4698, 59, 11901, 7200, 63, 3373, 0, 300, 4698, 300, 0, 600, 59, 4699, 298, 3599, 3599, 1100, 0, 4699, 1099, 0, 0, 4699, 4586, 2789, 0, 59, 4700, 0, 299, 19100, 1100, 13, 3599, 4602, 0, 0, 4701, 0, 0, 4370, 0, 286, 299, 3600, 0, 0, 4701, 76701, 0, 56, 0, 76702, 0, 4702, 0, 235, 600, 3600, 0, 2844, 3599, 7200, 0, 3600, 0, 0, 0, 300, 1200, 0, 3599, 0, 4704, 1105, 0, 0, 0, 3599, 3600, 65, 3600, 300, 1, 4707, 300, 4706, 300, 0, 19, 0, 3510, 3600, 4706, 3600, 3600, 3600, 0, 4707, 0, 600, 0, 3315, 22, 0, 299, 4707, 60, 0, 3600, 0, 4707, 4708, 76708, 1200, 600, 0, 0, 4712, 0, 3599, 5485, 0, 4360, 3598, 3372, 0, 3599, 0, 0, 15, 0, 2062, 0, 111, 900, 33510, 3600, 0, 1110, 3600, 111, 0, 0, 4589, 76710, 4710, 0, 3508, 0, 3600, 3599, 4709, 4711, 0, 759, 4711, 20, 33511, 4711, 4711, 4711, 269, 899, 117, 0, 3599, 599, 1800, 0, 120, 1111, 76711, 59, 30, 59, 1800, 0, 76712, 4712, 3600, 4712, 0, 300, 0, 4712, 4713, 600, 4713, 0, 99, 4714, 0, 3600, 11914, 299, 4715, 217, 4715, 59, 1799, 0, 0, 0, 864, 900, 0, 60, 3600, 0, 0, 4721, 3599, 0, 4713, 3600, 52, 0, 4715, 58, 1800, 300, 299, 900, 7200, 76562, 599, 4716, 3599, 4716, 0, 0, 15, 1800, 755, 0, 4716, 120, 4716, 4716, 3503, 4717, 4369, 4717, 106, 5479, 0, 60, 4719, 0, 1200, 4718, 0, 3599, 900, 3600, 76719, 0, 600, 7200, 300, 0, 19119, 4719, 0, 299, 0, 899, 0, 59, 76719, 1119, 3600, 3600, 3600, 4720, 3599, 298, 3600, 76721, 1799, 56, 899, 0, 33521, 7200, 4348, 76723, 4723, 600, 3600, 599, 0, 4723, 4722, 172, 0, 11923, 0, 300, 280, 1799, 4727, 0, 3599, 299, 300, 3599, 299, 3599, 4726, 4597, 600, 3598, 4724, 0, 0, 3600, 14335, 0, 351, 0, 150, 300, 14400, 5254, 0, 4726, 0, 900, 21, 12, 899, 900, 0, 4728, 3599, 3598, 76728, 4728, 0, 300, 76728, 0, 600, 600, 4729, 7200, 4731, 60, 0, 4702, 299, 137, 599, 1799, 4730, 20, 3600, 0, 4731, 4346, 87, 1792, 0, 0, 0, 5251, 4733, 7199, 1200, 33532, 4732, 58, 76733, 0, 3599, 0, 4732, 0, 3600, 1800, 0, 3600, 0, 3599, 2456, 4734, 530, 59, 7199, 3599, 0, 1134, 300, 0, 180, 300, 0, 299, 300, 0, 0, 4360, 0, 4734, 0, 11935, 76733, 600, 0, 20, 0, 3599, 4563, 300, 4733, 17, 299, 4605, 0, 600, 3600, 0, 4734, 0, 0, 3600, 0, 600, 297, 4735, 1135, 3599, 480, 4737, 4735, 4741, 4735, 100, 0, 33, 743, 3599, 1200, 76736, 0, 0, 1136, 4397, 3599, 350, 0, 3600, 7136, 0, 3020, 300, 3600, 3600, 1800, 300, 599, 0, 0, 600, 11938, 76738, 0, 0, 1719, 299, 900, 3600, 0, 600, 0, 76739, 3600, 0, 76739, 76739, 3600, 0, 1199, 0, 0, 1141, 4576, 0, 4742, 0, 59, 4741, 11941, 34, 4742, 4742, 58, 299, 0, 600, 4742, 300, 76743, 4743, 229, 60, 3600, 4744, 3600, 29, 586, 34, 4614, 4743, 0, 899, 3600, 19, 0, 599, 600, 300, 1, 76744, 38, 27, 0, 300, 0, 4745, 3226, 4596, 3599, 76745, 29, 0, 4744, 0, 33544, 19144, 3600, 300, 0, 600, 4745, 86, 149, 0, 0, 300, 0, 3600, 734, 0, 4743, 34, 102, 0, 76744, 4744, 0, 0, 300, 0, 3600, 4746, 1146, 3599, 3208, 1066, 1800, 0, 3599, 299, 299, 82, 1800, 73472, 3600, 0, 0, 0, 598, 0, 0, 1023, 600, 0, 76745, 600, 3581, 3600, 7200, 0, 300, 76746, 4746, 30, 33547, 1000, 0, 299, 0, 50, 4748, 0, 29, 4746, 0, 0, 4749, 0, 0, 4754, 3321, 4747, 3495, 900, 4748, 0, 3600, 4748, 3599, 0, 300, 0, 4531, 599, 4395, 600, 1473, 4749, 4749, 0, 654, 4332, 300, 4746, 3600, 77, 17824, 4749, 4507, 0, 300, 0, 599, 599, 3599, 0, 3600, 0, 3600, 0, 0, 0, 59, 0, 36, 291, 1150, 600, 0, 0, 4671, 76764, 4318, 0, 600, 4752, 4750, 3600, 0, 26, 4751, 3292, 4716, 0, 0, 832, 600, 60, 4752, 0, 4670, 86399, 4751, 0, 4753, 1800, 3600, 0, 599, 723, 300, 329, 599, 0, 1800, 5446, 225, 4753, 4753, 299, 20, 3599, 900, 0, 599, 216, 0, 300, 0, 29, 33553, 0, 3600, 4753, 3600, 178, 72, 11953, 300, 0, 3599, 66958, 0, 7199, 76753, 4752, 7017, 300, 0, 1800, 4501, 7200, 3600, 4754, 0, 3529, 600, 598, 3599, 600, 76755, 3598, 0, 4755, 36, 11, 7199, 299, 7200, 37, 3600, 4755, 20, 600, 3599, 76755, 600, 33555, 4755, 4721, 0, 4331, 30, 600, 60, 3600, 3600, 0, 4755, 0, 0, 69, 20, 19, 3600, 3599, 76756]
ttl_5000 = [4577, 20, 3600, 0, 14400, 4851, 150, 3386, 0, 0, 76851, 3600, 299, 20, 0, 4851, 4589, 832, 4851, 1799, 3599, 900, 127, 600, 0, 0, 3600, 46, 0, 600, 76852, 3600, 76852, 4653, 2790, 4852, 3600, 600, 0, 0, 4853, 0, 28799, 20, 57, 3600, 0, 178, 599, 4853, 600, 0, 4856, 630, 4852, 300, 3600, 4853, 3600, 0, 126, 0, 300, 0, 3600, 110, 1, 76853, 1253, 299, 0, 1799, 0, 3600, 4853, 20, 60, 300, 360, 900, 3600, 0, 0, 0, 55, 3600, 3235, 3599, 33447, 0, 599, 300, 0, 14399, 600, 3599, 19, 599, 0, 0, 2390, 0, 0, 0, 76854, 76854, 0, 0, 86399, 0, 4854, 0, 76268, 4233, 1800, 0, 4301, 1800, 4855, 128, 0, 1256, 600, 4864, 20, 3600, 852, 3509, 0, 300, 3600, 3196, 60, 2651, 0, 160, 0, 1798, 4855, 299, 599, 0, 60, 4408, 4857, 76857, 0, 0, 160, 300, 5351, 0, 76858, 0, 1258, 4858, 3117, 402, 1797, 3776, 33659, 0, 0, 4859, 3599, 208, 4260, 899, 299, 300, 600, 4859, 300, 0, 1800, 60, 33660, 1796, 33660, 900, 3600, 298, 3599, 0, 76861, 76861, 59, 4861, 600, 4862, 0, 3599, 3599, 0, 3600, 7200, 1, 4395, 7200, 4862, 4862, 7200, 33662, 121, 0, 300, 3600, 30, 4863, 4863, 76863, 4238, 300, 0, 1, 0, 76864, 4864, 599, 7199, 4864, 1794, 300, 0, 0, 1800, 14400, 600, 732, 3599, 0, 3599, 3599, 1793, 3599, 7200, 76865, 300, 59, 7018, 4866, 300, 4866, 0, 4866, 0, 59, 4866, 300, 0, 10, 0, 599, 0, 3600, 4577, 4868, 0, 1, 600, 14205, 0, 0, 259, 600, 5346, 1792, 4227, 4850, 4544, 0, 3599, 0, 3598, 0, 0, 0, 60, 0, 0, 4872, 0, 300, 4873, 0, 0, 0, 86400, 0, 600, 7200, 0, 300, 58, 3599, 45, 600, 0, 76437, 299, 1800, 4874, 1032, 17, 20, 12075, 4875, 299, 76878, 0, 76875, 0, 0, 4854, 1787, 0, 4876, 4876, 44, 0, 299, 0, 0, 0, 4876, 0, 600, 0, 7199, 600, 600, 300, 0, 3169, 0, 0, 4, 900, 15, 4877, 217, 0, 3599, 0, 0, 0, 4876, 20, 4532, 0, 299, 0, 0, 0, 76876, 28877, 4878, 0, 3599, 76878, 0, 0, 600, 900, 0, 0, 3600, 3218, 76878, 4568, 0, 3600, 76879, 4208, 0, 1784, 76479, 4885, 4213, 4879, 58, 599, 3599, 3600, 1427, 3600, 300, 658, 4883, 300, 4879, 7199, 289, 0, 707, 33430, 20, 0, 7200, 4276, 0, 1799, 60, 0, 60, 3600, 33272, 600, 412, 599, 0, 1800, 19, 0, 201, 33679, 4878, 1800, 76878, 49, 76878, 20, 3600, 20, 0, 0, 0, 19, 4203, 60, 0, 900, 1800, 400, 0, 0, 3114, 285, 3600, 0, 3600, 0, 4476, 300, 299, 0, 1799, 0, 4880, 300, 60, 0, 4880, 0, 0, 0, 4881, 3599, 0, 0, 7199, 0, 600, 899, 300, 1278, 0, 3487, 3600, 17701, 4554, 0, 4416, 4877, 3600, 4877, 599, 0, 0, 0, 0, 76876, 600, 6994, 600, 0, 277, 4877, 276, 0, 4877, 299, 0, 0, 0, 600, 3742, 300, 76369, 7200, 0, 300, 0, 0, 3741, 599, 0, 4878, 3586, 4878, 0, 0, 3600, 300, 30, 0, 4878, 0, 4878, 300, 72, 899, 0, 3599, 76879, 0, 3600, 7200, 75079, 60, 58, 0, 20, 19279, 600, 0, 0, 0, 1767, 1800, 4880, 1800, 3599, 76880, 300, 0, 299, 91, 4880, 0, 3600, 0, 57, 4880, 1199, 3600, 609, 3348, 599, 64, 4880, 0, 300, 60, 59, 300, 0, 0, 0, 4882, 4882, 3599, 76883, 3453, 3599, 3599, 76509, 3203, 0, 0, 4883, 0, 0, 4825, 299, 300, 59, 0, 4885, 0, 4886, 3394, 1799, 19287, 3599, 20, 4886, 1763, 3345, 76887, 60, 20, 60, 3600, 0, 600, 299, 59, 0, 0, 0, 27, 60, 4888, 12092, 4888, 4422, 3189, 20, 0, 0, 3600, 3599, 59, 0, 0, 0, 3598, 59, 76890, 3600, 3600, 600, 14400, 0, 20, 4891, 1760, 14400, 76892, 3599, 600, 0, 900, 0, 600, 0, 1200, 76892, 0, 3371, 60, 59, 0, 0, 0, 4893, 593, 76607, 86400, 299, 4893, 0, 1800, 292, 0, 76893, 3171, 4895, 20, 0, 76893, 3142, 3599, 76891, 3600, 81, 0, 4893, 1800, 772, 5, 4894, 1797, 3600, 60, 3598, 0, 0, 811, 4894, 3598, 0, 0, 1800, 0, 900, 0, 60, 300, 4893, 599, 4893, 809, 4, 19, 0, 4245, 900, 76894, 3600, 300, 122, 76894, 4894, 1800, 3600, 299, 0, 76895, 29, 76895, 455, 4895, 1753, 900, 599, 599, 120, 0, 148, 0, 0, 300, 0, 0, 0, 1260, 76895, 1, 3600, 3600, 76895, 4895, 0, 104, 7199, 0, 20, 76898, 4896, 1213, 0, 76896, 3600, 4894, 4896, 76897, 3600, 33697, 0, 4897, 600, 2700, 76897, 76898, 0, 300, 32982, 60, 0, 3149, 76425, 60, 0, 0, 300, 1608, 60, 0, 76896, 76897, 76897, 35934, 4897, 3600, 4897, 277, 0, 971, 30, 3599, 0, 0, 0, 3431, 0, 0, 4897, 0, 0, 20, 379, 4897, 4533, 0, 7200, 7200, 299, 3600, 3600, 76897, 4442, 4897, 3600, 0, 3600, 233, 120, 3601, 7022, 0, 169, 0, 1746, 105, 3598, 0, 600, 900, 169, 1798, 299, 299, 0, 0, 300, 0, 3600, 0, 4898, 3376, 4181, 300, 76880, 253, 1298, 1389, 1298, 0, 1800, 0, 0, 1800, 0, 0, 3428, 149, 3600, 0, 300, 600, 4899, 1299, 4900, 3599, 0, 0, 600, 620, 217, 179, 0, 0, 4900, 60, 300, 900, 4900, 4900, 0, 3600, 30, 299, 599, 899, 60, 1673, 600, 76899, 0, 0, 4901, 0, 4901, 3599, 0, 3177, 1301, 108, 3599, 865, 600, 0, 300, 0, 3063, 20, 4901, 90, 0, 0, 4215, 4908, 233, 20, 2751, 4901, 3599, 4901, 1742, 7200, 1800, 76903, 7147, 76903, 0, 3328, 3600, 300, 30, 3365, 0, 600, 600, 3600, 0, 0, 3600, 300, 6970, 0, 0, 76905, 599, 7199, 299, 300, 4905, 16, 119, 600, 1305, 3167, 76905, 0, 45, 299, 7063, 0, 6867, 599, 7200, 76905, 300, 0, 0, 440, 300, 20, 76906, 0, 30, 76907, 1738, 299, 0, 0, 2276, 76907, 300, 0, 76386, 3600, 76906, 0, 4337, 1199, 4908, 1737, 3599, 4907, 4847, 33707, 538, 243, 76189, 3600, 0, 4909, 300, 1737, 0, 3599, 4341, 0, 3168, 7200, 12109, 0, 0, 300, 4490, 3447, 3599, 1736, 76910, 76910, 599, 600, 4911, 4170, 4911, 295, 600, 124, 4910, 0, 3600, 1800, 0, 76911, 0, 0, 76911, 299, 3599, 60, 599, 4911, 19311, 0, 3600, 1800, 0, 299, 0, 86399, 0, 3599, 600, 4912, 76912, 0, 300, 420, 299, 0, 60, 3599, 0, 3600, 76822, 4484, 1800, 0, 2792, 4913, 23, 4913, 300, 670, 300, 3600, 60, 0, 900, 4394, 59, 299, 76914, 0, 60, 4914, 0, 3600, 60, 0, 4914, 3600, 7200, 895, 900, 40, 3600, 60, 0, 4915, 4915, 4915, 3600, 600, 299, 113, 0, 4920, 0, 300, 1800, 4915, 4916, 0, 3600, 4329, 3600, 0, 305, 1314, 0, 1799, 20, 438, 4914, 19314, 180, 14392, 4915, 0, 28914, 3062, 0, 3304, 83, 11, 0, 600, 0, 76914, 1200, 9914, 1313, 180, 299, 4914, 4359, 0, 4914, 76914, 900, 1, 57, 4914, 4914, 226, 76915, 3599, 28915, 4791, 0, 300, 0, 3599, 4915, 4915, 0, 3599, 3600, 0, 4916, 0, 600, 4563, 3702, 0, 1317, 1799, 0, 0, 600, 0, 299, 4845, 0, 4917, 7200, 117, 3701, 0, 299, 4497, 600, 0, 3599, 4151, 1800, 3119, 4917, 4497, 600, 2257, 0, 0, 3599, 0, 7199, 4918, 600, 0, 19317, 3408, 3600, 60, 76917, 600, 4155, 4918, 4918, 60, 0, 4918, 0, 149, 4918, 3599, 0, 3600, 3331, 3692, 299, 1318, 4918, 0, 20, 3600, 3600, 3600, 9908, 0, 0, 3600, 0, 33720, 0, 1321, 76921, 22, 1798, 300, 29, 300, 4920, 154, 1799, 4921, 12121, 0, 0, 0, 600, 0, 0, 79, 3599, 4921, 300, 76921, 0, 119, 617, 3600, 1716, 600, 3600, 4922, 4922, 600, 0, 7199, 299, 599, 3600, 75714, 299, 878, 348, 0, 4924, 7200, 76924, 600, 0, 299, 0, 3600, 4925, 4925, 1800, 76925, 659, 32945, 0, 4925, 4925, 4177, 3600, 3600, 3600, 76926, 3600, 76926, 59, 0, 4927, 59, 12125, 4927, 3599, 14400, 4926, 7200, 0, 1327, 0, 4926, 30, 4808, 0, 59, 300, 76509, 4926, 4926, 4175, 300, 3599, 1799, 1327, 3599, 599, 299, 548, 21, 300, 60, 0, 76558, 1200, 0, 4928, 76400, 600, 76928, 60, 3031, 0, 3599, 36, 0, 0, 3147, 299, 33729, 0, 600, 4343, 0, 1798, 75709, 1329, 0, 69, 0, 600, 3600, 139, 4929, 3599, 0, 4929, 2245, 300, 76929, 0, 0, 60, 300, 120, 3600, 4927, 5, 599, 4929, 4929, 1784, 0, 4929, 1707, 68, 300, 291, 0, 4930, 0, 540, 0, 4930, 4930, 0, 300, 3599, 4931, 7199, 3416, 300, 1331, 4931, 4931, 0, 7111, 600, 3601, 0, 55, 0, 1332, 3599, 3531, 48, 4932, 0, 4305, 0, 13276, 4932, 1799, 0, 0, 1800, 4933, 600, 141, 0, 599, 4326, 76933, 538, 157, 0, 4934, 300, 300, 92, 207, 0, 0, 103, 4934, 33734, 4507, 2557, 0, 4938, 0, 0, 3600, 87, 4934, 4859, 0, 1704, 4935, 4935, 0, 300, 4842, 0, 300, 0, 3599, 1800, 3599, 4458, 1799, 20, 30, 300, 0, 10800, 0, 33736, 6400, 300, 0, 3600, 119, 76936, 60, 20, 0, 10, 1800, 1338, 599, 4938, 0, 254, 0, 20, 3600, 599, 0, 3124, 7002, 0, 4938, 3600, 59, 0, 10, 20, 900, 282, 7200, 0, 3599, 0, 599, 4939, 0, 0, 0, 0, 30, 0, 4360, 2731, 4414, 4938, 4139, 300, 4939, 4, 0, 28939, 75, 1232, 4939, 0, 0, 60, 59, 3599, 0, 4938, 735, 0, 4939, 30, 4939, 0, 76939, 4939, 2173, 58, 0, 0, 76940, 1799, 60, 900, 0, 218, 0, 0, 1340, 600, 729, 4450, 41, 4912, 20, 0, 0, 3600, 1800, 33740, 300, 12140, 0, 1340, 12144, 0, 4196, 600, 3018, 4142, 1698, 0, 0, 600, 7199, 531, 2687, 76298, 0, 7199, 3599, 899, 0, 860, 300, 40, 300, 3600, 73268, 3120, 4941, 600, 7200, 3600, 0, 4942, 4942, 162, 0, 60, 0, 3599, 0, 4942, 76494, 3599, 1784, 7199, 600, 59, 120, 0, 0, 3033, 300, 0, 0, 599, 299, 30, 4130, 0, 30, 4943, 0, 0, 149, 301, 2711, 38, 0, 4420, 600, 300, 3600, 0, 12143, 3599, 4944, 0, 3284, 1694, 0, 0, 3121, 200, 33745, 300, 300, 131, 3600, 3600, 900, 1346, 4949, 19, 0, 1199, 0, 7200, 3600, 0, 4946, 600, 0, 3600, 0, 0, 18, 3600, 0, 0, 0, 0, 60, 0, 0, 3599, 0, 0, 76947, 75690, 198, 0, 6818, 0, 1348, 3600, 3600, 0, 0, 0, 60, 1800, 0, 4948, 76949, 60, 7200, 396, 0, 111, 299, 300, 60, 4899, 0, 4951, 0, 0, 0, 600, 4948, 3600, 4948, 3600, 1800, 743, 0, 3600, 3599, 4950, 3026, 0, 1199, 59, 1799, 0, 7200, 600, 600, 0, 4950, 696, 3600, 240, 4950, 0, 4950, 3275, 12, 60, 0, 13, 12091, 7200, 7200, 7199, 4385, 7199, 3599, 300, 600, 0, 4951, 8551, 1200, 4951, 300, 300, 1800, 2, 3600, 3598, 292, 4952, 4471, 0, 3599, 4305, 0, 76952, 4953, 519, 300, 19354, 0, 3552, 4311, 0, 300, 0, 0, 0, 0, 4955, 59, 899, 0, 3327, 4952, 0, 0, 76956, 4956, 300, 3600, 0, 297, 4956, 0, 3598, 0, 0, 20, 0, 298, 4156, 4956, 0, 566, 76957, 0, 300, 0, 299, 0, 1355, 0, 4955, 4956, 4891, 220, 4957, 4779, 1358, 76814, 0, 4958, 299, 19, 4958, 4958, 3600, 4959, 3600, 0, 180, 1800, 0, 30, 4958, 1357, 0, 0, 4958, 4120, 3599, 1358, 0, 0, 76960, 2665, 4958, 300, 4, 4334, 300, 0, 0, 3600, 0, 0, 4959, 60, 0, 76817, 0, 299, 900, 33759, 298, 0, 0, 300, 0, 4434, 0, 300, 600, 20, 2980, 0, 3599, 4959, 76959, 0, 157, 1200, 600, 0, 835, 20, 4960, 300, 0, 0, 76961, 300, 299, 77, 599, 4959, 3251, 1362, 285, 4959, 4959, 33759, 120, 0, 1359, 900, 76959, 19, 599, 4092, 0, 103, 299, 3599, 58, 4958, 0, 600, 299, 0, 0, 4958, 3552, 4959, 0, 0, 3600, 4959, 3599, 0, 4959, 600, 0, 44, 3600, 14400, 3600, 299, 0, 0, 3600, 4959, 3600, 4959, 0, 0, 0, 300, 4382, 4959, 7199, 76959, 0, 20, 4960, 299, 300, 4960, 76960, 0, 4295, 169, 284, 1800, 20, 0, 0]
ttl_7000 = [299, 0, 0, 4954, 0, 6317, 58, 3599, 0, 3599, 3186, 0, 4954, 0, 4953, 0, 0, 20, 0, 1800, 300, 1800, 0, 14400, 3600, 4954, 1354, 4954, 4954, 0, 19354, 300, 600, 1483, 0, 1789, 299, 60, 0, 4051, 600, 649, 60, 7200, 0, 166, 3855, 0, 600, 300, 19, 3600, 225, 900, 0, 0, 4956, 3599, 76006, 0, 0, 0, 299, 3600, 7200, 4955, 4955, 600, 0, 300, 0, 2741, 76955, 60, 3600, 0, 4, 4956, 4956, 0, 4956, 0, 0, 4959, 3600, 0, 4959, 20, 599, 3600, 4957, 299, 59, 0, 4956, 0, 261, 300, 27, 3600, 3600, 3878, 14400, 0, 0, 0, 0, 4957, 20, 2842, 4957, 4957, 20, 3499, 4957, 0, 0, 0, 7200, 0, 300, 300, 4958, 0, 0, 2724, 1358, 300, 0, 0, 3599, 141, 4958, 0, 4957, 300, 300, 101, 299, 2257, 0, 0, 299, 298, 60, 0, 12156, 4958, 0, 4957, 341, 0, 4959, 86400, 3600, 0, 1800, 4959, 3875, 0, 2831, 0, 0, 2, 33437, 33759, 204, 59, 76959, 600, 0, 300, 3600, 0, 879, 0, 0, 4063, 600, 3599, 4960, 359, 30, 1359, 600, 300, 203, 299, 0, 3600, 2742, 4960, 3600, 0, 0, 1800, 1046, 299, 76960, 3600, 0, 76961, 299, 1210, 0, 600, 0, 76961, 4961, 3600, 299, 600, 0, 0, 4962, 299, 0, 3599, 60, 7200, 4961, 2390, 4961, 76001, 0, 0, 300, 297, 76, 3600, 4962, 299, 76962, 4962, 0, 0, 4150, 231, 600, 0, 599, 600, 76963, 10, 33763, 0, 0, 0, 0, 300, 60, 4963, 0, 3599, 107, 600, 899, 13, 4964, 299, 1364, 4148, 299, 0, 3600, 7200, 900, 0, 300, 7200, 0, 76964, 345, 600, 2782, 7200, 3600, 3600, 3600, 8964, 0, 0, 4965, 600, 600, 299, 0, 0, 1365, 0, 599, 599, 0, 0, 0, 20, 600, 0, 7200, 0, 998, 299, 3600, 0, 0, 0, 0, 0, 4546, 7199, 0, 599, 300, 300, 66465, 0, 1366, 300, 0, 300, 600, 600, 2810, 0, 1367, 0, 0, 0, 0, 1397, 9511, 33767, 58, 11771, 3377, 0, 59, 3599, 600, 3600, 4967, 60, 76266, 0, 0, 442, 3600, 300, 300, 1800, 4969, 290, 300, 1397, 299, 899, 0, 3275, 600, 1396, 3600, 4969, 600, 60, 0, 59, 300, 0, 3599, 0, 600, 4970, 3600, 7200, 76574, 0, 4970, 4971, 76971, 4972, 17, 4972, 14400, 598, 600, 0, 0, 0, 0, 4971, 0, 300, 3366, 600, 300, 0, 76971, 10800, 0, 0, 600, 0, 300, 0, 0, 4972, 299, 7, 4973, 0, 20, 4973, 3600, 14400, 4973, 0, 0, 300, 0, 0, 0, 4669, 59, 7200, 3599, 600, 4973, 57, 0, 4973, 3600, 76974, 60, 298, 0, 33774, 1374, 0, 0, 4974, 3600, 599, 0, 4974, 0, 600, 3826, 600, 1800, 76975, 1387, 582, 3599, 3599, 4047, 0, 1379, 3600, 0, 1800, 0, 0, 4976, 3600, 30, 1377, 299, 2707, 0, 4939, 4976, 300, 3600, 30, 1800, 2445, 150, 1385, 300, 33777, 4977, 4977, 0, 76976, 105, 0, 4978, 0, 4978, 300, 600, 0, 3060, 4938, 2403, 300, 0, 20, 600, 0, 4980, 214, 4980, 299, 186, 20, 76979, 0, 1, 4980, 4980, 0, 3600, 7199, 0, 0, 76018, 0, 33780, 1382, 300, 600, 0, 59, 0, 1800, 300, 300, 0, 0, 0, 4981, 2804, 4981, 281, 599, 3809, 0, 4981, 4981, 0, 30, 0, 0, 0, 119, 33030, 3599, 599, 0, 4013, 0, 0, 0, 0, 300, 0, 4982, 20, 0, 0, 299, 4982, 3600, 288, 1800, 3600, 2684, 600, 0, 1382, 0, 4982, 0, 1049, 600, 4981, 600, 299, 0, 4980, 0, 0, 0, 0, 7199, 0, 76977, 3082, 0, 4977, 0, 300, 0, 3817, 4978, 1378, 3309, 6602, 0, 0, 599, 299, 3600, 4978, 61, 250, 60, 4981, 4982, 4032, 299, 60, 0, 0, 76978, 1371, 60, 3600, 32602, 0, 1800, 9, 2768, 1370, 899, 296, 0, 4557, 4979, 4516, 0, 3235, 3599, 262, 60, 4978, 0, 0, 0, 0, 3600, 76978, 1800, 299, 0, 76979, 75805, 3599, 3600, 0, 0, 3302, 7200, 1380, 4483, 299, 0, 227, 3600, 76981, 900, 0, 7200, 0, 4697, 600, 299, 30, 0, 214, 0, 300, 0, 2965, 4982, 1800, 0, 76983, 900, 0, 4983, 3827, 23, 0, 0, 0, 0, 0, 4, 0, 3600, 300, 600, 0, 76984, 599, 20, 2794, 4627, 270, 0, 2941, 76985, 3789, 3599, 300, 76983, 4985, 600, 4986, 4985, 3600, 181, 3600, 4987, 3600, 4988, 20, 0, 0, 0, 0, 761, 0, 0, 0, 1362, 0, 12189, 76989, 0, 3599, 75785, 129, 0, 300, 900, 300, 31, 7200, 0, 4990, 3599, 7199, 30, 3599, 7200, 0, 4990, 7199, 0, 20, 3599, 600, 600, 4990, 300, 76990, 4991, 0, 60, 56, 600, 0, 300, 1359, 0, 1358, 4990, 4410, 0, 0, 4192, 4990, 4992, 600, 2791, 300, 4992, 3600, 0, 299, 1391, 4992, 4992, 299, 0, 3600, 4991, 600, 300, 4991, 0, 20, 0, 3600, 3600, 599, 76992, 19392, 300, 576, 0, 3600, 3600, 600, 76992, 3600, 59, 0, 6664, 0, 4991, 4991, 0, 4991, 1800, 882, 300, 4014, 0, 0, 75792, 0, 1800, 0, 75777, 0, 30, 4992, 3600, 899, 0, 0, 20, 7200, 3600, 250, 600, 6653, 76993, 1800, 76993, 0, 7200, 0, 0, 4993, 2205, 12193, 4994, 120, 366, 3599, 185, 7199, 0, 0, 0, 6, 0, 0, 2792, 0, 2370, 4994, 600, 0, 3588, 0, 3599, 1393, 0, 3794, 258, 1, 3599, 300, 0, 1223, 600, 2780, 12194, 60, 4994, 1887, 60, 3600, 4180, 0, 0, 300, 0, 0, 60, 899, 0, 0, 0, 3, 299, 60, 59, 299, 181, 76993, 45, 20, 76996, 0, 0, 30, 589, 76995, 4995, 59, 3600, 4995, 299, 3599, 0, 4008, 0, 0, 4995, 76995, 4580, 2773, 300, 58, 0, 300, 1346, 30, 600, 4996, 59, 4996, 3600, 300, 599, 33798, 3598, 4998, 0, 2963, 300, 76998, 1398, 0, 0, 4998, 900, 60, 238, 59, 298, 3600, 0, 0, 300, 299, 0, 900, 600, 4563, 0, 12171, 0, 33798, 299, 3599, 76998, 4394, 1800, 4998, 3600, 3600, 3317, 1399, 0, 600, 32834, 0, 3209, 33800, 3600, 77000, 5000, 300, 5001, 0, 3599, 53, 0, 900, 2981, 5001, 0, 599, 4192, 0, 0, 20, 4045, 3599, 3196, 0, 0, 5003, 7199, 4563, 20, 300, 4038, 5003, 4534, 600, 4174, 4186, 3599, 0, 299, 0, 299, 16, 0, 0, 5003, 0, 59, 0, 2763, 1404, 59, 0, 253, 899, 0, 45, 3600, 2926, 7198, 60, 33804, 1800, 0, 77004, 4325, 3600, 3600, 59, 5005, 0, 3832, 7200, 59, 0, 171, 5003, 0, 5006, 32829, 223, 5006, 6562, 77006, 1800, 19407, 899, 3997, 5007, 299, 5007, 599, 3957, 77007, 0, 12207, 1337, 7200, 5007, 300, 0, 299, 300, 382, 0, 0, 5008, 0, 20, 5007, 77007, 3600, 5008, 3600, 0, 5048, 0, 3599, 3026, 5009, 0, 900, 0, 3600, 29009, 0, 0, 599, 0, 5009, 3600, 1023, 600, 0, 3770, 3599, 5009, 20, 5010, 3792, 300, 0, 5009, 0, 0, 5009, 0, 59, 299, 5010, 5010, 0, 0, 599, 3599, 60, 299, 5011, 77009, 1800, 3600, 1333, 21, 0, 0, 3600, 5008, 5010, 0, 3777, 0, 77011, 599, 0, 173, 1, 3600, 0, 20, 0, 300, 222, 0, 900, 0, 20, 29, 0, 5011, 5011, 0, 299, 600, 1800, 300, 600, 3600, 0, 3600, 5011, 5011, 600, 60, 1412, 0, 0, 3600, 5011, 59, 0, 0, 2753, 599, 495, 946, 76951, 0, 1800, 199, 5011, 3600, 77012, 5012, 1412, 5012, 228, 360, 5012, 5989, 77013, 300, 0, 4507, 0, 5013, 260, 3600, 600, 299, 3600, 126, 0, 77014, 150, 600, 300, 0, 5003, 130, 7199, 0, 3600, 0, 300, 7200, 0, 77015, 107, 5015, 0, 3791, 298, 5015, 0, 1415, 3600, 0, 0, 5015, 899, 1415, 0, 0, 5016, 3600, 0, 30, 5014, 300, 0, 5016, 300, 538, 0, 3600, 3599, 4136, 0, 599, 1800, 300, 30, 77016, 300, 77017, 0, 0, 0, 0, 300, 600, 1799, 0, 3130, 0, 1199, 3599, 1418, 3190, 3600, 600, 275, 600, 5018, 5018, 3793, 0, 0, 60, 300, 77019, 12220, 0, 3599, 59, 0, 0, 5019, 0, 300, 5020, 4471, 5020, 297, 3600, 1014, 599, 300, 0, 77018, 5021, 2720, 3943, 0, 30, 1318, 0, 4652, 5021, 3600, 0, 3292, 0, 0, 300, 0, 0, 5021, 0, 59, 3600, 29, 1422, 3298, 77022, 5022, 0, 0, 0, 299, 2989, 0, 1422, 3600, 300, 5022, 0, 4010, 3600, 2745, 212, 3599, 5023, 20, 3600, 7199, 600, 150, 3750, 77025, 0, 3599, 2894, 76451, 4523, 299, 3752, 992, 0, 0, 3600, 0, 5025, 0, 19425, 299, 3928, 0, 0, 3600, 0, 20, 271, 6722, 2715, 0, 19, 5025, 7200, 19425, 0, 0, 0, 2752, 66383, 76605, 300, 3600, 5026, 60, 3600, 600, 299, 4457, 1800, 3600, 0, 300, 3599, 0, 0, 5028, 235, 300, 5028, 899, 298, 3252, 3599, 0, 0, 5028, 0, 5028, 5028, 1402, 21, 0, 299, 569, 5029, 900, 3599, 0, 144, 5028, 25, 882, 2746, 24, 600, 5031, 629, 1800, 3117, 899, 38, 899, 1, 298, 5029, 9502, 5029, 3023, 300, 3600, 0, 0, 7200, 0, 0, 296, 0, 3600, 1406, 5030, 360, 299, 23, 37117, 5031, 59, 600, 0, 0, 3942, 0, 0, 0, 0, 300, 0, 3600, 5029, 0, 4582, 77030, 0, 3599, 5029, 0, 0, 5029, 5029, 300, 24, 4142, 20, 2616, 0, 0, 4576, 0, 3208, 0, 5031, 0, 3599, 600, 0, 599, 0, 0, 60, 0, 0, 0, 29, 5032, 3751, 0, 0, 60, 0, 600, 0, 3599, 73633, 299, 4379, 299, 60, 0, 3910, 77019, 299, 0, 91, 1306, 29, 5031, 5032, 1799, 77032, 2890, 3600, 0, 4498, 300, 0, 299, 3599, 58, 468, 0, 60, 2720, 0, 600, 5032, 6604, 3803, 300, 600, 59, 0, 5032, 7199, 600, 0, 5031, 3600, 332, 3600, 5032, 1395, 0, 0, 600, 75901, 3599, 77033, 77033, 3599, 6705, 599, 77033, 4405, 0, 0, 463, 600, 29033, 193, 1386, 60, 4135, 3600, 5033, 0, 77033, 3600, 77034, 3600, 0, 3599, 4504, 0, 3906, 0, 3600, 3599, 32799, 77039, 77036, 75898, 3600, 0, 600, 28, 1800, 600, 7200, 144, 0, 5041, 0, 3761, 300, 0, 4852, 0, 300, 4079, 1439, 0, 3599, 3599, 0, 30, 8, 77041, 191, 0, 3599, 0, 235, 300, 0, 77041, 600, 19441, 0, 0, 3104, 3599, 3599, 4057, 1185, 300, 157, 5041, 0, 299, 0, 5042, 189, 19, 0, 3600, 294, 505, 77042, 300, 2682, 3600, 3757, 1442, 0, 7198, 0, 7199, 0, 77043, 7199, 198, 10800, 600, 30, 0, 1800, 221, 300, 5043, 2665, 266, 599, 5043, 61, 5043, 3600, 5044, 555, 1444, 87, 300, 60, 599, 0, 4557, 5044, 1386, 4974, 0, 300, 0, 5042, 0, 0, 29044, 5038, 379, 3600, 5044, 61, 3126, 300, 59, 298, 0, 299, 23, 0, 0, 0, 5043, 15, 5045, 3599, 600, 1290, 12244, 0, 0, 7200, 4427, 77045, 5044, 0, 3600, 300, 30, 0, 59, 0, 797, 3600, 600, 5046, 5046, 0, 34, 253, 60, 30, 3600, 0, 600, 183, 3600, 1199, 122, 298, 3600, 600, 300, 3600, 3600, 77047, 5047, 300, 0, 0, 270, 5047, 0, 3600, 5047, 3600, 600, 59, 77047, 0, 4840, 0, 2, 600, 0, 599, 4479, 299, 0, 299, 179, 75773, 0, 0, 186, 0, 300, 5048, 5052, 600, 3600, 5048, 5049, 7200, 1449, 0, 1449, 179, 60, 0, 3729, 189, 58, 4549, 5050, 77050, 5052, 0, 0, 105, 30, 600, 75884, 4543, 3756, 816, 3600, 20, 3600, 4045, 191, 0, 5051, 3600, 77051, 1451, 30, 2604, 59, 3599, 7199, 3599, 300, 300, 600, 20, 2714, 30, 0, 4, 20, 1800, 600, 1799, 0, 0, 0, 0, 1799, 25997, 0, 5052, 33850, 0, 0, 3600, 186, 5051, 190, 1439, 0, 1282, 77052, 0, 75882, 175, 0, 77052, 301, 300, 1800, 0, 0, 2915, 0, 3599, 4392, 899, 1799, 149, 0, 0, 3600, 3600, 5053, 2862, 0, 556, 60, 289, 3600, 0, 3086, 0, 0, 8, 1454, 3600, 0, 5054, 0, 5054, 1323, 9, 299, 4471, 899, 4574, 0, 5055, 0, 600, 60, 0, 19454, 0, 300, 2133, 5055, 600, 4959, 300, 0, 7200, 60, 299, 4455, 0, 77056, 0, 4828, 0, 314, 3599, 3928, 2664, 0, 300, 600, 3966, 59, 5055, 5055, 0, 3939, 3599, 3599, 52, 30, 5055, 5055, 6185, 180, 99, 6502, 300, 0, 7199, 12256, 0, 0, 5056, 999]
ttl_record = ttl_1000 + ttl_3000 + ttl_5000 + ttl_7000
## 3. Form the Basic Feature Set
# (1) Load the Blacklist, Whois and Botnet feature set
blacklist_featureset = np.load(blacklist_featureset_path).reshape(7000,1)
whois_featureset = np.load(whois_featureset_path)
botnet_featureset = np.load(botnet_featureset_path)
# print(blacklist_featureset.shape)
# (7000,1)
# print(whois_featureset.shape)
# (7000,5)
# print(botnet_featureset.shape)
# (7000,5)
# print('len(is_record) = ', len(is_record))
# print('len(ttl_record) = ', len(ttl_record))
dns_ttl_record = np.array((is_record,ttl_record)).T
# print(dns_ttl_record.shape)
# (7000,2)
Host_based_Feature = np.hstack((blacklist_featureset,whois_featureset,botnet_featureset,dns_ttl_record))
print(Host_based_Feature.shape)
print(Host_based_Feature[:10,:])
## 4. Save the Basic Feature set
np.save('Host_based_FeatureSet.npy', Host_based_Feature)
## 5. Load the Basic Feature set
# hostbased_featureset = np.load(Host_based_Feature_path)
# print('hostbased.shape=',hostbased_featureset.shape)
| 332.229508
| 9,900
| 0.509161
| 14,767
| 60,798
| 2.086206
| 0.123722
| 0.227935
| 0.206447
| 0.174895
| 0.258318
| 0.243191
| 0.235401
| 0.235401
| 0.235401
| 0.235401
| 0
| 0.608846
| 0.250715
| 60,798
| 182
| 9,901
| 334.054945
| 0.067325
| 0.022238
| 0
| 0.306931
| 0
| 0
| 0.005576
| 0.00283
| 0
| 0
| 0
| 0
| 0
| 1
| 0.019802
| false
| 0
| 0.09901
| 0
| 0.227723
| 0.029703
| 0
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
d0baa10f8ea28aa2f5fbd009e941895953843258
| 73
|
py
|
Python
|
final_project/__init__.py
|
SV1997/xzceb-flask_eng_fr
|
691c83a1a821f23f230152dc2d97f1c2430e6293
|
[
"Apache-2.0"
] | null | null | null |
final_project/__init__.py
|
SV1997/xzceb-flask_eng_fr
|
691c83a1a821f23f230152dc2d97f1c2430e6293
|
[
"Apache-2.0"
] | null | null | null |
final_project/__init__.py
|
SV1997/xzceb-flask_eng_fr
|
691c83a1a821f23f230152dc2d97f1c2430e6293
|
[
"Apache-2.0"
] | null | null | null |
from translate import languagetr
from translate import test_languagetr
| 24.333333
| 38
| 0.863014
| 9
| 73
| 6.888889
| 0.555556
| 0.419355
| 0.612903
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.136986
| 73
| 2
| 39
| 36.5
| 0.984127
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
d0c583a52568e8c5ca2b63178f65791bc90476a6
| 2,176
|
py
|
Python
|
tests/test_sofa.py
|
szkkteam/miner
|
5fda38b39593db37ff4acd8a2afa12d256a9912d
|
[
"MIT"
] | null | null | null |
tests/test_sofa.py
|
szkkteam/miner
|
5fda38b39593db37ff4acd8a2afa12d256a9912d
|
[
"MIT"
] | null | null | null |
tests/test_sofa.py
|
szkkteam/miner
|
5fda38b39593db37ff4acd8a2afa12d256a9912d
|
[
"MIT"
] | null | null | null |
import pandas as pd
import pytest
import miner as m
from datetime import date
test_match_id = 7828232
def test_lineups_v1():
r = m.sofascore.SofaRequests()
resp = r.parse_lineups_event(test_match_id)
assert isinstance(resp, dict)
teams = ['homeTeam', 'awayTeam']
for team in teams:
# Test teams are present
assert team in resp
team_resp = resp[team]
# Test formation is present
assert 'formation' in team_resp
# Test lineup sorted is present
assert 'lineupsSorted' in team_resp
lineups = team_resp['lineupsSorted']
assert len(lineups) > 0
for lineup in lineups:
assert 'player' in lineup
assert 'id' in lineup['player']
assert 'name' in lineup['player']
assert 'positionName' in lineup
assert 'positionNameshort' in lineup
def test_lineups_v2():
r = m.sofascore.SofaRequests()
resp = r.parse_lineups_event_visual(test_match_id)
assert isinstance(resp, dict)
teams = ['homeTeam', 'awayTeam']
for team in teams:
# Test teams are present
assert team in resp
team_resp = resp[team]
# Test formation is present
assert 'formation' in team_resp
# Test lineup sorted is present
assert 'lineupsSorted' in team_resp
lineups = team_resp['lineupsSorted']
assert len(lineups) > 0
for lineup in lineups:
assert 'player' in lineup
assert 'id' in lineup['player']
assert 'name' in lineup['player']
assert 'positionName' in lineup
assert 'positionNameshort' in lineup
def test_fetch_future_match():
match_id = 7828232
handler = m.sofascore.SofaHandler(config={'multithreading': False})
result, _ = handler.fetch_matches(match_id)
assert len(result.keys()) == 415
def test_fetch_past_date():
start_date = date(2019, 5, 2)
handler = m.sofascore.SofaHandler(config={'multithreading': False})
result, _ = handler.fetch_dates(start=start_date)
assert len(result.keys()) == 427
| 34
| 72
| 0.624081
| 259
| 2,176
| 5.100386
| 0.250965
| 0.06056
| 0.04542
| 0.06056
| 0.803936
| 0.803936
| 0.803936
| 0.803936
| 0.803936
| 0.735806
| 0
| 0.019481
| 0.292279
| 2,176
| 64
| 73
| 34
| 0.838312
| 0.072151
| 0
| 0.666667
| 0
| 0
| 0.121026
| 0
| 0
| 0
| 0
| 0
| 0.431373
| 1
| 0.078431
| false
| 0
| 0.078431
| 0
| 0.156863
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
d0e7ea14fbc4627564b9d7abb89ec6eabd1caa0d
| 107
|
py
|
Python
|
django_js_reverse/tests/helper.py
|
thread/django-js-reverse
|
d3dc73879a2a61e9149c8c9f200c0fbc0e52e6c0
|
[
"MIT"
] | 492
|
2015-01-05T15:04:27.000Z
|
2022-03-31T19:53:06.000Z
|
django_js_reverse/tests/helper.py
|
thread/django-js-reverse
|
d3dc73879a2a61e9149c8c9f200c0fbc0e52e6c0
|
[
"MIT"
] | 88
|
2015-01-09T02:49:51.000Z
|
2022-01-11T01:28:26.000Z
|
django_js_reverse/tests/helper.py
|
thread/django-js-reverse
|
d3dc73879a2a61e9149c8c9f200c0fbc0e52e6c0
|
[
"MIT"
] | 82
|
2015-01-20T19:58:28.000Z
|
2022-03-06T11:04:47.000Z
|
# -*- coding: utf-8 -*-
from django import VERSION
def is_django_ver_gte_2():
return VERSION[0] >= 2
| 15.285714
| 26
| 0.654206
| 17
| 107
| 3.882353
| 0.823529
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.046512
| 0.196262
| 107
| 6
| 27
| 17.833333
| 0.72093
| 0.196262
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.333333
| true
| 0
| 0.333333
| 0.333333
| 1
| 0
| 1
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 1
| 1
| 1
| 0
|
0
| 7
|
ef6bbca6015d90a06a7e8406cbd349e546497780
| 2,779
|
py
|
Python
|
tests/test_test_tools.py
|
sivasanarul/amfe_topopt
|
ba7fa1ce756e7ea6e4fd7b2bdb609b83bbfac472
|
[
"BSD-3-Clause"
] | null | null | null |
tests/test_test_tools.py
|
sivasanarul/amfe_topopt
|
ba7fa1ce756e7ea6e4fd7b2bdb609b83bbfac472
|
[
"BSD-3-Clause"
] | null | null | null |
tests/test_test_tools.py
|
sivasanarul/amfe_topopt
|
ba7fa1ce756e7ea6e4fd7b2bdb609b83bbfac472
|
[
"BSD-3-Clause"
] | null | null | null |
"""
Test for tools module of test-tools
"""
from unittest import TestCase, expectedFailure
import numpy as np
from .tools import CustomDictAssertTest
from copy import copy
class CustomAssertMethodsTest(TestCase):
def setUp(self):
self.custom_asserter = CustomDictAssertTest()
def tearDown(self):
pass
def test_assert_dict_almost_equal(self):
dict1 = {'key1': np.array([0.00000000000000000000001, 5.400000000000000000000000001]),
'key2': 5,
(1, 2): 'value'}
dict2 = {'key1': np.array([0.0, 5.4]),
'key2': 5,
(1, 2): 'value'}
self.custom_asserter.assert_dict_almost_equal(dict1, dict2)
dict1 = {'key1': {'key2': {'key3': {'key4': {'key4': {'key5': 5}}}}}}
dict2 = copy(dict1)
self.custom_asserter.assert_dict_almost_equal(dict1, dict2)
dict1 = {'key1': {'key2': {'key3': {'key4': {'key4': {'key5': 5}}}}}}
dict2 = copy(dict1)
self.custom_asserter.assert_dict_almost_equal(dict1, dict2)
@expectedFailure
def test_assert_dict_almost_equal_failure(self):
dict1 = {'key1': np.array([0.00001, 5.40001]),
'key2': 5,
(1, 2): 'value'}
dict2 = {'key1': np.array([0.0, 5.4]),
'key2': 5,
(1, 2): 'value'}
self.custom_asserter.assert_dict_almost_equal(dict1, dict2)
@expectedFailure
def test_assert_dict_almost_equal_limit_failure(self):
dict1 = {'key1': {
'key2': {'key3': {'key4': {'key4': {'key5': {'key6': {'key7': {'key8': {'key9': {'key10': 10}}}}}}}}}}}
dict2 = copy(dict1)
self.custom_asserter.assert_dict_almost_equal(dict1, dict2)
def test_assert_dict_equal(self):
dict1 = {'key1': np.array([0, 5]),
'key2': 5,
(1, 2): 'value'}
dict2 = {'key1': np.array([0, 5]),
'key2': 5,
(1, 2): 'value'}
self.custom_asserter.assert_dict_equal(dict1, dict2)
@expectedFailure
def test_assert_dict_equal_failure(self):
dict1 = {'key1': np.array([0.00000000000000000000001, 5.400000000000000000000000001]),
'key2': 5,
(1, 2): 'value'}
dict2 = {'key1': np.array([0.0, 5.4]),
'key2': 5,
(1, 2): 'value'}
self.custom_asserter.assert_dict_equal(dict1, dict2)
@expectedFailure
def test_assert_dict_equal_limit_failure(self):
dict1 = {'key1': {
'key2': {'key3': {'key4': {'key4': {'key5': {'key6': {'key7': {'key8': {'key9': {'key10': 10}}}}}}}}}}}
dict2 = copy(dict1)
self.custom_asserter.assert_dict_almost_equal(dict1, dict2)
| 33.890244
| 115
| 0.550198
| 311
| 2,779
| 4.729904
| 0.173633
| 0.095173
| 0.110129
| 0.128484
| 0.827328
| 0.815772
| 0.800136
| 0.78722
| 0.763426
| 0.763426
| 0
| 0.125313
| 0.282116
| 2,779
| 81
| 116
| 34.308642
| 0.61203
| 0.012594
| 0
| 0.704918
| 0
| 0
| 0.088483
| 0
| 0
| 0
| 0
| 0
| 0.278689
| 1
| 0.131148
| false
| 0.016393
| 0.065574
| 0
| 0.213115
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
ef6bee7dcbb711c1cc719bd9d327f4a19ac1abee
| 3,293
|
py
|
Python
|
hallo/test/modules/channel_control/test_channel_password.py
|
joshcoales/Hallo
|
17145d8f76552ecd4cbc5caef8924bd2cf0cbf24
|
[
"MIT"
] | 1
|
2018-05-19T22:27:20.000Z
|
2018-05-19T22:27:20.000Z
|
hallo/test/modules/channel_control/test_channel_password.py
|
joshcoales/Hallo
|
17145d8f76552ecd4cbc5caef8924bd2cf0cbf24
|
[
"MIT"
] | 75
|
2015-09-26T18:07:18.000Z
|
2022-01-04T07:15:11.000Z
|
hallo/test/modules/channel_control/test_channel_password.py
|
SpangleLabs/Hallo
|
17145d8f76552ecd4cbc5caef8924bd2cf0cbf24
|
[
"MIT"
] | 1
|
2021-04-10T12:02:47.000Z
|
2021-04-10T12:02:47.000Z
|
from hallo.events import EventMessage
def test_pass_off(hallo_getter):
test_hallo = hallo_getter({"channel_control"})
test_hallo.test_chan.password = "test_pass"
test_hallo.function_dispatcher.dispatch(
EventMessage(test_hallo.test_server, test_hallo.test_chan, test_hallo.test_user, "channel password")
)
data = test_hallo.test_server.get_send_data(1, test_hallo.test_chan, EventMessage)
assert "error" not in data[0].text.lower()
assert "password disabled" in data[0].text.lower()
assert test_hallo.test_chan.password is None
def test_pass_null(hallo_getter):
test_hallo = hallo_getter({"channel_control"})
test_hallo.test_chan.password = "test_pass"
test_hallo.function_dispatcher.dispatch(
EventMessage(test_hallo.test_server, test_hallo.test_chan, test_hallo.test_user, "channel password none")
)
data = test_hallo.test_server.get_send_data(1, test_hallo.test_chan, EventMessage)
assert "error" not in data[0].text.lower()
assert "password disabled" in data[0].text.lower()
assert test_hallo.test_chan.password is None
def test_pass_set(hallo_getter):
test_hallo = hallo_getter({"channel_control"})
test_hallo.test_chan.password = None
test_hallo.function_dispatcher.dispatch(
EventMessage(test_hallo.test_server, test_hallo.test_chan, test_hallo.test_user, "channel password test_pass")
)
data = test_hallo.test_server.get_send_data(1, test_hallo.test_chan, EventMessage)
assert "error" not in data[0].text.lower()
assert "password set" in data[0].text.lower()
assert test_hallo.test_chan.password == "test_pass"
def test_pass_chan_null(hallo_getter):
test_hallo = hallo_getter({"channel_control"})
test_hallo.test_chan1 = test_hallo.test_server.get_channel_by_address(
"other_channel".lower(), "other_channel"
)
test_hallo.test_chan1.in_channel = True
test_hallo.test_chan1.password = "test_pass"
test_hallo.function_dispatcher.dispatch(
EventMessage(
test_hallo.test_server, test_hallo.test_chan, test_hallo.test_user, "channel password other_channel none"
)
)
data = test_hallo.test_server.get_send_data(1, test_hallo.test_chan, EventMessage)
assert "error" not in data[0].text.lower()
assert "password disabled" in data[0].text.lower()
assert "other_channel" in data[0].text.lower()
assert test_hallo.test_chan1.password is None
def test_pass_chan_set(hallo_getter):
test_hallo = hallo_getter({"channel_control"})
test_hallo.test_chan1 = test_hallo.test_server.get_channel_by_address(
"other_channel".lower(), "other_channel"
)
test_hallo.test_chan1.in_channel = True
test_hallo.test_chan1.password = None
test_hallo.function_dispatcher.dispatch(
EventMessage(
test_hallo.test_server,
test_hallo.test_chan,
test_hallo.test_user,
"channel password other_channel test_pass",
)
)
data = test_hallo.test_server.get_send_data(1, test_hallo.test_chan, EventMessage)
assert "error" not in data[0].text.lower()
assert "password set" in data[0].text.lower()
assert "other_channel" in data[0].text.lower()
assert test_hallo.test_chan1.password == "test_pass"
| 41.683544
| 118
| 0.734285
| 464
| 3,293
| 4.872845
| 0.086207
| 0.203008
| 0.235736
| 0.120301
| 0.970809
| 0.970809
| 0.963291
| 0.956214
| 0.956214
| 0.956214
| 0
| 0.009094
| 0.165199
| 3,293
| 78
| 119
| 42.217949
| 0.813387
| 0
| 0
| 0.573529
| 0
| 0
| 0.132402
| 0
| 0
| 0
| 0
| 0
| 0.25
| 1
| 0.073529
| false
| 0.367647
| 0.014706
| 0
| 0.088235
| 0
| 0
| 0
| 0
| null | 1
| 1
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
|
0
| 9
|
ef7194f171110196ec3aa15dd50aed43e1e1b38e
| 72
|
py
|
Python
|
yarll/deepq/__init__.py
|
H-Park/YARLL
|
9217e63e231f2b915c69baad44ccadc7d2a774b8
|
[
"MIT"
] | 1
|
2020-05-06T20:37:22.000Z
|
2020-05-06T20:37:22.000Z
|
yarll/deepq/__init__.py
|
H-Park/YARLL
|
9217e63e231f2b915c69baad44ccadc7d2a774b8
|
[
"MIT"
] | null | null | null |
yarll/deepq/__init__.py
|
H-Park/YARLL
|
9217e63e231f2b915c69baad44ccadc7d2a774b8
|
[
"MIT"
] | 1
|
2020-05-06T20:37:16.000Z
|
2020-05-06T20:37:16.000Z
|
from yarll.deepq.dqn import DQN
from yarll.deepq.policy import DQNPolicy
| 36
| 40
| 0.847222
| 12
| 72
| 5.083333
| 0.583333
| 0.295082
| 0.459016
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.097222
| 72
| 2
| 40
| 36
| 0.938462
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
ef198ae0cf3f08ed4a6843e051956e0dee8a1fb8
| 121
|
py
|
Python
|
keras_ex/metrics/__init__.py
|
aierwiki/keras-ex
|
cadf8108a6246b89b2287bb6c9f932df70ab78e2
|
[
"MIT"
] | null | null | null |
keras_ex/metrics/__init__.py
|
aierwiki/keras-ex
|
cadf8108a6246b89b2287bb6c9f932df70ab78e2
|
[
"MIT"
] | null | null | null |
keras_ex/metrics/__init__.py
|
aierwiki/keras-ex
|
cadf8108a6246b89b2287bb6c9f932df70ab78e2
|
[
"MIT"
] | null | null | null |
from ._classes import precision_score, recall_score, f1_score
__all__ = ["precision_score", "recall_score", "f1_score"]
| 30.25
| 61
| 0.785124
| 16
| 121
| 5.25
| 0.5
| 0.333333
| 0.47619
| 0.595238
| 0.761905
| 0.761905
| 0
| 0
| 0
| 0
| 0
| 0.018349
| 0.099174
| 121
| 3
| 62
| 40.333333
| 0.752294
| 0
| 0
| 0
| 0
| 0
| 0.289256
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.5
| 0
| 0.5
| 0
| 1
| 0
| 0
| null | 1
| 1
| 1
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
|
0
| 7
|
ef691ec33ca7b7d538c1df07bfc61d91f239bda5
| 8,761
|
py
|
Python
|
services/dts/src/oci_cli_transfer_appliance/transferappliance_cli_extended.py
|
honzajavorek/oci-cli
|
6ea058afba323c6b3b70e98212ffaebb0d31985e
|
[
"Apache-2.0"
] | null | null | null |
services/dts/src/oci_cli_transfer_appliance/transferappliance_cli_extended.py
|
honzajavorek/oci-cli
|
6ea058afba323c6b3b70e98212ffaebb0d31985e
|
[
"Apache-2.0"
] | null | null | null |
services/dts/src/oci_cli_transfer_appliance/transferappliance_cli_extended.py
|
honzajavorek/oci-cli
|
6ea058afba323c6b3b70e98212ffaebb0d31985e
|
[
"Apache-2.0"
] | null | null | null |
# coding: utf-8
# Copyright (c) 2016, 2019, Oracle and/or its affiliates. All rights reserved.
from __future__ import print_function
import click
from oci_cli import cli_util
from oci_cli import json_skeleton_utils
from oci_cli import custom_types
from services.dts.src.oci_cli_transfer_appliance.generated import transferappliance_cli
@cli_util.copy_params_from_generated_command(transferappliance_cli.create_transfer_appliance, params_to_exclude=['id', 'wait_for_state', 'max_wait_seconds', 'wait_interval_seconds', 'customer_shipping_address'])
@transferappliance_cli.transfer_appliance_root_group.command(name=transferappliance_cli.create_transfer_appliance.name, help=transferappliance_cli.create_transfer_appliance.help)
@cli_util.option('--job-id', required=True, help=u"""OCID of the Transfer Job""")
@cli_util.option('--customer-shipping-address', required=True, type=custom_types.CLI_COMPLEX_TYPE, help=u"""""" + custom_types.cli_complex_type.COMPLEX_TYPE_HELP)
@json_skeleton_utils.get_cli_json_input_option({'customer-shipping-address': {'module': 'dts', 'class': 'ShippingAddress'}})
@click.pass_context
@json_skeleton_utils.json_skeleton_generation_handler(input_params_to_complex_types={'customer-shipping-address': {'module': 'dts', 'class': 'ShippingAddress'}}, output_type={'module': 'dts', 'class': 'TransferAppliance'})
@cli_util.wrap_exceptions
def create_transfer_appliance_extended(ctx, **kwargs):
if 'job_id' in kwargs:
kwargs['id'] = kwargs['job_id']
kwargs.pop('job_id')
ctx.invoke(transferappliance_cli.create_transfer_appliance, **kwargs)
@cli_util.copy_params_from_generated_command(transferappliance_cli.get_transfer_appliance, params_to_exclude=['id', 'transfer_appliance_label'])
@transferappliance_cli.transfer_appliance_root_group.command(name=transferappliance_cli.get_transfer_appliance.name, help=transferappliance_cli.get_transfer_appliance.help)
@cli_util.option('--job-id', required=True, help=u"""OCID of the Transfer Job""")
@cli_util.option('--appliance-label', required=True, help=u"""Appliance label""")
@click.pass_context
@json_skeleton_utils.json_skeleton_generation_handler({})
@cli_util.wrap_exceptions
def show_transfer_appliance_extended(ctx, **kwargs):
if 'job_id' in kwargs:
kwargs['id'] = kwargs['job_id']
kwargs.pop('job_id')
if 'appliance_label' in kwargs:
kwargs['transfer_appliance_label'] = kwargs['appliance_label']
kwargs.pop('appliance_label')
ctx.invoke(transferappliance_cli.get_transfer_appliance, **kwargs)
@cli_util.copy_params_from_generated_command(transferappliance_cli.list_transfer_appliances, params_to_exclude=['id', 'lifecycle_state', 'all'])
@transferappliance_cli.transfer_appliance_root_group.command(
name=transferappliance_cli.list_transfer_appliances.name,
help=transferappliance_cli.list_transfer_appliances.help)
@cli_util.option('--job-id', required=True, help=u"""OCID of the Transfer Job""")
@click.pass_context
@json_skeleton_utils.json_skeleton_generation_handler({})
@cli_util.wrap_exceptions
def list_transfer_appliances_extended(ctx, **kwargs):
if 'job_id' in kwargs:
kwargs['id'] = kwargs['job_id']
kwargs.pop('job_id')
ctx.invoke(transferappliance_cli.list_transfer_appliances, **kwargs)
@cli_util.copy_params_from_generated_command(transferappliance_cli.get_transfer_appliance, params_to_exclude=['id', 'transfer_appliance_label'])
@transferappliance_cli.transfer_appliance_root_group.command(name="never-receive", help="""Mark the transfer appliance NEVER RECEIVED. """)
@cli_util.option('--job-id', required=True, help=u"""OCID of the Transfer Job""")
@cli_util.option('--appliance-label', required=True, help=u"""Appliance label""")
@click.pass_context
@json_skeleton_utils.json_skeleton_generation_handler({})
@cli_util.wrap_exceptions
def never_receive_transfer_appliance_extended(ctx, **kwargs):
if 'job_id' in kwargs:
kwargs['id'] = kwargs['job_id']
kwargs.pop('job_id')
if 'appliance_label' in kwargs:
kwargs['transfer_appliance_label'] = kwargs['appliance_label']
kwargs.pop('appliance_label')
kwargs["lifecycle_state"] = "CUSTOMER_NEVER_RECEIVED"
ctx.invoke(transferappliance_cli.update_transfer_appliance, **kwargs)
@cli_util.copy_params_from_generated_command(transferappliance_cli.get_transfer_appliance, params_to_exclude=['id', 'transfer_appliance_label'])
@transferappliance_cli.transfer_appliance_root_group.command(name="cancel", help="""Cancels the transfer appliance.""")
@cli_util.option('--job-id', required=True, help=u"""OCID of the Transfer Job""")
@cli_util.option('--appliance-label', required=True, help=u"""Appliance label""")
@click.pass_context
@json_skeleton_utils.json_skeleton_generation_handler({})
@cli_util.wrap_exceptions
def cancel_transfer_appliance_extended(ctx, **kwargs):
if 'job_id' in kwargs:
kwargs['id'] = kwargs['job_id']
kwargs.pop('job_id')
if 'appliance_label' in kwargs:
kwargs['transfer_appliance_label'] = kwargs['appliance_label']
kwargs.pop('appliance_label')
kwargs["lifecycle_state"] = "CANCELLED"
ctx.invoke(transferappliance_cli.update_transfer_appliance, **kwargs)
@cli_util.copy_params_from_generated_command(transferappliance_cli.delete_transfer_appliance, params_to_exclude=['id', 'transfer_appliance_label'])
@transferappliance_cli.transfer_appliance_root_group.command(name=transferappliance_cli.delete_transfer_appliance.name, help=transferappliance_cli.delete_transfer_appliance.name)
@cli_util.option('--job-id', required=True, help=u"""OCID of the Transfer Job""")
@cli_util.option('--appliance-label', required=True, help=u"""Appliance label""")
@click.pass_context
@json_skeleton_utils.json_skeleton_generation_handler({})
@cli_util.wrap_exceptions
def delete_transfer_appliance_extended(ctx, **kwargs):
if 'job_id' in kwargs:
kwargs['id'] = kwargs['job_id']
kwargs.pop('job_id')
if 'appliance_label' in kwargs:
kwargs['transfer_appliance_label'] = kwargs['appliance_label']
kwargs.pop('appliance_label')
kwargs["lifecycle_state"] = "DELETED"
ctx.invoke(transferappliance_cli.update_transfer_appliance, **kwargs)
@cli_util.copy_params_from_generated_command(transferappliance_cli.update_transfer_appliance, params_to_exclude=['id', 'customer_shipping_address', 'transfer_appliance_label', 'lifecycle_state', 'max_wait_seconds', 'wait_interval_seconds', 'wait_for_state', 'if_match'])
@transferappliance_cli.transfer_appliance_root_group.command(name='update-shipping-address', help="""Updates the shipping address""")
@cli_util.option('--job-id', required=True, help=u"""OCID of the Transfer Job""")
@cli_util.option('--appliance-label', required=True, help=u"""Appliance label""")
@cli_util.option('--customer-shipping-address', required=True, type=custom_types.CLI_COMPLEX_TYPE, help=u"""""" + custom_types.cli_complex_type.COMPLEX_TYPE_HELP)
@json_skeleton_utils.get_cli_json_input_option({'customer-shipping-address': {'module': 'dts', 'class': 'ShippingAddress'}})
@click.pass_context
@json_skeleton_utils.json_skeleton_generation_handler(input_params_to_complex_types={'customer-shipping-address': {'module': 'dts', 'class': 'ShippingAddress'}}, output_type={'module': 'dts', 'class': 'TransferAppliance'})
@cli_util.wrap_exceptions
def update_shipping_address_transfer_appliance(ctx, **kwargs):
if 'job_id' in kwargs:
kwargs['id'] = kwargs['job_id']
kwargs.pop('job_id')
if 'appliance_label' in kwargs:
kwargs['transfer_appliance_label'] = kwargs['appliance_label']
kwargs.pop('appliance_label')
ctx.invoke(transferappliance_cli.update_transfer_appliance, **kwargs)
@cli_util.copy_params_from_generated_command(transferappliance_cli.get_transfer_appliance_encryption_passphrase, params_to_exclude=['id', 'transfer_appliance_label'])
@transferappliance_cli.transfer_appliance_root_group.command(name=transferappliance_cli.get_transfer_appliance_encryption_passphrase.name, help="""Gets the transfer appliance encryption passphrase.""")
@cli_util.option('--job-id', required=True, help=u"""OCID of the Transfer Job""")
@cli_util.option('--appliance-label', required=True, help=u"""Appliance label""")
@click.pass_context
@json_skeleton_utils.json_skeleton_generation_handler({})
@cli_util.wrap_exceptions
def get_passphrase_extended(ctx, **kwargs):
if 'job_id' in kwargs:
kwargs['id'] = kwargs['job_id']
kwargs.pop('job_id')
if 'appliance_label' in kwargs:
kwargs['transfer_appliance_label'] = kwargs['appliance_label']
kwargs.pop('appliance_label')
ctx.invoke(transferappliance_cli.get_transfer_appliance_encryption_passphrase, **kwargs)
| 59.195946
| 270
| 0.781988
| 1,135
| 8,761
| 5.667841
| 0.093392
| 0.134774
| 0.032333
| 0.036997
| 0.882636
| 0.859785
| 0.825742
| 0.804601
| 0.795741
| 0.78688
| 0
| 0.001125
| 0.08652
| 8,761
| 147
| 271
| 59.598639
| 0.802699
| 0.010273
| 0
| 0.716535
| 0
| 0
| 0.229119
| 0.066913
| 0
| 0
| 0
| 0
| 0
| 1
| 0.062992
| false
| 0.094488
| 0.047244
| 0
| 0.110236
| 0.007874
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
|
0
| 8
|
32ab298afca3cf99e598e0642c31a1a986089ca0
| 2,590
|
py
|
Python
|
src/getters.py
|
gabogomes/web_scraper
|
d694bf31c76d3f45eb3acf833ae8bc8861c65b15
|
[
"MIT"
] | null | null | null |
src/getters.py
|
gabogomes/web_scraper
|
d694bf31c76d3f45eb3acf833ae8bc8861c65b15
|
[
"MIT"
] | null | null | null |
src/getters.py
|
gabogomes/web_scraper
|
d694bf31c76d3f45eb3acf833ae8bc8861c65b15
|
[
"MIT"
] | null | null | null |
import requests
from bs4 import BeautifulSoup
def get_css_files(url):
# Faz o Request ao URL e obtém objeto de resposta
response=requests.get(url)
# Etapa de parsing
soup=BeautifulSoup(response.text, 'html.parser')
# Encontra todos os hyperlinks presentes na webpage
links=soup.find_all('link')
i=0
try:
for link in links:
# Aqui eu faço uma restrição para obter somente arquivos PDF
if ('.css' in link.get('href')):
i += 1
factor = i
print("Baixando arquivo: ", i)
# Obtém objeto de resposta para o link
print(link.get('href'))
response = requests.get(url+link.get('href'))
#response = requests.get(link.get('href'))
# Escreve o conteúdo em arquivos PDF
css=open("css_templates/file_"+str(factor)+".css", 'wb')
css.write(response.content)
css.close()
print("Arquivo ", factor, " baixado")
print("Todos os arquivos baixados com sucesso!")
# Mensagem caso ocorram erros do tipo Runtime, TypeError, NameError
except (RuntimeError, TypeError, NameError):
print("Erro com algum link específico!")
def get_js_files(url):
# Faz o Request ao URL e obtém objeto de resposta
response=requests.get(url)
# Etapa de parsing
soup=BeautifulSoup(response.text, 'html.parser')
# Encontra todos os hyperlinks presentes na webpage
links=soup.find_all('link')
i=0
try:
for link in links:
# Aqui eu faço uma restrição para obter somente arquivos PDF
if ('.js' in link.get('href')):
i += 1
factor = i
print("Baixando arquivo: ", i)
# Obtém objeto de resposta para o link
print(link.get('href'))
response = requests.get(url+link.get('href'))
#response = requests.get(link.get('href'))
# Escreve o conteúdo em arquivos PDF
js=open("js_templates/file_"+str(factor)+".txt", 'wb')
js.write(response.content)
js.close()
print("Arquivo ", factor, " baixado")
print("Todos os arquivos baixados com sucesso!")
# Mensagem caso ocorram erros do tipo Runtime, TypeError, NameError
except (RuntimeError, TypeError, NameError):
print("Erro com algum link específico!")
| 31.204819
| 72
| 0.557529
| 298
| 2,590
| 4.812081
| 0.302013
| 0.039052
| 0.061367
| 0.058577
| 0.871688
| 0.871688
| 0.871688
| 0.871688
| 0.871688
| 0.871688
| 0
| 0.002948
| 0.345174
| 2,590
| 82
| 73
| 31.585366
| 0.842571
| 0.272201
| 0
| 0.714286
| 0
| 0
| 0.170236
| 0
| 0
| 0
| 0
| 0.012195
| 0
| 1
| 0.047619
| false
| 0
| 0.047619
| 0
| 0.095238
| 0.238095
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
32be924f26d6f81e432dede9a37728d714ee70b7
| 171
|
py
|
Python
|
Project3_NeuralNetwork/Pca.py
|
Unrealluver/CV-Projects
|
a293262200057dee40758f09fcd35a4d6722311b
|
[
"MIT"
] | null | null | null |
Project3_NeuralNetwork/Pca.py
|
Unrealluver/CV-Projects
|
a293262200057dee40758f09fcd35a4d6722311b
|
[
"MIT"
] | null | null | null |
Project3_NeuralNetwork/Pca.py
|
Unrealluver/CV-Projects
|
a293262200057dee40758f09fcd35a4d6722311b
|
[
"MIT"
] | null | null | null |
from sklearn.decomposition import PCA
def pca_process(X, n_components):
# n_components 选择要下降到多少维度
X = PCA(n_components=n_components).fit_transform(X)
return X
| 28.5
| 55
| 0.766082
| 25
| 171
| 5
| 0.56
| 0.352
| 0.192
| 0.352
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.157895
| 171
| 6
| 56
| 28.5
| 0.868056
| 0.134503
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.25
| false
| 0
| 0.25
| 0
| 0.75
| 0
| 1
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 1
| 0
|
0
| 7
|
088dfe84ad9736688d7bfec4dd73ad9a8f4c1347
| 138
|
py
|
Python
|
kolibri/core/context_processors/custom_context_processor.py
|
MBKayro/kolibri
|
0a38a5fb665503cf8f848b2f65938e73bfaa5989
|
[
"MIT"
] | 545
|
2016-01-19T19:26:55.000Z
|
2022-03-20T00:13:04.000Z
|
kolibri/core/context_processors/custom_context_processor.py
|
MBKayro/kolibri
|
0a38a5fb665503cf8f848b2f65938e73bfaa5989
|
[
"MIT"
] | 8,329
|
2016-01-19T19:32:02.000Z
|
2022-03-31T21:23:12.000Z
|
kolibri/core/context_processors/custom_context_processor.py
|
MBKayro/kolibri
|
0a38a5fb665503cf8f848b2f65938e73bfaa5989
|
[
"MIT"
] | 493
|
2016-01-19T19:26:48.000Z
|
2022-03-28T14:35:05.000Z
|
from django.conf import settings
def developer_mode(request):
return {"developer_mode": getattr(settings, "DEVELOPER_MODE", False)}
| 23
| 73
| 0.768116
| 17
| 138
| 6.058824
| 0.705882
| 0.378641
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.123188
| 138
| 5
| 74
| 27.6
| 0.85124
| 0
| 0
| 0
| 0
| 0
| 0.202899
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.333333
| false
| 0
| 0.333333
| 0.333333
| 1
| 0
| 1
| 0
| 0
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 1
| 1
| 0
|
0
| 7
|
08984edc69194382acc07847621dc2108870f905
| 4,595
|
py
|
Python
|
tests/parser/others.esra.blocks.b.test.py
|
veltri/DLV2
|
944aaef803aa75e7ec51d7e0c2b0d964687fdd0e
|
[
"Apache-2.0"
] | null | null | null |
tests/parser/others.esra.blocks.b.test.py
|
veltri/DLV2
|
944aaef803aa75e7ec51d7e0c2b0d964687fdd0e
|
[
"Apache-2.0"
] | null | null | null |
tests/parser/others.esra.blocks.b.test.py
|
veltri/DLV2
|
944aaef803aa75e7ec51d7e0c2b0d964687fdd0e
|
[
"Apache-2.0"
] | null | null | null |
input = """
% Date: Wed, 14 Oct 1998 10:22:30 -0500 (CDT)
% From: Esra Erdem <esra@cs.utexas.edu>
% To: Gerald Pfeifer <pfeifer@dbai.tuwien.ac.at>
% Message-ID: <Pine.LNX.3.96.981014101559.22229A-100000@pillbox.cs.utexas.edu>
%
% This is the version for smodels, where I have replaced the compute{} statement
% by a query and resolved two EDB/IDB problems by adding a rule of the form
% sth :- true. [Gerald, 14.10.1998]
% non(B,L,T) represents the classical negation of on(B,L,T), and similarly
% for the other predicates with mysterious names beginning with n.
% effect of moving a block
true.
on(B,L,T1) :- block(B),location(L),move(B,L,T),next(T,T1).
% a block can be moved only when it's clear and the goal location is clear
false :- move(B,L,T),on(B1,B,T).
false :- block(B1),move(B,B1,T),on(B2,B1,T).
% wherever a block is, it's not anywhere else
non_(B,L1,T) :- on(B,L,T),location(L1),not eq(L,L1).
% a block is never on top of itself
false :- block(B),time(T),on(B,B,T).
% no actions are executed at last time
false :- move(B,L,T), not nlasttime(T).
% no concurrency
false :- move(B,L,T),move(B1,L1,T),not eq(B,B1).
false :- move(B,L,T),move(B1,L1,T),not eq(L,L1).
% inertia
on(B,L,T1) :- on(B,L,T),not non_(B,L,T1),next(T,T1).
non_(B,L,T1) :- non_(B,L,T),not on(B,L,T1),next(T,T1).
% initial values and actions are exogeneous
on(B,L,0) :- block(B),location(L),not non_(B,L,0).
non_(B,L,0) :- block(B),location(L),not on(B,L,0).
move(B,L,T) :- block(B),location(L),time(T), not nmove(B,L,T).
nmove(B,L,T) :- block(B),location(L),time(T), not move(B,L,T).
% consistency
false :- on(B,L,T),non_(B,L,T).
false :- move(B,L,T),nmove(B,L,T).
% auxiliary predicates
block(b0). block(b1). block(b2).
next(0,1). next(1,2). next(2,3).
time(0) :- true.
time(T1) :- next(T,T1).
nlasttime(T) :- next(T,T1).
location(L) :- block(L).
location(table) :- true.
eq(L,L) :- location(L).
% planning problem
% compute 1 {not false,
% sussman anomaly
% on(b1, table, 0), on(b2,b0, 0), on(b0, table, 0),
% on(b1, b0, 3), on(b2, b1, 3), on(b0, table, 3)
% }
on(b1, table, 0) ? %not false, on(b1, table, 0), on(b2,b0, 0), on(b0, table, 0), on(b1, b0, 3), on(b2, b1, 3), on(b0, table, 3)?
"""
output = """
% Date: Wed, 14 Oct 1998 10:22:30 -0500 (CDT)
% From: Esra Erdem <esra@cs.utexas.edu>
% To: Gerald Pfeifer <pfeifer@dbai.tuwien.ac.at>
% Message-ID: <Pine.LNX.3.96.981014101559.22229A-100000@pillbox.cs.utexas.edu>
%
% This is the version for smodels, where I have replaced the compute{} statement
% by a query and resolved two EDB/IDB problems by adding a rule of the form
% sth :- true. [Gerald, 14.10.1998]
% non(B,L,T) represents the classical negation of on(B,L,T), and similarly
% for the other predicates with mysterious names beginning with n.
% effect of moving a block
true.
on(B,L,T1) :- block(B),location(L),move(B,L,T),next(T,T1).
% a block can be moved only when it's clear and the goal location is clear
false :- move(B,L,T),on(B1,B,T).
false :- block(B1),move(B,B1,T),on(B2,B1,T).
% wherever a block is, it's not anywhere else
non_(B,L1,T) :- on(B,L,T),location(L1),not eq(L,L1).
% a block is never on top of itself
false :- block(B),time(T),on(B,B,T).
% no actions are executed at last time
false :- move(B,L,T), not nlasttime(T).
% no concurrency
false :- move(B,L,T),move(B1,L1,T),not eq(B,B1).
false :- move(B,L,T),move(B1,L1,T),not eq(L,L1).
% inertia
on(B,L,T1) :- on(B,L,T),not non_(B,L,T1),next(T,T1).
non_(B,L,T1) :- non_(B,L,T),not on(B,L,T1),next(T,T1).
% initial values and actions are exogeneous
on(B,L,0) :- block(B),location(L),not non_(B,L,0).
non_(B,L,0) :- block(B),location(L),not on(B,L,0).
move(B,L,T) :- block(B),location(L),time(T), not nmove(B,L,T).
nmove(B,L,T) :- block(B),location(L),time(T), not move(B,L,T).
% consistency
false :- on(B,L,T),non_(B,L,T).
false :- move(B,L,T),nmove(B,L,T).
% auxiliary predicates
block(b0). block(b1). block(b2).
next(0,1). next(1,2). next(2,3).
time(0) :- true.
time(T1) :- next(T,T1).
nlasttime(T) :- next(T,T1).
location(L) :- block(L).
location(table) :- true.
eq(L,L) :- location(L).
% planning problem
% compute 1 {not false,
% sussman anomaly
% on(b1, table, 0), on(b2,b0, 0), on(b0, table, 0),
% on(b1, b0, 3), on(b2, b1, 3), on(b0, table, 3)
% }
on(b1, table, 0) ? %not false, on(b1, table, 0), on(b2,b0, 0), on(b0, table, 0), on(b1, b0, 3), on(b2, b1, 3), on(b0, table, 3)?
"""
| 25.960452
| 129
| 0.610881
| 914
| 4,595
| 3.055799
| 0.142232
| 0.038668
| 0.038668
| 0.0401
| 0.996062
| 0.996062
| 0.996062
| 0.996062
| 0.996062
| 0.996062
| 0
| 0.06467
| 0.17889
| 4,595
| 176
| 130
| 26.107955
| 0.67559
| 0
| 0
| 0.962963
| 0
| 0.296296
| 0.992991
| 0.227447
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 9
|
3ec7091ec5c1783e0cf99f2f40d55b372d54f92b
| 134
|
py
|
Python
|
graph_db/driver/null/__init__.py
|
josegomezr/graph_db
|
1ef286c9afdd4fd18559cccee9456dbc72ba7a8d
|
[
"Apache-2.0"
] | 4
|
2015-11-19T01:22:19.000Z
|
2020-09-05T03:03:24.000Z
|
graph_db/driver/null/__init__.py
|
josegomezr/graph_db
|
1ef286c9afdd4fd18559cccee9456dbc72ba7a8d
|
[
"Apache-2.0"
] | 1
|
2016-03-10T01:11:03.000Z
|
2016-03-10T01:11:03.000Z
|
graph_db/driver/null/__init__.py
|
josegomezr/graph_db
|
1ef286c9afdd4fd18559cccee9456dbc72ba7a8d
|
[
"Apache-2.0"
] | 1
|
2016-03-08T00:03:18.000Z
|
2016-03-08T00:03:18.000Z
|
from . import driver
from ... import exceptions
def Factory(settings):
"""@todo docstring"""
return driver.DBDriver(settings)
| 22.333333
| 36
| 0.708955
| 15
| 134
| 6.333333
| 0.733333
| 0.210526
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.164179
| 134
| 6
| 36
| 22.333333
| 0.848214
| 0.11194
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.166667
| 0
| 1
| 0.25
| false
| 0
| 0.5
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 1
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
3ed1508238cc2b02ae2fac063ced2138c797682e
| 110
|
py
|
Python
|
DataTime/ClassificationGen/__init__.py
|
aymanabid10/DataTime
|
52de2a841aa211ca6c1c54e0ea3c1be863919b14
|
[
"Apache-2.0"
] | null | null | null |
DataTime/ClassificationGen/__init__.py
|
aymanabid10/DataTime
|
52de2a841aa211ca6c1c54e0ea3c1be863919b14
|
[
"Apache-2.0"
] | null | null | null |
DataTime/ClassificationGen/__init__.py
|
aymanabid10/DataTime
|
52de2a841aa211ca6c1c54e0ea3c1be863919b14
|
[
"Apache-2.0"
] | null | null | null |
from .Generator import DataImageGenerator
#from DataTime.ClassificationGen.Generator import DataImageGenerator
| 55
| 68
| 0.9
| 10
| 110
| 9.9
| 0.6
| 0.30303
| 0.666667
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.063636
| 110
| 2
| 68
| 55
| 0.961165
| 0.609091
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
3ee827982621f155496302fd98d61265c7cde17b
| 2,225
|
py
|
Python
|
dryadic/learning/stan/margins/stan_models.py
|
ohsu-comp-bio/dryads
|
015f6d3186a5146809334e2490c072e675b22891
|
[
"MIT"
] | null | null | null |
dryadic/learning/stan/margins/stan_models.py
|
ohsu-comp-bio/dryads
|
015f6d3186a5146809334e2490c072e675b22891
|
[
"MIT"
] | null | null | null |
dryadic/learning/stan/margins/stan_models.py
|
ohsu-comp-bio/dryads
|
015f6d3186a5146809334e2490c072e675b22891
|
[
"MIT"
] | null | null | null |
gauss_model = '''
data {
int<lower=1> Nw; // number of wild-type samples
int<lower=1> Nm; // number of mutated samples
int<lower=1> G; // number of genetic features
matrix[Nw, G] expr_w; // wild-type RNA-seq expression values
matrix[Nm, G] expr_m; // mutated RNA-seq expression values
real wt_distr[2]; // wild-type label distribution
real mut_distr[2]; // mutated label distribution
real alpha; // feature coefficient regularization
}
parameters {
real intercept;
vector[G] gn_wghts;
}
model {
vector[Nw] stat_w;
vector[Nm] stat_m;
intercept ~ normal(0, 1.0);
gn_wghts ~ normal(0, alpha);
stat_w = intercept + expr_w * gn_wghts;
stat_m = intercept + expr_m * gn_wghts;
target += (normal_lpdf(stat_w | wt_distr[1], wt_distr[2])
* ((Nm * 1.0) / Nw));
target += (normal_lpdf(stat_m | mut_distr[1], mut_distr[2])
* ((Nw * 1.0) / Nm));
}
'''
cauchy_model = '''
data {
int<lower=1> Nw; // number of wild-type samples
int<lower=1> Nm; // number of mutated samples
int<lower=1> G; // number of genetic features
matrix[Nw, G] expr_w; // wild-type RNA-seq expression values
matrix[Nm, G] expr_m; // mutated RNA-seq expression values
real wt_distr[2]; // wild-type label distribution
real mut_distr[2]; // mutated label distribution
real alpha; // feature coefficient regularization
}
parameters {
real intercept;
vector[G] gn_wghts;
}
model {
vector[Nw] stat_w;
vector[Nm] stat_m;
intercept ~ normal(0, 1.0);
gn_wghts ~ cauchy(0, alpha);
stat_w = intercept + expr_w * gn_wghts;
stat_m = intercept + expr_m * gn_wghts;
target += (normal_lpdf(stat_w | wt_distr[1], wt_distr[2])
* ((Nm * 1.0) / Nw));
target += (normal_lpdf(stat_m | mut_distr[1], mut_distr[2])
* ((Nw * 1.0) / Nm));
}
'''
| 29.666667
| 74
| 0.525393
| 278
| 2,225
| 4.039568
| 0.169065
| 0.042743
| 0.048085
| 0.05699
| 0.979519
| 0.979519
| 0.979519
| 0.979519
| 0.979519
| 0.979519
| 0
| 0.023726
| 0.355955
| 2,225
| 74
| 75
| 30.067568
| 0.759944
| 0
| 0
| 0.821429
| 0
| 0
| 0.979757
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
f5c038d69e73bfddd1f1a093083cf9909bfcc5f6
| 75
|
py
|
Python
|
asproxy/cli.py
|
nnnewb/asproxy
|
076cb5a55026835f1cf8f5929a05cccfd3faa172
|
[
"WTFPL"
] | 1
|
2019-08-03T16:13:34.000Z
|
2019-08-03T16:13:34.000Z
|
asproxy/cli.py
|
nnnewb/asproxy
|
076cb5a55026835f1cf8f5929a05cccfd3faa172
|
[
"WTFPL"
] | null | null | null |
asproxy/cli.py
|
nnnewb/asproxy
|
076cb5a55026835f1cf8f5929a05cccfd3faa172
|
[
"WTFPL"
] | 1
|
2019-11-23T16:37:57.000Z
|
2019-11-23T16:37:57.000Z
|
from runpy import run_module
def main():
exit(run_module('asproxy'))
| 12.5
| 31
| 0.706667
| 11
| 75
| 4.636364
| 0.818182
| 0.352941
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.173333
| 75
| 5
| 32
| 15
| 0.822581
| 0
| 0
| 0
| 0
| 0
| 0.093333
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.333333
| true
| 0
| 0.333333
| 0
| 0.666667
| 0
| 1
| 0
| 0
| null | 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
de255c20daa4e2dd3c0d1745fdf7900f5a951364
| 95
|
py
|
Python
|
gym_delta_robot_trampoline/envs/__init__.py
|
RicoJia/delta_robot_trampoline
|
8fa09dbd7d62311daf09a9b11b58196464f37483
|
[
"BSD-2-Clause"
] | 3
|
2021-05-29T14:45:10.000Z
|
2021-09-17T07:30:40.000Z
|
gym_delta_robot_trampoline/envs/__init__.py
|
RicoJia/delta_robot_trampoline
|
8fa09dbd7d62311daf09a9b11b58196464f37483
|
[
"BSD-2-Clause"
] | null | null | null |
gym_delta_robot_trampoline/envs/__init__.py
|
RicoJia/delta_robot_trampoline
|
8fa09dbd7d62311daf09a9b11b58196464f37483
|
[
"BSD-2-Clause"
] | 1
|
2020-11-23T21:26:32.000Z
|
2020-11-23T21:26:32.000Z
|
from gym_delta_robot_trampoline.envs.delta_robot_trampoline_env import DeltaRobotTrampolineEnv
| 47.5
| 94
| 0.936842
| 12
| 95
| 6.916667
| 0.75
| 0.240964
| 0.481928
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.042105
| 95
| 1
| 95
| 95
| 0.912088
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
de81abc2d0e134f34aca3b226f2ce02d95d4ff8d
| 340
|
py
|
Python
|
thoipapy/feature_importance/__init__.py
|
bojigu/thoipapy
|
cc571677bd7e25e73db07af9d5d3c2cc36682903
|
[
"MIT"
] | 2
|
2018-04-06T15:59:52.000Z
|
2019-01-19T06:14:22.000Z
|
thoipapy/feature_importance/__init__.py
|
bojigu/thoipapy
|
cc571677bd7e25e73db07af9d5d3c2cc36682903
|
[
"MIT"
] | 17
|
2018-06-20T14:41:39.000Z
|
2022-03-12T00:50:25.000Z
|
thoipapy/feature_importance/__init__.py
|
bojigu/thoipapy
|
cc571677bd7e25e73db07af9d5d3c2cc36682903
|
[
"MIT"
] | null | null | null |
import thoipapy.feature_importance.anova
import thoipapy.feature_importance.ensemble_rfe
import thoipapy.feature_importance.mean_decrease_accuracy
import thoipapy.feature_importance.mean_decrease_impurity
import thoipapy.feature_importance.merge
import thoipapy.feature_importance.plots
import thoipapy.feature_importance.remove_duplicates
| 42.5
| 57
| 0.917647
| 41
| 340
| 7.292683
| 0.365854
| 0.327759
| 0.491639
| 0.725753
| 0.287625
| 0.287625
| 0
| 0
| 0
| 0
| 0
| 0
| 0.041176
| 340
| 7
| 58
| 48.571429
| 0.917178
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
9d17f435de4279133b2605a6e4c59d38472fe1c7
| 325
|
py
|
Python
|
venv/lib/python3.6/site-packages/callback/signals.py
|
GalenWang2017/ABOUT-NUTRITION
|
bef4cf6f171b82d5e30d30c05400d03633fd0838
|
[
"MIT"
] | null | null | null |
venv/lib/python3.6/site-packages/callback/signals.py
|
GalenWang2017/ABOUT-NUTRITION
|
bef4cf6f171b82d5e30d30c05400d03633fd0838
|
[
"MIT"
] | null | null | null |
venv/lib/python3.6/site-packages/callback/signals.py
|
GalenWang2017/ABOUT-NUTRITION
|
bef4cf6f171b82d5e30d30c05400d03633fd0838
|
[
"MIT"
] | null | null | null |
from django import dispatch
stored_callback = dispatch.Signal(
providing_args=['callback_instance', 'model_instance'],
)
processed_callback = dispatch.Signal(
providing_args=['callback_instance', 'model_instance'],
)
error_callback = dispatch.Signal(
providing_args=['callback_instance', 'model_instance'],
)
| 21.666667
| 59
| 0.763077
| 34
| 325
| 6.941176
| 0.382353
| 0.20339
| 0.279661
| 0.394068
| 0.813559
| 0.813559
| 0.813559
| 0.813559
| 0.813559
| 0
| 0
| 0
| 0.116923
| 325
| 14
| 60
| 23.214286
| 0.8223
| 0
| 0
| 0.3
| 0
| 0
| 0.286154
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.1
| 0
| 0.1
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 8
|
19db9a2f1c25c9fb3ecbf3d4950817aff204c859
| 182
|
py
|
Python
|
starfs/__init__.py
|
IQcollaboratory/starFS
|
7716454d28f77f513fdf3d9b525cf6756e1c93aa
|
[
"MIT"
] | 1
|
2020-02-05T19:11:52.000Z
|
2020-02-05T19:11:52.000Z
|
starfs/__init__.py
|
IQcollaboratory/starFS
|
7716454d28f77f513fdf3d9b525cf6756e1c93aa
|
[
"MIT"
] | null | null | null |
starfs/__init__.py
|
IQcollaboratory/starFS
|
7716454d28f77f513fdf3d9b525cf6756e1c93aa
|
[
"MIT"
] | null | null | null |
import os
# Path to light repo data
_MNULFI_DATA_DIR=os.path.join(os.path.dirname(os.path.dirname(os.path.realpath(__file__))), 'dat')
def dat_dir():
return _MNULFI_DATA_DIR
| 22.75
| 98
| 0.747253
| 31
| 182
| 4.032258
| 0.516129
| 0.24
| 0.208
| 0.24
| 0.256
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.120879
| 182
| 7
| 99
| 26
| 0.78125
| 0.126374
| 0
| 0
| 0
| 0
| 0.019355
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.25
| false
| 0
| 0.25
| 0.25
| 0.75
| 0
| 0
| 0
| 0
| null | 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 1
| 1
| 0
|
0
| 7
|
dfc3efc97a4347b98a1fb1073c0fb0508459ead0
| 993
|
py
|
Python
|
tests/integration/exercises/R/ch1/test_ex1.py
|
lair001/data-structures-and-algorithms-in-python-solutions
|
dc0364159f2ad4e51f3f7434e6de9a1742ccb9dc
|
[
"MIT"
] | 8
|
2018-07-09T07:01:28.000Z
|
2020-09-01T06:31:52.000Z
|
tests/integration/exercises/R/ch1/test_ex1.py
|
lair001/data-structures-and-algorithms-in-python-solutions
|
dc0364159f2ad4e51f3f7434e6de9a1742ccb9dc
|
[
"MIT"
] | null | null | null |
tests/integration/exercises/R/ch1/test_ex1.py
|
lair001/data-structures-and-algorithms-in-python-solutions
|
dc0364159f2ad4e51f3f7434e6de9a1742ccb9dc
|
[
"MIT"
] | 1
|
2018-10-15T06:29:17.000Z
|
2018-10-15T06:29:17.000Z
|
from os import path as os_path
from tests.libs.utils.shell import get_stdout_for_cmd
def test_using_modulo_when_multiple():
cmd = [os_path.join("solutions", "exercises", "R", "ch1", "ex1", "using_modulo"), "4", "2"]
result = get_stdout_for_cmd(cmd)
assert result == "4 is a multiple of 2.\n"
def test_using_modulo_when_not_multiple():
cmd = [os_path.join("solutions", "exercises", "R", "ch1", "ex1", "using_modulo"), "5", "3"]
result = get_stdout_for_cmd(cmd)
assert result == "5 is not a multiple of 3.\n"
def test_without_modulo_when_multiple():
cmd = [os_path.join("solutions", "exercises", "R", "ch1", "ex1", "without_modulo"), "4", "2"]
result = get_stdout_for_cmd(cmd)
assert result == "4 is a multiple of 2.\n"
def test_without_modulo_when_not_multiple():
cmd = [os_path.join("solutions", "exercises", "R", "ch1", "ex1", "without_modulo"), "5", "3"]
result = get_stdout_for_cmd(cmd)
assert result == "5 is not a multiple of 3.\n"
| 36.777778
| 97
| 0.666667
| 157
| 993
| 3.949045
| 0.235669
| 0.048387
| 0.096774
| 0.120968
| 0.890323
| 0.862903
| 0.829032
| 0.829032
| 0.829032
| 0.829032
| 0
| 0.028951
| 0.165156
| 993
| 26
| 98
| 38.192308
| 0.718938
| 0
| 0
| 0.444444
| 0
| 0
| 0.261833
| 0
| 0
| 0
| 0
| 0
| 0.222222
| 1
| 0.222222
| false
| 0
| 0.111111
| 0
| 0.333333
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
5f1b89a26dc46feb64d3478876f1aeb474793ec5
| 18,504
|
py
|
Python
|
yandex/cloud/apploadbalancer/v1/backend_group_service_pb2_grpc.py
|
korsar182/python-sdk
|
873bf2a9b136a8f2faae72e86fae1f5b5c3d896a
|
[
"MIT"
] | 36
|
2018-12-23T13:51:50.000Z
|
2022-03-25T07:48:24.000Z
|
yandex/cloud/apploadbalancer/v1/backend_group_service_pb2_grpc.py
|
korsar182/python-sdk
|
873bf2a9b136a8f2faae72e86fae1f5b5c3d896a
|
[
"MIT"
] | 15
|
2019-02-28T04:55:09.000Z
|
2022-03-06T23:17:24.000Z
|
yandex/cloud/apploadbalancer/v1/backend_group_service_pb2_grpc.py
|
korsar182/python-sdk
|
873bf2a9b136a8f2faae72e86fae1f5b5c3d896a
|
[
"MIT"
] | 18
|
2019-02-23T07:10:57.000Z
|
2022-03-28T14:41:08.000Z
|
# Generated by the gRPC Python protocol compiler plugin. DO NOT EDIT!
"""Client and server classes corresponding to protobuf-defined services."""
import grpc
from yandex.cloud.apploadbalancer.v1 import backend_group_pb2 as yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__pb2
from yandex.cloud.apploadbalancer.v1 import backend_group_service_pb2 as yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2
from yandex.cloud.operation import operation_pb2 as yandex_dot_cloud_dot_operation_dot_operation__pb2
class BackendGroupServiceStub(object):
"""A set of methods for managing backend groups.
"""
def __init__(self, channel):
"""Constructor.
Args:
channel: A grpc.Channel.
"""
self.Get = channel.unary_unary(
'/yandex.cloud.apploadbalancer.v1.BackendGroupService/Get',
request_serializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.GetBackendGroupRequest.SerializeToString,
response_deserializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__pb2.BackendGroup.FromString,
)
self.List = channel.unary_unary(
'/yandex.cloud.apploadbalancer.v1.BackendGroupService/List',
request_serializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.ListBackendGroupsRequest.SerializeToString,
response_deserializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.ListBackendGroupsResponse.FromString,
)
self.Create = channel.unary_unary(
'/yandex.cloud.apploadbalancer.v1.BackendGroupService/Create',
request_serializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.CreateBackendGroupRequest.SerializeToString,
response_deserializer=yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.FromString,
)
self.Update = channel.unary_unary(
'/yandex.cloud.apploadbalancer.v1.BackendGroupService/Update',
request_serializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.UpdateBackendGroupRequest.SerializeToString,
response_deserializer=yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.FromString,
)
self.Delete = channel.unary_unary(
'/yandex.cloud.apploadbalancer.v1.BackendGroupService/Delete',
request_serializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.DeleteBackendGroupRequest.SerializeToString,
response_deserializer=yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.FromString,
)
self.AddBackend = channel.unary_unary(
'/yandex.cloud.apploadbalancer.v1.BackendGroupService/AddBackend',
request_serializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.AddBackendRequest.SerializeToString,
response_deserializer=yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.FromString,
)
self.RemoveBackend = channel.unary_unary(
'/yandex.cloud.apploadbalancer.v1.BackendGroupService/RemoveBackend',
request_serializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.RemoveBackendRequest.SerializeToString,
response_deserializer=yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.FromString,
)
self.UpdateBackend = channel.unary_unary(
'/yandex.cloud.apploadbalancer.v1.BackendGroupService/UpdateBackend',
request_serializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.UpdateBackendRequest.SerializeToString,
response_deserializer=yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.FromString,
)
self.ListOperations = channel.unary_unary(
'/yandex.cloud.apploadbalancer.v1.BackendGroupService/ListOperations',
request_serializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.ListBackendGroupOperationsRequest.SerializeToString,
response_deserializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.ListBackendGroupOperationsResponse.FromString,
)
class BackendGroupServiceServicer(object):
"""A set of methods for managing backend groups.
"""
def Get(self, request, context):
"""Returns the specified backend group.
To get the list of all available backend groups, make a [List] request.
"""
context.set_code(grpc.StatusCode.UNIMPLEMENTED)
context.set_details('Method not implemented!')
raise NotImplementedError('Method not implemented!')
def List(self, request, context):
"""Lists backend groups in the specified folder.
"""
context.set_code(grpc.StatusCode.UNIMPLEMENTED)
context.set_details('Method not implemented!')
raise NotImplementedError('Method not implemented!')
def Create(self, request, context):
"""Creates a backend group in the specified folder.
"""
context.set_code(grpc.StatusCode.UNIMPLEMENTED)
context.set_details('Method not implemented!')
raise NotImplementedError('Method not implemented!')
def Update(self, request, context):
"""Updates the specified backend group.
"""
context.set_code(grpc.StatusCode.UNIMPLEMENTED)
context.set_details('Method not implemented!')
raise NotImplementedError('Method not implemented!')
def Delete(self, request, context):
"""Deletes the specified backend group.
"""
context.set_code(grpc.StatusCode.UNIMPLEMENTED)
context.set_details('Method not implemented!')
raise NotImplementedError('Method not implemented!')
def AddBackend(self, request, context):
"""Adds backends to the specified backend group.
"""
context.set_code(grpc.StatusCode.UNIMPLEMENTED)
context.set_details('Method not implemented!')
raise NotImplementedError('Method not implemented!')
def RemoveBackend(self, request, context):
"""Removes backends from the specified backend group.
"""
context.set_code(grpc.StatusCode.UNIMPLEMENTED)
context.set_details('Method not implemented!')
raise NotImplementedError('Method not implemented!')
def UpdateBackend(self, request, context):
"""Updates the specified backend.
"""
context.set_code(grpc.StatusCode.UNIMPLEMENTED)
context.set_details('Method not implemented!')
raise NotImplementedError('Method not implemented!')
def ListOperations(self, request, context):
"""Lists operations for the specified backend group.
"""
context.set_code(grpc.StatusCode.UNIMPLEMENTED)
context.set_details('Method not implemented!')
raise NotImplementedError('Method not implemented!')
def add_BackendGroupServiceServicer_to_server(servicer, server):
rpc_method_handlers = {
'Get': grpc.unary_unary_rpc_method_handler(
servicer.Get,
request_deserializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.GetBackendGroupRequest.FromString,
response_serializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__pb2.BackendGroup.SerializeToString,
),
'List': grpc.unary_unary_rpc_method_handler(
servicer.List,
request_deserializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.ListBackendGroupsRequest.FromString,
response_serializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.ListBackendGroupsResponse.SerializeToString,
),
'Create': grpc.unary_unary_rpc_method_handler(
servicer.Create,
request_deserializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.CreateBackendGroupRequest.FromString,
response_serializer=yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.SerializeToString,
),
'Update': grpc.unary_unary_rpc_method_handler(
servicer.Update,
request_deserializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.UpdateBackendGroupRequest.FromString,
response_serializer=yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.SerializeToString,
),
'Delete': grpc.unary_unary_rpc_method_handler(
servicer.Delete,
request_deserializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.DeleteBackendGroupRequest.FromString,
response_serializer=yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.SerializeToString,
),
'AddBackend': grpc.unary_unary_rpc_method_handler(
servicer.AddBackend,
request_deserializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.AddBackendRequest.FromString,
response_serializer=yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.SerializeToString,
),
'RemoveBackend': grpc.unary_unary_rpc_method_handler(
servicer.RemoveBackend,
request_deserializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.RemoveBackendRequest.FromString,
response_serializer=yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.SerializeToString,
),
'UpdateBackend': grpc.unary_unary_rpc_method_handler(
servicer.UpdateBackend,
request_deserializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.UpdateBackendRequest.FromString,
response_serializer=yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.SerializeToString,
),
'ListOperations': grpc.unary_unary_rpc_method_handler(
servicer.ListOperations,
request_deserializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.ListBackendGroupOperationsRequest.FromString,
response_serializer=yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.ListBackendGroupOperationsResponse.SerializeToString,
),
}
generic_handler = grpc.method_handlers_generic_handler(
'yandex.cloud.apploadbalancer.v1.BackendGroupService', rpc_method_handlers)
server.add_generic_rpc_handlers((generic_handler,))
# This class is part of an EXPERIMENTAL API.
class BackendGroupService(object):
"""A set of methods for managing backend groups.
"""
@staticmethod
def Get(request,
target,
options=(),
channel_credentials=None,
call_credentials=None,
insecure=False,
compression=None,
wait_for_ready=None,
timeout=None,
metadata=None):
return grpc.experimental.unary_unary(request, target, '/yandex.cloud.apploadbalancer.v1.BackendGroupService/Get',
yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.GetBackendGroupRequest.SerializeToString,
yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__pb2.BackendGroup.FromString,
options, channel_credentials,
insecure, call_credentials, compression, wait_for_ready, timeout, metadata)
@staticmethod
def List(request,
target,
options=(),
channel_credentials=None,
call_credentials=None,
insecure=False,
compression=None,
wait_for_ready=None,
timeout=None,
metadata=None):
return grpc.experimental.unary_unary(request, target, '/yandex.cloud.apploadbalancer.v1.BackendGroupService/List',
yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.ListBackendGroupsRequest.SerializeToString,
yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.ListBackendGroupsResponse.FromString,
options, channel_credentials,
insecure, call_credentials, compression, wait_for_ready, timeout, metadata)
@staticmethod
def Create(request,
target,
options=(),
channel_credentials=None,
call_credentials=None,
insecure=False,
compression=None,
wait_for_ready=None,
timeout=None,
metadata=None):
return grpc.experimental.unary_unary(request, target, '/yandex.cloud.apploadbalancer.v1.BackendGroupService/Create',
yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.CreateBackendGroupRequest.SerializeToString,
yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.FromString,
options, channel_credentials,
insecure, call_credentials, compression, wait_for_ready, timeout, metadata)
@staticmethod
def Update(request,
target,
options=(),
channel_credentials=None,
call_credentials=None,
insecure=False,
compression=None,
wait_for_ready=None,
timeout=None,
metadata=None):
return grpc.experimental.unary_unary(request, target, '/yandex.cloud.apploadbalancer.v1.BackendGroupService/Update',
yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.UpdateBackendGroupRequest.SerializeToString,
yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.FromString,
options, channel_credentials,
insecure, call_credentials, compression, wait_for_ready, timeout, metadata)
@staticmethod
def Delete(request,
target,
options=(),
channel_credentials=None,
call_credentials=None,
insecure=False,
compression=None,
wait_for_ready=None,
timeout=None,
metadata=None):
return grpc.experimental.unary_unary(request, target, '/yandex.cloud.apploadbalancer.v1.BackendGroupService/Delete',
yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.DeleteBackendGroupRequest.SerializeToString,
yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.FromString,
options, channel_credentials,
insecure, call_credentials, compression, wait_for_ready, timeout, metadata)
@staticmethod
def AddBackend(request,
target,
options=(),
channel_credentials=None,
call_credentials=None,
insecure=False,
compression=None,
wait_for_ready=None,
timeout=None,
metadata=None):
return grpc.experimental.unary_unary(request, target, '/yandex.cloud.apploadbalancer.v1.BackendGroupService/AddBackend',
yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.AddBackendRequest.SerializeToString,
yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.FromString,
options, channel_credentials,
insecure, call_credentials, compression, wait_for_ready, timeout, metadata)
@staticmethod
def RemoveBackend(request,
target,
options=(),
channel_credentials=None,
call_credentials=None,
insecure=False,
compression=None,
wait_for_ready=None,
timeout=None,
metadata=None):
return grpc.experimental.unary_unary(request, target, '/yandex.cloud.apploadbalancer.v1.BackendGroupService/RemoveBackend',
yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.RemoveBackendRequest.SerializeToString,
yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.FromString,
options, channel_credentials,
insecure, call_credentials, compression, wait_for_ready, timeout, metadata)
@staticmethod
def UpdateBackend(request,
target,
options=(),
channel_credentials=None,
call_credentials=None,
insecure=False,
compression=None,
wait_for_ready=None,
timeout=None,
metadata=None):
return grpc.experimental.unary_unary(request, target, '/yandex.cloud.apploadbalancer.v1.BackendGroupService/UpdateBackend',
yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.UpdateBackendRequest.SerializeToString,
yandex_dot_cloud_dot_operation_dot_operation__pb2.Operation.FromString,
options, channel_credentials,
insecure, call_credentials, compression, wait_for_ready, timeout, metadata)
@staticmethod
def ListOperations(request,
target,
options=(),
channel_credentials=None,
call_credentials=None,
insecure=False,
compression=None,
wait_for_ready=None,
timeout=None,
metadata=None):
return grpc.experimental.unary_unary(request, target, '/yandex.cloud.apploadbalancer.v1.BackendGroupService/ListOperations',
yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.ListBackendGroupOperationsRequest.SerializeToString,
yandex_dot_cloud_dot_apploadbalancer_dot_v1_dot_backend__group__service__pb2.ListBackendGroupOperationsResponse.FromString,
options, channel_credentials,
insecure, call_credentials, compression, wait_for_ready, timeout, metadata)
| 53.325648
| 170
| 0.714927
| 1,805
| 18,504
| 6.840997
| 0.071468
| 0.041545
| 0.064626
| 0.078474
| 0.896987
| 0.893181
| 0.880628
| 0.847344
| 0.789278
| 0.785795
| 0
| 0.008273
| 0.222601
| 18,504
| 346
| 171
| 53.479769
| 0.850122
| 0.049287
| 0
| 0.570423
| 1
| 0
| 0.094061
| 0.066083
| 0
| 0
| 0
| 0
| 0
| 1
| 0.070423
| false
| 0
| 0.014085
| 0.03169
| 0.126761
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
a03ac73f9ba77ee7a0e3dc6ae3dc3e481d31b5da
| 8,691
|
py
|
Python
|
growspace/__init__.py
|
YasmeenVH/growspace
|
d153a22a4c7e94f36a265a268a5445c6d4d6d1b1
|
[
"MIT"
] | 18
|
2021-05-11T18:29:08.000Z
|
2022-02-23T21:42:45.000Z
|
growspace/__init__.py
|
YasmeenVH/growspace
|
d153a22a4c7e94f36a265a268a5445c6d4d6d1b1
|
[
"MIT"
] | 2
|
2021-05-19T18:29:12.000Z
|
2021-09-24T20:14:33.000Z
|
growspace/__init__.py
|
YasmeenVH/growspace
|
d153a22a4c7e94f36a265a268a5445c6d4d6d1b1
|
[
"MIT"
] | 1
|
2021-10-02T13:51:50.000Z
|
2021-10-02T13:51:50.000Z
|
from gym.envs.registration import register
#
# register(
# id=f'GrowSpaceEnv-States-v0',
# entry_point='growspace.envs:GrowSpaceEnv',
# kwargs={
# # "observe_images": False
# },
# max_episode_steps=200, # number of total steps in the environment
# )
register(
id=f'GrowSpaceEnv-Control-v0',
entry_point='growspace.envs:GrowSpaceEnv_Control',
kwargs={'obs_type': None, 'level': None, 'setting': None,
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-ControlEasy-v0',
entry_point='growspace.envs:GrowSpaceEnv_Control',
kwargs={'obs_type': None, 'level': None, 'setting': 'easy',
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-ControlHard-v0',
entry_point='growspace.envs:GrowSpaceEnv_Control',
kwargs={'obs_type': None, 'level': None, 'setting': 'hard',
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-Control-v1',
entry_point='growspace.envs:GrowSpaceEnv_Control',
kwargs={'obs_type': 'Binary', 'level': None,
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-ControlEasy-v1',
entry_point='growspace.envs:GrowSpaceEnv_Control',
kwargs={'obs_type': 'binary', 'level': None, 'setting': 'easy',
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-ControlHard-v1',
entry_point='growspace.envs:GrowSpaceEnv_Control',
kwargs={'obs_type': 'binary', 'level': None, 'setting': 'hard',
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-Hierarchy-v0',
entry_point='growspace.envs:GrowSpaceEnv_Control',
kwargs={'obs_type': None, 'level': 'second', 'setting': None,
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-HierarchyEasy-v0',
entry_point='growspace.envs:GrowSpaceEnv_Control',
kwargs={'obs_type': None, 'level': 'second', 'setting': 'easy',
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-HierarchyHard-v0',
entry_point='growspace.envs:GrowSpaceEnv_Control',
kwargs={'obs_type': None, 'level': 'second', 'setting': 'hard',
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-Hierarchy-v1',
entry_point='growspace.envs:GrowSpaceEnv_Control',
kwargs={'obs_type': 'Binary', 'level': 'second', 'setting': None,
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-HierarchyEasy-v1',
entry_point='growspace.envs:GrowSpaceEnv_Control',
kwargs={'obs_type': 'binary', 'level': 'second', 'setting': 'easy',
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-HierarchyHard-v1',
entry_point='growspace.envs:GrowSpaceEnv_Control',
kwargs={'obs_type': 'binary', 'level': 'second', 'setting': 'hard',
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-Fairness-v0',
entry_point='growspace.envs:GrowSpaceEnv_Fairness',
kwargs={'obs_type': None, 'level': None, 'setting': None,
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-FairnessEasy-v0',
entry_point='growspace.envs:GrowSpaceEnv_Fairness',
kwargs={'obs_type': None, 'level': None, 'setting': 'easy',
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-FairnessMiddle-v0',
entry_point='growspace.envs:GrowSpaceEnv_Fairness',
kwargs={'obs_type': None, 'level': None, 'setting': 'hard_middle',
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-FairnessAbove-v0',
entry_point='growspace.envs:GrowSpaceEnv_Fairness',
kwargs={'obs_type': None, 'level': None, 'setting': 'hard_above',
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceEnv-Fairness-v1',
entry_point='growspace.envs:GrowSpaceEnv_Fairness',
kwargs={'obs_type': 'Binary', 'level': 'second',
# "observe_images": True
},
max_episode_steps=50, # number of total steps in the environment
)
register(
id=f'GrowSpaceSpotlight-Mnist0-v0',
entry_point='growspace.envs:GrowSpaceEnvSpotlightMnist',
max_episode_steps=50, # number of total steps in the environment
kwargs={'digit': '0',
},
)
register(
id=f'GrowSpaceSpotlight-Mnist1-v0',
entry_point='growspace.envs:GrowSpaceEnvSpotlightMnist',
max_episode_steps=50, # number of total steps in the environment
kwargs={'digit': '1',
},
)
register(
id=f'GrowSpaceSpotlight-Mnist2-v0',
entry_point='growspace.envs:GrowSpaceEnvSpotlightMnist',
max_episode_steps=70, # number of total steps in the environment
kwargs={'digit': '2',
},
)
register(
id=f'GrowSpaceSpotlight-Mnist3-v0',
entry_point='growspace.envs:GrowSpaceEnvSpotlightMnist',
max_episode_steps=50, # number of total steps in the environment
kwargs={'digit': '3',
},
)
register(
id=f'GrowSpaceSpotlight-Mnist4-v0',
entry_point='growspace.envs:GrowSpaceEnvSpotlightMnist',
max_episode_steps=50, # number of total steps in the environment
kwargs={'digit': '4',
},
)
register(
id=f'GrowSpaceSpotlight-Mnist5-v0',
entry_point='growspace.envs:GrowSpaceEnvSpotlightMnist',
max_episode_steps=50, # number of total steps in the environment
kwargs={'digit': '5',
},
)
register(
id=f'GrowSpaceSpotlight-Mnist6-v0',
entry_point='growspace.envs:GrowSpaceEnvSpotlightMnist',
max_episode_steps=50, # number of total steps in the environment
kwargs={'digit': '6',
},
)
register(
id=f'GrowSpaceSpotlight-Mnist7-v0',
entry_point='growspace.envs:GrowSpaceEnvSpotlightMnist',
max_episode_steps=50, # number of total steps in the environment
kwargs={'digit': '7',
},
)
register(
id=f'GrowSpaceSpotlight-Mnist8-v0',
entry_point='growspace.envs:GrowSpaceEnvSpotlightMnist',
max_episode_steps=50, # number of total steps in the environment
kwargs={'digit': '8',
},
)
register(
id=f'GrowSpaceSpotlight-Mnist9-v0',
entry_point='growspace.envs:GrowSpaceEnvSpotlightMnist',
max_episode_steps=50, # number of total steps in the environment
kwargs={'digit': '9',
},
)
register(
id=f'GrowSpaceSpotlight-Mnist1and7-v0',
entry_point='growspace.envs:GrowSpaceEnvSpotlightMnist',
max_episode_steps=50, # number of total steps in the environment
kwargs={'digit': '1_7_mix',
},
)
register(
id=f'GrowSpaceSpotlight-MnistMix-v0',
entry_point='growspace.envs:GrowSpaceEnvSpotlightMnist',
max_episode_steps=75, # number of total steps in the environment
kwargs={'digit': 'partymix',
},
)
register(
id=f'GrowSpaceSpotlight-MnistCurriculum-v0',
entry_point='growspace.envs:GrowSpaceEnvSpotlightMnist',
max_episode_steps=75, # number of total steps in the environment
kwargs={'digit': 'curriculum',
},
)
# register(
# id=f'GrowSpaceEnv-Mnist-v1',
# entry_point='growspace.envs:GrowSpaceEnv_Mnist',
# kwargs={'obs_type': 'Binary', 'level': None,
# # "observe_images": True
# },
# max_episode_steps=50, # number of total steps in the environment
# )
register(
id=f'GrowSpaceEnv-Continuous-v0',
entry_point='growspace.envs:GrowSpaceContinuous',
max_episode_steps=50,
)
# TOOD(Manuel): Register water
| 30.602113
| 71
| 0.658267
| 986
| 8,691
| 5.641988
| 0.090264
| 0.059321
| 0.065253
| 0.136437
| 0.864821
| 0.860327
| 0.84361
| 0.84361
| 0.84361
| 0.81359
| 0
| 0.018123
| 0.212749
| 8,691
| 283
| 72
| 30.710247
| 0.794943
| 0.245196
| 0
| 0.439815
| 0
| 0
| 0.399692
| 0.312327
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 0.00463
| 0
| 0.00463
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
a05f370d49fc651c20bb863489159d3feebafd7f
| 605
|
py
|
Python
|
day04/test_guards.py
|
richardpanda/advent-of-code-2018
|
adfe22d34bce0951f024d782d6b95595e5414cca
|
[
"MIT"
] | 1
|
2019-09-11T12:23:01.000Z
|
2019-09-11T12:23:01.000Z
|
day04/test_guards.py
|
richardpanda/advent-of-code-2018
|
adfe22d34bce0951f024d782d6b95595e5414cca
|
[
"MIT"
] | null | null | null |
day04/test_guards.py
|
richardpanda/advent-of-code-2018
|
adfe22d34bce0951f024d782d6b95595e5414cca
|
[
"MIT"
] | null | null | null |
from guards import (
find_most_consistently_asleep_guard,
find_most_frequently_asleep_guard,
)
def test_find_most_frequently_asleep_guard():
with open("sample.txt") as f:
assert find_most_consistently_asleep_guard(list(f)) == 4455
with open("input.txt") as f:
assert find_most_consistently_asleep_guard(list(f)) == 96951
def test_find_most_frequently_asleep_guard():
with open("sample.txt") as f:
assert find_most_frequently_asleep_guard(list(f)) == 240
with open("input.txt") as f:
assert find_most_frequently_asleep_guard(list(f)) == 131469
| 28.809524
| 68
| 0.730579
| 87
| 605
| 4.689655
| 0.275862
| 0.156863
| 0.220588
| 0.294118
| 0.916667
| 0.769608
| 0.769608
| 0.769608
| 0.769608
| 0.705882
| 0
| 0.036
| 0.173554
| 605
| 20
| 69
| 30.25
| 0.78
| 0
| 0
| 0.428571
| 0
| 0
| 0.06281
| 0
| 0
| 0
| 0
| 0
| 0.285714
| 1
| 0.142857
| true
| 0
| 0.071429
| 0
| 0.214286
| 0
| 0
| 0
| 0
| null | 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
|
0
| 9
|
a0679e796e20fbaa555c6a7a350d36a981998f17
| 30,295
|
py
|
Python
|
plugins/github/komand_github/actions/add_collaborator/schema.py
|
lukaszlaszuk/insightconnect-plugins
|
8c6ce323bfbb12c55f8b5a9c08975d25eb9f8892
|
[
"MIT"
] | 46
|
2019-06-05T20:47:58.000Z
|
2022-03-29T10:18:01.000Z
|
plugins/github/komand_github/actions/add_collaborator/schema.py
|
lukaszlaszuk/insightconnect-plugins
|
8c6ce323bfbb12c55f8b5a9c08975d25eb9f8892
|
[
"MIT"
] | 386
|
2019-06-07T20:20:39.000Z
|
2022-03-30T17:35:01.000Z
|
plugins/github/komand_github/actions/add_collaborator/schema.py
|
lukaszlaszuk/insightconnect-plugins
|
8c6ce323bfbb12c55f8b5a9c08975d25eb9f8892
|
[
"MIT"
] | 43
|
2019-07-09T14:13:58.000Z
|
2022-03-28T12:04:46.000Z
|
# GENERATED BY KOMAND SDK - DO NOT EDIT
import komand
import json
class Component:
DESCRIPTION = "Adds a user as a collaborator to a GitHub repository"
class Input:
ORGANIZATION = "organization"
PERMISSION = "permission"
REPOSITORY = "repository"
USERNAME = "username"
class Output:
RESULTS = "results"
class AddCollaboratorInput(komand.Input):
schema = json.loads("""
{
"type": "object",
"title": "Variables",
"properties": {
"organization": {
"type": "string",
"title": "Organization",
"description": "Organization the repository is under",
"order": 2
},
"permission": {
"type": "string",
"title": "Permission",
"description": "The permission to grant the collaborator. Only valid on organization-owned repositories",
"default": "push",
"enum": [
"pull",
"push",
"admin"
],
"order": 4
},
"repository": {
"type": "string",
"title": "Repository",
"description": "Repository to add user as a collaborator",
"order": 3
},
"username": {
"type": "string",
"title": "Username",
"description": "Username to add as a collaborator",
"order": 1
}
},
"required": [
"username"
]
}
""")
def __init__(self):
super(self.__class__, self).__init__(self.schema)
class AddCollaboratorOutput(komand.Output):
schema = json.loads("""
{
"type": "object",
"title": "Variables",
"properties": {
"results": {
"$ref": "#/definitions/add_collaborator",
"title": "Results",
"description": "Response from adding a new collaborator",
"order": 1
}
},
"definitions": {
"add_collaborator": {
"type": "object",
"title": "add_collaborator",
"properties": {
"created_at": {
"type": "string",
"title": "Created At",
"order": 6
},
"html_url": {
"type": "string",
"title": "Html Url",
"order": 8
},
"id": {
"type": "integer",
"title": "Id",
"order": 1
},
"invitee": {
"$ref": "#/definitions/collaborator_invite",
"title": "Invitee",
"order": 3
},
"inviter": {
"$ref": "#/definitions/collaborator_invite",
"title": "Inviter",
"order": 4
},
"permission": {
"type": "string",
"title": "Permission",
"order": 5
},
"repository": {
"$ref": "#/definitions/collaborator_repository",
"title": "Repository",
"order": 2
},
"url": {
"type": "string",
"title": "Url",
"order": 7
}
},
"definitions": {
"collaborator_invite": {
"type": "object",
"title": "collaborator_invite",
"properties": {
"avatar_url": {
"type": "string",
"title": "Avatar Url",
"order": 4
},
"events_url": {
"type": "string",
"title": "Events Url",
"order": 15
},
"followers_url": {
"type": "string",
"title": "Followers Url",
"order": 8
},
"following_url": {
"type": "string",
"title": "Following Url",
"order": 9
},
"gists_url": {
"type": "string",
"title": "Gists Url",
"order": 10
},
"gravatar_id": {
"type": "string",
"title": "Gravatar Id",
"order": 5
},
"html_url": {
"type": "string",
"title": "Html Url",
"order": 7
},
"id": {
"type": "integer",
"title": "Id",
"order": 2
},
"login": {
"type": "string",
"title": "Login",
"order": 1
},
"node_id": {
"type": "string",
"title": "Node Id",
"order": 3
},
"organizations_url": {
"type": "string",
"title": "Organizations Url",
"order": 13
},
"received_events_url": {
"type": "string",
"title": "Received Events Url",
"order": 16
},
"repos_url": {
"type": "string",
"title": "Repos Url",
"order": 14
},
"site_admin": {
"type": "boolean",
"title": "Site Admin",
"order": 18
},
"starred_url": {
"type": "string",
"title": "Starred Url",
"order": 11
},
"subscriptions_url": {
"type": "string",
"title": "Subscriptions Url",
"order": 12
},
"type": {
"type": "string",
"title": "Type",
"order": 17
},
"url": {
"type": "string",
"title": "Url",
"order": 6
}
}
},
"collaborator_repository": {
"type": "object",
"title": "collaborator_repository",
"properties": {
"archive_url": {
"type": "string",
"title": "Archive Url",
"order": 11
},
"assignees_url": {
"type": "string",
"title": "Assignees Url",
"order": 12
},
"blobs_url": {
"type": "string",
"title": "Blobs Url",
"order": 13
},
"branches_url": {
"type": "string",
"title": "Branches Url",
"order": 14
},
"collaborators_url": {
"type": "string",
"title": "Collaborators Url",
"order": 15
},
"comments_url": {
"type": "string",
"title": "Comments Url",
"order": 16
},
"commits_url": {
"type": "string",
"title": "Commits Url",
"order": 17
},
"compare_url": {
"type": "string",
"title": "Compare Url",
"order": 18
},
"contents_url": {
"type": "string",
"title": "Contents Url",
"order": 19
},
"contributors_url": {
"type": "string",
"title": "Contributors Url",
"order": 20
},
"deployments_url": {
"type": "string",
"title": "Deployments Url",
"order": 21
},
"description": {
"type": "string",
"title": "Description",
"order": 8
},
"downloads_url": {
"type": "string",
"title": "Downloads Url",
"order": 22
},
"events_url": {
"type": "string",
"title": "Events Url",
"order": 23
},
"fork": {
"type": "boolean",
"title": "Fork",
"order": 9
},
"forks_url": {
"type": "string",
"title": "Forks Url",
"order": 24
},
"full_name": {
"type": "string",
"title": "Full Name",
"order": 4
},
"git_commits_url": {
"type": "string",
"title": "Git Commits Url",
"order": 25
},
"git_refs_url": {
"type": "string",
"title": "Git Refs Url",
"order": 26
},
"git_tags_url": {
"type": "string",
"title": "Git Tags Url",
"order": 27
},
"git_url": {
"type": "string",
"title": "Git Url",
"order": 28
},
"html_url": {
"type": "string",
"title": "Html Url",
"order": 7
},
"id": {
"type": "integer",
"title": "Id",
"order": 1
},
"issue_comment_url": {
"type": "string",
"title": "Issue Comment Url",
"order": 29
},
"issue_events_url": {
"type": "string",
"title": "Issue Events Url",
"order": 30
},
"issues_url": {
"type": "string",
"title": "Issues Url",
"order": 31
},
"keys_url": {
"type": "string",
"title": "Keys Url",
"order": 32
},
"labels_url": {
"type": "string",
"title": "Labels Url",
"order": 33
},
"languages_url": {
"type": "string",
"title": "Languages Url",
"order": 34
},
"merges_url": {
"type": "string",
"title": "Merges Url",
"order": 35
},
"milestones_url": {
"type": "string",
"title": "Milestones Url",
"order": 36
},
"name": {
"type": "string",
"title": "Name",
"order": 3
},
"node_id": {
"type": "string",
"title": "Node Id",
"order": 2
},
"notifications_url": {
"type": "string",
"title": "Notifications Url",
"order": 37
},
"owner": {
"$ref": "#/definitions/organization",
"title": "Owner",
"order": 5
},
"private": {
"type": "boolean",
"title": "Private",
"order": 6
},
"pulls_url": {
"type": "string",
"title": "Pulls Url",
"order": 38
},
"releases_url": {
"type": "string",
"title": "Releases Url",
"order": 39
},
"ssh_url": {
"type": "string",
"title": "Ssh Url",
"order": 40
},
"stargazers_url": {
"type": "string",
"title": "Stargazers Url",
"order": 41
},
"statuses_url": {
"type": "string",
"title": "Statuses Url",
"order": 42
},
"subscribers_url": {
"type": "string",
"title": "Subscribers Url",
"order": 43
},
"subscription_url": {
"type": "string",
"title": "Subscription Url",
"order": 44
},
"tags_url": {
"type": "string",
"title": "Tags Url",
"order": 45
},
"teams_url": {
"type": "string",
"title": "Teams Url",
"order": 46
},
"trees_url": {
"type": "string",
"title": "Trees Url",
"order": 47
},
"url": {
"type": "string",
"title": "Url",
"order": 10
}
},
"definitions": {
"organization": {
"type": "object",
"title": "organization",
"properties": {
"avatar_url": {
"type": "string",
"title": "Avatar Url",
"order": 1
},
"events_url": {
"type": "string",
"title": "Events Url",
"order": 2
},
"followers_url": {
"type": "string",
"title": "Followers Url",
"order": 3
},
"following_url": {
"type": "string",
"title": "Following Url",
"order": 4
},
"gists_url": {
"type": "string",
"title": "Gists Url",
"order": 5
},
"gravatar_id": {
"type": "string",
"title": "Gravatar Id",
"order": 6
},
"html_url": {
"type": "string",
"title": "Html Url",
"order": 7
},
"id": {
"type": "integer",
"title": "Id",
"order": 8
},
"login": {
"type": "string",
"title": "Login",
"order": 9
},
"organizations_url": {
"type": "string",
"title": "Organizations Url",
"order": 10
},
"received_events_url": {
"type": "string",
"title": "Received Events Url",
"order": 11
},
"repos_url": {
"type": "string",
"title": "Repos Url",
"order": 12
},
"site_admin": {
"type": "boolean",
"title": "Site Admin",
"order": 13
},
"starred_url": {
"type": "string",
"title": "Starred Url",
"order": 14
},
"subscriptions_url": {
"type": "string",
"title": "Subscriptions Url",
"order": 15
},
"type": {
"type": "string",
"title": "Type",
"order": 16
},
"url": {
"type": "string",
"title": "Url",
"order": 17
}
}
}
}
},
"organization": {
"type": "object",
"title": "organization",
"properties": {
"avatar_url": {
"type": "string",
"title": "Avatar Url",
"order": 1
},
"events_url": {
"type": "string",
"title": "Events Url",
"order": 2
},
"followers_url": {
"type": "string",
"title": "Followers Url",
"order": 3
},
"following_url": {
"type": "string",
"title": "Following Url",
"order": 4
},
"gists_url": {
"type": "string",
"title": "Gists Url",
"order": 5
},
"gravatar_id": {
"type": "string",
"title": "Gravatar Id",
"order": 6
},
"html_url": {
"type": "string",
"title": "Html Url",
"order": 7
},
"id": {
"type": "integer",
"title": "Id",
"order": 8
},
"login": {
"type": "string",
"title": "Login",
"order": 9
},
"organizations_url": {
"type": "string",
"title": "Organizations Url",
"order": 10
},
"received_events_url": {
"type": "string",
"title": "Received Events Url",
"order": 11
},
"repos_url": {
"type": "string",
"title": "Repos Url",
"order": 12
},
"site_admin": {
"type": "boolean",
"title": "Site Admin",
"order": 13
},
"starred_url": {
"type": "string",
"title": "Starred Url",
"order": 14
},
"subscriptions_url": {
"type": "string",
"title": "Subscriptions Url",
"order": 15
},
"type": {
"type": "string",
"title": "Type",
"order": 16
},
"url": {
"type": "string",
"title": "Url",
"order": 17
}
}
}
}
},
"collaborator_invite": {
"type": "object",
"title": "collaborator_invite",
"properties": {
"avatar_url": {
"type": "string",
"title": "Avatar Url",
"order": 4
},
"events_url": {
"type": "string",
"title": "Events Url",
"order": 15
},
"followers_url": {
"type": "string",
"title": "Followers Url",
"order": 8
},
"following_url": {
"type": "string",
"title": "Following Url",
"order": 9
},
"gists_url": {
"type": "string",
"title": "Gists Url",
"order": 10
},
"gravatar_id": {
"type": "string",
"title": "Gravatar Id",
"order": 5
},
"html_url": {
"type": "string",
"title": "Html Url",
"order": 7
},
"id": {
"type": "integer",
"title": "Id",
"order": 2
},
"login": {
"type": "string",
"title": "Login",
"order": 1
},
"node_id": {
"type": "string",
"title": "Node Id",
"order": 3
},
"organizations_url": {
"type": "string",
"title": "Organizations Url",
"order": 13
},
"received_events_url": {
"type": "string",
"title": "Received Events Url",
"order": 16
},
"repos_url": {
"type": "string",
"title": "Repos Url",
"order": 14
},
"site_admin": {
"type": "boolean",
"title": "Site Admin",
"order": 18
},
"starred_url": {
"type": "string",
"title": "Starred Url",
"order": 11
},
"subscriptions_url": {
"type": "string",
"title": "Subscriptions Url",
"order": 12
},
"type": {
"type": "string",
"title": "Type",
"order": 17
},
"url": {
"type": "string",
"title": "Url",
"order": 6
}
}
},
"collaborator_repository": {
"type": "object",
"title": "collaborator_repository",
"properties": {
"archive_url": {
"type": "string",
"title": "Archive Url",
"order": 11
},
"assignees_url": {
"type": "string",
"title": "Assignees Url",
"order": 12
},
"blobs_url": {
"type": "string",
"title": "Blobs Url",
"order": 13
},
"branches_url": {
"type": "string",
"title": "Branches Url",
"order": 14
},
"collaborators_url": {
"type": "string",
"title": "Collaborators Url",
"order": 15
},
"comments_url": {
"type": "string",
"title": "Comments Url",
"order": 16
},
"commits_url": {
"type": "string",
"title": "Commits Url",
"order": 17
},
"compare_url": {
"type": "string",
"title": "Compare Url",
"order": 18
},
"contents_url": {
"type": "string",
"title": "Contents Url",
"order": 19
},
"contributors_url": {
"type": "string",
"title": "Contributors Url",
"order": 20
},
"deployments_url": {
"type": "string",
"title": "Deployments Url",
"order": 21
},
"description": {
"type": "string",
"title": "Description",
"order": 8
},
"downloads_url": {
"type": "string",
"title": "Downloads Url",
"order": 22
},
"events_url": {
"type": "string",
"title": "Events Url",
"order": 23
},
"fork": {
"type": "boolean",
"title": "Fork",
"order": 9
},
"forks_url": {
"type": "string",
"title": "Forks Url",
"order": 24
},
"full_name": {
"type": "string",
"title": "Full Name",
"order": 4
},
"git_commits_url": {
"type": "string",
"title": "Git Commits Url",
"order": 25
},
"git_refs_url": {
"type": "string",
"title": "Git Refs Url",
"order": 26
},
"git_tags_url": {
"type": "string",
"title": "Git Tags Url",
"order": 27
},
"git_url": {
"type": "string",
"title": "Git Url",
"order": 28
},
"html_url": {
"type": "string",
"title": "Html Url",
"order": 7
},
"id": {
"type": "integer",
"title": "Id",
"order": 1
},
"issue_comment_url": {
"type": "string",
"title": "Issue Comment Url",
"order": 29
},
"issue_events_url": {
"type": "string",
"title": "Issue Events Url",
"order": 30
},
"issues_url": {
"type": "string",
"title": "Issues Url",
"order": 31
},
"keys_url": {
"type": "string",
"title": "Keys Url",
"order": 32
},
"labels_url": {
"type": "string",
"title": "Labels Url",
"order": 33
},
"languages_url": {
"type": "string",
"title": "Languages Url",
"order": 34
},
"merges_url": {
"type": "string",
"title": "Merges Url",
"order": 35
},
"milestones_url": {
"type": "string",
"title": "Milestones Url",
"order": 36
},
"name": {
"type": "string",
"title": "Name",
"order": 3
},
"node_id": {
"type": "string",
"title": "Node Id",
"order": 2
},
"notifications_url": {
"type": "string",
"title": "Notifications Url",
"order": 37
},
"owner": {
"$ref": "#/definitions/organization",
"title": "Owner",
"order": 5
},
"private": {
"type": "boolean",
"title": "Private",
"order": 6
},
"pulls_url": {
"type": "string",
"title": "Pulls Url",
"order": 38
},
"releases_url": {
"type": "string",
"title": "Releases Url",
"order": 39
},
"ssh_url": {
"type": "string",
"title": "Ssh Url",
"order": 40
},
"stargazers_url": {
"type": "string",
"title": "Stargazers Url",
"order": 41
},
"statuses_url": {
"type": "string",
"title": "Statuses Url",
"order": 42
},
"subscribers_url": {
"type": "string",
"title": "Subscribers Url",
"order": 43
},
"subscription_url": {
"type": "string",
"title": "Subscription Url",
"order": 44
},
"tags_url": {
"type": "string",
"title": "Tags Url",
"order": 45
},
"teams_url": {
"type": "string",
"title": "Teams Url",
"order": 46
},
"trees_url": {
"type": "string",
"title": "Trees Url",
"order": 47
},
"url": {
"type": "string",
"title": "Url",
"order": 10
}
},
"definitions": {
"organization": {
"type": "object",
"title": "organization",
"properties": {
"avatar_url": {
"type": "string",
"title": "Avatar Url",
"order": 1
},
"events_url": {
"type": "string",
"title": "Events Url",
"order": 2
},
"followers_url": {
"type": "string",
"title": "Followers Url",
"order": 3
},
"following_url": {
"type": "string",
"title": "Following Url",
"order": 4
},
"gists_url": {
"type": "string",
"title": "Gists Url",
"order": 5
},
"gravatar_id": {
"type": "string",
"title": "Gravatar Id",
"order": 6
},
"html_url": {
"type": "string",
"title": "Html Url",
"order": 7
},
"id": {
"type": "integer",
"title": "Id",
"order": 8
},
"login": {
"type": "string",
"title": "Login",
"order": 9
},
"organizations_url": {
"type": "string",
"title": "Organizations Url",
"order": 10
},
"received_events_url": {
"type": "string",
"title": "Received Events Url",
"order": 11
},
"repos_url": {
"type": "string",
"title": "Repos Url",
"order": 12
},
"site_admin": {
"type": "boolean",
"title": "Site Admin",
"order": 13
},
"starred_url": {
"type": "string",
"title": "Starred Url",
"order": 14
},
"subscriptions_url": {
"type": "string",
"title": "Subscriptions Url",
"order": 15
},
"type": {
"type": "string",
"title": "Type",
"order": 16
},
"url": {
"type": "string",
"title": "Url",
"order": 17
}
}
}
}
},
"organization": {
"type": "object",
"title": "organization",
"properties": {
"avatar_url": {
"type": "string",
"title": "Avatar Url",
"order": 1
},
"events_url": {
"type": "string",
"title": "Events Url",
"order": 2
},
"followers_url": {
"type": "string",
"title": "Followers Url",
"order": 3
},
"following_url": {
"type": "string",
"title": "Following Url",
"order": 4
},
"gists_url": {
"type": "string",
"title": "Gists Url",
"order": 5
},
"gravatar_id": {
"type": "string",
"title": "Gravatar Id",
"order": 6
},
"html_url": {
"type": "string",
"title": "Html Url",
"order": 7
},
"id": {
"type": "integer",
"title": "Id",
"order": 8
},
"login": {
"type": "string",
"title": "Login",
"order": 9
},
"organizations_url": {
"type": "string",
"title": "Organizations Url",
"order": 10
},
"received_events_url": {
"type": "string",
"title": "Received Events Url",
"order": 11
},
"repos_url": {
"type": "string",
"title": "Repos Url",
"order": 12
},
"site_admin": {
"type": "boolean",
"title": "Site Admin",
"order": 13
},
"starred_url": {
"type": "string",
"title": "Starred Url",
"order": 14
},
"subscriptions_url": {
"type": "string",
"title": "Subscriptions Url",
"order": 15
},
"type": {
"type": "string",
"title": "Type",
"order": 16
},
"url": {
"type": "string",
"title": "Url",
"order": 17
}
}
}
}
}
""")
def __init__(self):
super(self.__class__, self).__init__(self.schema)
| 25.717317
| 111
| 0.336887
| 2,042
| 30,295
| 4.892262
| 0.084721
| 0.186186
| 0.279279
| 0.273874
| 0.898098
| 0.883684
| 0.881081
| 0.878478
| 0.868669
| 0.868669
| 0
| 0.022395
| 0.503284
| 30,295
| 1,177
| 112
| 25.739167
| 0.641481
| 0.001221
| 0
| 0.758591
| 1
| 0
| 0.982714
| 0.017418
| 0
| 0
| 0
| 0
| 0
| 1
| 0.001718
| false
| 0
| 0.001718
| 0
| 0.014605
| 0
| 0
| 0
| 0
| null | 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| 1
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 12
|
a06b904ad1578c9c64fbb942fe6230baba6bfdcf
| 230
|
py
|
Python
|
diggrtoolbox/standardize/__init__.py
|
diggr/diggrtoolbox
|
25f5cf73d5bc4d3a54096aa8417a42025693f0b6
|
[
"MIT"
] | 2
|
2018-08-31T22:02:04.000Z
|
2019-01-25T15:51:04.000Z
|
diggrtoolbox/standardize/__init__.py
|
diggr/diggrtoolbox
|
25f5cf73d5bc4d3a54096aa8417a42025693f0b6
|
[
"MIT"
] | null | null | null |
diggrtoolbox/standardize/__init__.py
|
diggr/diggrtoolbox
|
25f5cf73d5bc4d3a54096aa8417a42025693f0b6
|
[
"MIT"
] | null | null | null |
from .standardize import remove_html, remove_bracketed_text, remove_punctuation, std_url, std
__all__ = ['remove_html',
'remove_bracketed_text',
'remove_punctuation',
'std_url',
'std']
| 28.75
| 93
| 0.643478
| 24
| 230
| 5.583333
| 0.458333
| 0.149254
| 0.238806
| 0.373134
| 0.820896
| 0.820896
| 0.820896
| 0.820896
| 0.820896
| 0.820896
| 0
| 0
| 0.26087
| 230
| 7
| 94
| 32.857143
| 0.788235
| 0
| 0
| 0
| 0
| 0
| 0.26087
| 0.091304
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.166667
| 0
| 0.166667
| 0
| 1
| 0
| 0
| null | 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 10
|
261129b45b3118a52d22dde8cfdf08a8b36fa82f
| 45
|
py
|
Python
|
mdde/core/mdde/util/__init__.py
|
akharitonov/mdde
|
b0443f3c9c3ca948e9dda213572926087c214d8d
|
[
"MIT"
] | 1
|
2021-05-17T11:17:51.000Z
|
2021-05-17T11:17:51.000Z
|
mdde/core/mdde/util/__init__.py
|
akharitonov/mdde
|
b0443f3c9c3ca948e9dda213572926087c214d8d
|
[
"MIT"
] | 4
|
2020-05-30T12:23:04.000Z
|
2021-12-25T12:59:14.000Z
|
mdde/core/mdde/util/__init__.py
|
akharitonov/mdde
|
b0443f3c9c3ca948e9dda213572926087c214d8d
|
[
"MIT"
] | null | null | null |
from .assert_with_log import assert_with_log
| 22.5
| 44
| 0.888889
| 8
| 45
| 4.5
| 0.625
| 0.555556
| 0.722222
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.088889
| 45
| 1
| 45
| 45
| 0.878049
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 1
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 9
|
262b20f7fe97ae57b496a2305d2bb50cb65fcc01
| 364
|
py
|
Python
|
equipment/models.py
|
scottBowles/dnd
|
a1ef333f1a865d51b5426dc4b3493e8437584565
|
[
"MIT"
] | null | null | null |
equipment/models.py
|
scottBowles/dnd
|
a1ef333f1a865d51b5426dc4b3493e8437584565
|
[
"MIT"
] | null | null | null |
equipment/models.py
|
scottBowles/dnd
|
a1ef333f1a865d51b5426dc4b3493e8437584565
|
[
"MIT"
] | null | null | null |
from django.db import models
class Armor(models.Model):
name = models.CharField(max_length=255)
description = models.TextField()
class Weapon(models.Model):
name = models.CharField(max_length=255)
description = models.TextField()
class Equipment(models.Model):
name = models.CharField(max_length=255)
description = models.TextField()
| 21.411765
| 43
| 0.730769
| 44
| 364
| 5.977273
| 0.386364
| 0.125475
| 0.171103
| 0.239544
| 0.813688
| 0.813688
| 0.813688
| 0.813688
| 0.813688
| 0.813688
| 0
| 0.029412
| 0.159341
| 364
| 16
| 44
| 22.75
| 0.830065
| 0
| 0
| 0.6
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| false
| 0
| 0.1
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
|
0
| 8
|
263ae5e2c5ce270b2f3c06126d2b9552bbf4f6cf
| 150
|
py
|
Python
|
vkwave/bots/core/dispatching/filters/__init__.py
|
tdakkota/vkwave
|
8d8f55a541f51ee76be398e0a646131697d3ba17
|
[
"MIT"
] | null | null | null |
vkwave/bots/core/dispatching/filters/__init__.py
|
tdakkota/vkwave
|
8d8f55a541f51ee76be398e0a646131697d3ba17
|
[
"MIT"
] | null | null | null |
vkwave/bots/core/dispatching/filters/__init__.py
|
tdakkota/vkwave
|
8d8f55a541f51ee76be398e0a646131697d3ba17
|
[
"MIT"
] | null | null | null |
from .base import BaseFilter # noqa: F401
from .builtin import EventTypeFilter # noqa: F401
from .cast import caster as filter_caster # noqa: F401
| 37.5
| 55
| 0.766667
| 21
| 150
| 5.428571
| 0.571429
| 0.210526
| 0.210526
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0.072581
| 0.173333
| 150
| 3
| 56
| 50
| 0.846774
| 0.213333
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 1
| 0
| 0
| null | 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 7
|
cd479922afe28ef425aaf87eff3b91acd0df0bb1
| 3,498
|
py
|
Python
|
tests/motifs/contingency_tests.py
|
neksa/pymutagene
|
1122d64a5ab843a4960124933f78f3c2e388a792
|
[
"CC0-1.0"
] | 3
|
2020-05-18T07:00:46.000Z
|
2022-02-20T02:55:48.000Z
|
tests/motifs/contingency_tests.py
|
neksa/pymutagene
|
1122d64a5ab843a4960124933f78f3c2e388a792
|
[
"CC0-1.0"
] | 31
|
2020-03-13T16:28:34.000Z
|
2021-02-27T22:12:15.000Z
|
tests/motifs/contingency_tests.py
|
neksa/pymutagene
|
1122d64a5ab843a4960124933f78f3c2e388a792
|
[
"CC0-1.0"
] | 3
|
2020-03-24T20:01:44.000Z
|
2020-11-26T17:30:39.000Z
|
import pytest
import numpy as np
from mutagene.motifs import *
@pytest.mark.parametrize(
"contingency_table",
make_contingency_table(np.array(
[
[20, 10],
[40, 60]
]
))
)
def test_OR(contingency_table):
"""purpose: test odds ratio"""
contingency_table = Haldane_correction(contingency_table)
observed = calculate_OR(contingency_table)
assert observed == 1 / 3
@pytest.mark.parametrize(
"contingency_table",
make_contingency_table(np.array(
[
[20, 10],
[40, 60]
]
))
)
def test_RR(contingency_table):
"""purpose: test risk ratio/enrichment"""
contingency_table = Haldane_correction(contingency_table)
observed = calculate_RR(contingency_table)
assert observed == 5 / 9
@pytest.mark.parametrize(
"contingency_table",
make_contingency_table(np.array(
[
[0, 10],
[40, 60]
]
))
)
def test_OR_zero(contingency_table):
"""purpose: test odds ratio"""
contingency_table = Haldane_correction(contingency_table)
observed = calculate_OR(contingency_table)
assert np.isclose(observed, 14.057851239669422)
@pytest.mark.parametrize(
"contingency_table",
make_contingency_table(np.array(
[
[0, 0],
[40, 60]
]
))
)
def test_RR_zero(contingency_table):
# purpose: test risk ratio/enrichment
contingency_table = Haldane_correction(contingency_table)
observed = calculate_RR(contingency_table)
assert np.isclose(observed, 0.8347107438016529)
@pytest.mark.parametrize(
"contingency_table",
make_contingency_table((np.array(
[
[20, 10],
[40, 60]
]
)))
)
def test_bad_stat(contingency_table):
"""purpose: test if user enters incorrect pvalue type"""
contingency_table = Haldane_correction(contingency_table)
observed = get_stats(contingency_table, "XX")
assert observed == 1.0
@pytest.mark.parametrize(
"contingency_table",
make_contingency_table(np.array(
[
[-5, -10],
[40, 60]
]
))
)
def test_pval_errors(contingency_table):
"""purpose: test error handling when pvalue error"""
contingency_table = Haldane_correction(contingency_table)
observed = get_stats(contingency_table)
observed_chi = get_stats(contingency_table, 'chi2')
assert observed == observed_chi == 1.0
@pytest.mark.parametrize(
"contingency_table",
make_contingency_table(np.array(
[
[20, 10],
[40, 60]
]
))
)
def test_bad_stat_type(contingency_table):
"""purpose: test risk ratio/enrichment"""
contingency_table = Haldane_correction(contingency_table)
observed = get_stats(contingency_table, "XX")
assert observed == 1.0
# @pytest.mark.parametrize(
# "contingency_table",
# np.array([
# [
# [20, 10],
# [40, 60]
# ]
# ])
# )
# def test_pvalue_fisher(contingency_table):
# # purpose: test Fisher's pvalue
# observed = get_stats(contingency_table)
# return observed
#
#
# @pytest.mark.parametrize(
# "contingency_table",
# np.array([
# [
# [20, 10],
# [40, 60]
# ]
# ])
# )
# def test_pvalue_chi(contingency_table):
# # purpose: test Chi-Squared pvalue
# observed = get_stats(contingency_table, "chi2")
# print(observed)
| 23.795918
| 61
| 0.620069
| 366
| 3,498
| 5.674863
| 0.177596
| 0.377468
| 0.090997
| 0.138662
| 0.818488
| 0.785749
| 0.724603
| 0.724603
| 0.724603
| 0.724603
| 0
| 0.044306
| 0.264437
| 3,498
| 146
| 62
| 23.958904
| 0.762923
| 0.238422
| 0
| 0.547368
| 0
| 0
| 0.04879
| 0
| 0
| 0
| 0
| 0
| 0.073684
| 1
| 0.073684
| false
| 0
| 0.031579
| 0
| 0.105263
| 0
| 0
| 0
| 0
| null | 1
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
|
0
| 7
|
26ff20bd14fab068efe90638b061754eb53408f0
| 12,369
|
py
|
Python
|
SnowDown/backend/models.py
|
HACC2021/SnowDown
|
25f261d01a9f251a9bbb6a7120f9059de4020346
|
[
"MIT"
] | 1
|
2021-11-10T17:38:09.000Z
|
2021-11-10T17:38:09.000Z
|
SnowDown/backend/models.py
|
HACC2021/SnowDown
|
25f261d01a9f251a9bbb6a7120f9059de4020346
|
[
"MIT"
] | null | null | null |
SnowDown/backend/models.py
|
HACC2021/SnowDown
|
25f261d01a9f251a9bbb6a7120f9059de4020346
|
[
"MIT"
] | null | null | null |
from django.db import models
from django.conf import settings
from django.contrib.auth.models import AbstractBaseUser, BaseUserManager, PermissionsMixin
# Create your models here.
class UserManager(BaseUserManager):
def create_user(self, email, first_name, Last_name, phone, password=None, **extra_fields):
#Creates and saves a new user
if not email:
raise ValueError('Users must have an email address')
user = self.model(email=self.normalize_email(email), first_name=first_name, Last_name=Last_name,
phone=phone, **extra_fields)
user.set_password(password)
user.is_active = False
user.save(using=self._db)
return user
def create_Volunteer(self, email, first_name, Last_name, phone, password):
user = self.create_user(email, first_name, Last_name, phone, password)
user.is_staff = True
user.is_superuser = False
user.is_active = True
user.save(using=self._db)
return user
def create_superuser(self, email, first_name, Last_name, Picture, phone, password):
user = self.create_user(email, first_name, Last_name, phone, password)
user.is_staff = True
user.is_superuser = True
user.agent = True
user.is_active = True
user.Picture = Picture
user.save(using=self._db)
return user
class User(AbstractBaseUser, PermissionsMixin):
# Custom user model that supports using email instead of username
email = models.EmailField(max_length=225, unique=True)
phone = models.CharField(max_length=255)
first_name = models.CharField(max_length=255)
Last_name = models.CharField(max_length=255)
Volunteer = models.BooleanField(default=True)
Picture = models.ImageField(upload_to='User Profile Pic/', default='User Profile Pic/default.png', )
is_active = models.BooleanField(default=True)
is_staff = models.BooleanField(default=True)
objects = UserManager()
REQUIRED_FIELDS = ['first_name', 'Last_name', 'Picture', 'phone']
USERNAME_FIELD = 'email'
class TokenIssued(models.Model):
token=models.TextField()
email=models.EmailField(max_length=225)
def __str__(self):
return self.token
# Animal type
class Animal_Table(models.Model):
animal = models.CharField(max_length=400, unique=True)
acronym=models.CharField(max_length=200, blank=True)
def __str__(self):
return self.animal
# Animal Sub category
class SubAnimal_Table(models.Model):
subAnimal = models.CharField(max_length=400, unique=True)
acronym=models.CharField(max_length=200, blank=True)
animal = models.ForeignKey(Animal_Table, on_delete=models.CASCADE)
def __str__(self):
return self.animal.__str__() + ', ' + self.subAnimal.__str__()
# Animal Characteristics
class Incident_Photos_Table(models.Model):
photo = models.ImageField(upload_to='Report_Images/')
class Ticket_Type(models.Model):
ticket_type = models.CharField(max_length=100)
acronym=models.CharField(max_length=200, blank=True)
def __str__(self):
return self.ticket_type.__str__()
class Observer_Type(models.Model):
observer_type = models.CharField(max_length=20)
acronym=models.CharField(max_length=200, blank=True)
def __str__(self):
return self.observer_type.__str__()
class Sector(models.Model):
observer_type = models.CharField(max_length=20)
def __str__(self):
return self.observer_type.__str__()
class SealSize(models.Model):
options = models.CharField(max_length=30)
acronym=models.CharField(max_length=200, blank=True)
def __str__(self):
return self.options.__str__()
class Sex(models.Model):
options = models.CharField(max_length=30)
def __str__(self):
return self.options.__str__()
class TagSide(models.Model):
options = models.CharField(max_length=30)
def __str__(self):
return self.options.__str__()
class TagColor(models.Model):
options = models.CharField(max_length=10)
def __str__(self):
return self.options.__str__()
class Status(models.Model):
options = models.CharField(max_length=10)
def __str__(self):
return self.options.__str__()
class Death(models.Model):
options = models.CharField(max_length=30)
def __str__(self):
return self.options.__str__()
class FAST(models.Model):
options = models.CharField(max_length=10)
def __str__(self):
return self.options.__str__()
class Location(models.Model):
options = models.CharField(max_length=30)
def __str__(self):
return self.options.__str__()
class How_ID(models.Model):
options = models.CharField(max_length=30)
acronym=models.CharField(max_length=200, blank=True)
def __str__(self):
return self.options.__str__()
class Island(models.Model):
island = models.CharField(max_length=30)
def __str__(self):
return self.island.__str__()
# Holds the Incidents people have reported
class Incident_Table(models.Model):
dateTime = models.DateTimeField()
Date = models.CharField(max_length=100)
Time = models.CharField(max_length=100)
Ticket_Number = models.CharField(max_length=15)
Hotline_Operator_Initials = models.CharField(max_length=4, blank=True)
Ticket_Type = models.ForeignKey(Ticket_Type, on_delete=models.CASCADE)
firstName = models.CharField(max_length=100)
lastName = models.CharField(max_length=100)
phone = models.CharField(max_length=500)
email = models.CharField(max_length=500)
Observer_Initials = models.CharField(max_length=4)
Observer_Type = models.ForeignKey(Observer_Type, on_delete=models.CASCADE)
Sector = models.ForeignKey(Sector, on_delete=models.CASCADE)
location = models.CharField(max_length=500)
lat = models.DecimalField(max_digits=19, decimal_places=15, db_index=True)
lng = models.DecimalField(max_digits=19, decimal_places=15, db_index=True)
locationDetails = models.TextField(blank=True, null=True)
Animal_Present = models.BooleanField(default=False, blank=True, null=True)
SealSize = models.ForeignKey(SealSize, on_delete=models.CASCADE, blank=True, null=True)
sex = models.ForeignKey(Sex, on_delete=models.CASCADE, blank=True, null=True)
beach_Position = models.BooleanField(blank=True, null=True)
How_ID = models.ForeignKey(How_ID, on_delete=models.CASCADE, blank=True, null=True)
BleachNumber = models.CharField(max_length=10, blank=True, null=True)
Tag_Number = models.CharField(max_length=10, blank=True, null=True)
Tag_Side = models.ForeignKey(TagSide, blank=True, null=True, on_delete=models.CASCADE)
Tag_Color = models.ForeignKey(TagColor, blank=True, null=True, on_delete=models.CASCADE)
ID_Perm = models.CharField(max_length=10, blank=True, null=True)
Molt = models.BooleanField(blank=True, null=True)
ID_Description = models.TextField(blank=True, null=True)
ID_Verified_by = models.CharField(max_length=100)
SealLogging = models.BooleanField(blank=True, null=True)
MomPup = models.BooleanField(blank=True, null=True)
SRA_Set_Up = models.BooleanField(blank=True, null=True)
SRA_Set_by = models.CharField(max_length=100, blank=True, null=True)
Volunteers_Engaged = models.IntegerField(blank=True, null=True)
Seal_Depart = models.BooleanField(blank=True, null=True)
Seal_Depart_Date = models.DateField(blank=True, null=True)
Seal_Depart_Time = models.TimeField(blank=True, null=True)
description = models.TextField()
photos = models.ManyToManyField(Incident_Photos_Table)
animalType = models.ForeignKey(SubAnimal_Table, on_delete=models.CASCADE)
size = models.CharField(max_length=10, blank=True, null=True)
status = models.ForeignKey(Status, blank=True, null=True, on_delete=models.CASCADE)
CauseOfDeath = models.ForeignKey(Death, blank=True, null=True, on_delete=models.CASCADE)
Responder = models.CharField(max_length=100, blank=True, null=True)
Responder_Arrived = models.TimeField(blank=True, null=True)
Responder_Left = models.TimeField(blank=True, null=True)
Outreach_Provided = models.BooleanField()
FAST = models.ForeignKey(FAST, blank=True, null=True, on_delete=models.CASCADE)
Delivered = models.BooleanField(blank=True, null=True)
Where_To = models.ForeignKey(Location, blank=True, null=True, on_delete=models.CASCADE)
onIsland = models.ForeignKey(Island, blank=True, null=True, on_delete=models.CASCADE)
class Group_Incident_Table(models.Model):
incident = models.ManyToManyField(Incident_Table)
Top=models.DecimalField(max_digits=19, decimal_places=15)
Bottom=models.DecimalField(max_digits=19, decimal_places=15)
Left=models.DecimalField(max_digits=19, decimal_places=15)
Right=models.DecimalField(max_digits=19, decimal_places=15)
dateTime = models.DateTimeField()
Date = models.CharField(max_length=100)
Time = models.CharField(max_length=100)
Ticket_Number = models.CharField(max_length=15)
Hotline_Operator_Initials = models.CharField(max_length=4, blank=True, null=True)
Ticket_Type = models.ForeignKey(Ticket_Type, on_delete=models.CASCADE)
firstName = models.CharField(max_length=100)
lastName = models.CharField(max_length=100)
phone = models.CharField(max_length=500)
email = models.CharField(max_length=500)
Observer_Initials = models.CharField(max_length=4)
Observer_Type = models.ForeignKey(Observer_Type, on_delete=models.CASCADE)
Sector = models.ForeignKey(Sector, on_delete=models.CASCADE)
location = models.CharField(max_length=500)
lat = models.DecimalField(max_digits=19, decimal_places=15, db_index=True)
lng = models.DecimalField(max_digits=19, decimal_places=15, db_index=True)
locationDetails = models.TextField(blank=True, null=True)
Animal_Present = models.BooleanField(default=False, blank=True, null=True)
SealSize = models.ForeignKey(SealSize, on_delete=models.CASCADE, blank=True, null=True)
sex = models.ForeignKey(Sex, on_delete=models.CASCADE, blank=True, null=True)
beach_Position = models.BooleanField(blank=True, null=True)
How_ID = models.ForeignKey(How_ID, on_delete=models.CASCADE, blank=True, null=True)
BleachNumber = models.CharField(max_length=10, blank=True, null=True)
Tag_Number = models.CharField(max_length=10, blank=True, null=True)
Tag_Side = models.ForeignKey(TagSide, blank=True, null=True, on_delete=models.CASCADE)
Tag_Color = models.ForeignKey(TagColor, blank=True, null=True, on_delete=models.CASCADE)
ID_Perm = models.CharField(max_length=10, blank=True, null=True)
Molt = models.BooleanField(blank=True, null=True)
ID_Description = models.TextField(blank=True, null=True)
ID_Verified_by = models.CharField(max_length=100, blank=True, null=True)
SealLogging = models.BooleanField(blank=True, null=True)
MomPup = models.BooleanField(blank=True, null=True)
SRA_Set_Up = models.BooleanField(blank=True, null=True)
SRA_Set_by = models.CharField(max_length=100, blank=True, null=True)
Volunteers_Engaged = models.IntegerField(blank=True, null=True)
Seal_Depart = models.BooleanField(blank=True, null=True)
Seal_Depart_Date = models.DateField(blank=True, null=True)
Seal_Depart_Time = models.TimeField(blank=True, null=True)
description = models.TextField()
animalType = models.ForeignKey(SubAnimal_Table, on_delete=models.CASCADE)
size = models.CharField(max_length=10, blank=True, null=True)
status = models.ForeignKey(Status, blank=True, null=True, on_delete=models.CASCADE)
CauseOfDeath = models.ForeignKey(Death, blank=True, null=True, on_delete=models.CASCADE)
Responder = models.CharField(max_length=100, blank=True, null=True)
Responder_Arrived = models.TimeField(blank=True, null=True)
Responder_Left = models.TimeField(blank=True, null=True)
Outreach_Provided = models.BooleanField()
FAST = models.ForeignKey(FAST, blank=True, null=True, on_delete=models.CASCADE)
Delivered = models.BooleanField(blank=True, null=True)
Where_To = models.ForeignKey(Location, blank=True, null=True, on_delete=models.CASCADE)
onIsland = models.ForeignKey(Island, blank=True, null=True, on_delete=models.CASCADE)
| 46.675472
| 104
| 0.73571
| 1,613
| 12,369
| 5.415375
| 0.119033
| 0.073154
| 0.095249
| 0.124556
| 0.830109
| 0.813509
| 0.788094
| 0.784774
| 0.757184
| 0.730395
| 0
| 0.017421
| 0.155388
| 12,369
| 265
| 105
| 46.675472
| 0.818704
| 0.01714
| 0
| 0.684444
| 0
| 0
| 0.010617
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0.084444
| false
| 0.026667
| 0.013333
| 0.071111
| 0.915556
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
|
0
| 7
|
6ef4cda56a85850e4711e8771407e84e564d6c01
| 26,549
|
py
|
Python
|
user/tests/test_view.py
|
userlocalhost/airone-1
|
8aabeabb65fd2117876380f1f69a04f0cf39889d
|
[
"MIT"
] | null | null | null |
user/tests/test_view.py
|
userlocalhost/airone-1
|
8aabeabb65fd2117876380f1f69a04f0cf39889d
|
[
"MIT"
] | null | null | null |
user/tests/test_view.py
|
userlocalhost/airone-1
|
8aabeabb65fd2117876380f1f69a04f0cf39889d
|
[
"MIT"
] | null | null | null |
import json
from datetime import timedelta
from django.conf import settings
from django.test import TestCase, Client
from django.urls import reverse
from unittest.mock import patch
from unittest.mock import Mock
from user.forms import UsernameBasedPasswordResetForm
from user.models import User
from user.views import PasswordReset
class ViewTest(TestCase):
def setUp(self):
self._client = Client()
self.guest = self._create_user("guest", "guest@example.com")
self.admin = self._create_user("admin", "admin@example.com", True)
settings.MIDDLEWARE = [
x for x in settings.MIDDLEWARE if x != "airone.lib.log.LoggingRequestMiddleware"
]
def _create_user(
self,
name,
email="email",
is_superuser=False,
authenticate_type=User.AUTH_TYPE_LOCAL,
):
user = User(
username=name,
email=email,
is_superuser=is_superuser,
authenticate_type=authenticate_type,
)
user.set_password(name)
user.save()
return user
def _admin_login(self):
self.client.login(username="admin", password="admin")
def _guest_login(self):
self.client.login(username="guest", password="guest")
def _get_active_user_count(self):
return User.objects.filter(is_active=True).count()
def test_index_without_login(self):
resp = self.client.get(reverse("user:index"))
self.assertEqual(resp.status_code, 303)
def test_index_with_guest(self):
self._guest_login()
resp = self.client.get(reverse("user:index"))
self.assertEqual(resp.status_code, 200)
self.assertEqual(resp.context["users"], [self.guest])
def test_index_with_admin(self):
self._admin_login()
resp = self.client.get(reverse("user:index"))
self.assertEqual(resp.status_code, 200)
self.assertEqual(list(resp.context["users"]), [self.guest, self.admin])
# Check context of response
self.assertTemplateUsed(template_name="list_user.html")
self.assertEqual(
[x.username for x in resp.context["users"]],
[x.username for x in User.objects.filter(is_active=True)],
)
def test_create_get_without_login(self):
resp = self.client.get(reverse("user:create"))
self.assertEqual(resp.status_code, 303)
def test_create_get_with_login(self):
self._admin_login()
resp = self.client.get(reverse("user:create"))
self.assertEqual(resp.status_code, 200)
self.assertTemplateUsed(template_name="create_user.html")
def test_create_post_without_login(self):
count = User.objects.count()
params = {
"name": "hoge",
"email": "hoge@example.com",
"passwd": "puyo",
}
resp = self.client.post(reverse("user:do_create"), json.dumps(params), "application/json")
self.assertEqual(resp.status_code, 401)
self.assertEqual(User.objects.count(), count) # user should not be created
def test_create_user_without_permission(self):
# request of creating an user requires administrative permission
self._guest_login()
params = {
"name": "hoge",
"email": "hoge@example.com",
"passwd": "puyo",
}
resp = self.client.post(reverse("user:do_create"), json.dumps(params), "application/json")
self.assertEqual(resp.status_code, 400)
self.assertEqual(
resp.content.decode("utf-8"),
"This page needs administrative permission to access",
)
def test_create_post_with_login(self):
count = User.objects.count()
self._admin_login()
params = {
"name": "hoge",
"email": "hoge@example.com",
"passwd": "puyo",
}
resp = self.client.post(reverse("user:do_create"), json.dumps(params), "application/json")
self.assertEqual(resp.status_code, 200)
self.assertEqual(User.objects.count(), count + 1) # user should be created
self.assertEqual(User.objects.last().username, "hoge")
self.assertNotEqual(User.objects.last().password, "puyo")
self.assertFalse(User.objects.last().is_superuser)
def test_create_user_without_mandatory_param(self):
count = User.objects.count()
self._admin_login()
params = {
"email": "hoge@example.com",
"passwd": "puyo",
}
resp = self.client.post(reverse("user:do_create"), json.dumps(params), "application/json")
self.assertEqual(resp.status_code, 400)
self.assertEqual(User.objects.count(), count) # user should not be created
def test_create_user_with_empty_param(self):
count = User.objects.count()
self._admin_login()
params = {
"user": "hoge",
"email": "",
"passwd": "puyo",
}
resp = self.client.post(reverse("user:do_create"), json.dumps(params), "application/json")
self.assertEqual(resp.status_code, 400)
self.assertEqual(User.objects.count(), count) # user should be created
def test_edit_get_without_login(self):
resp = self.client.get(reverse("user:edit", args=[0]))
self.assertEqual(resp.status_code, 303)
def test_edit_get_with_guest_login(self):
self._guest_login()
user = User.objects.get(username="admin")
resp = self.client.get(reverse("user:edit", args=[user.id]))
self.assertEqual(resp.status_code, 400)
self.assertEqual(resp.content.decode("utf-8"), "You don't have permission to access")
def test_edit_get_with_admin_login(self):
self._admin_login()
self.client.put("/api/v1/user/access_token")
for username in ["guest", "admin"]:
user = User.objects.get(username=username)
resp = self.client.get(reverse("user:edit", args=[user.id]))
self.assertEqual(resp.status_code, 200)
# Check context of response
self.assertTemplateUsed(template_name="edit_user.html")
self.assertEqual(resp.context["user_id"], user.id)
self.assertEqual(resp.context["user_name"], user.username)
self.assertEqual(resp.context["user_email"], user.email)
self.assertEqual(resp.context["user_is_superuser"], user.is_superuser)
self.assertEqual(resp.context["token"], user.token if username == "admin" else None)
self.assertEqual(resp.context["token_lifetime"], user.token_lifetime)
self.assertEqual(
resp.context["token_created"],
(user.token.created.strftime("%Y/%m/%d %H:%M:%S") if username == "admin" else None),
)
self.assertEqual(
resp.context["token_expire"],
(
(user.token.created + timedelta(seconds=user.token_lifetime)).strftime(
"%Y/%m/%d %H:%M:%S"
)
if username == "admin"
else None
),
)
self.assertEqual(resp.context["is_authenticated_by_local"], True)
def test_edit_for_inactive_user(self):
self._admin_login()
user = User.objects.create(username="test", email="test@example.com", is_active=False)
resp = self.client.get(reverse("user:edit", args=[user.id]))
self.assertEqual(resp.status_code, 404)
def test_edit_post_without_login(self):
user = User.objects.create(username="test", email="test@example.com")
params = {
"name": "hoge", # update guest => hoge
"email": "hoge@example.com",
"is_superuser": True,
}
resp = self.client.post(
reverse("user:do_edit", args=[user.id]),
json.dumps(params),
"application/json",
)
self.assertEqual(resp.status_code, 401)
def test_edit_post_with_login(self):
self._admin_login()
user = User.objects.create(username="test", email="test@example.com")
count = User.objects.count()
params = {
"name": "hoge", # update guest => hoge
"email": "hoge@example.com",
"is_superuser": True,
}
resp = self.client.post(
reverse("user:do_edit", args=[user.id]),
json.dumps(params),
"application/json",
)
user.refresh_from_db()
self.assertEqual(resp.status_code, 200)
self.assertEqual(User.objects.count(), count) # user should be updated
self.assertEqual(user.username, params["name"])
self.assertEqual(user.email, params["email"])
self.assertTrue(user.is_superuser)
def test_edit_user_with_duplicated_name(self):
self._admin_login()
user = User.objects.get(username="guest")
params = {
"name": "admin", # duplicated
"email": "guest@example.com",
}
resp = self.client.post(
reverse("user:do_edit", args=[user.id]),
json.dumps(params),
"application/json",
)
user.refresh_from_db()
self.assertEqual(resp.status_code, 400)
self.assertEqual(user.username, "guest") # Not updated
def test_edit_user_with_duplicated_email(self):
self._admin_login()
user = User.objects.get(username="guest")
# create test user
self._create_user("hoge", "hoge@example.com")
params = {
"name": "guest",
"email": "hoge@example.com", # duplicated
}
resp = self.client.post(
reverse("user:do_edit", args=[user.id]),
json.dumps(params),
"application/json",
)
user.refresh_from_db()
self.assertEqual(resp.status_code, 400)
self.assertEqual(user.username, params["name"])
self.assertNotEqual(user.email, params["email"])
def test_edit_user_into_superuser(self):
self._admin_login()
# create test user
user = self._create_user("hoge", "hoge@example.com")
params = {
"name": "hoge",
"email": "hoge@example.com",
"is_superuser": True,
}
resp = self.client.post(
reverse("user:do_edit", args=[user.id]),
json.dumps(params),
"application/json",
)
user.refresh_from_db()
self.assertEqual(resp.status_code, 200)
self.assertEqual(user.username, params["name"])
self.assertEqual(user.email, params["email"])
self.assertTrue(user.is_superuser)
def test_edit_superuser_into_user(self):
self._admin_login()
# create test user
user = self._create_user("hoge", "hoge@example.com", True)
params = {
"name": "hoge",
"email": "hoge@example.com",
# If is_superuser doesn't exist, it becomes False
}
resp = self.client.post(
reverse("user:do_edit", args=[user.id]),
json.dumps(params),
"application/json",
)
user.refresh_from_db()
self.assertEqual(resp.status_code, 200)
self.assertEqual(user.username, params["name"])
self.assertEqual(user.email, params["email"])
self.assertFalse(user.is_superuser)
def test_edit_user_params_without_permission(self):
self._guest_login()
user = User.objects.get(username="guest")
params = {
"name": "hoge",
"email": "hoge@example.com",
}
resp = self.client.post(
reverse("user:do_edit", args=[user.id]),
json.dumps(params),
"application/json",
)
user.refresh_from_db()
self.assertEqual(resp.status_code, 200)
self.assertNotEqual(user.username, params["name"])
self.assertNotEqual(user.email, params["email"])
def test_set_invalid_token_lifetime(self):
self._guest_login()
user = User.objects.get(username="guest")
for invalid_value in ["abcd", "-1", str(User.MAXIMUM_TOKEN_LIFETIME + 1), ""]:
params = {
"name": "hoge",
"email": "hoge@example.com",
"token_lifetime": invalid_value,
}
resp = self.client.post(
reverse("user:do_edit", args=[user.id]),
json.dumps(params),
"application/json",
)
user.refresh_from_db()
self.assertEqual(resp.status_code, 400)
def test_set_valid_token_lifetime(self):
self._admin_login()
user = User.objects.get(username="guest")
params = {
"name": "hoge",
"email": "hoge@example.com",
"token_lifetime": "10",
}
resp = self.client.post(
reverse("user:do_edit", args=[user.id]),
json.dumps(params),
"application/json",
)
user.refresh_from_db()
self.assertEqual(resp.status_code, 200)
self.assertEqual(user.token_lifetime, 10)
def test_edit_post_for_inactive_user(self):
self._admin_login()
user = User.objects.create(username="test", email="test@example.com", is_active=False)
params = {
"name": "hoge",
"email": "hoge@example.com",
}
resp = self.client.post(
reverse("user:do_edit", args=[user.id]),
json.dumps(params),
"application/json",
)
self.assertEqual(resp.status_code, 404)
def test_edit_passwd_get_without_login(self):
resp = self.client.get(reverse("user:edit_passwd", args=[0]))
self.assertEqual(resp.status_code, 303)
def test_edit_passwd_get_with_guest_login(self):
self._guest_login()
user = User.objects.get(username="guest")
resp = self.client.get(reverse("user:edit_passwd", args=[user.id]))
self.assertEqual(resp.status_code, 200)
# Check context of response
self.assertTemplateUsed(template_name="edit_passwd.html")
self.assertEqual(resp.context["user_id"], user.id)
self.assertEqual(resp.context["user_name"], user.username)
self.assertEqual(resp.context["user_grade"], "self")
def test_edit_passwd_get_with_admin_login(self):
self._admin_login()
user = User.objects.get(username="guest")
resp = self.client.get(reverse("user:edit_passwd", args=[user.id]))
self.assertEqual(resp.status_code, 200)
# Check context of response
self.assertTemplateUsed(template_name="edit_passwd.html")
self.assertEqual(resp.context["user_id"], user.id)
self.assertEqual(resp.context["user_name"], user.username)
self.assertEqual(resp.context["user_grade"], "super")
def test_edit_passwd_get_for_inactive_user(self):
self._admin_login()
user = User.objects.create(username="test", email="test@example.com", is_active=False)
resp = self.client.get(reverse("user:edit_passwd", args=[user.id]))
self.assertEqual(resp.status_code, 404)
def test_edit_passwd_post_without_login(self):
params = {
"id": self.guest.id,
"old_passwd": "guest",
"new_passwd": "hoge",
"chk_passwd": "hoge",
}
resp = self.client.post(
reverse("user:do_edit_passwd", args=[params["id"]]),
json.dumps(params),
"application/json",
)
self.assertEqual(resp.status_code, 401)
def test_edit_passwd_post_with_guest_login(self):
self._guest_login()
count = User.objects.count()
params = {
"id": self.guest.id,
"old_passwd": "guest",
"new_passwd": "hoge",
"chk_passwd": "hoge",
}
resp = self.client.post(
reverse("user:do_edit_passwd", args=[params["id"]]),
json.dumps(params),
"application/json",
)
user = User.objects.get(id=params["id"])
self.assertEqual(resp.status_code, 200)
self.assertEqual(User.objects.count(), count) # user should be updated
self.assertTrue(user.check_password(params["new_passwd"]))
def test_edit_passwd_post_with_admin_login(self):
self._admin_login()
count = User.objects.count()
params = {
"id": self.guest.id,
"new_passwd": "hoge",
"chk_passwd": "hoge",
}
resp = self.client.post(
reverse("user:do_su_edit_passwd", args=[params["id"]]),
json.dumps(params),
"application/json",
)
user = User.objects.get(id=params["id"])
self.assertEqual(resp.status_code, 200)
self.assertEqual(User.objects.count(), count) # user should be updated
self.assertTrue(user.check_password(params["new_passwd"]))
def test_edit_passwd_with_guest_login_and_empty_pass(self):
self._guest_login()
params = {
"id": self.guest.id,
"old_passwd": "guest",
"new_passwd": "",
"chk_passwd": "hoge",
}
resp = self.client.post(
reverse("user:do_edit_passwd", args=[params["id"]]),
json.dumps(params),
"application/json",
)
user = User.objects.get(id=params["id"])
self.assertEqual(resp.status_code, 400)
self.assertTrue(user.check_password("guest")) # Not updated
def test_edit_passwd_for_inactive_user(self):
self._admin_login()
user = User.objects.create(username="test", email="test@example.com", is_active=False)
params = {
"id": user.id,
"old_passwd": "guest",
"new_passwd": "hoge",
"chk_passwd": "hoge",
}
resp = self.client.post(
reverse("user:do_edit_passwd", args=[params["id"]]),
json.dumps(params),
"application/json",
)
self.assertEqual(resp.status_code, 404)
def test_edit_passwd_with_admin_login_and_empty_pass(self):
self._admin_login()
params = {
"id": self.guest.id,
"new_passwd": "",
"chk_passwd": "hoge",
}
resp = self.client.post(
reverse("user:do_su_edit_passwd", args=[params["id"]]),
json.dumps(params),
"application/json",
)
user = User.objects.get(id=params["id"])
self.assertEqual(resp.status_code, 400)
self.assertTrue(user.check_password("guest")) # Not updated
def test_edit_passwd_with_wrong_old_pass(self):
self._guest_login()
params = {
"id": self.guest.id,
"old_passwd": "hoge",
"new_passwd": "hoge",
"chk_passwd": "hoge",
}
resp = self.client.post(
reverse("user:do_edit_passwd", args=[params["id"]]),
json.dumps(params),
"application/json",
)
user = User.objects.get(id=params["id"])
self.assertEqual(resp.status_code, 400)
self.assertTrue(user.check_password("guest")) # Not updated
def test_edit_passwd_with_guest_login_and_old_new_pass_duplicated(self):
self._guest_login()
params = {
"id": self.guest.id,
"old_passwd": "guest",
"new_passwd": "guest",
"chk_passwd": "guest",
}
resp = self.client.post(
reverse("user:do_edit_passwd", args=[params["id"]]),
json.dumps(params),
"application/json",
)
self.assertEqual(resp.status_code, 400)
def test_edit_passwd_with_guest_login_and_new_chk_pass_not_equal(self):
self._guest_login()
params = {
"id": self.guest.id,
"old_passwd": "guest",
"new_passwd": "hoge",
"chk_passwd": "fuga",
}
resp = self.client.post(
reverse("user:do_edit_passwd", args=[params["id"]]),
json.dumps(params),
"application/json",
)
user = User.objects.get(id=params["id"])
self.assertEqual(resp.status_code, 400)
self.assertTrue(user.check_password("guest")) # Not updated
def test_edit_passwd_with_admin_login_and_new_chk_pass_not_equal(self):
self._admin_login()
params = {
"id": self.guest.id,
"new_passwd": "hoge",
"chk_passwd": "fuga",
}
resp = self.client.post(
reverse("user:do_su_edit_passwd", args=[params["id"]]),
json.dumps(params),
"application/json",
)
user = User.objects.get(id=params["id"])
self.assertEqual(resp.status_code, 400)
self.assertTrue(user.check_password("guest")) # Not updated
def test_su_edit_passwd_for_inactive_user(self):
self._admin_login()
user = User.objects.create(username="test", email="test@example.com", is_active=False)
params = {
"id": user.id,
"old_passwd": "guest",
"new_passwd": "hoge",
"chk_passwd": "hoge",
}
resp = self.client.post(
reverse("user:do_su_edit_passwd", args=[params["id"]]),
json.dumps(params),
"application/json",
)
self.assertEqual(resp.status_code, 404)
def test_delete_post(self):
name = "someuser"
self._admin_login()
user = self._create_user(name)
user_count = User.objects.count()
active_user_count = self._get_active_user_count()
resp = self.client.post(
reverse("user:do_delete", args=[user.id]),
json.dumps({}),
"application/json",
)
self.assertEqual(resp.status_code, 200)
# user should not deleted from DB
self.assertEqual(User.objects.count(), user_count)
# active user should be decreased
self.assertEqual(self._get_active_user_count(), active_user_count - 1)
# user should be inactive
user = User.objects.get(username__icontains="%s_deleted_" % name)
self.assertFalse(user.is_active)
def test_create_user_by_guest_user(self):
self._guest_login()
params = {
"name": "hoge",
"email": "hoge@example.com",
"passwd": "puyo",
}
resp = self.client.post(reverse("user:do_create"), json.dumps(params), "application/json")
self.assertEqual(resp.status_code, 400)
def test_create_admin_user(self):
self._admin_login()
params = {
"name": "hoge",
"email": "hoge@example.com",
"passwd": "puyo",
"is_superuser": "on",
}
resp = self.client.post(reverse("user:do_create"), json.dumps(params), "application/json")
self.assertEqual(resp.status_code, 200)
self.assertTrue(User.objects.last().is_superuser)
def test_delete_post_by_guest_user(self):
self._guest_login()
user = self._create_user("testuser")
resp = self.client.post(
reverse("user:do_delete", args=[user.id]),
json.dumps({}),
"application/json",
)
self.assertEqual(resp.status_code, 400)
self.assertTrue(User.objects.get(username="testuser").is_active)
def test_delete_post_for_inactive_user(self):
self._admin_login()
user = User.objects.create(username="test", email="test@example.com", is_active=False)
params = {
"name": "hoge",
"email": "hoge@example.com",
}
resp = self.client.post(
reverse("user:do_delete", args=[user.id]),
json.dumps(params),
"application/json",
)
self.assertEqual(resp.status_code, 404)
@patch("user.views.LDAPBackend.is_authenticated", Mock(return_value=True))
def test_post_chnage_auth_with_correct_password(self):
self._guest_login()
resp = self.client.post(
reverse("user:change_ldap_auth"),
json.dumps({"ldap_password": "CORRECT_PASSWORD"}),
"application/json",
)
self.guest.refresh_from_db()
self.assertEqual(resp.status_code, 200)
self.assertEqual(self.guest.authenticate_type, User.AUTH_TYPE_LDAP)
@patch("user.views.LDAPBackend.is_authenticated", Mock(return_value=False))
def test_post_chnage_auth_with_incorrect_password(self):
self._guest_login()
resp = self.client.post(
reverse("user:change_ldap_auth"),
json.dumps({"ldap_password": "INCORRECT_PASSWORD"}),
"application/json",
)
self.assertEqual(resp.status_code, 400)
def test_post_chnage_auth_with_invalid_parameters(self):
self._guest_login()
invalid_parameters = [
{"invalid_parameter": "value"},
[{"invalid_parameter": "value"}],
{"ldap_password": {"invalid_value_type": "value"}},
{"ldap_password": [1, 2, 3, 4]},
{"ldap_password": 1234},
{"ldap_password": ""},
]
for _param in invalid_parameters:
resp = self.client.post(
reverse("user:change_ldap_auth"), json.dumps(_param), "application/json"
)
self.assertEqual(resp.status_code, 400)
def test_password_reset_with_invalid_username(self):
user = self._create_user("testuser", authenticate_type=User.AUTH_TYPE_LDAP)
# testing this view class requires a complicated client.
# instead of that, we call the override method directly for now.
# see also django tests/auth_tests/client.py
view = PasswordReset()
form_with_unknown_user = UsernameBasedPasswordResetForm({"username": "unknown"})
form_with_unknown_user.is_valid()
resp = view.form_valid(form_with_unknown_user)
self.assertEqual(resp.status_code, 400)
form_with_ldap_user = UsernameBasedPasswordResetForm({"username": user.username})
form_with_ldap_user.is_valid()
resp = view.form_valid(form_with_ldap_user)
self.assertEqual(resp.status_code, 400)
| 34.56901
| 100
| 0.589551
| 3,010
| 26,549
| 4.983389
| 0.0701
| 0.089
| 0.084867
| 0.081667
| 0.809133
| 0.769333
| 0.743333
| 0.719
| 0.704733
| 0.680533
| 0
| 0.008779
| 0.27922
| 26,549
| 767
| 101
| 34.614081
| 0.775084
| 0.030849
| 0
| 0.620032
| 0
| 0
| 0.140639
| 0.012375
| 0
| 0
| 0
| 0
| 0.17806
| 1
| 0.084261
| false
| 0.149444
| 0.015898
| 0.00159
| 0.104928
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 1
| 1
| 1
| 1
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
|
0
| 7
|
3e5b711513cc1a6bba82f201233d6caf9ed1a32d
| 348
|
py
|
Python
|
zvt/recorders/eastmoney/finance/__init__.py
|
h521822/zvt
|
c6bcc2b340406da55d920a411f59ab8d4cc7e76d
|
[
"MIT"
] | 22
|
2020-10-22T14:24:32.000Z
|
2022-03-30T22:19:14.000Z
|
zvt/recorders/eastmoney/finance/__init__.py
|
h521822/zvt
|
c6bcc2b340406da55d920a411f59ab8d4cc7e76d
|
[
"MIT"
] | 2
|
2019-12-20T13:12:30.000Z
|
2020-01-03T06:24:30.000Z
|
zvt/recorders/eastmoney/finance/__init__.py
|
h521822/zvt
|
c6bcc2b340406da55d920a411f59ab8d4cc7e76d
|
[
"MIT"
] | 6
|
2021-01-14T20:50:06.000Z
|
2022-01-11T23:12:43.000Z
|
# -*- coding: utf-8 -*-
from zvt.recorders.eastmoney.finance.china_stock_balance_sheet_recorder import *
from zvt.recorders.eastmoney.finance.china_stock_cash_flow_recorder import *
from zvt.recorders.eastmoney.finance.china_stock_finance_factor_recorder import *
from zvt.recorders.eastmoney.finance.china_stock_income_statement_recorder import *
| 58
| 83
| 0.856322
| 47
| 348
| 6
| 0.404255
| 0.099291
| 0.22695
| 0.35461
| 0.744681
| 0.744681
| 0.744681
| 0.595745
| 0.595745
| 0
| 0
| 0.003058
| 0.060345
| 348
| 5
| 84
| 69.6
| 0.859327
| 0.060345
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| true
| 0
| 1
| 0
| 1
| 0
| 0
| 0
| 0
| null | 0
| 1
| 1
| 0
| 1
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| 0
| null | 0
| 0
| 0
| 0
| 0
| 0
| 1
| 0
| 1
| 0
| 1
| 0
|
0
| 8
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.